Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-801

parrots are among the most endangered group of birds worldwide, and 15 of the 84 brazilian species are classified as being vulnerable or critically endangered. studies on parrot populations are important to establish a database that can be assessed in the event of outbreaks, which could also be useful for subsequent epidemiological studies and conservation efforts. however, health surveys of free-ranging wild animals are mostly focused on retrospective studies on mortality [3, 4]. research on diseases affecting free-ranging parrots is still scarce and studies performed often fail to maximize the scientific information that could be gathered [2, 58]. such data could be of extreme importance in guiding conservation measures ex situ and in situ. the hyacinth macaw and lear's macaw are well-known flagship species that have suffered heavily owing to the destruction of habitat and illegal trade. a number of studies aimed at promoting their recovery have been performed and actions taken; however, they are still classified as endangered species and face severe threats to their long-term survival. on the other hand, the blue-fronted amazon parrot is rated as a species of least concern regarding its conservation status. it is, however, the most illegally traded parrot species in brazil, and therefore, it is possible that decades of successive capturing of nestlings and concomitant ageing of the adult population could cause local extinctions in several areas where it is still common today. studies have established that the intestinal flora of most species of healthy captive psittacines is composed essentially of gram-positive bacteria [11, 12]. parrots in captivity are frequently affected by infections caused by gram-negative bacteria, and these microorganisms are considered either pathogenic or opportunistic. one such bacterium, escherichia coli (e. coli), is frequently involved in respiratory, digestive, and septicemic disorders in captive parrots. it is possible to classify e. coli into pathotypes by using genes responsible for the expression of virulence factors. commonly described pathotypes include epec (enteropathogenic e. coli), apec (avian pathogenic e. coli), and upec (uropathogenic e. coli) [14, 15]. epec is an important category of diarrheagenic e. coli and a major cause of infant diarrhea in developing countries, while apec is recognized for significant economic losses to the poultry industry, resulting in respiratory diseases and septicemia [14, 15]. upec is a serious cause of urinary diseases in humans, causing cystitis that may progress to pyelonephritis. although, certain e. coli classification studies performed on wild birds [1722] and those involving captive psittacines have found a certain degree of correlation between disease and specific pathotypes [2325], current serological methods to determine the pathogenicity of e. coli strains do not accurately predict which strains will be pathogenic in which birds. the purpose of this study was to test cloacal samples from asymptomatic free-living nestlings (blue-fronted amazon parrots as well as hyacinth and lear's macaws) to determine if they could be carriers of recognized e. coli pathotypes. in addition, we discuss the role that these strains could play in both free-living and captive parrots. the samples of this study were collected during field surveys of the nestlings of hyacinth macaws and blue-fronted amazon parrots in the pantanal (wetlands) region of the refgio ecolgico caiman and neighboring farms (1958s, 5624w) in mato grosso do sul state, and of lear's macaws at the estao ecolgica de canudos (095348s, 390135w) in the caatinga (semi-arid) of the bahia state. cloacal swabs (cultureswab sterile, difco becton dickenson and company, sparks, maryland, usa) were moistened with care using a sterile saline solution so as not to contaminate the swab during insertion in the cloaca. all chicks had no evident signs of disease (soiled vent, emaciation, prostration, or delays in development according to their estimated age). in total, 44 samples were obtained, of which 10 were from hyacinths, 13 from lear's, and 21 from blue-fronted amazon parrots. the swabs were refrigerated up to processing at which point they were aerobically incubated in bhi broth (brain heart infusion, difco) for 24 hours at 37c. they were then streaked onto macconkey (difco) agar plates and incubated for another 24 hours at 37c. bacteria were identified using a specific enterobacteria identification kit (newprov, pinhais, paran, brazil) and stored at 20c. isolates were tested using polymerase chain reaction (pcr) (table 2.), for the presence of e. coli attaching and effacing (eae) gene and bundle-forming pili structural (bfpa) gene of epec. for apec, the aerobactin (iucd), cytotoxic necrotizing factor (cnf1), s fimbrial adhesin (sfa), and p fimbrial adhesin (papef) genes were amplified. upec utilized alpha hemolysin (hlya) in addition to the genes used for apec. additional apec genes for serum resistance (iss) and temperature-sensitive hemagglutinin (tsh) were also tested. e. coli was obtained from all 44 samples. details on the positive samples are given in table 1. one sample was positive solely for eae and not for bfp and was characterized as atypical epec. a large number of samples were positive for virulence factors commonly found in apec (14 samples), with most originating from blue-fronted amazon chicks. this gene was also found associated with other virulence factors in 4 samples, all from blue-fronted amazon parrots. there was also an association between other virulence factors among some isolates (table 1). epec have the ability to cause lesions on the intestinal mucosa, leading to severe diarrhea. this process is initiated by adherence to the epithelial cell membrane and is mediated by the adhesin intimin (encoded by the eae gene). typical epec strains possess both intimin and bundle-forming pili (encoded by the bfp gene), which are responsible for the initial contact between the bacteria and the host cell; atypical isolates, on the other hand, lack the bfp gene. humans are considered the primary reservoir for the typical pathotype although it has also been found in dogs and cats [29, 30]. there are few reports of the presence of atypical epec in birds, especially the isolates obtained from poultry [3032]. there are also reports of atypical epec causing fatal outbreaks in backyard passerine species, and carriers have been found among feral pigeons and rehabilitated seagulls [20, 22]. a study using 103 samples from captive psittacines detected 4 samples characterized as typical epec and 3 others as atypical isolates, all of which originated from clinical cases of diarrhea, enteritis, or septicemia. another survey conducted in brazil regarding necropsy cases of symptomatic parrots also showed the presence of the eae gene in 2 atypical samples of e. coli isolated from the livers of 2 individual pet amazon parrots. the fact that we found an atypical isolate in an asymptomatic bird, especially a free-ranging individual, suggests that this pathotype is not pathogenic in all parrots depending on the situation to which the birds are subjected. apec and upec share several genes that encode virulence factors such as p fimbrial adhesin (pap gene) and s fimbrial adhesin (sfa gene). apec has been extensively studied in poultry where it has been observed that the p fimbrial adhesion enables binding of bacteria to internal organs and protects against heterophilic inflammation, while the s fimbrial adhesin is associated with omphalitis, salpingitis, chronic respiratory diseases, and sepsis. although several virulence factors have been associated with clinical cases of apec in poultry, no specific factor has been confirmed to be responsible for contributing to the pathogenicity observed, which makes it difficult to interpret results among lesser-studied groups such as wild birds. siderophores, such as aerobactin (iuc gene), enable e. coli to obtain iron stores from the host, and strains with this gene are quite frequently associated with clinical cases of poultry. toxins, such as alpha hemolysin (hlya gene characteristic of upec) and cytotoxic necrotizing factor 1 (cnf1 gene), provide the ability to cause tissue damage, contributing to dissemination and release of host nutrients while impairing the immune defenses. in this investigation, 2 samples were positive for the sfa and 1 was positive for the cnf1 gene. these genes have been reported in pathogenic strains of e. coli isolated from septicemic poultry, as well as from human and domestic animals with extraintestinal pathogenic e. coli infections [16, 34]. a survey dealing with healthy feral pigeons detected a number of positive cloacal-swab specimens for the cytotoxic necrotizing factor 1, showing the potential for disease spread by carriers of this species. other genes such as the tsh (temperature-sensitive hemagglutinin) and the iss (increased serum survival) are reported to be present in apec strains. the increased serum survival causes sepsis by conferring resistance to the bacteria against the host immune bactericidal defenses. the exact function of tsh is largely unknown, but it has been shown to be involved in mechanisms of adherence to the respiratory tract of poultry. in this study, however, it has been shown in poultry that the presence of the iss gene alone may not be sufficient to identify apec isolates because this gene can also be found in the intestinal microbiota of healthy individuals, and an association with the iuc gene was reported to be necessary for achieving higher levels of virulence. interestingly, a sample from an asymptomatic blue-fronted amazon chick in this study showed an association between the iss and iuc genes. this research also found 1 positive sample for the iss/tsh association. in domestic turkeys, a relationship between clinical cases of colibacillosis and the presence of iss and tsh has been described. the occurrence of gene associations such as iss/pap, iss/iuc/tsh, and pap/iuc/tsh has previously been reported in e. coli isolated from fecal, liver, and blood samples collected during necropsies performed in symptomatic psittacines in brazil. these results in captive birds demonstrate that there is a connection between the presence of these genes and some clinical cases of colibacillosis as a contributing cause of death whether as primary or opportunistic pathogens. even though the sample numbers were too small to reach definite conclusions, we observed differences in the presence of virulence factors among the different species. apec/upec genes were found mostly in species that usually nest on trees and live in a tropical climate (at least in this studied area, for the species a. hyacinthinus and a. aestiva). epec was found in species that nest on limestone cliffs and inhabit semi-arid regions (a. leari). differences among feeding habits, direct or indirect contact with other wild animals, and human activities (interference due to human settlements and domestic animals) could possibly have influenced these results, and thus, these results should be further investigated. although previous studies showed that some virulence factors are indeed involved in clinical cases of colibacillosis in psittacines [2325], this investigation found a number of carriers for virulence factors. these unusual findings focus the attention on the fact that, at least at the time of sampling, there was a stable host/parasite relationship. unlike wild birds, parrots maintained in captivity are frequently exposed to a number of factors that cause immunosuppression and increase their susceptibility to disease. these include deficient diets, inadequate hygiene, and lack of mental and physical stimuli; all of these are factors that may determine the course of the disease when the animal is exposed to a microorganism. the concept of disease is considered the result of an interactive relationship among the causative agent, the animal, and environmental factors, and a multitude of factors act together in order to initiate the disease process. if a factor is not present, it is probable that the organism will be capable of fighting the pathogen without showing overt clinical signs. the nestlings in our study successfully fledged, indicating that although the potential for disease was present, birds living in their natural environment, without the factors induced by captivity, are more likely to remain disease free. the results presented here are also important for the future conservation of the 2 endangered species (a. hyacinthinus and a. leari) as well as the heavily trafficked a. aestiva because they could better guide ex situ husbandry practices involved in captive breeding and rehabilitation/relocation programs, besides assisting monitoring of the overall health of the wild population. in conclusion, to our knowledge, this is the first study that tested e. coli virulence factors in wild psittacines. it is also the first to describe e. coli carriers in free-ranging parrots, and the results indicate that although the potential to develop disease was present, several factors that are most likely to be found in captivity needed to be involved in triggering disease development. other studies involving different species as well as a higher number of samples are important to further define the role and risks involved with specific e. coli pathotypes in the case of both wild and captive psittacines.

parrots in captivity are frequently affected by escherichia coli (e. coli) infections. the objective of this study was to collect information on the carrier state for e. coli pathotypes in asymptomatic free-ranging parrots. cloacal swabs were collected from nestlings of hyacinth, lear's macaws and blue-fronted amazon parrots and tested by polymerase chain reaction (pcr) for virulence factors commonly found in enteropathogenic, avian pathogenic, and uropathogenic e. coli strains. in total, 44 samples were cultured and e. coli isolates were yielded, from which dna was extracted and processed by pcr. genes commonly found in apec isolates from blue-fronted amazon parrots and hyacinth macaws were expressed in 14 of these 44 samples. one atypical epec isolate was obtained from a sample from lear's macaw. the most commonly found gene was the increased serum survival (iss) gene. this is the first report, that describes such pathotypes in asymptomatic free-living parrots. the findings of this study suggest the presence of a stable host/parasite relationship at the time of the sampling brings a new understanding to the role that e. coli plays in captive and wild parrots. such information can be used to improve husbandry protocols as well as help conservation efforts of free-living populations.

PMC3658587

pubmed-802

focal cervical dystonia cases were recruited from 2 movement disorders clinics in uk: (1) national hospital for neurology and neurosurgery, london; and (2) salford royal foundation trust, manchester. only cases that remained focal involvement were recruited and most of them were followed up in botulinum toxin clinic. cases were reviewed by movement disorder specialists, and only presumptive primary cases were recruited, with secondary causes like wilson s disease or other neurodegenerative disease ruled out where clinically appropriate. because of small sample size, subclassification according to family history of movement disorders and age of onset was not attempted all patients gave informed consent to the study, approved by the respective local ethics committee. dna was extracted locally from blood and genotyped in the university college london genomics microarray centre, using illumina human 610-quad beadchip (illumina, san diego, ca, usa). control data of european descent was drawn from the wellcome trust case control consortium (wtccc) data set as previously reported. a total of 2930 samples from 1958 birth cohort and 2737 samples from national blood services were genotyped in illumina 1.2 m duo array by the wellcome trust sanger institute. quality control measure was performed both before and after merging with the cases as detailed in the supporting materials. genotyped data from cervical dystonia cases was assembled in genomestudio (v2011.1) per the manufacturer s suggestion (illumina). postassembly quality control was performed in genomestudio and plink (version 1.07). in brief, genotyping quality of the sample and single-nucleotide polymorphisms (snps) were controlled for in genomestudio (illumina). further checking for gender mismatch, sample relatedness (identity-by-descent, excluding pihat>0.125) (pi-hat a parameter in plink using estimates of pairwise ibd to find pairs of individuals who are possibly related.), hardy-weinberg equilibrium (excluding p<13 10), allele frequency (excluding minor allele frequency [maf]<0.01), nonrandom missingness (missingness-by-haplotype, excluding p<1 10; missingness-by-genotype, excluding p<1 10) and population substructure (excluding 6 sd from combined mean of northern and western european ancestry (ceu) and toscani in italia (tsi) in multidimensional scaling [mds] component 1 or 2) were performed in plink (details in supporting materials). the dystonia sample data was merged with the wellcome trust case control consortium (wtccc), and association analysis was performed using logistic regression in the plink package. three covariates were used in the regression: gender and the first 2 components of plink mds analysis to adjust for gender and genetic variation. because of our relatively small sample size, we did not perform separate analysis that looked specifically at known loci. imputation for autosomal chromosome was performed with mach and minimac, in chunks of 10 megabases with 1 megabase overlapping at both ends. postimputation association was done in mach2dat excluding imputed snps with r squared (rsqr)<0.3 as suggested. a higher cutoff was chosen as the small sample size in this study contributed to false-positive association in snps with low maf. reference for imputation was taken from the 1000 genomes project 2010 august release and composed of 283 individuals from the european continental group. a total of 233 cases were genotyped and 212 cases (66 m, 146 f, mean age 60.6 years, sd 10.9 years) remained after quality control and 494 k snps had maf>0.01 (exclusion breakdown in supporting tables 1 and 2). the cases were clustered around the ceu-tsi controls in the mds plot confirming european descent (supporting fig. these were compared with 5173 controls (2609 m, 2564 f) from wtccc. quantile-quantile (qq) plot did not deviate from the expected (supporting fig. no single snp had reached a genomewide significant association (defined as p<5 10). the best signal was rs9416795 (p=2.00 10), located in an intergenic region on chromosome 10. this was followed by rs1338041 on chromosome 13, intron region of nalcn, coding for sodium leak channel, nonselective (fig. 1a, supporting table 3). after imputation and quality controls (rsqr>0.3 and maf 0.03) these had satisfactory genomewide coverage, except a few regions, mainly telomeric and centromeric regions (manhattan plot, fig. the regions not well covered with gwas and imputation are listed in supporting table 7. there were no snps with genomewide significance (defined as p<5 10). a few clusters of possible associations (defined as p<5 10) were found and shown in the manhattan plot (fig. 1b, table 1). with imputation, the best signals found clustered around nalcn with best p value of 9.8 10 in rs61973742 and 5 more snps in the same gene just short of the best p value. the majority of the associated snps were found in the first intron between the first and second exon. the remaining were within a few kilobases of the 5 region of exon 1 and 5 untranslated region (utr) (fig. the second cluster with peak p at 3.1 10 was found in rs67863238, chromosome 11 base position 48,267,856 (hg19). this cluster codes for a number of olfactory receptors (or4x1, or4x2, or4s1, and or4b1) (fig. 2b, supporting table 5). remaining imputed snps that passed the possible associations were found on chromosome (chr) 1 rgl1, chr 2 intergenic 3 of kiaa1715, chr 10 intergenic, and chr 11 col4a1. the snps and local plots of these regions are shown in supporting table 4 and supporting figures 4 and 5. in this cervical dystonia gwas, no loci reached a statistically significant association with dystonia. the most crucial limitation was the small sample size, which was underpowered to detect loci with a smaller disease effect. assuming maf of 0.4, odds ratio 1.3, additive model, and prevalence of 430 per million in dystonia, it would need more than 1800 cases to achieve an 80% power. if the odds ratio was as high as with the complement factor h in macular degeneration, the cohort of 212 cases with same assumptions would have a power of almost 100% to detect the snp. hence, we conclude that a common snp with large effect-size is unlikely to be present in idiopathic cervical dystonia, at least in chr 1 to 22 as shown in manhattan plot (fig. 1) and within the regions that were usually genotyped by microarray (supporting table 7 for uncovered regions). our group has also recently identified mutations in anoctamin (ano3-dyt23), a calcium-gated chloride channel gene, leading to autosomal dominant craniocervical dystonia. nalcn protein is a member of 4 6 transmembrane voltage-independent, nonselective, noninactivating ion channel found in all animals studied and universally expressed in mouse brain and spinal cord. our uk brain expression consortium data shows nalcn is universal expressed in brain (supporting fig. 3). in schizophrenia, the associated snp in nalcn was rs2044117, located at the last intron. the c-terminal end of the protein is the important site in coupling with unc79 and unc80 proteins. this complex senses calcium level and results in alteration of leaking current and neuronal excitability, comparable to ano3 as a calcium-gated chloride channel. mice with exon 1 knocked out die from disrupted respiratory neuronal firing in the brainstem, suggesting regions other than the c-terminal are also critical. our snps were clustered around the exon 1 both at 5 and within the first intron. there are a few synonymous and non-synonymous snps found in the exon 1 (rs144447052, rs145910377, rs74707055, rs76774740, rs75606652, rs77203309, rs188237867, rs79047578, and rs9557636). these snps are very rare, with maf well below 0.01 and not included in the imputation and analysis. these may be pathogenic but unidentified rare pathogenic variants tagged to our snps are also possible. the best snp from imputation (rs61973742) has a low r with the best snp rs1338041 in gwas. there is a great discrepancy of the maf, 0.062 in rs61973742 and 0.34 in rs1338041. a discrepancy in maf can lead to low r (vanliere and rosenberg and wray). these 2 snps have a |d| 5 0.88 despite its low r (0.05) in 1000 genomes 378 european population. it was not found in the initial gwas, but multiple snps with borderline p value were identified from imputation (supporting table 5). if replicated, this represents the power of finding new associations that are not well tagged by common snps and are identified through haplotypes inferred during imputation. this group of associations, namely or4x1, or4x2, or4s1, and or4b1, is interesting (fig. they belong to the olfactory receptor, family 4, a type of g-protein-coupled receptors (gpcrs). olfactory function may seem unrelated to dystonia. recently fuchs et al. reported the association of gnal mutation with primary torsion dystonia, and the predominant clinical feature in these patients is cervical dystonia. gnal, coding an olfactory g protein [g(olf)] is found highly expressed in striatum and coupled with the expression of dopamine d1 receptor (drd1). the 4 olfactory genes (or4x1, or4x2, or4s1, and or4b1) are universally expressed in brain and orb1 is highly expressed in striatum as well (allen brain atlas). this may lead to slightly different p values in gwas and imputation for the same snp. the 3 other hits found in gwas were located at intergenic at chr 6 92 mb, chr 10 28 mb, and chr 19 29 mb. the local plots of postimputation snps in these regions are shown in supporting figure 4. the sparse imputed snps around chr 10 suggested that might be a false-positive result, as were the imputation finding at chr 1 183 mb and chr 2 176 mb (supporting figure 4). the extra snps found with imputation at chr 6 92 mb and chr 19 29 mb suggested potential association. the p value was lower than the best 2 clusters in nalcn and or4x1 and the functional role within an intergenic region is difficult to predict. given the recent findings from encode, intergenic region may still play a significant function in transcription. in summary, we found a plausible association, though not statistically confirmed, of cervical dystonia with snps in the nalcn region. replication on another cohort of cervical dystonia cases would be essential to confirm the association. as dystonia gwas is relatively understudied, we make all these data publicly available to encourage further analyses of the problem.

dystonia is a common movement disorder. a number of monogenic causes have been identified. however, the majority of dystonia cases are not explained by single gene defects. cervical dystonia is one of the commonest forms without genetic causes identified. this pilot study aimed to identify large effect-size risk loci in cervical dystonia. a genomewide association study (gwas) was performed. british resident cervical dystonia patients of european descent were genotyped using the illumina-610-quad. comparison was made with controls of european descent from the wellcome trust case control consortium using logistic regression algorithm from plink. snps not genotyped by the array were imputed with 1000 genomes project data using the mach algorithm and minimac. postimputation analysis was done with the mach2dat algorithm using a logistic regression model. after quality control measures, 212 cases were compared with 5173 controls. no single snp passed the genome-wide significant level of 5 108 in the analysis of genotyped snp in plink. postimputation, there were 5 clusters of snps that had p value<5 106, and the best cluster of snps was found near exon 1 of nalcn, (sodium leak channel) with p=9.76 107. several potential regions were found in the gwas and imputation analysis. the lowest p value was found in nalcn. dysfunction of this ion channel is a plausible cause for dystonia. further replication in another cohort is needed to confirm this finding. we make this data publicly available to encourage further analyses of this disorder.

PMC4208301

pubmed-803

the ductus arteriosus develops from the distal portion of the left sixth aortic arch and connects the main pulmonary trunk to the descending aorta. it runs in a posterior-anterior, inferior-superior, and leftward direction from the aorta to the pulmonary artery. patent ductus arteriosus (pda) is a common congenital heart defect, and the incidence of isolated pda in full-term infants is about 1 in 2000, accounting for approximately 5% to 10% of all types of congenital heart disease. pda can be closed via such different modalities as video-assisted thoracoscopic surgery, conventional surgery with division and suture, and transcatheter closure by interventional catheterization. small pdas (< 1-2 mm) can be closed safely with cook detachable (flipper) coils or gianturco with minimal mortality and morbidity and excellent results. the amplatzer ductal occluder (ado), which was introduced in 1997, is recommended for pdas with sizes larger than 2 mm. an antegrade approach via venous line is required for the occlusion of pda using the ado. rates of complete closure are as high as 99.7%, as was confirmed during a long-term follow-up study. during the procedure, the device is pushed with a delivery cable until it reaches the tip of the delivery sheath in the descending aorta under fluoroscopy. the sheath is gently pulled to deploy the aortic disk, and the cable delivery sheath and device are subsequently pulled as one unit under lateral fluoroscopy until the retention disk is positioned at the ductal ampulla. at this stage by using fluoroscopy, the tracheal air column can be used as a landmark from the previous aortogram to position the device. also, a tugging sensation can be felt with the pulse of the aorta. by comparing the tracheal air column and the narrowest diameter of the pda from the diagnostic aortogram, the operator can retract the delivery sheath with only a slight tension on the cable and deploy the device. after the confirmation of the correct deployment of the ado by aortography, the device can be released by screwing the cable. some complications such as device embolization, narrowing of the aortic artery area, and left pulmonary stenosis have been previously described. one of the most critical complications of pda closure by ado is device embolization, frequently seen due to the undersizing of the ado or incorrect positioning of the ado in the pda. accordingly, having a practical landmark for the correct positioning of the device into the pda could reduce complications after device deployment. one of the best guides for the correct positioning of the ado is aortography after ado deployment in the descending aorta. be that as it may, in some procedures, there is no arterial line and aortography can not be performed until the ado is released. so the question remains as to when we can release the ado safely. in this article, we describe for the first time a sign that was extremely helpful during our use of the ado for the closure of pda. the study protocol was approved by the ethics committee of iran university of medical sciences. this retrospective study recruited all patients scheduled to undergo pda transcatheter closure between september 2009 and september 2012 in rajaie cardiovascular, medical and research center. the inclusion criteria were comprised of age<15 years, body weight>5 kg, conical pda, and narrowest size of the pulmonary end of the pda 2 mm in lateral view aortograms. the exclusion criteria consisted of other complex diseases requiring surgery, other pda shapes rendering it suitable for coiling, very small pdas, and near or systemic pulmonary hypertension. the clinical characteristics of the patients including age, sex, and weight were recorded. during cardiac catheterization, angiographic and catheterization data such as the size of the narrowest diameter of the pda and the type of the pda in lateral view aortograms, pulmonary artery pressure, and fluoroscopy time were obtained. the antegrade procedure via venous line under general anesthesia was recommended for all the patients. the course of the venous catheter was from the inferior vena cava to the right atrium, right ventricle, and pulmonary artery. after the estimation of the size of the pda via lateral view aortography, a device size at least 2 mm greater than the narrowest size of the pda at the pulmonary end was chosen. an appropriate sheath was positioned in the descending aorta, and the ado reached the tip of the delivery sheath by pushing the delivery cable. next, all of the sheath, delivery cable, and ado were pulled together in order to position the retention disk at the ductal ampulla. in some patients, there was no arterial line and the ado was positioned in the pda by pulling the sheath and tensing the cable. at this time in some of our patients, the continuity between the cable, sheath and ado was broken signifying the correct deployment of the ado. echocardiography was done during the procedure before releasing the ado and the day after the procedure as well as one month and six months postprocedurally by using a ge vivid 3 echocardiographic machine. the patients were assessed for residual pda, left pulmonary artery stenosis, and descending aorta stenosis intraprocedurally via echocardiography. in the case of the presence of significant complications, two hundred thirty-seven patients underwent pda transcatheter closure between september 2009 and september 2012. the study population comprised 130 female and 107 male patients. two patients had protrusion of the ado into the aortic artery but had no significant stenosis; these patients did not have coarctation of the aorta on follow-up. in one of our patients, the ado protruded into the left pulmonary artery; this artery had no obstruction on follow-up. transcatheter closure of pda is an established and safe method of treatment with no mortality and significant morbidity. in our study, transcatheter closure was performed in 237 patients under general anesthesia and the pda size ranged from 2.1 mm to 6.2 mm. there was no mortality, and there were minimal intraprocedural complications inasmuch as none of the patients had device embolization or vascular complications. the closure rate in our patients was greater than 99.7%, which is comparable to the rates reported in some other studies. two of our patients had ado protrusion into the aortic artery. on follow-up, however, there was no significant stenosis or other complications. if the ado protrudes into the descending aorta without significant coarctation of the aorta or if less than 50% of the aortic area is obstructed, long follow-up without other procedures is needed. as the patient grows older and this complication necessitates long follow-up periods, but this type of stenosis tends to diminish as the patient grows older. nonetheless, if left pulmonary stenosis leads to the reduction or obstruction of the left pulmonary artery flow, other alternative treatment modalities such as surgery and use of other devices should be taken into consideration. we herein introduce a sign, which can be useful for the correct deployment of the ado. figure 1 illustrates a normal conical pda in a lateral view aortogram. as is shown in figure 2, during the procedure and before complete deployment (i.e. when the device is pulled into the ductal ampulla), the device, delivery cable, and delivery sheath have continuity with each other in a curved line. the retention disk of the ado is placed in the ductal ampulla, and the other segments of the ado are positioned in the narrow segment of the pda. after pulling the cable delivery sheath and the device as one unit under lateral fluoroscopy, the delivery sheath is pulled into the pulmonary artery and the distal end of the ado is placed in the pulmonary artery at the narrowest part of the pda. when there is correct deployment, only the delivery sheath is pulled into the pulmonary artery and the continuity between the cable and the device is broken. this angulation is created by the angle between the pda and the pulmonary artery (figure 3). this figure shows an ado positioned in the pda with its retention disk placed in the ductal ampulla. the narrow segment of the device is also positioned in the junction between the pda and the pulmonary artery, and the distal end of the device is in the pulmonary artery. the continuity between the cable and the delivery sheath is broken by a sharp angle between the ado and the cable. during the procedure and before the release of the ado, echocardiography is performed to investigate the possible presence of coarctation of the aorta and left pulmonary artery stenosis. at this point in time, the operator knows that the ado is positioned in the correct site (especially in the absence of an arterial line) and he can release the ado safely. if the ado is positioned in other sites, the sign described herein can not be observed. in our study, more than 85% of the patients, who underwent pda closure by ado, had a positive sign, which denotes the reliability of this sign. the relatively small sample size and duration may be the major limitations of the present study. we herein introduced a new sign, which can assist in the correct deployment of the ado during pda closure. to our knowledge, the existing literature lacks signs similar to what we describe here. this sign, especially in the absence of an arterial line for post-pda aortography, can help the operator release the ado safely.

backgroundthe ductus arteriosus connects the main pulmonary trunk to the descending aorta. the incidence of isolated patent ductus arteriosus (pda) in full-term infants is about 1 in 2000. the amplatzer ductal occluder (ado) is recommended for pdas with sizes larger than 2 mm. in this procedure, we must confirm the ado position in pda by aortogram from the arterial line. the purpose of this study was to determine the optimal release time of the ado in the pda closure procedure, especially in the absence of an arterial line for post-pda aortography. methodsthis study recruited all patients scheduled to undergo pda transcatheter closure with the ado between september 2009 and september 2012 in our center. age, weight, pda diameter, systolic and diastolic pulmonic pressures, fluoroscopy time, and total angiographic time were studied. major complications such as mortality and vascular complications were considered. resultswe studied 237 patients in our investigation. we had 130 female and 107 male patients at a mean age of 34.3 40.6 months and mean weight of 14.2 7.8 kg. pda sizes ranged from 2.1 to 6.2 mm and its mean was 3.7 1.8 mm. mean of fluoroscopy time was 11.4 9.7 min and mean of total angiographic time was 42.0 12.3 min. there were no significant complications. conclusionwe herein describe a new sign, which proved extremely helpful during our pda closure procedures with the ado. by considering the angle between the ado and the cable during the procedure, the operator can release the ado safely.

PMC4434969

pubmed-804

the definition of congenital heart block for the purposes of this review will be the presence of conduction system disease of any form, which is diagnosed on or before 28 days of life. the incidence of congenital heart block has been estimated from several studies to be about 1 in 22,000 live births.1 although this is clearly an uncommon disorder, it may be associated with high mortality and morbidity and therefore requires a high index of suspicion for early diagnosis and aggressive therapy when appropriate. aggressive therapy can be defined as offering the prenatal use of dexamethasone or the other maternal drugs, fetal pacing, or early delivery. there are no data on the appropriateness of aggressive therapy, but our recent paper2 implies it may improve hydrops in the sickest fetuses. secondly, we will spend some time discussing the unique subtype of congenital heart block, that which occurs in the absence of major structural anomalies and which is associated with maternal autoimmune antibodies. the commonest forms of congenital heart disease associated with heart block include left atrial isomerism, often with an accompanying atrioventricular septal defect, as well as levo transposition of the great arteries. when diagnosed in the postnatal period, approximately one-third of cases of congenital conduction system disease have associated structural disease. in utero, diagnosis of congenital heart block is associated with structural heart disease in approximately one half of the cases.1 there is a higher association of congenital heart block occurring with congestive heart failure in utero, and thus a poorer prognosis. the outlook for patients with congenital heart block depends largely on the presence or absence of underlying structural heart disease, as well as the rate of ventricular activation and the presence or absence of congestive heart failure. if the heart block is diagnosed as a bradycardia during the fetal period, there is a very high rate of fetal and neonatal loss. prenatal risk factors for mortality prenatally depend on the presence of structural heart disease and a heart rate less than a critical value, frequently quoted as 55 bpm. the presence of hydrops fetalis or other signs of physiologic disturbance in cardiac function, are very poor prognostic signs. in severe cases, there has been as high as an 85% mortality rate in the neonatal period. according to the jaeggi paper3, mortality in complete atrioventricular block in the fetus was 43% (13 out of 15 total deaths were fetal); in the neonatal stage was 6%; and in children there were none. in fetal hydrops if the fetal heart rate (fhr) was less than 55bpm, the majority died (9 out of 15). according to the kertesz paper1, in various series of fetal congenital complete atrioventricular block,, only 14% survived the neonatal period compared to 85% survival of the autoimmune isolated congenital complete atrioventricular block. if the congenital heart block is first diagnosed in the newborn period, presumably the higher risk fetuses have not survived, and therefore the prognosis is somewhat better. once again, the presence or absence of underlying structural heart disease often determines the outcome. the survival rate in newborns with congenital heart block and no structural heart disease is about 85%. if the congenital heart block first presents beyond the newborn period, the outlook for survival is improved. these patients are unlikely to have severe structural heart disease, and the survival rate is much higher than 85%. such children, however, still almost always require pacemaker implantation as well as treatment for any underlying structural heart disease. finally, some patients are first diagnosed with their presumably congenital conduction system disease in later childhood or adulthood. such patients are unlikely to have structural heart disease and they tend to have a good prognosis after pacemaker implantation. however, it must be remembered that they might present with severe life threatening events as their first manifestation of bradycardia, and they seem to have a late risk of developing left ventricular dilation and mitral insufficiency, presumably from longstanding bradycardia or immunological damage to the heart. several studies have attempted to elucidate the risk factors for the requirement of pacemaker implantation in patients with congenital heart block.1 it is fairly well accepted that a mean resting heart rate below a determined number for the age group could be an indication to place a pacemaker. this is frequently quoted as a 55 bpm in the newborn period and gradually decreases with advancing age. here we give some examples of electrocardiograms displaying varying degrees of heart block (figures 14). it is also well accepted that any symptomatic bradycardia requires pacemaker implantation, and it should be recognized that this may be either a sudden presentation or simply limited exercise capability. in addition, the presence of significant structural congenital heart disease is felt to be an indication to pace a patient with congenital heart block. some studies have suggested that a prolonged qtc interval or a wide qrs escape rhythm with complex ventricular ectopy may warrant the use of pacemaker therapy. electrocardiogram showing first degree atrioventricular block (pr= 160 msec, heartrate= 170 bpm) in a newborn. electrocardiogram showing second degree atrioventricular block (mobitz type ii) with progressive pr prolongation leading to dropped beats. electrocardiogram showing third degree heart block with atrioventricular dissociation and slow ventricular rate (atrial rate is 150, ventricular rate is 85 bpm). electrocardiogram showing third degree heart block (atrioventricular dissociation with atrial rate of 170 bpm) and ventricular pacemaker capturing at 125 bpm. it is sometimes difficult to determine if the child is having symptomatic bradycardia, because children will limit their exertion based on their symptomatology. echocardiograms may be helpful also to determine progressive loss of systolic function of the ventricle with increasing heart size and the development of mitral regurgitation. the congenital heart block associated with neonatal lupus is considered a form of passively acquired autoimmune disease in which maternal autoantibodies to the intracellular ribonucleoproteins ro (ss-a) and la (ss-b), cross the placenta and injure the previously normal fetal heart. other manifestations of neonatal lupus may include the presence of skin rashes, liver abnormalities determined biochemically and abnormalities in the cellular elements of the blood including various cytopenias.2 while the non-cardiac manifestations of neonatal lupus are generally transient and resolve at approximately the time that the maternal antibodies are cleared from the infant's circulation at several months of age, the conduction system disease is essentially irreversible. neonatal lupus is usually diagnosed in the presence of a slow heart rate discovered in a fetus or newborn in the absence of associated structural cardiac abnormalities. maternal serum testing subsequently reveals antibodies to ro and/or la, usually evaluated by elisa testing. while the mother may have systemic lupus or other autoimmune diseases such as sjogren's syndrome, approximately half of the women at the time of diagnosis are asymptomatic. in utero, the peak onset of the diagnosis of bradycardia is between 18 and 24 weeks of gestation, corresponding to the window of opportunity about six weeks after effective placental transport of maternal igg antibodies begin. while the precise mechanism is unknown it is presumed that anti-ro/la antibodies directly or indirectly cause the cardiac damage. the degree of heart block may vary from first degree to third degree block, but most cases diagnosed in utero present with a least second degree or more advanced block. there is a high mortality rate, particularly in fetuses diagnosed in utero with hydrops, and it is approximately 20%. of all cases that have been recognized with congenital heart block, current data show that approximately two-thirds of these patients will have a pacemaker placed before reaching adulthood (see table 1). autoimmune congenital heart block statistics2 in those cases of autoimmune conduction system disease due to neonatal lupus, the bradycardia alone is not always the full extent of disease. recently, there has been the recognition of a relatively high incidence of the development of late cardiomyopathy leading to heart failure, death or transplantation despite successful pacemaker implantation (table 1).34 as referenced in the moak paper4, late cardiomyopathy is associated with immune-related congenital heart block in 5-11% of cases. clinical deterioration of cardiac function was seen up to 9.3 years. in our experience, other organ systems may be involved in the newborn as well, including the characteristic neonatal rash which appears generally as annular lesions, mostly on the face, particularly around the eyes and is photosensitive (figure 5). in addition, on serum testing, some of the newborns with maternal autoantibodies will have various low levels of red blood cell counts, white blood cell counts, and platelets. top shows 2d-directed m-mode echocardiogram of a newborn with a normal shortening fraction as the ventricle contracts in systole. the interventricular septum and the left ventricular posterior wall thicken toward each other during systole. bottom shows 2d-directed m-mode echocardiogram of a newborn showing a very poorly contractile, dilated ventricle. the occurrence rate of neonatal lupus has been estimated at approximately 2 to 3% in all pregnancies born to women with anti-ro or anti-la antibodies. the recurrence rate in a mother with antibodies who has a previous child who was affected, is approximately 18%.5 the mechanism of causation of neonatal lupus is not completely understood but evidence points to the fetus beginning life with a normal cardiac structure and conduction system. at approximately 12 weeks of gestation, maternal igg antibodies against ro and la intracellular ribonuclear proteins are actively transported across the placenta and are thought to bind specific cells of the fetal conduction system. there is also an element of maturation of the fetal immune system involved in the development of fetal immune disease. the majority of cases of congenital heart block, diagnosed in utero are detected by either auscultation or routine obstetrical ultrasound in low risk pregnancies. the diagnosis is confirmed by the performance of maternal fetal monitoring (mfm) and a fetal echocardiogram with doppler techniques (figures 610). in the past the purpose of the fetal echocardiogram is to determine the level of block and also to rule out major associated structural lesions of the heart, such as left atrial isomerism with or without atrioventricular septal defects, and ventricular inversion, which are structural diseases associated with the presence of heart block without antibodies. the fetal echocardiogram is also able to detect any associated myocarditis by looking for the presence of decreased contractility on fetal echocardiogram as well as any secondary changes of cardiac enlargement, tricuspid regurgitation, pericardial effusion, or the development of hydrops fetalis (figure 11). lower tracing is uterine contractions. note slow fetal heart rate (fhr) of 80-115 bpm. bottom shows fetal lvot doppler with measurement of mechanical pr interval, from onset of mitral a wave (nadir of flow between the e wave and the a wave, when e and a are not distinctly separated) to the onset of aortic flow. x axis= time in seconds; y axis= velocity in meters/second. fetal doppler pr interval shows 1st degree heart block with the addition of profound sinus bradycardia (fetal heart rate of 60 bpm). long pause between the onset of the atrial contraction and onset of ejection time (pr interval). fetal doppler pr interval shows wenckebach mobitz type i, a type of 2nd degree heart block. the pr intervals become progressively longer (top right and bottom left), with a non-conducted pr interval (bottom right) top shows fetal doppler pr interval with 3rd degree heart block. spectral doppler labeled a symbolizes a rapid atrial rate moving about 3 times as fast as ventricular rate seen below the baseline. bottom shows m-mode of ventricle and atrium in 3rd degree heart block with slow ventricular rate versus rapid atrial rate.. transverse section of fetal thorax displaying 4 chamber view of heart surrounded by pleural and pericardial effusions. with increasing prenatal care and use of ultrasound technology in pregnancy, increasing numbers of cases of autoimmune congenital block are being diagnosed between 18 and 24 weeks of gestation. unfortunately, although these babies are at high risk for morbidity and mortality, guidelines are not well established nor based on definite scientific evidence. based on the assumption that treatment for identified heart block in utero may be effective if it can reduce a generalized inflammatory insult and lower the titer of maternal autoantibodies, several prenatal therapeutic protocols have been utilized. these include the use of adrenocorticosteroids, which are not metabolized by the placenta, principally dexamethasone. some researchers have also attempted plasmapheresis and the use of maternal alpha adrenergic agents.2 our therapeutic approach to a fetal diagnosis of congenital heart block is as follows.2 if the heart block is already third degree and has been present for more than three weeks, we feel that an attempt at reversing this complete heart block is futile, and therefore we provide serial echocardiographic and obstetrical follow-up but no therapy is initiated. if, however, the third degree heart block has been recently diagnosed, we offer the patient a therapeutic course of dexamethasone 4 mg. if there has been no change in fetal status, we taper the course and discontinue it. on the other hand, if the fetus conduction system disease has improved to second degree block or better, then we continue dexamethasone until delivery and subsequently taper in the mother. if the fetus presents with alternating second and third degree block, we again offer dexamethasone at 4 mg orally daily for a six-week period of time. if the conduction system disease progresses to third degree block then we taper the drug and stop it. but if there has been improvement to second degree or better, we continue the steroids until delivery and taper thereafter. if the fetus is discovered to have only second degree or a simply prolonged mechanical pr interval (first degree block),6 then we offer the mother dexamethasone 4 mg. orally daily until delivery and taper her dose after that. on the other hand, if this early block progresses to permanent third degree block, we will taper the steroid if third degree block has been present for six weeks or longer. occasionally, the fetal congenital heart block is associated with early signs of myocarditis and fetal hydrops. in such a case, we again offer dexamethasone at 4 mg orally daily until improvement of the hydrops fetalis per se, and then taper. some studies have suggested7 that in severely hydropic fetuses there may be some benefit to daily dexamethasone at 4 mg. other varied therapies in such cases of hydrops have included plasmapheresis, maternal terbutaline, digoxin, diuretics or direct fetal pacing. there has been no long-term survival from these desperate measures, and therefore if the lungs are mature at this point, we would advise early delivery. these include the glucocorticoid associated risks of increased infection, loss of bone density, diabetes, hypertension and cataracts. the fetal risks of maternal steroids include oligohydramnios, intrauterine growth retardation and adrenal suppression. there is also some suggestion of a risk to the developing fetal brain when exposed to steroids. some questions have arisen as to the appropriate use of prophylactic therapy in the pregnancy with a high-risk mother, such as those women with very high titers of the antibodies or a previous child with neonatal lupus. we feel that there is no support for the initiation of immune modulating treatment as a pre-emptive strike prior to the development of fetal conduction system disease. it is clearly advantageous to provide close fetal follow-up for monitoring the patient at risk for congenital heart block in the presence of maternal autoantibodies. we recommend that all women with anti-ro antibodies be evaluated by serial fetal echocardiograms. particularly high-risk groups appear to be those women with very high titers of anti-ro and anti-la antibodies, as well as those with previously affected pregnancies. we have recently developed a new technique in fetal echocardiography that allows us the possibility to detect the first possible changes of fetal conduction system disease, that is, the presence of first degree heart block in the fetus. in this case, the overall fetal heart rate will still be normal, but our new non-invasive doppler technique can measure the mechanical pr interval in the absence of an electrocardiogram from the left ventricular outflow tracing. this will allow the earlier diagnosis and the possibility of very early treatment, which may be able to reverse the disease.68 for this reason, we strongly suggest weekly fetal echocardiograms with doppler for pregnancies at risk. supportive treatment for low output or congestive heart failure can clearly be offered as well as pacemakers for babies with significant bradycardia, such as those with a heart rate less than 55 bpm. although we recognize that the newborn serum contains maternal antibody titers, we have no real data on immune modification of the newborn after birth. similarly, we can not comment on the fact that anti-ro and anti-la antibodies have been detected in maternal breast milk. we do know that neonates at risk for developing lupus rashes should be protected from sun exposure, but otherwise treatment is fairly conservative with the use of topical corticosteroids. the liver enzyme abnormalities and blood count irregularities are usually self-limited and require no specific treatment. the risk of a baby born with neonatal lupus syndromes developing active lupus in the future, is small and probably related to the genetic inheritance of the risk of developing rheumatic diseases rather than the maternal antibodies themselves. women with serum titers of anti-ro antibody carry a 3% risk of having a child with neonatal lupus syndrome. if she has a prior experience with affected fetuses, her risk rises to about 18%.5 therefore, we believe that all women at risk with antibodies present, should be closely followed during the pregnancy with serial echocardiograms, specifically looking for the earliest signs of conduction system disease such as pr interval prolongation by doppler. although prophylactic therapy is not indicated at the present time, if manifestations of congenital heart block develop, we have established empiric treatment guidelines. neonatal lupus congenital heart block has a fairly high morbidity and mortality but we believe that the outcome can be improved with early diagnosis and aggressive therapy. those patients whose congenital heart block is associated with structural heart disease have a higher morbidity and mortality, which is determined more by the underlying structural congenital heart disease than it is by the need for a pacemaker per se.

congenital heart block is a rare disorder. it has an incidence of about 1 in 22,000 live births. it may be associated with high mortality and morbidity. this should generate a high index of suspicion for early diagnosis and aggressive therapy when appropriate. the congenital heart block associated with neonatal lupus is considered a form of passively acquired autoimmune disease in which maternal autoantibodies to the intracellular ribonucleoproteins ro (ss-a) and la (ss-b), cross the placenta and injure the previously normal fetal heart. women with serum titers of anti-ro antibody carry a 3% risk of having a child with neonatal lupus syndrome. recurrence rates are about 18%. we believe that serial echocardiograms should be acquired so that early diagnosis is made and aggressive therapy administered, if signs of conduction system disease such as pr interval prolongation by doppler are found, so as to optimize the outcome. establishment of guidelines for therapy have been set empirically, should signs of congenital heart block develop. those patients whose congenital heart block is associated with structural heart disease have a higher morbidity and mortality, which is determined more by the underlying structural congenital heart disease than it is by the need for a pacemaker per se.

PMC3232542

pubmed-805

the extraordinary physical and functional properties of dna and rna have led to extensive investigation into their suitability for use in many fields including therapeutics, diagnostics, chemistry, nanotechnology, and molecular computation (reviewed in refs (1 and 2)). in pursuit of these endeavors, researchers exploit both natural and contrived properties of nucleic acids, including interstrand and intrastrand hybridization, strand displacement, binding of ligands to aptamers, and catalysis by nucleic acid enzymes. in general, nucleic acid enzymes are composed of single strands of either dna (deoxyribozymes or dnazymes) or rna (ribozymes) that are organized into domains required for enzymatic activity (catalytic core domains) and for substrate recognition (substrate binding domains). dnazymes and ribozymes are capable of catalyzing a broad range of chemical reactions including cleavage, ligation, phosphorylation, and deglycoslyation of rna or dna (reviewed in ref (3)). catalytic nucleic acids, sometimes in combination with aptamers, have been studied extensively for their capacity to provide the basis for biosensors (reviewed in refs (15)). many strategies use nucleic acid sequences that include an intact catalytic core but have reduced enzymatic potential due to weakened association of the enzyme with its substrate (reviewed in ref (4)). in such designs, the presence of the target analyte induces a conformation change that increases substrate binding affinity and catalytic activity. for example, the target may disrupt an inhibitory hairpin structure(6) or it may bind to the enzyme and substrate, thus strengthening their interaction.(7) the disadvantage of this approach lies in the potential for low-level catalytic activity in the absence of the target analyte under low stringency conditions. an alternative and inherently safer strategy involves dividing the catalytic core between multiple oligonucleotides that are capable of combining to form active enzymes. such oligonucleotides have been discovered by extensive re-engineering or in vitro evolution of ribozymes (reviewed in refs (8 and 9)) or by rational design utilizing specific tertiary structures within dnazymes such as guanine quartets(10) or stemloops.(11) for example, kolpashchikov(11) chose the e6 dnazyme for splitting because it contained a nonconserved stemloop that was thought to be required for structural, but not catalytic, function. in this report we describe a general approach for deriving partial catalytic core sequences from nucleic acid enzymes, which can then be incorporated into partial enzymes (partzymes) useful for assembly into mnazymes. in contrast to previous studies, our strategy does not necessarily require knowledge of, or exploitation of, predicted or observed structural or functional domains. we demonstrate our approach by engineering multiple partzyme pairs incorporating various sequences derived by splitting catalytic domains from two different nucleic acid enzymes, known as the 1023 and 817 dnazymes.(12) while each partzyme is inherently inactive, when they are combined in the presence of an assembly facilitator, they may associate and form a catalytically active, multicomponent nucleic acid enzyme (mnazyme). mnazymes have numerous applications, including use as biosensors, as exemplified below where the target nucleic acids to be detected served as the assembly facilitators. however, assembly facilitators may also be synthetic and/or have multiple components, as shown in examples where mnazymes allowed the creation of molecular switches and cascades. it is the modular nature of mnazymes that imparts the enormous flexibility and functionality, which in turn increases the versatility of nucleic acid enzymes. mnazymes are multicomponent nucleic acid enzymes that are assembled, and therefore catalytically active, only in the presence of an assembly facilitator (figure 1). these enzymes are composed of multiple partial enzymes, or partzymes, which self-assemble in the presence of assembly facilitators and form active mnazymes that catalytically modify substrates to produce products. figure 1 provides an example of the components of an assembled mnazyme capable of recognizing and cleaving a substrate in the presence of an assembly facilitator. the partzymes have multiple domains including sensor arms that bind to the assembly facilitator or target; substrate arms that bind the substrate; and partial catalytic core sequences that, upon assembly, combine to provide a complete catalytic core (figure 1). mnazymes can be designed to recognize a broad range of input assembly facilitators including, for example, different target nucleic acid sequences. in response to the presence of the assembly facilitator the assembly facilitator may be a target nucleic acid present in a biological or environmental sample. in such cases, the detection of mnazyme activity is indicative of the presence of the target in the sample. this mnazyme was composed of partzymes a and b, each of which contained a substrate arm, a partial catalytic core, and a sensor arm that can bind to an assembly facilitator, such as a target nucleic acid molecule. the assembly facilitator provided the input that directed the assembly of partzymes into an mnazyme with a functional catalytic core capable of cleaving multiple substrates into products thus providing an output. if the substrate is labeled on each side of the cleavage site with a fluorophore (f) and a matched quencher (q), then cleavage can be monitored by an increase in fluorescence. the partial catalytic core modules in the following examples were engineered by splitting the catalytic core of the unimolecular dna enzymes known as the 1023 and the 817 dnazymes.(12) the general strategy we developed to engineer mnazymes from dnazymes is illustrated in figure 2. many dnazymes have similar structures: a catalytic core flanked by substrate arms that can be tailored to hybridize to a range of substrates. to engineer a new mnazyme from a dnazyme, positions are identified within the dnazyme catalytic core at which it can be split, so that each partial portion of the catalytic core can be distributed between two oligonucleotides (candidate partzymes a and b). partzymes are designed such that the sequence from 5 to 3 of candidate partzyme a contains (i) one sensor arm portion capable of binding to an assembly facilitator molecule, (ii) one partial catalytic core portion derived from the dnazyme, and (iii) one substrate binding arm portion; and candidate partzyme b contains (i) one substrate binding arm portion capable of binding adjacent to candidate partzyme a on the same substrate sequence, (ii) one partial catalytic core portion that contains the remaining bases from the catalytic core of the dnazyme that were not incorporated into the candidate partzyme a, and (iii) one sensor arm portion capable of binding to the same assembly facilitator as candidate partzyme a and in a position adjacent to partzyme a (figure 2). many dnazymes have a catalytic core flanked by substrate binding arms. to engineer mnazymes, sites for splitting the catalytic core of the dnazyme are selected, and then candidate partzymes a and b incorporating sensor arms are designed. candidate partzyme pairs a and b may be tested by mixing them with a substrate and assembly facilitator and then assessing the level of catalytic activity. a series of paired a and b candidate partzymes can be screened to determine whether they exhibit catalytic activity. candidate partzyme pairs are assessed by mixing them with suitable substrates and assembly facilitators and then ascertaining the degree of catalytic activity, if any. once active partzyme pairs have been identified, their partial catalytic cores can be incorporated into a range of new partzymes, which can be tailored for recognition of other assembly facilitators (e.g., new targets) and/or other substrates. the protocol for engineering mnazymes from dnazymes is illustrated in the following example where partzymes, based on the 1023 dnazyme,(12) were engineered and used as components for mnazymes, referred to here as type mz1. the sequence of the complete catalytic core domain of this dnazyme is shown in table 1. a control 1023 dnazyme (dz1), which was capable of cleaving a chimeric dna/rna substrate designated sub2i-fb, was synthesized. substrate sub2i-fb was labeled with a fluorophore (fam) and quencher (black hole quencher) on either side of the cleavage site. the 1023 catalytic core was then split at a number of positions (table 1) and candidate partzyme pairs were synthesized such that candidate partzyme b contained bases from g1 to the split position, and candidate partzyme a contained bases from the split position to a15. candidate partzymes were designed to hybridize to both an assembly facilitator dna oligonucleotide, af-ro5, and the substrate, sub2i-fb (table s1, supporting information). partzyme pairs were incubated in the presence of af-ro5 and sub2i-fb with 50 mm mgcl2 and the change in fluorescence, indicative of cleavage of the substrate, was monitored over time to provide a measurement of kobs (figure s1, supporting information). partzyme pair core sequences based on the 1023 dnazyme are designated mz1, with candidate partzyme sequences designated ag. n represents a dna base, and x and y denote the positions with respect to the complete catalytic core of the dnazyme that are split upon incorporation into candidate partzymes a and b, respectively. kobs values were obtained by fitting a hyperbolic function (by use of prism version 4.0, graphpad software inc.) to the fluorescence versus time data (figure s1, supporting information). the results (table 1; figure s1, supporting information) indicated that the most suitable sites for splitting the 1023 catalytic core to generate useful partial core pairs were between c7 and t8 (mz1c) and between t8 and a9 (mz1d). partzymes based on splitting the core between a9 and c10 (mz1e) showed activity, albeit reduced compared to the mz1c and mz1d splits, and other candidate pairs showed little activity. the kobs values for control 1023 dnazyme and for mz1c and mz1d partzyme designs were comparable. to confirm that the mnazyme cleaves the substrate in a similar fashion to the original dnazyme, figure 3a shows a polyacrylamide gel demonstrating cleavage of the radiolabeled dna/rna chimeric substrate sub2-fb by both a 1023 dnazyme and an mnazyme (mz2c) engineered as described above. cleavage of radiolabeled and fluorescent substrates by catalytic nucleic acids and use of mnazymes in the detection of target nucleic acids. (a) polyacryamide gel electrophoresis showing uncleaved radiolabeled substrate (lane 1) and cleavage products of this substrate following incubation with a dnazyme (lane 2) and an mnazyme (lane 3). test reactions contained partzyme a (ro4aa/1) and partzyme b (ro4ba/1) in the presence of af-ro4 or in the absence of an assembly facilitator (no af). control reactions contained partzyme a only with af-ro4 (control 1); partzyme b only with af-ro4 (control 2); mutated partzyme a with partzyme b and af-ro4 (control 3); or partzymes a and b with a noncomplementary oligonucleotide af-ro5 (control 4). (c) use of mz1d mnazymes to determine the limit of detection of a target assembly facilitator by the isothermal direct detection protocol. test reactions contained ro3ad/2-p, ro3bd/2-p, and sub2i-fb, with either various concentrations of target af-ro3 (750, 500, 250, 50, 10, or 5 pm) or no assembly facilitator (no af). (d) mnazymes were used to monitor the accumulation of amplicons during pcr amplification of the k-ras gene from human genomic dna (5-fold dilutions from 100 ng to 32 pg). the calibration curve generated from this plot had an r=0.999 and an efficiency of 94%. to demonstrate the generality of our approach for engineering mnazymes from dnazymes, the process was repeated and additional mnazymes based on variants of the 817 dnazyme(12) were produced; they are designated here as mz2 mnazymes (tables s2 and s3, supporting information). similar to mz1 mnazymes, the activity of mz2 mnazymes was influenced by the location of the core split (figure s2, supporting information). to further analyze mnazyme activity, partzymes were synthesized to contain partial catalytic core sequences based on the 817 dnazyme variant 1 (mz2a), along with substrate arms complementary to a substrate (from ref (13)), referred to here as sub1i-fb. incubation of partzymes a and b in the presence of the complementary assembly facilitator af-ro4 resulted in the formation of active mz2a mnazymes that cleaved sub1i-fb, resulting in an increase in fluorescence over time (figure 3b). control reactions, which lacked either partzyme b (control 1) or partzyme a (control 2) or which lacked the assembly facilitator and had an irrelevant noncomplementary oligonucleotide (control 4), did not show an increase in fluorescence. this confirmed that the increase in fluorescence was due to catalytic activity of the mnazymes and was dependent on the hybridization and assembly of the partzymes with the assembly facilitator and that the partzymes, either alone or as a pair, had no catalytic activity until they were assembled into mnazymes on the assembly facilitator. to further confirm that the mechanism for generation of fluorescence was cleavage of sub1i-fb by the mnazymes, a c to t mutation was introduced into the partial catalytic core within an mz2a partzyme a. this base is the equivalent of the c nucleotide at position 11 within the complete catalytic core domain and has been reported to be crucial for enzymatic activity of the 817 dnazyme.(14) when this mutation was incorporated into partzyme a, the catalytic activity of the mnazyme was abolished (control 3, figure 3b), consistent with a similar mechanism of catalysis between the dnazyme and mnazymes derived from it. finally, the lack of any activity of the oligonucleotide complexes containing this mutated partzyme confirms that the increase in fluorescence generated by the active mz2a mnazymes is indeed due to cleavage of the substrate and is not due to a beacon-like effect caused by hybridization of the partzyme substrate-binding arms to the substrate. the kinetics of mnazymes were analyzed, with the mz1d core split as an example, and compared to those of the 1023 dnazyme on which the mz1 series was based. both enzymes had identical substrate binding arm sequences and were designed to cleave substrate sub2i-fb. turnover was compared by measuring kcat, that is, the amount of substrate converted to product per unit of time. kinetic studies measured kcat and km values for the mnazyme as approximately 28 min and 95 nm, respectively. in comparison, the kcat and km of the dnazyme were approximately 80 min and 140 nm, respectively. kcat/km was 2.9 10 min m for the mnazyme and 5.6 10 min m for the dnazyme. together these data demonstrate that an mnazyme can function as a true enzyme capable of multiple turnover with only slightly decreased efficiency compared to the dnazyme on which it is based. further, similar to dnazymes, the rate of cleavage by mnazymes was shown to be dependent on many factors including temperature, length of the substrate binding arms, and the constituents and concentration of buffer. the arm length of various substrates was optimized to allow cleavage by mnazymes under various conditions, including those compatible with real-time polymerase chain reaction (pcr). by way of example, measurement of kobs of the substrate sub2i-fb over a broad temperature range showed an optimum at around 50 c (figure s3, supporting information). in this example the number of bases in the substrate binding arms was 11 and 10 for the a and b partzymes, respectively. analysis of other mnazymes showed that the optimal temperature decreased as the lengths of substrate arms decreased, consistent with faster product dissociation of shorter oligonucleotides at lower temperatures (data not shown). santoro and joyce(12) demonstrated that the rate of catalysis of the 1023 dnazyme is also dependent upon the concentration of divalent cations. additional experiments confirmed that the rate of catalysis by this mnazyme was similarly dependent on the concentration of mg. the catalytic rate of this mnazyme increased approximately linearly with increasing concentrations over the range of 0100 mm mg, after which the rate reached a plateau (data not shown). mnazymes can be used as tools for direct detection of target nucleic acids in a protein-free, isothermal, fluorescent format. the limit of detection of such an assay was assessed in a series of three experiments with mz1d partzymes, which were designed to assemble in the presence of the target af-ro3 and cleave sub2i-fb. at 52 c the mnazyme assay could discriminate 5 pm of target assembly facilitator from the background signal (measured by the absence of target) (figure 3c). this corresponds to approximately 125 amol or 7.5 10 copies of the target nucleic acid sequence in a 25 l reaction. changes in fluorescence following cleavage of sub2-fb allowed real-time detection and quantification of the k-ras gene from human genomic dna (figure 3d). in the absence of genomic dna, fluorescence did not increase. a standard curve was generated by plotting the log of the initial dna concentration of a serial dilution of genomic dna against the threshold cycle, resulting in a linear plot with a correlation coefficient of 0.999 and a pcr efficiency of 94%. signal was detected in reactions containing as little as 32 pg of genomic dna, corresponding to approximately 10 copies of the target gene, demonstrating the high sensitivity of mnazyme detection coupled with real-time pcr. many variations of the basic mnazyme design, some of which involve using additional component oligonucleotides beyond those illustrated in figure 1, have been shown to form active mnazymes (figure 4) and provide further functionalities and utility. one possible variation incorporates a partzyme with a truncated sensor arm that requires hybridization of a stabilizer arm adjacent to it on the target to facilitate formation of an active mnazyme (figure 4a i). this type of mnazyme structure can be exploited to discriminate two targets differing by a single base (figure 5a). in the following example, the sensor arm of one partzyme was truncated and contained only five bases, all of which were fully complementary to an assembly facilitator (af-xdc). a second oligonucleotide (af-xdt) was identical to af-xdc with the exception that a thymine replaced a cytosine, thus resulting in a single mismatch with respect to the truncated partzyme sensor arm. a stabilizer arm, fully complementary to the adjacent sequence of both af-xdc and af-xdt, was added to the reaction. in the presence of the partzymes, the stabilizer arm, and the fully matched target af-xdc, mnazyme activity resulted in cleavage of the substrate sub2i-fb (figures 4a i and 5a omission of the stabilizer arm from this reaction resulted in no cleavage, demonstrating this oligonucleotide was essential for formation of active mnazymes incorporating the partzyme with the truncated sensor arm (figures 4a ii and 5a ii). when the partzymes and the stabilizer arm were incubated with the mismatched target af-xdt, no mnazyme activity was evident, consistent with the capacity of mnazymes to discriminate between two sequences differing by only a single base (figures 4a iii and 5a iii). together these data demonstrate that active mnazymes, which incorporate partzymes with truncated sensor arms, are formed only when the stabilizer arm is present and the assembly facilitator is fully matched to the sensor arms. absence of the stabilizer arm and/or the presence of a mismatch in the assembly facilitator within the region that hybridizes to the truncated sensor arm results in an inactive complex. the following abbreviations indicate oligonucleotides in this figure: sa, stabilizer arm; af, assembly facilitator; af-mut, mutated assembly facilitator; afc, assembly facilitator component; ai, assembly inhibitor; s, substrate; pz, partzyme pair; s1p, cleavage product of substrate 1. af-mut indicates a sequence that is identical to af with the exception of a single base difference. numbers are used to indicate the presence of more than one of any of the above elements in a particular series of complexes indicated in this figure. for example, the substrate s1 can also function as an ai and in such cases the second function is indicated in brackets. similarly, once s1 is cleaved, one of its products (s1p) can function as afc2. while some oligonucleotide complexes represent active mnazymes (a i, b i, and c i and ii), others are catalytically inactive (a ii and iii, b ii and iii, and c iii). (a) detection of a single base difference by use of a partzyme, xdbd/2-p, that has a truncated five-base sensor arm in combination with the stabilizer arm, xdsa-p. reactions also contained xdsa-p in the presence of either (i) fully matched target (af-xdc), (iii) mismatched target (af-xdt), or (iv) no assembly facilitator. an additional control reaction (ii) contained fully matched target (af-xdc) but lacked the stabilizer arm (xdsa-p). (b) demonstration of active mnazymes requiring two assembly facilitator components and inactive complexes incorporating inhibitor sequences. in addition, reactions also contained (i) assembly facilitator components afc1-ro1 and afc2-ro1, (ii) no afc2-ro1, (iii) afc1-ro1 and assembly inhibitor ai (sub6-trb), or (iv) no assembly facilitator components. reactions contained the components of the initiating mnazyme (ro5ad/6-p, ro5bd/6-p, and sub6-trb) and the cascading mnazyme (ro1ad/2-p, ro1bd/2-p, sub2i-fb, and afc1-ro1). in addition, reactions either contained target af-ro5 (i, ii) or lacked target (iii, iv), and fluorescence of either texas red (i, iii) or fam (ii, iv) was monitored over time. mnazymes can also be designed so that the formation of an active enzyme depends upon the presence of multiple assembly facilitator components (afc), any one of which can be used to switch the enzyme from the on state (active mnazyme) to an off state (inactive complex) or vice versa. further, inclusion of assembly inhibitor oligonucleotides can result in formation of alternative inactive complexes that incorporate and sequester mnazyme components, including partzymes. structures incorporating two assembly facilitator components, afc1-ro1 and afc2-ro1, were shown to facilitate active mnazyme formation followed by cleavage of the substrate sub2i-fb and a resultant increase in fluorescence (figures 4b i and 5b omission of one of the assembly facilitators, afc2-ro1, from this reaction resulted in inactive complexes (figures 4b ii and 5b ii). an assembly inhibitor oligonucleotide (ai) was tested that incorporated one domain equivalent to the sequence of one assembly facilitator component (afc2-ro1) plus a second domain containing noncomplementary bases appended to the termini at the junction with the other assembly facilitator component (afc1-ro1) (figure 4b iii). incubation of the partzymes, one assembly facilitator component (afc1-ro1), and the assembly inhibitor oligonucleotide (sub6) again produced inactive complexes that were unable to cleave the substrate (figure 5b iii). these alternate structures could function as a molecular switch that is on when afc2-ro1 completes the formation of an active mnazyme and is off when the assembly inhibitor binds in its place, forming an inactive complex. reactions were set up to contain partzymes and a substrate for both an initiating mnazyme (ro5ad/6-p, ro5bd/6-p and sub6-trb) and a cascading mnazyme (ro1ad/2-p, ro1bd/2-p, and sub2i-fb) plus a first assembly facilitator component, afc1-ro1, required for the active state for the cascading mnazyme. reactions either contained or lacked the target, af-ro5. in the presence of the target, the initiating mnazyme was formed, which cleaved the first substrate sub6-trb, resulting in an increase in texas red fluorescence (figures 4c i and 5c i). cleavage of sub6-trb by the initiating mnazyme produces a cleavage product (s1p) that is one of two facilitator components required to direct assembly of the cascading mnazyme. the cascading mnazyme then cleaved the second substrate sub2i-fb, causing an increase in the fluorescence of fam (figures 4c ii and 5c ii). as such, an increase in fluorescence of both texas red and fam is indicative of the presence of the target af-ro5 in the reaction. in the absence of target sequence, no significant increase in fluorescence of either texas red or fam was observed over time (figure 5c iii and iv). in its intact state, uncleaved sub6-trb would bind to one of the partzymes of the cascading mnazyme and function as an assembly inhibitor oligonucleotide directing formation of inactive complexes (schematic in figure 4c iii). this paper describes mnazymes, which are a powerful type of nucleic acid enzyme, with increased versatility and functionality that stems from the multiple components that make up these modular enzymes. the specific mnazymes characterized here are dna enzymes that comprise partial enzymes or partzymes, each of which lacks part of the sequence necessary for catalysis. partzymes combine to form catalytically active enzymes only in the presence of one or more assembly facilitators. active mnazymes catalyze substrate modification, thus producing an output signal. when the assembly facilitator is a target nucleic acid, modification of the substrate produces a signal that heralds the presence of the target in the sample. kinetic analysis established that mnazymes are capable of multiple turnover: for each target molecule present, multiple substrate molecules are modified and this results in signal amplification. the kcat values observed for both the dnazyme and mnazyme in this study are on the order of 10-fold higher than the maximum kcat reported for a dnazyme by santoro and joyce.(12) several factors, such as the use of higher ph and temperature, may have contributed to this result; however, the most significant contributor is likely due to differences in the composition of the substrates used in the studies. santoro and joyce(12) observed that kcat was highly dependent on the specific base composition of the substrate, and ota et al.(15) demonstrated that a specific dnazyme cleaved a dna/rna chimeric substrate with an enhanced rate compared to its all rna counterpart. the substrate used in kinetic studies by santoro and joyce was an in vitro-transcribed rna substrate selected because it corresponded to the start codon within the hiv target. in contrast, our kinetic studies used a dna/rna chimeric substrate that was selected by screening hundreds of different substrate sequences for those that afforded faster turnover rates. a subset of substrates was chosen as the basis for a series of generic substrates, each of which can be incorporated into single or multiplexed mnazymes assays for detection of a broad range of targets. a general strategy for engineering new mnazymes based on dnazymes we demonstrated the generality of this approach by deriving mnazymes from 1023 and 817 dnazymes.(12) mnazymes were found to have similar properties to the dnazymes from which they were engineered. for example, these mnazymes were shown to be true enzymes capable of multiple turnover at a rate that is dependent on both the concentration of magnesium ions and the reaction temperature. like protein enzymes, dnazyme catalysis is highly dependent on tertiary structure formation, and factors that impact this even subtly can have a profound influence on the catalytic rate. therefore, it is remarkable that mnazymes have enzyme activity comparable to that of dnazymes when their fundamental differences in structure are considered. this is particularly true for mnazymes based on the 1023 dnazyme, which has no apparent stemloop or other tertiary structures within the catalytic core. such structures could theoretically promote the formation of an active mnazyme catalytic core by supporting association and/or stabilization of partial catalytic domains when the complete dnazyme core has been split between two partzymes. for example, the presence of the structural stemloop within the parent e6 dnazyme most likely contributes to the association of component oligonucleotides that constitute the binary deoxyribozyme developed by kolpashchikov.(11) while the enzymes exemplified in our paper all cleave nucleic acid substrates, recent work in our laboratory has extended this repertoire by deriving an mnazyme capable of ligation (data not shown). furthermore, the strategy described here could be applied to derive new mnazymes from either dnazymes or ribozymes, which could have a broad range of catalytic functions. much of the power of mnazymes comes from the modularity imparted by component partzymes. in practice, partzymes can be synthesized to have sensor arms that hybridize to any target nucleic acid of interest and substrate arms that hybridize to any one of a series of generic substrates. examples in this report have used various combinations that incorporated seven partial core sequence pairs, five target binding sequences, and three substrate binding sequences to produce 12 different mnazymes. further, the use of generic substrates as probes provides multiple advantages regardless of the application for which mnazymes are being used. in particular, the use of generic substrates in protocols allowing target detection confers reliable, consistent performance regardless of the target sequence. further, their use reduces assay development time, lowers the cost of goods, and eliminates substrate waste since any excess can be used for the next system. mnazymes have functionalities useful for a range of biotechnical applications, especially molecular diagnostics, where demand is increasing for point-of-care assays and technologies with higher throughput, sensitivity, and specificity. in two demonstrations of utility described here, we reported the use of mnazymes in an isothermal, protein-free assay for direct detection of nucleic acids. the assay detected approximately 125 amol of target in 2 h by fluorescence monitoring in a format compatible with analysis on any general-purpose fluorometer. the ability of this mnazyme to detect a low concentration of target was superior to that reported for the e6 binary deoxyribozyme,(11) which only detected 1 nm after 30 h. our mnazyme detection strategy provides a simple, inexpensive protocol suitable for detecting targets present at a high copy number in a point-of-care setting. this isothermal mnazyme protocol could also produce a colorimetric readout if combined with an approach such as that published by lui and lu.(18) however, methods that use either dnazymes or split dnazymes to produce a colorimetric readout have the disadvantage that they are not capable of multiplex analysis of more than one target in a single reaction chamber. in alternative detection strategies, mnazymes can be linked to various target amplification technologies including real-time pcr. to date, no binary or split dnazymes have been described as being capable of functioning at the elevated temperatures (50 c) required for pcr. we demonstrated the use of mnazyme real-time pcr to quantify a target gene present in genomic dna and detected as little as 10 copies. the method is highly sensitive and has enhanced specificity compared to other real-time pcr protocols since two partzymes and two pcr primers are required to bind for amplification and detection. a series of generic substrates has been successfully used in multiplex mnazyme real-time pcr assays that simultaneously quantified five rna transcripts.(20) furthermore, multiplex mnazyme real-time pcr was also used to follow an rna transcript (oz1 rna) and a control transcript in an international phase ii gene therapy clinical trial,(21) demonstrating the robustness and utility of the technology in a clinical setting. mnazymes are highly versatile enzymes encompassing a range of structures with variant oligonucleotide composition and structure. for example, mnazymes may incorporate elements such as partzymes with truncated sensor arms and stabilizer arm oligonucleotides, and/or they may require multiple assembly facilitator components for functionality. this further broadens their range of utility to encompass applications such as base-sensitive biosensor elements and computational switches (reviewed in ref (2)). partzymes with truncated sensor arms, together with stabilizer arms, are particularly useful for detection of sequence variations including mutations and single nucleotide polymorphisms (snps). in this report, detection of a single base change was dependent upon hybridization at 46 c between a five-base truncated sensor arm and a target. it is likely that the truncated sensor arm and the adjacent stabilizer arm synergistically cooperated by coaxial helix stacking to complete the complex. the position within the sensor arm and the specific mismatch both influence the degree of discrimination. many authors have reported that certain mismatches, for example, c-a or g-a, have a greater destabilizing effect on duplexes than others such as g-t. experiments to date indicate these rules are also useful for predicting mismatches between a target assembly facilitator and a partzyme sensor arm that result in inactive complexes. while the experiments reported in this study used an isothermal, direct detection format, we have since used partzymes with truncated arms for mutation and snp detection in an mnazyme real-time pcr (data not shown). in another example, mnazyme structures were formed with the use of multiple assembly facilitator component oligonucleotides, all of which were required for enzyme activity. switch-like effect such that the absence of an assembly facilitator component, and/or the presence of an assembly inhibitor, prevented formation of an active enzyme and resulted in catalytically inactive or off complexes. in contrast, the presence of all abutting assembly facilitator components resulted in catalytically on mnazymes. combining the functions of an mnazyme that is ready to receive input and produce output along with the ability to be turned off and on provides the basis of molecular switches and provides useful components of nucleic acid cascades. these structures can be used for transducing signals, facilitating molecular computation, and/or providing structural elements useful for bioengineering nanoscale machines. our laboratory has exploited mnazyme structures to develop cascade protocols that may be linked to any isothermal mnazyme assay to increase the sensitivity of target detection and/or amplify the signal. the cascade strategy employed here is controlled by a molecular switch where an initiating mnazyme controls the formation of a second cascading mnazyme. the target-dependent assembly of the initiating mnazyme is required to produce an essential component of the cascading mnazyme, and thus the initiating mnazyme is a molecular switch to turn the cascading mnazyme on. while it was useful to label the two substrates with different fluorophores to provide evidence of both stages of the cascade in this example, labeling both substrates with the same fluorophore would be advantageous in an analytical setting, as this would increase the degree of signal amplification afforded for each target molecule. this study demonstrates the power of mnazymes, which are inherently more versatile than the antecedent dnazyme on which they were based. in general, dnazymes or ribozymes recognize and modify a target substrate; however, the separation of target recognition from substrate modification in the mnazyme design affords increased flexibility and functionality. further, our study discloses a general method for generating new mnazymes from other nucleic acid enzymes. mnazymes use stable nucleic acid components and this will facilitate simple, fast, and cost-effective methods for the detection of targets. mnazymes are a powerful class of enzyme that can be activated by the input of any specific synthetic or biological nucleic acid to produce an amplified output, which can be generic in nature. furthermore, their activity can be switched on or off by the presence or absence of other nucleic acid sequences, and they can be linked in series to produce a molecular cascade or signal transducer. the extraordinary properties of mnazymes confers potential for their integration into diverse devices such as diagnostic biosensors, molecular computers, and/or nanoscale machines. reactions contained a bulk mix consisting of 0.2 m each of partzyme a and partzyme b, pcr buffer ii (applied biosystems), and 25 mm mgcl2, (unless stated otherwise). in addition, reactions may also have contained a stabilizer, an assembly facilitator or assembly facilitator component(s), mutated assembly facilitator, or no assembly facilitator (no af control reaction). the total volume of each reaction was 25 l. reactions were incubated at various, constant temperatures in a smartcycler system thermocycler (cepheid), and fluorescence was monitored over time. a substrate-only reaction was performed to enable subtraction of the background level of fluorescence from the reactions. results in all figures are the averages from replicates and were plotted by use of excel (version 11). mnazyme activity was monitored by cleavage of a dual-labeled nucleic acid substrate composed of dna (uppercase) and rna (lowercase) bases. underlined bases indicate the position of a 6-fam (f) or texas red (tr) moiety on the 5 side of the rna bases and the black hole quencher moiety (b) on the 3 side of the rna bases. sub2 was either end-labeled (sub2-fb, aaggtttcctcguccctgggca) or internally labeled (sub2i-fb, aaggtttcctcguccctgggca). the substrate used for studies of mz2 mnazymes was sub1i-fb, which was internally labeled (actcactataggaagagatg). partzyme sequences used in these experiments are displayed such that the bases shown underlined form part of the catalytic core of the assembled mnazyme, bases shown in boldface type hybridize with the assembly facilitator, and bases shown in italic type hybridize to the substrate. indicates 3 phosphorylation of the partzyme, which prevents extension when partzymes are used in conjunction with pcr. the assembly facilitators (af) af-ro3 (cagtgacttcacatggggcaatggcaccagcacgggcagcagctggc), af-ro4 (gccattgtcgaacacctgctggatgaccagc), and af-ro5 (gaaggtgtaatccgtctccacagacaaggccaggactcgtttg) and assembly facilitator component (afc) afc1-ro1 (acttccaggtcgccctgtcttccctgagc) were homologous to sequence from the human rplp0 gene (nm_001002). the assembly facilitator af-xdt (tgccccctcaccctcacgaaggtatacagacagatggacatccagttggtga) was homologous to the human plxnb1 gene (nm_002673), and af-xdc (tgccccctcaccctcacgaaggcatacagacagatggacatccagttggtga) was homologous to the mutant a5359g(22) of the human plxnb1 gene. reactions were performed in triplicate and were monitored in real time at 9 s intervals for 15 min at 55 c by the isothermal direct detection method (see above) with the modification of 50 mm mgcl2. test reactions for mz1 candidate partzyme pairs (ag series; see table s1 in supporting information) each contained 0.2 m af-ro5 or no assembly facilitator. substrate sub2-fb (1 m) was 5 end-labeled in 10 ci [-p]atp (perkin-elmer), 1 pnk buffer, and 1 unit of polynucleotide kinase (new england biolabs) at 37 c for 30 min. the reaction contained 1 immobuffer (bioline), 50 mm mgcl2, 5 nm labeled sub2-fb, and either 100 nm 1023 deoxyribozyme (dz1) or 100 nm mnazyme [100 nm each of ro5ac/2-p (caaacgagtcctggccttgtcttacaacgagaggaaacctt-p), ro5bc/2-p (tgcccagggaggctagcgtggagacggattacaccttc-p), and af-ro5] or no enzyme. the reactions were stopped by adding formamide loading dye containing 100 mm ethylenediaminetetraacetic acid (edta). upon completion of the reactions, the uncleaved substrate and cleavage products of the deoxyribozyme and the mnazyme were resolved by electrophoresis on a 16% denaturing polyacrylamide gel. reactions reported in figure 3b were monitored at 36 s intervals for 1 h at 40 c by the isothermal direct detection method (see above) with the modifications of 50 mm mgcl2 and 50 mm tris hcl (ph 9.0 at 25 c). test reactions also contained sub1i-fb, ro4aa/1 (gctggtcatccagcagcggtcgaaatagtgagt), and ro4ba/1 (catctcttctccgagcgtgttcgacaatggc) in the presence of 0.2 m af-ro4 or in the absence of an assembly facilitator (no af). control reactions included ro4aa/1 with 0.2 m af-ro4 (no partzyme b, control 1); ro4ba/1 with 0.2 m af-ro4 (no partzyme a, control 2); mutated partzyme a (ro4aa/1mut gctggtcatccagcagcggttgaaatagtgagt) with ro4ba/1 and 0.2 m af-ro4 (control 3); and ro4aa/1 and ro4ba/1 with 0.2 m af-ro5 (control 4). three independent experiments were performed, with each reaction done in triplicate and monitored in real time at 18 s intervals for 15 min at 55 c. the isothermal direct detection method (see above) was used with the modifications of 50 mm mgcl2 and various concentrations of sub2i-fb (either 1000, 750, 500, 250, 200, 150, or 100 nm). mnazyme test reactions used the mz1d split (table s1 in supporting information) and contained 1 m ro5ad/2-p, 1 nm ro5bd/2-p, and 1 m af-ro5 (equivalent to a maximum concentration of assembled mnazyme of 1 nm). the 1023 dnazyme reaction contained 1 nm dz1. to enable the conversion of fluorescence data into reaction velocities, a standard curve was generated from a range of concentrations (1000, 500, 250, 125, 62.5, or 31.1 nm) of totally cleaved substrate. the michaelismenten equation was fitted to the data generated from the enzymatic reactions (by use of prism version 4.0, graphpad software inc.) to derive the enzymatic parameters vmax and km. the kobs values were obtained by fitting a hyperbolic function (by use of prism version 4.0, graphpad software inc.) to the fluorescence versus time data. reactions in figure 3c were performed in duplicate and were monitored at 72 s intervals for 2 h at 52 c by the isothermal direct detection method. all reactions contained ro3ad/2-p (agctgctgcccgtgctggtgacaacgagaggaaacctt-p), ro3bd/2-p (tgcccagggaggctagctccattgccccatgtgaagtca-p), and sub2i-fb. test reactions contained various concentrations of target af-ro3 (750, 500, 250, 50, 10, or 5 pm) or no assembly facilitator (no af). human genomic dna extracted from the im9 cell line (american type culture collection) was used as template for amplification of the k-ras gene (nt_009714.16). real-time pcr amplification and quantification of the target sequence the cycling parameters were 95 c for 10 min, followed by 5 cycles of 95 c for 30 s and 55 c for 60 s, and followed by 40 cycles of 95 c for 30 s and 53 c for 60 s. the reactions contained 40 nm forward primer (5k-ras tagtgtattaaccttatgtgtgac) and 200 nm of each reverse primer (3k-ras aatgattctgaattagctgtatc), k-rasad/2-p (taaacttgtggtagttggagacaacgagaggaaacctt), k-rasbd/2-p (tgcccagggaggctagctctggtggcgtaggcaagagtgcc), and sub2-fb, 8 mm mgcl2, 10 units of rnasin (promega), 1 immobuffer (bioline), 2 units of immolase (bioline), and either genomic dna template (100 ng, 20 ng, 4 ng, 800 pg, 160 pg, or 32 pg) or no dna (h2o). reactions in figure 5a were performed in duplicate and were monitored at 72 s intervals for 2 h at 46 c by the isothermal direct detection method. all reactions contained xdad/2-p (actggatgtccatctgtctgacaacgagaggaaacctt-p), xdbd/2-p (tgcccagggaggctagcttatgc-p), and sub2i-fb. reactions also contained 0.2 m xdsa-p (cttcgtgagggtgag-p) in the presence of either 10 nm af-xdc or 10 nm af-xdt or no assembly facilitator. an additional control reaction contained 10 nm af-xdc but lacked xdsa-p. reactions in figure 5b were performed in duplicate and were monitored at 36 s intervals for 1 h at 47 c by the isothermal direct detection method. all reactions contained ro1ad/2-p (gctcagggaagacagggcgacctgacaacgagaggaaacctt-p), ro1bd/2-p (tgcccagggaggctagctgaagtcgaggcgtgat), and sub2i-fb. in addition, reactions also contained either 0.2 m afc1-ro1 and afc2-ro1, or 0.2 m afc1-ro1, or 0.2 m each of afc1-ro1 and assembly inhibitor ai (sub6-trb), or no assembly facilitator components. reactions in figure 5c were performed in duplicate, and fluorescence of both texas red and fam were monitored at 36 s intervals for 1 h at 48 c by the isothermal direct detection method. reactions contained the components of the initiating mnazyme, ro5ad/6-p (caaacgagtcctggccttgtctacaacgagaggcgtgat-p), ro5bd/6-p (ctgggaggaaggctagctgtggagacggattacaccttc-p), and sub6-trb, and the cascading mnazyme (ro1ad/2-p, ro1bd/2-p, sub2i-fb, and 0.2 m afc1-ro1). in addition, reactions either contained 10 nm target af-ro5 or lacked target.

to increase the versatility and utility of nucleic acid enzymes, we developed multicomponent complexes, known as mnazymes, which produce amplified output signals in response to specific input signals. multiple oligonucleotide partzymes assemble into active mnazymes only in the presence of an input assembly facilitator such as a target nucleic acid. once formed, mnazymes catalytically modify a generic substrate, generating an amplified output signal that heralds the presence of the target while leaving the target intact. we demonstrated several applications including sensitive, isothermal target detection; discrimination of polymorphisms; and highly specific monitoring of real-time polymerase chain reaction (pcr). furthermore, we showed their capacity to function as molecular switches and to work in series to create a molecular cascade. the modular nature of mnazymes, together with the separation of input and output functionalities, provides potential for their integration into diverse devices such as diagnostic biosensors, molecular computers, and/or nanoscale machines.

PMC2808728

pubmed-806

uremia related, non -traditional risk factors, such as inflammation, oxidative stress, dyslipidemia, vascular calcification alterations in calcium and phosphorus (p) metabolism, have been proposed to play a central role (2). elevated plasma beta2 microglobulin (2 m), is a well-known characteristic of chronic renal failure. predialysis serum 2 m level predicted mortality and increase of 2 m clearance during hd was associated with improved outcomes (3). the source of the elevated serum 2 m in hemodialysis patients, has not been explained absolutely. there is controversy as to whether elevated levels are caused predominantly by increased synthesis, the use of membranes in hemodialysis with different clearance capacities, or diminished renal elimination. use of middle and high-flux biocompatible membranes was shown to be associated with a notable reduction 2 m (4). the surface of lymphocytes and monocytes are particularly rich in 2 m, the latter being synthesized to large amounts by lymphocytes and regulated by interferons and proinflammatory cytokines (5), which might explain the pathophysiological role in atherosclerosis. but remains to be further clarified if 2 m is solely a marker of inflammation or if it has a direct pathogenic effect and if other yet unknown confounders may influence 2 m levels (6). the uremic state is associated with an altered immune response, and intermittent stimulation by endotoxins originating from the dialysis water supply and artificial vein grafts or bio incompatibility caused the increased circulating inflammatory proteins, such as c-reactive protein (crp) (7), produced by the liver, mainly in response to interleukin -6 (il-6). hemodialysis patients, exhibit significant alterations in lipoprotein metabolism, which in their most advanced form result in the development of severe dyslipidemia. lipid disorders stem largely from dysregulation of high density lipoprotein (hdl) and triglyceride-rich lipoproteins metabolism. the down regulation of the expression of several genes along with the changes in the composition of lipoprotein particles and the direct inhibitory effect of various uremic toxins on the enzymes involved in lipid metabolism, represent the most important pathophysiological mechanisms underlying the development of hypertriglyceridemia (8). several mechanisms, working in concert, may underlie the reduction in hdl levels, which is usually indicative of impaired reverse cholesterol transport. thus, uremic patients exhibit decreased levels of apolipoproteins ai and aii, diminished activity of lecithin-cholesterol acyl-transferase, as well as increased activity of cholesteryl ester transfer protein that facilitates the transfer of cholesterol esters from hdl to triglyceride-rich lipoproteins, thus reducing the concentration of hdl (8). lipoprotein(a) [lp(a)] is an independent risk factor for clinical events attributed to atherosclerotic cardiovascular disease in chronic hemodialysis. lp(a) levels are frequently elevated in hd patients (9) and are considered a major risk factor for cardiovascular disease (10). secondary hyperparathyroidism, is one of the major complications of patients in chronic hemodialysis (11). parathyroid hormone (pth) starts to rise very early in the course of kidney disease. as disease progresses, plasma levels of vitamin d and calcium begin to decline, thus contributing to greater secretion of pth. in addition, the retention of phosphate further increases pth secretion independent of calcium and vitamin d levels. previous studies have supported the view that high pth serum levels in uremic patients may cause deleterious effects in myocardium metabolism and function (12). the aim of this study is to investigate the association of 2-m with inflammatory markers, dyslipidemia and mineral disorders in high-flux membrane hemodialysis patients. in study were included 40 patients, undergoing maintenance high-flux membrane hemodialysis treatment in the clinical centre in prishtina, for a period longer than 6 months. a) based in patient s history, angina, possible myocardial infarction, cerebrovascular events, infective diseases and cancer, were excluded. in all patients, 2-m, crp, il-6, triglycerides, cholesterol, ldl, hdl, lp(a), pth, calcium, triglycerides, cholesterol, hdl, ldl, calcium, phosphorus and albumin were measured by biochemical analysis; b) the assay of -2 microglobulin is based on a latex enhanced immunoturbidimetric method. c) crp was determined by the turbidimetric method, il-6 with enzyme linked immunosorbent immunoassay (elisa), lipoprotein (a) with immunoturbidimetric method depth with a chemiluminometric immunoassay; d) twenty-four healthy subjects (12 women and 12 men, aged 56.08 12.34 years) served as controls. serum concentration of 2 m, crp, il-6, triglycerides, lp(a), p and pth in hemodialysis patients were significantly higher than in controls (19.84 2.23 mg/l vs 2.11 1.0 mg/l, p<0.001; 39.75 29.7 mg/l vs 16.25 3.78mg/l, p<0.001; 3.06 1.08 pg/ml vs 0.35 0.3 pg/ml, p<0.001; 3.17 1.28 mmol/l vs 1.19 0.38 mmol/l, p<0.001; 40.25 12.98 mg/dl vs 24.33 8.51 mg/dl, p<0.001; 1.9 0.6 mmol/l, p<0.001; 137.35 50.7 pg/ml vs 46.56 28.64 the concentration of hdl and serum albumin was significantly lower (1.14 0.34 vs 1.52 0.35 mmol/l, p<0.001; 34.83 3.89 g/l vs 40.5 3.94 g/l, p<0.001 (table 1). we did not find any difference in cholesterol, ldl and calcium levels between two groups (4.0 1.11mmol/l vs 4.26 0.16 mmol/l, p=0.16; 2.90 1.14 mmol/l vs 2.41 0.57 mmol/l, p<0.05; 2.2 0.24 mmol/l vs 2.26 0.25 mmol/l, p=0.11 (table 1). biochemical parameters in hemodialysis patients and controls 2 m was inversely associated with hdl, albumin and calcium concentration (r=-0.73, p<0.001; r=-0.53, p<0.001; r=-0.50, p<0.01 (table 2), whereas positively was associated with triglycerides, p and pth (r= 0.69, p<0.001; r= 0.53, p<0.001; r=0.58, p<0.05 (table 2). the patients with high 2 m values, simultaneously had higher lp(a) concentrations, but we did not observe significant correlation (r=0.28 (table 2). we also found low positive correlation of 2 m with age (r=0.46, p<0.001 (table 2). 2 m levels were upper in patients with high crp levels, but there was no significant relationship between crp or il-6 and 2 m (r= 0.11, p<0.001; r= 0.23, p<0.001 (table 2). there was no correlation of 2 m with cholesterol and ldl cholesterol (r=0.13, p<0.001; r=0.18, p<0.001 (table 2). positive correlation exists between crp and il-6 (r=0.94, p<0.001 (table 2). albumins correlated negatively with il-6 and lpa (r=-0.60, p<0.001; r=-0.72, p<0.005 (table 2). correlation between serum 2 m levels with selected biochemical parameters during the follow-up period of three years, 6 out of 40 patients had died, from cardiovascular events. significant correlation exists between b2 m and glomerular filtration rate even when renal function was only slightly impaired. liabeuf, et al, reported plasma 2 m level to be a predictor of cardiovascular events and mortality in patients with different stages of chronic kidney disease (14). we examined the impact of 2 m on some cardiovascular risk factors in high-flux membrane hemodialysis patients. a correlation between an inflammatory response during hemodialysis and elevated serum 2 m has been described (15). compared with the controls, hd patients exhibited marked elevation of serum 2 m, crp and il-6 (19.84 2.23 mg 29.7mg/l vs 16.25 3.78mg/l, p<0.001; 3.06 1.08 pg/ml vs 0.35 0.3 pg/ml, p<0.001 (table 1). but we found no relationship between crp or il-6and 2 m (r= 0.11, p<0.001; r= 0.23, p<0.001 (table 2) when high-flux membranes are used. (16, 17, 18). even in studies, where the low flux membranes were used our findings suggested that plasma b2 m level is directly correlated with some metabolic and cardiovascular risk factors. triglycerides start to increase in early stages of chronic kidney disease and show the highest values in dialysis patients. hemodialysis patients presented increased triglycerides compared with controls (3.17 1.28 mmol/l vs 1.19 0.38 mmol/l, p<0.001 (table 1). we find significant positive correlation between triglycerides and 2 m levels (r= 0.69, p<0.001 (table 2). hdl concentrations exhibited significant reduction in patients compared to controls (1.14 0.34 vs 1.52 0.35 mmol/l, p<0.001 (table 1). serum 2 m concentrations were inversely associated with hdl (r=-0.73, p<0.001 (table 2). supporting, linear regression analysis confirmed the negative impact of 2 m concentrations on hdl level. lp(a) start increasing early during the course of chronic kidney disease and becomes pronounced with increasing severity of disease. lp(a) levels were significantly higher in patients than in controls (40.25 12.98 mg/dl vs 24.33 8.51 mg/dl, p<0.001 (table 1), which confirm that kidney have an important role in lp(a) metabolism. the patients with high 2 m values, simultaneously had higher lp(a) concentrations but we did not observe high correlation (r=0.28, p<0.05 (table 2). the negative correlation of lp(a) with albumin (r=-072, p<0.005 (table 2), suggests that the mechanism behind the increased lp(a) levels may be related to the protein losses, perhaps via an increased synthesis rate of apolipoprotein (a) in the liver or via decreased lp(a) catabolism in hd patients. we found a significant indirect relationship between 2 m and albumin (r=-0.53, p<0.001 (table 2). this correlation may be used to identify the patients at high risk, from cardiovascular disease (22). mineral and bone disorder is a growing health care concern associated with secondary hyperparathyroidism, mineral abnormalities, and increased risk of cardiovascular disease (23). in hemodialysis patients, concentrations of pth and p were significantly higher compared with controls (137.35 50.7 pg/ml vs 46.56 28.64 pg/ml, p<0.001; 1.9 0.6 mmol/l vs 1.26 0.33 calcium levels were lower in patients compare with controls, but with no significant difference (2.2 0.24 mmol/l vs 2.26 0.25 mmol/l, p=0.11 (table 1). mineral and bone disorders are associated with accelerated atherosclerosis (24), which is an important cause of cardiovascular death in chronic hemodialysis (25). in this study, serum concentration of 2 m positively correlated with p and pth (r= 0.53, p<0.001; r=0.58, p<0.05 (table 2), whereas negatively with calcium (r=-0.50, p<0.01 (table 2), which proves that 2 m has direct impact in mineral disorders and cardiovascular risk in hd patients. it has been suggested that the predictive value of serum 2 m concentration is superior to that provided by established prognostic factors for mortality, such as glomerular filtration, cystatin c and crp (26). during the follow-up period of three years, 6 out of 40 patients had died from cardiovascular events. even if there was no correlation of 2 m with inflammation, in high-flux membrane hemodialysis patients, our finding indicates that 2 m might have an important role in the development of cardiovascular diseases.

background: higher than expected cardiovascular mortality in hemodialysis patients, has been attributed to dyslipidemia as well as inflammation. beta2-microglobulin (2 m) is an independent predictor of outcome for hemodialysis patients and a representative substance of middle molecules. results:in 40 patients in high-flux membrane hemodialysis, we found negative correlation of 2 m with high density lipoprotein (r=-0.73, p<0.001) and albumin (r= -0.53, p<0.001) and positive correlation with triglycerides (r=0.69, p<0.001), parathyroid hormone (r=0.58, p<0.05) and phosphorus (r= 0.53, p<0.001). there was no correlation of 2 m with c- reactive protein (crp) and interleukin-6 (il-6). during the follow-up period of three years, 6 out of 40 patients have died from cardiovascular events. conclusion:in high-flux membrane hemodialysis patients, we observed a significant relationship of 2 m with dyslipidemia and mineral bone disorders, but there was no correlation with inflammation.

PMC5136433

pubmed-807

hd begins gradually with mood disturbances, increasing involuntary movements (chorea), and cognitive impairment, finally leading to dystonia and severe dementia. the first symptoms typically appear in mid -life (late fourth and fifth decade); however, there are also juvenile and late-onset cases. within 15 to 20 years after its onset mood abnormalities often start appearing a few years before movement dysfunction, which comprises both involuntary as well as impaired voluntary movements. chorea is observed in -90% of all hd patients and increases during the first 10 years of the illness, while dystonia is infrequent in the early symptomatic period but becomes prominent at the late stages of the illness. hd is classified into five pathological grades, ranging from microscopically undetectable abnormalities of patient brains to extensive atrophy. all grades exhibit a loss of brain weight (up to 30%) resulting from neuronal cell death. the extent of neuronal cell death is directly related to the severity of disease. in the basal ganglia, the specific progressive atrophy in these brain regions is associated with reactive astrocytosis. within the striatum there is selective loss of medium spiny g aba (y-arninobutyric acid)-ergic neurons, which project into the pallidum forming the indirect striatopallidal pathway. in addition to atrophy in the striatum, extensive neuronal cell loss also occurs in the deep layers of the cerebral cortex, white matter, hippocampus, amygdala, and thalamus. the human hd gene is located in the chromosomal region 4pl6.3 and was isolated by positional cloning approaches. it contains 67 exons and encodes the huntingtin protein of 3144 residues with a molecular mass of about 350 kd. the mutation underlying hd is an unstable cag trinucleotide repeat expansion in the first exon of the gene. it ranges from 6 to 37 units in healthy individuals, and 38 to 180 units in hd patients.- the cag repeat is translated into a polyglutamine stretch, which is conserved in vertebrates, containing 7 glutamines in the mouse and only 4 in the puffer fish, but is absent from the drosophila protein. the predicted huntingtin protein sequence is highly conserved between human, mouse, and puffer fish, but shows no significant homology with other proteins in databases. the only functional motives that have been discovered are a putative leucine zipper and a heat repeat. heat repeats consist of two hydrophobic a-helices and were found in proteins involved in cellular transport processes. we have found that the huntingtin interacting protein- 1 (hip1) associates with the heat repeat. however, whether this sequence motive is essential for protein-protein interaction remains to be determined. hip1 has been identified using the yeast two-hybrid system. the predicted amino acid sequence of hip1 exhibits significant similarity to cytoskeleton proteins, suggesting that hip1 and the huntingtin protein play a functional role in the cell filament networks and/or vesicle trafficking. for example, hip1 is homologous to the yeast protein sla2p, which associates with the membrane cytoskeleton and plays a functional role in endocytosis. recently, colocalization of hip1 and huntingtin with clathrin-coated vesicles in mammalian cells has been described, suggesting that both proteins also play a functional role in endocytosis in higher eukaryotes., this hypothesis is substantiated by the finding that huntingtin and its associated protein, huntingtin-associated protein-1 (hap1), are transported along microtubules in axons. furthermore, direct binding of hap1 with pl50glued of the dynactin complex, which is critical for retrograde movement of vesicles along microtubules, has been described. together these findings indicate that a protein complex consisting of the proteins hip1, hap1, and huntingtin is functionally involved in endocytosis and retrograde transport of clathrin-coated vesicles along microtubules. however, additional cell biology and biochemical studies will be necessary to address this hypothesis in more detail. using the yeast two-hybrid system we have also demonstrated that the sh3-containing grb2-like protein sh3gl3 associates with huntingtin. this protein is preferentially expressed in brain and testis and selectively interacts with the proline-rich region in huntingtin, which is located immediately downstream of the polyglutamine tract. the sh3gl3 protein, as well as its homologous proteins sh3gl1 and sh3gl2, belongs to a novel sh3-containing protein family. members of this family contain the sh3 domain at the c-terminus that is evolutionarily conserved and drives protein-protein interactions through proline-rich ligands. in the central nervous system, these proteins play a major role in the signal transduction from membrane receptors and the regulation of the exocytic/endocytic cycle of synaptic vesicles. thus, enhanced binding of sh3gl3 to huntingtin with a polyglutamine sequence in the pathological range (eg, 50 glutamines) could result in dysregulation of the endocytic/exocytic cycle in mammalian cells. in order to address the functional role of huntingtin, hip1, and sh3gl3 in synaptic vesicle transport in more detail, the homologous mouse genes were mapped and cloned.- the generation of hip1 and sh3gl3 knockout as well as transgenic animal models will help elucidate the normal function of huntingtin and may also help to understand the key steps in the pathogenesis of hd. in order to study the effect of an elongated polyglutamine sequence on neuronal dysfunction and neurodegeneration in vivo, mangiarini et al generated the first hd transgenic mice. in these animals, exon 1 of the human hd gene carrying a cag repeat of 115 to 156 units was expressed under the control of the hd promoter. strikingly, expression of the mutant huntingtin fragment resulted in the development of a progressive neurological phenotype very similar to hd, including tremor, epileptic seizures, involuntary movements, and cell loss. this indicates that expression of a truncated huntingtin fragment with a polyglutamine sequence in the pathological range is sufficient for the development of a neurological phenotype with characteristic features of hd. davies et al observed that these transgenic animals developed pronounced neuronal intranuclear inclusions (nils) containing huntingtin and ubiquitin prior to the development of the neurological phenotype, indicating that formation of nils is a prerequisite for the development of neuronal dysfunction in hd. within the last few years, several other laboratories have confirmed the appearance of nils using different transgenic mouse models of hd.- full-length huntingtin protein as well as truncated versions of the protein with a polyglutamine sequence in the pathological range (40-150 glutamines) were expressed in mice under the control of different promoters. the majority of these studies suggest that the formation of nils is correlated with the appearance of progressive neuronal dysfunction and toxicity. thus, it is reasonable to assume that reduction of inclusion body formation and huntingtin aggregation may have a beneficial effect on disease progression in hd patients. using a conditional mouse model of hd, yamamoto et al demonstrated that blocking the expression of mutant huntingtin protein in neurons resulted in the disappearance of inclusions and the behavioral phenotype. therefore, reduction of hd protein expression in patients and/or stimulation of natural clearance mechanisms could be effective therapeutic strategies for hd. apart from nils, inclusion bodies with aggregated huntingtin protein were recently detected in axons and axon terminals of striatal neurons. the formation of these aggregates is likely to affect specific neuronal functions such as axonal transport and neurotransmitter release or uptake in axon terminals. therefore, the deposition of mutant huntingtin protein in the terminals of striatal neurons, which are affected most in hd, may contribute to the selective neuropathology of hd. after the discovery of nils in brains of transgenic animals, similar structures were detected in postmortem brains of hd patients. immunohistochemical studies showed that they are most abundant in the striatum and the cerebral cortex, the areas most affected by hd. in the striatum, inclusions were found in the medium spiny neurons that are selectively lost during hd. nils in patient brains are detected by antibodies directed against the n-terminus of huntingtin, but not by antibodies that recognize the c-terminus of the protein, indicating that a truncated n-terminal huntingtin fragment rather than the full-length protein is present in the nils of patients. like the nils in transgenic animals, these results suggest that the truncated huntingtin protein present in the inclusion bodies is ubiquitinated but can not be degraded by the proteasome system. ultrastructural studies revealed that nils in patient brains contain aggregated huntingtin protein with a fibrillar and granular morphology. it remains unclear to date whether the formation of nils, dystrophic neurites, or neuropil aggregates is the cause or merely a consequence of neurodegenerative disorders. using neuronal cell culture model systems and transgenic animals, saudou et al and klement et al presented evidence that the formation of inclusion bodies could be nontoxic or even beneficial to neuronal cells. they showed that overexpression of disease proteins with a polyglutamine sequence in the pathological range is toxic for neuronal cells, but inclusion formation does not contribute to toxicity. however, using cell culture as well as transgenic animal model systems in the presence of more physiological amounts of mutant huntingtin, cell death was observed only after fibrillar structures had formed. we therefore propose that formation of aggregates and subsequently of inclusion bodies is a key step in the development of late-onset progressive neurodegenerative disorders. we have developed a number of in vitro and in vivo strategies to address this issue, the creation of a drug screen assay being one of them. we found that hd exon 1 protein fragments with polyglutamine tracts in the pathological range (> 37 glutamines), but not with a polyglutamine tract in the normal range (20-32 glutamines), form high-molecular-weight protein aggregates., electron micrographs of these aggregates revealed a characteristic fibrillar or ribbon-like morphology, reminiscent of scrapie prion rods and the -amyloid fibrils found in alzheimer's disease. the fibrillar structures are thought to result from the polyglutamine sequences acting as polar zippers. perutz proposed that expansion of polyglutamine repeats beyond a critical length of 41 glutamines may lead to a phase change from random coils to hydrogen-bonded hairpins that self-assemble into insoluble protein aggregates. our in vitro experiments with glutathione s- transferase (gst)-hd exon 1 fusion proteins support this hypothesis, suggesting that the structural transition caused by expansion and required for aggregate formation occurs between 32 to 37 glutamines. polyglutamine tracts with 37 or more glutamines readily self-assemble into insoluble protein aggregates, whereas polyglutamine tracts with less than 32 glutamines did not show any evidence of fibril formation. interestingly, it has been shown that the pathological range of the polyglutamine sequence in hd is between 38 to 41 glutamines, with no hd case reported with fewer than 38 glutamines, nor any individual with more than 41 glutamines having remained unafflicted by hd. the threshold for the formation of insoluble huntingtin fibrils in vitro is remarkably similar to the pathological threshold in hd. jarrett and lansbury proposed that the self-assembly of -amyloids into fibrillar structures in alzheimer's disease occurs by a nucleation-dependent mechanism. we found that the formation of amyloid -like huntingtin fibrils in vitro and in vivo critically depends on polyglutamine repeat length, protein concentration, and time. furthermore, huntingtin aggregation can be seeded by preformed fibrils, suggesting that fibrillogenesis in hd, as in alzheimer's disease, is caused by nucleation-dependent polymerization. our findings that the assembly of huntingtin aggregates requires the formation of a nucleus and is time- and protein concentration-dependent may account for the late onset and progressive phenotype in hd. although fibril formation occurs within hours in the in vitro system, it may take years in neuronal cells of hd patients. the concentration of mutant huntingtin in medium spiny neurons, which are affected most in hd, is unknown, but it is likely to be much lower than that used in the in vitro aggregation assays. thus, we suggest that the lag time during which huntingtin dinners, trimers, and oligomers are formed in vivo is significantly elongated in hd patients. for the identification of huntingtin aggregation inhibitors, we have developed a rapid and sensitive filter retardation assay, which is suitable for the highthroughput screening of drugs that prevent aggregate formation. this assay is based on the finding that hd exon 1 aggregates are insoluble in sodium dodecyl sulfate (sds) and are retained on a cellulose acetate filter, whereas monomelic forms of the hd exon 1 protein do not bind to this filter membrane. the captured aggregates are then detected by simple immunoblot analysis using a specific anti-huntingtin antibody. using the filter retardation assay, we first tested a number of known inhibitors of -amyloid, prp, and microtubule fibril formation for their effect on huntingtin aggregation in vitro. we found that congo red, thioflavine s, chrysamine g, and direct fast yellow inhibited hd exon 1 protein aggregation in a dose-dependent manner, whereas other potential inhibitors of -amyloid formation, such as thioflavine t, gossypol, melatonin, and rifampicin, had little or no effect on huntingtin aggregation. furthermore, we found that the monoclonal antibody 1c2, which specifically recognizes the elongated polyglutamine stretch in huntingtin, and the heat shock proteins hsp70 and hsp40 are potent inhibitors of huntingtin aggregation., interestingly, the addition of heat shock proteins to in vitro aggregation reactions shifts the self-association pathway of huntingtin from fibrillar to amorphous aggregation. this suggests that in vivo chaperones may have the potential to transform toxic fibrillar aggregates into nontoxic aggregates, which can then be degraded by the ubiquitin/proteasome system. thus, small molecules that activate a heat shock response in neurons may be effective in delaying the onset and progression of hd. however, additional research using in vitro and in vivo model systems will be required to show whether an increase in chaperone levels in neurons is a viable therapeutic strategy. drugs that bind to the mutant huntingtin protein should delay the onset and progression of hd. the future challenge will be to find small chemical compounds that have reasonable brain permeability, and per se are nontoxic to neuronal cells. in order to find such compounds, we have performed high-throughput screening using an automated filter retardation assay. within the last year we have tested more then 180 000 different chemical compounds and identified about 700 small molecules that prevent huntingtin aggregation in vitro. we were able to reduce aggregate formation in mammalian cells; as a consequence, cytotoxicity was lowered. this is a very important finding, because it shows for the first time that there is a direct link between the process of aggregate formation and disease. the next challenge will be to test these substances in transgenic animals for their ability to cross the blood-brain barrier, to dissolve neuronal inclusions or prevent their formation, and to reduce neurodegenerative symptoms. since the identification of the gene for huntington's chorea in 1993, this would represent a major milestone in hd research and also in molecular medicine generally, because for the first time a causal therapy for an inherited disease would be within reach. it would also have positive implications for functional genomics, because it would be the first time the strategy of finding a gene with a positional cloning approach and subsequent functional analysis and characterization of the pathogenetic mechanism had been able to lead to a causal therapy of an illness.

huntington's disease (hd) is a progressive, late-onset neurodegenerative illness with autosomal dominant inheritance that affects one in 10 000 individuals in western europe. the disease is caused by a polyglutamine repeat expansion located in the n-terminal region of the huntingtin protein. the mutation is likely to act by a gain of function, but the molecular mechanisms by which it leads to neuronal dysfunction and cell death are not yet known. the normal function of huntingtin in cell metabolism is also unclear. there is no therapy for hd. research on hd should help elucidate the pathogenetic mechanism of this illness in order to develop successful treatments to prevent or slow down symptoms. this article presents new results in hd research focusing on in vivo and in vitro model systems, potential molecular mechanisms of hd, and the development of therapeutic strategies.

PMC3181644

pubmed-808

during 20002010 in chobe district, botswana, we performed 38 necropsies on macroscopically tb-positive mongooses, of which 18 were further evaluated and tb was confirmed by histopathologic examination. an in-depth histologic evaluation was performed on a subsample of 8 of these animals from the 2008 outbreak. the most striking feature identified in the sick mongooses was anorexia, followed by nasal distortion and, less commonly, erosions of the nasal planum with involvement of the hard palate. for 7 of the 8 tb-positive animals examined intensively, histologic examination detected unequivocal tb lesions in the skin of the nose and the anterior nasal mucosa. our findings suggested entry of the organism through erosions on the nasal planum, perhaps in association with abrasions, which might occur during foraging. such lesions were present in the hairless parts of the nose tip of most tb-infected mongooses. furthermore, granulomatous inflammation and mycobacterial organisms were found in the dermis of the skin directly below these erosions. inflammation and organisms were present in some cases in the nasal mucosa, but erosion was not found. this finding is consistent with pneumonic tb being present in only a few advanced cases of disseminated tb. histologically, the tb pneumonia was determined to be hematogenous rather than bronchogenous (i.e., by inhalation); thus, no evidence for aerosol transmission was found. rather, pathogen invasion appears to have occurred through the nasal planum of the mongoose, and hematogenous or lymphatic spread through the body was a strikingly unique feature of this particular m. tuberculosis complex organism. samples from histologically positive mongooses were positive by pcr for the mpb70 target, is6110 element, and 16s rdna, indicating that the infective organism was a member of the m. tuberculosis complex (3,4). samples were further evaluated with an m. tuberculosis complex specific multiplex pcr (5), which provided distinct results, differing clearly from those for other members of the m. tuberculosis complex (table 1).*determined by pcr amplification (5). rd, region of difference; rd1, m. bovis bcg specific rd1; rd1, m. microti specific rd1; rd2, m. pinnipedii specific rd2; p, present; a, absent. the gyrb gene (encoding for gyrase b) sequence, used to identify m. tuberculosis complex member specific sequence single-nucleotide polymorphisms (snps) (6), identified the position of the organism as being situated between dassie bacillus and m. africanum subtype 1(a) and showed no detectable new snps (figure 2, panel a). amplification of rd701 and rd702 and lack of snps in rpob and hsp65 genes demonstrated that this organism was not a member of the m. africanum subtype 1(a) sublineage (6,11) (figure 2, panel a). a) schematic of the phylogenetic relationships among mycobacterium tuberculosis complex species, including newly discovered m. mungi, based on the presence or absence of regions of difference (gray boxes) as well as specific single-nucleotide polymorphisms (white boxes), modified from (7). b) spoligotype of m. mungi compared with representative spoligotypes from other m. tuberculosis complex species (810). three markers were evaluated to definitively exclude the organism from being dassie bacillus: n-rd25 deletion, rd1 deletion, and snp 389 in the gene rv0911 (6). the n-rd25 amplification gave the right product for the presence of a deletion in this region, and further sequencing confirmed that it contained a deletion in the same position as n-rd25; however, sequencing of rv0911 showed no snp at position 389, indicating that this organism was not dassie bacillus. as a final test, we amplified the rd1 region but were unable to amplify a product from the mongoose isolates. we redesigned primers to amplify a smaller region of different diagnostic sizes (248 bp when rd1 is deleted and 318 bp when rd1 is intact) but still had no amplification. this finding indicates that the rd1 region is deleted in this organism but that the deletion is larger than that of the dassie bacillus. we then used spoligotyping analysis (12) to further evaluate mongoose samples and identified a unique spoligotype pattern with no known matches in the international spoligotyping database spoldb4 (9) or the m. bovis this pattern was constant during 20002009 in different mongoose troops and locations (table a1). this unique spoligotyping pattern will enable identification of m. mungi in future tb surveillance programs. for these same isolates, the full set of 24 mycobacterial interspersed repetitive unit variable number tandem repeats (13) identified a pattern that was unique compared with others in the international database at www.miru-vntrplus.org (table 2). evidence of multiple m. mungi substrains circulating between years and within social groups (6601b and 6600b) in the same outbreak year (table 2) suggests complexity in m. mungi transmission and potential evolution of the organism over the past decade.*miru, mycobacterial interspersed repetitive unit; vntr, variable number tandem repeats; db, dassie bacillus; m. a., m. africanum; ob, oryx bacillus; m. p., m. pinnipedii; m. t., m. tuberculosis ;, not applicable. gray shading highlights differences between the mycobacterium tuberculosis complex species and m. mungi as well as variation within m. mungi samples evaluated. m. africanum west african 2 strain 8163/02 (st181), m. microti strain 287/99 (st539), m. pinnipedii strain 7739/01, m. caprae strain 5358/99 (st647), and m. bovis strain 8490/00 (st482) data from www.miru-venterplus.org. this newly identified mycobacterial pathogen has many unique ecologic characteristics that set it apart from other members of the m. tuberculosis complex. first, it causes high numbers of deaths of banded mongooses, threatening local extinction of smaller social groups. second, rather than having a primary respiratory transmission route with direct transmission between individuals, as is characteristic of other m. tuberculosis complex species, m. mungi appears to infect banded mongooses by means of a nonrespiratory route through the nasal planum, suggestive of environmental transmission. third, the time from clinical presentation to death for affected mongooses is generally short (23 months) compared with that for other m. tuberculosis complex pathogens (more chronic infection, can take years to progress to death). acute illness and high mortality rates, as seen in banded mongooses with m. mungi infection, have been associated with extremely isolated human communities newly exposed to tb (14). conventional laboratory culture, biochemical testing, and a limited molecular evaluation were insufficient for differentiating m. mungi from m. tuberculosis (2). organism differentiation required an extensive suite of additional molecular assessments not available at that time, thus underscoring the difficulty of diagnosing m. tuberculosis complex agents correctly and the inability of most national health laboratories to do so. the fact that new host-adapted m. tuberculosis complex species continue to be identified illustrates the diversity within the m. tuberculosis complex and stresses the need for sensitive techniques for species differentiation. the identification of this previously unknown pathogen within the m. tuberculosis complex identifies new concerns for human and animal health and illustrates the continuing scope of the threat posed by tb pathogens.

seven outbreaks involving increasing numbers of banded mongoose troops and high death rates have been documented. we identified a mycobacterium tuberculosis complex pathogen, m. mungi sp. nov., as the causative agent among banded mongooses that live near humans in chobe district, botswana. host spectrum and transmission dynamics remain unknown.

PMC3298296

pubmed-809

the most commonly used materials for bone implants are metals (such as titanium, ti) and polymers (such as ultra high molecular weight polyethylene). numerous problems exist with these implants such as (i) insufficient prolonged bonding between the implanted material and juxtaposed bone (kaplan et al 1994a, 1994b; buser et al 1999; webster 2001), (ii) different mechanical properties between bone and the implant leading to stress shielding (kaplan et al 1994a, 1994b; webster 2001), and (iii) wear debris generated at articulating surfaces of orthopedic implants that may lead to cell death (kaplan et al 1994a, 1994b). it has been speculated that nano-structured materials can increase orthopedic implant efficacy since it is well known that the nanometer scale is the length scale that most of the body s natural materials possess. for example, hydroxyapatite, the major inorganic component of bone, exists predominantly as platelet-or rod-shape crystals about 25 nm in width and 50 nm in length. type i collagen, the major organic component of bone, has fibrils 300 nm in length, 0.5 nm in width, and has a periodicity of 67 nm (park and lakes 1992). therefore, it is reasonable to consider that osteoblasts (or bone-forming cells) will be more accustomed to nano-structured surfaces compared to currently used nano-smooth implant surfaces. such problems with promoting new bone growth next to implant surfaces are made only more complex for patients with bone cancer (both primary bone cancer and metastasized bone cancers). for example, it is estimated that 2,380 people will be diagnosed with bone and joint cancers and 1,470 people will die from primary bone and joint cancers in 2008 in the us (american cancer society 2008). primary bone cancer is rare but bone cancer as a result of the metastasis from other organs (such as the lungs, breasts and the prostate) is very common (miller and webster 2007). thus, the number of patients affiliated with bone cancer is much higher when considering the statistics of cancer metastasis. for these reasons, the main goal of this study was to introduce a new biomaterial naturally found in the human body that has chemopreventive properties for orthopedic implants: elemental selenium. the first goal in this effort was to create nano-structured roughness on such materials and to determine bone cell responses on such nano-structured selenium materials. selenium shots (amorphous, metals basis, spherical and/or semi-spherical 24 mm in diameter; alfa asear, ward hill, ma) were pressed into cylindrical compacts (0.635 cm radius and 0.2 cm thickness) at 1000 psi for 2 minutes using a uniaxial compacting hydraulic press (carver, inc., the compacts were then chemically treated with 1n naoh for either 10 or 30 min. after etching, selenium compacts were washed with excessive deionized water to remove the naoh that remained on the selenium compacts. surfaces of untreated selenium compacts as well as selenium compacts treated with 1n naoh for 10 and 30 min were visualized (without a conductive coating) using a scanning electron microscope (sem, leo 1530vp fe-4800) with an accelerating voltage from 3 to 10 kv. energy dispersive x-ray spectroscopy (eds, leo 1530) was used to determine the surface chemistry of the compacts. to investigate osteoblast adhesion on selenium compacts, human osteoblast-like cells (bone-forming cells; crl-11372 american type of culture collection, population numbers 1415) in dulbecco s modified eagle media supplemented with 10% fetal bovine serum (hyclone) and 1% penicillin/streptomycin (hyclone) were seeded at a density of 3500 cells/cm and placed in an incubator under standard cell culture conditions (37c, 5% co2, 95% humidified air) for 24 h. importantly, this is an immortalized cell line which has been used widely in experiments involving orthopedic applications since previous studies have demonstrated that when cultured under similar conditions as described in the present study, these cells secrete bone-related proteins and deposit calcium containing mineral (miller and webster 2007). louis, mo), stained with 4,6-diamidino-2-phenylindole (dapi) (sigma) and counted under fluorescence microscopy (zeiss axiovert 200 m light microscope) in five random fields which were averaged for each compact. data were collected and statistical comparisons were assessed using a one-tailed student t-test. the sem images of the selenium compacts (untreated and treated with naoh for different time periods) revealed various surface roughness. untreated surfaces (figure 1 image a) possessed mostly micron rough surface features while those treated with 1n naoh for different time periods created submicron (figure 1 image b) and nano-rough (figure 1 image c) surface features on selenium. in particular, biologically inspired surface roughness increased with increasing naoh treatment time periods. as the etchant, naoh is believed to dissolve the oxide layer on the surface of the selenium compacts creating submicron and nanometer features at increasing times. chemical etching is a very common, inexpensive, and simple method used to modify the surface properties (eg, topography, chemistry, roughness, wettability, etc.) of biomaterials. chemical etching can be used for a wide range of biomaterials from metals, ceramics, to polymers. for example, etching titanium with hcl followed by naoh has led to the formation of uniform micrometer featured surfaces that increased the formation of hydroxycarbonated apatite when exposed to a simulated body fluid (jonasova et al 2004). moreover, etching poly (lactic-co-glycolic acid) (plga) films using naoh has created biologically inspired nanometer surface feature dimensions to promote the functions of numerous cells. for example, this nanometer plga structured surface was shown to promote bladder smooth muscle cell functions compared to conventional, micrometer-structured plga after 1, 3, and 5 days of culture (thapa et al 2003). in addition, feldspathic porcelain etched in 5% hydrofluoric acid was shown to promote the bonding strength between orthodontic brackets and ceramic crowns when compared to those treated by mechanical roughening with fine diamond burs or sandblasting (schmage et al 2003). clearly, chemical etching can be an inexpensive effective way to transform nano-smooth surfaces into nano-rough surfaces for a wide range of materials to promote their biological performance. importantly, eds profiles of the compacts used in the present study revealed that the chemistry of the selenium compacts remained unaffected after treatment in 1n naoh (figure 2). moreover, table 1 lists the weight percentages of selenium and sodium for each compact. the results showed trace amounts of sodium on the surfaces of selenium compacts treated with 1n naoh. this indicated that chemical etching (ie, using 1n naoh for up to 30 min) only changed the surface roughness, not the surface chemistry of the selenium compacts. the ability to change an implant s surface roughness and/or topography without altering its chemistry is of great interest since, when fabricating implant materials, it is crucial not to induce any potential harmful chemistry changes. in this study, selenium compact chemistry remained unaltered after treatment with 1n naoh for up to 30 min. when these substrates were used as substrates for culturing osteoblasts, after 1 day, significantly increased cell densities were observed on the increasing nano-rough surfaces (ie, compacts treated with 1n naoh for 10 and 30 min) (figures 3, 4). especially, the compacts treated with 1n naoh for 30 min, which had the largest amount of nanometer surface features, had the highest osteoblast density. however, although closer, these selenium compacts (ie, compacts treated with 1n naoh for 30 min) had osteoblast densities lower than that of titanium. future studies will need to utilize greater times and/or concentrations of naoh etching to determine if osteoblast adhesion can be matched between selenium and titanium. moreover, future studies will need to examine primary osteoblast cells (since that was not accomplished here) as well as the multitude of cancerous cells that can cause bone cancer. it has been shown that increased nanometer surface roughness promotes osteoblast functions (from adhesion to the deposition of calcium containing mineral) (webster et al 1999, 2000a, 2000b; webster 2001; webster and ejiofor 2004). the results of this study showed a similar trend of increased healthy osteoblast densities after 1 day of culture on selenium with increased nanometer surface roughness. the significance of these results is also the introduction of a new chemistry to the orthopedic community particularly geared at inhibiting bone cancer regrowth: selenium. selenium has been shown to have chemo-preventive effects in numerous reports (combs and combs 1986; clark et al 1991, 1998; combs and gray 1998; navarro-alarcon and lopez-martinez 2000; zhuo et al 2004; wei et al 2004). however, the mechanisms of selenium-based chemoprevention are complex and incompletely understood (combs 2001). by imparting nano features onto selenium compacts, the objective of this study was to create a material that promotes healthy osteoblast functions since evidence has already been provided concerning its role in inhibiting cancer growth. in the present study, healthy osteoblast adhesion was shown to be enhanced on nano-rough selenium compacts when compared to micro-rough selenium compacts. however, it has been shown that nano-roughness effectively increased the initial absorption of proteins (such as fibronectin and vitronectin) which mediate subsequent cell adhesion (webster et al 2000b, 2001; khang et al 2007). in particular, particle boundaries on other material (ti, ti6al4v, and cocrmo) surfaces were shown to be active regions for such protein adsorption (webster and ejiofor 2004). nano-structured surfaces clearly offer more particle boundaries when compared to micron-structured surfaces for promoting initial protein adsorption events. in another recent study, elemental selenium nanoclusters were coated on conventional titanium substrates to create nano-structured surfaces. these surfaces were shown to promote healthy osteoblast functions after 1 day of culture and, importantly, inhibit cancerous osteoblast cell functions after 3 days of culture (sarin et al 2008). in the present study, nano-structured selenium surfaces were created by a different method: chemically etching selenium bulk compacts. the approach used in this study is simpler than the coating method used (which involved selenium chemical precipitation) and can eliminate the influence of titanium in the interaction with osteoblasts since selenium coatings in that previous study did not completely cover the underlying titanium. however, considering the toxicity of selenium at high levels (whanger et al 1996), the use of selenium compacts may be problematic concerning how much selenium is exposed to the body leading to possible toxic effects. future studies need to clearly investigate this possible toxicity as well as cancerous bone cell functions on these selenium compacts. this study provided techniques to create nano-structured roughness without altering chemistry on selenium compacts for anti-cancer orthopedic applications. since previous studies have shown greater osteoblast functions on nano-structured compared to conventional ceramics, metals, polymers, and composites, the ability to create nano-structured roughness on selenium compacts is promising for increasing bone cell functions, while inhibiting the return of bone cancer.

metallic bone implants possess numerous problems limiting their long-term efficacy, such as poor prolonged osseointegration, stress shielding, and corrosion under in vivo environments. such problems are compounded for bone cancer patients since numerous patients receive orthopedic implants after cancerous bone resection. unfortunately, current orthopedic materials were not originally developed to simultaneously increase healthy bone growth (as in traditional orthopedic implant applications) while inhibiting cancerous bone growth. the long-term objective of the present research is to investigate the use of nano-rough selenium to prevent bone cancer from re-occurring while promoting healthy bone growth for this select group of cancer patients. selenium is a well known anti-cancer chemical. however, what is not known is how healthy bone cells interact with selenium. to determine this, selenium, spherical or semispherical shots, were pressed into cylindrical compacts and these compacts were then etched using 1n naoh to obtain various surface structures ranging from the micron, submicron to nano scales. changes in surface chemistry were also analyzed. through these etching techniques, results of this study showed that biologically inspired surface roughness values were created on selenium compacts to match that of natural bone roughness. moreover, results showed that healthy bone cell adhesion increased with greater nanometer selenium roughness (more closely matching that of titanium). in this manner, this study suggests that nano-rough selenium should be further tested for orthopedic applications involving bone cancer treatment.

PMC2626931

pubmed-810

schistosomiasis is a parasitic disease caused by the digenetic trematodes of the genus schistosoma members which are commonly known as blood flukes. schistosoma haematobium was discovered by theodore bilharz in 1851 during autopsy at kasr el ainy hospital. in 1915, schistosomiasis comes after malaria among parasitic diseases as regards the number of people infected and those at risk of infection. there are two major forms of schistosomiasis intestinal and urogenital-caused by five species of the parasite. intestinal schistosomiasis is caused by four species namely: schistosoma mansoni (s.mansoni), s. japonicum, s. mekongi and s. intercalatum. s. mansoni is the most prevalent species being endemic in 55 countries e.g. arab peninsula, egypt, libya, sudan, sub-saharan africa, brazil, some caribbean islands, suriname and venzuela. s. japonicum is endemic in china, indonesia and the philippines while s. mekongi prevails in several districts of cambodia and the lao peoples democratic republic and s. intercalatum prevails in rain forest areas of central africa. on the other hand, s. haematobium which is the causative agent of urogenital schistosomiasis is endemic in 53 countries in africa and the middle east. in the absence of accurate epidemiological data, estimates must still be used to determine the possible burden of infection due to schistosomiasis. on the basis of extrapolating the national prevalence data obtained from the world atlas of schistosomiasis and applying it to 1995 population estimates, it was calculated that about 625 million people would be at risk and 193 million would be infected. based on these calculations, 85% of the estimated number of infected people are in the african continent. although successful control projects have been implemented in the last 50 years, yet neither the number of endemic countries nor the estimated number of people infected or at risk of infection were reduced. the radiological examination also strongly suggested that the calcified bladders in two other mummies were due to s. haematobium infection. the use of an immunodiagnostic test, the elisa, led to the diagnosis of the earliest case of human schistosomiasis (s. haematobium) which occurred more than 5000 years ago in an egyptian adolescent. elisa also identified s. haematobium infection in two mummies aged 3000 and 4000 years. scott, 1937, was the first to describe the pattern of s. haematobium and s. mansoni infection throughout egypt fig. 1. his conclusions were based on two series of data which seemed to harmonize fairly well. the first were data obtained from 2 million samples collected by the endemic diseases section of the public health departments. the second were the results of examination of samples from 40,000 persons in a house to house survey done under scott s direct supervision. on the basis of the distribution of the human schistosomes, scott divided egypt into four regions (the first region is the northern and eastern parts of the delta, the second is the southern part of the delta while the third and fourth parts are in the nile valley south of cairo. the third part is areas with perennial irrigation system and fourth part is areas with basin irrigation). in the first three regions about 60% of the rural population the northern and eastern parts of the delta, s. mansoni also infected 60% of the population, while about 85% had either one or both species. in the second region, the southern part of the delta, s. mansoni infected not more than 6%, although the intermediate host, the biomphlaria alexandrina snail, seemed to be as abundant as in the first region. no topographic, hydrographic or demographic differences between these regions could be noted, although the line of demarcation was very sharp as far as the prevalence of the parasite was concerned. the third and fourth regions were in the nile valley south of cairo and there, the snail intermediate host of s. mansoni had never been found. in the third region where perennial irrigation was used s. haematobium only was found and its prevalence was 60%. in the fourth region -areas with basin irrigation scott observed that the snails were much more abundant where perennial irrigation furnished canals and ditches containing water throughout the year while with basin irrigation most of the breeding places were alternatively swept by the annual flood and desiccated in the hot summer. this led him to conclude that the change in the system of irrigation in upper egypt was responsible for the increase in s. haematobium infection rate from 5% to 60%. furthermore, azim, 1935 and khalil and azim, 1938 demonstrated the impact of converting the basin irrigation system to perennial irrigation in upper egypt on the transmission of schistosomiasis haematobium. similarly, el zawahry reported that the construction of the perennial irrigation system in old nubia led to a remarkable increase in s. haematobium infection rate. after scott s survey, several studies were conducted to estimate the pattern of schistosomiasis transmission in one or more governorates of egypt [1419]. twenty years after scott s study, wright reported the distribution of both species of schistosomes based on data which originated from another survey carried out by the egyptian ministry of health using the same methods employed by scott and in the same villages which he had surveyed, but involving 124,253 persons taken by random sampling. comparing the data obtained with those of scott s, changes in the pattern of the two species were observed. however, s. mansoni had increased in giza and s. haematobium had decreased in upper egypt except in sohag, qena and aswan where there was a dramatic increase in these three governorates due to conversion to the perennial irrigation system. furthermore, in 1977, studies conducted in eight villages in qalubeia governorate reported obvious changes in the pattern of transmission of schistosomiasis prevalence during the previous two decades. the prevalence of s. haematobium showed a marked decrease contrary to s. mansoni which showed a relative increase. these findings led to the design of two cross-sectional surveys of the population of the nile delta in 1983 and 1990. the two surveys included the study of 71 villages, one village from each of the 71 districts comprising the eight governorates of the nile delta. when the data of 1983 survey was compared with scott s data, a slight increase in the overall s. mansoni prevalence from 33% in 1935 to 39% in 1983 one governorate, menofeia, had a sharp increase in the prevalence (from 3% to 20%) which accounted for most of the change. the authors attributed the overall increase in prevalence in 1983 to the use of more sensitive diagnostic tests. the relative sensitivity of the diagnostic techniques used in the two surveys must be considered. scott used the stoll and hausheer dilution technique while the kato technique was used in the 1983 study. the effective amount of stools examined was 5 mg in 1935 study as compared to the 43 mg in 1983 study. the authors (cline et al.) of 1983 study believed that if the dilution technique was used in their study, the infection rate would have been much lower than 39%. on the other hand, there was a striking decrease in s. haematobium prevalence from 56% to 5% in all governorates of the delta which could not be attributed to diagnostic sensitivity. the results of the survey in1990 demonstrated a 38% decrease in the overall prevalence of s. mansoni infections in the nile delta governorates since the 1983 study. on the other hand, s. haematobium infections have continued to disappear from the delta showing a 40% decrease in prevalence during the same period., 1993 attributed the changes in prevalence of both species of schistosomal infections to the advent and the increasing availability of the safe and effective anti-schistosomal drug, praziquantel in addition to the dissemination of information about schistosomiasis through the mass media. as regards the middle and upper egypt governorates, it is obvious that there was consistent reduction in the prevalence of s. haematobium except in the most southern three governorates, sohag, qena and aswan. consequently, the national schistosomiasis control program has formulated objectives to prevent the further spread of s. mansoni in upper egypt. in 1990, an extensive national house to house survey similar to the one conducted by scott in 1935 was conducted to investigate the prevalence and intensity of infection with schistosome species, the prevalence and magnitude of morbidity caused by schistosomiasis, the changing pattern of distribution of s. mansoni and s. haematobium and the determinants of infection and morbidity. a random sample of the rural inhabitants of nine governorates selected as representative of each area (upper and lower egypt) and of governorates with both high and low infection rates. although the study was conducted over a period beginning in 1990 and ending in 1994, yet the results were published in 2000 except for kafr el sheikh (kes) governorate which was published in 1995. as regards lower egypt, the five governorates; kes, gharbeia, menoufeia, qalubia and ismailia, where s. mansoni is endemic, showed a prevalence rate ranging from 17.5% to 42.9% with an average of 36.45% [22,2731]. s. haematobium on the other hand, was rare in these governorates; ismailia had the highest infection rate of 1.8% while qalubia had the lowest (0.08%). in upper egypt governorates, where s. haematobium is endemic, s. mansoni was rare being consequential in fayoum only, which had a prevalence of 4.3%. although this survey did not include giza, yet another study carried out in one of the villages of this governorate indicated that the estimated prevalence of s. haematobium was 7.4% which was in accord with the results of other areas of middle and upper egypt [3436]. on the other hand, the prevalence of s. mansoni was unusually high amongst the villagers (33.7%) and exceptionally high amongst the primary school children (57.7%) of the same village. in conclusion, the study of the nine governorates of egypt confirmed the already documented change in the pattern of transmission of both species of schistosome infection in upper and lower egypt. the change from basin to perennial irrigation was the result of the construction of the aswan high dam. since both these factors played a vital role regarding the situation of schistosomiasis infection, they will be discussed in details under separate topics later. the aswan high dam was constructed on the river nile, 7 km south of aswan. the designs of the dam were completed in 1959 and its construction began in 1960. temporary closure of the nile in 1965 was instituted till the building of the dam was completed in 1967 and by 1970 all 12 turbines were in operation. the effect of aswan high dam on the prevalence of schistosomiasis has aroused a lot of controversy. he even stated that there is evidence that the high incidence of the human blood fluke (schistosomiasis or bilharziasis) in the area may well cancel out the benefits the construction of the dam may yield. this increase in schistosomiasis prevalence was attributed to reclamation of new land and conversion of the basin irrigation system to the perennial. furthermore, in 1977, malek stated other reasons for the increase in schistosomiasis transmission. his study indicated that, at least in some sections of the lower nile, ecological changes as a consequence of the dam were enhancing the transmission of the disease. in addition to the abundance of the snail intermediate host in the nile, the absence of silt and decrease in water current velocity in the lower nile would have given higher chance for the miracidia to come in contact with the snails and for the cercaria to infect humans. the same author reported that human activities in and near the nile water had increased considerably throughout the year because of the low, clean and slow water. another significant factor in the ecology of the snail host living in the irrigation canals in the nile delta is the elimination of the winter closure because clearance of the canals -during this period-from the flood silt deposited in their beds was not needed anymore. such an adverse and disastrous factor which used to affect the snail population will be absent after the high dam construction, thus leading to flourishing of the breeding of snails in the nile delta canals with increase in schistosomiasis transmission. another study conducted in some villages in upper egypt close to the dam reported an increase in the prevalence rate of schistosomiasis haematobium among some inhabitants of these villages. in contradiction to the previous conclusions, other scientists reported that the construction of the aswan high dam did not cause an increase in schistosomiasis prevalence. in 1978, miller et al. conducted an environmental and epidemiological survey on 15,329 rural egyptians who were selected from three major geographical regions of egypt (nile delta, middle egypt and upper egypt) in addition to the resettled nubian population. prevalence of either or both species of schistosomiasis was 42.1% in the north central delta region. in middle egypt which spreads from beni suef and assiut governorate, prevalence in the study sites of upper egypt varied according to the location of the village. in desert villages, the prevalence of s. haematobium was very low (4.1%) compared to the prevalence in agricultural villages (24.8%). there was sufficient historical and current data to firmly disregard any role of the aswan high dam in causing an increase in schistosomiasis in rural egypt. they also reported that all available data pointed to an overall decrease of both s. haematobium and s. mansoni rather than increase and this included the resettled nubia. however, there was an indication that the distribution of s. mansoni is expanding southwards. they attributed the reported reduction in the prevalence to the improvement in the domestic water supply to villages, the development and delivery of proper health care in addition to the increase in the general awareness among the population at risk of how to avoid infection and how to get treatment. as regards transmission of schistosomiasis in lake nasser, infection with s. haematobium was prevalent among the fishermen working there. the prevalence of detected s. haematobium infection at entry to the lake declined from 67% in both 1974 and 1975 to 18% in 1980 and 20% in 1981. this was attributed to the widespread use of metrifonate in upper egypt beginning in 1975. as regards s. mansoni infection, the snail intermediate host of s. haematobium (bulinus truncatus) was present in abundance; some of them were infected with s. haematobium. on the other hand, biomphlaria alexandrina, (the intermediate host of s. mansoni) was detected in only one site at the northern tip of the lake, but none of them was infected. the egyptian ministry of health installed mobile units to examine and treat all pupils at a large number of elementary, primary and secondary schools thus stopping the disease in early childhood. the number of these units increased from 6 in 1924 to 56 in 1933 with the number of annual treatments increasing from nearly 47000 to 311000. in 1926, the first planned control scheme was started at dakhla oasis. it comprised treatment of about a third of the population with tarter emetic in addition to application of copper sulfate for 96 h to all irrigation canals. regular surveys in the early 1930s failed to detect snails and none of the 70 children born after the last mollusciciding in 1929 was infected at 1936 survey. until mid eighties of the last century, the strategy for schistosomiasis control -recommended by the who aimed at reducing transmission by diminishing the snail population. as this method became effective, morbidity in the human population was slowly reduced and in the long term, the complete eradication of the parasite might have been achieved. in 1984, a major change in the strategy became possible with: (a) recognition that morbidity of schistosomiasis was directly related to the prevalence and intensity of infection, both being high in the 1014 years age group. (c) the development of new antischistosomal drug (praziquantel) which is safe and effective against the three important human schistosome species. at present, the main objective of control is to reduce or eliminate morbidity or at least serious disease. all schistosomiasis control projects carried out in egypt followed the same strategy recommended by the who. all programs conducted before 1984 aimed at transmission control and the main activity was based on snail control which might be supplemented by antibilharzial treatment. the following control projects were implemented during the period from 1953 to 1985 .qaliub project (19531954): snail control using copper sulfate.qalubeya project (19531959): mass treatment using tartar emetic.warrak el arab project (19531959): snail control using sodium pentachlorophenate.egypt 049 project (19611969): snail control using niclosamide.iflaka project (19621966): mass treatment using astiban.giza project (shimbari 1970): mass treatment using hycanthone.fayoum project (1969): chemotherapy and snail control using niclosamide .middle egypt control program: started in 1977, implemented in beni suif, menia and assiut north of dairut).upper egypt control program: started in 1980, implemented in assiut south of dairut, sohag, qena and aswan. qaliub project (19531954): snail control using copper sulfate. middle egypt control program: started in 1977, implemented in beni suif, menia and assiut north of dairut). upper egypt control program: started in 1980, implemented in assiut south of dairut, sohag, qena and aswan. middle and upper egypt control projects were the largest of those conducted in egypt. they covered about two million irrigated feddans and a total population of more than 12 million people. extensive land reclamation with installation of the drainage has been carried out in different parts of the area. the project was divided into three phases: (1) intensive phase; 3 years. (2) consolidation phase; 3 years. (3) maintenance phase. the intensive phase involved: (a) area wide application of niclosamide for three times/year. (b) chemotherapy for infected individuals, metrifonate (bilarcil), three doses with 14 days apart. in 1988 praziquantil was used for treatment. impact of the projects: an international evaluation team, in 1985, showed that since the initiation of control intervention, the overall prevalence of schistosomiasis haematobium of about 30% in the middle egypt project area, determined in 1977, had been reduced to approximately 8.5%. furthermore, the detailed data reported by the ministry of health showed a continuous downward trend in prevalence rates. but significant re-infections were reported among school children particularly in young age groups during the summer season indicating that appreciable transmission was continuing in the project area. although it was apparent that a large measure of control had been achieved since intervention began, the results showed some upward trends in prevalence of infection during the maintenance phase. national schistosomiasis control program (nscp) in the nile delta: this project started in 1997 and was based on the morbidity control strategy adopted by the who in 1984. mass treatment was offered without prior diagnosis to all school children 618 years old and to all inhabitants of villages where s. mansoni prevalence among outpatients of rural health units was 20%. furthermore, focal mollusciciding using niclosamide was applied on water courses with high snail density or harboring infected snails. in addition, health education campaigns and capacity building through training of personnel working in rural health units or involved in snail control activities were applied. as the program progressed, and s. mansoni prevalence decreased, the threshold for mass chemotherapy was changed to 10% in 1999, 5% in 2000 and 3.5% in 2002 to 3% in 2003. the records of ministry of health reported that in 1996 before the application of mass chemotherapy campaign; 168 villages had prevalence>30%, 324 villages had prevalence 2030% and 654 villages had prevalence 1020%. by the end of 2010, in the whole country only 20 villages had prevalence more than 3.5% and none had prevalence more than 10%. at present, a multi-sectoral approach is adopted. this aims at interrupting transmission and achieving elimination through wider integration of the present strategy with other interventions such as mass chemotherapy campaigns for school-age children and populations in hot spot areas together with improvement of health awareness, social mobilization, snail control within the activities of the primary healthcare system, and environmental sanitation. the strategy adopted for control differs according to the epidemiological setting. in newly developed areas with no transmission and no autocthonous cases, surveillance and routine screening is done. in villages where schistosomiasis prevalence is<3%, active population screening, monitoring after treatment, snail control and water and sanitation are done. on the other hand, in villages with active transmission and a prevalence>3%, mass treatment, snail control and clean water and sanitation are stressed. although it is well documented that schistosomiasis haematobium was endemic in ancient egypt, yet the first detailed study describing its pattern of prevalence was carried out in 1937 by scott. he reported that schistosomiasis was highly prevalent in both the nile delta and the nile valley south of cairo in districts where the perennial irrigation system was used. the highest prevalence was recorded in the northern and eastern parts of the delta where 85% of the population was infected with either one or both species of the parasite. on the other hand, s. mansoni infection was very low in the southern part of the delta and completely absent from the nile valley south of cairo whether basin or perennial irrigation system were used. after scott s study, several large scale surveys were conducted to estimate the pattern of schistosomiasis infection. in general, in the nile delta governorates there was a gradual reduction in the overall prevalence of s. mansoni infection while s. haematobium prevalence continued to decrease till it disappeared completely. in middle and upper egypt governorates, there was a consistent reduction in the prevalence of s. haematobium infection except in sohag, qena and aswan following the construction of the high dam where basin irrigation was converted to perennial irrigation system. at present, the ministry of health and population records indicate that by the end of 2010 only 20 villages in the whole country showed prevalence more than 3.5% and none had more than 10%. the great success in controlling schistosomiasis in egypt is achieved through the implementation of several control programs which adopted the same strategy recommended by the who .

schistosomiasis is a parasitic disease caused by blood flukes (trematodes) of the genus schistosoma (s.). it is well documented that schistosomiasis haematobium was endemic in ancient egypt. infection was diagnosed in mummies 3000, 4000 and 5000 years old. scott was the first to describe the pattern of schistosomiasis infection in egypt. schistosomiasis haematobium was highly prevalent (60%) both in the nile delta and nile valley south of cairo in districts of perennial irrigation while it was low (6%) in districts of basin irrigation. schistosoma mansoni infected 60% of the population in the northern and eastern parts of the nile delta and only 6% in the southern part. neither s. mansoni cases nor its snail intermediate host were found in the nile valley south of cairo. the building of the aswan high dam -which was completed in 1967 did not cause any increase in schistosomiasis prevalence. in 1990, a study conducted in nine governorates of egypt confirmed the change in the pattern of schistosomiasis transmission in the delta. there was an overall reduction in s. mansoni prevalence while schistosoma haematobium had continued to disappear. in middle and upper egypt there was consistent reduction in the prevalence of s. haematobium except in sohag, qena, and aswan governorates. however, foci of s. mansoni were detected in giza, fayoum, menya and assiut. all schistosomiasis control projects implemented in egypt from 1953 to 1985 adopted the strategy of transmission control and were based mainly on snail control supplemented by anti-bilharzial chemotherapy. in 1997, the national schistosomiasis control program (nscp) was launched in the nile delta. it adopted morbidity control strategy with praziquantel mass treatment as the main component. in 1996, before the nscp, 168 villages had s. mansoni prevalence>30%, 324 villages 2030% and 654 villages 1020%. by the end of 2010, in the whole country only 29 villages had prevalence>3% and none had more than 10%.

PMC4293883

pubmed-811

patients with stroke show various muscle abnormalities, including a combination of denervation, disuse, remodeling, and spasticity1. abnormal gaits cause flexion and extension synergy patterns due to compensatory actions of muscles, etc., on the unaffected side, impairment of proprioceptive sensibility, and abnormal coordination of stiffened muscles of the lower limb3. as a substitute of stair climbing exercise, inclined treadmill walking training, which is aimed at improving these gait disorders, is being considered as an essential means for indoor and outdoor movements of the disabled, the elderly, or pregnant women who are unable to use stairs4. however, rhea et al.5 stated that treadmill walking training, compared with walking on flat ground, is characterized by a shorter step length. oh, kim, and woo6 argued that treadmill walking training has negative effects on gait asymmetry. sensory elements play an important part in compensating for these weaknesses7, and rhythmic auditory stimulation (ras) can be used as a complementing intervention8. in this intervention, the external auditory sense of rhythms generates rhythmic and more symmetrical alternate movements in the lower limbs of stroke patients who show gait asymmetry6, 9. existing studies have not shown consistent results regarding the effects of treadmill walking training on the gait of stroke patients. in particular, with regard to balance and gait, which are essential for the activity and participation of stroke patients, there are no systematic studies showing the effects of inclined treadmill walking training with ras thus far. therefore, the purpose of this study was to identify the effects of inclined treadmill walking training with ras on balance and gait in stroke patients. the study population included 30 patients diagnosed with stroke at b hospital located in gangwon-do, south korea who provided written consent and understood the purpose of this experiment. they were randomly assigned to three groups of 10 subjects each: the inclined treadmill with ras training group (experimental group 1, g1), the inclined treadmill without ras training group (g2), and the only treadmill training group (g3). this study was approved by the institutional review board of the korea national university of transportation (approval no. the subjects in each group walked on a treadmill (s23 t; taeha mechatronics, republic of korea). for g1, ras was additionally applied using a metronome (fretway metro, fretway, usa). regarding treadmill speed for g1, g2, and g3, the patients most favorite speed was adopted in the first week, and this speed was increased by 5% in the second week. an additional 5% increase was made in the third week and no increase was made in the fourth week. although a treadmill incline of 10% was set in the second and third weeks, this increase was not applied for those who were unable to perform treadmill walking at this inclination. for the beat of the metronome in g1, the subjects cadence measured using a wireless three-axis accelerometer was applied in the first week6. this beat was increased by 5% increments in the second and third weeks, without any change in the fourth week9. each group performed its respective training five times a week over a 4-week period. the timed up and go (tug) test and the berg balance scale (bbs) test were performed to measure the subjects balance ability. for the measurement of their gait ability, spatiotemporal gait abilities such as walking speed, cadence, single limb support of the affected side (sls), and symmetric index (si) were measured using the 6-minute test (6mwt) and the wireless three-axis accelerometer (g-walk; bts s.t.a., italy). pasw 18.0 was used for statistical analysis. chi-squared test and kruskal-wallis h test were performed to test homogeneity between the two groups, and the results showed that the two groups were homogeneous (table 1table 1.general characteristics of the subjectsg1g2g3gender (m/f)6/46/35/4age (yrs)50.8 14.456.3 7.161.2 13.0height (cm)167.8 10.1165.7 8.8160.8 9.6weight (kg)69.8 10.962.3 11.165.8 7.4onset (months)16.4 10.3 13.6 8.517.1 8.4diagnosis (h/i)7/35/44/5hemiside (rt/lt)6/43/64/5 m: male, f: female, h: hemorrhage, i: infarction, rt: right, lt: left). wilcoxon signed rank test was used to examine changes in the dependent variables within each group, and kruskal-wallis h test was used to compare changes between the two groups. mann-whitney u test with bonferroni correction was used for post-hoc comparisons. m: male, f: female, h: hemorrhage, i: infarction, rt: right, lt: left comparison of the variables before and after the experiment within each group showed statistically significant improvements in all variables except for the tug in g3 (p<0.05; table 2table 2.comparison of change in balance and gait between the three groupsg1g2g3pre-trainingpost-trainingpre-trainingpost-trainingpre-trainingpost-trainingtug (sec)32.6 12.330.00 12.3*28.2 9.326.8 9.131.2 6.330.6 6.2bbs (score)34.6 6.742.4 6.8*36.7 6.740.7 6.137.7 8.340.1 8.16mwt (sec)109.5 35.3130.6 35.2*120.5 34.5135.3 34.080.6 39.090.0 40.9speed (m/s)1.2 0.61.5 0.7*0.9 0.51.0 0.51.1 0.61.2 0.6cadence (s/m)85.5 23.399.4 20.1*85.4 24.090.7 23.164.1 29.267.7 28.6sls (%) 24.3 8.341.9 8.2*31.6 9.338.9 7.333.3 7.037.2 8.3si0.5 0.20.7 0.2*0.4 0.30.5 0.30.4 0.30.6 0.3tug: timed up and go test; bbs: berg balance scale; 6mwt: 6 m walking test; cadence: steps/min; sls: single limb support; si: symmetric index. mean standard deviation, *intra-group, statistically significant at p<0.05, statistically significant compared with g1 at p<0.05, statistically significant compared with g2 at p<0.05). with regard to group differences, g1 showed statistically significant higher improvements in all variables when compared with g2 and g3, and g2 exhibited statistically significant higher improvements in the tug, bbs, 6mwt, walking speed, and si when compared with g3 (table 2). tug: timed up and go test; bbs: berg balance scale; 6mwt: 6 m walking test; cadence: steps/min; sls: single limb support; si: symmetric index. mean standard deviation, *intra-group, statistically significant at p<0.05, statistically significant compared with g1 at p<0.05, statistically significant compared with g2 at p<0.05 the study showed that g1 was more effective than g2 and g3 in improving balance and gait. previous studies have reported that repetitive rhythms combined with movements of patients with central nerve system damage were effective in improving their ability to perform exercises9,10,11,12,13. in addition, repetitive rhythms enhanced coordination and improved gait because of improved movements in the pelvis and the shoulder girdle14. in the present study, g1 showed statistically significant higher improvements in the tug and bbs when compared with g2 and g3, whereas g3 did not exhibit statistically significant differences within the group. this result suggests that the training for g1 was more effective than that for g2 or g3 in improving the balance in stroke patients. in addition, regarding gait, g1 showed statistically significant higher improvements in all variables when compared with g2 and g3, and g2 exhibited statistically significant higher improvements in 6mwt, walking speed, and si when compared with g3. all three groups showed improvements in gait endurance, which can be attributed to the effects of task-specific training for 30 minutes a day. rhythms affect brain activities through encoding and, thus, can provide the feedback of nerve roots and generate instinctive movements16. the more effective outcome in balance, gait speed, and cadence could be due to improvements in sls following the ras-induced rhythmical walking. thaut et al.17 reported that the application of treadmill walking training with ras in stroke patients led to statistically significant improvements in gait symmetry. this result is in agreement with that of the present study. for the route of ras, as the body subconsciously responds to the signals of rhythms, unlike the general auditory route, these signals are transmitted to the cerebral cortex through the supraspinal auditory system18. therefore, improvements in balance and gait could have been more significant in the present study. however, our study had a limitation in that the study sample was small and included only patients with stroke who were capable of walking. therefore, the results of this study can not be generalized for all stroke patients. thus, future longer-term studies with a larger sample size should be conducted.

[ purpose] the purpose of this study was to determine if an inclined treadmill with rhythmic auditory stimulation gait training can improve balance and gait ability in stroke patients. [subjects and methods] thirty participants were randomly divided into three groups: inclined treadmill with rhythmic auditory stimulation training group (n=10), inclined treadmill training group (n=10), and treadmill training group (n=10). for all groups, the training was conducted for 4 weeks, 30 minutes per session, 5 times per week. two subjects dropped out before study completion. [results] all variables of balance and gait, except for the timed up and go test in the treadmill group, significantly improved in all groups. moreover, all variables showed a more significant improvement in the inclined treadmill with rhythmic auditory stimulation group when compared with the other groups. timed up and go test, berg balance scale, 6 m walking test, walking speed, and symmetric index were significantly improved in the inclined treadmill group when compared with the treadmill group. [conclusion] thus, for stroke patients receiving gait training, inclined treadmill with rhythmic auditory stimulation training was more effective in maintaining balance and gait than inclined treadmill without rhythmic auditory stimulation or only treadmill training.

PMC5276762

pubmed-812

topiramate is a sulfamate-substituted monosaccharide, used in the treatment of epilepsy, depression, migraine, and neuropathic pain. secondary angle closure glaucoma due to topiramate is well recognized and has been related to supraciliary effusions and forward rotation of ciliary processes. furthermore, the medication is associated with drug-induced myopia, due to anterior displacement of the iris-lens diaphragm. in most cases, this secondary angle closure glaucoma and myopic shift resolves rapidly with discontinuation of the medication and management of intraocular pressure (iop) with topical therapy. a 36-year-old caucasian female presented to the emergency department with a one-day history of severe headache, abdominal pain, and decreased vision in the left eye (os). the patient reported that she had been suffering from headaches for the past 11 months, for which she was being treated by a neurologist. during previous headache episodes, she experienced decreased vision in either eye and a frontal headache centered around or behind the affected eye lasting 810 hours. her medical history was significant for crohn s disease, migraines, erosive gastritis, and kidney stones. her medications included mesalamine, sumatriptan, topiramate (prescribed 10 months prior by neurologist), dexlansoprazole, oxycodone/acetaminophen, ondansetron, and promethazine. on examination, visual acuity was 20/30 in the right eye (od) and count fingers at 6 inches os. iop via tono-pen (tono-pen avia tonometer, reichert technologies, depew, ny, usa) was 31 mmhg od, and 53 mmhg os. anterior segment examination os revealed mild conjunctival injection, diffuse microcystic edema of the cornea, and a narrow anterior chamber with 12+pigmented cells. gonioscopy revealed appositionally closed angles bilaterally, which did not open with goniocompression os, and opened with a plateau iris configuration (double hump sign) od. undilated funduscopic examination findings were asymmetric with a cup-disc ratio of 0.3 od, and 0.7 os. topical therapy was initiated with brimonidine/timolol and dorzolamide ophthalmic drops. while iop od improved to 18 mmhg the patient had a history of kidney stones, therefore oral and intravenous carbonic anhydrase inhibitors were avoided. the patient was also advised to discontinue use of topiramate. while the mechanism of acute angle closure was thought to be secondary to topiramate use, underlying chronic angle closure could not be ruled out given the history of repeated episodes of vision loss during headaches, even prior to initiation of topiramate and the advanced cupping of the optic nerve os. ultrasound biomicroscopy was not available, therefore, based on the clinical examination (gonioscopy), plateau iris angle closure was suspected while recognizing that secondary angle closure from ciliary body effusion may also be a factor. therefore, in addition to advising discontinuation of topiramate, a laser peripheral iridotomy (pi) was performed os with reduction in iop to 22 mmhg os. twelve hours later, visual acuity was 20/30 od, and 20/70 os with iop of 09 mmhg od, and 34 mmhg os, despite the discontinuation of topiramate and the use of topical bimatoprost and brimonidine/timolol. gonioscopy revealed plateau iris configuration with patent iridotomies and an open angle od, but peripheral anterior synechiae with a closed angle despite goniocompression os. at this time because the patient was visiting from out of state and had to return home immediately, follow-up with a glaucoma specialist was arranged. at the patient s initial consultation with the glaucoma specialist 2 days later, visual acuity was 20/20 od, and 20/40 os with an iop of 12 mmhg od, and 50 mmhg os. the plan was to proceed with a trabeculectomy the following day, however, this was postponed as the patient was admitted to the hospital for a flare-up of her crohn s disease. throughout her hospitalization, iop remained well controlled in the range of 1012 mmhg ou without topical medications od, and on topical bimatoprost, brimonidine/timolol and dorzolamide os. one day after the patient was discharged from the hospital, she was found to have elevated iop 53 mmhg os with a patent iridotomy. the following day, the iop was elevated again to 51 mmhg os and the patient underwent an urgent trabeculectomy with mitomycin c os. postoperatively, the patient s visual acuity os returned to 20/20 and iop os was controlled with trabeculectomy in the range of 0910 mmhg. banta et al1, sanka et al2, and rhee et al3 were among the first to report cases of secondary angle closure glaucoma associated with the use of topiramate in 2001. they described uveal effusions, ciliary process swelling, and forward displacement of the iris-lens diaphragm leading to myopic shift and secondary angle closure glaucoma. by 2003, they found that 85% of cases of topiramate associated secondary angle closure glaucoma occurred within the first 2 weeks of treatment. there were 17 reports of acute bilateral myopia (up to 8.75 diopters), and vision returned to normal within a few days to a few weeks of discontinuation of topiramate. management of topiramate induced secondary angle closure glaucoma based on fraunfelder et al4 included: 1) prompt discontinuation of topiramate, as iop decreases rapidly after the medication is stopped; 2) maximal medical therapy (oral medications and aqueous suppressants), and avoiding topical miotics in order to avoid relative pupillary block. furthermore, laser pi was not found to be beneficial if glaucoma was only associated with topiramate. topiramate induced secondary angle closure glaucoma has been found to resolve within 2448 hours of discontinuation of the mediation, while the myopia resolves within 12 weeks.5 we present the case of a 36-year-old caucasian female with plateau iris configuration, acute onset angle closure, and acute angle closure superimposed on chronic angle closure in the setting of topiramate use. while it is difficult to prove the exact etiology of her angle closure without ultrasound biomicroscopy, which we did not have the luxury of obtaining during this patient s acute attack, it is presumed that her topiramate use may have contributed to the acute attack. her acute change in vision in a previous emmetropic eye and improvement in visual acuity with discontinuation of the medication support this assumption. regardless of the mechanism, this case raises a few notable points: 1) the multifactorial etiology of some forms of angle closure; 2) the prescription of topiramate in eyes with underlying narrow angles; and 3) the possibility of delayed secondary angle closure with topiramate use. our patient did not have a prior ophthalmology examination diagnosis of narrow angles or angle closure glaucoma, but had clinical symptoms of angle closure which preceded the topiramate use, and clinical findings including narrow angles (plateau iris od) and chronic angle closure os, which suggests multiple etiologies as an underlying mechanism for angle closure. follow-up examination od revealed a more open, narrow, non-occludable angle with a patent pi off topiramate but with a plateau iris configuration, which could explain the presenting angle closure od, while the 360 degree peripheral anterior synechiae os (likely from chronic intermittent angle closure episodes) explains the persistent elevated iop and permanently closed angle os. finally, topiramate use could have further contributed to the angle closure precipitating the attack by a ciliary body effusion that led the patient to present to our emergency department. of note, this patient was on other systemic medications with anticholinergic properties which could further contribute to her risk of angle closure. her case highlights the often multifactorial nature of angle closure glaucoma that can indicate multiple therapeutic interventions. in this patient s case, while topiramate induced secondary angle closure was one suspected mechanism, a peripheral iridotomy was also warranted based on other clinical findings (plateau iris) and to help rule out aqueous misdirection once the topiramate was discontinued. furthermore, when plateau iris is identified on gonioscopy but the patient is asymptomatic with a normal iop, we typically attempt laser pi first. we find that this will often open up the angle and resolve the occludability. if, however, the peripheral iridotomy fails to open up the angle or the patient is symptomatic or develops elevated iop, we would then perform peripheral iridoplasty. the multifactorial nature of this patient s angle closure also raises the question of whether this patient was a suitable candidate for topiramate therapy and whether her underlying narrow occludable angles should have been a relative contraindication to this drug. it suggests that perhaps, baseline ophthalmic examination with gonioscopy should be performed on all individuals being considered for topiramate therapy. finally, our patient had been receiving topiramate therapy for roughly 10 months, far longer than the average timeframe of 2 weeks post-initiation of therapy to induce secondary angle closure glaucoma, and by taking into account her history we suspect the patient was having angle closure symptoms prior to commencing topiramate. only one such report exists by czyz et al7 who reported a delayed onset of topiramate induced angle closure glaucoma, 262 days after initiation of therapy, which resolved with topical aqueous suppressants and discontinuation of topiramate. this finding suggests that patients on topiramate should be monitored and counseled regarding angle closure beyond the initial 24 weeks after initiation of therapy. while angle closure secondary to topiramate therapy has been widely recognized as a potential side effect of this medication, our report suggests that perhaps baseline ophthalmic examination should be performed prior to initiation of therapy, and that findings of narrow occludable angles should be a relative contraindication to treatment with this medication. patients with angle closure symptoms could be mistaken by non-ophthalmologists as suffering from migraines. further analysis of combined-mechanism angle closure is warranted to elucidate whether exclusion of patients with narrow angle glaucoma from topiramate treatment would reduce the occurrence of this side effect.

this is a case report describing recurrent intermittent acute angle closure episodes in the setting of topiramate use in a female suffering from migraines. despite laser peripheral iridotomy placement for the pupillary block component, and the discontinuation of topiramate, the acute angle closure did not resolve in the left eye with chronic angle closure and the patient required urgent trabeculectomy. the right eye responded to laser peripheral iridotomy immediately and further improved after the cessation of topiramate. while secondary angle closure glaucoma due to topiramate use has been widely reported, its effects in patients with underlying primary angle closure glaucoma have not been discussed. our report highlights the importance of recognizing the often multifactorial etiology of angle closure glaucoma to help guide clinical management.

PMC4109630

pubmed-813

. first introduced laparoscopic surgery in the field of urology, progress in laparoscopic radical surgery has been remarkable in urologic oncology. advances in surgical instruments and techniques have made incision, resection and coagulation easier, enabling the application of this procedure to be extended up to radical prostatectomy. laparoscopic radical prostatectomy (lrp) has been widely used as a minimally invasive surgery since its introduction by schuessler et al.. the advantages of lrp include decreased postoperative pain, earlier return to daily activities due to minimally invasive surgical wound, shorter hospital stay, decreased blood loss, earlier recovery of potency and an oncological outcome similar to that of open radical prostatectomy (orp).. demonstrated that lrp is beneficial in the preservation of the urethral sphincter and nerves due to the wide surgical field, resulting in the restoration of continence and potency. recently, laparoendoscopic single-site (less) surgery, by which surgical instruments can be introduced through a single incision, has improved the esthetic outcome and has replaced conventional laparoscopic surgery. we report herein our initial experience and reason for conversion of less radical prostatectomy (lessrp), using a homemade single-port device, to conventional lrp, with a schematic surgical illustration. the patient complained of frequency intervals of 1-2 h and nocturia of 3 times per night. before this presentation, digital rectal examination had revealed bilateral enlargement of the prostatic lobes. under a clinical diagnosis of benign prostate hyperplasia after medical treatment, his serum prostate-specific antigen was 4.11 ng/ml, which was a 4-fold increase from the baseline prostate-specific antigen. he underwent a 12-core transrectal ultrasonography (trus)-guided prostate biopsy, which showed a localized prostate cancer (pca) with a gleason score of 7 (3+4) in the bilateral peripheral zones. magnetic resonance imaging for tumor staging revealed benign prostate hyperplasia and hematoma due to trus-guided biopsy, and bone scintigraphy displayed no bony metastasis. we decided to perform a radical prostatectomy under a diagnosis of localized pca (clinical stage t2cn0m0). informed consent was obtained after a complete description of the various surgical procedures including orp, lrp, robot-assisted lrp (ralrp) and lessrp using a homemade single-port device. under general anesthesia, the operator stood on the left side of the operating table, and 2 assistants stood on the right side. after a 3-cm vertical skin incision was made in a crease just superior to the umbilicus, dissection was performed up to the peritoneum. a homemade single-port device was prepared using a small alexis wound retractor (applied medical, rancho, santa margarita, calif., usa) and a powder-free surgical glove (triplex p-free glove, km healthcare, guri, korea). after the wound retractor was inserted through the incision site, the ring of the wound retractor was covered with a 6/2 surgical glove, which was rolled over around the ring, and the glove was forced to completely touch the abdominal wall. after cutting out 3 fingers of the glove, two 12-mm trocars and one 5-mm trocar were fixed with 1-0 silk suture material. in a steep trendelenburg position, a 30-degree 10-mm rigid laparoscope was introduced into the center trocar, and the other 2 trocars were used for flexible laparoscopic instruments (laparoangle, cambrige endo, framingham, mass., usa) and conventional rigid instruments. lessrp was performed using the homemade single-port device in the same manner as conventional lrp (fig. an additional 12-mm port was created by cutting out another finger of the surgical glove because there was interference between the flexible laparoscopic instruments during vesicourethral anastomosis after the resection of the prostate and seminal vesicle (fig. however, since the working space for the anastomosis and adequate angles between the instruments was not maintained, another two 12-mm transcutaneous ports were created above the anterior superior iliac spine on both sides, so that the procedure was converted to conventional lrp (fig. when a cystography performed 7 days after surgery showed no urine leakage, the catheter was removed. 4), and the pathological examination of the surgical specimen revealed pca with a gleason score of 7 (3+4) reflecting prostatic cancer invasion (pt3a). until now, the patient has been healthy for nine months postoperatively and treated with gnrh agonists and antiandrogens. however, this method has the disadvantages of difficulty in maintaining the surgical field, intraoperative bleeding, postoperative pain/thromboembolism/incontinence/erectile dysfunction and increased hospitalization. to solve these problems of orp however, lrp has the disadvantages of a longer operation time and the necessity for good familiarity with the surgical procedure. the disadvantages of ralrp are the requirement of an expensive da vinci robotic system (intuitive surgical, mountain view, calif., usa) and a high surgeon's fee compared to orp or lrp in korea. previous studies have proposed that the lrp may aid in the fine dissection of neurovascular bundles and facilitate a higher quality of watertight vesicourethral anastomosis. recent operations have been directed toward scar-free procedures, and thus new terms, natural orifice translumenal endoscopic surgery (notes) or less have been coined. less surgery, a laparoscopic surgery through a single incision site, was proposed as a new term after the 2008 laparoendoscopic single-site surgery consortium for assessment and research (lesscar). in the field of urology, rane et al. reported the first case of less nephrectomy using an r-port (advanced surgical concepts, dublin, ireland) at the 2007 world congress of endourology meeting. thereafter, many surgeons have applied this technique to various urological diseases and have reported its usefulness and safety.. stated that less simple prostatectomy using an r-port is more difficult than the conventional laparoscopic procedure with a total operation time of 120 min. reported 4 cases of lessrp using a uni-x single laparoscopic port system (pnavel systems, morganville, n.j. they reported a mean operation time of 285 min, a mean estimated blood loss of 287 ml and a mean duration of catheter placement of 14 days. in our lessrp using a homemade single-port device together with lrp, the operation time was 610 min, and the estimated blood loss was approximately 600 ml. first, it does not allow the laparoscope and instruments to be moved freely in a limited space. third, the long distance between the homemade single-port device and the symphysis pubis is also a problem in suturing. for those reasons, we could not perform precise vesicourethral anastomosis and converted to conventional lrp in the current case. it is thought that, although our technique may require a greater learning curve than conventional lrp and may increase operation time, new flexible or multifunctional laparoscopic instruments will make lessrp feasible and easier.

we report an initial experience in laparoendoscopic single-site radical prostatectomy (lessrp) using a homemade single-port device for prostate cancer. a 63-year-old man was diagnosed with prostate cancer. the patient underwent lessrp using an alexis wound retractor, which was inserted through an umbilical incision. a homemade single-port device was made by fixing a 6 1/2 surgical glove to the retractor's outer ring and securing the glove finger to the end of 4 trocars with a tie. using the flexible laparoscopic and rigid instruments, lessrp was performed using a procedure similar to conventional laparoscopic radical prostatectomy (lrp). in the current case, we could not perform complete lessrp, so we report our initial experience and consider the reason why laparoendoscopic single-site surgery was converted to conventional lrp.

PMC3100265

pubmed-814

majority of indian population resides in rural areas, of which more than 40% constitute children. dental caries is the single most prevalent chronic childhood disease worldwide, and it causes significant economic loss due to heavy expenses of dental treatment. during the past two decades many industrialized countries have experienced a dramatic reduction in the prevalence of dental caries and this is ascribed to improved changing living conditions, adoption of healthy lifestyles, improved self-care practices, effective use of fluorides and establishment of preventive oral care programs while increasing levels of dental caries has been observed in developing countries. petersen has observed that at the population level, oral health outcomes are related to distal socioenvironmental factors and characteristics of the oral health services available. in addition to the use of oral health services, proximal modifiable risk behaviors such as oral hygiene practices, dietary habits, tobacco use and excessive consumption of alcohol were found. across countries and oral health systems, the existence of a social gradient (economic characteristics and educational background) in dental caries prevalence was found. the prevalence of dental caries in 5-year-old children in india has been reported to be 50% which is comparatively lower than many other parts of asia. it has been reported that few developing countries recently introduced school based oral health education and preventive programmes aimed at improving oral health behavior and status of the child population and inspiring results were observed from such health projects that have been conducted in indonesia, brazil, madagascar and china. in india, unlike other developing countries no oral health education or preventive programs are in action, the only attempt in the field of oral health at national level was the national oral health survey that has been conducted in different states. based on the results, some variation was observed in oral health status and behavior between the urban and rural population along with variation among the states where population of rajasthan presented better oral health status than other states. thus, the present study intended to assess the dental caries experience in deciduous dentition of 6 year old urban and rural schoolchildren of udaipur district and to evaluate the influence of socio behavioral characteristics on dental caries experience. ethical approval for conducting the present cross sectional survey was obtained from ethical committee of darshan dental college and hospital. prior permissions were taken from the district education officer for conducting the survey in selected schools. verbal consent was obtained prior to examination from each subject and parent (mother or father) provided the proxy informed written consent on behalf of school children. this survey is part of a large survey conducted on 6 and 12-year-old schoolchildren of udaipur district. to facilitate collection of representative sample, a combination of multistage and cluster sampling procedure was executed. at first stage, four rural areas and four urban areas were selected randomly from 8 rural and 4 urban panchayat samithis, respectively. later at second stage, four schools (two primary schools and two upper primary schools) in the each selected location were selected randomly (two each for boys and girls). in regions where there were no separate schools for boys and girls, thus a total sample of 875 first standard children participated in the study, selected from a total of 16 primary schools. subjects present on the days of the survey were included while physically challenged and systemically ill children were excluded. clinical examination was conducted by a single investigator under adequate illumination and dmft (decayed, missing, and filled teeth) index was used to evaluate dental caries. in order to minimize the intra examiner variability, 10% subjects who underwent the clinical examinations were randomly selected in each school by the recorder for repeated examinations. kappa co-efficient for intra-examiner reliability was found to be 92% for dmft. socio-demographic information such as name, age, gender, place of residence, occupation and education of the parents in addition to information on oral health practices (tooth cleaning practices, use of oral hygiene aids, use of tooth paste and dental visiting habits) was collected prior to clinical examination by personal interviews carried out by investigator himself. occupation and education status of parents was classified according to occupation and education components of kuppuswamy scale. statistical package for social sciences (spss 15.0, inc. unpaired t-test and one way anova were used to evaluate the significant differences in means between two and three or more groups respectively. binomial multiple logistic regression analysis was executed to assess the influence of various independent variables on the dental caries occurrence. the independent variables that were significant in bivariate analysis were categorized as; gender (boys and girls), location (rural and urban), parent's occupation (professional or semi professional, unskilled or unemployed and other occupations), parent's education (> 10 years of education, 1-10 years of education and illiterate), brushing frequency (sometimes or never and more than once a day) and dental visit (never been and had been to dentist at least once during lifetime). the effect of each independent variable was assessed adjusting for all other variables in the model. among the selected sample of 875 school children, 461 and 412 belonged to urban and rural locations respectively while 463 were boys and 412 were girls. the caries prevalence and mean caries experience of 6-year-old children was found to be 58.9% and 1.69 (1.99) respectively as illustrated in table 1. there was a significant difference for the caries prevalence between the genders with greater proportion of boys (62.2%) experiencing caries than girls (55.1%), decayed component constituted a major contribution in the total caries experience. dental caries prevalence and experience of 6-year-old schoolchildren according to location of residence and gender statistical analysis revealed significant differences for mean number of filled teeth between the locations of residence. though insignificant, mean dmft among rural subjects (1.79) was greater than the urban individuals (1.60) while it was greater in boys (1.77) than girls (1.60). tables 2 and 3 display the caries experience in relation to parent's occupation and education respectively. children whose fathers were professionals (1.25) experienced the lowest caries in contradiction to skilled (2.50). children of semi-professional (1.00) and unskilled (2.23) mothers had lowest and highest caries experience, respectively. when parent's level of education was considered highest caries experience was observed among children of fathers (2.92) and mothers (2.82) who completed primary school education. lowest mean dmft was among children of fathers who had a professional or honors degree and graduate or post-graduate mothers. one way anova revealed significant differences between the parent's occupation and level of education for filled component of dmft. mean caries experience in primary dentition of 6-year-old children according to parent's occupation mean caries experience in primary dentition of 6-year-old children according to parent's level of education table 4 documents the frequencies of oral health practices and statistically significant differences were observed by location and gender for most of the practices. percentage distribution of 6-year-old school children according to various oral health practices in relation to location and gender among the urban children, 75% reported that they cleaned their teeth at least once daily against 63.7% of rural children. barely half (53.2% and 54.3%) of the 6-year-old children said that they used toothbrush and toothpaste when they cleaned their teeth and only 7.8% children claimed of brushing twice or more than twice daily. among the urban children who cleaned their teeth, 61% used tooth brush in comparison to 44.4% of rural children. there was significant difference between genders and location of residence for tooth paste usage, 60.5% of urban against 56.4% rural and 53.6% boys against 55.1% girls. rural children visited the dentist less often than the urban children (p<0.05) and 93.3% of children had never been to dentist. logistic regression analysis was employed to determine the influence of various socio-behavioral variables on dental caries [table 5]. only those independent variables that had a significant influence on the dental caries occurrence are presented in the table. parent's occupation and level of education also played an important role, children of professional or semi professional parents and those who have completed at least 10 years of education were less likely to demonstrate caries. the association between oral hygiene practices and caries occurrence was evident, subjects who cleaned their teeth at least once a day were less likely to have caries than those who cleaned their teeth rarely or never (or=1.43; ci-1.13-1.81). moreover, children those who never visited a dentist were almost one half times more likely to have dental caries than those who had been to dentist sometime in their life (or=1.49, ci-1.17-1.89). logistic regression analysis with presence or absence of caries as dependent variable and various socio-behavioral predictors as independent variables among 6-year-old schoolchildren of udaipur district the present study provides epidemiological data regarding dental caries experience in primary dentition of 6-year-old urban and rural schoolchildren of udaipur district, which helps in planning preventive programmes for this population. in addition, emphasis was given to assess the effect of socio-behavioral risk factors on dental caries experience. the survey was not conducted on a national scale and therefore, the data are not representative of the whole country. however, the sample is considered to be representative of the school children from whole district as the study population was randomly recruited from all the divisions of the district. thus, future studies are recommended for assessment of dental caries and its related factors among non-school going children of the district. school children of first standard have been selected for the present study considering that the children of the first grade would be 6 or 7 years of age. the who recommended index age is 5 and the reason for recommending 5 years is that it is the age of interest in relation to caries in the primary dentition, which may exhibit changes over a shorter time span and it is the age when children begin primary school. however, it has been suggested by who that ages 6 or 7 can be used in countries where school entry is late. the mean dmft accounted to 1.69 approximating the mean dmft value of 5-year-old children of the whole nation (1.8) but is greater than caries experience observed by a previous survey in udaipur region (0.4) and rajasthan state (0.7), however it is much lesser than the mean dmft of 3.51 among chennai school children. there was a significant difference for the caries prevalence between the genders with greater proportion of boys experiencing caries than girls, similar results were observed in previous studies from india and this difference had been attributed to parents exhibiting preferential behavior towards boys in india.[1618] though insignificant, caries experience was higher in children living in rural than urban areas in harmony with the previous studies. and this may be explained by differences in dental care habits, social norms and dental attitudes. however, urban school children had significantly greater filled teeth in contrast to no filled teeth in their rural counterparts. this is in accordance to a recent study from north russia where urban school children had significantly greater filled teeth than rural ones. this difference in filled teeth between the regions might be due to the greater accessibility of dental care in urban than the rural areas. parent's occupation significantly altered caries status with children of those parents in better occupations experienced lesser caries and comparable results were observed in a past study. moreover, similar findings were observed among 5 to 15-year-old school going children of chidambaram in india where children of low socioeconomic status experience greatest caries. parent's level of education significantly influenced the caries experience, a review of risk factors for dental caries in young children associated low father's and mother's education with high caries prevalence. the proportion of children claiming of brushing twice or more than twice daily was 7.8% which is very less when compared to children of jordan and portugal. very few children paid dental visits and 93.3% had never been to a dentist, which is worse than 58% among chinese children. rural children visited the dentist much less often than the urban children (p<0.05) in agreement with 6-year-old children of portugal., suggested that urban centers facilitate access to toothbrushes and toothpaste and the use of these hygiene measures are considered a sign of modern life style. consequently, 6-year-old urban children used tooth brush and tooth paste significantly more than rural individuals. the proportion of 6-year-old children with caries was 58.9% in the present study which is in accordance to the 50% of the national data. the most important predictors for caries occurrence were place of residence, gender, parent's level of education and brushing frequency. thus, caries was related to many socio-behavioral factors in agreement with the previous studies.[2830]

background: based on the previous national oral health survey in india, some variation was observed in oral health status and behavior between the urban and rural population. thus, the present study aimed to assess the dental caries experience in deciduous dentition of 6-year-old urban and rural schoolchildren of udaipur district and to evaluate the influence of socio behavioral characteristics on dental caries experience. materials and methods: a combination of multi stage and cluster sampling procedure was executed to collect a representative sample of 875, 6-year-old school children. clinical examination for caries was conducted using dmft (decayed, missing and filled teeth) index. socio-demographic information was collected prior to clinical examination in addition to information on oral health behavior by personal interviews. results:only 7.8% children reported of brushing their teeth twice or more than twice daily. rural children visited the dentist less often than the urban children (p<0.05). greater proportion of boys (62.2%) experienced caries than girls (55.1%), decayed component constituted a major contribution for dmft. multivariate analysis demonstrated the influence of gender, urbanization, tooth brushing frequency, dental visits, parent's education and occupation on caries occurrence. conclusions:rural children and boys experienced greater caries than their urban and girl counterparts. caries experience was related to the parent's occupation and education. moreover, caries occurrence was influenced by brushing frequency and dental visiting habits.

