Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-201

radiological investigations and therapeutics have become an integral part of the management of critically ill patients in the intensive care unit (icu). patients admitted to the icu routinely undergo bedside imaging procedures such as chest radiographs for diagnosing heart, lung and other pathology, and for confirmation of the position of devices like endotracheal tubes, nasogastric tubes, central venous catheters and intercostal drains. a review article has suggested that among icu patients, up to 65% of daily chest radiographs and 70-75% of chest computerized tomography (ct) scans reveal significant or unsuspected abnormalities that may lead to a change in the patient's management. further, critically ill patients are frequently transported to the ct scan as well as digital subtraction angiography suites for diagnostic and therapeutic procedures such as angiography, embolization and stenting. in most situations, the icu team is responsible for the transport and management of the patient in the radiology department for these procedures. there is, therefore, potential radiation exposure to healthcare workers, particularly for those working for long periods of time in the icu. epidemiological data indicates that the exposure to even low-dose radiation may be a cause for concern because such exposure can result in leukemia, thyroid malignancies and other cancers. nonneoplastic effects of radiation include genetic mutation and developmental malformation in children whose mothers were exposed to radiation during pregnancy. a number of studies have looked at radiation exposure in critically ill patients undergoing repeated radiological procedures. one study has specifically focused on the pediatric age group probably in view of the high ratio of exposure to patient size and the potential for long-term sequelae as the radiation effects have a longer period to become manifest. however, the available literature on the extent of radiation exposure to icu personnel is scarce and relates mainly to the level of scattered radiation within the icu. the conclusion of these studies is that the level of radiation exposure is extremely low and does not pose a hazard to icu personnel. none of these studies have considered the additional radiation exposure to icu personnel involved in the management of critically ill patients in the radiology department. in our icu in a tertiary care cancer referral center, resident doctors working on 12 h shifts in the icu are also responsible for the transport and management of icu patients when they undergo diagnostic and therapeutic procedures in the radiology department. we, therefore, carried out this study to determine the total radiation exposure to icu resident doctors involved in the course of their duties. we conducted a prospective, observational study in the icu and postanesthesia care unit (pacu) of a 500-bedded tertiary care cancer referral center in mumbai, india from september 2012 to february 2013. all resident doctors who gave voluntary written consent to participate in the study were included. since the study did not involve patient contact, the requirement for obtaining consent from patients was waived by the ethics committee. the study was carried out in accordance with the principles of good clinical research practice. the resident doctors provide 24 h cover, working in 12 h shifts, with four doctors in each shift. in each shift the icu has a total of 14 beds as shown in figure 1. on another floor is the pacu with 23 beds, subdivided into 14 postoperative recovery room beds and 9 intensive care beds [figure 2]. residents provide care for patients in the icu and pacu and also accompany patients from these locations for radiological procedures in the ct scan or interventional radiology suites. location of thermoluminescent dosimeters are shown with filled triangles layout of postanesthesia care unit showing location of thermoluminescent dosimeter in pacu (tld surrounded by beds) and other in long lobby as control tld to detect levels of radiation, we used thermoluminescent dosimeters (tlds) which are a type of radiation detector. the tld measures cumulative dose of ionizing radiation exposure by measuring the amount of visible light emitted from a crystal in the detector when the crystal is heated. tlds can measure a wide dosimetric range (from 10 gray to 10 grays) of radiation exposure and are routinely used as personal dosimeters because they are small in size, convenient to use and not expensive. a tld was given to each of the four resident doctors; they were handed over to the next team during shift changeover. in addition, three tlds were kept in nursing stations in icu, and one tld was placed in the pacu. one tld was kept in the doctors ' duty room which was within the premises of the icu, and the last was kept as a control in the office of the department of anesthesia, critical care and pain, remote from icu and pacu, and where no radiological procedures were performed. the layout of icu and pacu is represented by figures 1 and 2 respectively and locations of tlds are marked with filled triangles. the participating resident doctors were instructed to wear the tlds at all times during their duty hours. staff not required to be present during radiographic procedures were kept at least 3 m away from the patient (a distance at which exposure from scattered radiation is considered negligible). it was ensured that patients who were shifted from icu to the radiology suite were accompanied by one icu resident and that the resident was wearing his tld throughout. residents, if required to be directly involved in the radiologic procedure in suites, wore lead aprons, and the tld was underneath the lead apron. bedside chest x-rays in the icu were done by siemens multimobil 2.5 (manufactured by siemens ltd, goa, india), ct and ct guided biopsies were performed on siemens somatom emotion 16 (manufactured by siemens shanghai medical equipments ltd, shanghai china) and ge light speed 16 (manufactured by general electric co., milwaukee, usa) respectively. interventional radiology procedures were carried out using ge innova 4100 iq (manufactured by ge medical systems, france). the study was carried out in two phases of 3 months each. at the end of the first phase, the tlds were handed over to department of nuclear medicine for analysis and another set of tlds was issued at the same time. during the period of the study, we maintained a database of procedures performed both in the icu and in the radiological suites along with the bed number and the patient's hospital registration number. the primary outcome of this study was to quantify the cumulative radiation exposure to the resident doctors working in the icu over a period of 6 months in the course of their duties. the secondary outcomes were to measure the cumulative scattered radiation exposure in various areas of the icu calculated as the average of readings of icu tld badges over 6 months and the estimated cumulative radiation exposure to the resident doctors per year. the control tld placed in the department of anesthesia served as a measure of baseline atmospheric ionizing radiation, and all other values are reported above this baseline. the results of dosimetric analysis of residents tlds during the two phases are shown in table 2. readings from tlds placed in the nursing station and doctors ' duty room during both phases were immeasurable. the mean values in the first and last 3 months were 0.052 and 0.069 msv respectively, though the highest individual value approached 0.1 msv. since this was recorded in a 3 month period, the projected reading for similar exposure throughout the year, even assuming a 24 h duty period, would be 0.4 msv, which is well below the safety limit of 20 msv/year. revolutionary progress in the field of medical imaging has given a big leap to advances in medical diagnostics and therapeutics. this development has also infiltrated the field of critical care medicine, and radio-diagnosis and interventional radiological procedures now play a key role in the management of critically ill patients. while this advancement offers the advantages of rapid bedside diagnosis, and cost-effective and minimally invasive treatment options to critically ill patients, it carries the danger of exposure of patient and physician to radiation. the detrimental effects of exposure to even low-level ionizing radiation have always been known; however, there is renewed concern because of its wide-spread use in medical radio-diagnosis and therapeutics in critically ill patients. it is, therefore, natural that there may be concerns about the long-term effects of radiation exposure to doctors working for long periods of time in the icu. in addition, where icu doctors are responsible for transport of patients to the radiology suite, the extent of radiation exposure is increased. it is reassuring that the results of our study confirm that the extent of radiation exposure to critical care physician during the course of his duty is well within acceptable limits. there is considerable literature on occupational hazards of radiation exposure among radiologists; however, it is difficult to directly extrapolate the conclusions of these studies to the icu. working conditions in the icu do not mimic those in radiology suites-working hours tend to be long, there is a need to accompany mechanically ventilated and hemodynamically unstable patients inside the radiology suite for procedures, and icu doctors may sometimes take radiation safety norms lightly. a study performed in a trauma icu (ticu) has concluded that radiation exposure is not a significant occupational hazard for the ticu personnel. similarly, another study looked into the radiation exposure to icu nurses and found that the exposure was well below the permissible level. the strength of our study is that it was planned in a more pragmatic way-apart from bedside radiological procedures, we also took into account the radiation exposure to icu residents accompanying the patient to radiological suites for diagnostic and therapeutic procedures. ionizing radiation from fluoroscopy in the ct scan or interventional radiology suites may be significant and were not considered in the previous studies. we also tried to measure the amount of scattered radiation within the icu and the pacu, which contributes to overall radiation exposure. even after taking these additional sources of radiation exposure into account, we found that the cumulative radiation exposure was negligible. the number and types of bedside and out-of-icu radiological procedures can vary on a day-to-day basis according to the case-mix of the icu population, and this may affect the overall radiation exposure; however, this study was carried out over a period of 6 months, and the data obtained would have been adequately representative. the other limitation relates to the generalizability of the study; differences in the types of cases, working pattern of resident doctors, quality and maintenance of radiological equipment between hospitals may restrict the applicability of these results to other hospitals. however, given the large margin of safety that our study has shown, it is unlikely that exposure levels would be dangerously high in any other setting. though, with advances in technology, the number and types of radiological procedures performed on patients are likely to increase. furthermore, there is a growing trend toward using radionuclide-based positron emission tomography scans for diagnostic procedures in critically ill patients especially when they are admitted to icu during their diagnostic work-up. some of these patients may continue to emit radiation long after their procedures are completed. though none of these patients featured in our study, it will add to the radiation exposure to doctors. the results of this study do not in any way underrate the need to follow safety precautions, while carrying out radiological procedures in critically ill patients. the levels of exposure found in this study should be interpreted bearing in mind that standard protection norms were used by all personnel involved in the study. with these precautions in place, radiation exposure to doctors managing critically ill patients in the icu is minimal and acceptable. literature on radiation exposure among icu doctors is scarce. in addition to bedside radiological procedures, the risk of exposure may be increased if the same doctors accompany icu patients for out-of-icu radiological investigations. however, we found that if standard safety precautions were followed, cumulative radiation exposure to icu resident doctor was well within permissible limits and was not the cause of concern and hence routine personal dosimetric monitoring is not needed for residents in icu. however, in view of changing practice, there is a need to repeat such audits periodically to monitor radiation exposure.

background and aims: with the expanding use of diagnostic and therapeutic radiological modalities in critically ill patients, doctors working in intensive care units (icus) are increasingly exposed to ionizing radiation. this risk of radiation exposure occurs not only during bedside radiologic procedures, but also when icu physicians accompany patients to radiology suites. the aim of this study was to quantify levels of radiation exposure among medical professionals working in the icu. materials and methods: the study was carried out prospectively over 6 months in the icu of a tertiary-referral cancer hospital. two teams consisting of 4 icu resident doctors each were instructed to wear thermoluminescent dosimeters (tlds) during their duty shifts. standard radiation protection precautions were used throughout the study period. tlds were also placed in selected areas of the icu to measure the amount of scattered radiation. tlds were analyzed at the end of every 3 months. results:the readings recorded on tlds placed in the icu were almost immeasurable. the mean value of residents ' radiation exposure was 0.059 msv, though the highest individual reading approached 0.1 msv. the projected maximum yearly radiation exposure was 0.4 msv. conclusions:if standard radiation safety precautions are followed, the cumulative radiation exposure to icu resident doctors is well within permissible limits and is not a cause of concern. however, with the increasing use of radiological procedures in the management of critically ill patients, there is a need to repeat such audits periodically to monitor radiation exposure.

PMC4166874

pubmed-202

despite the huge burden of hepatitis b worldwide, with an estimated 350 million people chronically infected, very few patients in low- and middle-income countries are currently receiving antiviral treatment. this is largely to blame on lack of access to viral load quantification, because this is considered a mandatory component of the diagnostic work-up in all international liver society guidelines. without a viral load measurement, it is virtually impossible to establish whether a hepatitis b surface antigen (hbsag) positive individual has chronic hepatitis b, characterized by a level of hepatitis b virus (hbv) dna>200020 000 iu/ml and continued necro-inflammation in the liver. these patients are at high risk of progression to cirrhosis and hepatocellular carcinoma in the absence of antiviral treatment, whereas inactive carriers, characterized by hbv dna levels<2000 iu/ml, have an excellent prognosis in the absence of treatment. the situation for hepatitis c is somewhat different because the main obstacle to treatment has been expensive and toxic treatment regimens. with the release of new direct acting antivirals for hepatitis c, opportunities are opening up in less developed countries where the disease burden is often high. an estimated 130150 million people are chronically infected with hepatitis c virus (hcv) globally, and the prevalence is higher in certain areas such as north africa and central and east asia. however, prior to starting treatment of hepatitis c, hcv rna measurements are required to establish the diagnosis of chronic hcv infection, which is a major obstacle in many places in the world. lack of access to viral load testing and antiviral treatment of hbv and hcv in resource-limited settings is a silent epidemic with major consequences. the world health organization (who) estimates that about 1 million people die from chronic hbv and hcv infection each year, which places viral hepatitis on the top 10 leading causes of mortality globally. first, serological tests are used to screen for hepatitis markers and exclude co-infections. thereafter, a new battery of tests is needed to distinguish past or inactive infection from chronic hepatitis. this diagnostic work-up involves molecular biology laboratories and advanced target amplification methods such as polymerase chain reaction (pcr) assays. these tests are typically performed at large referral laboratories, because they require sophisticated equipment, highly specialized laboratory personnel and strict quality control measures. in resource-limited settings, furthermore, stringent requirements for storage and shipment of plasma to the referral laboratory are barriers in settings with limited infrastructure. the solution to this challenge would be to develop reliable, cheap, and easy-to-use assays that can be performed at the site of patient care (point-of-care assays). numerous rapid diagnostic tests (rdts) for hepatitis b and c are commercially available, most of which provide a test result within 530 minutes; however, the diagnostic accuracy varies from excellent to very poor. a recent meta-analysis by shivkumar and colleagues found that the sensitivity of hbsag rdts used to screen for hepatitis b infection varied from 42 to 100% and the specificity from 0 to 100%. the same authors also reviewed anti-hcv rdts used for hepatitis c screening and found sensitivities ranging from 0 to 100% and specificities from 81.6 to 100%. hence, although high-quality rdts can be used with confidence in screening for hbv and hcv, health authorities should warn against the use of unreliable (and often very cheap) rdts with poor sensitivity and specificity. even though serological point-of-care assays for hepatitis b and c are widely available, the same is not the case for virological analyses. however, if we look over the fence into the hiv landscape, there has been an active development of point-of-care kits for viral load quantification over the past few years. because of major international investments in the fight against hiv/aids, there is an attractive commercial market for such kits. the first products were recently launched, including the alere q analyzer (alere inc., waltham, ma, usa) and the samba (diagnostics for the real world, sunnyvale, ca, usa), both of which have undergone field testing in sub-saharan africa and shown excellent performance. as there are no similar funding mechanisms for viral hepatitis in resource-limited settings, commercial actors have not shown the same interest in low-tech diagnostics for hbv and hcv; however, many of the technological advances for hiv can be modified to detect other viruses. currently, there is one product, truenat (molbio diagnostics, goa, india), for hbv dna quantification which is advertized as a point-of-care assay. the truenat kit provides a pcr result within an hour; however, it seems rather complex, involving several manual steps and multiple reagents, making it less ideal for outside laboratory settings.. an independent evaluation of the truenat kit under field conditions would be of major interest. the us-based company wave 80 biosciences is developing a point-of-care kit for hbv dna quantification as well as a qualitative assay for hcv rna detection, building on their existing hiv viral load assay eoscape-hiv (wave 80 biosciences, san francisco, ca, usa). eoscape-hiv is a fully automated, cartridge format system which is said to be robust and easy to operate. however, eoscape-hiv is still not commercially available, so the timing for the release of the hbv and hcv kits is still uncertain. the uk biotechnology company epistem received a prestigious grant award in 2013 to develop an hcv point-of-care device for viral load testing and genotyping. this novel assay will build on their existing genedrive (epistem, manchester, uk) device, which is a rapid, easy to use, sensitive, handheld pcr platform already ce-ivd marked for other genotype tests, such as mycobacterium tuberculosis identification and antibiotic resistance testing. far too often advanced technology has been shipped to low-income countries with good intentions, but ended up in a storeroom because of insufficient training, lack of maintenance, and shortage of reagents. partly, this has to be blamed on the manufacturers, who rarely offer training or service agreements to low- and middle-income countries. it is important, therefore, that point-of-care assays should be designed specifically to operate under basic conditions with minimal maintenance requirements and not just be high-tech solutions forced to fit low-tech settings. the international nongovernmental organization mdecins sans frontires published their desired specifications for a point-of-care hiv viral load assay a few years ago, and the same specification would also apply to an ideal hbv or hcv assay: no need for specialized laboratory facilities closed system to avoid contamination long shelf life in tropical climate no need for cold chain transportation or refrigerated storage affordability is an important issue if treatment for viral hepatitis is to be scaled-up globally. both the initial cost for the machine, but also the consumables thereafter must be priced reasonably. with regard to hbv, repeated tests over time are usually required, and the accumulated cost of viral load testing can be high. for hepatitis c, on the other hand, one viral load measurement prior to treatment and another 24 weeks after treatment would be sufficient if patients are being treated with the new direct acting antivirals. sustainability is another major concern with all technological devices, and it should be a prerequisite that the manufacturers provide adequate training and service agreements locally. furthermore, sensitivity of the assay should be high enough to ensure treatment for those who need it, and even more importantly, specificity must be close to 100% to avoid unnecessary and expensive treatment in uninfected individuals. as described by greenman and colleagues in the current issue of jvh, dried blood spots (dbs) can be a feasible and reliable alternative to point-of-care assays for viral hepatitis. the main advantage of dbs is that it solves the problem of storage and shipment of samples in places with poor infrastructure. dbs can be stored for weeks at ambient temperature without clinically significant degradation of nucleic acids. a drawback with dbs is the delayed reporting back of results. with viral hepatitis, however, this might be less of a concern, as viral load quantification is part of the pretreatment work-up of each patient and not the day-to-day monitoring of treatment effect (as in hiv). and in viral hepatitis, the decision to start treatment is rarely a matter of urgency. use of dbs is limited by the small amount of plasma per blood spot and less efficient nucleic acid extraction, which gives a reduced sensitivity in samples with low-level viraemia. with regard to hepatitis c, this rarely has any practical consequences, as most untreated patients have viral loads (far) above 1000 iu/ml. for hepatitis b, however, the situation is rather different as hepatitis b e-antigen (hbeag) negative hepatitis is now the main type of chronic hepatitis b worldwide. these patients typically have fluctuating viral load levels in the lower to medium range, and it is often difficult to distinguish them from inactive carriers. a lack of precision in dbs could therefore jeopardize the management of these patients. previous studies of hbv dna quantification in dbs have shown inconsistent results. a recent study by mohamed and colleagues showed that dbs yielded viral loads 0.65 log10 lower than plasma, and an older study by jardi and colleagues found that viral load levels were 1 log10 lower in dbs compared to plasma. on the contrary, lira and colleagues found no significant difference between dbs and plasma (0.21 log10 lower in dbs). thus, more studies are needed to evaluate the precision of dbs for hbv dna quantification, especially in the lower range around the decision threshold of 200020 000 iu/ml. in conclusion, dbs can be a valuable tool for the pretreatment evaluation of patients with hepatitis c, but might be more troublesome in hepatitis b due to a reduced sensitivity in the lower range of viral loads. management of viral hepatitis is going through a revolution with the launch of new direct acting antivirals for hepatitis c treatment. the cost of nearly 100 000 usd per patient, however, keeps these drugs out of reach for most patients worldwide. recently, the pharmaceutical company gilead announced that they work with generic drug manufactures in india to produce high-quality, low-cost sofosbuvir for developing countries, raising expectations that this game-changing drug might become available in low- and middle-income countries. drug availability, however, is not the only issue. in the absence of viral load measurements, doctors in resource-limited settings are left virtually blindfolded in the management of their patients with hepatitis. point-of-care viral load assays for hepatitis b and c have the potential to bridge this gap and prove valuable tools for expansion of treatment globally. however, assay performance under standardized conditions in europe or north america does not necessarily reflect real-life application in sub-saharan africa, and it is crucial to carry out independent field testing of these instruments before large scale use can be recommended. finally, sustainable funding mechanisms for diagnostics and treatment of viral hepatitis must be established. scaling up of hiv treatment globally would have been impossible without major donor programs such as pepfar, unitaid and the global fund to fight aids, tuberculosis, and malaria. then our colleagues in resource-limited settings might be able to treat viral hepatitis in the not so distant future.