PMC3612213

pubmed-815

after approval was granted by the clinical research center and ethics committee, records of all patients with the diagnosis of crps were reviewed. a total of 5 patients were identified, but only 4 patients agreed to undergo t2 and t3 rf sympathectomy after receiving an explanation of the risks and benefits of the procedure. the 4 patients were all male and all presented with total unilateral upper limb paralysis. the brachial plexus injuries involved were, in all cases, the result of motor vehicle accidents. the diagnosis of crps was based on the international association for the study of pain (iasp) diagnostic criteria. stellate ganglion blockades had been administered but were not found to provide satisfactory pain relief. all patients were subsequently offered diagnostic t2 ganglion blockade, followed by rf sympathectomy of t2 and t3 ganglia. both the diagnostic block and rf sympathectomy were performed with the patient in the prone position. the diagnostic block was performed at t2 level and an adequate volume of local anesthetic and dye was injected to ensure that spread of the local anesthetic reached t3 level. under fluoroscopic guidance, the t2 vertebral body was identified in an anteroposterior view. in order to square the t2 vertebral body, the fluoroscope was obliqued at approximately 20 toward the ipsilateral side and was then rotated approximately 20 in a cephalad direction. the skin entry point was at the lateral edge of the t2 vertebral body just cephalad to the third rib. from surface anatomy, the skin entry point was kept within 4 cm from the spinous process to reduce the risk of pneumothorax. a 25 gauge, 10 cm spinocan needle (b. braun, melsungen ag, germany) was advanced toward the lateral border of the t2 vertebral body above the third rib in a tunnel view. with the aid of lateral, anteroposterior, and oblique fluoroscopic views, the needle was further advanced with the needle sliding along the lateral aspect of the vertebral body. the final location of the needle tip was at the posterior third of the vertebral body and midline in cephalocaudad relation in lateral view (fig. 1). once satisfactory placement of the needle tip was achieved, 0.5 to 1 ml of ommipac 240 mg/ml was injected. the dye was observed to spread up and down the thoracic vertebral column, in both the anteroposterior and lateral views. a total of 5 ml of levobupivacaine 0.25% with triamcinolone acetate 40 mg was then injected. the diagnostic block was considered effective if a greater than 75% reduction in vas (visual analogue scale) pain score for the whole upper limb was achieved for at least 6 hours. for rf sympathectomy, a 22 gauge, 10 cm curved, sharp rf insulated needle with an active tip of 10 mm and cosman g4 rf generator (cosman medical, inc., burlington, ma, usa) were used. needle entry was performed and the final placement of the needle tip was located as per the technique described previously. once the correct position was confirmed, a 10 cm csk-tc10 electrode was introduced through the rf needle. before lesioning, a sensory (at 50 hz, up to 0.6 v) and motor (at 2 hz, up to 1.2 v) test stimulation was performed to verify the location. if the patient experienced no dermatome-related sensation and had no intercostal muscle contractions, the needle positions were deemed satisfactory. prior to lesioning, a total of levobupivacaine 0.25% 3 ml and triamcinolone acetate 40 mg were injected. two lesions were made with the needle angled in the medial-cephalad and medial-caudad directions to increase the lesion area. the rf lesioning settings were set for 60 seconds at 80. the rf procedure was performed at both the t2 and t3 levels in this manner. all patients experienced greater than 75% pain relief after diagnostic block at the t2 level and rf sympathectomy. at the 6-month follow-up, all patients were still experiencing more than 50% pain relief compared to their pain score prior to rf sympathectomy (table 2). at the time the study was conducted, the mean duration of follow-up was 7.5 months. all of the study patients underwent only one rf sympathectomy, except for patient 1, who underwent another rf sympathectomy 9 months later. after the second rf sympathectomy, patient 1 experienced a pain relief effect similar to that of the previous procedure. all patients were able to decrease their oral analgesic dosage by more than 50% during the course of follow-up (table 3). neuropathic pain secondary to brachial plexus injury is one of the most severe types of pain experienced. the treatment for crps involves a multidisciplinary approach combining pain management, psychological treatment and support, and rehabilitation, in order to control pain and to restore limb function and prevent complications, e.g., contractures and osteoporosis. before crps begins to develop, early surgical repair of injured brachial plexus has shown promising results in both pain reduction and functional recovery. this is also true for spinal cord stimulation, as various reports have shown favorable outcomes of spinal cord stimulation in the management of crps. however, expertise in brachial plexus surgical repair and spinal cord stimulation is not widely available, as in our institution. rehabilitation in patients with brachial plexus injury is often hampered by the development of crps. early diagnosis and treatment of crps has been shown to result in better treatment outcomes. while there is no curative treatment for crps, sympathetic blockade is found to be effective in controlling pain by decreasing abnormal hyperactive sympathetic tone. a comprehensive understanding of the anatomy of the upper limb sympathetic system is crucial in the management of crps secondary to posttraumatic brachial plexus injury. with considerable anatomical variations in the sympathetic supply to the upper limb, and also with the existence of the nerve of kuntz, conclusions concerning the efficacy of stellate ganglion blockade, especially as a long-term treatment for crps, sympathetic ganglion cell bodies that supply the upper limbs originate in the intermediolateral horn of the spinal cord from level t2 to t8., they ascend cephalad and synapse with postganglionic fibers, primarily in t2, but also in t3, in the stellate ganglia and in the middle cervical ganglia. by blocking both ganglia which are the crucial synaptic stations, this could explain the reasonable efficacy of rf sympathectomy in controlling upper limb crps in the present study, even at 6 months post-sympathectomy. besides crps, thoracic sympathectomy has been used for treatment of neuropathic pain in the thorax or upper abdominal viscera, pain related to herpes zoster or postherpetic neuralgia, and phantom breast pain after mastectomy. other indications include vascular insufficiency leading to ischemia, raynaud's disease, buerger's disease, and frost injuries of the upper limbs. additional non-pain related conditions which are indications for thoracic sympathectomy include hyperhidrosis and facial flushing. despite a lengthy literature search, only a few studies were identified describing upper thoracic sympathectomy for severe crps. in one study, agarwal-kozlowski et al. demonstrated that significant pain reduction was achieved by using computed tomography-guided catheter injection of 80.75% ethanol. the spread of ethanol might cover a wider area of neurolysis with a higher success rate, but the spread would not be predictable. thus, unwanted destruction or irritation of surrounding structures might occur. in another study, in a series of twenty-four patients with sympathetically mediated pain, herz et al. this technique, however, was invasive and subjected patients to surgical complications, which were mentioned in the study. thoracoscopic sympathectomy gained wide acceptance among surgeons and was claimed to be less invasive than the open technique. both open and endoscopic approaches require surgical expertise, which might not be available in every institution. in addition, both approaches pose a significant challenge to anesthetists and subject patients to surgical complications. as for the percutaneous technique, wilkinson performed 148 rf sympathectomies in patients with various conditions, with symptomatic pneumothorax occurring in 6 patients. the drawbacks of this procedure are the procedurerelated complications and the difficulty in achieving correct placement of the needle tip in a relatively crowded thoracic region. this complication, however, could be minimized by keeping the needle entry point within 4 cm from the spinous process and advancing the needle with the " hugging the vertebral body " technique. besides pneumothorax, injury to the intercostal nerve is also a possible complication, if sensory and motor stimulations were not performed adequately prior to rf lesioning. with further advancements in imaging techniques, e.g., ct scan and fluoroscopy with cone-beam ct, more precise sympathectomies with fewer complications should be achievable in the near future. successful sympathectomy is usually accompanied by temperature elevation of the ipsilateral limb. as this report was not planned for research or publication purposes initially, no objective thermographic measurement of limb temperature was done, but all respondents reported experiencing noticeable elevation in limb temperature. considerable anatomical variation in the sympathetic supply to the upper limb has been observed, which may explain the high incidence of recurrence of pain in the upper limb after thoracic sympathectomy. crps is a collection of various types of pain, with sympathetically mediated pain being the major component. thus, although sympathectomy might result in a significant reduction in pain, it would not completely eradicate all of the pain, as observed in the present study. this case series illustrates the success of percutaneous t2 and t3 rf sympathectomy via the multimodal approach to chronic pain management in controlling the pain suffered by patients with crps secondary to brachial plexus injury. when surgical repair of the brachial plexus and spinal cord stimulation are not available, percutaneous t2 and t3 rf sympathectomy could be considered in patients with type ii crps.

complex regional pain syndrome secondary to brachial plexus injury is often severe, debilitating and difficult to manage. percuteneous radiofrequency sympathectomy is a relatively new technique, which has shown promising results in various chronic pain disorders. we present four consecutive patients with complex regional pain syndrome secondary to brachial plexus injury for more than 6 months duration, who had undergone percutaneous t2 and t3 radiofrequency sympathectomy after a diagnostic block. all four patients experienced minimal pain relief with conservative treatment and stellate ganglion blockade. an acceptable 6 month pain relief was achieved in all 4 patients where pain score remained less than 50% than that of initial score and all oral analgesics were able to be tapered down. there were no complications attributed to this procedure were reported. from this case series, percutaneous t2 and t3 radiofrequency sympathectomy might play a significant role in multi-modal approach of crps management.

PMC3800715

pubmed-816

cervical spinal cord diseases are common neurological disorders in dogs. the severity of these disorders can be graded into five levels based upon the following clinical signs: grade 1, neck pain; grade 2, ambulatory tetraparesis (or hemiparesis); grade 3, non-ambulatory tetraparesis (or hemiparesis); grade 4, tetraplegia; and grade 5, tetraplegia without deep pain. conservative therapies are noninvasive and include medication, rehabilitation, and confinement. surgical treatments such as decompression and fixation are considered invasive. the choice of treatment depends on the severity of the disease, condition of the dog, and economic considerations. certain dogs need surgery, whereas some owners choose to try noninvasive therapy such as acupuncture (ap). however, there is no standard protocol and the underlying chinese medical theories about the existence of meridians, qi deficiency, and qi stagnation, which are most commonly encountered in cervical spinal deficiency, have yet to be confirmed scientifically. the ap protocol utilized depends on the diagnosis according to traditional chinese veterinary medicine (tcvm) and veterinarians ' experiences. there are many commonly used ap points (acupoints) for cervical spinal disorders, including local points (acupoints around the lesion) and distant points (acupoints distal to the lesion). in this study, we sought to simplify the points and standardize the protocol for treating different levels of cervical neurological deficits. the specific purpose of this study was to evaluate the effects of new ap protocols for the treatment of cervical spinal cord diseases in 19 dogs. clinical neurology case records were retrospectively collected from the university veterinary hospital for 2009 to 2014. lesions in all 19 dogs were localized to the cervical spinal cord, resulting in neck pain. the dogs had histories of neck stiffness, screaming, or poor cervical range of motion. however, they continued to suffer hemiparesis or tetraparesis. dogs presented with ataxic gait affecting four limbs or non-weight bearing paresis in ipsilateral limbs or all four limbs. additionally, four dogs underwent mri (vet-mr 0.2 tesla; esaote, italy), and one underwent mri and ct (activion 16; toshiba, japan). the dogs were referred for at least four tcvm treatments consisting of ap or ap combined with chinese herbal medicines. distant points included li4 (he gu), si3 (hou xi), liv3 (tai chong), bl11 (da zhu), and th5 (wai guan) (table 1, fig. the local points were stimulated using stainless steel needles (0.3 mm in diameter, 25 mm in length; yu guang, taiwan) with a perpendicular insertion depth of 0.51.0 cm. distant points were stimulated using stainless steel needles (0.27 mm in diameter, 13 mm in length; yu guang) with a perpendicular insertion depth of 0.250.50 cm. the choice of acupoints and method used depended on the grade of severity, onset period, and weakness of limbs. briefly, grade 1 comprised neck pain/stiffness and no other deficit, grade 2 included ambulatory tetraparesis (or hemiparesis) and grade 3 was non-ambulatory tetraparesis (or hemiparesis). treatment option 2 was used in dogs presenting with chronic, long-term signs lasting longer than 2 weeks. treatment option 1, dry needling in local points c1-c3-c5 (jjj) and in distant points si3, liv3 and li4; treatment option 2, option 1 with eap in local points jjj; and treatment option 3, option 2 with eap in distant points bl11+th5 (bl11 to th5 connected). with the dry needle method, the procedure was identical to that of ap, except that electrical stimulation was applied to the needle while inserted. an electrostimulator (ching ming tens model-05b; ching ming, taiwan) was used to provide stimulation for 15 min at 0.2 vp-p (voltage peak to peak) with a frequency of 20 hz (interrupted wave type). the intensity of electrostimulation was adjusted according to the dog's response to avoid discomfort. eap points included two pairs of points, a bilateral jjj and bl11 (da zhu) and th5 (wai guan). the ap treatment was performed two times per week initially, then once per week after significant improvement was achieved. chinese herbs, which consisted of double pii (jing tang, usa; the classical antecedent was da huo luo dan) and cervical formula (jing tang; no classical antecedent) (table 2), were given to 15 of 19 dogs. the dosage was 1 g per 5 to 10 kg of body weight, which was administered orally twice daily until recovery. in four cases, specifically, one dog had a hypersensitivity to the chinese herbs (case 11) and three dog owners were reluctant to apply chinese herbal treatments (cases 3, 13 and 17). dogs treated less than four times (at the owner's discretion) without any improvement were excluded from the analysis. the duration of signs prior to tcvm treatment (defined as the time period from disease onset tcvm treatment start) was recorded. after tcvm treatment, improvement time (defined as the time needed to walk without assistance in paretic cases or pain alleviating in neck pain cases) and recovery time (defined as the time required to return to normal daily life or absence of pain in neck pain cases) were recorded. spss (ver. 18.0; spss, usa) was used to analyze the data. signalment, lesion location, examination, diagnosis, severity, treatment methods, and time courses were retrieved from the medical records (table 3). the improvement in grade 1 cases (neck pain) progressed from improved neck stiffness and screaming to increased range of neck motion and increased activity, such as wagging tail freely, reduced pain medication or free from pain medication, to willingness to play (no pain). in grade 2 cases (ambulatory tetraparesis), the improve process went from gait ataxia to a well-coordinated gait. in grade 3 cases (non-ambulatory tetraparesis), the improvement proceeded from increased activity, lateral recumbence to sternal positioning, trying to stand, ataxic gait, small strides, and walking well to a little running. the mean body weight was 8.4 kg (range, 2.525.5) and the average age was 9.8 years (range, 516). the mean duration of signs before tcvm integration was 12.7 17.6 days (range, 360), the mean improvement time was 11.3 7.2 days (range, 430) and the mean recovery time was 16.9 23.0 days (range, 790). the clinical findings included neck pain/stiffness in five dogs, ambulatory tetraparesis in three dogs, non-ambulatory tetraparesis in nine dogs, and non-ambulatory hemiparesis in two dogs. in grade 1 cases (n=5), the mean improvement time was 8 days (range, 414), while the mean recovery time was 25.6 days (range, 1175). in grade 2 cases (n=3), the average improvement time was 7 days, and the average recovery time was 14 days (range, 714). in grade 3 (including tetraparesis and hemiparesis) cases (n=11), the mean improvement time was 14 days (range, 430) and the mean recovery time was 35.7 days (range, 790) (table 4). because the data were not normally distributed, they were analyzed using the kruskal-wallis test. the duration of signs to tcvm integration was significantly longer (p<0.05) in dogs weighing greater than 10 kg (n=5) than in those weighing less than 10 kg (n=14). n=9) or<10 years (n=10)] had no significant effect on the duration of signs, improvement, or recovery times. the two treatment methods, eap plus ap (n=8) and ap only (n=11) however, the improvement and recovery times were significantly longer in the ap+eap group (p<0.05). the effects of treatments with ap or ap+eap were compared by severity in table 5. the three different severity grades had similar improvement times following ap treatment, while for the duration of signs, grade 1>grade 2>grade 3. the recovery times of grade 3 dogs were longer than for grade 1 and grade 2 dogs. with ap+eap treatment, improvement time for grade 1 dogs was similar to that of grade 3, but the recovery times were far longer than for grade 3 dogs, while the duration of signs was longer than for grade 3 dogs. dogs in group 3 receiving ap+eap had similar durations of signs and improvement times. however, the recovery times were longer in the dogs receiving option 3 treatment. among the 19 dogs, the duration of signs, improvement time, and recovery time did not differ between groups receiving ap with chinese herbs (n=15) and ap without chinese herbs (n=4). additionally, there was no significant difference between 2 groups with respect to neurological localization at c1c5 (n=12) and c6t2 (n=7) or for the final diagnosis ivdd (intervertebral disc disease) (n=11) and ivdd with spondylosis deformans (n=7). table 6 compares different variables related to treatment progress. the duration of signs, improvement times, and recovery times in the c1c5 localization group were longer than in the c6t2 group and in the ivdd group than in the ivdd+spondylosis deformans group. there is much less literature available pertaining to tcvm treatment for cervical spinal cord diseases in dogs than there is for traditional chinese medical treatment of human cervical spinal cord disease. in humans, we found no literature on jjj points used as local acupoints for the treatment of cervical spinal cord diseases in dogs. based on our experience, the tcvm treatment protocol and ap point selection depended on each individual case. in this study, we sought to standardize protocols as simply as possible for the cervical spinal cases we treated. in traditional chinese medicine, stimulation of jjj points harmonizes the gv (governing vessel) and bl (bladder) channels. in anatomy, stimulation of jjj points triggers a reflex arc, resulting in sympathetically induced, segmental, superficial, and visceral vasodilation. another important effect of local point stimulation is that it activates local immune-inflammatory systems. the stimulation site also releases bradykinin, and thus, increases local vascular permeability to allow other inflammatory mediators access to the area. because of the high concentration of nerve endings and dense microvasculature around the acupoints, these effects are greater than the effects of local stimulation on stimulation sites. in dogs, superficial needling may not attain the best point identification, and the jjj points are very near the cervical spinal cord. it is easy to palpate the lateral transverse processes and insert the needles into jjj points. given that there is a needling sensation, changes in needle depth at the jjj points do not make cause obvious differences in the therapeutic efficacy during treatment of certain cervical spinal problems. the purpose of stimulation to si3, li4, and liv3 is to stimulate the distal extremities to arouse conscious proprioception. stimulation through the afferent nerves enters the spinal cord and passes up to the brain, after which it travels via the efferent nerves down to the extremities to re-educate the nerves and facilitate their healing. concurrent stimulation of bl11+th5 strengthens weak thoracic limbs. for one of the dogs with grade 1 disease, although the dog had grade 1 severity in terms of neurology, neck pain is sometimes not well tolerated by dogs over the long term. for this dog, the variance could be related to the individual conditions of the dogs, their healing abilities, and their individual responses to ap. for dogs, we found that jjj points were also beneficial for the treatment of tetraparetic dogs. from a clinical point of view, the prominent improvements were pain relief and recovery of ambulation. two treatments were necessary for neck pain relief and four treatments (twice a week) were needed for improvement in ambulation. among the larger, heavier dogs (n=5), two had delays in starting tcvm (cases 12 and 13). these dogs were treated for neck pain at a local animal hospital for two months before being referred for tcvm because of their poor responses to treatment and the side effects of the analgesics. since there were no differences in improvement and recovery times, the ap protocol had the same impact on both lighter, smaller dogs (2.5-9.0 kg) and heavier, larger dogs (14.0-25.5 kg). because there were no differences in duration of signs, improvement times, and recovery times between the two age groups of dogs, the ap protocol had the same effects on both younger dogs (5-9 years) and older dogs (10-16 years). in addition to duration of signs, the severity of the disease was also taken into account when considering whether to add eap to the protocol. in anatomy, the purpose of eap stimulation connecting bl11 to th5 is to enforce the stimulation of ap to the thoracic limbs. in this study, 20 hz (interrupted wave) was applied for 15 min. an in vivo study in cats revealed that peripheral stimulation at 20 hz maximized the release of substance p. substance p, which acts via neurokinin-1 receptors, promotes the proliferation of neural cells and is associated with the regulation of neurogenesis. one possible reason is that there were more dogs with grade 3 severity in the ap+eap group. in the ap group, dogs with different severity grades had similar improvement times, but the recovery times were longer in dogs with grade 3 severity than in those with lesser severity grades. thus, with ap treatment, dogs with severe grade 3 disease needed a longer time to heal (recover) even though the duration of signs was short. in the same grade 3 group, ap treatment resulted in shorter improvement and recovery times than ap+eap treatment, probably because of the shorter duration of signs. these findings indicate that a delay in treatment at this severity grade, even when receiving ap+eap, resulted in a longer time being required to heal. dogs in the same grade 3 group receiving ap+eap had a similar duration of signs and improvement times, but the recovery times were longer in dogs with weak thoracic limbs. thus, dogs with grade 3 and thoracic limb weakness needed more time to heal. only one dog with grade 1 severity received ap+eap because of the long duration of signs. its improvement time was similar to that of dogs with grade 3 severity, but its recovery time was longer than that of dogs with grade 3 severity receiving ap+eap. these findings indicate that even though the severity grade was low, once the duration of signs was long, it affected the prognosis. further study with more cases is necessary to verify these assumptions. in this study, no dogs with grade 2 received ap+eap because of the acceptable effects produced by ap. we anticipate that dogs with grade 2 severity (ambulatory tetraparesis), a certain duration of signs and without thoracic limb weakness will have a good prognosis upon ap+eap treatment. further study is required to determine whether or not dogs with long-term (more than 2 weeks) or only short-term (less than 1 week) grade 2 severity should be treated with ap+eap for a better neurological response. dogs with ivdd+spondylosis deformans had shorter improvement and recovery times than those with ivdd alone. one possible reason is a shorter duration of signs before treatment in ivdd+spondylosis deformans dogs. therefore, a shorter onset of disease was associated with a better outcome, even when two disorders presented together. similarly, dogs with more severe c6t2 lesions had shorter improvement and recovery times than those with c1c5 because of the shorter onset of disease before treatment. when stagnation resolves, qi flows freely; thus, pain ends and the function resumes. in this study, two chinese herb formulas were prescribed to improve the flow of qi, double pii (jing tang) and cervical formula (jing tang). the treatment principles of double pii are to break down stasis in the spine, move qi, and relieve pain. the cervical formula is a cervical transporter, blood activator, and qi mover that dissipates stagnation and relieves neck pain. although there was no obvious statistical difference between ap treatment combined with chinese herbs or without in this study, we anticipate that improvement and recovery times would be shorter when treatment included chinese herbs (table 6); however a larger study should be conducted to confirm this. all 19 dog owners were asked to bring their dogs to the veterinary clinic for reexamination to check their conditions every few weeks or months. all of the dogs were successfully treated using this ap protocol with no relapse as of completion of the study and subsequently over a period ranging from 1.5 years (case 19) to 5 years (case 12). we do not recommend this ap protocol in cases of significant structural change, such as ruptured nerves, severe cervical vertebral dislocation, or cervical spinal cord compression due to a tumor because such cases usually have poor prognosis, even after aggressive treatment such as surgery. in the case of tetraparesis, other factors related to improvement and recovery include rehabilitation and care. in the early stages of the treatment, encouragement to stand and walk with assistance (such as walking with a sling or cart) is crucial to educate the nerves and train the muscles. when dogs exhibit marked improvement, vigorous physical rehabilitation by underwater treadmill training or sling assisted walking is highly recommended to help increase muscle strength. in this study, dogs with body weight over 10 kg received underwater treadmill rehabilitation (cases 1, 11 and 19), while those with body weight under 10 kg underwent sling aided walking (cases 2, 5, 6, 7, 9, 15, 17 and 18). there are many methods to treat cervical spinal diseases resulting in neck pain or tetraparesis in dogs, including tcvm. among the 19 successfully treated dogs in this study, the new standardized ap protocol led to a marked improvement after only four sessions of twice weekly treatment. the dog with fibrocartilaginous embolism needed at least two sessions for improvement and six sessions to recover. additionally, dogs with ivdd needed at least four sessions to improve and seven sessions to recover, while those with ivdd and spondylosis deformans required three sessions to improve and five sessions to recover. we objectively evaluated the effects of ap from the functional clinical perspective; however, more studies with greater numbers of subjects are needed to confirm our results and document the bio-molecular changes and mechanisms of treatment.

this study was conducted to evaluate new acupuncture protocols for the clinical treatment of cervical spinal cord diseases in 19 dogs. three treatment options containing jing-jiaji (cervical jiaji) were developed to treat neck pain, hemiparesis, and tetraparesis depending on the severity. the interval between the neurological disease onset and treatment (duration of signs), time to improvement after treatment, and recovery time were compared in dogs by body weight, age, and dry needle acupuncture (ap) with or without electro-ap (eap). the duration of signs was longer in dogs weighing greater than 10 kg than in those weighing less than 10 kg (p<0.05). improvement and recovery times did not vary by body weight. additionally, improvement and recovery times did not vary by age. the improvement and recovery times were longer in the ap+eap group than the ap group (p<0.05). acupuncture with jing-jiaji was effective in cervical spinal cord diseases in different sized dogs and in middle-aged and senior dogs. this report standardized ap treatment containing jing-jiaji for canine cervical problems and evaluated its effects. the newly standardized ap methodology offers clinical practitioners an effective way to improve the outcomes of cervical neurological diseases in dogs.

PMC5037301

pubmed-817

the importance of leukemia inhibitory factor (lif) stimulated signaling in mouse embryonic stem cell (esc) culture in vitro has long been recognized. by activating janus kinase (jak) and signal transducer and activator of transcription 3 (stat3), lif plays essential roles in the generation and maintenance of mouse pluripotent embryonic stem cells which are capable of infinite self-renewal and differentiation to any cell type of the three-germ layers of an embryo. over the past two decades, much information has been obtained regarding the lif signaling pathway through studying mouse escs. however, the exact mechanism by which activated stat3 controls pluripotency still remains to be elucidated. the induced pluripotent stem cell (ipsc) technology provides a powerful tool to reprogram somatic cells such as skin fibroblasts to a pluripotent state, and brings us much closer to the establishment of personalized, cell-based therapy for the treatment of currently incurable diseases such as diabetes and neural degenerative diseases. in many aspects, somatic cell reprogramming represents a reversed cell differentiation process, by epigenetically resetting the cell nuclei back to a pluripotent state. a the same time reprogrammed cells turn on a cellular signal network capable of both robust cell division and fending off intra- and extra-cellular differentiation stimuli. recently, the lif-jak-stat3 axis was demonstrated by a number of studies to be essential for the nave state pluripotency establishment during somatic cell reprogramming. in addition, these studies provided important insight for further understanding of the mechanism behind lif regulated esc pluripotency. in this review, we will summarize the current knowledge on the role of lif and especially jak-stat3 signaling pathway in esc pluripotency maintenance and in somatic cell reprogramming. leukemia inhibitory factor (lif) is a member of the interleukin (il)-6-type cytokine family, which includes il-6, il-11, il-27, lif, ciliary neurotrophic factor (cntf), cardiotropin-1 (ct-1), oncostatin m (osm), and cardiotrophin-like cytokine-1/novel neurotrophin-1/b-cell stimulating factor-3 (clc-1/nnt-1/bsf-3). lif was initially discovered to be pleiotropic in different mouse leukemia cell lines, by exerting either an inhibitory or promotional role on cell proliferation. the same cytokine was also isolated from culture medium conditioned with buffalo rat liver cells, which can promote the self-renewal and sustain the pluripotency of mouse escs in the absence of fibroblast feeder cells. lif binds to the low-affinity cell surface lif receptor (lifr), which stimulates the hetero-dimerization of lifr with the signal transducer glycoprotein 130 (gp130) (fig. 1). this triggers the activation of gp130-associated jak kinases, and the subsequent phosphorylation of tyrosine residues in the gp130 cytoplasmic domain. these phosphor-tyrosines then serve as the docking sites to recruit the src-homology-2 (sh2) domain containing stat proteins (stat1 and 3), which are phosphorylated by activated jak kinase. once phosphorylated, the stat proteins dimerize and enter the cell nucleus to regulate the expression of their target genes. although the jak kinases including jak1, jak2, and tyk2 can all be phosphorylated following stimulation by lif as well as other il-6-type cytokines, jak1-mediated il-6/il-11 signaling can not be substituted by jak2 and tyk2. additionally, while rna inhibition of jak1 induces mouse esc differentiation, jak2-deficient escs are responsive to lif stimulation. it was also found that in mouse escs, the activity of stat3, but not stat1, is responsible for pluripotency maintenance, and artificially activated stat3 can sustain esc self-renewal in the absence of lif. these lines of evidence suggest that the prevailing stemness signaling is mediated by jak1 activated stat3 dimerization in mouse escs. this is followed by the activation of jak-stat3, pi3k/akt, and erk1/2 signaling pathways. the activated stat3 leads to increased expression of socs3, which serves as a negative feedback signal to lif stimulated activation of stat3 and erk1/2. likewise, lifr can serve as the receptor to mediate signals of several ligands including lif, cntf, ct-1, osm, and clc-1 (table 1). il-6-type cytokines induced gp130 homo- or heterodimerization with lifr also activates the phosphatidylinositol 3-kinase (pi3k)/protein kinase b (akt), and the sh2-domain containing tyrosine phosphatase (shp2)/extracellular-signal-regulated kinases 1/2 (erk1/2) pathways. activated gp130 recruits shp2 through its tyrosine residue (tyr in humans, equivalent to tyr in mice), where shp2 is phosphorylated by jak kinases and interacts with the growth-factor receptor bound protein 2 (grb2) and son of sevenless (sos) complex to activate erk1/2. the activation of stat3 also triggers the expression of the suppressors of cytokine signaling 3 (socs3), which competes with shp2 for the cytoplasmic domain of gp130 phosphorylated at tyrosine residue tyr (human) or tyr (mouse), and inhibits the jak-stat3 and erk1/2 activation (fig. 1). the negative regulation of jak kinases by socs3 involves both direct inhibition of the jak catalytic domain and the promotion of proteasomal degradation of jak. while constitutively activated akt was reported to sustain mouse esc pluripotency independent of stat3, signaling from activated erk1/2 promotes the neural commitment of escs. as the jak-stat3, pi3k/akt and erk1/2 pathways are simultaneously activated by lif, it obviously contributes to the pleiotropic roles that lif plays in different cell types, and complicates the understanding of lif signaling regulated pluripotency. it is well-known that jak-stat3 signaling is important in maintaining mouse esc pluripotency and propagation. unfortunately, thorough elucidation has not been achieved despite the numerous attempts made to uncover the mechanism behind jak-stat3-mediated esc self-renewal. stat3 is a transcription factor whose amino acid sequence is highly conserved across species among humans, cattle, pigs, rats, and mice. its dna binding domain recognizes the consensus sequence of ttcc(c/g)ggaa which is present in the regulatory regions of many genes. the phosphorylation of tyr of stat3 is important for stat3 homo-dimerization and nuclear translocation following gp130 activation. by mutating the stat3 binding tyrosine residues in the cytoplasmic domain of gp130, it was shown that stat3 activity was necessary for gp130 signaling mediated mouse esc self-renewal. expressing a mutant form of stat3 (stat3f, tyr to phenylalanine) leads to esc differentiation even in the presence of lif, while dimerization of stat3 fused with estrogen receptor (stat3er) upon 4-hydroxytamoxifen (4-ht) treatment promoted mouse esc self-renewal in the absence of lif. thus it became clear that stat3 is the key downstream mediator of lif stimulated pluripotent signal. these embryos can form embryonic ectoderm and visceral endoderm but not the mesoderm. in culture of wild-type escs, lif prevents their differentiation into mesoderm and endoderm but needs either serum supplement or bone morphogenetic proteins (bmps) to suppress the neuronal differentiation. bmp signaling induces the expression of inhibition of differentiation (i d) proteins, and mouse escs transfected with ids remain undifferentiated in the presence of lif without serum. microarray analysis using stat3er transfected escs identified 58 stat3 targets, among which 22 are responsible for inhibiting the differentiation of either mesoderm (ccm4l, cyr61, dact1, etc.), endoderm (krppel-like factor 4 [klf4], gbx2, pim1, pim3, sall4, smad7, etc.), or both (klf5). interestingly, 14 of these genes, including klf4, klf5, pim1, dact1, and smad7, are co-regulated by nanog, indicating a partially functional redundancy between stat3 and nanog in pluripotency maintenance. this is also in line with the finding that overexpression of either nanog or stat3 maintains esc self-renewal in the presence of reduced signaling from one another. in mouse escs, the global dna binding sites of 13 pluripotency-, cell cycle-, dna binding-, or reprogramming-related transcription factors were evaluated using chromatin immunoprecipitation coupled with high-throughput sequencing (chip-seq). also, a total of 718 genomic loci were identified to be co-bound by stat3 and at least another 3 of the 13 factors, and stat3 clusters with nanog, oct4 (also known as pou5f1), or sex determining region y-box 2 (sox2) among 56.8% of these loci, clearly demonstrating that stat3 shares many common targets with the core pluripotent oct4-sox2-nanog circuitry. interestingly, stat3 were found to co-bind with oct4, sox2, nanog, and smad1 to the regulatory region of key pluripotent genes which were also found to be reprogramming factors such as nanog, oct4, sox2, estrogen-related receptor (esrrb), klf4, c-myc, t-box transcription factor 3 (tbx3), sall4, etc. c-myc had been previously identified as a stat3 target and overexpression of constitutively active c-myc mutant maintains mouse esc pluripotency in the absence of lif. it was postulated that the lif/stat3 signaling promotes esc self-renewal by stimulating c-myc mrna expression, and by stabilizing c-myc protein levels through inhibiting glycogen synthase kinase 3 (gsk3) mediated threonine 58 (thr) phosphorylation. however, mouse escs with c-myc disruption were reportedly normal in self-renewal, presumably due to the redundant function from n-myc. using chip and microarray analysis (chip-chip), 948 genes and 1459 genes were found bound by stat3 and c-myc in mouse escs, respectively, of which stat3 and c-myc co-occupy the promoters of 218 genes, including n-myc, rest, stat3, mbd3, and jmjd3. interestingly, it was shown that while stat3 binds to genes that are either transcriptionally activated or repressed, c-myc mainly occupies actively transcribed genes in escs. these, together with other studies described above, indicate that while stat3 functions synergistically with the oct4-sox2-nanog pluripotent circuitry and myc by co-regulating their common target gene expression, unique function by stat3 through regulating its specific targets not bound by these factors may exist for the pluripotency maintenance. similar to nanog, overexpression of klf4 or tbx3 gene confers lif-independent mouse esc self-renewal. it was elegantly demonstrated that upon lif stimulation, klf4 expression in mouse escs is preferentially stimulated by jak-stat3 activation, whereas tbx3 expression is stimulated by pi3k/akt pathway upon the inhibition of erk activities. based on their finding, proposed a model where lif regulates pluripotency maintenance by simultaneous stimulation of jak-stat3 and pi3k/akt pathways in escs. this leads to the activation of klf4 and tbx3 expression, and the subsequent expression of sox2 and nanog, respectively. sox2/nanog cooperate to maintain oct4 expression, while nanog also reinforce the established oct4-sox2-nanog pluripotency network in the absence of klf4 and tbx3 (fig. 2). schematic representation of lif regulated pluripotency circuit in escs. upon lif activation, jak-stat3 promotes the expression of the core pluripotency circuit (green box) together with pi3k/akt for pluripotency maintenance. this model of parallel axes by lif/jak-stat3/sox2 and lif/pi3k/nanog to maintain pluripotency are supported by multiple lines of evidences. first, selective activation of klf4 by stat3 was reported to synergize with klf2, activated by oct4, to ward off the differentiation stimuli to escs. stat3 was also reported to directly upregulate sox2 during neural progenitor cell differentiation from escs. second, upregulation of nanog through pi3k activation or gsk3 inhibition has been reported to contribute to esc maintenance. using pi3k inhibitor ly294002, 646 downstream targets of pi3k pathway were identified in mouse escs by microarray analysis. these include some key pluripotent genes such as nanog, esrrb, tbx3, and tcl-1, as well as zscan4c, one of the zscan4 family of zinc finger proteins. interestingly, it was found that inhibition of zscan4c reduces the proportion of escs expressing high levels of nanog, and zscan4c was found to regulate telomerase elongation and chromosome stability in escs. in addition, although it is unclear why the constitutively activated akt confers mouse esc self-renewal, akt stabilizes myc by inhibiting gsk3-mediated phosphorylation and degradation, and akt also phosphorylates sox2, thus enhancing its stability and transcriptional activity in escs. however, in addition to the pi3k/nanog axes in escs, stat3 also binds to nanog promoter with brachyury which co-activates nanog expression in early mesoderm progenitor cells derived from escs. the activation of canonical wnt pathway leads to phosphorylation and inhibition of gsk3 and the subsequent nuclear accumulation of -catenin to regulate cell fate and many other biological events. it was reported that inhibition of gsk3 using 6-bromoindirubin-3-oxime promotes mouse esc self-renewal in the absence of lif, and that activated -catenin upregulates nanog expression by interacting with oct4. however, it was also reported that wnt signaling alone is not sufficient for the maintenance of mouse esc self-renewal but can cooperate with lif for this action. part of this synergistic effect of wnt could be through increasing stat3 mrna level in escs. a more recent study indicates that wnt regulated expression of orphan nuclear receptor nr5a2 (also known as lrh-1) is significant in augmenting pi3k/akt pluripotent signaling through regulating tbx3, nanog, and oct4 expression independent of jak-stat3. however, unlike nanog and tbx3, overexpression of nr5a2 can not sustain esc pluripotency in the absence of lif. the culture of mouse escs under the dual inhibition of erk and gsk3 (2i) ensures esc self-renewal and pluripotency maintenance without lif. stat3 null escs can be derived under the 2i or triple inhibition of fgf receptor, erk1/2, and gsk3 culture condition. although -catenin was found dispensable for esc self-renewal, its overexpression enhances pluripotent gene expression and delays the mouse esc differentiation. the pluripotency maintenance effect of gsk3 inhibition was recently found to be through inhibiting transcription factor 3 (tcf3) protein by activated -catenin, which relieves the suppressive effect of tcf3, leading to the expression of pluripotent gene esrrb. smith s group therefore proposed a model of esc signal network in which pluripotency is supported by the inhibition of gsk3 and the activation of stat3 which in turn activate the expression of tcf3 and klf4, respectively, and esc is maintained by an expanded core pluripotent circuitry including oct4/sox2, nanog, klf4, tbx2, and tcf3 (fig. 2). however, esrrb is also dispensable for esc maintenance in the presence of lif, which highlights the parallel compensatory capacity by the core pluripotent circuitry for esc self-renewal. a complementary model was proposed by savatier s group which describes the synergistic effect of stat3 with nanog in preventing mesoderm and endoderm differentiation, as well as stat3 s direct effect in preventing endoderm differentiation through regulating its specific target genes in mouse escs. together, these studies contribute a comprehensive depiction to our understanding of lif signal network (fig. 2). a few studies also investigated the stat3 regulated esc pluripotency and gene expression at the epigenetic level. one study discovered that in mouse escs, stat3, and oct4 co-bind to the promoter region of embryonic ectoderm development (eed) gene and promote its expression. as eed is a core component of polycomb repressive complex 2 (prc2), this stabilizes the histone 3 lysine 27 tri-methylation (h3k27me3) at the promoter regions of several lineage commitment genes, therefore suppresses their expression. the pluripotent cell-specific atp-dependent swi/snf chromatin remodeling helicase complex (esbaf) is essential for esc pluripotency and self-renewal, with brg1 (also known as smarca4) as a key esbaf component. in mouse escs, brg1 was shown to be required to prepare the chromatin access for stat3 to activate many of its target genes, whose promoters are otherwise occupied by prc2 complex. other studies also demonstrated that brg1 binding to stat3 is necessary to allow stat3 to access the promoter region of inf regulatory factor 1 to control its expression, as well as the promoter of the p21waf1 gene followed by stat3-cdk9 interaction promoted transcriptional elongation. ipscs are esc-like cells reprogrammed from somatic cells by overexpression a set of reprogramming factors including oct4, klf4, sox2, and c-myc (oksm) in the mice and humans, or oct4, sox2, nanog, and lin28 in humans. this technology represents a powerful way for regenerative medicine in terms of massively producing patient-specific pluripotent cells within a short time. however, many technical issues still remain unsolved, including the efficiency of reprogramming, the development of integration-free reprogramming method, the quality and safety of induced ipscs for clinical application, and lastly but probably most importantly, the understanding of the molecular mechanisms of reprogramming. such information is required to ensure a proper translation of the ipsc technology to human medicine. many major differences exist between the mouse escs/ipscs and human escs/ipscs. for example, human escs/ipscs are flat in colony morphology; depend on fgf/activin signaling for their pluripotency maintenance; and have completed x chromosome inactivation. they divide slowly (36 h doubling time), and survive poorly after single cell dissociationa property essential for gene targeting. on the contrary, mouse escs/ipscs are dome-shaped, depend on lif signaling for pluripotency, divide rapidly (16 h doubling time), and are amenable for single-cell colonization and gene targeting. the human escs/ipscs are in fact similar to mouse epiblast stem cells (mepiscs) derived from pre- or post-implantation mouse embryos which have limited in vivo differentiation capacity, and these cells are collectively referred to as being in the primed pluripotent state, while the mouse escs/ipscs from pre-implantation embryos are referred as in the nave state. so far numerous studies have focused on the role of jak-stat3 in the maintenance of the steady-state pluripotency of escs; however, until recently little had been known whether lif signaling is essential for ipsc induction, despite that lif was preferably included in the induction medium. interestingly, withdrawing lif and supplementing the culture medium with fgf/activin a results in the transition of nave mouse escs to primed episc state. at the same time, episcs can be reprogrammed into nave mouse ipscs by overexpression of klf4, klf2, or nanog. using this episc-esc reprogramming system, yang et al. in smith s group studied the effect of lif signaling in the conversion of primed to nave state pluripotency. they first found that lif is necessary for episc-escs transition induced by klf4 or nanog overexpression under the 2i condition. previously a chimeric receptor was described (gy118f), in which the ligand binding domain of the granulocyte colony stimulating factor (gcsf) receptor was fused to the trans-membrane and cytoplasmic domains of gp130 modified at residue tyr (corresponding to the tyr of the wild-type mouse gp130) to phenylalanine. this ensures constitutive activation of stat3 upon gcsf stimulation. by expressing the gy118f receptor in episcs with gcsf stimulation, yang et al. discovered that activation of stat3 can convert episcs directly to nave ipscs in 2i medium. they further demonstrated that stat3 activation in episcs does not stimulate klf4 or nanog expression. rather, stat3 acts synergistically with either of them to dramatically improve the reprogramming efficiency. finally, they demonstrated that activated stat3 also improves the reprogramming of mouse neural stem cells and partially reprogrammed cells (pre-ipscs) to nave state ipscs induced by oct4, klf4, c-myc (okm), or oksm, respectively. the study by smith s group for the first time demonstrated that stat3 activation is necessary for the reprogramming between mouse episcs to ipscs. a later study also demonstrated that enhanced stat3 activation can reprogram mouse episcs to nave pluripotent cells even in the presence of fgf/activin differentiation signals. thus the stat3 activity becomes essential for converting the primed state to nave state pluripotency in the mouse. however, it remained unclear whether the lif signaling is necessary for reprogramming of terminally differentiated mouse somatic cells, which bypasses the episc stage during reprogramming with lif containing medium. furthermore, the molecular mechanism of stat3 induced reprogramming remains elusive, albeit much information has been obtained by studying the steady-state pluripotency maintenance. we addressed these questions by studying the role of stat3 during the reprogramming of terminally differentiated mouse embryonic fibroblasts (mefs). using stat3c, a constitutively activated stat3 mutant with two residues in its sh2 domain mutated to cysteine (a662c and n664c), we discovered that enhanced stat3 activation significantly promotes the reprogramming from mef cells to ipscs by oct4, klf4, sox2 (oks), or oksm overexpression. this result was doubly confirmed by expressing a mutant gp130 with tyr converted to phenylalanine, as well as by deprivation of lif during reprogramming. we further found that the complete mef reprogramming, as indicated by expression of gfp transgene driven by the oct4 distal enhancer, was completely blocked in the presence of jak inhibitor 1 (jaki) but not the pi3k inhibitor, ly294002. however, the total number of induced colonies was not affected by the jaki treatment. these observations demonstrated that stat3 activation plays a vital role in the late-stage somatic cell reprogramming, i.e., the activation of the endogenous oct4 gene. we also studied the role of stat3 activation in the complete reprogramming of pre-ipscs induced by okm. these cells form colonies but do not express endogenous oct4, and can be completely reprogrammed by the expression of sox2 or the addition of repsox, an inhibitor of transforming growth factor receptor (tgfbr). again our results show that stat3 activation is necessary for sox2 or tgf-signaling pathway inhibitor promoted reprogramming of pre-ipscs. examining the promoter dna methylation status revealed that jak-stat3 inhibition prevents the demethylation of endogenous oct4 and nanog during reprogramming. this is associated with increased expression of dna methyltransferase 1 (dnmt1), class i histone deacetylases (hdacs), and other chromatin-repressive genes. inhibition of dnmt1 and hdacs has been shown to significantly improve somatic cell reprogramming. in order to test whether the stat3 induced inhibition of dnmt1 and hdac expression is important for complete reprogramming, we applied inhibitors for dnmt1 and hdacs together with the inhibition of stat3 during reprogramming. indeed we found that inhibiting either dnmt1 or hdacs but not the overexpression of nanog can overcome the halted reprogramming by stat3 inactivation. during this study, we also observed that stat3 inhibition resulted in continued expression of the retroviral transgenes which are otherwise gradually silenced at late-stage reprogramming. this lack of external gene silencing is tightly associated with the diminished expression of de novo dna methyltransferase dnmt3l. it has previously been demonstrated that expression of dnmt3l in mouse escs is crucial to the activation of de novo dna methylation which silences the viral transgenes. our finding therefore reveals a new role of stat3 in regulating de novo dna methylation for epigenetic gene silencing during reprogramming. taken together, our work demonstrated that (1) jak-stat3 activation is essential for the reprogramming of murine somatic cells, (2) stat3 activity is crucial for the pluripotent gene promoter demethylation, and (3) stat3 is important for retroviral transgene silencing during the reprogramming. the discovery that stat3 activity is essential for the reprogramming from mouse episcs and somatic cells to nave ipscs, as demonstrated by others and us, respectively, is significant for the understanding of reprogramming and pluripotency. the continued high-level expression of ectopic transgenes in pre-ipscs and in reprogrammed cells caused by stat3 inhibition strongly indicates the existence of a reprogramming barrier which can not be simply overcome by a greater dosage of reprogramming factors in the absence of stat3 activity, even with the overexpression of klf4 and nanog which can sustain esc self-renewal in the absence of lif. a passive model of genomic dna demethylation as a result of inhibited methylation maintenance has been proposed to explain the somatic cell reprogramming. it was also found that transient stat3 activation poises the episcs for complete reprogramming by klf4 or nanog. these are in accordance with our finding that jak-stat3 functions epigenetically to inhibit the expression of dnmt1 and other heterochromatin-promoting genes, which in turn promotes the demethylation of pluripotent loci during reprogramming. together, our results strongly suggest a central role of stat3 during reprogramming, by orchestrating the establishment of open-chromatin to completely activate the pluripotent genes, and by promoting the de novo dna methylation activity to silence the expression of viral transgenes and possibly the lineage commitment genes, in addition to the stat3 promoted suppression through prc2 (fig. schematic representation of stat3 regulated somatic cell reprogramming via epigenetic mechanisms. during late-stage reprogramming, stat3 orchestrates the epigenetic changes leading to complete pluripotency, by ensuring full activation of core pluripotency genes through promoting dna demethylation and open chromatin formation, while suppressing the viral transgenes and lineage commitment genes by promoting de novo dna methylation and probably prc2 mediated histone modifications. the jak-stat3 pathway has been identified as the core signaling pathway for pluripotency maintenance, and was also demonstrated recently to be essential for the complete reprogramming of mouse somatic cells. although a number of stat3 downstream target genes had been identified, a thorough understanding of the stat3 mediated reprogramming still remains unachieved. an emerging area of study on stat3 mechanism is to investigate the epigenetic roles of stat3 in the maintenance of steady-state pluripotency and during the dynamic changes of somatic cell reprogramming. special emphasis may be placed on the stat3 induced formation of euchromatin for the pluripotent gene activation, and formation of heterochromatin for lineage commitment gene silencing. interestingly, recently several groups reported the generation of nave state human ipscs, which also rely on lif signaling for their self-renewal. together, these series of studies have brought jak-stat3 to the central stage of ipscs research.

reprogramming somatic cells to pluripotency, especially by the induced pluripotent stem cell (ipsc) technology, has become widely used today to generate various types of stem cells for research and for regenerative medicine. however the mechanism(s) of reprogramming still need detailed elucidation, including the roles played by the leukemia inhibitory factor (lif) signaling pathway. lif is central in maintaining the ground state pluripotency of mouse embryonic stem cells (escs) and ipscs by activating the janus kinase-signal transducer and activator of transcription 3 (jak-stat3) pathway. characterizing and understanding this pathway holds the key to generate nave pluripotent human ipscs which will facilitate the development of patient-specific stem cell therapy. here we review the historical and recent developments on how lif signaling pathway regulates esc pluripotency maintenance and somatic cell reprogramming, with a focus on jak-stat3.

PMC3894236

pubmed-818

streptococcus pneumoniae is a leading respiratory pathogen that is responsible for infections such as pneumonia, meningitis, bacteremia and otitis media. in 2003, the world health organization (who) estimated that pneumococcal disease is responsible for 1 million deaths annually, most of which occur in children<5 years of age in the developing world. although pneumococcal meningitis is relatively rare, it is strongly associated with mortality or subsequent neurologic damage. pneumococcal resistance to penicillin was first described in 1967, and since the 1990s an increasing rate of resistance has been reported worldwide. this resistance makes the treatment of serious pneumococcal infections difficult, and many antibiotic treatment failures have been reported. in algeria, several reports have shown an increase in antibiotic resistance from 1996 to 2010, especially among children [69]. although epidemiologic surveillance data for invasive pneumococcal infections are available, clinical data are lacking. moreover, since the introduction of haemophilus influenzae type b vaccination in 2008 in algeria, s. pneumoniae has become the predominant pathogen in bacterial meningitis (unpublished data). the s. pneumoniae polysaccharide capsule is a major virulence factor; more than 90 serotypes have been identified, and their distribution differs in different regions and between developing and developed countries. the aim of the study was to investigate the evolution of antibiotic resistance and serotype distribution of s. pneumoniae in infections in children in algeria. from january 2005 to june 2012, a total of 270 unique s. pneumoniae isolates were collected from children aged 0 to 16 years with invasive and noninvasive infections; about 89% were from algiers and 11% from oran, a town located in the western part of the country. every year, the centers isolate between 15 and 50 s. pneumoniae strains from children who are diagnosed by physicians with invasive pneumococcal disease (ipd) and non-ipd (nipd). s. pneumoniae isolates were identified by colony morphology, gram staining, catalase reaction, optochin susceptibility and bile lysis. antibiotic susceptibilities for oxacillin, erythromycin, clindamycin, tetracyclin, chloramphenicol and cotrimoxazole were determined following the clinical and laboratory standards institute (clsi) recommendations. minimum inhibitory concentrations (mics) for penicillin, amoxicillin and cefotaxim were determined using the e-test following the manufacturer's instructions (solna, sweden) for all strains. serotyping was performed by latex agglutination for determining pools, and serotypes were identified using the neufeld test (pneumo test latex; statens serum institute, copenhagen, denmark). a total of 127 isolates were serotyped, 85 from invasive samples and 42 from noninvasive samples. the isolates that were serotyped were selected on the basis of the clinical data, with priority given to ipd and the number of viable isolates. from the 270 isolates collected (ipd n=97, nipd n=173), 197 (73.0%) were from children<5 years, of whom 151 (76.7%) were<2 years. among the isolates from children with ipd, 78.4% were collected from children<5 years of age, of whom 76.3% were<2 years old. the ipd isolates were collected from children with meningitis (n=53), pneumonia and pleuropneumonia (n=25), bacteremia (n=11), arthritis or peritonitis infections (n=8). the non-ipd isolates were from ear, nose and throat infections (n=91), bronchopulmonary infections (n=77) and other suppurative infections (n=5). among the isolates from children with nipd, 69.9% were from children<5 years of age; 53.8% were<2 years old (table 1). nonsusceptibility to penicillin was detected in 48% of the s. pneumoniae isolates (mics ranged from 0.016 g/ml to 4 g/ml); 2.6% of isolates had intermediate resistance to amoxicillin; 7% and 1.7% of isolates had intermediate and full resistance to cefotaxime, respectively. for the ipd isolates, the mic90s were 2 g/ml for penicillin and amoxicillin and 1.5 g/ml for cefotaxime. the highest rate of cefotaxim resistance was observed in isolates from meningitis: 20.8% intermediate and 3.8% resistant (table 2). the percentages of isolates that were resistant to non--lactam antibiotics were 53.0% for erythromycin and cotrimoxazole; 43.7% for clindamycin; 42.0% for tetracycline; and 5.3% for chloramphenicol. according to the new breakpoints suggested by clsi, whereby meningitis and nonmeningitis isolates have different breakpoints, 49.0% of the meningitis isolates were resistant to penicillin (mic 0.12 g/ml), among which 26.9% had a mic of 2 g/ml. after meningitis isolates, the next highest rate of penicillin-nonsusceptible s. pneumoniae (pnsp) was observed in the isolates from nipd. from all the invasive isolates (n=97), 40.3% were pnsp, with 81.5% of these from children<5 years and 72.7% from children<2 years. among the 85 ipd samples that were serotyped, meningitis was the most common diagnosis, at 50 (58.8%), followed by pneumonia and pleuropneumonia, at 21 (24.7%), and bacteremia, at 9 (10.6%) (table 3). the prevalence of ipd in children aged<5 years and<2 years was 78.3% (n=76) and 59.8% (n=58), respectively (table 1). the most frequent serotypes for invasive isolates were 14 (29.4%), 1 (10.6%), 19f (10.6%), 19a (7%), 6b (7%), 5 (4.7%), 3 (4.7%), 6a (3.5%) and 23f (3.5%). serotype 14 was the most prevalent in meningitis (34%) and pleuropneumonia (28.6%), while serotypes 19f (38%) and 14 (23.8%) were the most frequent in noninvasive samples (table 3, fig. serotypes 14, 19f, 6b, 19a, 1, 5, 23f, 6a, 3, 7f and 18c accounted for 91.0% of ipd in children<5 years old. serotypes 5, 7f, 6b, 18c and 19a were found exclusively in children<2 years of age. the serotypes that were most often antibiotic resistant were 14, 19f, 19a and 6b; they were mainly highly resistant to penicillin, and only serotypes 14 and 19a were resistance to cefotaxime (fig. 2, the prevalence of penicillin resistance among pneumococcal disease isolates in algeria, which was measured by the oxacillin disc diffusion method, appears to have increased over the years, from 34.6% in 19952000 to 48.1% in 20052012 (current study) [69]. the percentage of pnsp among ipd isolates in children was reported to be approximately 11% in western european countries, with the highest percentage (49%) in spain. our results are more consistent with the increasing antibiotic resistance rates reported for north african countries. for instance, in tunisia and morocco, the rates of pnsp were, respectively, 52.8% and 43.3% [69,1315]. the dramatic increase in the antibiotic resistance rate since our previous study (pnsp of 48.1% in this study compared with 34.6% in 2001) could be explained by overuse of antibiotics for acute respiratory tract infections in algeria. although the distribution is similar to that reported for morocco and tunisia, as well as other developing countries, it differs from that reported in our previous study, where we found that serotypes/serogroups 1, 5, 14 and 6 were the most frequent. some pneumococcal serotypes, such as serotypes 1, 5 and 7f, have more invasive potential than others; serotype 7f has been reported to be associated with a higher risk of severe and fatal outcomes. in africa, serotypes 1 and 5 are commonly associated with invasive diseases. in algeria, the frequency of serotype 1 was low during the 20022004 and 20052007 periods but increased in 20082009 (unpublished data). similar observations of cyclical peaks in serotype 1 incidence have been reported in many countries. although serotypes 1 and 5 are designated as developing country serotypes, they have also been reported to be frequently responsible for pediatric ipd in industrialized countries such as germany, sweden and england. serotype 1 has remained one of the most prevalent invasive serotypes and is usually associated with meningitis outbreaks in africa and in crowded communities. it is ranked as one of the four serotypes with the highest ipd burden in africa, asia and latin american, while serotype 5 is ranked third in africa and latin america and fourth in asia. in thailand, the seven most frequent serotypes associated with ipd in patients<5 years old were 6b, 23f, 14, 19f, 19a, 6a, and 4 or 9v. two studies in oxford and stockholm that characterized the genotypes and serotypes of nasopharyngeal and invasive pneumococcal isolates from children and adults identified serotypes 1, 4 and 7f as having a high level of invasiveness, and serotypes 3 and 7f as having a higher case fatality rate compared with other serotypes. the predominant serotypes of pnsp in our study are similar to those reported in other studies and previous studies in algeria, with the emergence of serotype 19a in the absence of routine pneumococcal vaccination in our country. the most commonly multidrug-resistant serotypes among the pnsp were 19a, 19f, 14 and 6b, which were resistant to erythromycin, cotrimoxazole, clindamycin and tetracycline. serotype 14 is one of the most invasive serotypes that can cause life-threatening ipds. moreover, it can harbour multiple resistance determinants, conferring resistance to penicillin, erythromycin and cefotaxime. in many countries the multidrug-resistant serotype 19a has become the most predominant nonvaccine serotype isolated after pcv7 vaccination. on the basis of the serotype distribution observed in our study, the pcv7 coverage in children<5 years of age with ipd in algeria is 55.3%, the pcv10 coverage is 71.1% and the pcv13 coverage is 86.8%. this vaccine coverage among children<2 years is 51.7% for pcv7, 69% for pcv10 and 87.9% for pcv13. these data may not reflect the situation in all cases of ipd in the studied regions because many children with ipd are treated empirically. in addition, the limitations of existing diagnostic tests affect the ability to obtain accurate ipd burden data: only 10% of blood culture results are positive, so most patients with pneumonia are not bacteriemic. in algeria, the lack of laboratory facilities, including no facilities for storing samples frozen at 80c in different regions of the country, is another limiting factor for conducting a multicenter study in order to obtain accurate ipd burden data. despite limited financial resources dedicated to ipd surveillance in algeria, we have conducted a nasopharyngeal carriage in healthy children and the most prevalent serogroups were 6, 14 and 19 (23rd european congress of clinical microbiology and infectious diseases, abstract r2717). the pneumococcal conjugate vaccines (pcvs) currently available have been shown to protect children. the first licensed 7-valent vaccine, which was widely used, resulted in dramatic reductions in pneumococcal disease mortality and morbidity. the emergence of the multidrug-resistant serotype 19a and the absence of the so-called developing country serotypes, 1 and 5, has led manufacturers to develop higher valency pcvs, such as pcv9, pcv10, pcv11 and pcv13. the who recommends the inclusion of pcvs in childhood immunization programs worldwide, especially in countries with childhood mortality that exceeds 50 deaths per 1000 births. although there are some limitations with our study, the results show that the burden of ipd is high in our country. the good vaccine serotype coverage suggests that the introduction of childhood vaccination with pcvs could be expected to have a dramatic effect on the burden of ipd in our country. continuous national monitoring of ipd and nasopharyngeal carriage as well as judicious use of antibiotics are crucial before and after pcv implementation in order to evaluate the effect of vaccination and to prevent the selection of multidrug-resistant clones.

pneumococcal infections are a major cause of morbidity and mortality in developing countries. the introduction of pneumococcal conjugate vaccines (pcvs) has dramatically reduced the incidence of pneumococcal diseases. pcvs are not currently being used in algeria. we conducted a prospective study from 2005 to 2012 in algeria to determine antimicrobial drug resistance and serotype distribution of streptococcus pneumoniae from children with pneumococcal disease. among 270 isolated strains from children, 97 (36%) were invasive disease; of these, 48% were not susceptible to penicillin and 53% not susceptible to erythromycin. a high rate of antimicrobial nonsusceptibility was observed in strains isolated from children with meningitis. the serotype distribution from pneumococci isolated from children with invasive infections was (by order of prevalence): 14, 1, 19f, 19a, 6b, 5, 3, 6a and 23f. multidrug resistance was observed in serotypes 14, 19f, 19a and 6b. the vaccine coverage of serotypes isolated from children aged<5 years was 55.3% for pcv7, 71.1% for pcv10 and 86.8% for pcv13. our results highlight the burden of pneumococcal disease in algeria and the increasing s. pneumoniae antibiotic resistance. the current pneumococcal vaccines cover a high percentage of the circulating strains. therefore, vaccination would reduce the incidence of pneumococcal disease in algeria.

PMC4475694

pubmed-819

tumors of the clivus are very rare; chordomas are the most common type of tumors in this region, representing only 0.1-0.2% of all intracranial tumors9). common sources of bone metastases are breast, prostate, kidney, and thyroid tumors. kistler and pribram8) reported 11 cases with metastatic disease in the sella turcica originating from prostate, breast, lung, thyroid, or lymphosarcoma malignancies. metastasis from gastric adenocarcinoma is extremely rare and could be explained by a rapid progression of the gastric adenocarcinoma. with regard to sites of intracranial metastasis, a literature review revealed only two case reports5,6) of clival metastasis from stomach cancer. to the best of our knowledge, this is the second published english case report of skull base metastasis originating from a gastric adenocarcinoma. in this study, we report the case of a 42-year-old female patient with an adenocarcinoma of the stomach that metastasized to the clivus. a 42-year-old female patient was admitted to our hospital with 1-month history of headaches, nausea, and vomiting. in the previous month, she had lost 2 kg of weight. laboratory examination detected abnormally elevated levels of the alpha feto-protein (1665 ng/ml), carcinoembryonic antigen (1493 ng/ml), and carbohydrate antigen 19-9 (695 u/ml). a computed tomography (ct) scan of the brain showed a bulging bony mass, which had destroyed the clivus and affected the sphenoid and cavernous sinuses (fig. 1). magnetic resonance imaging (mri) scan showed an abnormal mass in the upper portion of the clivus, extending to the cavernous sinus and invasion into both carotid arteries. the mass showed cystic change and heterogeneous patterns of enhancement after intravenous injection of gadolinium (fig. a mass (approximate diameter, 2.7 1.62.0 cm) was detected in the sellar region. the mass involved the sphenoid sinus, cavernous sinus, both internal carotid arteries, and the optic chiasm, but had destroyed the clivus and sphenoid corpus. an abdominal ct scan suggested gastric cancer with liver and multiple lymph node (ln) metastases. a fiber endoscopic study of the stomach confirmed advanced cancer with poor differentiation at the cardia (fig. lumbar puncture yielded a watery-clear fluid but the cerebrospinal pressure was not increased and subsequent cytological examination of the fluid revealed no malignant cells. a chest ct scan showed left supraclavicular lymphadenopathy, indicative of metastasis. for diagnostic purposes, histopathological findings of this biopsy were similar to those obtained from the tumor of the stomach (fig. the immunohistochemical analysis of the stomach specimen revealed negative results for mucin 5ac, mucin 6, and mucin 2 on a mucin stain and a positive result for the cd10 protein, which was similar to the results obtained for intestinal-type adenocarcinoma and for clivus metastasis. after three cycles of chemotherapy [folfox: folinic acid (leucovorin), fluorouracil (5-fu), and oxaliplatin (eloxatin)], the patient's condition deteriorated rapidly; liver and ln metastasis progressed, and she developed tumor thrombosis at the splenoportal and superior mesenteric veins and cancer peritonei. the clivus is a single midline structure of bone comprising a part of the skull base and is formed from the sphenoid rostrally and the occiput caudally. both benign or malignant primary tumors as well as secondary metastatic tumors may occur at the clivus. some lesions that specifically involve the clivus are chordomas, chondrosarcomas, or lymphomas3,11). a chordoma is a rare, slow-growing tumor that originates from remnants of the primitive notochord along the craniospinal axis, particularly at either end. cranial chordomas constitute less than 1% of all intracranial neoplasms, and patients can present with headaches and diplopia11). metastasis to the clivus is very rare, and only few cases have previously been reported4). hematogenesis is the most common route of metastasis, and most clival metastatic lesions arise from prostate, thyroid, or breast cancers13). this is in contrast to chordomas, where surgical decompression commonly results in improvements in eye movement1). ct evaluation is required to assess the degree of bone involvement or destruction and to detect patterns of calcifications within the lesion. mri scans provide excellent 3-dimensional analysis of the posterior fossa, especially the brainstem, sella turcica, cavernous sinuses, and middle cranial fossa. ct is better than mri to observe calcifications and the precise involvement of skull base osteolysis, especially those at the skull base foramina2). three-dimensional gradient-echo t1-weighted sequences are helpful because they allow the tumor to be visible in 3 planes within a short time and allow a good signal analysis of the tumor2). skull base chordomas are well delineated at the outset because they displace adjacent structures; however, more advanced tumors become invasive and have a pseudomalignant appearance with bone erosion and soft tissue invasion, mimicking malignant clival tumors including metastasis2). one feature that may help distinguish metastases from chordoma-like tumors is hypo-intensity on t2-weighted mri images; this would be possible because of the higher cellular density and lower cytoplasm to nuclear ratio in metastases12). most chordomas exhibit a high-intensity signal on t2-weighted images, which is nonspecific. fluid and gelatinous mucoid substances associated with recent and old hemorrhage and necrotic areas are found within the tumor; in some patients, calcification and sequestered bone fragments are found as well. the variety of these components may explain the signal heterogeneity observed on an mri scan. incomplete delineation of the tumor and microscopic distal extension of tumor cells may explain the frequency of recurrences2). on imaging, other primary tumors of the clivus show findings similar to those of metastases of the skull. lymphoma and plasmacytoma of the clivus, for example, may show a similar mri signal on t2-weighted images7). another useful diagnostic indication on an mri scan that may help distinguish chordomas from metastases is the heterogeneity with a honeycomb appearance shown by chordomas in lobulated areas, corresponding to low-intensity t1-signal areas within the tumor after contrast infusion. the pattern of contrast enhancement can be related to the pathologic features of the chordoma, which is organized in lobules with mucinous and gelatinous contents2). in patients without a history of cancer, metastasis to the clivus occurring as the first indication of a primary neoplasm is difficult to identify. in addition, delayed clivus metastases are difficult to detect13). pallini et al.12) reported metastasis to the clivus from a cutaneous melanoma 8 years after the primary tumor was detected, and altman et al.1) described a single metastasis to the clivus that presented 12 years after treatment of a follicular thyroid carcinoma. our patient showed symptoms of cranial nerve palsy as the first sign of metastasis, prior to the diagnosis of the primary stomach malignancy. the overall prognosis of patients with clival metastases is very poor, with a median overall survival of about 2.5 years. cranial nerve palsies are associated with a poorer prognosis, with an average survival of only 5 months10). clival metastasis of gastric adenocarcinoma is extremely rare, but should be considered in the differential diagnosis of bony lesions of the clivus.

tumors of the clivus and metastases to the clivus are very rare. metastasis involving the clivus has previously been described in only two case reports. in skull metastasis, the breast and prostate are the most common primary foci, while metastasis from gastric carcinoma is extremely rare. a review of the english literature revealed only one published case of clivus metastases from gastric adenocarcinoma. there is no literature thoroughly explaining the differential diagnosis between chordoma and metastasis. here we report a rare case of metastasis to the clivus from a gastric adenocarcinoma in a 42-year-old female patient with sudden blurry vision, presenting as bilateral cranial nerve vi palsy.

PMC4373051

pubmed-820

hiv-infected patients, especially on a long duration of antiretroviral therapy (art), are now facing newer challenges in terms of developing pathological aberrations of fat metabolism and redistribution. the two terms, hiv-associated adipose redistribution syndrome (hars) and hiv-associated lipodystrophy syndrome (hals), possibly have the same connotation to describe an acquired (? lipodystrophy (changes in fat distribution) is a clinical diagnosis and mostly subjective as standardized diagnostic criteria have not yet been defined. that is why, the exact prevalence rate of hals has not been precisely quantified since it was first reported 13 years ago. hiv-associated lipodystrophy involves fat redistribution (lipodystrophy), fat loss from the face, buttocks, and extremities (lipoatrophy), and mixed fat disturbances (lipodystrophy and lipoatrophy). they often have insulin resistance, type 2 diabetes, and elevated plasma lipid concentrations. the combination of hyperlipidemia, insulin resistance, and visceral fat accumulation resembles the cluster of abnormalities described in the metabolic syndrome associated with increased cardiovascular risk. skeletal muscle leptin resistance can potentially contribute to muscular fatty acid accumulation in common human obesity, simulating the muscle steatosis found in lipodystrophy patients. anabolic steroids, growth hormone (gh), growth hormone releasing hormone (ghrh), recombinant human leptin, and adiponectin (synthetic form unavailable) are the candidates for hormone therapy. for the last 15 years, much has been known about leptin biology. however, it is only recently that the leptin hypothalamic axis has newly been explored which regulates insulin and glucose metabolism independent of its effect on adiposity. this article affords a comprehensive review of leptin therapy, a new strategy now in clinical trials, and its beneficial role in hiv patients in correction of metabolic complications related to hals. 7, originally identified in 1995 through positional cloning of ob/ob mice, a mouse model of obesity discovered serendipitously at jackson laboratories where these mice were found having complete leptin deficiency causing hyperphagia, severe obesity, diabetes, infertility, and other neuroendocrine abnormalities.[47] this discovery led to further research works that revealed important role of leptin in energy homeostasis, weight regulation, immunity, and neuroendocrine function. leptin is secreted in a pulsatile fashion by white adipose tissue and is also found in circulation and cerebrospinal fluid. its circulatory levels positively correlate with the amount of body fat and have significant diurnal variation, with higher levels in the evening and early morning hours. leptin mediates its effects by binding to specific leptin receptors (obrs) expressed in brain and peripheral tissues. the obra isoform (short leptin receptor isoform) is found to have an important role in leptin transport across the blood brain barrier, while the obrb isoform (long leptin receptor isoform), also known as lepr-l or leprb, is thought to mediate signal transduction with its strong expression in hypothalamus. leptin in brain (both in parenchyma and cerebrovascular fluid) is derived from peripheral circulation and local synthesis. short isoform of leptin receptors on vascular endothelium and epithelium of choroid plexus transports leptin across the blood brain barrier. it has been seen that both hypo- and hyperleptinemia are associated with reduced leptin entry into the brain. the discovery of leptin has advanced our understanding of metabolic diseases. its identification has revealed a new neuroendocrine system regulating body weight. complete leptin deficiency from mutations in leptin gene, as found in some rare genetic conditions, presents with infantile morbid obesity and associated endocrinal dysfunction including insulin resistance and hypogonadotropic hypogonadism. severe lipodystrophy, both genetic and acquired (as in hals), is another hypoleptinemic state characterized by adipose tissue loss, hypertriglyceridemia, severe insulin resistance, and even overt diabetes mellitus. recombinant human leptin replacement therapy at physiologic replacement dose in both the situations described above has improved hormonal abnormalities, glycemic control, and dyslipidemia.[1214] in the management of hiv lipodystrophy and metabolic syndrome, recombinant human leptin (metreleptin) has recently been extensively studied in the context of many open-label, clinical trials. since no approved effective treatment exists for alleviating the major health problems associated with hals, leptin therapy, in this context, stands out to be essentially promising which will be reviewed next. though most of the therapeutic trials with leptin started focusing primarily on obesity, the majority of obese subjects were proved to be leptin resistant with high serum leptin levels, which establishes that obesity is the result of hormone resistance. leptin treatment resulted in weight loss only in a subset of obese patients, and was therefore not found to be of much help in treating obesity in general. again, there is substantial variability of leptin levels at a given body mass index or percent fat and approximately 10-15% of obese subjects have endogenous levels of leptin that are indistinguishable from lean patients. leptin insufficiency syndrome, a concept promulgated a few years ago based mainly on strong experimental support has replaced leptin resistance as causal in the etiology of diabetes and obesity. the leptin insufficiency syndrome manifests due to hypoleptinemia and/or decreased leptin delivery to the hypothalamus by transport restrictions across blood brain interphase and increased binding of leptin to c-reactive protein (crp) in peripheral circulation are the two important endogenous defense mechanisms that operate simultaneously in hyperleptinemic state to restrict leptin supply to the hypothalamus. hypothalamic axis has a crucial role in regulating pancreatic insulin secretion and glucose metabolism independent of its effect on adiposity. newer experiments revealed multiple novel mechanisms whereby central leptin insufficiency and peripheral hyperleptinemia concomitantly participate in the causation of metabolic syndrome. acute inhibition of insulin secretion by central administration of leptin has recently been reported. enhanced leptin signaling in selected hypothalamic sites such as the medial preoptic area (mpoa), paraventriculare hypothalamus (pvn), ventromedial hypothalamus (vmh), or arcuate nucleus (arc) experimentally corrects hyperinsulinemia and averts the development of insulin resistance. several tract tracing studies including those with microinjection of leptin transgene in hypothalamic sites imply that hypothalamus sends efferent insulin inhibiting signals to pancreas by hypothalamic neuropeptide y npy-ergic system bypassing the dorsal vagal neurons. recent studies also detected insulin-independent role of leptin in hypothalamic glucose regulation possibly by accelerating glucose metabolism in brown adipose tissue, liver, skeletal muscles, and fat cells. various attempts to increase leptin delivery to hypothalamus and extrahypothalamic sites with daily injection or continuous infusion, both systemically and centrally (intracerebro-ventricular or intrathecal), in pharmacological doses over short periods have been quite satisfactory in animal models. this one-time neurotherapy with its durable antidiabetic efficacy offers a potential substitution for insulin therapy in metabolic syndrome in near future. it is evident that only hypoleptinemic hiv-infected patients are the actual beneficiaries and are selected for recombinant leptin treatment trials to combat metabolic syndrome. as serum leptin level varies in general population depending on age, sex, feeding status, body habitus, and circadian cycle, hypoleptinemia is usually considered when serum leptin level is <3 ng/ml in men and<4 ng/ml in women. fasting leptin levels have been shown to correlate with total body fat concentrations in hiv-infected patients. nagy et al. found that leptin levels were lowest in hiv patients exhibiting lipoatrophy, intermediate in those with mixed lipodystrophy or normal body habitus, and highest in those with lipohypertrophy. these findings suggest a reduction in leptin synthesis in those having lipoatrophy with reduced subcutaneous adipose tissue and excess circulating levels of leptin might be due to leptin resistance in those with visceral adipose tissue hypertrophy. this leptin-resistant state might also be related to metabolic syndrome and insulin resistance seen in hiv patients with lipohypertrophy. untreated hiv infection is a progressive cellular immunodeficiency state with anorexia, weight loss, malnutrition, and opportunistic infections. though leptin was shown to induce anorexia and augment t helper cell (th1) population, most of the patients with hiv-associated wasting were found to have decreased serum leptin levels and that low value was proportional to the degree of fat loss. leptin levels in hiv patients have also been studied in the absence of antiretrovirals and irrespective of wasting. in symptomatic aids patients, leptin levels are shown to be depressed irrespective of wasting, possibly due to downregulation of leptin secretion by persistent inflammation, especially in the presence of secondary infections. a study on art-nave hiv-infected nigerians in 2008 has shown that serum leptin levels were significantly lower in wasted hiv-infected patients compared to normal weight hiv patients from nigeria, and leptin levels were depressed during symptomatic hiv/aids independent of the effect of body mass index (bmi). grunfeld and coworkers also reported a similar bmi-independent suppression of serum leptin levels by secondary infection in aids patients, contrary to the known fact that circulatory leptin level increases during sepsis and inflammation in response to bacterial endotoxins and cytokines [tumor necrosis factor-alpha (tnf-)]. exhaustion of leptin production by chronic tubercular inflammation was suggested by van crevel and colleagues as the cause of hypoleptinemia in hiv-negative tuberculosis patients irrespective of the effect of bmi. these researchers also reported insignificant difference in leptin levels between asymptomatic aids patients without wasting and normal hiv-negative individuals of similar bmi. leptin levels have been shown to be higher in general female population than males for any given measure of adipose mass. leptin levels also rise more rapidly in women than men with increase in proportion of body fat. in contrast, the nigerian study revealed lower level of leptin among female hiv patients as compared to male patients. reversal of this sex difference may contribute to more wasting in female aids patients as most of the hiv wasted patients were females. most studies in humans and animal models also found a positive correlation between the number of cd4 t cells and leptin levels in healthy controls, but this correlation was blunted in hiv patients. the morphologic and metabolic changes associated with art have led to the development of hals characterized by peripheral lipoatrophy (fat loss in face, arms, legs, buttocks), localized fat accumulation, hyperlipidemia, insulin resistance, and hyperglycemia. hepatic steatosis may also occur, but acanthosis nigricans seems extremely rare in contrast to congenital lipodystrophy. the prevalence of hals in patients taking art has been reported to be up to 80% with increased cardiovascular risks. hals is thought to be multifactorial with complex interactions of drugs, viral and host-related factors. although art with protease inhibitors (pis) and nucleoside reverse transcriptase inhibitors (nrtis) are said to be the most compelling risk factors, gender, altered adipose gene expression, altered adipokines, mitochondrial toxicity, hiv- 1 associated protein, and genetic polymorphism are some of the important pathophysiologic mechanisms underlying its development.[3236] cross-sectional studies have shown low levels of leptin and adiponectin in hals, which are closely and inversely correlated with dyslipidemia and insulin resistance. animal experiments also demonstrated that combined administration of both leptin and adiponectin fully normalized insulin sensitivity in hypoleptinemic and hypoadiponectinemic lipoatrophic mice. walker and brinkman have shown a relation between peripheral lipoatrophy and mitochondrial toxicity in hiv patients. mitochondrial toxicity occurs due to inhibition of mitochondrial dna polymerase- by several antiretrovirals with variable affinity for the enzyme. in vitro studies using hepg2 human hepatoma cells showed the worst effects with zalcitabine, didanosine, and stavudine in reducing order causing marked hyperlactatemia and multiorgan toxicities involving liver, pancreas, peripheral nerves, and skeletal muscles.[4143] altered levels of adipokines and proinflammatory cytokines (as demonstrated in in vitro murine and human adipocyte cell lines and in vivo studies with nrtis and pis) may be responsible for insulin resistance seen in lipodystrophy. pis have been found to cause reduction in lipid accumulation in adipocytes, increase in adipocyte apoptosis, inhibition of insulin-stimulated glucose uptake [inhibiting glucose transporter type 4 (glut4)], induction of interleukin (il)-6, tnf-, reduction in gene expression, and secretion of adiponectin, all thereby inducing insulin resistance. lipoatrophic fat from hals patients demonstrated reduced adipogenic transcription factors like sterol regulatory element-binding protein 1c (srebp-1c), caat enhancer binding protein- (c/ebp-), and peroxisome proliferator activated receptor- (ppar-) all involved in adipocyte differentiation along with reduced mrna expression of adiponectin and leptin. some studies have shown similar changes in hiv patients who were not being treated with art, suggesting that hiv may have a direct role in the mechanism of lipodystrophy. pis have also been found to inhibit proteasome chemotryptic activity, leading to endoplasmic reticulum stress response to misfolded proteins. several small open-label clinical trials have demonstrated that patients with severe leptin deficiency from congenital and non hiv-related acquired generalized lipodystrophy could be benefited by the physiological replacement doses of leptin (0.040.08 mg/kg s.c. daily) in terms of improvements in insulin sensitivity, glucose tolerance, levels of fasting glucose, and hba1c, hypertriglyceridemia, transaminitis, and changes in body composition (weight loss with decreased adipose tissue and lean mass), and thus the need for insulin or oral hypoglycemic agents could be lessened with the help of leptin.[5052] similarly, trial-based recombinant human leptin therapy has been tried in hypoleptinemic patients with hiv-associated lipodystrophy, and leptin was well tolerated with marked improvement in fasting insulin levels, insulin resistance, high density lipoprotein (hdl) cholesterol, and truncal obesity. furthermore, the improvements in insulin resistance reported in patients with hals treated with metreleptin provide an advantage over gh replacement therapy as gh treatment is associated with glucose intolerance. but only those patients who have an absolute leptin deficiency (usually <3 ng/ml in men and<4 ng/ml in women) would enjoy the dramatic treatment benefit with leptin. riddle et al. in the in vitro animal (ritonavir-treated mice) study with leptin showed reversal of raised total cholesterol, reduction in ritonavir-induced interscapular fat, and improved hepatic steatosis. observed similar beneficial effect of recombinant human leptin therapy (0.04 mg/kg s.c. daily for 2 months) in 7 men with hals, low leptin, and hypertriglyceridemia. beneficial response was also reported by mulligan et al. with recombinant methionyl human leptin for 6 months (0.01 mg/kg s.c. leptin treatment was associated with around 32% decrease in visceral fat, improvement in insulin sensitivity, fasting insulin and glucose levels, and hdl cholesterol, and 1520% decrease in low density lipoprotein (ldl) cholesterol, with considerable decrease in triglyceride, whole body lipolysis, and free fatty acid levels. it has been proposed that leptin may improve insulin resistance through several mechanisms such as: (1) activating insulin signaling pathways including skeletal muscle phosphatidylinositol 3-kinase and amp-activated protein kinase (ampk); (2) preventing lipotoxicity: decreasing intrahepatic and intramyocellular fat by activating fatty acid oxidation in skeletal muscles; (3) decreasing caloric intake; and (4) decreasing body weight and fat mass. mulligan and khatami et al. also suggested that leptin can improve hepatic insulin sensitivity possibly irrespective of its effect on peripheral insulin sensitivity and independent of reduction in visceral adipose tissue. in spite of the above-mentioned small observation-based hypotheses, the precise mechanisms underlying leptin's beneficial role in hals is yet to be established. leptin as a monotherapy or an insulin-sparing agent in controlling metabolic components of hals is still a remote theoretical possibility. in spite of its successful placebo-controlled trials, leptin therapy has not yet been compared head-to-head with any of the many other available treatment modalities like metformin, thiazolidinediones (tzds) rosiglitazone, pioglitazone, gh, or synthetic ghrh (sermorelin, tesamorelin).[5658] it is also not known whether a combination of leptin with any of the above-mentioned drugs can work even better than a single agent. just like leptin, metformin and tzds (which also increase adiponectin level) improve insulin sensitivity, but gh or synthetic ghrh is diabetogenic. as individuals with hals tend to be gh deficient, gh replacement can be a promising treatment option in this patient population. as leptin acts independent of the gh and insulin-like growth factor-1 (igf-1) system, a combination therapy with leptin and gh or ghrh analogs could potentially have additive metabolic benefits without adversely affecting glucose intolerance. adiponectin, a 244 amino acid protein, is another endogenous insulin sensitizer that reduces gluconeogenesis primarily by stimulating adiponectin receptor 2 (adipor2) and activation of ampk phosphorylation. it also increases fatty acid oxidation in muscle via adipor1 whose stimulation in the hypothalamus might influence insulin and leptin signaling that promotes increased insulin sensitivity and reduced food intake. adiponectin levels are also low in patients with hals, and hypoadiponectinemia is associated with insulin resistance, hypertriglyceridemia, and adipose tissue redistribution in hiv-infected patients on antiretroviral medications. although leptin or adiponectin alone improves insulin resistance in mouse models of lipodystrophy, the combined administration of both hormones fully normalizes insulin sensitivity in animal models. adiponectin as well as its receptors adipor1 and adipor2 are attractive future targets for drug development in hals. recombinant human leptin, still an investigational product, is not yet available commercially in the market for the patients suffering from hiv-associated lipodystrophy and metabolic complications. the scope for its therapeutic utility is grossly suffering from lack of longer and larger well-furnished clinical trials from many countries worldwide. leptin levels in circulation of hiv patients under various other treatments are largely unknown, which has become a major limitation of leptin therapy. controversies and queries remain about the optimal dose, route of administration (peripheral vs. central leptin therapy), number of daily administrations, duration of therapy, need to follow-up the circulating leptin level, scope for combination therapy, possible adverse effects after long-term usage, and last but not the least, expected benefit in patients with relatively higher leptin levels. naturally, additional information are needed further for the basic clarity of this unclear practical scenario.

leptin therapy in human recombinant form has recently been used in hiv-associated lipodystrophy syndrome on experimental basis in some small short-term clinical trials. it has shown its beneficial effects only in hypoleptinemic hiv-infected patients by causing definite improvement in their insulin sensitivity, glucose tolerance, lipid status, and truncal obesity. leptin prevents lipotoxicity and activates insulin signaling pathways through several postulated mechanisms. central leptin insufficiency with peripheral hyperleptinemia has come out to be a significant contributor to the development of obesity and metabolic syndrome. in this article, we will review the basis of leptin therapy in hiv patients, with its promises. however, further larger clinical trials are needed to prove its long-term efficacy in the control of metabolic complications related to hiv therapy.

PMC3602994

pubmed-821

takotsubo cardiomyopathy is characterized by transient left ventricular (lv) regional wall motion abnormalities and usually involves apical segments in the absence of significant coronary artery stenosis. in the recent years, several cases on atypical forms of transient lv ballooning syndrome have been reported. the pathophysiological mechanisms remain unclear, however, the catecholamine excess and increased sympathetic activity are likely to play a pivotal role in triggering this syndrome.1-3) in this report, we describe an unusual case of a 38-year-old woman who had pulmonary embolism (pe) and reverse takotsubo cardiomyopathy. pe has been listed as stressors of stress-induced cardiomyopathy,2)3) because the pain and the decreased perfusion within the lung related to pe probably cause a release of catecholamines.4)5) however, it is uncommon to present reverse types of stress-induced cardiomyopathy in the setting of pe for our patient. a 38-year-old woman with no history of cardiac diseases or cardiac risk factors was referred to our emergency department because of chest discomforts, arrhythmia and shortness of breath after the surgery. a few days before she had fallen off the ladder and underwent surgery for right lateral malleolar fracture under spinal anesthesia. physical examination revealed vital signs as follows: blood pressure 90/60 mm hg, heart rate 75 beats/min, body temperature 36.7, respiratory rate 22/min and oxygen saturation 88% on room air. the electrocardiogram (ecg) recording showed sinus rhythm, st-segment depression in v3 through v5, and there were no typical features of ecg abnormalities associated with pe such as sinus tachycardia, s1q3t3 pattern, complete and incomplete rbbb, and t wave inversion (fig. chest radiography showed diffuse increased bronchovascular lung markings with mild congestion and edema, d-dimer was elevated to 1572 ng/ml (normal reference range 0-243 ng/ml) and altered results of the arterial blood gas analysis (ph 7.42/pco2 25.8 mm hg/po2 69.7 mm hg/hco3 16.4 mmol/l) aroused suspicion of pe. it was confirmed by computed tomography and thus, therapy with heparin infusion was initiated (fig. other laboratory findings indicated white blood cell counts of 10000/mm; hemoglobin 9.7 g/dl; platelet count 275000/mm; c-reactive protein 0.0 mg/dl; alanine aminotransferase 18 u/l; aspartate aminotransferase 39 u/l; total bilirubin 0.46 mg/dl; and serum creatinine 0.7 mg/dl. the cardiac enzyme levels were elevated with a peak level of creatine kinase-mb isoform 27 ng/ml (normal reference range 0-3.6 ng/ml) and troponin i 5.30 ng/ml (normal reference range 0-0.1 ng/ml). transthoracic echocardiography showed hypokinesia of mid/base segments of lv with hypercontraction of apical segments and reduced ejection fractions estimated at 47% with no significant valvular dysfunctions. right ventricular systolic dysfunction or dilated right ventricle was not found, and yet an estimated systolic pulmonary artery pressure increased mildly to 43 mm hg on the assumption of right arterial pressure of 10 mm hg (tricuspid regurgitation peak velocity: 2.87 m/s) (fig. coronary angiography was immediately performed within an hour of admission and ruled out obstructive atherosclerotic diseases. she was managed with medical therapy using -blocker and diuretics.2)3)6)7) angiotensin converting enzyme inhibitors was not indicated because of mild hypotensions. after the medical treatment, the patient was presented free of symptoms for the following few days. transthoracic echocardiography was undergone 1 week after her admission and showed improvements in ejection fractions of 58% with no wall motion abnormalities (fig. the patient was discharged in good clinical conditions and remained well after 3 months of follow-up. takotsubo cardiomyopathy, also known as apical ballooning syndrome, is generally characterized as severe, reversible lv dysfunctions of apical segments. variants, the non-apical ballooning syndrome, have been recognized as reversed, mid-ventricular, and localized type based on the involvement of the left ventricular.8) our case is consistent with the reverse type, hyperdynamic apex and akinesia of the mid/base segments of lv. compared to typical lv ballooning syndrome, this atypical form of transient lv ballooning syndromes have different characteristics of patients.6)8) hahn et al.6) described that patients with atypical transient lv ballooning syndrome were younger with the mean age of 36 and had fewer coronary risk factors such as hypertensions, diabetes, and smoking habits. also, t wave inversion in an ecg was found as less similar to our patient. however, according to the recent reviews and many published clinical cases, the excessive catecholamine and exaggerated sympathetic activities are greatly accountable.1-3)9-11) differences in anatomical location and density of cardiac adrenergic receptors and the degree of sympathetic activity may explain the wall motion abnormalities as seen in the typical and reverse types.8)11)12) clinical presentations and transient nature of lv wall motion abnormalities in reverse type are similar to those of classic takotsubo cardiomyopathy which could indicate a possibility of sharing pathophysiological mechanisms, and yet, none of related evidences has been revealed. estrogens, which have a protective effect on cathecholamine-induced toxicity, appear to have influences on the preponderances of postmenopausal women toward takotsubo cardiomyopathy.1)2)13) however, further researches for the interaction of catecholamines and estrogen are necessary to clarify the underlying mechanisms of stress-induced cardiomyopathy at a younger age without estrogen deficiency, and the specific reasons for rare presentations of men with physiologically estrogen-deficient. takotsubo cardiomyopathy has been described with a wide range of emotional or physical stressful triggers. herein, we report a middle-aged woman with inverted takotsubo cardiomyopathy in the setting of pe, which is a rare coexistence for this association. the exact mechanisms of the relation between pe and atypical takotsubo cardiomyopathy are not clear. but increased catecholamine levels during severe pain and perfusion defect within the lung related to pe seem to result in the development of lv wall motion abnormalities.4)5) in this case, it is difficult to detect pe and reverse takotsubo cardiomyopathy independently, due to the fact that both clinical features mimic acute coronary syndromes. despite of the poor sensitivity and specificity of ecg abnormalities to diagnose pe and inverse takotsubo cardiomyopathy, there are several frequent features including sinus tachycardia, both complete and incomplete rbbb, s1q3t3 pattern, and st-segment elevation, non specific t wave abnormalities, respectively.2)4-6) a transthoracic echocardiography (tte) provide the evidence of pe such as right ventricular systolic dysfunctions and pulmonary hypertensions,4)5) and stress-induced cardiomyopathy may have right ventricular involvement which is associated with more severe impairments in lv systolic functions.14) thus, it is important to carry out ecg promptly, tte and coronary angiography based on a high degree of clinical suspicions. further research is needed to elucidate this relationship and different pathophysiological mechanisms for various ventricular morphologies of stress-induced cardiomyopathy. diagnosing pe especially in a patient with characteristics of acute coronary syndrome such as stressinduced cardiomyopathy can be difficult. it needs to be highlighted that pe should be considered as a potential stressor once the reverse takotsubo syndrome is suspected.

as the use of early coronary angiography and echocardiography become widely available in the setting of acute coronary syndrome, the gradual increase for variant forms of transient left ventricular (lv) apical ballooning syndrome have been recognized. this syndrome usually occurs in women and is frequently elicited by an intense emotional, psychological, and physical event. while the patients ' characteristics between typical and non-typical lv ballooning syndrome seem to differ, the presentation, clinical features, and reversibility of lv wall motion abnormalities are similar. we present a middle-aged woman who experienced inverted takotsubo cardiomyopathy triggered by pulmonary embolism. to the best of our knowledge, this case is particularly unique and is rarely reported in the disease entity.

PMC3875701

pubmed-822

helicases are molecular motors that couple the energy of nucleoside triphosphate hydrolysis to the unwinding and remodeling of structured dna or rna [13]. the number of helicases expressed in higher organisms is strikingly high, with approximately 1% of the genes in many eukaryotic genomes apparently encoding rna or dna helicases. helicases are involved in virtually all aspects of nucleic acid metabolism, including replication, repair, recombination, transcription, chromosome segregation, and telomere maintenance [47]. based on their substrates, helicases can be classified as dna or rna helicases, although some can function on both dna and rna molecules. dna helicases have been reported to function in a variety of dna metabolic processes, including unwinding duplex or alternative dna structures (triplex, g-quadruplex), stripping protein bound to dna, and chromatin remodeling [5, 6, 9, 10]. traditionally, helicases are known to unwind double-stranded dna or rna in an atp-dependent manner. however, increasing evidence suggests that some helicases can rewind, or anneal, complementary strands of polynucleic acids in the presence or absence of nucleoside triphosphate (figure 1). moreover, two so-called human helicases that were identified recently appear to only have atp-dependent rewinding activity [1115]. these discoveries not only enrich the definition of helicases but also establish the presence of a new type of protein: annealing helicase. the mechanism of this novel strand annealing activity and its biological consequences remain largely unknown. in this paper, i will provide a brief overview of strand annealing activity found in various proteins across species and then focus on annealing helicases in humans and their potential mechanisms and functions. most knowledge regarding the strand annealing activity of proteins has come from studies of model systems, including bacteria, yeast, and xenopus laevis. the lehman lab reported the atp-dependent annealing activity of purified recombinant escherichia coli reca protein three decades ago. although similar results were obtained by several other labs [1719], the annealing activity of reca (the human rad51 homolog) is likely due to the binding of single-stranded dna (ssdna), which forms a nucleoprotein filament. the reca (rad51) searches for homology along double-stranded dna (dsdna) and forms a stretching of dna duplex. regulator protein stpa and recombination mediator protein reco have been reported to promote annealing of complementary single stranded rna (ssrna) and ssdna, respectively [20, 21]. the dna replication polymerase (dpo1) of sulfolobus solfataricus also possesses strand annealing activity. in yeast, the rothstein lab first found that rad52 protein binds ssdna and dsdna and promotes strand annealing. later, the kowalczykowski lab demonstrated that rad51 and replication protein a (rpa) regulate rad52 's annealing function [2426]. another yeast protein, rad59, also stimulates complementary ssdna annealing [27, 28]. xenopus rna-binding protein x1rbpa was reported to promote rna: rna annealing. for example, tat, one of six hiv regulatory proteins, encodes a small nuclear transcriptional activator and stimulates dna: dna annealing [30, 31]; dengue virus core protein also promotes rna: rna annealing. the wilson lab first reported that rat heterogeneous nuclear ribonucleoprotein (hnrnp) a1 has strand annealing activity on both dna and rna, and the activity is inhibited by phosphorylation of kinase pka or pkc. the annealing activity is restored by dephosphorylation of hnrnp by phosphatase 2a [34, 35]. mouse p53 protein inhibits the unwinding activity of t antigen helicase in vitro; human p53 protein was also later found to inhibit several other helicases ' unwinding activity due to its strong dna: dna and rna: rna annealing activity. the human rad51b, rad51c, rad51d, and xrcc2 protein complex catalyzes the strand-annealing reaction between a long linear ssdna (1.2 kb in length) and its complementary circular ssdna. in summary, at least a dozen proteins, particularly those involved in dna replication and repair, have been demonstrated to possess strand annealing activity. however, it is surprising to find that helicases, which unwind double stranded dna or rna, also possess strand annealing activity. the annealing activity was first reported in rna helicases (table 1). in 1997, the busch lab reported that human rh ii/gu rna helicase has rna folding activity forming an intramolecular duplex. in 2001, the stahl lab discovered that rna helicase p68 and its close relative p72 possess rna annealing activity for two complementary rna strands, and they also showed that ddx42p, another p68 homolog, has similar activity. rna helicase a, also known as nuclear dna helicase ii or dhx9, is a superfamily 2 (sf2) helicase that unwinds dna-dna, rna-rna, and dna-rna strands with a 3-5 polarity. recently, it was reported that rna helicase a promotes the annealing of trna3, the primer for reversing transcription, to hiv-1 rna. in addition to human rna helicases, some yeast and bacterial rna helicases also contain annealing ability. for example, the jankowsky lab demonstrated that ded1 from saccharomyces cerevisiae, in addition to its rna unwinding activity, facilitates the formation of rna duplexes. the lambowitz lab found that mss116p of s. cerevisiae promotes the annealing of the oligonucleotides in the absence of atp. crhr, a cyanobacterial rna helicase, was also found to promote duplex formation in the presence of atp. compared with rna helicase, more dna helicases have been found to possess annealing activity (table 1). the janscak lab is the first to report that both unwinding and annealing activity resided in a dna helicase, recq5 in 2004. the janscak lab not only discovered the novel activity of recq5, but also mapped the unique c-terminal portion (aa 411991) that possesses the dna strand-annealing activity. this was the first demonstration of a dna helicase with an intrinsic dna annealing function residing in a separate domain of the same polypeptide (figure 2). subsequently, many helicases, particularly recq family helicases, have been found to possess annealing activity. in humans, there are five recq homologs, and mutations in three of these genes (blm, wrn, and recq4) are associated with bloom's, werner, and rothmund-thomson syndromes, respectively. although no disease has been linked to mutations of recq5, recq5 mice are highly cancer prone and display genomic instability [60, 61]. a single nucleotide polymorphism in recq1 correlates with decreased survival of pancreatic cancer patients [62, 63]. annealing activity was reported for the bloom's syndrome helicase, blm, in 2005 by two independent groups [51, 53]. recently, the brill lab further identified a subdomain of the blm/sgs1 n-terminus that contains annealing activity in vitro. not only do human blm and yeast sgs1 display annealing activity, so does the drosophila blm homolog (mus309/dmblm) [51, 64, 65]. the wrn helicase was reported to contain strand pairing activity, and the annealing activity was mapped to the c-terminal region (aa 10721150). later, the vindigni lab reported that recq1 efficiently promotes strand annealing as a higher order oligomer (pentamer or hexamer), while smaller oligomeric states (dimer or monomer) act to unwind duplex dna. different quaternary states of recq1, modulated by binding of ssdna and atp, are associated with its strand annealing or unwinding activity (discussed later). unlike other recq helicases, neither endogenous recq4 purified from hela cell extracts nor recombinant recq4 purified from e. coli originally showed unwinding activity. the unwinding activity of recq4 appears to have been masked by its strong intrinsic dna annealing activity [54, 69]. because of its robust annealing activity, the presence of a third strand (e.g., same sequence as the labelled oligo but unlabelled) is required to demonstrate unwinding by recq4. furthermore, the n-terminus (aa 1492) is required for the annealing activity of recq4. although it was later reported that recq4 could displace short oligonucleotides (22 mer) without a third strand, the fact that longer oligonucleotides (30 mer) require a third strand [69, 70] indicates the strong annealing activity resides in the recq4 peptide. in addition to the recq helicase family, several other dna helicases possess strand annealing activity too (table 1). the pif1 helicase family is a group of 5 3 directed, atp-dependent, super-family ib helicase that is found in nearly all eukaryotes. the purified recombinant human pif1 proteins display robust annealing activity without atp, and this activity resides in the n-terminal region (aa 1180) of the protein (figure 2). dna2 is a helicase and nuclease involved in okazaki fragment processing, double-strand break (dsb) repair, telomere regulation, and mitochondrial function. point mutation analysis revealed that the annealing activity does not require either the nuclease or the helicase activity of dna2, indicating that the rewinding activity is uncoupled from nuclease and/or unwinding activity. mutations in csb gene cause cockayne syndrome, a rare inherited genetic disorder characterized by uv sensitivity, severe neurological abnormalities, and progeroid symptoms. the csb protein catalyzes strand annealing of complementary ssdna, while both atp and rpa inhibit its annealing activity. twinkle is a human mitochondrial dna helicase that is associated with heritable neuromuscular diseases, and it has ntp-independent annealing activity. the t4 phage uvsw helicase two archaea helicases (hjm/hel308a and hel112), and mycobacterium tuberculosis xpb also contain strand annealing activities. the term annealing helicase was created when two helicase domain-containing proteins were discovered to possess annealing activity and no unwinding activity. in 2008, the kadonaga lab discovered that harp is an atp-dependent annealing helicase. harp (hepa-related protein), also known as smarcal1 (swi/snf-related, matrix-associated, actin-dependent regulator of chromatin, subfamily a-like 1), is a member of the swi/snf family protein. mutations in harp are associated with schimke immuno-osseous dysplasia (siod), a multisystem autosomal recessive disorder characterized by short stature, kidney disease, and a weakened immune system. the majority of siod patients have t-cell deficiency and associated risk for opportunistic infection, a common cause of death. loss of harp affects cellular proliferation and differentiation, and the response to replication stress. following the kadonaga lab's report, three other labs found similar enzymatic activity for harp and further defined its biological functions [1113]. harp binds directly to rpa via a conserved n-terminal motif and anneals rpa-coated complementary ssdna. it was proposed that harp might dictate its role in the s-phase-specific dna damage response to protect stalled replication forks by minimizing the accumulation of ssdna regions and facilitating the repair of collapsed replication forks [1113, 80]. the chen lab further identified that two hp domains, each has about 60 residues, dictate the annealing activity of harp. more recently, the cortez lab reported that the first hp domain is not required for annealing activity, and, intriguingly, harp is able to catalyze branch migration of holliday junctions (hjs) and regression of replication forks. after discovering the unique activity of the harp protein, the kadonaga lab identified another annealing helicase that they named annealing helicase 2 (ah2). ah2 was previously named zranb3 (zinc-finger, ran-binding domain containing 3), a member of the snf2 family. similar to harp, the purified recombinant ah2 protein displays dna-dependent atpase activity and atp-dependent rewinding activity. however, unlike harp, ah2 lacks a conserved rpa-binding domain and does not interact with rpa. in addition, ah2 contains an hnh motif at its extreme c-terminus (figure 2), which is common in prokaryotes and is often associated with nuclease activity. contrary to expectations, the purified recombinant ah2 protein does not exhibit nuclease activity. with no disease linked to ah2 or genetic model generated for ah2, interestingly, the direction of both annealing helicases (harp and ah2) has not been examined in vitro. since classic dna-dependent atpases that are bonafide helicases that have the ability to catalytically separate complementary strands behave in a directional manner with respect to the strand that the helicase protein is presumed to be bound, depend on which we define 3-5 or 5-3 helicase, therefore, it would be of interest to know whether harp or ah2 translocate in a directionally specific manner. specific helicases need to function on the appropriate nucleic acid substrate at the appropriate time. in addition, these enzymes might be required to facilitate unwinding and/or rewinding under different circumstances. indeed, several bloom's syndrome missense mutant proteins lack unwinding activity, but still possess strand annealing activity that is even greater than wild type blm, indicating that the misregulation of unwinding and rewinding activity may be one of the pathogenic factors. a key emerging question is how these two opposite activities of helicase are precisely regulated. the number of helicase motifs varies from seven, nine, to twelve, which are responsible for nucleic acid binding, ntp hydrolyzing, and dna or rna unwinding [2, 87]. some helicases also contain accessory domain(s) at the n- or c-terminus, such as nuclease domain and various protein-protein interaction domains. as shown in figure 2, studies of human blm helicase and its orthologs including budding yeast sgs1 and drosophila blm revealed that its n-terminal region contains strand annealing activity. studies of the recq5 helicase revealed that the c-terminus is responsible for its annealing activity. furthermore, studies of recq4 protein revealed that some missense mutants lose unwinding activity but still possess strand annealing activity. these results suggest that the dna unwinding and strand annealing activities can be uncoupled, but the question remains whether there is a conserved domain that controls annealing activity. the cortez lab found that only the second hp domain is required for the annealing activity of harp (figure 2). alignment of the hp domain with ah2 reveals a putative hp-like domain in the ah2 protein (residues 712820). although hp domain-like amino acids are found in the ah2, it is unlikely that the hp domain is a universal element that governs annealing activity across helicases. for example, the n-terminal region (residue 156) of recq1 and the c-terminal region (aa 10721150) of the wrn helicase are required for their respective annealing activities. alignment of the annealing domains of these two recq helicases with the hp domains present in harp and the hp-like domain in ah2 reveals no significant conserved residue. although the n-terminal domain of recq4 and the c-terminal region of recq5 share certain identity and similarity, alignment of the n-terminus of recq4 and blm, and the c-terminus of recq5 does not result in any significant homology (data not shown). thus, it is unlikely that a single conserved domain is responsible for the annealing activity of these helicases. certain helicases may self-assemble to form dimers or higher order oligomers, and this can influence their catalytic activity or biological function [13]. human recq1 helicase efficiently promotes strand annealing as a higher order oligomer (tetramer) while smaller oligomeric states (dimer or monomer) acting to separate duplex dna [50, 88]. electron microscopy reconstructions of the higher order oligomeric form revealed that a cage-like structure forms a hollow channel, which may facilitate the annealing activity of recq1. both consistent and inconsistent with the findings of recq1, hel112, a homologue of human recq5 in sulfolobus solfataricus, exists as two predominant stable oligomeric states: monomer and dimer. only the monomeric form has 3-5 dna-helicase activity, while both the monomer and the dimer possess strand-annealing activity. these findings raise the possibility that higher order oligomers promote annealing activity and smaller order oligomers promote unwinding activity. nevertheless, additional studies are needed to address the relationship between the oligomerization and dual activities of helicases. for helicases that possess unwinding activity, it makes sense that atp fuels the unwinding activity, in turn, inhibits the annealing activity. indeed, this has been seen in dna helicases such as blm, pif1, as well as the e. coli cas3 helicase. it was also reported that, for the rna helicase ddx42p, atp triggers rna strand separation while adp triggers annealing of complementary rna strands. however, for helicases with no detectable unwinding activity, it is largely unknown how atp regulates their annealing activity. for example, how atp inhibits csb's annealing activity, while harp and ah2 require atp [14, 15]. rather than fueling the unwinding activity by hydrolyzing atp for example, the strand-annealing activity of recq5 is strongly inhibited by atps, a poorly hydrolyzable analog of atp. this effect is alleviated by mutations in the atp-binding motif of recq5, indicating that the atp-bound form of the protein can not promote strand annealing. atps also inhibits the annealing activity of blm, wrn, and crhr helicases. for recq1, atp binding induces a conformational change in the protein that serves as a molecular switch from a strand-annealing to a dna-unwinding mode. if atp indeed functions as a switch to regulate or balance the unwinding and rewinding activity of helicases, a promising avenue for future research will be to investigate the regulation mechanism, for example, structural determination of helicases with and without atp. rpa is a fundamental protein involved in all aspects of cellular metabolism (see review [90, 91]). in dna repair processes, rpa physically coats ssdna to protect it from degradation by nucleases and also serves as a scaffold protein to recruit other repair proteins (e.g., rad51) to strand break sites. at the same time, rpa promotes checkpoint signaling after replication fork stalling through activation of atratrip and rad17 complexes. rpa has been shown to stimulate the unwinding activity of many helicases in vitro, including wrn [92, 93], blm, recq1, and fancj. in turn, the strand annealing activity of recq1, pif1, and csb is inhibited by rpa. rpa depletion causes a dramatic reduction in the formation of the annealing products in xenopus egg extracts, suggesting that rpa is required for single-strand annealing. the annealing helicase harp associates with rpa, but whether it is just a physical interaction or if rpa modulates harp's annealing function remains unknown. for ah2, yet to be identified proteins may regulate its nuclease and/or annealing activity. in addition to rpa, several other proteins have been shown to promote annealing activity of helicases. the 65 kda subunit of u2af is reported to mediate the annealing of complementary single-stranded rna or single-stranded dna, which reverses the action of rna helicase a. the purified human p53 protein inhibits the unwinding activity of several dna helicases, such as t antigen dna helicase, dna helicases i and ii of e. coli, and rna helicases p68, by promoting the rapid renaturation of complementary strands. the endonuclease xpg is also reported to stimulate the annealing activity of the wrn helicase. catalytic activities of proteins can be modulated by posttranslational modifications, such as phosphorylation/dephosphorylation, acetylation, ubiquitination, and sumoylation. for example, endogenous recq1 is phosphorylated upon treatment of cells with ionizing radiation (ir), ultraviolet (uv), and hydroxyurea (hu); blm is phosphorylated by atm in response to ir [101, 102], atr in response to hu, and several other kinases ck1, cdc2, and mps1. wrn is phosphorylated by atm and atr in response to replication fork arrest [107, 108]. harp is phosphorylated by atm, atr, and dna-pk in response to the dna damage checkpoint [11, 81]. indeed, the strand annealing activity of csb is increased by dephosphorylation with phosphatase i and decreased by phosphorylation with ckii. thus, helicase function may in specific cases be regulated by post translational modification through modulation of its strand annealing activity. nevertheless, it remains largely unknown how annealing activity is modulated by these protein modifications. the biological function of so-called real helicases, which possess unwinding activity that includes recq family helicases [4, 6], pif1, and dna2, has been extensively reviewed. the physiological relevance of helicase annealing activity is revealed by the finding that several mutations observed in siod patients result in defective annealing activity in harp protein [14, 78, 111]. although a limited number of annealing helicases have been identified, several biological functions have been indicated by related experimental evidence. stalled replication forks can arise during normal chromosome replication or in the presence of dna lesions, but will collapse if being left unrepaired due to the presence of long stretches of ssdna. annealing helicases might stabilize stalled replication forks through pairing the parental ssdna, migrating chicken foot/holliday junctions structures, and/or directly participating in repair of the lesion (figures 3(a) and 3(b)). green fluorescent protein (gfp)-tagged harp is recruited to stalled replication forks. compared with ssdna and dsdna, fork dna is a preferred substrate for ah2 binding and atpase activity, indicating that the forked dna is a physical substrate for ah2. because harp and ah2 can act as an opposing force to unwinding activities in vivo, there are obvious potential implications for the role of harp and ah2 in dna replication and dna repair activities (discussed below). harp and ah2 might dictate their role in protecting stalled replication forks by minimizing the accumulation of ssdna regions and facilitating the repair of collapsed replication forks during dna replication. consistent with its function on ssdna, four research groups have found that harp associates with the rpa complex [1113, 81], which possibly anchors harp to the ssdna. cells depleted of harp accumulate ssdna and display increased sensitivity to aphidicolin and hu [12, 13]. dna fibre analyses show that restart of replication forks after 2 hours of aphidicolin treatment is reduced in harp-depleted cells [11, 81]. these data suggest that harp promotes fork stability and restart by reannealing long stretches of ssdna generated at stalled replication forks. indeed, very recently, the cortez lab demonstrated that in vitro harp can bind and branch-migrate three-way and four-way dna structures, and catalyze extensive fork regression of model replication forks. the recq family helicases have been well recognized to function in damaged replication forks. wrn- deficient cells are hypersensitive to replication blocking agents, including hu [107, 114] and dna-interstrand cross-linking drugs. blm-deficient cells are also hypersensitive to hu and mitomycin c (mmc). although less sensitive to hu as blm-deficient and wrn- deficient cells, recq4-deficient cells are sensitive to hu. recq1-depleted human cells are sensitive to hu and camptothecin (cpt). in addition, it has been reported that both blm and wrn are recruited to blocked replication forks in vivo and can catalyze fork regression in vitro [120, 121]. moreover, the orren lab recently demonstrated that wrn and blm reestablish functional replication forks to overcome fork blockage. all these evidence suggest that recq helicase, particularly blm and wrn, participate in remodeling of stalled replication forks. however, it remains unknown how these helicases exert their annealing activity to contribute to replication fork restart. in addition to the recq helicases, human pif1 helicase specifically recognizes and unwinds dna structures resembling putative stalled replication forks. using yeast ribosomal dna as a dna replication model, it has been shown that the events of replication fork block are increased in dna2 mutants. in particular, dna2 is involved in okazaki fragment processing, and it will be of interest to determine if its annealing activity stabilizes the lagging strand. unlike harp and ah2, it would seem most likely that proteins with both unwinding and annealing activities might coordinate those activities to catalyze strand exchange and/or branch migration, such as generating and migrating a holliday junction or chicken foot structure for stalled dna replication forks (figure 3(a)). the function of the recq helicase family in dna repair processes is well recognized. the csb protein is known to function in transcription-coupled dna repair (tcr). cells with harp depletion display a higher frequency of dsb [13, 81] and sensitivity to dna-damage (e.g., ir, mmc, and cpt). harp is phosphorylated by atm, atr, and dna-pk in vitro, and the mobility of harp in sds gels is altered when it is isolated from cells treated with dna damage (hu, ir, and uv radiation). taken together, evidence suggested that annealing helicases are involved in dna repair, but the question remains how the annealing activity contributes to dna repair processes. of the various types of dna damage, dsb may be the most common and cytotoxic to cells. dsbs are repaired by non-homologous end joining (nhej), homologous recombination (hr), and microhomology-mediated end joining (mmej). all three dna repair pathways need pairing of complementary single-stranded dna, particularly hr and mmej. there are mainly four forms of hr in higher eukaryotic cells: double holliday junctions (dhj) formed through crossover, synthesis-dependent strand annealing (sdsa) utilized by non-crossover, single-strand annealing (ssa) pathway between two repeat sequences, and break-induced replication (bir) pathway that repairs hr pathways are initiated by rad51 that searches and invades base-paired strands of homologous dna molecules, then d-loop and hjs are formed consequently (figure 3(b), left). recq helicases have strand exchange activity [51, 126] and hjs branch migration ability [120, 121]. in the dhj pathway, it is very likely that the recq helicases, particularly wrn and blm, coordinate their unwinding and annealing activities to separate intact double-stranded dna and pair invading strand to template in the early stage, migrate hjs, and finally help to cleave hjs. sdsa is a mechanism in which homology-mediated repair of dsbs occurs without formation and resolution of ligated hjs; it anneals the newly synthesized strand with the single strand resulting from resection of the second end (figure 3(b), left). mmej or ssa use microhomologous sequences (525 bp) or long homologies (> 30 bp) to align broken ends before ligation (figure 3(b), right). nevertheless, dhj, sdsa, mmej, and ssa pathways heavily rely on single-strand dna-annealing activity driven by proteins. on the other hand, dna helicases are recognized to play negative regulatory roles in recombination/repair through antirecombination, by disrupting presynaptic filaments prior to strand invasion, or by resolving d-loops before they can be extended and converted into replication forks. although annealing helicases harp and ah2 have not been investigated in the dna repair pathways discussed above, both recq4 and blm helicases are reported to be required to promote sdsa [128, 129]. in the mmej or ssa pathways, nuclease activity is required in the flap-trimming step (figure 3(b), right). in fact, it has been reported that several helicases, including annealing activity containing helicase recq5, blm, and wrn, stimulate cleavage activity of flap endonuclease 1 (fen-1). besides their function in dna replication and repair, another function of annealing helicases might be in dna transcription (figure 3(c)). cas3 is a superfamily 2 helicase that possesses atpase, helicase, and nuclease activities as evident in the cas3 protein of streptococcus thermophilus. recently, the e. coli cas3 protein was found to promote r-loop (rna: dna hybrid) formation within duplex dna in the absence of atp and to disassemble r-loops in the presence of atp, which is more relevant to structures formed in dna transcription. given the fact that the csb protein is recruited to the site of a chromatin bound uv-stalled rna polymerase ii complex and that the recq5 helicase physically and functionally associates with rna polymerase ii [135138], it will be of interest to determine if the csb and recq5 use their annealing activity to stabilize the transcription machine as a dna damage response. a number of recq helicases are implicated in telomere metabolism, including wrn, blm, and recq4. the purified recombinant pif1 proteins bind telomeric dna with a 100-fold higher affinity compared to random sequence, and telomere shortening was observed when pif1 was overexpressed. telomere effects of dna2 proteins have been reported in s. cerevisiae and s. pombe [144, 145]. it will be of interest to know how these helicases exert their strand annealing activity, in particular recq4 that has robust annealing activity, to function in telomere maintenance. annealing helicases might participate in telomere metabolism, where single strand overhang could require an annealing helicase to form a more stable structure, such as t-loop (figure 3(d)). for cells which operated by the alternative lengthening of telomere (alt) pathway, it is possible that strand annealing/strand exchange catalyzed by certain recq helicases may participate in telomere-sister chromatid exchange and hr-dependent dna replication (figure 3(d)). coordination of strand annealing and unwinding activity at the g-rich telomeric end may influence telomere stability by affecting dna replication and repair processes, such as resolving g4 dna. the characteristic feature of this class of enzymes is that they contain a conserved atpase domain with the seven classic helicase-related motifs. the swi2/snf2 atpases are grouped within the sf2 helicase superfamily, and they have a distinct primary sequence signature defined by the spacing between helicase motifs iii and iv as well as conserved features of their sequences within the domain. although most swi2/snf2 atpases do not have duplex dna strand separating activity, they retain other features of helicases, including directional dna translocation fueled by atp hydrolysis, participation in chromatin structure modeling, regulation transcription, and dna repair. unlike harp and ah2, not all helicase domains containing snf2 family proteins have annealing activity, but like harp and ah2, many of them have been identified to promote branch migration of hjs in an atp hydrolysis-dependent manner. in prokaryotes, ruvab and recg have been shown to promote branch migration of hjs [147, 148]. in eukaryotes, several members of snf2 can promote fork regression and/or branch migration of hjs, including rad54, rad5 [150, 151], and hltf. chd7, a helicase domain containing snf2 protein accounted for the majority of charge syndrome, plays a role in transcription regulation by chromatin remodeling. although fancm is not a snf2 family member, it consists of an n-terminal sf2 helicase domain and a c-terminal inactive endonuclease domain. fancm is able to branch migrate hjs and replication forks in vitro [154, 155]. very recently, several helicase domain containing snf2 proteins, including smarca2 and smarca4, were identified to cause nicolaides-baraitser syndrome and coffin-siris syndrome. interestingly, most of the patient mutations are located in the helicase domain, suggesting its importance for their function. however, it remains unknown whether they have strand annealing activity in vitro. in conclusion, it is a growing family of proteins that contain atpase/helicase domain, which use their enzymatic activity to regulate chromatin structure and gene expression. the discovery of annealing helicases establishes the presence of a class of enzymes that possess only rewinding activity and opens a new area of research. the range of proteins that function as annealing helicases remains to be determined. researchers now hope to determine the biological function of harp and ah2 more fully, as well as to discover more of these types of enzymes. annealing helicases could also potentially be found for rna-dna and rna-rna hybrids, expanding the research into areas such as protein synthesis, rna stability, and gene silencing. the coordinated action of unwinding and annealing may play a role in fork regression or synthesis-dependent strand annealing, in the pathway for dsb repair, as well as in transcription and telomere metabolism. the challenge will then be to understand how cells regulate helicase unwinding and rewinding activity in vivo, and determine where or when the annealing activity of helicase is needed. from an experimental standpoint, it would be great interest to identify and characterize separation of function mutants which: (1) inactivate helicase activity but retain strand annealing; (2) inactivate strand annealing but retain helicase activity. characterization of clinically relevant or engineered helicase core domain and auxiliary domain missense mutants may be valuable to determine which biological pathways/steps require strand annealing versus unwinding activity. finally, a better understanding of the biological function of annealing helicases is likely to provide the basis for treating a variety of human disorders, such as siod of harp, premature aging of recq helicases, and cancers.

helicases are enzymes that use atp-driven motor force to unwind double-stranded dna or rna. recently, increasing evidence demonstrates that some helicases also possess rewinding activity in other words, they can anneal two complementary single-stranded nucleic acids. all five members of the human recq helicase family, helicase pif1, mitochondrial helicase twinkle, and helicase/nuclease dna2 have been shown to possess strand-annealing activity. moreover, two recently identified helicases harp and ah2 have only atp-dependent rewinding activity. these findings not only enhance our understanding of helicase enzymes but also establish the presence of a new type of protein: annealing helicases. this paper discusses what is known about these helicases, focusing on their biochemical activity to zip and unzip double-stranded dna and/or rna, their possible regulation mechanisms, and biological functions.

PMC3409536

pubmed-823

in many ways, cidp resembles a chronic form of gbs.10,14 cidp differs from gbs in that few patients recall preceding infections or other triggering events. also, unlike the putative role of antiganglioside antibodies in some gbs variants (e.g., aman), no single major target antigen(s) has been identified in cidp.14,23 nevertheless, plasma exchange (plex), which presumably removes autoantibodies, complement, and cytokines/other soluble factors, is very effective in cidp as well as in gbs, with many patients responding within a few days.10,2326 reports of clinical improvement after the use of immunoadsorbents to selectively remove immunoglobulins in small series of cidp and gbs also suggest a direct role of autoantibodies in these conditions.27,28 the importance of autoantibodies may also be supported by reports that some mmn and cidp patients improve with the anti-b cell antibody, rituximab,8,29 although this effect was not observed in all studies.30 antibodies against peripheral myelin proteins including neurofascin and contactin-1, pmp 22, and p0; nodal proteins including gliomedin; and/or gangliosides have been reported in sera of cidp patients.3141 antibodies against any individual defined antigen are relatively infrequent in any particular series, however, and in the majority of cidp patients the antigenic target is unknown.14,23 animal studies, including induction of cidp-like experimental neuritis by immunization with myelin or myelin proteins, and passive transfer studies also support a role for antibodies in the pathogenesis of cidp.13,26,33 shifts in the balance of helper, effector, and regulatory t-cell subsets in the blood of cidp patients and elevations of t-cell derived cytokines all support a role for t-cells in inducing or maintaining the autoantibody response.4149 however, the t-cells and macrophages in biopsies appear predominately in perivascular areas, rather than along the nerve fiber itself.5052 the relative paucity of t-cell infiltrates in nerve biopsies from cidp patients and the lack of cerebrospinal fluid pleocytosis51 cast doubt on the role t-cells as major effectors of nerve damage/dysfunction per se. together with the range of recognizable clinical variants of cidp,12,53 these observations suggest heterogeneity of the autoimmune pathology and chronic neural dysfunction.12 characteristic findings on microscopic pathology of cidp include segmental demyelination/ remyelination.50,54 onion bulbs, thought to represent a response of schwann cells and macrophages to repeated cycles of injury and repair, may also be seen. the presence of segmental demyelination and onion bulbs certainly suggest that myelin disruption plays a role in cidp pathogenesis and the disability experienced by patients.51,52,5558 myelin disruption, however, may only be a partial explanation and may occur later than the initial stages of the disease. electrophysiologic studies are beginning to highlight the importance of nodal dysfunction, and they suggest that rapid reversal of disability may be tied to improvement in nodal function.1521,55,5961 classical electrophysiologic findings considered important for the diagnosis of cidp include multifocal conduction velocity slowing, distal latency prolongation, conduction block, and temporal dispersion, which have generally been considered indicative of demyelination.14,61,62 studies of axonal excitability using the responses to multiple stimuli, strength-duration relationships, and excitability-recovery protocols offer a complementary mechanism that may be particularly relevant to the clinical experience of some cidp patients. in a study of cidp patients, measurements of axonal excitability in response to subthreshold polarizing currents (threshold electrotonus) were interpreted as showing hyperpolarizing changes.60 in another study of cidp patients, stimulus-response curves suggested increased threshold requirements.59 nerve excitability has also been studied before and after ivig administration. duration time constant was observed shortly after ivig infusions in patients with both mmn and cidp, perhaps reflecting a reduction in the persistent na current.16 these membrane changes may be mediated by autoantibodies capable of disrupting na+ channel clusters and functions of na+/k+ atpases in nodes of ranvier, resulting in hyperpolarization and decreased excitability.1518,20,21 similar electrophysiologic changes can be replicated in laboratory animals with antiganglioside antibodies and complement63 or by immunizing animals against gliomedin.13 although focal demyelination is often considered the cause of conduction block, nodal excitability changes resulting in increased thresholds for nerve stimulation may be an alternative explanation for this classic electrophysiologic finding in cidp.59 clinical response to ivig or plex may occur rapidly, often within just a few days. remyelination or axonal regeneration, while likely important in eventual recovery, are implausible as explanations for this rapid clinical improvement.16,55 small studies of recordings obtained just before and at various time points after individual ivig doses have been interpreted to suggest that improvements in motor performance correspond to rapid but reversible changes in nodal function.1618,20 the duration of improvements in axonal excitability and muscle strength may be limited, with a return to the preinfusion baseline before the next dose of ivig is due.15,18,21 an interesting analogy may be found in a recent report of mg patients who responded to ivig. thirty-two of the 37 patients reported improvement within a few days after each ivig infusion but worsening of myasthenic symptoms a few days before their next scheduled ivig infusion.9 no change in achr antibody titers were observed, even with prolonged ivig therapy. therefore, the authors concluded that the major effect of ivig was to neutralize the autoantibody, rather than to suppress its production, and that ivig was, therefore, not a disease modifying treatment in mg.9 a dramatic example of this phenomenon in cidp is shown in figure 1. in cases in which the therapeutic effects of ivig do not persist throughout the usual 28 to 30 day dosing interval, improved management of rapidly reversible responses may offer an important opportunity for optimizing short-term treatment effects. further studies are needed to determine if optimizing short-term responses affects the long term prognosis of cidp. cidp: cyclic gain in strength of ankle dorsiflexion in response to monthly ivig with return to baeline before next dose is due (days 078). after the addition of prednisolone and imuran on day 79, cyclic response to monthly ivig continues, but each month, peak and nadir are higher than on ivig alone. from pollard and armati18 with permission of publisher. mmn is distinguished by demonstrating multiple conduction blocks limited to motor nerves, with sparing of sensory nerves.6467 the electrophysiologically demonstrated conduction blocks have been considered a consequence of segmental demyelination, but recent studies suggest immunologic target(s) actually on axons rather than/or in addition to schwann cells or myelin per se.67 a major puzzle in understanding mmn is the observation that corticosteroids and plex are usually not effective,64,65,67 while ivig has become the standard of care.68 approximately half of mmn patients have igm antibodies against the ganglioside gm1, and these seropositive patients tend to have more severe weakness, disability, and eventual axon loss than seronegative patients.69 mmn patients ' sera containing igm anti-gm1 have been shown to activate complement in vitro,70,71 so it is possible that ivig is acting mainly by inhibiting c3 (third component of serum complement system) activation and/or deposition on ganglioside-rich domains of axonal membranes.21,71 although the complement membrane attack complex is often considered a lytic lesion which kills cells, sublytic attack can also occur, because nucleated cells can remove membrane attack complex pores by shedding or internalizing microscopic membrane vesicles.72 when this occurs, functionally important membrane proteins can be lost. this type of membrane loss is believed to explain the simplification of postsynaptic membrane folds and loss of achr in mg22 and might be hypothesized to occur at nodes of ranvier in mmn.21 yuki et al. have shown that in mmn, igm-induced complement-mediated injury occurs at the nodes of ranvier, which in turn leads to conduction block and muscle weakness.71 they further showed that ivig can block antiganglioside antibody binding in a dose-dependent manner.71 using stimulus strength duration measurements to assess motor axon excitability, priori et al. showed that axonal hyperpolarization occurs in mmn, suggesting that antibody-mediated inactivation of the na+ channels at the nodal membrane contributes to the apparent conduction block.73 boerio et al. performed nerve excitability studies before and just after ivig treatment in mmn (and cidp) patients. they reported that ivig improved axonal excitability, which they attributed to restoration of na+ channel expression and/or activity.16 these electrophysiological observations could potentially explain why effects of ivig may improve muscle strength shortly after each infusion but wane in subsequent weeks.7375 thus, taken together, the results of these recent studies of axonal excitability in cidp and mmn, the absence of clearly identifiable effector cells attacking the involved nerves, and the rapid responses to ivig reported in both disorders suggest that autoantibodies (complement) may disrupt axon function in addition to inducing structural damage. in turn, the reports of rapidity and reversibility of the responses to igg infusions in some cases may suggest competition between infused therapeutic igg and endogenous pathologic antibodies.21 a corollary of this hypothesis is that the specificities, titer, and affinities of the autoantibodies being produced by any given patient at any point in time, together with the susceptibility of the target axons, may be important determinants of the treatment regimen required to optimally manage that particular patient at that time. the initial dose of ivig used for most autoimmune/inflammatory diseases follows a regimen serendipitously found effective shortly after ivig was introduced in 1981. four cll patients with thrombocytopenia and concomitant immune deficiency had increased platelet counts after receiving what was then the standard monthly dose of ivig for antibody replacement, 0.4 gm/kg. because of the rise in the platelet count, the ivig dose was repeated the next day, then also on the remaining working days (but not the weekend days) of the same week, leading to a cumulative dose of 2 gm/kg given over 45 days.76 a subsequent randomized, multicenter trial comparing the 0.4 gm/kg per day 5 regimen with a single infusion of 2 gm/kg over 10 h in children with kawasaki syndrome found that the latter was more effective in preventing aneurysms and led to faster resolution of fever and biochemical markers of inflammation.77 this suggests that the peak igg level is the most important determinant of the success of therapy in some situations. however, kawasaki syndrome, like gbs, is considered an acute monophasic disease; while cidp, mmn, and mg are chronic disorders. in current neurologic practice, a loading dose of 2 gm/kg divided over 25 days is usually followed by maintenance doses of 12 gm/kg every 36 weeks.68,78 infusion of 2 gm/kg of ivig increases the serum igg level>4-fold, from pretreatment means of 7001,060 mg/dl to peaks well over 3,000 mg/dl.78 the levels then drop by approximately 50% over 4872 h, as igg is distributed into the total extracellular fluid volume, which is approximately double the intravascular volume.78,79 after this rapid equilibration, the igg is catabolized with first-order kinetics and a half-life of 2130 days, so infusions are usually repeated monthly.7881 the relatively slow catabolism of igg as compared to other plasma proteins is due to a saturable endothelial cell receptor which protects endocytosed igg from lysosomal degradation and returns it to the plasma.80,82 saturation of this receptor with high concentrations of normal igg from exogenous ivig keeps endogenous pathologic igg from the recycling pathway and increases its degradation.83 this is likely an important concentration-dependent mechanism by which ivig can compete with autoantibodies without affecting their production.21,83 reports of patients responsive but chronically dependent upon ivig support the notion that the effects of each dose are transient, without any cumulative effect.9,21 certainly, not all patients are chronically dependent on ivig; up to 30% might achieve long-term drug free remission. whether these observations can be explained by spontaneous remission with neuronal integrity supported by ivig while the disease is in the active state, or if ivig fundamentally alters the immune process remains to be clarified. in either case, accumulating evidence supports the hypothesis that the infused antibodies in ivig compete with putative pathologic antibodies and/or complement, and that the effect diminishes as the relative concentrations of normal versus pathologic antibodies decrease with time after each dose.21,83 in contrast to intravenously administered igg, with subcutaneously administered igg (scig), the initial direction of the movement of igg is opposite that of ivig. scig is first absorbed into and transported through lymphatics, then enters the bloodstream by means of the thoracic duct.84 equilibration of the igg from scig into the intravascular space requires approximately the same amount of time as equilibration of ivig out of the intravascular compartment, 3672 h.8486 the peak serum concentration achieved with scig is, on average, only 61% of the peak achieved with iv infusions of the same dose.86 the slower rate of rise toward the peak and the truncation of its height are believed to be responsible for the much lower incidence of systemic adverse effects (aes) with scig.84,85,87 this is consistent with numerous reports that many of the aes of ivig infusions are rate-related and can be obviated by giving the igg by the sc route.87,88 no differences have been reported in the half-lives (t1/2) of igg given by the sc versus iv routes, generally reported to be approximately 3035 days with currently marketed igg products.81,85,86 because of the low incidence of systemic aes and lack of a requirement for venous access, scig is commonly self-administered at home, usually weekly.89 with weekly scig, only a few days elapse between the peak serum level from 1 dose and administration of the next dose. serum igg levels experienced 34 weeks after a large bolus of ivig.85 pooled data from 7 studies in which equivalent monthly igg doses were given as weekly scig infusions versus ivig boluses every 2128 days showed that trough serum igg levels were higher by 1020% (mean=12.7%) with weekly scig.81,85,86 after 612 weekly infusions, scig results in near-steady-state igg levels, with peak-trough differences only approximately 5% of the overall mean.85,86 in contrast, with ivig the trough-to-peak difference is often greater than 100% of the overall mean.81,89 as with any other therapy, the shorter the interval between doses, the higher the trough level and the smaller the difference between peak and trough levels are likely to be, regardless of the route of administration.81,89,90 the overall bioavailability of scig is approximately 30% lower than that of ivig, presumably because of binding to extracellular matrix and/or degradation in the tissues.91 for this reason, to achieve the same total systemic exposure to igg, defined by the area under the curve (auc) of serum igg versus time, it is necessary to increase the monthly dose of scig by 30 to 50% compared with the monthly dose of ivig.86,91 however, there is little evidence which supports basing doses on the auc, as opposed to the trough serum igg level. typical pk curves from ivig and scig in a patient with primary immunodeficiency (pidd) who makes only minimal endogenous igg are shown in figure 2a and b. the large differences in peak and trough on ivig versus the near steady-state serum igg levels with scig are readily apparent. if the effect of therapeutic igg is proportional to its serum concentration at any point in time (for example, in pidd, the moment when exposure to an infectious agent occurs), it is easy to see how the effect of ivig would wane as it is metabolized and its concentration decreases. figure 2c shows a prototypic pk curve for monthly ivig superimposed on the muscle-strength curve from figure 1, while the patient was on monthly ivig but no other anti-inflammatory or immunosuppressive treatment. seen in this way, it is quite easy to understand why there would be a rapid response to the markedly increased serum igg level in the few days just after an intravenous dose, but also why that effect begins to wear off a, b: serum igg levels in a patient with x-linked (bruton's) aggamaglobulinemia. a: ivig at 406 mg/kg (30 grams total) every 22 days. b: scig at 12 grams/week (36 grams total), a 20% increment in dose. the igg remains at a near steady state with a mean of 850 mg/dl. c: cyclic response to ivig from cidp patient in figure 1 superimposed on typical pharmacokinetic curve of ivig (on a logarithmic scale)-from bonilla81 with permission of the publisher. note the increase in muscle strength accompanying the rapid rise in serum igg level following each monthly dose, but then the decrease in strength shortly after the igg level falls. the diagnosis of cidp requires integration of clinical, electrophysiological, and laboratory data as well as collection of appropriate exclusionary information. often the diagnosis is not straightforward. a recent editorial by cornblath et al. suggests that as many as one-third of cidp patients in the us have been incorrectly diagnosed and may be receiving inappropriate treatment.62 therefore, strict adherence to scientifically derived and consensus clinical diagnostic criteria is critical.62 after the cidp diagnosis is confirmed, ensuring that treatment is effective, tolerable, and minimizes the patient's disability become the major goals. based upon results of the largest controlled trial of ivig in cidp, the study of ivig, 10% caprylate-chromatography purified for the treatment of cidp (ice trial), the food and drug administration (us) approved ivig for cidp using a loading a dose of 2 gm/kg followed by maintenance dosing of 1 gm/kg every 3 weeks.92 however, optimal ivig doses and infusion intervals across a broader range of patients have yet to be clearly established, and prescribing regimens other than those used in the ice trial are common.9395 wide inter-patient variations in the pharmacokinetics of ivig9497 further highlight the need to individualize dosing to achieve an optimal treatment response. nonetheless, relatively little emphasis has been placed on determining how to maximize treatment efficacy. there are anecdotal reports of patients asking for booster doses of ivig before their next monthly dose is due, but few reports of objective measurements which correlate with these end of dose effects. in the absence of a validated laboratory biomarker or any other way to establish a igg level,98 frequent measurements of muscle strength and functional capabilities may provide the best basis for individualizing and optimizing therapy (see the unanswered questions/ research issues section). studies in patients with primary antibody deficiency have demonstrated that different individuals require different serum igg levels to remain free from infection,97,99 and that there is very wide variability in igg dose and treatment interval necessary to achieve and maintain clinically determined target igg levels in different patients.86,97 gbs may have a similar dose reported that serum igg levels obtained 2 weeks after ivig 2 gm/kg showed a large degree of pharmacokinetic variation and that those patients with greater increments in their serum igg levels had better clinical outcomes at 6 months posttreatment.96 in a prospective study in cidp, the same group showed that different patients required different ivig dosing intervals and serum igg levels to achieve and maintain optimal clinical responses.90 the mean trough serum igg level (just before each dose was given) required by the subset of these patients on a single ivig product (n=17) was 1,500 mg/dl, but the range was 1,100 to 1,900 mg/dl.90 besides the suggestion that different patients require different igg levels to achieve maximum muscle strength, the doses and treatment intervals required to achieve and maintain any given igg level are also likely to vary greatly between individuals.90,9395,98 many immunodeficient patients report feeling better and remain free from recurrent symptoms of chronic low-grade infection when their serum igg level is maintained at a steady-state with the use of weekly scig.100 a few reports suggest that maintaining high steady state levels of normal igg by the use of scig may also be beneficial in cidp and mmn (see below), but additional studies are needed. as with plex, the initial response to ivig in many patients with cidp is rapid, with symptomatic improvement beginning within days.101103 the beneficial effect generally wanes within weeks, and ivig infusions are repeated at regular intervals, often for years.104 harbo et al. reported that 6 of 11 cidp patients on individualized ivig regimens began to lose strength within a few days when their ivig was delayed beyond the usual interval.105 conversely, they began to regain strength in 5 days after an ivig dose, although a plateau was not achieved for 15 days.106 in the ice trial, improvements in grip strength and incat score in responding subjects were seen at the first post-ivig determination 16 days after the infusion.101103 further improvement was recorded at 3 and 6 weeks, but repeated measurements were not taken before and after subsequent doses of ivig.101 wearing off of the effect of each dose of ivig may be a reason that as many as 30% of cidp patients had dosing intervals of 15 days in a us survey93 and 21 days in a uk study94 (fig. recently reported results of a study in which they confirmed ivig dependency by determining whether reducing the dose increased the patient's disability. they then used assessments of grip strength (vigorometer), mrc sum score, incat sensory score, and disability assessments as part of a protocol for optimizing the ivig regimen in which the dose was increased until the maximal clinical response end of dose symptoms and signs.90 although the frequency of the efficacy measurements was not described, the use of this protocol resulted in 52% of the patients receiving ivig at intervals of 1014 days and an additional 8% receiving ivig at intervals<10 days90 (bottom bar, fig. the utility of hand grip strength measurements is also supported by a cross-sectional analysis of 31 cidp patients using dynamometry, electrophysiology, and conventional clinical assessments, from which rajabally and narashimhan reported highly significant correlations between jamar dynamometer measurements and results of global and upper extremity motor and sensory scores.107 ultimately, frequent measurements with hand grip dynamometers or other devices the patient can be instructed to use at home should help determine the proportion of patients who might benefit by weekly or even more frequent igg dosing, and help to identify the treatment regimens which yield the best long-term results. larger and longer studies using tools like grip strength monitoring that specifically address the short and long term consequences of treatment-related clinical fluctuations are needed. actual ivig dosing intervals used for cidp patients in practice: horizontal bars indicate% of cidp patients receiving ivig at intervals 14 days in each study. rajabally in the uk and kuitwaard in holland performed prospective studies designed to optimize responses, n=15 and 25, respectively.. reported on a cross-sectional analysis of prescriptions for ivig therapy for 46 unique patients from a home care/specialty pharmacy by 30 different doctors in the us. if weekly or more frequent igg dosing seems desirable on clinical grounds, self-administration of scig at home offers a practical route to maintain high steady-state igg levels. the safety, efficacy and practicality of this route of therapy in cidp has been described in case reports and a small randomized, placebo controlled study,109111 and is now being evaluated in a large multicenter trial.112 some of the patients in these studies reported improved tolerability, increased independence, and stabilization of clinical status.109111 while these factors may not be applicable to all patients, the possibility of maximizing treatment by maintaining a high steady-state igg level by means of a potentially more tolerable route of igg administration (i.e., sc) is attractive. if cidp patients have a better response to higher igg levels, as reported in a recent study in gbs,96 and different patients require different igg doses and treatment intervals to achieve optimal clinical responses,90,9395,98 then frequent clinical monitoring and correlation with frequent serum igg levels may identify those patients who benefit most from frequent iv infusions or the use of scig. the possibility that minimizing treatment-related clinical fluctuations may result in better long-term outcomes remains to be determined in long-term studies. responsiveness of the majority of mmn patients to ivig despite the lack of response to plex113 or corticosteroids114 was demonstrated in the mid-90s by multiple anecdotal and case-series reports.114116 small controlled studies soon followed,117120 and the results of a 44-subject randomized, double-blinded placebo-controlled, crossover trial were reported by hahn et al. in 2013.120 mean maximal grip strength declined 31% during placebo treatment and increased 3.75% during ivig treatment (p=0.005),120 ivig was recommended as first-line treatment by a european federation of neurologic societies/peripheral nerve society task force in 2006121 and 2010.68 of interest, even early reports noted that improvement associated with reduction in the degree of conduction block began within a few days, but lasted only 12 months, at best.114,115 others observed that the beneficial effects of ivig generally decrease over time.74,75,122 although increasing the dose or shortening the interval generally restores short-term efficacy, gradual worsening with progressive reduction of mrc sum scores and/or distal cmap amplitudes still occurs commonly.74,75 baumann et al., reported that the use of a protocol designed to determine the lowest effective ivig dose and longest tolerable interval resulted in slowly progressive muscle weakness over a 4-year period while the patients received a mean of 0.5 gm/kg/month of ivig given at 4- to 12-week intervals.123 the investigators subsequently performed a prospective dose escalation study and observed that 6 of 9 subjects improved when their dose was increased to 1.2 gm/kg/month. the authors concluded that their initial strategy of trying to find the lowest dose at the longest tolerated interval resulted in significant underdosing.123 others have also reported that mmn patients gradually decline despite therapy and need slowly escalating ivig doses to maintain their strength.74,75,122 notably, these reports initially used mean cumulative ivig doses equal to or less than 1.2 gr/kg/mo.74,75,122 in contrast, vucic et al. reported the results over a 7.25 year mean follow-up period of 10 patients initially treated with 3 courses of 2 gm/kg ivig at 4 week intervals then maintained on a mean ivig dose of 1.63 gm/kg/4 weeks. muscle strength in these patients was stable, the number of nerve segments showing conduction block decreased by 45%, and distal compound muscle action potential amplitudes were stable or improved.124 thus, we have much to learn about optimizing the use of igg in mmn. early diagnosis and institution of therapy, followed by close monitoring and frequent adjustment of dose and interval to assure that the patients are achieving maximal short-term responses may offer the best chances for favorable long-term outcomes. monthly ivig is now the accepted first-line treatment for mmn.68,121 even so, treatment-related fluctuations in strength and end-of-dose weakness are also reported in this condition.125 several case reports and small case series have suggested that scig may be as effective as ivig for long-term maintenance of strength in mmn,126130 but large clinical trials have not compared the efficacy of scig versus ivig. scig may have advantages over ivig, including the ability to maintain igg levels at a higher steady-state81,85,86 and perhaps smooth out end-of-dose weakness. an mmn patient who had cyclic fluctuations in disability while receiving ivig every 34 weeks for 10 years provides a provocative example. switching to weekly scig and increasing the total monthly dose by 25% resulted in increased strength, which was stable at the peak he had previously achieved only transiently after each ivig dose.128 this improvement was accompanied by an increase in the trough serum igg level from 1,500 mg/dl to a steady state of 2,100 mg/dl, consistent with the hypothesis that the patient's strength at any point in time is directly related to the total igg concentration of in his circulation.128 similar dose-dependency observations were reported in small prospective, open-label, noncontrolled trials in which 4 of 5 patients maintained stable mrc sum scores for at least 6 months with steady-state serum igg levels of 1,380 to 1,740 mg/dl.129,130 taken together, these results suggest that scig may be a useful alternative to ivig for some mmn patients, particularly those that experience treatment-related wear-off or there remains a controversy as to whether prolonged ivig treatment totally controls the progression of mmn, or whether axonal degeneration and long term deterioration are inevitable. some studies suggest that careful optimization of therapy with frequent adjustments to avoid end-of-dose weakening may help promote long-term recovery and prevent axonal loss,124 although other reports suggest gradual worsening despite this approach.75 it may be that axon damage increases toward the end of each dosing interval, when the ratio of the putative autoantibodies to normal igg is relatively high and the patient is experiencing increased weakness. if that is the case, using scig to maintain higher steady-state igg levels without cyclic troughs may decrease long-term deterioration in mmn, but that hypothesis remains to be tested. in 2007, the peripheral neuropathy outcome measures standardization (perinoms) study began.131 a major aim of this international collaboration is to better define the metrics used to follow patients with inflammatory neuropathies. in 2013, the group analyzed outcome measure data collected from cross-sectional validity and reliability studies as well as longitudinal studies of responses.132 the results emphasized the importance of measuring disability (i.e., activities and participation), strength and sensory impairment, and quality of life. disability measured by the rasch-built overall disability scale (r-ods),133 impairment measured by grip strength (martin vigorimeter),103 and quality of life measured by the short form-36 item health survey134 emerged as useful metrics by which cidp patients can be assessed and treatment responses can be better defined. although the use of these kinds of assessments has typically been limited to clinical trials, these measures (especially r-ods and grip strength) can be performed very quickly and reliably and, if validated, may greatly facilitate routine clinical care. we propose that frequent collection of validated and reliable disease-specific measures between physician visits can be used to optimize clinical care and improve outcomes. of course, continued assessment of symptoms and signs by interviewing and examining the patient during office visits is invaluable and irreplaceable. defining the treatment response during relatively brief, intermittent office visits may be difficult and not representative of the patient's function in his/her home environment. what about pain, fatigue, and/or other subjective symptoms in the absence of clear indicators of disease activity? which factors should drive the treatment plan? for the patient who demonstrates some improvement, how do we know that therapy has been maximized? these treatment challenges are further magnified by the limited frequency with which a comprehensive examination and interview can be achieved, especially with current economic pressures. one approach to treatment optimization is frequent collection of disease-specific outcome measures like grip strength and r-ods as discussed within perinoms. ivig regimens offer a unique opportunity to perform such assessments at the time of the infusions. if a patient achieves only a partial peak response and/or reports wear-off, the ivig dose and frequency can be optimized with rapid confirmation of the desired effect. on the other hand, this type of monitoring can also be useful to identify patients who fail to respond or who no longer need ivig. the dose can then be tapered or the interval between infusions lengthened with the security of frequently obtained reliable measures in case of relapse. use of these metrics can help establish drug efficacy in individual cases, provide a rationale for patient-specific treatment tailoring, and allow rapid detection of nonresponders. the importance of these metrics in clinical trials is obvious, but their long-term utility has yet to be studied. extending their application to routine clinical care may offer a unique opportunity to optimize inflammatory neuropathy treatment paradigms and hopefully long term outcomes. many investigators are actively seeking an immunologic biomarker or soluble indicator of neuronal damage which could be used to identify those patients who are most likely to respond to igg therapy and to monitor its effects in mmn, cidp and other neuropathies.33,62,64,90,95,96,122 in the absence of such biomarkers, frequent measurements of grip strength and of disability using r-ods may be used to better characterize treatment responses. current treatment strategies rely heavily on data obtained through unstructured and often unsolicited communication from patients as well as from infrequent face-to-face office visits. adherence to rigorous diagnostic standards3,53,62,68,122,123 and collection of focused disease-specific outcome measures at more frequent intervals may assist with development of better paradigms for optimizing treatment. prompt recognition of those patients for whom igg or other expensive biologicals are unnecessary or ineffective is another likely benefit of frequent measurements, which may aid in the development of criteria for identifying nonresponders and selecting appropriate alternatives ,. although several recent reports suggest that dosing ivig as frequently as every 714 days, or the use of scig to maintain high steady-state igg levels may be preferable in terms of maintaining consistent function and minimizing disability, several questions remain unanswered. importantly, analyses of larger and more diverse populations are needed to determine which patients are characterized by a predominance of functional immunologic effects that are rapidly and reversibly responsive to igg and/or other immunotherapies as opposed to those who have mainly structural and/or permanent damage. similarly, longer term follow-up is necessary to determine whether the kinetics of responsiveness vary at different stages of disease, and whether minimizing short-term fluctuations in strength and/or disability correlates with long term outcomes. immunologic as well as clinical studies suggest that cidp is a heterogeneous group of conditions with a multiplicity of immunologic targets and mediators. the kinetics and pattern of response to igg and other therapies may be a useful criterion according to which subsets of these diseases are classified and split-out for further studies. because igg can act by many different mechanisms, it seems quite likely that better definition of the immunopathogenesis of particular disease subtypes might lead to preferential use of different therapies, such as steroids and anti-inflammatories, complement inhibitors, or monoclonal antibodies and other narrowly targeted biologicals. in conclusion, recent studies of the immunology and electrophysiology of cidp and mmn suggest that much of the morbidity and disability in these conditions is caused by readily reversible functional effects of autoantibodies rather than more slowly repairable structural damage.18,21 these results serve as a foundation for understanding clinical observations of rapid responses and wear-off effects with intermittent ivig bolus therapy. together, these observations suggest the hypothesis that infused antibodies in igg actually compete with pathologic autoantibodies. observations that dosing of ivig as often as every 710 days or the use of scig to continuously maintain high steady-state igg levels may be preferable to the periodic extremely high peaks and low troughs of ivig boluses given every 46 weeks. giving smaller doses of ivig more frequently or routine weekly self-administration of scig in the home may be associated with fewer, less severe adverse effects and significant cost savings as compared to intermittent high dose ivig, which requires administration and monitoring by a trained nurse, even if given at home. additional research is needed to determine how widely applicable frequent dosing of ivig or scig might be, and whether continuous maintenance of optimal strength/minimal disability is associated with better long-term outcomes. this can only be achieved with the use of frequent monitoring of patients ' responses and periodic re-assessments of therapeutic efficacy. the authors thank david schaefer and tim walton of axelacare, lenexa, kansas, for helpful discussions.

prolonged intravenous immunoglobulin (ivig) therapy is used for the chronic autoimmune neuropathies chronic idiopathic demyelinating polyneuropathy and multifocal motor neuropathy, but the doses and treatment intervals are usually chosen empirically due to a paucity of data from dose response studies. recent studies of the electrophysiology and immunology of these diseases suggest that antibody-induced reversible dysfunction of nodes of ranvier may play a role in conduction block and disability which responds to immunotherapy more rapidly than would be expected for demyelination or axonal damage per se. clinical reports suggest that in some cases, the effects of each dose of ivig may be transient, wearing-off before the next dose is due. these observations lead us to hypothesize that that therapeutic igg acts by competing with pathologic autoantibodies and that individual patients may require different igg levels for optimal therapeutic effects. frequent ivig dosing and weekly subcutaneous igg have been tried as ways of continuously maintaining high serum igg levels, resulting in stabilization of neuromuscular function in small case series. frequent grip strength and disability measurements, performed by the patient at home and reported electronically, can be used to assess the extent and duration of responses to igg doses. individualization of igg treatment regimens may optimize efficacy, minimize disability, and identify nonresponders. muscle nerve 51: 315326, 2015

PMC4357394

pubmed-824

vitamin d is a fat-soluble vitamin obtained by the human body in two possible ways. there can be a dietary intake, mainly through fatty fish, eggs and fortified food as well as endogenous production, where transformation of 7-dehydrocholesterol into vitamin d in the skin occurs after exposure to ultraviolet b radiation. in the liver, vitamin d is hydroxylated to 25-hydroxyvitamin d. subsequent hydroxylation in the kidney forms the active metabolite, 1,25-oh vitamin d. in pregnancy, there is a 2-fold higher concentration of 1,25-oh vitamin d in maternal serum due to activity of placental 1--hydroxylase (novakovic et al., 2009). vitamin d not only influences bone mineralisation but has implications on maternal and fetal well-being. 25-oh vitamin d deficiency is associated with an increased risk of developing preeclampsia (bodnar et al., 2007; haugen et al., 2009), multiple sclerosis (hayes et al., 1997; pierrot-deseilligny, 2009) and schizophrenia (mcgrath, 1999; mcgrath et al., there is also an association with type 1 diabetes (stene et al., 2000) and asthma (brehm et al., 2009; erkkola et al., 2009; willers et al., 2007) after deficiency in utero or in early life. neonates from deficient mothers have lower birthweight (mannion et al., 2006; sabour et al., 2006; scholl and chen, 2009) and at age 9 still demonstrate a lower bone mineral content (javaid et al., 2006). in vitro studies have suggested a protective effect of 25-oh vitamin d against malignancies such as breastcancer and cancer of the colon. risk factors for developing deficiency have been identified; living in northern latitudes, limited sun exposure, dark skin, poor social circumstances and extensive clothing are amongst the most common ones (baile et al., 1979 ;, 2009; mulligan et al., 2009; sachan et al., 2005 ;, 2009; taha et al., 1984; waiters et al., 1999; this makes immigrants in northern countries, especially when dark skinned and/or covered, extremely vulnerable (bowyer et al., 2009 ;, 2006; wielders et al., 2006) (clemens et al., 1982). results of vitamin d status in the pregnant flemish population have never been published before. this pilot study aims at determining the prevalence of vitamin d deficiency in the antwerp population. the pilot study ran from august 1, 2009 until november 30, 2009 after approval of the local ethical commitee was obtained. in each blood sample that was taken from pregnant women consulting the antenatal clinic, we determined 25-oh vitamin d. the nurse taking the blood samples put every patient in a category according to their sun exposure. there were three possible categories: not covered, covering of only the head and leaving arms exposed to sun or complete covering with no sun exposure except for the face. because part of the period studied coincided with the month ramadan, we also asked the women whether they were fasting or not. our laboratory uses the elecsys 25-oh d3 immunoassay (leino et al., 2008) for determination of 25-oh vitamin d3 levels. this immunoassay is performed on a modular analytics e170 apparatus (roche diagnostics, manheimm, germany). the measuring range is 4-100 ng/ml (10-250 nmol/l), the reference range for hypovitaminosis in our laboratory is< 30 ng/ml, corresponding the health based reference values. vitamin d levels between 16-20 ng/ml are seen as mild deficiency, 6-16 ng/ml as moderate deficiency and values lower than 6 ng/ml as severe deficiency. for the statistical analysis, we used spss statistics 17.0 (spss inc., chicago, illinois). normality was tested with the kolmogorov-smirnov test, the means of vitamin d between all three groups were compared with anova-analysis. the means of each group according to exposure were compared with an independent samples t-test. to compare the groups of women who used a prenatal vitamin and those who did not we also used the independent samples t-test. linear regression was used to analyse wether vitamin d level is influenced by gestational age, maternal age, parity, gravidity, sun exposure, intake of supplements and/or date of blood sample. for all tests significance was accepted at p<0.05. the odd s ratio between covered and non-covered women with vitamin d levels lower than 30 ng/ml was calculated, and 95% confidence intercal group were also compared using the chi squared test. we determined 25-oh vitamin d3 in 171 women (n=171). the mean age of this population was 29,1 4,6 (standard deviation or sd) years. the median gestational age was 24 weeks (range: 4-37), most women were primiparae (72/171, 42,1%). the number of fasting women was too small (4/171, 2,3%) to draw any conclusions. 17% (n=29) of the women was taking a multivitamin preparation. they all used the same brand containing 10 microgram (400 iu) of vitamin d. in the entire population the mean 25-oh vitamin d value was 28 12,4 (sd) ng/ml. there was no effect of age, gravidity, parity, intake of supplements nor gestational age on the vitamin d level. there was however a statistically significant influence of date of blood sampling and sun exposure (p=0,001). the mean vitamin d value of women taking supplements was 28,5 12,5 (sd) ng/ml, the group without supplements had a mean of 27,9 12,5 (sd) ng/ml. the difference in means between these two groups was not significantly different (p=0,8). of all women 86% (n=147) was not covered, 10,5% (n=18) wore head covers but had other body parts exposed to the sun, 3,5% (n=6) was completely covered, leaving only the face open for sun exposure. there was a significant effect of degree of body covering on vitamin d level (linear regression, p<0,001). the mean 25-oh vitamin d value in the non-covered group was 29,5 12,2 (sd) ng/ml. there was a significant difference in vitamin d level between the three groups (anova, p=0,001) (fig. 1). the mean of the partially veiled group, 17,2 7,2 (sd) ng/ml, was significantly lower than the mean of the non-veiled group (t-test, p=0,001). the mean of the completely veiled group, being 22,5 12,9 (sd) ng/ml was not significantly higher than that of the partially veiled group and not significantly lower than the non-veiled group (t-test, p>0,05). when we only compare covered versus non-covered groups, there are significantly more covered than non-covered women with a concentration of vitamin d lower than 30 ng/ml (odds ratio 6,2; 95% ci: 1,8-21,7; p<0,05). the mean vitamin d value of our population, 28 ng/ml, was below the reference range used in our laboratory. this suggests a widespread shortage of vitamin d in our population, 1,75% was suffering from severe deficiency, 9,9% had moderate deficiency and 18,1% had mild deficiency. the values used are based on concentrations that avoid development of rickets and osteomalacia (vieth et al., 2007). with new date on the role of vitamin d besides bone metabolism, some authors are pleading for higher cut-off values to determine deficiency (norman et al. heaney (2005) states that 32 ng/ml should be considered as a minimum for normal physiology, bischoff-ferrari (2008) defines values of 36-40 ng/ml as optimal serum concentrations. we found no effect of maternal age, gestational age, parity, gravidity and intake of supplements on the vitamin d level. no consensus exists on the recommended intake and supplementation of 25-oh vitamin d during pregnancy., 2007; madelenat et al., 2001; saadi et al., 2007 ;, 2009; yu et al., 2009) and several authors agree that the current recommended intake of 200-600 iu (or 5-15 g) is too low, daily requirements may be closer to 1000 iu (25 g) or higher (bisschof-ferrari et al. the most commonly prescribed multivitamin preparation in belgium, only contains 10 g (400 iu) of vitamin d, a value that will not suffice to maintain or build sufficient levels. this fact is confirmed in our pilot study: no significant difference in vitamin d levels between women taking supplements and those who did not. there clearly was an effect of sun exposure and date of sampling, probably because august has more sun hours than november. in the population studied, the non-covered women had higher mean serum concentrations of vitamin d compared to partially covered women. the higher mean values of the completely covered group were probably due to small group size and were not statistically significant compared with other groups. however, we did not classify the participants according to their nationality nor their skin tone and as most women wearing head/body cover also have a darker skin, this is a fact that we should have taken into account. furthermore, most of the covered women are immigrants who often live in poorer social circumstances. hence, their lower vitamin d levels might not be only attributable to wearing head/body cover but also to poor dietary intake. although most of the vitamin d production comes from skin conversion, the dietary intake of vitamin d is something we ll have to examine in further studies, as well as darkness of skin and nationality. as this was a pilot study, we only measured 25-oh vitamin d. in the future, we will start including other relevant parameters such as medical history, serum levels of calcium and parathyroid hormone. low vitamin d levels are frequently found in pregnancy but the optimal serum concentration remains unknown., we found that low vitamin d levels in the antwerp population are frequent and that there is an effect of the seasonal moment of the year and degree of sun exposure. a large scale study is needed to come to clinical guidelines and recommendation for obstetricians.

introduction: vitamin d deficiency in utero or early neonatal life may have a major impact on children s health. little is known on vitamin d deficiency in pregnant women in belgium, non on the impact of wearing head and/or body cover. objectives: this was a preliminary exploration of the vitamin d status in pregnant women visiting the antenatal clinic in the antwerp university hospital. method: from august 1 2009 until november 30 2009 we systematically determined 25-hydroxy vitamin d (25-oh vitamin d) in each blood sample taken from pregnant women visiting the antenatal clinic. we also registered the degree of head/body cover and inquired for intake of vitamin supplements. results: our population consisted of 171 women, mostly primiparous, of which 86% were not covered. the mean value of 25-oh vitamin d was 28 ng/ml. non-covered women had a mean of 29,5 12,2 (sd) ng/ml, the partially covered group had a mean of 17,2 7,2 (sd) ng/ml and the completely covered group had a mean of 22,5 12,9 (sd) ng/ml. the difference in serum concentrations between the 3 groups was statistically significant (anova, p<0,00001). there were significantly more covered than non-covered women with a vitamin d concentration lower than 30 ng/ml (or6.2; 95% ci: 1,8-21,7; p<0,05).there was no effect of gestational age, maternal age, gravidity, parity and intake of supplements on vitamin d levels. there was a siginificant seasonal effect from summer to fall, with vitamine d levels lowering from august to november (linear regression, p<0,05). conclusion: low vitamin d levels seem to be frequent and covered woman are at a higher risk of deficiency.