viral hepatitis claims one million lives each year. scaling up treatment for hepatitis b and c in resource-limited settings is not possible without access to reliable diagnostic tools. this article gives an overview of current technologies and the pipeline for easy-to-use assays for serological and virological analyses, which can be performed at the site of patient care (point-of-care assays). furthermore, the utility of dried blood spots for hepatitis b and c viral load testing is discussed. in addition to simple and reliable diagnostics, there is a need for a sustainable funding scheme and generic production of antiviral drugs to reduce the burden of viral hepatitis worldwide.

PMC4403955

pubmed-203

the term presbyopia derives from greek for old eyes and refers to the age-related loss of natural accommodation and resulting reduction of baseline near vision around the age of 40 years. as people continue to work and stay active later in life than ever before, their need for quality vision at both near and distance vision is also growing. in fact, the presbyopic population worldwide is predicted to rise to 1.4 billion by 2020 and to 1.8 billion by 2050. presbyopia can be compensated by glasses or contact lenses, but there is increasing interest in surgical options. since presbyopia is caused by progressive elasticity changes in the biological crystalline lens, presbyopic surgeries may either directly replace the lens through an intraocular approach or modify extraocular structures such as the cornea or sclera. this review will focus on corneal-based surgical strategies to treat presbyopia and in particular how these methods have been or may be used in pseudophakic patients. to improve uncorrected near vision in presbyopia, the two major techniques to alter the cornea generally utilize either an intracorneal inlay device or laser refractive surgery. corneal inlays are devices that are surgically placed within the corneal stroma of the nondominant eye to change the optical properties of the cornea. several different types of corneal inlays each take a distinct approach to minimizing presbyopia (table 1). the best studied inlay to date is the kamra inlay by acufocus, which is an opaque polymer ring that employs a pinhole concept to expand the depth of focus. the raindrop near vision inlay by revision optics is a clear hydrogel implant that increases the anterior corneal curvature to add optical power, with a refractive index approximating that of the cornea. inlays can also confer differing amounts of refractive power as in the flexivue microlens implant by presbia, which creates a multifocal effect via a central plano zone surrounded by circular rings of plus power. the icolens by neoptics ag is another corneal inlay with a bifocal design similar in concept to the flexivue. corneal inlays are intended to improve uncorrected near vision but may come at the cost of lowered distance vision or increased glare or haloes [7, 8] or rarely infectious keratitis. however, inlays have been promoted as an additive, removable technology unlike laser refractive surgery which ablates corneal tissue; patients usually return to within+/1.00 diopter of their preoperative refractive state after corneal inlay removal. it should be noted that intrastromal corneal ring segments (icrs or intacs) are another type of corneal implant but are indicated for treatment of keratoconus rather than presbyopia. laser refractive surgery on the cornea uses an excimer laser to remodel the corneal curvature in order to improve uncorrected vision and reduce dependency on eyeglasses or contact lenses. one of the most popular techniques, laser-assisted in situ keratomileusis (lasik), removes corneal stromal tissue under an anterior flap. lasik can produce either monovision or multifocality, the latter of which has been nicknamed presbylasik when it is used to treat presbyopia. conventional monovision lasik corrects the dominant eye for distance vision and the nondominant eye for near vision. in central presbylasik, the central area is shaped hyperpositively for near vision, whereas the midperipheral cornea is adjusted for far vision. in peripheral presbylasik, the central area is shaped for far vision and the midperipheral corneal area for near vision. in the third approach, laser blended vision creates a combination of micromonovision and depth of field increase by inducing spherical aberration. there are concerns for the decreased contrast sensitivity, visual quality, and irreversibility of these laser ablation procedures. laser blended vision treatment seems to provide the best compromise in terms of safety and quality of vision. in contrast to the literature on corneal inlays in phakic patients, there are only a handful of published reports in pseudophakic individuals (table 2). these include only case reports and retrospective case series. the largest study of pseudophakic patients undergoing inlay implantation included 13 patients with monofocal intraocular lenses (iols). four of these patients also underwent simultaneous lasik to optimize their underlying refractive error prior to insertion of a kamra pinhole inlay. the mean uncorrected near visual acuity (unva) improved 5 lines from j10 to j4 at 3 months postoperatively, without significant change in mean uncorrected or corrected distance visual acuity (udva, cdva) or corrected near visual acuity (cnva). on a postoperative survey, 77% of the patients said they would opt to have the surgery again. in an earlier report by the same group, kamra inlays were inserted in the nondominant eye of 3 patients with phakic iol implants. these patients saw 25 lines of improvement in unva without change in udva at 3 months postoperatively. both of these studies had a short follow-up period of 3 months, at which point the authors assert that operative results would have stabilized. nonetheless, longer studies are definitely needed as the mean age of these patients was around 55 years and so the patients would be expected to live with the inlays for several decades. two case reports with slightly longer follow-up each described a pseudophakic patient who retained improvement of uncorrected near vision at 624 months after a corneal inlay procedure. one young patient at 32 years of age had received a monofocal iol on account of a traumatic cataract in the right eye, and a year later he developed headaches and asthenopia while reading with his right eye. given his requirement of a+3.00 reading add in the right eye, he could not tolerate glasses due to anisometropia. after kamra inlay implantation, he reported improved symptoms but also slightly worse reading in dim light compared to bright light conditions. his unva improved from j17 to j3 in the operated eye at the 6-month follow-up. another pseudophakic patient with a monofocal iol saw a j3 to j1 improvement in unva after implantation of a flexivue microlens inlay 6 months after the cataract extraction. this recovery of uncorrected near vision continued to be maintained at a 2-year follow-up after inlay implantation. interestingly, this patient developed a symptomatic posterior capsule opacification in the operated eye at 2 years after the cataract surgery, underwent standard neodymium: yag (nd: yag) capsulotomy, and was reported to still be satisfied and spectacle free with unva of j1 6 months later. the authors asserted that the transparent design of this particular inlay enabled visualization for the nd: yag capsulotomy and also fundoscopy. the aforementioned studies demonstrate the efficacy of corneal inlays in presbyopes with a history of prior intraocular and/or refractive surgery. similar studies done in phakic patients suggest that the improved uncorrected near vision is achieved for at least 1 to 5 years after corneal inlay implantation. a mexican prospective study of 30 phakic patients undergoing inlay implantation (raindrop near vision inlay) and lasik demonstrated improvement of mean unva by 3 lines at one year, suggesting that the improved unva could also be stable at one year in pseudophakes. a larger retrospective study of 277 eyes in japan showed similar results at one year after simultaneous kamra inlay implantation and lasik, with mean unva improving from j8j10 to j2-j3 depending on patient age. the longest published follow-up of inlays involved an austrian prospective cohort of 32 emmetropic phakic patients who retained improved uncorrected near vision at 5 years after kamra inlay implantation. of note, the mean unva enhancement declined somewhat from j1 to j3 between the 3- and 5-year time points; however, cdva did not change. it is worth mentioning that, by the 5-year follow-up, there were still no biocompatibility concerns and 84% of the patients said they would opt for the surgery again. several complications occurred, including 2 inlays needed to be recentered, 1 eye that required debridement for epithelial ingrowth, 18 eyes that developed iron deposits by year 3, and 1 inlay that was removed at year 3 due to patient dissatisfaction. there are several case reports describing the opposite sequence of events, where patients with prior corneal inlay implantation subsequently