PMC4188019

pubmed-825

the majority of the protein structures deposited in the protein data bank are determined either by x-ray crystallography or solution-state nuclear magnetic resonance spectroscopy (nmr). while x-ray crystal structures are derived from electron density data and are often of higher accuracy, protein nmr structure determination in solution may more accurately reflect molecular dynamics and has the advantage of not requiring crystallization. solution nmr structure determination is generally based on three classes of experimental restraints: distance restraints, dihedral angle restraints, and orientation restraints. in combination with these restraints, different algorithms and force fields have been implemented to determine nmr structure using a variety of programs. two groups of simulated annealing based programs are most commonly used by the nmr community: xplor/cns and dyana/cyana. aside from the accuracy and completeness of experimental data, the quality of nmr structures also depends on the programs utilized in structure calculation and structure refinement. in particular, as demonstrated by many studies, the quality of nmr structures can be improved by structure refinement in state-of-the-art force field with explicit or implicit solvent. using such advanced refinement protocols, a few large-scale rerefinement studies have been done to improve the quality of nmr structures, especially for nmr structures determined prior to 2000. one is the assessment of how well the structures fit with the experimental nmr data, including noe-based distance restraint violations, dihedral angle restraint violations, noe completeness, and goodness-of-fit with nmr noesy peak list and rdc data. the second class includes knowledge-based normality scores relative to high-resolution x-ray crystal structures, such as bond length, bond angle, backbone or side chain dihedral angle, and packing statistics. recent studies comparing various methods for automated analysis of nmr data and structure generation, such as the critical assessment of structure determination by nmr (casd-nmr) study, demonstrate that the algorithms and force fields utilized in nmr structure refinement can significantly improve these normality scores. for example, protein nmr structures refined by rosetta without restraints generally have excellent knowledge-based stereochemical and geometric quality scores, but sometimes have poorer fit to the original experimental data. the rosetta molecular modeling program was first developed for de novo protein structure prediction, homology modeling, and protein design. however, it has also been used in protein crystallography as part of improved protocols for determining crystallographic phases by molecular replacement and for nmr structure determination and unrestrained nmr structure refinement. have shown that unrestrained rosetta refinement can improve the phasing power of an nmr structure by moving it closer to its x-ray crystal structure counterpart. this observation has been corroborated for two additional nmr structures as part of a systematic investigation of using nmr structures in molecular replacement. these results are intriguing, as they suggest that the force field of rosetta may be even more accurate than the nmr data themselves in defining the protein structure. however, only one or two examples are reported in these two papers. in order to assess the generality of unrestrained rosetta refinement, it is necessary to perform a systematic study using a much larger data set. another intriguing observation is that the number of restraint violations significantly increases after unrestrained rosetta refinement, which begs the question: do those violated restraints reflect true structural differences between nmr structures and x-ray crystal structures? if that is the case, then would incorporating those nmr experimental restraints into rosetta refinement drive the nmr structure away from its x-ray counterpart? more generally, what is the most efficient protocol for using rosetta to improve the accuracy of protein nmr structures? the northeast structural genomics consortium (nesg; http://www.nesg.org) is one of several large-scale structure production centers of the protein structure initiative (psi). the nesg has contributed more than 500 nmr structures to the pdb over the past 12 years (summarized at http://www.nesg.org/statistics.html), representing some 5% of the 10 000 nmr structures available in the pdb. although most nesg structures have been solved by either nmr or x-ray crystallography, as of december, 2011 the nesg consortium had solved 41 pairs of protein structures for identical construct sequences using both x-ray crystallography and nmr methods. these 3d structures of proteins with identical sequences, together with the raw nmr and crystallography data available in the biomagresbank (bmrb) and protein data bank (pdb), are an extremely valuable composite data set available for studies directed at understanding structural variations between solution and crystal states and for new methods development. in this study, we carried out a comprehensive and systematic study of both unrestrained and restrained rosetta refinement for the nmr structures of 40 nesg nmr/x-ray structure pairs. nesg target gr4 was excluded from this study, since it s deposited nmr structure is a single model and our protocol requires the input nmr structure as an ensemble of multiple models. for a subset of these pairs, we also assessed the value of the restrained cs-rosetta method carried out starting from extended conformations. the accuracy of (i) previously deposited pdb nmr structures, which were mostly refined using cns with explicit solvent, (ii) unrestrained rosetta refined structures, (iii) restrained rosetta refined structures, and (iv) restrained cs-rosetta structures generated with nmr restraints starting from extended conformations, were assessed by various structural validation metrics, including restraint violation analysis, comparison against unassigned noesy peak list data, convergence based on ensemble rmsd calculation, and various knowledge-based stereochemical and packing statistics. the rosetta refined structures were further assessed based on their structural similarity with corresponding x-ray crystal structures and by analysis of how useful they are as molecular replacement (mr) templates for solving the corresponding x-ray crystal structure. this comprehensive study demonstrates the significant value of restrained rosetta refinement of protein nmr structures, and provides efficient standard protocols for restrained rosetta refinement that will be broadly useful to the protein nmr community. experimental data for this study were obtained by the nesg consortium for 40 proteins or protein domains solved by both solution nmr and x-ray crystallography and deposited in the pdb as of december 31, 2011. the structures range in size from 5 to 22 kda and include 7 homodimers. most of these nmr structures were refined using a standard nesg refinement protocol involving initial structure generation with cyana followed by structure refinement with cns in explicit water solvent, as described in detail at http://www.nmr2.buffalo.edu/nesg.wiki/. the coordinate files of both nmr structures and x-ray crystal structures were downloaded from the pdb database, along with the nmr restraint and x-ray structure factor files. structure factor files, downloaded in mmcif format, were converted to mtz format using the ccp4 program cif2mtz (collaborative computational project, number 4, 1994). these protein data sets, together with citations to the corresponding pdb files, are summarized in supplementary table s1. another ccp4 program uniquefy was used to standardize the mtz files and select reflections for free r calculation. the nmr restraints files are either in cyana format or in xplor/cns format. the extensive experimental data for the 40 nmr and x-ray structures have been organized in a single publicly available database (http://psvs-1_4-dev.nesg.org/results/rosetta_mr/dataset.html). this compilation of nmr and crystallographic data, which was done as part of this study, will be valuable for future methods development projects. the robetta fragment server was used to generate a fragment library, based on the target protein sequence (excluding chemical shift data). although this process could be done using chemical shift data in the fragment selection, for the refinement protocols developed in this work, chemical shift data were not used in the fragment generation for the rosetta refinement calculations. tests using chemical-shift-based fragment selection demonstrated no significant improvement in the refinement protocol, although there is no a priori reason not to use chemical shift data in the fragment selection for restrained rosetta refinement. for each target protein, fragments from the target protein itself were eliminated from the fragment library. loop regions were then defined by the consensus of (i) secondary structure, (ii) not-well-defined residues identified by the psvs server based on dihedral angle order parameter values, and (iii) noncore residues determined by findcore. for these regions, loop rebuilding was done together with all-atom refinement of the entire structure using the loopmodeling application of rosetta version 3.3, based on cyclic coordinate descent (ccd) and kinematic closure (kic). fastrelax mode was used to allow the whole structure to relax in rosetta all-atom force field. the process was used to sample side chain conformations of the well-defined regions and both backbone and side chain conformations of the loop and not-well-defined regions. the fast relax modes work by running many side chain repack and minimization cycles to locate a low-energy state for the input model. the structural divergence of the starting model to the relaxed model is determined by the resulting energy gap. the structure can change up to 23 from the starting conformation during the minimization cycles. for restrained rosetta refinement, rosetta formatted distance restraints and dihedral angle restraints were generated using the pdbstat restraint converter software and were merged into a single restraint file. although dihedrals are restrained by rosetta s energy terms, where chemical shift data provide reliable dihedral restraint data using talos+, these dihedral restraints were retained in the refinement process. these distance restraints were used in restrained rosetta refinement with an upper-bound tolerance of 0.3, to allow the structure to better relax energetically in the rosetta force field. details of the restraint violation penalty functions are provided in the supporting information. for each individual conformer of the nmr structure ensemble, the restrained rosetta refinement was used to generate 10 decoys, and the one with lowest rosetta energy was selected as the final rosetta refined model for this specific conformer. for homodimeric nmr structures, a symmetry definition file, restraining the structures of protomers to be identical, is generated by rosetta and used to guide rosetta refinement, as outlined in supporting information. the other steps in the restrained rosetta refinement were exactly the same as those outlined above for unrestrained rosetta refinement. sophisticated methods could be used to define the relative weight, w, between knowledge-based rosetta energy terms and experimental restraint terms. in this study, the rational was that at this value of w, plots of total energy (rosetta energy+restraint energy) vs w exhibit a minimum (as shown in supplementary table s3 and figure s5). a detailed protocol for restrained cs-rosetta (rcs-rosetta) calculations, starting from extended conformations, is also included as supporting information. chemical shift information is used in rosetta fragment picking by mfr method using the updated fragment library. then, a total of 10 000 decoys were generated using the abinitiorelax application of rosetta 3.3 with the nmr restraints. for 9 targets in 1022 kda range, 20 000 decoys were generated for each target instead of 10 000 decoys. chemical shift rescores were then calculated for the 1000 lowest rosetta energy decoys, and the 20 lowest rescore decoys are selected as the final rcs-rosetta model. gdt.ts stands for global distance test total score, which measures the 3d similarity of two structures with identical amino acid sequences. the global distance test performs many different sequence-independent superpositions of the model and the gold standard structure and calculates the percentage of structurally equivalent pairs of c atoms that are within specified distance cutoffs d. the gdt.ts score is the arithmetic mean of four scores obtained with distance cutoffs of d=1, 2, 4, and 8. the protein structure validation software suite (psvs) (http://psvs.nesg.org/) was used for structure quality assessment analysis. psvs provides z scores for a variety of widely adopted structural quality measures, such as procheck g factor, molprobity clash score and other structure quality assessment metrics. the procheck all dihedral angle g factor is determined by the stereochemical quality of both backbone and side-chain dihedral angles of proteins, and the molprobity clash score is calculated by the program probe is a measure to reflect the number of high-energy contacts in a structure. structure quality assessments also include ensemble rmsd analysis, restraint violations, (46) and rpf-dp statistics. z scores are computed relative to a set of 252 high-resolution x-ray structures and normalized so that more positive z scores corresponding to better structure quality scores. (21) to evaluate structural similarity between nmr structure models and their x-ray counterparts, we utilized the programs findcore and pdbstat v5.9 to calculate the rmsd of backbone atom and/or all heavy atom positions, for both well-defined residues and for all residues (including those that are ill-defined in the pdb nmr structures). we also used the tm-score program to calculate the gdt.ts global superimposition scores. to further determine rmsd for specific subset of atoms, such as side chain atoms of -helix residues, we used pymol to superimpose nmr structures with reference x-ray crystal structures, then calculated average rmsd based on the structural superimposition. the same procedures were performed to evaluate structural similarity between rosetta refined structures and the corresponding x-ray crystal structures. well-ordered residues are defined by dihedral angle order parameters with s()+s() 1.8 units, and core atoms were calculated using the findcore program based on interatomic distance variance matrices. the dssp program was utilized for annotating secondary structure elements, and solvent accessible areas of atoms were calculated by areaimol program in ccp4 package. the program phaser (version 2.1) was used for estimating diffraction phases by molecular replacement. the programs arp/warp version 7.0 and/or phenix.autobuild were used for automatic model building, based on the phaser mr solution. the arp/warp expert system mode was employed for automatic model building, and refmac5 was used in refinement, staring from the positioned search model, and a maximum of 10 building cycles were allowed. forty nesg nmr structures which have corresponding x-ray crystal structures were downloaded from the pdb and refined using unrestrained and restrained rosetta protocols, as outlined in supporting information. more comprehensive structure quality statistics for these structures are available on line at http://psvs-1_4-dev.nesg.org/results/rosetta_mr/rosettamr_psvs_summary.html. we assessed distance restraint and dihedral angle restraint violations for the 40 protein nmr structures downloaded from the pdb and for the corresponding unrestrained and restrained rosetta refined structures. restraint violations were assessed using the standardized methods of the pdbstat program, against the original distance and dihedral restraint lists (i.e., not accounting for the 0.3 upper-bound tolerance used in the restrained rosetta calculations). distance restraint violations were divided into three categories based on the level of severity; i.e., distance restraint violations between 0.1 and 0.2, between 0.2 and 0.5, and higher than 0.5. dihedral angle restraint violations were divided into two categories: between 1 and 10 and higher than 10. the mean and standard deviations of the number of restraint violations in each category were calculated. these restraint violation statistics for each nmr structure ensemble are summarized in table s2, and the average violations per conformer of the 40 nmr structures assessed for each of the restraint violation categories and for each of three methods are presented in table 1. these distributions of restraint violations obtained for these three data sets are also illustrated graphically in figure 1. the number of restraint violations is significantly reduced by incorporating nmr restraints into rosetta refinement. restraint violations were assessed using pdbstat, across the complete set of 40 nesg nmr structures used in this study. (a) boxplot of the number of distance restraint violations between 0.1 and 0.2. (b) boxplot of the number of distance restraint violations between 0.2 and 0.5. (c) boxplot of the number of distance restraint violations larger than 0.5. (d) boxplot of the number of dihedral angle restraint violations between 1 deg and 10 deg. (e) boxplot of the number of dihedral angle restraint violations larger than 10 deg. knowledge-based statistics were calculated using the programs verify3d, prosaii, procheck, and molprobity, normalized to z=0 for a set of 252 high-resolution x-ray crystal structures. structure quality scores were calculated for the nmr structures available from the pdb (pdb) and for the unrestrained rosetta (r3) and restrained rosetta (r3rst) structures. for each statistic, the mean and standard deviation were computed across the 40 nmr structures and are formatted as mean sd. computed following superimposition of atoms with well-defined atomic positions, as determined by the dihedral angle order parameter method as implemented in psvs. bb_ord, backbone atoms (n, c, c) in well-ordered residues; hvy_ord, all heavy (n, c, o, s) atoms in well-ordered residues; bb_all, backbone atoms of all residues; hvy_all, all heavy atoms in all residues. rpf-dp scores were computed for 35 nmr structures for which noesy peak list data is available, and provide a statistical assessment of the consistency of the 3d nmr structure ensemble with the noesy peak list as provided by the rpf software. as expected, unrestrained rosetta refinement results in a significant number of restraint violations, especially for the most severe violation categories. however, in restrained rosetta refined structures the number and distribution of restraint violations per conformer is similar to, though slightly higher than, those assessed for the nmr structure ensembles deposited in the pdb (table 1 and figure 1). from this analysis we conclude that protocols for incorporating nmr restraints into rosetta refinement are effective in generating rosetta refined nmr structures that satisfy the experimental distance and dihedral angle restraint data as well as the structures deposited in the pdb that have been refined by conventional methods. the resolution of electron density maps and atomic b-factors reflect the precision of x-ray crystal structures. however, there are no such experimental observables to define the precision of solution nmr structures. usually, the rmsd of the ensemble of superimposed nmr conformers is considered to be a useful measure of its overall precision, although as discussed elsewhere this measure can be problematic if there are extensive intramolecular dynamics. we calculated the ensemble rmsd of pdb nmr structures (pdb), unrestrained rosetta refined structures (r3), and restrained rosetta refined structures (r3rst) for each of the 40 protein nmr structure ensembles in our data set. four categories of rmsd were calculated: (i) backbone rmsd of well-defined residues, defined by dihedral angle order parameters, (ii) backbone rmsd of all residues, (iii) heavy atom rmsd of well-defined residues, defined by dihedral angle order parameters, and (iv) heavy atom rmsd of all residues. the mean and standard deviations of rmsds for backbone and for all heavy atoms in these well-defined residues are listed in table 1, and the values for each of the 40 ensembles generated by each of the three protocols are plotted in supplementary figure s1. the rmsd s of unrestrained rosetta-refined structures are higher than pdb nmr structures in all four categories, for both backbone atom and all-heavy atom classes (figure s1a d). ignoring experimental restraints in rosetta refinement (r3) generally increases structural uncertainty for all the backbone and side chain atoms of all residues. for restrained rosetta refined structures (r3rst), in well-defined regions the average rmsd of backbone atoms is comparable with pdb nmr structures (figure s1a), and the average rmsd of all heavy atoms is about 10% lower than pdb nmr structures (supplementary figure s1c). for most targets restrained rosetta refined structures have lower ensemble rmsds in well-defined regions for all heavy atoms (including both backbone and side chain atoms) than pdb nmr structures. these results demonstrate that restrained rosetta refinement has the potential to improve the precision of side-chain atoms. on the other hand, the average ensemble rmsd statistics for all residues (including atoms that are not well-defined in the original pdb nmr ensembles), for both unrestrained and restrained rosetta refined structures, are higher than for the corresponding pdb nmr structures (supplementary figure s1b, d). this demonstrates that when restraints are included, the loop rebuilding process implemented in our rosetta refinement protocol does a better job of sampling the wide range of conformations which are consistent with the experimental data. rpf-dp is a metric used to evaluate how well a protein nmr model fits the experimental unassigned noesy peak list and resonance assignment data. the program calculates recall, precision, and dp scores of the match between short distances in the model and all possible noesy crosspeak assignments. recall is defined as the percentage of peaks in the noesy peak list that are consistent with the interproton distances of the 3d structures. precision is defined as the percentage of close distances (general set at<5) between proton pairs in the query structures whose back calculated noe cross peaks are also actually detected in nmr experiments. the dp score is a normalized f-score calculated from the recall and precision to measure the overall fit between the query structure and the experimental data, with a freely rotating chain model and the quality of the noesy data set defining the lower and upper bounds, respectively, of the f-measure. noesy peak list data are available for 35 of the 40 protein nmr/x-ray structure pairs used in this study. the mean and standard deviations of recall, precision, and dp score are listed table 1, and boxplots of recall, precision, and dp score are shown in figure 2. unrestrained rosetta refined structures generally have precision similar to pdb nmr structures but lower recall and dp scores, i.e., in general, the unrestrained rosetta refined structure does not fit the noesy peak list data as well at the pdb nmr structures. on the other hand, restrained rosetta refined structures have recall, precision, and dp scores that are essential identical to those of the pdb nmr structures (table 1 and figure 2a c). while the majority of the nmr structures generated by unrestrained rosetta refinement (r3) have dp scores lower than the pdb nmr structures, most structures refined by the restrained rosetta protocol (r3rst) have dp scores similar to pdb nmr structures (figure 2c, d). in a few cases, the restrained rosetta refined nmr structures have significantly better dp scores compared with the corresponding pdb nmr structure (figure 2d). rosetta-refined structures have rpf-dp scores, comparing the structure against the unassigned noesy peak list, similar to those of structures deposited in the pdb. (a) boxplots of recall scores for structures deposited in the pdb or refined with rosetta protocols. (b) boxplots of precision scores for structures deposited in the pdb or refined with rosetta protocols. (c) boxplots of dp- scores for structures deposited in the pdb or refined with rosetta protocols. dp-scores of the pdb nmr structures are plotted on the x-axis, while the dp-scores of both the unrestrained rosetta refined structures represented by red solid triangle symbols (r3) and restrained rosetta refined structures represented by blue solid rectangle symbols (r3rst) are plotted on the y-axis. the black dashed line indicates y=x. data are presented for 35 nmr structures for which noesy peak list data are available. as no distance restraints are enforced during the unrestrained rosetta refinement process, the refined structures do not satisfy distance restraints as well as the pdb nmr structures. they also do not fit as well to the unassigned noesy peak lists data because the distance restraints are directly derived from noesy peak lists. on the other hand, when distance restraints are incorporated into rosetta refinement, the refined structures generally fit the noesy peak list data as well or better than the pdb nmr structures that have been refined by conventional methods. we used psvs to calculate a variety of knowledge-based structural quality z scores, including verify3d, prosa, procheck backbone g factor (procheck_bb), procheck all dihedral angle g factor (procheck_all), and molprobity clash scores. these scores are normalized so that more positive z scores correspond to better values of these knowledge-based metrics. the mean and standard deviation of those z scores for the 40 nmr structures generated by the three methods (nmr pdb, unrestrained rosetta, and restrained rosetta) are summarized in table 1. both unrestrained and restrained rosetta refined structures have better (i.e., more positive) z scores for all the five measures, especially for procheck all dihedral angle g factor and molprobity clash score z scores. boxplots of procheck_bb, procheck_all, molprobity clash score z scores for these nmr pdb and unrestrained and restrained rosetta refined structures are shown in figure 3a, c, e. rosetta refined structures consistently have improved procheck_bb, procheck_all, and molprobity clash score z scores. (a) boxplot of procheck backbone dihedral angle g-factor z-scores for structures refined with different protocols. (b) scatterplot of procheck backbone dihedral angle g-factor z-scores. (c) boxplot of procheck all dihedral angle g-factor z-scores for structures refined with different protocols. (d) scatterplot of procheck all dihedral angle g-factor z-scores. (e) boxplot of molprobity clashscore z-scores for structures refined with different protocols. (f) scatterplot of molprobity clashscore z-scores. in the scatter plots (b), (d) and (f), the z-scores of unrestrained rosetta refined structures (r3) are plotted on the x-axis, while the z-scores of restrained rosetta refined structures (r3rst) are plotted on the y-axis. in order to further investigate the effect of incorporating experimental restraints into rosetta refinement on these knowledge-based z scores, we also made 2d scatter plots of procheck_bb, procheck_all, and molprobity clash score z scores comparing unrestrained and restrained rosetta refined structures. in figure 3b, d, f the z scores of unrestrained (r3) and restrained rosetta refined structures (r3rst) are plotted on x- and y-axes respectively. the procheck_bb z scores of restrained rosetta refined structures are consistently better than unrestrained rosetta refined structures (figure 3a, b). this is attributable to the fact that the experimental dihedral angle restraints and local noe data are very helpful in guiding rosetta to generate decoys with more accurate backbone stereochemical quality. procheck_all z scores, which include side chain dihedrals, are also marginally improved for the restrained rosetta refined structures (figure 3c, d). on the contrary, the molprobity clash score z scores of unrestrained rosetta refined structures are generally better than restrained rosetta refined structures (figure 3f). however, while the unrestrained rosetta refined structures have fewer molprobity clashes, they are less converged and sometimes underpacked relative to restrained rosetta refined structures. overall, these data demonstrate that stereochemical quality and geometry of pdb nmr structures can be significantly improved by rosetta refinement carried out with or without restraints. however, the restrained rosetta refinement protocol provides structures that have both improved z scores (figure 3) and simultaneously fit well to both the experimental distance restraints (figure 1) and the unassigned noesy peak list data (figure 2). theoretically, solution nmr structures need not necessarily be identical to x-ray crystal structures, which are determined in a crystalline environment. in addition, these crystal structures were determined with cryoprotection at 77 k, while the nmr structures were determined in solution at 300 k. in particular, crystal packing effects may stabilize conformers that do not predominate in solution. however, since x-ray structures are highly hydrated, with relatively few intermolecular contacts, one might expect that such effects are the exception rather than the rule and that the dominant structure in solution characterized by nmr should generally be very similar to the x-ray crystal structure that is obtained for the same protein construct. this conclusion is supported by comparisons of protein structures in different crystal forms, which generally agree within an rmsd of<0.5. based on these considerations, and assuming the x-ray structure to be a accurate representation of the predominant solution structure, we also assessed whether or not rosetta refinement, with or without experimental restraints, moves the pdb nmr structures closer to their x-ray counterparts. for this assessment, we calculated the gdt.ts between (i) pdb nmr structures, (ii) unrestrained rosetta refined structures, and (iii) restrained rosetta refined structures, with their corresponding x-ray structures. nesg target drr147d was left out of this analysis because its solution nmr structure is a monomer solved at ph 4.5, while its x-ray structure is a dimer solved at ph 6.0, and nmr studies demonstrate a significant structural change over this ph range (data not shown). these results for the remaining 39 nesg nmr/x-ray pairs are summarized in a gdt.ts scatterplot (figure 4), with the gdt.ts of pdb nmr structures relative to the corresponding x-ray crystal structure on the x-axis and gdt.ts of the unrestrained or restrained rosetta refined structures on the y-axis. based on observations of previous studies done with a much small number (i.e., 1 or 2) of protein targets, we expected unrestrained rosetta refinement would generally move nmr structures closer to their x-ray counterparts. however, as illustrated in figure 4, using this larger data set of 39 nmr/x-ray pairs after unrestrained rosetta refinement (r3), only 17 of 39 targets exhibit higher gdt.ts values, 6 targets remain about the same, and 16 of the protein ensembles have lower gdt.ts values than the nmr structures refined by conventional methods and deposited in the pdb. on average, unrestrained rosetta refinement improved the gdt.ts by only 0.4%. on the other hand, as illustrated in figure 4, restrained rosetta refinement (r3rst) generally improved the gdt.ts score to the x-ray crystal structure, compared with the nmr structure deposited in the pdb; 32 of 39 targets have better gdt.ts values, 4 targets remain about the same, and only 3 targets have slightly lower gdt.ts values. on average, restrained rosetta refinement improved the gdt.ts scores of the pdb nmr structures by 2.5%, with some increasing by as much as 10%. restrained rosetta refined structures are more similar to their corresponding x-ray crystal structures than pdb nmr structures. gdt.ts values of pdb nmr structures to corresponding x-ray structures are plotted on the x-axis, and gdt.ts values of both unrestrained rosetta refined structures (r3, represented by red solid triangle) and restrained rosetta refined structures (r3rst, represented by blue solid rectangles) to their corresponding x-ray structures are plotted on the y-axis. the two green dash lines indicate gdt.ts of pdb nmr structures equal to 0.7 and 0.85 respectively. the black dash line indicates y=x, and the two gray dash lines indicate y=x +0.05 and y=x 0.05 respectively. further analysis of the data of figure 4 indicates that when the similarity between the conventionally-refined nmr structure and the corresponding x-ray crystal structure is moderate (0.7 gdt.ts 0.85), more often than not, rosetta refinement can move nmr structures closer to their x-ray counterparts when the experimental restraints are incorporated. however, in cases where the similarity between nmr and x-ray structures is initially high (gdt.ts>0.85), more often than not, unrestrained rosetta refinement moves nmr structures further from their x-ray counterparts, while the improvement provided by restrained rosetta refinement is less dramatic (figure 4). we further investigated in these data how restrained rosetta refinement improves the similarity between nmr and x-ray structures by rmsd calculations. as illustrated in figure 5 (top panel), restrained rosetta refinement consistently improved the agreement between nmr and x-ray structures for both backbone and side chain atoms. the lower panel provides some comparisons between the mediod nmr conformer (i.e., the single conformer in the nmr ensemble most like all the other members of the ensemble) before and after restrained rosetta refinement, and the corresponding x-ray crystal structure coordinates. typically, improvements in accuracy are the result of better packing between secondary structure elements. often, this improves the accuracy of interhelical orientations, as shown for example in figure 5 for nesg targets hr3646e and hr4435b. for dhr29b, in order to emphasize the structural changes, only the last two c-terminal strands are plotted. in this case, the two-residue strand (7677) of the nmr structure deposited in the pdb is extended to six residues long (7681) after restrained rosetta, which is more consistent with corresponding x-ray crystal structure. the agreement between nmr structures and their x-ray counterparts are generally improved following restrained rosetta refinement. top: plot of differences of rmsd to x-ray crystal structures before and after restrained rosetta refinement. the nesg nmr/x-ray pair target index is plotted on the x-axis, and the differences between the rmsd of pdb nmr structures to their corresponding x-ray structures and the rmsd of restrained rosetta refined structures to their corresponding x-ray structures are plotted on the y-axis in units of ngstroms. the four subpanels summarize data for well-defined (lower half) and not-well defined (upper half) residues, and for backbone (left) and sidechain (right) atoms. well-defined vs not well-defined residues are defined by s(phi)+s(psi) 1.8. bottom: superimposition of x-ray, nmr and restrained rosetta refined structures. left hr3646e; middle hr4435b; right dhr29b. the structures are color coded as: magenta- x-ray crystal structure; cyan nmr structure deposited in pdb; blue restrained rosetta refined structure. for dhr29b, only the last two c-terminal beta strands are plotted. on average, the improvement of structural similarity to corresponding x-ray structure resulting from restrained rosetta refinement is modest. however, restrained rosetta refinement drives some nmr structures significantly closer to their x-ray counterparts, as much as 0.45 and 0.55 rmsd, respectively, for backbone and side chain atoms in well-defined regions (figure 5 top). specific atom positions change by as much as 13 (as illustrated in some of the examples of superimposed structures shown in figure 5 bottom). these changes may be biologically significant and can have significant effects on the phasing power of the structure, as illustrated below. the fact that restrained rosetta refinement consistently improves the accuracy of nmr structures relative to the corresponding x-ray crystal structure is a significant observation. in order to explore this in more detail, we compared the rmsd between either refined nmr or deposited nmr structures relative to x-ray crystal structures for several different classes of atoms. these included (i) atoms in well-defined residues (defined by dihedral angle order parameters), (ii) well-defined core atom sets calculated by findcore program, (iii) atoms in buried residues, and (iv) atoms in regular secondary structure elements. comparisons were made for both unrestrained rosetta refinements (summarized in supplementary figure s2) and for restrained rosetta refinements (summarized in supplementary figure s3). more often than not, restrained rosetta refinement also improved the agreement between nmr structures and x-ray structures for (i) not-well-defined regions, (ii) noncore residues, (iii) surface residues, and (iv) loop regions as well as for well-defined backbone and side-chain atoms. for classes of atoms in regions of the structure that are not-well-defined (i.e., less well converged) in the nmr ensemble, the improvement is often quite substantial, as illustrated in the top half of figure 5 for some structures the accuracy relative to the corresponding crystal structure improves by 1.02.5 rmsd in loop regions. this reflects the ability of rosetta to accurately model regions of the protein structure, such as surface loops, that are under-restrained by the experimental nmr data. molecular replacement (mr) is widely used for addressing the phase problem in x-ray crystallography. historically, the common notion in the structural biology community is that the quality of nmr structure is often not good enough for mr, even when the sequence of the search model is identical to the target x-ray structure. however, as demonstrated by a recent study with 25 nesg nmr/x-ray pairs, protein nmr structures prepared by excluding not-well-defined atom positions using an interatomic variance matrix-based protocol can generally be used successfully as mr templates. additionally, the phasing power of nmr structures that failed to provide good mr solutions was observed to be improved by unrestrained rosetta refinement in two cases. using the extensive set of nmr/x-ray pairs, we critically assessed this hypothesis by comparing the phasing powers of the conventionally-refined pdb nmr structures with those of unrestrained and restrained rosetta refined structures. we prepared the mr starting models for pdb nmr structures, unrestrained rosetta refined structures, and restrained rosetta refined structures by first eliminating not-well-defined atoms using the findcore protocol. two targets (drr147d, er382a) were excluded in this study due to the following facts: the nmr structure of target er382a (pdb i d: 2jn0) was solved as a monomer without a ligand, whereas its crystal structure counterpart (pdb i d: 3fif) has eight subunits in the asymmetric unit and was solved in complex with a heptapeptide ligand and appears to have a distinct structure, i.e., the c rmsd between the nmr structure and chain a of the crystal structure is 2.44. as mentioned above, the nmr structure of target drr147d (pdb i d: 2kcz) is a monomer solved at ph 4.5, while its crystal structure counterpart (pdb i d: 3ggn) is a dimer solved at ph 6.0, with significant structural changes in backbone structure due to ph-induced dissociation of the dimer. the remaining 38 nmr/x-ray pairs were used to assess the impact of restrained rosetta refinement on the mr phasing power of the nmr ensemble. for the initial rosetta refinement protocol, the decoys are picked solely based on rosetta energy, that is, we picked the top 20 decoys with the lowest rosetta energy from the entire pool of decoys generated from all the conformers in nmr structure ensemble. it was observed, however, that frequently those 20 decoys originated from the same one or two similar conformers in the unrefined nmr ensemble; thus the structural variance information within the nmr ensemble is lost using this simple decoy picking process. in order to preserve the conformational variability information within the nmr ensemble, we adopted a protocol in which the one lowest-energy rosetta decoy was selected from the ensemble of decoys generated from each nmr conformer. as shown in figure 6a, b, the resulting rosetta ensembles are much better mr templates and also fit the noesy peak list data better than the rosetta ensembles generated by our initial protocol, as manifested by the significantly improved tfz and dp scores for the majority of the targets. these ensembles of rosetta refined (with or without restraints) conformers were then trimmed to exclude not-well-defined atoms using findcore and used as templates for phaser as described previously. for rosetta refinement of nmr structure, preserving ensemble information is beneficial for mr success. scatterplot of phaser tfz scores (a) and dp-scores (b) for two different protocols for selecting models for mr. decoy(energy) rosetta-refined structure ensembles are composed of the 20 lowest rosetta energy decoys from the entire pool of decoys generated from all the nmr conformers. decoy(conformer+energy) rosetta-refined structure ensembles are composed of each lowest rosetta energy decoy generated from each nmr conformer. the scores of structures picked by decoy(energy) protocol are plotted on the x-axis, and the scores of structures picked by decoy(conformer+energy) protocol are plotted on the y-axis. unrestrained rosetta refined structures are represented by red solid triangles and restrained rosetta refined structures are represented by blue solid rectangles. data are summarized for 38 nesg nmr/xray pairs used in the crystallographic mr study. starting from phaser mr solutions obtained by three methods [nmr pdb, unrestrained rosetta refinement (r3), and restrained rosetta refinement (r3rst)] for 38 nmr structures, we utilized phenix and arp/warp for automatic model rebuilding and refinement. models generated by either software with the lowest rfree values were chosen as the final structures solved by mr. hence 114 crystal structures were determined from the nmr structures and compared with the corresponding x-ray crystal structure available in the pdb. for each target, the rfree values of the final mr structures are plotted against the sources of their templates in figure 7. structures generated using the ensembles of pdb nmr structures, unrestrained rosetta refined structures, and restrained rosetta refined structures are represented by black, red, and green dots, respectively. the green dashed line indicates rfree=0.3, and the red dashed line indicates rfree=0.45. data points above the red dashed line (rfree>0.45) are considered as failed mr solutions. starting from nmr structures deposited in the pdb as mr templates, seven targets (zr18, sgr145, rpr324, str65, spr104, sr478, hr4435b) failed to provide valid mr solutions. four of these (rpr324, str65, sr478, hr4435b) provided good mr solutions after rosetta refinement with or without experimental restraints. one target (zr18) provided a good mr solution and another target (spr104) a borderline acceptable mr solution (gdt.ts between mr structure and x-ray structure is 0.875) only after restrained rosetta refinement. two targets (hr41, srr115c), which originally provided valid mr solutions when using their pdb nmr structures as mr templates, failed to provide valid mr solutions after unrestrained rosetta refinement but could be solved after restrained rosetta refinement. only one target (sgr145) failed to provide good mr solutions with any of the protocols, even after restrained rosetta refinement. sgr145 is a sparse-restraint nmr structure, and its c rmsd to the corresponding x-ray structure is relatively large (3.1). restrained rosetta refined nmr structures provide better templates for mr, and generally yield crystal structures with better rfree scores. dotplot of rfree values of mr structures using mr templates for 38 nesg nmr/x-ray pairs deposited in the pdb or refined by rosetta. pdb nmr structures (pdb), unrestrained rosetta refined structures (r3) and restrained rosetta refined structures (r3rst) are colored black, red and green respectively. each subpanel represents one nesg target, and the subpanels are organized in ascending order of the resolution of its x-ray crystal structure from bottom left corner to top right corner. the same conclusion can be drawn from figure s4, comparing the gdt.ts of the x-ray crystal structure models phased using the pdb nmr structures or rosetta refined structures as mr templates, and autotraced, compared to the corresponding x-ray crystal structures deposited in the pdb. most of these crystal structures deposited in the pdb were solved by anomalous dispersion (sad or mad) methods. these data further demonstrate that when the nmr structures available from the pdb are poor mr templates to start with, with gdt.ts <0.8, their phasing power and the quality of the resulting crystal structure solution were generally significantly improved by restrained rosetta refinement. as is also illustrated in figure 7 for targets srr115c, psr293, and hr41, if the initial nmr structures are good mr templates, their phasing power can potentially deteriorate by unrestrained rosetta refinement. therefore, despite the fact that unrestrained rosetta refinement has been reported to sometimes improve the phasing power of nmr structures, ignoring the experimental restraints is not recommended when preparing nmr structures for use in phasing crystallographic data by molecular replacement. for thirteen nmr structures with gdt.ts<0.85 relative to their x-ray counterparts, we also carried out restrained cs-rosetta (rcs-rosetta) calculations, starting from extended conformations, using the same restraints used in the corresponding restrained rosetta refinement calculations. rcs-rosetta calculations are much more cpu intensive than the restrained rosetta refinement protocol outlined above, requiring 45 times more cpu time for proteins in the size range of 510 kda and exponentially longer times for larger proteins. these results are summarized in table 2. for proteins<10 kda, the restrained cs-rosetta structures (cs-rrst) were slightly closer to the x-ray structure than the corresponding restrained rosetta refined structures (r3rst), especially for targets er382a and zr18. on the other hand, for proteins in the 10 22 kda range, the faster r3rst restrained rosetta refinement protocol provides structures with accuracy, relative to their x-ray counterparts, similar to the computationally-intensive cs-rrst protocol. indeed, for the 19 kda target hr41, the faster r3rst protocol provided a more accurate structure than the restrained cs-rosetta protocol. these results demonstrate that the two restrained rosetta protocols described in this work, r3rst which refines a structure initially modeled with other methods and cs-rst which generates a structure starting from an extended conformation, are well suited for small to medium sized proteins, of up to about 25 kda. while restrained cs-rosetta (cs-rst) can provide slightly more accurate structures, the improvements relative to the restrained cs-rosetta (r3rst) results are often marginal relative to the much longer cpu times required. number of residues, excluding short disordered purification tags. molecular weight (kda). the quality of solution nmr structures is mainly determined by two factors: the accuracy and completeness of experimental data and the algorithm and energy force field used in structure calculation and refinement. in the past few years, several papers have demonstrated that unrestrained rosetta refinement can improve the stereochemical quality of nmr structures and move nmr structures closer to x-ray crystal structures. these observations may be explained by an interesting hypothesis: once the protein conformation has been placed in a near-native structure using experimental restraints, energy minimization by all-atom relaxation in the rosetta energy field without restraints can produce a more accurate structure than is obtained using the restraints. in this interpretation, the small errors in the nmr experimental restraints, which are in conflict with the x-ray structure, can be circumvented or corrected using the unrestrained energy force field. in this study, we tested this hypothesis in a large-scale investigation of the impact of rosetta refinement on nmr structure accuracy, and the significance of experimental restraints in rosetta refinement. this analysis has allowed us to design a protocol for using rosetta to improve the quality of protein nmr structures with tractable computational cpu requirements. as would be expected, restrained rosetta refinement of nmr structures produces models with much fewer restraint violations than models generated by unrestrained rosetta refinement. this result is significant in that it demonstrates that our restrained rosetta refinement protocol is self-consistent with respect to a large number of experimental restraints, validating the accurate implementation of restraint conversions by pdbstat software and interpretations of these restraints by the rosetta program. we observed that if the relative weights on restraints are too high, the final rosetta refined models are over restrained and often end up with poor rosetta energies. on the other hand, if the weights of restraints are too low, the final rosetta refined models exhibit a large number of restraint violations, and the restraint information is not fully utilized. an important concern in assessing nmr method development regards which structure to used as the gold standard of accuracy. although the natural choice is the corresponding x-ray crystal structure, this issue has been controversial insofar as the crystal structure may be influenced by the structural and energetic requirements of intermolecular packing. for example, the crystal lattice may select for one of multiple conformational states of the protein structure. moreover, protein x-ray crystal structures are often determined using cryoprotected crystals at 77 k, while nmr structures are generally determined at 2040 c. none the less, as we have demonstrated elsewhere, except under special circumstances, the solution nmr structure is generally quite similar to the crystal structure and can be used for phasing by molecular replacement methods. hence, we contend that the crystal structure is an excellent proxy for nmr structure accuracy. the availability of these 40 nmr/x-ray pairs together with extensive raw experimental nmr and diffraction data (summarized in supplemental tables s1 and s2) will greatly facilitate the testing and development of new methods for protein nmr structure refinement and analyses of subtle structural differences between crystal and solution nmr structures. judged by ensemble rmsd analysis, unrestrained rosetta refinement generally decreases the precision of nmr structures, while restrained rosetta refinement can increase the precision of the side chain heavy atoms of otherwise well-defined residues. additionally, restrained rosetta refined structures fit the unassigned noesy peak list data significantly better than unrestrained rosetta refined structures. rosetta refinement can generally improve the stereochemical quality and geometry of nmr structures. more specifically, the experimental backbone dihedral angle restraints can guide rosetta to generate models with even better backbone structures than is achieved without restraints. in most cases, restrained rosetta refinement will move protein nmr structures closer to their x-ray counterparts, while unrestrained rosetta refinement often fails to do so, especially when the structural similarity between the nmr and x-ray structures is high (gdt.ts>0.85). for nmr structures with poor phasing power, rosetta refinement can often be used to generate mr templates which are better able to guide phasing software, such as phaser, to identify correct mr solutions. the phasing power of the template and the accuracy of the resulting crystal structures are better when experimental restraints are utilized in rosetta refinement. indeed, unrestrained rosetta refinement can sometimes make nmr structures less useful mr templates, even when they are good mr templates to start with. with respect to our hypothesis regarding final-stage unrestrained rosetta refinement providing more accurate structures than can be achieved using all of the experimental restraints, this comprehensive study with 40 nmr/x-ray pairs demonstrates that the majority of nmr experimental restraints are completely consistent with the corresponding x-ray structures. while in some cases, a few inaccurate restraints may be identified using an unrestrained rosetta refinement protocol as proposed by ramelot et al., the most accurate structures, with the highest phasing power, were obtained by combining the experimental restraints with the sophisticated algorithms and the more advanced force field of rosetta. we also computed rosetta energies of relaxed x-ray and relaxed nmr structures. the structures are first idealized using rosetta idealization application and then are relaxed in rosetta all-atom energy field. the relaxed x-ray structures generally have lower rosetta energy per residue, while the relaxed nmr structures, the r3-refined nmr structures, and the r3rst-refined nmr structures generally have slightly higher, similar rosetta energies. this suggests that even our r3rst-refined nmr structures have some room for improvement in terms of their energies. while they are more accurate relative to the corresponding x-ray crystal structure and generally satisfy the experimental restraint data, restrained rosetta refined structures have modestly more small distance restraint violations than the nmr structures from which they are derived. as discussed in detail elsewhere, these small restraint violations associated with rosetta refined nmr structures may reflect inaccuracies in the interpretation of upper-bound distance restraints from noesy data due various effects, including relaxation-modulation of noe intensities in heteronuclear filtered noesy data and the effects of dynamic averaging. it is generally not possible to satisfy all of the experimental restraints in a r3rst refinement. this is evidenced first from the fact that the lowest-energy rosetta structures generated in this study [i.e., the unrestrained rosetta refined (r3) structures] have poorer agreement with the noesy peak list data (i.e., lower dp scores summarized in figure 2) than restrained rosetta refined (r3rst) structures. the r3 structures also often diverge from the x-ray structures (figure 4), our best proxy for a gold standard. the inconsistency between the noe-derived distance restraints and rosetta energy terms is also illustrated in analyses presented in supplementary figure s5 and table s3; increasing the relative weight on restraint terms allows excellent satisfaction of restraints but results in structures with higher rosetta conformational energies. accordingly, there is some fundamental inconsistency between our minimum rosetta energy structures, the noesy peak list data, the nmr restraints, and the gold standard x-ray crystal structures. in order to further investigate potential inaccuracies on the noe-derived restraints themselves, we also assessed how well the corresponding x-ray crystal structures fit these nmr restraint data. hydrogen atoms were added to the x-ray structure coordinates using rosetta idealization application, which rebuilds molecules using ideal bond lengths, bond angles, and torsion angles. all those resulting idealized x-ray structures have quite a few restraint violations, and the number of restraint violations varies from target to target. no attempt was made to further adjust the x-ray crystal structures to better match the nmr restraint data. inconsistencies between the nmr restraints, the x-ray crystal structures, and the rosetta energy function arise from several sources, including (i) the crystal lattice, which may stabilize a subset of the conformations that are present in the solution nmr experiments and that contribute to the noesy data, (ii) the noesy data arise from ensemble averages of dynamic distributions which are not captured by the methods used in these studies to model restraints and nmr structures, and (iii) there may be inaccuracies in the rosetta potential energy function. however, aside from these fundamental challenges in modeling protein structures from nmr data, it is not surprising that the lowest-energy models do not perfectly satisfy the noe-derived distance restraints. these distance restraints are interpreted from noesy spectra assuming a simple two-spin approximation, single isotropic rotational correlation time, uniform linewidths, identical relaxation in filtering through bound c and n atoms, and many other assumptions that are simply not correct. the details of how upper bound distance restraint violations were defined are different as various laboratories across the nesg use somewhat different methods for calibrating these distances. although noesy peak lists (usually providing resonance intensities) are available for many of the data sets, the issues of linewidths and differential relaxation in different x-filtered noesy spectra can not be addressed with the available data. it could be interesting to compare simulated spectra generated for r3 and r3rst models using full-relaxation matrix analysis with relaxation-corrected, integrated, noesy spectra data, but such an analysis is beyond the scope of the current work. an alternative method for incorporating the rosetta force field into the nmr structure determination process is restrained cs-rosetta (rcs-rosetta) in which structures are generated starting from extended conformations with nmr restraints and the cs-rosetta protocol. generally, for a 100-residue protein rcs-rosetta calculations require about 510 times more cpu time to generate each decoy than restrained rosetta refinement. the difference in cpu time becomes even larger as the size of protein increases. rcs-rosetta calculations generally require tens of thousands decoys in order to ensure convergence, compared to only hundreds of decoys required for restrained rosetta refinements which begin with native-like conformations as the starting point. hence, the restrained rosetta refinement protocols used here are some 200500 (or more) times faster than restrained cs-rosetta methods. for example, for a 100 residue protein, rcs-rosetta calculations required about 4000 min to generate 10 000 decoys using 20 2.5 ghz processors (0.4 min per decoy). for the same size protein, cyana structure generation followed by restrained rosetta refinement requires about 1020 min per for an ensemble of 20 conformers. the rasac iterative cs-rosetta protocol may sometimes provide more accurate structures using restrained cs-rosetta, but it is even more cpu intensive. therefore, for proteins of more than 10 kda, a good practice is to use traditional methods for nmr structure generation, followed by restrained rosetta refinement. although rosetta refinement can modify the input conformation to some extent, rosetta refined structures will not deviate significantly from the input structure because the rosetta refinement protocol samples only conformations that are close to the initial nmr structure. if the nmr structures are highly inaccurate to begin with, these severe structural differences can not be corrected by the restrained rosetta refinement protocol alone. moreover, for sparse-restraint nmr structures, such as the sgr145 target, additional information, such as evolutionary restraints, or more advanced sampling techniques, such as rasrec rosetta, may also be required to obtain the most accurate nmr structures. in comparison with nmr structures refined by traditional methods, restrained rosetta refined structures fit the experimental nmr data equally well and are of significantly better stereochemical and geometric quality. rosetta refinement drives nmr structures to be more similar to their x-ray counterparts, thus increasing their phasing power. despite the fact that they are more accurate relative to the corresponding x-ray crystal structure, restrained rosetta refined structures tend to have slightly higher distance restraint violations. this may reflect inaccuracies in the interpretation of nmr data in terms of upper bound restraints, providing guidance to the experimentalist to confirm and possibly refine these interpretations of the raw experimental data. the restrained rosetta refinement protocols described here utilize nmr structures initially determined by more conventional methods as input. they are much less cpu intensive than restrained cs-rosetta methods, which generate nmr structures from extended starting structures, and provide comparable or better results. all of the nmr and crystallographic experimental data used in this project are available on line at: http://psvs-1_4-dev.nesg.org/results/rosetta_mr/data set.html. coordinates of the unrestrained and restrained rosetta refined structures, together with structure quality assessment reports, are available on line at: http://psvs-1_4-dev.nesg.org/results/rosetta_mr/rosettamr_psvs_summary.html

we have found that refinement of protein nmr structures using rosetta with experimental nmr restraints yields more accurate protein nmr structures than those that have been deposited in the pdb using standard refinement protocols. using 40 pairs of nmr and x-ray crystal structures determined by the northeast structural genomics consortium, for proteins ranging in size from 522 kda, restrained rosetta refined structures fit better to the raw experimental data, are in better agreement with their x-ray counterparts, and have better phasing power compared to conventionally determined nmr structures. for 37 proteins for which nmr ensembles were available and which had similar structures in solution and in the crystal, all of the restrained rosetta refined nmr structures were sufficiently accurate to be used for solving the corresponding x-ray crystal structures by molecular replacement. the protocol for restrained refinement of protein nmr structures was also compared with restrained cs-rosetta calculations. for proteins smaller than 10 kda, restrained cs-rosetta, starting from extended conformations, provides slightly more accurate structures, while for proteins in the size range of 1025 kda the less cpu intensive restrained rosetta refinement protocols provided equally or more accurate structures. the restrained rosetta protocols described here can improve the accuracy of protein nmr structures and should find broad and general for studies of protein structure and function.

PMC4129517

pubmed-826

a variety of non-prescription slimming products are now readily available on the market, which are often advertised to contain purely natural ingredients, hence assumed to be harmless. however, these products may contain prescription weight-loss agents or banned pharmaceutical analogues that are not mentioned on the pack or in the patient information leaflet, and therefore may result in significant toxicities and even mortality.1)2) sibutramine, which has now been banned due to cardiovascular adverse effects, is one of the most commonly encountered illicit adulterants in non-prescription slimming pills.2) we describe a rare case of dilated cardiomyopathy with massive left ventricular (lv) thrombus in an otherwise healthy 32-year-old man who was taking sibutramine-containing slimming products. a 32-year-old man was admitted with progressively worsening dyspnea on exertion of 1 month duration. the patient was not known to have hypertension, diabetes or any other medical illness. he reported having taken the unauthorized health product, " slim-30 ", for the last 7 months and had stopped taking it 2 weeks ago. several medicines regulatory authorities are warning that this product contains an undeclared pharmaceutical ingredient, n-desmethyl sibutramine, an analogue of sibutramine, which has now been banned because of cardiovascular adverse effects. when the drug was first started, his body mass index was 26.3. from the outset the patient presented higher blood pressure and palpitation, on admission, initial vital signs were as follows: blood pressure of 110/80 mm hg, pulse rate of 130 beats/min, respiration rate of 20 breaths/min, and body temperature of 36.5. upon physical examination, pitting edema in both lower extremities was noted and a s3 gallop sound was audible. chest x-ray showed cardiomegaly (cardiothoracic ratio was 0.60) and no pulmonary edema (fig. the cardiac enzymes were within the normal range with a troponin-t level of 0.023 ng/ml (normal 0.100) and creatine kinase-mb level of 1.86 ng/ml (normal 4.94). however, pro-b-type natriuretic peptide level was elevated to 5404 pg/ml (normal 88). a complete blood cell count, coagulation profile, and thyroid function test were within normal limits. liver enzymes were elevated with an aspartate aminotransferase level of 80 iu/l and alanine transaminase level of 120 iu/l. the transthoracic and transesophageal echocardiogram revealed dilated lv (end-diastolic diameter of 6.5 cm) with severely impaired systolic function {ejection fraction (ef) of 23%} and multiple hyperechoic, pedunculated masses attached to the lv apical wall, of which the largest measured 4.61.5 cm in size (fig. severe lv systolic dysfunction, the mass-like lesions were suspected of thrombi. the patient was started on diuretics, angiotensin-converting-enzyme inhibitor (acei) and parenteral unfractionated heparin. he had a good clinical response to treatment and subsequent echocardiogram performed 10 days later showed that lv thrombi had nearly dissolved, although there was only a slight improvement in lv dilatation and contractility. multi-detector computed tomographic coronary angiography, which was performed before discharge, showed normal a coronary artery (fig. he was discharged in a stable condition and prescribed a beta blocker, acei, and oral warfarin. at 1 month follow-up, echocardiogram demonstrated complete resolution of lv thrombi and markedly improved lv systolic function (ef of 45%) and dilatation (end-diastolic diameter of 5.6 cm) (fig. the patient is currently doing well and is being followed up via the outpatient department. sibutramine (meridia, reductil, ectiva, abbott laboratories, abbott park, il, usa) was approved by the u.s. food and drug administration in 1997 and was approved for use in the european union (eu) in 1999 for the long-term (12 months) management of obesity. sibutramine and its two active metabolites, n-desmethyl and n-bisdesmethyl sibutramine, act centrally to inhibit serotonin and noradrenaline (norepinephrine) reuptake leading to satiety and act peripherally to increase metabolic rate, thermogenesis, and energy expenditure by stimulating 3-adrenergic receptors.3) such sympathomimetic activity of sibutramine causes a modest increase in heart rate and blood pressure,4)5) which can potentially increase the risk of adverse cardiovascular outcome in susceptible patients. since 2002, serious adverse events including cardiac arrhythmia (qt interval prolongation), myocardial infarction (mi), and death had been reported in sibutramine-treated patients.6-12) this led to a contraindication of the use of this drug in patients with established coronary heart disease, previous stroke, heart failure, or cardiac arrhythmias. in the sibutramine cardiovascular outcomes trial, subjects with pre-existing cardiovascular disease who were receiving long-term sibutramine treatment (5 years) had an increased risk of nonfatal mi and nonfatal stroke but not of cardiovascular death or death from any cause.5)13) on the basis of this trial, sibutramine was withdrawn from the eu in january 2010 and subsequently withdrawn from parts of asia and the u.s. market in october 2010.14-16) however, sibutramine has still been found in adulterated non-prescription slimming products or natural herbal products.1)17) these products, of which ingredients are not declared, are usually found to contain n-desmethyl sibutramine in concentrations far above the maximum daily dose (5 to 15 mg).1)17) the unperceived use of this substance may be even more hazardous and lead to unpredictable complications and even mortality for individuals without any cardiovascular risk factor. therefore, more effective and proactive measures are required to guard against illicit use of slimming products containing n-desmethyl sibutramine or other banned pharmaceutical analogues such as n-nitrosofenfluramine. one case has been reported of reversible cardiomyopathy possibly associated with sibutramine.18) however, cases of patients who presented with dilated cardiomyopathy with massive intracardiac thrombus secondary to sibutramine use have not been reported. in our case, the patient did not have any attendant cardiovascular risk factors and another culpable agent was not identified. we excluded other etiologic causes of reversible cardiomyopathy such as alcohol abuse, abnormal thyroid function, and coronary heart disease. the chance of myocarditis seemed to be very low due to cardiac enzymes within the normal range and no history of viral infection. this strongly suggested that sibutramine use was responsible for his dilated lv with severely impaired contractility, thereby causing intracardiac thrombus formation. we report a rare case of an otherwise healthy man who presented with dilated cardiomyopathy with massive lv thrombus secondary to the use of sibutramine-containing slimming pills. this case highlights the emerging threat posed by adulteration of non-prescription slimming products with undeclared, banned pharmaceutical analogues. when investigating the secondary cause of dilated cardiomyopathy with unknown etiology, physicians should be vigilant to the possibility of over-the-counter weight-loss agents or dietary supplements with undeclared ingredients.

sibutramine, which acts as an anti-obesity drug by inhibiting reuptake of serotonin and norepinephrine, has now been banned due to cardiovascular adverse effects. however, despite being banned, it is not uncommon for people to purchase products with sibutramine or its analogues used as adulterants in non-prescription slimming products or health foods available on the internet. sibutramine has been associated with rare but serious adverse reactions such as cardiac arrhythmia including qt interval prolongation, myocardial infarction, and cardiomyopathy, as well as increases in blood pressure and pulse rate. here, we report a case of a 32-year-old male who presented with dilated cardiomyopathy with massive left ventricular thrombus after taking unauthorized sibutramine-containing slimming pills sold over the internet.

PMC3808860

pubmed-827

maintenance of a normal serum sodium concentration is dependent on both an intact thirst sensation and the action of arginine vasopressin (avp), also known as antidiuretic hormone. thirst osmoreceptors and cell bodies containing avp overlap in location in the hypothalamus and share a common blood supply through branches of the anterior communicating artery 1. thus, disruption of this blood supply can result in both lack of thirst and avp synthesis, in response to appropriate stimuli of hypernatremia and hyperosmolality. herein, we report the case of adipsic diabetes insipidus following anterior communicating artery clipping. at presentation, the patient had no perception of thirst despite the presence of significant hypernatremia. the fluid management in this case is rendered more complex due to the patient having poor shortterm memory and the subtropical climate in queensland, australia. a 36yearold woman was transferred to our hospital for further investigation and management of a subarachnoid hemorrhage (sah). she had initially presented to the emergency department following a syncopal episode on a background of a 2day history of a severe frontal headache associated with nausea and vomiting. physical examination at the time of admission revealed weight of 85 kg, heart rate 84/min, blood pressure 140/85, respiratory rate 16 breaths/min, and oxygen saturation 99% on room air. computerized tomographic angiography (cta) revealed a ruptured 5 mm anterior communicating artery aneurysm (fig. endocrinology was notified for review after her urine output was recorded at 7.5 l on the day of the procedure. aneurysm arising from the anterior communicating artery and proximal a2 segment of the right anterior cerebral artery (a) preoperative serum sodium concentration on the morning of surgery was normal at 136 mmol/l (reference range: 135145). the following morning, the serum sodium level was 153 mmol/l and serum osmolality was 318 mosmol/kg (reference range: 280295). serum sodium concentration had further increased to 156 mmol/l 2 h later. the urine was dilute, with hourly urine output elevated at 300400 ml/h. a clinical diagnosis of central diabetes insipidus was made. despite the clinical presence of volume depletion and significant hypernatremia, the patient had no perception of thirst. given the anatomy and location of the aneurysm, the most likely diagnosis was adipsic diabetes insipidus secondary to clipping of the anterior communicating artery aneurysm. values varied from 159 to 823 mosmol/kg, depending on the temporal relationship with the administered desmopressin. there was no evidence of major temperature dysregulation in the immediate postoperative period, temperature varied between 36.5 and 38.1c, and by the second postoperative week was consistently between 36 and 37c. nmol/l at 08:10 h, free thyroxine concentration 7.2 pmol/l (reference range: 717), thyroidstimulating hormone (tsh) concentration 0.9 mu/l (reference range: 0.34.5), prolactin 374 mu/l (reference range: 71566), estradiol 141 pmol/l, folliclestimulating hormone (fsh) 1.8 u/l (reference range: 18), and luteinizing hormone (lh) 0.6 u/l (reference range: 112). during the acute period, the patient was initially monitored with hourly urine output, twice daily electrolytes, and daily weighs. initial parameters for repeat desmopressin administration were the presence of breakthrough polyuria, defined as a urine output of>350 ml/h for two consecutive hours, or>300 ml/h for three consecutive hours. several doses of parenteral desmopressin were required over the following 72 h. treatment was then commenced with regular oral desmopressin 100 g in the morning and 200 g in the evening. the patient continued to have no perception of thirst. based on her fluid balance chart after commencing oral desmopressin, therefore, she was placed on a regular water prescription of 250 ml eight times a day. it was not deemed necessary to perform a formal water deprivation test or infusion of hypertonic saline to confirm the diagnosis in this clinical setting. she was then transferred to the brain injuries unit for rehabilitation of shortterm memory impairment. after initiation of regular oral desmopressin and a fixed dose water prescription, the patient was able to maintain a normal serum sodium concentration in hospital. serum sodium concentration was initially monitored on a daily basis, with the interval being extended to twice weekly prior to discharge. discharge planning involved ongoing followup with weekly bloods for serum sodium concentration with her general practitioner. the desmopressin was increased to 200 g twice daily and the water prescription also modified, aiming for approximately 1 l above urine output. it was thought that insensible losses in the queensland late spring/summer accounted for the increased fluid requirements, as 24h urine volumes were not excessive and there was no nocturia. further review 2 months later revealed some improvement in cognitive function and stable normal electrolytes (serum na 139142 mmol/l) on the above regimen. longitudinal followup out to 15 months post sah has been undertaken. while improved, significant shortterm memory impairment persists. repeat assessment at 1 year indicates that her anterior pituitary function remains intact and she has regular menses. mmol/l since she has been living with family support in her own home. the most commonly reported causes include congenital lesions such as septooptic dysplasia, germinoma, anterior communicating artery rupture or clipping, and craniopharyngioma 2. crowley et al. 3 have reported a series of 13 patients, of whom four were the result of anterior communicating artery aneurysm surgery. a case report and review of the literature published in 2008 revealed 10 cases of adipsic diabetes insipidus following clipping of an anterior communicating artery aneurysm 2. two subsequent case reports have since been identified 4, 5. even in the presence of hypernatremia published cases have continued management in the community by using a combination of regular desmopressin and a fixed dose water prescription 6, 7. calculating an ideal body weight when the patient is euvolemic provides a set point from which water intake can be adjusted. a behavioral modification technique for the patient with shortterm memory impairment has also been described with the use of a wristwatch alarm 8. this report demonstrated the success of a staged technique, first by regular prompting by staff and initiation of a reward system when all water was consumed in a day. the rewards were gradually withdrawn and the patient maintained a stable serum osmolality by the use of a wristwatch alarm as the prompt to drink. the present case had isolated diabetes insipidus in the presence of normal anterior pituitary function. once the immediate postoperative period had passed, a regular twice daily dose of oral desmopressin coupled with a prescribed fluid intake resulted in stable serum sodium concentrations while in the rehabilitation ward. the challenge was to maintain this level of stability when she is living in the community. this is particularly important given the patient's subtropical geographical location of southeast queensland, australia where there are high ambient temperatures and humidity during the summer months (latitude 27 south, mean maximum ambient temperature 2829c, humidity 6570%), which will increase insensible fluid losses. this required adjustment in her water prescription, over and above what would generally be required in a temperate climate. this is in part related to associated conditions of nonendocrine hypothalamic dysfunction, such as obesity, temperature dysregulation, and sleep disorders, but also an apparent increased rate of venous thromboembolism 3 and serious infections 9. when compared to patients with diabetes insipidus and normal thirst perception, patients with adipsic diabetes insipidus are more than 10 times more likely to develop significant outpatient hypernatremia (> 150 mmol/l) 10. close monitoring in conjunction with the patient's general practitioner is an essential component of the longterm management. this has resulted in acceptable stability in the patient's serum sodium despite the triple challenge of adipsia, poor shortterm memory and humid subtropical climate.

key clinical messagediabetes insipidus without perception of thirst, as may follow an anterior communicating artery aneurysm, requires prescription of fluid intake as well as desmopressin. the management goal of maintaining a normal serum sodium is rendered more challenging in a humid subtropical environment, where insensible losses are higher.

PMC4929801

pubmed-828

since its introduction by clayman et al, laparoscopic surgery has enabled great progress in the area of urology, and less invasive techniques such as laparoendoscopic single-site surgery (less) and natural orifice transluminal endoscopic surgery (notes) have recently been introduced to clinical practice. minimally invasive procedures such as less and notes have an aesthetic advantage over conventional laparoscopic surgeries because they require fewer portals of entry, which leaves minimal to almost no evident surgical scars. laparoscopic partial nephrectomy is performed as the surgery of choice for small renal tumors with established evidence, and the surgical effectiveness and overall oncological outcomes of this procedure have been proved to be equal to those of conventional open surgeries for selected patients, even in the case of locally advanced renal tumors. for radical nephrectomy, the less technique is currently being practiced in many institutions, and its effectiveness has already been established. however, in the case of partial nephrectomy, the less technique is not yet actively practiced in clinical fields owing to its technical difficulties. we performed less partial nephrectomy in a porcine model with the objectives of overcoming the technical challenges of less and exploring the feasibility of the procedure from a technical viewpoint. under the approval of the seoul national university institutional animal care and use committee (snuiacuc), six partial nephrectomies were performed on bilateral kidneys of a 5-month-old swine that weighed 30 kg. three operations were done on each kidney by a surgical staff consisting of two urologists with much experience in laparoscopic surgery (e1, e2) and two less-experienced urologists (b1, b2). a 5 mm flexible laparoscope was used for vision, and the choice of articulating needle driver, rigid needle driver, grasper, and dissectors was made according to the preference of each surgeon. after a 2.5 cm skin incision was made at the umbilicus, the subcutaneous fat tissues were dissected and the peritoneum was opened. the octoport wound retractor (type b, designed for a small wound) was put into the peritoneal cavity covering from the skin to the peritoneum. the octoport wound retractor has 3 access ports, one 12 mm port and two 5 mm ports, and also has an additional gas inlet and gas outlet (fig. the renal hilum and gerota's fascia were dissected to expose the renal capsule. after scoring around the imaginary tumor by use of monopolar electrocautery, a bulldog clamp was applied on the renal artery and parenchymal resection was done. e1 performed a partial nephrectomy on the anterior side of the right kidney upper pole, e2 on the anterior side of the right kidney lower pole, and finally b1 on the posterior side of the right kidney lower pole, followed by b1 's right nephrectomy. e1 performed a partial nephrectomy on the anterior side of the left kidney upper pole, e2 on the anterior side of the left kidney lower pole hilar area, and last, b2 resected the left kidney after performing partial nephrectomy on the posterior side of the left kidney lower pole. all operators used 3-0 vicryl running sutures to repair the open calyx and for hemostasis of the resection bed and 1-0 vicryl interrupted sutures for renorrhaphy, which was done with sliding knots only, without the use of any suture slip equipment such as hem-o-lok (teleflex medical, research triangle park, nc, usa) or lapra-ty (ethicon, somerville, nj, usa). during the calyx and parenchyma suture, articulating needle drivers were used alone for the repair of the resection margin of e1 's first procedure and b2 's procedure, and an articulating needle driver and rigid needle driver were used concurrently in all other cases. the resected parenchymal tissues and each kidney were extracted through a 4 cm extended umbilical incision (fig. 2, 3). after all procedures were performed, the pig was euthanized by use of an extra dose of kcl intravenously. all six partial nephrectomies were successfully performed without the need to introduce any additional ports, and all hemostatic procedures were successful in the repair of the vascular and collecting systems on the resection bed and renorrhaphy. stable vital signs were maintained throughout the procedures, and there were no noticeable complications. during the partial resection of the renal parenchyme, an articulating grasper and articulating cold scissors were used in all cases. the mean time for partial resection was 3.1 minutes (range, 2.5-3.3 minutes), and the mean resection times for the upper and lower pole areas were 3.4 (range, 3-4) and 2.8 (range, 2.5-3.3) minutes, respectively. the experienced (e1, e2) and less-experienced (b1, b2) surgeons ' mean times for partial parenchymal resection were 2.9 minutes (range, 2.5-3.3 minutes) and 3.25 minutes (range, 2.5-4 minutes), respectively. the mean sizes of the resected parenchyma were 2.1 cm (range, 1.9-2.4 cm) and 1.5 cm (range, 1.4-1.6 cm) for the long diameter and depth, respectively. regarding warm ischemic time, e1 recorded 60 minutes on the anterior side of the right kidney upper pole and 35 minutes on the anterior side of the left kidney upper pole. e2 scored 30 minutes on the anterior side of the right kidney lower pole and 35 minutes on the anterior side of the left kidney lower pole around the hilar area. for b1 and b2, the warm ischemic times were 47 and 50 minutes for the posterior side of the right kidney lower pole and the posterior side of the left kidney lower pole, respectively. the shortest ischemic time, 30 minutes, was achieved by e2 by use of the early unclamping technique during renorrhaphy. the mean warm ischemic time was 42 minutes (range, 30-60 minutes); according to imaginary tumor location, it was 47.3 minutes (range, 35-60 minutes) for upper pole tumors and 36.7 minutes (range, 30-50 minutes) for lower pole tumors, respectively. the experienced (e1, e2) and less-experienced (b1, b2) surgeons ' mean ischemic times were 38.8 minutes (range, 30-60 minutes) and 48.5 minutes (range, 47-50 minutes), respectively. the average number of sutures for renorrhaphy was 3.2 (range, 2-5). the rising demand for minimally invasive surgical procedures and the development of surgical techniques to meet such a need has enabled urologists to apply the single-port surgery techniques to most laparoscopic surgeries in urology. the cleveland clinic has reported 100 surgical cases of less ranging from nephrectomy to even radical cystectomy. however, there are relatively fewer successful reports on less in partial nephrectomy. boylu et al reported 10 cases of partial nephrectomies using a porcine model. at this point in clinical practice, there are only initial case reports of less in highly selected cases. aron et al reported 4 human cases in highly selected patients, but they used an additional 2 mm grasper via a 2 mm veres needle for the purpose of tissue traction. our study focused on evaluating in a porcine model the technical feasibility of using a pure less technique for performing partial nephrectomy. in this study, all six partial nephrectomies were successfully done without any significant complications. one obvious difference between the less surgical technique and pure laparoscopy is the limitation in the movement of the instruments. that limitation makes the less surgery difficult and the learning curve for less surgery steep. three major procedures make it difficult to manipulate the surgical instruments properly in less partial nephrectomy., it took only 2.9 minutes for the experienced laparoscopic surgeons, and even for the inexperienced surgeons, it took only 3.3 minutes with the use of the flexible instruments. however, sewing the open calyx and resected renal parenchyma was the most difficult procedure during less partial nephrectomy. to identify whether the suture technique used in pure laparoscopic surgery could also be adapted for less partial nephrectomy, the surgeons in this study did not use any laparoscopic clips, which can make suturing easier and faster. we tried only interrupted parenchymal sutures with the sliding knot technique, which is simple and accurate but the most difficult and time-consuming technique, with the object of identifying the feasibility of this suturing technique for less partial nephrectomy. therefore, it took from 27 minutes to 57 minutes for the calyceal and parenchymal sutures. the articulating instrument is very useful during all of the procedures in less surgery, especially for triangulation and procuring enough space for the instruments to move freely in the restricted space. in our experience, it was convenient for the right-handers to use the articulating instrument for the right-side instrument, because the right-hand instrument usually performs the counter-traction to make the dissection easier in contrast with pure laparoscopic surgery. however, which hand should use the articulating instrument depends on the situation. regarding the needle drivers, the articulating needle drivers with their flexible characteristics did not provide sufficient strength during sutures, which made the sewing procedures more difficult. therefore, replacing the flexible needle drivers with rigid, conventional needle drivers became more convenient. when replacing the articulating needle driver with a rigid needle driver, the surgeons changed the right-hand instrument to the rigid needle driver, because all the surgeons in this study were right-handed. also, we used right-angled forceps for the left-hand instrument and instead of using triangulation of the instruments we coordinated both instruments in a parallel position. during knot-tying, however, the instruments should be coordinated in a forward and backward direction, because there is no space for the instruments to move in a lateral direction as in pure laparoscopic surgery. during the renal parenchymal suturing, we used early unclamping and the sliding knot technique to shorten the ischemic time. describing our early unclamping technique in detail, first, an interrupted renal parenchymal stitch was made. after making a loose square knot, we converted the square knot to a sliding knot. then two or three more stitches were made according to the size of the parenchymal resection. we made just one stitch fasten, unclamped the bulldog clamp, and finally fastened the other stitches. shikanov et al reported in a multicenter study that ischemic time (mean ischemic time was 29 minutes) does not affect global renal function in the case of two normal functioning kidneys. however, becker et al reported in a mass analysis that in order to minimize parenchymal ischemic injury, the tumor should be removed within 20 minutes of warm ischemia, regardless of the surgical approach. large-scale institutions today score mean ischemic time around 30 minutes in the case of laparoscopic partial nephrectomy and it is assumed that warm ischemic time under 30 minutes is required in order to successfully apply less to partial nephrectomy in clinical practice [9-11]. in our study, the mean warm ischemic time was 42 minutes. the experienced urologists group scored an average of 38.8 minutes, and e2 achieved 30 minutes by using the early unclamping technique. however, considering that this study was performed with a porcine model, a longer warm ischemic time can be assumed in the case of a human kidney. compared with the human body, the porcine model we used was smaller and had a smaller resected volume, which results in a shorter distance and smaller defect to repair. furthermore, it is believed that it is easier to obtain hemostasis in a porcine model than in a human kidney because of the different cell biology, blood supply, and tissue textures. all the above factors will make the procedure of less partial nephrectomy more difficult in humans than in the porcine model. nguyen and gill reported halving the ischemic time from 31.1 to 13.9 minutes by using the early unclamping technique, although the technique was associated with a risk of bleeding and reclamping. however, we can also infer that the early unclamping technique and dry and wet laboratory disciplinary efforts to handle the instruments more freely can reduce the warm ischemic time. although hem-o-lok (teleflex medical, research triangle park, nc, usa) or surgical clips such as lapra-ty (ethicon, cincinnati, oh, usa) are generally used in laparoscopic partial nephrectomy, our study used only sliding knots for suturing. another important fact that we found in this study was that there was no need for an additional trocar for less partial nephrectomy. all four surgeons could finish the less partial nephrectomy without any added trocars, even for right partial nephrectomies. boylu et al reported 10 consecutive less partial nephrectomies in porcine models performed by a single surgeon. that study showed an overcoming of the learning curve with decreasing warm ischemic time. in our study, because of the limited number of cases and the many surgeons, the learning curve could not be assessed. but we can postulate that consecutive dry and wet laboratory discipline and experience would improve surgical technique, shorten the warm ischemic time, and result in the surgeon overcoming the learning curve. however, our study suggests that less for partial nephrectomy results in longer ischemic times than for conventional laparoscopic surgeries. therefore, many dry and wet laboratory disciplinary efforts are needed to decrease the warm ischemic time and improve this surgical technique.

purposewe performed laparoendoscopic single-site (less) partial nephrectomy in a porcine model with the objectives of overcoming the technical challenges of this surgery and exploring its feasibility. materials and methodssix partial nephrectomies were performed on a pig aged 5 months, three cases on each kidney, by four surgeons: two urologists with much experience in laparoscopic surgery (e1, e2) and two less-experienced urologists (b1, b2). while under general anesthesia, the swine was placed in a lateral flank position. umbilical placement of an octoport was done with a 2.5 cm incision. after dissection of the renal hilum and gerota's fascia, a bulldog clamp was applied on the renal artery and parenchymal resection was done. renorrhaphy was then performed with interrupted sutures with the use of a sliding knot technique. resultsall six partial nephrectomies were performed successfully after repair of the vascular and collecting system at the resection margin and renorrhaphy without the need to introduce any additional ports. there were no noticeable intra- or postoperative complications. the mean warm ischemic time was 42 minutes (range, 30-60 minutes). the shortest warm ischemic time, 30 minutes, was achieved by using the early unclamping technique during renorrhaphy. the longest warm ischemic time was 60 minutes. the average number of renorrhaphy stitches was 3.2 (range, 2-5). conclusionsless partial nephrectomy was successfully performed in a porcine model but resulted in a longer ischemic time than that of conventional laparoscopic surgeries. therefore, further laboratory disciplinary efforts are needed to decrease the warm ischemic time and to improve this surgical technique.

PMC3037506

pubmed-829

the stainless steel crowns (sscs) are often the first choice for the repair of defects in primary dentition caused by caries, and have been one of the most effective and efficient methods of tooth restoration in pediatric dentistry since humphrey first used them in pediatric patients in 1950.1 ssc placement is simple and economical with a high success rate for protecting remaining teeth weakened by excessive preparation.23 however, sscs are disadvantaged by a non-aesthetic appearance,4 and this esthetic issue has become more and more important in patients with primary tooth problems. in a survey, esthetic concerns were confirmed to be the most critical issue for dental restoration in pediatric patients.5 accordingly, new materials, such as, open-faced crowns, bonded strip crowns, and pre-veneered sscs were developed to replace sscs.67 these new materials improve esthetics, but have side effects that include poor gingival health, hemorrhage of gingival tissues, and exposure of dental margins, which are associated with the presence of metals.3 in particular, the veneer resin of preveneered sscs frequently chips occurs and results in additional treatment and cost.78 the recently developed all-ceramic crown is now used as an esthetic restorative material for permanent teeth, and ready-made primary zirconia crowns are now being used for primary teeth. zirconia, also known as " ceramic steel ", has reasonable aesthetics and has excellent mechanical properties for the restoration of permanent teeth, and has been used for crowns, fixed partial dentures, implant abutments, fixtures, inlays, and onlays.9 however, zirconia crowns are thicker than sscs and can not be corrected, and thus, manufacturers recommend passive seating. furthermore, due to their thicknesses, aggressive tooth preparation is required and pulp exposure is increased. preveneered sscs can still provide full coverage despite esthetic veneer chipping or fracture, but zirconia crowns must be replaced when fractured.10 this limitation can be overcome by lithium disilicate or leucite crown restoration for permanent teeth, but no study has been conducted as yet on the use of different ceramics for the repair primary teeth. furthermore, no study has evaluated the wear resistance of primary teeth restored using different ceramic materials based on considerations of occlusal force in pediatric patients. primary tooth wear is common, and occurs due to the loss of enamel and dentin on the occlusal surface.1112 the abrasivities of primary and permanent teeth differ due to their different enamel strengths,13 morphological factors, such as, enamel and dentin thickness,14 and the different biting forces of adults and infants.15 in a comparative study conducted by nose16 on molar enamels of primary and permanent teeth, the vickers hardness number (hv) of primary teeth was 106 (hv) and that of permanent teeth was 126 (hv), which suggests poorer wear resistance of primary teeth. in a study by mortimer,17 primary teeth were found to be less mineralized than permanent teeth, and nelson et al.18 reported primary tooth enamel was thinner than permanent tooth enamel, and thus, more prone to wear. proffit and fields15 studied the bite forces of children and adults and found mean bite forces of 17.4 kg (mean age: 9.3) and 31.0 kg (mean age: 26.9) at a 2.5 mm opening; and 15.5 kg and 35.6 kg at a 6.0 mm opening, respectively, which confirmed that in children low bite forces reduced wear on the occlusal surfaces of posterior composite restorations. restoration materials affect enamel wear.19 seghi et al.20 stated that the wear rates of dental restoration materials should be similar to that of the enamel. previous studies on primary tooth abrasivity against restoration materials have focused on composite or glass ionomer restorative materials.212223 due to growing interest in esthetics and the development of zirconia crowns, various studies have been conducted utilizing different restorative materials. in an evaluative study by jung et al.24 on the abrasivity of natural teeth as compared with those of restoration materials, the natural tooth wear caused by zirconia was found to be much less than that caused by feldspathic dental porcelain. sripetchdanond and leevailoj25 confirmed that zirconia and composite resins wear enamel significantly less than glass ceramics and enamel. in pediatric dentistry, various cases of anterior tooth restoration using ready-made primary zirconia crowns have been reported.2627 however, few studies have conducted on primary tooth wear by ceramic restoration materials.212223 in this study, the associations between restoration materials, namely, zirconia crowns, lithium disilicate, and leucite and primary tooth wear were compared and evaluated to investigate the possibility of using ceramic restoration materials for primary tooth restoration. primary canine teeth with no cusp wear, which were lost naturally during transition to permanent teeth, were used in this study. teeth were washed in an ultrasonic cleaner and then placed in deionized water at 37 for 24 hours. the primary canine teeth were fixed in an acrylic resin (orthodontic resin, dentsply, philadelphia, pa, usa) and approximately 5 mm of the cusps of the primary canine teeth was exposed (20 mm wide and deep and 10 mm high). severely worn or fractured teeth and teeth with caries were excluded (fig. the 40 antagonistic specimens were assigned equally to a stainless steel (the steel group; the control group), a leucite glass-ceramic (the leucite group), a lithium disilicate glass-ceramic (the lithium group), or a monolithic zirconia (the zirconia group) group (table 1). for the steel control group, 11 mm-wide and -deep, and 13 mm-high, cubic specimens were prepared by crimping stainless steel (sts 304l) of sscs (kids crown, shinhung, seoul, korea). for the leucite, lithium, and zirconia experimental groups,, charlotte, nc, usa), and converted to stl files using design software (ceramill mind, amanngirrbach corp., the materials used were; a monolithic zirconia block (zirtooth fulluster, hass, kangneng, korea), a lithium disilicate block (rosetta sm, hass, kangneng, korea), and a leucite block (rosetta bm, hass, kangneng, korea). using a milling machine (ceramill motion2, amanngirrbach corp., charlotte, nc, usa), 11 mm-diameter and 13 mm-high specimens were prepared. heat treatments were conducted in ceramics except leucite group according to manufacturers ' instructions, and specimens were subsequently washed using an ultrasonic cleaner (table 2). prepared specimens were fixed with an acrylic resin (orthodontic resin, dentsply, philadelphia, pa, usa) using uniform molds by the same method used to prepare tooth specimens (fig. wear tests were conducted using a cs-4.8 masticator (sd mechatronik, feldkirchen-westerham, germany). in each chamber, restorative materials were placed on top and antagonistic teeth at the bottom using specimen holders (fig. a 3 mm vertical movement and a 2 mm horizontal movement were reproduced using two computer-controlled servomotors. masticatory force was established using the results of previous studies that compared the abrasivities of dental materials and primary teeth.2223 in the present study, 50 n was used as the masticatory force, which was the middle value of the lowest and the greatest masticatory forces used in previous studies. to meet the 50 n condition, in addition to the weight, a thermodynamic condition similar to the real oral environment was reproduced using a computer-controlled hot/cold water circulation system. testing was conducted over 100,000 loading cycles (table 3).23 to measure the amount of the volume of tooth loss, teeth were scanned using a 3d scanner before and after testing.2829 the 3d data obtained before and after testing were overlapped using 3d software (dentacian software, ezplant, seoul, korea). worn areas were then separated using boolean operations and wear volumes were measured using 3d software (dentacian software, ezplant, seoul, korea) (fig. 4). wear losses of restoration materials after testing were determined using an electronic scale (pag213, ohaus, seoul, korea) accurate to 10 gram. to qualitatively characterize wear patterns, antagonistic teeth and restorative materials tokyo, japan) operated at 15 kev at magnifications of 40, 100, and 1000. the statistical significances of changes in tooth volumes and weights of restoration materials in each group were evaluated. distribution normality and variance homogeneities were determined using the shapiro-wilk's test and levene's test. the analysis was conducted by one-way anova (= .05) with tukey's post-hoc test (= .05). chicago, il, usa) was used throughout, and significance level was set at 5%. the means and standard deviations of the volume losses of antagonistic teeth (vt) and the weight losses of restorative materials (vm) in each group after wear testing are shown in table 4 and fig. the leucite group showed the greatest tooth volume loss at 2.670 1.471 mm, followed by the lithium group with 2.042 0.696 mm, the zirconia group with 1.426 0.477 mm, and the steel group with 0.397 0.192 mm. tooth volume losses in the leucite and lithium groups were significantly greater than that in the steel group (p<.05), but no significant difference was observed between the steel group and the zirconia group (p>.05). in terms of weight losses of restorative materials after testing, the lithium group showed most at 0.006 0.002 g, followed by the leucite group (0.003 0.002 g) and the steel and zirconia groups (0.002 0.001 g). weight loss in the lithium group was significantly greater than in the steel and zirconia groups (p<.05), but no significant difference was observed between the steel, leucite, and zirconia groups (p>.05). the sem images of wear surface areas in enamel and tested materials are shown in fig. 6 and fig. 7. in enamel sem images of the steel group, smooth surfaces, fragmentation or particle chipping, and striated plow marks were observed. in tested material images, no notable surface changes or wear were observed other than slight stress marks and scratches in the sliding direction. even after wear testing, dense and homogeneous surfaces were observed. in sem images of the leucite group, notable surface changes and wear were observed on the rough surfaces of tooth enamel with ploughing in the sliding direction. in particular, the presence of fragments chipped from enamel surfaces was confirmed by irregular concavities and gaps on worn surfaces. striated wear grooves and rough surfaces, caused by lateral movements of the test instrument, were clearly observed on tested materials and on enamel surfaces. in enamel sem images of the zirconia group, surfaces were mostly smooth, and no chips or fractures were observed. comparative studies have been conducted on the abrasivities of different dental restorative materials and teeth. due to growing interest in esthetics, the abrasivities of teeth and of ceramic materials, such as, leucite, lithium disilicate, and zirconia, which have excellent mechanical properties and esthetics, have been evaluated. however, these attempts have been limited to permanent teeth.3031 more recently, in pediatric dentistry, several manufacturers have started to produce ready-made primary zirconia crowns, and clinical applications of these products have already been reported. 2627 however, no comparative study has yet addressed the abrasivities of these ceramic materials when worn against primary teeth. moreover, accurate measurements are challenging because variables such as chewing forces and environmental factors can not be completely controlled.32 although in vitro studies are limited in terms of accurately reproducing mastication in the oral cavity, simple movements, such as, tooth grinding and clenching, can be reproduced, and the anti-wear mechanisms of various restoration materials can be evaluated at the pre-clinical stage.33 because of the advantages of in vitro studies, various mastication simulators that reproduce wear process in the oral environment have been developed.3435 various tests (e.g., pin-on-block, pin-on-disk, three-body wear, and toothbrush simulation) can be used to investigate the wear performance of dental materials, and antagonist wear has been confirmed to be closely associated with ceramic material types and testing conditions.36 since the two-axe wear test device used in this study is practical, durable, and cost-effective, it has been widely used. the device has eight interior chambers and reproduces the mandibular closure of mastication through sliding movements after occlusal contact.30 in this study, a two-body wear test was conducted. this method is widely used to measure wear resistance, and reproduces the attrition caused by occlusal contact between restoration materials and teeth.34 this method can also reproduce the friction and fatigue wear caused by the direct contact between the maxillary and mandibular teeth during swallowing or non-functional dynamic occlusal movements.37 the 50 n force and 100,000 cycles used for the wear test in this study were determined based on the suggestions of previous studies that compared the abrasivities of various restoration materials and primary teeth.2223 simultaneous thermal cycling with water to reproduce temperature changes in the oral cavity also removes wear particles generated during the wear test, and thus simulates aging.38 suggestions made regarding the standardization of the enamel surface of natural teeth in the wear test are controversial.36 krejci et al.39 suggested a non-standardized enamel cusp of natural teeth is the most appropriate antagonist. kunzelmann et al.40 reported that unlike untreated enamel, polished enamel could show changes in the wear properties of enamel. accordingly, in this study, the enamel surfaces of primary canine teeth that were naturally lost during the transition to permanent dentition were used as antagonist teeth. magne et al.41 suggested height loss measurements provided a convenient method of measuring wear because they can be easily determined and are associated with clinical vertical measurements of occlusion. however, volumetric loss provides a more sensitive means than weight loss because measurements change linearly with time.42 in the present study, three-dimensional wear measurements with a laser scanner were used to measure the tooth wear. using this method 2829 on the other hand, in two-dimensional studies, it is difficult to overlap restoration material profiles before and after wear. weight measurement has also been used to measure and quantify the amounts of wear in restoration material. 43 but it is difficult to remove moisture from the teeth after wear due to the presence of dentinal tubules. despite drying, water can remain in teeth, and thus, moisture levels can not be determined before testing. however, after testing restoration materials were completely dried, and thus, precise measurements of weight losses were obtained. in this study, the abrasivity of primary teeth was compared with that of the four types of crown restoration materials: sscs (kids crown), which has been widely used for the crown restoration of primary teeth; zirconia as represented by the recently developed ready-made primary zirconia crowns (zirtooth fulluster); lithium-disilicate (rosetta sm), a particle-filled glass ceramic; and leucite (rosetta bm). the amount of wear of primary teeth was greatest in the leucite group, followed in order by, the lithium group, the zirconia group, and the steel group. in particular, amounts of wear in the leucite and lithium groups were significantly greater than that in the steel group. surface hardness and friction factor are used to estimate the wear levels of dental restoration materials. greater hardness is known to typically result in more enamel wear,24 and metal hardness has been shown to be associated with enamel wear.30 however, according to oh et al.,44 enamel wear by ceramic is associated more with surface roughness, microstructure, fracture toughness, and environmental factors than with hardness per se. in the present study, enamel wear was greatest in the leucite group because leucite has comparatively low flexural strength (120 mpa) and fracture toughness (1.42 mpam). in contrast, zirconia has high flexural strength (1,200 mpa) and fracture toughness (5.5 mpam), and showed less enamel wear than the leucite group. this result agrees with that of a previous study that demonstrated an association between a low wear rate and high flexural strength and fracture toughness.29 if a restorative ceramic material does not have enough ductility fracture and/or chipping may occur. furthermore, chips function as abrasives on ceramic surface and increase wear rates.45 the high enamel wears caused by glass particles in the leucite and lithium groups could be partly explained by the formation of wear debris. glass particles freed by wear function as abrasives, a phenomenon referred to as the " three-body wear mechanism".46 the steel group showed the lowest enamel wear rate because occlusal forces were absorbed by the ductility of the steel. in addition, as shown in the sem images, smooth surfaces might reduce the wear rates of antagonist teeth. in the present study, enamel wear in the zirconia group was comparatively small, as has been previously reported.24253031 this outcome is attributed to its excellent physical properties, such as, its hardness, flexural strength, density, and fracture toughness, which inhibit the formation of surface microfractures, and to the addition of yttria, which reinforces the crystal structure and prevents crack propagation.47 as a result, the smooth surface of zirconia was maintained during the wear test and only a small amount of enamel wear was observed after testing.37 the lithium group showed the largest amount of restoration material wear, followed by the leucite, zirconia, and steel groups. wear in the lithium group was significantly greater than that in the steel and zirconia groups, but no significantly difference was observed between the leucite and lithium groups. these outcomes concur with those of previous studies.34 the leucite and lithium group showed high amounts of wear because glass ceramics like leucite and lithium disilicate are sensitive to fatigue, which causes material defects.48 actually, wear starts with crack formation on the ceramic surface, is propagated by repetitive loading, and eventually results in material loss.49 according to our findings, the amounts of wear of restoration materials and of antagonistic primary teeth tended to be positively related. moreover, the flexural strength and fracture toughness of the ceramic materials (leucite, lithium disilicate, and zirconia) also seemed to be correlated with amounts of primary tooth wear. the occlusal force, masticatory movement, and conditions used in this study differ from those in the oral environment. in addition, two-body wears were evaluated in this study, and three-body wear tests could result in different outcomes. therefore, we suggest further long-term studies that simulate the oral environment be conducted to investigate the clinical implications of various ceramic material in primary teeth in vitro measured volumetric losses in the leucite and lithium groups were significantly greater than in the steel group, but no significant difference was found between the steel and zirconia groups. in this study, zirconia was the only material found to have an abrasivity that did not differ significantly from that of the steel used in conventional steel crowns. on the other hand, the leucite and lithium groups showed comparatively high primary-tooth abrasivity levels, which if confirmed in vivo may suggest that they should be used with caution in pediatric dentistry .

purposethis study was conducted to evaluate the effects of full-coverage all-ceramic zirconia, lithium disilicate glass-ceramic, leucite glass-ceramic, or stainless steel crowns on antagonistic primary tooth wear. materials and methodsthere were four study groups: the stainless steel (steel) group, the leucite glass-ceramic (leucite) group, the lithium disilicate glass-ceramic (lithium) group, and the monolithic zirconia (zirconia) group. ten flat crown specimens were prepared per group; opposing teeth were prepared using primary canines. a wear test was conducted over 100,000 chewing cycles using a dual-axis chewing simulator and a 50 n masticating force, and wear losses of antagonistic teeth and restorative materials were calculated using a three-dimensional profiling system and an electronic scale, respectively. statistical significance was determined using one-way anova and tukey's test (p<.05). resultsthe leucite group (2.6701.471 mm3) showed the greatest amount of antagonist tooth wear, followed by in decreasing order by the lithium (2.0420.696 mm3), zirconia (1.4260.477 mm3), and steel groups (0.3970.192 mm3). mean volume losses in the leucite and lithium groups were significantly greater than in the steel group (p<.05). no significant difference was observed between mean volume losses in the zirconia and steel groups (p>.05). conclusionleucite glass-ceramic and lithium disilicate glass-ceramic cause more primary tooth wear than stainless steel or zirconia.

PMC4769889

pubmed-830

meiosis-specific genes have been identified in several eukaryote pathogen genomes by phylogenomic analysis [5, 6], with demonstrated functionality in giardia intestinalis and trypanosoma brucei. three functionally distinct, meiosis-specific proteins (mnd1, dmc1, and hop1) were expressed in t. b. brucei strain j10, implying that meiosis might be an integral part of the trypanosome s developmental cycle in the tsetse fly vector. to test this hypothesis and to obtain further information on the timing of meiosis the endogenous loci of three genes expressed solely during the prophase of meiosis i were modified so that each contained an n-terminal yfp tag (yfp::mnd1, yfp::dmc1, yfp::hop1). we used the following trypanosomes: t. b. brucei (lister 427), t. b. rhodesiense (058), t. b. gambiense group 1 (dal972), and t. b. gambiense group 2 (th2), the last three being human pathogens. each strain expressed the meiosis-specific genes exactly as previously observed for t. b. brucei j10, confirming that the meiotic program takes place in the salivary glands (sg) during transmission of a clonal trypanosome strain (figure 1). although successful crosses of t. b. brucei, t. b. rhodesiense, and t. b. gambiense group 2 have been reported previously, this is the first indication that t. b. gambiense group 1 is capable of meiosis and, potentially, genetic exchange, despite lack of evidence of recombination in population genetics analyses [9, 10]. sex provides the opportunity for new pathogen strains to arise by recombination, a phenomenon already suspected in t. b. rhodesiense, which has the capacity to become human infective by transfer of a single gene for human serum resistance (sra). trypanosomes expressing meiosis-specific genes were present in fly sg dissected between 14 and 38 days after infection (figure 1c), with the highest frequency of expression around day 20. it follows that postmeiotic cells, including haploid gametes, should occur at the highest frequency at this time point. from measurements of nuclear dna contents of different life-cycle stages, it has been assumed that t. brucei is diploid throughout its developmental cycle [1315]. but mating in trypanosomes is believed to involve haploid nuclei or cells because the pattern of inheritance in experimental crosses is largely mendelian; moreover, triploid laboratory hybrids are often found, implying that fusion of haploid and diploid nuclei has taken place [3, 17, 18]. the expression of meiosis-specific genes preceded cell fusion, and hence meiosis generates the cells that subsequently undergo fusion. our initial search for haploid trypanosomes by flow cytometry of sg-derived trypanosomes was unsuccessful because cell numbers were too low and amounts of fly tissue and debris too great to distinguish signal from noise; movie s1 (available online) illustrates the suboptimal nature of the material under analysis. we therefore developed an alternative search strategy to find cells with gamete-like behavior in mixtures of sg-derived trypanosomes. analysis of trypanosome crosses is facilitated by the incorporation of red fluorescent protein (rfp) or green fluorescent protein (gfp) into the parental clones, enabling hybrids to be identified by yellow fluorescence. this system established that hybrid trypanosomes occur in the sg, not the midgut (mg), of infected flies and are found as early as 13 days after flies are coinfected with the parental clones. here, rather than carrying out the cross in vivo, we mixed the parental clones in vitro using trypanosomes derived from the sg of flies separately infected with either red or green fluorescent cell lines. trypanosomes were harvested from fly sg during the window of peak expression of meiosis-specific genes, and the ex vivo mixtures were observed as living cells in microslides over the course of about an hour, and also after fixation on microscope slides. twenty replicate experiments were carried out using mating-compatible pairs j10 rfp/1738 gfp or f1g2/f1r1 (table s1a). small clusters of two or more red and green fluorescent trypanosomes, as well as clusters of single color trypanosomes, were observed within 10 min of mixing the red and green fluorescent sg-derived parental cells (figure 2; movies s2 and s3). we focused the search for gamete interactions on the red-green clusters because single-color clusters might also arise from cell division. all red-green clusters contained at least one trypanosome with a short, wide body and long anterior flagellum. these trypanosomes were observed to interact by intertwining their long flagella, often drawing the cell bodies into close proximity (figure 2a). these interactions are reminiscent of the recognition and attachment of gametes of the unicellular plant chlamydomonas reinhardtii via their paired flagella. in the clusters, the trypanosomes were highly active, frequently changing position (movies s2 and s3). these distinctive cell interactions had not been observed previously in our analysis of experimental crosses [3, 18, 20]. to rule out the possibility that the sg cells were sticky, we set up mixtures of mg- and sg-derived trypanosomes in all possible combinations (table s1b). the distinctive flagellar interactions were observed only among sg-derived trypanosomes and did not occur in mixtures of sg- and mg-derived trypanosomes or between mg-derived trypanosomes; when red and green trypanosomes were found together in these mixtures, they were associated with debris or dead trypanosomes. yellow fluorescent trypanosomes started to appear within 30 min of mixing the sg-derived parental lines (figure 2b) and were observed in 11 of 20 experiments (table s1a). the rapid appearance of yellow fluorescent trypanosomes signifies fusion of cell membranes and exchange of cytoplasm between red and green fluorescent cells rather than de novo synthesis of fluorescent proteins, which would take several hours. these results demonstrate that clonal trypanosome populations derived from the sg already contain fusion-competent cells, ruling out the hypothesis that these cells are generated after recognition of nonself among trypanosomes of different genotypes. the trypanosomes implicated as trypanosome gametes had a distinctive morphology, and dapi staining revealed either one kinetoplast and one nucleus (1k1n) or two kinetoplasts and one nucleus (2k1n) (figure 2; movies s3 and s4). in trypanosome biology the closest is promastigote, which refers to a cell with an antenuclear kinetoplast and a flagellum that emerges anteriorly without connection to the cell body via an undulating membrane. in the following, we refer to these 1k1n and 2k1n cells collectively as promastigote-like (pl) cells. both 1k1n and 2k1n pl cells displayed gamete-like cell-cell interactions, but we were unable to distinguish different behavior during mating. the presence of two kinetoplasts in the 2k1n pl cells was confirmed by differential staining with dapi and propidium iodide (pi) (figures 3a and 3b) and also by visualization of the subcellular location of a yfp::p166 fusion construct (figures 3c and s1a). p166 is an intrinsic component of the tripartite attachment complex (tac), the filamentous structure that physically attaches the kinetoplast to the basal body of the flagellum. the intensity of fluorescence of p166 in the anterior tac was usually greater than that in the posterior tac (figure s1a), perhaps associated with the presence of a flagellum attached to the anterior kinetoplast. the 2k1n pl cells had only one flagellum, although the two kinetoplasts were widely separated at the two poles of the cell on either side of the nucleus, and a new flagellum would normally be evident at this stage of cell division. to detect whether a second flagellum was present but not discernible by light microscopy, we visualized the subcellular localization of pfr1, a major structural protein of the paraflagellar rod (pfr), using cells expressing the fusion yfp::pfr1 (figures 3d and s1b). of 26 2k1n pl cells examined, 23 (88%) had only a single fluorescent flagellum, arising near the anterior kinetoplast. the remaining three cells had two flagella, the posterior flagellum appearing as a tiny dot of fluorescence near the posterior kinetoplast (figure s1b). the pfr extends from the point at which the flagellum emerges from the flagellar pocket to its distal tip, and thus pfr1 is absent from a transitional zone of the flagellum adjacent to the basal body. we therefore can not rule out the presence in all 2k1n cells of a very short flagellum that does not extend beyond the flagellar pocket, as seen in leishmania amastigotes. the above evidence on interactions and cytoplasmic fusion implicates pl cells as trypanosome gametes; the crucial question is whether they are haploid, a defining feature of eukaryote gametes. pl cells were present in small numbers in live preparations of sg spillout (movies s1 and s5), together with metacyclics and other unattached trypanosomes. fixed cells were stained with both dapi and propidium iodide (pi) before measurement of total fluorescence intensity of the nucleus. this provided two independent measures of nuclear dna content, because dapi and pi have different dna binding characteristics (although dna binding could in principle be affected by chromatin packing). both 2k1n and 1k1n pl cells were haploid relative to metacyclics, the diploid, g1-arrested, mammal-infective stage also present in the sg (figure 4a). the combined dapi and pi pixel intensities of pl cells peaked at 0.5, compared to metacyclics at 1.0 (2c dna content) (figure 4a). procyclics from the fly midgut had a major peak at 1.0 and a smaller peak at around 2.0, consistent with the 2c and 4c peaks expected for this proliferating cell population (figure 4a). epimastigotes are also a proliferative insect stage, which are characteristically found attached to the sg epithelium via the flagellum, but here we examined free epimastigotes in the sg spillout; these cells did not have the elongated posterior nozzle typical of attached epimastigotes. the population shows nuclear dna content peaks at 1.0 (2c) and 2.0 (4c) like procyclics, but there is a noticeable shoulder of nuclei with dna content<1.0 (figure 4a). reexamination of this population revealed ten cells apparently in division, as each had two nuclei (either 3k2n or 2k2n), with nuclear dna contents in the haploid range. we speculate that some of these are cells in reduction division (meiosis ii), but they were difficult to distinguish from dividing pl cells, except by the extreme length of the flagellum (figure s2). a total of 12 dividing pl cells was recorded among 600 cells examined; because this was a clonal trypanosome population, this cell morphology is unlikely to arise by fusion of pl cells. a small number of epimastigotes in meiosis i was identified by morphology (2k epimastigote with posterior nucleus and two short flagella; figure s1b); these had nuclear dna contents consistent with 4c or greater (mei, figure 4). meiotic cells are often found attached inside the sg (figure 1b), explaining the small number of free meiotic cells observed. pl cells frequently had a large, elongated anterior kinetoplast, which was highly conspicuous in dapi staining (figure 2), confirmed by measurement of kinetoplast dna (kdna) contents relative to the unit kinetoplast of metacyclics (figure 4b). twice the unit amount of kdna usually indicates a kinetoplast about to divide, suggesting a simple hypothesis for the generation of 2k1n pl cells by kinetoplast division in 1k1n pl cells. however, this is contradicted by the fact that both 1k1n and 2k1n pl cells had enlarged kinetoplasts. alternatively, 1k1n and 2k1n pl cells might arise by unequal division of a 3k1n cell, because both pl cell types were found in approximately equal numbers. both 3k1n and 3k2n cells were observed (e.g., figure s2e). in summary, we have shown that meiosis is a normal part of the developmental cycle of t. brucei in the tsetse fly and have identified a novel haploid pl cell that displays the behavior expected of a gamete. when pl cells of different strains are mixed, they readily form pairs or clusters and undergo cytoplasmic fusion. we conclude that the haploid pl cells are trypanosome gametes, although formal proof will require the demonstration of exchange of nuclear and kinetoplast dna. until now, the extent and significance of sex in kinetoplastid parasites have been controversial, but this study reveals that t. brucei is essentially a sexual organism. hence, these results support the hypothesis that meiosis and sexual reproduction are ancestral and ubiquitous features of eukaryotes. the following tsetse-transmissible strains of trypanosoma brucei subspecies were used: t. b. brucei j10 (mcro/zm/73/j10 clone 1), 1738 (movs/ke/70/eatro 1738), lister 427 (movs/ug/60/427 variant 3); t. b. rhodesiense 058 (mhom/zm/74/058 clone b); t. b. gambiense group 1 dal972 (mhom/ci/86/dal972 clone 1); t. b. gambiense group 2 (mhom/ci/78/th2). the experimental cross of j10 and 1738 carrying cytoplasmically expressed genes for fluorescent proteins is described in and produced hybrid progeny f1g2 and f1r1. procyclic form (pf) trypanosomes were grown in cunningham s medium (cm) supplemented with 10% v/v heat-inactivated fetal calf serum, 5 g/ml hemin, and 10 g/ml gentamycin at 27c. fusion constructs of the yfp gene with the homologs of meiosis-specific genes (dmc1, tb09.211.1210; hop1, tb10.70.1530; mnd1, tb11.02.3380) and pfr1 (tb927.3.4290) were described in. p166, a component of the tripartite attachment complex connecting the kinetoplast and basal body of the flagellum, was also tagged with yfp (accession number fj407182). pfs were transfected by electroporation, antibiotic selected, and cloned as previously described. for analysis of expression of fusion proteins associated with meiosis, fly organs (sg and alimentary tract from the proventriculus to the hindgut) were dissected in a drop of pbs and examined for the presence of fluorescent trypanosomes using a dmrb microscope (leica) equipped with a retiga exi camera (qimaging) and volocity software (perkinelmer). cells were fixed in 2% w/v paraformaldehyde (pfa) at room temperature for 20 min and stained with dapi in vectashield mounting medium (vector laboratories) to visualize the nucleus and kinetoplast. for analysis of mating between red and green fluorescent trypanosomes, medium containing spilled-out trypanosomes was introduced into a microslide capillary for live imaging as above, together with hoechst live stain if required. alternatively, preparations were spread on microscope slides using a cytospin after fixation in 2% w/v pfa and were dapi stained and mounted as above.

summaryin eukaryote pathogens, sex is an important driving force in spreading genes for drug resistance, pathogenicity, and virulence [1]. for the parasitic trypanosomes that cause african sleeping sickness, mating occurs during transmission by the tsetse vector [2, 3] and involves meiosis [4], but haploid gametes have not yet been identified. here, we show that meiosis is a normal part of development in the insect salivary glands for all subspecies of trypanosoma brucei, including the human pathogens. by observing insect-derived trypanosomes during the window of peak expression of meiosis-specific genes, we identified promastigote-like (pl) cells that interacted with each other via their flagella and underwent fusion, as visualized by the mixing of cytoplasmic red and green fluorescent proteins. pl cells had a short, wide body, a very long anterior flagellum, and either one or two kinetoplasts, but only the anterior kinetoplast was associated with the flagellum. measurement of nuclear dna contents showed that pl cells were haploid relative to diploid metacyclics. trypanosomes are among the earliest diverging eukaryotes, and our results support the hypothesis that meiosis and sexual reproduction are ubiquitous in eukaryotes and likely to have been early innovations [5].

PMC3928991

pubmed-831

in order to maintain cellular homeostasis, the amount of proteins in cells is selectively controlled not only in protein synthesis but also in protein degradation. the ubiquitin proteasome pathway is essential for multiple physiological systems via selective degradation of target proteins (hershko and ciechanover, 1998). the proteins designated for proteasome-mediated degradation are conjugated with polypeptide of ubiquitin, which are then targeted to 26s proteasome complex (hochstrasser, 1995). ubiquitination of target protein is regulated through multi-enzyme processes in an atp-dependent manner. first, the e1 protein, ubiquitin-activating enzyme, activates ubiquitin, which is then transferred to the e2 protein. the ring finger-containing e3 ligase binds to its substrate and the ubiquitinated e2 protein and then directly transfers the ubiquitin from the e2 protein to the substrate (lipkowitz and weissman, 2011). on the other hand, the hect domain-containing e3 ligase can also receive ubiquitin from the e2 protein first through an active-site cysteine of its hect domain then interacts with its substrate to catalyze the conjugation of the activated ubiquitin to the substrate (kee and huibregtse, 2007). since the specificity of the target proteins for proteasome-mediated degradation is dependent on the interaction between the e3 ligases and their targets, the e3 ubiquitin ligases are critical for regulating the expression levels of key short-lived proteins. cancer is a genetic disease that is caused by multiple genetic mutations. in cancer cells, oncogenic drivers that are frequently mutated or overexpressed activate the signaling pathways to promote cell proliferation, growth, and survival while tumor suppressors that are commonly inactivated by mutation or deletion inhibit these pathways. it has been demonstrated that the expression levels of some key oncoproteins and tumor suppressors are under the control of ubiquitin proteasome system with some e3 ligases that function as oncogenic factors or tumor suppressors. for example, mdm2 and skp2 ubiquitinate and inhibit tumor suppressors via proteasomal degradation, and thereby function as oncogenic factors (marine and lozano, 2010; wang et al., 2011). in contrast, other e3 ligases such as the anaphase promoting complex/cyclosome (apc/c) and f-box and wd repeat domain-containing 7 (fbw7) serve as tumor suppressors by downregulating oncogenic factors (crusio et al., 2010; wasch et al., 2010)., bortezomib is a specific proteasome inhibitor that is currently used for the treatment of multiple myeloma. moreover, the inhibitors for specific e3 ligases have been also considered as potential anti-cancer drugs. mdm2 is the primary ubiquitin ligase for tumor suppressor protein, p53, which induces apoptosis or senescence in response to oncogenic stress or dna damage. the p53 pathway is frequently inactivated in human cancer cells, and the small molecules that block the interaction between p53 and mdm2 to inhibit p53 degradation have been tested in clinical trials (brown et al., 2009). protein kinases and phosphatases catalyze the protein phosphorylation and dephosphorylation, respectively, which are essential for maintaining signal transduction. when cells receive extracellular signaling and stress, the signals are primarily transduced to the nucleus via protein phosphorylation, resulting in the alteration of gene expression. for example, epidermal growth factor (egf) stimulates cell proliferation by binding to its receptor, egf receptor (egfr), and activating it. egfr is a receptor tyrosine kinase that phosphorylates and activates multiple downstream targets and promotes cell growth and survival. egfr, considered as an oncogene, is frequently overexpressed or mutated in multiple human cancers and promotes tumor progression, metastasis, and drug resistance (nicholson et al., 2001; hynes and lane, 2005; quatrale et al., indeed, many oncoproteins include protein kinases, and these oncogenic kinases phosphorylate downstream targets to promote tumor growth, metastasis, and/or angiogenesis. the serine/threonine kinase akt is one of the major downstream kinases activated by growth factor signaling such as egfr, platelet-derived growth factor receptor (pdgfr), and insulin-like growth factor receptor (igfr). akt has three isoforms, akt1, akt2, and akt3, and their activities are frequently elevated in multiple human cancers, which contribute to cancer cell survival and growth (altomare and testa, 2005). akt is activated by phosphatidylinositol-3 kinase (pi3k) that converts phosphatidylinositol (3,4)-bisphosphate (pip2) to phosphatidylinositol (3,4,5)-trisphosphate (pip3) in plasma membrane through lipid phosphorylation (altomare and testa, 2005; yuan and cantley, 2008). akt and phosphoinositide dependent kinase 1 (pdk1) are then recruited to the plasma membrane where akt is directly phosphorylated and activated by pdk1 (chan et al., 1999). activated akt phosphorylates various substrates involved in cell metabolism (gsk3, tsc2), survival (bad, foxo), and cell cycles (p21, p27, mdm2; cross et al., 1995; datta et al., 1997; 2001a, b; liang et al., 2002; manning et al., 2002), and then inhibits apoptosis and promotes cell growth. therefore, the pi3k akt pathway is a potential drug target, and several pi3k or akt inhibitors have been actively tested in numerous clinical trials (garcia-echeverria and sellers, 2008; wong et al., 2010; chappell et al., extracellular signal-regulated kinase (erk) is another critical downstream kinase in growth factor signaling and plays an essential role in cancer cell proliferation (robinson and cobb, 1997; sebolt-leopold, 2000). erk pathway is a well-characterized signaling pathway and is commonly activated in multiple human cancers. studies have shown that ras and raf are frequently mutated in various human cancer types and responsible for cancer progression (adjei, 2001; davies et al., 2002). therefore, this signaling pathway has been considered a drug target for cancer therapy, and a variety of inhibitors have been developed, including mek or raf inhibitors (davies et al., 2007; bollag et al., 2010; hatzivassiliou et al., 2010; maurer et al., ib kinases (ikks) are the primary regulator of nf-b, which plays a key role in immune response, cell proliferation, and survival (baldwin, 2001; luo et al., 2005). ikks are activated in response to various cytokines and inflammatory stimuli such as tumor necrosis factor (tnf)-, interleukin-1, and lipopolysaccharide. the ikk family includes ikk, ikk, ikk, ikk, and tank-binding kinase 1 (tbk1). interestingly, ikk has no kinase activity and functions as an adaptor protein for the canonical ikk complex (hacker and karin, 2006). ikks are involved in two distinct pathways for nf-b activation: the canonical and non-canonical pathways. ikk plays a dominant role in the canonical pathway and ikk in the non-canonical pathway (perkins, 2007; israel, 2010). in the canonical pathway, ikk, ikk, and ikk form a kinase complex that phosphorylates ib, an inhibitor protein of nf-b, and induces the ubiquitination and subsequent proteasome-dependent degradation of ib. in the non-canonical pathway, ikk forms a homodimer and phosphorylates p100, and generates p52 by partial processing of p100, resulting in the activation of p52/relb. in contrast to ikk and ikk, ikk and tbk1 play a role in the induction of interferon signaling in response to viral infection (shen and hahn, 2011). although nf-b has been known to be involved in the progression of various cancers, increasing evidence suggests that ikks also play vital roles in cancer independently of nf-b (lee and hung, 2008; baud and karin, 2009; shen and hahn, 2011). for example, ikk phosphorylates both estrogen receptor (er) and co-activator src3 and enhances er transcriptional activity while ikk phosphorylates a tumor suppressor, tuberous sclerosis 1 (tsc1), and inhibits its function (park et al., 2005; ikk also phosphorylates cbp and the phosphorylated cbp preferentially interacts with nf-b rather than p53, resulting in nf-b activation as well as p53 inactivation (huang et al., 2007). inactivation of foxa2 results in the decrease of numb expression, and subsequent notch activation (liu et al., 2012). considering that inhibition of nf-b may affect inflammatory responses, ikks may be the potential alternative drug targets for cancer. the above-mentioned three survival kinases play critical roles in cancer cell survival, metabolism, proliferation, and growth. interestingly, these kinases have many common targets that they directly or indirectly regulate. moreover, we and others have identified several common targets of these three kinases that are regulated by the ubiquitin we will discuss these proteins one by one in the later next section of the review. the forkhead box o (foxo) family proteins are critical transcription factors that are involved in the regulation of cell proliferation, cell death, cell metabolism, and dna repair (tran et al., 2003; arden, 2008). foxo family includes foxo1, foxo3, foxo4, and foxo6, and is conserved from c. elegans to mammals (burgering, 2008; calnan and brunet, 2008). foxo family proteins directly activate multiple gene expression involved in cell cycles, apoptosis, metabolism, and dna damage repair, such as p27kip, bim, fasl, mnsod, gadd45 (dijkers et al., 2000; kops et al., 2002; tran et al., 2002; ciechomska et al., 2003; sunters et al moreover, it has been shown that foxo proteins are dysregulated in multiple human cancers such as breast, prostate, leukemia, and glioblastoma (hu et al., 2004; seoane et al., 2004; conditional knockout mice of foxo1, 3, and 4 develop thymic lymphomas and hemangiomas (paik et al. it has been shown that ikk, akt, and erk directly phosphorylate foxo and induce foxo ubiquitination and degradation. among the three kinases, akt was first identified as a foxo kinase that phosphorylates foxo3 at t32, s253, and s315. phosphorylated foxo3 protein is excluded from entering the nucleus and binds to 14-3-3 in the cytoplasm (brunet et al., 1999) in addition to foxo3, foxo1, and foxo4 are also phoshorylated by akt (tzivion et al., 2011). akt-phosphorylated foxo1 and foxo3 then undergo degradation in a proteasome-dependent manner (plas and thompson, 2003). specifically, foxo1 phosphorylated by akt translocates to the cytosol where it is ubiquitinated by skp2 and subjected to proteasome-dependent degradation (huang et al., 2005). we found that ikk directly phosphorylates foxo3 at s644 and induces its ubiquitination and degradation (hu et al., 2004). recently, e3 ligase -transducing repeat-containing protein (-trcp) is reported to interact with foxo3 and induces ubiquitination and degradation in an ikk-mediated-phosphorylation-dependent manner (tsai et al., 2010; su et al., 2011). furthermore, we and others demonstrated that erk phosphorylates foxo3 and foxo1, respectively (asada et al., 2007; yang et al., 2008). we also showed that foxo3 is phosphorylated by erk at s294, s344, and s425, which then undergoes mdm2-mediated ubiquitination, followed by proteasome-dependent degradation (yang et al., 2008). mdm2-mediated ubiquitination and degradation is also observed with foxo1, which is dependent on the akt-mediated phosphorylation (fu et al., 2009). interestingly, mdm2 induces mono-ubiquitination of foxo4, which promotes nuclear localization of foxo4, and subsequent polyubiquitination by skp2 and degradation (brenkman et al., 2008). taken together, the ubiquitin proteasome system plays an essential role in regulating foxo transcription factors by akt, erk, and ikk, and mdm2, skp2, and trcp are e3 ligases for foxo ubiquitination (figure 1a). (a) akt, erk, and ikk phosphorylates foxo3 at different sites and induces its ubiquitination and subsequent degradation via skp2, mdm2, and -trcp, respectively. gsk3 phosphorylates catenin and induces its ubiquitination and subsequent degradation via -trcp. both akt and ikk phosphorylate -catenin and stabilize it. -catenin is the key protein in both cadherin junction and wnt pathway and plays an important role in development and adult homeostasis as well as tumorigenesis (cadigan, 2008; stepniak et al., 2009). in the wnt signaling pathway, -catenin functions as a transcription co-factor and is involved in the transactivation of several oncogenic proteins such as c-myc, cyclind1, and matrix metalloproteases (he et al., 1998; lin et al., 2000 glycogen synthase kinase-3 (gsk3) and casein kinase 1 (ck1) are the major protein kinases regulating the -catenin stability. in the absence of wnt ligand, -catenin forms a complex with axin, apc, gsk3, and ck1 and is phosphorylated by these kinases. once phosphorylated, -catenin undergoes -trcp-mediated ubiquitination and subsequent degradation. when wnt binds to its receptor, frizzles, and co-receptor, lrp5/6, the receptor complex recruits axin gsk3 complex to cell membrane, releasing -catenin from the complex for its translocation to the nucleus where it activates gene transcription with t-cell factor (tcf) and lymphocyte enhancer factor (lef). akt has been shown to directly phosphorylate gsk3 and inhibits it (cross et al., 1995), and therefore, akt seems to indirectly inhibit -catenin degradation and inactivation through inhibition of gsk3 (monick et al., 2001). in addition to the indirect mechanism, akt directly mediates the -catenin stability by phosphorylating -catenin at s552. once phosphorylated by akt, -catenin binds to 14-3-3 and is stabilized (tian et al. in addition to akt, we also demonstrated that erk upregulates -catenin via inhibition of gsk3 (ding et al., activated erk directly interacts with gsk3 and phosphorylates it at t43. after the phosphorylation by erk, gsk3 is primed for subsequent phosphorylation by p90rsk at s9, which inactivates it. furthermore, ikk has been shown to be directly involved in the -catenin regulation, and ikk but not ikk phosphorylates -catenin and prevent its ubiquitination and degradation (lamberti et al., 2001; albanese et al., 2003; carayol and wang, 2006). collectively, -catenin is another common target of akt, erk, and ikk, demonstrating that the ubiquitin myeloid cell leukemia-1 (mcl-1) is a member of anti-apoptotic bcl-2 family proteins which are the central regulators of apoptosis signaling pathway (inuzuka et al., 2011a). the bcl-2 family consist of pro-apoptotic and anti-apoptotic proteins that regulate the release of apoptogenic proteins such as cytochrome c and smac from mitochondria (youle and strasser, 2008). pro-apoptotic bcl-2 family proteins include the bh3-only proteins such as bim, bid, bik, and bad and multi-bh domain like bax and bak. bax and bak are able to form channels on the surface of mitochondria from which cytochrome c and smac are released. anti-apoptotic bcl-2 family proteins, which include bcl-2, bcl-xl, and mcl-1, prevent apoptotic cell death by inhibiting the activation and channel formation of bax and bak. in contrast, the bh3-only proteins directly bind to anti-apoptotic bcl-2 family proteins and inhibit their functions. thus, the balance of anti-apoptotic and pro-apoptotic proteins determines cell survival and death, and the expression of anti-apoptotic bcl-2 family protein is the critical for cell survival. among the anti-apoptotic bcl-2 family proteins, 2003; adams and cooper, 2007) but its expression is enhanced in various cancer types (placzek et al., 2010). the primary kinase that regulates mcl-1 stability is gsk3. we and another group reported that gsk3 interacts with and phosphorylates mcl-1 at s155, s159, and t163 (maurer et al. mule is the bh3 domain-containing e3 ligase that was the first identified as the mcl-1 ubiquitin ligase by biochemical purification (zhong et al., 2005). later, we found that -trcp can ubiquitinate and induce mcl-1 degradation in gsk3-mediated-phosphorylation-dependent manner (ding et al., 2007). recently, a tumor suppressor protein, fbw7, is shown to function as a mcl-1 ubiquitin ligase (inuzuka et al. fbw7-induced ubiquitination of mcl-1 is also dependent the phosphorylation induced by gsk3. although both -trcp and fbw7 recognize the same gsk3-mediated phosphorylation sites in mcl-1, the exact roles of these two ubiquitin ligases under various apoptotic stresses are unknown. akt and erk have been shown to upregulate mcl-1 transcription (wang et al., 1999; in addition, both pi3k/akt and mek/erk pathways have also been shown to enhance mcl-1 protein stability (derouet et al., 2004). because akt inhibits gsk3 as described above, akt increases mcl-1 stability, at least in part, by inhibiting gsk3. indeed, the inhibition of pi3k induces s159 phosphorylation of mcl-1 and subsequent ubiquitination and degradation of mcl-1, which are blocked by gsk3 inhibition (maurer et al., 2006). in addition to gsk3, it has been show that erk phosphorylates mcl-1 at t92 and t163 (domina et al. in particular, we showed that erk-phoshorylated mcl-1 can interact with pin1 (ding et al., 2008). prolyl cis/trans isomerase that binds to specific ps/t-p motifs and then isomerizes its substrates, resulting in their conformational changes. interestingly, pin1 stabilizes mcl-1 protein after the phosphorylation by erk, and the expression of mcl-1 correlates with pin1 in multiple human cancer cell lines (ding et al., 2008). regarding ikk, there is no evidence that ikk is directly involved in mcl-1 or gsk3 phosphorylation and/or ubiquitination. however, it has been shown that nf-b is required for egf-induced mcl-1 induction, suggesting that the ikk nf-b pathway plays a role in mcl-1 expression or stability (henson et al., 2003). thus, mcl-1 is a critical apoptosis regulator that is controlled by the three kinases at the post-translational as well as transcriptional level (figure 2a). gsk3 phosphorylates mcl-1 and induces its ubiquitination and subsequent degradation via -trcp, mule, and/or fbw7. erk also directly phosphorylates mcl-1, and phosphorylated mcl-1 interacts with pin1, resulting in its stabilization. gsk3 phosphorylates snail and induces its nuclear exclusion, ubiquitination and subsequent degradation via -trcp. nf-b pathway inhibits snail via upregulation of csn2, which interferes with the gsk3snail interaction and ubiquitination of snail. epithelial mesenchymal transition (emt) is an important physiological process that converts epithelial cells to mesenchymal cells which plays an essential role in embryonic development and tissue repair (nieto, 2009). epithelial cells lose cell cell contacts and gain migratory properties during emt. during cancer progression, cancer cells undergo emt, resulting in increased motility, invasiveness, and aggressive behavior (kalluri and weinberg, 2009). snail is a zinc-finger transcription repressor that is one of the emt regulators. snail family contains snail1 (snail), snail2 (slug), and snail3 (smuc; de herreros et al., 2010). like other emt regulators in addition to emt, snail is also involved in cell death, survival, stem cell, and immune regulation by controlling multiple target genes (wu and zhou, 2010). downregulation of snail reduces tumor growth and invasiveness in xenograft animal model (olmeda et al., 2007). moreover, snail is overexpressed in multiple human cancers, and expression of snail is associated with poor cancer prognosis (peinado et al., 2007). snail stability is primarily regulated by gsk3 through the pi3k akt pathway (song et al., 2009). we have shown that gsk3 can phosphorylate snail at six serine residues in which two of them are responsible for snail stability while the other four are involved in its nuclear localization (zhou et al., 2004). first, gsk3 phosphorylates snail at four serine residues to allow its export from the nucleus. then, gsk3 phosphorylates the other two sites, resulting in -trcp-mediated ubiquitination and degradation of snail. specifically, nf-b induces cop9 signalosome 2 (csn2), which disrupts the interaction between gsk3 and snail, resulting in the inhibition of snail ubiquitination and subsequent degradation (wu et al., 2009). however, erk does play a role in c-myc-induced emt via the inhibition of gsk3, and there by stabilizing snail (cho et al., 2010). furthermore, erk upregulates snail gene transcription though activation of ap-1 transcription factor (hudson et al. independently of kinases, wild type p53 but not mutant p53 has been shown to interact with and induce snail and slug ubiquitination and degradation (wang et al., 2009; lim et al., moreover, f-box and leucine-rich repeat protein 14 (fbxl14) has been shown to interact with and induce snail ubiquitination and degradation (vinas-castells et al., 2010). so far, no other kinases have been reported to be involved in mdm2- or fbxl-mediated snail ubiquitination. thus, the three kinases (akt, erk, and ikk) seem to be involved in emt, at least in part, by regulating snail expression through ubiquitination (figure 2b). recent advances in signal transduction studies have identified many key oncogenic kinases and their substrates in cancer progression, and the signaling pathways associated with these kinases have been recognized as promising drug targets. indeed, several kinase inhibitors have been developed and used in clinic that show high efficacy and low toxicity (sharma and settleman, 2010). however, several clinical studies have emerged showing that some patients exhibit little or no response to these targeted drugs, and those who originally responded the drugs eventually developed resistance. although the detailed mechanisms underlying drug resistance are not fully understood, there is evidence to support that alternative pathways are being activated in resistant cells to compensate for the survival signal blocked by targeting agents. for example, egfr tyrosine kinase inhibitors (tkis) are effective drugs for egfr mutant lung cancer, but c-met amplification or k-ras mutation causes the resistance to tkis by bypassing the inhibition of survival signaling (bean et al., 2007; linardou et al., we also showed that cancer cells with high akt signaling pathway exhibit resistance to erk inhibitors by inhibiting foxo3 (yang et al., 2010). therefore, in order to develop effective personalized cancer therapy, it would be essential that we understand the cross-talk among the multiple oncogenic signaling pathways. in this review, we introduced akt, erk, and ikk as the key survival kinases for cancer progression and survival. we also mentioned that these three pathways have several common targets that are critical for cancer cell proliferation, survival, and emt. because there are many other pathways that are activated in human cancers, we believe that they likely also contribute to the same targets we described here. these three kinase-signaling pathways may have other common targets that are critical for cancer progression. we also introduce some examples of the signaling pathways that are controlled via the ubiquitin proteasome system, which seems to play an essential role in signaling pathway like phosphorylation. as we described above, inhibition of protein ubiquitination moreover, blockade of specific ubiquitination may exhibit less toxicity because inhibition of upstream molecules in key oncogenic signaling pathways may affect numerous signaling pathways and induce unfavorable side effects. clearly, further studies for signaling pathways in cancer including post-translational modifications are required for the development of effective personalized cancer therapies. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

the ubiquitin proteasome system is essential for multiple physiological processes via selective degradation of target proteins and has been shown to plays a critical role in human cancer. activation of oncogenic factors and inhibition of tumor suppressors have been shown to be essential for cancer development, and protein ubiquitination has been linked to the regulation of oncogenic factors and tumor suppressors. three kinases, akt, extracellular signal-regulated kinase, and ib kinase, we refer to as oncokinases, are activated in multiple human cancers. we and others have identified several key downstream targets that are commonly regulated by these oncokinases, some of which are regulated directly or indirectly via ubiquitin-mediated proteasome degradation, including foxo3, -catenin, myeloid cell leukemia-1, and snail. in this review, we summarize these findings from our and other groups and discuss potential future studies and applications in the clinic.

PMC3355968

pubmed-832

congenital adrenal hyperplasia (cah) is caused by deficiency of 21-hydroxylase in the adrenal glands. cortisone acetate (ca) is used worldwide as an equivalent to hydrocortisone (hc), as the glucocorticoid component of substitution therapy for cah. hc is identical to cortisol, while ca is nearly equivalent to cortisone apart from the presence of an acetate group at the c21 position. cortisol represents active glucocorticoid, while cortisone is an inactive form. the hepatic enzyme 11-hydroxysteroid dehydrogenase (11-hsd) type 1 catalyzes the conversion of cortisone to cortisol by reducing the keto group at the c11 position to a hydroxyl group accordingly, orally administered ca must be converted to cortisol by 11-hsd in order to be bioactive. the overall bioactivity of ca given orally has been reported to be 80% of that of hc (1). furthermore, a patient with 21-hydroxylase deficiency has been reported as a poor responder to ca treatment (2). we converted 10 of our cah patients from ca to hc substitution therapy, compared clinical and laboratory findings before and after the change. ten patients with cah caused by 21-hydroxylase deficiency were studied (6 male, 4 female; ages, 4 to 35 yr). of the 10 patients, 8 were salt losers, who required fludrocortisone in addition to glucocorticoids. for all subjects, hc was administered instead of ca, initially at 80% of the previous ca dose. the dose of hc then was increased or decreased according to circulating concentrations of 17-hydroxyprogesterone (ohp) and/or adrenocorticotropin (acth). target concentrations were below 10 ng/ml for 17-ohp and below 50 pg/ml for acth. doses of fludrocortisone were not changed. to compare required doses of ca and hc, the ca requirement was calculated as the average of the several months preceding the change of drug, while the hc requirement was the dose found to provide stable control of cah after several months. these doses were calculated as milligrams per square meter of body-surface area. before and after the drug change, we measured concentrations of 17-ohp and acth, as well as patients height and weight. the mean observation period after the drug change was 10 mo (6 to 14 mo). a radioimmunoassay was used to measure 17-ohp, while acth was measured by immunoradiometric assay. genomic dna of a patient who responded poorly to treatment with ca was obtained from peripheral leukocytes. all exons, exon-intron boundary regions and 2.4 kb of the promoter region of 11-hsd were amplified by pcr. then the dna sequence was determined using an abi prism 310 genetic analyzer. for bone age determination, the tanner-whitehouse 2 rus method according to the japanese standard was used. the mean 17-ohp concentration during treatment of our patients with ca was 48.6 ng/ml. this decreased to 10.1 ng/ml when the treatment was changed to hc (table 1table 1 demographic, pharmacologic, and endocrinologic data for individual subjects, fig. 1 serum concentrations of 17-hydroxyprogesterone (ohp) during treatment were significantly lowered by changing from cortisone acetate (ca) to hydrocortisone (hc). each data point represents the mean concentration of 17-ohp of an individual during treatment with ca or hc.). the mean concentration of acth was 198.0 pg/ml during treatment with ca, decreasing to 35.1 pg/ml during treatment with hc. we compared the dose of ca preceding the change of drug with that of hc after dose adjustment, when disease control was stable. the average drug requirement for ca was 33.9 mg/m, while it was 20.3 mg/m for hc. the relationship can be expressed as an equation, hc=0.58 ca, and the coefficient is substantially lower than the conventionally reported dose ratio of 0.8 (1). in addition, older patients required more ca per square meter of body-surface than younger patients. the relationship between the ca dose shortly before the change of drug and the final hc dose is shown in fig.. 2 relationship between the dose requirements of cortisone acetate (ca) and hydrocortisone (hc). the solid regression line can be expressed as: hc=0.58 ca .. no significant change in the obesity index occurred in any subject in association with the change of drug. among subjects who already had attained their adult height, all male patients (cases 5, 8, and 9) showed short stature attributable to precocious puberty. in case 5, four patients (cases 1 to 4) who had been diagnosed by neonatal screening were at a prepubertal age. in cases 1 to 3, no change of height sd score was recognized before or after the drug change. case 4 showed some auxological change related to medication, described below. serum concentrations of 17-hydroxyprogesterone (ohp) during treatment were significantly lowered by changing from cortisone acetate (ca) to hydrocortisone (hc). each data point represents the mean concentration of 17-ohp of an individual during treatment with ca or hc. relationship between the dose requirements of cortisone acetate (ca) and hydrocortisone (hc). the solid regression line can be expressed as: hc=0.58 ca. case 4: a 10-yr-old boy was found to have an increased concentration of 17-ohp at 6 yr of age, and was treated with ca. the ca dose was increased from 20 mg/m at 6 yr to 35 mg/m at 8.2 yr. during this period, height velocity increased, as did height sd score (0.1 to 0.8). the bone age (ba)/chronological age (ca) ratio also increased (0.9 to 1.2). after conversion to hc at 9.4 yr of age, control of disease improved as evidenced by a decrease in 17-ohp. at 10.1 yr of age, the height sd score had decreased to 0.6, and the ba/ca ratio had decreased to 1.1. the hc requirement was 20.9 mg/m. in case 5, we performed dna sequence analysis for 11-hsd type 1 because treatment with ca had no effect at all. case 5: a 13 -yr-old boy was referred from another hospital where he had been treated with 28 mg/m of hc. in our outpatient clinic, treatment was changed to 36 mg/m of ca. soon afterwards 17-ohp increased abruptly to 260 ng/ml from 5.3 ng/ml. the plasma level of acth increased to 1038 pg/ml from 8.3 pg/ml. since this patient appeared to be a poor responder to ca, 28 mg/m of hc inability to respond to ca initially was thought to result from impaired low conversion of cortisone to cortisol, because of low activity of 11-hsd type 1. however, dna sequence determination in the gene encoding this enzyme detected no changes from the reported normal sequence in any of the six exons, exon-intron boundary regions, or the promoter region (2.4 kb) (3). in 10 patients with 21-hydroxylase deficiency, we changed the glucocorticoid for the substitution therapy from ca to hc. indices of control of cah such as 17-ohp, and acth decreased, indicating improvement. on average, the final requirement for hc based on these indicators, was only 0.58 times the previous dose of ca, which was smaller than previously reported (1). whorwood and warne (4) determined urinary tetrahydrocortisone (the)/ tetrahydrocortisol (thf) ratios for 14 cah patients treated with ca, and found that better control of the disease was associated with lower the/thf ratios. the pharmacologic effect of ca depends on conversion of cortisone to cortisol by 11-hsd. however, when we performed gene sequencing in one of our poor ca responders, we found no mutation in the 11-hsd gene including the promoter region. (2) similarly reported failure to detect a mutation in the 11-hsd gene. up to the present, no 11-hsd gene mutation has been detected in poor responders. even single-nucleotide polymorphism has not been common, apart from the recently reported intronic gene polymorphism (5). as described for case 4, an individual patient s response to ca can vary with age or other factors. in addition, blood concentrations of cortisone have been reported to be higher than those of cortisol in the neonatal period and early infancy (6). accordingly steroid metabolism in young children may differ from that in school-age or older children. in our study, a poor response to ca, therefore, may involve variability of 11-hsd activity rather than genetic changes. jamieson et al. (7) reported a 36-yr-old woman who had clinical features of hypercortisolemia associated with a normal plasma cortisol concentration and an elevated urinary the/thf ratio, possibly caused by a defect in hepatic 11-hsd. in another case of 6 yr old boy with precocious pubarche had an elevated urinary the/thf ratio (decreased thf/the ratio) attributed to low activity of 11-hsd (8). this enzyme has attracted considerable attention in studies concerning obesity and other endocrinological disorders. an agonist at the peroxisome proliferator-activated receptor is suspected to regulate 11-hsd, decreasing its activity (9). among patients with cah, good responders however, we found no relationship between response to ca and obesity. among our subjects who attained adult height, male patients were shorter than previously reported adult patients with cah (10). our findings provided no definitive indication of whether or not hc is superior to ca in achieving a desirable height. however, in one growing child (case 4), changing the drug from ca to hc decreased the ba/ca ratio. final height in patients treated with hc might prove to be greater than that in patients treated with ca. as a therapeutic agent, ca shows considerably greater inter- and intra-individual variations in efficacy than hc. in addition, we found greater difference in pharmacological activity between ca and hc than has been previously reported. ca would seem inadequate for substitution therapy not only in patients with cah, but also those with other forms of adrenal insufficiency such as adrenal hypoplasia or hypofunction caused by pituitary disorders. treatment with hc is recommended for these patients as well. however, since hc has been reported to be too bioavailable to maintain cortisol concentrations within physiologic limits (11), careful evaluation of physiologic aspects of hc-based substitution regimens may be needed .

although cortisone acetate is approved worldwide as corticosteroid substitution therapy in congenital adrenal hyperplasia (21-hydroxylase deficiency), its effectiveness is uncertain since its biologic activity depends on activation by 11-hydroxysteroid dehydrogenase (11-hsd). we sought to compare the effect of cortisone acetate with that of hydrocortisone. in 10 patients with congenital adrenal hyperplasia, cortisone acetate was replaced with hydrocortisone in substitution therapy. during this change, blood concentrations of 17-hydroxy-progesterone, adrenocorticotropin (acth), and requirements for each drug were monitored. concentrations of 17-hydroxyprogesterone decreased (mean 10.1 vs. 48.6 ng/ml), as did those of acth. cortisone acetate dose requirements averaged 33.9 mg/m2, while hydrocortisone dose requirements averaged only 20.3 mg/m2. in one of the patients resistant to cortisone acetate therapy, dna sequences in the coding regions and promoter of the 11-hsd gene were analyzed, detecting no genetic abnormalities. cortisone acetate is inferior to hydrocortisone as substitution therapy in patients with congenital adrenal hyperplasia.

PMC4004908

pubmed-833

melanocyte-stimulating hormone release inhibiting factor-1 (mif-1), also known as plg based on its amino acid structure (pro-leu-gly-nh2), is an endogenous brain peptide that exerts a variety of pharmacological effects on the central nervous system. clinical studies have shown that mif-1 can alleviate symptoms in parkinson's disease (pd) and mental depression. these have been summarized elsewhere, although the review overlooked a report in the chinese literature of favorable results of mif-1 in pd. mif-1 was the first hypothalamic peptide shown to act up on the brain, not just down on the pituitary. in human plasma, a duration of 5 days is required for 50% degradation of mif-1 at 37c. this remarkable stability of mif-1 in human blood, coupled with its persisting biological activity, makes mif-1 a worthwhile candidate as a human therapeutic agent. the therapeutic potential of mif-1 indicates the importance of further determining how it acts on the brain. there already is evidence that mif-1 activates cns pathways related to opiate and dopaminergic systems based on the following evidence: (1) mif-1 antagonizes opiate actions, and the first report of such activity correctly predicted the discovery of other endogenous antiopiate peptides blocking the analgesic effect of morphine and enkephalin in a radiant heat tail-flick assay. mif-1 also significantly antagonized the effects of morphine in a double-blind study in humans. (2) mif-1 is effective in the dopa-potentiation, oxotremorine antagonism, and deserpidine antagonism tests. in a small number of patients with pd, barbeau found its potentiation of the effects of levodopa to be remarkable; (3) mif-1 can modulate dopaminergic transmission in-vitro as well as in-vivo, increasing the binding affinity of agonists to the high-affinity state of the dopamine receptor and shifting the ratio of high- and low-affinity states of the dopamine receptor in favor of the g-protein-coupled high-affinity state. (4) the actions of mif-1 appear rather selective toward dopamine receptors since it does not interact with other aminergic receptors such as adrenergic, gabaergic, or serotonergic receptors. (5) mif-1 also facilitates passive acquisition of brightness discrimination, passive avoidance retention, appetitive maze performance, and inhibits shock-suppressed water intake, findings interpreted as contributing to the processes of memory consolidation [1, 12]. however, mif-1 does not change camp in the brain in contrast to the increase induced by -msh, and its induction of cgmp is not robust in rat brain. this led us to study alternative cellular signaling pathways. a number of exogenous stimuli, including an increase in neuronal activity, trigger the transcription of c-fos, which is an immediate early gene that in combination with the specific jun proteins forms the heterodimeric transcription regulator, ap-1. the extracellular signal-regulated kinase (erk)-1/2 pathways are involved in the induction and regulation of c-fos. in this study, we performed a brain mapping of the neuronal expression of c-fos after intravenous (iv) or intracerebroventricular (icv) injection of mif-1. all studies were conducted following a protocol approved by the institutional animal care and use committee. adult male c57bl/6j mice were purchased from jackson laboratories (bar harbor, me) and housed in the animal care facility for at least 2 weeks before study. the mice were housed 4/cage and provided with regular rodent chow and water ad libitum. the light span was 07:0019:00 hours in a light-dark (ld) 12:12 lighting regimen. mif-1 was purchased from phoenix pharmaceuticals (burlingame, ca) and reconstituted in phosphate-buffered saline (pbs) before use. rabbit polyclonal anti-c-fos antibody, goat anti-pstat3-tyr antibody, and mouse anti-perk e-4 monoclonal antibody were purchased from santa cruz biotechnology (santa cruz, ca). louis, mo). in accordance with a protocol approved by the institutional animal care and use committee, c57bl/6j male mice (57 weeks old) mif-1 was delivered either into the isolated left jugular vein (iv) at 10 g/mouse in a volume of 50 l (n=3), or into the right lateral cerebral ventricle (icv) at 1 g/mouse in a volume of 1 l (n=3). the icv coordinates were 2 mm lateral and 0.2 mm posterior to the bregma, and 2.5 mm below the skull. the mice were perfused intracardially with 30 ml of normal saline (ns) followed by 60 ml of 4% paraformaldehyde. the brain was postfixed overnight in 4% paraformaldehyde and cryoprotected in 15% and then 30% sucrose. coronal sections of 20 m thickness were obtained by the use of a cryostat. the tissue sections were permeabilized with 0.3% triton x-100 and blocked with 10% normal donkey serum, and incubated with a primary antibody overnight at 4c. the antibodies include rabbit polyclonal anti-c-fos antibody (1: 200, santa cruz biotechnology sc-52) and anti-rat neun antibody (1: 100, chemicon). after thorough washing, they were incubated with respective alexa488-conjugated secondary antibodies at room temperature for 1 hour, washed, and mounted. sh-sy5y human neuroblastoma cells (american type culture collection, atcc, manassas, va) were grown in dulbecco's modified eagle's medium (dmem) with 10% fetal bovine serum (fbs). the cells were differentiated by treatment with 10 m of all-trans retinoic acid (sigma, st. sixteen hours after serum starvation, the cells were treated with mif-1 (110 ng/ml for different time intervals (03 hours). all cells were plated at the same time and treated according to the time intervals designed for individual experiments. the cells were lysed in ice-cold ripa buffer (100 mm nacl, 10 mm tris, ph 7.2, 0.1% sds, 1% triton x-100, 1% deoxycholate, 5 mm edta) in the presence of protease inhibitor cocktail (pierce, rockford, il). thirty to 50 g of protein was electrophoresed on 12% sds-polyacrylamide gel and transferred to a nitrocellulose membrane (bio-rad, hercules, ca). the membrane was blocked with 5% non-fat dry milk in tris-buffered saline (ph 7.6) containing 0.1% tween-20, and probed with rabbit anti-c-fos (polyclonal, 1: 200, santa cruz biotechnology, sc-52), goat anti-pstat3 tyr 705 (polyclonal, 1: 1,000 sc-7993), mouse anti-perk e-4 (monoclonal, 1: 500, sc-7383 and mouse anti--actin (monoclonal, 1: 10,000, sigma, a2228) overnight at 4c. after thorough washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody for 1 hour at room temperature. the signals were developed with enhanced chemiluminescence-plus western blotting detection reagents (amersham biosciences, piscataway, nj). we previously observed that mif-1 is saturably transported from blood to brain. in this study, we demonstrate that iv injection of mif-1 increased c-fos immunoreactivity in different brain regions. the regions that showed the highest c-fos activation include cingulate cortex (figures 1(c3) and 2(a)), infralimbic cortex (figures 1(c1) and 2(e)), nucleus accumbens (figures 1(c1) and 2(i)), paraventricular nucleus (pvn) in the hypothalamus (figures 1(c5) and 2(f)), medial basal amygdaloid nucleus (figures 1(c6) and 2(h)), fiber tract in piriform cortex (figures 1(c6) and 2(g)), paraventricular thalamic nucleus (figures 1(c6), 2(c), and 2(d)), and other thalamic nuclei (figures 1(c7) and 2(b)). double labeling with neun showed that many of the cells expressing c-fos were neurons. the increase in c-fos expression was greater after iv injection than after icv injection in many brain regions. this is consistent with the ability of stable substances in the cerebral circulation to reach all parts of the brain rapidly. after icv, the increase of c-fos was mainly seen in the paraventricular nucleus of the hypothalamus (figures 1(b5) and 2(f)). table 1 summarizes the number of c-fos immunopositive cells in different brain regions. western blotting showed that the c-fos signal was increased 60 minutes after mif-1 treatment (10 ng/ml). there was also a dose-dependent increase, highest at the maximal dose of 10 g/ml, but even the lowest concentration of mif-1 tested (6.25 ng/ml) showed a robust induction of c-fos 1 hour later (figure 3(b)). western blotting analysis showed that perk expression was increased in sh-sy5y cells 10 minutes after mif-1 treatment (10 ng/ml) (figure 4). by contrast, the cells responded to mif-1 with an initial reduction of pstat3 at 10 and 60 minutes, followed by increased pstat3 expression at 2 and 3 hours (figure 5). in this study, we showed that mif-1 induces c-fos activation in different regions of the brain and in cultured neurons. this is the first report stating that mif-1 increases the phosphorylation of erk, indicative of activation of a mitogen-activated protein kinase (mapk) pathway. our results show that mif-1 decreased pstat3 initially (10 and 60 minutes), but then increased pstat3 at later times (2 and 3 hours) in neuronal culture, probably reflecting a secondary mechanism. this also is the first report showing that mif-1 modulates pstat3 activation, although the functional consequences are not clear. these are not classical elements of the gpcr signaling pathway, and suggest a broader action of this orphan ligand. while a peptide like mif-1 may either show direct cns effects or activate secondary mediators, c-fos immunoreactivity reflects a final common pathway of brain activation as a result of mif-1 application. the immediate early gene product c-fos is an easily identifiable and rather sensitive marker for cns activation. the increase of c-fos has been demonstrated after various stimuli, including growth factors, ion channel activation, neurotransmitter release, and behavioral modifications. the increase of its expression can be mediated by many intracellular signaling pathways, such as increases in camp, calcium influx, and activation of mapk. our results show that the increase in c-fos expression is greater after iv injection than after icv injection in many brain regions. after icv administration, the increase of c-fos immunoreactivity was mainly seen in the pvn of the hypothalamus. considering that less than 1% of mif-1 from blood permeates the blood-brain barrier to reach the brain, like most centrally active peptides and even l-dopa and morphine, this indicates that blood-borne mif-1 is more effective than when administered into the slower moving ventricular system of the brain. this is not surprising considering that no neuron is more than about 8 m from a capillary. it is also possible that peripherally injected mif-1 activates additional mediators, thus triggering a cascade of signalling events. the implications of mif-1-induced c-fos activation in different brain regions are discussed below. (1) cingulate cortex: the cingulate cortex is an anatomically and functionally heterogeneous region and it modulates emotion and mood. attention deficit in pd has been explained by dopamine depletion of the cingulate cortex. fornix-induced lesions can reduce c-fos immunoreactivity in the cingulate cortex of rats. earlier studies showed that lesions of the cingulate cortex affect behavior in the open-field and interspecies aggression behavior in rats. melatonin (5-methoxy-n-acetyltryptamine) was reported to be critically involved in the regulation of both mood and pain. melatonin receptor type 1 (mt1)-knockout mice display depression-like behavior with altered sensory responses and attention deficits. these previous studies show that the central melatoninergic system might play an important role in the mechanism of interactions between pain and depression, and the anterior cingulate cortex could be a forebrain region of interest in this process. mif-1 can potentiate the melanocyte-lightening effect of melatonin in rats, and its effects in patients with pd are associated with marked mood elevation. therefore, the mif-1-induced c-fos activation in the cingulate cortex supports the speculation that the effectiveness of mif-1 in treating movement disorders may be associated with increased melatonin secretion. (2) thalamus: the lateral geniculate nucleus of the thalamus is involved in fluctuations in both visual attention and visual awareness. mif-1 can facilitate acquisition of brightness discrimination, probably by affecting processes of attention when rats are tested with a spatial extradimensional shift problem after acquisition of a visual task. c-fos expression has been found in the medial geniculate body (mgb) of the thalamus after mice acquired a visually cued conditioned fear. the activation of c-fos by mif-1 in the thalamus supports the direct effects of mif-1 there. (3) infralimbic cortex: the infralimbic cortex (il) is a cortical region in the medial prefrontal cortex that is important in tonic inhibition of subcortical structures and emotional responses such as fear this illustrates cortical control over extinction processes, which is one of the simplest forms of emotional regulation. less c-fos immunoreactivity is present in the il of the extinction-resistant mouse compared with the control. in a 12-choice warden maze for a palatable food reward, rats receiving mif-1 have shorter latencies and make fewer errors than controls during learning, but not extinction, of the task. (4) nucleus accumbens: both typical and atypical antipsychotic drugs increase c-fos protein expression in the nucleus accumbens shell. the ability of mif-1 to increase c-fos in the forebrain may have considerable predictive validity for antipsychotic drug actions. administration of mif-1 to patients with depression showed substantial improvement within a few days after initiation of treatment [3335]. previous studies showed that antipsychotic drugs like clozapine and amperozide preferentially increase dopamine release in the rat nucleus accumbens and prefrontal cortex. hippocampal dopamine receptors modulate c-fos expression in the rat nucleus accumbens that is evoked by chemical stimulation of the ventral hippocampus. thus, mif-1 may activate cells in the nucleus accumbens and modulate dopaminergic activity there to alleviate mood and schizoaffective disorder. (5) pvn: the pvn plays important roles in neuroendocrine and autonomic nervous system controls. for example, many experimental challenges (such as restraint stress, dehydration, and immune challenge) induce c-fos expression in the pvn [38, 39]. although mif-1 has no effects on a naloxone-sensitive peptide yy (pyy) model of hyperphagia after pyy injection into the pvn, the induction of c-fos by mif-1 through both iv and icv injection indicates that pvn is a major site of action for mif-1. (6) medial amygdaloid nucleus: an avoidance task in the elevated t maze can increase fos protein expression in the medial amygdaloid nucleus. the amygdala is a point of convergence for conditioned and unconditioned stimuli and seems to impart emotional value to sensory stimulation. increased expression of immediate early genes in the amygdala has been reported in several paradigms of aversive conditioning. these findings may provide a physiological basis for mif-1 induced c-fos activation in the amygdala. (7) piriform cortex: the presence of the c-fos protein has been shown in the piriform cortex at different stages during the acquisition of trace conditioning in rabbits. mif-1 also facilitates passive avoidance retention and inhibits shock-suppressed water intake, findings interpreted as contributing to the processes of memory consolidation. in elevated-plus-maze tests, mice treated with tyr-mif-1 tend to spend more time in the open arms compared with the control group, suggesting the anxiolytic properties of this peptide that shows structural homology with mif-1. training induces c-fos mrna expression in the piriform cortex and the neocortex of n-3-fatty acid depleted rats, who showed learning improvement in an olfactory discrimination task. mif-1 also improves the capacity of rats to store information received through olfactory cues in social investigatory behavior. in summary, the results show that mif-1 increased c-fos expression in brain regions involved in the regulation of mood, anxiety, depression, and memory. blood-borne mif-1 induced a greater extent of activation than that after icv, suggesting a prominent role of blood-brain barrier permeation. the activation status of perk and pstat3 may contribute to the overall expression level of c-fos. thus, the results indicate the cellular mechanisms of actions of mif-1 that may underlie the therapeutic effects of mif-1 in the treatment of parkinson's disease and depression.

mif-1 (pro-leu-gly-nh2) is a tripeptide for which the therapeutic potential in parkinson's disease and depression has been indicated by many studies. however, the cellular mechanisms of action of mif-1 are not yet clear. here, we show the specific brain regions responsive to mif-1 treatment by c-fos mapping, and determine the kinetics of cellular signaling by western blotting of perk, pstat3, and c-fos in cultured neurons. the immunoreactivity of c-fos was increased 4 hours after mif-1 treatment in brain regions critically involved in the regulation of mood, anxiety, depression, and memory. the number of cells activated was greater after peripheral treatment (intravenous delivery) than after intracerebroventricular injection. in cultured sh-sy5y neuronal cells, c-fos was induced time- and dose-dependently. the activation of cellular c-fos was preceded by a transient increase of mitogen-activated protein kinase perk but a reduction of phosphorylated signal transducer and activator of transcription (pstat3) initially. we conclude that mif-1 can modulate multiple cellular signals including perk, and pstat3 to activate c-fos. the cellular activation in specific brain regions illustrates the biochemical and neuroanatomical basis underlying the therapeutic effect of mif-1 in parkinson's disease and depression.

PMC2915805

pubmed-834

the fda-approved da vinci surgical system is a novel approach to perform minimally invasive surgery and is considered a second revolution in surgery after the introduction of laparoscopic surgery. this system was introduced in april 2003 at our institution, with 90 pediatric patients undergoing a variety of procedures performed by our surgical group. among these procedures, several reports have been published on this subject, concluding that it is a feasible, safe alternative. despite some of its potential benefits, there has yet to be any improvement shown by using the robot over the standard laparoscopic or open technique. our objective in this study was to compare results using the robot system with that of laparoscopic and open techniques in our pediatric patients to determine the potential for acceptance as a standard approach in this population. following irb approval, 150 charts of patients who underwent nissen procedures from 1994 to 2005 were divided into 3 treatment groups defined by technical approach, either robotic (r) (n=50), laparoscopic (l) (n=50), or open (o) (n=50). groups were case-matched and performed by several surgeons and residents, under the care of one of the 3 staff surgeons at our facility. the robot system used was the da vinci (intuitive surgical, mountain view, ca, usa). the fourth arm was used in a minority of pediatric patients due to the short distance between ports leading to the restricted movement of the working arms outside the patient. we now use a 5-mm scope in addition to the 11-mm stereoscopic scope more typically used. all cases were performed with the patient in a reverse trendelenburg position under general anesthesia and complete paralysis with an age-appropriate esophageal dilator in place. port placement with the robot followed laparoscopic standards with the exception of ports being placed more distant to one another to allow broader external movements. in open cases, unless the patient had a previous midline scar, a left subcostal incision was performed. regardless of the surgical approach, once the equipment was inside the abdominal cavity, identical steps were taken to dissect the gastroesophageal junction and wrap the gastric fundus around the esophagus. descriptive and analytical statistics were applied to compare surgical times, length of hospitalization, and outcomes using kruskal-wallis and tukey tests for continuous data and the chi-square text for nominal data. in the 150 nissen cases included in this study, patients were younger and smaller in the open group (8555 months, 2417 kg, p<0.05) compared with those in the robotic (11764 months, 3723 kg) and laparoscopic groups (10771 months, 3324 kg) (table 1). the most common indication for the procedure was reflux refractory to medical management either as the sole reason or associated with failure to thrive or neurological impairment, or both of these [r=39(78%), l=50(100%), o=34(68%)]. other indications include a failed previous antireflux procedure, reflux associated with oromotor dysfunction, hiatal hernias, aspiration with an acute life-threatening event, and esophageal stricture. robot operative times proved significantly longer compared with times for laparoscopic and open procedures (r 16061 min, l=107+31 min, o=7327 min, p<0.05). the number of gastrostomy tubes done in addition to the nissen fundoplication in the robot group were similar to that of the other groups [r=17/50 (34%), l=24/50 (48%), o=11/50 (22%), p>0.05]. the robot group experienced 2 conversions to the open approach (2/50 4%), comparable to the laparoscopic conversion rate (1/50 2%). open cases resulted in longer hospitalization compared with the robot-assisted cases [r=2.944.5 d, o=3.52.8, p<0.05]. complication rates were equivalent between groups, including hiatal hernia, tight wrap requiring dilatation, and wound infection [r=7(14%), l=8(16%), o=5(10%), p=0.387]. the most common complication with the da vinci and laparoscopic approaches was a tight wrap, requiring dilatation [r=4/50, 8% and l=3/50, 6%], whereas in the open series, wound infections were more common (2/50, 4%). on 30-day follow-up, the presence of transient symptoms including dysphagia, abdominal pain, feeding aversion, and gas bloating were equivalent [r=15 (30%), l=14(28%), o=6(12%), p=0.06]. in our experience, the robot proved to be an acceptable approach for laparoscopic nissen fundoplication. this parallels the findings reported on early experiences from other centers. as in previous randomized trials, our experience with nissen fundoplication shows comparable efficacy of the robotic and laparoscopic approaches, with similar morbidity. the laparoscopic procedure, whether da vinci assisted or not, demonstrated a slight reduction in hospital stay compared with the open technique. patient demographics, surgical times, and complication rates according to surgical approach denotes significant difference between the robot vs. open group. of the 2 robot cases that were converted to open, one was due to intraoperative hypotension and arrhythmia and the other due to difficult dissection following failed prior repair. postoperatively, the presence of transient symptoms was similar between groups, reaching up to 30%. there was a trend towards fewer symptoms in the open group that may be due to achieving a tighter wrap in the robot and laparoscopic groups leading to more gas bloating and abdominal complaints. however, in long-term follow-up, all patients achieved symptomatic relief. the learning curve for the da vinci system played a key role in our surgical times despite previous reports. the 50 robotic cases in our study were distributed among the 3 surgical faculty and 4 pediatric surgery residents during this time. in addition to this, the robot requires several extra steps to achieve assembly in a sterile fashion and to change the instruments. we believe these factors combined would explain why the robot-assisted procedures resulted in both longer operative and total room times compared with the open series. we expect reduced surgical times once the operating surgeons overcome this 10-case learning curve and reduced setup time as well with more practice and repetition of use. therefore, like others, we have found no proven outcome benefits of using the robot in low- or medium-difficulty cases compared with the laparoscopic approach. potential benefits over standard laparoscopy include 3-dimensional image quality, camera steadiness, and the dexterity of the instrumentation for dissection and suturing. to better delineate cases that benefit most from each one of the 3 techniques, randomized prospective trials utilizing surgeons past the learning curve is required. robot-assisted surgery is equivalent to standard laparoscopic surgery in terms of complications and length of stay, with both having significantly increased operation times but reduced length of stay compared with open surgery. improved results are expected once the learning curve is overcome. however, potential outcome benefits have yet to be proven.

background: robot-assisted surgery must be evaluated before its acceptance as an option for standard therapy in the pediatric population. our objective is a comparison of results using the robot system with results for the laparoscopic and open approaches. methods:following irb approval, robot-assisted procedures were case-matched with controls, selected from 1994 to 2005. data for 150 nissen cases were divided equally into 3 groups [robot (r), laparoscopic (l), and open (o)], comparing surgical times, length of hospitalization, and outcomes. results:the average age (r=11764 months, l=10771 months, o=8555 months, p<0.05) and weight (r=3723 kg, l=3324 kg, o=2417 kg, p<0.05) of the open group were lower comparatively. robot operative times proved significantly longer compared with laparoscopic and open time (r=16061 min, l=107+31 min, o=7327 min, p<0.05). the robot had 2 conversions (2/50, 4%), comparable to the laparoscopic conversion rate (1/50, 2%). open cases resulted in longer hospitalization [r=2.944.5 days, l=3.547.8 days, o=3.52.8, p<0.05]. complication rates were equivalent between groups. the most common complication with the da vinci and laparoscopic approaches was tight wrap requiring dilation [r=4/50 (8%) and l=3/50 (6%)]. conclusion: robot-assisted surgery is equivalent to standard laparoscopic surgery in terms of complications and length of stay, with both having significantly increased operation times but reduced length of stay compared with open surgery. further experience with this technology is needed to overcome the learning curve and reduce operative times.

PMC3015888

pubmed-835

oculo-orbital malformations are developmental anomalies of the eye and/or ocular adnexa. in europe, its prevalence in the general population varies between 2.2 and 14 per 10,000 births.1 african studies have mainly reported cataract and congenital glaucoma as the most frequent types of eye malformations.24 malformations of the eye and orbit can be isolated or associated with other systemic malformations. to the best of our knowledge, the aim of this study was to describe the clinical aspects of a series of oculo-orbital malformations among children seen at the ophthalmology unit of the yaound gynaecology, obstetrics and pediatrics hospital. we carried out a retrospective study in which all children aged 05 years who were seen at the ophthalmology unit of the yaound gynaecology, obstetrics and pediatrics hospital from january 2003 to december 2009 were included. the medical records of all children diagnosed with a malformation of the eye and/or ocular adnexae were retained. in children with multiple malformations, the following variables were analyzed: age at first consultation (diagnosis), sex, and the various malformations observed. a total of 2254 children aged 05 years were examined in the ophthalmology unit during this period, and 150 of them were diagnosed with eye malformations, representing 6.65% of our consultations. there were 78 boys (52%) and 72 girls (48%), corresponding to a male-to-female ratio of 1.08. eye malformations were diagnosed in 71.66% (n=107) of cases during the first year of life. table 1 presents the distribution of children according to the age at which their malformation was diagnosed. diagnosis was made in 72.66% of cases (n=109) during the first year of life, with 11.33% of cases (n=12) diagnosed during the first month. a total of 159 malformations were identified from the 150 files selected, considering that a child could present with one or several malformations. congenital lacrimal duct obstruction (cldo) was the most frequent malformation, with a total of 106 cases out of 159 (66.66%). it was unilateral in 90 patients (84%) and bilateral in 16 patients (15.10%). congenital cataract was second, with 17 cases (10.69%), unilateral in 41.18% of cases (n=7) and bilateral in 58.82% of cases eight cases of congenital glaucoma were diagnosed (5.03%); it was more frequent among boys (five boys against three girls). congenital glaucoma was diagnosed in 62.5% (n=5) of cases before the age of 1 year and in 37.5% of cases (n=3) between 1 and 3 years. with regards to microphthalmos, eight cases (5.03%) six cases of ptosis (3.77%) were recorded and one bilateral aniridia associated with a case of congenital glaucoma without an associated systemic anomaly. the relevance of this study lies in the fact that it is a pioneer study in this domain in cameroon. it is intended to provide the basis for prospective studies that will specifically target each of the anomalies identified, especially the most frequent ones. a prevalence of 1.7% was reported in nigeria by lawan2 and 2.2% in the democratic republic of the congo by kaimbo wa kaimbo et al.5 the difference between these results may be explained by the heterogeneous nature of the study population in each study. the age group was 010 years in the study carried out by lawan; and 025 years in that by kaimbo wa kaimbo et al. the true prevalence of eye malformations could not be determined in this study because the total population served by this unit could not be easily assessed. the yaound gynaecology, obstetrics and pediatrics hospital is a referral center for the management of mother-and-child diseases, and therefore the majority of children seen are referred cases. several authors have reported that males are more affected.27 late diagnosis, which was observed in this study, might be due to the lack of attention given to suspicion of eye malformations in infants by mothers and medical practitioners. on the contrary, studies carried out in europe report a diagnosis rate of 80% during the first week of life.8,9 in this study, congenital cldo was the most frequent malformation. this is contrary to the studies conducted by lawan2 and bodunde and ajibode,3 both in nigeria, where cldo was the third-commonest eye malformation after congenital cataract and congenital glaucoma. cldo among children is most often caused by failure of hasner s valve to open spontaneously.10 the majority of cases resolve spontaneously during the first year of life with massage and local antibiotic therapy.11,12 congenital cataract, which was the second most frequent malformation in this study, is the main cause of blindness and low vision among children.13 mature forms require early surgery as well as long-term and rigorous management of amblyopia, which requires the participation of the child and his/her family.14 in immature forms allowing for visual development, surgery may be delayed until the child starts learning to read or even until it becomes impossible for normal schooling.14 intrauterine infections by toxoplasmosis, rubella, cytomegalovirus, and herpes (torch) microorganisms, especially congenital rubella, are known for being responsible for congenital cataract.4,15 torch infection screening, although recommended during pregnancy, is not always done for several reasons: firstly, practitioners do not frequently request the tests, and secondly, even when requested, they are not done due to lack of means to pay. cameroon is a developing country without a social security policy allowing for low-cost medical coverage. congenital glaucoma (figure 1) was diagnosed in 62.5% of cases during the first year of life. this is less than those reported by several african studies,6,7,16 in which the diagnosis was made in 73%82% of cases during the first year of life. it is also lower than the result obtained by zech and ravault in lyon, who reported 80% of cases before the age of 1 month.8 congenital glaucoma presents a surgical emergency, but the delay in diagnosis and hence late management in the african context might be explained by the fact that parents are ignorant about the signs. the equal distribution between bilateral and unilateral forms is contrary to data published in the literature, where bilateral cases are more predominant. this predominance is explained by the hereditary nature of the illness.79 microphthalmos was eight times more frequent than clinical anophthalmos (figure 2), both of which are incompatible with normal visual development resulting from an arrest in the development of the primary optic vesicles at the embryonic stage.17 with regards to ptosis, its prevalence worldwide is unknown, and it is unilateral in most cases.18 in severe cases of ptosis, the drooping eyelid can cover part of or the entire pupil and interfere with vision, resulting in amblyopia.19 bilateral aniridia is rare, with prevalence varing between 1/64,000 and 1/100,000.20,21 it is caused by a mutation in the pax6 gene, located on human chromosome 11, and is usually associated with other eye and systemic anomalies. cataract is found in 50%85% of patients suffering from bilateral aniridia.20 ectopia lentis, which is considered a major diagnostic criterion for marfan s syndrome,22 was found in one patient. it is caused by a deficient development of the zonule, which like elastic tissue is of mesodermic origin.23 goldenhar syndrome (figure 3) also known as oculoauriculovertebral dysplasia, is a rare congenital anomaly involving derivatives of the first and second branchial arches.24 its main ocular manifestation is limbal dermoid, which is found in 30%60% of cases and is a cause of astigmatism, amblyopia, and strabismus.25 persistent hyperplastic primary vitreous results from failure of the primary vitreous and hyaloid vasculature to regress. its unilateral localization, which was found in this study, exists equally in literature, where it represents 90% of cases.26 other malformations, such as cryptophthalmos, iris coloboma, and the usher syndrome, described in the literature4,15 were not identified in this study. eye malformations in children may lead to visual impairment. consequently, systematic postnatal screening for early detection and management are recommended. close collaboration among pediatricians, general practitioners, and ophthalmologists for a multidisciplinary care approach is necessary.

summarythe aim of this work was to describe the clinical aspects of eye malformations observed at the ophthalmology unit of the yaound gynaecology, obstetrics and pediatrics hospital. patients and methodswe carried out a retrospective study of all malformations of the eye and its adnexae observed among children aged 05 years who were seen at the ophthalmology unit from january 2003 to december 2009. resultsout of the 2254 children who were examined, 150 (6.65%) presented eye malformations. the mean age was 14.40 4 months. eye malformations were diagnosed in 71.66% of cases during the first year of life. the most frequent malformations were congenital lacrimal duct obstruction (66.66%), congenital cataract (10.9%), congenital glaucoma (10.9%), microphthalmos (5.03%), and congenital ptosis (3.77%). conclusioneye malformations among children can lead to visual impairment and are a cause for discomfort to children and parents. therefore, systematic postnatal screening is recommended to enable early management.

PMC3468283

pubmed-836

demand for improvement of quality of therapists has increased with the recent advancement in medical technologies and the growing understanding of society toward rehabilitation medicine1. however, the basic scholastic ability of students enrolled in training schools is not increasing. the minimum attainment level for pre-graduation education was changed from becoming able to perform basic physical therapy to becoming able to perform basic physical therapy with some advice and supervision by the physical therapy education guidelines3. a previous study4 reported that most novice physical therapists (pts) need supervisors advice and can not accomplish their duties independently. other previous studies5,6,7,8,9 suggest that novice pts do not have sufficient clinical skill and thus require postgraduate education. in the current japanese situation first, postgraduate education is performed in individual facilities, which have their own characteristics and are thus not homogenized10. in other facilities, novice pts rotate among different departments based on the type or stage of disease12. regarding the relation between the number of therapists and the education system, postgraduate education systems are better established in a facility with a large number of therapists13. second, many members of the japanese physical therapy association are young, with ages ranging from 2030 years3, 4.thus, lack of supervising therapists is also a crucial problem. under these circumstances, the postgraduate education systems are not likely to ensure a certain level of quality. to maintain a level of educational quality, setting an explicit goal, goal setting has a second-order effect that promotes self-directed learning based on adult learning theories14. in line with these perspectives, the medical education system has compulsory post graduation clinical training for 2 years that has an explicit goal15. in the nursing education system, postgraduate training goals and guidelines on supervision have been established as well16. however, in the therapist education system, goals for post graduation therapists have not been determined yet. to achieve a certain level of quality in novice pts, the first goal is for them to be able to implement their duties independently. the aim of this study was to clarify the essential abilities of novice physical and occupational therapists for independent execution of their duties and to develop an assessment tool. first, semi structured interviews were conducted on 15 experienced therapists to create a comprehensive list of essential abilities that novice therapists need17. second, 30 experienced therapists participated in a two-round delphi study to select items for the assessment tool being developed for novice therapists. therapists working in hospitals, training schools, or geriatric health services facilities; those with experience in supervising other therapists; and those with management experience were included in the study. all experienced therapists were provided with oral explanations regarding the details of this study as ethical considerations. the study was conducted with the approval of the ethics committee of fujita health university (13-254). before the interview, the definition of therapist who is able to implement their duties independently (table 1table 1.definition of terms and the interview guidedefinition of terms: therapists who are able to independently implement their duties1) having basic clinical skills that all therapists should develop regardless of individual domain expertise 2) not requiring supervisors active guide3) being able to behave appropriately in workplaces (as members of society)the details of an interviews guide used in this study:please answer the following questions, envisioning what you supervise novice therapists:1) when do you feel that therapists under your supervision reach the level enough to routine clinical practice independently?2) what actions do you expect such novice therapists to achieve under your supervision?3) when you have been brought up as a therapist, what type of experience did you need to become able to independently implement your duties?), which was defined based on the definition of doctors basic clinical ability18, was presented to participants to ensure that the term has the same meaning to the subjects. all participants were simultaneously interviewed using with focus group semi structured interview methods19 based on an interview guide (table 1). the participants were asked to imagine supervising other therapists and answer questions such as, what novice pt behaviors affect your appreciation that therapists under your supervision have the ability to fulfill their professional duties independently? the researchers encouraged the participants to verbalize their thought and listened with close attention. all interview contents were recorded using an ic recorder and were converted into character data to create narrative records. therapists who are able to fulfill their professional duties independently and classified the contents into categories based on similarity of content. we used 5-point rating method (1=unnecessary; 2=relatively necessary; 3=necessary; 4=absolutely necessary but may not be achieved within 6 months; 5=absolutely necessary and should be achieved within 6 months) focusing on therapists who are able to fulfill their professional duties independently. in the second round, the ratings of each rater and the frequency distribution, median, and interquartile range of all participants ratings were presented. subsequently, all raters were again asked to rate the items extracted from the first round. using the results of the second round, the items where more than 80% of the total number of experienced therapists scored a rating of 4 or 5 were adopted as evaluation items. then, these items were classified based on semantic similarity, and each category was named by the abstraction of their semantic contents. to confirm the reliability of the results, the items must also be classified into such categories by other experienced therapists serving as third party. based on the classifications set by the researchers and third-party therapists, one hundred fifty-six items were extracted from data obtained through interview with 15 experienced participants in relation to abilities necessary for therapists to fulfill their professional duties independently. by unifying similar or overlapping items, these items were aggregated to 86 items. after a considerable discussion using two-round delphi technique, these items were classified into three categories: basic attitudes, 19 items; therapeutic skills, 20 items; clinical practice-related thoughts, 16 items (table 2table 2.outcomes of the development of a clinical ability evaluation table for therapistsevaluation items: basic attitudeusing appropriate language as a member of societyadhering to appointed times and deadlinescomplying with rules in the workplaceunderstanding the role and duties of the therapist as a team memberadopting appropriate actions in consideration of the role of the therapist as a team membercontributing to the improvement of coordination as a team memberefficiently implementing duties so as to be completed within working hoursappropriately understanding and considering confidentiality and personal information managementperforming appropriate infection control measures (including hand wash)performing appropriate equipment management (before and after use)performing treatment, with a sense of responsibilityappropriately managing the therapist s own physical condition and schedule and avoiding interfering with his/her dutiesappropriately implementing reporting, communication, and consultation procedures (developing and expressing the therapist s own thoughts) in all timesidentifying problems which are difficult to independently addressconsulting problems which are difficult to independently address with appropriate persons in appropriate situationsseriously accepting and addressing issues noted by the supervisor or the therapist s own failuresdeveloping positive attitudes and making efforts to achieve knowledge and skillsperforming treatment and implement duties based on learning outcomes and experiencetherapeutic skillsadopting appropriate measures, such as life-saving techniques, to manage sudden changes in patients conditionsappropriately dealing with individual patients in consideration of their symptomsusing appropriate verbal or non-verbal communication methods for individual patientsshowing empathy when communicating with patients in consideration of their psychological conditionsappropriately listening to patients and their families to clarify their needshaving medical knowledge necessary for a therapistselecting appropriate evaluation items for individual patientsperforming vital (blood pressure and heart rate) measurement, according to each situationappropriately (and also accurately, efficiently) conducting medical interviews with patientsappropriately (and also accurately, efficiently) examining reflexesappropriately (and also accurately, efficiently) conducting orthopedic examinationappropriately (and also accurately, efficiently) evaluating painappropriately (and also accurately, efficiently) evaluating coordinationappropriately (and also accurately, efficiently) evaluating muscle toneappropriately (and also accurately, efficiently) measuring the range of motionappropriately (and also accurately, efficiently) evaluating the muscle strengthappropriately (and also accurately, efficiently) conducting sensory examinationappropriately (and also accurately, efficiently) performing morphometryappropriately (and also accurately, efficiently) evaluating the motor function of patients with paralysis (using the sias and brunnstrom stage test)appropriately (and also accurately, efficiently) evaluating adl (using instruments, such as the fim and barthel index)clinical practice-related thoughtsclarifying individual patients general characteristicsidentifying individual patients possible risks based on the results of examinationlogically examining the causes of problems in movements or activities of daily livingdeveloping treatment programs to achieve goals (also referring to literature)safely implementing treatment programssafely handling treatment devicesappropriately managing risks related to medical accidents, such as tube removal and bleedingappropriately managing risks related to fallsproviding appropriate range-of-motion trainingproviding appropriate muscle-strengthening trainingproviding appropriate assistance and guidance for the maintenance of sitting positionsproviding appropriate assistance and guidance for the maintenance of standing positionsproviding appropriate assistance and guidance for standing from a seatproviding appropriate assistance and guidance for transferproviding appropriate assistance and guidance for gait trainingcontinuously evaluating (and observing) patients in the progress of treatmentcriteria: ratings. 4=being able to accurately understand and adopt appropriate actions without supervision. 3=being able to accurately understand and adopt appropriate actions under monitoring and supervision. 2=being able to understand and adopt appropriate actions to a certain extent under monitoring and supervision. 1=being unable to understand or adopt appropriate actions even under monitoring or supervision. 0=being inappropriate for implementation.). the coefficient, representing the agreement rate between the researcher and third-party experienced therapist, was 0.86. criteria: ratings. 4=being able to accurately understand and adopt appropriate actions without supervision. 3=being able to accurately understand and adopt appropriate actions under monitoring and supervision. 2=being able to understand and adopt appropriate actions to a certain extent under monitoring and supervision. 1=being unable to understand or adopt appropriate actions even under monitoring or supervision. 0=being inappropriate for implementation this study adopted the sequential exploratory strategy performed from a qualitative approach to a quantitative approach in a phased manner21, 22. in other words, the data were collected qualitatively and examined quantitatively using the delphi technique, which is a questionnaire method with repetitive feedback23,24,25. as a result, the focus group interview used in the present study might be effective in facilitating the collection of a broad range of opinions from experienced therapists because similar experiences about supervision assists in causing a sense of empathy and stimulates the discussion. the items were classified into three categories: basic attitudes, therapeutic skills, and clinical practice-related thoughts. the high coefficient between classifications by the researcher and a third-party therapist suggest high reliability of the classification. the basic attitudes category consisted of items associated with the ability for continuing self-education, as mentioned in the japanese physical therapy association s code of ethics26. in addition, an attitude of humility toward each patient and a cooperative attitude toward other professionals were included in this category. thus, the results suggest that knowledge of these social skills is also important in the postgraduate education of novice therapists. the therapeutic skills category consisted of abilities associated with collection of medical information such as communication with patients and assessment technique. these items suggest that novice therapists should have a certain amount of communication skill in addition to medical knowledge. thus, optimal communicational education methods have to be developed for the postgraduate education of novice therapists. the clinical practice-related thoughts category included items associated with integration of patient information obtained from medical assessment, determination of disabilities (impairment, activity limitation, participation restriction), planning of therapeutic program, re-evaluation, and corresponding plan revision. these items are substantially coincident with the clinical reasoning model proposed by edwards, which includes a set of processes such as the recognition and interpretation of medical information, development and revision of hypothesis, determination of intent, and re-evaluation after intervention27. in the present study, experienced therapists were encouraged to consider not only knowledge of implementing therapy-related duties, clinical practice-related thoughts, or therapeutic skills, but also appropriate social skills and attitudes, self-management, and self-education, for continuous self-improvement. the 55 evaluation items may cover all domains defined in the taxonomy (cognitive, emotional, and psychomotor), which is a concept often used in medical education and services28. therefore, the preset items might accurately represent the abilities needed by therapists to implement their duties independently and should be the appropriate goals of novice therapists.

[ purpose] the aim of this study was to clarify essential abilities of novice physical and occupational therapists for independent execution of their duties and to develop a clinical competence assessment tool. [subjects] forty-five experienced therapists participated in this study. [methods] a two-phase mixed-methods design was used. first, semi structured interviews were conducted on 15 experienced therapists to create a comprehensive list of essential abilities that novice therapists need. second, 30 experienced therapists participated in a two-round delphi study to select items for the assessment tool being developed. [results] fifty-five items were extracted and classified into three categories: basic attitudes, therapeutic skills, and clinical practice-related thoughts. [conclusion] present results suggest that not only knowledge of execution of therapy-related duties and therapeutic skills is essential in novice therapist, but also appropriate abilities in social adjustment, self-management, and self-education. the newly developed tool might be useful for postgraduate education in clinical practice.

PMC4842476

pubmed-837

the advent of titanium implants resulted in a treatment modality with a high level of applicability in several clinical situations. although the original protocol was initially designed for the treatment of completely edentulous patients, the need arose to extrapolate treatment alternatives with osseointegrated implants to partially dentate patients. implant dentistry added a new alternative in oral rehabilitation, but at no time, have osseointegrated implants been capable of resembling natural teeth with regard to their characteristics. this combination was applied to partially edentulous patients, contradicting branemark's protocol, which was based on isolating implants from natural teeth. however, the distribution of the teeth in the arch may induce the adoption of combined prostheses. for decades, tooth-implant-supported dentures have been questioned because of the differences of mobility between the abutments, the risk of intrusion of the natural abutment, as well as the atrophy of the periodontal ligament, and the high general risk of technical complications. the great difference between an osseointegrated implant and a natural tooth is the form of the structural union with the bone and the different mechanism of absorption and dissipation of force, which makes the tooth-implant bond a biomechanical dilemma. the possibility of connecting implants to teeth in fixed denture, with a favorable prognosis has been studied by several authors who concluded that the tooth-implant bond does not have a negative influence on the marginal bone and soft tissues. therefore, it was not possible to show any greater risk of deficiency for fixed tooth-implant-supported dentures (ftisd) when compared with implant-supported dentures, which were well accepted, particularly by patients in unfavorable financial situations, who were unable to have the ideal number of implants placed. nevertheless, the connection of natural teeth and osseointegrated implants in a rigid denture caused concern and publications, with studies and guidelines for both extremes. there is a significant difference in the absorption and distribution of force between natural teeth and implants. this occurs because in tooth-supported dentures there is a system of cushioning causing a micro-movement of 100 to 300 m due to the presence of the periodontal ligament, as load will be transmitted to the bone with beneficial stimulation by transforming the stresses of pressure into uniform traction on the alveolar cortical. in implants, the resultant stress is concentrated on the bone crest, and this different dissipation of force may cause a lever arm, which depends on the length of the pontic producing torque on the implant, causing loosening or fracture of the retention screw. in view of such a situation, the use of semi-rigid connections has been recommended, taking into consideration that this type of connection could be more efficient in terms of compensating for the difference in mobility between the abutments. nevertheless, other authors have reported that the semi-rigid connections are rarely indicated in unilateral fixed dentures. this type of connection does not improve the stress distribution between the abutments, and are the cause of migration of the natural teeth. ideal tooth-implant supported fixed dentures (tisfds) are those in which the space is small, including one tooth and one implant with the possibility of a maximum of two pontics. nevertheless, other authors have reported that the ideal tisfds are those with a larger number of natural abutments to promote greater rigidity of this denture. the aim of this study was to use finite element method (fem) to evaluate the generation of stresses in a fixed tooth-implant-supported denture with a rigid connection, when varying the number of teeth used as abutments. over the last few years, fem applied to biomechanics has become an extremely useful tool for numerically assessing stresses and deformations associated with the mechanical behavior of biomaterials and human tissues. in this study, the 3-d model of the fem is an approximate representation of an in vivo geometry, with the physical characteristics of a real model. in this study, the ansys revision 5.7 program was used to develop a model of a partially edentulous maxilla, conceived by means of 3-d fem, in which an implant-tooth supported fixed denture was constructed. representative volumes of the implants, abutments, prosthetic crowns and cortical and spongy bone were created. connection of this denture was simulated by means of a metal surface of a non-noble nicr alloy, varying the number of teeth connected to an osseointegrated iti strauman implant, 10.00 mm long, 4.1 mm in diameter, with a 4.8 mm platform. to compose this denture, metal-ceramic crowns were constructed in the shape of premolars, which were connected by means of a pontic, using rigid connection, in order to be analyzed in two configurations: the first configuration contemplated one tooth and one implant (model 1), and the second configuration contemplated two teeth and one implant (model 2). from the basic geometry created, the elastic properties of the various materials were attributed, using approximate values found in the literature (table 1). the elastic properties of the materials were adopted in a linear system, whose hypothesis is that the deformation of elastic bodies is proportional to the force applied. furthermore, these properties were considered constant and isotropic (equal in all directions). elastic properties of several materials that compose the model from the creation of the basic geometry, the finite element mesh composed of 297.096 knots and 213.129 elements for the model with one tooth and one implant (model 1) and 529.930 knots and 383.670 elements for the model with two teeth and one implant (model 2) were generated, according to figures 1 and 2. finite element mesh model 1 finite element mesh model 2 the study of biomechanics is, however, an analysis of the distribution of forces to the bone when teeth are occluding. it has been observed in tests that the intensity of the bilateral and unilateral physiological force is 569 n and 430 n respectively and clinical observations have shown that lateral forces are not well tolerated by the dental and bone structures, as occurs with axial forces. in this model, a vertical load of 100 n was applied on the occlusal face of the entire prosthetic set, distributed uniformly according to the number of elements of the respective surfaces (figures 3 and 4). nodal load of 100 n on the denture containing 3 elements nodal load of 100 n on the denture containing 4 elements this model was designed and submitted to a vertical load, in which its effect was assessed quantitatively in n/mm (mpa) and qualitatively. the images generated by the program used in the present study made it possible to gain a broad and significant understanding of the distribution of these stresses in the bone tissue, as well as in the prosthetic components and associated structures. the quantitative results are summarized in table 2 with plotting of the von mises stress (seqv) for the tooth-implant-supported dentures with one and two teeth. the table also shows the results of maximum displacement (dmx) of the set. quantitative analysis seqv=von mises stress; dmx=maximum displacement in a qualitative analysis, it may be observed that the vertical displacement of tooth-implant-supported dentures with one tooth and one implant, the tooth showed greater movement in the apical direction (figure 5). however, when a tooth was added in the mesial region of this denture, a reduction in its vertical movement was observed (figure 6). movement of the set in the occlusal-gingival direction (model 1) movement of the set in the occlusal-gingival direction (model 2) in the analysis of the seqv stresses, it was observed that the maximum stress in the tisfds containing one tooth (model 1) was 47.84 mpa, whereas for the denture containing two teeth (model 2) the maximum stress was 35.82 mpa, both located in the region between the tooth and the pontic, as shown in figures 7 and 8. in selecting the images, when the structures that compose the prosthetic crowns are removed, we can verify that the maximum seqv stress occurred on the mesial side of the implant neck region, at the junction with the cortical bone, with values of 12.15 and 8.85 mpa for models 1 and 2 respectively, as illustrated in figures 9 and 10. it can be verified that in the denture containing two teeth, the load is practically absorbed by the implant with a slight increase in tension on the tooth closest to the pontic, however, these loads can be considered insignificant. von mises stress (seqv) in model 1 von mises stress (seqv) in model 2 von mises stress (seqv) in the implant region in model 1 von mises stress (seqv) in the implant and teeth in model 2 in the analysis of equivalent stresses of von mises (seqv) generated in metal, we note that the maximum stress is found in the same region between the natural abutment and pontic for both the models, with values of 50.0 mpa for model 1 and 34.14 mpa for model 2 (figures 11 and 12). this location of the maximum value in metal indicates that there is greater flexion of the metal bar in the region between the tooth and pontic. von mises stress (seqv) in the metallic infrastructure (model 1) von mises stress (seqv) in the metallic infrastructure (model 1) in the electromyography study to assess the intensity of the bilateral and unilateral physiological force, the result found for bilateral force was 569 n and 430 n when measured unilaterally. thus, according to table 3, one may make a comparison for functional loads from the flow limit of the materials. this table allows one to observe that the porcelain with specific properties used in this study, when submitted to load in model 1, showed admissible values for occlusal loads (kx100n) lower than the one found for maximum physiological load. maximum von mises stress (seqv) values compared with the se flow stresses and admissible occlusal loads for the materials starting from a real principle proposed in the literature, the connection between teeth and implants must not be considered as the first alternative for rehabilitation and it is preferable to adopt planning of isolated implant-supported dentures. nevertheless, in case of anatomic limitations that may require advanced surgical techniques at high costs or if teeth already require restorative interventions and are favorably distributed in the arch, a combination between teeth and implants may be adopted with success rates similar to those of fixed implant-supported dentures. there is a vast amount of literature with regard to the biomechanical challenge of the connection between teeth and implants. authors have reported that this complication is due to the difference in mobility between them, different mechanisms of absorption and dissipation of forces and mechanical-receptor properties. however, biomechanical responses in the face of a force are completely different, and in tooth-implant-supported dentures, special care must be taken in planning to compensate this difference. nevertheless, according to the literature it is conclusive that in fixed tooth-implant-supported dentures, connections of the semi-rigid type generate more stress in the denture components so that the rigid connection has been preferred instead of the semi-rigid type. from analysis of the results, the present study allows one to observe that there was a reduction in the displacement of the prosthetic set, as well as a lower stress, when a natural abutment was added, confirming previous findings that if the placement of only one implant were possible, then two natural abutments must be used as retainers to support a pontic thereby improving the rigidity of the set. this difference in stresses can also be explained by the fact that although the loading value had been equal, the loads were better distributed in model 2. according to the literature, the resulting stress in implants is concentrated on the bone crest, which is in agreement with the results obtained in this study, in which the maximum seqv stresses occurred on the mesial side in the neck region of the implant, as reported elsewhere. it has been stated that the ideal tooth-implant supported fixed dentures are those in which the space between the abutments is small, including only one tooth and one implant, with the possibility of a maximum of two pontics. this configuration is necessary because the flexion of the bar is proportional to the cube of the length of the edentulous space, in agreement with the findings of this study, in which it was observed a greater displacement in the pontic region, and higher tension located between the pontic and the abutments. according to the quantitative and qualitative analysis of the present study, it may be concluded that: tooth-implant-supported prostheses must be limited with regard to the edentulous space and it is a feasible and biomechanically predictable treatment option; the placement of additional teeth decrease the resultant stress values; the type of alloy used in the metallic infrastructure plays a key role in denture displacement, and preference should be given to those with the highest modulus of elasticity. the internal connection type of implant provides greater rigidity to the set (abutment/implant) mechanically presenting lower stress levels.

objectivesin some clinical situations, dentists come across partially edentulous patients, and it might be necessary to connect teeth to implants. the aim of this study was to evaluate a metal-ceramic fixed tooth/implant-supported denture with a straight segment, located in the posterior region of the maxilla, when varying the number of teeth used as abutments. materials and methodsa three-element fixed denture composed of one tooth and one implant (model 1), and a four-element fixed denture composed of two teeth and one implant (model 2) were modeled. a 100 n load was applied, distributed uniformly on the entire set, simulating functional mastication, for further analysis of the seqv (von mises) principal stresses, which were compared with the flow limit of the materials. resultsin a quantitative analysis, it may be observed that in the denture with one tooth, the maximum seqv stress was 47.84 mpa, whereas for the denture with two teeth the maximum seqv stress was 35.82 mpa, both located in the region between the pontic and the tooth. conclusionlower stresses were observed in the denture with an additional tooth. based on the flow limit of the materials, porcelain showed values below the limit of functional mastication.

PMC3973470

pubmed-838

cervical infection by one of approximately 15 high-risk hpv types is generally accepted as the necessary causative agent of cervical cancer [1, 2]. the upper aerodigestive tract, including the oral cavity, the pharynx, and the larynx, is also lined by a squamous mucous membrane and because of the morphological similarities and epitheliotropic nature of hpv, a link between head and neck squamous cell carcinoma (hnscc) and hpv seems logical. hnscc is usually etiologically linked to tobacco and/or alcohol or other lifestyle habits, but a minority of patients develop hnscc in the absence of exposure to these factors or any other obvious predisposing genetic defect. several investigators have reported detection of hpv infection in healthy oral mucosa as well as in squamous cell carcinoma of the oral cavity (oscc) and oropharynx (opscc) [4, 5], which are related to sexual behaviour and younger age. hpv has shown to have a predilection for certain, especially nonkeratinized, anatomical sites of the oropharynx. high-risk hpv types, such as hpv 16, have been detected even in clinically normal oropharyngeal mucosa. in the cervix, the persistence of hpv infection may increase the likelihood of viral integration and concomitant deregulation of viral protein expression, leading to overexpression of e6/e7 oncoproteins [7, 8]. in oral cancers the integration of hpv dna into the host's cell genome is probably a less common event. various hpv types have been identified in patients with oral cancer, but clinical and case control studies have not proved a causal relationship between the virus and oral carcinomas beyond any reasonable doubt [8, 9, 11]. hpv dna detection alone is regarded as insufficient evidence for a causal role in oral cells transformation and is more like a secondary invader [7, 10]. hpv integration into the host cell genome however, is a causal factor in head and neck carcinogenesis [1113]. in many reports, in which the hpv-positivity varies from 40 to 57%, there is no reference to the viral integration of the hpv positive samples [5, 8, 10]. the purpose of our study is to define hpv detection in patients with osccs and to evaluate the detection of e6/e7 high-risk hpv mrna as a possible biomarker for posttreatment surveillance. sixty-four (64) cytological samples were obtained from patients with hnscc of the oral cavity, (35 oral tongue, 8 maxilla, 4 mandible, 8 floor of mouth, 6 retromolar trigone, and 3 buccal mucosa) who visited the outpatient clinic of the radiotherapy department of the regional anticancer oncology hospital saint savvas, athens, greece, between november 2008 and november 2011. ethical approval was granted by the ethics committee of regional anticancer oncology hospital of athens st. the samples were collected using a brush and swabbing the mouth, maxilla and mandible, oral tongue, and buccal mucosa and were preserved in thin prep (preservcyt solution, hologic uk). cytological samples were transferred in lysis buffer (nuclisens lysis buffer, biomrieux hellas s.a, cat no. 200292) for 30 minutes, then total nucleic acid was extracted by the offboard protocol with the nuclisens easymag platform (biomrieux hellas s.a), according to the manufacturer's instructions. dna quality test was carried out using human globin, beta, primer set kit (maxim biotech, inc., south san francisco, ca, usa) according to manufacturer's instructions. to assess rna integrity, 5 g of rna per sample then, the papillocheck hpv-screening (greiner, germany) was used for the type-specific identification of 24 types of hpv (15 high-risk types: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82, probable high-risk types: 53, 66 and 7 low-risk types: 6, 11, 40, 42, 43, 44/55, and 70). this technology is based on a dna chip for the type-specific identification of 24 types of hpv. e1-based pcr was performed according to the manufacturer's guidelines. for each sample, we mixed 19.8 l papillocheck mastermix, 0.2 l hotstartaq plus dna polymerase (5u/l, qiagen, cat no. hybridization is followed by mixing 30 l of the papillocheck hybridization buffer in a new reaction tube with 5 l of the pcr product at room temperature and transferring 25 l of the hybridization mix into each compartment of the chip. the chip was washed in 3 washing solutions, centrifuged for 3 minutes at 5000 rpm, and scanned on the checkscannertm. a commercial real-time nuclisens easyq assay (nuclisens easyq hpv 1.1, biomrieux hellas s.a, cat no. 290003) was performed for the qualitative detection of hpv e6/e7 mrna of five high-risk hpv types (16, 18, 31, 33, and 45) according to the manufacturer's instructions. firstly, three premixes were made by adding reagent sphere diluent (tris-hcl, 45% dmso) into reagent spheres (nucleotides, dithiotreitol, and mgcl2). in each premix, we added u1a/hpv 16, hpv 33/45, or hpv 18/31 primer and molecular beacon mixes, kcl stock solution, and nasba water. secondly, 10 l of this premix was distributed to each well in a reaction plate, and the addition of 5 l rna followed. the plates were incubated for 4 minutes at 65c to destabilize secondary structures of rna, followed by cooling down to 41c. the reaction was started by addition of enzymes (amv-rt, rnase h, t7 rna polymerase, and bovine serum albumin) and measured in real time using the lambda fl 600 fluorescence reader (bio-tek, winooski, vt) at 41c for 2 hours and 30 minutes. following diagnosis and molecular analysis, patients with positive histology of hnscc of the oral cavity, with a karnofsky index (ki) 70%, and with normal renal, hepatic and bone marrow function were included. baseline laboratories studies requirements included neutrophils greater than 1.5 10/l and platelets>100 10/l. exclusion criteria were distant metastatic disease, a life expectancy of<3 months, pregnancy, previous cancer disease within 5 years of study entry, existence of second primary tumor, and karnofsky index (ki) of<70%. furthermore, patients with severe renal, liver, cardiovascular, or pulmonary diseases and patients with hematological malignancies were excluded. all participants underwent an extensive presurgical evaluation that included clinical examination, panendoscopy, complete blood count and biochemical profile, clearance creatinine, cardiovascular examination, chest x-ray or ct, and ct and/or mri of head and neck. patients with early stage resectable disease (stage i-ii) and selected patients of stage iii (t2n1m0) were treated surgically. patients with locally advanced disease (unresectable or marginally resectable), stage iii-iva, were treated either with induction chemotherapy or radical chemoradiation. depending on response after induction chemotherapy, patients underwent either surgery followed by postoperative chemoradiation or radical combined radiation therapy with chemotherapy. before induction chemotherapy the palpable edges of the primary lesion (both the longest and the shortest axes) were marked by at least four points, which were 0.5 cm away. tumor response was evaluated after the end of induction chemotherapy using a clinical examination and ct or mri of the head and neck with tumor volumetry. complete response (cr) was defined as a reduction of the tumor volume 70% up to the complete disappearance. partial response (pr) was defined as at least a 30% decrease in the sum of diameters of tumor, taking as reference the baseline sum diameters. progressive disease (pd) was defined as enlargement of tumor volume 20% or new tumor manifestations. stable disease (sd) was defined as insufficient shrinkage to qualify for pr and insufficient increase to qualify for pd. the median follow-up interval was 18 months (range 4 to 36 months). patients are monitored every two months in the first two years, every three to four months in the next 3 to 5 years, and once a year thereafter until death. disease-free survival was estimated from the end of treatment to tumor recurrence, distant metastasis, or death from any cause. chi-squared tests were performed to assess statistical significance of any differences in prevalence. 2 2 contingency tables fisher's exact test was performed along with odds ratio and 95% confidence intervals calculation. we collected 64 samples from the oral cavity, 19 of which were unsatisfactory for molecular analysis due to insufficient quantity of dna, thus 45 samples were finally analysed (table 1). the patients ' ages ranged from 19 to 82 years (mean age: 51.9 years). clinical, pathological, and treatment characteristics of the patients are described in table 1. papillocheck assay detected high risk hpv dna in 3/45 of the osccs (2 sccs of the oral tongue and 1 of the floor of the mouth). the different hpv types revealed by the dna and rna test are shown in table 2. in the 3 high-risk hpv dna positive oral cavity cancers, hpv 16 was detected in 2 samples (1 case of scc of the oral tongue and 1 of the floor of the mouth) and hpv 18 in 1 sample (1 case of oral tongue scc). in addition, the low-risk hpv 6 was found in 2 oral tongue samples. further analysis using the nuclisens easyq assay detected e6/e7 mrna expression from the five high-risk hpv types (16, 18, 31, 33, and 45) in 4/45 of the total samples (8.9%) (3 cases of oral tongue scc and 1 of the floor of the mouth). hpv 16 was the commonest type revealed by the rna test as shown in table 2. as far as the site-specific oscc is concerned, hpv 16 was detected in 3 out of 5 hpv dna positive oral cavity sccs (2 cases of oral tongue scc and 1 of floor of the mouth), while hpv 18 was found in 1 out of 5 hpv-infected oral cavity sccs (1 case of oral tongue scc), by the rna detection method. 8 of 45 patients (1 stage i (t1n0m0), 5 stage ii (t2n0m0), 2 stage iii (t2n1m0)) underwent surgical excision (7 oral tongue, 1 maxilla). 4 of them had no adverse features, and they did not undergo any further treatment. the rest of the 4 patients with adverse features (> 2 positive ln, resection margins<5 mm, perineural tumor invasion, and vascular space invasion) received external beam radiation therapy (ebrt) 5460 gy. all patients who were treated surgically are so far disease-free (7 hpv dna negative and 1 hpv dna positive (defined as absence of recurrence at the primary site, assessed by physical examination at every clinic visit and imaging studies at specified intervals). however, one of them developed a second primary tumor of the lung and so far is disease-free from both primaries (table 2). from the 37 patients with locally advanced (unresectable or marginally resectable) disease (stage iii-iva), 28 patients underwent induction chemotherapy with 2 cycles of tpf (docetaxel 75 mg/m, (d1) cisplatin 75 mg/m (d1), and 5-fu 500 mg/m (d1-d5) (referred as treatment protocol a) and 9 patients underwent radical external beam radiation therapy (ebrt: 6872 gy) with concurrent chemotherapy (cisplatin) (d1d22) and weekly cetuximab due to medical contraindications for induction chemotherapy with tpf (referred as treatment protocol b). from 28 patients treated with protocol a, 18 had complete response. 10 of them underwent radical surgery and 8 of them underwent radical radiotherapy with concurrent chemotherapy. depending on histological findings, patients underwent ebrt 5460 gy with or without concurrent chemotherapy (cisplatin 75 mg/m d1, d22) and weekly cetuximab. for the patients with high-risk features, such as r1 resection, extra capsular nodal spread, and vascular space invasion, perineural invasion total dose of 66 gy was granted. from 18 patients with complete response, 14 patients are today free of disease (3 hpv dna positive (hpv 18, 16, 6), 11 hpv dna negative), 2 died from lung metastasis (1 hpv dna positive (hpv 16), 1 hpv dna negative), and 2 are still alive with local recurrence (2 hpv dna negative) (table 2). the rest of the 10 patients who were treated with protocol a had partial response (table 1). all of them underwent radical ebrt (6872 gy) with concurrent chemotherapy (cisplatin) (d1d22) and weekly cetuximab. 1 of them is free of disease, 6 died from metastatic disease, 1 died from other causes, and 2 of them are still alive with local recurrence. from 9 patients with stage iii-iva who were treated with protocol b, 5 of them are free of disease, 1 died from metastatic disease, and 3 are still alive with local recurrence. of the approximately 120 hpv types so far known to infect the mucosal surfaces of the genital tract, 14 are considered to be high risk or oncogenic [1, 2]. some of these high-risk types have been found in the oral cavity and oropharynx of both cancer-free adult individuals and in patients suffering from hnscc [4, 7, 8, 12]. hpv 16, the hpv type most prevalent in cervical sccs, is also the most common type present in hpv-positive hnsccs [10, 1315]. the great variation in hpv prevalence found in osccs in different studies may be due to differences among the analyzed population, but also due to differences in the samples tested (i.e., formalin-fixed or fresh biopsies, exfoliated fresh cells), the methods of dna extraction, and, most importantly, the hpv detection methods used [8, 16]. several studies using a variety of techniques, including immunohistochemistry, in situ hybridization, dot blot and southern blot hybridization, and polymerase chain reaction (pcr), have been used to demonstrate the presence of hpv genome in hnscc [4, 5, 7, 15]. our study shows that the use of dna and rna detection methods confirms the prevalence of hpv infection among patients with osccs. hpv 16 infection has been found in 2 cases. in both cases infected by hpv 16, what is interesting is that the rna test revealed hpv 16 e6/e7 mrna. this may be explained by the fact that total viral dna of hpv 16 has been integrated into the host genome, and, therefore, it can not be detected by the dna test. in 75% of the hpv-positive sccs of the oral tongue, hpv implication in oral tongue cancer has already been stated by many authors [5, 17]. on the other hand, clinical results indicated that the association between patient mortality and hpv detection was not statistically significant (p=0.4215). the prevalence of hpv among currently disease-free patients was also not statically significant (p=1.000). as already stated, e6/e7 mrna expression from high-risk hpv types is probably a less common event in hnscc patients [13, 14]. nevertheless different investigators ' results suggest that hpv-positive carcinomas represent a different tumor entity [14, 18]. high-risk hpv types demonstrate an integration tendency, as can be assumed in our study by the mrna oncoproteins ' expression. we should also mention, as many investigators indicate, that low-risk hpv types (hpv 6 in our case) have been found in some head and neck carcinomas and might be implicated in the carcinogenesis process [14, 18, 19]. although authors support better prognosis for hpv-positive oral cancer cases [3, 14, 16, 18], hpv-positive tumors are usually diagnosed in higher stage than hpv-negative tumors. therefore there is a small subgroup of hpv oral cancers that demonstrate a worse response to treatment and have a lower rate of survival. sexual transmission of oncogenic hpv genotypes is universally accepted for the anogenital region, whereas the route of infection for the oropharyngeal region is unclear [2, 18]. although several studies have recently identified hpv, particularly type 16, in a subset of squamous cell carcinoma of the tonsils and base of the tongue [9, 14, 16, 21], the possibility of sexual or other transmission of hpv in oral cancer patients also needs to be explored [5, 6, 18]. the immune response might also affect the survival, but it seems to depend on whether hpv is present in the tumor cells in an episomal form or as an integrated virus [14, 18]. although our data showed a relatively low hpv and oral cancer association, people from different geographical regions often demonstrate higher or lower hpv prevalence in oscc, which could also be the reason for our results. despite the heterogeneity between different studies, hpv appears to play an important role in some types of oropharyngeal carcinomas and possibly a small subgroup of cancers in the oral cavity and may represent an alternative pathway in carcinogenesis to the known and established factors of tobacco and alcohol [9, 18] the ability to control head and neck cancer will therefore depend on three basic cornerstones: prevention, detection, and early diagnosis. the recent development of an hpv vaccine might offer hope for the prevention of cervical and anogenital carcinomas and possibly also represent an additional prevention option for a substantial number of patients with hnscc. this study described the detection rates and attribution of hpv genotypes as well as the e6/e7 mrna expression of site-specific osccs in 45 greek patients. dna and rna assays detected the same genotypes in all high-risk hpv infected samples. this study confirms the prevalence of hpv infection among patients with osccs. future analysis and followup of more osccs

the relation between hpv and head and neck cancer has recently and extensively been investigated. the purpose of this study was to indentify hpv genotypes, as well as e6/e7 mrna expression of high-risk hpvs (16, 18, 31, 33 and 45) in oral squamous cell carcinomas (osccs) from 45 greek patients. the overall prevalence of hpv dna positive osccs was 11.1% (5/45), while high-risk hpv dna was found in 6.7% (3/45) of osccs. e6/e7 mrna expression was detected in 8.9% (4/45) of the oral cavity samples. our data indicated that hpv 16 was the commonest genotype identified in hpv-positive osccs by both dna and rna tests. this study confirms the prevalence of hpv infections among patients with osccs. future analysis and followup of more osccs will enable us to correlate hpv detection and clinical outcome.

PMC3600178

pubmed-839

physical fitness directly affects one s health state and becomes the basis of healthy adulthood1. therefore, suitable physical activity in children and adolescents contributes to the development of their physique, strength, and balance. many developed countries have national projects designed to encourage students to enhance their physical fitness, e.g., fitnessgram in the united states, trimming 130 in germany, participaction in canada, eurofit in europe. health-related physical fitness measures were first developed in 2009 in korea to evaluate students physical strengths (cardiorespiratory endurance, muscular strength, muscular endurance, flexibility, and body fat). the physical activity promotion system (paps) is used for continuous management of the degrees of improvement in physical fitness and activities among elementary, middle, and high school students through systematic evaluation of their physical fitness as well as the recommendation of desirable physical activities to the students via their parents and teachers. a cardiorespiratory endurance test includes stepping, running, and walking, and its evaluation results are classified into five grades using the heart rate to evaluate heart function2. the current study focuses only on the measured physical fitness levels and lacks follow-up management. efficient management by exercise programs that provide various benefits should be offered to elementary school children. in the recent years, studies have been conducted on exercise machines, such as the simulator, that are used to enhance the muscle strength and cardiorespiratory endurance, improve flexibility, and reduce body fat3, 4. the ski simulator exercises in particular are designed to mimic snow surface repulsion; hence, they have the advantage of providing resistance. such resistance exercises enhance the muscle mass and stimulate muscle strengthening, thus efficiently aligning the body parts and maintaining good posture. they also improve one s ability to perform various exercises requiring muscle strength, endurance, and energy; thus, they can positively influence basic health functions such as metabolism and cardiovascular functioning6, 7. in a study on the effects of simulator-based exercises on injury prevention, lee et al.8 reported that training with a ski simulator contributes to increased range of motion and improved hamstring strength, which help to prevent sports-related injuries. however most previous studies analyzed the skier s posture9, 10, and some differences were noted between individuals depending on the exercise intensity and the simulator type. due to continuous demand for research in this area, in this study, the heart rate was measured and analyzed after a ski simulator exercise and the harvard step test. these exercises have various effects that can be used to evaluate the cardiopulmonary endurance by calculating the post-exercise recovery rate. the body mass index (bmi) analysis can provide useful information. because simulator exercises improve the muscle strength and endurance, this study aimed to assess the exercise performance capacity improvements of elementary school students. participants included 77 elementary school students (normal weight, 40 students; overweight and obesity, 37, based on the asia oceania association for the study of obesity standards) with no previous or current foot injury. this study was approved by the ethics committee of the institutional review board of pukyong national university. the cohort size was calculated using the g*power 3.1 version program by faul et al11. the specifications of the sample calculated by this analysis was 70 participants with a 0.05 significance level, 0.95 power, and 0.8 effect size being the largest size; therefore, this cohort (77 participants) satisfied the required sample size criteria (table 1table 1.participants characteristicsnormal (40)over weight/obesity (37)height (cm)149.28.1151.97.2weight (kg)45.16.455.86.3bmi (kg/m)20.21.624.11.0normal group (18.5 bmi<23.0 kg/m), overweight, obesity (bmi 23.0 kg/m) aoaso (asia oceania association for the study of obesity) s standards). this study was conducted after obtaining written informed consent of the participants and their parents and teachers. the ski simulators (pro ski simulator; slovenia) were fixed onto a flat surface consisting of a platform on wheels that moved left and right on two bowed parallel metal rails. rubber belts fastened the platform to the rails and ensured that it regained its resting position in the middle of the apparatus. the ski simulator s band elasticity had a rotation radius of 16 levels; larger the rotation radius, weaker was the band elasticity. this study conducted the experiment with two elasticity strength levels. to ensure accuracy, sufficient time was given to each subject for practice, and then the actual skiing was performed for 3 minutes. each subject held a strap in each hand to maintain balance, and a low intensity ski simulator setting was used for the study. each participant performed the harvard step movements for 3 minutes and then rested in a chair for 3 minutes. the height of the step box for harvard step test was 20.3 cm, and the steps were performed at a rate of 24 steps per minute. to ensure postural accuracy, each subject a heart rate monitor and a stopwatch were used in this study, and cardiorespiratory endurance was calculated by the physical efficiency index (pei) formula described below.pei=d/(2 p) 100d: duration of the exercise (s)p: first phase (6090 s)+second phase (120150 s)+third phase (180210 s) heart rates normal group (18.5 bmi<23.0 kg/m), overweight, obesity (bmi 23.0 kg/m) aoaso (asia oceania association for the study of obesity) s standards using these methods, the heart rate in each phase as well as the differences in the 2 groups and the 2 exercises were computed through analysis of the biomechanical factors. each subject rested for 10 minutes between the conditions, which were performed in a random order to avoid compromising the results. the data were statistically processed using the statistical package for the social sciences, version 23.0. the independent t-test and paired t-test were used to examine the differences, which were considered statistically significant at p values<0.05. using the aforementioned methods, the movement-dependent cardiorespiratory endurance factors of heart rate and pei were calculated. there was a significant difference among the bmi based groups at 2 and 3 minutes when participants were exercising and at 6 minutes when they had cooled down. furthermore, the normal weight group had higher pei levels (table 2table 2.heart rate and physical efficiency index (pei)ski simulatornormaloverweight/obesity1 minute84.321.481.813.72 minute122.110.1139.612.7***3 minute130.17.4150.010.5***4 minute84.711.787.411.55 minute81.111.184.411.16 minute80.611.887.513.0*pei61.45.656.33.5***harvard stepnormaloverweight/obesity1 minute92.819.793.615.52 minute129.612.6140.414.8**3 minute137.89.3147.914.9**4 minute87.116.685.818.65 minute83.819.083.517.46 minute85.112.486.514.2pei57.55.555.24.2*normalski simulatorharvard step1 minute84.321.492.819.7*2 minute122.110.1129.612.6**3 minute130.17.4137.89.3***4 minute84.711.787.116.65 minute81.111.183.819.06 minute80.612.485.112.4pei 61.45.657.55.5**overweight/obesityski simulatorharvard step1 minute81.813.793.615.5**2 minute139.612.7140.414.83 minute150.010.5147.914.94 minute87.411.585.818.65 minute84.411.183.517.46 minute87.513.086.514.2pei56.33.555.24.2*<0.05,**<0.01,** *<0.001. pei=d/(2 p) 100; d: duration of the exercise (s); p: first phase (6090 s)+second phase (120150 s)+third phase (180210 s) heart rates). the t-test results regarding the participants heart rate before and after the exercises showed that the average heart rate of the normal weight group was higher during step-boxing; however, the overall pei was higher during skiing. the obesity group revealed significant differences in the initial stages of the exercise, and the overall pei of the obese group was higher during skiing. *<0.05,**<0.01,** *<0.001. pei=d/(2 p) 100; d: duration of the exercise (s); p: first phase (6090 s)+second phase (120150 s)+third phase (180210 s) heart rates the american college of sports medicine has underscored the importance of physical strength with regard to health over physical strength in terms of motor skills based on the fact that a decline in the capacities of body composition, cardiorespiratory endurance, muscular strength, and muscular endurance and flexibility significantly increases the probability of lifestyle diseases and health impairments. relying on the kinetic functions of the heart and lungs, cardiorespiratory endurance refers to the body s ability to continue supplying energy to the human circulatory system and muscles over extended periods. there have been positive reports12,13,14 about how advanced cardiorespiratory endurance not only enables one to engage in aerobic exercises, such as walking and jogging for a longer time, but also enhances one s academic accomplishments by improving concentration levels. there are many methods to evaluate cardiorespiratory endurance considering various aspects such as assessment purpose, targets, and social influences. a certain method may or may not be superior to another; however, the paps evaluation method is currently considered an optimal standard method. continued research15 showed that a solution is required to reduce the gaps among the different methods evaluating cardiorespiratory endurance. in this regard, skiing has developed as a popular health-improving sport that can facilitate students physical fitness development and provide great exercising benefits. the ski simulator exercise is a training machine that uses a band to simulate an environment of reduced resistance force between the snow surface and ski plates. due to these mechanical features, the ski simulator exercise is considered to have an effect similar to that of the elastic resistance exercises. anderson et al.16 reported that elastic resistance exercises are more effective for training small muscle groups, such as the muscles of the neck, shoulders, and arms, as compared to the strength training exercises using free weights. elastic bands undergo a linear increase in tension from the beginning of the contraction to the full range of motion17. the tension generated may make it difficult to maintain a balanced posture, thus facilitating the transition to the next movement with a different heart rate as evident from the pei data difference between two groups and exercises. oloughlin et al.18 emphasized on the absolute lack of physical activities due to increased time spent on video games and computers. on the other hand, kim et al.19 claimed that the interest in sports can promote the development of physical fitness by increasing the level of participation in exercises. the importance of adequate exercising applies to both obese and normal weight children; therefore, as mentioned in this study, skiing as an ideal sport can be practically utilized in real-life settings. taking bmi, physical fitness level, and sport durability into consideration, this study showed that the ski simulator exercise could produce a cumulative load even when performed at low intensity. furthermore, the ski simulator exercise can be effectively utilized as exercise equipment since it resulted in higher pei levels than the harvard step test. if the schools can increase sport durability by stimulating students interests, the ski simulator exercise can be practically used in programs designed to improve and strengthen students physical fitness.

[ purpose] efficient management using exercise programs with various benefits should be provided by educational institutions for children in their growth phase. we analyzed the heart rates of children during ski simulator exercise and the harvard step test to evaluate the cardiopulmonary endurance by calculating their post-exercise recovery rate. [subjects and methods] the subjects (n=77) were categorized into a normal weight and an overweight/obesity group by body mass index. they performed each exercise for 3 minutes. the cardiorespiratory endurance was calculated using the physical efficiency index formula. [results] the ski simulator and harvard step test showed that there was a significant difference in the heart rates of the 2 body mass index-based groups at each minute. the normal weight and the ski-simulator group had higher physical efficiency index levels. [conclusion] this study showed that a simulator exercise can produce a cumulative load even when performed at low intensity, and can be effectively utilized as exercise equipment since it resulted in higher physical efficiency index levels than the harvard step test. if schools can increase sport durability by stimulating students interests, the ski simulator exercise can be used in programs designed to improve and strengthen students physical fitness.

PMC4793025

pubmed-840

screening for gestational diabetes mellitus is routinely programmed to prevent complications caused by elevated blood glucose levels in pregnancy, including macrosomia, cesarean delivery, shoulder dystocia, neonatal metabolic problems, perinatal mortality, and pre-eclampsia.1 diabetes mellitus during pregnancy also appears to be associated with an increased risk of cardiovascular diseases even in later life.2 moreover, this underlying co-morbidity is an independent risk factor for subsequent coronary artery disease. in this context, diabetes mellitus during pregnancy has been identified as a major etiology for atherosclerosis in large elastic arteries.3 one of the main indicators for assessing atherosclerotic lesions during this period is the increased intima-media thickness (imt) of carotid arteries.4 it has been well known that, as opposed to the blood flow through the other arteries of the maternal organs, the blood flow through the carotid artery is decreased during pregnancy, which has been attributed to pregnancy-mediated increased responsiveness of the carotid artery to vasoconstrictors and decreased responsiveness to vasodilators.5 also, the endothelial hypertrophy of the carotid artery can be a common finding, leading to changes in the carotid blood flow and its complications.6, 7 thus, increased carotid imt can be deemed a validated endothelial dysfunction surrogate endpoint during pregnancy. some studies have recently shown that pregnant women with previous gestational diabetes mellitus are at increased risk of carotid artery disorders.8, 9 be that as it may, the scarcity of research into this hypothesis means that it is still unknown whether or not gestational diabetes mellitus causes increased imt. the current study was performed to evaluate carotid imt in diabetic pregnant women with gestational diabetes and to ascertain if an impaired oral glucose challenge test (ogct) correlates with the development of increased imt. this cohort study included 50 women ranging from 18 to 35 years of age at high risk of diabetes during pregnancy. gestational diabetes mellitus was screened with a one-hour 50 g oral glucose challenge test (ogct). abnormal results were, thereafter, confirmed with a three-hour 100 g oral glucose tolerance test (ogtt). eligible women were nulliparous with a singleton pregnancy, had a normal blood pressure at the time of recruitment, and gave informed consent. women with any of the following were excluded: family history of cardiovascular disorders; history of hypertension; anti-hypertensive and cholesterol medication use; hyperlipidemia; overt diabetes or fasting plasma glucose (fpg)>125 mg/dl according to the american diabetes association (ada) definition;10 chronic renal or hepatic diseases; malignancies; recent hormonal medications; cigarette smoking; severe obesity (body mass index [bmi]>35 kg/m); and history of infertility or polycystic ovarian disease. those with the status of plaques/shadowing (> 1.0 mm) at any carotid site were also excluded. the study protocol was approved by the research and ethics committees at kerman university of medical sciences. baseline demographic variables were collected either from the women s medical records or self-completed questionnaires at trial entry and comprised maternal age, height, weight, bmi, smoking status, and blood pressure at trial entry. total cholesterol was measured enzymatically with standard methods and total triglyceride was measured via standard spectrophotometric techniques. after the precipitation of low-density lipoprotein (ldl) particle with phosphotungstic acid, high-density lipoprotein (hdl) cholesterol was measured enzymatically in the supernatant by a modification of the method for total cholesterol. b-mode ultrasound scans were performed at baseline and at two time points of mid-term pregnancy (20 to 24 weeks) and full-term pregnancy (36 to 38 weeks) on all the participants. carotid ultrasound scans were carried out by a single trained sonographer unaware of the study protocols and methodology. b-mode ultrasound images were equipped with a 7.5-mhz linear array transducer and captured with a ge log 200 ultrasound machine. the ultrasonic variable used in the statistical analysis was the mean of the imt of common carotids and internal carotid arteries from two walls (near and far walls) at four different angles. the mean of carotid imt was compared between the women with impaired ogct and those who screened normal on ogct at the two study time points. for the statistical analyses, the statistical software spss version 19.0 for windows (spss inc. the continuous variables, if normally distributed, were analyzed using the student-test and presented as mean differences, while the mann-whitney test was employed for skewed data. the baseline characteristics of the pregnant women with impaired and normal ogct tests are presented in table 1. the two groups were similar in terms of pregnancy age, height, weight, bmi, and baseline laboratory parameters. there were no significant associations between carotid imt and maternal indices, including the demographic variables and laboratory parameters. an overall comparison between the impaired ogct test group and the control group via the mann-whitney u test revealed significant differences in carotid imt in the midterm and full-term pregnancy (table 2). the trend of the changes in carotid imt during the mid-term to full-term pregnancy was, however, insignificant in each group. an increased carotid imt can be observed not only in long-standing type ii diabetic but also in newly detected type ii diabetic patients. especially in pregnant women, carotid imt gradually increases from the first to the third trimester of normal pregnancy and regresses in the postpartum period. nevertheless, the trend of the increase in pregnant women with gestational diabetes is still unclear. in our study, with the aid of carotid ultrasound, arterial examination was performed at mid-term and full-term pregnancy and both controls and the women with an impaired ogct test were assessed and compared with regard to the changes in carotid imt. we showed that although carotid imt was more increased in those with impaired ogct, the trend of this change was similar between the impaired and normal ogct groups. furthermore, we observed that carotid imt was significantly higher in the diabetic group than in the normoglycemic group in different trimesters, but the trend of these gradual changes from the first to the third trimester was similar in both groups. totally, effective glycemic control seems to be helpful for the prevention of increased carotid imt. during the pregnancy period, peripheral vascular resistance is physiologically paralleled by improved macrovascular compliance.11, 12 some researchers have shown that 2-4 years after previous gestational diabetes mellitus, a significantly higher arterial stiffness can be found compared with reference women without a history of diabetes.13 pregnancies complicated by diabetes not only are associated with increased carotid imt but also can lead to increased maternal arterial stiffness.9 this study demonstrates increased imt of the carotid artery in a group of women who had a pregnancy complicated by impaired ogct. this finding is in line with the literature confirming that women with a history of gestational diabetes have a higher risk of developing increased carotid imt. one of the first steps in the development of atherosclerosis is endothelial activation, followed by endothelial dysfunction. thus, in diabetes mellitus, vascular endothelial activation or dysfunction is considered to play a key role in the development of many of the clinical manifestations related to carotid artery disease, several years after delivery. some epidemiological studies have found positive associations between parity and risk of carotid artery plaques in elderly women and, therefore, age of pregnancy can be a trigger for this phenomenon.14 also, multi-gravidity and previous history of coronary diseases have been also identified to be related to the appearance of carotid artery plaques.15 folate deficiency during pregnancy is another probable triggering factor for progressing carotid imt. folate deficiency is linked with hyperhomocystinemia,16 which is associated with accelerated progression of atherosclerosis17 and, thereby, carotid artery imt. pregnancy is potentially a cause of folate deficiency.18 consequently, it is possible that multiparous women are at risk of prolonged folate deficiency; this may explain their susceptibility to the development of carotid artery imt. in the present study, the main limitation was blood glucose controlled by insulin; we could not hold treatment because of ethical issues. also, we did not assess the confounding effects of the triggering variables such as age of pregnancy, multi-parity, or medication during this period on increasing carotid imt; that should be considered in further studies. prospective follow-up studies will also be needed and have meanwhile been started to determine whether diabetes during pregnancy itself is responsible for the increase in imt. in conclusion, an impaired ogct test is proven to be an independent risk factor for increased carotid imt and subsequent coronary artery disease. even with this small study, we were able to find an increased imt after diabetes appearance, which might be used as an indicator of a potential increased vascular risk. furthermore, imt measurements in diabetic pregnant women could offer an opportunity to identify a high-risk group of women who might benefit from early screening and preventive measures. these measures could include lifestyle interventions such as improving diet and physical activity as well as increased surveillance of blood pressure, serum lipids, and particularly blood glucose.

background: pregnant women with previous gestational diabetes mellitus are at increased risk of progressive carotid artery disorders. the current study evaluated carotid intima-media thickness (imt) in pregnant women with gestational diabetes at two time points of mid-term and full-term pregnancy to determine whether gestational diabetes mellitus causes increased imt. methods:this cross-sectional study carried out at afzalipour hospital (kerman, iran) between 2009 and 2010, recruited 50 women who were at high risk of gestational diabetes during pregnancy and had an oral glucose challenge test (ogct) as screening for gestational diabetes. b-mode ultrasound scans were performed at baseline and at two time points of mid-term pregnancy (20 to 24 weeks) and full-term pregnancy (36 to 38 weeks) on all the participants. the mean imt of common carotids and internal carotid arteries from two walls (near and far walls) at four different angles was assessed. results:an overall comparison between the impaired ogct test group and the control group revealed significant differences in carotid imt in the mid-term (0.65 0.07 vs. 0.59 0.06 mm; p value=0.002) and full-term (0.65 0.05 vs. 0.59 0.04 mm; p value<0.001) pregnancy; however, the trend of the changes in carotid imt during mid to full-term pregnancy was insignificant in each group (p value>0.05). conclusion: carotid imt was significantly higher in the women with gestational diabetes than that in the normoglycemic group in different trimesters. this finding denotes that atherosclerosis might start years before the diagnosis of gestational diabetes in vulnerable women.

PMC3537204

pubmed-841

since dental ceramic restorations have been introduced in 20 century,1 reproduction of natural appearance of teeth has been a major concern in dentistry. for metal-ceramic restorations, light reflection from an opaque porcelain layer to mask the metal substrate resulted in opaque appearance and therefore, their use in high esthetic area was limited.2 glass ceramic restorations without metal substrate induced more light transmission and accordingly, they improved the ability to reproduce the appearance of tooth structure.3 despite the esthetic advantage of glass ceramics, the demands for stronger ceramic restorations have increased. as a result, high strength zirconia-based ceramics combined with cad/cam technology have broadened the range of their applications in dentistry.4 however, cohesive failure of the veneering porcelain has been reported as a major drawback56 and thereby, fabricating monolithic zirconia restoration which consists of a single zirconia material without any veneering could be an alternative approach to obviate the veneering failure.7 the esthetic value of dental ceramic restorations is influenced by several factors, such as color, translucency, fluorescence, surface texture and shape.8 furthermore, the overall color of ceramic restorations can be influenced by the thickness of the ceramic, the thickness and the color of luting agent, and the color of the underlying tooth structure. 9 several studies investigated the effect of the thickness on overall color and translucency of ceramic restorations.291011121314 changes of color and translucency may be expected when the thickness of porcelain layer changes, although the direction of color change may depend on the specific components of the ceramic systems.15 due to its inherent white and opaque appearance, monolithic zirconia can be colored in a pre-sintered state to match adjacent teeth. in a clinical situation, there could be a thickness reduction during the process of occlusal adjustment by dentists. however, there have been no reported studies regarding the changes of color and translucency as a function of changes in thickness using monolithic zirconia. the purpose of this study was to evaluate the effect of the amount of thickness reduction on color and translucency of dental monolithic zirconia ceramics. the null hypothesis to be tested was that there was no significant difference in color and translucency between monolithic zirconia ceramics with different amount of thickness reduction. one-hundred sixty-five square-shaped specimens from presintered yttria-stabilized tetragonal zirconia blocks (lot no.: b 105566, b 105583, b 105565, b 88712; bruxzir, glidewell laboratories, newport beach, ca, usa) were colored with coloring liquid (lot no.: 40127, 40129; tanaka zircolor, a2, tanaka dental, skokie, il, usa) and assigned to 5 groups according to the number of coloring liquid application (group i (one time) to v (five times), n=33 per each group) following the same protocol used in our previous study.7 the specimens were heated in a furnace (austromat basic, dekema dental-keramikfen gmbh, freilassing, germany) with a step sintering procedure; sintering at 950 for 10 minutes and at 1,500 for 2 hours. after sintering, the thickness adjustment was performed in the same manner as was used in our previous studies.716 accordingly, the final dimensions of the specimens were 16.3 mm 16.3 mm 2.0 mm. each group was then divided into eleven subgroups (n=3 per each subgroup) by reducing the thickness of 0.1 to 1.0 mm in increments of 0.1-mm on the colored surface using a horizontal grinding machine (hrg-150, am technology, asan, korea); subgroup 0 (no reduction), subgroup 1 (0.1 mm reduction) to subgroup 10 (1.0 mm reduction). color parameters were obtained from cie-lab (commission internationale de l'eclairage l, a, b) color space relative to d65 on a reflection spectrophotometer (cm-3500d, konica minolta, tokyo, japan). for the instrument, diffuse illumination was used and the reflected light was measured (cie diffuse/8-degree) at the center and each quarter of the specimen. a 3-mm diameter aperture for diffuse illumination and 3-mm measurement area each of l, a and b values was measured against a black background (cm-a 101b, konica minolta, tokyo, japan, l=0.1099, a=0.2107, and b=-0.4292) and a white background (cm-a120, konica minolta, tokyo, japan, l=96.6880, a=-0.1755, and b=-0.1236) in the reflectance mode with specular component excluded (sce) at 10 nm intervals in the wavelength range of visible light, 400-700 nm. optical contact was obtained by placing a drop of distilled water (refractive index: 1.33, approximately) between each specimen and a background.11 spectral reflectance against a white background was recorded at 10 nm intervals in the range of 400 to 700 nm. color difference between each subgroup was calculated using cie lab color-difference formula17 denoted by eab=[(l)+(a)+(b)]. l, a, and b refer to the difference on lightness, red/green axis, and yellow/blue axis, respectively. to determine the color difference, the average cie values against a black background were used. for translucency measurements, translucency parameter tp value was calculated by the color difference between values against a black and a white background18 which is denoted by tp=[(lb-lw)+(ab-aw)+(bb-bw)]. diffuse transmittance measurement was performed using an integrating sphere with the aperture size of 9.5 mm in diameter. all measurements, therefore, were made at the center and each quarter of the specimen and values were averaged., chicago, il, usa) and the level was set at 0.05. normal distribution of each color value and tp value was verified with shapiro-wilk test. to identify if there is any significant difference in color and tp values among subgroups, one-way anova was carried out followed by multiple comparison scheff test. pearson correlation and linear regression was fitted to test for a relationship between the amount of thickness reduction and color and tp values. 3 showed means of cie l, a and b values of each group against a black background in the reflectance mode as a function of the amount of thickness reduction, respectively. cie a value generally increased, while cie b value decreased with the increase of thickness reduction in all groups. correlation analyses between l, a or b values against a black background in the reflectance mode and the amount of thickness reduction were conducted. there were negative, but weak correlations between l value and the amount of thickness reduction in most groups (-0.58<r<0.34, 0.09<r<0.34). there were positive correlations between a value and the amount of thickness reduction in all groups (0.72<r<0.85, 0.52<r<0.73). there were negative correlations between b value and the amount of thickness reduction in all groups (-0.86<r<-0.07, 0.00<r<0.74). average spectral reflectance curves against a white background of each subgroup within groups were obtained (fig. 4). there was a significant difference between subgroup 0 and other subgroups through the entire spectrum and the values of spectral reflectance in other subgroups were lower than subgroup 0. the interpretation of the color difference for this study is based on the visual matching study of johnston and kao19 who found that color difference of 3.7 eab unit was acceptable for resin composites. color differences between subgroup 0 and other subgroups were clinically perceptible (eab>3.7) (fig. 5) color differences between subgroup 1 and 2 were within the range of perceptibility threshold (eab<3.7) except group ii. color differences between subgroup 2 and 3 were within the range of perceptibility threshold except group v. color differences between subgroup 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10 were within the range of perceptibility threshold in all groups. means of tp for each subgroup within groups are calculated and ranged from 2.27 to 5.34 (table 1). highly significant correlations were found out between tp values and the amount of thickness reduction in all groups (r>0.94, r>0.89, p<.001). spectral transmittance of each subgroup exhibited similar spectral behavior through the entire spectrum and transmittance generally increased with increasing the amount of thickness reduction in all groups (fig. according to the results of this in vitro study, the null hypothesis could be rejected because there were significant differences in l, a or b values and tp values between monolithic zirconia specimens with different amount of thickness reduction. the effect of various changes in thickness of each layer on the final appearance of layered metal-ceramic structures has been studied.212152021 l value substantially increased with the decrease of porcelain thickness212 and the direction of color changes were dependent on porcelain shade and the type of metal-ceramic alloy. increasing the thickness of dentin porcelain produced more scattering and absorption of the incident light and less light reflected back from the opaque layer. with regard to all-ceramic systems, l value generally decreased due to increased absorption of incident light with thicker specimens, while a and b values increased as the ceramic thickness increased.101113 there might be a difference in the amount of light reflection at the opaque core between all-ceramic systems with different core translucency. douglas and przybylska2 demonstrated that the semi-translucent all-ceramic systems were less affected by reduced porcelain thicknesses compared to metal-ceramics. in this study, the changes in l value showed a different feature compared to metal-ceramic or all-ceramic systems. there was a significant decrease in l value at initial reduction, but there were no further significant changes on l value in most groups (fig. 1). the different aspect of change might come from different optical and structural properties since monolithic zirconia ceramic is polycrystalline monolayer without any veneering. it can be inferred that there might be reduced scattering due to the reduced thickness which induces lower l value at first 0.1 mm reduction. however, as the thickness reduction proceeds, monolithic zirconia itself could act as an opaque core and induce internal reflection.22 thus, reduced reflection might compensate increased internal reflection and l value could be relatively stable. chromatically, a value increased, while b value generally decreased with increasing thickness reduction. regarding the shift in chroma, b value was more sensitive to the change of thickness than a value showing minimal shifts in a value. 21113 according to the study of douglas and brewer,23 dental observers were more sensitive and critical to the color difference in redness than yellowness for metal-ceramic crowns. however, their study was conducted with metalceramic crowns and therefore, further study should be performed to determine whether there is any difference in subjective color assessment between a and b value for monolithic zirconia restorations. 3), group ii exhibited noticeable changes in a and b values down to 0.2 mm reduction and group iii; to 0.3 mm reduction, group iv; to 0.6 mm reduction, and group v; to 0.5 mm reduction. there was no distinct difference in a and b values between groups after around 0.6 mm reduction. it can be inferred that the more coloring liquid is applied, the deeper the coloring liquid infiltrates. in addition, one time of coloring liquid application might infiltrate 0.1 mm deep through monolithic zirconia specimen, two times of application; 0.2 mm deep, three times of application; 0.3 mm deep, and four or five times of application; around 0.6 mm deep through monolithic zirconia specimen. this study exhibited a perceptible color difference from no reduction (eab>3.7) even after first 0.1 mm reduction regardless of the number of coloring liquid applications. antonson and anusavice14 investigated the translucency of dental core and veneering ceramics as a function of ceramic thickness. there was a positive linear correlation between contrast ratio and thickness (r>0.81). hefffernan et al. investigated the effect of the thickness of core materials,24 and the thickness of veneered core materials25 on the translucency of the specimens. o'keefe et al.26 suggested that the thickness of the porcelain veneer was the primary factor affecting light transmission and not the opacity. tp values generally increased as the amount of thickness reduction increased in all groups (r>0.89, p<.001). based on lambert's law,27 decreasing the thickness of material the fraction of incident light that is reflected, absorbed, and transmitted depends upon the thickness of the specimen as well as the scattering and absorption characteristics.28 this in vitro study has several potential limitations. the first limitation is that even application of coloring liquid on the specimens and exact amount of the increase of coloring liquid were difficult to control. secondly, possible pressure fluctuation inside the furnace during the sintering process might have induced uneven color of the specimens. thirdly, the aperture diameter of spectrophotometer for reflectance measurement was 3 mm and possible edge loss would have affected the color measurement. finally, this study was conducted with limited color of shade a2 and with a specific kind of monolithic zirconia system and coloring liquid. therefore, the influence of varied color combinations with different monolithic zirconia systems should be further studied. increasing thickness reduction reduces lightness and increases a reddish, bluish appearance, and translucency of monolithic zirconia ceramics .

purposethis study investigated the effect of amount of thickness reduction on color and translucency of dental monolithic zirconia ceramics. materials and methodsone-hundred sixty-five monolithic zirconia specimens (16.3 mm 16.3 mm 2.0 mm) were divided into 5 groups (group i to v) according to the number of a2-coloring liquid applications. each group was then divided into 11 subgroups by reducing the thickness up to 1.0 mm in 0.1-mm increments (subgroup 0 to 10, n=3). colors and spectral distributions were measured according to cielab on a reflection spectrophotometer. all measurements were performed on five different areas of each specimen. color difference (e*ab) and translucency parameter (tp) were calculated. data were analyzed using one-way anova and multiple comparison scheff test (=.05). resultsthere were significant differences in cie l*between subgroup 0 and other subgroups in all groups. cie a*increased (0.52<r2<0.73), while cie b*decreased (0.00<r2<0.74) in all groups with increasing thickness reduction. perceptible color differences (e* ab>3.7) were obtained between subgroup 0 and other subgroups. tp values generally increased as the thickness reduction increased in all groups (r2>0.89, p<.001). conclusionincreasing thickness reduction reduces lightness and increases a reddish, bluish appearance, and translucency of monolithic zirconia ceramics.

PMC4769888

pubmed-842

diabetes mellitus is a common endocrine disease that is characterized by chronic hyperglycemia and insulin deficiency or resistance which are associated with other complications such as macroangiopathy and microangiopathy. moreover, studies have also recorded that hyperglycemia can eventually induce the production of reactive oxygen species (ros) and nitric oxide (no) in the long run, increase cell apoptosis, decrease cell mass, and cause insulin deficiency and resistance. to date, the treatment for diabetes including insulin, metformin, and sulfonylureas was found to cause various side effects especially the development of resistance after a certain period of time. thus, efforts to search for alternative and novel therapies to manage diabetes are still receiving great attention. personalized nutritional management and physical activity have been recommended to replace the american diabetes association diet to achieve better glycemic control in diabetic patients. besides, complementary and alternative medicine in the form of plant-based food and spices that are commonly used in traditional medicine to treat diabetes have also been recommend as better oral agents. for example, momordica charantia (bitter melon) is a traditional antidiabetic remedy that has been identified as a potential hypoglycemic agent in streptozocin/alloxan-induced diabetic and type ii diabetic subjects. other than herbs, whole grains and cereals that serve as the source of energy in asian food have also been suggested as potential antidiabetic food due to their low-glycemic indices [6, 7]. the glycemic index of a food is defined as an effect on postprandial glucose in comparison to the reference food. low-glycemic index foods have been proven to improve glycemic control of insulin and noninsulin-dependent diabetes mellitus. mung bean (vigna radiata l.) is a food that is traditionally used to reduce fever and used for detoxification. among all types of seeds, mung bean has been recommended as an alternative food for diabetic patients due to its high-fiber content and low-glycemic index. yao et al. had reported that ethanolic extract of mung bean was able to reduce blood glucose, total cholesterol, and tg levels while enhancing the glucose tolerance and insulin sensitivity in type ii diabetic mice. fermentation is a common food processing method traditionally practiced in the east and southeast asian regions to improve the food colour quality, flavour, or even the nutrient content. alterations made by microflora during the fermentation process may help to release the active ingredients that are beneficial to human health. fermented soybean, for example, was found to have better antidiabetic effect due to attenuation of the structures and contents of isoflavonoids and smaller bioactive peptides. although the antihyperglycemic effect of mung bean has been reported, the potential of fermentation in improving the antihyperglycemic and the antioxidant effect of mung bean is still unknown. thus, this study compared the effects of fermented and nonfermented mung bean extracts on normoglycemic, glucose-induced hyperglycemic and alloxan-induced hyperglycemic mice. the serum antioxidant levels of extracts treated alloxan-induced hyperglycemic mice were also evaluated in this study. alloxan, glucose, folin-ciocalteu reagent, ascorbic acid, gallic acid, and gsh assay kit were purchased from sigma-aldrich (usa). momordica charantia was purchased from ccm pharmaceutical (malaysia) as positive control in this study. strain 5351 inoculums were obtained from the culture collection center of the malaysian agricultural research and development institute (mardi). seeds of mung bean (vigna radiate) were subjected to solid-state fermentation before extraction. then, the fermented bean was dried and ground into powder followed by water extraction in the ratio of 1 g of fermented seeds in 20 ml of deionised water (25c) for 30 minutes. the mixture was then centrifuged and the supernantant was freeze-dried at an operating temperature of 50c to obtain a final yield of 25% (w/w). uplc analysis was performed on a acquity uplc system (waters corp, usa) coupled with acquity uplc accq tag ultra column (2.1 100 mm, 1.7 m) and pda detector at 55c to analyse gaba and amino acid concentrations. gaba and amino acids were separated using a gradient mobile phase consisting of a: accq tag ultra eluent a and b: accq tag ultra eluent b with the following gradient conditions: 00.54 min, 0.19.1% b; 5.747.74 min, 9.1%21.2% b; and finally, reconditioning the column with 0.1% b with isocratic flow for 2.1 min after washing column with 59.6% b for 0.30 min. one l of all samples and standards were injected at a flow rate of 0.7 ml/min. the data were then analyzed using the waters empower 2 software. from the analysis, every 100 g of the nonfermented mung bean extract contained 0.016 0.001 g of gaba and 0.256 g of total amino acids. in contrast, the concentration of gaba in the fermented mung bean extract increased by 7.6-fold to 0.122 0.009 g/100 g of dried powder while the amount of amino acids increased by 13 fold to 3.326 g/100 g dried powder. the experiments were evaluated on normoglycemic, glucose-induced hyperglycemic, and alloxan-induced diabetic mice. the mice were subjected to 18 h of fasting before each test was carried out. balb/c mice (8 weeks old, 1822 g) were purchased from the animal house in the institute of bioscience, university putra malaysia. standard laboratory pellet diet and water were made available ad libitum throughout the experimental period at 22c of dark-light cycle. this study was approved by the animal care and use committee of university putra malaysia. mice were randomly assigned into their respective groups for normoglycemic, glucose-induced hyperglycemic, and alloxan-induced hyperglycemic studies as listed below. blood glucose was collected from all experimental mice for analysis after 18 h of fasting. group i: normal control mice without any treatment; group ii: m. charantia extract (200 mg/kg); group iii: nonfermented mung bean extract (1000 mg/kg); group iv and v: fermented mung bean extract (200 mg/kg and 1000 mg/kg, resp.). after 18 hours of fasting, blood glucose was determined (0 min) before oral administration of distilled water or the respective extracts (0.3 ml/mice) was given to each mouse. monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after the administration of treatment or distilled water. mice were randomly assigned into five different groups (n=8) as listed above. after 18 h of fasting, blood glucose level was determined at 0 min. then, oral feeding of distilled water or the respective extract was given simultaneously with 1 g/kg (0.3 ml) of glucose solution to each group. monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after the oral administration. group 1 was the normal control mice that received distilled water as placebo while groups 26 were diabetic mice. diabetes was induced using intraperitoneal injection of alloxan (100 mg/kg, 0.1 ml). the hyperglycemic mice were maintained on 5% glucose solution for the next 24 h to prevent hypoglycemia and monitored for 3 days to ensure constant blood glucose levels before they were subjected to 18 hours of fasting. after the fasting period, blood glucose was determined at 0 min, followed by oral feeding with distilled water (group 1 and 2) or the respective treatment. group 3 received m. charantia extract (200 mg/kg); group 4 received nonfermented mung bean extract (1000 mg/kg); group 5 and 6 received fermented mung bean extract (200 mg/kg and 1000 mg/kg, resp.). in addition, all the mice were also fed with glucose solution once (1 g/kg, 0.3 ml, p.o.). monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after administration. treatments with distilled water and the extracts were continued for a total of 10 days. on the last day of treatment, all mice were fasted for 18 h before being anesthetized with ether and sacrificed by cervical dislocation. blood was collected to obtain serum for determination of glucose, total cholesterol (biovision, usa), triglyceride (tg) (biovision, usa), low-density lipoprotein (ldl) (biovision, usa), high-density lipoprotein (hdl) (biovision, usa), and insulin (mercodia, sweden) levels. the antioxidant level of serum was evaluated by detecting the level of malondiadehyde (mda) as described previously while serum nitric oxide level was determined using the griess method (invitrogen, usa). the results for blood glucose level, serum biochemical profiles, and antioxidant level were presented as mean s.d. one way analysis of variance (anova) followed by duncan test was used in this study with p values<0.05 being considered as significant. overall, fermented mung bean, nonfermented mung bean, and m. charantia extracts did not produce any hypoglycemic effect but caused slight hyperglycemic effect within 2 hours of oral feeding in normal mice (figure 1(a)). however, for the glucose-induced hyperglycemic mice, the animals from all groups were found to develop high blood glucose levels at the first 30 minutes after oral administration (figure 1(b)). however, treatment with 1000 mg/kg body weight of fermented and nonfermented mung bean extracts could significantly reduce the elevated blood glucose level in comparison to the normal control group. although significant effect was also shown by the m. charantia extract treatment but the effect was comparatively weaker than in the previous groups. on the other hand, low concentrations of the fermented mung bean extract did not show any significant difference in antihyperglycemic effect when compared to the normal control. significant changes of body weights were observed in the untreated normal mice. for all the diabetic mice, changes of body weights were not significant (figure 2). treatments on day 15 were based on 22 g/mice while from day 6 to10 were based on 24 g/mice. generally, diabetic mice (groups 2 to 6) gained less weight than normal mice (group 1) during the treatment period (figure 2). nonfermented mung bean showed a hyperglycemic effect similar to the untreated diabetic mice in group 2. m. charantia and fermented mung bean extracts (200 mg/kg body weight) on the other hand were able to prevent drastic increases in blood sugar when compared to the untreated diabetic mice. among all treatment groups, high concentration of fermented mung bean extract (1000 mg/kg body weight) was able to reduce blood sugar level most significantly throughout the period of monitoring (30 min to 2 hours after feeding) (figure 1(c)). the alloxan-induced diabetic mice were monitored continuously in the following 10 days with continued treatment for groups 3 to 6. untreated mice in group 2 maintained a high blood glucose level in comparison to mice in the other groups. the blood sugar levels of m. charantia, nonfermented mung bean, and low concentration of fermented mung bean (200 mg/kg body weight) extracts treatment groups were found to be reduced slightly at day 10 while a high concentration of fermented mung bean extract at 1000 mg/kg body weight was able to reduce blood sugar levels even at day 5 after administration (figure 1(d)). the serum lipid profile and the insulin level of the alloxan-induced hyperglycemic mice after 10 days of treatment were assessed. untreated diabetic mice in group 2 showed significantly higher levels of total cholesterol and tg but lower levels of hdl and insulin. in contrast, a high concentration of fermented mung bean extract (1000 mg/kg body weight) showed lower levels of total cholesterol and tg but higher levels of insulin and hdl in comparison to the nonfermented mung bean extract (table 1). similar to the effects on serum lipid profile and insulin levels, untreated diabetic mice in group 2 exhibited significantly higher mda and no levels. both m. charantia and fermented mung bean extracts were able to restore the antioxidant level more effectively than the nonfermented mung bean extract. besides, we also observed that the antihyperglycemic effect of the fermented mung bean extract was dosage dependent whereby a higher concentration of fermented mung bean (comparing between group 5 and group 6) exhibited better antioxidant activity with lower no level (table 1). previously, m. charantia and mung bean have been reported as potential antidiabetic agents. low-glycemic-index mung bean was able to reduce plasma lipid level, epidilymal adipocyte volume and plasma insulin [68]. thus, mung bean has been recommended as a food of choice for diabetic patients. however, it is still uncertain whether fermentation could enhance the antidiabetic effect of mung bean. in this study, we have compared the antihyperglycemic effects of fermented and nonfermented mung bean extracts in normoglycemic, glucose-induced hyperglycemic, and alloxan-induced hyperglycemic mice. normal fasting blood glucose for mice is around 90 mg/dl (~5 mmol/l). animals having fasting blood glucose levels more than 200 mg/dl (~11 changes of fasting blood glucose of normaglycaemic and glucose-induced hyperglycaemic mice which were 20% lower than those of the untreated normal control were considered as hypoglycaemia. all the extract-treated mice in the normoglycemic study showed slight increases in blood sugar without indication of hypoglycemic effect. this outcome may be contributed by the primary metabolites that are present in the water extract, or more specifically by the carbohydrates in this context. however, in both glucose- and alloxan-induced hyperglycemic mice, m. charantia, fermented and non-fermented mung bean extracts were able to reduce oral glucose tolerance to prevent drastic glucose increase in the blood. these results suggested the possibility of using fermented and nonfermented mung bean extracts for regulating blood sugar via their antihyperglycemic effects, which could enhance glucose adsorption in the gut. continued administration of the extracts for 10 days had also been associated with blood sugar reduction (figure 1(d)). fermented mung bean extract at 1000 mg/kg body weight showed the best reductions of blood sugar levels of diabetic mice at day 5. m. charantia, nonfermented mung bean, and low concentration of fermented mung bean extracts showed similar trends of reduction at day 10. the findings from this study were in good agreement with a previous report on the assistance of m. charantia in the regulation of blood sugar via improved insulin sensitivity and recovery of -cells in the pancreas after 12 days of treatment. in this study, fermented mung bean (200 mg/kg body weight) and non-fermented mung bean exhibited a trend of blood sugar regulation similar to that of m. charantia extract. therefore, fermented and nonfermented mung bean extracts could also possibly regulate blood sugar level by enhancing the sensitivity of insulin and by the regeneration of -cells in the pancreas. clinical studies had reported that low-glycemic-index diet contributed small effects on the control of postprandial hyperglycemia in diabetic patients. thus, the improved antidiabetic effect due to fermented mung bean may be contributed by the enhancement of phytochemicals during the fermentation process. advances in the effectiveness for controlling glucose metabolism through fermentation were also reported for soy bean [2, 16]. solid state fermentation was predicted to improve the antidiabetic effect of mung bean via enrichment of antioxidants and phytochemicals. in this study, we have found that enhanced blood sugar regulation by a high concentration of fermented mung bean may be contributed by the enriched gaba content (7.6 fold) in the extract as compared to the nonfermented mung bean. the regenerative effect of gaba on islet -cell via activation of pi3-k/akt-dependent growth and survival pathways had been reported by soltani et al. and tian et al. free amino acids (13 fold increase in fermented mung bean) had also been reported as an effective oral supplement for diabetic patients. among the tested free amino acids, lysine which recorded a marked increase in the fermented mung bean (0.001 g/100 g dry weight of nonfermented mung bean and 0.134 g/100 g dry weight of fermented mung bean) (result not shown) had also been reported as being an enhancer to the insulin-receptor tyrosine kinase activity in type ii diabetic patients. these free amino acids or more specifically lysine may contribute synergistically with gaba to regulate the blood glucose of the fermented mung bean-extract treated diabetic mice. elevated serum lipid profile including cholesterol, tg, ldl with low hdl level is one of the pathogenesis of diabetes that also representing the risk factor for coronary heart disease. in this study, alloxan-treated diabetic mice was observed with high serum cholesterol, tg, and ldl when compared with normal mice. treatment with m. charantia, fermented and nonfermented mung bean extracts were able to reduce the risk factors for coronary heart disease by restoring the healthy lipid profile in the alloxan-induced diabetic mice. other than a higher lipid profile, the serum of diabetic patient was also indicated with higher level of mda and oxidative stress [22, 23]. fermentation was able to improve the in vitro antioxidant and phenolic contents of mung bean. this effect may contributed greatly to the reduction of the mda level of the fermented mung bean extract (1000 mg/kg body weight) treated diabetic mice. besides, our results also showed that fermented mung bean extract was able to reduce the nitric oxide (no) level in the serum of the alloxan-induced diabetic mice in a dosage dependent manner. where ethanolic extract of mung bean showed anti-inflammatory effect and reduced no synthesis in a macrophage cell line. thus, the significant reduction of no by a high concentration of fermented mung bean extract may indirectly help to reduce the damage of -cell. in this study, fermented mung bean extract further improved the antihyperglycemic effect of nonfermented mung bean extract in both glucose and alloxan-induced hyperglycemic mice. this effect may be due to the improvement of the gaba and free amino acid contents through the fermentation process. investigating on the details mechanism of fermented mung bean's antihyperglycemic effect are still on-going.

mung bean was reported as a potential antidiabetic agent while fermented food has been proposed as one of the major contributors that can reduce the risk of diabetes in asian populations. in this study, we have compared the normoglycemic effect, glucose-induced hyperglycemic effect, and alloxan-induced hyperglycemic effect of fermented and nonfermented mung bean extracts. our results showed that fermented mung bean extracts did not induce hypoglycemic effect on normal mice but significantly reduced the blood sugar levels of glucose- and alloxan-induced hyperglycemic mice. the serum levels of cholesterol, triglyceride (tg), and low-density lipoprotein (ldl) were also lowered while insulin secretion and antioxidant level as measured by malonaldehyde (mda) assays were significantly improved in the plasma of the fermented mung bean-treated group in alloxan-induced hyperglycemic mouse. these results indicated that fermentation using mardi rhizopus sp. strain 5351 inoculums could enhance the antihyperglycemic and the antioxidant effects of mung bean in alloxan-treated mice. the improvement in the antihyperglycemic effect may also be contributed by the increased content of gaba and the free amino acid that are present in the fermented mung bean extracts.

PMC3469204

pubmed-843

in numerous industrial countries, cerebro-vascular accident (cva) has been the third common cause of death after coronary arteries diseases (cad) and cancers. several studies have indicated that higher levels of inflammatory biomarkers such as c-reactive protein (crp) and interlukin-6 (il-6) have been associated with worsening ischemic events. crp is a systemic inflammatory marker that is produced in a large amounts by hepatocytes in response to il-1, il-6 and tnf factor. rapid induction of crp, its long half-life (19 hours) and lack of alteration during day and night in comparison with other acute phase reactants has introduced crp as an important factor for evaluation in inflammatory and infectious diseases. nowadays, crp is a confirmed diagnostic marker for the patients with cva and recent prospective investigations showed that crp is clinically helpful for predicting the risk of the next cardiovascular diseases. although many studies have been conducted on association of crp and cardiac diseases; only few studies have evaluated its role in predicting mortality in stroke patients. in addition, it can be used as biomarker at early phases in diagnosis of stroke, determining prognostic value of therapeutic programs and secondary prevention strategies. in this study, we intended to evaluate association of crp as an inflammatory marker with acute cerebral ischemic attack characteristics, risk factors and to determine a cutoff point of hs-crp in predicting early mortality. this study was conducted on 200 patients with impression of stroke who had been referred to emergency ward of university hospital, imam khomeini hospital, tehran, iran, within may 2009 march 2011. patients who had referred earlier than 24 hours after ischemic stroke were enrolled in the study. 38 patients with body temperature higher than 37.8 c, hemorrhagic stroke and those with previous inflammatory or malignant diseases were excluded. medical history was taken from the patient or his/her relatives if the patient was unconscious or not able to speak. patients were evaluated for age, sex, diabetes, hyperlipidemia, ischemic heart diseases, smoking and past history of stroke or hypertension. routine laboratory tests, brain magnetic resonance imaging (mri), transthoracic echocardiography (tte) and carotid doppler ultrasonography were done in all of the patients. national institutes of health stroke scale (nihss) was used for assessing stroke severity. type of stroke was determined based on toast (trial of org 10172 in acute stroke treatment) classification. it is able to demonstrate various types of acute ischemic stroke with different etiology and is consisted of 5 sub-groups: large-vessel atherosclerosis, cardioembolic, small-vessel occlusion or lacunar, undetermined etiology, and non-atherosclerotic determined etiologies. another sample for specific tests was stored in room temperature for 20 minutes until clotting. serum was stored in -70 c and sent to heart center hospital of tehran university of medical sciences and hs-crp concentration was determined by turbidimetry method and roche kit (manufactured in swiss) with using cobaf apparatus (model integra400 +). usa) using chi-square test and student's t-test for univariate analysis and mantel hansel analysis for multivariate analysis. receiver operating characteristic (roc) curve was drawn for demonstrating cut off point of crp for predicting patients mortality within the first week of admission. they had been referred to emergency ward of imam khomeini hospital within may 2009march 2011. mean age of the patients was 67 12 years with a range of 33-95 years. patients were classified into 3 age groups: 11 patients were younger than 50 years (6.8%), 81 cases were 50-70 years (50%) and 70 patients were older than 70 years (43.2%). clinical demographic evaluation showed hypertension in 77 (47.5%) patients, diabetes in 50 (30.9%), hyperlipidemia in 56(35%), history of cardiovascular diseases in 46(24.8%), history of previous cva in 33(20.4%) and cigarette smoking in 67(41.4%) patients. mean of nihss score was 9.5 8 (min 1 and max 30). according to nihss score, our patients were classified to 3 sub-groups: nihss score<7 (mild neurologic disorders), nihss score 7-13 (moderate neurological disorders) and nihss score>13 (severe neurological disorders). according to toast classification criteria, large vessel atherosclerosis was seen in 95 subjects (58.6%), cardioembolic in 11 (6.8%) and small vessel occlusion in 56 patients (35%). regarding roc curve analysis, appropriate cut-off point for predicting patients short time mortality was determined as 2.15 in this study. in addition, nihss>10 was considered as appropriate score for predicting patients short-term mortality (fig. roc curve of variables for predicting mortality in the patients with stroke association between hs-crp and early mortality in the patients with acute cva was significant. mean of crp in died patients was 8.9 7 mg/dl and in survived patients was 2.2 5 mg/dl (p=0.0001). the hs-crp amounts showed a significant association with early mortality, diabetes, ihd (ischemic heart diseases), smoking and nihss. incidence of early onset mortality based on sub-groups of evaluated demographic variables in the investigated patients with acute ischemic stroke nihss: national institutes of health stroke scale; rr: relative risk; crp: c-reactive protein after multivariate analysis and adjusting for sex, age, history of heart disease, nihss score and toast, we found hs-crp as an independent factor in predicting early onset mortality. significantly increased rate of mortality by 13.3 times was seen in patients by simultaneous crp>2.15 and nihss>10 as cut-off points for predicting mortality, so that out of 23 patients possessing these conditions 11(47.8%) died. in the patients who had simultaneously crp>2.15, neurological defect severity was more than 10 and diabetes and mortality rate increased about 19 times; so that out of 13 patients possessing these conditions, 10(76.90%) died. therefore, co-existence of these three factors in a patient may strongly increase the risk of mortality. determinant criteria for mortality risk in the patients with cva and comparing them with each other are summarized in table 2. comparing of multivariate factors with early death in the patients with stroke nihss: national institutes of health stroke scale; rr: relative risk; crp: c-reactive protein the results of present study showed that hs-crp in the patients with acute ischemic cva who had died within the first week after manifesting symptoms was significantly higher than survived patients. in addition, hs-crp levels more than 2.15 mg/dl were considered as cut-off point for predicting mortality in this study. in addition, a large number of previous studies have reported that increasing crp at the first hours after stroke was associated with risk of mortality. montaner et al. introduced crp as a powerful factor for predicting mortality after cva. ischemic damage to brain resulted in disturbance in neuroglia activity especially astrocytes adhered to endothelial. therefore, these cells release cytokines and inflammatory factors that resulted in neuron necrosis and vessels endothelial permeability. at the same time by impaired blood brain barrier (bbb) permeability, neutrophils by exiting through endothelial cells, enters into tissues and increase inflammatory markers concentration. as a consequence, it is considerable that numerous articles recommend application of nihss system for more accuracy in stroke severity. cut-off point of>10 for nihss was shown in present study that in combination with an elevated crp>2.15 was associated with 13 times increase in mortality. similarly, studies performed by basic et al. and shenhar et al. showed association of nihss and increase in inflammatory factors. neurological defect severity and its association with elevated crp were shown in ischemic cycles so that more ischemia resulted in more neurological defect severity. among 16 dead cases, 14 (30.4%) patients had history of heart diseases and significant association was seen between hs-crp and mortality in relation to ischemic heart disease. in addition, a meta-analysis study indicated that crp is directly associated with ischemic heart diseases, stroke and mortality risk. time of hs-crp evaluation was a determining factor in early predicting mortality in this study. maximum of plasma crp concentration has been usually reported within 36 to 48 hours after initiating signs of stroke. a study by winbeck et al. showed that the most appropriate time for obtaining blood samples was 12-24 hours after initiating signs and can predict the risk of cardiac and cerebral vascular events. in the present study, this study showed that there was a direct association between hs-crp and mortality within the first week after stroke. cut-off point of crp was 2.15 mg/dl and measuring hs-crp within the first hours after stroke increase the predicting rate of early mortality risk. as up to now, a blood biomarker that can introduce accurate information about cause and outcome after stroke has not been known yet, cut-off point of hs-crp can be used for therapeutic decision making.

backgroundhigh sensitive c-reactive protein (hs-crp) is a systemic inflammatory marker that is produced in a large amount by hepatocytes in response to interleukin-1 (il-1), il-6 and tumor necrosis factor after ischemic stroke. methodsmeasurement of hs-crp in the first 24 hours of onset in 162 patients suffering from ischemic stroke was done. relation of crp with the risk of early mortality, national institutes of health stroke scale (nihss), stroke subtypes and other factors was determined. resultsregarding to roc curve analysis, appropriate cut-off point for predicting patients short time mortality was equal to 2.15 mg/dl in this study. significantly increased rate of mortality by 13.3 times was seen in patients with simultaneous crp>2.15 mg/dl and nihss>10. conclusionthe result of this study showed that there is a direct association between hs-crp and mortality within the first week after stroke. measuring hs-crp within the first hours after stroke increases the predicting rate of early mortality risk with cut-off point of 2.15.

PMC3829262

pubmed-844

the replacement of missing anterior teeth presents challenges to the prosthodontist regarding esthetics and function. implant supported prosthesis for missing anterior teeth are increasingly finding acceptance in the present day treatment options. the morphology of existing bone in the premaxilla often dictates that implants be placed at angles that are difficult to restore with conventional (0) abutments. angled implants are often used in single tooth replacements in the anterior region of the maxilla, distal extension cases in the maxillary and/or mandibular arch, overdentures in the edentulous maxilla and occasional anatomic problems for placement of straight implants. however, the angulated abutments might transfer unfavourable forces to the implant or bone, thereby compromising the prognosis of the treatment. the angulation of the implant abutments is one of the many biomechanical variables involved in implant dentistry. during the prosthetic phase, in order to have a well-designed, functioning and esthetic supra-structure, angulated abutments are used. however, due to a change between the long axis of the supra-structure, and the implant, the stresses generated in response to the masticatory or vertical load may be different in type, magnitude and direction. this may result in resorption of the bone at the cervical cortical region or loss of osseointegration. there is surprisingly little information in the available literature regarding the clinical success of angled abutments. hence, it was considered appropriate to undertake the study of stresses generated having different angulations to the long axis of the implant, under axial and oblique loading, by finite element modelling and analysis. because, it is difficult to assess the generated forces clinically, a finite element analysis was chosen for the present study as it is a useful tool in estimating stress distribution in the contact area of the implant with the bone. the three dimensional (3d) finite element analysis study was conducted in the post graduate department of prosthodontics, sardar patel post graduate institute of dental and medical sciences, lucknow-in collaboration with-lelogix design solutions private limited, greater noida, uttar pradesh using the software package solid works 2009 [figure 1a and 1b]. maxillary bone was modelled representing the frontal region of the maxilla with a cortical bone of 1.5 mm thickness enclosing cancellous core. implant was modelled as a cylindrical, round ended, 13 mm long with 4.1 mm diameter. abutment was modelled as 7 mm in height with a five degree occlusal taper [table 1]. finite element mesh was generated by a network of fine elements or nodes [table 2], [figures 2a-c] and then the mechanical properties of the material were assigned [table 3]. four different abutment angulations, respectively 0, 10, 15 and 20 were used. the magnitude of force in the axial loading was 100 n, 125 n, 150 n, 175 n, and 200 n. the oblique loading was kept constant at 50 n [figure 3]. the loading was based on the average axial/oblique loading observed in the natural dentition by different researchers. to prevent the movement of the model during loading, model of straight abutment (solid works 2009 software) model of angulated abutment (solid works 2009 software) list of parameters used in fea study number of elements and nodes modelled for the bone mesh of cortical bone mesh of cancellous bone material properties used in finite element analysis directions of load application (axial and oblique) the implant was placed in the section of the bone and the 0 abutment was placed onto it, and the von misses, compressive and tensile stresses were calculated. similarly, in the second and third and fourth groups, 10, 15 and 20 abutments were used on the same implant configuration and the same load was applied to the implant [tables 4 and 5], [figure 5a and b]. compressive stress and tensile stress under axial loading compressive stress and tensile stress for 50 n force under oblique loading compressive stress and tensile stress for 200 n force at 0 degree axial loading compressive stress and tensile stress for 50 n force at 45 degree oblique loading the most common complications in implant dentistry once the prosthesis is placed are bone loss, fracture of the occlusal materials or implant components. an implant, placed in improper position, can compromise the final result in esthetics, biomechanics and hygiene maintenance. the most compromising position for an implant is, when placed too far facially: phonetics, lip position and function are compromised. changing its angulation may have a bearing on the kind of loads transferred to the bone. this study was conducted to gain more insight into the influence of different angulated implant abutments on the stress distribution in the alveolar bone surrounding the implant both, under axial and oblique loading. the stresses can be evaluated by using one of the following methodologies: photoelastic methodstrain gauge analysisfinite element method/analysis. the finite element analysis is capable of providing detailed quantitative and qualitative data at any location within the mathematical model. the finite element analysis was chosen for the present study as it has proved to be a useful tool in estimating stress distribution in the contact area of the implant with cortical bone and around the apex of the implant in trabecular bone. the finite element analysis (fea) has been established as a standardized procedure for qualitative as well as quantitative assessment of the stress distribution in various structures. with the fea, the validity of the fea results depends on the precision, whether the geometry, the material proportion, the interface condition, support and loading are in accordance with the biomechanical reality and the mathematical modelling should be verified by actual experiment in order to verify the findings of the result. in the results the negative values assigned were that of the compressive stresses and positive for tensile stresses. a similar study was done by celland et al. in which axial loading of 178 n only was used. their results could be compared with the findings of the current study for 200 n axial loading since; it is nearest to the loading conditions used in the current study [figure 6a and b]. it was observed that the maximum compressive stresses for 20 abutment were about 3.271 mpa in the present study whereas their value was about 5.0 mpa. for tensile stresses their observed value was about 2 mpa as compared to the value of approximate 6.833 mpa in the current study. the slight variation could be attributed to the change in geometry, amount of loads applied and difference in the bone density. on comparing the location of stresses it was seen that as the abutment angulation increased from 0 to 20, the concentration of stresses shifted to the cortical bone which was a consistent finding in both the studies. it was seen that there was an increment in compressive stress in proportion to the force being used and the changes were statistically significant whereas in case of tensile stress, though an increment was observed on increasing the force, this was not a proportional or significant change. on analysis of the results it was seen that as the abutment angulation is increased there is an increase in stresses, both tensile and compressive. however the magnitude of tensile stresses under oblique loading was found to be the greatest of all. on assessing the location of these peak stresses as the angulation changes it was observed that the peaks were located in the region of cortical bone. on taking the physiological limit of bone to be 170 mpa for compressive stress and 100 n for tensile stress for compact bone and 2 to 5 mpa for both compressive and tensile stresses in trabecular bone.. only high levels of oblique loading for abutment angulations 20 were seen to be exceeding these limits. in general however, the component of oblique load should be kept to a minimum while designing restorations, as these forces were seen to be the ones which could be detrimental to the maintenance of bone around implants. 200 n force under axial loading 20 abutments (front view) 200 n force under axial loading 20 abutments (top view) though the location and magnitude of stresses generated in response to the load applied in the study are pertaining to the finite element model design of the study, yet limitations of modelling assumptions should also be considered as the nature of the material used for the study model as well as the static loads applied in the current study may vary from the heterogenous nature of the bone and dynamic chewing forces generated clinically. hence, further research using 3d fea combined with long term clinical evaluation is encouraged. on the basis of the observations, of a three dimensional finite element analysis to access stress pattern in different abutment angulations, it can be concluded that though the compressive and tensile stresses generated through axial and oblique loading increase as the abutment angulation increases yet they are within the tolerance limits of the bone. however, care should be taken while planning a restoration so as to minimize the oblique component of force.

introduction: the replacement of missing anterior teeth presents peculiar challenges to the prosthodontist. implants are increasingly gaining favour for the same. the morphology of existing bone in the premaxilla often dictates that implants are placed at angles that are difficult to restore with conventional abutments. however, the angulated abutments might transfer unfavourable forces to the implant or bone, thereby compromising the prognosis of the treatment. because, it is difficult to assess the generated forces clinically, a finite element analysis was chosen for the present study as it is useful tool in estimating stress distribution in the contact area of the implant with the bone. materials and methods: in this study, the frontal region of the maxilla was modelled with a cortical layer 1.5 mm thick containing an inner cancellous core. the implant was cylindrical, round ended, with length 13 mm and diameter 4.1 mm. the abutment was modelled as 7 mm in height with a 5 degree occlusal taper. the different abutment angulations used were 0, 10, 15 and 20. the amount of loads used were 100, 125, 150, 175 and 200 n axially, and 50 n in oblique direction, to approximate the kind of loads seen in clinical situations. result:it was seen that, as the abutment angulation changes from 0 to 20 both the compressive as well as tensile stresses increased; but, it is within the tolerance limit of the bone. conclusion:it seems reasonably safe to use angled abutments in anterior implant supported prostheses, in the maxillary arch.

PMC3800384

pubmed-845

bone marrow cells from all 13 mice transplanted with single cd150 hscs gave rise to hematopoiesis after secondary transplantation (morita et al., 2010). in contrast, only a minority of single cd150 or cd150 hscs gave rise to significant hematopoiesis in secondary recipients (morita et al. these findings dovetail with data demonstrating (with an entirely different hsc enrichment strategy) that cd150 expression predicts successful repopulation of secondary recipients (kent et al., 2009). 2008) about whether cd150 hscs exist into perspective and suggest that the answer is to some degree arbitrary. a proportion of hscs lacking cd150 meet the conventional criteria for hsc activity in primary recipients, but these cells largely lack durable self-renewal in secondary transplant assays. morita et al. (2010) further demonstrate that single cd150 hscs display robust myeloid reconstitution potential upon transplantation, whereas cd150 hscs mediate only faint myeloid, but superior lymphoid, reconstitution; these patterns appeared stable in secondary transplantations. recently, three other groups independently reported similar findings, even though the enrichment strategies for hscs were quite dissimilar except for the use of cd150 (kent et al., 2009; 2009) examined lymphoid versus myeloid reconstitution patterns associated with the absence or presence of cd150 on hscs (defined as cd45epcrcd48; kiel et al. 2006) and report a strong predominance of myeloid or lymphoid reconstitution after transplantation of cd150 or cd150 cells, respectively. challen et al. (2010) demonstrated that myeloid and lymphoid-biased hscs can be purified based on hoechst dye efflux in combination with the absence of lineage markers and the presence of sca-1 and c-kit; further separation of these hscs based on cd150 expression enhanced discrimination of the lineage bias. (2010) used an hsc isolation strategy similar to that used by nakauchi s group and detected the same lineage bias associated with cd150 expression. interestingly, this study revealed that the proportion of cd150 hscs strikingly increases with aging, whereas the proportion of cd150 or cd150 hscs strikingly diminishes with aging, suggesting that the well documented aging-related compromise of lymphopoiesis (sudo et al., 2000; rossi et al., 2005) is not caused by loss of lymphoid potential by a homogeneous population of stem cells, but rather by expansion of hsc populations with predominantly myeloid potential (beerman et al., 2010). this model is also supported by recent experiments using limiting dilution transplantation of total bone marrow (cho et al., 2008). collectively, these data suggest that the output of different blood cell types by the hematopoietic system may be influenced by a balance of coexisting stem cell populations with different lineage propensities. the proportions of different stem cells appear to impact the final composition of differentiated blood cell populations even before the separation of distinct lineages occurs (fig. if different hsc populations coexist, an important question is whether they exist in a hierarchy. in principle, the different populations might be able to convert into each other, or they may derive from a parental stem cell that may or may not persist into adulthood (challen et al., 2010). (2010) demonstrate that cd150 hscs can give rise to cd150 hscs (themselves), as well as to cd150 and cd150 hscs after transplantation, but that cd150 and cd150 hscs fail to give rise to cd150 hscs. thus, cd150 hscs represent the top of the hierarchy. yet, it is unclear at this point whether cd150 hscs continuously replenish cd150 and cd150 hscs during the steady state in adult bone marrow. (2009) demonstrated that cd150 hscs (lineage markerc-kitsca-1cd48) turn over almost as slowly as cd150 hscs. hence, it is possible that this population can be maintained for long periods of time, even with limited self-renewal capacity. during normal aging, cd150 hsc populations expand while cd150 hsc populations diminish, suggesting that they are differentially regulated (beerman et al., 2010). more directly, this notion is supported by the demonstration that lineage-biased hsc subtypes respond differently to transforming growth factor-1 (challen et al., 2010). deciphering the regulation of different hsc populations and investigating their potential cross talk is an important task for the future. cd150 hscs harbor an impressive capacity to reconstitute the lymphoid system (kent et al., 2009; however, their partially preserved self-renewal and the absence of expression of flt-3 clearly distinguish cd150 hscs from the first known major stage of lymphoid differentiation, the lymphoid-primed multipotent progenitor (lmpp; adolfsson et al., 2005). supporting a close developmental relationship between cd150 hscs and lmpps, cd150 hscs give rise to lmpps after transplantation much more efficiently than cd150 hscs (beerman et al. in addition, cd150 hscs harbor diminished erythroid-megakaryocytic potential in vitro (morita et al., 2010). this is intriguing because loss of erythroid-megakaryocytic potential, even if controversial (forsberg et al., 2006), was described as a hallmark trait of lmpps (adolfsson et al. thus, it appears that self-renewal is not always entirely extinguished during the initial steps toward lineage differentiation. (2010) suggests that the cd150 hsc population is still heterogeneous. in the future, first, some stem cells appear to exclusively give rise to myeloid cells and, nevertheless, are capable of repopulating secondary hosts. second, up to 10% of cd150 hscs represent latent stem cells, which did not give rise to detectable progeny for at least 3 mo after transplantation, and then produced only low levels of myeloid reconstitution in the primary host. the authors speculate that latent hscs may overlap with recently described highly quiescent label-retaining hscs (wilson et al. such label-retaining hscs, like latent hscs, exhibited much stronger reconstitution activity after secondary transplantation (wilson et al. single-cell transplantation of label-retaining hscs will be necessary to definitively clarify their overlap with latent hscs. whether or not they are quiescent, the existence of the latent reconstitution patterns demonstrates that not all hscs contribute to blood formation at all times. this observation is reminiscent of retroviral marking experiments, which suggested that hematopoiesis at any given time is sustained by only very few clones (lemischka et al., 1986 these experiments support a clonal succession model, in which most of the cells within the hsc pool remain quiescent, periodically releasing active clones to sustain blood production, as previously active clones exhaust their proliferative capacity. however, a clonal succession model was difficult to reconcile with data from chimeric mice made with different embryonic stem cell founders (harrison et al., 1987) that showed that hematopoiesis was sustained simultaneously by large numbers of hscs derived from different founder cells. nevertheless, the latter observations do not prove that all or even the majority of hscs produce blood at all times. it is tempting to speculate that latent stem cell behavior may be even more common in the nontransplanted host in the absence of stimulation from cytopenias resulting from myeloablative irradiation. it will likely be possible in the future to directly investigate such issues using conditional clonal genetic marking strategies that do not involve transplantation. at least in primary transplant recipients, latent hscs do not meet widely accepted operational criteria for hsc activity, which set the bar at a>1% contribution to myeloid and lymphoid progeny in the peripheral blood for 16 wk (morrison and weissman, 1994; miller and eaves, 1997; ema et al., 2005). as (2010) reasonably emphasize that current criteria for defining hscs may need to be reexamined. in fact, defining hsc activity based on peripheral blood analysis alone is also problematic for biological reasons. although granulocytes are short-lived so that their presence in the blood, indeed, indicates ongoing active cell production, the situation is much more complicated with blood b and t lymphocytes. conditional ablation of b and t cell production by time-controlled disruption of the recombination-activating gene-2 gene has shown that peripheral b and t lymphocytes are maintained for very long time periods, even in the absence of any new production (hao and rajewsky, 2001; bourgeois et al., 2008). for example, naive follicular b cells are only gradually lost, with a half-life of 4.5 mo, and some smaller b cell subsets remain stable indefinitely (hao and rajewsky, 2001). as a result, using 1% lymphoid reconstitution as a criterion may lead to considerable overestimates of hsc properties, particularly for hsc populations with predominantly lymphoid output. it is emerging that heterogeneous hsc populations in the bone marrow coexist and coordinately give rise to hematopoiesis. in combination with other markers, the slam family member cd150 allows for the prospective enrichment of hsc populations with distinct characteristics. high expression of cd150 appears to identify cells at the very top of the hematopoietic hierarchy, as it is correlated with high self-renewal and marks the only cells with the potential to give rise to themselves, as well as to all other stem cell populations after transplantation. absence or low expression of cd150 on hscs is associated with the acquisition of powerful lymphoid reconstitution potential. in the future, it will be important to further define the precise regulation, developmental relationships, and cross talk between different hsc populations, as well as to explore their role in disease.

hematopoietic stem cells (hscs) save lives in routine clinical practice every day, as they are the key element in transplantation-based therapies for hematologic malignancies. the success of clinical stem cell transplantation critically relies on the ability of stem cells to reconstitute the hematopoietic system for many decades after the administration of the powerful chemotherapy and/or irradiation that is required to eradicate malignant cells, but also irreversibly ablates patients own blood forming capacity. surprisingly, despite enormous efforts and continuous progress in the field, our understanding of the basic biology of hscs is still rather incomplete. several recent studies substantially refine our understanding of the cells at the very top of the hematopoietic hierarchy, and suggest that we may need to revise the criteria we typically use to identify and define hscs.

PMC2882834

pubmed-846

the surgical indication is difficult to establish in some cases (more than 40%). acute abdominal pain in women may be a manifestation of a disorder of various organs. in addition to surgical, urological, orthopedic, neurological, and psychogenic problems, gynecological causes play a major role. incarcerated herniation of the bowel, occurring through a defect in the broad ligament, is extremely rare. we herein report the 2 cases of women with intestinal obstruction, neither of whom had a previous history of any surgical pelvic treatment. the laparoscopic approach revealed in both cases an incarceration of the small bowel herniated through a defect in the broad ligament. without the antecedent of uterine surgery, delivery trauma, and pelvic diseases, congenital abnormalities are considered the causes of these defects although the real mechanism is unknown. this cause should therefore be considered in the differential diagnosis of female patients presenting with an intestinal obstruction who have not had a prior laparotomy. a 38-year-old gravida 1, para 1, woman was admitted to our hospital with a chief complaint of lower abdominal colicky pain and vomiting of 1 day's duration. her relevant past medical history included a laparoscopic appendectomy performed 7 years previously and a diagnosis, in the same setting, of endometriosis, since then successfully treated with medical therapy. laboratory findings showed slight leucocytosis, and a plain abdominal radiograph showed some loops of dilated small bowel with air fluid levels. ultrasonography confirmed the small bowel obstruction and disclosed the presence of fluid in the pelvis. with the diagnosis of intestinal obstruction of unknown origin because abdominal distension was moderate, a laparoscopic approach was performed with 3 trocars, instruments, and optics 5-mm in diameter. a 30-cm long ileal loop was found to have herniated through a defect in the right broad ligament. a 23-cm defect was noted, and it was closed by using a purse-string 2/0 monofilament absorbable suture. the postoperative course was uneventful, with bowel movement and hospital discharge on the first and fourth postoperative days, respectively. a 55-year-old gravida 2, para 2 woman was admitted to our department with symptoms of colicky pain and nausea but no vomiting for the previous 2 days. most notable, she had no history of prior abdominal or pelvic surgery or pelvic inflammatory disease. on examination, as with the previous case, a plain abdominal radiograph showed some loops of dilated small bowel with no air fluid levels. ultrasonography confirmed the small bowel obstruction and disclosed the presence of fluid in the pelvis. due to a diagnosis of intestinal obstruction of unknown origin, the patient was taken into the operating room and a laparoscopic approach was used in the same manner as the case described above. a 20-cm long ileal loop was found to have herniated through a fenestration of the left broad ligament. as above, the small bowel, once reduced, appeared vital, and a defect of 13 cm was seen and closed by using a purse-string monofilament absorbable 2/0 suture. the postoperative course was uneventful, with bowel movement and hospital discharge on the first and third postoperative days, respectively. surgeons treating a patient with lower abdominal pain of uncertain origin are caught between the extremes of conservative and operative treatment. after clinical examination and ultrasonography, exploratory laparoscopy has been shown by several studies to solve this therapeutic dilemma. a corollary to the application of diagnostic laparoscopy is the potential for therapeutic manipulation during the same setting. internal hernias represent only 0.4% to 4.1% of all small bowel incarcerations, and of these, the hernias through a defect of the broad ligament represent only 4% to 7%. regarding their cause, they are thought to be either congenital or acquired. the congenital ones are a consequence of a spontaneous rupture of congenital cystic structures within the broad ligament reminiscent of the mesonephric or mllerian ducts. this hypothesis could account for those patients who are nulliparous or have never undergone pelvic surgery. an acquired defect may result from either operative trauma, pregnancy and birth trauma, or prior pelvic inflammatory disease. they have therefore been frequently reported in multiparous patients, patients who have undergone a surgical pelvic procedure, and patients with a history of salpingitis or endometriosis. one of our patients had only a history of multiple pregnancies and deliveries, and the other patient with endometriosis had an appendectomy. a classification of broad ligament defects has been proposed based on their anatomical position: type 1 defect, which occurs throughout the entire broad ligament; type 2, which occurs throughout the mesosalpinx and the mesovarium; and type 3, which occurs throughout the meso-ligamentum teres. plain film radiography because of its low sensitivity and specificity helps little in the diagnosis of most causes of abdominal pain due to gynecological disorders. other radiological investigations, such as either ultrasonography or ct scan, or both used together, are expensive and not possible to perform in all hospital situations, 24 hours a day. diagnostic laparoscopy, with an accuracy of more than 90% has been demonstrated to be superior to other diagnostic tools and may lead to the correction of an erroneous preoperative diagnosis in up to 40% of patients, or it may be used to exclude other pathologies. a corollary to the application of diagnostic laparoscopy is the potential for therapeutic manipulation during the same setting, which has been reported in the literature to be more than 80%. the goal of surgical treatment includes reduction of the intestinal loop (its resection, if needed), and direct closure of the opening to avoid any recurrence. only one report exists in literature, to the best of our knowledge, of a pathology totally diagnosed and treated by using laparos-copy. for more than 10 years, we have been using laparoscopy routinely in both scheduled and emergency situations, if no absolute contraindication to the technique is present. in both cases reported herein, the laparoscopic approach was possible to perform due to the mild intestinal gas distension. intestinal resection was not necessary, and we closed the opening of the broad ligament with a purse-string absorbable suture. early diagnosis and, if possible, therapeutic laparoscopy is cost-effective in many scenarios dealing with managing nonspecific acute (low) abdominal pain, especially in women of reproductive age. thus, the following is perfectly applicable to the 2 cases we have report herein: both were rare gynecological pathologies causing small bowel obstruction that were diagnosed and treated in the same setting with good results and perceptions of the patients. we do think that laparoscopy is not an alternative to physical examination and conventional noninvasive diagnostic methods in any acute abdominal situation. however, it must be considered an effective option in patients in whom these methods fail, especially as surgeons become more experienced and skilled.

two cases of internal herniation through a defect in the broad ligament of the uterus are described. both were successfully treated laparoscopically. this rare condition should be borne in mind when a middle-aged woman presents with colicky lower abdominal pain. the cause is unknown, but both congenital and acquired origins have been proposed. as far as emergency situations are concerned, laparoscopy has proven to be both a diagnostic and a therapeutic tool.

PMC3015715

pubmed-847

hypertension (htn) is a medical condition that is characterized by high or uncontrolled blood pressure. inadequate control of htn can lead to more serious vascular conditions affecting the major blood vessels in the heart, brain, and body. additionally, htn and diabetes mellitus (dm) frequently coexist, which further increases the risk of developing vascular complications. hypertension is a major risk factor for vascular disease including heart attacks and strokes. in 2008, of those 17.3 million vascular-associated deaths, 6.2 million were due to strokes. it is predicted that, by the year 2030, an estimated 23.3 million will die from stroke and heart disease. addressing risk factors that contribute to htn may help prevent vascular complications. according to the world health organization (who), complications of htn such as strokes account for 9.4 million of the astounding 17 million vascular-associated deaths. another consideration is the financial burden of htn; according to the centers for disease control and prevention (cdc), the annual cost of htn treatment was 131 billion dollars. the physical and financial burdens of htn are not unique to any one group of individuals. however, it has been well documented that african americans (aas) have a disproportionate burden of morbidity and mortality compared to caucasians. data collected from 2008 suggest that non-hispanic blacks accounted for 31.7% of the 59.4 million people with htn, whereas non-hispanic whites accounted for only 26.8%. despite research and interventions to decrease both the physical and financial burdens of uncontrolled htn, specifically in the aa population, provider-centered barriers are the focus of this study and include limited patient-provider communication regarding lifestyle changes, lack of adherence to established guidelines for htn management, and resistance to change. in addition, systems barriers were assessed and include access to care, medication costs, and lack of healthcare coverage. racial disparities related to geographical areas in healthcare lead to disproportionate mortality and morbidity in rural areas. healthcare disparities such as ethnicity, poverty, and access to care are all associated with rurality and contribute to the higher incidence of htn in aas. for example, barriers to healthcare in rural communities include transportation, lack of health insurance, and lack of healthcare facilities and providers, all of which contribute to limited access to healthcare. as a result, rural communities have a higher incidence of chronic diseases such as htn and have poorer outcomes. as previously mentioned, a major problem for rural communities is access to healthcare. improving access to healthcare for rural america the national rural health association has developed a timeline for the affordable care act, which is designed to address the issues pertaining to access to healthcare. provisions on the timeline include workforce improvement, payment reimbursement, and requirement of the electronic health record requirements, to name a few. student loan repayment programs for those working in rural or underserved areas and improving medicare and medicaid reimbursement in rural practices are some specific provisions that have been implemented to improve access to healthcare in rural communities. the theoretical framework of avedis donabedian was used as a tool to guide this research. the three components that form the foundation of this theory are (1) structure of care, (2) process of care, and (3) outcomes. the concept is grounded on the principle of healthcare outcomes as a result of the medical care provided by medical professionals. describes structure of care as any process that relates to the organizational and physical aspects of care settings. a few specific examples of this process are facilities, equipment, and operational and financial processes supporting medical care. process of care is dependent upon the structures of care to supply resources and methods that are necessary for participants to carry out patient care activities. patient-provider communication, practice habits, and care management are all examples of process of care. further, the goal of process of care is to improve patient health by promoting recovery, patient survival, and even patient satisfaction. the final concept of this model, outcomes, is simply the patient outcomes based on medical health after the application of the two previous components. figure 1 depicts the components of donabedian's theory and how it is applicable to this study. a retrospective review of the emr was conducted to identify hypertensive aa patients in a rural clinic who were seen from july 1, 2014, to august 31, 2014. a descriptive, preexperimental, quantitative method was used to evaluate the degree of provider adherence to national htn guidelines in aas living in a rural community. inclusion criteria for the patients included (figure 2) (a) age 20 to 80 years, (b) aas with a diagnosis of htn, and (c) receiving antihypertensive medications. exclusion criteria included (a) specific end organ damage (i.e., ckd, stroke, cardiomyopathy, or myocardial infarctions), (b) age younger than 20 or greater than 80 years, (c) no office visits during research dates or office visits for reasons other than htn, (d) no established relationship with a single primary care provider (pcp), (e) diagnosis of medical nonadherence, (f) race other than aa, and (g) deceased patients. there are four primary care providers, one cardiologist, two pulmonologists, one neurologist, and one podiatrist. the primary source data were selected from the emr centricity developed by general electric healthcare. an emr is a digital or electronic version of a paper chart that contains the patient's medical history. a report was populated using the following criteria: (1) the practice site location, (2) race specified as black or african american, (3) birthdate on or after 01/01/1949 but before 01/01/1995, (4) appointment date on or after 07/01/2014 but before 09/01/2014, and (5) active international classification of diseases, ninth revision (icd-9) codes containing 401 for hypertension. the emr was reviewed to identify onset of htn if feasible, provider selection of antihypertensive drugs for initial treatment, and additional drug choices. htn was defined as a blood pressure 140/90 mmhg in the general population and>130/80 mmhg in hypertensive individuals with a comorbidity of dm in accordance with jnc 7 or patients taking antihypertensive medications. potential participants were consecutively recruited and a sample size of 62 participants met the inclusion criteria. other variables that were considered include the following antihypertensive drug classes: (a) thiazide diuretics, (b) angiotensin-converting-enzyme inhibitors (aceis), (c) angiotensin ii receptor blockers (arbs), and (d) calcium channel blockers (ccbs). jnc 7 (as cited in chobanian et al.) describes htn as a systolic blood pressure 140 mmhg or a diastolic blood pressure of 90 mmhg in the general population, including aas. if the patient has a comorbidity such as dm, a systolic blood pressure>130 mmhg and a diastolic blood pressure of>80 mmhg are considered suboptimal in the treatment of htn. the coexistence of htn and dm further increases the risk of vascular complications such as strokes and renal disease, which is why the optimal blood pressure goal is lower. diagnostic measurements for the classification of htn were performed based on jnc 7 guidelines (table 1). according to jnc 7, two consecutive readings in contralateral arms at least 5 minutes apart while sitting are categorized as htn. by auscultation, blood pressures were manually obtained by nurses using the appropriate size cuff with a sphygmomanometer. patients were in a seated position with feet on the floor and arm positioned at the level of the heart. a normal blood pressure is a systolic blood pressure of<140 mmhg and a diastolic blood pressure of<90 mmhg. stage 1 is a systolic blood pressure reading of 140 to 159 mmhg or a diastolic bp reading of 90 to 99 mmhg. stage 2 is classified as a systolic blood pressure 160 mmhg and a diastolic reading of 100 mmhg. in the general aa population, initial monotherapy with diuretics, specifically thiazide diuretics (tds), or ccbs should be used for stage 1 htn or a diuretic in combination with other drug classes for combination drug therapy regimen for stage 2 htn. jnc 7 recommends specialty referrals if blood pressure is not controlled after maximizing three medication classes, with one being a td. lastly, for those with compelling indications, such as those with a comorbidity of dm, aceis are recommended to reduce strokes and other vascular complications. with regard to follow-up, jnc 7 recommends a monthly follow-up office visit if blood pressure is not at goal and a follow-up office visit every 3 to 6 months if bp is at goal. laboratory values for potassium and creatinine should be obtained 1 to 2 times annually and patients with a comorbidity of dm should have their urine microalbumin levels measured at least annually. patients newly diagnosed with htn should have a urinalysis, blood glucose, hematocrit, potassium, creatinine, calcium, and lipid profile drawn prior to beginning pharmacological treatment. better outcomes have been found when lifestyle modification is incorporated into the plan of care. the following are the areas recommended for lifestyle modification: (a) weight loss, (b) following the dietary approaches to stop hypertension (dash) diet, which consists of a diet rich in fruit and vegetables, low fat dairy products, and reduced intake of saturated and total fat, (c) adhering to sodium restrictions, (d) regular physical activity, and (e) limiting alcohol consumption. statistical analyses were performed on the outcomes of blood pressure control in participants who were prescribed antihypertensive medications based on jnc 7 guidelines compared to those who were not and also on blood pressures that were at goal and those that were not. additionally, outcomes of provider adherence to the guidelines were measured based on adherence to medication choice recommendations, documented lifestyle modification recommendations, laboratory studies, and follow-up for patients with htn and htn with a comorbidity of dm. descriptive analysis was conducted using crosstabs, frequencies, and means comparison and reported as percentages to describe the results. crosstabs were used to determine the number of times the recommended combination of a thiazide diuretic was used in combination with an acei or arb. frequencies were conducted to identify the percentage of patients not prescribed a td or ccb as monotherapy. further, the use of means comparison was to compare differences in bp outcomes in patients prescribed aceis compared to tds as monotherapy. additionally, a chi square analysis was performed to determine if there is a relationship between provider adherence and blood pressure outcomes. physicians accounted for 64.5% (n=40) of the providers in this study. of the 29 patients with blood pressure at goal, a physician was the provider in 75.9% (n=22) of the office visits while nps provided care in 24.1% (n=7) of the visits. patient age was divided into 2 categories: less than 65 years and 65 years and older. the most frequent stage of uncontrolled htn was stage 1 accounting for 84.4% of the 32 patients. of those 16, 81% had stage 1 htn and the remaining 19% had stage 2 htn. in patients aged less than 65 years, 45.2% of the 31 patients had stage 1 htn and 12.9% had stage 2 htn. in the age group of 65 and over, stage 1 accounted for 41.9% of patients and stage 2 htn accounted for 3.2%. blue cross blue shield (bcbs) accounted for the second most utilized health insurance with 24.2% of the patients enrolled. medicaid, self-pay, and private insurances each accounted for 6.5% of the patients. of the 62 patients studied, 12.9% (n=8) were on monotherapy and 87.1% (n=54) were on combination therapy. combination therapy is described as taking two or more medications. those with a comorbidity of dm accounted for 53.2% (n=33) of the 62 patients. jnc 7 guidelines suggest that patients with a comorbidity of dm should take aceis to decrease morbidity and mortality. of the 33 diabetic patients, only 69.7% (n=23) were taking aceis as recommended. of the 54 patients taking combination therapy, 87% (n=47) were taking either a td or ccb. in the patients studied, 53.2% (n=33) of the 62 warranted medication adjustments as a result of uncontrolled blood pressure. only 15.2% (n=5) had medication adjustments, leaving 84.8% (n=28) inadequately treated. one patient (1.6%) required a referral to a htn specialist as a result of maximizing three different medication classes, including a td. that patient was not referred. in the eight patients on monotherapy, 37.5% (n=3) of them met their blood pressure goal despite not being on a td or ccb. of the 54 patients on combination therapy, 87% (n=47) were on a td or ccb as recommended by jnc 7. of those 47 patients, 55.3% (n=26) achieved goal blood pressures. a chi square test was used to determine if there is a relationship between being prescribed jnc 7 medication regimen and blood pressure outcomes. there was no significant relation between taking the recommended td or ccb and blood pressure control (= 0.0; p=0.99). the categories examined under lifestyle modifications included dash diet, weight loss, sodium restrictions, physical activity (pa), and alcohol consumption (see figure 3). only 6.5% (n=4) of the 62 patients had documentation of provider recommendations for the dash diet and alcohol consumption. weight loss, sodium restriction, and pa recommendations were documented in 82.3% (n=51) of the patients. jnc 7 recommends follow-up every 3 to 6 months if bp is controlled. providers were adherent to follow-up recommendations 96.6% (n=28) of the time in the 29 patients with controlled blood pressure. in the remaining 33 patients who required monthly follow-up due to uncontrolled blood pressure, providers were only 9.1% (n providers were adherent to obtaining laboratory tests prior to initiating treatment in 0% of the two patients with new diagnoses of htn. the adherence rate for biannual laboratory tests in patients with historical diagnosis of htn was 65% (n=39) of the 60 qualifying patients. in patients with a comorbidity of dm, providers were 15.2% (n=5) adherent to the guidelines in the 33 diabetic patients. endless and organized activities that result in measurable improvement in healthcare services and targeted patient outcomes have been described as qi. the us department of health and human services identified the 4 principles of quality improvement (qi) as (1) qi work as systems and processes, (2) focus on patients, (3) focus on being part of the team, and (4) focus on use of data. qi work as systems and processes refers to resources and activities that are carried out and are evaluated simultaneously to improve quality of care or outcomes. this study focused on the systems or structural components of systems barriers such as the rural setting the study was conducted in, emr structure, emr utilization, providers, and policy. activities assessed included provider barriers, access to jnc 7 guidelines, provider adherence to those guidelines, recommendation of lifestyle changes, laboratory assessment, and follow-up. outcome goals include decreasing the prevalence of uncontrolled htn in aas, decreasing cost associated with htn, increasing quality of life, and equity. this study was conducted to assess what is currently being done in this rural primary care setting to address the increased prevalence and mortality of htn in aas. using the methodical framework of donabedian, both quantitative (frequencies) and qualitative (descriptive) data were collected and analyzed to assess the current system and to identify areas for improvement. the national heart lung and blood institute (nhlbi) traditionally has endorsed previous versions. controversy surrounding the eighth report of the joint national committee (jnc 8) has led to nhlbi not endorsing jnc 8. the controversy surrounds the increased bp goal of<150/90 in patients aged>60 and a goal of<140/90 for those aged 18 to 60, including those having comorbidities of dm and ckd. jnc 8 guidelines were avoided for this study due to this controversy and its relatively new release. first, the first-line drug choice as monotherapy in the treatment of htn in aas should be tds or ccbs, as recommended by jnc 7. while there were only eight patients receiving monotherapy, none of them were on tds or ccbs, which indicates 100% nonadherence to the guidelines regarding monotherapy. in fact, the majority of the patients on monotherapy were on aceis, while the remaining were on arbs. however, studies have found that aceis and arbs are less effective in the aa population. these findings are consistent with the studies reviewed in the literature review for this study. whites had a greater systolic (mean difference of 4.64) and diastolic (mean difference of 2.82) reduction in bp compared to aas. in contrast, providers were more consistent with the guideline recommendations in aas on combination drug therapy. provider adherence was documented in 87% of the patients receiving combination therapy. one of the goals of a previous study was to determine provider adherence to national guidelines including a td in combination therapy in aas of nigerian decent. the majority (88.8%) of the study sample in addition, combination therapy was more effective than monotherapy in reducing both systolic and diastolic bp (32.64 mmhg compared to 15.43 mmhg and 18.56 mmhg compared to 6.96 mmhg, resp.). less than half of the 62 patients in this study have at goal bp readings at the level recommended by jnc 7 despite moderate provider adherence. similar findings were found in a previous study. provider adherence to the guidelines overall was 76%. mean bp values decreased but insignificantly concluding no correlation with provider adherence and attaining bp goals. in this study, additionally, provider adherence in prescribing aceis in patients with a comorbidity of dm was seen in 70% of the population. provider adherence to prescribing an acei or arb in patients with comorbidities such as dm was seen in 88% of the population. studies have shown that the use of aceis in this population decreases mortality and morbidity by decreasing end organ damage and cardiovascular incidents. lifestyle modification, as an adjunct to pharmacologic therapy, has been associated with better bp control. detailed recommendations for the dash diet and alcohol were only documented in 4 of the 62 emrs. adherence was high in the recommendations for physical activity, weight loss, and sodium restrictions. the smart plan is inclusive of these 3 recommendations, which was documented in 51 of the 62 patients. patient adherence with adequate office visit follow-up has been known to yield better bp control. jnc 7 recommends an office visit follow-up every 3 to 6 months in patients with bp at goal and monthly visits for those who are not at goal. provider adherence was evident in the 3-to-6-month follow-up population (97%). a monthly follow-up recommendation for those with uncontrolled bp uncontrolled bp can lead to end organ damage such as renal insufficiency or failure, heart attacks, or strokes. further, the medications used to treat htn can have adverse effects on other organs. jnc 7 recommendations include a urinalysis, blood glucose, hematocrit, potassium, creatinine, calcium, and lipids in patients newly diagnosed with htn before initiating therapy. due to the limitations of the emr, only 2 patients were identified as newly diagnosed. of these patients, neither of them had laboratory testing performed prior to starting treatment. for example, the finding of no documentation of patients receiving labs prior to the initiation of drug therapy may provide a greater impact and consistency in a larger sample size. secondly, the study was conducted during only the summer months and over a short duration. extending the study period and expanding the study to include fall or winter months may provide input for comparison to determine if seasons impact bp control. despite evidence-based recommendations by jnc 7, provider adherence in aas has room for improvement. provider pharmacologic choices and lifestyle modification recommendations are major components to blood pressure control in this population. ccbs are preferred over aceis because of the increased risk of stroke, myocardial infarctions, and other vascular conditions associated with aceis. better adherence in prescribing a td or ccb is seen in prescribing patterns for patients on combination therapy. providers are not adherent to the monthly follow-up recommendations required for medication adjustment or specialist referrals when bp is not at goal. lack of lifestyle modification documentation, specifically the dash diet and alcohol consumption, is consistent with nonadherence to the jnc 7 guidelines. although there appears to be no relationship between receiving the recommended medications and bp outcomes, more than half of the population did not meet bp goals. specific components impacting provider barriers include access to jnc 7 guidelines, provider adherence to jnc 7 guidelines, recommendation of lifestyle changes, and follow-up. lack of documentation, provider-prescribing habits, and lack of knowledge of up-to-date, evidence-based guidelines may be contributing factors. while there is a gap between evidence-based national guidelines and clinical practice to controlling htn, all contributing factors, including physician, patient, and systems barriers ,

purpose. to evaluate provider adherence to national guidelines for the treatment of hypertension in african americans. design. a descriptive, preexperimental, quantitative method. methods. electronic medical records were reviewed and data were obtained from 62 charts. clinical data collected included blood pressure readings, medications prescribed, laboratory studies, lifestyle modification, referral to hypertension specialist, and follow-up care. findings. overall provider adherence was 75%. weight loss, sodium restriction, and physical activity recommendations were documented on 82.3% of patients. dash diet and alcohol consumption were documented in 6.5% of participants. follow-up was documented in 96.6% of the patients with controlled blood pressure and 9.1% in patients with uncontrolled blood pressure. adherence in prescribing aceis in patients with a comorbidity of dm was documented in 70% of participants. microalbumin levels were ordered in 15.2% of participants. laboratory adherence prior to prescribing medications was documented in 0% of the patients and biannual routine labs were documented in 65% of participants. conclusion. provider adherence overall was moderate. despite moderate provider adherence, bp outcomes and provider adherence were not related. contributing factors that may explain this lack of correlation include patient barriers such as nonadherence to medication and lifestyle modification recommendations and lack of adequate follow-up. further research is warranted.

PMC4621359

pubmed-848

ms is a chronic progressive cns inflammatory disease, in which the autoimmune response against the cns myelin proteins leads to a chronic inflammatory response [1, 2]. during the inflammatory response, autoreactive t-cells migrate through the otherwise impermeable blood-brain barrier into the cns perivascular areas, where they cause demyelination and axonal degeneration. the chronic inflammatory response leads to neuronal conduction deficits associated with neurological symptoms and eventually results in the loss of functional neuronal tissue. several immunomodulatory and immunosuppressive therapies (ifn, glatiramer acetate, fingolimod, natalizumab, and mitoxantrone) are used in clinical practice as effective therapies in controlling disease activity and disability progression in patients with rr ms. th17-cells have been shown to play a critical role in the development of autoimmune responses in several autoimmune diseases, including ms, rheumatoid arthritis, psoriasis, juvenile diabetes, ulcerative colitis, and autoimmune uveitis [3, 4]. th17-cells are identified in the cns ms lesions, cerebrospinal fluid, and among the blood-derived mononuclear cells from ms patients, implying that they may play a critical role in the immunopathogenesis of ms [58]. our laboratory has identified increased numbers of th17-cells and an increase in the th17-cells ' master regulatory transcription factor, retinoic acid-related orphan nuclear factor (rorc), and cytokines that mediate th17-cell expansion in ms lesions. th17-cell frequency is approximately 7 times higher in the peripheral circulation of rr ms patients in comparison to healthy controls (hcs), and it positively correlates with the clinical disease activity. while multiple studies have reported on the association of th17-cells and autoimmune diseases, only several reports have provided a mechanistic data on the function of il-17a in the development of the autoimmune response. il-17a induces the secretion of cxcl1 and cxcl2, neutrophil-attracting cytokines, which attract those inflammatory cells into the cns in the early or acute phase of the disease. il-17a together with il-22 induces blood brain barrier permeability due to their effect on the endothelial cells. il-17a induces production of additional proinflammatory cytokines, including il-1 and il-6, and cytokines coexpressed by th17-cells, il-9, il-21, il-22, and gm-csf, also contribute to the development of the autoimmune response. socs proteins are a family of intracellular cytokine-inducible proteins, consisting of 8 members (cis and socs1-socs7). they have two structural components: an src homology domain (sh2), which is involved in phosphotyrosine binding to activated signaling molecules and a c-terminal socs box involved in the degradation of signaling molecules through the ubiquitin-proteasome pathway. socs gene expression is triggered by interleukins, interferons, haematopoietic growth factors, and tlr ligands such as lipopolysaccharides (lps) and cpg-containing dna [13, 14]. the induction of the socs proteins occurs through cytokine-mediated activation of the janus kinase/signal transducers and activators of the transcription (jak/stat) signaling pathway, which leads to the phosphorylation of the stat transcription factors. the socs proteins negatively regulate cytokine signaling through their association with phosphorylated tyrosine residues on jak proteins and/or cytokine receptors or by inhibition of stat binding to the cytoplasmic domain of the receptors. they terminate the inflammatory responses by mediating proteasomal degradation of the bound proteins [13, 15, 16]. among the socs family members, socs1 and socs3 have been described to play the most important role in the regulation of the autoimmune response. they block phosphorylation-dependent activation of stat1 in response to ifn-, or stat3 in response to il-6, and target the ifnr- and il-6r-signaling complexes for proteasomal degradation. interestingly, two recent large genetic studies have identified socs1 as one of the genes with the strongest association with the susceptibility for ms [18, 19]. among the available ms therapies, ifn and the recently introduced statins have been reported to exert their immunomodulatory effects through the induction of socs1 and socs3 in various inflammatory cell subsets. ifn and statins inhibit th17-cell differentiation directly and indirectly via their effects on antigen-presenting cells (apcs). in this paper, we will discuss their therapeutic effects in rr ms patients, which are indirectly mediated through the induction of socs1 and socs3 in monocytes, dcs, and b-cells as well as directly affecting the th17-cells. similar to th1- and th2-cells, the differentiation of th17-cells is orchestrated by cytokines secreted by apcs. the differentiation of mouse and human th1-cells occurs upon exposure to il-12 and ifn- and th2-cells upon exposure to il-4 and il-10, whereas the differentiation of mouse and human th17-cells differ in the required th17-polarizing cytokines [20, 21]. tgf- and il-6 are required in the mouse, while il-6, il-1, and il-23 drive human th17-cell differentiation [2224]. specific stat molecules are involved in the differentiation of each t-cell subset. th1-cells ' differentiation induced by ifn- and il-12 mediate activation of stat4 and stat1, which directly control the transcription factor t-bet. in the differentiation of th2-cells, il-4-induced stat6 phosphorylation is crucial for the gene transcription of the master regulatory transcription factor gata-3, whereas stat3 is pivotal in human and mouse th17-cell differentiation, where it is induced by il-6, il-23, and il-21. these studies have demonstrated a pivotal role of stat molecules in t-cell differentiation. stats ' regulation is critical for the cytokine secretion profile and the subsequent inflammatory t-cell responses. socs1 is induced by various cytokines, including ifn, ifn, il-4, and il-6 [27, 28], which activate the jak/stat signaling pathway. several studies have demonstrated that socs1 is induced by the tlr4 (lps) and tlr9 ligands (cpg-dna) [14, 29]. socs1 classically inhibits ifn signaling through association with the ifn- receptor 1 (ifnar1) and ifn- receptor (ifngr) subunits and suppression of ifn-induced stat1 and stat3 phosphorylation [3032]. in addition to ifn regulation, socs1 also inhibits tnf- signaling [14, 29]. socs1 deficiency leads to overresponsiveness to ifn-, whereas socs1 overexpression leads to a reduced responsiveness to ifn- in various cell subsets [31, 33, 34], implying that socs1 plays a negative regulatory role in ifn- signaling. socs3 is expressed in dcs, monocytes, t-cells and b-cells upon induction by il-2, il-3, il-6, il-12, il-23, ifn//, il-27, il-4, il-10, il-1, tgf, tnf-, gm-csf, and lps. socs3 expression is high in resting cd4 cells, but it rapidly decreases after t-cell receptor activation. earlier studies have reported that during t-cell differentiation, socs3 is selectively expressed in th2-cells, while socs1 expression is higher in th1-cells. high socs3 expression in transgenic mice led to skewing to th2 type differentiation, because socs3 binds to il-12rb2 and inhibits the il-12-mediated stat4 activation, therefore blocking th1-cell development. socs3 inhibits il-6 signaling by binding to the il-6 gp130 receptor complex and mediating its proteasomal degradation [36, 37]., stat3 induces the expression of the master regulatory transcription factor rorc and is, therefore, critical for the differentiation of human and mouse th17-cells [26, 38, 39]. a socs3 deficiency in nave t-cells leads to a sustained stat3 phosphorylation and results in higher frequencies of differentiated th17-cells. in addition, socs3 deficiency in t-cells is associated with enhanced il-17a production, induced by il-23 or il-6 plus tgf-. il-27 signaling can also induce socs3 via stat1 so that il-27 may block th17-cell development, as may type i and ii ifns, via sequential activation of stat1 and socs3, resulting in stat3 antagonism. monocytes, cd4 and cd8 t-cells were found to have a lower socs3 and increased stat3 expression during ms relapses. furthermore, socs3 suppresses the th17-polarizing cytokine il-1 and il-23 secretion by dcs and b-cells [43, 44]. socs3 is induced by several stimuli in apcs, where it plays an important role in the inhibition of th17 polarizing cytokines il-1 and il-23, which suppress stat3 activation required for the gene transcription of the master th17 cell regulatory transcription factor rorc. these studies suggest that socs3 induction may represent a beneficial therapeutic approach in patients with rr ms. ifn is an innate immune response cytokine that suppresses the disease activity and disability progression of rr ms and its animal model, experimental autoimmune encephalomyelitis (eae). earlier studies in mice and humans have demonstrated an association between an endogenous ifn deficiency and an increased susceptibility for eae and rr ms [45, 46]. in addition, the administration of exogenous ifn effectively reduced the clinical relapse rate and the formation of new cns lesions in several large placebo-controlled clinical trials. an increase in the th1 receptor il-12r2 expression and the secretion of the immunoregulatory cytokine il-10 [48, 49] were identified as the biomarkers of ifn's therapeutic effects. multiple proposed mechanisms of ifn's therapeutic effect include inhibition of antigen presentation, suppression of t-cell proliferation and migration, and modulation of proinflammatory cytokine production [48, 49]. more recent studies have shown that ifn effectively suppresses th17-cells differentiation in mouse and human. mice deficient for ifnar1 receptor and its downstream signaling molecules have been found to be more susceptible to eae [50, 51]. in addition, durelli et al. have demonstrated that ifn reduced the numbers of th17-cells in their longitudinal study of ifn-1a-treated rr ms patients. this finding has been supported by our in vitro experiments on the effect of ifn on human th17-cell differentiation, where we demonstrated that ifn suppresses th17-cell differentiation via its effects on monocytes, dcs, b-cells and nave t-cells [43, 44, 52]. monocytes, macrophages, dcs and b-cells induce human th17-cell differentiation through their secretion of il-1 and il-23. have reported an increased expression of il-23p19 in acute ms brain lesions, while vaknin-dembinsky et al. identified an increased synthesis of il-23 by dcs derived from ms patients [53, 54]. in our in vitro experiments, we found a decreased expression of il-1 and il-23, whereas il-12p35 and il-27 gene expression was increased in ifn-treated dcs. rr ms patients treated with ifn have been reported to have reduced il-23p19 gene expression in their peripheral blood mononuclear cells (pbmcs), a finding that is reinforced by our in vitro experiments showing that dcs and b-cells exhibited decreased il-23 secretion upon incubation with ifn [43, 44, 52]. we also demonstrated that the reduced secretion of il-1 and il-23 in supernatants (sns) from ifn-treated dcs led to a decreased differentiation of th17-cells. the addition of il-1 and il-23 and the blocking of il-27 in the sns from ifn-treated dcs and b-cells lead to a reversal of the ifn effect and an increase in th17-cell differentiation [43, 44]. in ifnar knock-out mice that are highly susceptible to eae, the eae is reversed with il-27 administration. these studies led us to conclude that ifn suppresses the th17-cell differentiation by inhibiting il-1 and il-23 and inducing il-27 secretion in dcs and b-cells as shown in figure 1. ifn is a potent inducer of socs1 and socs3, molecules that contribute to th17-cell differentiation [43, 55, 56]. we observed an increased expression of socs3 in ifn-treated dcs, which is induced through stat3 activation [43, 44]. several studies have reported that socs3 suppresses il-1 and il-23 expression [57, 58]. collectively, these reported in vitro and in vivo findings indicate that ifn suppresses the il-1 and il-23 expression through socs3 upregulation in dcs and b-cells [43, 44]. we found that b-cells from rr ms patients and hcs exhibit an increased socs1 expression upon ifn-induced stat1 phosphorylation. in vivo studies by liu et al. have demonstrated that ifn-1b treatment of rr ms patients inhibits the cd40 co-stimulatory molecule expression on b-cells. we further identified in our experiments that ifn inhibited cd40 expression on b-cells through the induction of socs1. stat1 inhibition with fludarabine leads to increased cd40 expression in b-cells and the reversal of ifn-1b's in-vitro effect [44, 55]. similar findings have been reported for the ifn-- and ifn--induced cd40 expression on macrophages. in a recent study, we have demonstrated that socs1 plays an important role in the regulation of b-cell cd40 expression and subsequently on their antigen presenting capacity. the t-cell proliferation decreased when ifn-pretreated b-cells were used as apcs and cocultured with the antigen-specific t-cells. in contrast, the proliferative response was reversed when the ifn-treated b-cells were simultaneously incubated with the stat1 inhibitor fludarabine. these results confirm the role of ifn-1b-induced stat1 phosphorylation and socs1 expression in the inhibition of the antigen presenting capacity of b-cells. in a recent study, tanaka et al. have demonstrated that the eae induction was reduced in mice with a t-cell-specific socs1 knockout, which differentiated into th1-cells, while the frequency of th17-cells was reduced. the socs1-deficient t-cells exhibited a sustained stat1 activation. in the absence of an socs1 inhibitory effect on ifn- signaling, nave t-cells not all rr ms patients respond to ifn therapy, and early identification of nonresponders is important to avoid irreversible disability progression. have recently demonstrated that monocytes from rr ms nonresponders have an increased baseline level of stat1 phosphorylation and ifnar1 expression compared to ifn-responders, which are identified by the suppression of clinical disease activity. the expression of socs1 and socs3 was similar in responders and non-responders, suggesting that these negative regulators of stat1 activation may be expressed but functionally deficient in non-responders. in summary the induction of socs1 in b-cells leads to cd40 suppression, whereas the induction of socs3 inhibits the gene expression of th17-polarizing cytokines il-1 and il-23. in nave cd45ra t-cells, ifn also induces socs3 which inhibits stat3 cell signaling and a subsequent expression of the th17-cell master regulatory transcription factor rorc. statins are selective inhibitors of 3-hydroxy-3-methylglutaryl (hmg)-coa reductase, an enzyme involved in the conversion of hmg-coa to mevalonic acid. statins have been widely used as cholesterol-lowering agents in the treatment of cardiovascular diseases. more recently, they have been found to have anti-inflammatory and immunomodulatory properties, since they inhibit dcs ' maturation and antigen presentation [62, 63]. the anti-inflammatory benefits of statins are related to their ability to reduce mevalonate and the mevalonate-derived isoprenoids farnesyl pyrophosphate (fpp) and geranylgeranyl pyrophosphate (ggpp). fpp and ggpp are involved in the posttranslational modification of small g-proteins. simvastatin may have a therapeutic potential in rr ms, since it has been demonstrated to decrease new cns lesion formation by 42% after six months of treatment in comparison to the baseline magnetic resonance imaging studies. we have also reported that nave cd45ra t-cells cultured with sns from simvastatin-treated monocytes decreased th17-cell differentiation. the simvastatin treatment of monocytes and dcs from rr ms patients and hc induced decreased expression of the th17-promoting cytokines il-1 and il-23 [66, 67]. we have also identified an increase in the socs3 expression in simvastatin-treated monocytes [68, 69]. statin-induced socs3 downregulates the expression of il-1 and il-23, creating a cytokine milieu that inhibits the th17-cell differentiation, as shown in figure 1. previous eae studies have indicated that statins shifted th1 cytokine (ifn-, il-12, and tnf-) to th2 cytokine production (il-4, il-5, and il-10). a more recent study has suggested that statins inhibit human th17-cells ' differentiation and the production of the th17 cytokines il-17a, il-17f, il-21, and il-22. huang et al. have demonstrated that statins block stat1 phosphorylation, which is crucial in ifn- signaling and th1-cell differentiation. socs3, a negative regulator of stat1 and stat3 activation, is increased in the statin-treated cells. statin-induced socs3 expression is proposed to downregulate the stat1 and stat3 phosphorylation during th1 and th17-cell differentiation, through which its therapeutic effect is mediated in rr ms. ifn and statins have been shown to be an effective treatment of rr ms. despite different mechanisms of action, both therapies target similar signaling pathways. ifn suppresses the differentiation of pathogenic th17-cells, through its effect on the cells of the innate system (macrophages, monocytes, dcs, and b-cells), by the inhibition of the th17-cell-promoting cytokines il-1 and il-23 via induction of socs3. in b-cells, ifn downregulates cd40 costimulatory molecule expression through the induction of socs1. statins lead to socs3 and socs7 expression in the innate immune response cells. in monocytes and dcs, socs3 inhibits il-1 and il-23 expression, which leads to an inhibitory cytokine milieu for the th17-cells ' differentiation. statins and ifn both induce the socs3 expression, which is crucial in the suppression of th17-cell differentiation and consequently for their therapeutic effect in rr ms. the available results have identified socs proteins as an attractive therapeutic target in autoimmune diseases. the designer socs-mimetic drugs have already been tested in an animal model of the cns inflammatory disease. tyrosine kinase inhibitor peptide (tkip), a short peptide socs1 mimetic, both prevented and treated active eae, thus representing a promising therapeutic approach that will likely be further pursued in clinical testing.

multiple sclerosis (ms) is an inflammatory demyelinating, presumably autoimmune disease of the central nervous system (cns). among the available ms therapies, interferon (ifn) and the recently introduced statins have been reported to exert their immunomodulatory effects through the induction of socs1 and socs3 in various inflammatory cell subsets. the socs proteins negatively regulate cytokine and toll-like receptors- (tlr-) induced signaling in the inflammatory cells. socs1 and socs3 have been reported to play an important role in the regulation of th17-cell differentiation through their effects on the cells of the innate and adaptive immune systems. ifn and statins inhibit th17-cell differentiation directly and indirectly via induction of socs1 and socs3 expression in monocytes, dendritic cells (dcs), and b-cells. due to their rapid induction and degradation, and socs-mediated regulation of multiple cytokine-signaling pathways, they represent an attractive therapeutic target in the autoimmune diseases, and particularly relapsing remitting (rr) ms.

PMC3206360

pubmed-849

pineal region tumors (prts) are a heterogeneous group of tumors that can be assigned to four main categories: germ cell tumors, pineal parenchymal tumors (ppts), glial cell tumors, and other miscellaneous tumors and cysts. prts, which are rare tumors, account for approximately 0.4-1.0% of intracranial tumors. ppts are even rarer, and approximately 30% of ppts occur in neoplasms of the pineal region. according to the world health organization (who) classification of tumors in the central nervous system, which was revised in 2007, ppts are subdivided into well differentiated pineocytoma (pc), ppt with intermediate differentiation (pptid), and poorly differentiated pineoblastoma (pb). a standard treatment strategy for these tumors various treatments from surgery or radiotherapy and chemotherapy alone or in combination have been applied. part of the tumor was initially removed through surgery followed by radiation therapy; however, this treatment was not effective; therefore, chemotherapy was applied and resulted in successful elimination of the tumor. in this study, we also discuss the pathological and biological features of ppt and available treatment options. a 37-year-old male visited a clinic due to a headache and dizziness in december 2010. there was no distinguishable observation in his past history, physical examination, and laboratory tests. in addition, the head-up-tilt-table test and video eyeball exam showed no obvious abnormalities. computed tomography (ct) of his brain was performed and a mass measuring 2.5 cm in size was observed in the midbrain and obstructive hydrocephalus. the tumor showed intermediate enhancement in t1-weighted magnetic resonance (mr) imaging and a high intensity of enhancement in t2-weighted mr (fig. histological diagnosis concluded that the mass was a ppt with intermediate differentiation. the majority of the tumor tissue consisted of small hyperchromatic cells with moderately increased cellularity and a high nuclear to cytoplasmic ratio. a clear homer wright rosette, many of which have been termed " pineocytomatous resettes " was not found (fig. diffuse staining for neuron specific enolase and focal staining for synaptophysin were observed, while the immunohistochemistry analysis showed very little glial fibrillary acidic protein (gfap) staining. such a focal staining pattern of synaptophysin staining in the pineal region neoplasm, coupled with the lack of gfap staining was most consistent with a ppt (fig. he underwent irradiation with 54 gy of radiation on 27 fractions for removal of the remaining tumor for approximately one month after surgery. however, a remnant mass in the superoposterior aspect of the midbrain had extended to the hypothalamus and the third ventricle approximately five months after the operation. he was referred to the department of medical oncology for palliative chemotherapy and was treated with a procarbazine, lomustine, vincristine (pcv) regimen one month later. the size of the remaining tumor in the midbrain and the leptomeningeal enhancement was reduced in the follow-up brain mr imaging. two months later, after the sixth cycle of pcv chemotherapy, no evidence of the tumor was observed in the brain mr imaging (fig. no additional signs of a tumor were observed in the latest follow-up imaging, which was performed approximately 20 months after the initial diagnosis. the patient was free of any signs of recurrence without any neurological deficits six months after the end of treatment. there are still some controversies with regard to ppt classification, primarily due to the rare occurrence of these tumors. many older published studies (prior to 2007) separated ppt into only two histological subtypes; pc and pb. pc was classified as an indolent tumor and designated as grade i with a benign feature. pb was categorized as a highly malignant primitive neuroectodermal tumor and assigned a who grade iv, which tends to have a higher propensity for seeding the cerebrospinal axis. the 2007 who classification of tumors of the central nervous system designated a new category of ppt, called pptid, which describes a group of tumors that have an intermediate malignancy between pc and pb. proposed a new prognostic grading system that subdivides the category of pptid into two groups with different prognoses (grades ii and iii) according to the mitotic activity and the degree of neuronal differentiation. grade iii has been defined as pptid with either six or more than six mitoses or fewer than six mitoses but no immunostaining for neurofilaments. in our case, the patient had been diagnosed as pptid grade iii, since the tumor contained more than six mitoses and atypical mitosis. fauchon et al. reported that grade iii pptid had a much more aggressive biologic behavior compared with grade ii. they reported that grade ii and grade iii differed by 74% and 39% in five-year survival and by 26% and 56% in the recurrence rate, respectively. a previous report compared the histological types between initial diagnosed and recurrent tumors in pptid. a 47-year-old male who had been diagnosed with pptid iii through endoscopic third ventriculostomy was treated with gamma knife surgery and no residual tumor was observed. however, a new mass lesion appeared on the cerebellum four years later and was found to be pb after a creniectomy and open biopsy were performed. in regard to the reoccurrence of ppt, no cases of a changed diagnosis have been reported, except for the report described above. however, ppt might be morphologically heterogeneous within a tumor and an endoscopic biopsy might not be sufficient for observation of the whole tumor. the authors even stated that the first tumor might have been a mixed pptid-pb. although we did not perform a repeat biopsy in our case, it is likely that the recurred cancer was also a pptid of high grade. a previous study recommended a variety of treatment approaches ranging from surgery or external irradiation alone to combined treatment with surgery, radiotherapy, or chemotherapy. surgery has been reported to play a significant role in relieving the local mass effect and providing a maximal tissue sample for histological analysis of low-grade ppt. despite the significant progress in surgical techniques and perioperative care, surgical intervention in the pineal area contemporary studies have reported a surgical mortality rate of 4-7%, and the permanent morbidity rate may be as high as 10%. some authors found no correlation between the extent of resection and survival, although total resection showed an association with better local control. in a study of a children's cancer group, which included 25 prt patients, no significant difference in survival was observed (< 90% surgical resection vs.90% surgical resection (p>0.3, data not shown). pbs or high grade pptids usually require more aggressive treatment, including craniospinal irradiation and chemotherapy. a retrospective study of 22 ppt patients with pb, mixed ppt or pptid with seeding potential found that fractionated irradiation applied primarily or as an adjuvant postoperatively could control the tumor and increase survival. the one-year, three-year, and five-year survival rates for these patients (seeding varieties) were 88%, 78%, and 58%. the indications and protocols were heterogenous in the initial stages when chemotherapy was administered during postoperative treatment. because of the harmful effect of radiotherapy on the developing nervous system and the hypothalamic-pituitary axis in children, concerns about radiation toxicity have prompted efforts to reduce radiation therapy. in the pediatric oncology group (pog) experience, all 11 reported children under the age of 36 months with pb were treated with multi-agent chemotherapy for 12-24 months in order to delay radiation until the age of 36 months. gururangan et al. studied the efficacy of high-dose chemotherapy with or without craniospinal radiotherapy for pb. they reported that five of 12 patients who had undergone radical tumor resection followed by chemotherapy survived and four of seven patients treated with chemotherapy after biopsy or incomplete resection lived without any recurrences for a median follow-up period of 62 months. recent studies on chemotherapy have focused primarily on pb and few studies on pptid have been reported.. reported on a patient with pptid ii who had received treatment with 36 gy of craniospinal irradiation and an additional local boost of 19.8 gy after undergoing partial tumor resection. the patient received one cycle of intensive chemo-therapy consisting of cisplatin, oral etoposide, cyclophosphamide, and vincristine. chemotherapy could not be continued due to development of thrombocytopenia, and cyberknife radiotherapy (marginal doses of 23 gy/3 fractions) was performed two months later. the report stated that the patient was free of any signs of recurrence without any neurological deficits 17 months after the end of cyberknife radiotherapy. in this study, we report on a case of pptid, in which remission was achieved through pcv chemotherapy. pptid is extremely rare and few large-scale studies have reviewed the long-term effects of treatment, and there have been no definite conclusions regarding treatment plans for pptid in adults. in addition, few cases involving successful treatment of pptid in adults with neoadjuvant chemotherapy and craniospinal irradiation have been reported. we would like this form of treatment to help a larger number of ppt patients. therefore, based on the findings of this case, combining surgery and irradiation with chemotherapy may be a feasible and efficient therapeutic approach for treatment of pptid. however, conduct of a prospective study including a larger number of patient groups will be needed in order to conclusively demonstrate the effectiveness of chemo- and radiotherapy for treatment of ppts.

a 37-year-old male presented with a mass measuring 2.5 cm in size in the midbrain and obstructive hydrocephalus, which had manifested as a headache and dizziness. magnetic resonance (mr) imaging of the brain showed intermediate enhancement on t1-weighted mr imaging and a high intensity of enhancement on t2-weighted mr. neurosurgeons performed an occipital craniotomy with partial removal of the tumor and the postoperative diagnosis was a pineal parenchymal tumor with intermediate differentiation. he had undergone irradiation with 54 gy of radiation on 27 fractions for removal of the remaining tumor approximately one month after surgery. however, in follow-up imaging performed four months after radiotherapy, a remnant mass in the superoposterior aspect of the midbrain was found to have extended to the hypothalamus and the third ventricle. he was treated with six cycles of procarbazine, lomustine, vincristine chemotherapy. at five months since the completion of chemotherapy, the brain mr imaging showed no evidence of any remaining tumor and he no longer displayed any of his initial symptoms.

PMC3804738

pubmed-850

i squeeze into the back, next to the two community-owned resource persons (corp) and a tanzanian phd student under the supervision of the principal investigator of the urban malaria control programme (umcp). our first stop is on the western edge of town, a 20-minute drive from my hotel on the peninsula. where the electric lights grow few and far between, we turn off the tarmac and bounce along a network of washed-out mud roads. it quickly becomes too narrow to drive, so we get out of the car and make our way single-file through the back alleys, straddling streams, heaps of garbage and small garden plots. around the corner of a house, we find a young man with his pants rolled up, a headlamp and a rubber tube in hand. seeing us approach, he stands up, stretches and hands the student a form. the student picks up the netting-covered plastic cup on the ground near the man's feet. he makes a note on his datasheet, pats the man on the back, and turns to leave. he's a good one, this guy, the student says, always here. the visit is short; there is a lot more to do. behind us we leave him there in the moonlight, rats running along the drainage ditches and radio playing in the street. the investigative focus of the umcp is the effectiveness of larval control in reducing the incidence of malaria in dar es salaam. in contrast to ddt, bti is safe for nontarget organisms and because it contains multiple toxins, its use is less likely to result in resistance. but while highly effective in killing mosquito larvae, with little residual activity, bti must be re-applied on a weekly basis. to prove the effectiveness of bti as a viable instrument of disease control, the principal investigator required up-to-date evidence of mosquito densities across the city. for this purpose, the human landing catch (hlc) the key methodological advantage of the hlc is that mosquitoes are caught as they come to feed. thus, in contrast to those captured by a light trap, the samples obtained can be deemed representative of disease transmission. hlc is also cheap and relatively simple; an aspirator (a mesh-covered glass vial attached to a rubber sucking tube), cotton wool, some rubber bands, a few plastic cups, a source of light and a human volunteer are the only necessary equipment. as most anopheles gambiae the most common malaria vector are nocturnal, hlcs perform their duties between sunset and sunrise. customarily, the hlc is conducted within homes and can be reinforced or supplemented by a bed-net trap. but after decades of spraying homes with insecticide and covering beds with insecticide-treated nets, dar es salaam's mosquito populations, once domestic, now seek their hosts in the streets. therefore, in the context of the umcp, placing hlcs outdoors is the only way of collecting accurate evidence. catching mosquitoes over night is both mentally and physically exhausting. sitting in a chair, waiting for mosquitoes to land, sucking them off the legs into a tube and then blowing them into a cup demands patience, intensive focus, and above all, stamina. with catches going on in 268 routinely maintained sites in dar's back alleys hourly records of catches may reduce the possibility of data-fabrication, but random spot checks are still necessary to ensure volunteers stay at their posts. because collectors differ in their attractiveness to mosquitoes and in their skill in catching them, another obvious problem with the hlc is that it involves direct exposure to mosquito-borne infections. precautions are taken all volunteers are screened weekly for malaria and, when infected, treated with artemisin-based combination therapy. because it involves placing the catcher in a compromising position, the hlc is restricted to men over 18 years of age. but particularly at a time when drug-resistant malaria is on the rise, becoming a target for mosquitoes poses what may seem unnecessary risks. but for the purposes of this paper, i would like, for the moment, to suspend the visceral discomfort the experimental scenario provokes and consider first its value. i use the term value, broadly to describe both the moral virtues of knowledge-production and the monetary costs of malaria control. drawing on theoretical resources from anthropology, science and technology studies and economic sociology, this paper examines how political, economic, and scientific logics are inter-articulated through public health research practice. the paper tracks these overlapping and countervailing forms of value across three sections and each of them conceptualizes the role of the hlc differently. it begins by examining the hlc as a species of experimental subjectivity particular to the informal economy of tanzania. in dar es salaam, the formation of the hlc's experimental subjectivity is in continuity with a post-colonial, post-socialist trajectory. i suggest that in the case of the umcp, the practices of transnational knowledge production overlap with residual forms of civic identification. in the second section, i elaborate the collective character of experimental participation as technical work by linking the hlc to the particular investigative demands of the project. of particular interest is the relationship between the hlc as knowledge-producer and the transformation of dar es salaam into a venue for disease management. the third and final part of the paper considers how the value of the hlc's labour coincides with the organization of global health. markedly out-of-step with current r&d trends, the umcp investigates an environmental strategy associated with colonial governments. the malaria investigated here is defined by ecological and administrative specificity relations that lie outside the current figuration of malaria as a threat to the global economy. my argument is that the hlc reanimates those relations and projects them on a future civic order. the theoretical consequences of immobility i leave for the conclusion where i briefly consider the hlc as a counterweight to the project form of humanitarian engagement (boltanski&chiapello 2005). in presenting this particular account of these dynamics, i point to different alignments of knowledge, work, science and place and suggest how these shape the value of research. the first place to look for the value of the hlc is where money changes hands. on average, this sum reflects a moderate increase on what they might make from selling batteries, oranges, or phone cards the activity that provides most catchers with their primary source of income. of course, the payment of $2.45 is strictly not a salary, but rather a minimal emolument for volunteered and consented participation (fillinger et al. 2008). here, as in all biomedical research, the motivation of the subject provides an ethical anchor; the exploitative potential of putting the body to use is mitigated by the degree to which it is freely offered (geissler, this issue). monetary exchange whether framed as compensation, reimbursement, or reward must be kept ideologically distinct from the logics of accumulation; any disambiguation of the pragmatics of participation risks impugning the purposes of research. work in the social sciences has repeatedly shown that the trope of volunteerism lacks empirical traction in the context of clinical research (e.g. geissler et al. scholars have situated participation within the social and political circumstances in which research is conducted. kaushik sunder rajan's ethnographic work on the emerging indian bio-industry is of note in this regard. zeroing-in on clinical research conducted in parel once the hub of mumbai's textile industry and now the home of a genome company, hospital and lab -sunder rajan excavates the collective identity of experimental subjects who were formerly mill workers. for sunder rajan, the integrity of the individual participant's consent is not of concern indeed the trials conducted in parel adhere to the highest ethical standards. the violence he identifies is structural, introduced through the specific colonial histories and political economies of mumbai and exacted within the institutions in which work takes place. in contrast to the social character of factory work, formalized through unions and materialized in the built environment of the mills, participating in trials is individual, placeless and (by ethical prescription) anonymous. as the indian economy shifts from commodity-based to speculative capital, the working-class identity is: under threat of erasure. this is because part of the evisceration of the industry involves pushing more and more workers into informal sectors of work, and therefore away from trade unions the structurally formed subject-position in bombay is not one of shared social identification, but rather one of desperate individuation and alienation. (sunder rajan 2002, p. 169, p. 173) the rise in contingent forms of labour has replaced a politically robust class-consciousness with thinly imagined human rights. for sunder rajan, the professional experimental subject is not an ethical aporia but an archetype of the disenfranchisement of the labourer under advanced capitalism. following sunder rajan, the question we might ask is how the hlc tallies with the distinct economic realities of contemporary life in dar es salaam? is being bait yet another expression of neo-liberal logics? like parel, dar es salaam is dominated by an informal economy (tripp 1997). but though a flexibly configured economic landscape is characteristic of african urbanization (simone 2004), dar es salaam's informal sector bears the distinct marks of a failed socialist project. here, the informal economy does not merely denote unregulated economic activities, but rather the creation of resources through which people sustain the civic capacities formally articulated by the state. nyerere's political philosophy of ujamaa drew heavily on a british tradition of welfare economics that recognized the state as the guarantor of equity, and thus the rightful distributor of key resources. he aspired to liberate tanzania from the chronic underdevelopment to which it was condemned by colonialism by righting the imbalance between production and consumption, the needs of the countryside and those of the metropolis. the engine of modernity for nyerere's independent state was thus not the formal urban sector. rather, social progress would be the outcome of state-initiatives realized through the diligent participation of a self-reliant citizenry. to advance that vision, villiganization the forced relocation of rural populations to organized sites of cooperative production. in the city, trade was heavily regulated; private industry and sideline employment, deemed contrary to the spirit of ujamaa, were persecuted (lewinson 2007). his social polices alienated aid donors from the west. his efforts to restructure agricultural production disregarding heavy industry impoverished the country further (pratt 1999). as economic crisis struck and structural adjustment measures were put in place, informal businesses became the primary source of household income. locally organized groups took responsibility for public services that the state no longer could provide such as waste removal, infrastructural upkeep and security. while counter to the official political ideology, the informal sector supported government institutions and thus mitigated their deterioration. as mari ali tripp suggests, the resiliency of society and its ability to reproduce itself with considerable autonomy from the state is one of the reasons the entire fabric of society did not fall apart during the unprecedented hardship (tripp 1997, p. 5). the volunteer was not enrolled into the project as an experimental subject, rather he was first employed as a member of the community-owned resource persons (corps), and in that capacity was delegated the responsibility of performing the landing catch. in the past, corps had been appointed by members living within ten cell units (tcu) a cluster of about 10 houses -to perform basic public health services and small-scale maintenance tasks, such as garbage collection, road cleaning and soap distribution. a feature of nyerere's urban reforms, but like many national programmes they fell victim to the economic reforms in the 1980s. though many continued to work on a volunteer basis, with little administrative or financial support from the city council, corps no longer functioned as a coordinated system. recruiting participants through this network offered considerable operational advantages for the umcp. in ecological studies, access is of critical importance. selected by street chairman, the corps guaranteed the project's acceptance among local residents. their familiarity with the physical and social landscape enabled the research team to locate mosquito-breeding sites, many of which were occurring within private homes and gardens. the mosquito collector received a compensation equivalent to that offered to a volunteer municipal servant for any odd job, like road cleaning (chaki et al. 2009). the use of a dormant social infrastructure within the research project raises some interesting questions about how to value the mosquito catcher's labour. paid by the research project but enrolled as a corp, the hlc's experimental role is embedded within a civic sociality. his labour falls partly outside the economy of transnational clinical research, even as it is sustained by it. how, then, do we understand the value of that labour at the intersection of different modes of economic rationality? do we agree that $2.45 is a fair compensation for the risks he sustains and, further, for his contribution to the project's outcomes? in the following section, i begin to respond to these questions by widening the scope of analysis to the other forms of experimental work associated with corps. the heuristic value of the night mosquito catches lies in tracking the density of urban mosquito populations and, by extension, revealing the transmission rate of malaria. but within the umcp, that task also serves to demonstrate the work of larval control the size of the hlc's collection indicates whether the application of larvicide has been comprehensive, and, if not, the areas that have been missed. those responsible for larval control and those enrolled to catch mosquitoes are kept separate in order to achieve evaluative rigour. however, they constitute the same volunteer municipal body. the aggregative function of these groups points to the particular relationship of experimental work and the production of knowledge in the context of the umcp. on any given night in dar es salaam, men can be found catching mosquitoes in a garden, on a curb, along a drain. these randomly selected sites serve to build a picture of urban mosquito transmission. but these locations also constitute key coordinates in the geography of the experiment. in this section, i will examine the hlc's location as part of a broader project transforming dar es salaam into a model city for larval control in africa. i suggest that the civic epistemology of mosquito mapping resituates the value of experimental work as not only an index of disease but also as an instrument to experimentally format the city. because mosquito-breeding sites are bounded and easily located, cities are regarded as the most suitable environments for larval control. but to generate the conditions under which larval control is possible necessitates an ecological understanding of man-mosquito dynamics on fine spatial scales. dar es salaam encompasses a diverse range of habitats including sewage pools, cattle troughs, rain gutters, water buckets and ponds caused by poor drainage. and these are only the most identifiable sties mosquitoes are highly associated with human activity and are just as likely to breed in footprints as they are in swamps. however, advances in remotely sensed (rs) imagery and global positioning systems (gps) have provided the necessary tools to identify and record these habitats. with these technologies, the umcp research team produced a high-resolution map that related the minor ecology of each area to the spatial distribution of disease across the city. while accurate, the maps were not practical. as with the hlc, larval control was delegated to a group of volunteers, selected by street chairmen, and enrolled into the project as members of the corps. larval control is also highly demanding: locating and monitoring the diverse and shifting mosquito habitats that characterise dar es salaam make staying awake in a chair over night seem easy. because they bore no relation to how the corps visualized the city, the maps produced did little to ease that task. to bridge these different understandings, the umcp developed a protocol for participatory mapping, whereby each larval control corp was asked to draw a sketch of the area for which he was responsible. mosquitoes provided the cartographic anchor of these depictions; the corp identified any potential breeding sites and habitats and related their position to features of the plot such as roads, drains, walls or houses. knowing where to spray was only part of the problem: watchdogs, gates and intimidating owners were often enough to dissuade a corp from even approaching a house, let alone asking if they could enter, check and spray any potential breading grounds in their gardens. the guidelines for spraying stress the interdependence of ecological capacity and social knowledge: to find all mosquito breeding habitats, you have first to know each and every square metre in your mtaa [neighbourhood] the only sure way to do this is to know who owns, occupies or uses which plot of land regardless of whether it is surveyed or unsurveyed. 2007, additional file, guidelines for larval control) with the help of a member of the research team, corps calibrated their sketch maps with a blown up aerial photograph of their area; boundaries whether administrative, natural or socio-economic were marked with non-permanent pens. the prints were laminated to protect them during intensive use in the field, and to encourage corps to adapt the map to their daily experiences and to new data from night mosquito catches. capturing the dynamic reality of the encounter between man and mosquito demands a flexible methodological format: tied to the demands of place, these technologies of spatial representation are subject to continual modification. night-catches render visible mosquito movements and reorient larval control activities to new breeding grounds. this finely tuned process of vision-and-revision stands in stark contrast to the geographic colonization of territory described in theories of the state-formation (e.g. mitchell 2002). dar es salaam is here elaborated as an active network of relations, references and practices the making of a mosquito map is embedded in the sociality of the city streets. the hlc sits as a sentinel along that chain of designation; his night-catches reveal the slippage between scientific space and urban place. thus, though the work of the corps is highly physical, it also entails more immaterial, affective aspects. their intimate knowledge of the field and its inhabitants generates the conditions for the cartographic liveliness critical to the generation of ecological knowledge. in terms of project value, one question we might ask is how that socio-technological praxis tallies with the work of the research team. this is a familiar question for the sociology of scientific knowledge: steve shapin explores the role of the invisible technicians who designed, constructed, and operated robert boyle's foundational experiments (shapin 1989). shapin argues that the division between technical and analytical labours and the difference in their value was grounded in the status of the workers as servants and not gentlemen. in other words, while boyle could pursue knowledge freely, the technicians were all remuneratively engaged to work at boyle's request. that is they agreed to exchange a certain amount of autonomy and work for a certain amount of money (shapin 1989, p. 561). once they entered into monetary exchange, their contribution was disconnected from the authority of science. though scientists now receive a wage, the division between menial and mental labour continues to have a bearing on contemporary scientific research. however, in africa, the relationship of scientific assistants to the production of knowledge has a slightly different significance. some of the earliest forms of colonial education were aimed at extending the arms and hands of colonial medical officers (hunt 1999). the colonial training and employment of spray-men, medical technicians, and volunteer health attendants was animated by logics of expansion (in volumes of patients, samples, analyses), socio-spatial access, divisions of labour, and hierarchies of scientific practice. after independence, these biomedical middlemen became central to large-scale social engineering projects aimed at eradicating inequity and establishing a strong nation state (beinart et al. the first comprises that practical aspects of experimentation that are kept radically distinct from the truth these experiments produce; the second functions as a means of exerting geographic and demographic control. the alignment of research protocol and governmental practice is transformative; the corps work to make dar es salaam a typical african city, a neutral backdrop against which to diagnose and predict the effectiveness of larval control. but in so doing, they also render the city manageable as an object of control. through the corps handy-work dar es salaam becomes a collaborative project, a site of development. in the final section, i will elaborate further the economic forms of value that underpin that process of transformation. it is a proof-of-concept, a demonstration of chemical efficacy, a test of cost-effectiveness, and a simulation of environmental management. as a pilot for a future policy, the umcp's persuasive power depends upon the social and material connections it forges between test setting and site of intervention (lezaun&millo 2006). those connections come about through the participation of the corps who, by the consistency of their practice, forecast the validity of the trial and close the gap between science and city. between research pilot and public health programme, their work encompasses different techniques of calculation, configured around the resources brought to bear by malaria, international science, and the state. let me now return to the emolument offered for a night's work in the chair. a competitive wage in dar es salaam, $2.45 seems at odds with the millions of dollars in capital and material resources made available to the project by the gates and melinda foundation, usaid, the wellcome trust and the swiss tropical institute. more broadly, the project sits squarely within the funding priorities of global health; in 2009, the global fund awarded tanzania $680 million to expand malaria treatment and prevention. in the sections above, i discussed the mosquito-catchers labour first, in terms of their experimental subjectivity, and, second as a scientific practice. now, i want to explore how these practices participate in each other, and how their technical and ideational compatibility influences the way in which malaria is framed as an object of intervention. in his analysis of how economics constitute markets economic and, further, in the socio-technical consequences of that framing. an ancient disease, malaria is an externality with considerable puissance; the parasite has overturned battles, dispatched sovereigns, and relocated civilizations. it has shaped agricultural techniques, methods of building, and the planning of cities. taking malaria into account was the founding goal of tropical medicine; often viewed as the benevolent aspect of colonialism, modern public health was (and continues to be) intertwined with the interests of international commerce (e.g. anderson 2006). the international system of economic governance that emerged after world war two reframed malaria as a threat to markets on a global scale. this transformation from situated illness to international pandemic took shape through epidemiological models that defined malaria not as a problem of social ecology, but as a probabilistic relationship between mosquitoes, malaria parasites and human hosts (packard 2007). second, that relationship was costed in terms of worker productivity, school absenteeism, medical costs, cognitive ability, population mobility, trade and tourism through a raft of social-technical algorithms and multiple regression analyses. third, those costs have been aggregated, stabilized and projected. according to john gallup and jeffery sachs, malaria costs african nations roughly $12 billion annually in direct economic losses and many times more in reduced economic development a growth penalty which, for sub-saharan countries like tanzania, is currently calculated at 1.3% per year (gallup&sachs 2001). as an object of economic calculation local methods of control, such as improvements to infrastructure and strategies of environmental management, seem myopic pitted against an epidemic of such global proportions. but most of all they are criticized as inefficient: integrating disease control into social development programmes demands heavy investment with limited returns. in contrast, programmes that specifically target disease transmission on a global scale are expensive, but have far reaching potential. the failure of the global malaria eradication programme in the 1950s was not regarded as a problem of modelling, but was rather blamed on negative externalities drug and insecticide resistance, the environmental movement, and philanthropic fatigue. when malaria returned to the centre stage of global health agendas in the late 1990s, the strategy was to anticipate and neutralize these problems with the breadth of technological innovation and the sheer size of investment. with the support of the bill and melinda gates foundation, international funding of malaria research and control interventions has quadrupled over the last few years from $249 million in 2004 to $1.1 billion in 2008 (mccoy et al. the competing costs incurred by the disease and by its control, again, suggest that obliterating the pathogen is the only way to clear the balance sheet. anything short of global eradication is a bad decision, for it means, to quote melinda gates, that we will keep bearing forever the human costs of malaria, even as we keep paying forever the financial costs of trying to treat and control it (melinda gates, malaria forum, october 2007). funds bring with them their own calculative devices performance indicators, accountability measures and systems of audit (strathern 2002). the question, then, is how the work of the hlc renders malaria legible within these forms of valuation. to answer this question, we need to situate the umcp within the technical trajectory of the disease as it has evolved in tanzania and more specifically, dar es salaam. the city has a long history of malaria control, which sets it apart as a venue for intervention and, experimentation. malaria has been a persistent feature of its urban landscape since the german colonial authorities introduced planning schemes to separate malaria-endemic native bodies from susceptible white ones. under the direction of robert koch, the city became the site of the most extensive quinine treatment programme in colonial africa. following world war one, the british, introduced strict legal sanctions for the destruction of ponds and other sources of stagnant water, and, through the deployment of the royal army medical corps, carried out a wide range of vector-control strategies, including comprehensive drainage work, stream straightening, livestock surveillance, and eventually, larvicidal aerial spraying (castro et al. 2004). during independence, malaria control provided an arena for the extension of the newly established state (gerrets 2010). nyerere's theoretical and political starting point was the link between economic inequality and disease. his plan for tanzania's development, outlined in the arusha declaration (1967), hinged upon restructuring the health sector on the basis of socialism and self-reliance (marsland 2006). inspired by china's barefoot doctor programme, nyerere created a network of rural centres, and ultimately relocated the rural population to facilitate access (hsu 2007). urban malaria control was successfully integrated into the general health services, owing in large part to the participatory mechanisms nyerere put in place to decentralize health care. in 1971, the who east africa aedes research unit experimented with an integrated vector control programme in collaboration with the dar es salaam city council. by 1973, the transmission rate of dar es salaam reached its lowest point in a century, ironically just at the moment when tanzania's deepening economic crisis made environmental management programme economically unfeasible. through the 1980s, dar es salaam's experience mirrors that of sub-saharan africa. as a result of the pressures of the imf, spending on health malaria parasites became drug-resistant and the density of anopheles mosquitoes soared. in 1988, the city once again became the site of intervention, when the government of japan, interested in expanding its development aid portfolio, selected tanzania as its key recipient and launched an integrated urban malaria control programme with an emphasis on mosquito surveillance. over the course of eight years, the japan international cooperation agency (jica) donated resources, equipment and technical expertise amounting to roughly $21 million us dollars. despite its success in rehabilitating drainage infrastructure, in an interview with one of the municipal directors, she attributed this failure to the architecture of the intervention. in accordance with japanese government policy, japanese expert advisors rotated every two years, advising tanzanian partners on the techniques of vector control, but neglecting its more managerial aspects such as data collection and analysis. by the time malaria had made its reappearance on the global health stage, it was already highly visible in dar es salaam. though not sustainable as a programme in vector control, routine remote sensory images and aerial stereoscopic maps documented the city's ecology and epidemiology, already described by records dating back almost a century. in addition to its textual depth, dar es salaam's infrastructural and political landscapes not to mention mosquito populations had been profoundly shaped by repeated efforts at malaria control. further, the prospect that by 2030 more than half of the sub-saharan african population will live in cities suggests a need for more malaria research conducted in urban settings. dar es salaam provided an ideal unit of analysis, a-ready-made truth-spot scalable to cities across the tropics (gieyrn 2006). the history of malaria research in dar es salaam and its metropolitan trajectory provided the key selling points for the project's principal investigator, an ecological biologist deeply committed to an integrated-approach to vector control. he managed to secure pilot-funds from the bill and melinda gates foundation though the invention he led did not match the foundation's innovation-focused profile. that support was, however, limited to one year, after which the programme's existence would depend on further ad hoc funding. because larval control can take years to show an impact on transmission, sustainability was not only a long-term goal for the programme, but also a condition to demonstrate its effects thus, though the efficacy of bti provided the justification for the study, its protocol emphasized the operational feasibility of implementing a large-scale, community-led larval control programme. but while potentially cost-effective, integrating the project into pre-existing municipal structures required a complex system of surveillance stretching across distinct spatial and administrative scales. for instance, corps responsible for the application of larvicide and those performing hlcs reported to separate ward supervisors, who provided weekly summaries of these reports to the municipal mosquito control coordinator (mmcc). every month, the mmcc sent the aggregated forms with action notes to the city mosquito control coordinator (cmcc). the cmcc, in turn, produced a written narrative of the programme's progress for the city mosquito surveillance officers (cmso). collection forms, excel spreadsheets, data reports, and written feedback link the administrative layers of the hierarchy, formalise action plans and allow for an unambiguous assessment of performance (riles 2006). this layered system of annotated exchange also extended the temporality of the research from project to programme: overall, the vector surveillance and management systems developed in dar es salaam allow timely collection, interpretation and reaction to field-collected entomologic data with reaction times at ward, municipal and city levels vector density patterns were drafted into manuscript format figures within three weeks of their collection through these standard low-technology procedures, therefore serving as an instant monitoring and teaching tool. 2008, p. 13) the umcp thus became a combination of operational programme, research project and training platform. as part of the infrastructure for malaria control, the hlc's value is calibrated not to the facts the project produced, but to its future. between the research project and the system of public health management malaria appears both as an economic and sociopolitical entity an obstacle to development and its vehicle. three years into the umcp the operational costs and the mosquito density have dropped dramatically, malaria transmission rates are down. the national malaria control programme has now set itself the target of establishing similar programmes in five tanzanian cities by 2013, but the country lacks the necessary financial resources to do so. the hope is that further funds will become available as the dream of eradication fades and the need to develop new ways to control malaria comes into sharper focus. processes of economization render unruly entities subject to management and subject to control (callskan&callon 2009). as an economic object, malaria is detached from its political histories and ecological specificities and costed as a parasitological exchange. what is striking about the hlc is that it reconnects the economics of malaria to its administrative practice the mosquitoes he enumerates entangle the parasite in urban planning, in infrastructure, in community relations, and in local politics. immobilized in his chair, the hlc enables other things to move the population of mosquitoes, men and parasites, the contours of the urban landscape. these circulations are rendered visible but not static; the presence of the mosquito catcher enables an elastic response to the adaptability of the vector. mosquitoes change their behaviour in response to human environments and public health interventions; each time the bti is applied the dynamics of that parasitological exchange between men and mosquito and the landscape of infection is subtly adjusted. the situated, persistent work of the hlc also mediates the flow of knowledge between ecologists, volunteers and communities; an ancillary epistemic exchange that runs through the production of facts. in short, his work sediments scientific practice: his collection transforms city streets into project evaluations, experimental techniques into tools of control. this paper has explored the distinct orders of value involved in and generated by the hlc. i tried to locate the act of being-bait both in the economy of tanzanian society and within the relevant protocols of scientific research. i have also suggested how the stationary volunteers of this malaria control project affected the direction and meaning of the experiment. the administrative intimacy of the experiment yields a productive overflow as a pedagogic instrument, a catalyst of community action, and a rationale for urban planning. finally, i have suggested that the extensibility of the project its capacity for growth through use opens a space for politics in global health research (miyasaki 2004). in the words of hassan mshinda, the head of tanzania's commission for science and technology: unlike cutting-edge molecular biology, semi-field ecological studies and open-field research can be undertaken in any african setting, and constitute an immediate opportunity for malaria-afflicted nations to regain their roles as stakeholders, decision-makers, and eventual owners of this technology (mshinda et al. though they form a central part of malaria control in dar es salaam, environmental strategies have for the most part been committed to the dustbin of pre-world war two history (who 2008, p. 9). today, methods that entail this sort of logistical complexity and are bound to specific institutional and geographical topographies run counter to the dominant economic rationale of malaria control, and to the ideological underpinnings of global health. the emphasis of euro-american policy on emerging diseases has shifted public health from a problem of population management to one of surveillance in the interests of establishing networks of information exchange, projects circumvent sovereign states, pursuing partnerships between non-governmental organizations, charities and private industry (king 2002). indeed, we are accustomed to thinking of scientific significance as a feature of its mobility; reliable knowledge is that proved to hold true regardless of time or place (latour 1983). boltanski and chiapello (2005) identify the project as the archetype of the new spirit of capital a social order and economic practice that privileges flexible, mobile and temporary forms of labour. in contrast to the top-down hierarchical organizations associated with industry, projects render capital fluid. assembling disparate groups of people for short periods of intense connection, these pockets of accumulation operate as an encounter. the logic of the encounter is that not being integrated once and for all into an institution or environment, it presents itself as an action to be formed, not as something that it is already there (boltanski&chiapello, p. 110). the links made through projects are continually suppressed to pursue other forms of connection made available in the those unable to join and profit from the shifting array of projects are excluded from the flows of capital. boltanski and chiapello critique the normative imperative of mobility and its ideological associations with liberation. immobility, they argue, serves a critical but often hidden function of cultivating social links the values the value of the hlc lies in its peculiar balance of circulation and emplacement. despite its collaborative potential, within the global public health landscape, the umcp was a discrete project within the global public health landscape, funded by international donors and limited in time. yet the presence of the mosquito catcher, night after night, embeds the resources of international science into the administrative practices of the municipality. he provides a platform to integrate and entangle mobile resources into fixed, stable institutions (kelly et al. 2010). his is a precarious position in the sense of being financially insecure and physically dangerous, but also one offering potential for new subjectivities, new socialities and a new kind of politics (gill&pratt 2008, p. 3). the capacity of the hlc to be there produces value by forming connections between the world as an object of description and the capacities of those who inhabit it. that epistemic intimacy takes considerable commitment once a week, at six in the evening, he will find his way to one of the four sampling locations in his neighbourhood, roll up his pants, and wait. my first thanks go to the corps, gerry killeen, prosper chaki, and the public health entomology team working with the ihi in dar es salaam. this article benefited greatly from the keen insight and generous attention of the blind reviewers and tony bennett. for their close reading, the research from which this paper draws was conducted with a wellcome trust bioethics grant grant (# 2173) and written during a fellowship at the brocher foundation.

this paper focuses on an unsettling example of experimental labour the human landing catch (hlc). the hlc is a cheap and reliable technique to produce data on mosquito densities in a defined area. it requires only a human volunteer to sit over night with his legs exposed, a headlamp to spot mosquitoes, and a rubber tube and plastic cup to catch them as they come to feed on him. the hlc formed the central methodological and operational strategy for a malaria control that took place in dar es salaam, funded by the bill and melinda gates foundation. this paper analyses the epistemic and economic value of this experimental scenario by examining in detail the work it entails. in conceptualizing the different species of productivity associated with the hlc, of particular interest is the surprising fact that he is there. this paper argues that the interplay of mobility and immobility offers a way to rethink the value of research within interlocking circulations of capital, science, mosquitoes and men.

PMC3158131

pubmed-851

national comorbidity survey reveals that major depressive disorder (mdd) is a debilitating disease with a prevalence rate of 16.2% (kessler et al., 2003). in depression remission is achieved by only one third of the patients after treatment with antidepressant agents (rush et al., 2006). another major disease as a global burden is obesity as it is directly associated with increased morbidity from cardiovascular disease, type 2 diabetes and some cancers. epidemiological data suggest that obesity is linked to an increased risk of depressive and mood disorders (simon et al., 2006). the current antidepressants like citalopram and fluoxetine have been reported to show resistance in depression associated with obesity (isingrini et al., 2010). despite this information, there is presently little information on how the development of obesity heightens the risk for depression. chronic unpredictable mild stress (cums) is the most important pathogenic factor in several neuropsychiatric diseases such as depressive disorder, as stress exposure modifies the onset and evolution of some neurological diseases (garcia-bueno et al., 2008). in rodents, cums model is mostly used for assessing the pathophysiology of depression and to study the effect of various therapeutic interventions on cums induced depression (willner, 2005). furthermore, cums leads to various long term behavioral, neurochemical, neuroimmune and neuroendocrine alterations that resemble to those observed in patients with depression (cryan and holmes, 2005). clinical reports suggest that obesity and other metabolic disorders are frequently observed among the individuals seeking treatment for mood disorders (mcelroy et al., 2004). the biological mechanisms associated with increased cardiometabolic risk may contribute to the development of mood disorders such as depression (vogelzangs et al., 2010). the patients with metabolic syndrome or insulin resistance syndrome experience a significantly elevated risk of developing depression (almeida et al., 2009) pioglitazone (pgz),a well established drug known as peroxisome proliferator-activated receptor gamma (ppar-) agonist belonging to thiozolidinodienes (tzds) class regulates lipid metabolism, exerts potent central and peripheral anti-neuroinflammatory action and possesses neuroprotective effect (wozniak et al., 1993; zhao et al., 2006; garcia-bueno et al., 2010, heneka and landreth, 2011). several clinical and pre-clinical studies reported tzds as superior treatments for neurological and psychiatric conditions including autism (boris et al., 2007), alzheimer s disease (miller et al., 2011), multiple sclerosis (kaiser et al., 2009) and mdd (kemp et al., 2012). insulin resistance and impaired glucose tolerance has been observed at higher frequency in depression (almeida et al., 2009). a bidirectional relation between mood disorders and metabolic disturbances is well evident from the literature (barry et al., 2009). pioglitazone is well known drug in the treatment of insulin resistance or altered plasma glucose. considering the insulin resistance or altered plasma glucose as important pathogenic link for depression associated with obesity, the present study was designed to investigate the effect of pioglitazone on cums induced depression in obese mice using behavioral tests and biochemical estimations. behavioral experiments were conducted using male swiss albino mice (2025 g) that were procured from hissar agricultural university, hissar, india (reg. the animals were housed under standard laboratory conditions (temperature 22 2 c and room humidity 60 10%) and maintained on 12:12 h light/dark cycle and had free access to food and water. in india, committee for the purpose of control and supervision of experiments on animals (cpcsea) is established under prevention of cruelty to animals act 1960. cpcsea has a representative body at institute level named as institutional animal ethics committee (iaec). the experimental procedures performed on animals were in compliance with the protocol approved by iaec of birla institute of technology&science, pilani, india (protocol no. animals were fed with high fat diet (hfd) for 14 weeks, prepared according to srinivasan et al. pioglitazone and escitalopram was obtained from aarti drugs limited (tarapur, india) and ranbaxy laboratories limited (gurgaon, india) respectively, as a generous gift sample. the diagnostic kits for estimation of plasma glucose, total cholesterol, triglycerides and total proteins were purchased from spinreact, girona, spain. pioglitazone was prepared as a suspension in 0.25% sodium carboxyl methyl cellulose (cmc) freshly every day. pioglitazone was administered by oral gavage (p.o.) daily from day 1428 of the cums procedure (table 1). the dose of pioglitazone (30 mg/kg p.o.) was selected according to the earlier studies (kashani et al., 2013, sato et al., 2011, kubota et al., 2006). sixty mice were randomized based on body weight and divided into ten different groups (n=6/group). group i consisted of normal pellet diet (npd) mice receiving vehicle by gavage (10 ml/kg p.o.), group ii comprised of npd+pioglitazone (30 mg/kg p.o.), group iii comprised of npd+cums control, group iv consisted of npd+cums+pioglitazone (30 mg/kg p.o.), group v consisted of npd+cums+escitalopram (10 mg/kg p.o.), group vi comprised of hfd control, group vii consisted of hfd+pioglitazone (30 mg/kg p.o.), group viii comprised of hfd+cums control, group ix consisted of hfd+cums+pioglitazone (30 mg/kg p.o.) and group x comprised of hfd+cums+escitalopram (10 mg/kg p.o.). initially, for one week period, animals were only subjected to different stress procedures. from day 8th to 28th along with stress, animals of group ii, iv, vii and ix received pioglitazone (30 mg/kg p.o.), group v and x received escitalopram (10 mg/kg p.o.) using oral gavage daily once, whereas, group i, iii, vi and viii were administered with vehicle orally through oral gavage as a suspension of 0.25% sodium carboxyl methyl cellulose (cmc) (table 1). the cums was performed as described earlier (ducottet et al., 2003). briefly, the cums protocol consisted of the sequential application of a variety of mild stressors. these stressors were randomly scheduled over one week period as shown in table 2, and repeated throughout the 4 week experiment. non-stressed animals were left undisturbed in their home cages except during housekeeping procedures such as cage cleaning. the test was performed as described earlier (casarotto and andreatini, 2007) with minor modifications. briefly, before the test, mice were trained to adapt to sucrose solution (1%, w/v), two bottles of sucrose solution were placed in each cage for 24 h and then one bottle of sucrose solution was replaced with water for 24 h. after the adaptation, mice were deprived of water and food for 24 h. sucrose preference test was conducted at 9:30 a.m. in which mice were housed in individual cages and were free to access to two bottles containing 100 ml of sucrose solution (1% w/v) and 100 ml of water, respectively. after 24 h, the volumes of consumed sucrose solution and water were recorded and the sucrose preference was calculated by the formula as described in following equation.% sucrose preference=[sucrose consumption (ml)/water+sucrose consumption (ml)] 100 the spontaneous locomotor activity of hfd obese mice subjected to cums was measured by using actophotometer (boissier and simon, 1965, engeland et al., 2003) (inco, india) which consisted of a square arena (30 30 cm) and walls along with photocells just above the level of floor. on the day of experiment, before beginning of the tests, photocells were checked properly. as the beam of light is cut by the movement of animal the reading is automatically recorded by counter and displayed on the screen. mice from all the respective groups were gently placed in the center of the box individually. after initial 1 min of acclimatization period, the locomotor activity score was recorded digitally for next 4 min in a dimly lit room. after each test, the floor was cleaned thoroughly with 75% alcohol solution to eliminate possible bias due to odors left by previous mice. fst was performed as described previously (porsolt et al., 1977) with slight modification. briefly, the mice were individually forced to swim in a 25 12 25 cm (l b h) filled with water (23 2 c) up to a height of 15 cm. animals were allowed to swim for 15 min as training period 24 h before commencement of the test. on the test day, after the initial 2 min of vigorous activity, mice were observed for immobility for next 4 min. an animal was considered to be immobile whenever it remained floating passively in the water in a slightly hunched but upright position, its nose above the water surface. this immobile posture reflects a state of behavioral despair or helplessness (santiago et al., 2010). briefly, mice were suspended by the bands and hung from a hook mounted 50 cm above the floor for 6 min. the time that the mice spent immobile during the 6 min of the testing period was measured. the elevated plus maze was performed by the method mentioned earlier (adeyemi et al., briefly, it consisted of two open and two closed arms (all arms: 20 4 12 cm) made of wooden blocks elevated at a height of 25 cm from floor, which was lighten with 60 w bulb through a height of 100 cm. each mouse was placed in the central square (5 cm 5 cm) facing an open arm and allowed to explore the maze for 5 min of test period. the parameter measured was time spent in open arm and number of entries in open arm. the maze was cleaned with dilute alcohol in between two test sessions to get rid of residual odor. two days post behavioral tests, animals were bleeded by sinus retro-orbital route for collection of plasma in a tube containing 10 l of heparin solution and centrifuged at 10,000 rpm for 15 min. estimation of plasma glucose (trinder, 1969), total cholesterol (meittini et al., 1978), triglycerides (buccolo and david, 1973) and total proteins (koller, 1984) was done by using commercially available kits (spineract). data were analyzed using graph pad prism software version 2.01 (graphpad software, la jolla, usa). all the values are expressed as mean standard error of the mean (s.e.m.). the significance of differences between groups for behavioral and biochemical assays were analyzed using two-way analysis of variance (anova) followed by post hoc bonferroni test. for statistical analysis p hfd control group showed significantly (p<0.01) higher body weight compared to npd control animals. hfd mice exposed to cums showed significant weight reduction compared to hfd control group (p<0.01). repeated treatment with pioglitazone (30 mg/kg p.o.) and standard reference drug escitalopram (10 mg/kg p.o.) significantly [f (9, 50)=708.7, p hfd control animals showed significantly (p<0.01) reduced sucrose consumption compared to normal control animals (fig. 2). hfd+cums control group exhibited significantly (p<0.01) decreased sucrose consumption as compared to hfd control animals. chronic treatment with pioglitazone (30 mg/kg p.o.) and standard escitalopram (10 mg/kg p.o.) showed significantly [f (9, 50)=14.18, p<0.01] increased sucrose consumption in obese mice subjected to cums. the locomotor activity in normal, hfd obese and hfd+cums animals is shown in fig. no alteration was observed in the locomotor activity between the normal control and hfd control mice. however, obese mice subjected to cums showed significantly (p<0.01) decreased locomotor activity as compared to hfd control group. chronic treatment with pioglitazone (30 mg/kg p.o.) and standard drug escitalopram (10 mg/kg p.o.)< 0.01] reversed the cums induced reduced locomotor activity in obese mice. fig. 4 shows the effect of repetitive treatment on immobility time in fst in stressed obese mice. hfd control animals exhibited significantly (p<0.05) increased immobility time in fst compared to normal control animals. cums significantly (p<0.05) increased the immobility time in obese in fst compared to obese control group. pioglitazone (30 mg/kg p.o.) and standard escitalopram (10 mg/kg p.o.) significantly [f (9, 50)=18.56, p<0.01) reduced the immobility time in obese mice subjected to cums in fst. the effect of pioglitazone treatment on immobility time in tst is shown in fig. hfd control animals exhibited significant (p<0.05) higher immobility time compared to normal control group in tst. in obese animals cums significantly (p<0.05) increased duration of immobility as compared to hfd control group. chronic treatment with pioglitazone (30 mg/kg p.o.) and standard reference drug escitalopram (10 mg/kg p.o.) p<0.01] reduced the immobility time in obese animals subjected to cums compared to hfd+cums control group in tst. hfd group showed significantly (p<0.01) reduced percent time spent in open arm as compared to normal control animals. hfd+cums animals showed significantly (p<0.01) decreased time in open arm as compared to hfd control animals. however, percent open arm entries were not significantly altered in hfd and hfd+cums animals compared to normal and hfd control groups, respectively with pioglitazone treatment. repetitive treatment with pioglitazone (30 mg/kg p.o.) and standard escitalopram (10 mg/kg p.o.) showed significant [f (9, 50)=13.11, p<0.01] increased percent time in obese animals subjected to cums as compared to hfd+cums control group. pioglitazone (30 mg/kg p.o.) and standard escitalopram (10 mg/kg p.o.) did not showed significant effect on the percent open arm entries in obese mice subjected to cums. the effect of pioglitazone treatment on plasma biochemical parameters is shown in table 4. hfd control animals showed significant (p<0.01) increased levels of plasma glucose, total cholesterol, triglycerides and total proteins as compared to normal control animals. obese mice subjected to cums showed significant (p<0.05) increased plasma glucose as compared to hfd control animals, whereas no significant alterations in plasma total cholesterol, triglycerides and total proteins were observed in obese mice subjected to cums compared to hfd control group. chronic treatment with pioglitazone (30 mg/kg p.o.) and standard drug escitalopram (10 mg/kg p.o.) significantly reduced the elevated plasma glucose [f (9, 50)=9.89, p<0.01], total cholesterol [f (9, 50)=24.14, p<0.05], triglycerides [f (9, 50)=19.42, p<0.05] and total proteins [f (9, 50)=5.46, p<0.01] as compared to hfd and hfd+cums groups, respectively. several meta-analysis studies demonstrated that obesity is associated with increased risk of developing depression (zhao et al., 2009). the chronic consumption of hfd risks the anxiety and depressive-like behavior, heightens the hpa axis response to stress and leads to several biochemical modifications (sharma and fulton, 2012). the use of animal model for human mental disorder, despite of their oblivious limitation have proved to be of great value in the pre-clinical analysis for experimental validation of psychopharmacological assessment. it is reported that, chronic stress plays an important role in the onset and relapse of depression (lee et al., 2002). cums induced depression is probably the most popular and suitable model to study depressive behavior in rodents as it possesses higher face, construct and predictive validities, reflecting the similarities in the pathogenic and behavioral alteration in human and animal depression. cums model aims to simulate severe depressive-like condition that is developed gradually as those are generally observed in depression patients (luo et al., 2008). however, cums model provide insight but obviously can not recapitulate the complex pathophysiology of major depressive disorder (willner et al., 1992). these abnormal lipid levels inhibit the release of insulin in response to glucose that further worsens the insulin resistance (borchard, 2001). stress also plays a crucial role in the development of systemic inflammation that are considered as metabolic syndrome by elevating the levels of pro-inflammatory cytokines such as tumor necrosis factor-alpha (tnf-), interlukin-6 (il-6) (wisse, 2004). evidence supports the role of these inflammatory markers in development of diabetes (pradhan et al., 2001). earlier research has made a clear indication of the relationship between stress response, visceral fat, insulin resistance and hpa axis dysregulation (rosmond et al., 1998). it has been reported that psychosocial stress in primates leads to development of several abnormal conditions such as elevated corticosterone, insulin resistance, dyslipidemia, hypertension and coronary atherosclerosis (jayo et al., 1993). in humans stress causes abnormal cortisol secretion that further causes metabolic disorder such as insulin resistance, diabetes and psychological diseases such as depression, anxiety (rosmond and bjorntorp, 2000, raikkonen et al., 1994). hippocampus, striatum, frontal cortex and hypothalamus (drew et al., 2006) and expressed on immune cells (heneka et al., 2007). several clinical (kemp et al., 2006, kemp et al., 2012) and pre-clinical studies (eissa et al., 2009, sadaghiani et al., 2011) have described the antidepressant-like effects of ppar agonists rosiglitazone and pioglitazone. anhedonia indicates lack of pleasure or interest which is one of the major hallmark of human depressive symptoms and in animals this is evidenced through reduced preference for sucrose (willner et al., 1987, strekalova et al., 2006). further, high predictive validity models (cryan and slattery, 2007, cryan et al., 2005) like fst and tst were performed. in order to avoid the false positive results, locomotor activity score was measured and no alterations were observed in the basal locomotor activity between normal animals and hfd control animals. epm is widely used for screening anti-anxiety agents (hogg, 1996) where it reflects the psychomotor and emotional aspects in rodents which correlate with unconditioned anxiety. anxiolytics elevates the frequency of entries and time spent in open arms in epm (dawson and tricklebank, 1995). overall, the result of behavioral studies examines the antidepressive-like effect of pioglitazone by improving sucrose consumption, reducing immobility time in fst and tst, increasing percent open arm time in epm on cums induced depression in obese mice. furthermore, in the biochemical assessments, plasma glucose, total cholesterol, triglycerides and total proteins were estimated in obese mice subjected to cums. plasma glucose is one of the most important biochemical assessments as insulin resistance is observed in depression and obesity. earlier reports claimed insulin resistance due to excess cortisol release in the circulation owing to dysregulation of hypothalamus pituitary adrenal (hpa) axis, as observed in depressed and obese subjects (brown et al., 2004). obesity is well known metabolic disorder in which insulin resistance holds the key and is characterized by dysregulation of lipids (kahn and flier, 2000, lee et al., 2013). in the earlier reports it is well understood that, an association of dyslipidemia and obesity with the individuals reflecting more depressive and anxiety-like behavior (van reedt dortland et al., 2010). reduced level of total proteins in depression (maes et al., 1995) whereas, unclear influence of total protein synthesis in obesity is well discussed previously (anderson et al., 2008). our study showed elevated plasma glucose, total cholesterol, triglycerides and total proteins in hfd obese mice subjected to cums. pioglitazone reversed these biochemical alterations through agonistic action at ppar-gamma receptor thereby increasing the peripheral glucose utilization. moreover, we claim that altered glucose or insulin resistance as major hallmark for depressive behavior associated with obesity and treatment of the altered glucose or insulin resistance ameliorates these co-morbid disorders. the results of biochemical assessments showed similarities with the earlier reports suggesting improved insulin sensitization and lipid lowering properties of pioglitazone by regulating a transcription factor responsible for glucose and fat metabolism (srinivasan et al., 2004). from a mechanistic standpoint, improved depression severity with repetitive pioglitazone treatment may occur due to decreased in visceral adiposity and inflammation, and improved insulin sensitivity., 1997) that may mediate improved depressive behavior by increasing neuronal survival (fuenzalida et al., 2007), increasing glial uptake of excitotoxic molecules (romera et al., 2007), or modulating calcium dependent pathways in the brain (pancani et al., 2009). a better understanding of the mechanisms linking insulin resistance with depression could provide therapeutic strategies with novel mechanisms. although the exact mechanism(s) of pioglitazone is not well understood, it is known to decrease free fatty acid levels and insulin gene transcription, to remodel lipid distribution and to improve glucose disposal in insulin-resistant individuals (schinner et al., 2009). at the molecular level, it acts as ligands for ppar, a nuclear receptor of the nr1c family, expressed predominantly in adipose tissue. in addition to improving glucose disposal, pioglitazone favorably altered lipid distribution in the body. deposition of fat in the non-adipose tissue such as liver and muscle has been implicated in the development of insulin resistance. the ppar agonist pioglitazone is known to improve lipid distribution, insulin sensitivity and to suppress hepatic glucose production (vikram et al., 2010). the plasma glucose and lipid profile was reduced by pioglitazone in our findings in obese animals exposed to chronic stress. this was our preliminary investigation suggesting that as pioglitazone has ability to cross bbb, future research exploring this mechanism could turn out very crucial. also, pioglitazone has ability to improve peripheral insulin sensitivity by controlling the blood glucose and lipid distribution. therefore, studying and exploring the mechanisms of pioglitazone including both central action and peripheral action could be very interesting area of for future research in the field of metabolic brain disorders such as co-morbid depression, anxiety associated with obesity. in conclusion, in the present study chronic treatment with ppar agonist, pioglitazone reversed the cums induced behavioral and biochemical changes in obese mice, thus exhibiting antidepressive-like effect. the plasma glucose level indicates that the altered plasma glucose or insulin resistance, to play a crucial role in such co-morbid disorders and pioglitazone through activation of ppar receptors alleviated the altered plasma glucose or insulin resistance and exhibited antidepressant-like effect. however, these are only the preliminary findings and hence, further studies dealing with the role of pioglitazone with respect to molecular mechanisms including brain derived neurotrophic factor (bdnf), corticosterone levels, mrna expression in cortex and hippocampus in depression associated with obesity will shade light on the mechanism aspects.

pioglitazone, a peroxisome proliferator activated receptor gamma (ppar) agonist belonging to thiazolidinedione class, is mainly used in diabetes mellitus. obese subjects are twice likely to become depressed than non-obese individuals. the biological mechanisms linking depression with obesity still remain poorly understood and there is immense need for better therapeutic intervention against such co-morbid disorders. the present study investigates the effect of pioglitazone on the chronic unpredictable mild stress (cums) induced depression in obese mice by using behavioral tests and biochemical estimations. mice were fed with high fat diet (hfd) for 14 weeks and were further subjected to different stress procedures for 28 days to induce depressive behavior. animals were administered orally with pioglitazone (30 mg/kg p.o.)/escitalopram (10 mg/kg p.o.)/vehicle (10 ml/kg p.o.) daily from day 1528. various behavioral paradigms such as sucrose preference test, forced swim test (fst), tail suspension test (tst) and elevated plus maze (epm) were performed. biochemical estimations including plasma glucose, total cholesterol, triglycerides, and total proteins were performed. the data obtained from behavioral assays and biochemical assessments indicated that obese animals exhibited severe depressive-like behavior compared to non-obese animals. furthermore, obese animals subjected to cums worsen the depressive behavior compared to obese control animals. repetitive treatment with pioglitazone reversed the cums induced behavioral and biochemical alterations in hfd fed obese mice which atleast in part may be mediated through improving altered plasma glucose. the study suggests that pioglitazone needs further attention with respect to molecular mechanisms that could provide a better therapeutic strategy against depression associated with obesity.