undergo cataract extraction with intraocular lens placement, either with or without initially removing the inlay. these patients had previously received any one of the three major corneal inlay types, including the kamra inlay, presbia microlens inlay, and the raindrop near vision inlay. these anecdotes suggest that cataract surgery can still be successfully performed after inlay implantation, which will be important for those young presbyopes opting for surgical treatment of their presbyopia. an extensive review of the literature on laser refractive surgery for presbyopia revealed very few studies done in pseudophakic patients, although there are numerous published accounts in phakic patients. similar to the body of literature on corneal inlays, a history of prior intraocular surgery such as cataract extraction typically excluded such patients from studies on laser refractive surgery for presbyopia. nonetheless, laser refractive surgery has been performed successfully on pseudophakes to correct for ametropias [2225], suggesting that laser refractive surgery to address presbyopia is likely to be equally successful in pseudophakic patients who have monofocal iols. clearly, the application of laser refractive surgery to presbyopia in pseudophakia merits more research. various studies examine the efficacy of laser refractive surgery on treating presbyopia in phakic patients. a prospective trial of central multifocal presbylasik on 50 hyperopic-presbyopic eyes resulted in spectacle independence at all distances for 72% of the patients after 6 months, although nearly a third lost 1-2 lines of cdva. this and similar studies have suggested that multifocal laser approaches to improving uncorrected near vision in presbyopia may compromise distance vision to some degree [2729]. another study utilizing peripheral presbylasik improved mean binocular udva and unva with high reported patient satisfaction rates but decreased contrast sensitivity. presbylasik treatment for presbyopia may be further modified in pseudophakic patients who are not satisfied with the outcome, as described in a recent case report using a wavefront-guided aspheric treatment to reverse the presbyopic treatment and eliminate dysphotopsia up to 6 months later. lasik and photorefractive keratectomy (prk) are known to be effective for fine-tuning residual ametropias after presbyopia-compensating iol implantation, which suggests that laser refractive surgery could similarly address presbyopia after iol implantation. two subsequent studies showed efficacy of lasik at up to 6 months in treating pseudophakic ametropia after multifocal iol implantation in 53 eyes and 85 eyes with mixed ametropias. these and other similar studies suggest that laser refractive surgery could also be used in pseudophakes to treat presbyopia. a general consensus is that lasik should be performed at least 612 weeks after intraocular surgery to reduce possible complications related to cataract incisions, postoperative corneal edema, and refractive and iol stability. while prk and lasik have both been performed safely in pseudophakic patients, it has been postulated that neither are as effective as primary refractive surgery. conductive keratoplasty (ck), a corneal refractive surgical technique that uses radiofrequency energy to reshape the central cornea by shrinking peripheral collagen, has also been used to treat presbyopia. while again the majority of studies only include phakic patients, one chinese study reported that ck improved unva up to one year later in presbyopic pseudophakic patients with monofocal iols. studies have noted that myopes and hyperopes may express different levels of satisfaction with presbylasik as well as with other presbyopic treatments. although near acuity results tend to be better in myopes, the majority of hyperopes are satisfied whereas the majority of myopes are not. the decreasing visual quality after presbylasik in myopes who have experienced excellent uncorrected near visual acuity preoperatively can lead to dissatisfaction over unmet expectations. pseudophakic patients present a unique set of challenges and advantages for presbyopic surgeries as compared to the phakic population. some of the challenges stem from the prior intraocular surgery itself, such as navigating corneal scars and residual corneal irregularities from prior incisions. additionally, iol aberrations may alter laser refractive measurements and calculations normally used on phakic eyes. in general, the age difference of approximately two decades between pseudophakic patients and typical refractive patients also renders keratorefractive treatments less predictable and less effective. the older age of most pseudophakic patients correlates with increased prevalence of dry eye symptoms and slower healing rates. studies have suggested that the final uncorrected visual acuity after excimer laser or corneal inlay surgery is lower in pseudophakic patients than in typical refractive patients. on the other hand, older patients have reported similar or higher levels of satisfaction after presbyopic surgeries as compared with younger patients who may have had higher postoperative acuity expectations [17, 36]. presbyopia may continue to progress for phakic individuals who undergo refractive or inlay procedures at a younger age, whereas this is not an issue for patients who have had cataract surgery. at the same time, the lack of residual natural accommodative power in pseudophakic patients gives little room for error in presbyopic surgeries. it is worth noting, however, that because the iol treats most of the spherical error in pseudophakic patients, there would be less keratorefractive-induced effect on the corneal prolate asphericity and quality of vision than in nonametropic phakic patients. in all patients, regardless of phakic status, there are certain considerations to optimize a satisfactory outcome from corneal-based presbyopic surgeries. the importance of a thorough preoperative evaluation can not be understated, and trial frames or contact lenses should be used in various lighting conditions to help develop realistic patient expectations. patients should be selected appropriately from baseline characteristics including tear film adequacy, normal corneal shape and thickness, and reasonable expectations. there need to be more studies and counseling of patients on possible negative outcomes of presbyopic surgeries, ranging from increased dry eye or glare symptoms to decreased distance and/or night vision and subsequent safety concerns. presbyopic surgery may not completely eliminate the need for reading glasses. given the necessity of fundus viewing for diagnosis and treatment of diseases such as age-related macular degeneration, diabetic retinopathy, or retinal detachments, it should be considered that corneal inlays may obstruct the view or hinder treatment unless they are first removed. although corneal inlays are promoted as removable, long-term follow-up on removed inlays is not available and presbylasik procedures are in general not reversible with the commonly available technology at present. as the first wave of refractive patients begins to require cataract surgery, we may be required to change not only the assessment and technique of cataract surgery for these patients, but also how we counsel these patients who have high expectations for visual acuity and spectacle independence. for patients suffering from presbyopia, there are now exciting surgical alternatives to glasses and contact lenses. pseudophakic patients who still desire better uncorrected near vision may choose corneal-based surgical therapies, such as corneal inlays or laser refractive surgery. nevertheless, presbyopic surgeries will not be ideal for all patients, and appropriately screening patients and managing patient expectations are both key to maximizing satisfactory outcomes. many studies on presbyopic surgeries excluded patients with prior ocular surgery, and the few published studies on pseudophakic patients are limited by short-term follow-up, small numbers, and limited lighting conditions. undoubtedly, there is a pressing need for more research on presbyopic surgeries in the pseudophakic population.

purpose. the purpose of this review is to provide a summary of laser refractive surgery and corneal inlay approaches to treat presbyopia in patients after cataract surgery. summary. the presbyopic population is growing rapidly along with increasing demands for spectacle independence. this review will focus on the corneal-based surgical options to address presbyopia including various types of corneal intrastromal inlays and laser ablation techniques to generate either a multifocal cornea (presbylasik) or monovision. the natural history of presbyopia develops prior to cataracts, and these presbyopic surgeries have been largely studied in phakic patients. nevertheless, pseudophakic patients may also undergo these presbyopia-compensating procedures for enhanced quality of life. this review examines the published reports that apply these technologies to patients after cataract surgery and discusses unique considerations for this population.