PMC5146196

pubmed-852

with increasing medical care costs and a weakening economy more attention is being placed upon obtaining value from how health care dollars are spent. initiatives to obtain increased value from health care purchases are especially focused upon perceived waste (aaron, 2008). the frequency and cost of hospital acquired complications are at the forefront of perceived waste since hospitals, patients and payers are all adversely impacted by their occurrence. following the final implementation of the national uniform billing committee changes (ub 04) on may 23, 2007, the standard claims form was modified to allow the submission of a present on admission (poa) indicator for each diagnosis. in october of 2007, medicare began requiring that the poa indicator be submitted on all medicare claims. this change has permitted, for the first time, the ability to distinguish, using standard claims data, complications that are hospital acquired from those developed prior to admission. both payers and hospital providers have responded to this newly acquired, and evolving, information source by developing initiatives to reassure stakeholders that they are focused upon meaningful change to improve the quality of health outcomes. as required by the deficit reduction act of 2005 (p. l. 109-171), cms has led the way for payers by enacting a policy whereby any payment increase due to the occurrence of a limited range of hospital acquired complications is eliminated. for cms the anticipated reduction in spending is $21million out of the total $105 billion (.02%) that is currently paid for inpatient hospital operating payments within the inpatient prospective payment system for short term acute hospitals (centers for medicare&medicaid services, 2008). as preemptive initiatives, many hospital associations have responded by creating voluntary guidelines for specified adverse events (so called never events) where no charge is made to payers. while the purpose of these payment reductions is to provide incentives to improve quality, the amount of payment currently associated with these efforts, relative to the total cost of hospital care, is very small. it is the purpose of this article to develop an estimate of the incremental cost of different types of hospital acquired complications and to determine the total incremental cost burden of hospital acquired complications on the health care system. improved estimates of the magnitude of incremental cost incurred by short term acute hospitals due to hospital acquired complications should stimulate debate around the financial justification for supporting quality improvement efforts aimed at reducing hospital acquired complication rates. further, the availability of estimates of the incremental cost of individual types of hospital acquired complications will expand the policy options open to cms for broadening the range of the hospital acquired complications subject to payment reductions. while it is important to understand that not all hospital acquired complications can reasonably be thought of as being preventable, high complication rates at individual facilities, after adjusting for the mix and severity of illness of patient admissions, are indicative of low quality care and system waste (peng, kurtz, and johannes, 2006). in order to identify the complete spectrum of hospital acquired complications the potentially preventable complication (ppc) were used in this analysis (hughes et al., 2006). ppcs identify potentially preventable harmful events or negative outcomes originating during inpatient care that result from the processes of care and treatment rather than from the natural progression of underlying disease. ppcs contain 64 mutually exclusive types of inpatient complications that are identified from 1,450 icd-9-cm secondary diagnosis codes not present on admission, and from selected icd-9-cm procedure codes. a post admission complication may be preventable for some types of patients but not for others. therefore, the ppc methodology includes a series of clinical exclusions that prevent a ppc from being assigned to a patient when there are other underlying diseases present at admission for which the complication would represent an inevitable, natural or expected progression, consequence or manifestation of a pre-existing underlying condition. patients having one or more ppcs present can be hypothesized as having additional costs in comparison to similar patients who do not. for example hospital costs will increase when a patient develops a urinary tract infection (uti) due to an indwelling urinary catheter (iuc) during a hospital stay. patient treatment costs vary depending upon the patient's reason for admission, severity of illness at the time of admission and the presence of post admission complications. isolating and quantifying the incremental cost of a specific type of complication requires the disentangling of these interrelated factors. in order to adjust for the mix and severity of illness of patients, all patient refined diagnosis related groups (apr drg) were used to classify patients in terms of their reason for admission and severity of illness at the time of admission (averill et al., 2002; sedman et al., 2004). version 26.1 of the apr drg system incorporates an admission apr drg as standard output. the admission apr drg differs from the discharge apr drg in that only those conditions that were reported as present, or can be clinically assumed to be present, at the time of admission are used in making the apr drg assignment. conditions or complications that occurred during the hospital stay are not used to assign a patient to an admission apr drg. procedures that were clearly related to a post-admission event (i.e., complications) are also excluded from the admission apr drg assignment. apr drgs assign each patient to one of 314 base apr drgs that describe the patient's reason for admission and further subdivides each base apr drg into four levels of illness severity (soi) subclasses. the term apr drg is used to refer to the 1,256 base apr drg and soi subclass combinations. maryland and california require the reporting of the poa indicator for all short-term acute hospital patients. in maryland, hospital data can be obtained from the health services and cost review commission (hscrc), while in california, hospital data can be obtained from the office of statewide planning and development. fiscal year 2008 (july 2007 june 2008) maryland data and fiscal year 2006 (october 2005 the consistency of reporting of the poa data in the two data sets was evaluated using an extensive set of edits. of the 48 hospitals in the maryland database, five hospitals comprising 83,863 patient claims were removed. of the 353 hospitals in the california database, patient claims with a discharge status of transferred (2) or expired (20) were excluded from analysis, as were claims that were classified within claims that had total charge values below $200 or above $2,000,000 were similarly excluded because extraordinarily high and low cost claims have the potential to introduce significant estimation error into the regression model. further, the dollar exclusion threshold was introduced in the absence of a systematically applied policy to determine outliers within apr drgs and the lack of availability of hospital specific cost to charge ratios for the california data. maryland's hscrc regulates hospital charges to closely track efficient hospital costs thereby obviating the need to incorporate cost to charge ratios. in applying its rate setting methodology the hscrc creates approved base rate values, charge per case (cpc), that factor in estimates for indirect medical education (ime), disproportionate share (dsh), uncompensated care, capital and labor variations. additionally, charge patterns are constrained so as to match reported cost at a service level. maryland claims charges were standardized using hospital specific cpcs to equate individual hospital charges with the statewide average. the california data lacked both the hospital specific payment variables available in the maryland data and a hospital specific identifier that could be linked to hospital cost data made public through the medicare program. instead a single standard approximation of a statewide cost to charge ratio was applied to all charges to transform charge values to more closely approximate actual cost. the cost to charge ratio used was 0.264 and derived from the hospital unweighted median cost to charge ratio used by california's division of workers compensation effective april 1, 2007 (division of workers compensation, 2007). this is a linear transformation with the singular purpose of simplifying subsequent interpretation of coefficient values rather than correcting estimation error. california data was therefore not adjusted for the effect of variation in cost to charge ratios across hospitals and service lines. similarly, the known effects upon costs posed by teaching programs, the prevalence of indigent patients and geographically induced input cost variation was not adjusted for. as with any predictive estimate attempting to relate costs to charge patterns, the inability to adjust for these factors in the california data reduces the accuracy of the incremental cost estimates. the final california analysis database contained 235 hospitals comprising 1,836,396 patients. inpatient hospital claims for the maryland and california data sets no adjustment, other than the specified $200/$2 million exclusion, was made to exclude extraordinarily high or low cost claims having created two independent analysis databases (maryland and california), with admission apr drgs assigned, approximate claim level costs calculated and ppcs identified, a simple linear regression was specified of the form: cost i is the adjusted charge for claim i apr drg k, i is a binary variable (0,1) indicating which of the 1,256 admission apr drg k was assigned to the i claim ppc ji is a binary variable (0,1) indicating which of the j ppcs were present on the i claim is the average cost for a reference apr drg, excluding the incidence of ppcs, which acts as a constant cost contribution to each claim k is the coefficient associated with apr drg k and measures the incremental cost above due to the patient's reason for admission and admission severity of illness level j is the coefficient associated with ppc j and measures the incremental cost for patients with ppc j relative to patients that do not have ppc j i is the residual error of the model for discharge i as specified, the regression model hypothesizes that cost increases associated with ppcs are both uniform and act independently of the base apr drg and severity level to which they are assigned. the hypothesized model treats the cost of complications as both additive and uniform across apr drgs. estimates of incremental cost associated with a specific ppc can therefore be interpreted as constant amounts independent of the specific apr drg in which they occur and independent of the presence of other ppcs. to calculate stable estimates first, if an apr drg had fewer than 21 claims assigned, all patients assigned to the apr drg were omitted from the analysis. correcting for low volume apr drgs is particularly important because an imprecise estimate of the average cost in an apr drg could impact the estimate of the constant coefficient for a ppc applied across all apr drgs. second, a t-test was applied to identify apr drgs that had coefficients that were not statistically significant at the 0.05 level. such apr drgs were omitted from the analysis database because lack of statistical significance implies excessive cost volatility in those apr drgs. no attempt was made to retain apr drgs by introducing a synthetic outlier policy to reduce the impact of extraordinary costly claims. to do so would be to import assumptions surrounding the causation of outliers and potentially their relationship with ppcs. as detailed below, the application of these statistical edits had minimal impact on the final retention of claims within the analysis database. twenty-nine of the possible 1,256 apr drgs had no claim volume while 217 apr drgs had fewer than 21 claims, resulting in 1,920 claims being removed from the analysis database. an additional 22 apr drgs were not statistically significant resulting in an additional 5,914 claims to being removed from the analysis database. in total 7,834 (1.2%) claims after standardization the sum of adjusted charges (approximate cost) for the remaining claims was $6,504,557,501, approximately $9,980 per included claim. in the maryland database 36,474 patients had one ppc (5.6%) and 14,518 patients had multiple ppcs (2.2%). nineteen of the possible 1,256 apr drgs had no claim volume while 150 apr drgs had fewer than 21 claims, resulting in 1,214 claims to being removed from the analysis database. an additional 10 apr drgs were not statistically significant resulting in an additional 1,147 claims to being removed from the analysis database. in total 2,361 (0.1%) claims after standardization the sum of adjusted charges (approximate cost) for these remaining claims was $18,509,876,873, approximately $10,090 per included claim. in the california database 72,819 patients had one ppc (4%) and 29,026 patients had multiple ppcs (1.6%). the fit of the regression model for estimating per patient cost, measured by the adjusted r statistic, was 0.58 for maryland data and 0.60 for california data. this result is obtained by using the apr drg assigned at admission with separate identification of ppcs that occur after admission to predict patient cost. the combination of admission apr drgs and ppcs therefore offers a robust fit for the variation in per claim costs. for each of the 64 ppcs in the second column of table 1, the coefficient value (coeff) measures the incremental patient cost (i.e., j) above that of patients in the same admission apr drg associated with the presence of the ppc after accounting for the presence of other ppcs. this value is referred to as the incremental cost of the ppc. since the regression model is additive, multiplying the frequency (freq) of the ppc by its incremental cost calculates a total cost associated with each ppc. the total cost for all included claims in the maryland data is $6,504,557,501, of which $626,416,710 (9.63%) is associated with ppcs. an asterisk in the standard error column indicates that the incremental cost estimate for the ppc is not statistically significant. ppc 32 transfusion compatibility reaction is statistically significant but should be interpreted cautiously due to the low volume of observations. the impact upon total costs of the 13 ppcs that are not statistically significant is minimal. in column 6 the total estimated cost for each ppc, (freq*coeff), thus, pneumonia and other lung factors, ppc 5, contributes 0.93% to total inpatient cost. in column 7 the total estimated cost for each ppc, (freq*coeff), is divided by the total cost of all patients who had that ppc expressed as a percentage. thus, for patients who had the ppc, column 7 is the average per patient cost increase due to the ppc. for example, utis (ppc 22) account for 0.67% of total inpatient hospital costs (column 6) and on average when a uti occurs patient level cost increases by 19.6% (column 7). california claims constitute a similar percentage of total costs associated with ppcs (9.39% percent for california versus 9.63% for maryland). as shown in table 2, 3 ppcs have no volume and 8 ppcs lacked statistical significance. as with maryland data table 3 ranks 48 ppc coefficient estimates that are considered statistically significant in both databases. the spearman's rank correlation coefficient is 0.90 indicating that the relative value of coefficient estimates is highly correlated between the two states. the coefficient estimates for both california and maryland data in table 3 show significant bunching around ppc types. for example the eight ppcs with the lowest predicted values of incremental cost in the california data (ranks 48 41) correspond with the same eight ppcs in maryland data and occupy a range of $2,720 in california and $2,312 in maryland. the california ppc coefficients are larger for 41 of the 48 ppcs while the estimation of the percentage of total cost associated with complications is greater in maryland. given the independence of the two data sources it is not to be expected that the two sets of results would be identical, but it is worth addressing these findings in more detail. firstly, while the estimated incremental cost per ppc is generally higher in california than maryland, the cost per claim utilized in the estimates for california is also higher ($ 10,090 versus $9,980). moreover, to interpret the difference in coefficient magnitude from the two databases, the average claims value for each needs to be adjusted for case mix intensity. relative weights for this purpose were calculated using the healthcare cost and utilization project (hcup) claims data for cy2006. apr drg v26.1 weights were calculated from claims data based upon time of discharge for this portion of the analysis. the resultant average statewide case mix value, case mix index (cmi), was computed for california and maryland. the cmi for the california claims was found to be 1.08, while the cmi for maryland claims was 1.12. deflating the average value observed for each database by its cmi yields adjusted values of $9,323 for california and $8,929 for maryland. a more accurate comparison of coefficients is therefore obtained by reducing the magnitude of coefficients in the california data by 4.4% ($ 9,323/$8,929). this adjustment results in ppc 14 having a larger estimated coefficient for maryland than california while the estimation differences between other ppcs is narrowed. a second contributing factor to the observed differences is the relationship between patient severity at the time of admission and the frequency of complications (hughes et al., 2006; thomas and brennan, 2000). academic medical centers (amcs) tend both to treat patients of higher severity and to be higher cost hospitals. the combination of these two factors means that complications at amcs are likely to be more frequent and to be relatively more costly as they originate in settings with relatively more expensive cost structures. maryland data was adjusted for the inflationary effects of ime and dsh while california data was not. the lack of standardization acts to increase the estimated coefficients within california relative to maryland. a third contributing factor to the observed differences is the relative completeness with which diagnoses are coded upon claims. within the california database secondary diagnosis codes were submitted at an average rate of 5.1 per claim. for the maryland database this figure rises to 9.1 per claim. unsurprisingly the frequency with which ppcs are submitted on maryland claims is greater than that observed in california, both for claims with single (5.6% versus 4.0%) and multiple (2.2% versus 1.6%) ppcs. maryland's allpayer claims data is the basis for hospital payment and uses the apr drg classification system. the change to apr drg based payment has been accompanied by an increase in coding completeness (health services cost review commission, 2005). variation in coding completeness impacts both the estimation of per ppc cost and the estimate of total cost associated with complications. the regression model can not distinguish increased cost attributed to complications where no complication is reported. since the incremental cost associated with a ppc is estimated relative to the underlying average apr drg cost, the estimate of incremental ppc costs will be reduced if no complications are reported. this results because the cost of unreported complications within the regression is attributed to the apr drg average cost. this effect is likely to be relatively small as claims with ppcs make up relatively small percentages of claims within an apr drg. however, for claims with at least one ppc, the failure to code all ppcs which are truly present causes the incremental cost associated with other uncoded ppcs to be attributed to the incremental cost estimate of coded ppcs. this effect may have a more substantial impact on the estimate of incremental ppc cost than the costs of some ppcs being incorrectly attributed to the apr drg average cost. if complications are being more consistently reported in maryland then the expectation would be for the estimate of incremental ppc cost in maryland to be lower than that for california. data limitations and differences in the pattern of coding may therefore explain variations in both the frequency of complications and their associated contribution to total hospital cost. the source of variation may also stem from real differences being observed in the data. for example, the increased frequency of complications may result from lower quality hospital care in maryland an interpretation that can neither be rejected nor supported in this analysis; however, there is no externally corroborating evidence that lower quality care in maryland is a causal factor. external rankings of statewide hospital quality tend to indicate that the opposite is in fact true (healthgrades, 2007). alternatively the frequency of reported complications may be higher in maryland due to a greater underlying complexity in patient mix. the accuracy of the incremental cost estimates for the ppcs assumes that apr drgs provide an adequate measure of patient severity of illness. it is particularly important that there are no unmeasured aspects of severity of illness with strong correlation to the presence of ppcs that would serve to increase costs and upwardly bias estimates of the incremental cost of ppcs. if such unmeasured aspects of severity of illness existed then it can be hypothesized that patients with unmeasured severity would be concentrated in hospitals with certain characteristics. one study simulated an apr drg based payment system using california data in which payments were reduced when a major ppc was present (averill et al., 2006). using the hospital payment reduction due to ppcs as the dependent variable, the impact of the reduction upon the hospital case-mix index and number of hospital discharges was estimated using a regression model. the adjusted r for the model was only 13.28 indicating a weak association between ppc related payment reductions and these hospital characteristics. while not conclusive, the results suggest that the extent to which unmeasured severity influences the estimates of incremental cost associated with ppcs is minimal. central to the analysis is an assumption that the post admission complications identified by the ppcs are preventable. one study demonstrated that catheterrelated blood stream infections, ppc 54, could be reduced by 66 percent through evidence based interventions (pronovost, goeschel, and wachter, 2008). unfortunately, there is very little data like that for catheter-associated blood stream infection that explicitly quantifies the preventability of specific types of complications. the new york department of health has provided comparative reports on ppc rates to new york hospitals for several years. some hospitals have reported that they have been able to use the ppc reports to lower the occurrence of complications (editorial board, 2009). except for a few so-called never events that are almost always related to preventable medical errors such as foreign objects left in after surgery complications will never be totally preventable even with optimal care (averill et al., 2009). most post-admission complications (such as pulmonary embolism or post-operative mi) are not clearly linked to medical errors, and although they may relate to errors in judgment or lapses in execution that reflect poor quality care, they can not be considered always preventable. of the 64 categories of preventable complications (ppcs) evaluated with the maryland and california data, statistically significant estimates for incremental costs incremental ppc costs are estimated to account for more than 9% of total inpatient hospital cost. earlier studies have estimated the cost of catheter-related blood stream infections at $18,000 compared to the $22,000 observed in the maryland data found here which offers a measure of reasonableness for the results (perencevich and pittet, 2009). the impact ppcs are seen to have on hospital cost demonstrates that there are substantial opportunities for both hospitals and payers to improve quality while reducing expenditure. the medicare inpatient pps fully incorporates ppc related cost into relative weights. the narrow definition of hacs, as currently employed by cms, has such a limited impact on payments that the medicare inpatient pps essentially continues to pay the full ms drg payment rate for virtually all patients. thus, if hospitals can reduce their ppc rates, they can substantially increase their per case profit margins. conversely, payers are paying hospitals at a level that includes substantial costs associated with ppcs. payers need to provide hospitals greater incentive to reduce complications by reducing payments when a ppc occurs. hospital payment systems can be complex with many interrelated adjustments, necessitating payment redesign to be carried out with care. for example, in the medicare inpatient pps, the removal of a ppc diagnosis from ms drg assignment can be used to assign the patient to a lower paying ms drg. however, the assignment to a lower paying ms drg may make the hospital eligible for outlier payments which could entirely or partially offset the payment reduction. thus, as payment adjustments for complications are imposed, the impact on outlier payments must be taken into consideration by adjusting outlier threshold levels. data on the cost of specific types of complications, such as those presented in this article, will be essential to such adjustments. identifying the cost of specific complication types can also act as a basis for payers contracting under per diem arrangements to introduce actuarially representative quality incentives. the inherent probabilistic nature of the preventability of complications presents significant problems for the expansion of the current cms payment policy related to hospital acquired complications (hacs). for every case with an hac, the hac payment policy eliminates the entire payment increase generated by the hac implying that hacs are always preventable. as a result, hacs have been limited to the relatively few complications that are, arguably, nearly always preventable but have minimal impact on medicare inpatient hospital expenditures. in order to substantially increase the scope of hacs, the current hac case-by-case payment reductions and the implied preventability of the hac for similarly, the hac payment policy could be revised to reduce payments for hospitals with high hac rates. assuming that the number of excess hacs in a hospital can be identified by comparison of risk-adjusted hac rates then the number of excess hacs in a hospital will need to be converted into a payment adjustment amount for the hospital. estimates of incremental costs for ppcs, like those computed here, can provide a basis for converting the excess complications observed in a hospital into a payment adjustment amount, thereby expanding the policy options open to cms for expanding the range of complications applicable to a payment reduction. it was beyond the scope of this analysis to include additional costs associated with a complication that are incurred beyond the inpatient stay. the end of a hospitalization does not mark the period where all hospital acquired complications have become apparent. the estimate of incremental ppc costs carried out here does not factor in the degree of preventability of a complication or how much of the identified hospital cost may be considered fixed rather than variable. the use of claims data, whether to identify complications or to estimate incremental costs, is not free from criticism. claims submissions are subject to variation in accuracy, both through the coding and documentation process. hospital accounting functions are rarely sophisticated enough to identify and allocate patient level costs, while the standardizing of hospital cost data has already been described here as both imperfect and offering the potential for bias. variation in coding completeness can contribute to both bias in the total estimated cost of complications and the estimate of incremental costs for individual ppcs. despite these potential data limitations the hypothesized model delivers statistically valid estimates for the incremental cost of complications within the data sets from which they are drawn. these results, obtained from two distinct sources, are generally consistent providing an indication of the robustness of both the method and results. two state's claims databases, from disparate regions of the country, with hospitals paid under different auspices and with cost standardized using different methods, independently yield very similar estimates for the cost of potentially preventable complications. at a patient level the impact of preventable complications on cost for many routinely observed complications, such as utis and catheter-related blood stream infections, is substantial. potentially preventable complications are estimated to add 9.4%-9.7% to hospital inpatient costs. with national estimates of inpatient hospital care costs totaling $940 billion in 2006 (american hospital association, 2008), the 0.02% hac payment reduction currently implemented by medicare while very limited in scope is an important first step toward addressing a problem with substantial cost implications. the robust incremental cost estimates for complications, obtained by treating hospital acquired complications as additive, categorical events, may open the door to alternative ways to design payment systems so as to provide greater incentives to significantly reduce hospital complications .

california and maryland hospital data are used to estimate the incremental cost associated with 64 categories of hospital acquired complications. the reason for admission, severity of illness at admission and the presence of hospital acquired complications are used in a linear regression model to predict incremental per patient cost yielding an adjusted r2 of 0.58 for maryland data and 0.60 for california data. the estimated incremental cost due to each of the 64 categories of complications was consistent across both databases and accounted for an increase in total short term acute inpatient hospital cost of 9.39 percent in the california data and 9.63 percent in the maryland data.

PMC4195062

pubmed-853

many people, approximately 20% of the population, suffer from allergic rhinitis worldwide. from the clinical point of view, allergic rhinitis causes sneezing, nasal discharge, and nasal obstruction. from the immunological point of view, allergic rhinitis is a typical th2 immune disorder characterized by a high level of antigen specific ige production. because the enhanced ige production and inflammatory response in rhinitis are due to predominant production of th2 cytokines such as il-4, the allergic symptoms can be alleviated by inhibition of th2 cytokine responses. many researchers have investigated allergic rhinitis using an animal model.1, 2, 3 the model of allergic mice made by ova sensitization and challenge had increased serum ige and eosinophil. shin'iseihaito (ssht; magnolia flower lung-clearing decoction; xn y qng fi tng), a formula consisting of nine crude drugs, has been used for the treatment of nasal diseases such as chronic sinusitis in traditional japanese kampo medicine (r bn hn y) and traditional chinese medicine (tcm; zhng y).4, 5 more than 50% of individuals with allergic rhinitis have clinical or radiographic evidence of chronic sinusitis and 2558% of individuals with sinusitis have aeroallergen sensitization. previous researches suggest that chronic sinusitis could be an atopic disease driven by ige sensitization to aeroallergens. from these studies however, it has not been clarified for its role in anti-allergy therapy before. thus, in the present study, we investigated whether ssht is able to suppress the murine allergic reaction induced by nasal sensitization. female balb/c mice (japan slc ltd, hamamatsu, japan) were used. shin'iseihaito consists of 3.0 g (daily dose for human) of gypsum fibrosum (sh go), 3.0 g of tuber of ophiopogon japonicus (mi mn dng), 1.5 g of root of scutellaria baicalensis (hung qn), 1.5 g of rhizome of anemarrhena asphodeloides (zh m), 0.75 g of fruit of gardenia jasminoides (zh z), 1.5 g of bulb of lilium lancifolium (bi h), 1.5 g of flower of magnolia salicifolia (xn y), 0.5 g of leaf of eriobotrya japonica (p p y), 0.75 g of rhizome of cimicifuga heracleifolia (shng m). these crude drugs were boiled, filtered, and the decoction was dried to yield powdered extract (ssht, 2.5 g for daily human dose). ssht (lot: 14b019) was provided as a generous gift from the kobayashi pharmaceutical co., ltd (osaka, japan). ssht was suspended in distilled water to prepare the stock solution at a concentration of 0.1 g/ml and kept in 20 c until use. allergic murine models were established based on the previously described methods with minor modifications.7, 8 the experimental timetable is provided in fig. 1. mice were intraperitoneally administered 0.1 mg/ml ova (sigma aldrich, st. louis, mo, usa) and 40 mg/ml al(oh3) in saline at a dosage of 100 l/mouse. sensitization was repeated twice (days 0 and 7), followed by daily injections of ova solution (15 mg/ml in saline, 10 l/each nostril) into nostrils from day 1428 (challenge). in the ssht-treated group, mice were force-fed ssht (10 mg/0.1 ml/10 g body weight (bw)/day, 20-fold of human dosage) from day 1328. mice in the control group were given an equal volume of saline and were infected using the same method. at the end of animal experiment, all animal procedures were approved by the institutional animal care and use committee at nagoya city university, japan. blood samples from the allergic murine model were collected after 2 h of the last challenge on day 28. the number of leukocyte and eosinophilia were measured in tohkai cytopathology institute (gifu, japan). concentrations of serum total ige, il-4, and ifn- were evaluated using mouse ige elisa, mouse il-4, and mouse ifn- elisa kit (biolegend inc. san diego, ca, usa) according to the manufacturer's instructions, respectively. cytokine levels were calculated using standard murine recombinant cytokine curves run on the same immunoplate. the untreated female 6 week-old balb/c mice were injected intradermally with 10 l aliquot of 50 fold diluted anti-ova of serum in saline into shaved dorsal skin sites. after two days, ova (0.1 mg) with 0.5% evans blue (wako pure chemicals, osaka, japan) in saline was injected intravenously into the tail vein. one hour after antigen challenge, mice were euthanized and the dorsal skin of the mouse was removed to measure the pigment area. the area of blue spots on the internal surface of the skin was measured.10, 11 statistical analysis was performed by repeated one-way analysis of variance (anova) and the tukey/bonferroni/dunnett's multiple comparison test. a probability value (p<0.05) was considered to be statistically significant. the leukocyte levels were significantly higher in allergic mice than those in untreated mice, but those levels were not significantly changed by ssht-treatment [fig. the eosinophilia levels were significantly higher in allergic mice than those in untreated mice. compared to allergic mice, the allergic rhinitis mice treated with ssht had significantly decreased eosinophil levels (p<0.01) [fig. the ige levels were higher in allergic mice than those in untreated mice. compared to allergic mice, the il-4 levels were significantly higher in allergic mice than those in untreated mice. compared to allergic mice, the allergic mice treated with ssht had also significantly decreased il-4 levels (p<0.01) [fig. the ifn- levels were significantly lower in allergic mice than those in untreated mice. compared to allergic mice, the allergic mice treated with ssht had also significantly increased ifn- levels (p<0.01) [fig. 3c]. as we found that the eosinophilia and cytokine level of allergic mouse treated with ssht were remarkably decreased the sera containing ova-specific anaphylactic antibodies were intradermally injected and the pca reaction was measured 1 h after the injection of the evans blue solution containing ova. we observed that pca reactions using the sera of allergic mice were exhibited as blue spots. however, the average sizes of blue spots were significantly decreased in the sera of ssht-treated allergic mice compared to those in the sera of allergic mice. in the present study, we showed that the administration of shin'iseihaito (ssht; magnolia flower lung-clearing decoction; xn y qng fi tng) is capable of suppressing the ige and il-4 levels in murine allergic reaction induced by nasal sensitization. thus, our result showed that ssht may return the decreased ifn-/il-4 (th1/th2) ratio of the allergic group to the normal range. this result may also explain the reasons why the administration of ssht suppressed the production of anti-ova ige antibody without affecting the development of cd4 t cells, since il-4 is the cytokine known to induce immunoglobulin class switching to ige. il-4 is known to serve not only as a mast cell growth factor but also as the major mast cell chemoattachment. therefore, it is possible that the decrease of th2 responses in nasal mucosa modulated the mast cell (ige)-mediated nasal symptoms, in concert with the decreased production of anti-ova ige antibody. our result of pca reaction also demonstrated that ssht inhibited the anaphylaxic factors such as ige and other antigens. the precise mechanism of the effect of ssht on pca reaction is to be determined in a future study. although our results demonstrate that ssht had anti-inflammatory effect, each individual component of ssht also shows anti-inflammatory effect. especially, the flower of m. salicifolia (xn y) has several anti-inflammatory effects including the inhibitory effects of mast cell-derived histamine release and pca reaction.14, 15, 16, 17 the fruit of g. jasminoides (zh z) inhibits the histamine release from mast cells and lowered the serum level of ige and histamine in allergic murine model. the rhizome of a. asphodeloides (zh m) inhibits nf-b transcription activity via the p38 mapk and erk pathway. the leaf of e. japonica (p p y) had anti-inflammatory effect with attenuation of p38map kinase and erk. some researcher reported that the root of s. baicalensis (hung qn), the bulb of l. lancifolium (bi h), and the tuber of o. japonicus (mi mn dng) had anti-inflammatory activity.21, 22, 23 although each component has anti-inflammation effect, this mechanism in detail has been unknown. japanese traditional kampo medicine (r bn hn y) is generally composed of several components and the interaction of them may enhance the effect of drugs. as further investigation from this perspective is needed, ssht may have pronounced anti-inflammatory effects. administration of shin'iseihaito (ssht; magnolia flower lung-clearing decoction; xn y qng fi tng) is capable of improving allergic status in ova-induced allergic murine model. further studies are required to confirm the anti-allergy effects and elucidate the mechanisms of anti-allergy action of ssht in allergic murine model.

shin'iseihaito (magnolia flower lung-clearing decoction; xn y qng fi tng), a formula of traditional japanese kampo medicine (r bn hn y) and traditional chinese medicine (tcm; zhng y), has been used for the treatment of chronic sinusitis. the objective of this study was to evaluate the anti-allergic effect of shin'iseihaito on murine allergic reaction induced by nasal sensitization using ovalbumin (ova) as an antigen. extract of shin'iseihaito (ssht) could reduce the eosinophil, serum ige and interleukin (il)-4 levels, while increased the interferon (ifn)- levels in allergic mouse. furthermore, allergic-murine serum treated with ssht could not activate passive cutaneous anaphylaxis (pca) reaction in murine model. thus, our study showed that ssht may possess anti-allergic activity. we suggested that ssht may contribute to inhibit the exacerbation of allergic reaction induced by nasal sensitization.

PMC4936765

pubmed-854

during the past two centuries, the anatomical variations of the axilla have been described in both textbook of human anatomy and more recently in those of operative surgery. a muscle extending from the latissimus dorsi to the pectoralis major muscle has been called axillary arch or langer's axillary arch. this occurs in at least 7% of different populations but may not always be clinically apparent. among the muscles the usual lesion is absence of the sternocostal portion, with or without absence of the pectoralis minor muscle. in a period of one year, we identified two patients (4%) with axillary arch and one patient (2%) with absent pectoralis major and minor muscle among fifty subjects which undergoing axillary dissection for breast cancer surgery. the anatomy of axilla regarding muscular variations was studied in 50 patients who had an axillary dissection for the staging and treatment of invasive primary breast cancer over one year. the axillary vein was identified and all fatty and lymphatic tissue was removed inferior to the axillary vein, between the anterior border of latissimus dorsi muscle laterally and the lateral border of the pectoralis minor muscle (level of first rib) medially. during the procedure, two individuals with axillary arch muscle and one individual with absent pectoralis major and minor muscles were identified. of the 50 patients, 3 had a variation from the anatomy described in the standard textbooks of anatomy and operative surgery. there were two patients who had an abnormal band of muscle arising from the latissimus dorsi muscle and crossed the axilla medially towards pectoralis major muscle, pectoralis minor muscle and the coracoid process, without interruption by any type of tendinous fibres. axillary arch (aa) muscle crossing anteriorly over right axillary vein (av) there was left sided absence of pectoralis major and minor muscles in a 45 years old woman operated for left sided carcinoma of breast [figure 2]. there was little interest in ramsay's description until langer, in 1846, described the muscle more accurately and it became known as the embryological derivation of langer's arch remains unknown, but the most reliable theory supports its origin from the panniculus carnosus, which is an embryologic remnant of skin-associated musculature, lying at the junction between the superficial fascia and the subcutaneous fat. in lower mammals the panniculus carnosus is highly developed to form the pectoral group of muscles. however, in man it has regressed because its functional importance decreased during evolution in favour of wide upper limb mobility. langer's arch is usually asymptomatic and its main importance is the confusion it can cause during routine axillary surgery for breast cancer. an axillary arch may be palpable in living subjects and should be borne in mind during clinical examination of the axilla as it may be mistaken for a tumor. the presence of axillary arch can impede adequate exposure of the true axillary fat and in particular may limit access to the lower lateral group of lymph nodes, thus resulting in an incomplete clearance of the axilla. because of its close proximity with neurovascular and lymphatic structures within the axilla, as the axillary arch crosses the vessels and nerves, it may present with axillary vein obstruction. the axillary arch may lead the surgeon one level above the axillary vein and as a result the neurovascular bundle of the axilla may be injured. the pectoral musculature is derived from dorsal limb bud masses which arise from myoblasts that migrate out of last five cervical and first thoracic myotomes into developing limb buds during fifth week of development. the pectoral muscles assume their final form through a combination of migration, fusion and apoptosis of muscle cell precursors. absence of one or more skeletal muscles is more common than is generally recognised; common examples are the sternocostal head of the pectoralis major, the palmaris longus, trapezius, serratus anterior and quadrates femoris. usually only a single muscle is absent on one side of the body, or only part of the muscle fails to develop. occasionally the same muscle or muscles may be absent on both sides of the body. these structures fail to develop in the embryo.the muscles develop partly, fail to attach to the bone and subsequently atrophy.the premuscle mass, which in normal development goes to form the pectoralis minor and two portions of the pectoralis major, fails to differentiate into its separate parts.in one study, pectoralis major was absent in three of 15,000 cases and in another study, the muscle was absent in five of 54,000 cases. on average, the premuscle mass, which in normal development goes to form the pectoralis minor and two portions of the pectoralis major, fails to differentiate into its separate parts. paraskevas george noted that anomalies of the pectoralis major muscle are of prominent interest for plastic surgeons because that muscle is harvested during total, segmental or turn over flap graft removal for coverage of major sternal wound infections after cardiac surgery, breast reconstruction, or local mediastinal wounds and may serve as treatment for a paralytic elbow. furthermore, the pectoralis minor muscle is useful as a free flap in cases of facial palsy. clinical detection of this muscle is difficult; however, it is possible to detect the presence of the axillary arch on performing computed tomography scan or magnetic resonance imaging of the axillary region. caution should be exercised while performing fnac, core needle or tru cut biopsy of breast lesions in patients with poland syndrome. the procedure should be preferably performed under image guidance in such patients in order to minimize the risk of complication of pneumothorax. the reported incidence of this complication varies between 3 in 100 and 1 in 10,000. when present, axillary arch should always be accurately identified and formally divided to allow adequate exposure of axillary contents in order to achieve a complete lymphatic dissection. axillary arch can easily cause difficulty for the inexperienced surgeon if, by following the band, the dissection is carried higher than normal, into the region of the axillary artery and brachial plexus. the defects of pectorals usually cause little or no functional disability and often go unnoticed by the patients or relatives. however an understanding of the spectrum and complexity of this anatomical variation may be of benefit to the surgeon and pathologists while performing fnac, core needle or tru cut biopsy. absence of these muscles may increase the chances of direct spread of cancer breast through chest wall into cavity, which can worsen the prognosis.

aim: the present study was conducted to detect the musculature variations during axillary dissection for breast cancer surgery. methods:the anatomy of axilla regarding muscular variations was studied in 50 patients who had an axillary dissection for the staging and treatment of invasive primary breast cancer over one year. results:in a period of one year, two patients (4%) with axillary arch and one patient (2%) with absent pectoralis major and minor muscles among fifty patients undergoing axillary surgery for breast cancer were identified. conclusions:axillary arch when present should always be identified and formally divided to allow adequate exposure of axillary contents, in order to achieve a complete lymphatic dissection. complete absence of pectoralis major and minor muscles precludes the insertion of breast implants and worsens the prognosis of breast cancer.

PMC4382647

pubmed-855

endothelial cells (ecs) are key cellular components of blood vessels, functioning as selectively permeable barriers between blood and tissues. under pathological conditions, endothelial cell (ec) apoptosis leads to excess neointima formation [1, 2], a lipid transport disorder [3, 4], and plaque rupture. thus, maintaining endothelial cell viability by inhibiting the induction of apoptosis could be used in the prevention and/or treatment of atherosclerosis [6, 7]. oxidatively modiflied ldl (oxldl) has been implicated in the development of atherosclerosis and plaque rupture by promoting lipid accumulation, proinflammatory responses, release of metalloproteinases, and apoptotic cell death of ecs [8, 9]. oxldl also increases endothelial expression of adhesion molecules, which recruit inflammatory cells that adhere to and migrate through the endothelial barrier. these processes are followed by endothelial dysfunction and loss of expression of antiapoptotic proteins, which in turn causes ecs to become apoptotic [1012]. lectin-like oxldl receptor-1 (lox-1) is considered the major receptor for oxldl in human and various animal vascular endothelial cells (ecs). 6-shogaol is the major bioactive compound present in zingiber officinale which possesses antitumor, antioxidant, anti-inflammatory [1618], antiplatelet aggregation, antihypertensive [20, 21], and antiatherosclerosis [22, 23] effects. the mechanism of anti-as action of ginger extract is associated with a significant reduction in plasma and ldl cholesterol levels and a significant reduction in the ldl basal oxidative state, as well as their susceptibility to oxidation and aggregation [22, 23]. the present study evaluated effects of 6-shogaol on oxldl-induced insults to huvecs and its possible molecular mechanisms. lucigenin, dimethylsulfoxide (dmso), 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (mtt), diphenyleneiodonium (dpi), was obtained from sigma (st. louis, mo). 6-shogaol was purchased from national institute for the control of pharmaceutical and biological products (beijing, china). the identity and purity of the compound were determined using hplc (high-performance liquid chromatography) and 2d nmr and were>99%. blood was processed for ldl separation within 1 day by sequential flotation in nabr solution containing 1 mg/ml edta. cu-modified ldl (1.0 mg protein/ml) was prepared by exposure of ldl to 5 mm cuso4 for 18 h at 37c. the extent of ldl oxidation was determined by thiobarbituric acid-reactive substances (tbars). this experiment was approved by the research ethics committee of shanghai east hospital, tongji university school of medicine. after receiving written consent from the parents, we obtained fresh human umbilical cords from normal full-term neonates shortly after birth and suspended them in hanks ' balanced salt solution (hbss; gibco) at 4c. briefly, huvecs were removed from human umbilical veins after collagenase type i digestion and cultured in medium 199 containing 20% fetal calf serum, penicillin (100 u/ml), streptomycin (100 u/ml), and heparin (50 u/ml), supplemented with l-glutamine (2 mm), sodium pyruvate (1 mm), and endothelial cell growth factor (b-ecgf, 5 ng/ml), at 37c in 5% co2 on 0.1% gelatin-coated culture flasks. 6-shogaol was dissolved in dimethyl sulfoxide (dmso) and stored at 20c until use. final concentration of dmso in culture media was 0.1% huvecs were randomly divided into six groups: a normal control group, a oxldl group, four 6-shogaol groups. the huvecs in the oxldl group were incubated for 24 hours with medium containing 200 g/ml oxldl. in the 6-shogaol groups, the cells were preincubated for 2 h with different final concentrations of 6-shogaol: 1 m, 5 m, 10 m, and 30 m, followed by a 24-hour incubation with 200 g/ml ox-ldl. thp-1, a human monocytic leukemia cell line, was obtained from atcc (rockville, md) and cultured in rpmi with 10% fbs at a density of 25 10 cells/ml as suggested in the product specification sheet provided by the vendor. cells were seeded at density of 5 10 cells/ml in 96-well plates and the cell viability was measured using the mtt assay. briefly, at the indicated time points after the treatment as before, the culture supernatant was removed, and the cells were washed with pbs, incubated with mtt (5 mg/ml) in culture medium at 37c for another 3 h. after mtt removal, the colored formosan was dissolved in 100 l of dmso. the absorption values were measured at 490 nm using a sunrise remote microplate reader (grodlg, austria). the viability of huvecs in each well was presented as percentage of control cells. briefly, 5 10 huvecs were cultured in 12-well tissue culture plates overnight and then cotreated with drugs and 2,7-dichlorofluorescin diacetate. relative fluorescence intensities of cells were quantified using a flow cytometer (facs calibur, becton dickinson, san jose, ca, usa). to evaluate the role of nadph oxidase and lox-1 in oxldl-induced ros generation, we preincubated cells with the flavoprotein inhibitor dpi (5 m) and anti-lox-1 monoclonal antibody (mab; 40 g/ml) for 2 h before exposure to oxldl. sod activity in the homogenate was determined by an enzymatic assay method using a commercial kit (calbiochem) according to the manufacturer's instructions. specific nadph-dependent o2 production was measured by lucigenin (5 mm) chemiluminescence as previously described. the cells were pretreated with various concentrations of 6-shogaol or vehicle for 60 min, after which oxldl (200 g/ml) was added for additional 60 min. then cells were scraped into ice-cold hbss supplemented with 0.8 mm mgcl2 and 1.8 mm cacl2, disrupted by rapid freezing in liquid nitrogen followed by sonication. oxygen radical production was measured in the presence of 5 mm lucigenin, with or without nadph (100 mm) for 10 min. the relative light units (rlu) of chemiluminescence were read in turner td 20/20 luminometer. apoptosis was also examined by analysis of dna fragmentation using flow cytometry [27, 28]. huvecs were washed and double-stained by using an annexin v-fitc apoptosis detection kit. annexin v has a strong ca-dependent affinity for phosphatidylserine (ps), which translocates from the internal to the external surface of the plasma membrane as a probe for detecting apoptosis. cells that have the loss of membrane integrity will show red staining (propidium iodide, pi) throughout the nucleus and therefore will be easily distinguished between the early apoptotic cells and the late apoptotic cells or necrotic cells. samples were incubated at room temperature for 15 min in the dark with annexin v and pi and quantitatively analyzed by a facs vantage se flow cytometer. the activities of caspase-3, caspase-8, and caspase-9 were measured according to the kit manufacturers ' instructions. in brief, after 24 h treatment by different medium conditions, huvecs of each group were lysed and removed from culture dishes, washed twice with pbs, and pelleted by centrifugation. cell pellets were then treated for 10 minutes with iced lysis buffer supplied by the manufacturers: caspase-3, caspase-8 assay cellular activity kit, and caspase-9 assay kit (calbiochem). then the suspensions were centrifuged at 10000 g for 10 minutes, and the supernatants were transferred to a clear tube. to each tube, specific substrate conjugate [acetyl-asp-glu-val-asp-p-nitroaniline (ac-devd- p-na) for caspase-3, acetyl-ile-glu-thr-aspaminotrifluoromethyl coumarin (ac-ietd-afc) for caspase-8 and acetyl-leu-glu-his-asp-p-nitroaniline (ac-lehd-p-na) for caspase-9] was added and the tubes were incubated at 37c for 2 hours. during incubation, the caspases cleaved the substrates to form p-na or afc. caspase-3 and -9 activities were read in a microtiter plate reader at 405 nm. caspase-8 activity was read in a fluorescent plate reader at 400 nm for excitation and at 505 nm for emission. assays were performed in triplicate and three independent experiments were performed in this study. mrna from huvecs exposed to 6-shogaol, oxldl, or a combination of 6-shogaol and oxldl were prepared for real-time polymerase chain reaction (pcr) analyses of lox-1 and gapdh mrna. the oligonucleotides for the pcr analyses of lox-1 and gapdh mrna were designed and synthesized by invitrogen laboratories (palo alto, ca, usa). the oligonucleotide sequences for these mrna analyses were 5-tcttagcatgaatttggaaat-3 and 5-cccagctaaagggcccatgg-3 for lox-1, and gapdh (forward: 5-cca-ccc atg gca aat tcc atg gca-3 and reverse: 5-tct aga cgg cag gtc agg tcc acc-3. a real-time pcr analysis was performed using iqsybr green supermix (bio-rad, hercules, ca, usa) and the myiq single-color real-time pcr detection system (bio-rad). cells were lysed in a modified ripa buffer (150 mm nacl, 10 mm tris, ph 7.4, 1 mm edta, 1% triton x-100, 1% deoxycholic acid, 1 mm pmsf, with addition of complete tm protease inhibitor cocktail). protein concentrations were determined by a bca assay and separated by an 8% sdspage, and then transferred to a pvdf membrane (millipore, usa). the membrane was blocked at rt for 2 h in 5% nonfat dry milk diluted with tbst (in mm: tris-hcl 20, nacl 150, ph 7.5, 0.1% tween 20). the membrane was incubated overnight at 4c with a polyclonal rabbit anti-human lox-1 and bcl-2 (1: 500 dilution; santa cruz biotechnology inc. the membrane was incubated for 1 h with a goat anti-rabbit igg conjugated to horseradish peroxidase (1: 10000 dilution; santa cruz biotechnology inc. at last, the levels of lox-1 and bcl-2 protein were determined using amersham ecltm western blotting detection reagents (ge healthcare, uk). incubation with polyclonal rabbit -actin antibody (1: 1000 dilution; santa cruz biotechnology inc. relative intensities of protein bands were analyzed by scan-gel-it software. pcmv6-xl5-lox-1 plasmids, which were constructed with full-length human lox-1 cdna, were purchased from origene technologies (rockville, md, usa). pcmv6-xl5-lox-1 plasmids were transfected into huvecs usinga fugene 6 transfection reagent (roche diagnostics, mannheim, germany) as previously described. briefly, huvecs were cultured in antibiotic-free dulbecco's modified eagle's medium at 37c for 24 hours, then the sirna duplex solution was added. activation of nf-b was assessed by measuring the p65 protein-dna binding activity in nuclear extracts of huvecs. when the cells were 7090% confluent, the medium was changed to 15 ml of complete m199 (20% fbs) and incubated for 2 h in the absence or the presence of 6-shogaol or anti-lox-1 monoclonal antibody (mab; 40 g/ml), after which huvecs were challenged with 200 g/ml ox-ldl. for comparison purposes, huvecs were also incubated for 1 h with pyrrolidine dithiocarbamate (pdtc), a known inhibitor of nf-b activation [30, 31]. after 1 h of incubation with ox-ldl, the reaction was stopped by washing the cells with cold pbs. nuclear extracts were prepared according to the manufacturer's instructions, and the dna binding activity of p65 was measured by elisa (active motif, carlsbad, ca). briefly, nuclear extracts were added to wells previously coated with dna containing specific sequences for the binding of p65. after incubation at room temperature for 1 h, wells were washed and sequentially incubated for 1 h with a primary antibody raised against p65 and a secondary enzyme-linked antibody. the plate was developed by addition of chromogen, and the absorbance at 450 nm was recorded in a plate-reader spectrophotometer (spectromax 190). huvecs were grown to confluence, then pretreated with 6-shogaol for 2 h, and stimulated cells with oxldl (200 g/ml) for 24 h. at the end of stimulation, huvecs were harvested and incubated with fitc conjugated anti-icam-1, anti-e-selectin, and anti-mcp-1 (r&d systems) for 45 min at room temperature. after the huvecs had been washed three times, their immunofluorescence intensity was analyzed by flow cytometry using a becton dickinson facscan flow cytometer (mountain view, ca) huvecs at 1 10 cells/ml were cultured in 96-well flat-bottom plates (0.1 ml/well) for 1-2 days. cells were then pretreated with the indicated concentrations of 6-shogaol for 2 h and incubated with oxldl (200 g/ml) for 24 h. the medium was then removed, and 0.1 ml/well of thp-1 cells (prelabeled with 4 m bcecf-am for 30 min in rpmi at a 1 10 cell/ml density) were added in rpmi. the cells were allowed to adhere at 37c for 1 h in a 5% co2 incubator. the number of adherent cells was estimated by microscopic examination; the cells were then lysed with 0.1 ml of 0.25% triton x-100. the fluorescence intensity was measured at 485-nm excitation and 538-nm emission using a labsystems fluorescence microplate reader. data analysis values were expressed as mean sd, statistical significance was determined by student's two-tailed t-test or one-way anova followed by bonferroni posttests when more than two treatments were compared. concentration-response curves were analysed by two-way anova followed by bonferroni posttests. treatment of mouse huvecs with 1, 5, 10, and 30 m 6-shogaol for 24, 48, and 72 hours did not affect cell viability (data not shown). meanwhile, after exposure for 72 hours, 6-shogaol at 60 m caused a significant 27% decrease in cell viability. when the treated concentration reached 100 mol/l, administration of 6-shogaol for 48 and 72 hours, respectively, decreased the viability of huvecs by 41% and 61% (data not shown). next, we observed the 6-shogaol antioxidation activity by mda measurement and used fluorescence microscopy to analyze the effect of 6-shogaol on the lox-1 mediated redox-sensitive signaling pathway in endothelial cells. as shown in figure 1(a), when ldl was reacted with copper sulfate for 1, 6, 12, 18, and 24 hours, amounts of malondialdehyde significantly increased by 3.62-, 8.18, 12.74-, 16.47-, and 19.44-fold, respectively. 6-shogaol at 0.5 m did not affect the oxidation of ldl by copper sulfate (figure 1(b)). meanwhile, when the concentrations reached 1, 5, 10, 30 m, 6-shogaol decreased copper sulfate-caused oxidation of ldl by 10.3%, 29.1%, 39.1%, and 59.8%, respectively. the intracellular ros concentration in huvecs was determined by measuring the intensity of dcfh fluorescence. when dcfh-da-labeled cells were incubated in the medium for 2 h, a sudden increment in fluorescence intensity indicated the oxidation of dcfh-da by intracellular radicals (figure 1(c)). the production of dcfh fluorescence in huvecs with oxldl increased significantly to 364% of the vehicle-treated control group, whereas preincubation with 6-shogaol (130 m) significantly reduced the increased fluorescence induced by oxldl in a concentration-dependent manner. in addition, oxldl-induced ros was abrogated by pretreatment with monoclonal antibody of lox-1 (anti-lox-1 mab) or dpi (figure 1(c)). in addition, the involved ros is able to inactivate antioxidative enzymes that additionally increase the imbalance in favor of oxidative stress. we next turned our attention to the total activity of sod in endothelial cells in response to oxldl. as shown in (figure 2(a)), 6-shogaol at 5, 10, and 30 m significantly decreased the suppression of sod activity caused by oxldl. endothelial nadph oxidase is a major source of ros in vascular endothelial cells, and atherogenic levels of ldl have been shown to induce a marked increase in nadph oxidase-generated ros by the endothelium. as shown in figure 1(d), incubation of huvecs with oxldl (200 g/ml) for 1 h increased the nadph oxidase activity by 132% (p 6-shogaol at 10 and 30 m significantly reduced nadph oxidase activity of huvecs from 87.18 5.06 rlu/s/mg protein to 63.92 6.82 rlu/s/mg protein and 55.53 3.95 rlu/s/mg protein, respectively (p<0.05). as shown in figure 2(b), the survival rate of huvecs was about 52.37 6.59% after exposure to 200 g/ml oxldl. however, preincubation of huvecs with different concentrations of 6-shogaol (1, 5, 10, 30 m) markedly increased the viability of oxldl-treated huvecs in a concentration-dependent manner. the treatment with 1, 5, 10, and 30 m concentrations of 6-shogaol increased the viability of huvecs in a statistically significant fashion to 69.68 4.40%, 76.91 3.06%, and 83.15 3.07%, respectively. in addition, no difference was seen in cell viability between cells treated with 6-shogaol (130 m) alone and controls (data not shown). these results suggest that 6-shogaol protected huvecs from oxidative stress-related cellular injuries. as shown in figure 2(c), in the vehicle-treated control group, the percentage of apoptotic cells was 4.78% 1.40%. after exposure to 200 g/ml oxldl for 24 h, the percentage of apoptosis increased to 32.43% 2.75%. nonetheless, preincubation with 6-shogaol (130 m) for 2 h prior to ox-ldl exposure concenteration-dependently arrested the apoptosis, and the values of apoptosis were decreased to 27.93% 2.85%, 21.58% 2.27%, and 16.53% 2.37%%, respectively (p<0.05). moreover, the induction of apoptosis in huvecs treated with 6-shogaol (130 m) alone was not observed (data not shown). application of lox-1 sirna into huvecs for 24 and 48 hours decreased the levels of lox-1 receptor (figure 3(a)). exposure to lox-1 sirna for 24 and 48 hours caused significant 32% and 79% decreases in the levels of lox-1. exposure of huvecs to 6-shogaol or lox-1 sirna alone did not induce cell apoptosis (figure 3(c)). treatment with 6-shogaol and lox-1 sirna, respectively, caused significant 58% and 65% decreases in oxldl-induced huvecs apoptosis. cotreatment with 6-shogaol and lox-1 sirna synergistically reduced oxldl-caused cell apoptosis by 88% (figure 3(c)). by comparison, overexpression of lox-1 alone in huvecs did not affect cell apoptosis but completely attenuated 6-shogaol involved protection against oxldl-induced apoptotic insults (figure 3(b)). consistent with previous study, incubation of huvecs with oxldl (200 g/ml) enhanced lox-1 expression at both the gene (figure 4(a)) and protein levels (figure 4(b)). pretreatment of huvecs with 6-shogaol for 2 h before exposure to oxldl for 24 h resulted in suppression of lox-1 expression in a concentration-dependent manner. notably, pretreatment with dpi, an inhibitor of ros production, markedly inhibited oxldl-induced lox-1 upregulation (figures 4(a) and 4(b)), strongly suggesting that ros plays a critical role in the increased expression of lox-1. oxldl binding to lox-1 decreased the expression of antiapoptotic proteins such as bcl-2 and c-iap-1, subsequently activated apoptotic signaling pathway caspase-9 and caspase-3, and finally resulted in apoptosis. consistent with these studies, oxldl treatment decreased the expression of antiapoptotic protein bcl-2 (figure 5(a)), while 6-shogaol significantly blocked the decreasing bcl-2 expression induced by oxldl on huvecs. caspase-3 is one of the downstream effectors of the caspase family and is involved in both the mitochondrial apoptotic pathway and the death receptor pathway. the activity of caspase-3 and caspase-9 were not affected by 6-shogaol (figure 5). treatment of huvecs with 200 g/ml oxldl led to a significant increase in activity of caspase-9 (figure 5(b)) and caspase-3, not for caspase-8 (figures 5(b), 5(c), and 5(d)) as compared to control; however, 6-shogaol administration significantly decreased oxldl-induced caspase-3 and caspase-9 activation (figures 5(b) and 5(c), p<0.05). devd-cho (25 mol/l), an inhibitor of caspase-3, was applied to huvecs to further evaluate the roles of this protease in 6-shogaol-caused protection (figure 6(a)). treatment with devd-cho significantly decreased oxldl-induced augmentation of caspase-3 activity by 68.5% (figure 6(a)). cotreatment with 6-shogaol and z-veid-fmk completely lowered oxldl-caused enhancement of caspase-3 activity. the oxldl-caused huvecs apoptosis was significantly ameliorated by 65.45% following administration of devd-cho (figure 6(b)). simultaneous exposure to 6-shogaol and devd-cho completely lowered oxldl-induced cell apoptosis. oxldl-induced ros can activate nf-b activation, which facilitates nuclear translocation and subsequent regulation of proinflammatory gene expression [32, 33]. a shown in figure 7(a), activation of nf-b, as indicated by nuclear translocation and dna binding of its p65 subunit, was decreased by 6-shogaol in a concentration dependent manner, meanwhile 10 m pyrrolidine dithiocarbamate and 40 g/ml anti-lox-1 monoclonal antibody also exerted strong inhibition (figure 7(a)). the effect of 6-shogaol on the surface expression of adhesion molecules on huvecs exposed to oxldl was subsequently examined. as shown in figure 7(b), the expression levels of icam-1, mcp-1, and e-selectin were significantly higher in huvecs that had been treated with oxldl (200 g/ml) for 24 h than in the control cells (229, 304, and 460%, resp. flow cytometry revealed that the induction of adhesion molecule expression was significantly ameliorated by the presence of 130 m 6-shogaol. in addition, oxldl-induced expression of adhesion molecules was abrogated by pretreatment with monoclonal antibody of lox-1 (anti-lox-1 mab) or sirna (figure 7(b)). oxldl-enhanced recruitment, retention, and adhesiveness of human monocytes and monocytic cell lines to endothelium have been implicated in the initial stage of atherogenesis. to test the effect of 6-shogaol on monocyte adhesion to huvecs, confluent monolayers of huvecs were pretreated with various concentrations of 6-shogaol or anti-lox-1 monoclonal antibody (mab; 40 g/ml) for 2 h and then stimulated with oxldl (200 g/ml) for 24 h, followed by incubation with thp-1 cells for 1 h at 37c. as shown in figure 7(c), oxldl stimulated an increase in adherence of thp-1 cells to huvecs (472 17%, p<0.05); however, the effect was significantly inhibited by 6-shogaol treatment in a concentration-dependent manner (all p<0.05). oxldl is an important initiating factor for endothelial activation and injury contributing to endothelial dysfunction, one of the earliest hallmarks of atherosclerosis [8, 34, 35]; lox-1, as the primary oxldl receptor on endothelial cells, plays an important role in the pathogenesis of atherosclerosis [3638]. the binding of oxldl to lox-1 initiates ros formation, which in turn upregulates lox-1 expression, thereby contributing to further ros generation. the present study shows the effectiveness of 6-shogaol, the major bioactive compound present in zingiber officinale, in suppressing endothelial lox-1 expression and lox-1-mediated proatherogenic effects. this effect of 6-shogaol on endothelial lox-1 expression appears to be exerted at the transcriptional level, as reflected by the parallel decrease in lox-1 mrna and protein levels in 6-shogaol -treated cells (figure 3). furthermore, pretreatment with dpi or blockade of lox-1 with anti-lox-1 mab or sirna-lox-1 prevented oxldl-induced ros generation and cell apoptosis, which suggests that the binding of oxldl to lox-1 and the consequent formation of ros may be the first event in lox-1-mediated endothelial dysfunction (figures 1 and 4). because regulation of lox-1 gene expression is redox sensitive, suppression of oxldl-induced ros production by 6-shogaol may contribute to the reduction of lox-1-mediated expression of a number of proinflammatory molecules and cell apoptosis. nadph oxidase is recognized as the major source of ros in endothelial cells and the increased nadph activity has been detected in atherosclerotic arterie. it has been shown that oxldl-induced endothelial dysfunction is caused by an increase in nadph oxidase-generated superoxide concentrations and a decrease in antioxidative enzyme activity, resulting in the activation of multiple ros-sensitive signaling pathways. consistent with the literature, our data show that 6-shogaol treatment significantly reduced the level of oxldl-induced ros generation (figures 1(c) and 1(d)) and increased the level of sod activity (figure 2(a)). ros can activate nf-b and enable nuclear translocation and subsequent regulation of proinflammatory molecules, including cytokines, chemokines, enzymes, and adhesion molecules. in the present study, ros production in huvecs occurred within 5 min (data not shown), and nf-b was activated within 1.5 h of the addition of oxldl. however, pretreatment with anti-lox-1 mab, ros production, and nf-b activation, and icam-1, mcp-1, and e-selectin expression were decreased markedly, which suggests that the binding of oxldl to lox-1 and the consequent nf-b activation. furthermore, our stuy showed that 6-shogaol inhibited nf-b activation (figure 7(b)) and repressed the oxldl-induced icam-1, mcp-1, and e-selectin expression (figure 7(c)). from these, we speculated that 6-shogaol protection against oxldl-induced endothelial dysfunction may be by blockading the binding of oxldl to lox-1, and subsequently decrease intracellular ros generation and the proinflammatory molecules expression. all of these findings strongly indicate that 6-shogaol elicits antioxidative and anti-inflammatory effects. apoptosis, also called programmed cell death, is an important process of many pathological conditions including atherosclerosis. lox-1 activation by oxldl stimulates endothelial proinflammatory gene expression and production of superoxide radicals and leads to activation of apoptotic signaling pathway [13, 45]. their findings suggested that oxldl binding to lox-1 subsequently decreased the expression of antiapoptotic proteins, such as bcl-2 and c-iap-1, then activated apoptotic signaling pathway caspase-9 and caspase-3, and finally resulted in apoptosis. consistent with previous reports, the results presented here indicated that oxldl induced decrease in bcl-2 expression, but 6-shogaol completely normalized this oxldl-induced alterations. application of lox-1 small interference (si)rna into huvecs simultaneously increased 6-shogaol protection from oxldl-induced cell apoptosis. by comparison, overexpression of lox-1 attenuates 6-shogaol protection. both 6-shogaol and therefore, this study shows that 6-shogaol may protect huvecs from oxldl-induced apoptotic insults via downregulating lox-1-mediated activation caspase protease pathway. in summary, the results from our experiments indicate that 6-shogaol prevents the oxldl-induced lox-1-mediated biological events in huvecs, probably via its antioxidative and anti-inflammatory functions. our work adds 6-shogaol to the growing list of herbal remedies whose mode of action has been at least partially revealed on a molecular level.

endothelial dysfunction and oxldl are believed to be early and critical events in atherogenesis. 6-shogaol is the major bioactive compound present in zingiber officinale and possesses the anti-atherosclerotic effect. however, the mechanisms remain poorly understood. the goal of this study was to investigate the effects of 6-shogaol on oxldl-induced human umbilical vein endothelial cells (huvecs) injuries and its possible molecular mechanisms. hence, we studied the effects of 6-shogaol on cell apoptosis, cellular reactive oxygen species (ros), nf-b activation, bcl-2 expression, and caspase -3, -8, -9 activities. in addition, e-selectin, mcp-1, and icam-1 were determined by elisa. our study show that oxldl increased lox-1 expression, ros levels, nf-b, caspases-9 and -3 activation and decreased bcl-2 expression in huvecs. these alterations were attenuated by 6-shogaol. cotreatment with 6-shogaol and sirna of lox-1 synergistically reduced oxldl-induced caspases -9, -3 activities and cell apoptosis. overexpression of lox-1 attenuated the protection by 6-shogaol and suppressed the effects of 6-shogaol on oxldl-induced oxidative stress. in addition, oxldl enhanced the activation of nf-b and expression of adhesion molecules. pretreatment with 6-shogaol, however, exerted significant cytoprotective effects in all events. our data indicate that 6-shogaol might be a potential natural antiapoptotic agent for the treatment of atherosclerosis.

PMC3590502

pubmed-856

in the last decade the amount of data regarding micrornas (mirs) and their target genes described in the literature has expanded tremendously. the volume of information on this new group of regulators (i.e., mirs) has complicated attempts to integrate this data within existing metabolic and signalling networks. as regulators of gene expression in addition, a single mir can potentially regulate multiple different genes at the same time, leading to complex functional outcomes. however, from another perspective, the identification of groups of genes targeted by the same mir and the clustering of these genes within individual signalling pathways represents a means to understand the cross talk between multiple signalling networks and their role in a common biological process. the focus of this review is to summarize the validated groups of mirs functionally linked to the cross talk between tgf-, notch, and wnt signalling during the common biological process of epithelial-to-mesenchymal transition (emt). in particular, this review will address whether the documented cross talk between these three important emt-associated pathways could be further reinforced by the identification of a signature of mirs, already depicted in the literature but not yet sharpened or clearly defined in this role. in the past years, many studies have elegantly described the role of tgf-, notch, and wnt pathways in promoting emt and emt-associated disorders including fibrosis and metastatic dissemination in cancer [16]. here we identify published and validated interactions between mirs and genes involved in tgf-, notch, and wnt signalling. this led to the discovery of a signature of 30 mirs each regulating all three pathways. we then searched for additional validated genes targeted by these 30 mirs and then further clustered these into the tgf-, notch, and wnt signalling pathways. interestingly, in our attempt to identify mirs that were common to all three of these signalling pathways, we found that the 30-mir signature strongly reinforced existing evidence supporting cross talk between these three pathways during emt. in this review we used tarbase v6.0, the largest currently available manually curated mir target gene database, which includes targets derived from specific and high throughput experiments. using tarbase v6.0 we searched the collection of manually curated, experimentally validated mir-gene interactions for tgf- (hsa04350), wnt (hsa04310), and notch (hsa04330) signalling kegg pathways in homo sapiens. using diana-mirpath, a mir pathway analysis web-server, we clustered the validated mirs using experimentally validated mir interactions derived from diana-tarbase v6.0. results were merged using a union of genes and analysed with a priori analysis methods (overrepresentation statistical analysis). this statistical analysis identified pathways significantly enriched with targets belonging to a union of genes. a p value threshold of 0.05 was applied with false discovery rate (fdr) correction to the resulting significance levels. using tarbase v6.0 we explored the collection of manually curated, experimentally validated mir interactions with genes in the tgf-, wnt, and notch kegg pathways. we identified 84 experimentally validated mirs interacting with genes involved in the tgf- signalling pathway, 104 mirs in the wnt pathway, and 48 mirs interacting with genes involved in notch signalling. we clustered the mirs identified in our search in order to obtain a list of experimentally validated mirs shared between all three pathways focusing first on clusters of two out of three pathways (i.e., experimentally validated mirs shared between only tgf- and notch, tgf- and wnt, or notch and wnt) (figure 1). we identified 2 experimentally validated mirs shared between the tgf- and notch pathways (figure 1 and supplementary table 1 available online at http://dx.doi.org/10.1155/2015/198967); 10 mirs shared between the notch and wnt pathways (figure 1 and supplementary table 2); 39 mirs shared between the tgf- and wnt pathways (figure 1 and supplementary table 3). we further identified a signature of 30 experimentally validated mirs targeting all three pathways (figure 1 and tables 1, 2, and 3). within this 30-mir signature, 4 mirs (mir-103a, mir-132, mir-30a, and mir-10a) had validated target genes not ascribable to the manually annotated interactions within the kegg pathways. diana-mirpath was used to collect the complete list of manually annotated, experimentally validated, and published target genes for the 30 mirs identified. this was done in order to get better insight into the experimental data and understand the functional relevance of our analysis. of all validated target genes 48 genes could be ascribed to the tgf- pathway (p value=6.9e 09), 30 to the notch pathway (p value=4.7e 05), and 88 to the wnt signalling pathway (p value=5.07e 14). using the same approach as for the mirs, a cluster of genes was found to be shared between only two of the three pathways (i.e., experimentally validated mir-gene interactions from tgf- and notch, tgf- and wnt, or notch and wnt kegg pathways). with this procedure, we identified 8 manually annotated and validated target genes shared by tgf- and wnt kegg pathways (smad2, smad3, smad4, rock2, rhoa, myc, ppp2r1a, and ppp2r1b) and 5 manually annotated and validated target genes shared by notch and wnt kegg pathways (ctbp1, ctbp2, dvl2, dvl3, and psen1). interestingly, no genes were shared between tgf- and notch kegg pathways (figure 2). finally, we determined whether a new cluster of experimentally validated target genes coupled to our signature described above could be connected to a common biological process among tgf-, notch, and wnt signalling pathways. strikingly, only 2 validated target genes, the transcriptional coactivator camp-response element-binding protein- (creb-) binding protein (cbp) and the adenovirus e1a-associated cellular p300 transcriptional coactivator protein p300 (ep300), were shared exclusively between the tgf-, notch, and wnt signalling kegg pathways (figure 2). these results indicate the relevance of the 30-identified-mir signature thus suggesting a possible link between these mirs and cross talk between tgf-, notch, and wnt pathways during emt. tgf- signalling plays complex roles during tumor progression and can either inhibit or promote tumor growth depending on the cellular context. the complexity of tgf- signalling derives in part from the capability of its receptors to activate distinct canonical and noncanonical signalling pathways. in the smad-dependent canonical pathway, tgf- ligands assemble their specific type ii and type i transmembrane serine kinase receptors, allowing the constitutively active type ii receptor kinase to phosphorylate the type i receptor, thereby activating its kinase. the active type i receptor then phosphorylates its cognate cytoplasmic smad proteins which then enter the nucleus to regulate the transcription of target genes. by contrast, the noncanonical pathway is smad-independent and includes tgf- signalling via the rho family of gtpases and mapk/pi3k pathways. in this context, tgf- has been shown to rapidly activate the rho-gtpases and its activation of rhoa in epithelial cells leads to induction of stress fibers and acquisition of mesenchymal characteristics, thus promoting emt. additionally, rhoa is a crucial regulator in the signal transduction events that link activation of latent tgf- by plasma membrane receptors (e.g., integrins) to the assembly of focal adhesions and sites of f-actin fiber organization. interestingly, we have identified interactions between rhoa and a group of 5 validated mirs (mir-155, mir-124, mir-375, mir-122, and mir-31) [1217] (figure 3). more specifically, in endothelial cells, mir-155 was shown to block the acquisition of the mesenchymal phenotype induced by tgf- by directly targeting rhoa. similar observations were made in osteoclast precursor cells, where overexpression of mir-124 decreased rhoa expression and reduced cell migration. dramatic effects on migration and cytoskeleton disruption have also been reported for mir-122 in hepatocellular carcinoma (hcc). in this context, mir-122 and rhoa interact directly and overexpression of rhoa reverts mir-122-induced mesenchymal-to-epithelial transition (met) and inhibition of migration. finally, in breast cancer cells it was demonstrated that overexpression of mir-31 decreases invasion and metastasis via downregulation of rhoa (figure 3). together, these findings highlight the relevance of these mirs in interfering with rhoa mediated emt. modulation of stress fibers and cytoskeletal rearrangements are key events in the acquisition of a mesenchymal phenotype and in the modulation of cellular motility. two key players in this process are the rho-serine/threonine kinases rock1 and rock2 which regulate smooth muscle contraction, formation of stress fibers, and focal adhesions. rock1 and rock2 are two major downstream effectors of rhoa that constitute additional important mediators of tgf--induced emt. interestingly, among the 30 mirs in our signature, we found 2 validated mirs (mir-335 and mir-124) that regulate expression of rock1 and rock2 [20, 21]. low levels of mir-335 were correlated with poor overall patient survival in neuroblastoma while overexpression of this mir strongly reduced cell migration and impaired f-actin organization. further analysis revealed that mir-335 directly targets rock1 providing an explanation for its ability to reduce cell invasion. low levels of mir-124 have been associated with poor prognosis in aggressive hcc while overexpression of mir-124 in hcc cell lines strongly decreased rock2 expression and inhibited emt, formation of stress fibers, filopodia, and lamellipodia. taken together these experimental data highlight an important role for mir-335 and mir-124 in smad-independent, noncanonical tgf- effects on cytoskeletal rearrangements via rhoa-dependent signalling pathways (figure 3). tgf- also induces mesenchymal characteristics via canonical signalling, that is, via smad2 and smad3. in the previous paragraph we described the ability of mir-155 to directly decrease rhoa expression and thereby interestingly, mir-155 has also been shown to interfere with the canonical tgf- pathway by directly affecting the formation of the smad2/3 signalling complex. have demonstrated that mir-155 directly targets smad2, leading to a reduction of tgf--induced smad2 phosphorylation and blocking smad2-dependent activation of a tgf--inducible, smad-dependent caga reporter plasmid. additionally, mir-155 targets presenilin 1 (psen1), a catalytic subunit of the gamma-secretase complex which catalyzes the cleavage of membrane proteins including notch receptors. in this have shown that psen1 plays a crucial role in mediating the interaction between tgf- and notch signalling by promoting the association between the tgf- type i receptor intracellular domain (tri-icd) and the notch intracellular domain (nicd) which in turn triggers cell-invasive behaviour in prostate cancer. altogether, these data suggest that mir-155 can disrupt both the canonical and noncanonical tgf- pathways and might represent an interesting modulator of cross talk between tgf- and notch signalling pathways (figure 3). the observation that tgf- alone can be sufficient to induce emt in epithelial cells while other cell types may not be sensitive to this effect of tgf- suggests that induction of emt by tgf- requires cooperation with other signalling pathways. indeed, several studies indicate that tgf- acts together with the notch and wnt pathways to promote emt [4, 6, 26, 27]. remarkably, in our analysis we could not identify any validated mir target genes shared exclusively between the tgf- and notch pathways. however, notch is able to antagonize tgf- via sequestration of ep300, a factor that in turn acts as a transcriptional coactivator for notch1. the interaction in the cluster of mir target genes ascribable to notch signalling and their interactions with mir target genes associated with both tgf- and wnt signalling pathways are discussed below. concerning wnt signalling, two interesting genes highlighted in our analysis are ppp2r1a and ppp2r1b. these are the catalytic subunits of the pp2a holoenzyme, a protein phosphatase that reverts the action of protein kinases in many signalling cascades, including wnt signalling. several reports support the notion that pp2a plays a dual role in wnt signalling and can act as either a positive or a negative regulator of the pathway. on one hand, in the absence of wnt, -catenin forms a complex with apc, axin, and gsk3. this allows gsk3 to phosphorylate -catenin that is then ubiquitinated and targeted for proteasomal degradation. in this context, different pp2a subunits bind to axin and apc, decreasing -catenin levels and thereby negatively regulating wnt signalling. on the other hand, in the presence of wnt, pp2a seems to exert a positive role in -catenin stabilization. in this situation, the complex of apc, axin, and gsk3 is degraded by dishevelled (dsh) leading to nuclear -catenin accumulation and activation of wnt target genes. stabilized -catenin can subsequently localize at plasma membrane in complex with e-cadherin and pp2a, thus reducing emt. recently, we have demonstrated that activation of wnt signalling via gsk3 inhibition in metastatic and androgen independent prostate cancer cells (pc3, du145, and c4-2b) induces dramatic changes in their morphology, blocks their migration, reduces their metastatic growth, and strongly affects their mesenchymal phenotype. this highlights the ability of wnt signalling to stabilize e-cadherin and interfere with emt in prostate cancer suggesting that pp2a may act as a negative regulator of emt. consistent with this possibility, it has been shown that restoring expression of a catalytic subunit of pp2a can revert emt and suppress tumor growth and metastasis in an orthotopic mouse model of human prostate cancer. interestingly, we identified two mirs in our signature (mir-16 and mir-124) that directly block the expression of catalytic subunits of pp2a (ppp2r1a and ppp2r1b) and that have been positively validated by proteomics and microarray, respectively [13, 23]. strikingly, homozygous deletion (hd) of the mir-16 locus was observed in androgen independent prostate cancer in xenograft models. the hd of mir-16 in a subset of androgen independent prostate cancer xenograft might suggest that, in this context, pp2a is present and stable. in turn, this might also suggest that activation of wnt signalling in androgen independent prostate cancer cells could act synergistically with pp2a to promote stabilization of -catenin and e-cadherin leading to reduced emt. taken together, these data might identify a subset of androgen independent prostate cancers in which restoration of wnt signalling reduces the aggressiveness of tumor cells and abolishes their mesenchymal phenotype. the involvement of mir-16 in emt in the context of prostate cancer is further reinforced by an interesting observation regarding its role in the tumor-supportive capacity of stromal cells. have shown that mir-16 is downregulated in fibroblasts surrounding prostate tumors in patients. additionally, they have demonstrated that mir-16 restoration considerably impairs the tumor-supportive capability of stromal cells in vitro and in vivo. from this perspective, it is important to note that the prostate tumor microenvironment is rich in tgf- superfamily members including tgf-s, bone morphogenetic proteins (bmps), growth/differentiation factors (gdfs), activins, inhibins, nodal, and anti-mllerian hormone (amh). among them, mir-16 has been suggested to regulate activin/nodal signalling via direct interaction with teratocarcinoma-derived growth factor 1 (cripto, tdgf1). have indeed shown using luciferase reporter assays that mir-16 (together with mir-15a) directly interacts with the 3utr of cripto. cripto is a small, gpi-anchored protein that functions as a secreted growth factor and as an obligatory cell surface coreceptor for a subset of tgf- superfamily ligands including nodal. cripto regulates both cell movement and emt during embryonic development and cancer and, strikingly, nodal, which has been implicated in enhancing tumor cell plasticity and aggressiveness, is expressed in cancerous but not normal human prostate specimens. although it is required for nodal signalling, cripto suppresses tgf- signalling in multiple cell types, reinforcing the inclusion of mir-16 in our signature. therefore, the reduced expression of mir-16 in the tumor microenvironment in prostate cancer is predicted to facilitate cripto-dependent nodal signalling which together with cripto's other tumor-promoting effects could trigger invasiveness, bone metastasis, and emt. similar to mir-16, overexpression of mir-124 in androgen independent prostate cancer cell lines (du145) strongly reduces aggressiveness and invasion. this further supports the hypothesis that the increased pp2a stability caused by low levels of mir-16 and mir-124 in a subset of androgen independent prostate cancer cell lines could explain reduced cell migration and invasion, an effect that we also documented upon gsk3 inhibition. mir-124 is also likely to be an important player in wnt signal transduction since proteomics and microarray analyses have revealed that it interacts with dvl2 (a member of dsh protein family) [13, 42]. dvl2 binds the cytoplasmic c-terminus of the frizzled family of wnt receptors and transduces the wnt signal to downstream effectors. interestingly, dvl2 also interacts with insulin receptor substrates (irs1/2) and thereby promotes canonical wnt signalling. moreover, irs1/2 have been identified as key players in the regulation of e-cadherin expression during emt [44, 45]. the irs1/2 ratio has been shown to be significantly lower in malignant prostate tumors than in benign prostatic tissue and functional polymorphisms in irs1 have been associated with a more advanced gleason score [46, 47]. also reduced migration was documented after mir-124 overexpression in androgen independent prostate cancer suggesting a mechanism in which low levels of mir-124 boost dvl2. this, in turn, would be predicted to lead to gsk3 blockade with subsequent -catenin and e-cadherin stabilization. additionally, low levels of mir-124 strengthen pp2a, which further contribute to stabilization of -catenin and e-cadherin, therefore reducing emt. another mir in our signature, mir-324, has also been shown to regulate expression of dvl2. interestingly, dysregulation of mir-324 has been linked to macrophage dysfunction in colorectal cancer, where altered wnt signalling is known to play a pivotal role. more specifically, mir-324 was found to be highly expressed in infiltrated macrophages in fresh colon cancer tissues isolated immediately after surgical removal. additionally, in the same work, the oncogene c-myc was identified as a candidate transcription factor capable of regulating mir-324. this, combined with the identification of mir-324 in our analysis, suggests a fascinating role for mir-324 in the cross talk between tgf- and wnt signalling in emt and colorectal cancer. double edged sword during colon cancer progression has been extensively documented in the literature. in its tumor suppressive role, tgf- inhibits progression of the cell cycle by inducing the tumor suppressors p15 (ink4b) and p21 (cdkn1a) and inhibiting expression c-myc. at the same time, c-myc is also a crucial downstream target of altered wnt signalling in colon cancer and has been shown to cause loss of e-cadherin, which is a hallmark of emt. therefore, mir-324 could be involved in a feedback loop between wnt, tgf-, and c-myc. more specifically, altered wnt signalling during colorectal cancer development could modulate c-myc levels and therefore mir-324 expression. in turn, abnormal mir-324 levels can interfere with dvl2 expression leading to alteration in the wnt signalling pathway that further alter c-myc and e-cadherin levels (figure 3). we have identified a group of 6 mirs (mir-335, mir-34a, mir-21, mir-98, mir-24, and mir-145) directly linked to c-myc, reinforcing the role of c-myc as a common downstream target between tgf-- and wnt-mediated emt. among them, we have already discussed the role of mir-335 in emt induced by tgf-, particularly its interaction with rock1 and rock2. interestingly, tavazoie et al. have shown by microarray that mir-335 also interacts with c-myc, suggesting a more comprehensive role for mir-335 in tgf-- and wnt-mediated emt. additionally, sampson et al. have suggested that mir-98 (from let-7/mir-98 family) might regulate c-myc expression. they have shown that administration of 10058-f4, a compound that inhibits myc, strongly increases the expression of mir-98 and other let-7 family members. strikingly, treatment of melanoma cells with 10058-f4 efficiently diminished emt mediated by tgf- and s-phase kinase-associated protein 2 (skp2). taken together, these data suggest that mir-98 could represent an important mediator in the cross talk between tgf- and wnt and their effect in modulation of emt. deregulated expression of c-myc has been reported in a wide variety of human cancers and among several key regulators of c-myc expression, an important role is exerted by p53. interestingly mir-145 has been reported to repress c-myc in response to the p53 pathway reinforcing its identification in our emt signature. similarly, members of mir-34 family are known to be direct transcriptional targets of p53 and p53-binding sites are localized on the mir-34 gene promoter. however, christoffersen et al. demonstrated that mir-34a is capable of repressing c-myc in a p53 independent manner. this suggests that, beside the cross talk between p53 and c-myc, there are additional mechanisms that contribute to fine tuning of the role of c-myc in tgf-- and wnt-dependent emt. from this perspective, a crucial outcome of deregulated myc signalling lal et al. have shown that mir-24 directly targets myc, suggesting that this mir could potentially play an interesting role in emt modulation. to support this hypothesis, mir-24 has also been recently shown to regulate the emt program in response to tgf- in breast cancer cells. papadimitriou et al. have demonstrated that mir-24 is capable of modulating tgf--induced breast cancer cell invasiveness through regulation of rhoa-specific guanine nucleotide exchange factor net1 isoform2 (net1a), a protein that is necessary for tgf--mediated rhoa activation. the last mir included in the group of those targeting c-myc is mir-21. singh et al. have suggested that mir-21 regulates self-renewal in mouse embryonic stem (es) cells and could potentially interact with myc and other self-renewal markers (oct4, nanog, and sox2). they have shown that enforced expression of mir-21 in es cells downregulates renewal markers, including c-myc. this suggests that in specific contexts modulation of mir-21 could potentially affect c-myc expression and therefore modulate e-cadherin levels and affect emt. finally, in the previous paragraphs we have described the role of mir-155 as an interesting player capable of disrupting the tumor-promoting effects of smad-dependent and smad-independent tgf- signalling. interestingly, in our analysis we identified another group of 4 mirs linked to tgf- signalling and belonging to the mir-17-92 cluster (i.e., mir-19a, mir-19b, and mir-92a) and to its paralog cluster mir-106b-25 (i.e., mir-93). interestingly, c-myc has been reported to upregulate the mir-17-92 cluster, providing further evidence of cross talk between wnt and tgf- signalling. dews et al. performed a detailed study to elucidate the mechanism of interaction between the mir-17-92 cluster and tgf- signalling, particularly with smad4. using qpcr and microarray analyses they provide evidence suggesting that mir-19a, mir-19b, and mir-92a regulate smad4 indirectly, that is, without interacting with the smad4 3utr. as mentioned above, ep300 (p300) and crebbp (creb-binding protein, cbp) are the only two kegg pathway genes shared among all three pathways (i.e., tgf-, wnt, and notch). ep300 and crebbp are functionally related transcriptional coactivator proteins that play many important roles in processes including cell proliferation, differentiation, and apoptosis. in the context of wnt signalling, ep300 has been shown to act synergistically with -catenin and t cell factor (tcf) during neoplastic transformation. similarly, in the context of tgf- signalling, it has been reported that phosphorylated smad3 interacts with the crebbp/ep300 complex to augment transcriptional activation. additionally, the notch intracellular domain (nicd) can recruit the complex crebbp/ep300 to interact with the transcription factor csl (cbf1/su(h)/lag-1) which, in turn, activates the transcription of two known notch related basic-helix-loop-helix transcription factor families, hey and he s. ep300 and crebbp were originally identified in protein interaction assays through their association with the transcription factor creb and with the adenoviral-transforming protein e1a, respectively [6870]. the roles of crebbp and ep300 and their interaction during emt have been extensively studied. however, the large degree of cellular heterogeneity within different organs and tissues makes the role of ep300 in emt difficult to define with precision. strikingly, some reports have linked the expression of wild-type ep300 in colorectal and prostate cancer with the degree of intravascular dissemination of cancer cells (probably affected by ongoing emt) and poor prognosis [7274]. in this context, ep300 seems to promote cancer cells emt. in support of this, elevated expression of ep300 in hepatocellular carcinomas (hcc) correlates with enhanced vascular invasion, intrahepatic metastasis, shortened survival, and, strikingly, low e-cadherin expression. ep300 knockdown strongly increased e-cadherin expression and significantly decreased migration and invasion in a hepatoma cell line (hle) that is otherwise highly invasive and poorly differentiated. in the context of cancerous hepatocytes, tgf- is one factor that plays a major role in the induction of emt, causing type i collagen induction and formation of liver fibrosis. in this situation, ep300 interacts with smad3 and functions as signal integrator for mediating regulation of collagen synthesis by tgf-. treatment with hdac inhibitor strongly decreases ep300 levels and restores e-cadherin distribution to the hepatocytes cell membrane therefore reducing tgf--induced emt. as outlined above, targeting the expression of ep300 and/or crebbp can simultaneously affect tgf-, wnt, and notch pathways. in this regard, mir-9, which is represented in our 30-mir signature, was shown to target ep300 as determined by microarray analysis (figure 3). remarkably, mir-9 has also been shown to be involved in the modulation of e-cadherin levels via c-myc. more specifically, ma et al. have shown that myc acts as a transcriptional activator of mir-9 and that mir-9, in turn, directly targets e-cadherin. therefore, not only is mir-9 one of the common mirs linking tgf-, wnt, and notch signalling but also it has the ability to target e-cadherin which links it directly to emt. thus, it appears that mir-9 might represent an interesting regulator of the cross talk between tgf-, wnt, and notch signalling pathways in both normal cells and cancer cells. on one hand, through its effect on e-cadherin and ep300, mir-9 may maintain the balance between epithelial and mesenchymal cell state in normal cells. on the other hand, in cancer cells that have lost the tumor suppressive effect of tgf-, the disruption of the tgf- cytostatic program could cause c-myc induced upregulation of mir-9 leading to loss of e-cadherin and subsequent emt. have further shown that, in the context of notch signalling, in addition to its connection with ep300, mir-9 also interacts directly with hes1. this reinforces the hypothesis that mir-9 represents an interesting regulator of the notch signalling pathway with a role in the cross talk between tgf-, wnt, and notch. regulation of the crebbp/ep300 complex by mir-9 represents an interesting mechanism of coregulation of tgf-, wnt, and notch signalling pathways. in this regard, it is interesting to note that we identified another group of 5 mirs (mir-26b, mir-194, mir-182, mir-374, and mir-324) that also were shown to interact with ep300 and crebbp by microarray. among these, have shown that mir-26 is strongly downregulated in ht-29 colon cancer cells undergoing tgf--induced emt, whereas ragan et al. have described an interaction between mir-324 and crebbp by transcriptomic analysis [48, 82]. moreover, interestingly in our analysis we have also identified mir-1, that has been shown to interact with ctbp1/2, two proteins that bind to the c-terminus of adenovirus e1a protein and act as corepressors of notch target genes (figure 3). as discussed above, there is a connection between mir-324 and dvl2 in the context of wnt signalling and colon cancer [48, 49]. in particular, in the context of colon cancer, the cascade of events that drives tumor progression is characterized by series of genetic modifications involving components of the wnt and tgf- signalling pathways. in colon cancer, the adenoma-carcinoma sequence is initiated by alteration in wnt signalling (i.e., inactivation of apc). subsequently, the late stage adenoma shows loss of 18q-arm, where it maps the best candidate tumor suppressor gene dpc4/madh4, which encodes smad4, involved in the tgf- pathway. this event drives the progression from the intermediate adenoma stage to late adenoma, resulting in loss of the cytostatic effect of tgf-. strikingly, the interaction between -catenin and the tgf- pathway depends on the transcriptional coactivator crebbp as demonstrated by zhou et al. who used chromatin immune precipitation to show that a complex forms between smad3, -catenin, and crebbp. these findings together with the identification of ep300 and crebbp in our analysis suggest that mir-26 and mir-324 may link tgf- and wnt signalling with emt in colon cancer progression. recent studies have indicated that the switch in tumor cells from a sessile, epithelial phenotype towards a motile, mesenchymal phenotype is accompanied by the acquisition of stem/progenitor cell characteristics. in particular, cells undergoing emt acquire chemoresistance, a key property attributed to cancer stem cells (cscs). the mir-200 family includes mir-200c-3p, mir-200b-3p, and mir-429 (all identified in our analysis) and inhibits emt and cancer cell migration by directly targeting the e-cadherin transcriptional repressors zeb1 and zeb2. additionally, downregulation of mir-200 family has been described in docetaxel resistant prostate cancer cells, reinforcing the link between emt and resistance to chemotherapy. mizuguchi et al. have shown that acetyltransferase ep300 regulates expression of mir-200c-3p overcoming its transcriptional suppression by zeb1. the same authors showed that treatment with an hdac inhibitor significantly increased mir-200c-3p levels causing a decrease in vimentine and zeb1 and upregulation of e-cadherin. strikingly, mir-200c-3p, mir-200b-3p, and mir-429 have also been shown to interact with ep300 by microarray and protein analysis. these observations enhance the complexity of the regulatory mechanisms governing the interplay between ep300 and e-cadherin and suggest a positive feedback loop between mir-200 family and ep300. the inhibitory effect of zeb1 on mir-200 could be attenuated by ep300 which upregulates mir-200 expression. furthermore, higher levels of mir-200 could decrease zeb1, suggesting that the positive effect of ep300 on e-cadherin expression could also be mediated via mir-200 family (figure 3). in this review, we discussed and summarized the known interactions between mirs and genes involved in tgf-, notch, and wnt signalling pathways and highlighted a signature of 30 validated mirs linking these pathways to the process of emt. our novel approach led to the identification of a cluster of validated and known mirs involved in different pathways in an attempt to reduce the extraordinary volume of information related to the interaction between mirs and different target genes. we believe that the identification of groups of genes targeted by the same mir and the clustering of these genes in different pathways could potentially represent an interesting strategy to better understand the cross talk between multiple signalling networks, thus facilitating the understanding of their connections and their role in a common biological process.

epithelial-to-mesenchymal transition (emt) is a reversible process by which cancer cells can switch from a sessile epithelial phenotype to an invasive mesenchymal state. emt enables tumor cells to become invasive, intravasate, survive in the circulation, extravasate, and colonize distant sites. paracrine heterotypic stroma-derived signals as well as paracrine homotypic or autocrine signals can mediate oncogenic emt and contribute to the acquisition of stem/progenitor cell properties, expansion of cancer stem cells, development of therapy resistance, and often lethal metastatic disease. emt is regulated by a variety of stimuli that trigger specific intracellular signalling pathways. altered microrna (mir) expression and perturbed signalling pathways have been associated with epithelial plasticity, including oncogenic emt. in this review we analyse and describe the interaction between experimentally validated mirs and their target genes in tgf-, notch, and wnt signalling pathways. interestingly, in this process, we identified a signature of 30 experimentally validated mirs and a cluster of validated target genes that seem to mediate the cross talk between tgf-, notch, and wnt signalling networks during emt and reinforce their connection to the regulation of epithelial plasticity in health and disease.

PMC4390187

pubmed-857

dengue infection causes various clinical symptoms ranging from mild fever to severe hemorrhagic fever and dengue shock syndrome [13]. the virus uses host cell ribosomes to translate its genomic rna to full-length precursor polyprotein. subsequently, the host cell furin and dengue ns2b-ns3 serine protease (ns2b-ns3pro) cleave viral polyprotein at various regions to produce structural and nonstructural viral proteins [46]. the ns3 protein is one of the viral non-structural proteins that possess enzymatic activities. the n-terminal of this protein contains 180 amino acid residues that represent ns3 protease [7, 8], while c-terminal region contains amino acid residues that represent rna helicase and rna-stimulated ntpase [9, 10]. the activity of ns2b-ns3pro depends on the interaction with its cofactor ns2b to form a ns2b-ns3pro complex. it has been found that the disruption of ns2b-ns3pro functions inhibits viral replication. therefore, ns2b-ns3pro is considered as a potential target for the design of antiviral drugs. at present, a legitimate vaccine or treatment to prevent or to cure this disease is unavailable. these facts emphasize the need for a better understanding of the mechanism of viral infection and propagation in the host cell to combat this disease. recently, computational studies indicated that cationic cyclic peptides have potential inhibition towards dengue ns2b-ns3pro [15, 16]. protegrin-1 (pg-1, rggrlcycrrrfcvcvgr) is an eighteen amino acids cationic cyclic peptide with high content of basic residues and two disulphide bonds. the peptide is originally isolated from porcine white blood cells and considered as an antibiotic agent against a broad range of microorganisms [17, 18]. the formation of two disulphide bonds between cysteine residues endows pg-1 with a stabile -hairpin secondary structure that is crucial for antimicrobial activity [19, 20]. therefore, removal of these two disulphide bonds is found to noticeably reduce the antimicrobial activity of pg-1. the peptide is able to penetrate and disrupt the cell membrane by homodimerization [22, 23]. the mechanism of this activity depends on the secondary structure and the cationic nature of pg-1 molecules which are essential to generate pores in the cell membrane of microorganism [2427]. in this study, our objective was to examine the efficacy of pg-1 as cationic cyclic peptide to inhibit dengue serine protease and subsequently reduce viral replication in host cells. the linear peptides were prepared by automated peptide synthesis using symphony parallel synthesizer (protein technologies, tucson, az, usa) by standard solid-phase peptide synthesis. the lyophilized peptide was dissolved in 20% dmso solution in a round bottom flask and stirred on a magnetic stirrer to produce a peptide concentration of 1.1 mm. the formation of the first disulphide bond was completed within 24 hrs. the solution was then lyophilized to proceed for second disulfide formation. the lyophilized peptide with the first disulphide bond was dissolved in acetic acid water (4: 1) so that the peptide concentration was 1.2 mm and iodine (10 equivalents) was added in one portion. the reactions were stirred at 25c for 60 min and then quenched by diluting with water and extracting with ccl4 to remove excess iodine. purification of crude cyclised peptide was accomplished by rp-hplc (agilent 1200 series). the identity of the purified peptide with 98% purity was confirmed by lc-ms (shimadzu lc/ms 2020, single quad). to produce single chain protease nsb2- (g4-t-g4)-ns3, the ns2b fragments were amplified individually by pcr using the primer pairs ns2b-f (5-atactgaggatcc gccgatttggaactg-3) and ns2blinker-r (acctactaggtacctcctccacccagtgtctgttcttc). the ns2b-ns3 was amplified by ns3linker-f (5-atctataggtaccggcggtggaggtgctggagtattgtgg-3) and ns3-r (5-agcataagcttaagcttcaattttct-3). the linker sequence was added to ns2blinker-r and ns3linker-f primers which included the site for kpni restriction enzyme (all restriction sites are underlined). the pcr product of ns2b fragment was digested with bamhi and kpni while ns2b fragment was digested with kpni and hindiii. purified fragments were cloned into pqe30 plasmid downstream of 6his tag. the escherichia coli x-the recombinant e. coli was inoculated in luria-bertani liquid medium (1% tryptone, 1% nacl, 0.5% yeast extract, w/v, ph 7.0) supplemented with 100 mg/l ampicillin and cultured overnight at 37c. in brief, 10 ml of overnight grown culture was added to 1000 ml of medium and incubated with shaking at 37c until the optical density at 600 nm reached 0.5. subsequently, isopropylthio--d-galactoside (iptg) was then added to a final concentration of 0.5 mm and the bacteria were cultured for an additional 5 hrs at 37c in a shaking incubator to induce protein expression. finally, bacterial cells were harvested by centrifugation at 4000 rpm for 15 min at 4c. the recombinant ns3pro was produced as soluble proteins and, therefore, the purification had been performed by his gravitrap flow precharged ni sepharose 6 fast column (amersham biosciences, usa) according to the manufacturer's instructions. in brief, the column was normalized with phosphate buffer (20 mm sodium phosphate buffer and 500 mm nacl, ph 7.4). the sample was loaded into the column and the column was washed with binding buffer (phosphate buffer containing 20 mm imidazole, ph 7.4). the recombinant protein was eluted with elution buffer (phosphate buffer containing 200 mm imidazole, ph 7.4). the bioassay used in this study was modified from the method published by kiat and coworkers. these reaction mixtures consisted of 100 m fluorogenic peptide substrate (boc-gly-arg-arg-mca), 2 m ns2b-ns3pro complex, with or without pg-1 of varying concentrations, buffered at ph 8.5 with 200 mm tris-hcl. the pg-1 was initially prepared in tris-hcl buffer and assayed at five different concentrations. subsequently, the substrate was added and the mixture was further incubated at the same temperature for 30 minutes. triplicates were performed for all measurements and the readings were taken using tecan infinite m200 pro fluorescence spectrophotometer. substrate cleavage was optimized at the emission at 440 nm upon excitation at 350 nm. the readings were then used for calculating km values of peptide substrate and ic50 values of peptide inhibitors using nonlinear regression models in graphpad prism 5.01 software. the mk2 cell lines were seeded at 1 10 cells per well in triplicate at optimal conditions (37c, 5% co2 in humidified incubator) in 96 well plates. pg-1 was diluted to serial concentrations 2.5, 12.5, 25, 50, 100 and 200 m with dmem media supplemented with 2% fbs. the cell culture was analyzed at 24, 48 and 72 hours using nonradioactive cell proliferation assay (promega, usa) according to the manufacture protocol. the mk2 cell lines were grown in a 24-well tissue culture plate (1 10 cells/well), incubated 24 hrs under optimal conditions (37c and 5% co2). denv-2 was added to the wells (moi of 2) followed by incubation for 1 hr with gentle shaking every 10 min for optimal virus to cell contact. the virus supernatant was removed, and the cells were washed twice with fresh serum free dmem media to remove residual virus. new complete dmem media containing 2.5, 7.5 and 12.5 m of pg-1 were added and the cultures were incubated for 24, 48 and 72 hrs. afterwards, cellular supernatants were collected and stored at 80c for viral quantification by real-time pcr. for quantification of denv-2 copies, the standard curve was generated by 10-fold serial dilution of known copies of denv-2 rna. viral rna was extracted from culture supernatant using qiamp viral rna minikit (qiagen, germany) according to the manufacturer's instructions. a fragment located at the 5utr region of the virus genome one-step rt-pcr using sybr green master kit (qiagen, germany) was used to conduct absolute quantification using abi7300 machine from applied biosystems (foster city, ca). the pcr programme included 1 cycle of 50c for 2 min, 1 cycle of 95c for 10 min, and 40 cycles of 95c for 15 sec and 60c for 1 min. results were analyzed using sequence detection software version 1.3 (applied biosystems, foster city, ca, usa). all the assays were done in triplicates and the statistical analyses were performed using graphpad prism version 5.01 (graphpad software, san diego, ca). the recombinant ns2b-ns3pro was produced as a soluble protein in e. coli and purified by nickel column (figure 1(a)). further purification was applied using gel affinity chromatography to achieve more than 95% of enzyme purity (figure 1(b)). the activity of purified enzyme had been assessed at 37c by catalyzing the fluorogenic peptide substrate t-butyloxycarbonylglycyl-l-arginyl-l-arginyl-l-4-methylcoumaryl-7-amide (boc-gly-arg-arg-mca). the pg-1 peptide was added to the protease reaction at different concentrations and the inhibition profile was plotted as shown in figure 2. it was observed that the inhibition potential increased with pg-1 concentration and the highest inhibition (95.7%) with low concentrations of pg-1 was at 40 m. the kinetic assay study indicated that pg-1 competitively inhibited ns2b-ns3pro activity (alpha value 3.14) with ki value 5.85 m (table 1). intriguingly, the maximum enzyme velocity decreased threefold when pg-1 concentration was 20 m (figure 3). previous studies have shown that various types of natural and chemical compounds were able to inhibit dengue ns2b-ns3pro activity. for example, some of plant natural compounds, such as chalcones, have shown good inhibition potential against the dengue protease (ki value 2125 m). the synthesized peptidic -keto-amide compound inhibited dengue ns2b-ns3pro with ki value of 47 m. most recent study indicated that the retrotripeptides with an arylcyanoacrylamide group as n-terminal cap exhibited high inhibition potential against dengue protease with ki value of 4.6 m. most recent study showed that the inhibition potential of some chemical compounds towards ns2b-ns3pro measured by ic50 was 15.4, 20.4, and 27.0 m. cytotoxicity and compound stability can be considered as major limitations of the practical application of protease inhibitors. in this study, to test pg-1 toxicity, mk2 cell lines were incubated with increasing concentrations of pg-1 for 24, 48, and 72 hrs. the pg-1 peptide showed toxic effect against mk2 cell lines at concentrations greater than 12.5 m (figure 4). other studies indicated that pg-1 was also toxic to 293a cell lines (human embryonic kidney cells) at 50 g/ml (25 m) and more than 50% of human red blood cells lyses were observed at 80 g/ml (40 m). therefore, three concentrations at nontoxic range were used to test pg-1 stability and ability to reduce dengue viral replication in mk2 cell lines. the results showed that the viral copy number significantly (p<0.001) reduced with increasing concentrations of pg-1 (figure 5(a)). furthermore, the highest inhibition percentage was observed when the pg-1 concentration was 12.5 m at 24, 48 and 72 hrs (figure 5(b)). however, the low concentrations exhibited less inhibition percentage at 48 and 72 hrs as compared with 24 hrs, indicating that the pg-1 stability declined with longer incubation in culture media (figures 5(a) and 5(b)). similarly, it has been showed that at low doses (4 g/ml), pg-1 has significant in vitro antimicrobial activity with low in vivo toxicity (up to 8 mg/kg i.v. this may be accounted by its short half-life in vivo as its level in mice plasma that was injected with 4 mg/ml i.v although pg-1 showed significant inhibition profile towards dengue virus in this study and to human immunodeficiency virus 1 (hiv1) in another study, the peptide instability should be considered as a major concern. the results in this study may give a clear picture that would then help in engineering new sequence of peptides to retain the antiviral activity against dengue while increasing its stability and eliminating the toxic characteristics of pg-1.

dengue diseases have an economic as well as social burden worldwide. in this study, the antiviral activity of protegrin-1 (pg-1, rggrlcycrrrfcvcvgr) peptide towards dengue ns2b-ns3pro and viral replication in rhesus monkey kidney (mk2) cells was investigated. the peptide pg-1 was synthesized by solid-phase peptide synthesis, and disulphide bonds formation followed by peptide purification was confirmed by lc-ms and rphplc. dengue ns2b-ns3pro was produced as a single-chain recombinant protein in e. coli. the ns2b-ns3pro assay was carried out by measuring the florescence emission of catalyzed substrate. real-time pcr was used to evaluate the inhibition potential of pg-1 towards dengue serotype-2 (denv-2) replication in mk2 cells. the results showed that pg-1 inhibited dengue ns2b-ns3pro at ic50 of 11.7 m. the graded concentrations of pg-1 at nontoxic range were able to reduce viral replication significantly (p<0.001) at 24, 48, and 72 hrs after viral infection. however, the percentage of inhibition was significantly (p<0.01) higher at 24 hrs compared to 48 and 72 hrs. these data show promising therapeutic potential of pg-1 against dengue infection, hence it warrants further analysis and improvement of the peptide features as a prospective starting point for consideration in designing attractive dengue virus inhibitors.

PMC3470887

pubmed-858

desmoid tumors (dts), also called aggressive fibromatosis, are very rare with an estimated incidence of 25 cases per million of inhabitants in european countries [1, 2]. dts lack the capacity to metastasize but may behave in a locally aggressive fashion and possess a high risk of local recurrence despite adequate surgical resection with negative margins [1, 3]. dts can develop in any musculoaponeurotic structure and they may be located at virtually any anatomical site. the principal sites of involvement for extra-abdominal fibromatosis are the shoulder, chest wall and back, thigh and head and neck region. intra-abdominal fibromatosis arises in the mesentery or pelvis while abdominal tumors arise from musculoaponeurotic structures of the abdominal wall, especially the rectus and internal oblique muscles and their fascial coverings [4, 5]. in the surgically treated patients who experience recurrence of dt (local recurrence rates are about 2565%) a wide excision is needed in some cases. synthetic meshes often used in extensive abdominal wall reconstruction may present with complications, including infection, bowel adhesion, extrusion, and fistula according to the prosthetic material used. a prosthetic material with more favorable properties than traditional mesh could have a major effect on surgical practice and patient outcomes, avoiding chronic inflammation and resisting infection after implantation. considering baumann's description of the ideal biomaterial for abdominal wall repair, our choice was directed towards a not cross-linked acellular dermal matrix (adm) which remodels into host tissue. the matrix serves as a scaffold and becomes rapidly revascularized and infiltrated with host cells, avoiding fibrotic reaction and encapsulation as well as seroma formation. the revascularization of biological matrices is thought to promote access of host immune cells as well, thereby providing further resistance to future infections. this is the first report about the use of the not cross-linked dermal matrix egis in a case of abdominal wall recostruction after extensive dt resection. in 2008, a 37-year-old woman underwent, in a different hospital, exeresis of a neoformation in the epigastric region of the abdominal wall and reinforcement with small prosthetic mesh. she reported an appendectomy, two pregnancies with cesarean births and a voluntary interruption of pregnancy. in 2014, a recurrence occurred in the context of the rectus abdominis in the left iliac fossa. the patient therefore underwent tamoxifen therapy for 1 year followed by 3 months of neoadiuvant chemotherapy for progressive disease. in september 2015, magnetic resonance imaging (mri) 1a, c, e), which revealed a marked progression of the disease (calculated size 18 10 6.4 cm). after discussions at our multidisciplinary sarcoma meeting, the group decision was to treat the patient surgically. one month later, the woman had a surgical resection through a suprapubic transverse incision. the abdominal flap was cranially detached; the neoformation invaded completely the left abdominal rectus muscle and partially oblique muscles with an extension of approximately 30 20 cm (fig. 1a, 2a). the rectus muscle and a large portion of the oblique and transverse muscles were removed en bloc with 1 cm of healthy margin from the mass (fig. intraperitoneal drainage was placed, and a wide continuous solution was adopted in the left abdomen. the not cross-linked porcine dermal matrix egis (decomed, venice, italy) 30 20 cm, 1.5 mm thick, was hydrated for 10 min in sterile saline solution and then secured with interrupted absorbable suture (vicryl 2/0) to the fascia and abdominal wall muscles (fig. we performed caudal mobilization of the abdominal flap and then dermolipectomy of the superfluous integument. the postoperative course was uneventful and the patient was discharged on the 8th postoperative day. there was no evidence of recurrence of the tumor or incisional hernia at 12 months of follow-up (fig. 1b, d, f) and the membrane turned out to be completly incorporated with the sourrounding tissues. histological examination of the resected specimen (17 10 6 cm) revealed tumor-free margins and a whitish lesion with increased thickness and fibrous appearance, which had almost completely invaded the abdominal muscle. the diagnosis was confirmed by the presence of spindle-cellular tumors which had immigrated through muscle tissues as shown by nuclear -catenin staining. dfs are neoplasms with infiltrating growth and with a tendency toward local recurrences; nevertheless, they lack metastatic potential. although the morphologies of these tumors have been well characterized, their nature and pathogenesis have remained obscure for many years [6, 9]. according to the literature, the median age at the diagnosis of dfs is about 35 years, and the majority of patients are women. in particular, patients between puberty and the fourth decade of life tend to be female, and in these patients the abdominal wall is the preferred site of involvement. supposed risk factors of desmoids are previous surgical interventions, pregnancy, and hormonal treatment with estrogens. because the tumor biology is notoriously unpredictable, periods of rapid tumor growth can be followed by stability or even regression. the treatment with tamoxifen, as well as chemotherapy and radiation, is controversial, since the long-term clinical improvement is minimal, while surgical excision should be performed only when absolutely necessary. abdominal wall integrity after full-thickness surgery can be restored with direct suture, but the occurrence of postoperative incisional hernia is highly reported. for this reason one-stage reconstruction with prosthetic abdominal wall reinforcement increases the chance of definitive cure, enhancing the patient's perceived quality of treatment. randomized controlled trial observed a double rate of hernia recurrence in the primary suture group compared with the mesh reinforcement group. the meshes used are classified according to their gap size which defines the porosity of the mesh and consequently the behavior with surrounding tissue, but a common tendency to develop postoperative complications was reported with all these devices. synthetic meshes are usually associated with an increased risk of extrusion, adhesion, and following obstruction and enterocutaneus fistula formation, especially when placed in an overlay fashion. moreover, patients who have had radiation to the abdominal wall prior to reconstruction are at increased risk for wound healing complications and subsequent mesh exposure. for that reason, butler et al. recommend avoiding synthetic meshes in patients with radiated abdominal walls. the advent of biological matrices has added a valuable option to the field of abdominal wall reconstruction. the inherent ability of biological matrix to turn into patient self-tissue, and therefore resist infection, allows to implant it in direct contact with the bowel, resulting in fewer adhesions than prosthetic mesh [8, 12]. these bioprosthetic devices, deriving from human or animal dermis, are chemically and enzymatically cleaned to remove all cellular components while maintaining the extracellular matrix, which can be cross-linked or not. it is hypothesized that cross-linking treatment adds strength to the matrix, theoretically resulting in lower rates of hernia recurrence as compared to non-cross-linked products. in contrast butler et al. in a comparative study had not appreciated any mechanical differences between cross-linked and non-cross-linked matrices. moreover cross-linked matrices revealed delayed revascularization and higher percentage of adhesions resulting in poor integration regarding non-cross-linked adms. despite the great advantages reported about the biological matrices, the high price that distinguishes them, ranging from usd 8.60/cm to usd 22.00/cm, remains a high deterrent to their use. one variation of the biological materials, egis, has not been described yet in the literature for abdominal wall reconstruction after tumor excision. egis (decomed, venice, italy) is a dry porcine adm, non-cross-linked, without any chemical preservative; its very competitive price, about half of the aforementioned costs, allows us to choose the benefits of a biological matrix with the advantage of controlled expense. we report for the first time the successful use of egis in a complex abdominal wall reconstruction following the resection of a large dt. the matrix was well accepted without any postoperative complications and no evidence of recurrence of the tumor or incisional hernia has been reported 12 months later. in conclusion, this single-case experience makes us to consider the biological matrix egis, as well as other adms, an ideal alternative to synthetic mesh, mainly in cases with a potential risk of infection. the protocol for data collection of this case has been approved by the institute's committee and complies with the helsinki guidelines for human studies.

desmoid tumor is a rare monoclonal fibroblast proliferation that is regarded as benign. the clinical management of desmoid tumors is very complex and requires a multidisciplinary approach because of the unpredictable disease course. for those cases localized in the anterior abdominal wall, symptomatic and unresponsive to medical treatment, radical resection and reconstruction with a prosthetic device are indicated. we present here a case of desmoid fibromatosis of the left anterolateral abdominal wall with a marked increase of the mass that required a large excision followed by reconstruction with biological matrix. the fact that it can be incorporated in patient tissue without a fibrotic response and that it can resist future infections, together with a very competetive price, made the new collagen matrix egis our first choice.

PMC5346936

pubmed-859

if genetic variation affecting patterns of trait covariation have fitness consequences, then a particular pattern of integration that allows for a closer match to a new local multivariate phenotypic optimum should be favoured [13]. alternatively, ancestrally conserved patterns of integration may act to constrain the rate and direction of evolution by preventing certain functions from evolving [4, 5]. either way, modularity may influence the pace of evolution and determine evolvability [6, 7]. it is therefore not surprising that the study of trait integration has been of interest to biologists for more than half a century [810] and has recently seen renewed attention [3, 1114]. the study of integration has more recently been extended to the closely related concept of modularity the relative degrees of connectivity in systems. a module is a tightly integrated unit that is relatively independent from other such modules. for morphological data, modularity has been studied in a variety of contexts including those that are developmental, genetic, functional, and evolutionary in their focus [1522]. an emerging consensus is that patterns of modularity in complex phenotypes likely represents a balance between functional and developmental integration and that modularity is better viewed as a matter of degrees rather than an all-or-nothing phenomenon. it has been suggested that modularity can facilitate divergence by allowing organisms to alter aspects of their phenotype without facing the developmental or fitness tradeoffs that would be present in a wholly integrated unit [12, 13]. in this way, the evolution of modularity could be tied to the idea of key innovations (see for an example). the origin or evolutionary success of taxa key innovations may enhance competitive ability, relax adaptive tradeoffs, or permit exploitation of a new productive resource base. the african cichlids from lakes victoria, tanganyika, and malawi in east-africa's great rift valley represent the largest extant example of vertebrate adaptive radiations known. certain anatomical features of this group have been proposed as key innovations that have facilitated the rapid evolution of these fishes [25, 26]. the best known of these represents an important example of functional modularity, wherein the highly derived cichlid pharyngeal jaw mechanism allows the processing of prey within the throat to be decoupled from prey capture by the oral jaws [12, 26]. this is thought to have allowed african cichlids to exploit a wide array of niches that would be unavailable if only one set of jaws was present. the cichlid radiation of lake malawi is particularly interesting, because although it is intermediate to tanganyika and victoria in terms of age and morphological diversity [28, 34], it has produced the greatest number of endemic species (well over 700) [35, 36]. the evolutionary history of malawi cichlids suggests that current diversity arose via three stages of diversification: (1) early divergence of the sand-dweller and rock-dweller clades, each of which has adapted to a major macrohabitat, (2) competition for trophic resources within each of these clades that caused further differentiation of trophic morphology, and (3) divergent sexual selection resulting in differentiation of male nuptial coloration [37, 38]. we recently completed an extensive analysis that explored patterns of craniofacial shape variation in african cichlids from each of the three rift lakes. our data, which represented approximately 80% of the genera across lakes, revealed that all three cichlid radiations share a common trajectory of divergence with respect to each lineage's major axis of divergence (pc1). our geometric morphometric analysis also showed that these changes were primarily related to changes in the relative length and size of the preorbital region of the skull, which encompasses the oral jaws and supporting structures, with shape posterior to the orbital region remaining relatively stable. these trends suggest that a large portion of the head diversity seen in african cichlids has been achieved by relatively simple and repeated shifts in jaw shape and that these may have happened relatively early in their evolutionary history. african cichlids with longer oral jaws are either suction feeders and forage on zooplankton, or they are piscivorous and feed on other fishes. alternatively, species with shortened jaws are typically biters that possess a higher mechanical advantage to scrape algae or forage on large macrobenthic prey. in lake malawi, this fundamental division is reflected in the cladogenic split between rock- and sand-dwelling species. on average, rock-dwelling species have a shorter jaw in common morphospace, whereas sand-dwellers species have relatively longer jaws [28, cooper unpublished data]. notably, these morphological patterns seem to be a common theme in the adaptive radiation of other fish assemblages (e.g.,) and even in population-level divergence among ecomorphs of charr whitefish, and sunfish [4042]. thus, a propensity for changes in the size of oral jaws seems to exist in teleosts at multiple levels of biological organization and perhaps represents a key innovation for this group as a whole. while the evolutionary origins for a preorbital module may not lie within african cichlids examining potential patterns of craniofacial modularity in cichlids may identify important targets for future developmental genetic research to understand the proximate mechanisms that have facilitated these important radiations and divergence in other groups of fishes. cichlids may be especially useful for this research, because species with widely variable jaw morphologies can be hybridized, facilitating the creation of large populations for genetic mapping to identify the loci and genetic pathways that underlie changes in jaw shape [43, 44]. as mentioned, liem's seminal work on the pharyngeal jaw apparatus in cichlids suggested that the functional decoupling of prey capture and processing should free the oral jaws to more readily adopt an array of niche-specific shapes for food capture, largely independent of other traits. implicitly, this insight confers a level of modularity to the cichlid oral jaw apparatus. recent work in our lab, as well as from others, supports this assertion by demonstrating that morphological divergence among rift lake cichlids is characterized by prodigious shifts in oral jaw shape [28, 34] and has lead to the specific hypothesis that the preorbital region of the skull represents an evolutionary module that is conserved among cichlids from each of the three east african rift lakes. here, we objectively test this hypothesis by comparing multiple combinations of models of cichlid head variational modularity. specifically, we use an approach of model selection recently introduced by mrquez to statistically assess patterns of variational modularity across a large sample of rift valley lake cichlids. to determine whether similar patterns of modularity are operating at different levels of biological organization, we also examine craniofacial modularity in each lake separately, as well as within the rock- and sand-dwelling clades of lake malawi. the data used for this study has been previously published in cooper et al., where further details, including a full list of specimens sampled, can be found. briefly, our sampling included 78.8% of the genera endemic to the three east-african rift lakes, with the following percentages from each lake: tanganyika (74.5%), malawi (88.5%), and victoria (57.1%). within lake malawi, 19 rock-dwelling species, representing 11 genera, were sampled, and 36 sand-dwelling species, representing 31 genera, were also sampled. dissections were performed on cichlid heads in order to expose anatomical landmarks important for oral jaw function (figure 1). a total of sixteen anatomical landmarks were plotted on the images of each specimen using the software program tpsdig2. our goals were to determine first whether modularity was present in the cichlid head and second what the best-supported pattern of modularity was in our data. this required comparative testing of alternative a priori models, each of which specified a particular modular structure in the cichlid head. in this approach, each model is comprised of a series of partitions defined as anatomical regions delimited by landmarks, each representing a hypothesized module predicted to be highly integrated relative to other such partitions. based on knowledge of the development and biomechanical function of cichlid heads, we constructed a number of hypotheses of modularity that were intended to extensively cover potential patterns of covariance. we selected a total of five a priori models representing the spatial distribution of developmental units and functional components of the cichlid head (see table 1). an additional null model representing a lack of any integration or modularity was included in our analyses. because it is not biologically realistic to expect that patterns of modularity predicted by these developmental and functional models are mutually exclusive, all possible nonnested combinations of the modules defined by the original five hypotheses of modularity were also included in model comparisons. in total it is important to note that while this list of hypotheses is far from exhaustive, it represents an extensive collection of models likely covers a substantial proportion of the developmental and functional processes capable of affecting covariation in the cichlid head. the methodology for testing a priori hypotheses of modularity was adapted from an approach proposed by mrquez consisting of four basic steps implemented in the mint software package (available at: http://www-personal.umich.edu/~emarquez/morph/). (1) computation of an expected covariance matrix from each model of modularity, by assuming that each module resides in its own subspace within the phenotypic space occupied by the entire structure, as described in mrquez. (2) computation of a goodness of fit statistic,, to measure the dissimilarity between observed and expected covariances for each model, as (1)=trace {(s s0)(s s0)t }, where s and s0 are the observed and modeled covariance matrices and t is the transpose symbol. to ensure the comparability of this statistic across models, is standardized twice: first, all values are divided by max, corresponding to the null model describing complete absence of integration, so that is scaled to vary within the interval [0, 1]; second, scaled is standardized via linear regression to remove the effect of the number of estimated parameters in models, which takes advantage of the linear relation observed between and the number of zeros in models. the standardized statistic is defined as the residual m *= f(z), where f(z) represents the linear function relating the values of computed from all possible models of modularity to their corresponding counts of zero elements, z. even though it would be computationally unfeasible for most studies to include all possible models, the fact that scaled values are restricted to the interval [0, 1], where 0 corresponds to the observed covariance matrix and 1 to the null model of no integration, implies that f(z) must also vary within these limits, which are sufficient to define the linear function for any given set of variables. given a large random sample of models, with values symmetrically distributed about their mean, e() f(z), and thus e( *) 0. in which *<0 correspond to comparisons where observed covariances are relatively low on average and hypothesized to be zero, and conversely, cases where *>0 occur when relatively high covariances are on average hypothesized to be zero, the best-fitting model is that with the lowest *value. note that this approach differs slightly from the one used in mrquez, where f(z) was estimated via regression using only the models included in a study, as opposed to all possible models. 95% confidence intervals were computed as the 2.5 and 97.5 percentiles of a distribution of 1,000 jackknife subsamples formed by removing random subsets of 10% of the specimens from each sample. (3) the statistical significance of *was assessed using a parametric monte carlo approach. in these tests, a null distribution for the statistic is generated by comparing the original observed covariance matrix s to each of 1,000 random matrices generated from a wishart distribution with mean vector 0 (i.e., the same mean as procrustes residual data) and covariance matrix s [45, 49]. (4) finally, to allow choice among the multiple models that are significantly better than chance according to the monte carlo approach described above, models are ranked by their goodness of fit (i.e., *values, in ascending order). the relative support for each model is determined by computing the stability of its rank using a jackknife approach in which *values and model ranks are recomputed after removing a random portion of the samples. in this study, we removed 10% of the data in each of 1,000 jackknife replicates. if a single model fits two of our groups (lake tanganyika, lt; lake malawi, lm; lake victoria, lv; rock dwellers, rd; sand dwellers, sd) equally well, it would not necessarily mean that they were close to each other in our model space. this is because two objects that are equally distant from a third (the best supported model) are not required to occupy the same position, especially in a high-dimensional space. in our case, the *values calculated for each group represents reference points useful for determining their relative position. this vector of *values can have two interpretations, the first as a set of distances between the observed covariation matrix and known patterns of modularity and the second as coordinates for the data in model space centered on a group covariance pattern. because each group may be centered at a different position, only the direction of these vectors can be compared, which was achieved through the use of correlations between *vectors of each group. this involved two separate analysis; first, we determined levels of correlation for *across the three lakes; second, we determined levels of correlation for *among lm, rd, and sd groups. however, we did not use all 137 possible gamma values in these correlations; rather, we used the ten top-ranked models in for each group. this increased the likelihood that we were testing associations between the most biologically relevant models. monte carlo tests were unable to distinguish among models, suggesting that hypotheses were too similar to distinguish amongst each other given available sample sizes. we, therefore, focus our interpretations on the basis of the relative rankings of *values and their jackknife support. overall, there was strong support for the hypothesis that modularity is present in the heads of african cichlids. across the three lakes the null model of no integration was ranked 57th, 100th, and 102nd, out the 137 models in lv, lm, and lt, respectively. in the rd and sd jackknife tests provided high support for these rankings in all groups. at all levels, the best supported hypothesis included one preorbital and one postorbital module. in our pooled data set across all lakes, as well as separate data sets for lv and rd, a preorbital module that defined the upper jaws and encompassed the exact same set of landmarks support for these patterns of modularity was high with the top model in the pooled sample of cichlids being ranked number 1 in 96.6% of jackknife reps. lv and rd groupings had top models that were similarly highly supported with 84%, and 85% of jackknife reps, respectively. for lm as a whole and the sd sample, the top ranked models displayed a preorbital module that encompassed both the upper and lower jaws (figure 2). statistical support for the lm model was high with 86% of jackknife reps maintaining its top ranking. in the case of the sd sample, there were two, statistically indistinguishable top models: the highest-ranked model included three modules, one encompassing the oral jaws, one defining the orbital size, and another that covers much of the posterior region of the head. the second ranked model was identical to the first with the exception that it did not possess an eye/orbital module. support for the best sd model (i.e., three modules) was low, with only 47% of jackknife reps supporting its ranking. the second best sd model (i.e., two modules) was also ranked as the best model in 44% of jackknife reps. however, a subsequent set of analyses found that when one of these models was removed, support for the other model significantly improved to where its top ranking was supported in over 97% of jackknife reps. the lt dataset also showed strong support for a preorbital module in its top-ranked hypothesis (supported in 98.6% of jackknife reps). however, it differed from the other groups by having a preorbital module comprised primarily of the lower jaw (figure 2). across the three lakes, we observed strikingly similar patterns of covariation. we used *values from a total of 23 hypotheses of modularity, reflecting the top ten ranked models for each of the three lakes, meaning that 7 of these hypotheses were shared among lakes. the r-values for our tests were all extremely high, and positively correlated, indicating that in spite of differences between top-ranked models, very similar patterns of covariance underlie each of these adaptive radiations (table 2). we used a total of 18 models to describe the top ten models across lm and within the rd and sd datasets. thus, a total of 12 out of a possible 30 models were shared among these groups. the correlation between *values for lm as a whole and sd dataset was particularly strong, indicating that sand dwellers may be influencing the overall pattern of modularity exhibited by malawi cichlids. this result could be due, in part, to their larger relative sample size compared to rd cichlids. alternatively, lm as a whole showed almost no relationship with rd species, and there was a strong negative relationship between sd and rd species (table 3). these data suggest that patterns of trait covariance are being repelled between sd and rd. our results demonstrate that a preorbital module is present in the oral jaws of east african rift valley cichlids and that this pattern of covariation is conserved across all lakes. this trend strongly supports the hypothesis that this pattern of modularity has influenced the rate and direction of adaptive phenotypic divergence among african cichlid radiations an idea rooted in the proposal that the cichlid pharyngeal jaw apparatus is a key innovation that freed the oral jaws from a functional constraint, formalized in light of quantitative patterns of trophic divergence among cichlid lineages, and empirically tested here. while our results are compelling, we suggest that the comparisons of rates of evolution to other groups which lack a pharyngeal jaw apparatus (e.g., salmonids and characids), and possibly a preorbital module, may be needed to confirm whether the patterns of modularity identified in cichlids represent a key innovation. while the results of our correlation analyses indicate that general patterns of covariance are conserved across lakes, there were several notable differences in the top-ranked hypotheses of modularity among groups, suggesting that while conserved patterns exist, modularity itself is capable of evolving. the lm dataset had a pattern of modularity in which the preorbital module encompassed both the upper and lower jaws, while in the lt dataset, the preorbital module was exclusive to the mandible. the lv radiation is the youngest of the three rift lakes, and correspondingly, our prior analysis found relatively low levels of shape variation (disparity) in this lake compared to lm and lt cichlids. also, more than 60% of the morphological variation among species in lv can be explained by a single major axis (principal component), considerably more than was explained by this shared axis for lm and lt (i.e., victoria cichlid head anatomies were relatively more integrated). taken together, these results suggest that the younger divergence in lv is determined by a more limited set of strong interactions among traits. since the upper jaw contains the anatomical linkages most responsible for highly kinetic jaw movements, such as jaw protrusion, this would imply that both the functional and morphological evolution of this lineage has been constrained. as the youngest of the three rift lake lineages, patterns observed within lv may offer insight into the proximate mechanisms that have shaped cichlid radiations in general. it is possible that the pattern of modularity we have identified in lv has played a dominant role in the early patterns of divergence of cichlids in lm and lt. consistent with this idea, the preorbital module identified in the upper jaw for lv was very similar to one identified in the top-ranked model for our pooled data set across all cichlids (figure 2). the top-ranked models for the sd and rd clades within lm also exhibited notable differences. whereas the sd group exhibited a preorbital module that included both the upper and lower jaws, rd species expressed a pattern of modularity similar to that of lv, where only the upper jaws were integrated. moreover, the sd/rd division within malawi was characterized by a strong negative relationship in covariance patterns, suggesting that ecological competition between these clades during the early history of the lake may have caused patterns of trait covariance to diverge. this pattern is consistent with character displacement, but at a different biological scale (groups of species or clades) than where it is usually recognized [5153]. character displacement is often thought to occur between two closely related species; however, research suggests that character displacement can also occur between distantly related species, as well as whole communities [54, 55]; see also [56, 57] for evidence of character displacement in african cichlids. therefore, it is appropriate to speculate that this process is contributing to divergence between sd and rd clades in lm. integration between the upper and lower jaws, as displayed by the sd dataset, may be especially advantageous for ram/suction-feeding predators, a predominant sd trophic niche, because both jaws need to work together in a highly coordinated fashion to produce kinematic force. alternatively, in rd species that most often employ a biting tactic whereby the upper jaw is relatively more stationary during foraging, the upper jaw is integrated, and the lower is not. this implies that the lower jaw in rd species is free to evolve a wide array of geometries, which may be advantageous for substrate feeding species, where demands on the lower jaw should be more variable relative to the upper jaw apparatus. however, this is not to say that there is a complete lack of integration between the upper and lower jaw, as modularity is a matter of degree rather than an all-or-nothing phenomenon. also, it is important to note that patterns of divergence among sd and rd are still acting within the overall context of a preorbital module (i.e., both upper and lower jaw for sd, upper jaw for rd,) suggesting that the rate and direction of phenotypic evolution is being dictated by historical constraints that are manifested in patterns of covariance and modularity. in other words, putative character displacement between sd and rd species in malawi cichlids may be proceeding along genetic lines of least resistance [5, 53]. although there are a number of possible functional explanations for patterns of craniofacial modularity, it is important to remember that selection must work within the context of developmental systems to improve functional performance. that is not to say development inherently constrains evolution, but rather that it can direct its outcome in concert with selection. in fact, simulations have shown that some degree of order may actually be required for evolution to proceed with ease. it is, therefore, probable that the patterns of craniofacial modularity identified here, while probably causing an increased propensity for adaptations involving the oral jaws, are also dictated by underlying developmental processes. clues to these potential processes may lie in early embryological events during the formation of craniofacial anatomy in fishes (see for a similar view in mammals). structural progenitors of the ossified structures in the preorbital region of the skull include the trabeculae and ethmoid cartilages (i.e., anterior neurocranium), palatoquadrate (i.e., upper jaw precursor), and meckel's cartilage (i.e., lower jaw precursor). all of these structures are derived from the same population of anterior cranial neural crest (cnc) cells that migrate away from neural tissue beginning at approximately 12 hours afterfertilization (hpf) in zebrafish. thus, the preorbital region of the skull is defined early in development, and these events may underlie the persistence of a preorbital module among african riftlake cichlids. for instance, lm cichlids show integration between the upper and lower jaws, suggesting that this developmental hypothesis may have particular merit for this adaptive radiation. the modular divisions between the upper and lower jaws found between lv and lt may be influenced by slightly later developmental events. fate mapping experiments in zebrafish show that at approximately 24 hpf the stomodeum forms as an invagination of the oral ectoderm, and both the pterygoid process and anterior neurocranium reside within a compact condensation of cells closely associated with dorsal edge of this structure, whereas meckel's cartilage forms from cells ventral to this structure. thus, while early ontogenetic events (i.e., cnc migration) regionalize the skull along the anterior-posterior axis, slightly later events (i.e., formation of the mouth) are necessary to specify the dorsal-ventral identity of the jaws within the preorbital region of the skull. later still in development, the sequence of ossification in bones of the craniofacial region may play a role in determining patterns of modularity. evidence from zebrafish and nile tilapia (oreochromis niloticus) show that the oral jaws (premaxillae, maxillae, and dentary) are among the first structures to become mineralized in the teleost head [63, 64]. in fact, the only other structures that are ossified as early as the oral jaws include the basio-occipital and opercle. functional reasons have been attributed to this chronological pattern in teleost development [63, 6567]. specifically, bones involved in early basic functions such as respiration and feeding have been observed to ossify first. this suggests that the bones of the oral jaws and opercular regions of the skull are predisposed to reflect the patterns of variational modularity we have identified. ossification sequence, and heterochronic shifts in this process, could, therefore, act as another early mechanism that sets the stage for craniofacial modularity throughout life history. beyond initial ossification, bone remodeling over ontogeny could represent another means of achieving modularity of the oral jaws and a way of simultaneously integrating developmental and functional mechanisms in a straightforward way. bone is a dynamic, metabolically active tissue that is constantly being renewed and changed. bone cells are strain sensitive and can transduce signals from mechanical loading into cues that result in either reduced bone loss or gain [6871]. disuse usually causes an acceleration of bone turnover, with resorption being the dominant process. conversely, excessive strain can damage bone, which may in turn be repaired or further reinforced through remodeling. importantly, both bone resorption and deposition involve highly conserved genetic and developmental pathways [7274]. mechanical stimuli may be particularly important for inducing adaptive patterns of modularity through the process of bone remodelling. bone turnover tends to be most effective in areas of high stress, thus reducing the risk of injury. in teleosts, the oral jaws are used for both respiration and food acquisition, but it is likely that the oral jaws are under the highest stress during food acquisition and processing, which should in turn provide the greatest stimulus for bone remodeling. indeed, several lab-based studies on cichlids have documented that different diet treatments can induce changes in bone and head shape [75, 76], demonstrating the ability of elements in the upper and lower jaws to respond to mechanical stimuli through changes in shape. within the rd lineage of lm, it is certainly possible that a high degree of remodeling and plasticity of the lower jaw has led to a pattern of modularity, wherein the mandible lacks a measurable degree of integration across species. the lower jaw may be more amenable to remodeling due the greater degree of movement that it is afforded in the rd lineage. alternatively, patterns of integration within the lower jaw may differ between species, resulting in a perceived lack of integration in the combined dataset. in either case, the conclusion that must be drawn is that the lower jaw is a highly evolvable trait within the rd lineage. perhaps the most compelling evidence for a fundamental link between developmental and functional processes comes from work in the bmp family of signaling proteins (reviewed by). critical roles for bmp signaling during bone and cartilage development are well established (reviewed by), and variation in bmp expression over ontogeny has been associated with the origin and adaptation of key vertebrate innovations including the turtle shell, bat wing, cichlid mandible [44, 80], and bird bills [8183]. all of these examples involve differential bmp expression that is presumed to be due to mutational effects (either cis or trans), but several studies have also documented environmentally induced changes in bmp expression in skeletal tissue. specifically, tensile stress has been shown to alter bmp expression during bone growth [84, 85], remodeling, and repair [87, 88]. thus, a scenario wherein patterns of craniofacial modularity are established via early developmental mechanisms and then either reinforced or altered by functional processes might represent the true nature of variational modules within the cichlid skull. examining how patterns of integration potentially shift over ontogeny and under different feeding regimes in different cichlid lineages would represent a fruitful line of future research. recent reviews suggest that an extended evolutionary synthesis (ees) is necessary to account for the origins of variation that is acted upon by natural selection [6, 7]. the empirical center for the ees will lie in discovering the features of organisms that determine evolvability. while specific definitions of evolvability are numerous and vary according to context, modularity figures prominently in these discussions insofar as it imposes a constraint on direction or speed of evolutionary change [12, 13]. in this context, we suggest that modularity can act as a key innovation. while key innovations are typically defined by the appearance of an anatomical structure that precedes an adaptive radiation, as is the case for the pharyngeal jaws, we contend that patterns of modularity, whereby the cichlid oral jaws represent a module that allows them to change with a high degree of autonomy, have had a strong influence on the rate and direction of adaptive divergence in this group. this pattern of modularity is likely what has allowed for the rapid lengthening or shortening of the oral jaws relative to the rest of the head in cichlids and shape changes that comprise the major axes of variation in each of the three african rift lakes, and likely, it represents the template upon which additional changes in trophic morphology occur. in other words, the evolution of this pattern of modularity may facilitate evolution, providing an example of the evolution of evolvability (see). the degree to which these patterns are specific to cichlids, or represent a more generalized perciform innovation, will be an important area of future study. several avenues may have lead to preorbital modularity; therefore, finding groups that lack this pattern of modularity and comparing rates of diversification will be important for identifying its potential role as a key innovation. as discussed above, several avenues may have led to the consistent patterns of preorbital modularity we have discovered. in the order of their ontogenetic appearance, these include (1) migration and specification of progenitor cells, (2) dorsal-ventral division of the oral cavity, (3) sequence of ossification with early calcification of the jaws and operculum region, and (4) remodeling of bone in response to mechanical stimuli. these all represent separate hypotheses and processes that can be tested to understand the developmental and genetic basis of a preorbital module. we predict that each of these processes may play important roles in determining modularity in the cichlid head, depending on the lineage being queried. fortunately, we have the means to assess patterns of modularity over ontogeny in cichlids and can statistically track when the patterns we have identified in adult cichlids begin to emerge. we also have the means to identify qtl associated with these anatomical modules and to track changes in gene expression during the emergence of these patterns [43, 44]. in all, cichlids represent an attractive model to reveal both the genetic basis of modularity and the evolvability of the craniofacial skeleton.

the african cichlids of the east-african rift-lakes provide one of the most dramatic examples of adaptive radiation known. it has long been thought that functional decoupling of the oral and pharyngeal jaws in cichlids has facilitated their explosive evolution. recent research has also shown that craniofacial evolution from radiations in lakes victoria, malawi, and tanganyika has occurred along a shared primary axis of shape divergence, whereby the preorbital region of the skull changes in a manner that is, relatively independent from other head regions. we predicted that the preorbital region would comprise a variational module and used an extensive dataset from each lake that allowed us to test this prediction using a model selection approach. our findings supported the presence of a preorbital module across all lakes, within each lake, and for malawi, within sand and rock-dwelling clades. however, while a preorbital module was consistently present, notable differences were also observed among groups. of particular interest, a negative association between patterns of variational modularity was observed between the sand and rock-dwelling clades, a patter consistent with character displacement. these findings provide the basis for further experimental research involving the determination of the developmental and genetic bases of these patterns of modularity.

PMC3119590

pubmed-860

this fundamental concept has a military origin. the united states navy considers proficiency in basic damage control skills as part of basic seamanship. the stated objectives of shipboard damage control are as follows: take all practicable preliminary measures to prevent damageminimize and localize damage as it occursaccomplish emergency repairs as quickly as possible, restore equipment to operation, and care for the injured personnel. take all practicable preliminary measures to prevent damage minimize and localize damage as it occurs accomplish emergency repairs as quickly as possible, restore equipment to operation, and care for the injured personnel. these objectives and the overriding principle of performing the minimum repairs necessary to maintain ship worthiness have been adapted to the care of severely injured patients. the most pervasive concept in trauma care over the last 2 decades has been the adoption of damage control principles. damage control is a fundamental shift from the traditional surgical focus of anatomical restoration to that of physiological restoration. pringle perhaps ushered the damage control concept by advocating temporary inflow occlusion and perihepatic packing for liver hemorrhage in 1908. in 1982, kashuk et al. described the development of the vicious cycle of hypothermia, coagulopathy, and acidosis in major abdominal vascular injuries [figure 1]. described truncating the operative procedure at the first indication of major coagulopathy in the following year. initially, the patient undergoes resuscitative, abbreviated surgery, where control of hemorrhage and contamination is rapidly obtained and definitive repairs deferred. the patient is then transported to the intensive care unit (icu) where active rewarming, correction of coagulopathy and acidosis occurs. once normal physiology is restored, definitive surgical management is completed. independently, hypothermia, coagulopathy, and acidosis have been demonstrated to worsen the outcome of severely injured patients. if not corrected, each component can further perpetuate the vicious cycle, resulting in certain death. hypothermia results as an imbalance between heat loss and the body's ability to generate and maintain metabolic energy. clinically significant hypothermia occurs when the core temperature is<35c; 21% of all severely injured patients and up to 46% of all trauma patients requiring laparotomy are hypothermic. in 1987, jurkovich et al. demonstrated a 100% mortality in those severely injured patients undergoing laparotomy, who had a core temperature of<hypothermia is associated with an increase in sympathetic drive with resulting peripheral vasoconstriction, end-organ hypoperfusion, and metabolic acidosis from anaerobic respiration. in addition, hypothermia may exacerbate coagulopathy by causing dysfunction of the intrinsic and extrinsic coagulation pathways, as well as platelet activity. traditionally, the causes of coagulopathy in severely injured patients have been attributed to acidosis, hypothermia, consumption of clotting factors, and hemodilution. however, this theory has been challenged by recent data suggesting that acute coagulopathy in trauma is due to hypoperfusion rather than the aforementioned causes.[1517] brohi and colleagues have suggested that hypoperfusion leads to activation of protein c and systemic hyperfibrinolysis. acidosis is a result of tissue hypoperfusion and subsequent switch from aerobic to anaerobic respiration. the adverse effects of acidosis on cardiac function were documented in physiological studies over 40 years ago. in addition, impairment of oxygen utilization and coagulation dysfunction are associated with the acidotic state.[2224] et al's original series, only patients with major vascular injury and 2 or more visceral injuries showed a survival benefit with a damage control approach. thus, only those with a severe injury pattern, whose physiologic reserve is insufficient to tolerate a prolonged, definitive operative procedure, should be subjected to a damage control approach. asensio et al. identified pre-operating room characteristics predictive of exsanguinating syndrome, in which a damage control approach would be appropriate [box 1]. there is a 98% probability of developing life-threatening coagulopathy if the injury severity score is>25, systolic blood pressure<70 mmhg, ph<7.1, and temperature<34c. hirshberg and mattox furthermore recommend that injury pattern recognition guide the experienced surgeon toward an abbreviated operation. although originally described for those patients requiring abdominal operative interventions, the same criteria for damage control apply for other body regions. damage control principles have been described for thoracic, vascular, neurosurgical, and orthopedic injuries, as well as trauma anesthesia.[2841] for example, in orthopedic procedures, severe associated head injury and/or pulmonary contusion have been suggested as indications for damage control surgery.[4244] damage control principles are applicable in all initial phases of care of the severely injured patient [figure 2]. damage control sequence summary of damage control and defi nitive interventions prehospital and emergency department damage control interventions are aimed toward temporarily stopping hemorrhage and maintaining minimum perfusion until definitive hemorrhage control can be achieved. rapid transport of the patient from the scene to early surgical care has enabled the survival of many injured patients, who previously had a significant risk of dying in the prehospital phase. the injury to admission interval was reduced from 12-18 h in world war ii to 1.25 h for the vietnam war, with a corresponding decrease in mortality from 9.5% to 2.3%. the us army has adopted a staged approach to battlefield treatment, where damage control principles are practiced by forward surgical teams and/or at the combat support hospital. tourniquet use has been demonstrated to be effective and life-saving during recent military conflicts in iraq and afghanistan.[4851] tourniquets must be applied correctly, as inappropriately applied devices cause an increase in bleeding due to occlusion of low-pressure venous outflow and inadequate occlusion of arterial inflow. topical hemostatic agents for external bleeding include dry fibrin sealant dressings, chitosan dressings, and mineral zeolite. these agents have been used again in military conflicts with success for mainly large soft tissue injuries with small vessel bleeding. the concept of permissive hypotension was originally noted by cannon et al. and subsequently shown by bickell et al. to be beneficial in patients with penetrating injuries to the torso. the concept behind this strategy is that early replacement of blood, plasma, and platelets will prevent spiralling into the vicious cycle due to excessive infusion of crystalloid solution. the military experience in iraq indicated a physiological improvement in those injured soldiers resuscitated with a 1:1:1 ratio of packed red blood cells tofresh frozen plasma and platelets, respectively.[5760] emerging data suggest that this strategy may likewise improve survival in severely injured civilian trauma patients,[6163] but awaits confirmation in prospective trials. within the operating room, damage control anesthesia aims to rapidly establish a definitive airway, maintain oxygenation, prevent hypothermia, initiate correction of coagulopathy, and maintain permissive hypotension until definitive hemorrhage control has been obtained [table 2]. anesthetic resuscitation goals during and after damage control surgery (from dutton et al.) abdominal damage control entails rapid celiotomy, control of hemorrhage, limiting contamination, and temporary abdominal closure. surgical bleeding may be controlled by a combination of packing, direct arterial ligation, vascular clamping in situ, splenectomy, and nephrectomy, whereas contamination is limited by rapid stapled resections, temporary hollow viscus closures and pancreatic drainage.[21125276467] temporary abdominal closure is most commonly achieved with a vacuum-assisted dressing. alternative methods of temporary closure include towel clip or running nylon skin closure, bogota bag, or silo closure. removal of packs, thorough re-exploration, complete vascular repair, establishment of gastrointestinal continuity or stoma formation, and fascial closure are carried out in the definitive phase. thoracic injuries present a unique challenge, as structures within the chest are not easily controlled with temporary maneuvers. packing is limited to the apices and cardiophrenic angles, but lung injuries can be rapidly controlled with nonanatomic, stapled wedge resections. definitive procedures at re-operation include removal of packs, thorough exploration for air leaks, and chest wall closure. damage control principles for vascular trauma hinges on 2 categories of vascular repairs: simple and complex. complex repairs include vascular reconstructions, such as patch angioplasty, end anastomosis and graft interposition, which are time consuming and not ideal in the hypothermic, coagulopathic patient. once appropriate physiology has been restored, definitive vascular reconstruction can be achieved before delayed closure of fasciotomy wounds. since the 1980s, early total care has been the standard of care for orthopedic injuries following bone's landmark paper demonstrating an increase in pulmonary complications with delayed femoral fracture repair. however, an increasing understanding of the inflammatory process and effects of orthopedic intervention, otherwise known as the second hit, led to the concept of damage control orthopedics. temporary external fixation or traction for long-bone fractures and minimally invasive pelvic stabilization for pelvic fractures are the initial orthopedic interventions. some data suggest that definitive fixation should occur within 24 h of injury or after 5 days to avoid pulmonary complications. optimizing the general condition of the patient is essential in optimizing outcomes from head injury. damage control neurosurgery involves rapid arrest of intracranial bleeding, the evacuation of intracranial hematomas and the early debridement of compound wounds to the skull. craniectomy may be beneficial for cerebral edema, however, dural closure should be attempted to prevent intracranial infection. the extent of debridement, however, remains a controversial issue, as aggressive debridement of brain tissue, bone and missile fragments, may at times worsen neurologic deficits. the aims as previously stated are to rewarm the patient and correct acidosis and coagulopathy. rewarming to a temperature of 37c can be achieved by warming the icu room, removing any wet sheets or clothing, covering the patient with warm blankets and applying a forced air-warming device. initial coagulation targets should include inr<1.2, fibrinogen>100 mg/dl, platelets>100,000/mm. although activated factor vii was a promising adjunct in the arrest of nonsurgical sources of hemorrhage, recent trials failed to show a mortality benefit. a review by rotondo et al. identified an overall 50% mortality and 40% morbidity in 961 damage control patients. the early reports of damage control surgery demonstrated a significant improvement in mortality when comparing patients undergoing abbreviated procedures to those patients undergoing conventional surgery. it is important to note that these comparisons apply to damage control laparotomy; mortality outcomes have not yet been demonstrated in other damage control procedures. complications from damage control laparotomy include intra-abdominal abscess formation (0%83%), enteric fistula (2%25%), dehiscence (9%25%), abdominal compartment syndrome (2%25%), and inability to reapproximate the fascia edges (1040%). orthopedic external fixation may increase pin-site infection and damage control vascular procedures may increase graft infections. it is essential that trauma providers be au-fait with the principles of damage control for they are clearly life-saving in many patients with multisystem trauma. the damage control concept originated over 100 years ago, and has since grown to encompass all phases of the initial care of the severely injured patient. by learning from the accumulated experience, outcomes and complications of damage control, modern surgeons can apply this strategy following a rationalized approach. nowadays, damage control principles are also applied for non-trauma care, including the treatment of abdominal compartment syndrome and intra-abdominal sepsis. ongoing and future developments will continue to define the most appropriate patients that may benefit from damage control.

the damage control concept is an essential component in the management of severely injured patients. the principles in sequence are as follows: (1) abbreviated surgical procedures limited to haemorrhage and contamination control; (2) correction of physiological derangements; (3) definitive surgical procedures. although originally described in the management of major abdominal injuries, the concept has been extended to include thoracic, vascular, orthopedic, and neurosurgical procedures, as well as anesthesia and resuscitative strategies.

PMC3209990

pubmed-861

mental disorders there was since of human creation, and based on the world health organization (who) estimation, 25% of the people suffer from at least one of these disorders. these multi-factorial syndromic disorders (genetic, physical, chemical, biological, psychological, and socio-cultural) are known to be associated with destruction in thought, mood, or behavior, and cause maladaptive behavior, disability in coping with usual stress, and destruction in function. mood disorders are among the mental disorders that are accompanied by mood imbalance, unusual mood, and changes in physical, emotional, and behavioral responses. they range from mania to depression and involve individuals of all ages and of any gender and history. this social function disorder influences the individuals in familial, marital, occupational, and educational dimensions. statistics show that mood disorders comprise 25% of all diseases in the us with prevalence of 1.2-1.6% in the general population. about 33% of iranians are involved in a type of mental diseases and the prevalence of mood disorders has been reported to be between 2 and 25%, of which two thirds suffer from depression. trend of type ii bipolar disorder as a mood disorder is chronic and needs long-term treatment. about 40% of type i bipolar disorder patients and 20% of depressed patients have a chronic trend. major depression is the most severe type of mood disorder and the fourth cause of disability in the world. families are involved in numerous conflicts and problems with these patients, including treatment costs, patients conduct and control, giving daily care to these patients as a result of their lowered independency, and helping them to join the society and to have social communication with others. one of the determinants for quality of life is familial health which is expressed through family members physical health, familial psychological atmosphere, and familial socio-population characteristics. quality of life is a vast concept influenced by personal health, mental status independence level, social communication, and communications with the environment, and each factor which has a negative effect on individuals well-being and ability in conducting their daily activities can lower the quality of life. this concept always includes five dimensions: physical, mental, spiritual, social, and disease-related signs. in families of patient with mental disease, there are problems such as sleep disorder, eating disorder, physical stress related manifestations, changes in health status behavior, and sexual problems, as well as burnout due to lesser leisure time that the family can have. in mental dimension, due to presence of the patient in the family, the family experiences problems such as daily conflicts and concerns about patients occupational and educational future, emotions like fiasco, anxiety, fear, depression, guilt, and sorrow, hopelessness, insolvency, lowered self-esteem, and feeling of shame and sadness resulting from internalizing negative social attitudes. in social dimension, there are problems like changes in social communications and a reduction in social activities and isolation, and in disease-related signs dimension, with regard to high stress and anxiety, which exists in the family, signs of physical psychosomatic diseases are observed. family's capability to react toward the disease can be empowered through conducting interventions and making changes in the quality of life. these interventions include group psycho-education, which emphasizes on mental, social, and biological dimensions and makes a cognitive frame that helps the individuals to understand logical ideas and problems in terms of treatment and to make the best use of their acquired experiences in life. group psycho-education is an intervention based on the needs of the group, which focuses on perception, knowledge, and skills in families who are in relation with a diseased member. the outcomes of this intervention are increased feeling of well-being, lowered level of families and individuals stress, improvement of social function, reduced negative signs and symptoms, improved insight and judgment, and lowered family's caring burden and family adaptation. research has shown that group psycho-education can improve the quality of life in patients with major depression and bipolar disorder in the contexts of occupational, social, emotional, and physical functions, and leads to a better recovery from depression signs and patients quality of life, compared to conventional and personal treatments. in a study conducted in 2008, it was reported the group psycho-educational program was effective on reduction of disease recurrence and re-hospitalization treatments through increase of caregivers awareness and promotion of coping skills. a study conducted in 2009 showed that group psycho-education caused improvement in quality of life, a reduction in treatment costs, disease recurrence, and re-hospitalization, and higher capacity of treatment compliance, as well as a reduction in disease signs in bipolar patients. the notable point is that most of the research on group psycho-education focused on the patient and few studies were conducted on the effect of this program on these patients families and their quality of life. as the patient is a member of the family unit, and in a unit, the members affect one another, and considering the fact that quality of life is of great importance in various social groups, especially among the individuals with special physical and mental conditions and their related tensions, improvement of patients quality of life can not be expected prior to improvement of their families quality of life. therefore, the researchers decided to study the effect of group psycho-educational program on the quality of life in families of patients with mood disorders. this is a two-group three-step interventional study conducted on 32 families of patients with mood disorders in iran, isfahan in 2011. the research environment comprised farabi and nour hospitals in isfahan and the study population consisted of the family members of the patients with mood disorders (spouse, father, mother, child, sister, and brother) who had caring, supportive, emotional, and economic responsibilities of the patient. inclusion criteria were feeling to be the principal caregiver of the patient and having caring responsibility in this regard, age>18 years, the ability to understand and speak in persian, having a fixed contact address or with phone number available, education level above primary school, residing in isfahan, attending the study as the principal caregiver, not concurrently taking care of more than one patient with a mental disorder or physical disease, taking care of a patient with mood disorder for at least 3 months, no previous attendance in family education classes, and no consumption of psychotic medication or drug abuse. the subject was excluded if he/she did not attend the family education sessions for more than two sessions or when his/her family members died during the study. sampling was randomly conducted through referring to nour and farabi hospitals and checking the existing files related to the patients with one of mood disorders and meeting the inclusion criteria in the men and women psychiatry wards. after selecting the patients, their families were called and the research process and its goals were explained to them. next, based on the inclusion criteria and after obtaining their consent, two 16-subject groups were selected by random numbers chart as the study and control groups. the subjects were assured about the confidentiality of their information and they were informed that they could have the research results if they liked. the subjects in the control group were informed that they would receive an educational booklet and a related cd. the first section was on personal characteristics of the family members and the patient, and the second one contained world health organization's quality of life-bref (whoqol-breef) including the four domains of physical health, mental health, social communications, and environmental health. this tool was firstly validated in iran with a goal of translation and measurement of its validity and reliability and structural factors by nejat et al. the questionnaire reliability was measured by cronbach's alpha and intra-class correlation was obtained by test the values on intra-class correlation and cronbach's alpha were obtained over 0.7 in all domains, except for social communications with cronbach's alpha of 0.55, possibly due to lesser number of questions in this domain or presence of sensible questions. reliability of the questionnaire was assessed by linear regression in the groups of healthy and diseased subjects by distinguishing the ability of tools. the obtained results revealed validity, reliability, and acceptability of structural factors of this tool in iran in healthy and diseased subjects groups. the subjects filled the questionnaire before beginning the study, immediately after (after 10 sessions), and 1 month after the intervention. the control group received no intervention and the subjects were asked not to attend any other educational programs during the study. group psycho-educational program [table 1] was conducted by an ms of psychiatry nursing for ten 90-min sessions twice a week for 5 weeks in the study group. content of group psycho-educational program (length of each session was 90 min) methods such as lecture, question and answer, role play, and techniques like brain storming, group discussion, and small groups were adopted. in the end of the sessions, the related cd containing the relaxation techniques, and anger and tension control, and an educational booklet which was briefly prepared and related to the content of each session were given to the subjects. inferential statistical tests and independent t-test showed no significant difference in the means of age, number of family members, and length of care between the two groups [table 2]. chi-square and mann whitney tests also showed no significant difference in the personal characteristics of the family members and the patients (variables of sex, marital status, type of accommodation and occupation, relativity with the patient, and the level of education) in the two groups of study and control (p>0.1). independent t-test showed no significant difference in the mean scores of the quality of life before intervention in the dimensions of physical health, mental health, social communications, and environmental health and the mean total scores of quality of life, and in the mean scores of quality of life in the domain of physical health immediately after intervention between the two groups (p>0.3). comparison of mean scores and sds of age, number of family members, and length of care among the subjects in the study and control groups but there was a significant difference in the domains of mental health, social communications, environmental health, and the mean total scores of quality of life immediately after intervention (p<0.05). there was also a significant difference 1 month after intervention in the mean scores of quality of life in the domains of mental health, social communications, and environmental health and the mean total score of quality of life in the two groups (p<0.05), but there was no significant difference in the domain of physical health (p=0.1). repeated measure anova showed an increase in the mean scores of quality of life in the domain of physical health immediately after and 1 month after intervention in the study group, but this increase was not statistically significant. in the domains of mental health and social communications, there was a significant increase in three time points, whereas the mean score of quality of life firstly showed an increase and then a decrease in the domain of environmental health, but the changes were not statistically significant. in the control group, despite a reduction in the mean score, there was no significant difference in environmental health during three time points. in the study group, there was a significant increase in the mean total score of quality of life in three time points. in the control group, although there was a reduction in the mean total scores of quality of life, the reduction was not significant [table 3]. comparison of mean total scores of quality of life and mean scores of quality of life in four domains and three time points in the two groups of study and control in this study, we tried to investigate the effect of group psycho-educational program on the quality of life in families of patients with mood disorders. findings showed that intervention led to an increase in the mean total score of quality of life in the study group, while lack of intervention in the control group resulted in a reduction in quality of life, but the difference was not statistically significant. therefore, the intervention resulted in prevention of the reduction in quality of life and led to its improvement in families of patients with mood disorders. sanchez (2009) showed that group psycho-education could be effective on reducing the severity of the disease signs and improving the quality of life in patients with minor and moderate depression, and resulted in recovery, reduction in the signs, and improvement of quality of life. (2005), in a study on the effect of group psycho-education with time limitation on the perception of quality of life in bipolar patients, showed that the mean score of quality of life notably increased immediately after the intervention. the common point of the studies conducted earlier with the present study is the type of intervention, which is group psycho-education, and measurement of quality of life concept. meanwhile, there were differences in the study population, and the number of subjects and educational sessions, and future follow-ups. (2009), in a study on families with adolescents suffering from bipolar disorder, showed that family-focused psychological education resulted in an increase in their quality of life. (2008), in a study on the efficacy of modified psycho-educational interventions on family burden and improvement of quality of life in families of bipolar patients, showed that the total score of quality of life increased in three time points (at the time of intervention and at 3 and 6 months after the intervention) in the study group. in these studies, the quality of life in families of patients with bipolar disorder, as one of the mood disorders, was measured, which is similar and consistent with the present study. meanwhile, there were differences in the type of educational intervention, number of subjects, and future follow-ups. (2010), in a study on the effect of cognitive behavioral training on improvement of quality of life in cardiac patients, showed that cognitive behavioral education had a significant effect on the three subscales of emotional, physical, and social functions of quality of life, as well as the total score of quality of life. 2012), in a study on the effects of peer support group on promoting quality of life in patients with breast cancer, showed that the patients, supported by peers, had a higher quality of life after the intervention, and the increase in mean total score of quality of life was significant. the common point between these studies and the present study is the measurement of quality of life and its final outcome, but the study population, the type of intervention, and the number of subjects are different from those of the present study. despite this, it is observed that the interventions with educational origin can affect not only patients quality of life but also their families quality of life in different populations. the reason can be attributed to the increase of awareness, perception, knowledge, and insight, which is obtained through receiving information by this type of intervention. quality of life is defined as individuals perception from their situations in life from the cultural point, the value system in which they live, as well as their goals, expectations, standards, and priorities. it is absolutely personal and can not be observed by others, and is founded on individuals perceptions from their life, so these positive results and effects can be interpreted. repeated measure anova showed an increase in the mean scores of quality of life immediately after and 1 month after the intervention in the domains of physical health, mental health, and social communications in the study group, of which except for the domain of physical health, the increase was significant. in the domain of environmental health, the mean score of quality of life firstly showed an increase and then a decrease, but the difference was not significant. (2005), in a separate study on the domains of quality of life, reported significant changes in the domains of physical health and general satisfaction, but no significant difference in the domain of social communications despite its increasing trend. (2008) showed that there was an increase in the mean scores of physical health, mental health, and environmental health and a decrease in the mean score of social communications, 3 months after intervention, but the increase and decrease were not significant. six months after intervention, there was an increase in the mean scores of physical health, mental and environmental health, but the difference was not significant. there was a decrease in the mean score of social communications, which was not significant. in the study group, only in the domains of physical health and mental health, there was a significant difference in the 6 month. (2012) showed that the differences in subscales were significant in two phases of intervention in tehran. the differences in the results of some of the domains including physical health and social communications in the studies conducted, compared to the present study, can be due to the difference in sample size, type of intervention and its length, and the follow-ups. in the present study, a lower sample size has been adopted compared to other studies and the follow-up lasted for 1 month after intervention, but in other studies, a longer time was considered to investigate the longevity of effect for intervention. the obtained finding of the present study showed the positive effect of the group psycho-educational program on quality of life of the families with patients of mood disorders. the findings of the present study are expected to be applied in counseling, clinical and research domains. psychiatric nurses are in touch with these families in their counseling sessions and can use group psycho-educational method for family group counseling. research showed that if group psycho-education is administered by trained nurses, more participants join the program. nurses can also conduct this program in psychiatric ward to increase patients and families awareness and knowledge, in order to take steps toward promotion of their quality of life. the limitations of the present study included less number of subjects and short time of follow-up to investigate the longevity of intervention effect. the researchers hope their obtained results to be useful to conduct further studies to promote the quality of life of the families with a patient of a mental disorder. it is suggested to conduct a study with higher sample size and longer follow-up to investigate the effect of a group psycho-educational program not only on the quality of life of families of patients with mood disorders but also on the families with patients of other mental disorders.

background: mood disorders related behaviors are imposed on family members and influence the family's mental atmosphere and level of quality of life. therefore, the researchers decided to study the effect of group psycho-educational program on the quality of life in families of patients with mood disorders. materials and methods: this is a two-group interventional study conducted on 32 members of families of the patients with mood disorders selected through random sampling. a group psycho-educational program was conducted in ten 90-min sessions (twice a week) for the study group. (world health organization's quality of life-bref whoqol-bref) questionnaire was adopted in the study and was filled before, immediately after, and 1 month after the intervention. results:independent t-test showed a significant difference in the scores of quality of life in the domains of mental health, social communications, and environmental health, immediately after and 1 month after intervention in the study group compared to the control group. repeated measure analysis of variance showed a significant increase in the mean scores of quality of life in the study group. conclusions:the results showed that the impact of group psycho-educational program is observed in the prevention of reduction in quality of life and its promotion in the families of patients with mood disorders.

PMC3917185

pubmed-862

almost all of our knowledge about the effect of inflammatory events on blood-brain barrier is related to chronic diseases or acute events, in which exacerbated responses to pathogens are present. the role of low-grade inflammation in the generation or exacerbation of neuropathologies is recently explored because several conditions such as obesity and diabetes concur with this inflammatory status during long-term periods and, perhaps, it may be related to systemic and central comorbidities. sleep loss per se, including sleep deprivation, sleep restriction, or sleep fragmentation (see table 1 for a full differentiation between the concepts), generates a pathogen-independent low-grade inflammatory status. here, we will review (1) the inflammatory mediators that increase during periods of sleep loss and their association with general disturbances in peripheral endothelium and epithelium and (2) how those inflammatory mediators might alter the blood-brain barrier during sleep loss. with the evidence presented in this review, we propose a hypothetical mechanism by which sleep restriction could induce blood-brain barrier disruption, emphasizing the effect of inflammatory molecules on tight junction maintenance. sleep is one of the most widely observed phenomena in mammals and is recognized to play a vital regulatory role in a number of physiological and psychological systems [1, 2]. the paramount role of sleep in the physiology of animal models and humans is evident by the effects of sleep loss. serious physiological consequences of sleep loss include decreased neurogenesis, cognitive dysfunction (deficits in learning, memory, and decision-making), metabolic alterations, cardiovascular diseases, immune disturbances, and blood-brain barrier disruption [18]. both chronic and acute sleep loss associate with energy balance disturbances and changes in cellular and humoral immunity [10, 11]; however, the direct mechanism by which sleep induces a low-grade inflammatory status is unclear. experimental research has demonstrated that acute and chronic sleep loss result in impairments in the immune response, characterized by deficits in the cellular component (both in number and in function) and increased levels of proinflammatory mediators, such as tumor necrosis factor- (tfn-), interleukin-1 (il-1), il-6, il-17a, and c-reactive protein (crp) (for details of the cytokine levels related to varying periods of sleep loss see). in addition to immune-derived inflammatory mediators, sleep loss also increases the levels of other inflammatory molecules such as cyclooxygenase-2 (cox-2), nitric oxide synthase (nos), endothelin-1 (et-1), vascular endothelial growth factor (vegf), and insulin-like growth factor-1 (igf-1) [8, 13]. the major aim of this review is to discuss the role of low-grade inflammation in the blood-brain barrier disruption induced by sleep loss; nevertheless, because endothelial cells form the blood-brain barrier we considered it relevant also to discuss the effect of sleep loss on peripheral endothelial and epithelial cells as early markers of inflammation. endothelial and epithelial cells form protecting barriers in the central nervous system but also in the periphery. several pathological states are known to target peripheral epithelial and/or endothelial barriers; therefore the knowledge of regulatory mechanisms in those peripheral barriers may contribute to improving the understanding of central barriers. among the pathologies affecting body barriers, those involving infections and also diabetes, cardiovascular diseases, psoriasis, and cancer are associated with sleep disturbances [1416]. here, we present evidence regarding the disrupting effect of sleep loss on peripheral epithelial and endothelial cells. when fluid compartmentalization goes awry, homeostasis is altered and the possibility exists of induction of inflammation by microorganism invasion and even of tumor microenvironment induction. in humans sleep restriction increases sympathetic activity and, concomitantly, causes endothelial dysfunction at the venous level; the effect may be mediated via endothelin-1 (et-1) because et-1-mediated vasoconstriction is greater in adults with short sleep duration (less than 7 h per night) than in those with normal sleep duration (79 h per night). the link between sleep restriction and increased et-1 activity is not clear, but the role of the inflammatory status induced by sleep loss may partially explain this association. in this way, inflammatory cytokines, insulin, and epinephrine altered during sleep loss the cytokines that may increase in sleep-deprived humans (e.g., tnf-, il-1, and il-6) raise arterial vascular tone via endothelin receptors. several reports indicate that sleep loss induces vascular alterations related to inflammatory markers (for a review see). some studies have tried to clarify the underlying mechanism; for instance, sleep deprivation in humans induced magnesium deficiency, which produces arterial constriction, and is a possible cause of myocardial damage. other barriers are not yet studied in sleep-deprived or sleep-restricted humans, but some studies indicate that sleep deficiency alters skin conductance. animal models currently used in sleep research include those that model shift work by totally sleep depriving rodents; human sleep deficiency by sleep restricting; and sleep loss-associated with pathologies, such as obstructive apnoea, by promoting sleep fragmentation. contrary to the human studies, in the case of animal models, several studies have identified negative effects of sleep loss on peripheral endothelia and epithelia. for instance, sleep fragmentation in mice (20 weeks) induces vascular endothelial dysfunction and mild blood pressure increases. those physiological effects are accompanied by morphological vessel changes characterized by elastic fiber disruption and disorganization, increased recruitment of inflammatory cells to the vessel wall, and increased plasma levels of il-6. in rats, this endothelial dysfunction is independent of blood pressure and sympathetic activity but is associated with changes in nos and cox pathways. the effect of sleep loss on physical barriers such as the intestinal barrier or blood-testis barrier is not reported; however, gut bacteria are present in blood after sleep deprivation and both sleep-deprived and sleep-restricted rats exhibit lower sperm viabilities associated with an increase in endothelial nos expression. those data suggest that sleep loss also might alter the physiology of the above-mentioned barriers with the ensuing tissue damage. we reported for the first time that sleep restriction induces blood-brain barrier hyperpermeability in rats. we used a procedure consisting of 20-hour sleep deprivation plus 4 hours of sleep opportunity during 10 consecutive days; because a reduction in total sleep time is observed, it is named sleep restriction. in our conditions, rapid eye movement (rem) sleep is fully suppressed and non-rem sleep is 30% reduced since the first day of sleep restriction. in those conditions we showed a widespread breakdown of the blood-brain barrier. we described that brief periods of sleep opportunity (40 to 120 minutes) induced a progressive recovery of blood-brain barrier permeability to evans blue (> 60 000 da) in the majority of brain regions studied, with exception of the hippocampus and cerebellum. we also observed that in the hippocampus the number of pinocytic vesicles increased threefold. in a subsequent study, mice were subjected to sleep restriction for 6 days in a rotatory bar for 12 hours per day. sleep restriction by this method induced rem sleep loss in the first 3 days with partial rem sleep recovery afterwards; at the end of the 6th day of sleep restriction, there was 13.3% increase of wakefulness, 10.2% reduction of non-rem sleep, and 2.1% reduction of rem sleep. under these conditions, increased blood-brain barrier permeability to sodium fluorescein, a low molecular-weight tracer, was observed; sleep recovery by 24 hours fully reverted the effect. in the same way, sleep restriction decreased the mrna levels of the tight junction proteins claudin-5, zonula occludens-2 (zo-2), and occludin. in the first study a yoked control was included to avoid any potential confounding effects of stress on blood-brain barrier permeability; rats were placed on large platforms during the same period of time as sleep-restricted subjects and despite being in the same stressful conditions as the sleep-restricted subjects they have a fully functional blood-brain barrier. the second study did not include a yoked control, a newly developed sleep deprivation method was used that involves a rotating bar at the bottom of the house-cage with random changes of direction; this method may certainly be stressful to the rodents due to the presence of forced exercise; however, our recent results replicate their findings (hurtado-alvarado et al. personal communication). therefore, the evidence of changes in the blood-brain barrier integrity induced by sleep loss is substantial and inflammatory molecules appear to play a key role in the mechanism subjacent to this phenomenon. the increase in the levels of inflammatory mediators during chronic sleep loss may be related to blood-brain barrier disruption because several previous reports show that per se those inflammatory molecules affect the integrity of the blood-brain barrier (see table 2 for a summary). tumor necrosis factor- (tnf-) is a protein synthesized mainly by monocytes and macrophages that plays an essential role in the initial activation of the immune system. in the central nervous system tnf- is a multipotent cytokine produced by neurons, glia, and microvascular endothelial cells that is implicated in several physiological events, such as memory consolidation and sleep regulation. the role of tnf- as an inductor of blood-brain barrier disruption includes its overexpression in microglia, astrocytes, and microvascular endothelial cells. several reports indicate that sleep loss increases the plasma and brain levels of tnf- [2933], the mrna expression of tnf- in the brain [33, 34], the spontaneous production of tnf- in lymphocytes, and the mrna expression of tnf- in peritoneal and epididymal adipose tissue [36, 37]. despite the fact that the changes in tnf- induced by sleep loss are 2 to 5 times higher compared to rats sleeping ad libitum, the levels are below those reported in the case of infectious diseases; however, the chronic exposure to this inflammatory mediator may underlie the sleep-induced blood-brain barrier dysfunction. the effect of tnf- in endothelial cells is well studied. in vivo and in vitro studies report an increase in the permeability of microvascular endothelial cells after the administration of tnf- in both animal models and human cell lines [3841]. nonetheless, the tnf- levels used in those studies are 100,000 times higher compared to concentrations reported under sleep loss conditions. the lower dose of tnf- used in in vitro studies (1 ng/ml) results in a transendothelial electric resistance (teer) reduction at 60 minutes after treatment with teer recovery at 210 minutes after administration, which is similar to the results observed using higher doses of tnf- (50, 100 ng/ml), suggesting that the effect mediated by tnf- receptors is saturable. while we can infer that peripheral changes mediate the main effect of tnf- on blood-brain barrier, we must not ignore the fact that tnf- levels also increase in the brain. in this way, it is known that after the administration of tnf- (250 ng) in the lateral ventricle an increase in the transport from cerebrospinal fluid (csf) to blood of i-human serum albumin is observed in rats, which demonstrates that tnf- promotes the clearance of macromolecules from the csf to the venous blood. taking into consideration that the restorative function of non-rem sleep may be a consequence of the enhanced removal of waste products accumulated in the awaking brain via the glymphatic system, the tnf- increase during sleep loss may contribute to the clearance of toxins by efflux of potentially neurotoxic waste products via the blood-brain barrier. interestingly, in the brain, sleep restriction increases the mrna expression of tnf- in a region-dependent manner in the mouse, suggesting that if tnf- regulates the microvascular brain endothelial cells from inside the brain, it may do it in specific areas, such as the somatosensory and frontal cortices, which indicates that blood-brain barrier regulation by inflammatory molecules is heterogeneous (a finding reported by us in the case of blood-brain barrier changes induced by sleep loss and recovery; see). another example of tnf- role in blood-brain barrier regulation during peripheral inflammation occurs after the induction of acute pancreatitis in rats, where an increase in tnf- levels is observed as early as 6 hours after pancreatitis induction and at the same time increases the blood-brain barrier permeability to sodium fluorescein (365 da) in the hippocampus and cerebellum as well as to evans blue in the hippocampus, basal nuclei, and cerebellum. in the case of the low molecular-weight tracer the normal blood-brain barrier permeability reestablishes at 24 hours after induction, while, for evans blue, reestablishment occurs 48 hours after induction. we also observed region-dependent effects of sleep loss and recovery on blood-brain barrier integrity; for instance, in the cerebellum the hyperpermeability remained even after sleep opportunity periods of 40120 minutes; meanwhile the cortex recovered the normal blood-brain barrier permeability at the same time points. therefore, the cerebellum could be considered as a highly susceptible region to inflammatory mediators such as tnf- in comparison with other brain regions (e.g., the hippocampus and cortex). the differential distribution of tnf- receptors in the brain may explain why tnf- regulates blood-brain barrier function in a region-dependent manner; however, is it also possible that other molecules may have synergic effects with tnf- to regulate blood-brain barrier physiology. classically, phagocytic cells in response to inflammatory stimuli release il-1; in the brain il-1 activates the regions involved in the generation of hyperthermia. similar to the effect of tnf-, il-1 administration promotes sleep in mammals and sleep deprivation has been shown to increase serum il-1 levels both in humans and in animal models [3, 4, 29, 49]. in addition, sleep loss induces il-1 gene expression in the brain [34, 45], cardiac muscle, and adipose tissue and on phytohaemagglutinin (pha) activated peripheral blood mononuclear cells (pbmc). in the case of the brain, several reports indicate that the expression of the il-1 receptor-1 (il-1r1) in endothelial cells is high in the preoptic area, subfornical organ, and supraoptic hypothalamus, while a lesser expression is found in the paraventricular hypothalamus, cerebral cortex, nucleus of the solitary tract, ventrolateral medulla, trigeminal and hypoglossal motor nuclei, and the area postrema [5153]. in in vitro models of blood-brain barrier, il-1 (in doses of 5, 100, and 1000 ng/ml) decreases the teer similar to the levels observed after tnf- administration [42, 54]. il-1 also promotes the release of il-6 and prostaglandin e (pge2) in rat brain endothelial cells. likely, in vivo studies have shown that il-1 induces sickness behaviour mediated by endothelial il-1r1 activation in rats; the probable mechanism may be the induction of cox-2 in brain endothelial cells after il-1r1 activation with the concomitant increase in the synthesis of pge2. il-1 may have a key role in blood-brain barrier dysfunction during sleep loss because it has been reported that sleep loss increases il-1 gene expression in the cerebral cortex, hippocampus, and basal forebrain. in addition, il-1 released from activated microglia increases blood-brain barrier permeability; this effect may depend on the suppression of astrocyte-derived signals that maintain blood-brain barrier integrity (e.g., sonic hedgehog, shh). il-1 action on blood-brain barrier may induce the expression of other inflammatory mediators produced by microglia and astroglia. for instance, the lack of il-1r1 specifically in endothelial cells precluded the brain increase of il-1, tnf-, and il-6 in stressed rats despite the presence of reactive microglia [59, 60], which places il-1 and its receptor on endothelial cells as central mediators of brain inflammatory responses. hence, the role of il-1 in blood-brain barrier could be mainly related to endothelial-glial interactions. sleep onset is associated with an increase in circulating levels of il-6; nevertheless, the potential role of il-6 in sleep regulation is controversial, and it may take a secondary role as compared to its primary role in the acute-phase response. some studies indicate an increase of il-6 circulating levels in sleep-deprived subjects [6466] and also in gene expression in immune cells [35, 50, 67], whereas others report a delay in the sleep-related peak of plasma il-6 in sleep-restricted subjects. even some authors report that plasma levels of il-6 are maintained without change despite sleep loss [30, 68]. some studies also show that sleep recovery after total sleep deprivation increases plasma levels of il-6; however, others found that in immune cells il-6 levels remain unchanged during sleep recovery. il-6 is a pleiotropic cytokine key for immune regulation and if secreted during sleep loss and recovery may have neuroprotective effects; indeed, it has been reported that il-6 appears to be neuroprotective and is involved in endothelial survival after shear stress. however, given the high variability of il-6 after sleep loss and recovery, the role of il-6 as a possible modulator of blood-brain barrier during sleep is unclear. it is necessary to elucidate the precise changes in il-6 levels both centrally and peripherally to clarify the role of il-6 in blood-brain barrier modulation during sleep. il-6 has pyrogenic effects when endogenously released during systemic inflammation; it achieves this function by its binding to il-6 receptor (il-6 r) on brain endothelial cells and the subsequent induction of pge synthesis. however, those effects require high levels of il-6 (> 1 ng/ml). in humans, il-6 serum levels were less than 100 pg/ml and the normal levels for il-6 in csf are around 10 pg/ml, significantly lesser than those measured in several in vitro and in vivo experiments. for instance, treatment with 50 or 500 ng of il-6 reduced the infarct volumes and symptoms of neurological deficit in a rat model of cerebral ischemia. in addition, the administration of il-6 decreased the blood-brain barrier permeability to evans blue by suppressing the expression of matrix metalloproteinase-9 (mmp-9). the role of il-6 as well as tnf- and il-1 may depend on the brain region, for example, the stimulation with lipopolysaccharide (lps) induces in the brain the expression of the il-6 receptor (il-6r) in the cortex and hippocampus but not in the cerebellum. therefore, considering il-6 a proinflammatory cytokine it is possible to suggest that its role in blood-brain barrier physiology during sleep loss may be related to the modulation of the expression of other proinflammatory cytokines. th17 cells have been identified as a subset of t helper lymphocytes characterized by the production of a number of cytokines including il-17a, il-17f, and il-22. for instance, high expression of il-17a is associated with autoimmune inflammatory diseases including multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, and systemic lupus erythematosus. during sleep loss a subtle increase of il-17a il-17a high levels were found in plasma even after 24 hours of sleep recovery in sleep-restricted rats. sleep loss also increases the mrna and protein expression of il-17a on pha activated pbmc in humans. particularly, the receptor for il-17a is expressed in epithelial and endothelial cells and promotes the expression of inflammatory mediators such as il-6 and chemokines. il-17a induces epithelial and endothelial dysfunction; it decreases the teer and concomitantly increases tracer permeability; the mechanism is mediated through tight junction disruption. finally, from in vitro experiments it is known that il-17a increases endothelial cell permeability at 10 or 100 ng/ml doses [78, 79]. these data suggest that il-17a might be involved in blood-brain barrier disruption during sleep loss. c-reactive protein (crp) is the major acute-phase protein involved in the resistance to microbes and autoimmune diseases and is an important risk marker of cardiovascular and cerebrovascular disorders. the plasma levels of crp increase faster and at higher magnitude than other acute-phase proteins. sleep loss increases the circulating levels of crp (0.5 g/ml), which is associated with increased risk of cardiovascular disease and stroke [4, 8, 50, 67, 81, 8183]. the synthesis of crp in the liver is controlled by proinflammatory cytokines, including tnf-, il-1, il-6, and il-17a [82, 84]. crp (1020 g/ml) induces blood-brain barrier disruption because brain endothelial cells express high levels of crp receptors (cd16 and cd32) and also because brain endothelial cells express high levels of the p22phox subunit of the nad(p)h-oxidase. the high expression of both exacerbates the generation of reactive oxygen species (ros) with the resultant oxidation of tight junction proteins. the expression of icam-1 in endothelial cells is pivotal in supporting lymphocyte migration across the vascular endothelium. icam-1 associates with an endothelial cytoskeleton fraction, suggesting that icam-1 redistribution is an early event in the signalling cascade during inflammatory events, particularly in lymphocyte transmigration. the expression of endothelial cell adhesion molecules increases in the central nervous system during inflammation secondary to pathogen intracerebral administration (e.g., corynebacterium parvum). brain vessels located in the centre of the cellular infiltrate began to express markers of fenestrate endothelium such as the endothelial-specific expression of meca32 suggesting an altered functional status of the endothelial cell. abundant icam-1 expression has been observed after il-1 or tnf- stimulation of cultured heart endothelial cells. elevated levels of icam-1 may contribute to cardiovascular disease and are associated with obstructive sleep apnoea (osa) and obesity, in which sleep deficiency is present. in the same way, it has been shown that patients with diabetes mellitus type 2 and poor sleep present higher morbidity of cardiovascular diseases than diabetes mellitus patients sleeping normally; those patients also present higher plasma levels of icam-1. icam-1 higher serum levels were also found during the sleep recovery period after 40 hours of total sleep deprivation in healthy men. therefore it seems that the mediator between poor sleep (with bad quality and poor sleep recovery) and higher risk for cardiovascular diseases is icam-1. inflammation is characterized by upregulation of vascular endothelial growth factor (vegf). in in vivo experiments, increases in vegf during neuroinflammation (e.g., in experimental autoimmune encephalomyelitis (eae)) are accompanied with increased blood-brain barrier permeability and decreased expression of tight junction proteins (e.g., claudin-5 and occludin). likely, vegf administration to human brain endothelial cells increases permeability of the monolayer and downregulates claudin-5 and occludin, but not junctional adhesion molecule-1 (jam-1), cingulin, peripheral plasma membrane protein (cask), or zo-1. given the role of vegf in regulating blood-brain barrier during neuroinflammation, it may participate in generating the vascular changes associated with sleep loss. indeed, it has been shown that vegf is overexpressed in osa patients and it is generally considered that vegf increases are associated with hypoxia events. however, osa patients also have severe sleep fragmentation; therefore, in addition to chronic intermittent hypoxia, vegf changes may be related to sleep loss. in fact, in a study with major depressive disorder patients, sleep deprivation increased vegf plasma levels. sleep deprivation decreases igf-1 levels in rats and humans and one night of sleep recovery is sufficient to restore its basal levels. the neuroprotective effects of igf-1 are unclear but it is known that igf-1 receptors are present in brain endothelial cells, microglia, and astroglia and even in neurons. indeed, it has been suggested that igf-1 may promote neuroprotection by acting on the blood-brain barrier; in an experimental model of ischemic stroke igf-1 reduced the inflammatory infiltrate in the brain. in an in vitro experiment with brain endothelial cells igf-1 reverted the hyperpermeability to bovine serum albumin induced by oxygen-glucose deprivation (an in vitro model of ischemic stroke). changes on inflammatory molecules during sleep loss are well described but we do not know what the source of those alterations is. in this way the role of microbiota could appear a good candidate to induce the low-grade proinflammatory status during sleep loss. the source of inflammatory mediators during sleep loss remains unclear; however, microbiota may play a key role in this event. in other conditions that exhibit low-grade systemic inflammation, such as chronic depression, obesity, and diabetes, evidence from murine models initially suggested a role for the gut microbiota in the generation of low-grade inflammation, with the consequent increased risk of endothelial and epithelial dysfunction [98, 99]. for instance, changes in gut microbiota composition increase intestinal permeability. in the same way, during sleep deprivation gut microbiota has been detected in blood, suggesting the induction of systemic inflammation and deficits in gut epithelial permeability. in addition, preclinical evidence from germ-free mice suggests that the microbiota can also modulate the blood-brain barrier; exposure of germ-free adult mice to the faecal microbiota from pathogen-free donors decreased the blood-brain barrier permeability and increased the expression of tight junction proteins in brain endothelial cells, therefore strengthening the hypothesis that the blood-brain barrier may also be sensible to changes in the gut microbiota composition. the candidate pathways to induce barriers dysfunction under altered gut microbiota composition include serotonin, cytokines, toll-like receptor activation, and short chain fatty acids. moreover, the inflammatory response subsequent to microbiota-induced barriers disruption may underlie the sleep loss-related cognitive deficits and the exacerbation of neurological disorders such as depression. these data might support the theory of a coevolution between sleep and blood-brain barrier proposed by korth in 1995. because the brain and blood-brain barrier react sensitively to the exposure to bacterial cell wall constituents and sleep is regulated by gut microbiota products, korth proposed that low amounts of bacterial cell wall constituents that induce sleep under sleep loss conditions, by themselves or by cytokine production, increase the blood-brain barrier permeability ensuing their passage into the brain. cytokines and other inflammatory mediators induce blood-brain barrier disruption through mechanisms involving signalling pathways that converge in the disorganization of tight junctions (figure 1). for instance, it has been reported that proinflammatory cytokines, including tnf- and il-1, decreased zo-1 expression and zo-1-occludin coassociation, concomitant to increased zo-1 phosphorylation in tyrosine and threonine residues. zo-1 phosphorylation in tyrosine residues is also observed after vegf administration. in this way, vegf-a also promotes disruption of blood-brain barrier by downregulating the expression of claudin-5 and occludin. low cytokine concentrations (> 1 ng/ml) led to activation of effector caspases via c-jun n-terminal kinases (jnk) and protein kinase c (pkc) signalling pathways, increased paracellular flux, and redistribution of zo-1 and ve-cadherin but failed to induce apoptosis. in addition to caspase-3, tnf- activates the production of mmp-9, which is also associated with high levels of il-1 in brain parenchyma. cox-2 plays a crucial role in the inflammatory response of the blood-brain barrier (for review see); particularly cox-2 derived pge2 increases blood-brain barrier permeability. other cytokines, such as il-1, use other signalling pathways that finally converge in cox-2 induction; particularly, the il-1 receptor-1 (il-1r1) signals via the p38 mitogen-activated protein kinase (mapk) and the c-jun pathway to induce cox-2 synthesis, whereas activation of the il-6 receptor leads to cox-2 expression through activation of signal transducer and activator of transcription-3 (stat-3). the activation of nfb by tnf- and il-1 is also correlated with cox-2 expression in microvascular endothelial cells. indeed, both ib and cox-2 are expressed within the same endothelial cells, suggesting a potential interaction between the transcription factor and cox-2 expression in the cerebral endothelium of animals with systemic inflammation. tnf- and il-1 promote the release of crp. the putative mechanism by which crp increases blood-brain barrier permeability is by its action on cd16/cd32 receptors present in the cell membrane of brain endothelial cells. this association activates the myosin light chain (mlc) phosphorylation by mlc-kinase (mlck) and the activation of p38-mapk, with the subsequent formation of actin stress fibers. brain endothelial cells express the p22phox subunit located in the cell membrane; this enzyme uses nadh or nadph as the electron donor for the single electron reduction of oxygen to produce ros during crp stimulation. the assembly of active nadph oxidase requires translocation of cytosolic subunits, p47phox, p67phox, and rac1 (a cytosolic gtpase), to the plasma membrane, where they interact with gp91phox and p22phox and associate with other membrane cofactors to form a functional enzyme complex. in addition, crp stimulation also disorganizes zo-1 via mlck and ros production. in this way, il-17a also induces nadph oxidase- or xanthine oxidase-dependent ros production and downregulates the expression of occludin by activation of mlck. the signalling of inflammatory mediators and particularly nadph oxidase may promote the upregulation of adhesion molecules such as icam-1 via jak/epidermal growth factor receptor (egfr) signalling contributing to a possible leukocyte infiltration. therefore, these changes may be deemed as the mechanisms involved in brain endothelial cell dysfunction during sleep loss. we propose that inflammatory mediators increased during chronic sleep loss might promote blood-brain barrier disruption (figures 1 and 2). for aims of clarity the hypothesis does not explicitly distinguish between rem and non-rem sleep and we know that other molecules altered during sleep loss also should be studied because they may have a potent role in the blood-brain barrier disruption such as adenosine and hormones. in interpreting these data, for instance, the cellular components of the blood-brain barrier that promote inflammation in the brain, such as microglia and astroglia, in addition to regulating blood-brain barrier may also be affecting several brain functions during sleep and sleep loss. on the other hand, pericytes have a unique synergistic relationship with brain endothelial cells in the regulation of capillary permeability through secretion of inflammatory mediators including cytokines, chemokines, nitric oxide, and matrix metalloproteinases. those inflammatory mediators released during sleep restriction may directly induce pericyte detachment from the vessel wall ensuing blood-brain barrier disruption (for review see hurtado-alvarado, 2014). summarizing, chronic sleep loss induces systemic low-grade inflammation that may be related to epithelial and endothelial disturbances both at the systemic and at the central level. particularly, the role of inflammatory mediators in the blood-brain barrier disruption induced by sleep loss might explain the cognitive impairment associated with sleep loss. the systemic and local effect of inflammatory molecules accumulated during chronic sleep loss should be taken into account for the study of general consequences of sleep deficiency including the risk of developing neurologic and neurodegenerative diseases.

sleep is a vital phenomenon related to immunomodulation at the central and peripheral level. sleep deficient in duration and/or quality is a common problem in the modern society and is considered a risk factor to develop neurodegenerative diseases. sleep loss in rodents induces blood-brain barrier disruption and the underlying mechanism is still unknown. several reports indicate that sleep loss induces a systemic low-grade inflammation characterized by the release of several molecules, such as cytokines, chemokines, and acute-phase proteins; all of them may promote changes in cellular components of the blood-brain barrier, particularly on brain endothelial cells. in the present review we discuss the role of inflammatory mediators that increase during sleep loss and their association with general disturbances in peripheral endothelium and epithelium and how those inflammatory mediators may alter the blood-brain barrier. finally, this manuscript proposes a hypothetical mechanism by which sleep loss may induce blood-brain barrier disruption, emphasizing the regulatory effect of inflammatory molecules on tight junction proteins.

PMC5050358

pubmed-863

although work provide a range of benefits such as increased income, social contact, and sense of purpose, it can also have negative effects on mental health, particularly in the form of stress. the national institute of occupational safety and health in the us (niosh) estimate the following: 40% of american workers reported their job was very or extremely stressful, 25% view their jobs as the number one stressor in their lives, three fourths of american employees believe that workers have more on-the-job stress than a generation ago. given the global recession, financial strain, and job losses, greater work stress might have adverse consequences in uk. the most recent data from the nhs information centre in uk suggest an increase in the suicide rate for the first time since 1998. the rate among men increased from 16.8 per 100,000 in 2007 to 17.7 per 100,000 in 2008. this increase is being interpreted by politicians and the public as a consequence of the global and national recession, increased job insecurity, risk of loss of jobs, and also stress at work, where the demands on the existing workforce have increased (the independent, 18th november, 2010). 11.4 million working days were lost in uk in 2008/2009 due to work-related stress, depression, or anxiety. there are also indirect costs, for example, through presenteeism when employees are at work but are too unwell to function fully. stress at work also can lead to physical illness, psychological distress and illness, and sickness absence [3, 4]. stress, depression, or anxiety accounts for 46% of days lost due to illness and are the single largest cause of all absences attributable to work-related illness. psychosocial work stressors such as job strain, low decision latitude, low social support, high psychological demands, effort-reward imbalance, and high job insecurity have all been implicated as causes of work stress-related anxiety and depressive illnesses. however, psychosocial work stressors can only be tackled by organisational and systemic strategies and policies. in order to consider the evidence base, there needs to be some agreement on the meaning of work stress. a popular model of stress considers inputs such as job characteristics; for example, excess demands, low control, poor social support, adverse life events such as bereavement or divorce, and additional demands outside of work such as carer responsibilities for a dependent relative or spouse [710]. an alternative approach is to theorise that stress is a manifestation of the poor fit between a person and their environment. stress is then seen to arise due to a discrepancy between the inputs and outputs and the mediating appraisal of stress, personal skills to manage it, and environmental demands and rewards. transactional models, as those proposed by lazarus and cox and ferguson, conceptualise stress as something that unfolds over time within a series of transactions between the person and their environment. stress is, therefore, elicited and maintained by the individual's actions and perceptions as well as the characteristics of their work environment. the specific conceptualisations of stress adopted influence the way interventions are constructed to tackle specific mechanisms in order to alter stress and its manifestations. describe categories of stress management interventions that target the individual or the organisation and specify actions at primary, secondary, or tertiary preventive levels (see table 1). individual interventions include stress awareness training or cognitive behavioural therapy for psychological and emotional stress. organisational interventions are those that affect whole populations or groups of people and include workplace adjustments or conflict management approaches in a specific organisation. some interventions target both the individual and organisation, for example, policies to secure a better work-life balance and peer-support groups. primary interventions aim to prevent the causal factors of stress, secondary interventions aim to reduce the severity or duration of symptoms, and tertiary or reactive interventions aim to provide rehabilitation and maximise functioning among those with chronic health conditions. the evidence of effective interventions to protect individual mental health and reduce organisational absenteeism rates is difficult to summarise in a manner that is of practical relevance. therefore, the purpose of this paper is to take the highest level of research evidence (systematic reviews providing narrative synthesis or meta-analyses) and synthesise this evidence to identify the key findings and gaps in the literature on the effectiveness of different stress management interventions for preventing anxiety and depression as the main cause of absenteeism. consequently, this review of systematic reviews focuses on common mental health problems (anxiety, depression) and absenteeism. undertaking a review of systematic review is challenging methodologically for two reasons; there is not a conventional accepted process to produce a meta-review or meta-synthesis across different types of systematic reviews, for different outcomes, and different complex interventions which may defy drawing a singular scientific conclusion that requires all sources of heterogeneity be overlooked. secondly, the ambition of the review and the form the findings take have, in part, to reflect the subject matter and the types of interventions that are being reviewed. so, for complex interventions for managing stress at work, there will be organizational and individual interventions, and different disciplinary approaches to the task of meta-synthesis of narrative findings. the notion of a meta-synthesis of narrative findings is itself contested by different qualitative research disciplines from which such approaches have evolved [20, 21]. the purpose of this paper is then to draw together literature and findings which are consistent across reviews and methodologically variant studies, where this is possible in order to demonstrate the strength of the findings. however, given the complex nature of interventions to tackle stress at work and that stress itself and mental health are so ill-defined in studies, we also wish to highlight findings that emerge from a critical comparison of reviews; we also wish to highlight the findings that are pertinent to well-defined common mental disorders (anxiety and depressive states); we also wish to acknowledge that narrative synthesis (or meta-synthesis, as it is sometimes called) may reveal complexities in the field of study such that the findings can not be neatly expressed as a single statement of efficacy or effectiveness, but that interventions might need to be developed to target specific subpopulations. the findings can, thus, signal the methodological issues that future research must tackle. the review identified all systematic reviews of evidence on stress management interventions in the workplace and summaries, tabulated extracted, and then synthesized the evidence for the relative merits of different interventions. consistent with previous work, we restricted the review to papers published since 1990, as recency in the literature is important to ensure the evidence is related to contemporary concepts of stress and work, and to ensure the current work conditions are represented in the evidence synthesis, rather than historical work conditions. the search terms used were: psychological ill health or anxiety or stress or distress or burnout, stress management or intervention or rehabilitation or prevention, work or job or employee or sick leave or occupation or workplace adjustments or employee assistance programmes. the criteria used for inclusion were english language articles, reviews published from 1990 to july 2011, reviews with data/narrative synthesis, the articles excluded were theoretical and educational reviews, those published prior to 1990. the total number of reviews initially retrieved after excluding duplicates was 7845 (see table 1).. data were extracted using the headings set out in table 3 by two researchers working independently. a third researcher checked for and resolved any discrepancies with reference to the original publications. the reviewed studies included many outcomes which ranged from physical health measures (e.g., cardiovascular measures) to psychological and psychiatric measures (e.g., well-being, psychological distress, burnout, general mental health, anxiety, depression, stress, psychiatric symptoms, and psychosomatic symptoms) to organisational measures (e.g., employee satisfaction, motivation, absenteeism). in this paper, we focus only on articles reporting, (a) individual outcomes of symptoms of anxiety and depression (including severe stress if measured by a specific rating scale of anxiety and depression) or anxiety and depressive illness formally assessed using specific diagnostic or psychometric measures and (b) absenteeism as an important organisational outcome as this has an economic cost to the employer. we included key words of anxiety and depression and severe stress as inclusion criteria, but many studies and reviews are not flagged on this basis, and the findings pertaining to these outcomes are often hidden in tables of results. piloting showed that searches specifically for anxiety and depression did not easily permit us to identify all studies that might include anxiety and depression as outcomes; this was only possible after reviewing the full-text paper. thus, we kept our original searches broad in order to be satisfied all such paper that met our inclusion criteria would be included. table 3 presents descriptive information on the twenty three reviews including the dates of published studies/papers included in the reviews, the number of published studies/papers, the prevention level (i.e., primary, secondary, and tertiary), whether the interventions were targeting the individual (i) or the organisation (o) level, and which level the outcomes specified: individual mental health (i) and/or absenteeism (o). due to the heterogeneity of the published reviews in terms of the methodology used (i.e., meta-analyses versus narrative synthesis or meta-narratives), the analysis and synthesis of meta-analytic reviews is reported first (see table 4; 11 reviews), then the narrative synthesis reviews (table 5; 12 reviews), each annotated to indicate individual and organisational interventions, and individual and organisational outcomes (see table 3). including narrative reviews permitted evaluation of in-depth information that might be overlooked in meta-analytic reviews, as this information is important for constructing appropriate interventions and implementing them in order to prevent severe stress and anxiety and depression at work. for example, components of an appropriate organisational intervention will be difficult to capture in a meta-analytic review given these interventions will vary between organisations; only in-depth descriptions can capture the components that can then be considered for similar organisational contexts. for meta-analyses, the effect sizes and original conclusions are presented, along with the outcomes used, where these were reported (table 4). for narrative reviews, we present the key narrative conclusions (or evidence summary statement), along with the number of studies finding improvement (), deterioration (), or no effect (). this was done for the same two outcomes: mental health and for absenteeism (table 5). judgements about the number of studies finding a positive, negative or no effect in the narrative synthesis were challenging, as many studies tended to use words such as stress, psychological distress, psychosomatic disorders interchangeably, and negative findings may not have been reported. we only rated studies as having effects on mental health (anxiety and depression), where it was clear they had used a specific measure of mental disorders or severe stress either alone or as part of a composite measure of mental health and well-being. this is an advance on existing reviews which tend to group all types of stress, including that associated with anxiety and depression, and other types of measures of stress such that the findings are interpreted with reference to a large number of emotional and health states. we felt this approach would not permit us to isolate the findings of relevance to the preventing common mental disorders which are the most important cause of sickness-related absenteeism. eleven reviews included meta-analyses [16, 2231]; 12 included a systematic or literature review [3243] with meta-narrative conclusions (see table 5). as set out in table 3, of the twenty three reviews, four reported on individual interventions only (three with a meta-analysis) [26, 27, 31, 36]; three of these assessed their impact on individual and organisational outcomes [26, 31, 36], whilst the other one assessed impact on individual outcomes only. there were three reviews that examined the effectiveness of only organisational interventions [24, 32, 40]. six reviews included studies that looked separately at individual and organisational interventions in the same studies [16, 37, 3942]. of these, mimura and griffiths reported only on individual outcomes, the rest reported on both individual and organisational outcomes. the remaining seven reviews assessed interventions at both individual and organisational levels [23, 25, 29, 30, 3335]. of these, one looked only at organisational outcomes, and one looked at individual outcomes. eleven reviews [16, 2231] reported effect sizes from meta-analyses (table 4) on mental health and absenteeism. the overall impression from the meta-analytic reviews is that the effect size is greater at the individual level for individual interventions compared with organisational interventions, and that organisational or mixed interventions can also impact on the mental health of individuals. of these eleven reviews, six showed that individual interventions lead to benefit on individual mental health outcomes [16, 23, 2527, 31]. five reviews of organisational interventions [16, 23, 25, 28, 30] together showed mixed evidence of benefit on individual outcomes; thus richardson and rothstein and van der klink et al richardson and rothstein and van der klink et al. also reviewed mixed interventions, both of which showed benefit at the individual level on mental health status. four reviews found individual interventions did not impact on absenteeism [23, 25, 28, 30]. parks and steelman and bond et al. found some evidence of benefit, whereas richardson and rothstein and van der klink et al. however, conn et al. showed clear benefit of organisational physical activity interventions on absenteeism. there were no studies of mixed individual-organisational interventions and impact on absenteeism. the overall conclusions from the narrative reviews support the findings from the meta-analyses that individual interventions do provide benefit at an individual level and reduce symptoms of anxiety and depression and stress, but individual interventions do not impact on absenteeism. however, organisational interventions impact at both individual and organisational levels. there are numerous studies of benefit on mental health outcomes, whereas benefit on absenteeism is mainly reported in one review including a number of high quality studies (table 5). worryingly, some interventions appeared to lead to deterioration in mental health [16, 3235] and absenteeism [33, 36] outcomes (see table 5). for example, marine et al. identifies smoking cessation to be associated with depression. although not directly mapping on to absenteeism, preliminary evidence from cancelliere et al. suggested that some workplace health promotion programmes can reduce presenteeism (being at work whilst unwell). presenteeism correlated with being overweight, a poor diet, a lack of exercise, high stress levels, poor relationships with coworkers and management. the different types and components of interventions, and whether they are primary, secondary, or tertiary preventive interventions, are set out in table 3. the meta-analytic reviews found that cognitive behavioural programmes consistently produced larger effects at the individual level compared to other types of interventions (e.g., relaxation). cognitive behavioural programmes were also suggested to be more effective by some of the narrative reviews [27, 31, 3436] as well as by some of the meta-analyses [23, 25]. murphy found that multimodal interventions (or combination strategies), which involved cbt produced the most consistent, significant results; a result which was not supported by one meta-analytic review. overall, the reviews suggested that organisational level interventions are too scarce and there is also a lack of studies that assess organisational-level outcomes. however, two meta-analytic reviews [22, 29] found that participation in organisational wellness programmes was associated with decreased absenteeism and increased job satisfaction. these were the only meta-analytic reviews of organisational based interventions and organisational-level outcomes. finally, there are insufficient studies to comment on the potential complementarity of interventions that operate at primary, secondary, and tertiary prevention levels. four studies investigated both primary and secondary prevention but not their interaction [23, 27, 33, 34]. our methods of isolating findings related to anxiety and depression, and partitioning the tabulation and extraction and synthesis by individual/organisational interventions and outcomes provides a rich, complex but authentic picture of the evidence base. reviews had to take account of many interventions that differed by their components, mode of delivery and whether they targeted individuals or organisations. this made it difficult for all of the reviews to compare benefits from any single intervention across a number of studies, except for cbt or physical activity. there were also many different outcome measures for assessing anxiety and depression, and many proxy measures of mental health, sometimes without clarity about which outcomes were used in the meta-analyses. in part, these were not specified due to the way multiple outcomes were handled in the analysis. the reviews used standardised differences including mean differences and mean effect sizes, and standardised differences and means. using a consistent set of outcomes to measure anxiety and depression in future primary studies will ensure that future reviews and meta-analyses can overcome these challenges, such that different intervention, of varying complexity and modes of delivery, might be compared more directly for impacts on absenteeism and on anxiety and depression and interactions between the individual and organisational impacts. overall, individual interventions show larger effects compared with organisational interventions or mixed interventions; benefits are seen mainly at the individual level although some studies do show organisational benefits. given that anxiety and depression are common, and mostly account for sickness absence, it is important to develop an evidence base that is specific to these manifestations of mental distress and illness, with an agreed range of acceptable outcome measures and for interventions that prevent and treat anxiety and depression promptly, as well as encourage early return to work. a small improvement in sickness absence statistics might yield substantial benefits for business viability and provision of services. the only organisational intervention to show convincing effects on absenteeism was physical activity programmes, but mental imaging, cbt, and in vivo exposure, each have a useful role, especially in secondary prevention. although better quality studies should be given greater weight, the quality of individual primary studies was selectively reported, making it difficult to know whether the positive findings reflected better quality studies; certainly, cbt and physical activity interventions are more well defined than say stress management standards or management practices or stress inoculation. similarly, the duration of the interventions and timing of measurement of outcomes was not a characteristic on which reviews drew conclusions; we were unable to draw any metaevidence about timing unless we had looked at primary studies. strikingly, although many reviews on face value were reviewing the same evidence, the reviews did not all identify the same primary studies, and therefore did not always reach the same conclusions; our meta-review, for the first time, brings together all of the strongest findings. these included 499 primary studies; the majority of reviews made the point that drawing metanarrative or meta-analytic conclusions was difficult because of this diversity in outcomes, intervention, and methods. had we undertaken a review of 499 primary studies, it is likely we would draw the same conclusions. management skills training, and support for staff, along with methods to cope with work stress all seem relevant components, but the review was not convincing about a positive benefit of these and where positive impacts were seen at individual levels [16, 28]; the effect could not entirely be attributed to improved management standards or working relationships. these studies are difficult to design and implement and require further research. on the other hand, more and more interest has been generated towards health promotion in the workplace (e.g., exercise) and encouraging individuals to take ownership of health risk behaviours and decisions about health, well-being, and family outside of work. this may be promising, as it requires the workforce to maintain healthy lifestyles generally and within that context to consider work stress rather than consider work as the only venue for health interventions. this review suggests that there is lack of evidence in comparing the relative effectiveness of stress management interventions that operate at both individual and organisational levels, or interventions that encourage an interactive or systemic effect, yet this might yield greater benefits at both levels. however, there are still a number of evidence gaps. more research is needed in the private sector and in smaller companies as well as research comparing different job types such as education and healthcare to examine whether they respond to the same or different intervention techniques. similarly, research needs to take into account factors such as socioeconomic status, duration of any effects of interventions, and cost effectiveness. for example, organisations with the most stressful work environments are less likely to participate in research as opposed to organisations with little stress amongst employees. consequently, organisations with low baseline stress levels would make any effects from targeted interventions more difficult to capture. however, preliminary support was found in one meta-analytic review that interventions conducted with employees at high levels of baseline stress appeared to be at least as effective as interventions conducted with employees at low levels of baseline stress. we did find more of these in more recent years (since 2008) and also reviews of health care workers and law enforcement officers who perhaps need specific attention given the unique circumstances and stressors to which they are exposed at work. the few methodologically rigorous studies that have been conducted with patients have not included nontreatment control groups but have compared 2 treatment types. more work might, therefore, be undertaken on populations at risk using secondary and tertiary prevention interventions. interventions need to be developed that can provide consistent and stronger effects on organisational outcomes such as absenteeism. there were a number of gaps in the literature, particularly studies investigating the influence of specific occupations, and different sized organisations, different sectors of organisations (public, private, and not for profit). studies of management practices seemed not to show strong effects, but there are still insufficient studies in this area.

background. psychosocial stressors in the workplace are a cause of anxiety and depressive illnesses, suicide and family disruption. methods. the present review synthesizes the evidence from existing systematic reviews published between 1990 and july 2011. we assessed the effectiveness of individual, organisational and mixed interventions on two outcomes: mental health and absenteeism. results. in total, 23 systematic reviews included 499 primary studies; there were 11 meta-analyses and 12 narrative reviews. meta-analytic studies found a greater effect size of individual interventions on individual outcomes. organisational interventions showed mixed evidence of benefit. organisational programmes for physical activity showed a reduction in absenteeism. the findings from the meta-analytic reviews were consistent with the findings from the narrative reviews. specifically, cognitive-behavioural programmes produced larger effects at the individual level compared with other interventions. some interventions appeared to lead to deterioration in mental health and absenteeism outcomes.gaps in the literature include studies of organisational outcomes like absenteeism, the influence of specific occupations and size of organisations, and studies of the comparative effectiveness of primary, secondary and tertiary prevention. conclusions. individual interventions (like cbt) improve individuals ' mental health. physical activity as an organisational intervention reduces absenteeism. research needs to target gaps in the evidence.

PMC3306941

pubmed-864

subependymoma, first described by scheinker in 1945, is a rare central nervous system tumor. since its first description in the spinal cord by boykin et al in 1954, 32 involved the cervical cord. in the spinal region, these lesions are predominantly subpial in location, with exophytic components. the location of these lesions in the spinal cord suggest a subpial glial progenitor origin rather than its proposed origin from subependymal progenitor cells.[14] a 37-year-old lady presented to us with complaints of neck pain and gait disturbances of 1 year duration with severe progressive weakness of her right upper limb since 3 months. mri revealed a long-segment t2 hyperintense intramedullary lesion opposite to the c3 to d4 vertebral levels with mild heterogeneous enhancement on the post contrast study [figure 1]. (a) sagittal t2 and (b) post contrast t1-weighted mr images showing a long segment t2 hyperintense and mild hetrogenous enhancing lesions in the cervical cord, showing cord expansion. intraoperatively, the lesion was firm, with a poor plane of demarcation from the normal cord, and was seen intermingling with posterior and anterior nerve rootlets. it was eccentric in location, involving more of the left hemicord, with exophytic components [figure 2]. surgical finding: typical exophytic subpial lesions, with lesion on either sides of the dorsal nerve roots. all of the resected tissue submitted for histopathological analysis was processed and embedded in three paraffin blocks. histopathological examination [figure 3] revealed characteristic features of a subependymoma (who grade 1) with small monomorphic cells arranged in a lobular pattern against a finely fibrillary background, with occasional rosette like pattern. features of pleomorphism, mitotic activity, endothelial cell proliferation, and necrosis were not seen. the mib-1 proliferative index was low (< 1% of tumor cells) (). immunohistochemistry revealed diffuse positivity for glial fibrillary acidic protein (gfap), whereas tumor cells failed to express epithelial membrane antigen (ema). histopathology: (a) h and e staining shows lobular pattern arrangement of monomorphic nuclei in fibrillary pattern (400). (b) mib-1 labeling index is less than 1% of tumor cells (not shown in figure) (400). immunohistochemistry for (c) gfap highlights diffusely positive tumor cells in a fibrillary background (400) (d) tumor cells are negative for ema (400) she did not receive any adjuvant treatment and has been on follow up for 6 months with periodic mr imaging. subependymomas are rare central nervous system tumors accounting for 0.7% of all intracranial neoplasms and 8.3% of all ependymal tumors. they are located most frequently in the fourth ventricle (5060% of cases) followed by the lateral ventricles (3040%). so far, only 47 cases have been reported in the english literature in the spinal cord; of which 32 cases were located in the cervical, cervico-medullary, and cervico-thoracic locations. most are intramedullary in location, with few subarachnoid and extramedullary variants mentioned in the literature. the symptomatic subependymoma generally occur after 40 years of age and are rare in childhood.[13] the salient features 33 in cases of cervical subependymomas they have a mean age of presentation of about 44 years with a strong male preponderance [table 2]. epidemiology of spinal subependymomas (including our case).[16, 814] histopathologically these tumors are low grade (who grade 1), characterized by homogenous cells with sparse cellularity showing clustering of nuclei over a fibrillary background formed by cell processes and occasional occurrence of microcysts. the tendency to form pseudorosettes and the cells being round with hyperchromatic nuclei are reminiscent of ependymomas. immunohistochemical characteristics are however identical to that of astrocytic neoplasms with diffuse gfap and s-100 protein positivity. in contrast to ependymomas, the former is evidenced by the processes containing intermediate filaments and the latter by microlumens, cilia, microvilli, and intercellular junctions. the histogenesis of these tumors has been much debated. due to their ultrastructural similarities with ependymal cells, they were initially thought to arise from ependymal cells, with reactive astrocytic proliferation. since immunohistochemical profile favors a glial origin, they were grouped with low-grade glial tumors. tanycytes were also proposed as source of origin, due to the presence of ultrastructural features of glial as well as ependymal components. however, the presence of round cells rather than spindle-shaped cells differentiates these lesions from tanycytic ependymomas. the identification of cells similar to subependymal glial precursor cells suggested alternate cell of origin. subependymal zone glial precursor cell origin can not explain the predominant peripheral and exophytic location of these lesions in spinal cord unlike their intracranial counterparts. the current concept seems to suggest that these progenitor cells exist throughout the spinal cord white matter as well as the root entry zones. they are more localized in the outer subpial white matter than the medial zones, especially at the dorsal and ventral spinocerebellar tracts. they tend to proliferate within their template zones and do not possess trans-zonal migratory ability. the tumor origin from these cells better explains the eccentric, subpial, and exophytic locations of spinal subependymomas. the progenitor cells origin postulated by horner et al is an alternative to the conventional old postnatal theory [type 1, figure 4] where the progenitor cells migrate from the subependymal zone to the outer zones. there are two alternative postulates: one where the stem cell divides asymmetrically and the daughter cell migrates to the outer white matter where it remains as a glial progenitor cell and multiplies [type 2, figure 4], and the second which postulates that the stem cells exist separately in the outer zone where tracts are constantly proliferating even postnatally and these give rise progenitor glial cells [type 3, figure 4]. (a) post natal theory: where the subependymal stem cells give rise to glial progenitor cells which then migrate to the periphery. (b and c) alternate new theories where the stem cells themselves migrate to the periphery and become glial progenitor cells (b) or the stem cells already existing in the periphery of the cord become glial progenitor cells (c). irrespective of their origin the subpial spinal white matter progenitor cells may be the origin of the spinal subependymoma. the subependymomas reported are more commonly located in the cervical cord and the cervico-thoracic cord followed by the pure thoracic and lumbar segments. one rare case occurring in the filum teminale has also been reported [table 2]. radiologically, these lesions are located eccentrically within the cord, with iso or hypointense on t1-weighted images and mild hyperintensity on t2-weighted images. there is minimal diffuse or no enhancement on contrast.[148] these lesions can usually be excised totally. only three cases have been reported with recurrence of the tumor after initial total excision. all of them had a resurgery and were not subjected to adjuvant radiation or chemotherapy despite recurrence. the chances of recurrence after total excision are low; hence, a total excision should always be attempted [tables 1 and 2]. however, as with our case, the size of the lesion and its extensive intermingling with the nerve roots made it sometimes necessary to settle for a subtotal excision. there have been instances of postoperative radiation following subtotal excision, but it is generally not recommended. residual or recurrent tumor on follow up after gross total resection should be strongly considered for a re-excision rather than adjuvant therapy.[268 ]

subependymomas are extremely rare lesions of the spinal cord. only 33 cases including ours have been reported in the cervical cord. these are typically benign slow growing tumors occurring eccentrically within the cord, producing minimal neurological deficits. the clinical, radiological, and histopathological aspects of this unusual lesion have been reviewed in detail. as the histogenesis of this tumor is much debated, we propose an alternate origin for the same.

PMC3505341

pubmed-865

chronic granulomatous disease (cgd) is an inherited phagocytes defect, characterized by defects of nadph-oxidase and inability of bacterial killing, which leads to recurrent life-threatening infections. respiratory problems, which are the major cause of morbidity in cgd, usually result from recurrent severe infections; however, vigorous inflammatory response could also cause respiratory diseases. herein, an 11 year-old patient with cgd is presented who suffered from chronic cough and dyspnea for 7 years. considering the results of chest x-ray, high-resolution computed tomography, and pulmonary function test, the diagnosis of interstitial lung disease was made. early recognition of manifestations associated with cgd and appropriate treatment could prevent further complications and reduce morbidity and mortality in this group of patients. chronic granulomatous disease (cgd) is a rare primary immunodeficiency disorder, which is caused by defects in superoxide generation and phagocytes function. subsequent defect of bacterial killing leads to cytokine release and inflammation of different organs in the patients with cgd [13]. the majority of cgd patients suffer from respiratory disease, including pneumonia, lung abscess, and pulmonary fibrosis. interstitial lung disease (ild) is a rare pulmonary condition in this group of patients which causes derangements of the alveolar walls and loss of functional alveolar capillary units leading to restrictive lung disease. typical features of ild include the presence of diffuse infiltrates on chest radiograph, and abnormal pulmonary function test (pft) with evidence of a restrictive defect and/or impaired gas exchange. exposure-related ild, systemic disease-associated ild, alveolar structure disorder-associated ild, and idiopathic ild in older children are generally considered as the main causes of ild in children. ild could be as a result of recurrent life-threatening infections, whereas non-infectious inflammation could also be responsible for such lung disease. an 11 year-old boy was diagnosed with cgd in infancy, following severe recurrent lower respiratory tract infections. the patient gradually developed hypoxia, dyspnea on exertion, cyanosis and became worse during childhood. there were some evidences of repeated pneumonia and consequently using intravenous antibiotics in his past medical history. at the time of his admission to our clinic, he had not fever, but physical examination revealed tachypnea, crackles, retraction, and increased anteroposterior diameter of chest. laboratory findings, including complete cell blood count (cbc), esr, liver function test, sweat chloride test and serum immunoglobulin levels were normal. arterial blood gas (abg) analysis showed: ph 7.28, o2 saturation 64.7% and pco2 54.3 mmhg. blood cultures and tracheobronchial secretion cultures for pyogenic, fungal and mycobacterial infections were negative. polymerase chain reaction (pcr) for aspergillus and candida albicans was negative. diagnostic bronchoalveolar lavage (bal) was performed to obtain specimens for cytology and culture. the smear of bal showed many isolated bronchial epithelial cells accompanied with few inflammatory cells. the result was compatible with diagnosis of cgd, which was also further confirmed by dihydro rhodamine123 (dhr) dye test. the result of high-resolution computed tomography (hrct) scan revealed ground glass appearance in both lung fields with some areas of decreased attenuation, honeycombing, asymmetric emphysematous change and increased interstitial marking, which was compatible with diagnosis of interstitial lung disease (fig. high resolution ct scan of the patient revealed ground glass appearance and emphysematous change in pft, forced expiratory volume in 1 second (fev1) was decreased to 38.7%; residual volume (rv) and total lung capacity were increased to 773.2% and 203.8%, respectively. the result of pft was air trapping and high airway resistance in favor of restrictive pattern and destructive lung disease. for excluding systemic disease-associated interstitial lung diseases, igm rheumatoid factor, serum antinuclear antibodies reactive to nuclear (ana), cytoplasmic antigens, anti smooth muscle antibody as well as serum angiotensin-converting enzyme level were measured, which were all normal. after considering ild in the patient, prednisolon therapy was initiated at a dose of 1 mg/kg/day associated with hydroxychloroquine. at the time of discharge, 30 days after admission, clinical respiratory findings such as cough and dyspnea subsided. after a 3-month course of prednisolone and tapering the dosage, an increased oxygenation at rest and sleep was achieved. chronic granulomatous disease (cgd) is an inherited immunodeficiency disease, which is generally considered as a rare disease, but its frequency, especially its autosomal recessive form, seems to be much higher in the regions with high rate of consanguinity [68]. although several organs could be affected in cgd, the most common site of involvement is lung [3, 6]. ild is characterized by thickening of the alveolar walls by a wide spectrum of inflammatory cells, immunoregulatory cells and/or fibrosis, accompanied by loss of functional alveolar capillary unit. diagnostic procedures could be used to detect ild, including chest x-ray, hrct, bronchoalveolar lavage, pft, and sometimes thoracoscopic lung biopsy. etiology of ild encompasses a group of known and unknown disorders in children, but infections account for many cases of known etiologies. after considering ild, a careful history and serum levels of antibodies is needed for eliminating exposure-related ild and systemic disease-associated ild, respectively. among disorders affecting the alveolar epithelium and the alveolar space, viral infections, microorganisms can be protected from intracellular killing, which consequently leads to leukocyte accumulation, cytokine release and inflammation. in spite of the fact that laboratory findings and bal specimens revealed no sign of bacterial, mycobacterial, and fungal infection, there was no further adequate facilities for diagnosis of respiratory viral infections in the patient. idiopathic ild with unknown etiology may be seen even in cgd, but the reason for non-infectious inflammation remains mostly elusive. recent studies demonstrated that genes encoding polymorphonuclear cells in cgd patients have an increased expression of pro-inflammatory molecules and decreased anti-inflammation mediators. key regulators of apoptosis, inflammation and host defense were differentially expressed in the absence or presence of reactive oxygen species, respectively. although cgd patients have increased susceptibility to infections, a higher incidence of sterile inflammatory disorders in these patients has also been noted. although a favorable response to corticosteroid therapy can be expected in about 50% of cases, significant sequels such as need for long-term oxygen therapy are often observed. in this report, a rare complication of ild in a child with cgd has been reported which could be resulted as of either viral or non-infectious etiology. early diagnosis of lung disease in an immunodeficient patient and appropriate management can prevent further complications, such as pulmonary fibrosis in this group of patients.

backgroundchronic granulomatous disease (cgd) is an inherited phagocytes defect, characterized by defects of nadph-oxidase and inability of bacterial killing, which leads to recurrent life-threatening infections. respiratory problems, which are the major cause of morbidity in cgd, usually result from recurrent severe infections; however, vigorous inflammatory response could also cause respiratory diseases. case presentationherein, an 11 year-old patient with cgd is presented who suffered from chronic cough and dyspnea for 7 years. considering the results of chest x-ray, high-resolution computed tomography, and pulmonary function test, the diagnosis of interstitial lung disease was made. conclusionearly recognition of manifestations associated with cgd and appropriate treatment could prevent further complications and reduce morbidity and mortality in this group of patients.

PMC3448230

pubmed-866

regeneration of oxidized glutathione by glutathione reductase to its reduced form, glutathione (gsh) is vitally important in combating oxidative stress in neurons. to reduce oxidized glutathione, glutathione reductase uses nicotinamide adenine dinucleotide phosphate (nadph) as its cofactor. as levels of reactive oxygen species accumulate in neurons, the demand for nadph increases (ben-yoseph et al., 1994). the levels of gsh in cells in culture are directly related to the production of nadph by the pentose phosphate pathway (ppp) (salvemini et al., 1999) and it has been shown that the ppp is the primary source of nadph in cells (pandolfi et al., 1995). importantly, in neurons the rate limiting glycolytic enzyme phosphofructokinase b3 is translated but subsequently ubiquitylated and degraded by the proteasome, with the result that neurons preferentially metabolize glucose via the ppp as opposed to glycolysis, in contrast to most other cell types (herrero-mendez et al., 2009). inhibiting glucose flux through the ppp in these experiments was shown to cause increased levels of oxidative stress and cell death, emphasizing the extent to which neurons rely on the ppp for survival. the effects of inhibiting the pentose phosphate and gluthathione pathways are similar to many of the pathologic changes associated with parkinson's disease (pd). depleting glutathione in rats using l-buthionine sulfoximine, has been shown to cause complex i and iv damage (heales et al., 1995), a phenomenon, which has been documented in postmortem pd brain tissue, with complex i damage in pd widely reported (schapira et al., 1989). similarly, decreased levels of total gsh have been measured in pd brains (perry et al. this loss of gsh is found in pd and lewy body disorders, but not multiple system atrophy, progressive supranuclear palsy, or huntington's disease (sian et al., 1994). one important, but less reported finding is that pharmacologic inhibition of the ppp in rats using the irreversible inhibitor 6-aminonicotinamide, has been shown to cause selective dopaminergic cell death in the striatum and muscle rigidity resembling bradykinesia (herken, 1990). recent studies investigating metabolism in pd have continued to emphasize the importance of glucose usage in the disease process, with glucose hypometabolism shown in pd using magnetic resonance imaging and fludeoxyglucose (18f) positron emission tomography studies (borghammer, 2012). genetic microarray studies of the substantia nigra in pd show a strong association with the transcriptional regulator pgc1, which is involved in the control of glucose usage (zheng et al., 2010) and in animal models, knocking down -synuclein (-syn) a recent article-characterizing metabolism in cultured adipocytes suggests that glucose uptake may be regulated by -syn signaling via the lpar2/gab1/pi3k/akt pathway (rodriguez-araujo et al., importantly, studies looking at the effect of glucagon-like-peptide 1 on animal models of pd, have shown that modulating glucose metabolism is able to reverse dopaminergic cell loss in rats (harkavyi et al., 2008; li et al., 2009) and clinical trials of the glucagon-like-peptide 1 agonist exendin-4 are currently at stage ii for use in pd (tom foltyne, personal communication). through this study comparison of these results with those from ad and control tissue; will allow any differences in nadph production to be identified. we hypothesize that reduced glucose metabolism via the ppp in neurons, is an early event in sporadic pd pathogenesis. we studied flash-frozen tissue from the frontal cortex (brodmann area 4), putamen, and cerebellar vermis. cases with pathologically diagnosed pd were stratified according to the mckeith criteria (mckeith et al., mild cases were grouped according to those with lewy body pathology in the brain stem only (mckeith brainstem predominant). moderate and/or severe cases were those with lewy body pathology visible in the limbic and neocortical areas (mckeith limbic and diffuse neocortical lewy body pathology). ad cases were similarly confirmed by postmortem analysis and cases with braak and braak stages iv-vi (braak et al., 2003) were selected for these experiments. for each brain region 13 controls, 11 mild pd, 12 moderate and/or severe, and 13 ad cases were used. where tissue was available, cortex, putamen, and cerebellum samples were taken from the same individual. controls were age matched and showed no lewy body pathology. cases with braak and braak stages ii and under were used for this study. tissue was homogenized in an isolation buffer of 320 mm sucrose, 1 mm ethylenediaminetetraacetic acid and 10 mm tris-base, ph 7.4 using a mechanical homogenizer. homogenates were centrifuged for 15 minutes at 16,000 g at 4 c and the supernatant removed for assaying. we characterized ppp in pd by assessing the total nadph generated by glucose-6-phosphate dehydrogenase (g6pd) and 6-phosphogluconate dehydrogenase (6pgd). this was done using a modified protocol, based on that described by (ninfali et al., 1997). tissue homogenate was assayed under 2 separate conditions, 1 containing g6p and 6pg to calculate the total activity of the pentose phosphate pathway and 1 with 6pg alone. g6pd activity was calculated by subtracting the nadph generated in the combined condition, from that in the 6pg condition. reaction mixture contained a final concentration of 2 mm nadp, 1 mm glucose-6-phosphate, and 1 mm phosphogluconic acid reconstituted in 1 m tris-hcl, 5 mm ethylenediaminetetraacetic acid ph 7.6, 15% (vol/vol) wst-8 dye supplemented with 0.2 mm 1-methoxy phenazinium methylsulfate (all materials were purchased from sigma-aldrich, poole, uk). samples were added to the reaction mixture and incubated at 37 c for 15 minutes. the levels of the nadph-producing enzymes g6pd and 6pgd were calculated using elisa kits specific for human g6pd and 6pgd, according to the manufacturer's instructions (wuhan life sciences, houston, tx, usa). samples were run in duplicate. protein concentration was estimated using the bio-rad dc protein assay kit according to the manufacturer's instructions (bio-rad, hemel hempstead, uk). all results in this study were analyzed using a 1-way analysis of variance (anova) followed by a bonferroni posttest. we set out to characterize utilization of the ppp in flash frozen postmortem pd brain tissue. to look at glucose metabolism via this pathway over the course of disease progression, we identified 2 groups of pd samples, which were classified according to the extent of their lewy body pathology based on the mckeith lewy body pathology criteria (mckeith et al., 2005). cases assigned to the mild group were those with lewy body pathology predominantly in the brain stem. moderate and/or severe cases were those with lewy body pathology that had progressed to the limbic and neocortical areas. all cases in the mild group showed a low level of lewy body deposition in the putamen. ad cases were confirmed by postmortem neuropathological examination and cases with braak and braak stages iv-vi (braak et al., 2003) were used for these experiments. controls were age matched and confirmed to have braak and braak stages of ii and under. total nadph produced by the ppp was calculated by addition of nadph production by g6pd and 6pgd. to assess the impact of enzyme expression on the production of nadph data for 6pgd elisa and enzyme activity levels are shown as supplementary data. increased nadph production in the cortex has been shown to occur in response to increased levels of oxidative stress in ad (martins et al., 1986). calculation of nadph production by the ppp in our samples showed that generation of nadph is significantly increased in the ad and moderate and/or severe pd groups as compared with controls (fig. 1a gray bars, 1-way anova followed by bonferroni posttest vs. control). this increase was accompanied by higher levels of the rate-limiting enzyme g6pd (fig. 1b, gray bars, 1-way anova followed by bonferroni posttest p<0.05). in the mild pd group, that is pd cases that do not have pathology in the cortex, there was no increase in either the amount of nadph produced or levels of g6pd enzymes (fig. 1a and b gray bars). calculating the efficiency of g6pd by expressing nadph production per elisa unit of g6pd protein showed that there was no significant change in any of the experimental groups characterized (fig. 1c, gray bars, 1-way anova, p =0.8017). total nadph produced by the ppp in the putamen was significantly increased in the brains of those with ad and in the moderate and/or severe pd group (fig. 1a, black bars, 1-way anova followed by bonferroni posttest). in ad, the levels of g6pd enzyme similarly the moderate and/or severe pd group showed no significant increase in protein levels of the rate-limiting enzyme g6pd however, the mild pd group showed a significant decrease, suggesting a down-regulation of this pathway at the protein level (fig. calculating the efficiency of g6pd for all samples, showed an activation of g6pd in the mild pd and ad groups. in these groups, each elisa unit of the enzyme produced approximately twice as much nadph per minute compared with the control group (fig. importantly, ad cases with braak and braak stages iv-vi have amyloid beta and tau pathology in the putamen and the activation of g6pd in these samples suggests that an oxidative stress response is occurring. while both the mild and moderate and/or severe pd cases used in this study showed lewy body pathology in the putamen, it is only the moderate and/or severe group which shows increased nadph production in response to this (fig. 1a, black bars) this would suggest that although the mild cases are able to match control nadph production levels, the ability to mount an oxidative stress responsive is decreased and that an increase in nadph is not seen until pd pathology is more extensive. to assess the function of the ppp pathway in a region not affected in pd, we measured nadph production and the enzyme levels of g6pd and 6pgd in the cerebellum. nadph production across all 3 experimental groups showed no significant change in the cerebellum when compared with controls (fig. interestingly however, quantification of g6pd protein levels, again showed a down-regulation of the rate-limiting enzyme that was present in both pd groups, with enzyme levels showing a significant decrease compared with control (fig. 1b, white bars, 1-way anova followed by bonferroni posttest). calculating the efficiency of g6pd in these samples showed a 2-fold increase in nadph production of about 2-fold in these samples when compared with controls (fig. 1c, 1-way anova followed by bonferroni posttest). as shown in the putamen of samples in the mild pd group, despite a significant decrease in nadph producing enzymes, net nadph production in both pd groups remains level with that of the controls, because of each unit of g6pd producing more nadph. samples in the ad group showed no difference in the nadph produced (fig. 1a, white bars), or in the levels of ppp enzymes measured (fig. neurons are subjected to high levels of oxidative stress because of a relatively high level of oxidative phosphorylation and nitric oxide signaling from astrocytes (bolanos and heales, 2010.), leaving them vulnerable to damage. it has been shown that production of nadph from the ppp is responsible for reduction of oxidative species and therefore reducing levels of oxidative stress, leaving neurons able to function normally. inhibition of the ppp is deleterious to neurons (filosa et al., 2003; pandolfi et al., 1995). increased levels of oxidative stress are important in the pathogenesis of pd (alam et al., 1997; dexter et al., 1989; floor et al., 1998) and it has been suggested that oxidative stress could play an important role in the formation of lewy body pathology (jenner and olanow, 1996). as the ppp is the main source of defense against oxidative stress in neurons, we thought it important to characterize the usage of this pathway in pd. studies showing increased activity of the ppp in ad (martins et al., 1986), neuromuscular diseases (meijer, 1991), myocardial infarction (gupte, 2008), and studies using hepatocyte cell models (ursini et al., 1997) however, characterization of the ppp in our experiments has shown that nadph production is not increased in the putamen of samples with early stage pd and furthermore, ppp enzyme levels are actually decreased. this is despite widely documented evidence that dopaminergic cell death in the striatum of pd cases is accompanied by increased markers for oxidative stress and neuroinflammation in postmortem samples (alam et al., 1997; imamura et al., 2003; marttila et al., 1988; ouchi et al., 2005; sanchez-ramos et al., 1994) and in vivo, by positron emission tomography imaging studies (ikawa et al., 2011). similarly, although there are a number of published studies showing increased levels of oxidative stress in the frontal cortex of cases with both clinical and preclinical pd (dalfo et al. 2008), the early stage cases in our experiments again did not show an increase in nadph levels. this could be because of faulty oxidative stress-sensing mechanisms in affected neurons, or because of an active suppression mechanism that is stopping increased nadph production from occurring. an article looking at the ppp in als, showed that neuroblastoma-spinal cord hybrid cell lines (nsc34) carrying g93a or g37r sod1 mutations display decreased levels of g6pd enzyme, which affects the production of nadph by this pathway (kirby et al., 2005). similarly ataxia telangiectasia mutated knockout mice also show a reduction of g6pd in the cerebellum (cosentino et al., 2011), suggesting that downregulation of the ppp in disease could be a key mechanism in some forms of neurodegeneration. taking our results together with data from cell and animal models, suggests that dysregulation of the ppp could be causing oxidative stress because of less efficient gsh recycling (heales et al., 1995; herrero-mendez et al., 2009) and that dysregulation of the ppp could be causative factor in the increased levels of oxidative stress seen in pd. the results of our experiments suggest that there are 2 stages of ppp involvement with oxidative stress in pd. in the early stages of disease, lower levels of ppp enzymes in the putamen could be causing increased levels of oxidative stress. in response to this, g6pd is activated, potentially by posttranslational modification of the enzyme as shown in other studies (cosentino et al., 2011; ursini et al., 1997) and the increased demand for nadph met by increased activity per elisa unit of the protein. in the later stages of disease, where pathology has spread to the limbic system and neocortex, our results show that there is a switch from activation of g6pd at its existing levels, to upregulating the nadph-producing enzymes at a protein level. interestingly, the exact mechanisms for regulation seem to differ between brain regions and despite evidence of increased oxidative stress in the cerebellum in pd, the cerebellum does not show evidence of neurodegeneration. elucidating the mechanisms underlying these differences could be important in understanding the vulnerability of certain cell types over others in different neurodegenerative diseases. the results of this study come with the caveat that the tissue was from postmortem brains and therefore only provides a snapshot of the changes occurring at that time. despite this, further investigation into mechanisms that are potentially underlying our findings may prove important in understanding the pathogenesis of pd the results of this study shed light on a potentially new mechanism in the pathogenesis of sporadic pd and when taken with further studies from cell and animal models, may lead to better understanding of these mechanisms. our data suggest that down-regulation of the ppp in pd could be a primary event in disease progression and further research down this avenue may provide potential targets for future therapeutic avenues. we hypothesize that mitochondrial damage in pd occurs as a direct result of ppp dysregulation and that -syn plays an important role in the altered metabolism of glucose via the ppp in this disease.

unlike most other cell types, neurons preferentially metabolize glucose via the pentose phosphate pathway (ppp) to maintain their antioxidant status. inhibiting the ppp in neuronal cell models causes cell death. in rodents, inhibition of this pathway causes selective dopaminergic cell death leading to motor deficits resembling parkinsonism. using postmortem human brain tissue, we characterized glucose metabolism via the ppp in sporadic parkinson's disease (pd), alzheimer's disease (ad), and controls. ad brains showed increased nicotinamide adenine dinucleotide phosphate (nadph) production in areas affected by disease. in pd however, increased nadph production was only seen in the affected areas of late-stage cases. quantifying ppp nadph-producing enzymes glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase by enzyme-linked immunosorbent assay, showed a reduction in the putamen of early-stage pd and interestingly in the cerebellum of early and late-stage pd. importantly, there was no decrease in enzyme levels in the cortex, putamen, or cerebellum of ad. our results suggest that down-regulation of ppp enzymes and a failure to increase antioxidant reserve is an early event in the pathogenesis of sporadic pd.

PMC3969149

pubmed-867

over the last two decades, the biological preeminence of cellular nitric oxide (no) signaling pathways has been intimately linked to many processes and to its regulated enzymatic formation from l-arginine via the actions of no synthases (nos) and to secondary activation of soluble guanylate cyclase as a major physiological target/effector system [120]. evolutionary pressure has established a functional diversity in cellular expression of nos isoenzymes derived from three distinct genes and designated as endothelial (e), neuronal (n) and inducible (i) nos. e- and n-nos are constitutively expressed, display ca dependent activation, and rapidly produce and release no within spatially defined cellular domains. in contrast, inos expression is intimately linked to proinflammatory processes, displays a significant latency period due to transcriptional and translational processing, and effects unregulated ca independent release of no for extended periods of time [7,2128]. interestingly, a significant body of literature supports the contention that constitutively released no can attenuate the expression of inos in vascular smooth muscle, neutrophils, microglia, astrocytes and hepatocytes [2935]. work from our laboratory has demonstrated significant feedback inhibition of no on constitutively derived no release [12,1416,3641] as well as inos derived no release. within the past decade, an important body of work has challenged the primacy of nos/l-arginine derived no in cellular signaling processes and involves the existence of chemically stable nitrite and nitrite reductase activities in these same cell/tissue types [4256]. nitrite is a major metabolic product of no and is found in all cell and tissue types that utilize no signaling processes [4246,52,53,5567]. accordingly, the establishment of a parallel and complementary no signaling pathway utilizing recycled nitrite chemical equivalents, independently expressed from well established nos/l-arginine signaling pathway, requires the identification and biochemical characterization of key candidate enzymes displaying significant nitrite reductase activities within meaningful biological contexts. until now, accumulated no/nitrite reductase literature has focused on xanthine oxidoreductase (xor) as the major candidate nitrite reductase enzyme linked to cellular no signaling events [49,51,52,5458,6064,6876]. other candidate nitrite reductases displaying potentially important biological roles as accessory players in no signaling events include the mitochondrial enzymes aldehyde dehydrogenase, cytochrome c/cytochrome c oxidase, deoxymyoglobin and deoxyhemoglobin. xanthine oxidoreductase has been previously characterized as a housekeeping enzyme responsible for cellular uric acid formation via enzymatic conversion of hypoxanthine and xanthine. based on its intrinsic state-dependent biochemical properties to exist as both a dehydrogenase and an oxidase, it became apparent to several investigators that xor possessed multi-functional enzymatic activities outside the realm of xanthine metabolism [5456,70,79]. hallmark positive vascular effects were well established to be mediated by cellular nos/l-arginine no signaling pathways [711]. a small but significant literature has also established a compelling functional association between administered sodium nitrite, xor activation, and pharmacologically characterized no transductive effects in positive cardiovascular function [62,63,75,8082], enhanced pulmonary perfusion, and protection against ischemia/reperfusion injury [64,7275] and hypoxic damage [56,58,8385] and oxidative stress. similar positive vascular and cellular effects were observed to be functionally associated with mitochondrial aldehyde dehydrogenase, cytochrome c/cytochrome c oxidase. nitric oxide derived from nos/l-arginine systems functions not only as a vasodilator but as a general antibacterial and antiviral agent and, counter-intuitively, it can down-regulate proinflammatory events [27,8692]. accordingly, significant anti-inflammatory properties of administered sodium nitrite have been attributed to xor activation via pharmacologically characterized no transductive effects. work from our laboratory supports the contention that constitutively derived no provides a basal or tonal level of chemical mediator keeps particular types of cells in a state of inhibition. on, i.e., respond to environmental changes, and that this low basal level of no provides an organism with a major pathway that functions to dampen microenvironmental this kind of activation really represents a disinhibition process, i.e., an overcoming of the inhibitory influence of no by changing the balance between basal no and the levels of excitatory signals. in support of the hypothesis stated above, there is considerable evidence that constitutively derived no down-regulates the immunocyte-endothelial interaction. the adherence of monocytes and granulocytes is reduced following the stimulation of cnos and, in the presence of no, monocytes, granulocytes and endothelial cells become round and inactive. these findings strongly indicate that no can diminish the adherence and level of activation of leukocytes and endothelial cells. it also suggests these are phenomena that occur within a microenvironment given no short-half life and the strength of the effect produced by many of these cells via autocrine and/paracrine signaling. it is now possible to add a functionally reinforcing mechanism whereby basal levels of cellular nitrite are recycled to active no equivalents via the actions of xor and accessory nitrite reductases upon physiological demand (figure 1). it has been well established that mitochondrial respiration linked to homeostasis of intermediary energy metabolism is regulated by no signaling systems [12,98104]. for example, pharmacological inhibition of constitutively derived no has been shown to increase oxygen consumption in many animal species [105109]. furthermore, a novel nos isoform, mtnos, is present in mitochondria and appears to modulate local circuit regulatory functions within electron transport complexes. interestingly, nitrite-derived no has been shown to potently regulate respiration, reactive oxygen species, and energy metabolism in plant mitochondria [83,111113]. the apparent redundancy of plant mitochondrial nos/l-arginine- and nitrite-derived no signaling systems [83,111113] provides a compelling platform for further investigation into reciprocal regulatory effects of mtnos and concerted nitrate reductase actions in mammalian mitochondria (figure 1) [4246,53,85,114]. a recent important publication has described local circuit nitrite/no cycling to produce biologically active no within liver mitochondria. the investigators have demonstrated that nitrite mediates cellular signaling through its reduction to no via reactions with the mitochondrial electron carrier cytochrome c. cytochrome c-mediated nitrite reductase activity is dependent on pentacoordination of the heme iron in the protein and occurs under anoxic and in the presence of nitrite, pentacoordinate cytochrome c generates bioavailable no that is able to inhibit mitochondrial respiration. an elegant complementary study has demonstrated in yeast that state-dependent hypoxia recruits cytochrome c oxidase as a functionally competent nitrite reductase. the investigators have also evaluated nitrite-dependent no production by specific isoforms of cytochrome c oxidase in support of a functional role of the enzyme in hypoxic signaling events. additionally, the study findings suggest a positive feedback mechanism for nitrite-derived mitochondrial no on selective gene expression of a cytochrome c oxidase subunit that is functionally associated with enhanced production of no in hypoxic/anoxic cells. on a functional basis it has become clear that the basal level of no derived from cnos in concert with cellular nitrite reduction by xor within a diverse class of nitrite reductases may serve as a key regulatory mechanism underlying complex, cascading, physiological processes associated with maintaining cellular and organ viability. further studies are required to probe selective regulatory effects of nos-derived and nitrite-derived no on gene expression of their cognate synthetic enzymes. similar compelling studies are needed to elucidate biologically meaningful cellular coupling of cytosolic xor and mitochondrial nitrite reductases in normal and pathophysiological states (figure 1) [6870,80,115117]. finally, holistic pre-clinical and studies to evaluate conversion of dietary nitrate to recycling active cellular nitrite pools hold great promise for improving quality of life in human and animal populations.

summaryour mini-review focuses on dual regulation of cellular nitric oxide (no) signaling pathways by traditionally characterized enzymatic formation from l-arginine via the actions of no synthases (nos) and by enzymatic reduction of available cellular nitrite pools by a diverse class of cytosolic and mitochondrial nitrite reductases. nitrite is a major metabolic product of no and is found in all cell and tissue types that utilize no signaling processes. xanthine oxidoreductase (xor) has been previously characterized as a housekeeping enzyme responsible for cellular uric acid formation via enzymatic conversion of hypoxanthine and xanthine. it has become apparent that xor possesses multi-functional enzymatic activities outside the realm of xanthine metabolism and a small but significant literature also established a compelling functional association between administered sodium nitrite, xor activation, and pharmacologically characterized no transductive effects in positive cardiovascular function enhanced pulmonary perfusion, and protection against ischemia/reperfusion injury and hypoxic damage and oxidative stress. similar positive vascular and cellular effects were observed to be functionally associated with mitochondrial aldehyde dehydrogenase and cytochrome c/cytochrome c oxidase. the profound implications of a reciprocal regulatory mechanism responsible for cytosolic and mitochondrial no production are discussed below.

PMC3539480

pubmed-868

a 52-year-old male patient with a height of 163 cm and a weight of 65 kg was admitted to the hospital due to right femoral edema, and following a diagnosis of right femoral abscess, an incision and drainage procedure was performed. with regard to medical history, the patient was paraplegic from the level of the fourth thoracic vertebra due to a t2-level spinal cord injury from a car accident 4 years previously. due to tetany symptoms in both lower limbs, he had been regularly taking an oral dantrolene formula of 50 mg (anorex cap. 25 mg, yooyoung pharmaceutical, seoul, korea) every night for the previous 3 years. prior to the operation, the patient's blood pressure was 100/60 mmhg, and his heart rate was 94 beats per minute. there was a systemic inflammation response due to the right femoral abscess, accompanied by an increase in body temperature (38.3); in addition, the prothrombin time was outside the normal range (inr 1.21). when the patient entered the operating room, the standard anesthetic monitoring devices were applied, and the blood pressure and heart rate were 123/78 mmhg and 86 beats per minute, respectively. the neuromuscular monitoring device (tof-watch, organon, boxtel, netherlands) was attached to the ulnar nerve of the left forearm flap. propofol 2 mg/kg was intravenously administered for induction of anesthesia, and i.v. rocuronium 0.3 mg/kg (ed95) was administered while ventilating with 5 l/min of oxygen and 4 vol% of sevoflurane. the tof ratio did not fall under 0.25 2 minutes after rocuronium administration, and 10 mg (0.15 mg/kg) of i.v. after 2 minutes, the tof count still had not decreased to 0, and 0.15 mg/kg of i.v. thereafter, the tof count decreased to 0, and endotracheal intubation was carried out. the mandible was sufficiently relaxed at the time of endotracheal intubation; there was no movement of the vocal cord, and coughing or movement was not observed after intubation. the anesthesia was maintained with 1.2-1.5 vol% of sevoflurane and 50% n2o during the operation. the tof ratio was 0.37 at the end of the operation, which was 35 minutes after the last dose of the muscle relaxant had been administered. intravenous pyridostigmine 0.15 mg/kg and glycopyrrolate 0.003 mg/kg were administered as antagonists of the muscle relaxant. extubation was carried out; the tof ratio was maintained above 0.9 at around 55 minutes after the last dose of the muscle relaxant had been administered. no sign of respiratory depression was observed after extubation, and no particular signs and symptoms were observed in the recovery unit. three months later, the patient was diagnosed with chronic osteomyelitis, and an incision and drainage operation was planned. it was decided to perform general anesthesia in consideration of the state of systemic inflammation and the patient's preference. as pretreatment for anesthesia, 0.2 mg of i.m. when the patient entered the operating room, the standard anesthetic monitoring devices and the neuromuscular monitoring device were applied in the same manner as in the previous operation. the blood pressure was 112/70 mmhg, and the heart rate was 93 beats per minute. the neuromuscular monitoring device (tof-watch sx, organon, netherlands) was attached to the ulnar nerve of the right forearm flap. after the loss of consciousness, stabilization and calibration were carried out to establish the initial value of the spasm height prior to the administration of rocuronium. for the calibration of the spasm reaction, a 50 hz tetanic stimulation was conducted for 5 seconds, which was then changed to a 2 hz tof stimulation with 15-second intervals, and the calibration was initiated by pressing the cal switch on the tof-watchsx (cal 2 mode). the tof response change was within 10% 2 minutes after the calibration, and this was considered as the stabilization of the spasm response. administration of rocuronium 0.3 mg/kg (ed95), a block of more than 80% of t1 failed; therefore, additional i.v. rocuronium 0.3 mg/kg was administered, and a 100% block of t1 was achieved at just past 300 seconds. the anesthesia was maintained with 1.5-2.0 vol% of sevoflurane and 50% of n2o during the operation. the time taken to recover t1 to 25% after the administration of the second dose of the muscle relaxant was 4 minutes and 36 seconds. twenty-five minutes after endotracheal intubation, t1 had recovered more than 25%; hence, an additional 7.5 mg of rocuronium was administered. with the recovery of the muscle relaxation, the time taken for t1 to recover from 25% to 75% was 9 minutes and 1 second. the tof ratio was 0.33 5 minutes after ceasing sevoflurane administration on completion of the operation. neostigmine 0.05 mg/kg and glycopyrrolate 0.005 mg/kg were administered to antagonize the muscle relaxation. at 5 minutes and 30 seconds after administration of the antagonist, t1 had recovered more than 95%, and the tof ratio had recovered to more than 0.9. therefore, extubation was carried out. the authors confirmed that long-term administration of oral dantrolene for the treatment of spasticity does not significantly affect the muscle relaxant action of rocuronium. regarding the induction of muscle relaxation in the second operation, t1 did not decrease more than 84% 3 minutes and 30 seconds after the administration of 0.3 mg/kg of rocuronium. hence, an extra dose of 0.3 mg/kg of rocuronium was administered. a more than 95% reduction in t1 was observed 5 minutes after the administration of the first dose of the muscle relaxant. in both of the operations, the total amount of rocuronium required for endotracheal intubation was twice the ed95 (0.6 mg/kg). for the maintenance of muscle relaxation, the clinical duration (the time taken from the administration of the intubating dose until 25% recovery of t1) was 24 minutes and 36 seconds, which was not extended any further. for the recovery of muscle relaxation, the recovery index (the time taken for t1 recover from 25 to 75%) in the second operation was 9 minutes and 1 second, and the time taken for the tof ratio after the last dose of the muscle relaxant to be greater than 0.9 was 22 minutes and 30 seconds, which was not extended any further. reported the case of an 8-year-old patient who had been taking oral dantrolene 20 mg daily for the treatment of spasticity for 2 years prior to an operation. when 75 g/kg of vecuronium was administered for general anesthesia, the recovery index was 7 minutes, and the recovery time of t1 to 90% was 25 minutes, which was not extended. after the operation, neostigmine and atropine were used as antagonists of the muscle relaxant when t1 had recovered to 25%. flewellen et al. evaluated the dose-dependent effect of dantrolene on the muscle relaxant action in adults without a particular medical history, and 75% twitch depression was observed when 2.4 mg/kg was intravenously administered with the additional administration of 0.1 mg/kg of dantrolene every 5 minutes. however, there was no significant change in maximum expiratory flow rate, lung capacity, or respiratory rate per minute. driessen et al. reported the case of a 60-year-old female patient who was administered 350 mg (5.3 mg/kg) of dantrolene for 28 hours prior to an operation for the prevention of malignant hyperthermia. when 45 g/kg of vecuronium was administered for general anesthesia, the spasm response of the 90% recovery time on the electromyogram was extended to 47 minutes. furthermore, watson et al. described the case of a 5-year-old female patient who was administered 2 doses of 1 mg/kg oral dantrolene every 6 hours for the prevention of malignant hyperthermia. after the second dose, the patient manifested muscle weakness and partial obstruction of the soft tissue of the upper respiratory tract under respiration. the patient in this case had been administered 50 mg of oral dantrolene once a day, and in both operations, the total dose of muscle relaxant (0.6 mg/kg) required for endotracheal intubation was not particularly different from the dose required in other patients. these results can be attributed to the fact that the patient was taking 0.76 mg/kg of dantrolene, and the elimination half life of dantrolene is 15.8 6.0 h. as the first operation was at 4 p.m. and the second operation was at 1 p.m., the operations were carried out 21 hours and 18 hours after the administration of dantrolene, respectively. therefore, the reduction in the serum concentration of dantrolene that was administered the day before the operation is considered to be one of the factors influencing the results. the perioperative administration of dantrolene may cause a delay in the recovery of muscle relaxation in a dose-dependent manner, and the timing of preoperative administration is especially important as it is associated with the serum dantrolene concentration. therefore, for patients taking a high dose of dantrolene, it is helpful to consider the half life of the medication when making decisions about the timing of medication discontinuation. however, there are individual differences in pharmacokinetics. for the use of a muscle relaxant, neuromuscular monitoring

oral dantrolene causes a dose-dependent depression of skeletal muscle contractility. a 52-year-old man treated with oral dantrolene for spasticity after spinal cord injury was scheduled to undergo irrigation and drainage of a thigh abscess under general anesthesia. he had taken 50 mg oral dantrolene per day for 3 years. under standard neuromuscular monitoring, anesthesia was performed with propofol, rocuronium, and sevoflurane. a bolus dose of ed95 (0.3 mg/kg) of rocuronium could not depress t1 up to 95%. an additional dose of rocuronium depressed t1 completely and decreased the train-of-four (tof) count to zero. there was no apparent prolongation of the neuromuscular blocking action of rocuronium. the tof ratio was recovered to more than 0.9 within 40 minutes after the last dose of rocuronium. a small dose of oral dantrolene does not prolong the duration of action and recovery of rocuronium.

PMC3948443

pubmed-869

rab-type small gtpases are conserved membrane trafficking proteins in all eukaryotes, and they mediate various steps in membrane trafficking, including vesicle budding, vesicle movement along cytoskeletons, vesicle docking to specific membranes, and vesicle fusion. rabs function as a molecular switch by cycling between two nucleotide-bound states, a gdp-bound inactive state (off state) and a gtp-bound active state (on state). rabs are activated by specific guanine nucleotide exchange factors (gefs), which promote the release of gdp from rab and binding of gtp to rab, and the activated rabs are then inactivated by gtpase-activating proteins (gaps) or spontaneously inactivated by their intrinsic gtpase activity. thus, investigation of rab-gefs is crucial to understanding the spatio-temporal regulation of rab gtpase activation. although a large number of putative rab-gefs, including denn-domain-containing proteins, have recently been reported, very little is known about their in vivo roles in rab targeting to specific membrane compartments. rab17 was originally described as an epithelial cell-specific rab isoform that regulates polarized trafficking but was subsequently found to be expressed in melanocytes and human breast adenocarcinoma, and more recently we demonstrated that rab17 is also expressed in mouse brain. localization of rab17 in mouse hippocampal neurons is unique, because rab17 is the only rab isoform that is specifically targeted to the dendrites and is not targeted to the axon. the targeting of rab17 to the dendrites is neuronal differentiation stage-dependent: at an early stage (3 d of in vitro culture) it localizes only in the cell body, whereas at a later stage (11 d of in vitro culture) some of the rab17 is translocated from the cell body to the dendrites. by contrast, other rab isoforms are targeted to the axon alone (e.g., rab3a) or to both the axon and dendrites (e.g., rab5a). targeting of rab17 to the dendrites is known to be crucial for dendrite morphogenesis and subsequent postsynapse formation, because knockdown of rab17 has been found to result in a marked reduction in both total dendrite length and the number of dendrite branches without affecting axon morphogenesis (i.e., total axon length and the number of axon branches). although several mammalian rab isoforms (e.g., rab7 and rab11) have been shown to regulate dendrite morphogenesis, rab17 is the first reported rab isoform that specifically regulates dendrite morphogenesis, but not axon morphogenesis, in mammalian neurons. we therefore thought that rab17 would be an ideal rab isoform to use to analyze a rab targeting mechanism at the cellular level. however, until recently the molecular basis of the specific rab17 targeting to dendrites had completely remained unknown and no physiological rab17-gefs that function in hippocampal neurons had been identified. in our latest study, we screened for rab17-gefs by performing yeast two-hybrid assays with a constitutive negative mutant of rab17 as bait and succeeded in identifying rabex-5 and als2, both of which were originally described as rab5-gefs, as plausible candidate rab17-gefs in mouse hippocampal neurons. it is noteworthy that overexpression of rabex-5, but not of als2, increased the proportion of rab17 in the dendrites, whereas knockdown of rabex-5 caused a dramatic reduction in the proportion of rab17 in the dendrites. importantly, overexpression of a gef-activity-deficient mutant of rabex-5 (rabex-5-d313a) failed to increase translocation of rab17 from the cell body to the dendrites. based on these findings, activation of rab17 by rabex-5 is responsible for the stage-dependent movement of rab17 from the cell body to the dendrites of hippocampal neurons. actually, forced activation of rab17, i.e., expression of a constitutive active mutant of rab17 (rab17-q77l), increased the dendrite localization of rab17 even in early stage neurons. more importantly, rabex-5 knockdown was found to cause a significant reduction in total dendrite length, the same as rab17 knockdown did, and the reduction was partially rescued by co-expression with rab17-q77l. these findings indicated that rabex-5 functions as an upstream activator of rab17 in developing hippocampal neurons (fig. proposed model of rabex-5-mediated translocation of its downstream rabs to the neurites of developing hippocampal neurons. rabex-5 functions not only as a rab17-gef (a) but also as a rab5/21-gef (b), and it determines dendrite targeting of rab17 and axon/dendrite targeting of rab5/21, respectively (dotted arrows). the solid arrows indicate the gef function of rabex-5 that promotes release of bound gdp from rab5/17/21 in exchange for gtp. because of the different sorting functions of rabex-5, rab17 specifically regulates dendrite morphogenesis, whereas rabex-5 and rab5 are involved in neurite morphogenesis in general. factor x in (a) is a putative rab17-specific effector that may also interact with rabex-5 and support dendrite targeting of rab17. rabaptin-5 is known to interact with both rab5/21 and rabex-5 at early endosomes, but whether rabaptin-5 is involved in neurite outgrowth remains to be determined (b). determining the molecular mechanism by which active rab17 is translocated from the cell body to the dendrites is an important task that has yet to be achieved. active rab17 itself is unlikely to have the ability to target dendrites, because unlike endogenous rab17, which specifically localizes in the dendrites, rab17-q77l also localizes in the axon. interestingly, overexpression of a gef domain (i.e., vps9 domain) of rabex-5 alone similarly increased the translocation of rab17 to both the axon and the dendrites, whereas overexpression of full-length rabex-5 increased endogenous rab17 translocation to the dendrites alone. thus, some additional domains of rabex-5 besides its gef domain (e.g., a zinc finger domain and/or a coiled-coil domain) must also be involved in rab17 targeting. we speculate that rabex-5 functionally links to dendrite-directed motors and that rab17 activated by rabex-5 is captured by certain motor proteins that transport it to the dendrites. since some rab effector molecules (or rabs themselves) are known to directly associate with motor proteins, in the future it would be interesting to search for rab17-specific effectors that form a link between rabex-5 and motor proteins. our finding that rabex-5 determines the dendrite localization of its downstream target rab17 is highly consistent with a recent report showing that rab-gefs (e.g., rabex-5 and rabin8) are major determinants of specific rab membrane targeting. however, one puzzling result of our research is that rab5 and rab21, two other downstream targets of rabex-5, are translocated both to the axon and to the dendrites of developing hippocampal neurons in a rabex-5-dependent manner (fig. 1b), meaning that rabex-5 determines not only the dendrite targeting of rab17 but the axon/dendrite targeting of rab5 and rab21 as well. because of the multiple roles of rabex-5 in rab targeting to neurites, rabex-5 is involved in both the axon morphogenesis and dendrite morphogenesis of developing hippocampal neurons by activating at least two downstream targets, rab5 and rab17. however, the molecular mechanism by which rabex-5 sorts different downstream rab proteins into the axon and/or dendrites is completely unknown. since rabex-5 constitutes a gef cascade by recruiting a rab5 effector, rabaptin-5, to early endosomes, rabex-5 may also recruit an as yet unidentified rab17-specific effector(s) (factor x in fig. 1a) that does not bind rab5 or rab21 and support dendrite targeting of rab17. thus, identifying rab17-specific effectors will be one of the most important tasks in future rab17 research designed to understand the molecular mechanism by which rabex-5 determines the targeting of its downstream rab proteins to neurites at the cellular level. since rab17 is also expressed in epithelial cells and melanocytes, it would be interesting to investigate whether rabex-5 also contributes to the polarized trafficking of rab17 in other cell types.

rab family small gtpases function as molecular switches in the regulation of membrane traffic, and their activity is thought to be controlled by guanine nucleotide exchange factors (gefs). however, the role of gefs in targeting rab proteins to specific membrane compartments is poorly understood. we have recently reported finding that rabex-5, originally described as a rab5-gef, also functions as a rab17-gef in mouse hippocampal neurons. the rab17 in developing hippocampal neurons is specifically targeted to their dendrites and not to their axons, and the gef activity of rabex-5 is required for translocation of rab17 from the cell body to the dendrites. interestingly, rabex-5 is also required for the axon and dendrite localization of rab5 and rab21 in hippocampal neurons. our findings indicate that rabex-5 determines the targeting of its downstream rab proteins to the dendrites (rab17) or to both the axon and dendrites (rab5 and rab21).

PMC3829932

pubmed-870

a challenge to increasing early childhood immunizations on a state or local level is the limited ability of standard summary measures of up-to-date (utd) rates to identify barriers to improvement. typically, early childhood utd rates are based on the number of doses of recommended vaccines, by individual antigen or in total, that a cohort of children receive by either a fixed age or a fixed date of assessment. for the national immunization survey (nis), this represents the proportion of 19- to 35-month-old children having all recommended doses for up to 7 vaccine types. similarly, health plans utilize a healthcare effectiveness data and information set (hedis) immunization measure, which counts the number of doses received by 24 months of age [2, 3]. however, a low utd rate among a population, derived using these measures, does not aid in determining why the rate is low. the growing complexity of the early childhood immunization schedule, with up to 19 vaccine doses recommended across at least 6 visits by age 2, means that there are many points of time and many reasons by which children can fall behind on immunizations. while immunization summary utd rates for 2-year-olds can identify general problems, there is also a need for more detailed assessment tools to describe local immunization coverage and more specific vaccine usage. one alternative method of evaluation is to consider age-appropriate vaccinations. a substantial body of prior work exists comparing summary utd measures against more specific assessments either for complete antigen series or combinations when actually due without considering late catch-up [79], or in comparison of individual antigens and shots to when they are expected or late. to the extent that early childhood immunizations are often used as a proxy for the quality of early childhood routine care, the timeliness of immunizations is a relevant measure delayed or lagging immunizations may reflect other issues with early childhood care. one perspective on age-appropriate immunizations is to track children's progress through immunization milestones between birth and age 2. immunization milestones are the ages at which recommended immunizations first become late according to the schedule developed by the advisory committee on immunization practices (acip). these milestones occur at 3, 5, 7, 16, 19, and 24 months of age. when immunizations are tracked using this approach, children's progression through milestones unfolds as a story of falling behind and catching up with recommended doses. this is a beneficial method as it facilitates identifying provider failure to give all or some of the immunizations that are due at healthcare encounters (missed opportunities) or parental failure to bring children to providers for vaccination-eligible encounters (missed visits). the prevalence of missed opportunities and missed visits at each milestone age can guide immunization interventions. however, basing milestone analysis exclusively on immunization record data may misclassify missed opportunities as missed visits, and shift the apparent burden of children who are not appropriately immunized for their age from providers to parents. this can occur because healthcare encounters during which no vaccinations are administered will not be captured into immunization record datasets. this study provides an example of using a milestone approach to assess a specific population and their progression through early childhood immunizations, where both payor-administrative and state-level immunization information system (iis) data are available. combining children's healthcare encounter information from payer records with their immunization records gives a more accurate assessment at each milestone age of the effect of missed opportunities and missed visits on age-appropriate immunizations and overall immunization rates. the study population consisted of a birth cohort of oregon children enrolled in the oregon health plan (ohp) and whose immunization records were in the oregon alert immunization information system (alert iis). alert iis immunization records were merged with provider encounter records from the ohp for this population. the alert iis is a statewide immunization registry which receives immunization records from 97% of oregon private healthcare providers and 100% of the immunization records from public providers. the ohp is oregon's public healthcare plan that provides healthcare coverage for children in families living below 185% of the federal poverty level and covers both those with traditional medicaid eligibility as well as an expanded state children's health insurance program (schip) population. the majority of ohp-enrolled children are placed in commercially available managed care plans. immunization records for ohp children are available both from ohp collected records for billing and encounters as well as from direct provider record submissions to alert. for this study, alert iis records and ohp encounter records immunization records and encounter data were restricted to those received through the child's 24th month of age. children's records were merged across the two data systems based on the child's name, date of birth, and county of residence. the matching process was based on the observation that within the 2005 oregon birth cohort, a combination of name and date of birth was over 99.9% unique, with almost all exceptions resolving with the inclusion of residence. this high-probability matching process was selected over the usual process alert uses to incorporate ohp and other administrative data, wherein a hard-match is required also on additional information such as address or phone number. immunization records were selected for the six vaccines (including combination vaccines) included in the recommended the 4:3:1:3:3:1 series consists of 4 diphtheria, tetanus toxoid, and acellular pertussis (dtap); 3 poliovirus (ipv); 1 measles, mumps, and rubella (mmr), 3 haemophilus influenzae type b (hib); 3 hepatitis b (hepb), and 1 varicella. records for these vaccines were reviewed for appropriate age and interval between doses, according to the 2007 acip immunization schedule. doses given too early or with insufficient spacing between doses to be considered valid were removed from the analysis. to ensure that records of encounters would be available to compare with immunizations at all of the milestone ages, children with limited enrollment or nonenrollment at key ages were excluded from the final analysis dataset. the study population was restricted to children enrolled in ohp within 30 days of birth, with a cumulative total of at least 365 days of enrollment by age 2, and continuous enrollment across the key period of 15 to 18 months, when the 4th dose of dtap is due. because ohp enrollment generally occurs in 12-month blocks, the majority of children meeting the above requirements were also continuously enrolled through their second birthday. children born outside oregon were excluded since possibly both early encounters and immunizations would not be reported to alert or ohp. children with only a birth dose of hepatitis b and no other vaccines in alert also were excluded. the ohp requires health plans and providers to submit detailed encounter records on enrolled children for all services received. for ohp-enrolled children, a subset of vaccination-eligible encounters was created from all encounters, based on a review of icd-9 and cpt coding in ohp encounter records. a vaccination-eligible encounter was defined as an encounter occurring in a nonemergent or noninpatient setting with a medical provider, and with either a cpt procedure code indicating that routine care or evaluation was performed, or an icd-9 diagnostic code indicating that the purpose of the encounter was consistent with routine care and immunization evaluation. these criteria were used to identify not only visits that providers would define as well-child visits, but also other visits during which immunizations could have been given, and include nonemergent sick visits. in a few cases, alert had a record of an immunization visit for which there was no matching ohp encounter record. this was usually found to reflect free vaccinations without administration fees at sites outside of those normally reporting to ohp, such as school clinics, and some public health departments. these visits were also counted as vaccination-eligible encounters. also if cpt codes for vaccine administration were found in ohp data without other evidence of a shot-eligible encounter, the definitions of milestone periods were taken from luman and chu, and reflect the dates at which recommended immunizations are first late according to the 2007 acip schedule. the milestone periods occur at the start of 3 months, 5 months, 7 months, 16 months, 19 months, and 24 months of age. immunization (utd) status at each milestone was evaluated for the timely receipt of all doses due in the 4:3:1:3:3:1 series by age 2. additionally children were categorized according to whether they had vaccination-eligible encounters in the period prior to each milestone. in cases in which a non-utd child at a milestone had multiple encounters in the prior period, and received vaccinations at some encounters and not at others, they were counted as having a vaccination visit. schematically, this classification is presented in table 1. at each milestone age, immunization status was compared with the immunization status at the previous milestone age to determine whether children had remained utd, remained non-utd, fallen behind due to a missed visit, fallen behind due to a missed opportunity, or caught up with the immunization schedule. children remained utd if they were utd at the prior milestone age and utd at the current milestone age. children remained non-utd if they were non-utd at the prior milestone age and non-utd at the current milestone age. children fell behind due to a missed visit if they were utd at the prior milestone age, non-utd at the current milestone age, and had no record of a valid healthcare visit or immunization record during the period in between. children fell behind due to a missed opportunity if they were utd at the prior milestone age, non-utd at the current milestone age, and had a vaccination-eligible healthcare visit during the period in between. children caught up if they were non-utd at the prior milestone age and utd at the current milestone age. an exception to the missed opportunity calculation is for the 16-month milestone, which includes the first mmr vaccine. the mmr is not valid before 12 months of age, so encounters between 7 months and 12 months were not counted as potential missed opportunities. as a check on the completeness of immunization visits represented by this merged dataset, a lincoln-peterson capture-recapture method was used to estimate the percentage of immunization visits for the study population not captured by the alert iis either by provider records or by ohp administrative records. the total number of immunization visits, both captured and uncaptured, was estimated by (1)n=[(a+1)(b+1)](ab1), where n is the total estimated number of visits, a is the number of visits captured by provider reports in alert, b is the number of visits captured by ohp billing and administrative reports, and ab is the number of visits captured in both by date. the principal assessment tool of this study is a time-based progression of young children across milestones and age-appropriate immunizations, presented in a novel form for easier depiction of change between milestones. the data by milestone are presented for whether children were complete on age-appropriate immunizations along with categories for catching up and falling behind by milestone, and by missed opportunities versus missed visits for non-utd children. finally, a comparison of age-appropriate milestone results is made to a summary utd measure for the 4:3:1:3:3:1 immunization series assessed at 24 to 35 months of age. of 20,411 children born in 2005 who were enrolled in the oregon health plan for some period of time, 13,199 met the requirements to be counted among the study population. the numbers of those excluded are listed in the order they were excluded and do not reflect the total prevalence of each criterion in the population; for example, of the 1,004 children excluded for being born out of oregon, the majority would also have been excluded for length of enrollment. the primary reason for exclusions from the study population is nonenrollment after 1 year of age, so that no encounter data would be reported to ohp. also 2% of the study population met all enrollment criteria except that they did not have any reported immunizations. the capture-recapture estimate of total immunization visits for the study population was 76,087. thus the dataset appears relatively complete for all immunization visits of the study population, with the combination of alert iis provider reports and ohp administrative data capturing 98.4% of estimated immunization visits among the study population. as shown in figure 1, only 32% of children had all acip recommended immunizations on time at all milestones, while 14% were not complete at only one milestone, 15% were not complete at 2 milestones, and 9% were not complete at any milestone. also 41% of children had vaccination-eligible encounters in all of the periods before each milestone, and 35% of children were missing encounters in only one of the periods before milestones. another 14% were missing encounters in 2 periods, and 10% were missing encounters in 3 or more periods. rates of completeness of age-appropriate immunizations per the acip schedule varied among the milestone ages, from a high of 82.4% at 3 months of age to a low of 52.5% at 19 months of age. for the final milestone at 24-months, no further vaccinations were due, and the final 24 month completion rate for the study population was 68.6%, with 16.1% catching up from the prior 19-month milestone. the pattern of completion, falling behind, and catching up by milestone period is presented in figure 2. while 17.6% of the study population had fallen behind by the 3-month milestone, representing a late start on immunizations, the most salient episode of falling behind occurred at the 5-month milestone, where 21.0% of children fell behind. in this analysis the 19-month milestone adds 4 antigens beyond the 16-month milestone, including the fourth dtap and varicella; and the risk of falling behind between these milestones is calculated from table 2 as (16.7/61.3)=27.2%. this is interpreted as, for those who are on schedule at 16 months, 27.2% will fall behind by 19 months. the largest total percentage of children without age-appropriate immunizations, 47.5%, also occurred at the 19-month milestone. overall, the percentages of children who were not complete by milestone from table 2 with missed opportunities was 68.5% at 3 months, 72.2% at 5 months, 71.7% at 7 months, 72.5% at 16 months, 58.4% at 19 months, and 60.0% at 24 months. another approach to interpreting the reasons for children falling behind is to further examine missed visits, missed opportunities, and vaccination visits at each milestone for those who were not complete. figure 3 describes how children who are not complete for age-appropriate immunizations at any milestone have either missed visits or missed opportunities, where missed opportunities are divided between provider encounters with no shots received versus encounters where some shots are received. the percentage of noncomplete children per milestone with provider encounters on which some shots were received (vaccination visits) ranged from a high of 50.8% prior to the 3-month milestone to a low of 15.2% before the 24-month milestone. the percentage of children with provider encounters and no shots, and without vaccination visits, in each period is a measure of the amount by which immunization-record-only data would misclassify missed opportunities as missed visits. this potential misclassified percentage of noncomplete children having vaccination-eligible encounters with no reported vaccinations ranged from a high of 44.8% at the 24-month milestone, to a low of 21.4% at the 5-month milestone. at the 3-month milestone, noncomplete children were evenly divided between those with no encounters on record during the period (31.4%), those with encounters but no vaccinations (34.1%), and those with encounters during which some vaccinations were given (34.5%). as a final analysis, the results by milestone for encounters and completeness were stratified by children's status on a summary utd measure for having all shots in a 4:3:1:3:3:1 series by age 24 to 35 months, and using a fixed date of assessment. overall 77.8% of the study population were utd by 24 to 35 months for the 4:3:1:3:3:1 series. the comparison across milestones for children who were utd of the children who were utd by the date of assessment, only 68% were complete for age-appropriate immunizations by the 19-month milestone, 72% were complete by the 16-month milestone, 67% were complete at the 7-month milestone, and 71% were complete at the 5-month milestone. the majority of those who were not complete at any milestone, with the exception of the 24-month milestone, also had encounters with providers on which some shots were given. figure 5 presents the same analysis across milestones for the 22.2% of the study population who were not utd for the 4:3:1:3:3:1 series at 24 to 35 months. children not utd at 2435 months were also not complete for age-appropriate immunizations at 19 and 24 months by definition of which shots were required at these milestones. overall in figure 5 the majority of non-utd children at 24 to 35 months who also were not complete at milestones had substantial volumes of encounters with providers. an analysis using only shot-record data, however, would reach, falsely, the conclusion that the majority of non-utd children were missing provider encounters at each milestone. the reality of children's immunizations in the present study population is a story of falling behind and catching up with recommended immunizations. what this study adds to the understanding of milestones and immunizations is a more accurate representation of how missed opportunities and missed visits contribute to children not being up-to-date for recommended vaccines. the present finding that for many children, periods of missed visits in immunization record data are actually periods of missed opportunities is a first in the analysis of larger, population-based data systems such as immunization registries. this finding should lead at least to caution in assigning reasons regarding why children are not up-to-date according to either state-level immunization registries or other immunization record data, including the national immunization survey. the importance of this is that the prevalence of either true missed visits or true missed opportunities should lead to different interventions to improve immunization rates. focusing on methods to improve rates of missed visits, such as reminder-recalls to parents of children who appear to have missing vaccinations and visits, may be of limited utility if the greater issue is that the parents have brought their children in to providers across milestones without receiving needed vaccinations. as a recommendation to correct this problem, immunization record data for at least a sample of covered children should be compared with encounter records from billing and administrative sources before considering appropriate immunization interventions. also, data collected from samples of provider records for immunization assessment should include basic information on all encounters, whether vaccinations were given or not. in this study, the majority of children who were not catching up at each milestone were having encounters with providers. these encounters were potentially ones in which missing vaccinations could be administered; however, converting these missed opportunities to vaccination visits may be difficult. provider reluctance to administer vaccinations during sick or other nonroutine visits is a known barrier to improving immunization rates, and may be difficult to change [1214]. the type of encounter may also be a barrier to receiving vaccinations in many clinics and healthcare providers; for example, in urgent care encounters, when limited time and a press of higher priority needs make it difficult to include review of records and delivery of vaccinations [1517]. while parental reluctance in such circumstances is likely a factor, at least one study has found that the barrier in such visits is more likely to be provider-based than parental. also, reimbursement levels may not be sufficient to encourage providers to expand immunizations outside of well-child visits. finally parents who bring their children in for sick visits or other encounters without immunizations may easily believe that their child has received all needed care, including immunizations. most parents of children who are not utd believe their child has received all needed immunizations and may not understand the difference between well-child and other types of encounters. solutions to this problem may lie in the redesign of early childhood care encounters within clinics and healthcare providers that are concerned about their immunization rates, to deemphasize urgent care or access to short, single-purpose visits in favor of longer appointments during which aspects of routine care such as immunizations are also reviewed. a strength of the present study is the combination of administrative data on all encounters with immunization records reported separately to the alert iis. this approach could potentially serve as a standard for the evaluation of immunizations given to health plan participants and public populations in areas that have strong immunization information systems such as alert. a similar approach by dombkowski et al. has previously demonstrated the utility of combining registry and medicaid data in michigan for assessing missed opportunities to vaccinate asthmatics against influenza. the potential for missed opportunities to be misclassified as missed visits when conducting milestone analysis solely from immunization record data without all encounters should lead to caution in interpreting the balance of responsibility between parents and providers for children not being up-to-date. also the present study does not address the extent to which parental reluctance to accept all age-appropriate immunizations may limit the ability of provider-based interventions to improve milestone immunization completeness. from the perspective of a state immunization program with concerns for improving immunization rates, the development of a roadmap showing where and how children are falling behind is invaluable for setting policy. while national measurements such as the nis can identify variations in rates between states, state-level programs have been left on their own to identify what in-state factors are affecting their rates. also because immunization levels are often taken as a measure for overall quality of care in early childhood, counting doses by age two is not as strong a proxy as is the checking of timely receipt of age-appropriate immunizations across the entire period from birth to age two. a risk of solely depending on immunization results at age two is that utd and non-utd status may be taken as discrete categories, irrespective of age-appropriate history. searching for explanatory factors for these two categories may be misleading for developing an understanding of where barriers exist and where interventions are needed. this is illustrated in the present study by the observation that only a minority of children were consistently on schedule at all milestone ages, and that the majority fell behind at one or more point in receiving immunizations. falling behind by milestone period is a more useful concept for intervention than final utd status. a useful model then is that most children are at great risk of falling behind at many points, and that their final status reflects the work that providers do to catch them up to standard. the concept of milestone ages and the charting of children's progress through the milestones, as advanced by luman and chu, provides such a roadmap for use by local programs. local variations in patterns of falling behind and catching up, however, argue for analyzing milestones with available local or state-level data to determine where problems are most salient. yet, while specific findings may differ, the present study confirms the utility of the milestone approach for a local population. the present study is representative only of a single state population, and of children enrolled through the oregon health plan. because children in the ohp are generally enrolled in the same health plans, with the same networks of providers and benefits, as privately insured children, their encounters are potentially similar to the wider state population. overall in 2007, the oip estimated that among all ohp-enrolled 2-year-olds, the utd rate for a 4:3:1:3:3:1 series was 75.2%, as compared to 72.9% among non-ohp-enrolled children. however, the present study population also reflects a group with stable, long-term enrollment in ohp. children with short-term enrollment or who disenrolled after age 1 are not represented and may have substantially different patterns of falling behind and catching up to recommended immunizations. also it is expected that individual health plans under the ohp are a significant factor in the receipt of age-appropriate immunizations; however, this information was not included in the present analysis dataset. another limitation on the present results is that the definition of encounters was deliberately set broadly, to reflect any encounters in which vaccinations could have been delivered as opposed to well-child visits, during which immunization screening should be routine. as such, the possibility of raising immunization rates by converting all missed opportunities here should be taken as an upper figure to what is possible. institutional, scheduling, reimbursement and parental acceptance are all potential factors on what proportion of encounters without vaccinations could incorporate immunization screening. also, encounters were not stratified by type of provider or principal reason for each encounter. while some research suggests that provider type is not a key factor for immunization performance when the volume of well-child visits is taken account, no provider information was included in the present study dataset to confirm or identify other relevant provider features. whether encounters without immunizations are due to children using a spectrum of different provider types, to parental reluctance, or are due to use of settings such as urgent care in place of scheduled well-child visits can not be determined from the data of this study. the milestone approach to evaluating early childhood immunizations provides a useful perspective for understanding the time-based progression of children through immunization periods. however, the results of this study warrant some caution in the use of immunization record data only in assessing failure to have age-appropriate immunizations because of the chance of misclassification of missed opportunities by providers as missed visits by parents. nevertheless, for local assessment by public agencies or health plans, and for the design of interventions to improve immunization rates, looking at the patterns by which children fall behind or catch up on immunizations at milestone periods is a valuable next step beyond the count of vaccine doses received by age two.

a challenge facing immunization registries is developing measures of childhood immunization coverage that contain more information for setting policy than present vaccine series up-to-date (utd) rates. this study combined milestone analysis with provider encounter data to determine when children either do not receive indicated immunizations during medical encounters or fail to visit providers. milestone analysis measures immunization status at key times between birth and age 2, when recommended immunizations first become late. the immunization status of a large population of children in the oregon alert immunization registry and in the oregon health plan was tracked across milestone ages. findings indicate that the majority of children went back and forth with regard to having complete age-appropriate immunizations over time. we also found that immunization utd rates when used alone are biased towards relating non-utd status to a lack of visits to providers, instead of to provider visits on which recommended immunizations are not given.

PMC2874993

pubmed-871

recent papers by and show the application of fractional calculus to pharmacokinetics (pk). leffler function: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ e_{\alpha} \left (z \right)=\sum\limits_{i=0}^{\infty} {{ \frac{{z^{i} }} {{ \upgamma \left ({ \alpha i+1} \right)} }}} $$ \end{document}in place of the mono-exponential:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ e^{z}=\sum\limits_{i=0}^{\infty} {{ \frac{{z^{i} }} {i !} }}=\sum\limits_{i=0}^{\infty} {{ \frac{{z^{i} }} {{ \upgamma \left ({ i+1} \right)} }}}=e_{1} \left (z \right) $$ \end{document}if drug is given as a bolus dose in a venous site, drug concentration in plasma at a time t after the dose administration, c(t), can be represented using a response function of the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c(t)=dose \, \left [{ \theta e_{\alpha} \left ({-\lambda t^{\alpha}} \right)} \right] $$ \end{document}where dose is the amount of drug given, and 1 have the interpretation of the elimination rate constant and the reciprocal of volume of distribution of the plasma compartment, respectively, if model (3) is seen as solution corresponding to a single compartment model described by a (caputo) fractional differential equation of order, see, e.g., [5, 6]. the paper of shows solutions for some specific two- and three-compartmental structures described by fractional order kinetics. however, as pointed out by, while the connection between response function and compartmental structure is immediate for the single compartment case, this is less so for the case of multi-compartmental ones. the purpose of this communication is to discuss this connection, and to do so we will (1) clarify the distinction between different types of systems of fractional differential equations, in particular discussing the difference between commensurable and non-commensurable ones, (2) show solutions for the corresponding response functions, and (3) discuss their application to the modeling of pk data. commensurate fractional order linear systems are described by a system of linear fractional differential equations (fde) of the form: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\frac{{d_{\blacktriangle} ^{{^{\alpha} }} }} {{ {\text{d}}t}}}{\mathbf{x}}(t)=\left ({ \begin{array}{*{20}c} {{ \frac{{d_{\blacktriangle} ^{{^{\alpha} }} }} {{ {\text{d}}t}}}x_{1} (t)} \\ \ldots \\ {{ \frac{{d_{\blacktriangle} ^{{^{\alpha} }} }} {{ {\text{d}}t}}}x_{m} (t)} \\ \end{array}} \right)=\left ({ \begin{array}{*{20}c} {a_{11}}&\ldots&{a_{1 m}} \\ \ldots&\ldots&\ldots \\ {a_{m1}}&\ldots&{a_{mm}} \\ \end{array}} \right){\mathbf{x}}(t)+{\mathbf{f}}(t)=a{\mathbf{x}}(t)+{\mathbf{f}}(t) $$ \end{document}with initial conditions\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\mathbf{x}}(0)={\mathbf{x}}_{0} $$ \end{document }, where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ d_{\blacktriangle} ^{{^{\alpha} }} $$ \end{document} is the caputo fractional differential operator of order >0, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\mathbf{f}}(t) $$ \end{document}is the (vector valued) input function to the system. these systems are called commensurate because all the differential equations are of the same fractional order ,. as a consequence t can be shown that the solution to the system of fde represents the entire state of the system at any given time. in particular, a compartmental system can be obtained, for 0< 1, exactly as for a system of ode, by introducing mass-balance constrains:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ a_{ji} \ge 0,\quad i \ne j $$ \end{document}and the following:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {\text{a}}_{ii} \le 0 \\ \left| {{ \text{a}}_{ii}} \right|\ge \sum\limits_{\begin{array}{l} j=1 \\ j \ne i\end{array}} ^{m} {a_{ji}} \hfill \\ \end{array} $$ \end{document}which guarantee that all states are non-negative. it can be shown (see e.g.) that the solutions to the system of linear fde (4) depend on the eigenvalues of its characteristic equation, that is, in the laplace domain, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \det \left ({ b(s)=a(s)-si} \right) $$ \end{document}. in particular if the eigenvalues are real and distinct the solution to eq. 4 takes the form1:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\mathbf{x}}(t)=b_{1} {\mathbf{u}}_{1}^{(1)} e_{\alpha} (\lambda_{1} t^{\alpha })+b_{2} {\mathbf{u}}_{2}^{(2)} e_{\alpha} (\lambda_{1} t^{\alpha })+\cdots+b_{m} {\mathbf{u}}_{m}^{(m)} e_{\alpha} (\lambda_{1} t^{\alpha }) $$ \end{document}where b1, b2,, bm are constants, 1, 2,, m and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\mathbf{u}}_{1}^{(1) }, {\mathbf{u}}_{2}^{(2) }, \ldots, {\mathbf{u}}_{m}^{(m)} $$ \end{document} are the eigenvalues and eigenvectors of the characteristic equation for (4). it is immediate from (7) that for a bolus input in the j-th compartment the solution for drug concentration in the same compartment takes the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c_{j} (t)=dose\left [{ \theta_{1} e_{\alpha} (\lambda_{1} t^{\alpha })+\theta_{2} e_{\alpha} (\lambda_{2} t^{\alpha })+\cdots+\theta_{m} e_{\alpha} (\lambda_{m} t^{\alpha })} \right] $$ \end{document}which establishes a direct connection with the familiar multi-exponential response function corresponding to ordinary multi-compartment linear systems with distinct eigenvalues. a non-commensurate fractional order linear system is described by: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \left ({ \begin{array}{*{20}c} {{ \frac{{d_{\blacktriangle} ^{{^{{\alpha_{1} }} }} }} {{ {\text{d}}t}}}x_{1} (t)} \\ \ldots \\ {{ \frac{{d_{\blacktriangle} ^{{^{{\alpha_{m} }} }} }} {{ {\text{d}}t}}}x_{m} (t)} \\ \end{array}} \right)=a{\mathbf{x}}(t)+{\mathbf{f}}(t) $$ \end{document}where now 1, 2,, m are distinct (real positive) numbers indicating the fractional order for each equation. as remarked by, in reference to the systems of compartments shown in (2), the equations in do not satisfy mass-balance even if conditions (5) are satisfied, and in general the solution to the system of fde (9) does not represent the states of the system. non-negativity is also no longer guaranteed by the relationships (6) (and there are non-trivial issues associated with demonstrating the stability, observability and reach-ability of such systems, see.) numerical methods must be employed to find the solution to (9), since a close form solution equivalent to (7) does not exist [10, 11]. however, solutions can be obtained if is assumed that the fractional orders are rational numbers, that is i=pi/qi where pi, qi are integers, i=1,, m (12).2 the mathematics necessary to obtain the general solution are quite involved, and for the purpose of this paper we only show a subset of the possible solutions, in particular for c(t) (see [1113] for more general results). for a non-commensurate system, it can be shown that a solution for drug concentration in the j-th compartment takes the form:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c_{j} (t)=dose\left\ {{ t^{{\gamma-\alpha_{j} }} \left [{ \theta_{1} e_{{\gamma, \gamma-\alpha_{j}+1}} (\lambda_{1} t^{\gamma })+\theta_{2} e_{{\gamma, \gamma-\alpha_{j}+1}} (\lambda_{2} t^{\gamma })+\cdots+\theta_{m} e_{{\gamma, \gamma-\alpha_{j}+1}} (\lambda_{m} t^{\gamma })} \right]} \right\} $$ \end{document}where =1/q, q=m.c.d(q1,, qm), and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ e_{\alpha, \beta} \left (z \right)=\sum\limits_{i=0}^{\infty} {{ \frac{{z^{i} }} {{ \upgamma \left ({ \alpha i+\beta} \right)} }}} $$ \end{document} is the two-parameters mittag leffler function (5). one notices two important facts: first, this solution only depends on the fractional order for compartment j, j, and, second in direct analogy to the solution (8) above, the mittag leffler function exponents are determined by the eigenvalues of the characteristic equation for the system. we now have the ingredients to show a simple example of applications of multi-terms mittag leffler response functions to fit pk data. we consider the case m=2, which for a standard ode system generates the response function:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c(t)=dose\left ({ \theta_{1} e^{{\lambda_{1} t}}+\theta_{2} e^{{\lambda_{2} t} }} \right) $$ \end{document}for a commensurate fde system obtains:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c(t)=dose\left ({ \theta_{1} e_{\alpha} (\lambda_{1} t^{\alpha })+\theta_{2} e_{\alpha} (\lambda_{2} t^{\alpha })} \right) $$ \end{document}and for a non-commensurate fde system\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ c(t)=dose \, t^{\gamma-\alpha} \left ({ \theta_{1} e_{\gamma, \gamma-\alpha+1} (\lambda_{1} t^{\gamma })+\theta_{2} e_{\gamma, \gamma-\alpha+1} (\lambda_{2} t^{\gamma })} \right) $$ \end{document}the parameters 1, 2, 1, 2,, are estimated from the data, with the constraints 1, 2>0, 1, 2<0, and 0 <, 1, which guarantee that eq. 13 is non-negative and non-increasing (strictly monotone) for t 0.3 to evaluate the single and two-parameters mittag leffler function we implemented a fortran 90 version the algorithm reported in. we used the computer program nonmem to obtain the parameters estimates. as a check, fig. 11 of, =1 and 0< 2. contrary to, which has a strong influence on the overall shape of the curve, the parameter has its most pronounced influence on the value of the function at t=0. fig. 1the mittag leffler function e,(t) for =1 and (0, 2) the mittag leffler function e,(t) for =1 and (0, 2) figure 2 shows the fit of models (11) (solid line), (12) (widely dashed line), and (13) (dashed line), to error corrupted data simulated using an eight compartments mammillary model. note the added flexibility introduced by use of a sum of single- and two-parameters mittag leffler functions in respect to exponentials: the values of minus twice log-likelihood for the fit of the simulated data were 316.895, 381.974, and 406.354, for models (11)(13), respectively. of course, this is just an example to show the feasibility of the approach: for this simulation, a sum of exponentials would fit the simulated data perfectly well. fig. 2simulated data (circles) with superimposed the fit of the response function for a second order ordinary system, eq. 11 in the text (solid line), commensurate fde, eq. 12 (widely dashed line), and non-commensurate fde, eq. 13 (dashed line) simulated data (circles) with superimposed the fit of the response function for a second order ordinary system, eq. 11 in the text (solid line), commensurate fde, eq. 12 (widely dashed line), and non-commensurate fde, eq. 13 (dashed line) following up on the papers of and, and the commentary by, the first purpose of this commentary is to further clarify the nature of systems of fde, and in particular to point out the distinction between commensurate and non-commensurate ones. commensurate systems of fde have a direct relationship with system of ode, and in particular when formulated in terms of compartmental models (that is, satisfying mass balance and non-negativity constraints, see eqs. 5, non-commensurate systems of fde do not, in general, represent the state of a system. leaving to the side the issue of what exactly system (9) represents, one is still justified in using it as a black-box type model for single-input/single-output experiments, as long as physical constraints (non-negativity in particular) are satisfied. to do so response functions are a convenient tool, and we show that, for commensurate and non-commensurate fde, relatively simple ones can be derived which satisfy such requirements. the solutions for a system of commensurate fde takes the form of the sum of mittag leffler functions, with a single parameter, eq. 8, while solutions for a system of non-commensurate fde can be expressed by a sum of two-parameters mittag leffler functions, such as eq., one can establish a direct analogy between the familiar sum of exponentials used in pk, and importantly all the relationships between compartmental transfer rate constants and the intercepts and exponents of the corresponding response functions found in classic textbooks on pk [17, 18], carry forward to fractional differential equations. in conclusion, while insight into the physiological interpretability of fde system might be gained in the future, and the formulation of non-commensurate systems of fde to represent the states of a system (required by, e.g., a physiological flow model) requires further investigation, the response functions (8) and (10) can be used to investigate the existence of pk data sets which might actually show complex fractional kinetics.4

systems of fractional differential equations (sfde) have been increasingly used to represent physical and control system, and have been recently proposed for use in pharmacokinetics (pk) by (j pharmacokinet pharmacodyn 36:165178, 2009) and (j phamacokinet pharmacodyn, 2010). we contribute to the development of a theory for the use of sfde in pk by, first, further clarifying the nature of systems of fde, and in particular point out the distinction and properties of commensurate versus non-commensurate ones. the second purpose is to show that for both types of systems, relatively simple response functions can be derived which satisfy the requirements to represent single-input/single-output pk experiments. the response functions are composed of sums of single- (for commensurate) or two-parameters (for non-commensurate) mittag leffler functions, and establish a direct correspondence with the familiar sums of exponentials used in pk.

PMC2861176

pubmed-872

systemic lupus erythematosus (sle) is an autoimmune disease that is typified by multiple abnormalities of the immune system, and which results in widespread pathology of multiple organs, including skin, kidney, heart, lungs, and joints. in addition to peripheral organ dysfunction in sle, there is a high incidence of neuropsychiatric symptoms especially headaches, cognitive dysfunction, and psychiatric disorders, with roughly 4070% of sle patients demonstrating affective disorders. brain pathology, loss of integrity of the blood-brain barrier and autoantibodies are thought to play a role in neuropsychiatric systemic lupus erythematosus (np-sle), although some patients with behavioral symptoms have histologically normal brain tissue and no identifiable markers in serum or csf [311]. neuropsychiatric symptoms, particularly affective disorders, may be among some of the earliest manifestations of sle [1214]. approximately 40% of the np-sle symptoms develop before the onset of sle or at the time of diagnosis and about 60% within the first year of diagnosis [13, 15, 16], indicating that neuropsychiatric symptoms are reliable indicators of disease activity and are often evident even before gross peripheral organ pathology occurs (in particular kidney disease). symptoms of np-sle may also be independent of active disease in other organs [1719]. this was found to be the case also in the animal model of lupus which is the subject of this paper, the mrl/lpr mouse, where depressive-like behavior is evident in young animals before significant levels of autoantibody titers and nephritis are evident [14, 20]. there are obvious limits to the search for mechanisms of cns disease in human patients, and furthermore the diagnosis is often made after lupus is in late stages of progression. thus, murine models can offer many advantages to elucidate the early mechanisms of neuropsychiatric manifestations of np-sle and help to distinguish between cns-specific mechanisms and nonspecific illness. in this paper we focus on a specific murine model of lupus, the mrl/lpr strain, and the ways in which this model reflects some of the most common manifestations of human np-sle. in addition, we discuss experimental data pointing to viable pathogenic mechanisms that underlie cns involvement in sle. excellent reviews about other aspects of this and other murine models of lupus can be found elsewhere [3, 11, 2134]. to best represent human disease and explore relevant translational aspects of pathogenesis and novel treatment approaches, it is crucial to identify the most appropriate animal model from among the several available mouse strains which spontaneously develop lupus-like disease. although there are induced models of sle in nonautoimmune mouse strains, organ involvement as a rule is less severe than that observed in genetically susceptible animals [35, 36]. therefore, spontaneous lupus models are often preferred for modeling of lupus-associated neuropsychiatric or other target organ disease. murine models that spontaneously develop hallmark diagnostic signs of sle include nzb nzw f1, nzm2410, bxsb, and mrl/lpr mouse strains. all of these strains (to a varying degree) develop lymphoid hyperplasia, b cell hyperactivity, autoantibodies, circulating immune complexes, complement consumption, and glomerulonephritis. these strains differ from human sle in that they display a high penetrance and relatively uniform disease expression over time. however, the disease course in murine lupus models (in the absence of extraneous intervention) is progressive, in contrast to the fluctuating course of flares and remissions typical in human sle [26, 27, 37]. although many of the spontaneous models of sle develop behavioral abnormalities at some point in the disease, the mrl mouse model has some advantages in the investigation of specific cns dysfunction and np-sle. first, nzb- and bxsb-derived strains of mice have a high incidence of inherited brain anomalies which can confound the assessment of autoimmunity-induced brain damage and the links between lupus-like disease and behavioral changes. thus the mrl/lpr model permits the examination of interrelationships between behavioral outcomes and their underlying mechanisms without the potential confound of pre-existing cns abnormalities [3840]. as human sle is overwhelmingly more common in females (about a 9: 1 female to male ratio), mouse models that reflect this sex bias, such as mrl/lpr, are also likely to be useful in elucidating the relationship of hormones, negative outcomes, and potential sex-differences in efficacy of therapeutic agents in autoimmune disease. mrl/lpr mice also express cardiolipin autoantibodies, one of a class of antiphospholipid autoantibodies thought to be important in the development of behavioral outcomes and cns damage [4345]. although the molecular defect in the fas gene underlying abnormal b cell regulation in mrl/lpr mice is not believed to be a cause for human sle [46, 47], it is clear that the b cell dysregulation that characterizes this murine model is also a critical pathological aspect of human sle [48, 49]. moreover, the early onset, rapid progression, and other similarities to the human disease state in mrl/lpr mice are also useful features of this model. the mrl lymphoproliferation strain (lpr) mrl/tnfrsf6 lpr/lpr (a.k.a. mrl/lpr) differs from the congenic (control) mrl/+ strain by a defect in membrane apoptotic-signaling fas protein, which is due to a retrotransposon in the fas gene [50, 51]. in addition to the typical signs of peripheral sle, including autoantibodies, skin disease, arthritis, lymphadenopathy, and nephritis, mrl/lpr mice develop a constellation of behavioral outcomes referred to as autoimmunity-associated behavioral syndrome, particularly in the behavioral domains of emotional reactivity, motivated behavior, and cognitive function [14, 20, 22, 24, 33, 5275]. nervous system involvement in lupus can include seizures, stroke and other cerebrovascular events, psychosis, cognitive dysfunction, and notably a very high incidence of mood disorders, particularly anxiety and depression [2, 18, 7678]. estimations of the prevalence of np-sle in human lupus range from 15% to 75% (or higher), reflecting variable diagnostic methodologies, a lack of standard criteria, and the sensitivity of diagnostic instruments to assess various behavioral outcomes [1, 2, 79]. furthermore, many clinical studies of np-sle address only the most severe cns symptoms, such as seizure, psychosis, and stroke, thus both the prevalence and importance of other neuropsychiatric symptoms are often underestimated. generally, when specific and well-validated cognitive and affective diagnostic batteries are administered, rather than simple quality of life exams, studies consistently indicate that a great majority of sle patients have some cns outcomes, particularly mood disorders and cognitive dysfunction. np-sle is a major determinant of morbidity and mortality and is associated with increased disease severity, poorer prognosis and earlier mortality [8085]. furthermore, np-sle can necessitate potent and long-term immunosuppressive treatment with attendant side effects, is a detriment to quality of life in lupus patients, may be a major factor in employment disability, and substantially increases the financial and emotional costs of sle [86, 87]. comprehensive reviews of np-sle manifestations, diagnosis, pathology, and treatment in humans are outside the scope of the paper, and can be found elsewhere [2, 4, 9, 8894]. as in humans, development of sle in mrl/lpr mice the most robust and reproducible deficits in mrl/lpr mice are emotional dysfunction, particularly in assays of depressive-like behavior such as the forced swim test and anhedonia. the forced swim test [95, 96] assesses behavioral despair as the proportion of immobility when rodents are placed in a tank of water [97, 98]. normal rodents placed in a narrow tank of water from which there is no escape will exhibit vigorous swimming and struggling activity for the duration of the test (typically 612 minutes) and only rarely adopt a characteristic immobile posture (floating). in contrast, animals treated with either pharmacological agents (such as hormones or via depletion of the amino acid tryptophan necessary to make serotonin [99, 100]), environmental manipulations (unpredictable chronic stress, social isolation [101103]), or genetic alterations (flinders strain, sert knockouts [104, 105 ]) thought to be important in the etiology of depression more rapidly become immobile and maintain this immobility for a significantly great proportion of time than control subjects. the forced swim test has been extensively validated, as immobility is reduced by a wide range of clinically active antidepressant drugs and has predicted the antidepressant efficacy of novel therapeutic agents. mrl/lpr mice develop depression-like behavior in the forced swim test as early as 5 weeks old, and this persists throughout the course of the disease [14, 20, 58, 65]. in addition to feelings of helplessness and despair, depressed patients report anhedonia the inability to experience pleasure or reward from events that normally have a positive hedonic value, such as eating, social interaction, or sexual activity. in rodents, a commonly used measure of anhedonia is the failure to prefer sweet solutions [107, 108]. mrl/lpr mice exhibit this lack of normal preference for sweet solutions as early as 5-6 weeks old and continue to exhibit anhedonia during the active disease phase (4-5 months old) [52, 53, 55, 109]. further symptoms of depression-like behavior include decreased activity, fatigue, and apathy. in rodents, this can be assessed as decreased voluntary activity and exploration in a novel environment, such as an open field. mrl/lpr mice exhibit reduced exploration and activity during both the nocturnal and diurnal phases [63, 65] by 811 weeks old [14, 33]. despite the high prevalence of depression in lupus patients and recent evidence that antidepressants may reduce symptoms of depression, in part, by reducing inflammatory responses [111, 112], there have been few studies investigating the efficacy of antidepressant therapies in human lupus or in murine models. immunosuppressive agents typically used to treat sle, such as cyclophosphamide and steroids, do reduce measures of depression-like behavior in mrl/lpr mice [33, 55, 59, 114] and also typically reduce the other hallmarks of sle, including autoantibody titers, proteinuria (nephritis), and the levels of proinflammatory cytokines [55, 59]. however, there have been few systematic studies to determine if these are effective at reducing measures of np-sle, especially cognitive and affective dysfunction, in humans. several studies indicate that high levels of both affective and cognitive disorders are present and persistent in np-sle patients undergoing such therapies [115, 116], though these traditional immunosuppressive agents do seem to be effective to prevent and/or treat the more severe np-sle outcomes, such as seizure and cerebrovascular events [13, 117, 118]. anxiety disorders are also common in np-sle [1, 119] and are often comorbid with depressive disorders. several commonly used methods can be applied to assess anxiety in rodents, and these include the elevated plus maze and the acoustic startle test [120127]. the elevated plus maze (epm) essentially assesses a preference between a comparatively safe environment (the closed arms) and a risky environment (elevated open spaces). the general principle is that the more anxious the subjects are, the less likely they will be to explore the open arms. the epm has been validated pharmacologically, with other tests of anxiety-like behaviors, and physiologically [120123]. with respect to anxiety in murine models of lupus, some groups have reported increased anxiety in mrl/lpr mice assessed in the elevated plus maze, while others have reported that mrl/lpr mice have normal or less anxiety than mrl/+ controls [14, 20, 70]. the lack of anxiety phenotype is also supported by a generally lower startle reactivity till 11 weeks old. there is also no clear consensus with respect to cognitive dysfunction in murine models of lupus. mild spatial memory deficits have been reported in the water maze, assessed as the latency to find a new platform position after previous training in the water maze and as deficits in linear maze acquisition as early as 8 weeks. however, behavior in the object placement and novel object recognition tasks [128130] is normal [14, 20]. the predominance and reproducibility of affective dysfunction in mrl/lpr mice are consistent with known pathology and/or dysfunction in several neurotransmitter systems and brain regions important in the regulation of mood. these include altered responses to the dopaminergic drugs amphetamine and apomorphine [52, 109, 132] and higher levels of apoptosis in the dopaminergic neurons in the nucleus accumbens and substantia nigra (thought to be involved in response to reward and anhedonia) in mrl/lpr mice [52, 109]. there are also decreased levels of serotonin in brain regions such as the hypothalamus, which regulate stress and response to appetitive stimuli (among other things), and increased levels in the hippocampus. this observation is consistent with altered serotonin levels in lupus patients similar to those that occur in depressed patients [134136], including those in which depression has been induced by cytokine therapy [137139]. decreased levels of noradrenaline evident in the prefrontal cortex of mrl/lpr mice would also be consistent with depressive-like behavior [58, 140142]. there is also a fascinating accidental experimental difference in mrl/lpr mice. over time, this strain of mice displayed a lessening of symptoms such as lymphoproliferation, a greatly delayed development of nephritis, and a longer lifespan. the line was eventually reconstituted and again manifests rapid development of the typical severe autoimmune profile (http://jaxmice.jax.org/: re-coding of stock #485-attenuated disease to stock #6825-reconstituted severe line). this serendipitous circumstance permits the differentiation between negative behavioral outcomes that may result from gross peripheral pathology and specific cns-mediated behaviors [14, 143]. a major difference in the disease-attenuated line is the long delay to develop renal disease and profoundly decreased proteinuria [14, 20]. the levels of autoantibodies tend to increase earlier and to a greater extent in the reconstituted severe line. furthermore, the disease-attenuated line has normal open field activity from 8 to 18 weeks while in the reconstituted severe line, the females have lower activity levels from 5 weeks, although mrl/lpr males exhibit normal open field activity until at least 18 weeks old [14, 20]. cognitive functions assessed in novel object exploration and placement tasks were normal in mice 518 weeks old in both sexes and both lines [14, 20]. motor coordination in the balance beam and anxiety in the elevated plus maze were also comparable in both lines from 5 to 18 weeks old [14, 20]. interestingly, there was no evidence of social withdrawal assessed in the social preference test in either line from 5 to 18 weeks compared to age- and sex-matched controls [14, 20]. however these results were likely due to the very low social preference evident in both mrl/+ female controls and female mrl/lpr mice. it is thus not clear if social withdrawal, a typical symptom of affective disorders, is evident in the mrl/lpr females due to sle or if there is some influence of the background strain that induces social withdrawal by some other route in females. depression-like behavior is robustly evident in disease-attenuated line in the forced swim test by 8 weeks and in reconstituted severe line by 5 weeks, although earlier time points were not tested in the disease-attenuated line. given that there is no evidence of kidney pathology in the disease-attenuated mice, these data confirm the robustness of emotional dysfunction and provide further support that such outcomes are likely a primary manifestation of autoimmunity rather than arising from nonspecific illness and peripheral organ pathology. finally, the presence of two mrl/lpr strains that share a mutated fas yet which differ in their autoantibody profile and neurobehavioral manifestations [14, 143] is strong evidence that the cns manifestations in these mice are primarily immunologically mediated, rather than resulting from possible effects of abnormal fas-mediated apoptosis on brain development or glial function. these include b cell/autoantibody-mediated nervous system compromise, immune complex deposition, vasculitis, microthrombosis and vasculopathy, aberrant mhc class ii antigen expression with t-cell mediated disease, autoactivated t-cells, and cytokine-induced brain inflammation [145, 146]. however, as there are multiple and quite disparate expressions of lupus involving the nervous system, it is unlikely that a single mechanism can account for every clinical manifestation of np-sle. as the most common behavioral manifestations of np-sle in both patients and murine models are affective and cognitive disorders, especially in the early stages of sle, we focus on below mechanisms thought to be involved in the etiology of affective and cognitive dysfunction. mrl/lpr mice express a range of autoantibodies including antinucleosome, antiribosomal antiphospholipid, and phosphoprotein (such as anticardiolipin and antinucleolin) autoantibodies. a critical role of autoantibodies in the etiology of lupus-associated nephritis has been well documented. nephritogenic lupus autoantibodies initiate immune deposit formation through direct or indirect interaction with glomerular antigens [152, 153] and result in kidney pathology that can be prevented by administration of an immunoglobulin-binding peptide [151, 154]. it has been suggested that autoantibodies reacting with brain antigens may similarly play a role in cns pathology and negative behavioral outcomes in np-sle [90, 155]. evidence supporting the role of autoantibodies in the pathogenesis of np-sle includes the increased titer of autoantibodies in serum of diseased mrl/lpr mice [156158], which occurs earlier in females [156, 159], consistent with the earlier onset of depressive-like behavior in mrl/lpr females. there is also evidence that some of these serum autoantibodies react with brain antigens [160, 161] and occur in serum of as early as 2-3 months old in mrl/lpr mice and in csf as early as 4-5 months. nevertheless, as further discussed below, the fact that behavioral deficits are present before major rises in serum autoantibody titers or detectable breaches in the blood-brain barrier indicates that serum antibodies alone are clearly not the sole important pathogenic factor in np-sle, at least early in the disease. the relationship of serum and csf levels of autoantibodies to the disease process is complex, but it is likely that intrathecal autoantibodies are likely to be more critically related to np-sle than are serum autoantibody titers. some evidence does suggest a role for serum autoantibody levels in np-sle, as mice with more severe peripheral and behavioral manifestations of sle also have more pronounced changes in hippocampal and cortical morphology and increased indices of cell death [163166]. this can be prevented with doses of cyclophosphamide that reduce serum autoantibody titers, although csf levels of autoantibodies were not assessed. however, igg levels in serum, but not csf, are positively correlated with spleen weight, suggesting that central autoimmune processes are relatively independent from systemic manifestations. this is supported by the fact that the patterns of autoantibody expression in serum and csf is not correlated over time in patients with np-sle. finally, csf from diseased mrl/lpr mice which was treated to remove cytokines is cytotoxic to cultured cells [71, 169] and was more cytotoxic than serum derived from diseased animals, indicating a primary intrathecal source of cytotoxic autoantibodies. cytotoxicity in culture was correlated with the extent of apoptosis in the brains of aged lpr mice from which the csf was derived, thus toxic mediators produced by the cns of diseased mrl/lpr mice are likely to be more pathogenic than those in serum the site of production of brain reactive antibodies in mrl-lpr mice is however not conclusively identified, although this remains a subject of intense research interest. autoantibodies recognizing brain antigens, such as the nmda receptor subtype of the excitatory neurotransmitter, glutamate, are also present in the serum and csf of patients with np-sle [168, 170]. when injected directly into the brain of otherwise healthy mice, or when injected peripherally to animals with a compromised blood-brain barrier, in addition, intrathecal administration of antiribosomal p antibodies induces depression-like behavior in the forced swim test. there have also been reports of positive correlations between serum levels of brain reactive autoantibodies and cognitive dysfunction and depression-like behavior [90, 155, 175] although other studies have failed to find such relationships [61, 161, 176] in patients with np-sle. it has thus been suggested that csf levels of brain-reactive autoantibodies may be more important factors than serum titers to the genesis of np-sle pathology and symptoms [90, 177]. these data further support the notion that cns-derived specific factors and possibly intrathecal production of autoantibodies can lead to brain pathology and corresponding negative behavioral outcomes [52, 162, 169]. however, the blood-brain barrier restricts the influx of circulating factors, including lymphocytes and antibodies, from entering the brain and cerebral circulation. generally, influx of antibodies or lymphocytes requires disintegration of the blood-brain barrier as general or localized lesions. there is no convincing evidence to date that this occurs as early as the earliest manifestations of the negative behavioral outcomes. therefore, while it is probable that the loss of integrity of the blood-brain barrier eventually occurs and obviously plays role in the resulting cns pathology [9, 178181], possibly in part by permitting the entry of autoantibodies and antibody-producing cells, negative behavioral outcomes might rather be initiated by different mechanisms than those that regulate pathology in peripheral organs and later onset, more severe symptoms of np-sle. thus, autoantibodies are possibly not the sole or primarily etiology of several of the symptoms of np-sle, especially given the notable role of cytokines and chemokines in affective and cognitive disorders [182186]. indeed, several lines of evidence suggest that autoantibodies may not be sufficient to induce np-sle in the mrl/lpr strain. first, increased secretion of chemokines and cytokines (such as interferons) cause inflammatory pathology in kidney [187, 188], even in the absence of autoantibody deposits. furthermore, the high proinflammatory cytokine levels in mrl/lpr mice are progressive and correlated with increasing disease severity. in fact, numerous anti-inflammatory agents with a wide variety of underlying mechanisms of action increase survival, reduce peripheral organ pathology, and normalize t-cell phenotypes in mice without altering the level of autoantibodies [192197]. however, neuropsychiatric symptoms have not been systematically assessed in most of these studies so it is not clear if there are also similar benefits to behavioral outcomes. further evidence suggesting that autoantibodies are not sufficient to produce np-sle includes the fact that dna-binding antibodies derived from autoimmune mrl mice fail to induce sle-like changes when administered to healthy animals. actually, all strains of mice thus far tested show some brain reactive autoantibodies in serum even in the absence of abnormal behavior. last, mrl/lpr mice that express a mutant transgene that prevents the secretion of circulating igg still develop nephritis despite the lack of soluble autoantibody production, indicating that circulating autoantibodies are neither requisite nor sufficient to induce pathology. thus, serum antibodies could be neurotoxic, but they can only access brain tissue after a compromise of blood-brain barrier integrity. furthermore, insults to the blood-brain barrier are likely to be regional rather than global and may occur later in the disease than the onset of robust emotional disturbances. so if brain-reactive autoantibodies are not engendering such symptoms early in np-sle, then what is? cytokines and chemokines are likely to be critical early factors regulating the negative behavioral outcomes, as they need not pass the blood-brain barrier to regulate neural function [57, 183, 201]. detection of increased secretion of peripheral inflammatory cytokines can occur across an intact blood-brain barrier, in part via the vagus nerve. this induces glia and microglia to produce cytokines and other inflammatory and cytotoxic agents (including prostaglandins and nitric oxide). these are well documented to elicit the physiological and behavioral symptoms of mood disorders, including lethargy, decreased social interaction, immobility in the forced swim test, and anhedonia [183, 184, 202204]. finally, cytokines have been linked to depression in humans [205213] and to neuropsychiatric symptoms in np-sle patients [8, 12, 170, 185, 214, 215]. the role of cytokines in emotional disturbances in mrl/lpr mice is supported by numerous studies. in very large samples, the severity of behavioral deficits in mrl/lpr mice does not relate strictly to autoantibody titers or brain infiltration by t cells, which would indicate a compromised blood-brain barrier. cytokine, chemokine, and prostaglandin dysregulation occurs as early as 14 weeks in mrl/lpr mice, well before disease onset and upregulation of autoantibodies [26, 30, 216223]. clinically, cytokine-mediated depression has certainly resulted from cytokine administration when used as treatments in cancer and viral infections [224228]. increased levels of il-6 and other cytokines have been found in the cerebrospinal fluid and brains of patients with np-sle. in mrl/lpr mice, treatment with anti-inflammatory cytokines reduces disease severity [189, 230237] while administration of proinflammatory cytokines accelerates glomerulonephritis, vasculitis, and other disease manifestations [231, 233]. mrl/lpr mice lacking the il-6 receptor have delayed mortality and nephritis and a reduction of autoantibody complex deposition, though these mice have not been behaviorally tested, so the affect on symptoms of np-sle is not known. the early dysregulation of cytokine production, especially tnf-alpha, il-1, il-2, and il-6 [188, 223, 239, 240], corresponds to the onset of symptoms of depressive-like behavior, such as anhedonia and behavioral despair in mrl/lpr mice and in other rodent strains [241, 242]. anhedonia can be ameliorated by cyclophosphamide, which abolishes the typically early and significant rise of cytokines, particularly il-6. notably, anhedonia and other behavioral indices of depressive-like behavior in mice can be replicated by exogenous il-6 and are prevented by knockout of the il-6 receptor. other proinflammatory immunomodulators, such as tnf-alpha, also increase behavioral indices of depressive-like behavior in mice while blocking their secretion or receptors decreases depressive-like behavior [242, 243]. high levels of proinflammatory cytokines may also impair the function of the blood-brain barrier [244, 245] and may thus be permissive to the negative effects of autoantibodies and lymphocytes. finally, cytokine dysregulation is a shared characteristic of murine lupus models with different underlying genetic mechanisms. thus, while recent and substantial evidence indicates a role for cytokines in the early mechanisms of np-sle, several obstacles have prevented the further studies needed to elucidate the specific underlying etiology. first, it is important to recognize that local alterations in brain cytokine levels that can be very relevant to np-sle pathogenesis may be present early in the disease course, yet these may not necessarily be reflected in abnormal serum levels. second, there are numerous cytokines, and it is a gross oversimplification to assume that an individual cytokine is pro- or anti-inflammatory. rather, the precise proportions of cytokine levels in serum and brain are likely to be more important than absolute levels of a single cytokine. furthermore, cytokines are necessary for normal brain development and cognitive function [247250], and thus global knock-outs of specific cytokine receptors can be problematic, as these can cause cognitive, reproductive, and other deficits [248, 251] and also require large breeding colonies to achieve appropriate genotypes. more precise timing of cytokine receptor knockdown can be accomplished by viral vectors, but these are also less than ideal in studies of sle as they are thought to induce immune responses. moreover, females with autoimmune disease have a higher risk of psychiatric disorders, particularly depression. disease severity and rate of progression are also accelerated in female mrl/lpr mice as compared to males of this strain. serum autoantibodies appear earlier in female mrl/lpr mice [14, 156]. female mrl/lpr mice also have higher levels of igg in the csf compared to males. symptoms of depressive-like behavior are also worse in female mrl/lpr mice. one possible mediator of sex differences in the prevalence and outcomes of sle is sex steroid hormones, such as estrogens [254263]. administration of exogenous estrogens can induce a lupus-like syndrome in otherwise healthy mice and exacerbate symptoms in mrl/lpr mice, in which estrogens globally increase igm levels autoantibody titers, glomerulonephritis, lymphoproliferation, mortality, and cytokine levels. conversely, treatment with the estrogen receptor antagonist, tamoxifen, reduces proteinuria, serum tiers of anti-dsdna autoantibodies and increases survival. estrogens also differentially affect b and t cell-mediated immune responses in mrl/lpr mice [255, 256]. immune complex-mediated glomerulonephritis is significantly accelerated by estrogens whereas t cell-mediated lesions, such as renal vasculitis and periarticular inflammation, are reduced in mrl/lpr mice after estrogen treatment [255, 256]. estrogens can also modulate blood-brain barrier permeability [267, 268] and increase cytokine levels in patients with sle [259, 262, 269, 270]. moreover, the myriad effects of estrogen on neuroprotection are being increasingly recognized [271273]. while space constraints prevent going into further details about the role of sex hormones in maintaining the integrity of the blood-brain barrier and providing neuroprotection, the interested reader can find additional details in some recent comprehensive reviews [267, 271, 272, 274, 275]. these sex and hormone differences may have clinical implications for treatment of sle, as cyclophosphamide prevents pulmonary disease in male but not female mrl/lpr mice. similarly, sex differences in the efficacy of treatment in autoimmune disorders is not uncommon. furthermore, there are notable sex differences in both humans and in animal models in the susceptibility of depression, responses to antidepressant treatments, and in underlying hormonal, immune, and neurochemical alterations in affective disorders [278, 279]. cns disease in np-sle may share common mechanisms with peripheral organ pathology in sle, especially in the latter stages of the disease, but the distinct nature of cns-mediated immunity and the blood-brain barrier indicates that early manifestations of particularly mood disorders may be derived from some unique mechanisms. additionally, agents critical to the pathology of np-sle, such as cytokines, are regulated by sex and steroid hormones, which is consistent with the predominance of sle and mood disorders in females. altered cytokine profiles in serum and/or cns can result in the activation of astrocytes, microglia, and changes in neuronal function and morphology and dysregulation of the blood-brain barrier pathology of the blood-brain barrier could lead to altered homeostasis and play a significant role in impairment of cns function seen in later onset of np-sle as well many other immune disorders. despite the importance of the mrl/lpr and other murine models for elucidating the underlying mechanisms of np-sle, there are yet many questions that have not been conclusively answered. these include relating measures of the earliest onset of negative behavioral outcomes with intrathecal levels of cytokines and native brain-reactive autoantibodies, systematic study of the efficacy of alternative therapeutics (such as traditional and novel antidepressants), and comprehensive analysis of the time course of blood-brain barrier dysfunction.

to date, cns disease and neuropsychiatric symptoms of systemic lupus erythematosus (np-sle) have been understudied compared to end-organ failure and peripheral pathology. in this review, we focus on a specific mouse model of lupus and the ways in which this model reflects some of the most common manifestations and potential mechanisms of human np-sle. the mouse mrl lymphoproliferation strain (a.k.a. mrl/lpr) spontaneously develops the hallmark serological markers and peripheral pathologies typifying lupus in addition to displaying the cognitive and affective dysfunction characteristic of np-sle, which may be among the earliest symptoms of lupus. we suggest that although np-sle may share common mechanisms with peripheral organ pathology in lupus, especially in the latter stages of the disease, the immunologically privileged nature of the cns indicates that early manifestations of particularly mood disorders maybe derived from some unique mechanisms. these include altered cytokine profiles that can activate astrocytes, microglia, and alter neuronal function before dysregulation of the blood-brain barrier and development of clinical autoantibody titres.

PMC3038428

pubmed-873

megaloblastic anemia is a group of disorders characterized by ineffective hematopoiesis, frequently manifested by peripheral blood cytopenia. they are usually caused by nutritional deficiencies (most common) of either vitamin b12 or folate or both, inherited disorders of dna synthesis, or following certain drug therapy. the differentiation from pyrexia of unknown origin (puo) in such cases is difficult and often requires exhaustive laboratory investigations. the aim of this article was to highlight this aspect of megaloblastic anemia and the importance of considering this diagnosis in all cases presenting with puo. this study was conducted on 15 patients of megaloblastic anemia associated with fever, attending the outpatient department over a period of 6 months (june 2014 to november 2014). the inclusion criteria for the study were temperature of 100 f (37.8c) or more, hemoglobin level<10 g/dl, mean corpuscular volume (mcv)>100 fl, peripheral blood film findings consistent with megaloblastosis (including macrocytosis, hypersegmented neutrophils and pancytopenia in few cases), low serum vitamin b12 and/or folate levels, and bone marrow findings consistent with megaloblastic anemia. all other causes of fever were excluded by appropriate investigations (complete hemogram, aso titer, blood film for malarial parasite, widal test, brucella agglutination test, weil-felix test, dengue serology, leptospira serology, rheumatoid factor, blood culture, liver function test, renal function test, complete urine examination, chest radiograph, ultrasound abdomen and pelvis and others). a total of 64 patients of megaloblastic anemia attended our hospital clinics over the mentioned 6 months period. only 15 of these satisfied the inclusion criteria and were included in the study. majority of the patients were from rural areas (12 out of 15, 80%). most of the patients belonged to the age group of 2140 years and most had duration of illness of around 3 weeks. there was no history of cough, headache, arthralgia, rashes, jaundice or exposure to any patient of tuberculosis in any of the patients. on examination, two patients had hyperpigmentation of knuckles. cardiovascular system examination revealed loud s1 heart sound and ejection systolic murmur in the pulmonary area in 8 patients. abdominal examination revealed mild to moderate splenomegaly in majority of patients (10 out of 15). 12 patients had fever of 100102 f and 3 had a temperature of>102 f. two patients had fever lasting for<7 days, 10 had fever from 7 to 20 days and 3 had fever>21 days. other symptoms were easy fatigability (8 patients, 53%), anorexia and gastritis (5 patients, 33%) and bleeding tendency in 1 patient (6.7%). table 2 demonstrates the hemoglobin levels, mcv values and serum folate/vitamin b12 levels of the patients. nine patients (60%) had low serum levels of vitamin b12 only, 2 (13.3%) had decreased serum folate levels only; while 4 (26.6%) had combined deficiency of both. bone marrow examinations were available in all 15 patients and revealed moderate to severe megaloblastosis. initially, all the patients were started on empirical broad spectrum intravenous (iv) antibiotic treatment. eleven (73%) of them responded to this approach and showed a decrease in temperature levels. however, 4 (26.6%) continued to remain febrile. in these patients, antibiotics were stopped, and vitamin b12 and folate supplementation was started. all of these 4 patients showed symptomatic improvement within 48 h along with the improvement in hematological parameters by the 7 day. further improvement in hemoglobin, mcv, and other hematological parameters were seen on follow-up. table 3 describes the clinical and investigation findings in 4 patients who showed improvement with vitamin b12 and folate administration. most of these patients were females with low-grade fever lasting for the duration of>2 weeks. three of the patients had combined deficiency of b12 and folate while 1 had isolated folate deficiency. as observed in our study, infection continues to be the most common cause of fever in patients of megaloblastic anemia. this is evidenced by the fact that 73% of our patients showed improvement on administration of broad spectrum iv antibiotics. this was despite the fact that no obvious focus of infection could be found in them, even after extensive investigations. it has been suggested that patients of megaloblastic anemia are more susceptible to infection due to impaired intracellular killing of ingested bacteria by the neutrophils and macrophages. the metabolic activation is reduced by 3536% in the leukocytes that are deficient in b12 (but not so with folate deficiency). hence, bacterial killing is reduced and abnormal; and it is reverted after specific therapy. however, 4 of our patients (26.6%) showed no improvement with antibiotics but showed marked improvement within 48 h on administration of vitamin b12 and folate. this shows that though it is rare to find megaloblastic anemia as the sole cause of fever, it still remains an important and often overlooked cause of the same. such cases are often treated as cases of puo, and precious time and money is wasted on their management. as per the modified petersdorf criteria, fuo is defined as: a temperature exceeding 38.3c duration of the fever of more than 3 weeks and evaluation of three outpatient visits or 3 days in hospital. on the review of literature for causes of puo we found in our study that most of the patients had low-grade fever with temperature<100 f. the temperature was>102 f in only 3 of the 15 patients (20%). furthermore, it was observed that most of the patients who presented with megaloblastic anemia being the sole cause of fever; had a longer duration of disease, more severe anemia and higher values of mcv. it has been suggested that since megaloblastic anemia is a panmyelosis, characterized by hypercellular marrow and ineffective hematopoiesis, premature destruction of hematopoietic precursors could possibly release intracellular substances which might function as systemic pyrogens. alternatively, studies have proposed that defective oxygenation at the thermoregulatory center of the hypothalamus might be the explanation for pyrexia. however, lack of correlation between neurological manifestation and pyrexia in megaloblastic disease negates this theory. to confound matters even further, few studies have shown that a rise in temperature might cause depletion of folate stores, both in red blood cells and serum, leading to disturbances in folate metabolism. hence, whether pyrexia is a cause or effect of folate deficiency remains to be fully understood. although the reason behind it remains unclear, the association of fever with megaloblastic anemia remains a well-documented phenomenon. further studies on bone marrow microenvironment and role of cytokine signaling in these cases would help in discovering the cause in the future. we conclude that though infection remains to be the most common cause of pyrexia in patients of megaloblastic anemia, few cases also show a causal relationship between the two. hence, measurement of b12 and folate levels should be advised in all patients presenting with fever without any obvious cause. the correct identification of b12/folate deficiency being the cause of fever (after all other causes have been ruled out), would help in adequate and timely management of the patient and avoid unnecessary use of antibiotics.

objectivethe objective was to study megaloblastic anemia as a cause of pyrexia of unknown origin (puo). materials and methodswe conducted a study on 15 patients of megaloblastic anemia associated with fever, attending our hospital clinics over a period of 6 months. resultswhile 11 patients had symptoms suggesting foci of infection and responded well to intravenous antibiotics, 4 patients had neither any evidence of infection nor responded with empirical broad spectrum antibiotic treatment. they were treated with vitamin b12/folate therapy which led to marked improvement in fever within 48 h. presenting complaints of the patients and severity/duration of fever along with other epidemiological data were also studied in each case. conclusionthe present study led us to conclude that megaloblastic anemia forms an important and reversible cause of fever and should be ruled out in all patients presenting with puo. this knowledge would help the physicians in adequate and timely management of these patients.

PMC4936446

pubmed-874

radical chemistry has always taken a backseat to ionic chemistry. in the basic undergraduate curriculum of organic synthesis, the aldol reaction, grignard addition, and pericyclic transformations like the diels alder reaction are at the forefront. more advanced texts highlight the vital modern-day use of cross-coupling. however, little emphasis is placed on topics pertaining to radicals. this radical discrimination might be due to a historically accepted notion that these species are chaotic, uncontrollable, and mysteriously baffling. despite these misconceptions, a plethora of useful and elegant chemistry has been developed over the years using radical intermediates. to properly put this perspective in context, figure 1 outlines some of the great milestones in radical chemistry. the emergence of the first useful radical processes actually preceded fundamental understanding of these chemical entities, as seen with the kolbe electrochemical decarboxylation, the borodin hunsdiecker reaction, and the hofmann discovery of the pinacol coupling spawned modern means of harnessing ketyl radicals, such as the mcmurry coupling and the kagan reagent (first report in 1977), while the mechanistically similar acyloin reaction enabled sheehan to achieve tremendous advances in steroid synthesis. gomberg discovered the existence of the trityl radical as a trivalent species, and kharasch realized that radicals could allow one to access anti-markovnikov selectivity in an early example of atom-transfer reaction. shortly afterward, bachmann postulated the persistent radical effect (pre), suggesting the preferential coupling between persistent and fleeting radical species, thus laying a foundation for the rational design of radical reactions (vide infra). studies by hey and waters unraveled the intricacies of homolytic aromatic substitution which form the tenets of radical arene functionalization. the meerwein arylation showcased the possibility of utilizing high-energy aryl radicals in the hydroarylation of olefins. the birch reduction opened up a new dimension to the synthetic utility of arenes. waters s thiol-catalyzed aldehyde homolysis in 1952 provided efficient means of accessing acyl radicals; it also raised stimulating discussions on radical polar effects, which were extensively examined by walling, leading to the entire area of polarity reversal catalysis. studies into stannanes allowed for the mild and chemoselective generation of carbon-centered radicals, setting the stage for later synthetic applications. oxidative homolysis of alkyl boranes was later found to offer another means of accessing these radicals at low temperatures. around this time, the barton nitrite photolysis was invented, the impact of which in solving a real-world problem (procurement of aldosterone acetate) was eye-opening. this reaction, together with breslow s remote radical functionalization, demonstrated the immense power of radical translocation. the seeds of what would later become extremely useful transformations were planted starting in the late 1960s with the discovery of mn(iii)-mediated oxidative additions to olefins, radical-cation-mediated cycloadditions, the minisci heterocycle c h alkylation, and radical-based cross-coupling chemistry. the ingenious barton decarboxylation and deoxygenation (barton mccombie) reactions were invented as a consequence of an interaction barton had during a consulting visit to schering-plough. methodic kinetic investigations by walling, beckwith, and ingold, among others, demonstrated the remarkable selectivity of radicals, thus propelling significant developments in synthetic radical chemistry in the 1980s. authoritative treatise on the rules for radical ring closure set the stage for the ueno curran s stunning achievements in total synthesis illustrate the innate ability of radical chain reactions to effect tandem bond formations. others provided absolute rate constants for numerous radical processes (a small sampling of rate data is shown in figure 1b). the scope of radical precursors was appreciably expanded toward the end of the 1980s. zard s startling xanthate transfer chemistry found applications in both polymerization and organic synthesis. use of pet, nugent and rajanbabu s epoxide reduction, and mukaiyama s use of in situ-generated metal hydride species opened the door to using ubiquitous functionalities such as carboxylates, epoxides, and olefins as radical precursors. significant advances were made in multiple directions shortly before the advent of the 21st century. the development of atom-transfer radical polymerization (atrp) in the 1990s led to countless applications in material science. pioneering efforts by curran, giese, porter, sibi, and renaud furnished elegant methods of stereocontrolled radical additions (depicted in figure 1 is a simplified representation of sibi s chiral lewis acid-mediated enantioselective radical addition). roberts s enantioselective hydrosilylation offered a complementary approach where a thiyl radical is the source of chirality. chatgilialoglu s silane reagents, walton and studer s cyclohexadienes, and curran s fluorous stannanes represent practical means of ameliorating the classical tin hydride method. studer s studies on nitroxyl radicals had tangible impacts on both cyclization and polymerization reactions. radical-based azide transfer, emerging from renaud s laboratory, forges c they have shown that radicals can be harnessed in unique and exciting ways to deliver useful structures in an incredibly rapid fashion. sometimes radicals have enabled access to chemical space that was previously unimaginable, and in other cases their use facilitates the most concise route to a target structure. more often than not, embracing radical reactivity leads to unique applications in an industrial setting. in our view, the properties of radicals and the reactions they enable can have a profound impact in drug discovery, agrochemicals, material science, and fine-chemical manufacturing. the next five sections highlight separate areas of radical chemistry that our laboratory has been involved in over the past decade, followed by a perspective on the latest developments in the field of radical chemistry. it is our hope that some of the transformations highlighted will find use by those making materials for the betterment of humankind. the hapalindole family of marine natural products (e.g., 17) combines promising bioactivities with startling structural complexity (figure 2a). a retrosynthetic analysis of these indole alkaloids, aiming to divergently access as many family members as possible, revealed 8 as a common precursor. the union of indole and carvone (11) represented the most direct means to access 8. however, the electron-rich indole is affixed at c-3 to the -carbon of a ketone, creating a notoriously challenging dissonant relationship which is usually surmounted in ionic chemistry through reactivity umpolung. such an approach requires extraneous functional group interconversions associated with prefunctionalized building blocks such as 9 and 10. evolution of enolate oxidative coupling in our laboratory and its synthetic applications. to avoid these concession steps while utilizing the inherent reactivity of these systems, a single-electron oxidation of enolates was pursued. it was envisaged that interactions between the in situ-formed electrophilic -keto radical and a nucleophilic indole species would afford 8 (putatively via 12 and 13). after some initial forays, cu(ii) 2-ethylhexanoate was found to effect the direct coupling between indoles and enolate-derived -keto radicals (figure 2b). as the reaction takes advantage of the intrinsic nucleophilicity of indoles, coupling takes place selectively at c-3, and protection of the free n ample amounts of 8 were obtained in a single step, allowing protecting-group-free syntheses of various hapalindole alkaloids. the chemoselectivity of this process is notable, with various sensitive functionalities such as epoxides, halides, and alcohols being well tolerated. enolates of esters and amides can be used as well; this allows introduction of chiral auxiliaries to furnish enantioenriched products. ma and co-workers beautifully extended this oxidative coupling approach even when the c-3 position of indole was substituted, allowing them to expediently forge challenging quaternary centers en route to ()-communesin f (14), ()-vincorine (15), and n-methyl-decarbomethoxy-chanofruticosinate (16). unprotected pyrroles (18) are also viable substrates that react regioselectively at c-2 (figure 2c): a four-step synthesis of (s)-ketorolac (20) was developed on the basis of this reactivity. notably, this anti-inflammatory agent is currently administered in racemic form, even though the (s)-enantiomer is known to exhibit fewer side effects. efforts were undertaken to explore the radical chemistry of enolates further. in the presence of an iron or copper oxidant, heterodimerization between two enolates was achieved both intramolecularly and intermolecularly (figure 2d). in the latter case, when enolates of amides or oxazolidines (21) are reacted with those of esters or ketones (22), differences in redox potentials are sufficiently large, and heterodimerization products such as 23a c are formed exclusively. this reaction furnishes 1,4-dicarbonyl products (23) with the concomitant creation of two vicinal stereocenters in a redox-economical fashion. the heterocoupling reaction thus permitted short syntheses of a metalloproteinase inhibitor (24) and the natural product bursehernin (25); the intramolecular variant was harnessed to forge highly congested c c bonds in our syntheses of (+) -stephacidin a (26) and (+) -avrainvillamide (27), as well as ()-stephacidin b (28) (figure 2e). moreover, oxidative enolate heterocoupling has found use in both industrial and academic circles. for instance, gavai and co-workers from bristol-myers squibb used this method to synthesize a series of anticancer agents such as bms-906024 (29) (currently in phase ii clinical trials). the groups of overman, tang, nicolaou, yang, and thomson have applied this approach to the syntheses of ()-actinophyllic acid (30), spirobacillene a (31), furanocembranoid precursors such as 32, (+) -propindilactone g (33), and metacycloprodigiosin (34), and propolisbenzofuran b (35), respectively. our interest in silver-mediated radical reactions originated from the total syntheses of the axinellamines (38), massidine, and palauamine (figure 3). imidazole alkaloids each possess a dense array of nitrogenous functionalities, among which the common guanidinium hemiaminal motif stands out as a vexing feature. to avert concessional maneuvers, the installation of this sensitive moiety was deferred to a late stage via a direct oxidation of c-20. this strategy would simultaneously allow for the synthesis of the entire alkaloid family from a common intermediate. after extensive experimentation, silver(ii) picolinate was identified as the optimal oxidant for this unique transformation (36 37) (figure 3a). strikingly, the c-20 position was oxidized with admirable chemo- and regioselectivity, delivering the hemiaminal without over-oxidation. this enabling reaction not only led to the total syntheses of the axinellamines, massidine, and palauamine but also allowed us to procure axinellamines in gram quantities to establish their broad-spectrum anti-bacterial activities. 14783-00-7) has now been commercialized by sigma-aldrich, the initial scope of this reaction is currently limited to the esoteric area of guanidine oxidation. we were thus motivated to look into other silver-catalyzed processes with more translational potential. the venerable minisci reaction is one such example wherein a carboxylic acid undergoes radical decarboxylation in the presence of a silver catalyst. the alkyl radical thus formed can directly functionalize electron-deficient heteroarenes (39). the importance of these omnipresent heteroarenes can not be overstated they are vital to life and are found in vitamins, drugs, dyes, pesticides, and polymers. despite the tremendous amount of work describing their functionalizations, societal needs call for more-efficient syntheses of (hetero)biaryl frameworks to access various pharmaceutical core structures, as well as the simple stitching of small alkyl groups for the modulation of physiochemical properties. such transformations are often achieved by programmed or regiospecific chemistry (figure 3b). although predictable and programmable methods will continue to be vital in all aspects of chemistry, the method 39 40 41 inherently requires two steps or more. as chemists are constantly searching for rapid and operationally simple ways to generate a large library of related compounds for screening, simple c h functionalization techniques are needed (39 41) to directly access desired c although such one-step methods, exemplified by directed hydrogen metal exchange, already exist, they require cumbersome cryogenic, anaerobic, or anhydrous conditions. with the peculiar reactivity and selectivity of radicals, nevertheless, this classical reaction presents several drawbacks which preclude its broad applications: radical generation from the carboxylic acid is relatively inefficient and limited in scope. consequently, elevated temperatures as well as prolonged reaction times are often necessary. formation of aryl radicals via decarboxylation is particularly challenging, and heteroarene acceptors have to be used in super-stoichiometric quantities to trap these fleeting species. this gap in methodology was addressed with the identification of aryl boronic acids as convenient radical progenitors. $380/mol) and a persulfate oxidant can efficiently homolyze the c b bond under ambient temperature (figure 3c). the resulting radical was found to readily attack a variety of heteroarenes in an aqueous medium, affording arylation products 42 following spontaneous re-aromatization. while triplet oxygen is known to combine with radicals at diffusion rates, running the reaction under open air did not diminish the yields, presumably because the effective concentration of oxygen is low in the reaction system. the regiochemical course of the reaction is governed predictably by the innate electron density of the heteroaryl substrates: pyridines or quinolines are preferentially arylated at c-2, and substrates bearing multiple nitrogens such as pyrimidines, pyrazines, or quinoxalines favor arylation at the most electron-deficient positions. this diverse range of substrates encompasses many privileged medicinal scaffolds, making the reaction amenable for drug derivatization. for example, quinine can be functionalized selectively at its quinoline core to furnish 42a in the presence of several other unprotected functionalities, including a highly oxidizable benzylic alcohol, an electron-rich olefin, and a basic quinuclidine nitrogen. many other functional groups, such as ketones and aryl halides, exhibited compatibility with the mild reaction conditions. the exceptional chemoselectivity of this radical process, coupled with its operational simplicity, allows rapid diversification of densely functionalized active pharmaceutical ingredients (apis). in an analogous fashion, molander developed a manganese-mediated heteroarene alkylation wherein radicals obtained from his eponymous potassium trifluoroborates were found to react with pyridines and quinolines, forming various adducts (43). shortly before molander s report, benzoquinone (44) was found to undergo c h alkylation under borono-minisci conditions with alkyl boronic acids to give products such as 45a, b (figure 3d). like -deficient heteroarenes, 44 also reacted smoothly with aryl boronic acids of varying electron densities to afford 45c f. benzoquinone adduct (45h) was obtained without protecting the steroidal ketone; a farnesyl chain can be appended selectively at the terminal position (45 g). substituted quinones are viable substrates as well, permitting schwalbe and co-workers to prepare the potent allergen primin (46) in a single step. although quinones are prevalent motifs in biomedical and material research, few general methods for their direct installations have hitherto been developed. in fact, many of the quinone adducts surveyed during the course of the reaction development represented new structural entities. despite their semblance of michael acceptors, quinones rarely undergo smooth conjugate additions with organometallic reagents; their inertia toward transition metal catalysis is evidenced by their roles as ligands or oxidants in such reactions. this simple chemical avenue, through a radical process, tames quinones unique electronic properties. moreover, owing to the development of the suzuki coupling, a multitude of boronic acids are now available to medicinal chemistry practitioners. capitalizing on the ubiquity of these radical precursors, the borono-minisci reaction represents a unique opportunity to exploit the biomedical niches of both quinones and heteroarenes in depth. b bond-forming methods, from the pioneering efforts of h. c. brown to seminal studies on c h borylation. the scope of this chemistry can thus be expanded far beyond the commercial repertoire of boronic acids. simplifying retrosynthetic disconnections can therefore be devised on the basis of this innate c h functionalization strategy. for instance, a borono-minisci cyclization was conceived to construct polycyclic scaffolds such as 48 from the corresponding boronic acid derivative 47, which can in turn be obtained from the halide (figure 3e). this method furnishes the central ring in dibenzofurans and fluorenones while obviating the use of hazardous arenediazonium salts employed in the classical pschorr reaction. capitalizing further on the borono-minisci transform, a terpenyl radical precursor, borono-sclareolide (49), was synthesized (figure 3f). the radical derived from 49 reacted readily with benzoquinone (44), permitting a rapid synthesis of (+) -chromazonarol (50), which diverged further to provide access to various meroterpenoids in a concise and scalable fashion. these sesquiterpenoids possess intriguing bioactivities which remain largely untapped due to material supply issues this joint effort with leo pharma has furnished ample quantities of each product, enabling explorations into a large area of natural product space. in a similar fashion, the borono-minisci reaction allowed expedient syntheses of various valuable molecular architectures. these include sarcodonin (51) and phellodonin, botryllazines a (52) and b, cytotoxic meriolin (53), and photochromic compounds such as 54, as well as the sodium channel inhibitor 55. aside from the original silver catalyst, in some of these studies, iron salts or thermolysis was found to initiate radical formation, further bolstering the practicality of the reaction. the trifluoromethyl (cf3) group, in particular, is an excellent methyl bioisostere it imparts various favorable physicochemical attributes, such as lipophilicity and metabolic stability, to a lead target. (hetero)arenes bearing cf3 groups constitute an indispensable part of numerous important drugs, including celebrex (celecoxib), sustiva (efavirenz), and prozac (fluoxetine). effective means of trifluoromethylation are thus vehemently sought by both academic and industrial scientists. although cf3 can be introduced by transition metal-catalyzed approaches, such methods are often air- and water-sensitive and require prefunctionalization. a robust and yet operationally simple radical approach to c however, direct application of the borono-minisci conditions with various heteroarenes failed to yield any trifluoromethylation product 56 (figure 4a). after considerable investigation, [cf3so2]na, a reagent originally utilized by langlois for the trifluoromethylation of phenols and anilines, was discovered to effect the conversion of c h bonds into c cf3 bonds in the presence of a cheap industrial oxidant, t-buooh (tbhp). sensitive functional groups such as alcohols, amines, and olefins are left unscathed. this is ideal for the functionalization of biomedically relevant substrates such as deoxyuridine, leading to trifluridine/viroptic (56a). the reaction proceeds through the intermediacy of a highly reactive trifluoromethyl radical, which readily engages a gamut of both electron-deficient and electron-rich heteroarenes. the addition of this radical onto an unactivated olefin was also observed in our initial report; this precedent has subsequently been extended in many creative ways. applying this method, molinski and co-workers were able to selectively functionalize the pyrrole ring of agelastatin. the resulting 13-trifluoromethylagelastatin (56b) exhibited considerably higher potency against chronic lymphocytic leukemia than the parent compound. overall, this c h functionalization protocol allows for the rapid late-stage derivatization of existing drugs and known pharmaceutical motifs under practical (open-flask) conditions. development and applications of sulfinate reagents as enabling radical precursors in biomedical research. the effectiveness of langlois s salt as a trifluoromethyl radical precursor stems from its weak c s bond (figure 4a); moreover, its propensity to extrude so2 under oxidative conditions entropically favors radical formation. in anticipation of the generality of these properties, syntheses of various sulfinates were undertaken to access a diverse array of carbon-centered radicals. during this process, choice of the cation was found to be critical: while sodium fluoroalkanesulfinates often lack stability or reactivity, the corresponding zinc salts proved superior. the first reagent of the series, zinc difluoromethanesulfinate, or [cf2h so2]2zn (dubbed dfms), is an air-stable compound that allowed for c h to c cf2h transformation (figure 4b). heteroarene trifluoromethylation was revisited: [cf3so2]2zn (tfms) was synthesized, and the yield-enhancing zinc effect was observed. building on this positive effect, a flurry of other zinc bis(fluoroalkane)sulfinate reagents were synthesized (only their chemical acronyms are shown here). these reagents can modulate the physicochemical profiles of various drug candidates through chemoselective radical reactions: dfms installs the cf2h group, leading to phenol bioisosteres; dfes creates aryl ether isosteres; psms draws inspirations from nature s s-adenosyl methionine (sam) methyl transferase to enable site-selective methylation. c h functionalization using these salts can be carried out in a variety of biologically relevant media (aqueous and aerobic), including cell lysate, oolong tea, and a lactamase buffer (figure 4b)! it is worth noting that sulfinate salts can also participate in desulfinylative cross-couplings with boronic acid derivatives and carboxylic acids. the sulfinate reagents described above have been commercialized by sigma-aldrich as diversinates (catalog numbers are shown in figure 4b) and have already gained much popularity within the pharmaceutical community. high demand for dfms has prompted large-scale industrial production, providing commercial access to 1 kg bottles. as a testament to the impact of this chemistry notably, roughly 80% of the purchases are made by pharmaceutical companies such as bristol-myers squibb, novartis, merck, gilead, genentech, roche, boehringer ingelheim, and pfizer. elaborating further on this work, a linker reagent (daas-na) was developed. this difluoroalkyl azide linker enables the bioconjugation of heteroarene drugs to monoclonal antibodies (figure 4b). typically, only conventional functional groups can be tagged by linkers, but some medicinal scaffolds present the challenge of not having any apparent chemical handles. the linker can be installed onto complex drugs such as pioglitazone and bosutinib with admirable selectivity to yield 58a and 58b. in another application of sulfinate chemistry, dfms was used as a litmus test to predict the vulnerability of a pharmaceutical candidate toward aldehyde oxidase (ao) metabolism, which is thought to proceed via the nucleophilic attack of a high-valent molybdenum species onto a heteroarene s most electrophilic position. identifications of such positions are prohibitively difficult in fused azaheterocyclic systems; computational modeling has also been largely ineffective. the nucleophilic difluoromethyl radical generated from dfms acts as a rapid diagnostic for ao susceptibility, reacting with electron-deficient heteroarenes that are prone to ao degradation (figure 4b). the addition of a metabolically stable difluoromethyl motif into a position prone to ao offered a potential inroad to a therapeutic agent. aside from the nucleophilic difluoromethyl radical, (fluoro)alkyl radicals of varying polarities can be accessed from different sulfinate salts. these reagents can be harnessed as probes to elucidate the intrinsic reactivities of heteroarenes. regiochemical outcomes of such processes were unpredictable owing to the presence of substituents exerting additive effects. the chemoselectivity of sulfinate radical chemistry coupled with its robustness enabled investigations into a large sampling of heteroarenes under various conditions. as a result, a set of general guidelines was furnished to predict the positional selectivity of heteroaromatic radical c h functionalizations (figure 4c). these empirical rules determine the most nucleophilic/electrophilic positions of a heteroarene through the additive effects of various substituents. thus, site-specific modification of complex drugs such as nevirapine can be formulated, as addition of the nucleophilic isopropyl radical led exclusively to 60, in accordance with predicted selectivity. tandem functionalization of dihydroquinine was realized with isopropyl and trifluoromethyl radicals attacking the electrophilic c-2 and nucleophilic c-7 sequentially to yield 61. relative contributions of opposing substituents were found to depend on external factors such as solvent and ph thus, the regiochemical outcome of certain substrates can be fine-tuned through simple variations in reaction conditions. while in an acidic chloroform/water mixture the electrophilic cf3 radical reacts with 62 selectively at c-4, use of dmso as solvent elicits conjugate reactivity of the ester group and c-5 substitution prevails. in cases where large quantities of a product are needed, the use of stoichiometric tbhp can be circumvented when electrochemistry is used to initiate the desulfinylative radical formation. various recalcitrant substrates such as pentoxyfylline (56c) or metroindazole (56d) showed improved yields (figure 4d); monitoring of the reaction progress under electrochemical initiation also allowed deconvolution of processes related to radical formation and radical consumption. some sulfinate reagents (64) can be prepared from the corresponding sulfonyl chlorides (63). however, only a limited number of these expensive starting materials are commercially available. the hu reagent (65) represents an alternative precursor with the pyridylsulfone moiety serving as a sulfinate surrogate. this route, nevertheless, can only furnish difluoroalkyl sulfinates (67) (figure 4e). in an effort to generate a larger repertoire of sulfinates, an interrupted barton decarboxylation was developed, converting carboxylic acids 68, which are inexpensive chemical feedstock building blocks (vide infra), to sulfinates in good yields (figure 4f). this is achieved through sequential barton ester (69) formation with inexpensive n-hydroxy-2-thiopyridone salts (industrial feedstock) and photolytic rearrangement (69 70). carboxylic acids are often not convenient precursors of reactive radical species but can now be easily converted into designer sulfinates (71), which are efficient radical precursors. following this simplifying transform, an assortment of sulfinates of medicinal relevance has been synthesized (e.g., 71a these reagents granted rapid access to heteroarene derivatives that would otherwise require laborious de novo preparations. for example, the previous synthesis of 74 was achieved in four steps from a starting material of limited availability, enlisting the use of hazardous diazomethane to append the coveted trifluorocyclopropyl motif over the course of 1 week. tfcs (71a), on the other hand, allows the installation of trifluorocyclopropyl directly to afford the same product after a two-step, one-pot operation in about 2 h. as with other sulfinates, these reagents have the ability to change the physicochemical and biological properties of the parent molecule to impact various aspects of drug discovery, including lead target modification, bioisostere formation, and bioconjugation. as with both the oxidative enolate coupling and the borono-minisci reaction, the development of iron-mediated radical olefin hydrofunctionalizations in our laboratory can be traced back to natural product synthesis, specifically from the ent-kaurane family of terpenes. adhering to the two-phase paradigm of terpene synthesis required access to 77 (figure 5a) as a cyclase phase end point. while terpene skeletons have frequently been constructed using cationic polyene cyclizations, the use of radical methodologies in terpene synthesis has largely been limited to the pioneering work of the snider group. it was our hope to develop a complementary radical-based method to forge lowly oxidized terpene frameworks (79 78 77). the pioneering metal-catalyzed olefin hydrofunctionalization approaches of mukaiyama, carreira, boger, and others were particularly path-pointing in this regard. we envisioned that this type of reactivity could be coupled to a giese-type radical conjugate addition to create a reductive olefin coupling between an unactivated olefin and an electron-deficient olefin. n bond construction. using boger s iron-promoted olefin hydrofunctionalization conditions as a starting point, we eventually found that fe(acac)3 and phsih3 were able to facilitate the desired transformation, where an unactivated donor olefin 80 (figure 5b, x=alkyl or aryl) was able to be directly coupled to an electron-deficient acceptor olefin (82) through the intermediacy of nucleophilic radical 81. the reaction can be applied to both intermolecular cross-couplings and intramolecular cyclizations and could form quaternary centers (e.g., 83b) with ease. although the donor scope was somewhat limited in our initial report, the acceptor scope was quite broad, with almost any electron-withdrawing group being competent to activate the acceptor olefin. upon further investigation, we found that modifying the reaction conditions and switching from fe(acac)3 to a slightly bulkier catalyst, fe(dibm)3, greatly expanded the reaction scope with regard to the donor olefin. oxygen-, nitrogen-, sulfur-, silicon-, boron-, and halogen-based functionalities could all be tolerated to give products such as 83a, c g. functionalized olefin cross-coupling allowed for the execution of the synthesis of glucal derivative 83a in a single step from benzyl-protected 80a and methyl vinyl ketone (82a) and in a higher overall yield than the three-step process that has previously been described in the literature. similar to the case of oxidative enolate coupling, functionalized olefin cross-coupling represents an umpolung of traditional reactivity in the case of oxygen- and nitrogen-substituted donor olefins. the generation of the nucleophilic radical takes place adjacent to the heteroatom, a site that is conventionally electrophilic. the radical-based nature of this reaction is perhaps its main benefit, as its orthogonality to polar and pd-based cross-coupling chemistry allows it to tolerate functionalities that are traditionally viewed as reactive. inspired by reports of radical additions into hydrazones, we wondered if the fe(acac)3/phsih3 system would allow for a coupling of olefins with hydrazones. reaction with the hydrazone derived from formaldehyde (85) would generate adduct 86 (figure 5c). however, the real utility would be in eliminating n2 and rso2h from 86 to generate 87, the product of a net addition of methane across an unactivated olefin. although this is a conceptually simple transformation, there have only been scattered reports in the literature, and a general strategy for olefin hydromethylation did not exist. attempts to isolate 85 for use in an olefin hydromethylation were unsuccessful; however, preparing the hydrazone in situ allowed the realization of a hydromethylation sequence. mono-, di-, and trisubstituted olefins could all be utilized, and due to the radical nature of the reaction, free alcohols, halides, pseudohalides, azides, and boronic esters could all be tolerated. this formal addition of methane across an olefin could also be used to introduce isotopically labeled methyl groups into molecules. by using different combinations of deuterated and undeuterated formaldehyde and methanol, one can incorporate any number of deuterium atoms into the methyl group (87a d). the late-stage introduction of a methyl group, or methyl editing, of natural product scaffolds was demonstrated by employing -d-glucofuranose derivatives citronellol, quinine, and gibberellic acid to give 87e h, respectively. although the transformations previously described enlisted carbon-based electrophiles as coupling partners, it was discovered that non-carbon electrophiles could also be used. when the olefin-to-nucleophilic radical transformation (84 88) was performed in the presence of nitro(hetero)arene (90), hydroamination (89) was observed (figure 5d). such a coupling was unexpected, as nitro(hetero)arenes have largely been limited to the realm of nucleophilic aromatic substitution and reduction to the corresponding anilines. however, control studies provided evidence that the nitro functionality was first reduced to the nitroso analogue 91. as nitroso(hetero)arenes are well-documented radical acceptors, it is likely that they serve as the true electrophile in the olefin hydroamination. the scope of the hydroamination was shown to be quite broad owing to the orthogonality that radical processes have to traditional ionic reactivity. over 100 adducts were synthesized using this methodology, with a host of functionalities present in both the donor olefin and the nitro(hetero)arene scaffold. the utilization of this method at both bristol-myers squibb and kemxtree attests to the translational potential of this transformation. furthermore, it was found that the olefin hydroamination could be used to accelerate the synthesis of a variety of medicinally relevant molecules such as the glucocorticoid receptor modulator 89a. what previously took two steps to make from the nitrobenzopyrazole 90a and aziridine 93 could be achieved in a single step in over twice the yield by using the same nitroheteroarene to hydroaminate the disubstituted olefin 92. two other examples of utilizing the olefin hydroamination to abbreviate the synthesis of medicinally relevant molecules were also presented. this reductive olefin coupling has been utilized by other research groups to achieve transformations that would have been difficult to achieve otherwise. in an elegant approach to emindole sb (95, figure 5e), pronin was able to smoothly cyclize enal 94 with fe(acac)3 and phsih2(oi-pr) to give the natural product after additional elaboration. furthermore, olefin cross-coupling enabled chemists at astrazeneca to circumvent an issue with the selective deoxygenation of 98 by instead directly coupling the -branched styrene 96 with enones to give diaryl ketone 97 (figure 5f). in a report detailing a transfer hydrocyanation, morandi and co-workers realized that their newly developed method could be used in conjunction with the reductive olefin coupling to effect the addition of ethylene across an unactivated olefin. to demonstrate this, estrone derivative 99 (figure 5 g) transfer hydrocyanation to norbornadiene resulted in concomitant formation of the vinyl group of 101 in 78% yield over two steps. the scope of the electrophilic coupling partners in these transformations has recently been expanded by other groups. cui has shown that stabilized diazo compounds (102), -nitrostyrenes (104), and para-quinone methides (106) could be used to generate hydrazones (103), styrenes (105), and phenols (107) respectively, when used to intercept the nucleophilic radical intermediate (figure 5h). furthermore, fu and co-workers demonstrated that the radical conjugate addition into michael acceptors bearing evans oxazolidinones (108) could serve as a useful pathway to access a variety of protected -amino acids (109) with high diastereocontrol. although our foray into this area was propelled with vague mechanistic hypotheses suggesting that a radical intermediate is involved, shenvi has recently shown that these reactions proceed through radical hydrogen atom transfer (hat) processes, presumably through an in situ-generated transition metal hydride. further understanding of this mechanism will undoubtedly contribute to the invention of even more creative ways to utilize olefins as nucleophilic radical progenitors. the minisci decarboxylative alkylation of heteroarenes is an incredibly useful tool (vide supra). one notable drawback of this classical reaction is its reliance on the inherent reactivity of heteroarenes with the scope generally limited to electron-deficient systems. experience in this area coupled with the use of the barton decarboxylation to prepare sulfinate salts (110 113) led us to wonder if the experimental simplicity of minisci/barton chemistry could be combined with the programmability of single-electron transfer (set) cross-coupling catalyzed by ni or fe salts. part of the attractiveness of minisci chemistry is its use of feedstock carboxylic acids whereas most set-based alkyl cross-couplings use alkyl halides, which often need to be prepared. alkyl radicals generated from barton esters (e.g., 110) are typically trapped with a hydrogen-atom source (e.g., bu3snh) or a variety of other radical acceptors including protonated electron-deficient heterocycles, but to our knowledge, had never been captured by a transition metal for the purposes of cross-coupling (figure 6a). development of redox-active esters (raes) as radical precursors in cross-coupling reactions. to our delight, ni complex (1.0 equiv) gave the desired cross-coupling product (115) in 51% yield. however, 115 was still produced in 54% yield in the absence of light at room temperature! given that barton esters have, for 4 decades, been known to give rise to radicals using either heat or light, it was quite shocking that the same process could be mediated by a transition metal. we hypothesized that the success of this reaction hinged on the ability of the ligated ar ni complex to reduce the barton ester to a radical anion (114) that could then fragment and decarboxylate, thereby generating an alkyl radical that recombines with the ar ni complex followed by reductive elimination to yield the coupled product. while ar ni complexes can be conveniently obtained from stable ni(ii) complexes and organozinc, photosensitivity of barton esters thwarted the direct generalization of this transformation (116e 117). instead, it was surmised that activated esters commonly used in peptide bond formation might be similarly predisposed to accept an electron. indeed, carpino s hobt and hoat esters (116c and 116d formed in situ using hbtu or hatu, respectively) worked extremely well. even nefkens and tesser s active ester, n-hydroxyphthalimide (nhpi, 116a), functioned smoothly in this reaction (figure 6b). retrospectively, okada s finding that nhpi esters could fragment under pet conditions reinforced the feasibility of such reactions. the tetrachloro derivative of nhpi (tcnhpi, 116b), introduced into organic synthesis in the context of an electrochemical c h oxidation method, was also found to be a great substrate for this type of coupling. however, not all esters that can activate a carbonyl in amide-bond-forming chemistry were competent. for example, n-hydroxysuccinimide (118) or pentafluorophenyl groups (119) were not. thus, we define a redox-active ester (rae) as one that can serve as a precursor to the corresponding radical under set conditions. building upon the initial discovery, a catalytic variant was developed, allowing for the coupling of secondary raes (116) with arylzinc reagents using a simple ni salt. a striking feature of this reaction was that both -heteroatom-stabilized carboxylic acids as well as simple unstabilized alkyl acids were competent coupling partners in a simple, thermal process. it was hypothesized that raes could be thought of more generally as a proxy or substitute for alkyl halides in set-based cross-coupling chemistry. whereas the area of alkyl aryl cross-coupling is expansive, the number of robust alkyl alkyl cross-couplings is comparatively miniscule due to the difficulty associated with controlling such reactions. sp cross-coupling of raes with dialkylzinc reagents (figure 6c) performed so smoothly. a wide range of carboxylic acids were found to be compatible, featuring multiple examples of carboxylic acid-containing natural products (e.g., 122d), drug molecules (e.g., 122b), and bridgehead tertiary acids (e.g., 123). as an alternative to traditional williamson ether synthesis, alkylation of -oxy raes is presented in numerous examples such as 122e. it is significant that the multitude of carboxylic acid substrates, variegated in nature, were all commercially available. the procedural simplicity is also notable as reactions were carried out without a glovebox with ease comparable to that of classical amide bond formation. although raes of simple tertiary acids (e.g., pivalic acid) are not competent direct coupling partners with either aryl or alkylzinc reagents, presumably due to steric constraints, a conjunctive coupling between a tertiary rae (124), radical trap (such as benzyl acrylate), and an arylzinc reagent was envisioned, thereby exploiting this perceived limitation (figure 6d). reasoning that a tertiary radical would react rapidly with an acrylate in a 1,4-fashion as we demonstrated in our fe-based studies (vide supra), it was logical that the resulting -keto radical would recombine with an ar ni complex and reductively eliminate, thereby forging two c c bonds and generating a quaternary center in a single reaction. this scalable three-component coupling rapidly generates structures (125a g) that would be exceedingly difficult to access through traditional ionic chemistry in moderate to good yields. the analogy of this chemistry to amide bond formation really only holds if it exhibits the necessary chemoselectivity to operate in the context of solid-phase peptide synthesis. this was demonstrated in several instances, the most notable of which is the simultaneous sp sp cross-coupling of both aspartic acid and glutamic acid side chains on a resin-bound peptide (figure 6e). this transformation allows for the synthesis of highly diverse functionalized peptides containing non-proteinogenic amino acids such as 127. although initial reports focused on the use of organozinc reagents in rae cross-couplings, attention rapidly turned to the use of boronic acids due to their shelf stability and wide availability (vide supra). boronic acids, like carboxylic acids, are among the most widely commercially available building blocks and are often used by medicinal chemists to generate diversity in a short, timely manner. after extensive optimization, this desirable transformation was realized using cheap nicl26h2o as a ni precatalyst and triethylamine as an inexpensive base (figure 6f). interestingly, this cross-coupling relied on the exclusive use of the tcnhpi rae (nhpi and other raes explored did not work). a wide range of both aryl (129a c, e, f) and styrenyl (129d) boronic acids, including heteroaromatic ones (129a, b, e), can be coupled using this chemistry, and this reaction shows remarkable chemoselectivity: aryl bromides on the boronic acid coupling partner are tolerated (129c, f) and primary alkyl bromides (129f) present on primary raes remain intact under the reaction conditions, thereby showing orthogonality to other alkyl-suzuki-type arylation reactions. as the component of the method was of utmost importance to us, it was also shown that the reaction requires no special precautions to exclude moisture or air, making the barrier to adoption in a discovery setting quite low. as mentioned above, raes represent a unique way of converting an alkyl carboxylic acid to the functional equivalent of an alkyl halide. for this to be proven as generally true, other transition metal catalysts capable of set-type coupling should work as well. the first choice for exploration in this regard was fe-based catalysis due to its numerous advertised benefits over ni, such as its lack of toxicity and wide abundance. yet, we sought more than just an alternative to ni for the same reaction. in an extensive study, the use of ni- and fe-based catalysts was benchmarked across a range of over 40 substrates (e.g., 130a, b) to understand the context-dependent advantages of each (figure 6 g). for the fe-system, a catalyst/ligand combination that was pioneered by nakamura and bedford for the analogous alkyl halides was employed. the findings were surprising in that fe catalysis enabled near-instantaneous reaction rates, applicability to tertiary systems (124) including access to exotic cubane structures (131 132), and superiority in the coupling of amino acid and unactivated primary systems (figure 6h). combined with the obvious advantages of fe over ni, this reaction may prove to be useful not only in a discovery setting but also in the demanding area of process chemistry. ni- and fe-catalyzed rae cross-coupling presumably operates under mechanisms analogous to those previously reported in the literature for ni- and fe-catalyzed cross-couplings (figure 6i) of alkyl halides. a low-valent fe or ni complex likely undergoes transmetalation with an organometallic reagent (133 134). set from 134 to the rae (124) generates a radical anion (137) that undergoes decarboxylative fragmentation to generate an alkyl radical (138). this alkyl radical then recombines with the metal center to form 136 (high selectivity of this heterocoupling process over homodimerization of 138 can be attributed to the pre, vide infra). the presence of radical intermediates in all of these transformations has been implicated in radical cyclopropane ring-opening experiments. further mechanistic studies are underway to understand the role of ligands, stoichiometry, and rae structure on reactivity. concurrent with our initial studies, weix and co-workers demonstrated the viability of raes in ni-catalyzed cross-electrophile couplings and found that aryl iodides as well as acid chlorides can be coupled to raes under ni catalysis (figure 6j). inspired by our work, others have adapted raes for additional ni-catalyzed transformations. judging by the hundreds of different known reactions of alkyl halides in set-based cross-couplings, it is anticipated that raes will find wide use and permit a broad array of carboxylic acid building blocks to be enlisted in similar transformations. they are generally inert to a host of reactive functionalities such as amines and alcohols. thus, radical reactions can often be carried out on complex substrates in open flasks. radicals frequently enable the most direct means of reactivity umpolung. due to their early transition states and lack of stifling aggregation spheres, these properties, in our view, make them eminent candidates to either provide a shortcut to known molecular frameworks or to open up new chemical space altogether. inspiring recent accomplishments, primarily from other laboratories, that may guide future directions of this vibrant discipline are organized into the following five sections: (1) unique reactivity that is also scalable (figure 7a), (2) rapid generation of complexity in total synthesis (figure 7b), (3) chemo- and regioselective transformations (figure 7c), (4) cross-coupling chemistry (figure 7d), and (5) enantioselective radical reactions (figure 7e). radical chemistry: selected highlights from the past 5 years that capitalize on the unique power of these reactive intermediates. mild and robust radical reactions have found numerous applications (figure 7a). this manganese-mediated reaction proceeds through the intermediacy of a benzylic radical and is complete within several minutes, allowing efficient radiolabeling of drug molecules such as enalaprilat with f to afford 139. a similar radical c h fluorination was utilized by merck to furnish -fluoroleucine methyl ester (140) en route to odanacatib; this protocol, based on polyoxometalate pet chemistry originating in the 1990s, was amenable to process scale in a continuous flow reactor. in another elegant masterpiece of process development, such efforts to harness radicals on a large scale are espoused by milder and more sustainable means of radical generation. in an illustrative example, electrochemistry was used to initiate a radical cationic cyclization, delivering diazonamide analogue dz-2384 (142) on a large scale; skeletons of complex terpenes could also be oxidized electrochemically in an environmentally benign fashion to furnish enones such as 143. meanwhile, potassium tert-butoxide was found to promote c h silylation via a putative radical species. this inexpensive and scalable reaction developed by stoltz and grubbs gives rapid access to silylated drug analogues such as 144, boding well for industrial applications. radicals have continued to play vital roles in the syntheses of complex molecules (figure 7b). while the ability of free radicals to propagate in chain reactions have always been exploited to forge multiple bonds simultaneously, increased mechanistic understanding of such processes enabled fine-tuning of selectivity, affording complexity in a controllable fashion. maimone s stunning synthesis of ()-6-epi-ophiobolin n (145) embodies this notion: not only did a radical cascade furnish the challenging skeleton in a single operation, the use of a thiol catalyst overrode inherent conformational bias to achieve the desired stereochemical outcome. in their syntheses of (+) -pleuromutilin (146) and ()-maoecrystal z (147), procter and reisman both made use of samarium iodide mediated radical cascades; these reactions expediently stitch together ubiquitous olefins and carbonyls. overman s synthesis of ()-aplyviolene (148) highlights radicals abilities to prevail against steric crowding, as a strategic radical conjugate addition was enlisted for the convergent union of two complex fragments. snyder s synthesis of (+) -scholarisine (149) reinforced this point a quaternary center is constructed via a tandem radical translocation cyclization. the affinity of radicals for peroxo species makes them ideal candidates for the rapid incorporation of oxygenated functionalities as well. this is evidenced through maimone s synthesis of (+) -cardamom peroxide (150) wherein three c o bonds are formed in a single step. oxidative radical cascades also permit the simultaneous construction of c o and c c bonds as can be illustrated by the syntheses of clavilactone a (151) and (+) -fusarisetin a (152) by li and theodorakis, respectively. the utility of radical cyclizations transcends the realm of natural products alabugin and co-workers, for example, employed a reductive radical cascade to prepare polyaromatic nanoribbons such as 153; this remarkable reaction accomplished five cyclizations, tremendously expediting their synthetic endeavor. zard s bidirectional ketone synthesis convergently merges unactivated olefins through a simple conjunctive radical precursor, offering an alternative retrosynthetic strategy to a diverse range of building blocks such as 154. chemo- and regioselective radical methodologies have continued to flourish (figure 7c). recent research has seen a renewed interest in the use of radicals to activate c h bonds. as has been reviewed extensively, such an approach allows selective functionalization of unactivated c for instance, in their collaborative synthesis of (+) -chlorolissoimide (155), alexanian and vanderwal took advantage of an intermolecular hlf reaction to directly effect regioselective c h chlorination on (+) -sclareolide. while a halogenated amine derivative (a chloroamide) was used to initiate c h abstraction as in the case of traditional hlf protocols, betley and co-workers demonstrated that simple azides are capable of similar reactivities. when treated with an iron complex, alkyl azides were transformed into cyclization products such as 156 via a radical pathway. in another variant of this classical reaction, yu and co-workers achieved a tandem c h functionalization whereby the lactam and olefin in 157 were forged in a single step through consecutive c h homolysis. through such processes, methods of intermolecular c these reactions enlist copper and iron catalysts to generate highly reactive radical species from selectfluor and zhdankin s reagent; in spite of their high energy, the ensuing radicals exhibited strikingly high selectivity toward complex substrates adorned with multiple functionalities products such as 158 and 159 are obtained in synthetically useful yields. s inspiring work on vinblastine analogues (160) is another testament to the unparalleled chemoselectivity of free radical processes. a late-stage hydroazidation was utilized, where a tertiary radical was formed from an olefin via hat (vide supra). azidation of this intermediate forged the final c n bond in the presence of multiple functionalities. notably, the scope of such hat-based methodology is expanding as novel hydrogen atom donors of varying selectivity profiles are being developed. curran s work on nhc-boranes provides an illustrative example whereby these complexes could selectively reduce alkyl halides in the presence of a labile epoxide to give 161. on top of carbon-centered radicals, the distinctive characteristics of radical chemistry highlighted above pertain to a variety of other species. n-centered (sulfonyl)imidyl radicals showed high reactivity and selectivity in their interactions with bioactive heteroarenes and functional polyaromatics to afford adducts such as 162 and 163. these radicals can be unleashed from bench-stable precursors through metal-mediated or photoinduced cleavage of n-heteroatom bonds. the oxygen-centered diradical derived from decomposition of phthaloyl peroxide was found to selectively react with arenes, affording complex phenols such as 164 while sparing various reactive aliphatic c h bonds. the peculiar selectivity can be explained by a reverse rebound mechanism. another emerging approach to arene functionalization exploits the high electrophilicity of aromatic radical cations. these transient species can be obtained electrochemically or through photoinduced or transition-metal-mediated electron transfer, as shown by the groups of yoshida, nicewicz, and ritter, respectively. in each case, arenes were selectively oxidized into the radical cations, leaving different functionalities unscathed. regioselective trapping by nitrogen-centered nucleophiles formed amination products such as 165, 166, and 167. cross-coupling reactions represent yet another exciting avenue in recent radical research. building upon kochi s illuminating legacy, empowering synergy between radicals and metal complexes through the pre (vide infra) has significantly expanded the scope of cross-coupling. through radical reactivity, fu and co-workers demonstrated the challenging coupling of unactivated tertiary halides with boronic acid derivatives (figure 7d). nickel s propensity to undergo set was harnessed to generate carbon-centered radicals, overcoming hindered halides inertia toward two-electron oxidative additions. quaternary centers as in the case of 168 can be constructed. in a similar vein, molander designed a single-electron transmetalation process wherein alkyl trifluoroborates were homolyzed under pet conditions, and the resulting benzyl radical engaged in nickel-mediated coupling. products such as 169, which are difficult to access via classical suzuki coupling, can be obtained. radicals derived from stabilized carboxylic acids through pet undergo similar nickel-catalyzed reactions. single-electron processes involving radicals have also been harnessed to aid challenging c n coupling reactions. through photoinduced phenyl radical generation, fu and peters developed ullmann-type couplings of various nucleophiles. this approach led to aryl amines such as 170 under mild conditions, obviating the need for prolonged heating. n coupling of unactivated secondary and tertiary halides using set-initiated radical formation, affording hindered amine derivates such as 171. alkyl radicals derived from hunsdiecker-type reactions were also shown to undergo copper-mediated c an important ramification of this metal radical synergy is the possibility of conducting enantioselective radical reactions with chiral metal complexes. to this end, buchwald elegantly showcased a convenient method to access enantioenriched butyrolactones (173) via copper-mediated enantioselective cyclization. it is noteworthy that this reaction may be initiated by a broad range of radical species. chiral copper catalyst also allowed stahl and liu to achieve enantioselective benzylic cyanation through a radical relay fu and macmillan synthesized chiral carbamates such as 175, utilizing a chiral nickel catalyst to capture stabilized -amino radicals derived from pet. weix and co-workers reported that when the nugent rajanbabu reaction was performed with a chiral titanium complex, the resulting radical could be intercepted with nickel in an enantioselective coupling, leading to 176. in a different approach, drawing inspiration from roberts s precedent, maruoka and co-workers utilized a chiral thiyl radical to mediate enantioselective tandem c c bond formation. thiyl radicals predisposition to undergo reversible additions with olefins allowed them to be used in catalytic quantities (3%), while the temporal incorporation of chirality led to 177 in good enantiomeric excess. ingold pre undergirds a significant portion of the chemistry highlighted in figure 7 and warrants further discussion. high selectivity in many radical processes seems baffling at first, as most carbon-centered radicals are transient species (rtra, figure 8) which are expected to recombine at diffusion rates before engaging in any productive reactions. pre offers a means of suppressing this ultra-fast self-destruction using persistent radicals (rper) that have lower rates of dimerization. when rtra and rper are formed at equal rates in a reaction, incipient homocoupling of rtra quickly depletes its concentration, leading to a buildup of rper. under steady-state conditions, this excess rper scavenges any rtra that is formed, thereby favoring cross-coupling products. revisiting the persistent radical effect (pre). this phenomenon underscores the photostability of vitamin b12: when the c co bond in methylcobalamin (178) is photolyzed, dimerization between the resulting methyl radical is kept minimal by the persistent co(ii) complex 179. instead, heterocoupling quenches the reactive methyl radicals to regenerate the vitamin (figure 8a) in a degenerate pathway. this equilibrium can be altered in the presence of a radical trap whereby transient radicals derived from cobalamine mimics (e.g., 180) can engage in irreversible addition reactions (182 183). since homodimerization of 182 is suppressed through pre and reversible heterocoupling with 181 regenerates 180, cyclization proceeds cleanly as the only net reaction. the profound impact of pre extends far beyond organocobalt chemistry it underlies the resurgent interests in radical-based cross couplings. most paramagnetic metal complexes can be construed as persistent radicals. in cross-coupling reactions, set between metal catalysts and organic electrophiles (halides or rae) generates these species (186, m=ni(i), pd(i), cu(ii), etc.) at equal rates as transient carbon-centered radicals (e.g., 187). owing to the pre, dimerization of 187 is disfavored, and recombination with the paramagnetic metal occurs preferentially (186+187 188). cross-coupling products can thus be selectively furnished after the ensuing reductive elimination step (188 189). aside from metal complexes, the barton photolysis (190 194, figure 8b) provides an illustrative example. in this case, the long-lived nitrite radical 191 allows translocation of the alkoxy radical 192 to outcompete premature termination via dimerization. pre also accounts for the selective coupling between the resulting carbon-centered radical 193 with 192 to afford the final product 194. in an analogous fashion, pre is operative in many other radical-mediated c h functionalizations using haloamides, halogenated amines (e.g., hlf, vide supra), or hypoiodites (e.g., surez reaction). nitroxides, exemplified by tempo (196), constitute another important class of persistent organic radicals. while their application in tandem cyclizations (195 198) is depicted in figure 8, these highly stable radicals have also played pivotal roles in living polymerization reactions. since the focus of this perspective is on the area of small-molecule chemistry, a detailed discussion of these radical polymerization reactions is beyond the scope. despite this, the collection of studies in this section remains a stunning testament to the versatility of radical species. they enable rapid and practical routes to complex molecules or new bond disconnections that would have been unimaginable even a few years ago. hence, radicals can provide an opportunity to consider radically different ways of achieving new transformations or synthesis plans. progress in so many areas of societal need, from agrochemicals to drugs, relies on advances in organic chemistry. a perfect storm of shortened timelines, increased regulatory hurdles, and shrinking ip space has created an ideal opportunity for synthesis to make a real difference., they can save chemists enormous amounts of time and can access wide areas of unexplored chemical space. in fact, the studies originating from our laboratory outlined in this perspective were born out of necessity: simplifying the synthesis of complex natural products in many cases required the invention of powerful radical-based reactions. interactions with industry inspired our group to apply the aforementioned advantages of radicals to areas of great need. looking forward, one can anticipate exciting new frontiers enabled by radical chemistry, such as asymmetric cross-couplings of unstabilized systems, regiocontrolled minisci-type functionalizations, and programmed cross-couplings of olefin-derived radicals. one thing is clear: the translational potential of radicals is high, and it has only just begun to be exploited.

this perspective illustrates the defining characteristics of free radical chemistry, beginning with its rich and storied history. studies from our laboratory are discussed along with recent developments emanating from others in this burgeoning area. the practicality and chemoselectivity of radical reactions enable rapid access to molecules of relevance to drug discovery, agrochemistry, material science, and other disciplines. thus, these reactive intermediates possess inherent translational potential, as they can be widely used to expedite scientific endeavors for the betterment of humankind.