PMC4804036

pubmed-204

the use of ergotamines causing ischemia of peripheral vessels has been reported, particularly in patients with peripheral vascular disease. ischemic bowel induced by ergotamines is a much rarer event, with few documented cases in the literature. while colitis is always on the differential diagnosis of hospital patients with abdominal pain, the majority of cases are secondary to infectious colitis associated with antibiotic therapy. when suspected, non-occlusive mesenteric ischemia can be treated with anti-coagulation and blood pressure support with intravenous fluids. the predisposition for ischemia in patients with chronic constipation secondary to opioid use is amplified by concomitant use of vasoactive medications to control symptoms of migraine headache. while abdominal ct scanning is frequently used to assess colonic pathology, findings often lag behind those identified at the time of colonoscopy. patchy areas of ischemia are often managed non-surgically by discontinuing the offending medication. widespread necrosis, coupled with clinical deterioration, as in this case, mandated immediate surgical intervention to prevent irreversible septic shock. a 48-year-old woman with a long-standing history of intractable migraine headaches was admitted to our institution's specialty headache unit for aggressive management. she had no known history of peripheral vascular or cardiac disease but has been admitted multiple times for treatment of her headaches since her initial diagnosis in 2003. during the course of each of these hospitalizations, she had received one to two courses of dihydroergotamine mesylate (dhe) 45. during this admission she received two courses of dhe 0.5 mg 1, then 1 mg every 8 h for a total of eight doses, on days 13 and the second course of therapy on days 79. several hours after the final dose of her second round she became obtunded, minimally responsive and hypotensive with a blood pressure of 80/45 mm hg. on physical examination her abdomen was moderately distended with few bowel sounds. mmol/l, white blood cell count was 18.0 (with 17% bands), and stool was clostridium difficile negative. the patient was transferred to the intensive care unit, given intravenous fluid boluses, started on vasopressors, and given broad spectrum antibiotics. her chest radiograph was unremarkable, and her abdominal x-rays showed only mild prominence of the colon. over the next several hours she became progressively acidotic with a worsening bandemia. a bedside colonoscopy showed diffuse ischemic colitis with fecal impaction and no pseudomembranes (fig. operative findings showed a peritoneal cavity filled with murky, foul-smelling fluid and gangrene of the descending colon was seen with necrosis in the area immediately distal to the splenic flexure to the sigmoid colon. final pathology on the surgical specimen showed 86 cm of patchy, dark green/black large bowel, consistent with ischemic necrosis. the final diagnosis was gangrenous large bowel, ischemic colitis with thrombi or emboli noted. a hypercoaguable panel was performed following the operation and the patient was negative for clotting disorders. the differential diagnosis of ischemic colitis includes arterial occlusion, caused by emboli or thrombus, venous thrombosis, and non-occlusive ischemia caused by systemic hypotension or, as is strongly suspected in this case, ergotamine-induced vasospasm. a diagnosis of ergotamine-induced vasospasm is a diagnosis of exclusion, made when all other etiologies of ischemia have been ruled out. in this case, an arterial occlusion is unlikely, because there was no palpable thrombus and there was no clear ischemic demarcation to suggest a major vessel distribution. the patient had no history of cardiac arrhythmias, such as atrial fibrillation, to predispose her to emboli. furthermore she was a non-smoker and had no other cardiac risk factors such as atherosclerosis or hyperlipidemia. emboli to inferior mesenteric artery (i m a) are exceedingly rare, and there are no reported cases of spontaneous emboli or thrombosis to i m a. all reported cases of i m a thrombosis are subsequent to trauma [1, 2]. venous thrombosis as a cause of ischemia in this patient is equally unlikely as there were no signs of venous congestion or stasis at the time of surgery. the patient had no hypercoagulable disorder and on examination the colon was not edematous and no clot was identified in the vasculature. ischemia secondary to systemic hypotension alone would have resulted in a watershed-type distribution of gangrene. in this case the most probable cause of this event was non-occlusive mesenteric ischemia in the i m a distribution and more specifically the left colic artery due to intense vasoconstriction induced by high-dose ergotamine use. underlying bowel wall distention from the impacted stool in combination with vasoconstriction from ergotamine is the most likely etiology for this patient's bowel ischemia. dhe is indicated for the acute treatment of migraine headaches with or without aura and the acute treatment of cluster headache episodes. its therapeutic activity in the treatment of migraine headaches is generally attributed to the agonist effect at 5-ht1d receptors. according to the neurovascular theory of migraine, it is hypothesized that activation of 5-ht1d receptors on intracranial blood vessels leads to vasoconstriction. the 5-ht1d receptors on sensory nerve endings of the trigeminal are also activated, causing inhibition of pro-inflammatory neuropeptide release. ergotamine and dhe cause vasoconstriction of both arteries and veins due to alpha-adrenergic agonistic action, and they may also have possible interaction with prostaglandins, calcium and serotonin. dhe was developed in 1943 for migraine prophylaxis and shown in four studies in 1987 and five studies in 2001 to have less effect on peripheral arteries than ergotamine. as indicated in this case a european consensus report in 2000 concluded that ergotamine is not a drug of first choice in the triptan era, but may be useful in longstanding migraine attacks with multiple recurrences. ergotamine is known to cause peripheral ischemia, as has been reported in several case studies, most commonly in the lower limbs [5, 6, 7, 8, 9]. a causal relationship has not however been clearly established and is still the subject of some debate. other reports of ergotamine causing ischemic bowel appear in the literature [13, 14, 15]. in previous reported cases of colitis, expectant management with this is the first reported cases of ischemia progressing to gangrene such that colon resection was required. it should be noted in this case that the patient's dose of dhe was greater than the recommended amount. the recommended dosing of dhe 45 is 1 mg iv/im/sc, repeated once every 24 h for a total dose not to exceed 6 mg in 7 days. in this case, the patient received 17 mg of dhe over the course of 9 days. although ischemic colitis is considered a rare side effect of high-dose ergotamine use, it is a very real risk of which clinicians need to remain aware. this is the fourth reported case of ischemic colitis secondary to high-dose ergotamine use reported in the literature and the first to require colon resection. while dhe can be useful in patients with refractory migraines, patients should be informed of the risks of both peripheral and visceral ischemia before deciding on this treatment. finally, ischemic colitis should be considered in the differential diagnosis of all patients taking ergotamines who present with abdominal pain.

a 48-year-old woman with a history of chronic migraines, initially admitted for inpatient management of intractable migraine headaches, developed new onset abdominal pain, hypotension, and diarrhea on hospital day number ten. in our institution's headache unit, patients are treated by a multidisciplinary approach, including individualized drug therapy based on diagnosis and previous response to therapy. given the patient's hypotension and clinical appearance, she was transferred to the intensive care unit and treated for septic shock and metabolic acidosis. a bedside colonscopy revealed diffuse ischemic colitis. final pathology after colon resection showed widespread, transmural necrosis of the colonic wall. we review the pathophysiology of ergotamine use and its potential association with ischemic colitis.