PMC5054485

pubmed-875

ependymomas are relatively rare neuroepithelial tumors and account for 3 to 7% of all central nervous system tumors. the incidence of ependymomas is more frequent in children, and 50% occur in children<5 years of age. infratentorial locations of ependymomas are more frequent in infants and childhood, whereas supratentorial ependymomas are more often seen in adults.1 ependymal tumors are closely related to the ventricular system and central canal. they can be observed extradurally in the sacral region and in the subarachnoidal space of the hemispheres. the most common location for infratentorial ependymomas is inside the fourth ventricle.2 the clinical signs and symptoms of intracranial ependymomas depend on the location, size of the tumor, and the age of the patient. the symptoms in posterior fossa ependymomas are related to increased intracranial pressure from hydrocephalus caused by obstruction of the fourth ventricle. ataxia, dizziness, hemiparesis, and visual disturbance may add to the clinical picture.1 2 the current imaging protocol for the diagnosis is magnetic resonance imaging (mri). the most characteristic finding on mri is a downward extrusion of the tumor through the foramen of magendie into the cervical subarachnoid cervical space or through the foramen of luschka into the cerebellopontine cistern.3 4 this presentation highlights the requirement for close follow-up of grade ii ependymomas for anaplastic transformation. his eyes were open spontaneously; however, his left eye was looking at medial and downside, and his left eye gaze was limited to upside and lateral. an infratentorial brain tumor in the median and right cerebellar area was found on contrast mri. axial initial magnetic resonance imaging scans show posterior fossa mass filled in fourth ventricle (a) with nonhomogeneous slight contrast enhancement (b). severe hydrocephalus can be seen with temporal horn filling secondary to the obstruction of the fourth ventricle. postoperative axial (c) and coronal contrasted images (d) show complete resection of the mass with opening of the fourth ventricle and relaxation of the temporal horns. the patient presented with vomiting and visual disturbance to the pediatric emergency department 12 months later. on the second operation, the tumor was hard to aspirate with the cavitron ultrasonic surgical aspirator (sonoca 400, sring gmbh, quickborn, germany) and was adherent to the brainstem and lower cranial nerves. only subtotal extirpation could be achieved (fig. the recurrent tumor showed anaplastic features such as nuclear pleomorphisms and necrosis with pseudopalisading (fig. 3). postcontrast axial (a) and coronal (b) images show regrowth of the mass lesion with strong contrast uptake. (a) moderately cellular tumor composed of monomorphic cells with round to oval nuclei containing salt and pepper pattern of chromatin. radially arranged ependymal cell processes become thinner toward the vascular wall leaving an acellular zone around the blood vessel, called perivascular pseudorosette, a key histologic feature for ependymoma (hematoxylin and eosin [h&e] 100). after the second operation (b) abundant endothelial proliferation, microvascular proliferation, hypercellularity with nuclear hyperchromasia, pleomorphism, numerous mitoses, and pseudopalisading necrosis warrants a diagnosis of anaplastic ependymoma when seen throughout the lesion (h&e 200). moreover (c), focus of coagulative necrosis, nuclear pseudopalisading was prominent around the necrotic areas, tumor cells oriented closer to viable areas emphasizing anaplastic changes (h&e 200). ki-67 immunolabeling index is an independent prognostic factor and accurate predictor of outcome in patients with intracranial ependymoma (d). the index was 10% in the first operation that increased to 35% for our case in this image (ki-67 200). bailey and cushing recognized ependymomas as an independent entity in their first brain tumor classification in 1926. variants were subsequently established. the most recent world health organization (who) classification identified four variants of ependymal tumors in addition to three grades of malignancy.5 6 these four variants are myxopapillary ependymoma, subependymoma, tanycytic ependymoma, and clear cell ependymoma.3 6 7 myxopapillary ependymomas and subependymomas are slow-growing tumors classified as grade i. both lesions are easily recognizable lesions; grade iii ependymomas have increased cellularity and brisk mitotic activity, often associated with microvascular proliferation and pseudo palisading necrosis. their results showed that poor clinical results paralleled histopathologic grade.8 the outcome of children with intracranial ependymomas has improved significantly during the last few years. recent reports demonstrate a 5-year overall survival rate not more than 40 to 65% in children with intracranial ependymomas.9 10 11 12 pediatric oncology group findings suggest that the poor survival estimates frequently reported for infants are most likely related to the higher incidence of infratentorial tumors, the lower rate of complete resection, and the delay of the administration of radiation therapy.13 the extent of surgical resection appears to be the other important prognostic factor in outcome for children with intracranial ependymomas. in patients with complete removal, 5-year survival is 67 to 80%; 5-year progression-free survival is 51 to 75%.14 15 16 studies have shown that patients with ependymoma who receive radiation therapy have a better outcome than who are not treated with irradiation.17 18 however, there is no standard protocol for optimal management for children with intracranial ependymomas. total/near-total surgical resection with an acceptable neurologic outcome combined with postoperative radiation therapy is the current treatment modality. immediate postoperative irradiation is not widely accepted in the treatment of children<3 years of age. stereotactic radiosurgery has been applied to manage recurrent or residual intracranial tumor in some institutions. some reports described that adjuvant chemotherapy did not influence survival of patient with anaplastic ependymomas.18 19 20 the most common location for infratentorial ependymoma is within the fourth ventricle. the selected surgical approach may be a suboccipital craniotomy with or without c1 laminectomy depending on the extension of the tumor in the cervical region. surgical resection appears to the most important prognostic factor; therefore the best effort to perform total or near-total resection should be made.21 22 in conclusion, the ependymomas of the children are difficult to control, and surgical removal remains the mainstay of the treatment. despite a gross total resection, the correct grading of intracranial ependymomas may be difficult for the anaplastic variant because the common criteria for anaplasia are not completely reliable for all cases.13 22 ependymomas in young infants have a worse prognosis than older children, so we need a grading scheme with a proven general ability to distinguish grades and to predict the evolution of individual cases.23 also new radiation therapy techniques and chemotherapeutic agents need to be developed. postoperative irradiation is not recommended in the treatment of grade ii ependymomas for children<3 years of age.

ependymomas are central nervous system neoplasms that account for a third of all posterior fossa tumors in children. the most common location for infratentorial ependymoma is within the fourth ventricle. we present a case report of malignant transformation of an infratentorial grade ii ependymoma in a 2-year-old child who presented with vomiting and visual disturbance. an infratentorial brain tumor in the left cerebellar area was totally removed, and the initial pathologic diagnosis was grade ii ependymoma. the tumor recurred aggressively 1 year later; subtotal removal and adjuvant chemotherapy were performed. after a second operation, a histopathologic study was performed. the second specimen was defined as a grade iii anaplastic ependymoma. transformation to grade iii anaplastic ependymoma is possible for a grade ii ependymoma but very rare. the diagnosis of the anaplastic variant of intracranial ependymomas is difficult. surgical treatment remains the mainstay of the treatment for all cases. ependymomas in young infants have a worse prognosis than older children, so we need individual clinical evaluation and close follow-up of such cases. this article highlights the requirement of a close follow-up for grade ii ependymomas for anaplastic transformation.

PMC4520988

pubmed-876

although radical cystectomy with urinary diversion has been regarded as the standard treatment for muscle invasive bladder cancer (mibc), it is associated with high postoperative complication and mortality as well as decreased quality of life. as a result, different kinds of bladder sparing approaches have been proposed for mibc treatment. partial cystectomy (pc) with pelvic lymph node dissection (plnd) combined with chemotherapy or radiotherapy, which offers complete tumor resection, accurate staging and good quality of life, is regarded as a good bladder sparing treatment modality. even though, pc is still criticized for an unacceptable high recurrence rate. recurrent bladder carcinoma after pc is usually correctly diagnosed by urologists, because of the appearance of typical papillary in ultrasonography or cystoscopy, and can be easily confirmed by tumor biopsy. however, in this case series, we presented 3 patients with rare deceptive benign appearance of recurrent mibc after pc, which delayed timely diagnosis and treatment for 2 of them. from january 2010 to december 2014, 93 consecutive patients underwent pc in our institution. of these patients, 56 cases of pc with plnd were performed for mibc. with a median follow-up of 21 months (range 452 months), 16 patients (28.6%) of the 16 patients who had bladder tumor recurrence, 2 men were diagnosed as deceptive mibc recurrence after pc. during the same period of time, one another patient, who was referred to our hospital, presented the same characteristics of tumor recurrence in the course of disease. all the patients declined cystectomy after transurethral resection of bladder tumors (turbt) confirmed mibc, and pc with plnd was thus performed instead. as lesions of the 3 patients were within 2 cm to ureteral orifice, ureteral reimplantation was performed at the same time. all patients recovered from pc surgery uneventfully and received 6 cycles of gemcitabine and cisplatinchemotherapy after surgery. all interventions given were part of normal health care and ethicalapproval was thus not necessary needed. lesions, measuring 2.5 1 cm, with cystitis glandularis appearance were found at the right lateral wall of bladder when the patient underwent cystoscopy 9 months after cystectomy. the pathology result of random biopsy at 3 different sites of the lesion showed cystitis glandularis with von brunn's nests proliferation. two months later, the patient presented gross hematuria, and contrast-enhanced pelvic computed tomography (ct) revealed irregular thickening and significantly enhanced bladder wall. the size of the lesion was found slightly increased in cystoscopy; however, the pathology of random biopsy still showed cystitis glandularis. turbt was then performed, and high-grade muscle invasive urothelial carcinoma with urothelialcystitis glandularis was diagnosed by pathological examination. cystoscopic evaluation revealed polypoidlesion, measuring 2 1 cm, on the left bladder wall 6 months after pc. turbt was carried out and the pathology showed high-grade muscle invasive urothelial bladder cancer. cystectomy with orthotopicneo bladder diversion was thus performed, and the patient was now still alive without bladder tumor recurrence for 48 months. polypoid lesions, measuring 1 1 cm, on the right bladder wall near the internal urethral orifice were found at cystoscopy 3 months after pc in another hospital. pathologic examination of biopsy showed chronic bladder inflammation with proliferation of von brunn's nests. he was referred into our hospital 2 months later because of right renal area dull pain. however, computed tomography urography (ctu) revealed right-sided hydroureteronephrosis and thicken bladder wall with unclear boundary to the surrounding tissue (figure 1b, figure 1c). comparison between the ct scan after tumor recurrence and before pc were made in figure 1. turbt was performed and the pathological evaluation revealed high-grade muscle invasive bladder urothelial carcinoma. the patient underwent cystectomy with ileal conduit diversion, and the gross pathologic examination showed that the bladder cancer had infiltrated the surrounding tissue with one lymph node metastasis. a. cystoscopy displayed cystitis glandularis appearance lesion (solid asterisk) on the right bladder wall near the internal urethral orifice; b. ctu confirmed hydroureteronephrosis (hollow asterisk) caused by mass on the right lateral bladder wall (black arrow); c. transverse ct image showed an irregular right lateral bladder wall thickened with unclear boundary to the surrounding tissue (black arrow); d. ct confirmed bladder mass on the right lateral bladder wall before bladder sparing treatment (white arrow). bladder sparing treatment is considered as an important alternative treatment approach for mibc. nowadays, various modalities of bladder-sparing methods have been reported and investigated, among which pc with plnd after completeness of turbt plus chemotherapy or radiotherapy is regarded as a rational one. it was reported that the 5-year cancer specific survival rate after pc bladder sparing treatment ranges from 67% to 69%. although the 5-year survival rate of pc is comparable to radical cystectomy, and the quality of life for mibc patients have been greatly improved, this therapeutic approach has not yet been regarded as a standard treatment option for mibc because of lack of randomizedtrials. critics of pc also argued that the tumor recurrence rate after pc was relatively high, which ranged from 19% to 58%, and two-thirds of tumor recurrence appeared during the first 2 years. as a result, one important component of bladder sparing treatment modality was vigilant surveillance after surgery, because early detection of tumor recurrence resulted in excellent outcome of salvage radical cystectomy. however, the window to salvage cystectomy was short, and the disease carried a poor prognosis once patients developed extravesical disease caused by delayed diagnosis. regular cystoscopy and random biopsy of suspected lesion played a pivotal role in detecting early recurrence. however, in the present study, 3 patients showed deceptive early mibc recurrence with a cystitis glandularis crust covered on the surface after bladder sparing treatment, escaping random multiple biopsies. as a consequence, 2 patients missed the optimal opportunity for early diagnosis and delayed timely cystectomy. enhanced ct and ctu were also the preferred method for bladder surveillance, which showed high accuracy for detecting and staging urinary tract cancer. although biopsy revealed negative results in the present cases, ct or ctu showed enhanced and thickened bladder wall, which suggested highly suspicious of bladder cancer recurrence. therefore, patients showed suspicious lesions in cystoscopy with negative biopsy, enhanced ct or ctu should be recommended for further evaluation rather than watchful waiting. someinvasive variants, such as nested variant and microcystic carcinoma, might even mimic benign lesions, which may cause difficulties for pathologists in the differential diagnosis. however, in the present study, the pathological sections of the biopsy tissue obtained at cystoscopy of the 3 patients were blindly sent to 2 different pathologists for further evaluation after turbt confirmed mibc, the results were also suggestive of benign tissue, excluding the possibility of nested variant or microcysticurothelial carcinoma. the relationship between the formation of cystitis glandularis and mibc recurrence was unknown, but several factors might contribute to the deceptive appearance formation. first, such situation potentially reflected a response to bladder injury or chronic bladder inflammation caused by bladder surgery. in addition, ureteral reimplantation was reported to be associated with high recurrence and poor prognosis after pc. it was interesting that all patients with deceptive mibc recurrence had undergone ureteral reimplantation, which suggested that ureteral reimplantation might be a risk factor for such kind of recurrence. early mibc recurrence after bladder sparing therapy could simultaneously occurred with cystitis glandularis caused by bladder surgery; this rare situation might lead to diagnosis of cystitis glandularis without realizing bladder cancer recurrence and missed the best treatment opportunity. the present cases served to remind and alert the urologists to be aware of the possibility of bladder cancer recurrence even when the biopsy of the bladder lesion was benign. as a result, timely pelvic enhanced ct and turbt were necessary when bladder lesion occurred after pc, avoiding the possibility of missing mibc recurrence and delaying timely cystectomy.

abstractmost of recurrent bladder carcinoma after partial cystectomy did not cause diagnostic difficulties for urologists, because of the appearance of typical papillary in ultrasonography or cystoscopy, and could be easily confirmed by tumor biopsy. three patients, ages from 35 to 62 years, had undergone bladder sparing treatment for muscle invasive bladder cancer, all of them had biopsy revealed benign bladder lesion at surveillance cystoscopy. however, transurethral resection of bladder tumor showed high-grade muscle invasive urothelial bladder carcinoma for these patients. two patients were thus delayed for timely cystectomy and consequently resulted in local or distal metastasis.as a result, we recommended that timely pelvic enhanced computed tomography and transurethral resection of bladder tumor were necessary when bladder lesion occurred after partial cystectomy, avoiding the possibility of missing muscle invasive urothelial bladder carcinoma recurrence and delaying timely cystectomy.

PMC4616362

pubmed-877

the success of radiotherapy (rt) depends not upon the expense and complexity involved, but upon the correctness of techniques. correct portal-design calls for correct knowledge regarding the location of the target volumes to be treated. traditional bony-landmarks may have been used as a surrogate, but they do not always correlate with the actual location of the soft-tissue target-volumes. the four-field-box (4fb) technique for cervical carcinoma is often utilized to improve dose homogeneity. the exact placement of the posterior border on the lateral portals of this technique is unfortunately not supported by stone-hard consensus; placing it at the s2-s3 junction may increase the chance of sparing rectum but at the risk of target-miss. we intend to demonstrate the potential benefits with the use of sectional imaging in safely delineating target-volumes. a lady on evaluation and referral from her gynecologist, presented to us with the diagnosis of stage-ib2 cervical-carcinoma staged as per the figo (federation of international gynaecologists and obstetricians) system. as we were preparing to initiate this patient on a course of concurrent chemo-rt, we had the opportunity to review her magnetic-resonance imaging (mri) films obtained earlier by her gynecologist. we noticed a stark retroversion of the uterus, which almost abutted the sacrum [figure 1]. this finding made us ponder over the potential perils associated with the conventional 4fb technique, which is widely utilized worldwide for portal design for cervical-carcinomas. given that the uterine and cervical lymphatics are interconnected, and that disease extension from the cervix to the uterus is highly probable, the current consensus state that the entire uterine-corpus should be a part of the clinical-target-volume (ctv) for every patient of cervical-carcinoma. the uterus, being a mobile organ may manifest various positions, which can not be taken into account during bony-landmark based planning. unless the true position of the uterus can be determined with imaging, it would be risky to place the posterior-margin of lateral fields at the s2-s3 junction. magnetic resonance imaging showing a retroverted uterine corpus extending well beyond the posterior border of the s2-s3 junction concurrent chemo-rt is a standard of care in the curative approach for stage-ib2 cervical-carcinoma. though there has been a recent emergence of the use of 3d-imaging based techniques, however, a considerable majority of patients across the world are treated with traditional rt techniques even to this day, mainly owing to the fact that cervical-cancer is mainly a disease of the developing world which suffers shortages with regards to advanced planning and treatment systems. conventional techniques may involve either the opposed anteroposterior-posteroanterior (ap/pa) two-field technique, or the 4fb technique-planned using radiologically determined bony-landmarks. in the 4fb technique, lateral portals are added with an intention to reduce the dose to the bowel anteriorly and to the rectum posteriorly. conventional techniques have been found to provide equivalent results in comparison to 3d-rt, which is more expensive and complex. however, inadequate coverage with improper portal-design can preclude chances of cure. the ap and pa field definitions are similar with the two-field and the 4fb technique. the caveat with the implementation of the 4fb technique has always been (and still continues to be) the fact that are no unanimous guidelines regarding the margin definitions for the lateral portals. the controversy lies in the definition of the posterior-margin of the lateral-portal. some authorities recommend its placement at or 0.5 cm posterior to the anterior-border of the s2-s3 interspace. with particular reference to the treatment of stage-ib carcinomas, one definition suggests that the posterior border be placed in such a way as to cover atleast 50% of the rectum. however, our point of contention would be that such a definition would be oblivious to the status of the uterine-position [figure 1] and rectal-distension. placing the posterior-margin of the lateral-portals at s2-s3 junction using bony references from radiographs was found to be inadequate to cover the ctv in patients with bulky-disease. an evaluation of the ctv coverage by using the s2-s3 junction for the posterior border of the lateral fields revealed an inability to cover the optimal target-volumes in about half of the stage-ib patients.[57] the consequent effects on local-control were also quantified. among stage-ib patients, the local-control at 3-years was 100% for patients who had adequate margins, compared to a drastically reduced value of 71% for patients of the same stage with inadequate margins. since cervical carcinoma is staged clinically with the figo-system (which gives no regard to the utility of imaging to describe uterine-corpus involvement), it would be potentially dangerous to apply a one definition fits all philosophy in designing portals for patients with staged ib2 with the figo system. the current consensus recommends the inclusion of the entire uterine-corpus into the ctv mainly since the uterine and cervical lymphatics are interconnected. retroverted uterus (after all, a normal variation of the uterine-position) may extend well beyond the line falling from the s2-s3 junction [figure 1]. the presence of uterine-retroversion is unlikely to be detected unless use is made of ct or mri. given that the ctv would be incomplete without the inclusion of the entire uterus, the design of lateral portals of the 4fb technique should never be based on bony references. it should be individualized to the patient's soft-tissue imaging (with ct/mri) obtained in the treatment position. usage of bony-landmarks for portal definition is insensitive to uterine flexion/version, which would be influenced by bladder and rectal filling. mri, if used in treatment planning provides a very accurate definition of the individual morbid anatomy. lateral portals designed using sagittal mri would help in a safe and confident placement of posterior margins. ct would be a reasonable alternative if mri based planning is unavailable, given that vivid soft-tissue detail and accurate reconstructions can be had with helical ct-scanners. in concluding, we remind the reader that as per current consensus, the ctv for cervical-carcinoma would be incomplete without the inclusion of the entire uterus. the uterus is not a fixed organ, and has many possible variations in its position, which can not be encompassed by bony-landmark based planning. ct/mri based target delineation provides an opportunity to take the uterine position and bulk into account.

radiation therapy (rt) plays a pivotal role in the curative approach for carcinoma of the cervix. inspite of the emergence of various new conformal techniques in rt, conventional techniques still hold vital importance. majority of the patients worldwide are treated with 2d-rt techniques. 2d-rt techniques have been proven to be non-inferior and simpler in comparison to 3d-rt in the context of carcinoma of the cervix. however, inadequate target volume coverage with improper portal design can preclude the chances of cure. we demonstrate the need for abolishing guesswork in terms of target volume determination through the example of a patient's sagittal magnetic resonance image showing a case of the retroverted uterus which would have been likely to be missed from the treatment portals if they were designed using definitions based on bony landmarks.

PMC3607345

pubmed-878

cardiac implantable electronic devices (cieds) have become increasingly important in cardiac disease management worldwide. in fact, pacemakers, implantable cardioverter defibrillators (icds), and cardiac resynchronization therapy (crt) have been used and developed since the 1960s. with the increase in the number of patients with cieds, the number of the cied-related complications, including infection, has also been increasing. from 1996 to 2003, the rates of hospitalization for cied infection reportedly increased faster than the rates of cied implantation. in patients with cied infection, complete removal of all hardware, regardless of location (subcutaneous, transvenous, or epicardial), is the recommended treatment. various tools (traction devices, mechanical sheaths, laser sheaths, electrosurgical sheaths, rotating threaded tip sheath, and telescoping sheaths) and methods (femoral approach, internal jugular approach, and a hybrid method with both, transvenous and surgical methods) have been developed for lead removal, and favorable results have been reported ,. however, data to determine the optimal duration of antimicrobial therapy for cied infection are limited. further, data on appropriate management after cied removal are also not available, although management of arrhythmic support after cied removal is needed until a new cied is implanted. in the present review, before a cied can be removed, the consequences of removal need to be ascertained. patients dependence on pacemakers, the risk of tachyarrhythmia, and requirement of crt must be determined, and the strategy for antiarrhythmic management should be determined on the basis of these investigations. second, until the new cied is implanted, temporary pacing should be set up, especially in patients completely dependent on a pacemaker, using tools such as passive fixation leads, active fixation leads, and epicardial leads. in their prospective, controlled study, braun et al. reported that transvenous pacing with active fixation is safe and is associated with a significantly lower rate of pacing-related adverse events than the standard technique of transvenous pacing using a passive external pacing catheter. forty-nine patients with systemic infection and hemodynamic-relevant bradyarrhythmia were temporarily paced using either a conventional pacing wire/catheter (n=26, reference group) or a permanent bipolar active pacing lead, which was placed transcutaneously in the right ventricle and connected to an external pacing generator (n=23, external lead group). the sensing values in the two groups were almost identical, but the median pacing threshold was significantly higher in the reference group (1.0 v vs. 0.6 v, p<0.05). within comparable durations of pacing (median: 8.2 vs. 7.7 days), there were 24 pacing-related adverse events (including dislocation, resuscitation due to severe bradycardia, and local infection) in the reference group but only one in the external lead group (p<0.01). active fixation of temporary leads was only introduced in japan in 2013. moreover, a 2-week gap is generally observed between cied removal and new cied implantation in patients with pocket infection and a 46-week gap in patients with systemic infection. therefore, especially in patients completely dependent on pacing, permanent active fixation of leads permitting bipolar stimulation has been used for temporary pacing (fig. these leads carry a very low risk of percutaneous infection and lead dysfunction for a couple of weeks. no clinical trial data are available for determining the optimal duration of antimicrobial therapy for cied infection. however, therapy for 1014 days after device removal is considered reasonable when cied infection is limited to the pocket site, while at least 24 weeks of parenteral therapy after extraction of the infected device is recommended for patients with bloodstream infection. only one study has reported simultaneous contralateral (side-to-side) replacement of an infected cied. a one-stage exchange was performed in 68 consecutive patients over a 14-year period by a single cardiologist, and dual-chamber devices were used in two-thirds of these patients. clinical presentations included device erosion (41%), cellulitis or abscess (35%), and endocarditis (24%). fifty-nine patients (87%) were followed up for more than 1 year, and 9 patients were lost to follow-up at 110 months after the one-stage contralateral device exchange, with no newly identified cied infections. additional experience with one-stage contralateral device exchange is needed before it can be recommended for routine use. the patient had cied infection on both sides, and open chest surgery was needed to remove all cieds. no re-infection was noted in the 2year follow-up period. in the other case, early re-implantation was performed because the patient experienced dementia and restlessness 3 days after cied removal. in this case as well, no re-infection was noted in the 2-year follow-up period. patients with high-energy cieds are more likely to develop an infection than patients with a pacemaker. patients with a high risk of tachyarrhythmia should be temporarily managed using tools such as wearable cardioverter defibrillators (wcds) and catheter ablation. healy et al. reported on the cost effectiveness of using wcds (fig. the incremental cost effectiveness of wcds was $20,300 per life-year or $26,436 per quality-adjusted life-year (qaly) as compared to discharge to home without a wcd. discharge to a skilled nursing facility and in-hospital monitoring resulted in higher costs and poorer clinical outcomes. the incremental cost-effectiveness ratio was as low as $15,392/qaly if the wcds successfully terminated 95% of sudden cardiac arrest (sca) events and exceeded the $50,000/qaly willingness-to-pay threshold if their efficacy was<69%. use of wcds remained cost effective, assuming a 2-month sca risk of 5.6%, as long as the time to reimplantation was at least 2 weeks. conducted a retrospective study on all wcd patients who underwent icd removal because of cardiac device infections at two referral centers. the median daily wcd use was 20 h/day and the median duration of use was 21 days. two patients had four episodes of sustained ventricular tachycardia (vt), which were successfully terminated by the wcd. this previous study concluded that the wcd can prevent sudden cardiac death until icd reimplantation is possible in patients from whom the cied has been removed because of cied infection. in japan, because most patients with cied infection are not discharged until a new cied is implanted and are monitored by a telemetry device, the rate of sudden death during the waiting period is low. however, wcd seems to be safer than only monitoring, even when the patients are hospitalized. s-icds are beneficial because they carry no risk of vascular injury, have a low risk of systemic infection, and have no need for fluoroscopy. although s-icds are not a temporary system, they may be suitable for early reimplantation in patients at a high risk of tachyarrhythmia. we encountered one case of successful ablation before removal of an infected crt-d. the patient was a 72-year-old woman with complete av block, sustained vt, and cardiac sarcoidosis. the vt was controlled using amiodarone and pilsicainide, but a vt storm occurred after pilsicainide was withdrawn. because the lv ejection fraction was less than 30% the vt was finally eliminated by catheter ablation, and it did not recur after implantation of a new cied. thus, catheter ablation may be another useful method for managing tachyarrhythmia during the waiting period. in patients dependent on crt, it is very difficult to maintain hemodynamics by using temporary vvi pacing after cied removal. to our knowledge, we encountered two cases in which temporary sequential pacing was used during the waiting period. the first was that of a 77-year-old man who suffered from a complete av block, sustained vt, and cardiac sarcoidosis. vvi pacing instead of crt aggravated the hemodynamic state (cardiac index [ci]=2.27 l min m in ddd with biv pacing; 1.76 l min m in vvi with rv pacing). the hemodynamic state was maintained for 2 weeks, and a new crt-d was successfully implanted after the infection disappeared. the other case was that of a 72-year-old woman with complete av block, sustained vt, and cardiac sarcoidosis. her pacemaker was upgraded to crt-d at the time of mitral valve replacement, and the lv lead was an epicardial lead (fig. vvi pacing instead of crt aggravated the hemodynamic state (ci=1.95 l min m in ddd with biv pacing; 1.74 l min m in ddd with only rv pacing; 1.45 l min m in vvi with rv pacing). the lateral chest wall was opened to remove the lv epicardial lead, but because of adhesion of the left lung, the lv lead was only partially removed. temporary epicardial atrial and lv leads were implanted. a temporary rv lead (with a permanent active fixation lead) the hemodynamic state was maintained for 2 weeks, and a new crt-d was successfully implanted after infection disappeared. we have never used a temporary transvenous lv lead, which may be required in some cases. various methods can be used for arrhythmic management during the waiting period before new cied implantation. the aim should be to use an appropriate method to prevent the occurrence of arrhythmic events.

arrhythmic management is needed after removal of cardiac implantable electronic devices (cieds). patients completely dependent on cieds need temporary device back-up until new cieds are implanted. various methods are available for device back-up, and the appropriate management varies among patients. the duration from cied removal to implantation of a new cied also differs among patients. temporary pacing is needed for patients with bradycardia, a wearable cardioverter defibrillator (wcd) or catheter ablation is needed for patients with tachyarrhythmia, and sequential pacing is needed for patients dependent on cardiac resynchronization therapy. the present review focuses on arrhythmic management after cied removal.

PMC4996859

pubmed-879

idiopathic hypereosinophilic syndrome (he s) is characterized by persistent or recurrent hypereosinophilia of unknown origin. currently, we recognize that he s consists of the myeloproliferative form and the lymphocytic form (t-cell-mediated disorders).1 recent identification of fip1l1-pdgfra fusion gene-positive he s, as a subgroup, has opened a door to innovative treatment using imatinib mesylate in patients with a subset of hes.2,3 however, treatment of other patients with a heterogeneous subgroup of gleich syndrome (periodic angioedema and eosinophilia) and other types of he s without known pathogenesis remains to be explored in future. the causes of periodic oscillating hypereosinophilia411 are often obscure and need to be precisely diagnosed clinically and/or molecularly for the most effective therapy. the patient reported here has shown significant periodic oscillating hypereosinophilia, which was shown to be fip1l1-pdgfra fusion gene-negative, and was suspected to have gleich syndrome, but not a version compatible with cases previously described. our patient is considered to have a distinct subtype of he s in which we documented (a) the pattern of seasonal oscillation of eosinophilia over 6 years and (b) effective control of eosinophilia with a combination of cyclosporin a, suplatast tosilate, and a small dose of prednisolone. a 29-year-old male patient with periodic oscillating hypereosinophilia was first diagnosed to have he s (absolute eosinophil counts (aec)>1500/l) at age 21. from age 21 to 26 years, he was treated for he s at a local hospital on and off with oral prednisolone, but details of the oscillating pattern were unknown. since he was referred to us, his he s was found to be characterized by high levels of serum soluble il-2r (up to 2700 u/ml; normal<518 u/ml), igm (up to 1140 mg/dl; normal<190 mg/dl), tryptase (14.4 g/l, normal 2.19.0 g/l), and vitamin b12 (1400 pg/ml; normal 233924 pg/ml). serum levels of il-5 were elevated to 46.7 u/ml (normal<7.8 u/ml), but serum ige levels remained consistently within the normal range. at the time of referral, he was initially treated with prednisolone (30 mg/day) alone, but did not attain a remission. the patient was found to have fip1l1-pdgfra fusion gene-negative; however because there was no useful therapy available, he was treated with imatinib mesylate (100200 mg/day) at age 26, which was effective in reducing the aec and negating the oscillating pattern of he s temporarily for about 30 weeks.12 thereafter, the patient s oscillating hypereosinophilia became uncontrollable again. in order to determine the pathogenesis of his he s and improve therapeutic measures, we performed flow cytometry analysis on his lymphocytes, which showed that the cd3cd4+population, a subset described in cases of gleich syndrome,9 was increased, accounting for 5.7% of the total (normal<1.0%), but clonality studies on t cell receptors (tcr) showed no rearrangement bands for tcr-c-beta, -j-gamma, and j-delta1 genes (data not shown). thus, we assumed that his he s could be defined as gleich syndrome9; however it was not clear if the seasonal periodic oscillation of aec was compatible with this syndrome. in addition, we were aware that aec showed a good correlation with some serum biomarkers, which was not previously noted in patients with gleich syndrome. as first noted, such cyclic episodes were temporarily suppressed during the imatinib therapy.12 after the patient became refractory to imatinib, we were able to document the exact oscillating pattern closely over the past 6 years. 10,000/l) two to three times a year, one in early spring (february march), another in fall (september october) and another in between (june) in two of the 3 years from 2005 to 2007 (figure 1a). among various biological markers, soluble il-2r (r=0.857, p<0.001) and serum igm (r=0.685, p<0.0025) values were closely associated with this eosinophilic oscillation (figure 2); however, none of hemoglobin, platelet counts, igg, or iga levels were correlated with the oscillation in eosinophil levels. during the peak hypereosinophilic episodes, the patient showed soft tissue swellings on the face, forearms, and the lower legs, which could be a kind of angioedematous presentation, but we searched for alternative therapeutic measures; anti-il-5 therapy using humanized anti-il-5 monoclonal antibody13,14 was not available in japan. since cyclosporine a was proven beneficial in the treatment of hes15 and the suplatast tosilate, the th2 cytokine inhibitor, was reported effective for a patient with hypereosinophilia with a high level of serum il-516 as well as for a patient with eosinophilic gastroenteritis associated with elevated serum il-5 and sil-2r,17 we employed a combination of oral suplatast tosilate (300 mg/day) combined with cyclosporine a (150 mg/day) and prednisolone (1015 mg/day) over the past 6 years. as seen in figure 1, peak heights of aec reduced from 2005 to 2007 (figure 1a), and further reduced yearly to 2010 in association with reduced incidence of the episodes (figure 1b). since july 2010, however, it was found that the cd3cd4+population remained at a level similar to that prior to the initiation of treatment (6.7% of the total). our observation explains the effectiveness of the combined therapy for this type of he s. as of october 2011, in he s, xiao et al described a 54-year-old man who had periodic oscillations in eosinophils, wbc, platelet counts, and hb.4 cyclic oscillations in blood cell counts were also reported for an he s case by malcovati et al.5 in the case of xiao et al, the oscillatory cycle lasted approximately 2 months.4 in cases of gleich syndrome, eosinophilic cycles are known to occur every 35 weeks, ie, almost every month,8,9,11 and are related to the menstrual cycle in female patients.18 as shown in figure 1, our case showed cyclic episodes occurring two to three times a year from 2005 to 2007; thereafter this cycle gradually became blunted over the next 3 years. it seems that the episodic cycles in our case are distinct from previously described patients with he s. in gleich syndrome, episodic angioedema with eosinophilia is associated with high serum il-5.611 although our case shows angioedematous soft tissue swelling at the peak heights of hypereosinophilic episodes, his clinical features are not associated with the high ige levels described by several authors,6,7,10 or with the itchy urticarial rash described by schiavino et al.7 in addition, the patient did not respond to prednisolone alone as previously reported.7,9,10 clonally proliferated helper t lymphocytes were also shown by several authors in cases of gleich syndrome.10,11 although we identified some increase in the cd3cd4+subset in peripheral blood, no t cell clonality was shown in our case. the hematopoietic abnormalities in the cases of xiao et al and malcovati et al are thought to originate at the pluripotent stem cell levels.4,5 by contrast, periodic oscillations of eosinophils in gleich syndrome are thought to be regulated by t-cell expansion-associated il-5 release.10,11,19 distinct oscillations in the aec of our case, particularly in association with serum igm levels, appear to occur via a varied pathogenesis, which may represent a variant of gleich syndrome, although precise mechanism(s) remain unknown. so far no triggering factors have been identified to explain the seasonal hypereosinophilic episodes in our case. in a situation where no anti-il-5 antibody is available, we have found that a combination of cyclosporin a, suplatast tosilate, and prednisolone is a good alternative approach in controlling the hypereosinophilic episodes, although suplatast tosilate is said to suppress ige, but not igg or igm production in vivo.20 over the past 6 years, the three drug combination slowly abolished aec oscillations in our case. how these drug combinations have acted to slowly alleviate his oscillating he s is unknown. since we found no decrease of cd3cd4+subset with treatment, it was assumed that the inhibitory effect of the treatment including cyclosporin a was not through an effect on the cd3cd4+subset. the fact that the precise pathogenesis of oscillating hypereosinophilia is still unknown underscores that there is considerable heterogeneity in he s and/or in gleich syndrome.

we report the treatment course of a 29-year-old man who has had unique oscillating fip1l1-pdgfra fusion gene-negative hypereosinophilic syndrome (he s) for nearly 6 years. his periodic oscillating pattern of eosinophilia associated with angioedematous soft tissue swelling has shown two to three seasonal peaks (> 15,000/l absolute eosinophil counts [aec ]) a year. initially, the patient, who was thought to have distinct he s not compatible with previously described cases, did not respond to treatment except for a temporary response to imatinib mesylate. for 6 years, from 2005 to 2010, he was treated with a combination of oral cyclosporine a, suplatast tosilate, and a small dose of prednisolone, which significantly reduced the peak heights of aec as well as blunting the oscillating patterns.

PMC3658243

pubmed-880

commercially pure titanium has been employed as the best material for dental implants due to its biocompatibility and excellent mechanical properties. healing of peri-implant tissue can be influenced by the physicochemical and mechanical properties of the implant material, microstructures, macrostructures, and surface chemistry of the implant. the surface topography and chemistry of an implant material can have beneficial or disadvantageous influence on cell adhesion and proliferation, thereby controlling the osseointegration process. studies on the effects of surface modified materials on the adherence and spreading of cells have recently been reported or are in progress.1,2,3,4,5 one of the handicaps of titanium from an esthetic point of view, as a dental implant material, is that the dark gray color of titanium can shine through the thin soft tissues. soft tissue shrinkage leading to gingival recession or peri-implantitis may leave the cervical titanium component visible. implants or transgingival abutments from tooth-colored materials such as zirconia ceramic may be one possible solution to these problems with the dark color of titanium. zirconia has tooth-like ivory color and somewhat translucency, making it sufficient material for esthetic restorations. zirconia ceramic is a biocompatible material that has optimal esthetic and mechanical properties for dental implants. the biomaterial-related properties of zirconia are as advantageous as those of titanium.6 tissue reaction and stability of zirconia, which are important factors in maintaining zirconia restorations free of periodontal problems, proved to be satisfactory.7,8 bacterial coverage and accumulation on zirconia was reported to be lower than on titanium.9,10 inflammation associated processes in peri-implant soft tissues were found to be higher around titanium than around zirconia.11 the material composition and profile of transgingival implant components seems to influence cell behavior and growth. the macrostructures of the zirconia ceramic are able to provide contact guidance and gingival contouring to provide biological seal.1,12 zirconia ceramic can be suitable for transgingival implant components13 resulting in final esthetic results, but more clinical and mechanical trials are necessary for a complete understanding of the behavior of zirconia abutments and implants over a long time period. in hard tissue engineering, calcium phosphate (cap) ceramics, such as hydroxyapatite [ha; ca10(po4)6(oh)2] and tricalcium phosphate [tcp, ca3(po4)2], have attracted attention due to their excellent biocompatibility and osteoconductivity.14 clinical reports on the cap ceramics proved their direct bonding to bone and complete osseointegration. however, their poor mechanical properties, such as low strength and fracture toughness, limited wide application in hard tissue implants. calcium phosphate was accumulated on zirconia surfaces by ion beam assisted deposition (ibad) and hydroxyapatite by aerosol deposition. the compositional degradation of calcium phosphate coatings is caused by the deposition process involving very high temperatures, low binding strength, and thick coatings. the binding strength between the coating and the implant material is one of the critical characteristics which affect the long-term stability of the bone-implant interface. the cell culture system used in this study was rat bone marrow-derived osteoblasts. after implantation, the surface properties of biomaterials can affect the osteogenic and differentiation potentials of mesenchymal cells. this study was performed to characterize the attachment and growth behavior of bone marrow-derived osteoblasts cultured on zirconia surfaces with calcium phosphate coatings and hydroxyapatite coatings compared to smooth surfaced zirconia. paul, mn, usa) of y-tzp (yttrium-stabilized tetragonal zirconia polycrystal) with a diameter of 10 mm and a thickness of 2 mm were prepared by pressing and sintering at 1500 for 2 hours. one type was y-tzp with a smooth surface (zs group), another was y-tzp with ibad (ion beam assisted deposition) ca-p coating (cap group), the third was y-tzp with ha deposition (ha group). twenty discs of each group were fabricated and tested for proliferation, differentiation, osteogenic potential, and gene expression. disc samples were cleaned ultrasonically in acetone, ethanol, and de-ionized water. calcium phosphate film (up to 500 nm) was deposited on zirconia disk by the electron-beam deposition system. mixed powder of hydroxyapatite (alfa aesar, johnson matthey, london, uk) and calcium oxide (sigma, st. an electron beam evaporator (telemark, battle ground, wa, usa) at 7.5 kv and 0.13 a, and an end-hall type ion gun (ionbeam scientific, berks, uk) at 90 v and 2.0 a were employed for deposition. heat treatment after the deposition was conducted at 400 in the vacuum of 3 mm torr. the raw ha powder (alfar aesar, ward hill, ma, usa) used in this study was subjected to the pre-deposition treatment consisting of heating to 1100 for 1 hour. the fine particles were carried by oxygen gas and sprayed onto the zirconia disk in the deposition chamber. bone marrow-derived osteoblasts were harvested and cultured following the methods described by maniatopoulos et al.15 femurs of two six-week-old male sprague-dawley rats were removed. the bones were washed with 70% alcohol and immersed twice in alpha-mem (sigma, st. louis, mo, usa) culture medium containing 100 units/ml penicillin-g, 100 g/ml streptomycin (gibco brl, life technologies bv, bleiswijk, the netherlands). the condyles were removed and the bone marrow flushed out using complete cell culture medium (alpha-mem) with 15% fetal bovine serum (gibco, invitrogen ltd., paisley, uk) and supplemented with 50 g/ml ascorbic acid (sigma, st. louis, mo, usa), 7 mm na-beta-glycerophosphate (sigma, st. after seven days of primary culture, cells were trypsinized and resuspended in complete culture medium. cells culture on disks placed in a 24-well plate was carried out for all experiments. cells were collected and seeded at a density of 1 10 cells/ml by using 0.1% trypsin and 0.02% edta in ca and mg-free eagle's buffer for cell release. each set of wells contained 24 sterile zirconia disks at 37 in 5% co2 for 24 hours. the samples were then moved to new dishes, fresh media were added, and the plated disks were cultured at 37 in 5% co2 for an additional 24 hours. all cell culture media were supplemented with 100 units/ml penicillin-g, 100 g/ml streptomycin, and 0.25 g/ml fungizone (gemini bio-products inc., woodland, ca, usa). the cellular viability and proliferation of cells were examined with an mtt based cell growth determination kit (cgd1; sigma, st. louis, mo, usa). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumsalt (mtt), which turns into a blue formazan product due to the viable mitochondria in active cells was used. the osteoblasts were seeded at a density of 2 10 cells/ml and incubated at 37 in 5% co2 for 24 hours and 48 hours. after 24 hours and 48 hours of incubation, the discs were moved to well plates and new media were added. then, diluted mtt (5 mg/ml) solution was added, and the incubation was continued at 37 in 5% co2 for 4 hours. the incubation medium was then removed, 400 l of isopropanol with 0.04 n hcl was added to each well, and the resulting formazan crystals were dissolved. the absorbance of the formazan product at 490 nm was measured with a microplate reader (bio-kinetics reader, el312e, winooski, vt, usa). cells were seeded at a density of 2 10 cells/ml. the cultured cells were incubated for 24 and 48 hours at 37 in 5% co2. the loosely-adherent or unbound cells were removed from the wells by aspiration. wells were washed twice with a 0.1 m phosphate buffered saline (pbs) buffer (ph 7.4), and the remaining bound cells were fixed with 2.5% glutaraldehyde in 0.1 m sodium cacodylate buffer, ph 7.3, for more than 1 hour. the excess glutaraldehyde solution was removed and the cells were rinsed once more in pbs before being dehydrated in ethanol baths of progressively higher concentrations (50, 60, 70, 80, 90, 95, and 100%, 10 min in each bath). after the cells were dried to a critical point, the samples were sputtered with a 100 nm thick layer of gold using an ion coater (ib-3, eiko co., tokyo, japan). attachment and morphology of the cells on the discs were observed by vega sem (tescan, brno, czech republic). osteoblast differentiation generally implies expression of alkaline phosphatase (alp), specific protein and mineralization capacity. alp is a widely used osteoblast marker, and increased alp activity is associated with elevated osteoblastic activity. the cells were seeded on the substrate at a density of 5 10 cells per well. cells were washed twice in cold tris-buffered saline (tbs), lysed with tbs-triton and centrifuged, and the supernatant was analysed for alp activity using 1 mg/ml p-nitrophenylphosphate (pnpp; sigma, st louis, mo, usa). the absorbance at 409 nm was measured using the microplate reader (bio-rad, hercules, ca, usa). x-ray photoelectron spectroscopy (xps) is a surface-sensitive quantitative spectroscopic technique that measures the elemental composition of the surface (top 0-10 nm usually). surface chemistry of the substrates was analyzed by x-ray photoelectron spectroscopy (xps, k-alpha; thermo fisher scientific, ma, usa). the xps spectra were recorded using normal al k (1486.6 ev) with a probing beam size of 125 m. the recorded spectra were calibrated to the binding energy of c 1s (284.6 ev) owing to the charge effect. xps spectra were obtained at zr 3d, y 3d, c 1s, o 1s, p 2p, ca 2p, and al 2p. the osteoblastic differentiation was evaluated by rt-pcr for examination of type i collagen, glyceraldehyde 3-phosphate dehydrogenase (gapdh), osteocalcin, and osteonectin. total rna extraction was performed with the rneasy mini kit (qiagen, chatsworth, ca, usa). amplitaq dnapolymerase (amersham pharmacia biotech, piscataway, nj, usa) was used to amplify the cdna. the pcr products were fractionated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining. the intensity of the bands was quantified under uv transillumination (eagle eye ii, stratagene, la jolla, ca, usa). dissolution behavior of ca and p ions from the coatings were evaluated by immersion of cap and ha group specimens in physiological saline solution (0.9%) nacl. at the predetermined time periods (4, 8, 12, 16, and 20 hours), the concentration of the ca and p ions released from the coated substrate was calculated with inductively coupled plasma-atomic emission spectrophotometer (icp-aes; icps-1001v, shimadzu, tokyo, japan) analysis. the mean values (mv) and standard deviations (sd) will be computed for the mtt test and alp analysis, and an analysis of variance (anova) and scheffe post hoc tests for multiple comparisons were conducted to assess the statistical significance of the differences between the groups. all statistical analyses were performed using spss 18.0 for windows (spss inc., chicago, il, usa). the optical densities of the formazan produced by osteoblasts in the zs, cap, and ha groups were measured after 4, 24 and 48 hours via a mtt assay (fig. after 48 hours of cell culture, all three groups showed increased cellular activity and proliferation, however, no significant differences were observed among the groups (p>.05). overall, the osteoblasts seeded onto the three groups of zirconia specimens showed similar degrees of vitality and proliferation. the general morphology and growth pattern of the osteoblasts for each group were observed using sem for each group (fig. 2 and fig. sem images after 24 and 48 hours of culture show that the cells were triangular or elongated in shape and spread or irregularly with some long filopodia attached to the substrate. after 48 hours of culture, cells on all discs showed increased contact to each other and firm adhesion to the substrate with increased formation of filopodia compared to 24 hours of culture. overall, the osteoblasts cultured on smooth zirconia group showed comparative initial adhesion properties and growth pattern, compared to the surface treated groups. alp assays were performed to compare the differentiation rate of osteoblasts on each group and the following results were obtained (fig. 4). after 14 days of incubation, alp was highest in the cap group and then the zs group with ha group the lowest. xps was used to determine the surface composition of the substrates of each group (fig. the zirconia surface was oxidized as zirconium oxide and polluted by carbon contaminants in all groups. however, the zs samples exhibited zirconia, yttrium, and aluminum peaks. samples with surface treatment showed peaks with calcium and phosphorous due to the different substances of the coating. the cells were incubated for 24 h and the mrna levels of type i collagen, osteocalcin, and osteonectin were analysed by rt-pcr. the levels of mrna for type i collagen, osteocalcin, and osteonectin on the zs, ha, and cap groups were comparable and showed no significant differences (fig.. the dissolution rate of ca and p was higher with cap group than ha group (fig. 7). also, the ca and p concentration increased with time for the cap group. however, it decreased with time and became generally stable at 20 hours for the ha group. research for new bioactive coatings for dental implants to improve tissue integration and stability are still in progress.16,17 the topography and the surface chemistry are of great importance.18,19 recently, surface-modified zirconia implants have been studied for long-term stability and strong bone tissue response.20 monoclinic zirconia coated on titanium has been proved to have positive osteoblastic behavior and is potentially useful in hard tissue replacements.21 calcium phosphate has been used as surface coatings on implants due to its bioactivity, which enables earlier stabilization of implants to the surrounding bone.22 coatings with high dissolution behavior have high concentration of ca which enhances osteoblast responses and improves bone formation around the implant.23 however, the dissolution behavior and the low adhesion strength of the coating layer have raised concerns on the stability of the implants.24 in the present study, the concentration of ca and p released from the coatings was higher with the cap group than the ha group. also, the ca and p concentrations increased with time on the cap group. the xps results show that the ion compositions of the cap and ha group are very similar. thus, the different coating methods of the cap or ha may explain the improved chemical stability of the ha group. this implies that aerosol deposition method can produce more stable coatings with implants and transgingival components. to verify the long-term stability of the zirconia coated with bioactive ceramics, evaluation of the adhesion strength between the coating and the substrate alp activity is an important parameter that allows for the assessment of the differentiation level of the mineralization of osteoblasts, and is considered as a marker of the early stage of osteogenic differentiation.25 in this study, alp activity of the cap coated group was shown to be the highest. although no significant differences were observed among the groups, it can be speculated that calcium phosphate coating may have positive effects on the early stage of osteogenic differentiation. type i collagens are major extracellular matrix components of osteoblasts and involved in adhesion. as osteocalcin is produced by osteoblasts, it is known as a marker for the bone formation process. also, osteonectin is an extracellular matrix glycoprotein which is secreted by osteoblasts during bone mineralization and modulates cell proliferation. no significant differences were found in the level of mrna for type i collagen, osteocalcin, and osteonectin during the 24 hours cell culture period. surface texture of machined zirconia is known to enhance bone apposition and has benefits on the removal torque values.6 however, in this study, smooth zirconia and surface coated zirconia showed overall comparable cellular viability which implies that surface chemistry affects osteoblast attachment and spreading. more in vivo and in vitro investigations are needed to establish the ideal surface roughness and biochemical coating for the zirconia implants. from the semi-quantitative xps analyses, it can be speculated that surface treatment affected the surface chemical composition of the zirconia surface. although sandblasting with al2o3 was not performed, xps results documented the presence of al on the smooth zirconia surface group which might have been incorporated for increasing the toughness of the zirconia.26 these al2o3 particles would not affect the osseointegration pattern as shown by animal studies.27 however, the role of residual al2o3 on implant surfaces is still a matter of controversy28 and it is difficult to conclude whether there is a positive or negative effect because of the low content of residual al on the smooth zirconia surface group. fluoride incorporation into the coating layer is known to bring about lower dissolution and greater chemical stability.29 therefore, further studies on the incorporation of other ions and coating techniques for the best resistance to dissolution and higher positive cell stimulating effects are needed. thus, we need to focus on the control of the in vivo degradation behavior and the mechanical properties of the coatings on the zirconia. the attachment and growth behavior of bone marrowderived osteoblasts cultured on smooth zirconia and surface coated zirconia showed comparable results. however, considering the dissolution behavior of the surface coatings of the zirconia, the ha coating was more stable compared to the cap coating. more in vitro and in vivo researches are necessary to identify a stable surface with controlled and standardized chemistry.

purposethis study was performed to characterize the effects of zirconia coated with calcium phosphate and hydroxyapatite compared to smooth zirconia after bone marrow-derived osteoblast culture. materials and methodsbone marrow-derived osteoblasts were cultured on (1) smooth zirconia, (2) zirconia coated with calcium phosphate (cap), and (3) zirconia coated with hydroxyapatite (ha). the tetrazolium-based colorimetric assay (mtt test) was used for cell proliferation evaluation. scanning electron microscopy (sem) and alkaline phosphatase (alp) activity was measured to evaluate the cellular morphology and differentiation rate. x-ray photoelectron spectroscopy (xps) was employed for the analysis of surface chemistry. the genetic expression of the osteoblasts and dissolution behavior of the coatings were observed. assessment of the significance level of the differences between the groups was done with analysis of variance (anova). resultsfrom the mtt assay, no significant difference between smooth and surface coated zirconia was found (p>.05). from the sem image, cells on all three groups of discs were sporadically triangular or spread out in shape with formation of filopodia. from the alp activity assay, the optical density of osteoblasts on smooth zirconia discs was higher than that on surface treated zirconia discs (p>.05). most of the genes related to cell adhesion showed similar expression level between smooth and surface treated zirconia. the dissolution rate was higher with cap than ha coating. conclusionthe attachment and growth behavior of bone-marrow-derived osteoblasts cultured on smooth surface coated zirconia showed comparable results. however, the ha coating showed more time-dependent stability compared to the cap coating.

PMC4024565

pubmed-881

the patient was a 33-year-old, 156 cm, and 62.5 kg primipara on the sixth day of the 40th week of pregnancy, and she was hospitalized on the day before the operation for vaginal delivery. the patient had not undergone any specific disease or operation according to her history, and the vital signs were normal at the time of hospitalization. the results of the blood test and urinalysis performed one month before the hospitalization were all normal. there was no cardiomegaly and abnormal finding in the pulmonary parenchyma by the chest radiography, and the electrocardiography results were all normal. the fetal heart rate measured at the time of hospitalization was 154 bpm, and the fetus showed normal reactivity. although induced labor was carried out by injecting oxytocin during the afternoon on the day of hospitalization, the fetal heart rate was reduced, and thus, the oxytocin injection was stopped. then, the fetal heart rate returned to normality and natural labor began. when oxytocin was injected again on the day of the operation, the fetal heart rate was reduced. since meconium staining was found following the amniotic membrane rupture, an emergent cesarean section was decided. the vital signs that were measured by the electrocardiography, pulse oximetry, and the automated blood pressure device at the operation room were 150 mmhg of systolic blood pressure, 100 mmhg of diastolic blood pressure, 90 of heart rate, and 94% of oxygen saturation. because there was no specific finding by the inquiry and auscultation, the low oxygen saturation was considered as an error by the low body temperature since the hands and feet of the parturient woman were cold. spinal anesthesia was decided because a little dry cough was found. after having the parturient woman take the right lateral decubitus position, 0.5% hyperbaric bupivacaine 10 mg mixed with fentanyl 20 ug was injected with a 26 g spinal needle between the l3 and l4 spines. the cold sense check was performed with an alcohol swab to verify the sensory block level to the fourth thoracic spinal segment. five minutes after the spinal anesthesia, blood pressure was decreased to 90/50 mmhg, and the pulse oxygen saturation to 88%. the parturient woman complained of severe dyspnea and a continued cough and a large amount of sputum mixed with pink bubbles were observed. after ephedrine was immediately injected 3 times, 8 mg each, the blood pressure was recovered to 110/80 mmhg, the heart rate to 90/min, and the oxygen saturation to 92%, and then the operation was initiated. the results of the arterial blood gas study at that moment were ph 7.39, oxygen partial pressure (pao2) 77.7 mmhg, carbon dioxide partial pressure (paco2) 34.5 mmhg, and oxygen saturation 95%. just after the start of the operation, the spontaneous breathing seemed no longer impossible due to the severe dyspnea and excessive airway secretion. thus, after injecting propofol 60 mg and succunycholine 70 mg, endotracheal intubation was carried out with the endotracheal tube of the inner diameter 7.0 mm. after the endotracheal intubation, a large amount of pink discharge was continuously aspirated through the tube to the extent that it blocked the tube, and the oxygen saturation of the patient was decreased down to 70%. after the fetus was delivered, the blood pressure was decreased to 60/40 mmhg, the oxygen saturation to 65%, and the heart rate to 60/min. although dobutamine and norepinephrine were injected since heart failure was suspected, pulseless electrical activity (pea) was found and the operation was suspended temporarily to carry out cardiopulmonary resuscitation. after the injection of epinephrine 1 mg and atropine 0.5 mg with continued thoracic compression, the sinus rhythm was recovered and the vital signs were increased to the blood pressure of 150/80 mmhg, oxygen saturation of 95%, and heart rate of 120/min. with the continuous intravenous injection of norepinephrine, as well as dopamine and dobutamine, a central vein catheter was inserted through the right internal jugular vein and an arterial catheter through the left femoral artery. although the operation was then resumed, a severe hemorrhage was found and the blood pressure was reduced to 60/40 mmhg and the oxygen saturation to 80% at the end of the operation. the results of the arterial blood gas study at that moment were ph 7.154, pao2 63.5 mmhg, paco2 57.5 mmhg, bicarbonate 19.8 mmol/l, and oxygen saturation 85.1%, which indicated a serious respiratory and metabolic acidosis and hypoxia. bicarbonate was injected to correct the acidosis and the 50% dextrose in water (d/w) solution to which cacl2 600 mg and insulin were added was also injected. since the possibility of hemorrhage by coagulation disorder, not the surgical hemorrhage, could not be excluded, the packed red blood cells and the fresh frozen plasma were transfused, too. although the blood test related with disseminated intravascular coagulation (dic) was carried out during the operation (bleeding time, prothrombin time, activated prothromin time, antithrombin iii, fibrinogen, d-dimer, and fibrinogen degradation product), the results could not be obtained because of coagulation of the blood sample. even after the finish of the operation, the low blood pressure was maintained and the patient returned to the pea state. cardiopulmonary resuscitation was performed and epinephrine 1 mg and atropine 0.5 mg were injected 2 times for each. after the patient was recovered to the sinus rhythm, she was moved to the intensive care unit. the total operation duration was 1 hour; the urination was 150 ml; the blood loss was 1,500 ml; the injected fluid was 1,850 ml; and the transfused blood was 1,250 ml. more than 3,000 ml of secretion was discharged through the endotracheal tube and it spouted out continuously even in the intensive care unit. however, the blood pressure was dropped to 53/30-40/20 mmhg, the heart rate to 20-30/min, and the oxygen saturation to 50-60%. the complete heart failure was continued as the patient's status did not become any better, and the patient showed no response to the medications. though the cardiac compression was continually carried out, the patient died after 3 hours. the autopsy was performed by the national institute of scientific investigation and the cause of death was proved to be amniotic fluid embolism. amniotic fluid embolism is a fatal syndrome that takes place during pregnancy or during or after delivery. amniotic fluid embolism was firstly described in 1926, and it was recognized as a syndrome by steiner and lushburgh as fetal debris were found within the pulmonary blood vessels of the parturient women who died during labor by similar clinical characteristics. although it was reported that the incident rate was 1 out of 8,000-15,200 live births and the mortality was in the range of 61-86%, the mortality was decreased to 13.3-44.0% according to a recent study. it is thought that this trend may be because the diagnosis and treatment have been advanced and only fatal cases were reported selectively. amniotic fluid embolism holds 5-15% of the overall causes of maternity deaths, and it leaves permanent neurological damage to 61% of the parturient women and 50% of the newborn children. many have been known as the risk factors of amniotic fluid embolism, but parturient women over the age of 35, cesarean section, forceps and fetal suction, placenta previa, abruptio placentae, eclampsia, and fetal distress syndrome were verified as the risk factors by a large scale research that was carried out recently although the correlation among them has not been understood clearly. the major clinical characteristics include cardiovascular collapse accompanied by severe hypotension and arrhythmia, cyanosis, respiratory distress, pulmonary edema or acute respiratory failure syndrome, respiratory arrest, consciousness fluctuation, and massive hemorrhage by dic. among these, the major causes of maternal death are cardiac arrest, massive hemorrhage by dic, acute respiratory failure syndrome, and multiple organs dysfunction. according to the report by lewis, 11 of the 17 parturient women who had experienced amniotic fluid embolism complained of prodromal symptoms such as dyspnea, chest pain, chilliness, restlessness, the feeling of being pierced by a pin, nausea and vomiting. the time interval between the observations of these symptoms to the women's collapse varied, ranging from several minutes to 4 hours. in this case report, even though the parturient woman showed the symptom of dry coughing from the morning of the operation day onwards, it was not very severe and no other specific symptom was observed. the causes of the prophase hypoxia, which is the most representative clinical characteristic of amniotic fluid embolism, are severe ventilation-perfusion mismatch by pulmonary vasoconstriction and bronchospasm, and those of the anaphase hypoxia include pulmonary edema by left ventricular failure and nonpsychogenic pulmonary edema that is related to the increase of the capillary permeability. the parturient woman in this case report showed an oxygen saturation of 94% at the time of entering the operation room, which might have been the indication of hypoxia that occurred already, rather than the error by hypothermia. in addition, from the chest radiograph taken in the operation room after the fetus was delivered (fig. 1), severe pulmonary edema at both lungs and normal central venous pressure were found, though the pulmonary arterial pressure was not measured. thus, it is assumed that the hypoxia might have been caused by pulmonary edema due to the left ventricular failure or the increase of the pulmonary capillary permeability, rather than by the pulmonary vasoconstriction at the initial stage. right ventricular failure can take place at the initial stage by the pulmonary vasoconstriction and pulmonary hypertension due to the secretion of endogenous mediators, which was proved in a number of reports. reported that acute right ventricular failure accompanied by severe pulmonary hypertension, left deviation of the atrial, and ventricular septum was found from the transesophageal echocardiography performed within 30 minutes after the occurrence of amniotic fluid embolism. a large amount of ascites was also found after the laparotomy in our case, which is thought to be the secondary result of the right ventricular failure. as the operation moved on to the anaphase, the pulmonary hypertension did not continue, but it was shifted to left ventricular failure, which might have been caused mainly by the decreased filling of the left ventricle following the enlargement of the right ventricular enlargement. other causes of myocardial failure that are known include myocardial ischemia due to hypoxia, decreased blood flow in coronary artery due to decreased cardiac output, and direct myocardial depression by the substances in amniotic fluid such as endothelin. the blood pressure of the parturient woman in our report was decreased after the spinal anesthesia, which could have resulted from the high level of sensory block to the t4 spine, but it could be probably because of the decrease of the general vascular resistance following the left ventricular failure. dic is also one of the factors that can cause hypovolemic shock, and it is found in 50% of the parturient women with amniotic fluid embolism. the mechanism of dic is not clear, but it is known by a previous animal experiment that amniotic fluid is related to the thromboplastin-like effect, platelet aggregation, and the activation of complement reaction. in addition, lockwood et al. discovered a large amount of tissue factors in amniotic fluid and explained the triggering of blood coagulation and consumptive coagulopathy caused by the activation of extrinsic pathway and factor x. dic, which is clinically characterized by continuous blood loss, can take place in any stage of amniotic fluid embolism, from the initial stage to the terminal stage. in this case report, the heart was temporarily recovered by the cardiopulmonary resuscitation after the cardiac arrest, but the prognosis could become worse as hypovolemic shock took place due to the dic afterward. in conclusion, the main causes of the maternal death of the parturient woman are thought to be the hypotension by the combined effect of the left ventricular failure, the decrease of the general vascular resistance due to the spinal anesthesia and continued blood loss by dic, and pulmonary failure by the severe pulmonary edema. the pathway of amniotic fluid influx to the maternal circulatory system includes the uterine cervical vein, damaged uterine site, and placental site. in early studies, pulmonary vascular occlusion was considered as the main etiology of amniotic fluid embolism, but various clinical characteristics of amniotic fluid embolism were hardly explained by the mechanism and it was not verified by animal experiment, implying that there might be another mechanism rather than the mechanical occlusion. now, the secretion of primary or secondary endogenous mediators following the amniotic fluid inflow to the maternal circulatory system is considered as the major etiology of amniotic fluid embolism based on several reports. the known mediators include histamine, bradykinin, endothelin, leukotriene, and arachidonic acid metabolites. these immunological factors can be supported by the fact that amniotic fluid embolism is found more frequently among the parturient women who have conceived a male fetus and with the history of drug allergy. in other words, amniotic fluid embolism can be strongly suspected in a pregnant woman or a puerperal woman, immediately after the delivery, with cardiovascular collapse as well as respiratory failure, dic, and convulsion, excluding anaphylaxis, septisemia, pulmonary embolism, myocardial infarction, perinatal cardiomyopathy, and hemorrhagic shock (atony, uterine rupture, and abruptio placentae). although in many studies amniotic fluid tissue was found in the blood aspirated at the terminal of the pulmonary artery catheter installed in parturient women who were diagnosed as having amniotic fluid embolism, the amniotic fluid tissue was found in only about 50% of the parturient women in the study of clark et al., as well as in other studies. moreover, the component of amniotic fluid is also found among the women who do not have amniotic fluid embolism or the women who are not pregnant. hence, that a component of amniotic fluid is found in a maternal circulatory system does not necessarily mean that amniotic fluid embolism has occurred. however, the probability of amniotic fluid embolism is increased in the case where there are the clinical characteristics that suggest amniotic fluid embolism. also, in the parturient woman in this case, the diagnosability was increased since a great amount of amniotic fluid component was found in the pulmonary blood vessels, as well as the clinical characteristics of amniotic fluid embolism. beside this, another known method of amniotic fluid embolism diagnosis is to measure zinc coproporphrin, sialyl tn antigen, tryptase, and complement factors in the peripheral blood of a parturient woman, but more research is required for it. the treatment is performed symptomatically depending on the symptoms of the patient and the basic direction of the treatment is maintenance of the appropriate oxygenation level and blood pressure, and correction of the coagulopathy. firstly, for the hypoxia, tracheal intubation should be immediately carried out and positive-pressure ventilation with oxygen of high concentration should be performed so as to maintain the oxygen saturation higher than 90%. for the hypotension and the shock, since an overdose of fluid can worsen the heart failure at this time, it is helpful to monitor by means of pulmonary catheter or electrocardiography. in the case of a serious hypotension which does not respond to a fluid treatment, vasopressors such as norepinephrine or cardiac inotropic agents such as dopamine, dobutamine, and milrinone can be used. when a large amount of hemorrhage occurs due to dic, packed red blood cells should be primarily transfused to supply oxygen to the tissue appropriately. platelets, fresh frozen plasma, and cryoprecipitate also need to be transfused. among them, cryoprecipitate has been known to help the patient to recover the cardiopulmonary and hematological state rapidly by enhancing the removal of antigenic and toxic substances such as amniotic fluid since it contains fibronectin. when cardiopulmonary arrest takes places during the clinical course, cardiopulmonary resuscitation should be immediately carried out and cesarean section should be performed as early as possible in order to improve the prognosis of the parturient woman and the fetus. since the gravid uterus represses the venous return by the aortocaval compression, quick delivery of the fetus makes the cardiopulmonary resuscitation more effective. in addition to these, other treatments are available including aprotinin, serine proteinase inhibitor, cardiopulmonary bypass, pulmonary embolectomy, hemofiltration, and inhalation of nitric oxide gas, etc. recently, a case where extracorporeal membrane oxygenation showed a good result in a parturient woman with amniotic fluid embolism who had a cardiac arrest was reported, and it was newly suggested as a treatment. in conclusion, as experienced in this case, amniotic fluid embolism is rare, but it is a rapidly developing, fatal disease. however, this disease is hard to diagnose in its onset, and the treatment is still difficult. thus, a prompt and positive treatment should be carried out if there is a parturient woman in whom a sudden cardiopulmonary collapse, respiratory failure, and hemorrhage are found. particularly when cardiac arrest takes place, cardiopulmonary resuscitation should be carried out immediately and the fetus should be delivered at the same time in order to improve the prognosis of the parturient woman and the fetus. it must be noted that even after the parturient woman has recovered from the cardiac arrest, neurologic damage caused by hypoxia can still take place.

amniotic fluid embolism (afe) is a rare but fatal obstetric emergency, characterized by sudden cardiovascular collapse, dyspnea or respiratory arrest and altered mentality, disseminated intravascular coagulation (dic). it can lead to severe maternal morbidity and mortality, but the prediction of its occurrence and treatment are very difficult. we experienced a case of afe during emergent cesarean section in a 40+6 weeks healthy pregnant woman, age 33. sudden dyspnea, hypotension, signs of pulmonary edema and dic were developed during cesarean section, and cardiac arrest followed after these events. the course of these events was so rapid and catastrophic, which was consistent with afe. thus, we report this case precisely and review pathophysiology, diagnosis, treatment of afe by referring to up-to-date literatures.

PMC3030025

pubmed-882

gels have been described as materials that are easier to recognize than define. most of the times this problem comes from industry, which develops products with a gel name, just to be attractive to consumers. however, gels have been accepted as semisolid materials comprising low concentrations (< 15%) of gelator molecules to form a network self-assembly that entraps the solvent (in organogels both nonpolar components), preventing flow due to surface tension. gels can be defined both from a rheological behavior and from a structural feature. in a rheological point of view, a gel is a system that does not flow and has the presence of a plateau region of storage modulus and a low tan (< 0.1) at an angular frequency from 10 to 10 rad/s. the structural definition is based on the connectivity of the system. gel is a system consisting of molecules, particles, and chains, which are partially connected to each other in a fluid medium by crosslinks to the macroscopic dimensions. organogels have been attracting much attention in biomedical and pharmaceutical fields, where the erosion of gels in stomach and intestines is important for drug delivery [4, 5]; therefore gels erosion has been applied for this purpose. as oils are safe materials and are suitable for lipophilic components, they are considered a good option for organogels elaboration. that is why food industry is very interested in this type of systems as a replacement of hydrogenated fats. thus, understanding organogels, definition is closely related to their characteristics and their crucial potential to develop new applications. the case of fat oils is very important due to their applications in food industry. the study of crystal nucleation, dissolution, and agglomeration in the overall precipitation scheme implies practical difficulties. nucleation and crystal growth are spontaneous processes, which diminish the energy of the growing particle and nucleation process in order to overcome activation energy; that is, the critical cluster (critical size) is the cluster with maximum gibbs free energy. the activation barrier may be represented by three parameters: supersaturation ratio, reaction temperature, and interfacial energy. following crystal formation in organogels can give detailed information on how their preparation is affecting their final structure. the crystallization behavior is related to concentration of gelator, cooling rate [11, 12], and shear rate on fat crystals [13, 14]. depending on the system, gels are formed by different forces and interactions and there are some parameters that affect, such as ph, ionic force, and mechanical forces. the plastic fat gels are formed due to the aggregation of fat crystals by several forces as van der waals, dipole-dipole, hydrophobic, and hydrogen bond interactions between crystals. fractal is a geometric pattern that is repeated at every smaller scale to produce irregular shapes and surfaces. hence, since the study of organogels is very complex, it must include structural analysis and rheological and thermal behaviors in order to have a clear understanding on how preparation parameters are affecting the final product. thus, our objective was to evaluate the influence of gelator (type and concentration), type of vegetable oil, stirring speed, and temperature preparation on the physical properties of obtained organogels. three different vegetable oils (soybean, canola, and corn oil) were used. they have important differences in composition of saturated fatty acids (sfa), monounsaturated fatty acids (mufa), and polyunsaturated fatty acids (pufa). the approximate compositions of soybean (sfa 15.65%, mufa 22.78%, and pufa 57.74%, wesson brand), canola (sfa 7.36%, mufa 63.27%, and pufa 28.14%, wesson brand), and corn (sfa 12.94%, mufa 27.57%, and pufa 54.67%, mazola brand) were considered. these oils were bought at a local supermarket in new brunswick (new jersey, usa). myverol (mainly monoglycerides glyceryl monostearate 49%, glyceryl monopalmitate 48%, and calcium silicate 3%) and myvatex (mixture of monoglycerides and diglycerides, soy monoglycerides 3545%, stearic acid monoester with propane-1-2-diol 4050%, sodium 2-stearoyl lactate 1015%, and calcium silicate 3%) were provided by kerry, mexico/usa, and used as gelator agents. gelators myverol (mv) and myvatex (mx) at three different concentrations (8, 9, and 10%) were heated (70, 80, and 90c) on glass containers until complete melting, and then either vegetable oil (soy (sy), canola (ca), or corn (cn)) was added. samples were stirred (t 25 digital ultra-turrax, ika, north carolina, usa) for five minutes at three independent speeds (3600, 7200, and 12000 rpm) to homogenize them; then, samples were cooled to room temperature and stored in refrigerator for 24 hours. dynamic frequency sweep tests were performed in a rheometer (ares rheometer 902-30004, ta instruments, new castle, de, usa) using parallel plates geometry (25 mm diameter) under the following experimental settings: strain 0.1%, temperature 20c, frequency sweep 0.1100 rad s, and a gap of 1 mm. the g and g modules, complex viscosity, and delta tangent for each experimental sample were obtained. polarized light microphotographs of organogels were obtained using a polarized light microscope linkam brand (t95 system controller; t95 linksys 32 soft, 2009, tadworth, uk). it was equipped with a q imaging camera (color rtv 10 bit) using an olympus th4-100 halogen lamp power supply unit (lts120 temp. controlled stage). images were taken at 20c, and video was taken using the camtasia studio v 7.0 (build 1426, 2010, techsmith corporation, okemos, mn, usa). thermal behavior of samples was studied using a differential scanning calorimeter (dsc q2000 ta instruments, schaumburg, ill, usa) equipped with refrigerated cooling system (rcs 40 ta instruments, schaumburg, ill, usa). samples were heated at 120c (30 min) for deleting fat thermal memory. x-ray diffraction experiment was developed by the use of a pxrd conduced with a d/m-2200 t automated system (ultima rigaku, tokyo, japan) with cu k radiation =1.5406 a. patterns were collected at 2 angles of 3 to 50 at a scan rate of 2/min. a graphite monochromator was used and the generator power settings were fixed at 40 kv and 40 ma. 2010.01.30, woburn, massachusetts, usa) for clarifying peaks, applying a single functional filter smoothing and five cycles of fourier deconvolution. the fractal dimension of the samples was calculated using (1) according to a described method, which is based on the avrami relationship. consider (1)ln(1xcr)=ktd, where xcr is the crystallinity of the system; t is time; k is a constant; and d denotes the dimension of growing. d and k were calculated by nonlinear estimation using levenberg-marquardt algorithm (statistica v 7.0, tulsa, ok, usa). crystalline fraction of samples was calculated adjusting values from complex viscosity of the system removing complex viscosity of the solvent: (2)xcr=(t)(). a universal relation has been developed, but in the present work a previous relationship was used, supported by earlier theoretical work in order to evaluate structural parameters. in this experimental work, a three-dimensional colloidal network was considered as being composed of interconnected flocs and the fractal dimension was used to quantify the relationship between the average floc size and the particle concentration of the colloidal network. the fractal nature of fat crystal networks has been already presented and explained the power-law relationship followed by g and the solid fat content (sfc) data for fat samples with low solid fat content (< 10%). rheological data from experimental work can lead us to obtain a parameter related to elastic modulus (the solid fraction previously obtained by xcr),, and m, obtained by nonlinear estimations (statistica v 7.0, levenberg-marquardt algorithm, tulsa, ok, usa). the hamaker constant was determined following reported methodology [18, 22] where a is the hamaker constant, a is the diameter of the particles within a floc, and d is the average distance between clusters. 14.0.0.567, menlo park, ca, usa) applying channel separation (cmyk) in order to obtain floc and distance parameters as clearly as possible. consider (4)~a3ad2. comparisons and calculations of parameters were obtained by nonlinear estimation with statistica software (ver. 7.0, 2007, tulsa, ok, usa) using levenberg-marquardt algorithm. mean effects on interactions between processing parameters and fractal dimensions and microstructural parameters were determined by screening design (jmp ver. higher values of g were observed for mv gels at higher frequencies used at 10% gelator concentration, 70c, and 12000 rpm. the elastic module (g) thus, this value may indicate that, at higher shear rates, structural order produced by lipid chains (i.e., acylglycerides) is organized in a more stable configuration, as a function of more contact between molecules that lower the necessary energy for self-organization and structure building. theoretical analysis of gels indicated that small particles could be aggregated to form large clusters with tenuous, chain-like, and self-similar structures that eventually span the entire enclosing space. this behavior not only was influenced by shear rate, but also seems to be influenced by the type of gelator used as can be seen in figures 1, 2, and 3. from these figures it can be observed that at the same conditions mv organogels always give higher elastic modules in comparison with the mx. the mechanisms of aggregation of gelators in organogels occur primarily through van der waals forces, specific intermolecular hydrogen bonding, electrostatic forces,-stacking, or london dispersion forces. thus, in function of the solvent and the gelator molecule, which type of intermolecular force predominates to stabilize the self-assembly primary structure, the growth mode, and finally the organogel microstructure and its thermomechanical properties is determined. however, the relationship between gelator chemical structure and its gelling capability is not evident a priori in most cases. however, it is desirable for gel modules to maintain a stable behavior during the complete frequency range. solid behavior is predominant in all samples at the experimental shear range used, so it can be considered suitable for an excipient. similar behavior was observed in the organogels prepared with different oils (figure 3), except for soy oil (sy), which seems to have a different effect, producing more elastic gels at the same conditions. sy seems to be favored by its higher solid fatty acids content, which gives more elastic modules to myvatex gelator samples. an explanation of this behavior has been already reported. in there, candelilla wax and amides derived from (r)-12-hydroxystearic acid were tested as gelators of safflower oil, observing that the increase in the hydrocarbon chain length raises both the organogel resistance to deformation and its instant recovery capacity. however, the extended recovery capacity of the gel decreased. as can be seen in figure 3, the behavior of each sample made with different oil at the same conditions changes significantly. this may be related to the different composition of vegetable oil and how each component is reacting at different preparation conditions. although the higher elastic modules are obtained with canola (ca) and corn (cn) oil samples, in general ca gave the higher elasticity samples in comparison with those made with cn and sy. this behavior could be related to the monounsaturated fatty acids (msfa) and polyunsaturated fatty acids (pufa) contents. obtained micrographs (figure 4) showed that myvatex tends to crystallize as spherulitic forms, some of them with larges spaces between these spherulites, while samples prepared with myverol crystallized as fibrillar networks. it was reported that the higher number of hydroxyl groups related to the diacylglycerides was correlated with a lack of gelation into the organogels. this gives further evidence to the fact that hydrogen bonding is critical to the organogelation. statistical analysis of enthalpy data showed that gelator type and its concentration (p<0.05) were the most important factors that influence enthalpy (table 1). the statistical analysis showed a very complex phenomenon influenced by the following interactions: oil oil, concentration gelator, and gelator temperature. organogels obtained with myvatex gelator showed two different nucleation stages related to the presence of two main types of molecules (mono- and diacylglycerides); so probably distributed free energy makes gels tend to crystallize as spherulites rather than as a needle shaped network. however, not only the gelator is important, but also its concentration and several interactions including vegetable oil type and temperature are important. at this point, it is interesting to highlight that the temperature factor does not have influence on the enthalpy of organogels. thus during cooling, both components might develop a mixed molecular packing with vegetable oils. on the other hand, myvatex gelator (mx) does not seem to be affected significantly by any preparation conditions. finally, it is clear that the use of myverol at higher concentrations produces organogels with higher values of gelation enthalpies, indicating more stable structures. a comparison of d spacing data was done in order to elucidate not only possible arrangements in packing, but also the most probable polymorphic forms in batches. since they were complex mixtures of components (nonpure components), at least two different packings and polymorphs were selected. it can be noticed that most of the structures obtained are mainly polymorphs, because most of them are amorphous materials and b crystals are present only in part. although mx also gave a good structure, it was only possible under the highest energy conditions. in order to compare different samples behaviors with a representative value, samples fractal dimensions (table 3) were obtained from rheological behavior according to others, on which we should obtain crystalline fraction of each sample based on complex viscosity behavior and then get fractal parameter from nonlinear estimation. once fractal data was obtained, anova test was developed looking for some important influence. the model obtained was too complex and t-student was not sensitive enough to detect means without a significant error. even in general no means were detected; some interesting effects were found when gelators and oils were blocked. also, several works on formation of organogels studied and correlated by avrami exponent (n) with fractal dimensionality have been reported [17, 28]. however, it was indicated that it may be inappropriate to compare avrami derived fractal dimensionalities from several systems in which different nucleation mechanisms for gelators are involved. thus, there are reports on homogeneous nucleation with a fractal dimensionality near 2, while others found a fractal dimensionality near 1 in a heterogeneous nucleation system. thus in the present experimental work, fractal dimensionality was in that range (lower than 2), particularly when using mono- and diacylglyceride blends, indicating a possible heterogeneous nucleation process. as an example, when the variable gelator (myvatex) was blocked on canola oil (p=0.047), the fractal dimension (d) was affected by the gelator concentration. also, when corn oil temperature was blocked, the results indicated that higher temperatures render higher fractal dimensions. the fractal dimensions (d) determined by the particle counting method are sensitive to the spatial distribution of particles in the crystal network. higher fractal dimensions occur in networks that are more ordered, whereas networks that arise from a more disordered nucleation and growth process result in lower fractal dimensions. the fractal dimension value found in the present work was lower, similar, and higher than other reports. even though we did not find any significant mean on rpm versus d parameters, independently of the gelator, d fractal dimension tends to decrease as rpm increases. this could mean that as the shear rises there is an increase in disorder of the structure, which is contrary to reports from others [13, 14]. this could also indicate that different conditions are affecting gels structure and there is not necessarily a codependence on shear rate and order of the structure. the highest value of was found for myverol (mainly monounsaturated fatty acids) in comparison with myvatex. the gelator molecules are related to the nature of the short-range weak forces and the strong solvent dependence on the molecular self-assembling capabilities, so that molecules with higher molecular weight could affect crystal growth and its consequence on fiber interpenetration among vicinal spherulites. however, not only gelator molecule is important, but solvent nature and interaction solvent-gelator are important too. in this way, experimental data was blocked for the two gelators in separated assessments. results showed that myverol is affected by the type of oil used for the sample (p=0.0085), by the oil-concentration interaction (p=0.04), and the concentration quadratic effect as well (p=0.0072). meanwhile for myvatex, the oil effect was also important (p=0.0766), but contrary to myverol, it was affected by the oil quadratic (p=0.43) and the temperature quadratic effects (p=0.032). thermal parameters could be helpful to explain this behavior, because they are associated with the molecules polarity and the energy of the molecular interactions that are established with the crystal structure of gelators in their neat and organogel states. thus, the energy related to the organogel depends on the energy of the noncovalent interactions involved during the molecular self-assembly. as can be seen, higher enthalpies were observed for myverol in comparison to myvatex, like a structural parameter. monoglycerides are known to be good initiators of fat crystallization and the matching in saturation and carbon chain length of both the gelator fatty acids and the oil phase are important in the particular lipid-lipid interactions. for the hamaker constant (table 3), gelator appears as a main effect (p 0.0001), followed by the stirring speed (p=0.052), as well as the interaction gelator-stirring speed (p=0.088). also the bilayer packing seems to be favored by the particularities on ca oil composition of mainly the high mufa and low pufa contents. also the first gelator tends to form needle shaped network structures with better intermolecular forces according to their hamaker constant and xrd analysis. the stirring speed should be an important parameter to take into account, as well as the gelator and its concentration. it was found that temperature does not seem to be an important parameter in gels preparation. finally, it is important to point out that most of the influence of the stirring speed conditions is apparently related to the oils higher mufa and low pufa contents.

the objective of this study was to evaluate the influence of gelator, vegetable oil, stirring speed, and temperature on the physical properties of obtained organogels. they were prepared under varying independent conditions and applying a fractional experimental design. from there a rheological characterization was developed. the physical characterization also included polarized light microscopy and calorimetric analysis. once these data were obtained, x-ray diffraction was applied to selected samples and a microstructure lattice was confirmed. commonly, the only conditions that affect crystallization have been analyzed (temperature, solvent, gelator, and cooling rate). we found that stirring speed is the most important parameter in the organogel preparation.

PMC4745555

pubmed-883

the mandible occupies a very prominent position on the face and is therefore a favored target of intentional and unintentional trauma1. the high incidence of fractures of the angle of the mandible is attributed to a thinner cross-sectional area relative to the neighboring segments of the mandible, the curvature of trajectories in the angle region, and the presence of third molars, particularly those that are impacted, which weakens the region2. it is therefore not uncommon for an oral and maxillofacial surgeon to encounter fractures of the angle of the mandible in their day-to-day practice. the oral and maxillofacial surgeon's preference for the approach to a fracture site depends on accessibility, ease of procedure, aesthetic demands by the patient, and surgical expertise. various approaches are used for the fixation of fractures of the angle region of the mandible. this technique had certain disadvantages such as an unaesthetic scar and the risk of facial nerve injury, although exposure and direct application of the plate was better with this approach3. to counteract these disadvantages, this approach involves operating entirely through an incision made in the oral mucosa/gingiva and is frequently used by surgeons. the disadvantages included placement of the plate in an anatomically unfavorable position, thin soft tissue coverage leading to an increase in dehiscence and exposure of the plate, and breakage of the plate due to a greater degree of intraoperative plate bending, which required to adapt to the complex contours of the superior border of the mandible. other disadvantages include placement of plate closer to the dentition, allowing an easier and shorter path for bacterial pathogens to move from the periodontal sulcus to the fixation hardware and more prevalent loosening of the screw, as there is less bone density on the superior aspect of the mandible and the alveolus4. the disadvantages of the transoral approach prompted surgeons to find an alternative method, namely the transbuccal approach. this approach involves an intraoral incision plus a small incision on the facial skin, which permits the use of a transbuccal trocar to allow instruments such as a drill or screwdriver to pass through. advantages include no external scarring, fixation of the plates on the thicker lateral cortical plate of the mandible in a sagittal plane, greater soft tissue coverage, less chance of plate fracture as weakening of plates by over-bending is avoided, lower infection rate due to less movement of pathogens from the third molar region, and direct visualization and confirmation of desired occlusion during fixation45. since the miniplate fixation differs for the transoral and transbuccal approaches, we decided to compare the two approaches in the management of angle fractures of the mandible. a total of 60 patients reporting to goa dental college and hospital from march 2013 to december 2014 were included in this prospective study and were randomly divided into 2 equal groups based on the type of approach employed for fracture fixation (group a, transoral approach; group b, transbuccal approach). the study was ethically approved by the goa dental college and hospital's review committee and written informed consent was obtained from all patients participating in the study. we included patients with an age between 15 to 60 years, unilateral/bilateral mandibular angle fractures or fractures associated with other facial bone fractures with radiographic preoperative displacement of the fracture segments ranging from 1 to 5 mm, patients with controlled systemic conditions, and those willing to follow-up. we excluded patients who refused to follow-up or had a medically compromised status and patients with infections or pathologic or comminuted fractures. the degree of anatomical displacement was studied with digital orthopantomogram (opg) and posteroanterior (pa) mandible radiographs. complete hematological investigations were performed and all patients were started on intravenous antibiotics that were continued for 5 days postoperatively in all patients. erich arch bars were applied to the maxillary and mandibular dentition a day prior to surgery. all patients were operated under general anesthesia with nasotracheal intubation following a standard surgical protocol by a single oral and maxillofacial surgeon. in group a, following local infiltration of the intraoral site with 2% lignocaine with 1:80,000 adrenaline, an incision was planned extending from the anterior border of the ascending ramus at the level of maxillary occlusal plane. the incision was then carried down just along the lateral portion of the anterior ramus and continued forward approximately 5 mm from the junction of the attached mucosa and vestibule to extend anteriorly to the level of the mandibular first molar. b) fractured segments were stabilized and fixed with a 2.5 mm 4-hole titanium miniplate with a gap, and were secured with monocortical screws that were 2.5-mm in diameter and 6 to 8 mm in length. general anesthesia was reversed and the patient was extubated and shifted to the recovery room. in group b, in addition to the transoral incision, a small extraoral stab incision was given to permit the insertion of the transbuccal cannula.(fig. b) the location of the extraoral stab incision was guided by the location of the fracture line and the position of the facial vessels. the trocar was advanced into the operative site with blunt dissection through the stab incision, perforating the periosteum in the area planned for plate fixation.(fig. c) the cheek retractor was applied to stabilize the trocar assembly during movement towards and away from the fracture site. a drill bit that was 11.5 cm in length and 2.3 mm in diameter the procedure followed for fracture reduction was similar to that of the transoral approach, except that after fracture reduction, the trocar assembly was removed and the extraoral skin incision was sutured with 5.0 ethilon (johnson&johnson, new brunswick, nj, usa) suture.(fig. d-h) all patients were hospitalized for 5 days and were placed on a liquid diet for 2 weeks, followed by a soft diet for another 4 weeks. intraoperatively, patients were evaluated for the ease of surgical access for fixation and the surgical time (time from incision to closure). the ease of surgical access for fixation in either approach was evaluated by the operating surgeon and graded as 1, good; 2, fair; and 3, poor, based on the visual analogue scale6. radiographic evaluation of fracture reduction between the two groups was done by measuring the gap between the fractured segments of the mandible in postoperative opg radiographs. all radiographs were performed using the orthophos xg machine (sirona dental systems, bensheim, germany) with similar exposure parameters. on the radiographs measurements of the fracture gap were conducted on these 4 defined points with a digital caliper6.(fig. 3, 4) postoperative complications such as scarring (in group b), occlusal discrepancy, infection, nonunion, and malunion were evaluated at each regular follow-up period. evaluation of scarring in group b was done with photographs at the 6th month postoperatively. the scoring for the scar was as follows: 1, hypertrophic scar; 2, invisible scar; and 3, barely visible scar7. postoperative occlusion was evaluated using the following scoring system: 1, pre trauma; 2, minor discrepancy; and 3, major discrepancy8. the data was tabulated and subjected to statistical analysis (spss version 13; spss inc., the mean age in this study was 26.73 years (range, 17-53 years), with a peak incidence in the second and third decades of life (n=46, 76.7%) which showed male predominance (n=58, 96.7%). road traffic accidents accounted for the majority of the cases (n=52, 86.7%). isolated mandibular angle fracture was seen in 20 patients (33.3%), with a higher incidence of right sided fracture (n=36, 60.0%) when compared to the left (n=24, 40.0%). the ease of surgical access for fixation revealed no statistical significance when compared between the two groups. (table 1) the mean surgical time for each group was 37 minutes and did not vary between groups.(table 2) postoperative radiographic tracing for both groups was done on the opg. it was noted that the reduction in the gap in group b was uniform from points a to d, whereas in group a, there was gradual increase in the distance between the fractured segments.(table 3) there was no statistical difference at point a for both groups. however, points b (p=0.030), c (p=0.016), and d (p=0.004) were statistically different between groups.(table 4) with regard to postoperative complications, scar evaluation in group b at 6 months revealed 1 patient (3.3%) with a hypertrophic scar, 6 patients (20.0%) with barely visible scars, and 23 patients (76.7%) with invisible scars. infection was noted in 2 patients (6.7%) in group b, compared to 6 patients (20.0%) in group a at 3 months postoperatively. the cause of the infection could be traced to the infected plates that were removed under local anesthesia, and patients were prescribed a course of oral antibiotics for 5 days. no cases of malunion or non-union were noted in the two groups. with regard to postoperative occlusion, 28 patients in group b had a score of 1 (pre-trauma occlusion), compared to 16 patients in group a (p=0.027, significant). twelve patients in group a had a score of 2 (mild discrepancy), compared to 2 patients in group b (p=0.016, significant). two patients in group a had a score of 3 (major discrepancy), compared to no patients in group b.(table 5) the occlusal discrepancy was noted only in the first week postsurgery in either group and was corrected using elastic traction in all patients. the mandibular angle is subjected to forces between the muscles of mastication and the supra-hyoid group of muscles, resulting in unstable rotation of distal and proximal fragments. the presence of an impacted third molar tooth in the line of fracture may result in the fracture being compounded intraorally, which may distract away from bone or interfere in ideal fracture reduction9. although the management of mandibular angle fractures is still a topic of debate, the treatment is dictated by the principles of fixation and aesthetic demand by the patient. as treatments and equipment have evolved, miniplate fixation can now be carried out in an anatomically favorable position using a transbuccal approach. however, some surgeons do not prefer the transbuccal technique due to the theoretical risk of damage to the facial nerve and an unfavorable facial scar1011. in this study of 60 patients, the incidence of mandibular angle fractures was seen in ages ranging from 17 to 53 years, with a mean age of 26.73 years. the peak incidence of fractures was seen in the second and third decades of life (n=46, 76.7%) with a definite predilection in males (n=58). road traffic accidents was the most common etiological factor, (n=52, 86.7%) followed by assault (n=8, 13.3%). the findings were in unison with a study conducted by kumar et al.12, which reported the pattern of maxillofacial fractures in 2,731 patients. the highest incidence of fractures in this study was found in the second and third decades of life (n=1,535, 56%). road traffic accidents were the most frequent cause (n=2,086, 76%), followed by assault (n=260, 12%). another similar study13 looked at 214 patients and stated that the incidence of angle fractures was higher in the male population and was most common in the third decade of life. although we report that surgical access is facilitated with the transbuccal approach, we did not observe any statistically significant differences between the two approaches for this parameter. surgical time is defined as the time taken from incision and exposure of the fractured site to closure. this finding contradicted studies in the literature that have shown increased surgical time with the transbuccal approach when compared to the transoral approach1011. radiographic evaluation of fracture reduction was performed by studying the gap using tracings done on the opg. however, points b (p=0.030), c (p=0.016), and d (p=0.004) were statistically different between groups. the reduction obtained in group b was uniform from points a to d, whereas in group a, there was a gradual increase in the distance between the fractured segments. we believe that the favorable position of the miniplate in the transbuccal approach brings about better control of the tensile and compressive forces, resulting in more uniform reduction in the fracture gap from points b to d. this observation was in accordance with a study on three-dimensional models by kroon et al.14 and choi et al.15, who observed bony gaps along the inferior fracture border and found that this fracture movement was a contributory factor for subsequent complications, including infection. a study by wan et al.4 states that in transbuccal approach, no patients developed facial nerve palsy, whereas 1 patient out of 227 (45%) developed a hypertrophic scar from the 6-mm facial skin incision. another study by sugar et al.10 reported similar findings in a population of 84 patients. no incidence of unsatisfactory facial scarring and facial nerve palsy from the transbuccal approach was noted. this is in accordance with our study, which reported 1 case (3.3%) of hypertrophic scarring and no incidence of facial nerve palsy in group b. three months after surgery, only two patients in group b had an infection, as compared to six patients in group a. this was due to the infected plate, which was retrieved under local anesthesia. a course of oral antibiotics for 5 days was subsequently prescribed and the healing was uneventful. a study by barry and kearns9 reported infection in 4 out of 50 patients in which the plate was retrieved at an out-patient department. another study by ellis and walker16 reported infection occurring within two weeks of surgery in 2 out of 81 patients; this infection was treated initially with oral antibiotics, which resulted in normal fracture healing. the gold standard in management of mandibular fracture is to establish the pre-trauma occlusion with minimal postoperative complications. when postoperative occlusion was assessed, the transoral group had significantly more occlusal discrepancy than the transbuccal group. the discrepancy in occlusion was observed only in the first week postsurgery and was managed using light guiding elastics in all patients, with no re-surgical intervention required in any patient. malocclusion may be due to the presence of concomitant fractures which may contribute to instability at the mandibular angle fracture site10. this is in concordance with our study, which showed concomitant fractures in 11 patients (73.3%) in group a and 9 patients (60%) in group b. the rate of postoperative malocclusion reported in the literature ranges from 0% to as high as 7.5%. sugar et al.10 presented a study showing a strong preference of surgeons for fixation using a transbuccal approach. the principal reasons given were ease of use, minimal requirement for plate bending, and facilitation of plate placement in the neutral mid-point area of the mandible. our experience with the transbuccal approach was somewhat similar. a meta-analysis by al-moraissi and ellis17 states that the use of one miniplate is superior to the use of two miniplates in the management of mandibular angle fractures, as the incidence of postoperative complications was considerably lower. this is concordant with the present study, which showed better results when a single miniplate was used either transorally or transbuccally. in conclusion, although both approaches have inherent advantages and disadvantages, the transbuccal approach was superior to the transoral approach with regard to radiographic reduction in the fracture gap, inconspicuous external scarring, and fewer postoperative complications. we did not find increased operating time or damage to the facial nerve, which was observed by other authors when the transbuccal approach was employed. we preferred the transbuccal approach over the transoral approach due to ease of use, minimal requirement for plate bending, and facilitation of plate placement in the neutral mid-point area of the mandible. a study employing a larger sample size and without any confounding variables is ongoing to define our results even more precisely.

objectiveswe compared the transbuccal and transoral approaches in the management of mandibular angle fractures. materials and methodssixty patients with mandibular angle fractures were randomly divided into two equal groups (a, transoral approach; group b, transbuccal approach) who received fracture reduction using a single 2.5 mm 4 holed miniplate with a bar using either of the two approaches. intraoperatively, the surgical time and the ease of surgical assess for fixation were noted. patients were followed at 1 week, 3 months, and 6 months postoperatively and evaluated clinically for post-surgical complications like scarring, infection, postoperative occlusal discrepancy, malunion, and non-union. radiographically, the interpretation of fracture reduction was also performed by studying the fracture gap following reduction using orthopantomogram tracing. the data was tabulated and subjected to statistical analysis. a p-value less than 0.05 was considered significant. resultsno significant difference was seen between the two groups for variables like surgical time and ease of fixation. radiographic interpretation of fracture reduction revealed statistical significance for group b from points b to d as compared to group a. no cases of malunion/non-union were noted. a single case of hypertrophic scar formation was noted in group b at 6 months postsurgery. infection was noted in 2 patients in group b compared to 6 patients in group a. there was significantly more occlusal discrepancy in group a compared to group b at 1 week postoperatively, but no long standing discrepancy was noted in either group at the 6 months follow-up. conclusionthe transbuccal approach was superior to the transoral approach with regard to radiographic reduction of the fracture gap, inconspicuous external scarring, and fewer postoperative complications. we preferred the transbuccal approach due to ease of use, minimal requirement for plate bending, and facilitation of plate placement in the neutral mid-point area of the mandible.

PMC4940199

pubmed-884

amputation is a complex procedure with physical, social, and psychological components. in developing countries, amputation rates have increased because of accidents, trauma, and various systemic diseases. a study in 2008 estimates nearly 2 million people are living with limb loss in the united states and it is projected that the number will more than double by 20501. a recent study that demonstrated the impact of limb loss in the us, showed that more than 57,000 (40%) of all amputation procedures were related to diagnose of diabetes2. unfortunately there is insufficient data about causes, procedures, and team-work for limb loss, and trauma-related amputation is more frequent in turkey3, 4. both traumatic and non-traumatic limb loss is often associated with multiple systemic conditions or complications like diabetes, obesity, cardiovascular disease, musculoskeletal problems, depression, and emotional stress2, 5. studies also estimate that 50% to 74% of people with limb loss have 5-year mortality rate higher than many cancers, especially due to vascular disease, diabetes, and some chronic conditions based on obesity2, 3, 6,7,8. therefore, the amputee requires multi-perspective expertise in coping with these systemic problems9,10,11. as a critical part of the rehabilitation program, physiotherapy has an important role in ensuring ideal functional outcome. in 1979, malone et al.12 suggested that significant financial and therapeutic benefits accrue from the application of an accelerated rehabilitation approach. additionally, recent studies indicated that amputees who were accepted into multi-disciplinary rehabilitation programs reached their highest functional level, and achieved or improved independent mobility and self-care with a significant reduction in time9,10,11, 13,14,15. therefore, in accordance with this literature, the aim of our study is to demonstrate the frequency of prosthetic applications and to appraise the importance of amputee rehabilitation in turkey. questionnaires were administered to owners or employees of 36 institutions and the obtained data were evaluated. the questionnaire consisted of 3 subsections including information about the corporation, prosthesis, and rehabilitation. descriptive information about corporation, number and profession of employees and frequency of professional training and scientific research were questioned in the first subscale. amputation levels, types of applied prosthesis and the frequency of patient control were questioned in the prosthesis section. the study protocol was approved by the non-interventional clinical researches ethics board of hacettepe university faculty of medicine. four hundred prosthetics application centers were contacted by e-mails or interviews. questionnaires that we created were administered to owners or employees of 36 institutions. while 75% of institutions had no physiotherapist, 22.2% had 1 physiotherapist, 2.8% had 2 physiotherapists. there were 4 or fewer technician in 86.1% of the institutions and the majority of employees were out of profession in almost all institutions (table 1table 1.frequencies of physiotherapists and technicians employed by institutionsn=360123 or morephysiotherapist27 (75)8 (22.2)1 (2.8)0 (0)technician0 (0)17 (47.2)10 (27.8)9 (25)values in parentheses are percentages.); 55.6%, 75%, 16.7%, and 25% of the institutions frequently encountered above-knee, below-knee, above elbow, and below elbow amputees respectively (table 2table 2.frequencies of different levels of amputees admitted to these institutions and different types of prosthetics manufactured in these institutionsn=36frequentlyoccasionallyrarelyneverbelow knee27 (75)5 (13.9)3 (8.3)1 (2.8)above knee20 (55.6)10 (27.8)5 (13.9)1 (2.8)below elbow9 (25)13 (36.1)12 (33.3)2 (5.6)above elbow6 (16.7)10 (27.8)17 (47.2)3 (8.3)classical3 (8.3)7 (19.4)20 (55.6)6 (16.7)technological23 (63.9)12 (33.3)1 (2.8)0 (0)advanced technological11 (30.6)13 (36.1)9 (25)3 (8.3)values in parentheses are percentages.). the frequency of manufacturing and application of classical prosthetics was 8.3%, that of technological prosthetics was 63.9%, and that of advanced technological prosthetics was 30.6% (table 2). falls and complications were reported in 83.3% and 75% of the institutions, respectively, and 58.3% of them reported occasionally encountering cases with need of repair; 55.6% of institutions performed preprosthetic evaluations, 63.9% used gait analysis, and 50% performed prosthetic rehabilitation frequently (table 3table 3.frequencies of preprosthetic evaluation and prosthetic rehabilitation made by these institutionsn=36frequentlyoccasionallyrarelyneverpreprosthetic evaluation20 (55.6)0 (0)0 (0)16 (44.4)prosthetic rehabilitation18 (50)10 (27.8)7 (19.4)1 (2.8)values in parentheses are percentages.). the reported evaluation methods were non-standardized, usually comprising measurement of stump and information about patient and amputation. subjective methods, like observational gait analysis, were often used as a method of gait analysis. rehabilitation process consisted of basic activities like wearing and removing prosthesis, transfers, stair climbing, and walking on uneven ground. the results of this study revealed that many of the institutions in turkey do not employ physiotherapists specializing in prosthetics and orthotics, observational and subjective evaluation methods are used by the institutions, and rehabilitation program consists of only teaching basic activities of daily living with prosthesis. amputation is not only an aesthetic loss but also a permanent disability that affects functional independence16, 17. appropriate prosthetic design, rehabilitation programs, and education are important to regain lost functions and improve the quality of life for amputees17,18,19,20. at present, new prosthetic designs, technologically advanced, and expensive prosthetic components are available. some of the prosthesis component manufacturers argue that new components create advantages to learn how to use these devices. however, technological progress and new expensive components do not trivialize the rehabilitation, and make it even more important21. selection of the appropriate prosthetic components and rehabilitation are important for patient s daily life, occupational, and recreational activities22. deficiencies related to physiotherapist employment, evaluation and rehabilitation processes in prosthetic application centers that were interviewed in this study can lead to errors in the choice of prosthesis, inability to sustain daily living and occupational activities and additional problems (wound on the stump, problems arising from gait disturbance, falls, etc.). the patient s health may be impaired due to these factors and patients may be affected socially and economically. consequently, quality of life can be reduced. amputee rehabilitation is a long process and an experienced multidisciplinary rehabilitation team is necessary in order to achieve successful outcomes for upper/lower extremity amputees23. experienced physiotherapists, physicians and technicians should be involved in the amputee rehabilitation process. twenty-seven of the institutions participating in this study do not employ physiotherapists, 8 employ one physiotherapist and 1 employs 2 physiotherapists. these results indicate that the number of physiotherapists employed in prosthetic application centers is very inadequate. this number should be increased for more success in prosthetic application and amputee rehabilitation in turkey. as known, physiotherapists contribute to improve balance and functional activities like walking, turning, walking uphill and on uneven grounds independently with or without prosthesis after lower limb amputation24,25,26. they provide training to perform activities of daily living and self-care after upper limb amputation26. twenty institutions reported they often perform assessments before prosthetic application; 23 reported they often perform gait analysis; and 18 reported they often performed prosthetic rehabilitation. the indicated assessment methods were non-standardized, usually including knowledge of patient and amputation, stump measurements, and observational gait analysis. the indicated rehabilitation process included basic activities like donning prosthesis, transfers, climbing stairs, and walking on uneven ground. however, amputation is a permanent disability; therefore, amputee rehabilitation is essential not only in early prosthetic stage but also lifelong23. deathe et al.27 found that there was no consensus regarding rehabilitation program or patient outcome measurement tools and the common outcome measures and rehabilitation methods were nonstandardized, informal methods in canada, with their same study. a limitation of this study was the small number of centers participating in the research. four hundred prosthetic application centers were contacted but only 36 participated in this study. this indicates that awareness of these institutions about the rehabilitation process is insufficient. to our knowledge, the majority of prosthetic application centers do not employ physiotherapists and information about rehabilitation of the other staff in these centers is limited. in addition, some of the participants may not have answered all questions correctly with commercial concerns. this study offers data about prosthetic applications, prosthetic application centers, and the status of the rehabilitation process in these centers in turkey. the results of this study reveal the requirement for more physiotherapists working in these centers, the utilization of standardized-objective assessment methods, and the development of the rehabilitation process for successful prosthetic applications and amputee rehabilitation in turkey. this study can create awareness to develop appropriate recommendations in order to maintain prosthetic applications and ensure healthier amputee rehabilitation. amputee rehabilitation should be considered in a broader context and physiotherapist employment should be increased for sufficient rehabilitation process in prosthetic application centers.

[ purpose] the aim of this study was to determine the frequency of prosthetic applications and to appraise the importance of amputee rehabilitation in turkey. [subjects and methods] questionnaires were administered to owners or employees of 36 institutions and the obtained data were evaluated. [results] while 75% of institutions had no physiotherapist, 25% had 1 or 2 physiotherapists; there were 4 or fewer technicians in 86.1%, and the majority of employees were out of profession in almost all institutions. a total of 83.3% of institutions reported falls, 75% reported complications, 58.3% of them occasionally noted the need of repair; 55.6% of institutions made preprosthetic assessments, 63.9% used gait analysis, and 50% performed prosthetic rehabilitation frequently. [conclusion] the results of this study reveal the need for more physiotherapists in these centers, the utilization of standardized-objective assessment methods, and development of rehabilitation processes for successful prosthetic applications and amputee rehabilitation in turkey.

PMC4905904

pubmed-885

ulcerative colitis is a chronic inflammatory disease of the large intestine. its exact cause is unknown, but it appears to be multifactorial, with a proposed interaction between genetic and environmental factors that results in continuous activation of the intestinal mucosal immune system. the inflammation affects the mucosa of the rectum, with different degrees of involvement of the colon.1 the management of ulcerative colitis is based on the extent of colon involvement, the activity, and the behavior of disease. the classification of the disease is defined according to the montreal classification, which describes the maximal macroscopic extent of the disease at colonscopy.2 this has important prognostic and management implications because patients with extensive ulcerative colitis bear a higher risk of colectomy and cancer,3 and patients with proctitis and left-sided colitis obtain much more benefit from topical therapies. however, the extent of colon involvement may change over time, such that about 20% of patients who are diagnosed with proctitis or left-sided ulcerative colitis are found to have proximal extension of the inflammation at follow-up. the clinical course of ulcerative colitis is characterized by different disease onsets and a remitting a recent population-based, inception cohort study identified four different patterns: (1) initial high activity that decreases to remission or mild severity (55% of patients); (2) initial low activity that changes to increased severity (1% of patients); (3) continuous symptoms (6% of patients); and (4) chronic intermittent symptoms (37% of patients). moreover, an initial presentation with extensive colitis, high systemic inflammation burden, and a younger age has been associated with higher subsequent colectomy rates.4 disease activity is commonly classified as: remission, mild, moderate, or severe. over the years, several different scoring systems have been developed as measures of disease activity, but most of these have only been used in clinical trials and have not been validated. in clinical practice, the combination of clinical features, laboratory findings, and the endoscopic appearance, forms the basis of patient management.5 the main treatment goals for ulcerative colitis are the induction and maintenance of clinical and endoscopic remission. as far as mild-to-moderate disease is concerned, the oral and topical aminosalicylates represent the standard therapy for achieving this outcome.6 in the event of inadequate response to aminosalicylates and in patients with moderate-to-severe disease, systemic corticosteroids are the best option for inducing remission.7 patients with active ulcerative colitis who do not have significant clinical improvement after 24 weeks of an appropriate course of corticosteroids are classified as corticosteroid-refractory. anti-tumor necrosis factor-alpha (tnf) monoclonal antibodies represent the best available option for this group of patients, achieving clinical and endoscopic remission without prolonged steroid exposure.8 after achieving a response with corticosteroid treatment, aminosalicylates are usually continued as maintenance therapy. however, patients relapsing within 3 months of stopping corticosteroids or who are not able to reduce the dose to below 10 mg/day of prednisolone within 3 months of starting are classified as corticosteroid dependent.1 in this specific disease setting, azathioprine has been shown to be significantly more effective than mesalazine for inducing corticosteroid-free clinical and endoscopic remission at 6 months and has a corticosteroid-sparing effect.9 treatment algorithms for patients with corticosteroid-dependent ulcerative colitis suggest starting concomitant thiopurine therapy and slowly withdrawing corticosteroids over 34 months, timed to coincide with the expected onset of action of the thiopurines.10 if symptoms persist or patients are unable to stop steroids after 12 weeks of starting thiopurines, anti-tnf agents should be started.10 finally, induction and scheduled maintenance treatment with infliximab has been recently reported to be effective for inducing steroid-free clinical remission and mucosal healing at 1 year, in both thiopurine-nave and experienced, corticosteroid-dependent, ulcerative colitis patients.11 patients with acute, severe ulcerative colitis need to be hospitalized and treated with intensive intravenous corticosteroids (methylprednisolone, 60 mg/24 h, or hydrocortisone, 100 mg, four times daily). a lack of improvement within 35 days of intensive treatment is an indication for rescue therapy or surgery. a recent open-label trial involving 115 patients with acute, severe ulcerative colitis who were refractory to intravenous corticosteroids and randomized to receive either intravenous cyclosporine or infliximab has shown no significant differences in treatment failure (primary efficacy outcome: 60% cyclosporine group vs 54% infliximab group; absolute risk difference, 6%; 95% confidence interval [ci], 7 to 19 [p=0.52]).12 therefore, the decisions of physicians are often determined on a case-by-case basis. these decisions are usually made based on personal experiences with this specific therapy and the physician s confidence for the management of adverse events, taking into account the long-term strategy. cyclosporine, in fact, has been shown to be effective only over the short-to-medium term. therefore, all patients should be bridged to thiopurines, although it has been shown that patients without previous thiopurine exposure have better outcomes.13 adalimumab is a human monoclonal immunoglobulin (ig) g1 antibody to tnf that is subcutaneously administered at a standard induction dose of 160 mg, followed by 80 mg after 2 weeks. maintenance doses are then scheduled at 40 mg every other week (eow).14 this drug has been shown to be effective for inducing and maintaining remission in patients with active, moderate-to-severe luminal or perianal crohn s disease; patients nave to anti-tnf; or patients with previous loss of response or intolerance to infliximab.1519 as far as ulcerative colitis is concerned after the publication of the results of the two pivotal, randomized placebo-controlled double-blind trials (ultra 1 and 2) (table 1),20,21 adalimumab was approved for use in patients with moderate-to-severe active disease and in those who were nonresponders or intolerant to conventional therapy. in these trials, involving more than 1000 patients with moderate-to-severe active ulcerative colitis, adalimumab was compared with placebo with regard to the efficacy of induction and as a maintenance treatment, assessed after 8 and 52 weeks, respectively. in the ultra 1 trial,20 patients with ulcerative colitis were initially randomized to adalimumab (160 mg/80 mg) or placebo at weeks 0 and 2, respectively. subsequently, after an amendment of the protocol, a third arm, with adalimumab at 80 mg/40 mg, was included. all patients enrolled were nave to anti-tnf therapy and had active disease (defined by a full mayo score of 612 and an endoscopic subscore of 23), despite stable doses of concomitant steroids, immunomodulators, or both. the primary endpoint, assessed in 390 patients with ulcerative colitis who were studied after the above amendment, was defined as the proportion of patients achieving clinical remission (full mayo score 2, with no individual subscore>1) by week 8 in each treatment arm. week 8 clinical remission was achieved in 18.5% of patients in the adalimumab 160/80 mg group and in 9.2% of patients in the placebo arm (p=0.031), showing a 9.3% of therapeutic gain. the week 8 clinical remission rate in the adalimumab 80/40 mg group was similar to that of the placebo group (10% vs 9.2%) (p=0.833). the clinical response and mucosal healing among the three groups (secondary endpoints) were not significantly different. a post hoc analysis identified baseline clinical variables, such as extensive disease, high disease activity (mayo score 10) and high levels of systemic inflammation (c-reactive protein=10 mg/l), that were associated with a low proportion of patients in clinical remission, which might reflect a lesser efficacy of adalimumab in patients with more severe disease. thereafter, 390 patients entered an open-label extension study after week 8 and were maintained on adalimumab 40 mg eow for 52 weeks, with the possibility of dose-escalation to 40 mg weekly. a clinical remission at week 52 was reported in 25.6% of patients maintained with 40 mg of adalimumab eow. a post hoc analysis, which included the patients who dose-escalated to 40 mg weekly, showed that 29.5% of patients were in remission at week 52.22 in the ultra 2 trial, 494 active ulcerative colitis patients were randomized to receive adalimumab 160 mg at week 0, 80 mg at week 2, and 40 mg eow, or placebo, through to 52 weeks. the clinical and endoscopic eligibility characteristics were similar to those associated with the ultra 1 study, with the exception of the inclusion of ulcerative colitis patients (40% of the population studied) who had already experienced anti-tnf agents, but with a discontinuation period of at least 8 weeks. the two co-primary endpoints were defined as the proportion of patients achieving clinical remission (defined as full mayo score 2, with no individual subscore>1) at week 8 and the proportion of patients achieving clinical remission at week 52. clinical remission at week 8 was achieved in 16.5% of patients in the adalimumab arm and in 9.3% of patients in the placebo arm (p=0.019) (7.2% therapeutic gain). the corresponding values at week 52 were 17.3% and 8.5% (p=0.004), respectively, with an absolute difference of adalimumab versus placebo of 8.8%. moreover, a clinical response was achieved in 50.4% of patients receiving adalimumab and 34.6% on placebo (p<0.001) at week 8 and in 30.2% and 18.3%, respectively (p=0.002) at week 52. the benefit over placebo was also significant by endoscopic remission, evaluated at week 8 (41.1%, adalimumab vs 31.7%, placebo) (p=0.032) and at week 52 (25% vs 15.4%, respectively) (p=0.009). a subgroup analysis, stratifying patients based on prior exposure to anti-tnf, was also performed. among nave patients, a week 8 clinical remission was achieved in 21.3% of patients in the adalimumab group and in 11% in the placebo group (p=0.017); the corresponding values at week 52 were 22% and 12.4%, respectively (p=0.029). a significant difference in clinical remission was found only at week 52 (10.2%, adalimumab and 3%, placebo) (p=0.039) in the anti-tnf-exposed group.21 a post hoc intention-to-treat analysis of ultra 2, including all patients randomized to adalimumab who achieved a clinical response, as per their partial mayo score at week 8, was performed to investigate week 52 clinical remission, response, mucosal healing, corticosteroid-free remission, and corticosteroid discontinuation rates. among the 248 patients originally randomized to adalimumab, 123 (49.6%) had achieved clinical response. of these, 30.9%, 49.6%, and 43.1% achieved clinical remission, clinical response, and mucosal healing at week 52, respectively. of the 150 adalimumab-treated patients taking corticosteroids at enrollment, 90 (60%) responded, as per their partial mayo score at week 8. of these, 21.1% achieved corticosteroid-free remission and 37.8% were corticosteroid-free at week 52, without significant differences among the anti-tnf-nave and exposed patients. these results were similar whether or not week 8 responses were assessed using the full mayo score.23 further analysis showed that patients who received the 160 mg/80 mg adalimumab induction dose had a significantly lower risk of all-cause hospitalizations and ulcerative colitis-related hospitalizations, compared with placebo, during the first 8 weeks of therapy.24 this benefit over placebo was also significant for adalimumab early-responders, during the follow-up.25 at 52 weeks, 588 patients who completed the ultra 12 trials entered an extension, open-label study. patients who entered the open-label, weekly adalimumab study continued at the same dose. patients who entered the study from any blinded arm or from an open-label cohort receiving adalimumab (40 mg eow) received adalimumab at a dose of 40 mg eow. at week 60 of the open-label extension study, 351 (59.7%) of the patients who had entered the extension study achieved clinical remission, per their partial mayo score.26 although adalimumab has been recently licensed, multiple lines of evidence from open-label and retrospective studies on adalimumab, administered for compassionate use in ulcerative colitis patients, have been available for several years (table 1). oussalah et al27 first presented data on 13 ulcerative colitis patients treated with adalimumab in 2008. all of the patients had been previously treated with infliximab, and most of them (90.31%) had been previously treated with thiopurines. patients were treated with adalimumab, with an induction dose of 160/80 mg at weeks 0 and 2, and then maintained with 40 mg eow. the primary endpoint was defined as the proportion of patients on adalimumab therapy during the study. after a median follow-up of 41 weeks eight patients discontinued adalimumab: six due to colectomy, one due to lack of response, and one due to an exacerbation of psoriasis. no significant differences were found in adalimumab withdrawal and colectomy rates between the patients who lost response to infliximab and those who became intolerant. from this small cohort of difficult-to-treat patients who had already been treated with all of the main available therapies, adalimumab treatment potentially avoided colectomy in about half of them. one year later, the mayo clinic group published the results of an uncontrolled, open-label study on adalimumab in 20 patients with ulcerative colitis, of whom 35% were nave to infliximab. all patients had active disease (defined as a mayo score of 612 points, with an endoscopic subscore of at least 2) despite concurrent treatment (steroids, and/or thiopurines, and/or aminosalicylates). patients were treated with adalimumab at an induction dose of 160/80 mg at weeks 0 and 2, respectively, and maintained with 40 mg eow. the primary endpoint was defined as the proportion of patients achieving a clinical response at week 8. the percentages of patients who had a clinical remission or response were 5% and 25% at week 8, respectively and 25% and 50% at week 24, respectively. no significant differences were found between infliximab-nave and infliximab-exposed patients. among the patients who entered the trial on corticosteroids, 58% were able to withdraw by week 24, showing the potential effectiveness of adalimumab as a steroid-sparing agent.28 hudis et al29 retrospectively reported data on nine patients, with active ulcerative colitis (mean mayo score of 6 1.66 at baseline) and secondary infliximab failure, who were treated with adalimumab (induction, 160/80 mg at weeks 0/2; maintenance, 40 mg eow). during the follow-up, adalimumab was found to be effective at inducing a clinical response (mean mayo score, 2.5 1) (p<0.0005), with a steroid-sparing effect (p<0.003). data, from a single referral center, involving 53 ulcerative colitis outpatients treated with biologic drugs, following a structured protocol for a step-up approach. all patients were intolerant and/or nonresponders to conventional therapy, including aminosalicylates, steroids, and thiopurines. among them, 25 patients were treated with adalimumab (160/80 mg at weeks 0 and 2, then 40 mg eow) and 28 with infliximab (5 mg/kg at weeks 0, 2, and 6, then every 8 weeks). most of patients had extensive colitis (96% in the adalimumab group and 90% in the infliximab group). concomitant immunosuppressive therapy (azathioprine or methotrexate) was taken by significantly fewer patients in the adalimumab group (20% vs 53.4%) (p=0.0118). the primary endpoint was defined as the proportion of patients treated with adalimumab or infliximab achieving and maintaining a clinical response. at 14 weeks, 47 of the 53 (88.7%) patients had a clinical response to anti-tnf therapy, without a significant difference between the adalimumab (20/25 patients, 80%) and infliximab (27/28 patients, 96%) groups (p=0.0889). among the patients who entered the maintenance treatment phase, 1420 adalimumab (70.0%) and 1418 (77.8%) infliximab patients had a response up to the end of follow-up (p=0.7190). the median duration for the maintenance phase was 54.5 weeks (range, 3108 weeks) for the adalimumab group and 64.5 weeks (range, 8180 weeks) for the infliximab group. of the six adalimumab patients who lost response, two underwent colectomy, one switched to infliximab, and three were treated with another course of steroids. about 92% of the patients who were initially taking steroids were able to stop over the course of the maintenance period, with similar results observed in both groups. cohort, adalimumab seemed to be as effective as infliximab at achieving induction and maintenance responses in ulcerative colitis patients. the effectiveness of adalimumab in a real-life setting has also been reported in a spanish retrospective multicenter study that enrolled 30 ulcerative colitis patients after the failure of other therapies. all patients were infliximab experienced: 53.3% had lost responsiveness, 40% had become intolerant, and 6.7% were primary nonresponders. adalimumab was administered to 26 patients because of moderate-to-severe, refractory ulcerative colitis, and four patients received adalimumab because of a severe attack that was refractory to intravenous corticosteroids. all patients received a loading dose of 160/80 mg of adalimumab at weeks 0 and 2, respectively and were maintained with 40 mg eow. patients were assessed at weeks 4 and 12, and then every 4 weeks in order to evaluate the short- and long-term outcomes. the primary endpoint was defined as the induction of a clinical response at week 12. sixteen (53.3%) and 18 (60%) patients achieved a clinical response at week 4 and 12, respectively. three (10%) and eight (26.7%) patients achieved a clinical remission at week 4 and 12, respectively. fifteen (50%) patients discontinued adalimumab during the median follow-up of 48 weeks (interquartile range [iqr], 16104), and 13 (86.6%) of them discontinued because of a lack or loss of response, including four inpatients with severe intravenous corticosteroid-refractory disease. all patients who were under corticosteroid treatment at baseline and entered the maintenance adalimumab treatment were able to discontinue the steroids. the rate of colectomy was 20%, with a median time to colectomy of 16 weeks (iqr, 5.240.5 weeks). a lack of response at week 12 was associated with an increased probability of withdrawal (p=0.001) and a higher rate of colectomy (p=0.001). thus, adalimumab induced a durable clinical response in a good percentage of patients with medically refractory ulcerative colitis, especially in those who achieved short-term clinical response.31 the same issue was also addressed by mcdermott et al,32 who collected data on 23 patients with ulcerative colitis treated with adalimumab (standard induction and maintenance treatment). twenty-two of the patients (96%) had received prior immunomodulatory therapy and 20 (86%) had previously been treated with infliximab (three primary nonresponders, eleven secondary failures, and six who experienced side effects). the primary endpoint was defined as treatment failure. during a median follow-up period of 22 months (iqr, 832 months), 16 patients (69.5%) discontinued adalimumab. the reasons for discontinuation were primary nonresponse in six patients (37%), secondary nonresponse in eight (50%), and side effects in one (6%). nine patients underwent colectomy, and three refused surgery; the colectomy-free survival was estimated to be 78% at 6 months, 70% at 12 months, and 59% at 2 years. no significant predictors of colectomy were identified, but 55% of patients who underwent surgery had failed adalimumab treatment within 3 months of starting treatment.32 further findings by ferrante et al33 confirmed that adalimumab is effective in inducing a durable clinical remission in patients who have already been treated with infliximab. fifty patients with moderate-to-severe ulcerative colitis received adalimumab induction treatment (160/80 mg at weeks 0 and 2, followed by 40 mg eow). the primary endpoint was the long-term efficacy of adalimumab. at week 4, 68% patients showed a short-term clinical response. in particular, 22% of the patients achieved a complete clinical response, defined as the absence of diarrhea and bloody stools, and 46% of the patients achieved a partial response, defined as a marked clinical improvement, with persisting rectal blood loss. after a median follow-up of 23 months, 52% achieved a durable response to adalimumab, defined as a lasting clinical response. dose escalation was necessary in 76% of patients and was associated with significantly increased serum adalimumab levels (from 4.75 to 7.95 g/ml) (p=0.023). short-term clinical response and response to dose escalation were associated with colectomy-free survival (p=0.030 and p<0.001, respectively). data from the spanish eneida (estudio nacional en enfermedad inflamatoria intestinal sobre determinantes genticos y ambientales) registry of 48 patients with ulcerative colitis treated with adalimumab (induction dose, 160/80 mg at weeks 0 and 2, in 93.7% of patients; maintenance dose, 40 mg eow) have been recently reported.31 among these patients, 39 (81.3%) had previously received infliximab and were categorized into one of three categories: remission, 51.3%; response, 33.3%; and primary nonresponse, 15.4%. the primary endpoint was defined as the proportion of patients achieving a clinical response during the follow-up period. the clinical response rates were assessed at weeks 12, 28, and 54 and were 70.8% (34/48), 43.2% (19/44), and 35% (14/40), respectively. a response to prior treatment with infliximab was the only factor predictive of a response to adalimumab at week 12, which was obtained in 90% of infliximab remitters, 53.8% of responders, and 33.3% of primary nonresponders a lack of response to adalimumab at week 12 was shown to be an independent predictor of colectomy: five of the 34 (14.7%) responders and six of the 14 (42.9%) nonresponders (p=0.035) required a colectomy, with a colectomy-free time that was significantly reduced among the nonresponding patients (p=0.01).34 the last real-life experience comes from an italian multicenter study that represents the largest case series of active ulcerative colitis treated with adalimumab. eighty-eight patients were treated with adalimumab (induction dose of 160 mg/80 mg in 77 patients [87.5%] and 80 mg/40 mg in eleven patients [12.5%], at weeks 0 and 2, respectively). after induction, the patients were maintained with adalimumab 40 mg eow; a dose escalation was allowed at the physician s discretion. all patients had active disease (medium partial mayo score, 6) (iqr, 48), and 57 (64.8%) had extensive colitis. sixty-nine patients (78.4%) had been previously treated with infliximab, and 65 (73.9%) had been exposed to immunomodulators (azathioprine, methotrexate, and cyclosporine). the indications for adalimumab treatment were corticosteroid dependence in 41 patients (46.6%), corticosteroid resistance in 23 patients (26.1%), extraintestinal manifestations in 14 patients (15.9%), and a combination of corticosteroid dependence and extraintestinal manifestations in ten patients (11.4%). the median duration of adalimumab therapy was 13 months (iqr, 621 months), with a median follow-up duration of 15.5 months (iqr, 1224 months). the co-primary endpoints were defined as the proportion of patients achieving clinical remission (partial mayo score 1) at 4, 12, 24, and 54 weeks. the clinical remission rates were 17%, 28.4%, 36.4%, and 43.2% at 4, 12, 24, and 54 weeks, respectively, with no significant differences between the infliximab-nave and infliximab-exposed patients. fifteen patients (17%) achieved sustained clinical remission, defined as a lasting clinical remission from week 12 up to 24 and 54 weeks. among the 60 patients who were taking steroids at baseline, 56.7% were able to discontinue steroids, and a steroid-free remission was achieved in 24 of 60 patients (40.0%) at week 54. fifty-seven patients underwent baseline and follow-up endoscopy after a median of 11 months (iqr, 5.113.2 months). an endoscopic remission was achieved in 28 (49.1%) of 57 patients, and 15 (26.3%) of the 57 achieved complete mucosal healing. overall, 25% (22 of 88) of the patients required colectomy, with a median time to colectomy of 5.5 months (iqr, 313 months). the rate of colectomy was higher in the infliximab-exposed group than in the infliximab-nave group (28.9% vs 10.5%), but this result did not achieve statistical significance, probably because of the small number of patients who ultimately required surgery and the small number of infliximab-nave patients enrolled in the study. in conclusion, in this large, real-life cohort of refractory and difficult-to-treat ulcerative colitis patients, adalimumab was shown to be effective at inducing and maintaining a durable clinical remission and to have a steroid-sparing effect.35 the subcutaneous administration is associated with generally mild injection site reactions that do not necessitate drug discontinuation. the overall safety profile in the clinical trials in patients with ulcerative colitis was comparable to that of placebo, and the rates of adverse events were similar to the ones that emerged for the other approved indications for adalimumab.36 no relevant warnings have emerged from the real-life studies. however, in two studies, a worsening of preexisting psoriasis, leading to drug withdrawal, was recorded.24,28 lastly, the fully human-designed features of adalimumab reduce, but do not eliminate, the risk of antidrug antibody development.22 the presence of human anti-human antibodies (haha) and low trough serum adalimumab levels have been reported to influence the long-term outcome of adalimumab therapy in patients with crohn s disease. increased adalimumab discontinuation rates have also been reported in crohn s disease patients with low trough serum adalimumab concentrations. furthermore, haha were detected in 92% of crohn s disease patients with low trough serum adalimumab levels during follow-up, probably reflecting the increased clearance of the drug and the subsequent loss of response. finally, concomitant immunosuppressive agents did not affect treatment outcomes, adalimumab trough levels, or haha development.37 the treatment of ulcerative colitis depends largely on the extension, severity, and behavior of the disease, and the traditional step-up approach with conventional drugs remains the standard management approach. however, there are subsets of patients who do not respond to conventional therapies or in whom conventional therapies are contraindicated. in these difficult-to-treat patients, the current guidelines recommend the use of biological drugs. in the recent past, infliximab was the only biological drug approved for the treatment of patients with ulcerative colitis. recently, after the publication of the results of the two pivotal, randomized ultra 12 trials, adalimumab was approved for use in patients with moderately-to-severely active disease, nonresponders, and those intolerant to conventional therapy. as often happens, the results of a clinical trial should be incorporated into real-life clinical practice, where patients have already experienced several therapies before, and may be intolerant or not fully adherent to treatments. therefore, the goal is to select the candidates who will best benefit from the drug. the emerging concept is that the ideal candidates for adalimumab therapy are anti-tnf-nave outpatients with moderate-to-severe corticosteroid- or immunosuppressive-refractory ulcerative colitis. short-term clinical responses, evaluated after 812 weeks, seem to influence the long-term outcomes and are associated with more durable clinical responses and colectomy-free survival. adalimumab also demonstrated a steroid-sparing effect and a mucosal healing capacity, and it may be a valid option for steroid-dependent patients. as has now been demonstrated in pivotal trials and in several real-life experiences, adalimumab is effective and safe for treating patients with different types of ulcerative colitis, including difficult-to-treat individuals.

the treatment of ulcerative colitis has changed over the last decade, with the introduction of biological drugs. this article reviews the currently available therapies for ulcerative colitis and the specific use of these therapies in the management of patients in different settings, particularly the difficult-to-treat patients. the focus of this review is on adalimumab, which has recently obtained approval by the european medicines agency and the us food and drug administration, for use in treating adult patients with moderate-to-severe, active ulcerative colitis, who are refractory, intolerant, or who have contraindications to conventional therapy, including corticosteroids and thiopurines. since the results emerging from the pivotal trials have been subject to some debate, the aim of this review was to summarize all available data on the use of adalimumab in ulcerative colitis, focusing also on a retrospective series of real-life experiences. taken together, the current evidence indicates that adalimumab is effective for the treatment of patients with different types of ulcerative colitis, including biologically nave and difficult-to-treat patients.

PMC3623546

pubmed-886

a positive family history of prostate cancer (pca) is an established risk factor for pca. first-degree relatives of affected men have a 23 fold increased risk of pca. when 3 or more first-degree relatives are affected (or at least 2 first-degree relatives before the age of 55 years), the family is considered a hereditary prostate cancer (hpc) family according to the so-called johns hopkins or carter criteria. yet, only a few very rare high-penetrance gene mutations have been identified to cause hpc. in recent years, genome-wide association studies have added approximately 40 low-penetrance genetic polymorphisms that are associated with an increased risk of pca [4, 5]. several polymorphisms have also been identified that are associated with serum prostate-specific antigen (psa), the most commonly used marker for early detection of pca [6, 7]. an ongoing matter of debate is whether psa testing should be used for population-wide screening. in a population-based setting, the european randomized study of screening for prostate cancer (erspc) showed a decrease in pca mortality of 31% in the screening arm after correction for non-attendance and contamination. by contrast, the prostate, lung, colorectal and ovarian cancer screening trial (plco), found no effect of psa screening on mortality, but suffered from methodological problems which severely hamper interpretation of the results. previous studies into the effectiveness of psa sceening in men with an increased risk due to family history have yielded largely inconsistent results. these range from a marked benefit for men in high-risk pca families (particularly for families with early onset pcas) to a decreased risk of pca for non-affected men in hpc families [13, 14]. the increasing use of psa testing in the general population has also had an important influence on men with a family history of pca. men with a positive family history are relatively more active in pursuing psa testing than men in the general population. this has led to an increased detection of mainly of small localized tumors. to guide the public and physicians in translating the results of the erspc and plco into clinical practice, the dutch association of urology (nvu) and the dutch college of general practitioners (nhg) concurrently released a policy statement in march 2009. this statement referred men to a website (http://www.prostaatwijzer.nl/) with information about pca and psa testing and advised them to consult their gp for further counseling. it did, however, not discuss dealing with a family history of pca or hpc. to date, in absence of official internationally accepted guidelines, the advice is to attempt to distinguish genetic predisposition-based families with multiple pca cases from ascertainment-based multiple-case families and offer pca screening only to the former. this study assessed the knowledge of dutch urologists, general practitioners (gps) and clinical geneticists (cgs) about hpc and pca as a phenotype in hereditary syndromes. furthermore, their post-erspc attitude towards pca testing and the role of family history in clinical decision-making about pca testing were assessed. to our knowledge, this is the first study to investigate this in different professions that counsel men about pca testing. after publication of the results of the erspc and plco and the statements of the nvu and nhg, an online survey was developed. this survey, targeted at dutch urologists, gps and cgs, contained questions about hpc and assessed the participants general attitude towards pca testing. in addition to this, it inquired into the role that family history played in the physician s daily clinical practice regarding pca testing. the survey also included case descriptions of a man requesting to be tested for pca. this fictitious man presented at different ages, in absence of family history and physical complaints. the survey could be completed anonymously. in january 2010, all dutch urologists (n=351), clinical oncogeneticists (n=32), cgs in training (n=50) and genetic counselors (n=68) were invited by e-mail from their respective professional associations. gps in the region of the comprehensive cancer centre east (ccce) who were enlisted to receive the ccce s e-newsletter (n=300) were invited by e-mail. for statistical analysis because of small numbers, clinical oncogeneticists, cgs in training and genetic counselors were pooled into one stratum (cgs). these were submitted by 109 urologists (31%), 69 gps (23%) and 46 cgs (31%). one pediatric urologist and two cgs were excluded from analyses because they never counseled men for pca testing. occasionally, participants did not complete all questions, causing small differences in the subtotals for different questions. of the urologists, 66% (71/107) counseled men about pca testing at least once a week and 93% (100/107) did this at least once a month. in comparison, 85% of the gps (59/69) did this at least once a month, as opposed to only 2% (1/44) of the cgs. by contrast, the cgs had the most accurate knowledge of the hpc criteria: 72% (31/43) correctly selected the minimum of three affected first-degree relatives for the criterion that is most frequently fulfilled (table 1). in comparison, only 36% (38/105) of the urologists and 18% (12/66) of the gps correctly selected this criterion (p<0.001). cgs were also best informed about the number of affected first-degree relatives with a pca diagnosis before 55 years of age to meet the definition of hpc, although the differences between the groups were smaller. the third definition of hpc, i.e., three consecutive generations with pca, was known to only a few participants. table 1responses to the question what is the minimum number of relatives with prostate cancer to meet the carter criteria for hereditary prostate cancer (hpc)?urologistsgpscgsnumber of affected first-degree relatives (all ages) two35 (33%)9 (14%)1 (2%) three38 (36%)12 (18%)31 (72%) four1 (1%)2 (3%)2 (5%) >four3 (3%)0 (0%)1 (2%) do nt know15 (14%)39 (59%)7 (16%) not a criterion13 (12%)4 (6%)1 (2%) total1056643number of affected first-degree relatives (diagnosis<55 years of age) two72 (68%)33 (48%)34 (76%) three6 (6%)0 (0%)3 (7%) four1 (1%)1 (1%)0 (0%)>four5 (5%)2 (3%)0 (0%) do nt know12 (11%)32 (46%)7 (16%) not a criterion10 (9%)1 (1%)1 (2%) total1066945number of consecutive generaties with prostate cancer two10 (10%)10 (15%)9 (21%) three15 (15%)6 (9%)5 (11%) four3 (3%)1 (2%)1 (2%) >four2 (2%)1 (2%)0 (0%) do nt know25 (25%)39 (58%)10 (23%) not a criterion44 (44%)10 (15%)19 (43%) total996744p 0.001 for differences between the physician groupscorrect answers are italicized responses to the question what is the minimum number of relatives with prostate cancer to meet the carter criteria for hereditary prostate cancer (hpc)? p 0.001 for differences between the physician groups correct answers are italicized almost all cgs (41/42, 98%) listed at least one inherited trait with pca as part of the phenotype, compared to only 24% (25/103) of the urologists and 9% (6/66) of the gps. the most frequently mentioned traits were the brca2 gene mutation (n=60), the brca1 gene mutation (n=40) and lynch syndrome (n=10). the rare hpc1, hpcx, msr1, rnasel and hpc2/elac2 mutations were sporadically mentioned. urologists had the least reservations towards pca testing in a man with no physical complaints and no family history of pca: 46% (32/69) of the gps and 49% (22/45) of the cgs preferred to refrain from testing unless there were strong reasons to test (table 2), as compared to 31% (33/108) of the urologists. for a man presenting at 55 and 75 years of age, cgs were more inclined not to test for pca. at 45 years of age, more physicians in all groups would not test for pca. table 2responses to the question would you test this man for pca? regarding a man with no physical complaints/no family history of pca, requesting to be tested for pcaage at presentationtest for prostate cancerurologistsgpscgsgeneral attitudewill test, unless 35 (32%)13 (19%)3 (7%)will not test, unless 33 (31%)32 (46%)22 (49%)leave choice to patient37 (34%)22 (32%)9 (20%)other*3 (3%)2 (3%)11 (25%)45 years of ageyes20 (19%)5 (7%)1 (2%)no12 (11%)18 (26%)28 (64%)first discuss pros and cons of prostate cancer testing75 (70%)46 (67%)15 (34%)55 years of ageyes29 (27%)16 (23%)1 (2%)no0 (0%)1 (1%)16 (36%)first discuss pros and cons of prostate cancer testing79 (73%)52 (75%)27 (61%)75 years of ageyes21 (19%)10 (15%)9 (21%)no8 (7%)3 (4%)14 (33%)first discuss pros and cons of prostate cancer testing79 (73%)56 (81%)20 (47%)*answers under other: most often (8/11) cgs indicated not to perform this kind of testing themselves, but would refer the man to their gpp<0.001 for differences between the physician groupsno significant difference between urologists and gps; p=0.40no significant difference between urologists and gps; p=0.45 responses to the question would you test this man for pca? regarding a man with no physical complaints/no family history of pca, requesting to be tested for pca*answers under other: most often (8/11) cgs indicated not to perform this kind of testing themselves, but would refer the man to their gp p<0.001 for differences between the physician groups no significant difference between urologists and gps; p=0.40 no significant difference between urologists and gps; p=0.45 age played a role when considering pca testing. of the urologists, 70% reported to use age limits, with 45 years as the mean and median lower age limit. this lower age limit was higher for gps (60% reported age limits) and cgs (30% reported age limits), with 50 years of age being the median lower age limit. the median maximum age limit was 80 years (mean 77) for urologists and gps, compared to 75 years (mean 74) for cgs. cgs always took family history into consideration when deciding whether or not to test for pca. by contrast, 3540% of urologists and gps answered that family history would not influence the decision whether or not to test for pca (table 3). this did not vary between physicians with different general attitudes towards psa testing (p=0.47 for the urologists and p=0.78 for the gps), as was assessed in a previous question. table 3responses to the question (a) does family history play a role in the decision whether or not to test a man for pca? and the follow-up question (b) how extensively do you inquire about the family history?urologistsgpscgsa. does family history play a role? yes67 (62%)44 (65%)40 (98%) no41 (38%)24 (35%)1 (2%) total1086841b only pca29 (43%)16 (37%)0 (0%) pca and other malignancies38 (57%)27 (63%)40 (100%) total674340 responses to the question (a) does family history play a role in the decision whether or not to test a man for pca? and the follow-up question (b) how extensively do you inquire about the family history? a majority of the urologists (76%) knew the erspc and plco results, compared to only 14 and 8% of cgs and gps, respectively. ninety-two percent (75/82) of the urologists who knew the studies found the erspc results more valuable. the statements of nvu and nhg, advising men to visit the website and consult the gp if further counseling was needed, were better known than the results of the trials: 85% (92/108) of the urologists and 59% (41/69) of the gps was familiar with the statements. of them, 12% (11/91) of the urologists and 24% (10/41) of the gps did not agree with the statements. a positive family history of pca is an important risk factor for pca and the balance between pros and cons of psa testing may be different in men with affected relatives. only one in three urologists and one in five gps is familiar with the criteria for hpc. the brca1 gene mutation was frequently selected as an inherited trait with pca as part of the phenotype. the evidence for an increased risk of pca due to a brca1 gene mutation is quite weak, though. by contrast, for brca2 gene mutations (selected by 14 urologists and all 42 cgs) there is fairly solid evidence of familial clustering of aggressive pca [18, 19]. recently, an elevated risk of pca for carriers of a mismatch-repair gene mutation was indeed found. this has, however, not been confirmed in other studies, so it remains unclear whether the physicians who selected lynch syndrome are correct. it should be noted that urologists and gps hardly ever counsel patients with an elevated pca risk based on these inherited traits. in general, urologists reported the least reservations towards pca testing and would test at a younger age than gps and cgs. however, the majority of urologists and gps stated to first discuss the risks and benefits of psa testing and only test if a man would still want to be tested. so, even though 41% of gps was not familiar with the statements regarding pca testing and 92% of them did not know the erspc and plco results, they adhered just as well to the guidelines as the urologists. participants who disagreed with the nvu/nhg statements, mostly indicated that the statements lacked attention for patients preferences. in contrast with the urologists and gps, cgs would more often not test for pca. this might be explained by the fact that the cgs mainly have an advisory role and refer their patients to a gp or urologist for pca testing. cgs hardly ever counsel men about pca testing, as there is no frequently occurring genetic defect known to cause pca. this may change, however, when more data become available about the risk of pca among brca2 carriers. one of the most striking observations might be that more than one in three urologists and gps would not take family history into account when deciding whether or not to test a man for pca. intuitively, one would think that men with a positive family history, and thus a higher a priori risk of pca, would benefit more from psa screening. arguing against this is that hpc cases do not seem to differ from sporadic cases with respect to gleason scores and pca-specific survival [21, 22]. even more so, screening programs amongst non-affected men in hpc families have shown that the chance of finding pca in non-affected men in hpc families is low. although we did not address this in our study, when a man requesting pca testing does have, e.g., an affected brother, he will very likely be tested, not in the least for reasons of anxiety management. however, whether this is beneficial, is doubtful. to better guide physicians in this matter, an addendum to pca guidelines should be developed in a multidisciplinary collaborative effort, describing how to deal with pca testing in case of a positive family history and hpc. the conclusion from a previous study to assess the extent and nature of the family history (predisposition-based vs. ascertainment-based) might well serve as a starting point for such a guideline. in addition to this, the use of decision aids, e.g., the swop-pri should be promoted, as they already include the effect of family history in the risk estimates. the results of this study should be interpreted with some caution. although the responder groups were reasonably large in absolute numbers, the response rate was only 31% at best (for urologists and cgs). hence, it is difficult to extrapolate the results to all dutch physicians providing pca counseling. even more so, if physicians with more interest in this topic completed the survey more often, the results regarding knowledge about hpc and adherence to guidelines might be overoptimistic. on the other hand, intuitively physicians who take care of most of the counseling are most eager to complete the survey. it is also important to bear in mind that the results may not easily be extrapolated to other countries as they may be influenced by the health care system. in the netherlands, e.g., men can not visit a urologist without a referral from their gp. in conclusion, however, these guidelines do not include family history and many physicians indicated not to consider family history. hence, pca counseling might not be optimal for men with a positive family history. we propose that additional guidelines on this topic are developed in a multidisciplinary effort to optimize counseling.

a family history of prostate cancer (pca) is an established risk factor for pca. in case of a positive family history, the balance between positive and adverse effects of prostate-specific antigen (psa) testing might be different from the general population, for which the european randomized study of screening for prostate cancer (erspc) showed a beneficial effect on mortality. this, however, went at the cost of considerable overtreatment. this study assessed dutch physicians knowledge of heredity and pca and their post-erspc attitude towards pca testing, including consideration of family history. in january 2010, all dutch urologists and clinical geneticists (cgs) and 300 general practitioners (gps) were invited by email to complete an anonymous online survey, which contained questions about hereditary pca and their attitudes towards pca case-finding and screening. 109 urologists (31%), 69 gps (23%) and 46 cgs (31%) completed the survey. cgs had the most accurate knowledge of hereditary pca. all but 1 cg mentioned at least one inherited trait with pca, compared to only 25% of urologists and 9% of gps. cgs hardly ever counseled men about pca testing. most urologists and gps discuss possible risks and benefits before testing for pca with psa. remarkably, 3540% of them do not take family history into consideration. knowledge of urologists and gps about heredity and pca is suboptimal. hence, pca counseling might not be optimal for men with a positive family history. multidisciplinary guidelines on this topic should be developed to optimize personalized counseling.

PMC3365231

pubmed-887

the influenza virus neuraminidase (na, aaabbreviations: fu, fluorescent unit; munana, 4-methylumbelliferyl-n-acetylneuraminic acid; na, neuraminidase; kdn, 2,3-difluoro-2-keto-3-deoxy-d-glycero-d-galactononulosonic acid. ec 3.2.1.18) functions in virus infection to remove sialic acid from receptors present on the surface of host cells. in the absence of na activity, the structure of the catalytic headgroup of influenza a na has been known since 1983, consisting of individual subunits of six-bladed -propellers that form a boxlike tetramer with dimensions 100 100 60. structures of the influenza b/beijing/1/87 and b/lee nas showed that the tetrameric head/-propeller topology of the influenza-a nas was conserved in influenza b nas. abbreviations: fu, fluorescent unit; munana, 4-methylumbelliferyl-n-acetylneuraminic acid; na, neuraminidase; kdn, 2,3-difluoro-2-keto-3-deoxy-d-glycero-d-galactononulosonic acid. analysis of na crystal structures in complex with the substrate sialic acid resulted in the development of zanamivir (1) and oseltamivir (oseltamivir carboxylate is the active ingredient used here (2)). a further inhibitor, these compounds are active against all influenza a and b viruses. while previously there have been reports of resistance from both influenza a and b viruses isolated from both immunocompromised and immunocompetent patients after treatment with 2, more recently the global spread of seasonal influenza a h1n1 strains resistant to 2(15,16) has been observed, although this appears to be unrelated to the use of 2. furthermore, resistance to 2 is emerging in strains of the pandemic h1n1/09 viruses either with or without treatment or prophylaxis. in contrast, resistance after 1 treatment has only been reported in an immunocompromised patient infected with an influenza b strain. influenza b viruses with a d197n mutation (d198 n2 numbering) have been isolated from an immunocompromised patient treated with 2(10) and arisen either spontaneously or by possible transmission from a treated patient. the d197n mutant na shows decreased binding to both 1 and 2, thus demonstrating the importance of d197 in the influenza b nas for tight binding of the na inhibitors. unlike other residues that confer resistance, d197 is not absolutely conserved across influenza a and b nas, as analyses of na sequences in the databases show that wild type influenza a n7 and n9 subtype nas have n197. residue d197 does not interact directly with substrate or inhibitor in the na but engages in a salt bridge interaction with r150 (r152 n2 numbering), which forms a hydrogen bond with the n-acetyl group of sialic acid and the na inhibitors. an influenza b virus with an r150k na mutation was isolated after prolonged treatment of an immunocompromised child with 1(19) with a significant impact on enzyme activity and cross-resistance to other na inhibitors, clearly demonstrating the importance of interactions of the r150 with the substrate and inhibitors. the b/perth/211/2001 (b/perth) virus was isolated from an infant with no history of treatment with or contact with na inhibitors. the sample contained both wild type and mutant viruses with a d197e mutation in the na. the mutant na had reduced sensitivity to 1, 2,and 3. when expressed in insect cells, recombinant b/perth wild type and mutant nas had properties similar to those of the virus associated nas. as we were unable to culture these viruses in eggs, we describe here the use of this recombinant na for structural studies. the clinical effectiveness of 2 against influenza b infection in children is reported to be less than against influenza a. however, until now, data on the structure of an influenza b na with oseltamivir bound have not been available. we present here structures of b/perth/211/2001 nas with d (b/perth d) or e (b/perth e) at position 197 in the apo form and in complex with 3 and provide an insight into the mechanism of resistance of mutations at d197. furthermore, the structure of the b/perth e complex with 2 is presented, and from these data we propose the mechanism of reduced binding of 2 in wild type influenza b nas. we wished to determine the impacts that the mutations at d197 had on the structure and function of the mutant proteins in order to understand the mechanisms of resistance to all na inhibitors. we previously reported that the native b/perth wild type d197 and mutant e197 nas expressed in insect cells had similar resistance profiles as the influenza virus associated nas. hence, we developed conditions for cleavage of the membrane anchor and stalk regions and for purification of the na from the insect cells. acetone fixation of the cells enabled us to store them with no effect on the enzyme function. digestion with either pronase or trypsin showed that optimal cleavage was obtained with trypsin at 2 mg/ml, between residues k69 and g70 in the stalk, comparable to cleavage of na heads from other influenza b viruses. after separation of the digests by superose-12 and lentil lectin affinity chromatography, page analysis showed a single band corresponding to the na (figure 2). purification of recombinant b/perth na heads by trypsin digestion of sf21 cells expressing the full length b/perth na: (a) gel filtration profile of crude extract; (b) silver stained page of gel filtration fractions; (c) samples after lentil lectin affinity chromatography. since this was the first time we had attempted to use recombinant na for structural studies, we used electron microscopy, as previously reported, to examine the integrity of na heads. the b/perth d heads were clearly tetrameric but interestingly spontaneously formed two-dimensional arrays on the carbon substrate. the most common was a simple square tessellation, and the second form consisted also of orthogonal rows and columns but with the square na heads rotated through 45, forming a hounds-tooth pattern. the third and least common form had na heads oriented on their sides or edges, arranged in an open square lattice. these first two forms are a rare example of actually seeing how the protein packs in crystalline arrays, corresponding to crystallographic arrangements subsequently detected by x-ray crystallography. samples were negatively stained with uranyl acetate and show two-dimensional arrays of na heads: (a) simple square tessellation; (b) hounds-tooth pattern of orthogonal rows and columns but with the square na heads rotated through 45; (c) an open square lattice with na heads oriented on their sides or edges. we have previously shown that the b/perth e197 na and the b/yamagata n197 na demonstrate cross-resistance to the na inhibitors 1, 2, and 3. some influenza nas demonstrate time dependent binding of the na inhibitors often called slow binding. many nas with a mutation in the active site are reported to have lost this property, binding the inhibitors rapidly. since d197 does not directly interact with substrate or inhibitor, we therefore were interested in whether the d197e or d197n mutations affected the enzyme function or the rate of binding of the inhibitors. comparisons of the activity of the purified recombinant b/perth d197 and e197 na proteins demonstrated that the specific activity of the mutant e197 na was approximately 70% of that of the wild type d197 enzyme. for comparing values for the km, ki, and ic50, we used detergent extracts of each of the four influenza viruses grown in cell culture, since we did not have recombinant na from either the b/gifu or b/yamagata viruses. the b/perth wild type d197, mutant e197, and the wild type d197 b/gifu nas had similar km values for munana of 12.4 4.2, 12.1 3.7, and 10.5 1.4 m, respectively. although the d197n mutation has less impact on ic50 than the e197 (table 1), it had a slightly higher km of 18.8 4.5 m. no pre or pre is the fold differences in the final ic50 values with no preincubation with inhibitor compared to 30 min of preincubation. we carried out two different experiments for each virus/drug combination to study the rate of inhibitor binding. the first experiment had no preincubation with the inhibitors, which enabled us to examine the rate of association of the drug with the na, and the second assay had a 30 min preincubation, which enabled us to examine whether any further association or dissociation of the nainhibitor complex occurred upon addition of substrate. others have used preincubation times from 10 min to 2 h, and it is not clear what impact these preincubation times, or the subsequent reaction times with substrate, may have on the calculated ic50. since the ic50 is also known to vary with substrate concentration, others have calculated ki values in addition to the ic50, since ki values are meant to be a more invariant measure of affinity for an inhibitor independent of substrate concentration. we therefore compared ic50 and ki values at each 10 min interval between 10 and 60 min either with no preincubation or after preincubation with the inhibitors. when the curves for the total fu versus elapsed time were compared, there were three types of curves. the first type of curve (figure 4a) seen after preincubation with 1 or 3 in the wild type d197 nas showed a gradual increase in the rate of reaction, indicating slow dissociation of inhibitor. the second type of curve where there was no preincubation of inhibitor, with 1 and 3 in the wild type nas, showed a gradually decreasing rate of reaction (figure 4b), indicating slow association of the inhibitor. the third type of curve reached a constant rate during the reaction (figure 4c) and was seen with 2 in the d197 nas and with all inhibitors with the mutant nas, indicating that rapid equilibrium had been reached. munana was added to detergent treated wild type and mutant viruses either after a 30 min preincubation or without incubation with inhibitors ranging from 10 000 to 0.1 nm. activity was monitored for 60 min after addition of substrate: (a) b/perth d activity in 1 after 30 min of preincubation showing an increase in rate with time, corresponding to slow dissociation; (b) b/perth d activity in 1 without preincubation, showing a decrease in rate with time, corresponding to slow association of 1; (c) b/yamagata (d197n) activity in 1 without preincubation, showing a constant rate, corresponding to a rapid association of 1. the effects these changing rates have on the ic50 and ki values are shown in figure 5. for both wild type d197 nas without preincubation there was a gradual decrease in ic50 corresponding to a slow association of both 1 and 3. after preincubation with these inhibitors there was a gradual increase in ic50, indicating slow dissociation. in contrast there was rapid association of 2 without preincubation with little change in ic50 after the first 20 min. although the initial ic50 values were not that much higher than for 1, there was more than a 10-fold change over the 60 min reaction time. because of the slow association of 3 and 1 in the wild type nas, the final 60 min ic50 values with no preincubation were still 6- to 19-fold higher than with preincubation (table 1), demonstrating that the inhibitor binding had not yet reached equilibrium. in contrast, there was less than a 2-fold difference between the 60 min no preincubation and preincubation ic50 values for 2 in both wild type nas. effect of incubation times after addition of substrate and inhibitor on (a) ic50 and (b) ki values. ic50 values were calculated after each 10 min interval as the drug concentration causing 50% inhibition compared to the uninhibited control. final ic50 values after 60 min for 1 and 2 in wild type b/perth and b/gifu nas were much higher without preincubation compared to 30 min preincubation, reflecting the slow binding of these two inhibitors. there was much less change in ic50 values for the binding of 2 in the wild type and 1, 2, and 3 in the mutant nas, demonstrating loss of slow binding. conversely 2 dissociated rapidly from the wild type na, in contrast to slow dissociation of 1 and 3, and 1, 2, and 3 all dissociated more rapidly from the mutant b/perth e and b/yamagata nas. (b) ki values also changed with time, reflecting the differences in the slow or fast binding or dissociation of the inhibitors, with less change seen with 2 in the wild type and 1, 2, and 3 in the mutant nas. when the ic50 values are compared without preincubation for all inhibitors for both mutant nas, the graphs show there is much less change in ic50 after the first 10 min. 2 also appears to bind even more rapidly to both mutant nas than to the wild type d197 nas. there is also faster dissociation of 1 and 3 after the nas are preincubated with inhibitor, compared to the wild type nas. for all inhibitors for both mutant nas the ratios after 60 min of the no preincubation to preincubation are all within 2-fold, indicating much more rapid equilibration of all inhibitors compared to the wild type nas. the slow binding of the 1 and 3 in the wild type d197 nas also resulted in the ki values continuing to change over the 60 min period, whereas for 2 in the wild type and all the inhibitors with the mutant nas the ki values stabilized much more quickly after the first 1020 min period, as seen in figure 5 and tables 1 and 2. this means that the fold resistance, often used to describe how resistant the isolates are, will vary significantly during the course of the reaction, depending on whether the inhibitors are faster or slower binding or dissociating compared to the wild type. the apo form of b/perth d crystallized in space group i4 and was solved by molecular replacement using a/tern/australia/g7oc/75 n9 na (pdb code 7nn9) followed by automatic rebuilding using phenix; the r and rfree were 33% and 39%, respectively. several cycles of model building and refinement gave a high quality final model (table 3). crystal contacts between subunits in the c-direction are formed entirely by carbohydrate-mediated interactions. a carbohydrate chain composed of glcnac and mannoside residues was appended to residue n284, consistent with known patterns of n-linked oligosaccharides in insect cell lines. the packing of tetramers in layers observed in this crystal form appears similar to that observed in electron microscopy (figure 3a). the b/perth d structure superimposes with a rmsd of 0.32 (over 388 c atoms) and 0.28 (over 385 c atoms) with b/lee/40 (pdb 1inv) and b/beijing/1/87 (pdb code 1nsb) nas, respectively, illustrating the high degree of structural conservation in influenza b nas. the active site of b/perth d contained water molecules and a sulfate group bound between the guanidinium moieties of r116, r292, and r374. r=hkl|fo(hkl) fc(hkl)|/hkl|fo(hkl)|, where fo and fc are the observed and calculated structure factors, respectively. for the b/perth e crystals, although the unit cell suggested tetragonal symmetry, good merging statistics were obtained only in space group p1. the b/perth e structure was solved by molecular replacement using tetramers of b/perth d as a search model. molrep selected a radius of integration of 61, and four tetramers were found with peak heights of 21.4, 18.9, 18.0, and 15.3. solutions for all four monomers were found in the translation function, resulting in an initial model with r and rfree factors of 31.2% and 31.1%. the structure of b/perth e is highly similar to the b/perth d structure in spite of the different crystal form. a sulfate group is bound between the guanidinium moieties of r116, r292, and r374, and a yttrium ion of partial occupancy is bound adjacent to the sulfate group. these groups are displaced by 2 or 3 upon soaking with those inhibitors (see below). crystals of b/perth d soaked with 3 adopted similar packing to the apoenzyme. 3 was included in the model at a late stage of refinement, and the final model is of high quality (table 3). soaking inhibitors into crystals of b/perth e proved challenging, with relatively weak data being obtained for crystals of this isozyme in the presence of 3 and 2 (table 3). nevertheless, the structure refinement and map interpretation were aided by 15 noncrystallographic symmetry (ncs) restraints. averaged electron density maps allowed for clear and unambiguous interpretation of the structures including, where present refinement of the b/perth e complex with 3 commenced using the apo-form of this mutant as the starting model (r=40.5%, rfree=40.4%). similarly, refinement of the b/perth e 2 complex commenced using b/perth e apo structure as the starting model (r=34.1%, rfree=35.3%). for both complexes 3 binds in a similar fashion to related inhibitors observed in previously determined b/beijing and b/lee structures. the carboxylic acid group lies in the pocket formed by r292, r374, and r116. the sec-pentyl moiety is stacked against the e275-c group (e276 n2 numbering) (figure 6b). upon inhibitor binding, e275 must rotate away from the inhibitor in a manner analogous to that described previously for b/beijing na in complex with dihydropyranphenethylpropylcarboxamide. this inhibitor has an ethyl moiety that corresponds to part of the sec-pentyl group of 3. comparisons of the active sites of b/perth wild type and mutant nas uncomplexed and with bound inhibitors (a, b) b/perth wild type d and (c, d, e) b/perth mutant e structures. apo (a, c) and 3-bound (b, d) forms are shown. (f) a model of the d197n mutant based on the wild-type b/perth structure is shown. active-site residues are shown in stick form and the backbone in cartoon form. surprisingly, rotation of e275 is not observed in the b/perth e complex with 2, which does not form any hydrophobic contacts with e275. instead, the sec-pentyl group makes less favorable contacts with the charged portions of r223, e275, and r292 (figure 6e). in this structure, there is only partial rotation of e275 away from the active site and hence only partial insertion of one arm of the sec-pentyl moiety into the resulting hydrophobic cleft (figure 6d). the d197e mutation in b/perth affects the way the carboxylic acid group of this residue engages with r150. in the structure of b/perth d determined in the absence of inhibitor, the carboxylic acid group of d197 engages side-on with the guanidinium group of r150 as seen in most influenza b na structures. in the b/perth e apo structure, the guanidinium group of r150 is rotated to engage in a stacking interaction with the carboxylic acid moiety of e197. furthermore, the guanidinium group has rotated 180 so that the n1-atom is now pointing away from the active site (figure 6c). in the structure of b/perth e with 3, r150 has rotated toward the active site relative to its position in the apo structure and engages in a hydrogen bond with the n-acetyl oxygen atom via the n-atom. the distances of the r150 to n-acetyl hydrogen bonds are longer in b/perth e compared with p/perth d: 3.4 versus 2.7, respectively. in the complex of b/perth e with 2, r150 is in the conformation observed in b/perth d, with atom n1 engaging in a hydrogen bond with the inhibitor n-acetyl oxygen atom (2.6). while the distance is not significantly different from the equivalent distance in the 3 complex, the r150 guanidinium group and n-acetyl group are no longer coplanar, indicating a geometrically less favorable and hence weakened interaction. as an additional way of demonstrating that the reduced binding of the inhibitors in the d197e and d197n nas was due to altered interactions with the n-acetyl group of the sugar ring, we compared inhibition of all four nas with 2,3-difluoro-2-keto-3-deoxy-d-glycero-d-galactononulosonic acid 4. although it is only a weak inhibitor, it has no n-acetyl group; hence, values should be similar for wild type and mutant nas if this interaction can no longer occur. there was no resistance to 4 with the mutant nas compared to the d197 wild type na. in fact the ic50 for each mutant was less than for the wild type pair, b/perth e197 na 19.4 1.7 m compared to the wild type 37.7 1.7 m and the b/yamagata n197 na 41.6 0.4 m compared to the b/gifu wild type of 134 17 m, respectively. this confirmed that decreased sensitivity was due solely to altered interactions with the n-acetyl group. we have used structural and functional studies here to gain an understanding of the mechanism of resistance to the na inhibitors of influenza b viruses with mutations at residue 197. equally important, our studies provide insights into why influenza b wild type nas have reduced binding of 2 compared to influenza a nas. we demonstrate that although d197 does not interact directly with substrate or inhibitors, mutations of d197e and d197n in influenza b alter binding of substrate and all three na inhibitors 1, 2, and 3, as shown by decreased specific activity and increased ki and ic50 values. we also demonstrate using a modified approach to the enzyme inhibition assay that the reaction time can significantly affect both the ki and ic50 differently for wild type and mutant nas, depending on whether the inhibitor is fast or slow binding. others have also reported variation in ki over time, due to the time dependent slow binding of 1. they observed a 10-fold decrease in ki over the course of their reaction, with a 10 min preincubation and 15 min reaction time after addition of substrate. because of the shorter preincubation time in their case, 1 was obviously still binding, rather than in our case where after a 30 min preincubation we start to see dissociation. thus, despite ki values being thought to be more consistent, because of the variation in the methods used by different laboratories and the impact of fast and slow binding with time of incubation, the ki values would appear to be more suitable as relative values within a laboratory for comparing enzyme properties of wild type and mutant nas rather than as absolute values that different laboratories can directly compare. experiments by simply monitoring changes in ic50 with time without the addition of stop solution. comparison of the changes in ic50 with preincubation or no preincubation with inhibitor shows that this approach can provide additional information about impacts of mutations on the rates of inhibitor binding and dissociation, compared to just a single end point ic50. this is an assay that can be carried out in any laboratory with a modern fluorimeter, without the need for any additional equipment. laboratories globally compare ic50 values, and we are striving to understand parameters that can affect the ic50 values to enable a better comparison of ic50 values from different laboratories. clearly both the preincubation and incubation times are critical. structural analysis indicates that the effect of the d to e mutation at position 197 was to destabilize the interaction with r150 and to reduce the stability of this crucial inhibitor-binding residue. it appears that the d197 to e mutant prefers a conformation in which the guanidinium group of r150 is rotated and moved slightly out of the active site but can rotate back so as to engage with an inhibitor. all clinically approved inhibitors possess an n-acetyl group that interacts with r150 or its equivalent and are potentially susceptible to this mechanism of drug resistance. this is consistent with the cross-resistance seen to 1, 2, and 3. lack of resistance to another inhibitor without the n-acetyl group, 4, also confirmed that resistance was due to altered binding to the n-acetyl group. the mechanism of resistance in b/perth e is different from that observed in n1 and n9 nas to date. in both the n1 na with an h274y mutation and the n9 na with an r292k mutation the altered binding is due to altered interactions of the e276 (n2 numbering) with the isopentyl ether group on 2. the influence of these mutations on the binding of 1 is less pronounced, as the side chain of e276 is able to maintain favorable interactions with the glycerol side chain. in contrast, reduced binding of 1 with an e119 g mutant na is partly due to reduced interactions with the guanidinium group at the 4 position on the sugar ring. the reduced binding in the d197 mutant nas is due to altered interactions with yet another part of the ring, the n-acetyl group, which is common to all inhibitors and substrate. the viability of the d197n mutation demonstrates that a salt bridge between this residue and r150 is not essential for function. we anticipate that the effect of the d197n mutation in b nas is to weaken the interaction of this residue with the r150 guanidinium group through the elimination of the salt bridge interaction of d197 and r150. n197 could still interact through a hydrogen bond between the o1 atom and the n or n2 groups of r150. this will have a similar effect to the d197e mutation in that it affords more flexibility to the r150 side chain and weakens the interaction with the n-acetyl group of the inhibitors (modeled in figure 6f). while nais are described as time dependent slow binding inhibitors, we have shown here that both d197e and d197n lead to loss of slow binding of 1, 2, and 3. loss of slow binding is generally associated with mutations in the na active site, leading to na inhibitor resistance. one proposed mechanism of slow binding is due to the need for the rotation of the e275 in inhibitors with the modified glycerol side chain. a proposed mechanism for the slow binding of 1 is the slow release of a water molecule by the guanidinium group. however, we see here a loss of slow binding in the nas with mutations at d197, remote from the position occupied by the guanidinium groups in both 3 and 1, and rotation of the e275 still occurs upon binding 3. thus, slow binding of the na inhibitors is clearly affected by more than interactions in either the vicinity of the 4-guanidino group or the rotation of the e275. although in the e197 mutant na the binding of 1 was reduced by nearly 30-fold compared to about 7-fold reduction for 2, the overall ic50 for 2 was higher. this is due to the lower sensitivity, or higher ic50, of the wild type b/perth na for 2(40) before the additional mutation. as the levels of 1 delivered to the upper respiratory tract after 10 mg doses nmol/l, this would still be more than 50-fold higher than the ic50 of the e197 enzyme. in contrast the plasma levels of 2 are estimated to range from 400 to 1200 nmol/l, and levels in saliva are estimated to be less than 5% of plasma levels. thus, with a potential level in the upper respiratory tract of only 2060 nm, efficacy of 2 against a similar d197e mutant strain could be significantly reduced. in addition to loss of slow binding of the mutant nas to 1, 2, and 3, our enzyme analyses show here that there is a loss of slow binding of 2 to the wild type b/perth and b/gifu d197 enzymes compared to binding of 1 and 3, as well as faster dissociation of 2. this is consistent with the lower sensitivity or partial resistance of wild type influenza b strains to 2 in enzyme assays compared to influenza a strains, especially in the munana assay where the ic50 values are around 1270 nm (compared to the na-star assay, 211 nm) and compared to an ic50 of around 0.52 nm for influenza a strains in both assays. the loss of slow binding is consistent with the observations of baum and colleagues, although kati et al. had described 2 to be also slow binding in influenza b viruses. consistent with our enzyme observations, we also importantly present structural evidence to explain the partial resistance of influenza b nas to 2. upon binding 2, residue e275 of b/perth na fails to rotate to allow binding of the sec-pentyl moiety to the aliphatic portion of this residue as observed in the equivalent residue (e276) in n1 and n9 nas. rotation of this residue is necessary for high affinity binding of 2, and failure to occur is consistent with resistance to 2, seen in other mutant nas. while we were unable to obtain the structure of b/perth d with 2, a previous publication also describes lack of full rotation of the e275 in the b/lee wild type na. it may be a general feature of type b nas that this part of the active site is more rigid and e275 is less able to rotate to accommodate hydrophobic groups, although rotation does occur upon binding 3. the floor of the active site of b-type nas has been described as being more sterically crowded than for a-type enzymes, indicating that residues in type-b na might be tightly constrained to the observed positions in the uncomplexed enzyme. we conclude that the rotation of residue e275 needed for high affinity binding of 2 does not occur in the current strains of influenza b wild type nas, and this would correlate with the loss of slowing binding of 2, the higher ic50 values seen especially in the munana assay, and possible decreased clinical efficacy of 2 in children. isolation of the b/perth viruses with wild type d197 na and mutant e197 na has been previously described. for this purpose we obtained the b/yamagata/186/05 virus with a d197n mutation in the na, but as this has several other na sequence differences compared to the b/perth, we obtained a control for this virus na which only had a single amino acid difference in the stalk region, b/gifu/11/2005. all virus stocks were serially plaque purified in mdck cells. 1, 2, and 3 were synthesized by gsk, (stevenage, u.k.). 2-keto-3-deoxy-d-glycero-d-galactononulosonic acid (4) (2,3, difluoro kdn) was provided by dr. serial log10 dilutions of inhibitors were prepared in water for inhibition assays ranging from 0.01 to 10 000 nm for 1, 2, and 3 and from 0.01 to 10 000 m for 4. the full length b/perth wild type d197 and mutant e197 nas were expressed in sf21 insect cells as previously described. an amount of 4 l of cells at (12) 10 cells/ml was infected with a multiplicity of infection of 1.5 plaque forming units per cell and were harvested at day 4, when about 30% cell death had occurred. an equal volume of acetone was added to fix the cells, and these were stored on ice until required. after removal of the acetone and being washed three times, the cells were resuspended in tris-buffered saline to a density of 1 10 cells/ml. cells were digested with trypsin (worthington, tpck) or pronase (calbiochem) at concentrations from 0.1 to 2 mg/ml for 2 h at 37 c to remove the na. na was recovered in the supernatant, and the cell pellet was resuspended in tbs and redigested. the pooled supernatants were concentrated in an amicon 8050 stirred cell concentrator using a pall 30k mwco polysulfone filter. the concentrated na was separated from other proteins in the trypsin digest by gel filtration using superose 12 in tbs. activity of the fractions was determined by the 4-methylumbelliferyl-n-acetylneuraminic acid (munana, sigma-aldrich) fluorescent enzyme assay. the active fractions were collected, analyzed by sdspage, and concentrated down again. these were further purified by running several times over a lentil lectin sepharose 4b column (amersham biosciences) and eluting with 100 mm methyl--d-mannopyranoside in 20 mm tris-cl, ph 7.4, 0.5 m nacl (lancaster). the activity of the fractions was again checked by the munana assay, and the purity was checked by sdspage and silver staining. the purest active fractions of both nas were concentrated to 4.5 mg/ml for crystallization trials. then 300-mesh copper grids were coated with a thin carbon film and glow-discharged in nitrogen for 30 s. the 510 l aliquots of the sample were pipetted onto the grids, and after 1 min of adsorption time, excess solution was drawn off using whatman 541 filter paper. the grids were washed with 5 l of tbs, and the grid was then stained with 2% uranyl acetate and was air-dried. the grids were examined in a tecnai 12 transmission electron microscope (fei, eindhoven, the netherlands) at an operating voltage of 120 kv, and images were recorded using a megaview iii ccd camera and analysis camera control software (olympus). activities of purified samples of recombinant b/perth d197 and e197 nas were titrated in the munana based na enzyme assay. (ii) km and ki.km and ki values were calculated using viruses solubilized by the addition of chaps (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) to a final volume of 1%. each of the extracts was titrated in the munana based enzyme assay to determine similar final values of fluorescent units without the addition of stop solution, since this enabled continual monitoring of the reactions. the rate of hydrolysis of munana was measured at substrate concentrations ranging from 6.25 to 200 m, with readings taken every minute in a victor 2 (wallac) or bmg fluostar optima reader. the maximum slope for each reaction was determined by comparing the slopes over different overlapping time intervals. initial velocities of the reactions were then calculated by measuring the maximum slopes plotted as a function of substrate concentrations. the michaelis menten constant, km, which represents the affinity of the enzyme for substrate, was calculated using a nonlinear regression function in graphpad prism. while the na inhibitors are competitive inhibitors, some wild type influenza nas are described as time dependent or slow binders of the inhibitors, and some mutant nas have lost this slow binding property. we followed the kinetics of inhibitor binding two ways, with preincubation of inhibitor for 30 min or without any preincubation, followed by 60 min of incubation with the munana substrate for both assays. we used a constant substrate concentration of 100 m munana and inhibitor concentrations ranging from 10000 to 0.01 nm. fluorescent readings were taken every minute in a bmg fluostar optima reader for 60 min. graphs of concentration of inhibitor versus% enzyme inhibition compared to the control were plotted for each 10 min data set. the ic50 was calculated as the concentration of inhibitor resulting in a 50% reduction in enzyme activity compared to the control for each 10 min time point. by use of the km and the substrate concentration, the ki can also be calculated using nonlinear regression and one-site competitive binding, using the equation of cheng and prusoffki=ic50/(1+[substrate]/km). as we had calculated the km, we then calculated ki values in graph pad prism using this method for each 10 min interval. all crystals were grown at the bio21 collaborative crystallization centre (www.csiro.au/c3). either a phoenix (art robbins industries) or a mosquito (ttp) dispensing robot was used to set up sitting drops in 96-well sd-2 plates (idex corp.). plates were stored at 281 k in a gallery 700 incubator and imaged with a minstrel ht imaging system (rigaku). a single commercial screen (the jcsg+ suite from qiagen) was set up initially to determine if the b/perth d protein concentration was appropriate for crystallization trials, using 0.2 l droplets consisting of 50% protein solution mixed with 50% reservoir solution, and equilibrated against a reservoir of 50 l. small (< 50 m) crystals grew from peg-based conditions in the jcsg+ suite trials, and subsequent crystallization trials were set up using the pact suites (qiagen), as well as from screens designed around the hits in these two commercial screens. x-ray data for flash-cooled crystals were collected at the australian synchrotron beamline mx-1 using the blu-ice software or photon factory beamline 17a. b/perth d protein (4.5 mg/ml) was mixed with reservoir solution in a 1:1 ratio (drop volume 0.2 l). x-ray data were measured from crystals grown at 8 c in 0.2 m na2so4, 20% w/v peg 3350, 0.1 m bis-tris propane, ph 6.5. these crystals were transferred to mother liquor with 10% v/v ethylene glycol and 10% v/v glycerol added just prior to flash-cooling to 100 k. remaining crystals were used for soaking inhibitors (1, 2, and 3). a successful soak of 3 was performed by seeding some solid compound into a drop containing crystals and allowing the sample to equilibrate for 10 days prior to flash-cooling to 100 k. the well solution in this case was 0.2 m nano3, 20% w/v peg3350, 0.1 m bis-tris propane, ph 6.5. we were not able to obtain crystals containing either 1 or 2 with the d197 protein. b/perth e (4.5 mg/ml) was used to grow crystals under conditions similar to those described above. the best crystals for diffraction experiments were grown in 1217% w/v peg 3350, 0.20.3 m na2so4, and 5 mm ycl3. the complex of b/perth e with 3 was obtained by placement of the compound directly into the drop as described above for b/perth d. the complex of b/perth e with 2 was obtained by adding the compound (5 mm) to the cryoprotectant (the same as for b/perth d) prior to flash cooling. the weighting of x-ray and geometric parameters in refinement and the type of ncs restraints were based on their effects on rfree cross-validation.

we have identified a virus, b/perth/211/2001, with a spontaneous mutation, d197e in the neuraminidase (na), which confers cross-resistance to all na inhibitors. we analyzed enzyme properties of the d197 and e197 nas and compared these to a d197n na, known to arise after oseltamivir treatment. zanamivir and peramivir bound slowly to the wild type na, but binding of oseltamivir was more rapid. the d197e/n mutations resulted in faster binding of all three inhibitors. analysis of the crystal structures of d197 and e197 nas with and without inhibitors showed that the d197e mutation compromised the interaction of neighboring r150 with the n-acetyl group, common to the substrate sialic acid and all na inhibitors. although rotation of the e275 in the na active site occurs upon binding peramivir in both the d197 and e197 nas, this does not occur upon binding oseltamivir in the e197 na. lack of the e275 rotation would also account for the loss of slow binding and the partial resistance of influenza b wild type nas to oseltamivir.

PMC2932999

pubmed-888

age-related macular degeneration (amd) is the most common cause of legal blindness in the elderly population of developed countries with over 300,000 newly diagnosed patients per year in europe and north america [1, 2]. it is widely believed that amd starts with the insidious, slowly progressing dry form (dry amd) and can later develop into the more severe wet amd, which advances very rapidly and is characterized by abnormal development of blood vessels, a process called choroidal neovascularization (cnv) [3, 4] that affects the macular region of the retina and leads to loss of central vision. in turn, dry amd without cnv can proceed to focal loss of the retinal pigment epithelium (rpe), termed geographic atrophy (ga), which is accompanied by loss of vision over these slowly expanding areas of rpe atrophy. rpe loss or dysfunction renders the surrounding tissue vulnerable to damage by reactive oxygen species and loss of photoreceptor density ensues. it has been recognized that accumulation of debris below the rpe in the macula, also known as drusen, is a risk factor for amd. identification of complement factor proteins in drusen from amd eyes, coupled with genetic variation in several complement factor genes in amd patients [813], collectively implicates inflammation as an important component in the pathophysiology of this disease [14, 15]. for instance, it was recently demonstrated that complement factor h (cfh) serves a protective role in amd by binding and inhibiting the inflammatory effects of the lipid peroxidation product malondialdehyde (mda). therefore, dissecting the initiating events of outer retinal inflammation during the early stages of amd can lead to a better understanding of its pathogenesis. such findings will enable the development of innovative immunotherapies that can prevent inflammatory damage to retinal tissue and loss of vision in a disease process that is estimated to increase in prevalence by 50% by the year 2020. in the past decade, several novel therapeutic agents have been identified as effective drugs to treat wet amd, which delay new blood vessel formation and improve vision. however, there is no effective treatment for dry amd to date. in the pursuit of identifying the signals from the outer retina that initiate inflammation and possibly involve the immune system in amd pathogenesis, we have evaluated immune responses to carboxyethylpyrrole (cep), a protein modification that forms from an oxidation fragment of docosahexaenoic acid (dha), the most oxidizable of all long chain polyunsaturated fatty acids. studies have shown that amd donor eyes contain more cep-modified proteins in the outer retina and drusen than in age-matched controls. cep-modified proteins and cep autoantibodies are also more abundant in amd plasma than in control samples [19, 20]. since dha is abundant in the outer retina, where the amalgamation of high oxygen tension and light provides an environment suitable for oxidative damage, our lab has previously developed a murine model in which mice immunized with cep-modified mouse serum albumin (cep-msa) develop a cep-specific immune response which correlates with dry amd-like pathology when compared to age-matched controls, including cep autoantibodies, complement deposition in the bruch's membrane, and rpe damage [22, 23]. to our knowledge, this is the first immune-mediated mouse model of dry amd in genetically unmanipulated animals and stems directly from observations in human patients. another component of the immune system that has been implicated in amd is the macrophage lineage [24, 25], although the specific role of these innate immune cells at different stages of amd disease progression is still controversial. within the retina, there are two sources of macrophages: (1) microglia, bone marrow-derived resident macrophages that are recruited to neural tissue during retinal development and provide immunosurveillance in the inner retina, and (2) circulating monocytes that can be recruited from the blood vessels to sites of inflammation when needed by specific chemokines and cytokines. independent of the source, these cells can undergo a diverse program of differentiation depending on the microenvironment that ultimately dictates their effector functions [26, 27]. macrophages activated in the presence of interferon-gamma (ifn-) become proinflammatory m1 macrophages, characterized by their production of tumor necrosis factor alpha (tnf-) and interleukin-12 (il-12) and are associated with tissue damage. on the other hand, macrophages activated in the presence of il-4 differentiate into m2-type, marked by production of the immunosuppressive cytokine il-10 and involved in tissue remodeling. the cep-msa-induced changes in the outer retina that provide a model for amd afford the unique opportunity to directly test the role of these cells in the disease process. our current study aims to characterize both the magnitude and kinetics of development of retinal lesions and macrophage involvement in the balb/c and c57bl/6 (b6) mouse strains at various intervals postimmunization (p.i.) in young mice compared to age-matched controls, before extensive retinal lesions are observed. here we extend our original study by showing that cep-msa immunization leads, in aged (old) balb/c mice, to the end stage cardinal feature of human dry amd: loss of photoreceptor cells. this major damage is the result of a low-grade but significant inflammatory response in the retina prior to overt tissue damage, which can be quantified in young mice. we have identified m1 macrophages localized to the interphotoreceptor matrix (ipm) surrounding the photoreceptor outer segments in close proximity to the rpe. these changes occur in both balb/c and b6 strains, but the kinetics are different; balb/c mice are more susceptible at a younger age. we also detected elevated levels of the monocyte chemoattractant ccl2 in the retinas of cep-immunized mice. moreover, ccr2 b6 mice immunized with cep-msa lack macrophage recruitment, and retinal lesion development is reduced or prevented. since amd is an age-related disease, defining the progression of inflammatory cell recruitment and development of amd-like lesions at earlier stages of the disease is essential in order to map the character and timing of immune mechanisms that take place in our model and correlate with development of pathology. this work clarifies a long-standing question by defining a clear mechanistic path that explains the role of inflammation in amd: m1 macrophages are key factors in dry amd pathogenesis. we also provide experimental demonstration for the idea that regulation of immune responses (in this case, inhibition of macrophage recruitment) can be a target of therapy to prevent the development of amd. we have previously described amd-like lesions in wild-type (wt) b6 mice immunized with cep-msa. we now describe in detail lesions in cep-msa-immunized mice on the balb/c background, which are inherently albino. importantly, but also technically challenging, the severity of lesions increases with time after immunization, and it can take for up to 1224 months to observe signs of geographic atrophy and photoreceptor cell loss, cardinal features of amd (figure 1, supplemental figure s1 available online at http://dx.doi.org/10.1155/2013/503725). the main purpose of the current study was to determine the earliest time at which significant differences between cep-immunized and control mice could be detected. the reasoning behind this approach is to define the molecular and cellular mechanisms that take place at the initial stages of disease, before there are gross changes to the retina that could alter its function. eyes harvested at 4090 days p.i. were defined as of early recovery times, those harvested at 100200 days p.i. focal lesions in the rpe and ipm consisting of vacuolization of individual or groups of cells, pyknotic rpe cells, hypertrophic rpe cells, and melanin engulfment by macrophages (only possible in b6 mice), as well as darkly stained nuclei of inflammatory (macrophage-like) cells in the rpe and ipm were counted (refer to methods for detailed scoring parameters) (figure 1). while significant damage can be observed in the retina of aged (1224 months old) control mice (mainly thinning of the photoreceptor layer, figure 1, supplementary figure 1), no ga pathology is seen in mice that did not receive cep immunization or in younger cep-immunized mice. our data was analyzed with a three-factor analysis of variance; the factors are (1) strain of mice (balb/c versus b6), (2) immunization status (nave versus immunized), and (3) time of recovery of tissue (early versus intermediate) (figure 2). pathology scores (defined as the summation of retinal lesions and cellular infiltration) were higher in balb/c cep-immunized mice at both early and intermediate recovery times but only higher in b6 cep-immunized mice at the intermediate recovery time (figure 2(a)). to have a representative and objective pathological score throughout the retina, we focused on the number of ipm-infiltrating cells present in close proximity to the rpe. using routine histopathology, it is not possible to distinguish different types of monocyte lineage cells present in the outer retina (for example, resident microglia versus macrophages recruited from the circulation). for this reason in the description of the results to follow, we will simply refer to the nonneural cells in the ipm as macrophages, since microglia are distinguished mainly for their location within the central nervous system. careful examination of the lesions at these early and intermediate recovery times demonstrated that a distinct population of macrophages is present in the ipm compartment near the rpe in these animals. quantification in plastic sections showed that cep-immunized balb/c mice have a significantly higher number of macrophages than age-matched nave animals harvested at 40100 days p.i. the same cellular quantification is observed with h&e staining of frozen sections (figure 2(c)). when comparing ipm macrophages between the two time points, balb/c mice showed an increase in the number of these cells in the early to intermediate recovery times in both immunized and nave mice, but the magnitude was significantly higher in immunized mice (p=0.012). while cep-immunized b6 mice harvested at early recovery times showed no significant differences in ipm macrophages when compared to nave b6 mice, immunized mice harvested at intermediate time points had more ipm macrophages than age-matched b6 nave controls (p=0.023). therefore, the number of monocyte-lineage cells present in the ipm increases over time in cep-immunized b6 mice to reach significant numbers by the intermediate recovery times. nave balb/c mice contained more macrophages in the ipm than age-matched nave b6 mice (p<0.01), and immunized balb/c mice show higher number of ipm macrophages than immunized b6 mice as well (p<0.01). this difference is also evident in the number of rpe lesions, which are higher in balb/c mice than in b6 mice, regardless of immunization status. to test the possibility that photosensitivity in the balb/c albino mice could be responsible for the differences in outer retinal lesion development and macrophage presence when compared to b6 mice, we immunized albino b6 mice (b6(cg)-tyr/j or tyr mice, which lack the tyrosinase enzyme) and compared them to age-matched nave tyr mice as well as to corresponding balb/c and wt-b6-immunized and nave mice at 4090 days p.i. the results from these comparisons showed that both macrophages in the outer retina and development of retinal lesions observed in tyr mice are comparable to wt b6 and do not show the enhanced cellular recruitment, rpe hypertrophy, and ros vacuolization present in balb/c mice at the early time points, regardless of immunization status (figure 3(a)). quantification analysis of pathological changes per section supports these observations (figure 3(b)). this suggests that the differences in inflammatory cells present in the outer retina and amd-like pathology observed between the balb/c and the b6 strains are not due to photosensitivity in the albino mice because of lack of pigmentation, but instead they are specific to genetic background, possibly due to differences in the immune responses against cep-msa between the mice or to inherent differences in rpe function and/or local oxidative damage responses in the retina. because inflammation associated with macrophages present in the ipm seems to play a role in the retinal pathology observed in cep-msa-immunized mice, we performed immunohistochemical (ihc) analysis using cell surface immune markers for the identification of the specific macrophages present in the retina, generally, and to the ipm region, specifically. a large number of cd45+(a pan-leukocyte marker) cells were observed in the choroid of immunized mice compared to controls (supplementary figure 2), indicating that cep immunization leads to increased ocular inflammation. in terms of specific cell subsets, we observed only a few cd3+and cd19+cells in the outer retina, suggesting that both t cells and b cells are largely absent from the site of retinal lesions (data not shown). in contrast, there were substantial numbers of choroidal cd11b+, f4/80 +, and cd68+cells surrounding the retinas of balb/c cep-msa-immunized mice and not of nave controls (data not shown). similar findings were observed in b6 immunized animals at late recovery times when lesions are present. immunofluorescence staining identified retinal cd11b+, f4/80 +, and cd68+cells in mice immunized with cep-msa, suggesting the potential role of macrophages in the development of disease in this model. we were able to localize a significant number of these macrophages in the rpe and ipm using nuclear counterstaining with dapi (figure 4(a), supplementary figure 3). this correlates with the location of the macrophages identified by histopathology using toluidine blue and h&e staining that are mostly observed in proximity with vacuolization and lesions of rpe and photoreceptors. in order to determine the specific class and activation status of these macrophages, we performed intracellular stains for tumor necrosis factor-alpha (tnf-) and interleukin-12 (il-12) production, which identify m1 macrophages, versus il-10 production, a hallmark of m2 macrophage differentiation. we observed both tnf+ and il-12+cells within the ipm of cep-msa-immunized mice, but il-10 staining was negative, indicating the presence of activated m1 macrophages in the pathological regions of immunized mice only (figure 4(b)). to substantiate the ihc results, we performed mrna quantification on ipm-infiltrating macrophages isolated by laser capture. these data confirmed that detectable levels of m1 marker genes (il-6, tnf-, and il-1) were observed only in cep-immunized mice, whereas il-10 expression was not detected (figure 4(c)). expression of arg1, another m2 marker, was not elevated in cep-immunized mice. interestingly, we also observed cep-associated increased expression of ccl2, a monocyte chemoattractant that has been implicated in amd, suggesting that the ccl2/ccr2 axis may play a role in cep-induced pathology. these data strongly suggest that m1 macrophages are primarily associated with the lesions we observe in the outer retina and may be the main effectors of the inflammatory response observed in this model. to directly test the role of macrophage recruitment into the ipm and development of outer retinal lesions we immunized ccr2-deficient mice on the b6 background. these mice have a defect in chemokine signaling and show poor recruitment of inflammatory cells into sites of inflammation. in addition, it has been previously shown that disruption of chemokine signaling to macrophages in these ccr2 knockout mice can have a deleterious effect on the integrity of the retina in aged mice (2 years and older). while ccr2 deficiency did not affect the levels of anti-cep antibody titers in young immunized mice (figure 5(a)), ccr2 animals showed no increase of ipm-infiltrating macrophages or outer retinal lesions in immunized mice compared to those in naive age-matched controls at late recovery times (figure 5(b)). this observation strongly suggests that macrophages, mainly recruited by ccl2, play a causative role in the induction of tissue damage in this model. immunization of mice with cep-msa provides a valuable model to study dry amd from an immunological perspective, helping to dissect the immune system's role in the development of disease. studies presented here link the amd-like histopathological changes with the presence of macrophages in the outer retina during early stages of disease, suggesting that macrophages are involved in the underlying pathology. notably, our data suggest that balb/c mice tend to be more sensitive to immunization with cep-msa than b6 mice by having a greater magnitude and earlier significant difference of inflammatory cells in the ipm when compared to age-matched controls. in addition, dry amd-like pathology, such as rpe cell hypertrophy, vacuolization of rpe and ros, and rpe cell pyknosis, is also found at greater magnitude and arises earlier following immunization in the balb/c mice. we also show that old cep-immunized balb/c mice develop photoreceptor cell loss. this suggests that future studies using this model would benefit from a more rapid and amplified immunopathological effect in balb/c mice than in b6 mice, yielding results as early as 40100 days postimmunization. even if balb/c mice show an earlier significant response to immunization with cep-msa than age-matched b6 mice, it is important to stress that cep-immunized mice contain larger numbers of macrophages in the ipm and amd-like pathology than nave controls in both strains. furthermore, our data showed no statistically significant differences between the two strains through time. this suggests that any age-related changes seen in immunized mice observed during the early stages of disease are of comparable magnitude regardless of strain, but that the higher number of macrophages present in the ipm of balb/c mice makes it technically easier for quantification of disease onset. in other words, the reason that there seems to be no early differences in nave versus cep-msa mice on the b6 background is because the actual number of ipm-infiltrating cells is too low at that point to achieve statistical significance. differences between these two strains could also be attributed to background-specific (genetic and/or immune) mechanisms or to the reduced melanin levels in balb/c mice. b6 mice are prone to develop t helper type 1 (th1) responses, whereas balb/c are th2-prone. on the other hand, it has been shown that melanin in the rpe provides protection from light damage. by showing that albino b6 (tyr) mice have comparable inflammatory cell numbers in the ipm and amd-like pathology with wt b6 mice in a much less robust form than balb/c mice, the possibility that light damage largely contributes to pathology is less likely. indeed, it has been previously shown that b6 (tyr) are not vulnerable to light damage. therefore, we believe that at least one major reason for the observed kinetic and quantitative differences is the number of inflammatory cells in the outer retinas of balb/c mice. whether there are significant differences in endogenous cep levels in the retinas of these mice, inherent differences in rpe function and/or local oxidative damage responses in the retina, or the particular contribution of specific adaptive immunity pathways, is an aspect under current investigation in our laboratory. this work also describes in detail the differences in subretinal macrophages between these two widely used mouse strains. while many macrophage-like cells are present in the subretinal space of young nave balb/c mice, we have not been able to successfully identify these cells based on surface marker expression. the true nature of these baseline retinal macrophages in balb/c mice remains unknown. importantly, we only found subretinal cd11b+/f4/80+/cd68+macrophages in cep-msa-immunized but not naive mice of either strain. a previous study has shown the presence of these macrophage-like cells in wt b6 mice but only after 20 months of age. because cep-msa immunization leads to the presence of these macrophages in younger mice, we believe that this is additional confirmation of the validity of our model in accelerating an endogenous aging-related process. thus, the cep model provides an ideal setting to study different subpopulations of retinal macrophages. the controversial role suggested for macrophages in amd stems primarily from the use of gene knockout mice as well as an acute model for choroidal neovascularization (cnv) that has been widely (and successfully) used to mimic wet amd. for instance, the assertion that macrophages are antiangiogenic comes mostly from studies using laser-induced cnv, which is actually an acute wound healing response, not a chronic pathological state progressing from a previously established disease state, such as human wet amd. a further complication involves the two different forms of amd: macrophages could have different roles in dry versus wet amd. it is important to stress that the laser-induced cnv model is a completely different system from our cep model of dry amd, and findings in one model will not necessarily be directly comparable to the other. the initial evidence linking macrophages with amd came from the analysis of mice deficient in macrophage chemokine signaling components (ccl2 and ccr2 mice) which show retinal defects similar to amd with advanced age (2-year-old mice or older), including spontaneous cnv and drusen formation. (2009) revealed that these findings were in fact an artifact due subretinal macrophage accumulation and that any amd-like pathology in ccl2 mice was most likely due to aging alone. an additional problem with the knockout mice mentioned previously and their use as amd models is the fact that these strains were found to include a known mutation (rd8) that by itself results in retinal degeneration [34, 35]. therefore most, if not all, the previously published papers using these strains must be reevaluated in that context. however, there is still acceptable evidence associating macrophages with amd. for example, young macrophages inhibit cnv in the laser-induced model of wet amd, but their antiangiogenic potential is reduced with age as they switch to an m2 phenotype. more recently, it has been shown that microglia can induce rpe cells to produce proinflammatory cytokines and chemokines. however, information is lacking to clarify the pathological role of macrophages at different stages of the amd disease process, particularly at the time of onset of dry amd before the transition to cnv. the presence of subretinal cd11b+/f4/80+/cd68+macrophages in cep-msa immunized mice we show here is similarly reported in a recent paper by a different group. this suggests a strong causal link between the m1 macrophages and outer retinal lesions. in the original publication of our model, it was suggested that macrophages were present as a result of tissue damage and were not likely to cause disease. the rationale for this conclusion was the fact that many lesions occurred in the absence of these cells. however, that original paper did not go into detail on the characterization of these cells. missing from the first study and addressed in this paper are three key parameters that now lead to the interpretation that there is a causal relationship between m1 macrophages and dry amd-like pathology: (i) kinetics and magnitude (quantification) of macrophage infiltration into the ipm relative to lesion development; (ii) activation status of the observed macrophages; (iii) how are the cells being recruited? this current study provides evidence for the first time that the early involvement of m1 macrophages occurs in animals that are predisposed to develop retinal lesions. we also provide the mechanism for recruitment of these cells, as ccl2 is elevated in retinas of cep-immunized mice, and its receptor, ccr2, is required for macrophage infiltration into the ipm. while we can not completely rule out at this time that the m1 macrophages present in the ipm of cep immunized mice are actually microglia migrating from the inner retina, it is likely that these cells come from the blood because of the systemic nature of our immunization protocol; retinal microglia are present at their normal inner retina location in rag-deficient mice that do not develop lesions upon cep-msa immunization. furthermore, this model relies on the endogenous accumulation of cep adducts in the outer retina, which should occur at equivalent rates in immunized versus nave mice, allowing resident microglia an equal access to the cep antigen. a more definitive distinction of the original source of these cells awaits the development of microglia-specific and/or macrophage-specific markers. regardless, our work confirms the critical role of bone-marrow-derived macrophages in the development of retinal degeneration and provides an excellent platform to further characterize this process. as mentioned previously, we are aware that both ccr2 and ccl2 mice develop amd-like pathology with age, even though the recent work by luhmann et al. [32, 34] has challenged this notion, at least for ccl2 mice. a major difference between these other studies and ours is that our model allows us to focus on the evaluation of relatively young animals following immunization with cep-msa, in contrast to the retinal lesions described previously that develop in the older knockout animals; we analyzed mice before 12 months of age, the nave ccr2 mice develop retinal pathology after 1820 months. therefore, it would be difficult to make a direct comparison with our study, but it provides the opportunity to explore new mechanisms that link immunity to amd. ccr2 mice do not lack ocular macrophages, just defective (or delayed) age-related recruitment (to the choroid). 2009, old ccl2 mice (which closely resemble the ccr2 macrophage phenotype) have increased macrophage recruitment to the subretinal space (the same area in which we observe macrophage infiltration in cep-msa mice) when compared to wild type, showing that a defective ccl2/ccr2 axis does not necessarily, by itself, preclude retinal infiltration of macrophages. while there is certainly a possibility that the observed pathology in cep-immunized wt mice may not be due to macrophages, we think the ccr2 data in this paper answers that question: if macrophages did not play a detrimental role in our model (if the retinal lesions in cep-msa mice were macrophage independent) then we should have observed some pathology in the immunized ccr2 mice, which we did not. because the ccr2 mice still develop cep antibodies similar to wt (indicative of an effective adaptive immune response), the m1 phenotype of subretinal macrophages as well as the temporal relationship between macrophage infiltration and retinal lesions (macrophage recruitment precedes lesion development), we believe that our interpretation that macrophages are detrimental in our model is justified. it is tempting to hypothesize that there could be two different populations of macrophages involved in the amd disease process: one being early harmful m1 and the other being the protective late m2, which in turn may contribute to cnv (once disease has progressed sufficiently). we believe that our data is representative of the role of early m1 macrophages and provides a nice platform to study early events in the development of amd. this does not exclude the idea that later cellular involvement may include m2 macrophages that could be important for resolution of disease, suggested in the published studies looking at aged ccr2/ccl2 knockout mice [29, 32]. in fact, it was recently shown in a retinal neuropathy injury model that il-10-producing (m2) macrophages have a protective role. the balance between m1 and m2 at different ages may actually dictate the damaged versus repaired tissue status of the retina. to support this notion, a recent paper analyzing human amd eyes showed that amd correlated with increased m1/m2 ratios, whereas normal aging eyes had more m2 macrophages. in the context of the retina, cep tilts the balance toward the m1 pathway for its role in inflammation-induced ga. the enhanced presence of proinflammatory macrophages in our model offers new opportunities to investigate their role and function in amd pathogenesis, as well as the immunological signals and inflammatory agents behind their activation and recruitment to the outer retina, a tissue historically thought of as an immunosuppressive environment. we believe that innovative immunotherapies that target the low-grade inflammatory responses at the early stages of our model can yield further promising information on the immune mechanisms that take place in response to oxidative damage in the retina. current understanding of amd recognizes oxidative stress and chronic retinal inflammation as possible causative factors. retinal macrophages have been recognized to have a role in amd, but their precise role (whether protective, damaging, or incidental) remains controversial. using our amd mouse model, we observed significant macrophage retinal infiltration that temporally preceded the onset of overt retinal pathology, suggesting a causative role for macrophages in retinal degeneration. interestingly, mice with defective macrophage recruitment (ccr2-deficient mice) lack macrophage retinal infiltrates and are devoid of amd-like retinal pathology. this work uncovers an important and detrimental role for macrophages in the development of amd. such an understanding raises the possibility of exploring immune-modulating therapy for the treatment or prevention of retinal degeneration, especially in patients exhibiting early signs of disease. balb/c wild-type mice, c57bl/6 wild-type mice, and ccr2 and b6(cg)-tyr/j (b6-albino) mice were obtained from the jackson laboratory. all mice were housed in a room exposed to 300 lux (outside the cage) in a 12 hr dark/light cycle. protocols for use of experimental animals in this study adhered to the arvo statement for the use of animals in ophthalmic and vision research and were approved by the institutional animal care and use committee of the university of miami miller school of medicine. cep-msa was prepared from commercially available mouse serum albumin (sigma-aldrich), which was converted to cep-modified msa following previously published procedures. the cep-msa immunization protocol has been described previously. in summary, mice were primed by hind leg injections of 200 g cep-msa in complete freund's adjuvant (cfa; from difco) at 610 weeks of age. at day 10 postimmunization (p.i.), the mice were challenged in the neck with 100 g cep-msa in incomplete freund's adjuvant (ifa; from difco), followed by a final boost with 100 g cep-msa in cfa in the neck seven days before harvest. anti-cep antibody titers at days 4060 p.i. were quantified by elisa as previously described and used to determine efficiency of immunization. all immunized mice were compared with age-matched nave, sham-msa, or cfa controls. there are no significant differences among the control mice (with low to undetectable anti-cep titers) in terms of retinal pathology and are therefore used interchangeably, depending on experimental setup. eyes were harvested at early (4090 days), intermediate (100200 days), and late (over 200 days) recovery times postimmunization (p.i.). right eyes were used for histology and were fixed in 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m po4 buffer (ph=7.4) overnight and dehydrated in graded ethanol and propylene oxide. after polymerization in a resin mixture containing polybed 812 (polysciences) and araldite 502 (polysciences), semithin (0.7 m) sagittal sections of each eye were stained with toluidine blue and analyzed for histopathology with light microscopy using a zeiss microscope (equipped with an axiocam digital camera) using a 63x oil-immersion lens. each individual mouse in this study was scored for retinal pathology on a masked fashion, using 10 sections of the right eye with at least 2530 m intervals between each section. scoring was divided in 2 subclasses: (1) the retinal lesion count represents the sum of rpe areas showing abnormal vesiculation, swelling, thinning, pyknosis, and cell lysis; (2) inflammatory cells were defined as dark nuclear stains of macrophage-like cells observed and counted only within the interphotoreceptor matrix compartment at the level of the photoreceptor outer segments and the apical border of the rpe. the data is always presented as pathology (cells or lesions or combined) per section. our data was analyzed in the biostatistics department at the bascom palmer eye institute with a three factor analysis of variance; the factors are: (1) strain of mice (balb/c versus b6), (2) immunization status (nave versus immunized), and (3) recovery time (early versus intermediate). a total of 35 mice were used in the analysis at each recovery time. repeat experiments with similar results were analyzed separately because of the use of independent batches of cep-msa. identification of inflammatory cells in the ipm was done by immunostaining of frozen sagittal sections from the corresponding left eye for each animal. following enucleation, eyes were embedded in oct compound (sakura finetek usa), frozen on dry ice, and 8 m sections were cut using a cryostat (20c). the sections were fixed with 3% formaldehyde for 25 min then pretreated with a blocking solution containing 0.05% tween 20 and 3% bovine serum albumin in pbs for 1 h at room temperature to saturate nonspecific binding sites. the sections were then incubated 1 h at room temperature with the primary antibody diluted in pbs tween and 1% bsa. the following antibodies were used for surface stains: rat anti-mouse cd11b, f4/80, cd68, and cd45 (all from ebioscience). for intracellular staining, we diluted the primary antibodies in saponin buffer. the following antibodies were used for intracellular stains: rat anti-mouse tnf- (bd bioscience), il-12p70 (endogen), and il-10 (bd bioscience). sections were then rinsed for 10 min in pbs tween and incubated with 1: 2000 goat anti-rat alexa fluor 594 (invitrogen) for 1 h at room temperature. the sections were washed three times for 10 min in pbs tween and for 10 min in pbs, coverslipped with vectashield with dapi for nuclear counterstaining (vector laboratory) and photographed in a zeiss universal microscope (carl zeiss, oberkochen, germany) equipped for incident-light fluorescence and confocal microscopy. cfa or cep-msa-immunized mice were euthanized in a co2 chamber, and their eyes were harvested for tissue processing. eyes were cryoprotected in 1.5% sucrose, embedded in tissue-tek oct compound (sakura finetek, usa), and frozen. cryostat sections, 12 m thick, were mounted on pen-membrane slides (leica). single infiltrating macrophages in interphotoreceptor matrix were collected using laser microdissection system lmd6000 (leica). total rna was extracted using the rneasy mini kit (qiagen) and reversely transcribed with high-capacity cdna archive kit (applied biosystems). cdna was preamplified with taqman preamp master mix kit followed by pcr amplifications of cdna, using taqman probe-based gene expression assay (applied biosystems). relative mrna (in arbitrary units) was calculated using the comparative quantitation method of relative quantity (2), with actin as the calibrator for each gene of interest. primer and probe sets were as follows: actb, mm00607939_s1, il-1, and mm01336189_m1; tnf-, mm00443258_m1; il-6, mm00446190_m1; ccl2, mm00441242_m1; il-10, mm99999062_m1; arg1, mm00475988_m1.

age-related macular degeneration (amd) is a major cause of blindness in the developed world. oxidative stress and inflammation are implicated in amd, but precise mechanisms remain poorly defined. carboxyethylpyrrole (cep) is an amd-associated lipid peroxidation product. we previously demonstrated that mice immunized with cep-modified albumin developed amd-like degenerative changes in the outer retina. here, we examined the kinetics of lesion development in immunized mice and the presence of macrophages within the interphotoreceptor matrix (ipm), between the retinal pigment epithelium and photoreceptor outer segments. we observed a significant and time-dependent increase in the number of macrophages in immunized mice relative to young age-matched controls prior to overt pathology. these changes were more pronounced in balb/c mice than in c57bl/6 mice. importantly, ipm-infiltrating macrophages were polarized toward the m1 phenotype but only in immunized mice. moreover, when ccr2-deficient mice were immunized, macrophages were not present in the ipm and no retinal lesions were observed, suggesting a deleterious role for these cells in our model. this work provides mechanistic evidence linking immune responses against oxidative damage with the presence of proinflammatory macrophages at sites of future amd and experimentally demonstrates that manipulating immunity may be a target for modulating the development of amd.

PMC3606733

pubmed-889

abnormal spinal curvature may be idiopathic or secondary to dystrophic etiologies, such as congenital, traumatic, and malignant causes. initial assessment and followup of patients with an abnormal spinal curvature have routinely been performed using plain radiographs. to evaluate dystrophic features, magnetic resonance imaging (mri) computed tomography (ct) is proving to be of benefit in the assessment of patients with an abnormal spinal curvature [410]. recent advances in multidetector ct (mdct) technique allow the evaluation of the spine in multiple 2-d planes (figures 1(a) and 2(a)) and with a three-dimensional volume-rendered series (3-d vr) (figures 1(b) and 2(b)). in addition, the data from the mdct study can also be used to generate a translucent display, a computer-generated image set that provides 3-d images of the spine enabling assessment of surgical instrumentation through the bony structures (figures 2(c) and 2(d)). the 3-d vr series, including the translucent display, which are generated by computer manipulation of the axial ct source data without additional radiation, have led to a growth in demand for mdct for the imaging of the spine by the spine surgeons at our institution, a major cancer center. however, to the best of our knowledge, there are no reports in the literature on the use of mdct with the 3-d vr series and the translucent display for evaluation of abnormal spinal curvature, which requires additional time for processing and interpretation. we tested the hypothesis that the 3-d vr series, including the translucent display, provides additional information beyond that of the 2-d orthogonal mdct in the evaluation of abnormal spinal curvature in patients treated at a cancer center. the institutional review board of the university of texas md anderson cancer center approved this study and waived the requirements for an informed consent. mdct studies of the spine in patients who had a history of possible primary or metastatic disease to the spine or neurofibromatosis type 1 and an abnormal spinal curvature greater than 25 degrees, as assessed on mdct, were included in our study. measurements of spinal curvature were made on the 2-d coronal or sagittal reconstructed ct images, as described in the literature [4, 5]. the review of the imaging studies and clinical data was performed by 3 neuroradiologists (jmd, lk, and ngt) in a consensus fashion. the 3-d vr series, including translucent display, was compared to the 2-d orthogonal mdct studies without the 3-d vr series in the assessment of the following 3 categories: spinal curvature; bony definition (deformity, fusion, and destruction); additional findings (mass lesions, fractures, and instrumentation). for each patient, the 3-d vr series was given a score of 1 if it was judged to be helpful in the evaluation of the aforementioned 3 categories (48 patients 3 categories=144 total possible categories) and a score of 0 if it was not helpful. mdct examinations were performed on a multidetector ct scanner (ge medical systems) to yield imaging in the axial plane using the following parameters: 140 kv, 220250 ma, and a 1.25 mm slice thickness. the mdct examinations were performed without (n=41), with (n=3), or without and with (n=4) intravenous contrast (optiray, mallinckrodt inc., bone algorithm and soft tissue images were available and reviewed in all patients ' mdct studies. postprocessing was then performed by a trained technologist on an advantage aw4.2 workstation (ge medical systems) using volume view software (ge medical systems). the post-processing provided imaging in the sagittal and coronal planes in all patients, and these images, together with the axial source images, are hereafter referred to as the 2-d orthogonal mdct study. in addition, 3-d vr images of the spine (figures 1(b) and 2(b)) and the translucent display (figures 2(c) and 2(d)), for patients in whom surgical instrumentation was placed for the stabilization of abnormal spinal curvature, were provided. the study included 48 patients (35 female and 13 male; ages 1272, mean age, 48 years), as summarized in table 1. twenty-four patients had a dextroscoliotic curvature measuring between 26 and 93 degrees (mean, 45.5), 9 patients had a levoscoliotic curvature measuring between 25 and 72 degrees (mean, 35.2 degrees), and 15 patients had a kyphotic curvature of measuring between 27 and 89 degrees (mean 48.1 degrees). twenty-six patients had a 3-d vr series without a transparent display and 22 patients had a 3-d vr series with a transparent display. the 3-d vr series was rated as helpful when compared to the 2-d orthogonal mdct study in 38 of 48 (79.2%) patients; in 10 of 48 (20.8%) patients, the 3-d vr series was rated as not helpful. helpful in 63 of 144 (43.8%) total possible categories (table 2). this included the assessment of the spinal curvature in 32 of 48 (66.7%) patients, including dextroscoliosis (n=16, 2683, mean 50.6), levoscoliosis (n=8, 2572, mean 35.3), and kyphosis (n=8; 4289, mean 58.9). the 3-d vr series was rated as not helpful in 16 of 48 patients (33.3%), including those with dextroscoliosis (n=8; 2949, mean 35.4), levoscoliosis (n=1, 35), and kyphosis (n=7; 2747, mean 35.7). the 3-d vr series was rated as helpful in the bone definition category for 14 of 48 (29.2%) patients, including bone deformity (n=6), bony fusion (n=4), bony destruction (n=2), anterolisthesis (n=2), and the additional findings category, including surgical instrumentation, in 17 patients, specifically, for the assessment of the fusion rods (n=15) or an anterior fusion plate and pedicular screws (n=2). figure 1 shows 2-d orthogonal mdct and 3-d vr images from patient no. 11, a 16-year-old male who presented with a kyphotic curvature secondary to a recurrent juvenile pilocytic astrocytoma of the thoracic spinal cord. the 3-d vr images were scored as 1, helpful in the evaluation of the spinal curvature as the spine is out of plane on 2-d orthogonal mdct imaging. 4, a 61-year-old woman who underwent correction of an abnormal spinal curvature at an outside institution. the patient had a levoscoliotic curvature of the thoracic spine to such a degree the spinal column and instrumentation could not be visualized as one structure on a single, 2-d orthogonal mdct image. the transparent display was helpful in demonstrating the scoliotic curvature and the position and integrity of the instrumentation. helpful in comparison to the corresponding 2-d orthogonal mdct in the assessment of abnormal spinal curvature in 38 of 48 patients, specifically in the evaluation of abnormal curvature in 32 patients, bony definition in 14 patients, and additional findings, including surgical instrumentation, in 17 patients. these findings confirm our hypothesis that the 3-d vr series, including the translucent display, is of additional benefit in the assessment of abnormal spinal curvature in patients treated at a major cancer center. as not all patients had abnormalities in each of the 3 categories, that is, surgical instrumentation, the percentage of cases where the 3-d vr was helpful is likely higher than what we report, further supporting our hypothesis. when reviewing an mdct study of abnormal spinal curvature, the 3-d vr series can be assessed before the 2-d orthogonal mdct study. as the spinal deformity in these patients is often out of the plane of imaging on a single, 2-d orthogonal mdct image (figures 1(a) and 2(a)), the 3-d vr sequence provides comprehensive assessment of the entire spine on a single 3-d image; this image can then be rotated and viewed from 360 degrees. in our study, we found this more beneficial in patients with a greater degree of dextroscoliotic than kyphotic curvature and more helpful for a greater degree of abnormal spinal curvature. not only can the 3-d vr series evaluate the shape of the spine, but also aid in the detection of a rotatory component, anterolisthesis, and the apex of the curvature. in addition, with the 3-d vr series, the number of vertebral bodies can be counted in a single view; this assures that the numbering assignment will be correct if an anomalous number of spinal segments are present. this is more difficult to determine on orthogonal 2-d mdct as the spine is often out of the plane of imaging due to the spinal curvature. the 3-d vr series can also evaluate the vertebral bodies for evidence of dysplasia, fracture, or bony destruction. previous authors [1012] have demonstrated that ct is better than plain radiographs for the evaluation of spine abnormalities. state that when a complex osseous deformity is present, radiographs are inadequate for complete evaluation and the use of ct is mandatory, especially when surgery is planned. our result takes this evaluation as a step further and demonstrate that the 3-d vr series would benefit 2-d orthogonal mdct in the evaluation of vertebral anomalies as the 14 studies scored a helpful rating in the evaluation of the bony structures, including 4 cases with prior surgical bony fusion. in the post-operative patient, the 3-d vr series with translucent display may be used to assess surgical instrumentation. this technique allows the visualization of the instrumentation through the bone and can also be rotated and viewed in 360 degrees, including in oblique planes. as the surgical instrumentation is visualized as one component on a single image, and the position and integrity of support rods and pedicular screws are assessed, coloring of the spinal instrumentation is also possible (figure 2(d)). in every case with surgical instrumentation in our study, in fact, our referring spine surgeons insist on inclusion of the 3-d vr series for the evaluation of the spine and the transparent display for a comprehensive overview of the surgical instrumentation. further study can be undertaken to determine if the 3-d vr series with translucent display can be used to evaluate surgical instrumentation following spinal surgery in the general population with an abnormal spinal curvature and to evaluate associated complications. as recent advances in mdct technology have led to a significant reduction in streak artifact related to metallic hardware [13, 14]. mdct with vr series may lead to better evaluation of the postoperative spine and possibly easier detection of complications. it should be noted, though, that the interpreting radiologist must be careful not to mistake streak artifact that extends through the surgical instrumentation of the breakage of hardware. the purpose of this study was to determine if the 3-d vr images provide additional information to the orthogonal 2-d mdct dataset and the results support our hypothesis. we are not suggesting that 3-d vr can replace the orthogonal 2-d mdct; rather 3-d vr is complementary. one limitation of the study is that this is a very select group of patients, mainly those presenting for treatment of their disease to a major cancer center. computed tomography has been described in the measurement of scoliosis, including the rotatory component [1519]. further study will be necessary to determine if the 3-d vr series can be for evaluation and measurement of abnormal curvature in the general population, including for idiopathic scoliosis. one negative aspect of mdct is that patients are imaged in the recumbent position and the use of ionizing radiation. the downside of patient positioning also applies to the reconstructed 3-d vr series; however, no addition radiation is necessary for computer generation of the 3-d vr series or the translucent display. herein, we have illustrated the added benefit of 3-d vr imaging and the translucent display to axial and 2-d orthogonal mdct imaging of the spine for the evaluation of abnormal spinal curvature among patients at a major cancer center. failure to recognize the etiology of spinal curvature, such as syndromic deformities, fractures, or malignancies of the spine, can affect treatment and management outcomes for patients. the translucent display series provides a more comprehensive evaluation of surgical instrumentation following correction of an abnormal spinal curvature or resection of malignancy. it is, therefore, beneficial for spine surgeons and radiologists involved in the care of patients with abnormal spinal curvature to be aware of the benefits of the 3-d vr series and the translucent display.

background. abnormal spinal curvature is routinely assessed with plain radiographs, mdct, and mri. mdct can provide two-dimensional (2-d) orthogonal as well as reconstructed three-dimensional volume-rendered (3-d vr) images of the spine, including the translucent display: a computer-generated image set that enables the visualization of surgical instrumentation through bony structures. we hypothesized that the 3-d vr series provides additional information beyond that of 2-d orthogonal mdct in the evaluation of abnormal spinal curvature in patients evaluated at a major cancer center. methods. the 3-d vr series, including the translucent display, was compared to 2-d orthogonal mdct studies in patients with an abnormal spinal curvature greater than 25 degrees and scored as being not helpful (0) or helpful (1) in 3 categories: spinal curvature; bony definition; additional findings (mass lesions, fractures, and instrumentation). results. in 38 of 48 (79.2%) patients assessed, the 3-d vr series were scored as helpful in 63 of 144 (43.8%) total possible categories (32 spinal curvature; 14 bony definition; 17 additional findings). conclusion. three-dimensional mdct images, including the translucent display, are complementary to multiplanar 2-d orthogonal mcdt in the evaluation of abnormal spinal curvature in patients treated at a major cancer center.

PMC4063197

pubmed-890

to study the influence of increased worldwide dengue activity on international travelers, 2,259 patients were studied retrospectively for dengue antibodies after returning from dengue-endemic countries. a 36-month period from january 1996 to december 1998 was compared with a 27-month period from january 2002 to march 2004. we recruited travelers who came to the travel clinic of the berlin institute of tropical medicine, germany, with fever (n=1,091) or diarrhea without fever (n=1,168) and for whom serum samples were available. thus, 2,259 patients ' serum samples were tested for anti-dengue igm and igg by using an igm-capture elisa and an igg indirect elisa (panbio pty ltd., a probable acute infection was defined according to manufacturer's instruction as having a sample: calibrator absorbance ratio of igm 1.0. acute probable primary infection was characterized by the elevation of igm 1.0 with igg 4.0, and acute secondary infection was characterized by the elevation of igg 4.0 (13). for a more specific diagnosis, all serum samples from patients with probable dengue infections were then investigated by using e/m and nonstructural protein ns1 serotype-specific igm elisas and ns1 serotype-specific igg elisa as described previously (11,12). furthermore, an additional confirmatory testing was performed by using immunofluorescence assays (euroimmun ag, luebeck, germany), and if these results were contrary, sera collected during the acute phase of illness were processed by using polymerase chain reaction assays to detect viral nucleic acid. among the recruited patients, 1,163 (51.5%) antibodies were detected by the screening test in 127 (5.6%) serum samples, indicating probable acute dengue infection. the more specific analysis confirmed infection in 64 cases (2.8% prevalence), including 8 (12.5%) patients with secondary immune response. one of these 8 secondary and none of the 56 primary infections led clinically to dhf. among 1,091 patients with fever and 1,168 diarrhea patients without fever, 51 (4.7%) and 13 (1.1%), respectively, had an acute dengue infection. the highest prevalence of dengue antibodies (4.6%), indicating acute infection, was found in patients returning from asia (n=1,020) (table 1), including southeast asia (7.4% of 500 total travelers and 11% of 310 febrile travelers) and the indian subcontinent (1.8%). traveling in southeast asia was associated with a significantly higher risk compared to other disease-endemic areas in africa and latin america (odds ratio 5.3, 95% confidence interval 3.29.0). comparing patients with and without acute dengue infection, no significant difference was seen in the median length of travel (28 vs. 24 days, respectively, p=0.083, mann-whitney test) or the median age of the patients (32 vs. 33 years, respectively, p=0.58, mann-whitney test). patients 3044 years of age had the highest antibody prevalence (37 [3.8%] of 966).*four patients are not included in this analysis since they traveled to>1 continent. when patients from 1996 to 1998 (n=1,073) were compared with those from 2002 to 2004 (n=1,186), a slight increase was seen in the overall prevalence, from 2.7% to 3.0%, although this finding was not significant (p=0.63). the figure shows annual dengue prevalence among travelers to thailand and to the indian subcontinent, highlighting that infection rates fluctuate strongly between years and between quarters within years. in the last quarter of 1997 and 1998, 64 travelers returned from thailand, and 14 (22%) acquired an acute dengue infection. among those, 5 were infected by the serotype denv-1, 3 by denv-2, and 4 by denv-3 (table 2). in 2 cases lines indicate acute dengue infection after returning from thailand (n=223) or from the indian subcontinent (n=495), both with and without fever, and in the total febrile population returning from all travel destinations (n=1,091). in this study population, 4.7% of all febrile patients returning from different areas of the tropics had dengue antibodies that indicated acute infection. this number underlines the effect on international travelers to dengue-endemic areas. as long as no dengue vaccine is commercially available, among patients without fever, 13 (1.1%) had detectable dengue antibodies compatible with acute dengue infection, which underscores that symptoms commonly associated with dengue, such as fever, myalgia, arthralgia, and exanthema, are helpful for diagnosis when present, but the absence of typical symptoms does not exclude infection. a study on 483 cases of imported dengue infections in europe showed that dhf developed in 2.7% of the patients; immigrants from dengue-endemic countries returning to europe after visiting their home country were at higher risk for more severe disease than europeans (9). however, immigrants from dengue-endemic countries have a higher prevalence of dengue antibodies from previous infections. in our population, all 54 patients with primary dengue infection had classical dengue fever, and 1 of 8 patients with secondary dengue infection had dhf. the patient with dhf was born in sri lanka and immigrated to germany 2 decades ago. these observations might be taken as more evidence for the importance of letting patients know that they have been infected with dengue and should, therefore, protect themselves from infection with subsequent serotypes. fluctuations in prevalence between years, especially the maximal prevalence in 1998, correspond to similar observations on record. in a study conducted among israeli travelers to southeast asia from 1994 to 1998, a sharp increase in incidence was noted in 1998 compared with previous years (14). similar to the worldwide increase of cases reported to the world health organization, the number of swedish travelers returning from southeast asia with dengue fever was considerably higher in 1998 than during previous years (3). decreasing resources for vectorborne infectious disease prevention and control (15) might have contributed to this epidemic in southeast asia, which followed the economic crisis in 1997. the risk among a cohort of dutch short-term travelers to dengue-endemic areas in asia from 1991 to 1992 showed marked seasonal variation for the indian subcontinent (7). in our population, such seasonal variations were not detectable. the infection rates were more influenced by major outbreaks, such as the one in india in 2003 or in southeast asia in 1997 to 1998. similar findings have been described for israeli travelers during their trip to thailand in 1998 (14) and in german travelers to brazil and thailand in 2001 and 2002, respectively (4). to screen our samples, elisa-based tests for igm and igg igm elisas had a sensitivity of 100% in primary infections and 99% in secondary infections. the specificity was 100% in non-flavivirus infections and 80% in japanese encephalitis virus infections when an igg sample: calibrator absorbance ratio of 3.0 was used as a cutoff (13). however, because our study was retrospective, only single serum samples were available from each traveler. to increase specificity, all serum samples that indicated probable infections were further investigated with more specific elisa techniques. by using virus-infected culture supernatants as the source of viral antigens, the e/m-specific capture igm has been found to differentiate reliably between japanese encephalitis, dengue, west nile virus, and yellow fever (12). furthermore, an ns1 isotype- and serotype-specific elisa can reliably differentiate japanese encephalitis virus infection, japanese encephalitis virus vaccination, and primary and secondary dengue virus infection (11). in primary infection, igm is detectable 38 days from the onset of symptoms (8); thus, some of our travelers might have had false-negative test results if samples were taken during the acute phase of illness. therefore, the true infection rates in our study might have been higher than the numbers indicated by single-sample serology. overall, we demonstrated an almost stable rate of dengue infections among berlin institute of tropical medicine patients returning from all tropical regions when recent years are compared with the mid-1990s. large outbreaks like those in 19971998 in southeast asia (especially thailand) and 2003 in major cities of india, all popular tourist destinations, contributed to the numbers. quarterly and annual fluctuations might lead to misinterpretation of probable trends if data are derived only from short-term observations. in addition, this variability underscores the importance of tourists ' seeking information before traveling to dengue-endemic areas.

we studied 2,259 german citizens after they returned from dengue-endemic countries from 1996 to 2004. serotype-specific dengue antibodies indicated acute infections in 51 (4.7%) travelers with recent fever and 13 (1.1%) travelers with no recent fever, depending largely on destination and epidemic activity in the countries visited.

PMC3320360

pubmed-891

a 55-year-old, postmenopausal woman was presented to the emergency department with a chief complaint of left lower quadrant pain, constipation, anorexia, nausea and vomiting of 4 days duration. her medications included calcium, vitamin d, acetaminophen, glucosamine, and chondroitin sulfate. on physical examination, she had a pulse of 113/min, blood pressure of 108/72 mmhg, respiratory rate of 18/min, and temperature of 37c. laboratory studies included wbc 18,700/l with 89.6% granulocytes, hemoglobin 13.4 g/dl, and platelet count 234,000/l. the glucose, electrolytes, bicarbonate, lactate, and renal and liver function tests were all within normal limits. ct scan of the abdomen and pelvis with oral and intravenous contrast showed abundant stool in the colon, particularly in the sigmoid colon with surrounding extensive infiltrative changes, wall thickening, and 6.5 cm dilation of the colon (fig. 2). image depicting large fecal load, sigmoid wall thickening and extensive peri-colonic infiltrative change. magnified image depicting a single focus of free air within the peritoneal cavity indicative of perforation. the patient was admitted to the medical service and given intravenous fluids, ciprofloxacin, and metronidazole. oral colace and, she complained of severe abdominal pain and had diffuse abdominal tenderness with rebound tenderness and further abdominal distension. surgical consultation was obtained and an emergent exploratory laparotomy was performed which revealed extensive fecal peritonitis. the peritoneal cavity was thoroughly lavaged and a hartmann procedure was performed with resection of the perforated sigmoid colon, creation of a proximal end colostomy, and closure of the rectal stump. the resected specimen was sent to the pathology department and peritoneal fluid was sent for cultures. green exudate and multiple adhesions. gross examination showed a 2.0-cm perforation, which was 5.5 cm from one resection margin. a mucosal ulceration with an overlying fecaloma (hard localized accumulation of stool) was seen around the perforation. the mucosal surface of the colon also showed prominent pink tan to red, congested circular folds and there were multiple diverticula. microscopic examination showed a perforation of the colonic wall with mucosal necrosis, acute and chronic inflammation and granulation tissue (fig. 3). hematoxylin and eosin staining of colonic biopsy specimen showing acute and chronic inflammation. the culture of the peritoneal fluid was positive for extended-spectrum beta-lactamase negative escherichia coli sensitive to cephalosporins and carbapenems. her postoperative course was complicated by hospital-acquired pneumonia, which was successfully treated with intravenous cefepime. stercoral perforation of the colon was initially described by berry in 1894 (9). however, it was the cause of 3.2% of colonic perforations in one series (1) and present in 2.2% of randomly selected autopsy examinations (10). cases of stercoral perforation of the colon are likely both under-reported and are often not recognized. with an aging population and an increase in life expectancy, there are many people who survive with debilitating conditions. sick elderly people, bed bound or minimally active, who are on multiple medications that affect bowel motility are prone to constipation. long-standing constipation and fecaloma formation in the distal colon exert persistent pressure over the bowel wall leading to ischemic necrosis of the colonic mucosa and ultimately stercoral perforation (1, 2). old age, chronic constipation, abnormal bowel motility, and increased intraluminal colonic pressure underlie the pathogenesis of both stercoral colitis and diverticular diseases (1, 2, 7, 8). despite some similarities in pathogenesis, the ability to differentiate the cause of perforation in a patient with both of these entities has not been addressed. both stercoral perforation and diverticular disease commonly occur in the sigmoid colon because this is the narrowest portion of the large intestine and stool gets progressively more dehydrated as water gets absorbed along the colon. these factors all contribute to significantly increased intraluminal pressure in the sigmoid colon (1, 2, 7, 8)., they exert prolonged localized pressure and compromise microcirculation of the bowel wall, particularly over the antimesenteric aspect where the blood supply is poor. these events culminate in stercoral ulcer formation and perforation (1, 2). the clinical presentation of stercoral perforation and diverticulitis with or without perforation can be similar (14, 11). stercoral perforation of the sigmoid colon usually presents with features of diffuse peritonitis and pneumoperitoneum (4) but can present with localized peritonitis (1720%) (1, 2) and can masquerade as diverticulitis or diverticular perforation (5). signs of hollow viscus perforation mandate urgent exploratory laparotomy regardless of the cause; however, identifying the cause of localized peritonitis guides appropriate management. in contrast to diverticular perforations, stercoral perforations present with the proximal colon loaded with multiple fecalomas (63%). inflammatory and necrotic process involves a longer segment of colon beyond the area of perforation. the perforations can be multiple (2128%) (1, 2). in selected cases of perforated diverticulitis, medical management or however, stercoral perforation mandates immediate surgical intervention (1, 2). in a patient with history of constipation, local or generalized peritonitis, palpable abdominal mass, stool impaction on rectal examination, pneumoperitoneum, fecal loading, or calcified feces on abdominal radiograph ct scan findings of fecal impaction or fecaloma, focal thickening of colonic wall, stranding of pericolonic fat, and presence of extraluminal gas bubbles or an abscess can assist in the preoperative diagnosis of stercoral perforation with the latter three findings absent in simple fecal impaction (3). the intraoperative findings include generalized peritonitis, fecaloma formation, colonic dilatation, edema of adjacent bowel wall, and ulcerations on the antimesenteric border usually measuring 110 cm, which are occasionally multiple (2128%). if frank perforation occurs, fecal material is found within the peritoneal cavity in close proximity to the perforation site (1, 2). histopathological findings include ischemic necrosis and nonspecific inflammatory changes (1, 2, 10). surgical management of stercoral perforation includes open laparotomy, massive peritoneal lavage, and hartmann's procedure with colostomy or segmental resection with primary anastomosis and diverting colostomy. the latter can be performed in patients with limited intraperitoneal septic condition and acceptable general condition and has the advantage of simple closure of diverting colostomy in future (1, 4, 17). in patients with stercoral perforation of colon, additional stercoral ulcers initially not visible may extend over a large colonic segment, bearing the risk of second perforation (1). substantial colonic dilation and the presence of multiple fecalomas may indicate additional stercoral ulcers (1). in fact, stercoral perforation has been reported to recur proximal to an end colostomy (18). therefore, the management of the proximal colon should be a definitive part of the operative management (2). intraoperatively, colon disimpaction, colonoscopy, identification of additional stercoral ulcers, and removal of entire pathologically altered or dilated colon segments may avoid second perforation and further complications. treatment of intra-abdominal sepsis can be achieved by massive peritoneal lavage, perforation control, and institution of broad-spectrum intravenous antibiotics. peritoneal fluid culture in stercoral perforation is positive for gram-negative and anaerobic organism (e.g., e. coli, enteroccocus faecalis, and b. fragilis), so patients should at least be treated with antibiotics effective against these organisms (4). a favorable outcome in the treatment of stercoral perforation depends on adequate resuscitation, generous removal of all diseased colonic tissue, extensive peritoneal lavage, aggressive therapy to counteract peritonitis, including broad-spectrum antibiotics, and appropriate treatment of any comorbid medical condition (4). most importantly, fecaloma may be present for months to years, before they cause complications (2), hence, chronic constipation and fecal impaction should be managed timely and adequately to avoid potential life-threatening complications. high index of suspicion is needed to diagnose stercoral perforation of the colon in patients presenting with localized or generalized peritonitis. early recognition of stercoral perforation in patients with concomitant diverticular diseases is important as it can help the physician to decide the appropriate treatment plan. the authors have not received any funding or benefits from industry or elsewhere to conduct this study.

stercoral colitis with perforation of the colon is an uncommon, yet life-threatening cause of the acute abdomen. no one defining symptom exists for stercoral colitis; it may present asymptomatically or with vague symptoms. diagnostic delay may result in perforation of the colon resulting in complications, even death. moreover, stercoral perforation of the colon can also present with localized left lower quadrant abdominal pain masquerading as diverticulitis. diverticular diseases and stercoral colitis share similar pathophysiology; furthermore, they may coexist, further complicating the diagnostic dilemma. the ability to decide the cause of perforation in a patient with both stercoral colitis and diverticulosis has not been discussed. we, therefore, report this case of stercoral perforation in a patient with diverticulosis and include a discussion of the epidemiology, clinical presentation, and a review of helpful diagnostic clues for a rapid differentiation to allow for accurate diagnosis and treatment.

PMC3937564

pubmed-892

damage often occurs to the supraspinatus muscle, which is one of the components of the shoulder, with repetitive use and small impacts1. this is mainly because the strength of the small muscles of the shoulder joint that endure the stress from repetitive use is small3. the supraspinatus muscle is the muscle that forms the rotator cuff of the shoulder joints, and it is located on the top of the scapula. it plays a role in raising the arms above the head. functional disability does not occur in accordance with the level of pain, but sometimes disability does occur in daily life when the level of pain is severe2, 4. furthermore, according to previous research, the main reason for damage of the supraspinatus muscle is unstable adjustment of the humeral head by the spheroidal joint or ball and socket joint6. also, when exercise is performed that utilizes the shoulder joint, the supraspinatus, which is the small rotator muscle, has to endure it. according to previous research, 190 out of 191 rotator cuff tear patients had rupture of the supraspinatus muscle7. patients with a damaged supraspinatus muscle must go through a period of inflammation and convalescence that has no relationship with the decision regarding surgical treatment. a previous study on the treatment process for patients after a rupture in the rotator cuff reported that inflammatory response of a subacromial mucous cyst induces a patient s symptoms8. in this kind of damage in the rotator cuff, there is a high interest in reducing pain through improvement of blood flow within the muscle. also, with the purpose of rehabilitation, even after surgery, exercise utilizing the proprioceptive neuromuscular facilitation (pnf) method is executed within the range of no pain to normalize the supraspinatus muscle and at the same time maintain suitable stability for performance of functional activities. in other words, the pnf treatment method is an important treatment to enhance the flexibility, stability, strength, and neuromuscular control of the supraspinatus muscle9. however, damage to the supraspinatus muscle of the shoulder joint has a high possibility of recurrence. there is little information regarding pnf treatment methods in this area, and the treatment results are controversial. thus, the present study examined the muscle recovery level in detail by determining the speed of blood flow within the muscle and change in pain subjectively after treatment with simple exercise and pnf treatment methods in for supraspinatus muscle tear patients. it was approved by kyungsung university s human research ethics committee. written informed consent was obtained from all subjects after a full explanation of the experimental purpose and the protocol of the study. the subjects of this study were patients who had visited a hospital due to shoulder joint pain and had been diagnosed with a muscle tear on mri. they included patients who had a normal range of movement in the shoulder joint, had a post-trauma medical history, or had had shoulder joint surgery and those who had been diagnosed with two or more instances of complete rupture of the supraspinatus muscle, adhesive capsulitis, or shoulder instability. the patients performed rehabilitation exercise for 12 weeks, and their physical characteristics are shown in table 1table 1.general characteristics of the subjectssubjectpnf (n=10)se (n=10)age (years)47.3 3.350.2 4.4weight (kg)63.6 2.559.7 4.1height (cm)161.3 2.6163.41 1.4mean sd. the aim of this research was to examine in detail the types of influence on the subjective pain level and speed of blood flow in the supraspinatus muscle resulting from pnf rehabilitation exercise and simple exercise treatments performed for 12 weeks. thus, the subjects were subjected to testing and then engaged in the rehabilitation treatment for 12 weeks. after the completion of the treatment term, the same tests as before the 12 weeks of treatment were performed using the same methods. two rehabilitation methods, the pnf treatment method and simple exercise method, were used. the subjects warmed up 10 minutes in the same way for both methods, and the exercises were mostly stretching and were performed in the range of no pain and within the range of movement of the shoulder joint. the pnf method was used to increase the range of movement of the shoulder joint with pain in the supraspinatus muscle using relaxation techniques such as contract-relax in extension-adduct-internal rotation and flexion-abduction-external rotation. the treatment was performed within the range in which pain did not occur for 10 minutes, and the combination of isotonics facilitation method was used within the range of movement to increase muscular strength. the simple exercise was performed to improve the muscle strength and instability of the aching part through hold-relax and repetitive stretching within the range of movement of the joints in which pain did not occur. after this exercise was finished, all patients performed finishing exercises-static and dynamic stretching-for about 10 minutes. to determine the recovery level of the supraspinatus muscle, an ultrasonic doppler blood flow meter (es-1000sp ii, hadeco, kawasaki, japan) was used to measure the speed of blood flow in the supraspinatus muscle. the area of the supraspinatus muscle rupture was measured a total of 12 times (every tuesdays). the visual analogue scale (vas) was used to determine the level of pain. the first measurement was obtained before participation in the rehabilitation treatment, and a total of 12 measurements were obtained (once a week). to measure the functional aspects of daily life actions after rupture of the supraspinatus muscle, the disabilities of the arm, shoulder, and hand (dash) questionnaire was used. the dash questionnaire has 21 items related to everyday actions (opening a sealed container, writing letters, opening a door with a key, preparing a meal, opening a door, placing an item on a shelf higher than the head, drawing up chores, taking care of a garden or gardening, laying out bedding, carrying a shopping bag or briefcase, carrying a heavy item (over 5 kg), changing a light bulb, washing or drying your hair, washing your back while showering, putting on a sweater, using a knife when cooking, other activities like card games or knitting, activities consuming a lot of energy such as hammering, activities using the arms such as badminton or throwing a frisbee, moving an item to another spot, and sexual life), items related to six symptoms (pain, pain during a certain activity, tingling, indigestion, stiffness, and sleeping disorder), and items related to 3 social functions (difficulty in social life with neighbors, limitations when working or during other activities, and decline in confidence). pasw statistics 18.0 was used to calculate the average and standard deviation for all data in this study. the difference in dash score, change in subjective pain, and change in speed of blood flow in the supraspinatus muscle of pnf exercise and simple exercise groups were analyzed in peated measures anova. as a result of observing 20 patients who had a rupture in the supraspinatus muscle for changes in speed of blood flow in the muslce, subjective pain, and dash csore after 12 weeks of pnf treatment and simple exercise, a significant difference was not found between the two groups, which had identical target. change in the speed of blood flow in the supraspinatus muscle between before and after pnf treatment and simple exercise. the speed of blood flow in the supraspinatus muscle changed between before and after the pnf treatment and simple exercise for 12 weeks. the speed of blood flow in the pnf treatment group was initially 7.8 m/sec (sd=2.47). four weeks later, it was 8.75 m/sec (sd=3.75); 8 weeks later, it was 13.22 m/sec (sd=7.34); and 12 weeks later, it was 13.41 m/sec (sd=6.32). in the simple exercise group, it was 8.14 m/sec (sd=2.64) before treatment. four weeks later, it was 9.35 m/sec (sd=3.87); 8 weeks later, it was 9.33 m/sec (sd=4.21); and 12 weeks later, it was 8.2 m/sec (sd=5.11). change in subjective pain (vas) between before and after pnf treatment and simple exercise. when looking at the change in subjective pain (vas) between before and after pnf treatment and simple exercise, pnf the pnf treatment group showed a vas score of 4.33.1 before treatment and a vas score of 3.62.5 after 12 weeks. the simple exercise group showed a vas score of 4.72.6 before treatment and a vas score of 3.73.7 after 12 weeks. as a result, change in dash score between before and after pnf treatment and simple exercise. when looking at the results of the dash questionnaires administered before and after pnf treatment and simple exercise, the pnf treatment group showed a dash score of 23.110.2 before treatment and a dash score of 13.16.7 after 12 weeks, indicating a significant decrease (p<0.05). the simple exercise group showed a dash score of 21.311.2 before treatment and a dash score of 18.17.5 after 12 weeks, indicating a significant difference (p<0.05). in this research, 20 shoulder joint rupture patients were subjected to pnf treatment or simple exercise therapy for 12 weeks to observe their influences on the speed of blood flow in the supraspinatus muscle, change in subjective pain, and functional aspects of the shoulder joint; thus, the factors above were analyzed, and they are discussed below. the muscles in the human shoulder joint are divided into the deltoid, subscapularis muscle, supraspinatus muscle, teres minor muscle, and teres major muscle. these muscles play a role in moving the shoulder joint in flexion, extension, abduction, adduction, internal rotation, and external rotation. it appears that rupture of the supraspinatus muscle occurs mostly from rupture of the rotator cuff of the muscles2. this lesion in particular results in the most limitation and highest pain level compared with other parts of the rotator cuff10. this is because rupture easily occurs in the joint capsule, and the ligament is also damaged due to repetitive movement in the area of the supraspinatus muscle. the diagnosis for the supraspinatus muscle was confirmed by a radiology specialist through echography in this study. in 1984, crass first used echography to diagnose rotator cuff rupture, and it was found that echography had a level of accuracy similar to mri11. according previous research, 8090% of cases of supraspinatus muscle rupture can be determined through echography12. in this context, analysis of our supraspinatus muscle patients revealed that, the pnf treatment group showed an average increase of 71% in the speed of blood flow between before and after treatment. as a result, through the exercise on advance study shoulder joint pain patients, it showed that the increase in bloodstream speed of muscle, research related to pain relief, and the increase in blood flow of muscle were correspondent with partial. the results of the present research indicate that the pnf treatment method is more effective for muscle function recovery in patients. on the other hand, regarding the change in subjective pain, there was an average decrease of 16% between before and after the pnf treatment, whereas the average decrease was 21% between before and after simple exercise. this relaxes the contract of peripheral vascular and hypertonic of sympathetic nervous system due to hypertonic muscle due to advanced research pain. moreover, blood circulation is accelerated for excrete colorific substances, which cuts the circulation of vicious circle14, 15 it showed different results with the research. blood flow increased by 71% as a result of pnf treatment, and the level of subjective pain decreased by 16%. blood flow increased by 0.7% as a result of simple exercise, and the level of subjective pain decreased by 21%. a significant change was not found statistically of subjective pain decrease, increase of blood flow, and the results of advanced research. in the dash items concerning the functional aspects of patients with a damaged supraspinatus muscle, the total average score decreased by an average of 43% as a result of pnf treatment, but they did not show decrease rate in the requirements of using the hand such as writing, opening a door, and preparing a meal, which they felt uncomfortableness. the total average score decreased by an average of 15% as a result of simple exercise. there was no decrease in scores for putting an item on a shelf higher than the head, washing or drying your hair, and putting on a sweater. thus, supraspinatus muscle rupture patients would not be satisfied with a treatment that results in a decrease in the total average dash score. the total average score decreased, but both treatment methods had certain limitations that have clinical implications. the methods used for treatment in this research show difference with the research of advanced researchers. decrease in pain was identified in the increase of blood flow, but this has a possibility of an error during the diagnosis through echography of the damage level of the supraspinatus muscle16. the supraspinatus muscle rupture patients did not experience pain, but there was an advanced research that patients had limitations in everyday activity like dash17. these were limitation of this research, and future research should use mri and echography for diagnosis both and only utilize patients who experiencing their first case of supraspinatus muscle damage to reduce the level of errors.

[ purpose] the aim of this study was to examine the effects of proprioceptive neuromuscular facilitation techniques and simple exercise on subjective pain reduction and blood flow velocity in supraspinatus tear patients and to evaluate muscle recovery. [subjects and methods] the 20 subjects of this study were diagnosed with supraspinatus tears by mri. the subjects have performed pnf techniques and simple exercise for 12 weeks. [results] after 12 weeks of proprioceptive neuromuscular facilitation techniques and simple exercise, the blood flow velocity, visual analogue scale, and disabilities of the arm, shoulder, and hand score showed statistically significant difference. also, the difference between the proprioceptive neuromuscular facilitation techniques and simple exercise was statistically significant. [conclusion] in conclusion, 12 weeks of proprioceptive neuromuscular facilitation treatment and simple exercise therapy had no effect on pain reduction in patients with supraspinatus tear, but in terms of functionality, the proprioceptive neuromuscular facilitation treatment was effective.

PMC4563286

pubmed-893

the estimated number of population with obesity around the world is 1.5 billion in 2012 and it continues to rise. the increases of obesity affect all classes of socioeconomic status (ses) with certain difference in both developed countries and developing countries in recent decades [1, 2]. as a result, burdens of diseases from chronic noncommunicable diseases associated with obesity such as cardiovascular diseases, diabetes, metabolic syndrome, and hypertension are increasing [3, 4]. the world health organization has recently set obesity as one of the key indicators for global action on noncommunicable diseases. studies have shown that the direction of association between obesity and ses varied by population and economic status of the countries. in the developed countries, individuals with lower socioeconomic status were more likely to be obese than those in the higher socioeconomic group [6, 7]. for the developing world where countries are in the transition of epidemiological period, pattern of obesity has varied by gender and socioeconomic status. the reversal association between ses and obesity in developing countries has been observed earlier in women. in thailand, a previous national health examination study showed that the prevalence of obesity increased approximately by 60% during 19912004. the surveys also reported that the distribution of overweight and obesity varied by education level, with significantly higher prevalence in men with high education level, but in women with low education level. it is not clear whether the pattern has been changed in the recent national health survey. in the present study, we reported the prevalence of the latest national health examination survey in 2009 and the trends of body mass index and prevalence of obesity from 1991 to 2009. we also examined the pattern of association between obesity and education level by sex, age group, and area of residence during 19912009. nhes is nationally representative of health examination survey of thai population conducted in 1990, 1997, 2004, and 2009. the survey was conducted by the national health examination survey office, health system research institute, thailand. in each survey, the sampling technique has been described elsewhere [9, 10]. for the nhes iv, briefly, the sampling unit in the first stage was province in each region, the second was the district, and the third stage was village in rural areas and enumeration unit in urban areas. the final sample size collected was 20,450 with a response rate of 93.1%. in this study, we included those aged 20 years and over with a total of 19,181 in the analysis. the sample sizes for the 1990, 1997, and 2004 surveys were, 15124, 7726, and 41630, respectively. this study was approved by the ethical review committee for research in human subjects, faculty of medicine, ramathibodi hospital, mahidol university. weight was measured while participants wore light cloths; height was measured at standing without shoes. body mass index was calculated as weight in kilograms divided by height in meters squared. obesity was defined using criteria for asian population, at a cut-off point of bmi 25 kg/m as obesity due to the higher risk of developing diabetes and obesity-related diseases compared to western population. consequently, bmi was divided into 4 categories: overweight: bmi 23<25, obesity class i: bmi 25<30, and obesity class ii: bmi 30 kg/m. education was categorized into four groups: less than primary, primary, secondary or vocational, and university education. all the statistical analyses were taken into account the complex survey design using stata software 10.1 (stat corp. age-adjusted mean of bmi and age-adjusted prevalence of obesity were calculated according to sex, area of residence (urban/rural), and level of education. the age and sex adjusted mean and prevalence of obesity were standardized using the standard population of the estimated 2004 population. for the 2009 survey, multinomial logistic regression models were used to assess the association of the ordinal scale of bmi categories: overweight and obesity class i and obesity class ii with independent variables of educational levels controlling for age, smoking, area of residence, and geographic regions (north, northeastern, central, south, and bangkok). we assessed the interaction by adding multiplicative interaction terms of area of residence and indicators variables for education levels in the models and found no significant interaction at p value<0.10. in the trend analysis between 1991 and 2009, we restricted the age group to those 2059 years old, because the bmi data for those aged 60 years were not available in the 1997 survey. sample size for those aged 2059 years in each survey included a total of 11,218, 3,062, 19,962, and 10,103 for years 1991, 1997, 2004, and 2009, respectively. we used linear regression to evaluate the average change of bmi per decade by using bmi of each survey as dependent variable and the survey year as independent variable controlling for age, area of residence, and educational levels. logistic regression was used to examine the linear trends in sex-specific prevalence of overweight and obesity class i and class ii, separately over the four surveys by educational level with year of survey as a continuous variable controlling for age and area of residence. in 2009, overall, age-adjusted mean bmi among thai adults aged 20 years was 23.9 kg/m (95% ci 23.6, 24.2 kg/m). women had higher bmi than men (24.4 kg/m (95% ci 24.1, 24.8) versus 23.3 kg/m (95% ci 23.0, 23.6), p<0.001). age-adjusted prevalence of overweight, obesity class i, and obesity class ii was 17.5% (95% ci 16.7, 18.4%), 26.0% (95% ci 24.1, 28.0%), and 9.0% (95% ci 7.9, 10.2%), respectively. the corresponding prevalence, except for overweight, was higher in women than in men (17.0% (95% ci 16.1, 17.9%), 29.0% (95% ci 26.5, 31.6%), and 11.5% (95% ci 10.1, 12.9%) in women and 18.2% (95 ci 16.8, 19.6%), 22.8% (95% ci 20.1, 25.7%), and 6.3% (95% ci 5.1, 7.6%) in men, resp., all p values<0.05). table 1 shows the prevalence of overweight and obesity overall and by sex, age, area of residence, and educational levels. for men, obesity class i and class ii prevalence were significantly higher in urban than in rural areas (all p<0.001); however, for women, only obesity class ii prevalence was significantly higher in urban than in rural areas (p=0.006). the pattern of obesity prevalence by education levels varied according to sex. among men in rural areas, the prevalence of obesity class i was higher among those with higher education levels and was highest among the university group, but, among men in urban areas, the prevalence of the obesity class i was relatively uniform by educational levels. for women, there was no significant difference in prevalence of obesity class i and class ii across educational levels; however, the prevalence of obesity class i was highest in the primary education level. table 2 shows adjusted odds ratios of overweight and obesity associated with age, areas of residence, and educational levels in 2009. after controlling for age and area of residence, for men, education was positively associated with overweight and obesity class i with highest odds ratios among those with university education but was not significantly associated with obesity class ii. for women, the adjusted odds of overweight and obesity appeared to be significantly highest in the primary education group and lowest in the university education group as compared to the less than primary education group. during 1991 and 2009, the overall age-adjusted prevalence of obesity class i and class ii in thai adults aged 2059 years increased significantly by the year of survey, whereas overweight prevalence was relatively stable. for men, the prevalence of obesity class i increased from 12.5% in 1991 to 16.6% in 1997, 19.9% in 2004, and 23.5% in 2009, and the corresponding prevalence of obesity class ii was 1.7%, 4.3%, 5.4%, and 6.8%, respectively. for women, the corresponding prevalence for obesity class i was 20.2%, 24.9%, 28.5%, and 29.4% and for obesity class ii was 5.9%, 8.8%, 10.3%, and 12.1%, respectively. figure 1 shows the trends in prevalence for men and women in urban/rural areas. obesity class i and class ii prevalence for all subgroups, except for women in urban areas, increased significantly across 19912009. figure 2 shows increasing trends in age-adjusted mean bmi by survey year according to sex, area of residence, age groups, and education levels. overall, the bmi trends increased for all subgroups with certain extent. in men, the adjusted mean bmi increased from 21.6 kg/m in 1991 to 23.3 kg/m in 2009, and the corresponding mean bmi in women was 22.8 kg/m and 24.4 kg/m, respectively. in linear regression analysis, the average increased bmi per decade was 0.8 kg/m (p<0.001) for men and 0.9 kg/m (p<0.001) for women. the mean bmi increased across all educational levels. for men, the rates of increase were highest among those with secondary education of 1.0 kg/m per decade and for women with primary education group with the same rate. women with university attainment had the lowest rate of increase in bmi (0.7 kg/m) per decade. table 3 shows that there were significant increases in annual prevalence odds of obesity class i and class ii in both men and women between 1991 and 2009. according to educational levels, for men, increases of obesity class i were significant for those with primary and secondary education levels (p<0.001 and 0.002, resp.) and increases in obesity class ii were significant for both with less than primary education and secondary education group (p=0.03 and 0.02, resp.). among women, for obesity class i, the increase was significant in the primary education group (p<0.001) and for obesity class ii was significant in both primary and secondary education groups (< 0.001 and 0.012, resp.). the prevalence of overweight and obesity defined by bmi in thai population from 1991 to 2009 linearly increased with an average of 0.95 kg/m per decade and affected all ses groups. compared to previous surveys, the prevalence as well as mean bmi increased dramatically during 19912009 with no sign of leveling off. the average increased bmi was higher than that of the global increase of 0.4-0.5 kg/m and was one of the highest among the southeast asian countries with an average increase per decade of 0.7 kg/m in men and 1.0 kg/m in women. with regard to ses classes, in 2009, obesity class i (bmi 2529.9 kg/m) was positively associated with higher education in men but was negatively associated in women. however, the higher annual increment in mean bmi and obesity class i was found in the primary education level in both men and women. this might suggest that there is a tendency of a shift in obesity toward the lower educational group in men in the near future. compared to other countries in asia, the rise in bmi and prevalence of obesity in thailand was consistent with the findings of other asian countries [1315]. in low income and middle income countries, individuals in the high ses urban areas are the first to have high prevalence of obesity and the prevalence shifts to the lower ses as economic growth increases. the pattern of shift in women concurred with studies in other middle income countries where obesity rapidly increases in the lowest income groups [2, 12, 16, 17]. the lower obesity among men in low ses has been explained and shared by the common nature that men in the lower ses were in occupation with higher energy expenditure [6, 7, 18]. the more affluent men have greater access to food supply and are less physically active. in addition, the cultural preference of fat body shape among men also plays role, as a larger body size is more likely to be valued as a sign of prowess. education might be a protective factor for people in high income countries, and for women in low or middle countries, but it might hardly apply for men. studies in several countries revealed that the most common association pattern was the nonsignificant or curvilinear relationship among men particularly in medium and high human index countries with a higher percentage of countries in medium human development index having a positive relationship [18, 19]. the higher prevalence of obesity among the primary education women might also reflect inequity in knowledge and access to healthy lifestyle, as women in the lower education are less aware and accessible to better food choice. however, in developing countries, it is less clear whether there are differences in energy expenditure and a trend towards less physical activity and less concern to have leisure-time exercise. research about the influence of lifestyle and obesogenic environment on obesity associated with ses in developing countries deserves further study. although there are limited studies to explain the casual factor of the current increasing trends in thai population, imbalance of energy intake and expenditures, in general, are implicated in the rising of obesity. the association of urbanization with higher obesity prevalence had been reported in our previous studies and others [13, 16]. globalization of the fast food and processed food makes the cheap and high energy food more accessible throughout the country. availability of food due to reduction in the cost of food has been implicated as a major driver of increase of the global obesity during the past 2 decades, and thailand is no exception. the thai gross national product (gnp) has continuously grown from million thai baht 2,082 in 1991 to 3,008, 3,278, and 4064 in the years 1997, 2004, and 2009, respectively. the lack of excess food consumption to the poor becomes uncommon, although lack of access to healthy food is possible. the poor choice might be due to access to information related to healthy food and less health concern or unawareness of the association between health consequences of excess energy intake. thus, low ses groups can easily access cheap high energy diet which leads to gain weight. increases in food supply are the major determinants of weight gain of the populations. in some middle income countries, the concurrent trends in adoption of knowledge of obesity harm to health might weaken the positive relationship between ses and obesity; however, this is still not the case in men with higher education in thai population [2, 6, 7]. multifaceted initiatives and multisectoral coordination across several sectors of government, ngo, industries, and civil society are needed. currently, the thai ministry of public health has launched a program so-called thailand healthy lifestyle plan aimed at reducing the morbidity and mortality of cardiovascular diseases and targeted on health program to promote physical activity and healthy dietary intake. given the relationship between obesity and ses, it is particularly important to tackle the obesogenic environment and ensure that the programs reach all ses groups. the thai health promotion foundation, a nonprofit agency with ear mark budget from excise tax of tobacco, has sponsored national campaigns and messages on benefit of proper weight in addition to the regular programs of the ministry of public health. the messages about obesity contribution to adverse health consequences have been publicized in multimedia including tv programs. however, effectiveness of these national programs and whether the messages reached all ses groups need further evaluation. secondly, data of causal factors such as changes in energy intake, physical activity, and factors related to energy imbalance to explain the determinants of increase in obesity were limited. finally, the educational attainment only reflected on part of the ses and more complete data on income might add more information and get a better picture of the associations. the implication of this study is that more stringent intervention to curb the obesity trends in thai population is needed. as obesity increases the risk of several chronic diseases which are leading to daly loss in thai population, without implementation of effective and integrated strategies, the burden caused by obesity will not be likely to decrease [9, 23]. policy and environment must be designed and modified to promote healthier choice on diet and physical activity for all ses groups. furthermore, strategies to increase the access to information on causes and burden of obesity among the lower ses group must be implemented. in conclusion, the present study demonstrated the increasing trends in bmi and obesity prevalence in all ses groups with a likelihood of higher rates among those with lower education and in rural residents during 19912009.

we determined the prevalence of obesity in thai adults aged 20 and over in 2009 and examined trends of body mass index (bmi) between 1991 and 2009. data from thai national health examination survey for 19,181 adults in 2009 and 64,480 adults between 1991 and 2004 were used to calculate age-adjusted mean and prevalence. logistic regression was used to examine the association of obesity with education level. in 2009, age-adjusted prevalence of obesity classes i (bmi 2529.9 kg/m2) and ii (bmi 30 kg/m2) in thai adults aged 20 years were 26.0% and 9.0%, respectively. compared with primary education, the odds of obesity class i were highest in men with university education. for women, the odds of obesity classes i and ii were highest in those with primary education. bmi significantly increased from 21.6 kg/m2 in men and 22.8 kg/m2 in women in 1991 to 23.3 kg/m2 and 24.4 kg/m2 in 2009, respectively. the average bmi increases per decade were highest in men with secondary education (1.0 kg/m2, p<0.001) and in women with primary education with the same rate. there were increasing trends in bmi with slight variation by ses groups in thai men and women during 19912009.

PMC3976913

pubmed-894

they originate either in bone (osseous plasmacytoma) or in soft tissues (extramedullary plasmacytoma). it can occur as the sole manifestation of plasma cell neoplasm, as a metastasis from another extramedullary plasmacytoma or as a consequence of multiple myeloma. it has no characteristics of multiple myeloma, but the development of multiple myeloma has been observed in 836% of patients months or years later. these plasma cell tumors can occur anywhere and have to be differentiated from other neoplasms, infectious processes and chloromas. the head and neck region has been reported as a frequent site for amyloid deposits. one of the most common forms of amyloid proteins are amyloid light chain (al-type), which is derived from plasma cells, contains immunoglobulin light chains and is associated with plasma cell dyscrasias. fine needle aspiration smears of a 50-year-old female patient with cervical lymphadenopathy were sent to the department of pathology without any clinical details. cytology smears (giemsa stain) showed sparse cellular aspirate with amorphous granular basophilic material, predominantly scattered lymphocytes, plasma cells and occasional epithelioid cells [figure 1]. this amorphous material was interpreted as caseous necrosis and the possibility of tuberculous lymphadenitis was suggested. subsequently, patient's clinical findings were provided with the request for review of slides as the patient had not responded to antituberculous treatment. in the details provided, a nasal growth was also mentioned to be present in the lateral wall of the nasal cavity, which was globular, firm and pink in colour and measured 3 2 2 cm. lymph node aspirate showing amorphous granular basophilic material which mimicked caseous necrosis (giemsa, 400) repeat aspiration from the cervical lymph node, imprint smears and biopsy from the growth were performed. repeat aspiration and imprint smears revealed high cellularity with amorphous basophilic material, large number of plasma cells with varying degree of maturity, myeloma cells and occasional scattered epithelioid cells. an occasional foreign body type, multinucleated giant cell with intracytoplasmic amorphous basophilic material was also seen. plasma cells had prominent eccentric nuclei, coarse chromatin, perinuclear halo and basophilic cytoplasm and myeloma cells had fine chromatin, prominent nucleoli and little or no halo. presence of numerous plasma cells and myeloma cells raised the possibility of plasmacytoma [figure 2]. the amorphous extracellular material and similar intracytoplasmic material within giant cells raised the possibility of amyloid within the cells. subsequent congo red staining of the cytology and histopathology slides, showed the amorphous material to be orange-red in color. it gave an apple-green birefringence when viewed under polarized light, confirming it to be amyloid. thus, the diagnosis of plasmacytoma with amyloidosis was suggested and confirmed by a histopathology study of the biopsy tissue. there was no clinical, radiological or laboratory evidence of plasma cell dyscrasias or systemic amyloidosis. repeat lymph node aspirate showing plasma cells (uninucleate and binucleate), myeloma cells, scattered lymphocytes and amorphous basophilic material (giemsa, 400) extramedullary plasmacytoma is a soft tissue neoplastic lesion that is made up of monoclonal plasma cells (plasma cell dyscrasias). it can be primary, without evidence of disease in other foci, or part of a systemic process during the course of multiple myeloma. thus, these patients should be carefully evaluated for the presence of disseminated disease/multiple myeloma before arriving at a diagnosis of extramedullary plasmacytoma. studies should include complete blood cell count, serum calcium levels, radiologic skeletal survey, magnetic resonance imaging (mri) of the spine, pelvis, humeri and femurs, immunoelectrophoretic examination of serum and urine, 2 microglobulin assay and bone marrow biopsies. diagnosis should be made only if all studies for disseminated disease are negative, as was seen in our case. these tumors can occur anywhere in the body, but nearly 8090% of all extramedullary plasmacytoma occur in the head and neck region. most of these cases arise in the aerodigestive tract, probably because of the abundance of lymphatic tissue in this area. in one study the frequently affected sites in decreasing order of frequency included nasal cavity or paranasal sinuses, nasopharynx, oropharynx and larynx. extramedullary plasmacytoma occurs in patients between 50 and 60 years of age, and is more common in men (4:1). plasmacytomas arising in the nasal cavity or nasopharynx usually present as a soft bleeding mass or as a polypoid mass, covered mostly by an intact overlying mucosa. cervical lymphadenopathy and nasal discharge may be the associated presenting symptoms in an occasional patient. microscopic examination of cytological smears show numerous plasma cells, including binucleate, multinucleate and pleomorphic forms. on histopathological examination, plasmacytomas are very vascular tumors with minimal stromal component and sheets of plasma cells with varying degrees of differentiation and immature plasma cells. differential diagnosis of plasmacytoma includes plasma cell granuloma, plasmacytoid lymphoma and large cell lymphoma of immunoblastic type. immunocytochemical study with antibody to kappa and lambda light chains is an important approach to differentiate these conditions. kappa or lambda light chain-restricted population confirms the diagnosis of plasmacytoma and suggests a pathogenetic relationship between plasmacytoma and amyloid deposition. sakai et al. diagnosed extramedullary plasmacytoma of the tonsil by demonstrating diffuse immunoreactivity for lambda light chains within plasmacytoid cells. immunoblastic lymphomas usually involve lymph nodes and show cytoplasmic igm heavy chain (igg and iga heavy chains in plasmacytomas) and express pan b cell surface antigens. eilam et al. reported a case of plasmacytoma of the nasal cavity that involved the palate, ethmoidal and maxillary sinuses and contained deposits of amyloid. reported a case of extramedullary plasmacytoma of the parotid gland with extensive amyloid deposition masking the cytologic and histopathologic picture. amyloid refers to the extracellular fibrillar proteinaceous substance deposited in various tissues and organs of the body in a wide variety of clinical settings clinically, the symptoms depend on the magnitude of the deposits and on the particular sites or the organs affected. regarding its imaging appearance, affected bony conchae and sinus walls show a fluffy appearance adjacent to amyloid deposit on computed tomography scan; calcification has been mentioned as a nonspecific finding. foreign body giant cell reaction may be evoked about the amyloid deposits, as was also seen in our case. it can be seen on mri as a peripheral enhancement in the region of amyloid deposits with contrast material administration. differential diagnosis of this material on lymph node cytology smears include caseous necrosis, tumor necrosis and colloid. completely amorphous granular material without identifiable cell remnants suggest caseous necrosis, seen predominantly in tuberculosis caused by mycobacteria and other bacterial diseases and fungal infections. the type of granulomatous reaction, clinical details and bacteriological data are necessary to differentiate these conditions. neoplastic conditions, specially the lymphomas (non-hodgkin's and hodgkin's) and metastatic carcinomas, show tumor necrosis and therefore should be excluded. tumor necrosis appears as numerous cell shadows with pyknotic nuclei it may be homogenous or granular, resembling caseous necrosis. colloid appears as a dense, blob-like material with sharp outlines on cytology smears from the thyroid. rectal/bone marrow biopsy and fine needle aspiration of abdominal subcutaneous fat is suggested to rule out systemic amyloidosis. the diagnosis of amyloid is based almost entirely on its staining characteristics. with light microscope and standard tissue stains differentiation between amyloid and other amorphous eosinphilic substances, such as hyaline material, collagen and fibrin, is impossible. thioflavin t and other fluorescent dyes offer greater sensitivity in detection of amyloid but both hyaline and fibrin give positive results. thus, the gold standard for diagnosis of amyloid is congo red staining, which stains the tissue pink or red in color by light microscopy and gives green birefringence by polarized microscopy due to a -pleated sheet conformation of amyloid fibrils.

amyloid material on lymph node cytology smears can mimic caseous necrosis. we report one such case where a 50-year-old lady presented with a nasal mass and cervical lymphadenopathy. fine needle aspiration cytology smears of the cervical lymph node were interpreted as tuberculous lymphadenitis based on the presence of an occasional epithelioid cell and caseous material. the patient did not respond to antituberculous therapy and was revaluated. repeat aspiration from the lymph node showed numerous plasma cells and myeloma cells in addition to the amorphous material which was confirmed to be amyloid on staining with congo red. a diagnosis of plasmacytoma with amyloidosis was rendered. imprint smears from nasal mass, detailed hematology workup and subsequent histology confirmed the diagnosis.

PMC3168006

pubmed-895

colorectal cancer is one of the most commonly diagnosed malignancies in western countries and represents a major cause of morbidity and mortality associated with cancer 1. detection and endoscopic resection of early stage colorectal tumors as well as precursor lesions is a well established approach to prevention and treatment of colorectal cancer. endoscopic mucosal resection (emr) is usually used for endoscopic removal of flat and sessile lesions of the large bowel. for tumors measuring 20 mm it is especially difficult to determine the lateral spread of the tumor to ensure complete removal. piecemeal resection is associated with a higher rate of local tumor recurrence in comparison with en bloc emr 2 3 4. endoscopic submucosal dissection (esd) is a novel therapeutic procedure with the major advantage being its ability to achieve a high level of en bloc resection and low level of local recurrence for flat and sessile colorectal lesions regardless of size. on the other hand, colorectal esd is associated with significant technical difficulty, longer procedure time, and increased risk of complications, especially perforations, in comparison with emr 5 6. colorectal esd is considered to be a more difficult and dangerous procedure than gastric esd. in japan, it is necessary to gain experience in gastric esd before starting to practice esd in the colon, usually under the supervision of an expert 7 8. in western countries, it is very difficult to follow the same learning pattern because of the different epidemiological situation (the incidence of gastric cancer is higher in japan and a lower percentage of cancers are diagnosed at an early stage in the west) and the very limited number of practitioners with expertise in colorectal esd 8. several factors have been implicated in an increased risk of incomplete or complicated dissection 9 10. it is important to establish a better approach to the difficulties of implementing colorectal esd during the learning period in western settings, as well as the factors associated with the risk of complications. we report our experience with esd for sessile and flat rectal and sigmoid colon lesions in a high-volume center in russia. during the period from november 2009 to september 2013, 44 patients with sessile and flat rectal and sigmoid colon lesions underwent esd at the department of endoscopy, vladivostok clinical railway hospital (russia). the clinical indications for esd included sessile and flat rectal and sigmoid colon lesions with one of the following features: (1) tumor size 20 mm; (2) tumor recurrence after previous emr. all of the relevant data have been taken from the standard esd protocol adopted by the department. lesion size has been estimated by comparison with the span of open (7 mm) biopsy forceps (fb-24u-1; olympus, japan). the colonic preparation was achieved by administration of a split-dose (2 and 2 liters) of macrogol 4000 solution (beaufour ipsen international, france) before the procedure. all of the patients underwent conscious sedation using the intravenous administration of propofol and analgesia with fentanyl. one endoscopist with experience in endoscopic mucosal resection in the large bowel (more than 200 cases) performed all procedures. procedure time, tumor size and location, gross morphology, the presence of fibrosis, and morphological findings were analyzed. the main outcomes were en bloc and r0 resection rate, and number of perforations. for an analysis of the learning curve, the whole study time was divided into two periods: first period: resections 1 22, the degree of submucosal fibrosis was classified into three types: f0, no fibrosis; f1; mild fibrosis; f2, severe fibrosis 10. total procedure time was defined as the time between the beginning of the submucosal injection and the completion of the dissection. complications were classified as immediate (during the procedure) or delayed (after completion of the procedure). perforation was defined as a hole in the muscle layer detectable endoscopically with free air outside the colonic lumen demonstrated on image studies. bleeding was considered clinically relevant in the case of a hemoglobin drop 1 g/dl. the esd procedure was classified as technically difficult in the case of procedure time> 120 minutes and/or piecemeal resection. esd procedures were conducted with a gastroscope (eg-530 d, fujifilm europe gmbh, germany) with a disposable distal attachment (d-201, olympus, japan or dh-28gr, 29cr; fujifilm medical co., japan) on the tip. a vio 200 d electrosurgical unit (erbe elektromedizin, germany) was used for electrical cutting and coagulation. carbon dioxide insufflation with a gw-1 delivery system (fujifilm europe gmbh, germany) was used in all esd cases. a 10% glycerin solution was used for submucosal injections using a 21-gauge injection needle (nm-400l-0421, olympus, japan) outside the tumor margin. a flush knife or flush knife-bt with a 2.0-mm-long tip (fujifilm europe gmbh, germany) connected to a waterjet pump was used to perform all steps in the esd procedure: mucosal cut (endo cut i regime, effect 2, duration 3, interval 3), submucosal dissection (forced coag regime, effect 2, 40 w), and small-vessel coagulation (soft coagulation regime, effect 7, 100 w). submucosal injection of 10% glycerin solution (via injection needle) and waterjet injection of saline solution using the flush knife were repeated during the procedure to maintain sufficient submucosal elevation during the procedure. a hemostatic forceps (coagrasper, fd-411ur, olympus) was used to prevent or stop significant bleeding from large vessels and to coagulate visible vessels in the post-procedure ulcer base (soft coagulation the specimen was stretched and pinned onto a hard plate before being sent to the pathology department. histological evaluation was performed according to the standard principles for colorectal emr and esd specimens 11. the pathological diagnosis was based on the vienna classification of gastrointestinal epithelial neoplasia 12. en bloc resection was defined as when the lesion was resected as a whole piece, and r0 resection was when the resected specimen was revealed to be free of tumor in both vertical and lateral margins. local recurrence was defined as a histopathologically confirmed neoplastic lesion found at the site of the esd scar. all patients received detailed information about the procedure, alternative approaches, risks of complications and additional surgery, and provided written informed consent before participating in any protocol-specific procedures. all data were analyzed using the chi-squared test and fisher s exact tests. for lesion size and procedure time, the pearson correlation coefficient was used to measure the strength of the association between two variables. forty-four patients took part in the study (23 men, 21 women). the mean age of the patients was 63.84 1.46 years (range 41 the mean size of the tumors was 34.77 3.26 mm (range 10 120 mm). all tumors were situated in the rectum or sigmoid colon. according to the paris classification correlation between the serial number of the esd procedure and both the tumor size and procedure time was weak (r=0.19 and 0.17, respectively). table 1 shows the tumor characteristics, resection rates, and procedure time during the two study periods. in 37 cases (84.1%), four tumors were removed in two fragments, and three tumors in three to four fragments. the mean size of the lesions removed in piecemeal fashion was higher than that for tumors resected en bloc, 44.0 4.55 mm and 33.03 3.73 mm, respectively, but the difference was not statistically significant (p=0.22). histological examination revealed low grade dysplasia, high grade dysplasia and cancer in 10, 22, and 12 cases, respectively. lgd, low grade dysplasia; hgd, high grade dysplasia. the mean procedure time was 119.95 11.22 minutes (range 25 360 minutes). there was a high direct positive correlation between tumor size and operation time (r=0.83, p<0.0001, 0.95 and 0.99 confidence interval for rho 0.71 0.904). operation time was shorter in the en bloc resection group than in the piecemeal group, 108.75 12.03 minutes and 179.14 19.85 minutes, respectively (p=0.019). the mean procedure time did not differ between the first and second 22 esd interventions: 101.85 11.74 minutes and 136.47 18.18 minutes, respectively (p=0.12). severe, mild and absent submucosal fibrosis were diagnosed in 15.9 %, 15.9 %, and 68.2% of cases, respectively. tumor size was not a significant predictor of severe fibrosis, although the mean size of the lesions with f2 fibrosis was higher than that for tumors with f0 f1 fibrosis, 40.0 5.34 mm and 33.78 3.74 mm, respectively (p=0.49). three out of seven f2 tumors were flat (two lst-ng (laterally spreading tumor, non-granular type) and one iia) and four were sessile (is). one lesion (lst-ng) was situated on the anastomotic site and in one case (iia), there was a recurrence after unsuccessful emr. severe submucosal fibrosis was diagnosed in four out of seven cases of piecemeal esd and in three cases of en bloc resection (p=0.0074). the procedure in patients with f0 f1 fibrosis was shorter than in patients with f2 fibrosis, 111.75 12.22 minutes and 162.28 23.88 minutes, respectively, but the difference did not reach the level of statistical significance (p=0.093). all cases of perforation were diagnosed during the procedure and were successfully treated with endoscopic clipping. a sigmoid colon perforation treated with endoclips is shown in fig. 1. endoscopic submucosal dissection (esd) in the sigmoid colon. a laterally spreading tumor, non-granular, pseudo-depressed type (lst-ng-pd) in the sigmoid colon; b marking around the tumor borders; c dissection of the submucosa (f2 fibrosis); d visible perforation hole; e perforation was closed with clips and endoloops; f scar 4 months later. three perforations occurred during the first half and two during the second half of the esd procedures. there was no difference between procedures complicated by perforation and uneventful esd by tumor size (31.0 6.0 mm and 35.25 3.61 mm, respectively p=0.68) and resection time (104.0 23.48 minutes and 122.0 12.35 minutes, respectively p=0.62). at the same time, severe submucosal fibrosis was diagnosed in four out of five cases complicated by perforation and in three cases of uneventful esd (p=0.0012). table 2 shows the comparison of tumor and procedure characteristics in patients with and without perforations associated with the esd procedure. in total, 19 procedures (43.1 %) were classified as technically difficult due to the following factors: procedure time> 120 minutes, 12 patients; combination of procedure time> 120 minutes and piecemeal resection, six patients; and piecemeal resection, one patient. mean tumor size was significantly larger in the difficult esd group compared with the standard esd group, 48.31 5.96 and 24.48 1.75 mm, respectively (p=0.0001). the majority of difficult esd procedures were performed for tumors of the sigmoid colon, but the difference did not reach a level of significance (p=0.06). table 3 shows a comparison of the tumor characteristics in the standard and difficult esd groups. no cases of clinically significant intraprocedural or postprocedural hemorrhage were noted. there were two cases of self-limited postprocedural hemorrhage, and no cases of surgery or death associated with complications of esd. two patients had cancer with submucosal invasion> 1 mm and one had a blood vessel invasion. endoscopic mucosal resection (emr) is a well-established method for treatment of colorectal epithelial neoplasms. in lesions larger than 20 mm and in cases of severe submucosal fibrosis, emr often results in piecemeal resection associated with the difficulties of histopathological assessment of r0 resection, the risk of incomplete resection and local recurrence 2 3 4. endoscopic submucosal dissection (esd) is a relatively new technique that is now established in japan for en bloc resection of large benign and early malignant lesions 13. while esd reduces local recurrence rates compared to emr, it is technically challenging, risky, and time consuming 5 6 14. compared with gastric lesions, esd in the colorectum is more difficult owing to anatomical features owing to its technical difficulty, complication risks, and relatively long learning curve, esd for colorectal lesions is rarely used in western countries and emr is currently the standard treatment. a step-by-step approach to accumulating experience in colorectal esd is desirable for adopting this technique 7 8. before first attempting esd in the large bowel, experience with at least 30 gastric esd cases has been recommended in japan 16 17. in the west, opportunities to follow a japanese esd training algorithm are limited by the low rates of early gastric cancer 8 18. at the same time, a number of authors have reported a relatively rapid learning curve and low complication rats for colorectal esd 19 20 21. several factors, including tumor location and size as well as severe submucosal fibrosis have been implicated in an increased risk for incomplete or complicated dissection 9 10. the incidence and implications of these factors during the learning curve have as yet not been well established. in this single-center study, the results of 44 esd procedures for rectal and sigmoid colon lesions have been described. all interventions have been performed by a single specialist with experience in endoscopic mucosal resection in the large bowel and with limited experience (19 cases) of gastric esd. the en bloc and r0 resection rates were the same 84.1 %. these figures are lower than reported by authors from high volume asian centers 14 22 23, but comparable to en bloc and r0 resection rates according to european data 19 21 24. procedure time in the study (120 minutes) was much longer than reported by japanese authors 14 22 23. however, the current results are comparable to western data presented by probst et al. larger tumor size and piecemeal resection were associated with longer procedure times in the current series. tumor size is regarded as one of the factors predicting the procedural time of esd, at least for gastric lesions 25 26. inability to perform en bloc esd usually reflects a difficult procedure that, in turn, leads to increased time required for the intervention 9. in this study, at the same time, larger tumor size was the single significant risk factor for technically difficult esd. almost two-thirds of difficult esds were performed for lesions of the sigmoid colon. 10 reported that, in cases of lesions with severe (f2) fibrosis, the rate of complete en bloc resection was low, and did not improve significantly even with growing operator experience. several studies have demonstrated that the presence of fibrosis is an independent risk factor for perforation during colorectal esd 10 27. at the same time, tumor size and location are conceded by several authors to be factors associated with difficult esd and increased risk of perforation 9 28. several factors have been implicated as a cause of severe submucosal fibrosis: previous emr attempts, multiple biopsies and inflammatory bowel disease. there are also reports that the macroscopic characteristics of the lesions can be used to predict the risk of fibrosis, but the results are still controversial. different authors have suggested that the incidence of f2 fibrosis was higher in lst-g (laterally spreading tumor, granular type) 10 or lst-ng and large is tumors 9. in our series, f2 fibrosis was reliably predicted by patient s history (previous unsuccessful emr) and characteristics of the lesion (tumor on the anastomosis site) in two cases. in another five cases of severe fibrosis, large (> 40 mm in diameter) sessile lesions (four tumors) prevailed. a relatively long period of growth in combination with chronic traumatization due to peristaltic movements can explain the high risk of fibrosis in such lesions. the possible role of endoscopic biopsy has not been analyzed owing to lack of relevant data. the number of perforations (11.4 %) in our study was high in comparison to most of the published data (1.8 7.4 %) 14 21 22. to the best of our knowledge, the highest level of perforations during colorectal esd (20.4 %) was reported by kim et al. the level of perforations would have been regarded as unacceptable if surgery had been required for correction. fortunately, most perforations can be managed successfully with nonsurgical treatment 14 22 23 27. we failed to show any difference in procedure time, en bloc resection rate as well as in the number of perforations between the first and second 22 interventions. probst et al. reported that a clear learning curve was apparent over time, with resection rates increasing and procedure times decreasing significantly after the first 25 esd procedures in the rectosigmoid 19., the operating time per square centimeter significantly decreased after 20 esd procedures 20. at the same time, based on their analysis of 120 colorectal esds, hotta et al. concluded that approximately 40 procedures were sufficient to acquire skill in avoiding perforations during the esd procedure, and approximately 80 procedures must be carried out to acquire skill with esd for large colorectal tumors 28. according to sakamoto et al., trainee endoscopists with experience in gastric esd can perform it safely and independently in the colon after preparatory training and experience with 30 cases. at the same time, the authors mentioned that the procedure time and en bloc resection rate were not significantly different among the training periods 29. saito et al. reported that the risk of perforation was related to the number of esd procedures performed, that is, the risk is higher when the endoscopist had performed less than 100 procedures 30. the main limitations of this study include the fact that it was a single center study and limited to lesions of the distal colon. we can conclude that esd in the distal colon is feasible, effective, and a relatively safe procedure for western endoscopists. despite the substantial rate of perforations, severe submucosal fibrosis was an important factor associated with a low rate of en bloc resection and a high risk of perforation during the learning curve for colorectal esd. it might be reasonable to start with smaller lesions and avoid cases with predictable f2 fibrosis during the training period. colorectal esd is associated with a relatively long learning curve, and 22 esd cases might not be sufficient to improve en bloc resection rates, reduce procedure times and the number of perforations during a further 22 resections. prospective randomized trials comparing emr and esd are awaited in europe to demonstrate the long-term results, the benefit of esd over piecemeal emr and also to determine the indications for esd vs. emr in different clinical settings.

background and study aims: colorectal endoscopic submucosal dissection (esd) is associated with significant technical difficulty, long procedure time, and increased risk of complications, especially perforation. this study aimed to determine the factors associated with clinical results of esd during the learning curve. patients and methods: in total, 44 patients with sessile and flat rectal and sigmoid colon lesions underwent esd from november 2009 to september 2013. the procedure time, resection method, tumor size, location, gross morphology, presence of fibrosis, histologic findings, rates of en bloc and piecemeal resections and perforation were analyzed. the esd procedure was classified as technically difficult in the case of procedure time> 120 minutes and/or piecemeal resection. the whole study time was divided into two periods: first period: resections 1 22, second period: resections 23 44. results: en bloc and r0 resection have been achieved in 84.1% of lesions. the mean procedure time was 119.95 11.22 minutes (range 25 360 minutes). perforation was seen in five cases (11.4%). a larger tumor size was a risk factor for difficult esd (p=0.0001). a finding of fibrosis was a risk factor for piecemeal esd (p=0.0074), and perforation (p=0.0012). there was a high direct positive correlation between tumor size and operation time (r=0.83, p<0.0001, 0.95 and 0.99 confidence interval for rho 0.71 0.904). there was no significant difference between the first and second period in terms of mean procedure time, en bloc resection or complication rate. conclusion: a larger tumor size was associated with technically difficult esd. severe submucosal fibrosis was a risk factor for both piecemeal resection and perforation.

PMC4424868

pubmed-896

a 78-year old male with past medical history significant for chronic shortness of breath (for the last two years), chronic systolic heart failure secondary to non-ischemic dilated cardiomyopathy, pulmonary hypertension, essential hypertension, coal miner s pneumoconiosis, and chronic obstructive lung disease was found to have bilateral pulmonary nodules on pre-operative chest x-ray. the work-up for the pulmonary nodules was initially planned on an outpatient basis. however, two weeks later the patient was admitted to the hospital with progressive shortness of breath. upon admission, vital signs included temperature 35.8c, pulse 56 beats/min, respiratory rate 22 breaths/min, and blood pressure 110/54 mmhg. on review of systems he reported decreased appetite for the past three months and a 20 pound weight loss. he denied hematuria, rhinorrhea, rashes, sinus pain, muscle aches, ear ache, hearing loss or hemoptysis. blood urea nitrogen was 18 mg/dl, creatinine 1.2 mg/dl, glomerular filtration rate 59 ml/min. chest x-ray revealed bilateral hilar and right upper lobe areas of infiltrate increased from the prior imaging examination. computed tomography (ct) scan revealed multiple cavitary lesions, the largest on the right, with a large air fluid level suspicious for infection. the day after admission the patient underwent ct guided fine needle aspiration of the right lung. all blood cultures were the negative and so were cultures of the pleural fluid and the surgical specimen. however, the antibiotics were soon discontinued secondary to low suspicion for the presence of active infection. at that point the diagnosis of vasculitis was entertained and a vasculitis panel was significant for elevated sedimentation rate at 84 mm/h. anti-glomerular basement membrane antibody level was negative, but proteinase 3-anti-neutrophil cytoplasmic antibody (pr3-anca) level was elevated at 3.8 units. stool studies were positive for clostridium difficile for which the patient was started on flagyl. repeat urinalysis showed brown colored urine with ph 6, specific gravity 1.023, moderate occult blood, bile negative, small leukocyte esterase, nitrate negative, 9-10 red blood cells (rbc)/high power field (hpf), 9-10 white blood cells/hpf, rare squamous epithelial cells, rare hyaline casts, 30a protein. kidney biopsy was inadequate for diagnosis. during the course of his treatment he also completed 5 cycles of plasmapheresis. wegener s granulomatosis (wg) is anca associated vasculitis of small and medium sized vessels. the disease has variable presentation and diagnosis is made on the basis of clinical, laboratory, pathologic and imaging studies. usually patients present with upper respiratory tract symptoms such as nasal ulcer, nasal discharge, rhinorrhea and sinus pain. kidney involvement manifests as acute renal failure with red cells, red cell casts and proteinuria. although wg is mainly characterized by respiratory disease and nephritis, it can also affect the nervous system, heart, eyes, skin, joints and spleen. the diagnostic criteria published by the american college of rheumatology include nasal or oral inflammation with ulcers or purulent bloody discharge; chest radiograph showing nodules, cavities or infiltrates; urinary sediment with red cell casts or microscopic hematuria; granulomatous inflammation on lung biopsy. infection could serve as a trigger for disease expression and is an established factor for disease relapse. under the effect of unknown antigen, neutrophils express cytoplasmic pr3, which leads to the production of anti-pr3 antibodies. laboratory studies include leukocytosis, elevated erythrocyte sedimentation rate, normocytic anemia, positive anca and rheumatoid factor. potential biopsy sites include affected areas such as nasal sinus, muscle, temporal artery, kidney, lung. kidney biopsies are done in patients with urinary sediment abnormalities, proteinuria or change in renal function. on histologic examination wg is characterized by vasculitis, inflammatory infiltration of medium and small vessels, and necrotizing granuloma formation. the limited form of wegener s usually does not affect the function of vital organs. the systemic form of wg is more common and only 25% of patients will have limited wg. some authors state that the limited form may evolve into systemic disease, implying that the two forms are different stages of progression of the same disease. they further state that the lack of progression in some of the cases is due to improved treatment modalities. c-anca is present in 50% of patients with the limited form and 80% of patients with the systemic form of the disease. initially our patient was found to have bilateral pulmonary nodules on preoperative chest x-ray. differential diagnosis at that time included more common conditions such as lung metastasis, tuberculosis, sarcoidosis, rheumatoid nodules, lung infection (bacterial or fungal). the presence of vasculitic process was investigated after the above mentioned conditions were ruled out. the patient did not present with upper respiratory findings or findings indicative of kidney involvement. due to the absence of such findings he later developed diarrhea and was diagnosed with clostridium difficile infection. at that time the patient developed systemic manifestations of wg including renal failure, vasculitic rash and hemoptysis. the degree of kidney involvement could not be assessed secondary to failure to obtain satisfactory biopsy specimen. the infection could have triggered the evolvement of his limited wg into systemic disease, supporting the theory that those two forms are different stages of the same disease entity. the patient s condition rapidly transformed from a limited form to a systemic form of wg in the course of two weeks. this highlights the importance of timely treatment in patients with limited wg in order to prevent disease progression. when left untreated, wg is usually fatal. wg that does not involve the kidneys or other vital organs can be treated with less toxic regimens such as methotrexate or azathioprine. limited wg may progress to involve kidneys and other organs and hence should be treated and closely monitored. however, patients do not always present with the triad and a high index of clinical suspicion is needed in order to make a prompt diagnosis. when patients present with limited disease, without renal involvement, diagnosis is delayed and immunosuppressive treatment is not recommended. there are no clear guidelines on how limited wg should be approached, followed up, or treated. our case demonstrates that limited wg can evolve into systemic disease secondary to environmental triggers such as infection. this supports the notion that the two forms represent different stages of the same disease.

wegener s granulomatosis is a granulomatous vasculitis that can present with a wide spectrum of clinical manifestations. this disease entity predominantly affects the respiratory tract and the kidneys. two forms of wegener s granulomatosis have been recognized: systemic and limited. it has not been established if the two forms represent separate disease entities or different stages of the same condition. in the limited form of wegener s granulomatosis there is no immediate threat to the function of vital organs and there is no evidence of glomerulonephritis. environmental factors that could serve as triggers for the activation of wegener s granulomatosis have not been clearly defined. we report a case of a 78-year old male who was found to have bilateral pulmonary nodules on pre-operative chest x-ray and was diagnosed with the limited form of wegener s granulomatosis. the patient developed clostridium difficile infection, and shortly after that active glomerulonephritis, a manifestation of systemic wegener s granulomatosis.

PMC3981232

pubmed-897

perforation of the biliary system occurs most frequently in the gallbladder, usually associated with (and complicating upto 10% cases of) acute cholecystitis. perforation of the extrahepatic biliary tree is a rare entity, accounting for less than 10% of intraperitoneal biliary rupture. bile duct perforation is most commonly described in infants related to congenital biliary system anomalies. aetiology in the adult is commonly attributable to intramural infection, necrosis of the wall of the bile duct secondary to thrombosis, increased intraductal pressure secondary to obstruction, cirrhosis, and direct erosion by calculi. overall, 70% of cases are related to calculi. the incidence of biliary tract disease during pregnancy ranges from 0.050.3%. despite these apparent low figures, complications from gallstones represent the most common general surgical condition requiring surgical intervention, second only to appendicitis. indications for intervention of gallstones during pregnancy include obstructive jaundice, acute cholecystitis, or pancreatitis failing medical management. we present the case of a young woman diagnosed with gallstones in late pregnancy, complicated by acute gallstone pancreatitis and subsequently spontaneous common bile duct perforation. a twenty-year-old primigravida woman was planned for elective caesarean section due to breech presentation. the patient had a past medical history of -thalassemia trait, but was not normally on regular medication. her mother had previously undergone a cholecystectomy for gallstones. at 34 weeks gestation, she presented acutely with a two-week history of worsening abdominal pain localised to the epigastric region, associated with vomiting. on examination, blood results revealed raised inflammatory markers (wbc 14.4 [4.011.0], neutrophils 11.9 [2.07.5], crp 60 [07.5 ]) and evidence of pancreatitis (amylase 1369 iu/l [36128]), mildly raised bilirubin (24 mol/l [020 ]) and raised alkaline phosphatase (183 an abdominal ultrasound revealed multiple small gallstones and a thickened gallbladder wall, but no evidence of a dilated intra or extrahepatic biliary system. the patient was treated conservatively, rapidly improved, and liver function tests normalised. an emergency caesarean section was performed and a term baby delivered, but no obvious cause was found to explain her clinical condition. the following day her clinical condition worsened, with progressive abdominal pain and a metabolic acidosis. she required aggressive resuscitation, inotropic, and ventilatory support and was, therefore, admitted to the intensive care unit. a computed tomography (ct) revealed extensive free peritoneal fluid and gas of which the aetiology was not apparent. the patient underwent a prompt laparotomy and was found to have generalised biliary peritonitis. the gallbladder was intact but a 2 mm perforation was found on the anterior surface of a dilated common bile duct (12 mm). on table cholangiography suggested obstruction of the distal common bile duct caused by a 5 mm gallstone impacted within the distal common bile duct. the calculus was removed, and the duct was repaired over a t-tube. a t-tube cholangiogram was performed after 4 weeks, and the tube was uneventfully removed (figure 1). although the pathogenesis of spontaneous biliary perforation is poorly understood, recognised mechanisms include the following: calculous perforation at the site of impaction; calculous erosion without impaction; increased canalicular pressure due to obstruction by tumour, stone, or spasm of the sphincter of oddi; intramural infection; mural vessel infarction leading to mural necrosis; or rupture of a biliary tract anomaly such as cyst or diverticulum. thus, because perforation of the biliary system is a recognised complication of cholelithiasis, the diagnosis should be suspected if a perihepatic abscess or peritonitis is combined with biliary stone disease. as early as 1882, freeland reported the first case of extrahepatic biliary system rupture in an adult (diagnosed at autopsy), an entity that was subsequently first described in pregnancy by piotrowski et al. over a century later. since this time, very few cases of spontaneous common bile duct perforation in adults have been reported in the literature, with cases occurring during pregnancy being even more scarce. the importance of this clinical scenario lies in the potential serious morbidity and not infrequent mortality associated with missed biliary system perforation. petrozza et al. described two cases of gallbladder perforation due to cholelithiasis in the early postpartum period. both cases presented a diagnostic dilemma, and it was concluded that a history of cholelithiasis in a patient with persistent intra-abdominal symptoms in the postpartum period must alert to prompt investigation and early management., one patient was found to have suffered gallbladder rupture as a result of cholecystitis, and in the second, a common bile duct perforation was found at laparotomy with no obvious precipitating cause.. also drew attention to the similarity of symptoms of gallbladder disease in pregnancy to mild pre-eclampsia, having in common hypertension, epigastric pain, and mildly deranged liver function tests. these cases highlight the importance of recognising the possibility of delayed diagnosis of cholelithiasis as a result of nonspecific abdominal symptoms during pregnancy and indicate early investigation and treatment in order to reduce serious morbidity.. block and kelly reported the optimum time for surgical management of gallstone pancreatitis to be in the second trimester or early postpartum period, in order to minimise maternal/fetal mortality and recurrent pancreatitis. unfortunately, in those women presenting late in pregnancy (as in the case described), the balance of risk favours watchful waiting until after delivery followed by elective cholecystectomy. certainly, this risks early recurrence of acute pancreatitis, as well as rare but severe consequences such as biliary peritonitis. whether an early endoscopic retrograde cholangiopancreaticography (ercp) and sphincterotomy in those cases presenting with gallstone pancreatitis can be an acceptable temporary preventive measure is unclear, but undertaking ercp is not without risk, and the potential risks should be considered carefully in individual cases. in this particular case, it is impossible to know whether the eroding calculus had been present during the initial episode of pancreatitis. magnetic resonance scanning is a commonly used imaging modality in obstetrics, considered to be safe and avoiding the use of ionising radiation. therefore, magnetic resonance cholangiopancreatography (mrcp) would have been a reasonable next investigation during this patient s initial presentation, and if a ductal stone had been revealed, then the indication for ercp may have been clearer. on the other hand, neonatal and postnatal care of babies born early have progressed significantly, suggesting the possibility of induction of labour perhaps at 3638 weeks gestation in severely symptomatic or high-risk patients. of course, every case must be considered individually, taking into account maternal and fetal history and health.

spontaneous perforation of the extrahepatic biliary system is a rare presentation of ductal stones. we report the case of a twenty-year-old woman presenting at term with biliary peritonitis caused by common bile duct (cbd) perforation due to an impacted stone in the distal common bile duct. the patient had suffered a single herald episode of acute gallstone pancreatitis during the third trimester. the patient underwent an emergency laparotomy, bile duct exploration, and removal of the ductal stone. the postoperative course was uneventful.

PMC2442185

pubmed-898

optimal phosphate balance is important for many physiological functions from cell signaling to energy metabolism to skeletal mineralization. inadequate phosphate balance disrupts a multitude of physiological processes, and can cause or exacerbate age-associated disorders, cardiovascular calcification and bone mineralization defects. physiologic phosphate balance is maintained by interactions among the intestine, kidney, parathyroid gland and bone. phosphate absorption takes place mostly in the small intestine, and the sodium-dependent phosphate (napi) co-transporter, napi-2b, facilitates such absorption. of relevance, the intestinal napi-2b activity is influenced by 1,25-dihydroxyvitamin d, which can increase the expression of intestinal napi-2b protein to augment intestinal phosphate uptake by the enterocytes. likewise, renal phosphate reabsorption is mostly accomplished by the napi-2a and napi-2c co-transporters. parathyroid hormone (pth) increases urinary phosphate excretion by reducing napi-dependent phosphate uptake in the proximal tubular epithelial cells. recent studies have shown that bone-derived fibroblast growth factor 23 (fgf23) and kidney-derived klotho can also directly suppress sodium phosphate co-transporter activities. in addition to intestine and kidney, bone also plays a major role in maintaining phosphate balance. when serum phosphate levels are low, the bone releases additional phosphate to maintain the homeostatic balance by increasing resorption, a process that is mostly influenced by the activity of pth and 1,25-dihydroxyvitamin d. pth alters receptor activator of nuclear factor kappa-b ligand-osteoprotegerin (rankl/opg) balance, by acting on the stromal cells to stimulate rankl expression, and also by reducing the expression of opg and vitamin d. on the other hand, pth stimulates osteoclast differentiation and activity, resulting in increased bone resorption. furthermore, pth and 1,25-dihydroxyvitamin d can induce skeletal fgf23 production to regulate serum phosphate levels and thereby can influence bone resorption. fgf23 is a 30 kda protein that is proteolytically processed to smaller n-terminal (18 kda) and c-terminal tail (12 kda) fragments. structural analysis of fgf23 protein found a fgf receptor (fgfr)-binding domain at the n-terminal and a potential klotho-interacting site at the c-terminal tail. recent studies have shown that the c-terminal tail determines the functionality of fgf23 protein. for instance, when the c-terminal tail of the fgf2 protein was replaced with the c-terminal tail of fgf23, the chimeric protein containing the n-terminal of fgf2 and c-terminal tail of fgf23 could act as a phosphatonin, and could also reduce renal 1(oh) synthesis. it is worth mentioning that the presence of the c-terminal tail of fgf23 in the chimeric protein paved the way for the klotho interaction. recently, family with sequence similarity 20, member c (fam20c) has shown to phosphorylate fgf23 on a ser-x-glu motif, and such phosphorylation promotes fgf23 proteolysis by furin through blocking o-glycosylation by polypeptide n-acetylgalactosaminyltransferase 3 (galnac-t3). this observation suggests that interplay between phosphorylation and o-glycosylation of fgf23 may be a critical posttranslational mechanism by which the activity of secreted fgf23 protein is determined. once secreted as a bioactive protein, fgf23, in presence of klotho, can induce downstream signaling molecules, as demonstrated by the activation of early growth response element-1 (egr-1) and the phosphorylation of fgf receptor substrate-2a, extracellular signal-regulated kinase (erk), p38, jun n-terminal kinase (jnk), and akt. of relevance, these signaling phosphoproteins were detected only when cells were challenged with both fgf23 and klotho, and not in cells treated with fgf23 without klotho. in accord with these in vitro observations, in vivo studies have shown that bioactive fgf23 protein could significantly reduce serum phosphate level in wild-type and fgf23 knockout mice, but failed to exert such phosphate lowering effects in fgf23/klotho double knockout mice, again suggesting that without klotho, fgf23 loses its phosphate regulating abilities. moreover, the fgf23-induced hypophosphatemic phenotype of hyp mutant mice was reversed to hyperphosphatemia in the hyp/klotho double mutant mice, despite significantly higher serum fgf23 levels in double mutants. in a similar line of observation, an inactivating mutation in the human klotho gene resulted in severe hyperphosphatemia in a tumoral calcinosis patient, despite high serum fgf23 levels. summarizing these above-mentioned observations, an indispensable role of klotho in fgf23-mediated urinary phosphate excretion is obvious. one of the possible mechanisms of fgf23-induced urinary phosphate excretion is that it suppresses napi-2a and napi-2c co-transporters, either directly or through influencing pth activity. pth, an 84 amino acid protein, is produced in response to low levels of serum calcium and secreted pth acts on the bone and kidney to increase serum calcium level. low serum calcium levels reduce calcium-sensor receptor (car) signaling and allow active pth to be secreted, which then binds to the pth receptor 1, a seven transmembrane g-protein coupled receptor, to activate the pka, pkc, and mapk pathways in kidney and bone. in addition to serum calcium, vitamin d can also suppress pth expression and parathyroid hyperplasia. it is believed that fgf23 and pth mutually regulate each other in a negative feedback loop, where pth stimulates fgf23 production and fgf23 in turn suppresses pth synthesis. when pth was genetically ablated from fgf23 knockout mice, serum calcium levels were normalized in double mutant (fgf23/pth) mice, despite high serum 1,25-dihydroxyvitamin d and high serum phosphate levels, suggesting that some of the biochemical changes documented in fgf23 mice are mediated by pth. it is a well-known fact that continuous administration of pth for a prolonged period can reduce bone mass. however, when fgf23 mice were challenged with constant pth infusion through osmotic minipumps for 3 weeks, pth-induced bone loss was more severe, suggesting that fgf23 might exert a protective effect against the long-term catabolic effects of pth on bone. in a mouse model of hyperparathyroidism, fgf23 levels positively correlated with those of pth, but inversely with serum phosphate levels. presence of both klotho and fgf receptors in the parathyroid glands raised the possibility that parathyroid gland might be a target organ for fgf23 activities. using bovine parathyroid cells, on the other hand, other studies have claimed that the activation of the pth receptor in bone via the pka signaling pathway suppresses the wnt inhibitor sclerostin, thereby allowing wnt signaling to increase fgf23 synthesis. it is, however, worth mentioning that reducing wnt signaling in vivo, by genetically inactivating its co-receptor, low-density lipoprotein receptor-related protein 6 (lrp6), did not affect fgf23-induced hypophosphatemia in hyp mice, as shown in hyp/lrp6 double mutant mice. furthermore, injection of bioactive fgf23 protein into lrp6 mutant mice reduced serum phosphate levels to a similar degree as fgf23 injection into wild-type mice, providing a genetic and pharmacological evidence for a wnt-independent function of fgf23 in the regulation of phosphate homeostasis. (this issue) claimed that pth, by activating nuclear orphan receptor (nurr1), can increase the transcription of fgf23 in bone cells. structural analysis has found that nurr1 protein is lacking a ligand-binding cavity, and therefore may act as a ligand-independent transcription factor. in the fgf23 promoter region, the presence of nurr1 response elements raises the possibility of its role in fgf23 synthesis. in a cell-based system, through over-expression and knock down of nurr1, an association between pth and fgf23 is suggested. moreover, in a rat model of chronic kidney disease (ckd), increased nurr1 mrna and protein levels were associated with increased fgf23 mrna expression, calcimimetic treatment of these ckd animals reduced pth and fgf23 levels, along with decreased calvarial nurr1 mrna and protein expression. despite the presence of nurr1 responsive elements in fgf23 promoter regions, the functionality of nurr1 responsive elements in fgf23 synthesis is not yet defined, and without mutagenesis studies, whether increased expression of nurr1 and fgf23 is a mutual regulation or merely an epiphenomenon, could not be established. moreover, to provide in vivo direct evidence, further studies will be needed to show that inactivating pth signaling, by targeting its receptors, can block pth induced nurr1 and fgf23 expression in long bones. it is also worth mentioning that pth induced fgf23 synthesis is a cell-line specific phenomenon. for instance, while pth can induce fgf23 in umr106 cell lines, no such response of pth on fgf23 is noted in ros16/2.8 cells. despite a better understanding of fgf23 biology in systemic regulation of phosphate turnover, factors inducing its skeletal expression are not yet fully documented. 1,25-dihydroxyvitamin d, phosphate, calcium, iron, leptin, acidosis, secreted klotho and pth are the factors currently known to induce fgf23 production (fig. 1). it is a well-accepted fact that pth can induce the synthesis of 1,25-dihydroxyvitamin d in the kidney, and that, in turn, 1,25-dihydroxyvitamin d can inhibit pth secretion by the parathyroid glands. recent studies have claimed that 1,25-dihydroxyvitamin d can stimulate fgf23 production in bone and that fgf23 can suppress 1,25-dihydroxyvitamin d production and pth secretion. the ability of pth to directly stimulate fgf23 expression forms an endocrine regulatory feedback loop to control mineral ion metabolism. studies, as the one highlighted here, will help us to understand molecular regulation of fgf23 synthesis and identify its yet to be documented functions.

bone-derived fibroblast growth factor-23 (fgf23) plays an important role in systemic phosphate turnover. increased fgf23 activity results in hypophosphatemic, while reduced activity is linked to hyperphosphatemic disorders. fgf23, together with klotho as co-factor, can activate fgf-receptors in its target tissues to exert its functions. however, molecular regulation of fgf23 synthesis is not clearly defined, and recent studies have found that pth can activate the nuclear receptor-associated protein-1 (nurr1) to induce fgf23 transcription in bone cells.

PMC4246422

pubmed-899

in fixed orthodontic treatment, brackets were used for transferring orthodontic forces to the teeth. at first, to attach the brackets to the tooth, orthodontic bands were used and after welding brackets to bands, they were cemented to the tooth. in 1955, buonocore introduced the acid-etch technique that was gradually used in different dental treatments. in 1965, newman used direct bonding of orthodontic brackets that was considered as the first step in application of appliances with the improvement of esthetic presentation. this technique was developed rapidly due to its simplicity, efficacy and providing more esthetic qualities. for achieving successful bonding, the bonding agent must penetrate to the enamel surface, have easy clinical use, dimensional stability and enough bond strength. the bond strength of orthodontic brackets should be enough to not cause bonding failure and delay in treatment and it also should have adequate resistance against chewing forces and stresses from archwires. on the other hand, easy debonding of the brackets without any damage to the teeth needs sufficient and safe bond strength. according to few stages for bonding of orthodontic brackets and related problems in the conventional system, other techniques such as application of self-etch primers or laser irradiation was suggested to simplify the bonding procedure. in the acid-etching technique, microporosity was produced on the enamel surface to provide micromechanical bonding. enamel etching with phosphoric acid results in loss of the superficial layer of the enamel and dissolution of the enamel subsurface. the amount of enamel loss depends on phosphoric acid concentration and the time of application. laser etching was performed by the erbium family with two different wavelengths (2940 and 2780 nm). this technique has some advantages such as having no vibration or heat and producing a surface which is acid resistant by altering the calcium to phosphor ratio and formation of less soluble compounds. there are some studies which have evaluated the effect of laser etching on bond strength of orthodontic brackets with controversial results. so, the purpose of this study was to compare shear bond strength (sbs) of orthodontic brackets bonded to enamel prepared by er: yag laser with two different powers and conventional acid-etching. forty-five human premolars extracted for orthodontic purposes were selected for this study. in transillumination examination, the teeth showed healthy enamel on the buccal surface, without attrition, fracture, restoration, congenital anomalies and structural defects. there was no history of chemical substance application such as hydrogen peroxide for these teeth. after rinsing the teeth, they were placed in 0.5% chloramine t for inhibiting bacterial growth for 2 hours. the teeth were divided into three groups according to conditioning method: group 1: conventional etching with 37% phosphoric acid; group 2: laser irradiation by er: yag laser with output power of 1w; and finally group 3: laser irradiation with er: yag laser with output power of 1.5w. in group 1, the samples were etched with 37% phosphoric acid gel (3 m, dental products, st.poul) for 15 sec, then rinsed for 15 sec with water spray and dried with air spray for 10 sec in a 2 cm distance above the surface of the enamel. laser irradiation in group 2 and 3 was carried out by er: yag laser (us20d, deka, italy) with a 2940 nm wavelength. the area was marked before irradiation. in group 2, laser was used with an output power of 1w, energy of 100 mj and frequency of 10 hz. these parameters were 1.5 w, 150 mj and 10 hz, respectively for group 3. the handpiece of laser was used 5 mm above the surface in non-contact mode and sweeping motion. subsequently, the adhesive kit (transbond xt, 3 m, unitek) was used. the adhesive paste was placed on the bracket base and the brackets were placed on the enamel with a 300 gr compressive force with gauge for 10 sec to produce uniform thickness. the resin was polymerized by led (mectron, starlight pro gac, italy) with a 440480 nm wavelength and 400 mw/cm intensity for 40 sec. consequently, the samples were thermocycled for 200 cycles between 5c and 55c water baths with 30 sec dwell time for each. the specimens were mounted in auto-cure acrylic resin and the shear bond strength was measured by using a universal testing machine with a crosshead speed of 0.5 mm per second. after debonding, the amount of resin remaining on the teeth was determined using the adhesive remnant index (ari) scored 1 to 5 (table 1) by stereomicroscope (nikon d-cs, japan) with 10x magnification. one-way analysis of variance was used to compare shear bond strengths and the kruskal-wallis test was performed to evaluate differences in the ari for different etching types. the mean and standard deviation of the conventional acid-etch group, laser group (1w) and laser group (1.5w) was 3.82 1.16, 6.97 3.64 and 6.93 4.87, respectively. there was no significant difference between laser group (1.5w) and laser group (1w) (p=1.000) and conventional group (p=0.085), but there was a significant difference between laser group (1w) and conventional group (p=0.016). according to graph 1, the variances of values of the laser samples bond strengths was higher than the acid-etch group. table 2 shows the frequency distribution of ari degrees in the three groups. according to the kruskal-wallis test there are some studies which evaluate the enamel preparation by laser irradiation for orthodontic brackets. the aim of this study was to assess the shear bond strength of orthodontic brackets bonded to enamel prepared by er: yag laser or acid-etch. the bond strength of light curing composites may be influenced by thermal changes of the oral cavity and the quality of polymerization. thermocycling is a common method for stimulating this condition; therefore, we used this technique in this research. the result of this study showed that both laser groups had higher bond strengths than the acid-etch group. although this difference was significant between the laser group with an output power of 1w and the acid-etch group, the laser group with an output power of 1.5w showed no significant difference with the acid-etch group. according to usumez s study, laser irradiation with a power of 2w in comparison with the acid-etch technique showed similar shear bond strengths, but application of laser with a power of 1w showed a lower bond strength. on the other hand, gokcelik et al.s study which assessed the shear bond strength of samples prepared by er: yag laser and acid-etch found no significant difference between these two groups. controversial results were obtained from different studies which evaluated the effect of laser irradiation compared to conventional methods due to different study designs and various parameters used in these studies. morphological changes of enamel produced after laser irradiation depends on the energy density of the laser, the time of exposure, the distance of the laser handpiece from the surface and percentage of water irrigation. samples irradiated with 1.5w power showed no significant difference compared to laser group with 1w power which is in agreement with the results obtained from basaran s study. in the present study, the laser groups showed higher bond strengths with higher standard deviations compared to the acid-etch group. this finding reduced the credibility of laser application for enamel preparation, considered as an unfavorable characteristic. in similarity, usumez et al. reported higher distribution coefficient for shear bond strength of orthodontic brackets in laser prepared surfaces. the reason may be related to the irregular etching pattern of surfaces irradiated by laser. sasaki et al. found that preparation of enamel surfaces by er: yag laser can not be done homogeneously. surfaces irradiated by laser showed some areas which were similar to unlased enamel surfaces but surface preparation by acid etch technique showed more homogeneous patterns which was like honey comb pattern that is favorable structure for adhesion process. higher standard deviations in the laser groups may be associated with intrinsic nature differences of the teeth collected from different people, time of storage and environmental effects on the tooth after extraction. in order to control these problems, animal teeth can be used because numerous tooth samples can be provided from an animal. among different animals maijer and smith stated that bond strength of 8 mpa is essential for orthodontic treatment. in this study, the mean of shear bond strength in the three groups was below the suggested value. cerekja and cakirer showed that that thermocycling process reduced the shear bond strength of orthodontic brackets. in addition, daub confirmed that this condition was due to differences in thermal expansion coefficients of the adhesive, brackets and enamel. two thirds of the samples showed an ari degree of 4 or 5 which showed that the highest debonding happened in resin to teeth contact surface which needs less cleaning of debonded enamel leading to reduction of abrasion risk to the enamel, but it is better to have debonding in resin-bracket contact or inside the resin because the less adhesive remaining on the tooth, the more stress affecting the enamel surface in clinical condition, this kind of debonding is rare because providing favorable etching in enamel surface is difficult due to lack of controlling humidity, time and cooperation of patients in preparing the surfaces. in addition, the structural pattern of the bracket base makes debonding in the resin bracket contact surface uncommon. in contrast to these results, lee in the evaluation of bonded brackets observed that samples prepared by acid-etch technique or er: yag laser irradiation showed more fracture pattern in resin-bracket contact surface. these different results may be contributed to the debonding test procedure, which was tensile bond strength in lee s study. valletta reported that debonding happened in bracket resin surface in tensile bond strength and in resin tooth contact surface in shear bond strength.: yag laser with an output power of 2 w and frequency of 2 hz showed no significant increase in shear bond strength compared to the control group. in the present study, ari degree among the two laser groups and between laser groups and in contrast, gokcelik showed higher ari degrees in er: yag laser compared to the acid-etch group. in laboratory conditions, loading forces to brackets were different from clinical conditions. in clinical conditions, besides, in the oral cavity, there are different kinds of stresses such as thermal changes, humidity and microbial plaque that make the simulation condition in laboratory difficult. although bond strength tests are still far from ideal, attempts should be made to standardize these tests to make comparisons easier. the shear bond strength of bracket to laser-prepared enamel with two different powers of 1 and 1.5 w was similar and laser groups showed higher bond strengths than the acid etch group. however, high variances of values in bond strength of irradiated enamel should be considered to find the appropriate parameters for applying er: yag laser as a favorable alternative for surface conditioning.

introduction: the purpose of this study was to compare shear bond strength (sbs) of orthodontic brackets bonded to enamel prepared by er: yag laser with two different powers and conventional acid-etching. materials and methods: forty-five human premolars extracted for orthodontic purposes were randomly assigned to three groups based on conditioning method: group 1- conventional etching with 37% phosphoric acid; group 2- irradiation with er: yag laser at 1 w; and group 3- irradiation with er: yag laser at 1.5 w. metal brackets were bonded on prepared enamel using a light-cured composite. all groups were subjected to thermocycling process. then, the specimens mounted in auto-cure acryle and shear bond strength were measured using a universal testing machine with a crosshead speed of 0.5 mm per second. after debonding, the amount of resin remaining on the teeth was determined using the adhesive remnant index (ari) scored 1 to 5. one-way analysis of variance was used to compare shear bond strengths and the kruskal-wallis test was performed to evaluate differences in the ari for different etching types. results:the mean and standard deviation of conventional acid-etch group, 1w laser group and 1.5w laser group was 3.82 1.16, 6.97 3.64 and 6.93 4.87, respectively. conclusion:the mean sbs obtained with an er: yag laser operated at 1w or 1.5w is approximately similar to that of conventional etching. however, the high variability of values in bond strength of irradiated enamel should be considered to find the appropriate parameters for applying er: yag laser as a favorable alternative for surface conditioning.

PMC3422059

pubmed-900

strains, cell lines and media-escherichia coli dh5 (invitrogen, usa) was used for the general propagation of plasmids and e. coli bl21 (de3) was used to express the e2 protein. bacterial cells were grown under agitation at 37c in a low-salt luria-bertani medium containing zeocin at a final concentration of 25 g/ml. yeast cultures were maintained in a yeast extract-peptone-dextrose (yepd) medium. the media for growth and induction were buffered complex glycerol medium (bmgy) and buffered complex methanol medium (bmmy), respectively, both at ph 4.0 huvecs (atcc crl-2873) were grown in rpmi-1640 medium (sigma aldrich, usa) containing 10% foetal bovine serum and a mix of antibiotics and antifungals (sigma aldrich). the cultures were kept at 37c and 5% co2 and disassociated from the culture dish using trypsin. cloning, expression and purification of e2 protein in e. coli-hcv cdna was obtained from viral rna extracted with the qiamp viral rna mini kit (qiagen, usa), according to the manufacturer s protocol, using pooled sera from individuals with hcv genotype 1a provided by the laboratory of clinical immunology of the pharmaceutical science school of araraquara, so paulo, brazil. the hcv sequence was found by comparison using the blastn local alignment program and its orf was entirely sequenced. to express recombinant e2 protein, the soluble form of the protein without the transmembrane domain the mature orf was amplified with the forward primer 5-ggccatgggggaaacccacgtcaccgg-3 and reverse primer 5-gctcgaggctcggacctgtccctgtc-3 (the underlined bases indicate introduced restriction sites for ncoi and xhoi, respectively) (rodrguez-rodrguez et al. the pet42a plasmid was used to generate the mature e2 protein orf flanked by glutathione s-transferase (gst) at the n-terminus and a 6x his tag at the c-terminus. the transformed e. coli bl21 were induced for 3 h with isopropylthio--galactoside (final concentration 0.4 mm) at 37c and 250 rpm when the optical density (od) at 600 nm reached 0.5. the cells were pelleted, suspended in lysis buffer (10 mm tris-hcl, 50 mm nah2po4 and 100 mm nacl, ph 8.0) and subjected to sonication (5 pulses of 1 min each). the soluble phase was purified using glutathione sepharose 4 fast flow (ge healthcare, usa). the binding buffer employed was 10 mm tris-base, 50 mm sodium phosphate and 100 mm sodium chloride at ph 8.0. the gst-tagged protein was eluted with a two-fold resin volume of elution buffer (10 mm reduced glutathione and 50 mm tris-hcl, ph 8.0). the fractions containing the purified protein were dialysed against phosphate-buffered saline (pbs) (ph 8.0), quantified using the pierce bca protein assay kit (thermo scientific, usa) and stored at -20c. cloning, expression and purification of recombinant protein in p. pastoris-the e2 protein orf was cloned into ppicza and the mature orf was amplified with the forward primer 5-aagaattcgaaacccacgtcaccgggggaa-3 and the reverse primer 5-aatctagattctcggacctgtccctgtcttcc-3 (the underlined bases indicate introduced ecori and xbai restriction sites, respectively). the cloning was performed to create a recombinant plasmid containing the e2 protein orf flanked by the secretion signal peptide (-factor) at the n-terminus and a 6x his tag at the c-terminus. before p. pastoris transformation, the recombinant plasmid was linearised with pmei endonuclease and introduced into the yeast by electroporation (1.5 kv, 25 f, 200) (cregg 2007)). transformants were cultivated in solid yepd with 1 m sorbitol and 100 g/ml zeocin. the yeast transformants were screened for protein induction in 24-well plates (boettner et al. (2012)), differing only in the use of bmgy and bmmy medium buffered with 100 mm mcilvaine s buffer, ph 4.0. the supernatant was dialysed against pbs buffer (ph 8.0), concentrated using the labscale tff system (membrane pellicon xl50, millipore, usa) until 10-fold reduction and stored at -20c. cell viability-for the determination of cell viability, huvecs were seeded at 5 x 10 cells/ml. the adherent cells were incubated for 24 h at 37c and 5% co2 with the recombinant proteins (e2b and e2y) at 250, 125, 62.5, 31.25, 15.63 and 7.81 g/ml or with 1.0 g/ml lipopolysaccharide (lps), 10 ng/ml tumour necrosis factor alpha (tnf-), 10% sodium dodecyl sulfate (sds) (positive controls) or rpmi medium and the culture supernatant of e. coli bl21 cells (negative controls). after incubation, the cells were incubated with 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (1 mg/ml) for 3 h. the resultant formazan salt was dissolved in acidic 2-propanol and the od was measured (540/620 nm filters). the od of the untreated cells was taken as 100% cell viability (mosmann 1983)). cell death-huvecs were seeded at 5 x 10 cells/ml and incubated for 24 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and controls as described in the cell viability section. the following controls were also added: cells without stimulation (negative) and annexin and propidium iodide (pi) controls. the evaluation of cell death was performed using the annexin v-fitc annexin v apoptosis detection kit (bd pharmingen, usa) according to the manufacturer s protocol. the cells were analysed by flow cytometry (using a facscanto flow cytometer, bd biosciences and facsdiva software v.6.1.3). in each run n-acetylcysteine (nac) treatment-the effect of nac on cells exposed to e2 recombinant proteins was studied with respect to apoptosis (parp cleavage) and no and hydrogen peroxide (h2o2) production. huvecs were pre-incubated with 5 mm nac for 1 h and treated with e2y, e2b and controls as described above. parp cleavage-huvecs at 5 x 10 cells/ml were pre-incubated in the presence or absence of nac (5 mm) for 1 h and incubated for 24 h at 37c and 5% co2 with recombinant e2 proteins (e2b and e2y) using the concentrations and control stimuli described in the cell viability section. huvecs were lysed in 10 mm tris (ph 7.4), 1 mm edta, 0.5 mm egta, 150 mm nacl, 1% triton x-100, 50 mm naf, 10 mm na4p2o710h2o, 5 g/ml aprotinin, 5 g/ml leupeptin and 1 mm pmsf. to evaluate cell apoptosis, 20 g of lysate protein was electrophoresed in 8% sds-polyacrylamide gels and transferred onto nitrocellulose membranes (hybond ecl). the membranes were blocked with 5% skim milk in tris-buffered saline (tbs) containing 0.1% tween-20 (tbs-t) and subsequently incubated with rabbit parp antibody (1:2000 dilution, santa cruz biotechnology, inc, usa) overnight at 4c to detect full-length parp (116 kda) and cleaved parp (carboxyl-terminal catalytic fragment, 89 kda). after washing with tbs-t for 1 h at room temperature (rt), the membranes were further incubated with a horseradish peroxidase-conjugated rabbit polyclonal antibody (1:2000 dilution; santa cruz biotechnology, inc) for 2 h followed by 1 h washing (with 3-5 wash buffer changes). actin levels were used to control for protein levels and were detected with an antibody against actin (yang et al. 2004)). no production-total no production was determined in the culture supernatant of huvecs seeded at 5 x 10 cells/ml incubated with e2b and e2y and controls as described in the cell viability section for 24 h at 37c and 5% co2. the samples were measured in a no analyser (sievers nitric oxide analyzer overview, model noa 280i, ge analytical instruments, usa), in which the nitrites, nitrates and nitrosothiols present in the supernatant were converted into no by a saturated solution of vanadium trichloride in 0.8 m hcl at 90c. no was detected by a chemiluminescent reaction in the gas phase between no and ozone (archer 1993, jaiswal et al. this reaction is based on l-arginine hydrolysis by arginase in cell lysates (corraliza et al. briefly, huvecs were cultured with recombinant proteins, lps, tnf- and culture medium or culture supernatant of e. coli bl21 cells using the concentrations and stimuli described in the cell viability section. the cells were lysed using 100 l of 0.1% triton x-100 for 30 min under agitation. subsequently, 50 l of cell lysate was added to 50 l of 25 mm tris-hcl and 25 l of 100 mm mncl2 and the final solution was incubated for 10 min at 56c for enzyme activation. next, 50 l of 0.5 m l-arginine (ph 9.7) was added and the test reaction was incubated at 37c for 60 min. the reaction was stopped by adding 400 l of stop solution (96% h2so4, 85% h3po4 and water, at a proportion of 1:3:7 v/v/v). twenty-five microlitres of 9% -isonitrosopropiophenone in 100% ethanol was added and the reaction was incubated at 95c for 30 min. finally, the cells were incubated at rt for 10 min and the absorbance was measured using a 540 nm filter. the urea concentration was calculated using a linear equation generated by known quantities of urea. one unit of enzyme activity was defined as the amount of enzyme capable of producing 1 mol of urea per minute. h 2 o 2 production-huvecs at 5 x 10cells/ml were incubated for 2 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and stimuli described in the cell viability section. approximately 600 ng/ml dihydrorhodamine 123 (dhr) (sigma-aldrich) was added and the cells were incubated at 37c for 10 min. the cells were washed with pbs (ph 7.2) and centrifuged for 5 min at 300 g. the supernatant was discarded and the cells were resuspended in 150 l of pbs (ph 7.2). the samples were read in the fl1 channel using a facscanto flow cytometer (bd biosciences) and facsdiva software v.6.1.3. the experiment included a control for spontaneous fluorescence (cells only) and a control for spontaneous production of h2o2 (dhr and cells without stimuli) (walrand et al. il-8, tnf- and vascular endothelial growth factor a (vegf-a) production-huvecs at 5 x 10 cells/ml were incubated for 24 h at 37c and 5% co2 with recombinant e2b and e2y using the concentrations and controls described in the cell viability section. an additional control using pma (0.50 m) was used in the tnf- detection assay. the negative control consisted of 300 l of culture medium and 300 l of pbs (ph 7.2; medium of the protein dilution). il-8, tnf- and vegf-a production was measured by elisa using the kit human vegf-a platinum elisa (ebioscience inc, usa), according to the manufacturer s instructions. the results are expressed in pg/ml. statistical analysis-the data were analysed by anova using a 5% level of significance followed by multiple comparisons with the tukey test and graphic representation of the data. the recombinant e2 proteins were expressed in two different expression systems, the e. coli rosetta strain (e2b) and the p. pastoris km71h strain (e2y) (fig. 1). the e2b protein exhibited a molecular weight of approximately 63.5 kda due to its expression as a fusion protein with gst (26 kda) and the 6x his tag (1 kda). the e2y protein exhibited a molecular weight of approximately 50.0 kda due to its expression as a fusion protein with the 6x his tag (1 kda). the n-glycosylation of the e2y protein was confirmed by protein treatment with a peptide-n-glycosidase, pngase f (new england biolabs, usa), according to the manufacturer s protocol. the proteins exhibited different molecular weights (e2b=36.5 kda and e2y=49 kda) due to the types of protein processing used in these two systems. fig. 1: produced envelope glycoprotein 2 (e2) recombinant proteins (sodium dodecyl sulfate polyacrylamide gel electrophoresis 12%). channel 1: molecular weight marker [benchmarktm protein ladder (10-220 kda), invitrogen]; 2: e2b (approximately 63.5 kda); 3: e2y (approximately 50 kda). we observed that some concentrations of the recombinant e2 proteins (e2y: 62.5-250 g/ml and e2b: 125-250 g/ml) were slightly cytotoxic to huvecs (fig. 2). at 250 g/ml, the decrease in viability was similar to that obtained when the cells were incubated with lps or tnf-. the cellular events provoked by the e2 proteins were evaluated using annexin v and pi assays, which indicated that early apoptosis was the main cause of cell death (fig. however, even at the highest concentration of e2 protein used in this study, the proportion of apoptotic cells was always lower than 30%. 2: effect of envelope glycoprotein 2 (e2) recombinant proteins on human umbilical vein endothelial cells viability [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay]. c-: negative control; c+: culture medium rpmi; lps: lipopolysaccharide (1.0 g/ml); sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng/ml); *: p <0.05 compared to the negative control;** *: p<0.001 compared to the negative control. 3: cytotoxicity of envelope glycoprotein 2 (e2) proteins on human umbilical vein endothelial cells. results presented as mean and standard deviation of percentage obtained in the assay. in each run, 30,000 cells were analysed and all experiments were performed in triplicate. c-: negative control; early apoptosis: annexin v stained cells; late apoptosis: cells double-positive for annexin v and propidium iodide (pi); lps: lipopolysaccharide (1.0 g/ml); necrosis: cells stained with pi; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng/ml);** *: p <0.001 compared to the negative control. to further explore the mechanism of e2 protein-induced apoptosis, we investigated the degradation of parp, which is thought to be one of the targets of activated caspase-3 or 7 during apoptosis (yang et al. immunoblot analysis revealed that the recombinant e2 proteins induced the degradation of endogenous 116 kda parp, as shown by the appearance of 89 kda fragments (fig. 4a, b), which were clearly detected in all samples treated with e2 protein or with the control stimuli, tnf- (fig. these results indicate that parp cleavage is associated with e2-induced apoptosis in huvecs. moreover, the pre-treatment of the cells with the antioxidant nac protected against apoptosis by preventing parp cleavage (fig. 4: parp cleavage in recombinant envelope glycoprotein 2 (e2)-induced apoptosis in human umbilical vein endothelial cells. cells were pre-treated (c, d) or no (a, b) with n-acetylcysteine (nac) for 1 h and incubated with recombinant e2 proteins, e2y (a, c) and e2b (b, d) in different concentrations. line 2: 7.81 g/ml; 3: 15.63 g/ml; 4: 31.25 g/ml; 5: 62.5 g/ml; 6: 125 g/ml; 7: 250 g/ml; a-d1: lysate of untreated cells; e1: cells without pre-treatment with nac and treated with tumour necrosis factor alpha (tnf-); e2: cells pre-treated with nac and treated with tnf-; e3: cells without pre-treatment with nac and treated with lipopolysaccharide (lps); e4: cells pre-treated with nac and treated with lps; f1-4: actin. statistical analysis of the results revealed that there was a statistically significant difference (p<0.01) when compared with the spontaneous control (negative control) or production stimulated by the bacterial supernatant. the e2 proteins were as effective as the classical stimuli, lps and tnf-. one exception was the treatment with 7.81 g/ml of e2 protein, in which only a slight, but significant elevation in no was observed relative to the more potent lps and tnf- stimuli. the higher production of no was not the result of increased or decreased arginase activity relative to the negative control (result not shown) because no significant differences were observed when compared with the negative control. our data also demonstrated that pre-treatment with nac significantly decreased (p<0.01) the e2 protein-induced no production. fig. 5: nitric oxide (no) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells. c-: no spontaneous production, cells and culture medium; lps: lipopolysaccharide (1.0 g/ml); nac: n-acetylcysteine; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng/ml);** *: p<0.001 compared to the negative control. the production of h2o2 was evaluated in huvecs after exposure to recombinant proteins at different concentrations and control stimuli. the relative production of h2o2, calculated as the mean fluorescence intensity, is presented in fig. the e2 proteins were able to stimulate the production of h2o2 at all of the tested concentrations. again, the production was similar to that obtained by stimulation with lps and was inferior to that of tnf-. of the two e2 proteins, e2y was more effective than e2b at concentrations of 7.81 g/ml (p<0.05). the results of pre-treatment with nac revealed a significant decrease (p<0.01) in the e2 protein-induced h2o2 production. fig. 6: hydrogen peroxide production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells. results presented as mean and standard deviation of the mean fluorescence intensity (mfi). the experiments were performed in triplicate. (1.0 g/ml); nac: n-acetylcysteine; sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng/ml);** *: p <0.001 in relation to negative control. the e2 proteins were capable of inducing the production of il-8 compared with non-stimulated cells. 7. there was a statistically significant difference (p<0.05) between all of the stimuli tested compared with the negative control. unlike the il-8 results, the e2 proteins were not able to induce the production of tnf- or lps by huvecs. however, 0.50 m pma induced huvecs to produce 173.05 pg/ml tnf-. fig. 7: interleukin-8 (il-8) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells. c-: cells and medium and phosphate-buffered saline (ph 7.2). lps: lipopolysaccharide (1.0 g/ml); sup: culture supernatant escherichia coli bl21; tnf-: tumour necrosis factor alpha (10 ng/ml);** *: p <0.001 compared to negative control; *: p<0.05 compared to negative control. the detection of vegf-a production by huvecs in response to control stimuli and recombinant proteins is presented in fig. the e2 proteins significantly induced (p<0.01) the production of vegf-a by huvecs. fig. 8: vascular endothelial growth factor a (vegf-a) production by envelope glycoprotein 2 (e2)-stimulated human umbilical vein endothelial cells. results presented as mean and standard deviation. lps: lipopolysaccharide (1.0 g/ml); tnf-: tumour necrosis factor alpha (10 ng/ml); sup: culture supernatant escherichia coli bl21; c-: cells and medium and phosphate-buffered saline (ph 7.2);**: p< 0.01 compared to the negative control;** *: p<0.001 compared to the negative control. the e2 protein-induced production of no, h2o2, il-8 and vegf by huvecs strongly supports the cytotoxicity of these proteins. there is evidence that endothelial cells are directly susceptible to infection by hcv (fletcher et al. 2012)) and that the damage caused by the infection leads to late complications, such as fibrosis, cirrhosis and hepatocellular carcinoma. these late complications are believed to be caused by numerous inflammatory molecules in response to viral infection of the liver (ming-ju et al. consistent with this hypothesis, we found that e2 proteins were able to induce apoptosis and several inflammatory responses in huvecs. the putative receptors for e2 proteins in this cellular type have been described previously, including low-density lipoprotein receptor (agnello et al. 1999)), tetraspanin cd81 (zhang et al. 2004)), scavenger receptor class b type 1 (scarselli et al. 2002)), claudin-1 (evans et al. 2007)), occludin (ocln) (ploss et al. 2009)) and transferrin receptor 1 (tfr1) (martin&uprichard 2013)). no is an inorganic free radical molecule (furchgott &zawadzki 1980)) that is highly diffusible and reactive (bredt&snyder 1992)) and is involved in various physiological functions and pathological conditions when produced in excess (kaufman 1999, benali-furet et al. 1997)), which may play an important role in the pathogenesis of cirrhosis associated with infection (hassan et al. 2002)). here, we have demonstrated for the first time that no production by huvecs was induced by both recombinant e2 proteins. this no production may lead to later inflammation in the portal vein and subsequent fibrosis and cirrhosis. the increased no production could be the consequence of the increased expression of arginase in huvecs. hcv infection is associated with the development of hepatocellular carcinoma (okuda 2007, tan et al. 2008)) and can alter the expression of arginase, thereby stimulating tumourigenesis and hepatocellular carcinoma (cao et al.. however, this pathway does not appear to be relevant to endothelial cells because arginase expression was not altered by the e2 proteins. the e2 proteins were also able to induce the production of h2o2 by huvecs. this is additional evidence of the role of e2 in the inflammatory response mediated by hcv. (2011)) and suggests the involvement of the e2 protein in h2o2 production and the development of inflammation in the hepatic portal vein, with the increased expression of factors related to hepatic fibrosis. (2003)) reported that the hcv e2 protein was able to stimulate intracellular signalling pathways, leading to the induction of secretion of pro-inflammatory cytokine il-8. il-8 is also observed in the serum of patients with chronic hepatitis c (polyak et al. 2001, akbar et al. 2011)), demonstrating a correlation between inflammation, il-8 serum levels and liver fibrosis (kaplanski et al. consistent with this hypothesis, recombinant e2 proteins stimulated the production of il-8 in huvecs. (2005)). however, the e2 proteins were not able to induce the production of tnf- by huvecs. these results are also consistent with the work of balasubramanian et al. (2005)), who reported that hcv proteins can interact with the endothelium and that e2 protein did not induce the production of cytokines such as monocyte chemotactic protein-1, tnf- and gamma interferon. analysis of peripheral blood mononuclear cells and liver biopsy samples of individuals chronically infected by the virus suggests that hcv infection may be able to induce apoptosis, causing damage to the liver while helping the virus to evade the immune system and facilitate viral dissemination (hiramatsu et al., we found that the e2 proteins were also able to induce apoptosis (early and late) as well as necrosis (fewer cells) in huvecs. the glycosylated protein expressed in p. pastoris (e2y) was a more effective inducer of apoptosis as well as necrosis relative to the non-glycosylated protein (e2b), demonstrating the influence of glycosylation on apoptosis. moreover, the apoptosis induced by recombinant e2 protein was effectively rescued in cells pre-treated with nac, suggesting that the generation of reactive oxygen species is involved in e2-induced apoptosis in huvecs. we also suggest that the production of no, h2o2, il-8 and vegf-a were not related to cell death induced by high concentrations of the recombinant protein, but are e2-specific effects. vegf-a is a potent angiogenic factor that plays a key role in the development of angiogenesis in various tumour types (toi et al. 2000)), including hepatocellular carcinoma (ng et al. 2001, poon et al. 2004)). vegf-a has a specific angiogenic effect on endothelial cells and can be stimulated by hcv infection (dvorak et al. additionally, vegf-a plays a role in the regulation of several cellular functions, including growth (nasimuzzaman et al. 2007)) and apoptosis (hglinger et al. 2007)). hepatic angiogenesis has been described in viral hepatitis, autoimmune liver cirrhosis, primary biliary cirrhosis and hepatocellular carcinoma (garca-monzn et al. hcv stimulates the synthesis and secretion of vegf-a via virus-induced oxidative stress (nasimuzzaman et al. 2007)). in our study, the exposure of huvecs to both recombinant e2 proteins induced the production of vegf-a. we suggest that oxidative stress, as demonstrated by the production of no and h2o2 in huvecs in response to e2 proteins, may represent the stimulating factor of vegf-a production. the literature reports that the hcv core protein is able to stimulate the production of vegf-a, but there are no data regarding the e2 protein (hassan et al. therefore, this is the first demonstration that the e2 protein is also able to induce the production of vegf-a and, consequently, angiogenesis. hcv is a positive-stranded rna virus that is unable to integrate its genetic material into the host cell genome. the hcv genome does not contain oncogenes, suggesting that hcv induces hepatocellular carcinoma indirectly by causing chronic inflammation, cell death, proliferation and cirrhosis (hassan et al., we provide evidence that endothelial cells, such as huvecs, are susceptible to e2 hcv envelope proteins. in conclusion, stimulation with e2 protein induced huvecs to produce inflammatory and angiogenic factors. considering that endothelial inflammation is a determinant of fibrosis progression and cirrhosis, we propose that these cellular effects might be involved in the persistence and chronicity of hcv infection. these results may contribute to our understanding of the pathophysiology of hepatitis c and, consequently, to the development of new therapeutic strategies against the interaction of hcv structural proteins and the hepatic endothelium.

the hepatitis c virus (hcv) encodes approximately 10 different structural and non-structural proteins, including the envelope glycoprotein 2 (e2). hcv proteins, especially the envelope proteins, bind to cell receptors and can damage tissues. endothelial inflammation is the most important determinant of fibrosis progression and, consequently, cirrhosis. the aim of this study was to evaluate and compare the inflammatory response of endothelial cells to two recombinant forms of the hcv e2 protein produced in different expression systems (escherichia coli and pichia pastoris). we observed the induction of cell death and the production of nitric oxide, hydrogen peroxide, interleukin-8 and vascular endothelial growth factor a in human umbilical vein endothelial cells (huvecs) stimulated by the two recombinant e2 proteins. the e2-induced apoptosis of huvecs was confirmed using the molecular marker parp. the apoptosis rescue observed when the antioxidant n-acetylcysteine was used suggests that reactive oxygen species are involved in e2-induced apoptosis. we propose that these proteins are involved in the chronic inflammation caused by hcv.

PMC4238766