PMC3280477

pubmed-205

acute embolic limb ischemia is an urgent clinical condition in which sudden decrease or worsening in limb perfusion causes a potential threat to extremity viability and to life. thorough removal of all occlusive emboli in the arterial tree results in the best outcomes; hence, some authors favored arteriography after embolectomy for lower limbs. angiography is traditionally performed with iodinated contrast material, but carbon dioxide (co2) has been studied as an alternative intravascular contrast agent for patients with iodine allergy or renal function impairment. since it is not nephrotoxic, it was considered reasonable to utilize this contrast in a patient with borderline renal function who would be submitted to the noxious stimuli of the reperfused limb after revascularization. to the best of our knowledge, this was the first case assessing the intraoperative use of co2 as a substitute for iodine contrast in a patient with known chronic kidney disease and an acute ischemic limb. a 79-year-old woman presented to the emergency department with acute limb ischemia in her left leg with a 2-hour history. past medical history was positive for hypertension, atrial fibrillation and non-dialysis-dependent chronic renal failure. two years before, she had been operated on for acute aortic embolic occlusion, with bilateral femoral catheter embolectomy. upon discharge she presented pedal pulses, but no posterior tibial pulses on either limb. medication use was irregular, and her international normalized ratio (inr) of prothrombin time upon admission was 1.1. her pulse was arrhythmic; she was hypertensive (160x110mmhg) and presented with normal femoral, popliteal and pedal pulses on her right leg. on palpation in the left lower limb only a weak femoral pulse was observed; there were no distal pulses. she was classified as grade iib limb ischemia (immediately threatened) and was immediately referred for surgery. preoperative exams revealed a diminished creatinine clearance (cockroft-gault of 12ml/min). arteriotomy was performed and a 4-fr embolectomy catheter was utilized (edwards lifesciences corp, irvine, california, usa). the catheter progressed more than 60 cm on the superficial artery, but could not be felt neither on pedal artery topography nor on posterior tibial artery topography. back bleeding was not significant, and a decision was made to perform an angiography to better assess the infra-popliteal arterial tree. a homemade water seal co2 delivery system was used, similar to another previously described, but with one modification to prevent room-air contamination. bloomington, indianopolis, usa) inserted in the arteriotomy while the arteries were clamped. figure 1 shows a patent popliteal artery, a patent fibular artery and an occlusion on the mid-third of the anterior tibial artery. we hypothesized that the embolectomy catheter reached the fibular artery on the first attempt, and thus could not be felt on physical exam. patent popliteal and fibular arteries, occlusion in the mid-third of the anterior tibial artery a new embolectomy was then performed. the catheter progressed to the foot, on the topography of the pedal artery (i.e., the catheter could be felt on the projection of the artery), and more thrombi were retrieved. control angiography (figure 2) showed complete resolution of the anterior tibial artery occlusion, with contrast up to the foot (figure 3). a total of 28ml of co2 was used, and no iodine contrast was needed. the arteries were unclamped, and the popliteal and pedal pulses were noted to be present on the limb. ischemia signs (e.g., pallor, hypothermia) were promptly resolved after arterial flow release. the patient remained in the intensive care unit (icu) until the 11 postoperative day. during this period, the patient did not receive any nephrotoxic agent, such as vancomycin or vasoactive drugs. after icu discharge she developed a urinary tract infection, as well as deteriorating renal function and uremia. the patient developed pneumonia, which progressed to septic shock on the 36 day of her admission. she required vasoactive drugs for 2 days at the icu and, unfortunately, her renal function was never fully recovered. she was discharged from hospital to a hospice care facility with a pedal pulse and no deficit on her limb, though requiring chronic dialysis. treatment of embolic arterial occlusion with severe limb ischemia is well defined and involves the use of an embolectomy catheter as the best alternative. co2 has been used electively in both diagnostic and therapeutic procedures in the femoropopliteal tree, and is reported to be safe and non-nephrotoxic. intraoperative angiography was beneficial because it allowed the diagnosis of the arterial tree occlusion after the initial embolectomy. additional removal of clots was performed and the result was documented as complete patency of the anterior tibial artery to the foot. our goal, when using co2, was to decrease the need for postoperative dialysis. probably, in this case, the deleterious stimuli (surgical stress, urinary tract infection and septic shock due to pneumonia) contributed to renal failure and subsequent need for dialysis. the countermeasure (such as the use of non-nephrotoxic contrast) if we had used the iodinated medium, we might wonder if something could have been done differently to avoid dialysis. we consider co2 to be an alternative to iodine contrast when the decision to perform angiography is made in the acutely ischemic limb. to the best of our knowledge, this agent has never been described in this clinical setting; it presents good quality imaging, is not nephrotoxic and does not increase the risk for the limb or the patient in acute arterial occlusions. this approach may prove to be fruitful in patients with borderline renal function, thereby reducing the risk of short or long-term need for dialysis. a isquemia aguda de membro de origem emblica uma situao clnica de carter urgente, em que ocorre uma diminuio ou piora sbita na perfuso de um membro, e configura um risco viabilidade da extremidade e vida. o tratamento consiste em revascularizao imediata com um cateter de embolectomia. a remoo completa de todos os mbolos oclusivos na rvore arterial leva aos melhores desfechos; por isso, alguns autores defendem a arteriografia aps a embolectomia, para os membros inferiores. a angiografia tradicionalmente realizada com contraste iodado, mas o dixido de carbono (co2) foi estudado como um agente de contraste intravascular alternativo para pacientes com alergia a iodo ou alterao na funo renal. como o co2 no nefrotxico, julgou-se razovel utilizar esse contraste em uma paciente com funo renal limtrofe (borderline) que seria submetida aos estmulos nocivos de reperfuso do membro, aps a revascularizao. em nosso entender, este foi o primeiro caso que avalia o uso intraoperatrio de co2 como um substituto de contraste iodado em um paciente com doena renal crnica conhecida e isquemia aguda de membro. paciente do sexo feminino, 79 anos, chegou ao pronto-socorro com isquemia aguda no membro inferior esquerdo, com durao de 2 horas. como antecedentes, apresentava hipertenso, fibrilao atrial e insuficincia renal crnica, no dependente de dilise. a paciente tinha sido operada 2 anos antes, por ocluso artica aguda de origem emblica, quando foi realizada embolectomia femoral bilateral com cateter. alta, os pulsos pediosos eram palpveis, mas os tibiais posteriores eram ausentes, bilateralmente. a paciente fazia uso irregular dos medicamentos, e o tempo de protrombina (inr, sigla do ingls international normalized ratio) era de 1,1. o pulso estava arrtmico; era hipertensa (160x110mmhg) e apresentava pulsos femoral, poplteo e distal normais, na perna direita. palpao do membro inferior esquerdo, havia apenas um pulso femoral fraco; os pulsos distais estavam ausentes. a paciente apresentava dor e dfice motor. ela foi considerada como portadora de isquemia de membro grau iib (risco eminente) e foi encaminhada imediatamente para cirurgia. o clearance de creatinina estava diminudo nos exames pr-operatrios (cockroft-gault de 12ml/min). sob anestesia geral, foi realizado acesso femoral na cicatriz da inciso anterior do membro inferior esquerdo. as artrias femorais comum, superficial e profunda foram dissecadas e clampeadas. foi feita arteriotomia e uso de cateter de embolectomia de 4fr (edwards lifesciences corp, irvine, califrnia, estados unidos). os trombos foram removidos das artrias femorais superficial e profunda. o cateter avanou mais de 60 cm na artria femoral superficial, mas no pde ser palpado. o fluxo retrgrado no foi significativo e decidiu-se realizar uma angiografia para avaliar melhor a rvore arterial infrapopltea. foi escolhido o co2 como substituto ao contraste iodado para a angiografia. utilizou-se um sistema home-made com fornecimento de co2 em selo dgua, semelhante a outro descrito anteriormente, mas com uma modificao para evitar a contaminao do ar ambiente. bloomington, indianpolis, estados unidos) inserido na arteriotomia, quando as artrias foram pinadas. a figura 1 mostra uma artria popltea e uma fibular prvias, e uma ocluso no tero mdio da artria tibial anterior. levantamos a hiptese de o cateter de embolectomia ter alcanado a artria fibular na primeira tentativa, e por isso no ter sido palpvel ao exame fsico. artrias popltea e fibular prvias, ocluso no tero mdio da artria tibial anterior realizou-se, ento, nova embolectomia. o cateter avanou at o p, na topografia da artria pediosa (isto, o cateter pde ser palpado na projeo da artria) e mais trombos foram removidos. a angiografia de controle (figura 2) mostrou resoluo completa da ocluso da artria tibial anterior, com contraste fluindo at o p (figura 3). foram usados 28ml de co2, e no foi necessrio aplicar o contraste iodado. resoluo completa da ocluso da artria tibial anterior figura 3arteriografia com dixido de carbono. chegada de contraste na artria tibial anterior at o p foi realizada a arteriorrafia. as artrias foram desclampeadas, os sinais de isquemia (palidez e hipotermia) foram imediatamente resolvidos aps a liberao do fluxo arterial. a paciente no desenvolveu sinais de sndrome compartimental. a paciente permaneceu na unidade de terapia intensiva (uti) at o 11 dia ps-operatrio. durante esse perodo, no recebeu nenhum agente nefrotxico, como vancomicina ou drogas vasoativas. aps a alta da uti, desenvolveu infeco urinria, piora da funo renal e uremia. iniciou dilise no 18 dia ps-operatrio. a paciente teve pneumonia, que evoluiu para choque sptico no 36 dia de internao. necessitou de drogas vasoativas por 2 dias na uti e, infelizmente, nunca mais recuperou a funo renal. teve alta hospitalar e foi para instituio de cuidados terminais, com pulso distal sem dfice no membro inferior, mas em dilise crnica. o tratamento da ocluso arterial emblica com isquemia grave de membro est bem definido, sendo o uso de cateter de embolectomia a melhor alternativa. o co2 tem sido empregado de forma eletiva tanto nos procedimentos diagnsticos como nos teraputicos na rvore fmoro-popltea, sendo descrito como seguro e no nefrotxico. a angiografia intraoperatria foi benfica, j que permitiu o diagnstico de ocluso da rvore arterial aps a primeira embolectomia. mais cogulos foram removidos, e o resultado documentado foi a permeabilidade completa da artria tibial anterior at o p. nosso objetivo, ao utilizar co2, foi o de diminuir a necessidade de dilise no ps-operatrio. neste caso, provavelmente, os estmulos prejudiciais (estresse cirrgico, infeco do trato urinrio e choque sptico por pneumonia) contriburam para a insuficincia renal e para consequente necessidade de dilise. a contramedida (como o uso de contraste no nefrotxico) poderia ter prevenido a insuficincia renal, se fosse esta uma situao nica. se tivssemos usado o contraste iodado, pensaramos se algo diferente poderia ter sido feito para evitar dilise. consideramos o co2 como uma alternativa ao contraste iodado quando necessria a angiografia para isquemia aguda de membro. em nosso entender, esse agente nunca foi descrito nessa situao clnica, proporcionando boa qualidade de imagem, no sendo nefrotxico, nem aumentado o risco do membro ou do paciente, em casos de ocluses arteriais agudas. essa abordagem pode se mostrar til em pacientes com funo renal limtrofe (borderline), reduzindo, assim, o risco de precisar de dilise a curto ou longo prazo.

acute limb ischemia can be potentially harmful to the limb and life threatening. renal failure is a possible outcome associated with release of products of ischemic limb reperfusion. some authors reported the benefit of performing angiography after embolectomy, even though iodine contrast is also nephrotoxic. we report a case of embolectomy on a patient with renal insufficiency in whom carbon dioxide was used as a substitute for iodine contrast.

PMC4943822

pubmed-206

emphysematous gastritis, which was first described by fraenkel in 1889 (1), is a rare disease characterized by the presence of air within the wall of the stomach and diffuse gastric wall inflammation by gas-forming bacteria, which may be also life-threatening due to systemic toxicity. predisposing factors include the ingestion of corrosives, alcohol abuse, recent abdominal surgery, diabetes, and immunocompromised conditions (1-3). since 1889, only 51 cases have been reported worldwide (1-8). mucormycosis is a rare fungal infection that usually involves the nasopharynx (9). among the several forms, gastrointestinal mucormycosis is very rare, and the manifestations range from colonization of peptic ulcers to infiltrative disease with vascular invasion and dissemination (9). commonly associated conditions include diabetes mellitus, lymphoma, leukemia, renal disease, septicemia, malnutrition, and long-term treatment with steroids and antibiotics (10). among the reported cases of emphysematous gastritis, fungal organisms such as candida species have been isolated rarely (4, 11-15). however, emphysematous gastritis associated with mucormycotic infection is extremely rare, and only one case has been reported in the english literature (15). here we report a case of emphysematous gastritis, diagnosed by computed tomography (ct) and confirmed by histopathologic findings associated with invasive gastric mucormycosis that showed angioinvasion, necrosis, ultimately disseminated to the colon and liver, and was fatal despite medical and surgical treatment. to our knowledge, this is the first report of a patient with emphysematous gastritis associated with invasive gastric mucormycosis in korea. a 43-yr old man was admitted to the emergency room because of diffuse abdominal pain, indigestion, and poor oral intake for 4 days. he had had a 1-yr history of hypertension, there was also a history of excessive ingestion of alcohol and heavy smoking for 20 yr, but there was no history of peptic ulcer disease. his blood pressure was 160/100 mmhg, with a body temperature of 36.2, pulse rate of 98/min, and respiration rate of 26/min. abdominal examination revealed decreased bowel sounds and severe tenderness in the epigastrium, with rigidity and rebound tenderness. hematological and biochemical examinations on admission showed hemoglobin 13.9 g/dl (normal: 13-18), white blood cell 11.7710/l (3.6-11), platelet 21010/l (150-450), blood sugar 816 mg/dl (70-110), aspartate aminotransferase 148 iu/l (5-38), alanine aminotransferase 76 iu/l (4-43), lactate dehydrogenase 1,320 iu/l (180-460), amylase 6 u/l (45-108), blood urea nitrogen 37.7 mg/dl (8-23), and creatinine 1.6 mg/dl (0.5-1.2), and blood acetone-positive. chest radiography revealed collapse and consolidation in the basal part of the left lower lobe, suggesting pneumonia. abdominal ct scan revealed gastric wall thickening with a collection of dirty air bubbles and a small amount of pneumoperitoneum (fig. operation findings showed nearly total necrosis of stomach wall with dark green colored pus collection around the stomach. grossly, the stomach had a large area of necrosis with black discoloration of the mucosa (fig. the remaining viable stomach wall showed large numbers of neutrophilis in the edematous submucosa and muscle layer. there were several gas-filled bubbles in the submucosa and muscle layer associated with numerous scattered or colonies of gram-negative bacilli, consistent with emphysematous gastritis (fig. 1). at the same time, there were numerous broad-based, non-septate, right angular branched fungal hyphae, morphologically consistent with mucormycosis, detected on hematoxyline and eosin stain as well as silver stains throughout both necrotic and viable stomach wall (fig. culture of pus in the peritoneum revealed klebsiella pneumonia, staphylococcus aureus, and pseudomonas aeruginosa. amphotericin b infusion was added after operation. on the fifth hospital day, there was pus discharge from the wound site. however, the patient remained to have non-toxic appearance with stable vital signs. on the seventh hospital day, he complained of diarrhea and vague abdominal discomfort. over the following 2 days, follow-up ct revealed an approximately 14.012.012.0 cm-sized, irregularly shaped air-containing fluid collection at the gastrectomy site, suggesting air-forming postoperative abscess and anastomotic site leakage. reoperation was performed, and the operative findings showed multiple perforations with necrosis in the transverse colon, necrotic change in the liver, hematoma with fluid collection in the peritoneal cavity, and leakage in the anastomotic site. rouxen-y esophagojejunostomy with cecocolostomy and segmental resection of the large intestine were performed. the submitted pathological specimen consisted of segments of colon, small intestine, and a portion of liver. the gross examination of the segment of colon showed multiple perforations, dirty serosa, and necrotic mucosa with greenish black exudates. microscopic examination of the colon and small intestine showed ischemic necrosis of mucosa with acute and chronic inflammation, and foreign body reaction. microscopic examination of the liver also showed totally necrotic parenchyma with many angioinvasive mucormycotic fungal hyphae. auscultation of the lungs revealed decreased breathing sounds with rale on both lung fields, and saturation of arterial blood gas analysis was decreased. he underwent intubation and ventilation. on the 21st-hospital day, the patient expired. clinically this condition is divided into gastric emphysema and emphysematous gastritis (3, 5, 12). these two conditions should be differentiated because they are characterized by different clinical symptoms, possible etiology, radiologic findings, treatment, and prognosis (3, 5, 12). in gastric emphysema, air enters the stomach wall from the lumen, from the peritoneal surface, or from its connections with the esophagus and duodenum, resulting from barotraumas in the absence of bacterial infection (12). radiologically, in contrast to emphysematous gastritis, a more linear distribution of gas in the gastric wall is characteristic of gastric emphysema (3). the symptom of acute abdomen as seen in patients with emphysematous gastritis is usually absent in patients with gastric emphysema (5). in general, gastric emphysema is asymptomatic; its course is usually benign and resolves spontaneously without treatment (3, 5, 12). on the other hand, emphysematous gastritis, the gas formed in situ by gas-forming bacteria invading the gastric wall, results in a necrotizing inflammation of the gastric wall. in 1889, fraenkel first reported a young man who died after several attacks of severe abdominal pain, blood vomitus, and diarrhea (1). at autopsy, originally, the stomach wall is well protected from bacterial infection by the close connection between cells, acidic ph, and good blood supply (3, 12). the predisposing factors, leading to the breakdown of these defenses, are ingestion of corrosives, alcohol abuse, diabetes, recent abdominal surgery, gastroenteritis, immunocompromised conditions, and treatment with non-steroidal anti-inflammatory drugs (1-3). in the present case, the patient had a history of alcohol abuse, which might have altered the unstirred mucous layer, and diabetes due to chronic pancreatitis, which might have led to a systemic predisposition to infection. patients with emphysematous gastritis typically develop acute abdominal pain, as was the case in our patient, usually developing 1 week after initiation, accompanied by diarrhea, nausea, vomiting, and occasionally hematemesis and melena (1, 4, 12). physical examination of the abdomen reveals epigastric tenderness, distension, and decreased bowel sounds (4, 12). abdominal computed tomography, the best imaging modality to establish the diagnosis, reveals gastric wall thickening and intramural gas (1, 3, 12). in contrast to gastric emphysema, the gas in the wall is in the form of irregular mottled bubbles or spots, especially around the fundus and the greater curvature, and remains in place despite the position of the body or absorption through the gastric tube (3, 4, 12). organisms that have been cultured from stomach aspirates, blood, and peritoneal fluid include streptococci, e. coli, p. aeruginosa, clostridium. perfringens, and s. aureus (1, 4). among the previously reported cases, those associated with fungal infection were rare (4, 11-15). of these, most cases were candida species (4, 11, 12, 15). pathologically, the gas forming organisms in emphysematous gastritis have been shown to infiltrate the stomach wall diffusely and there are edematous stomach wall-containing gas bubbles (1, 6). the therapeutic approach for emphysematous gastritis included initial stabilization of the septic condition through vigorous fluid resuscitation and early empirical parenteral antibiotic therapy with a broad range of antibiotics covering gram-negative and anaerobic bacteria (2, 3, 12, 14). specific therapy should be modified according to the results of the gastric fluid culture and sensitivity testing of the isolated organism (12). indication for emergency surgery include deterioration despite optimal medical management, involvement of a large portion of or the entire stomach, presence of gastric infarction, or perforation (3, 4). despite meticulous treatment, the mortality rate of emphysematous gastritis is about 60%, and the morbidity near 21% (2). mucormycosis is a rare, opportunistic fungal infection that occurs almost exclusively in immunocompromised hosts such as patients with diabetes, leukemia, lymphoma, renal disease, septicemia, burns, malnutrition, and following long-term treatment with steroids and antibiotics (10). clinical manifestations of mucormycosis can be categorized as rhinocerebral, pulmonary, disseminated, gastrointestinal, and cutaneous (9). among these, rhinocerebral and pulmonary disease are the most common forms, and gastrointestinal involvement is very rare, accounting for only 7% of all cases (16). other associated conditions are immunosuppressed conditions such as renal failure, hematological malignancies, cirrhosis, and solid organ transplantation (16). it is believed that infection of the alimentary tract is acquired through direct ingestion of and invasion by fungal spores. the gastrointestinal organ most frequently involved is the stomach, followed by the colon, small intestine, and esophagus (16). when they invade, the lesion extends and marked surrounding induration develops, with a shaggy, velvety discolored surface or large plaqe-like areas of green and blacked eschar (16). they also invade blood vessels and thus tend to cause extensive thrombosis, necrosis, and, ultimately, dissemination (10). association with emphysematous gastritis is an extremely rare, and only one such case has been reported (15). mucormycosis is not gas-forming, therefore this infection is not a direct cause of emphysematous gastritis. gastric wall necrosis caused by bacterial infection may be predisposed to the invasion by mucormycosis. alternatively, it is possible that invasive mucormycosis with subsequent gastric wall necrosis led to secondary bacterial invasion and intramural gas production (15). successful management of mucormycosis includes aggressive metabolic support, amphotericin b, and surgical debridement of all necrotic involved tissue (15, 16). as in emphysematous gastritis, the prognosis of gastrointestinal mucormycosis is poor. forty-two cases of gastric mucormycosis have been described in the literature thus for, with a mortality above 98% (15). we report an extremely rare case of emphysematous gastritis associated with invasive gastric mucormycosis in a 43-yr-old man. heavy alcohol abuse and diabetes mellitus were the predisposing factors. ct is the diagnostic procedure of choice of emphysematous gastritis and helps in differentiating with gastric emphysema. moreover, the gastric mucormycosis showed angioinvasion, necrosis, and ultimately, disseminate to colon and liver. in the case of mucormycosis, biopsy of involved areas this patient also had a fatal outcome despite antibiotic and antifungal therapy and surgery. increased awareness of these disease entities may facilitate early diagnosis, prompt medical therapy, and appropriate surgical intervention, and ultimately improve survival rates.

emphysematous gastritis is a rare form of phlegmonous gastritis, characterized by air in the wall of the stomach due to invasion by gas-forming microorganisms. the most commonly involved microorganisms are streptococci, escherichia coli, pseudomonas aeruginosa, clostrodium perfrigens and staphylococcus aureus. gastrointestinal mucormycosis is another rare condition, which is most frequently occurs in the stomach. because emphysematous gastritis associated with invasive gastric mucormycosis is an extremely rare clinical condition and both are life-threatening diseases, early precise diagnosis and early treatment should be done to avoid mortality. herein we present an extremely rare case of emphysematous gastritis associated with invasive gastric mucormycosis. a 43-yr-old man, suffering from alcoholism and diabetes, has experienced diffuse abdominal pain for 4 days. abdominal computed tomography scan demonstrated gas within the stomach wall. a histologic examination of the total gastrectomy specimen showed several gas-filled bubbles in the wall, along with numerous fungal hyphae throughout the necrotic stomach wall. he died of multiorgan failure secondary to disseminated mucormycosis, despite the intensive medical therapy.

PMC2693866

pubmed-207

in accordance with the 1997 documents of the world health organization (who), amoebiasis is the infection by the protozoan parasite entamoeba histolytica with or without clinical manifestations. the only known natural host of e. histolytica is the human body with the large intestine as the major target organ. this parasite has a very simple life cycle in which the infective form is the cyst that is considered a resistant form of the parasite. the asymptomatic cyst passers and the intestinal amoebiasis patients are the natural transmitters; they excrete cysts in their feces, which can contaminate food and water sources. the cysts are round structures around 1016 m in diameter. however, estimation of cyst diameter in entamoeba spp. in the old and recent literature the cyst has four visible nuclei when mature and only one when immature, and the nuclei are spherical with a membrane displaying small chromatin granules and a central karyosome. when in excystation, each cyst produces eight vegetative forms or trophozoites, which are the motile form of the parasite; they are 2040 m in diameter. life cycle and the relevant structures of both forms of parasite are shown in figure 1. cysts are resistant to desiccation in soil and can survive in humid environments and in water for several weeks. susceptible hosts exposed to the aforementioned infection sources ingest the cysts, which then undergo excystation during their pass through the gastrointestinal tract. amoebiasis is also considered a sexually transmitted disease, particularly in sexual relationships between men and in individuals with sexual anilingus practices. clinical and etiological diagnosis of intestinal and extra-intestinal amoebiasis is neither easy or simple in part because of the discovery of two species made from the previously known e. histolytica species, both indistinguishable under microscopy. e. histolytica sensu stricto is the potentially pathogenic species and e. dispar the commensal non-pathogenic entamoeba. d) trophozoites of e. histolytica species with phagocyted erythrocytes (dic 40) knowledge of both species with different pathogenic phenotypes comes from a large scientific debate during the second half of the twentieth century, which gave rise to the rapid development of diagnosis technology based on molecular and immunological strategies.[59] during the last 10 years, knowledge of the new epidemiology of amoebiasis in different geographic endemic and non-endemic areas has been obtained through the application of mostly molecular techniques.[1014] moreover, these molecular epidemiology studies have unveiled the extraordinary genetic variability[1315] of e. histolytica and e. dispar, allowing the discovery of other entamoeba species, such as e. moshkowskii, which can also infect the human intestine with a significant frequency. however, much of the epidemiology and its contribution to morbidity of entamoeba infections remain unknown. there are excellent recent reviews on the molecular epidemiology and intestinal and extra-intestinal characteristics of amoebiasis in the human host that can be consulted. nevertheless, the major purpose of the present work is to highlight the novelties in regard to human infection and the disease that can help the general physician from both endemic and non-endemic countries in their medical practice. this is especially critical given that emigration is undoubtedly a global phenomenon that is modifying the previous geography of infectious diseases worldwide. the speciation of entamoeba protozoa has been discussed since 1925 when emile brumpt proposed the existence of two distinct species that could infiltrate the human intestine: one associated with symptoms of diarrhea with or without dysentery and the other excreted with feces from asymptomatic individuals. while years of scientific discussions have left brump's theory behind, no molecular technology prior to the 1990s allowed clear differentiation of the currently known e. histolytica and e. dispar species in terms of pathogenic or non-pathogenic phenotypes. both species are genetically diverse and this variability allowed for the beginning of studies on molecular epidemiology in different endemic areas. the new data on the epidemiology of amoebiasis based on frontier technology suggests that genetic variability could be an important tool in the study of geographic distribution of both species and particular strains of entamoeba, which may determine the morbidity rates of different forms of amoebic infection in different geographic areas. some e. histolytica genetic variants (strains) have been isolated from asymptomatic cyst passers, patients with invasive intestinal amoebiasis or from samples of amoebic liver abscess material. however, e. dispar has been mainly isolated in feces samples resulting from asymptomatic cyst passers and displays high genetic polymorphisms, even more than the e. histolytica species. we recently have obtained evidence that in at least two endemic countries (brazil and mexico), e. dispar genetic variants have been detected in patients with invasive amoebiasis. in brazil, the icb-ado e. dispar strain was isolated from a non-dysenteric colitis patient maintained in culture with his own intestinal flora displaying a pathogenic behavior in experimental models of amoebic liver abscess. dna extracted from hepatic abscess material obtained from six patients in mexico also clearly showed the presence of e. dispar dna sequences. the third species of entamoeba, e. moshkowskii, has been considered a free-living organism since 1940s in contrast to e. histolytica and e. dispar, with a geographic distribution mainly in developing countries. e. moshkowskii has been frequently detected in individuals from developed and highly industrialized countries. particularly in regard to this species we are at the beginning of the study of its pathogenic potential and the context in which it is expressed and the epidemiologic significance of infection and its contribution to morbidity rates of diarrheic diseases. what doses of cysts are necessary for colonization of large bowel mucosa? for the three entamoeba species this is not known with any certainty. moreover, we do not know which environmental characteristics are permissive for intestinal colonization, and this could be an interesting field for future research. finally, until today, the only species recognized as an etiologic agent of amoebic invasive disease is e. histolytica, which, once in the colon, undergoes excystation and the generation of trophozoites. trophozoites multiply by binary fusion and some of them may encyst and be excreted with stools. cyst viability under appropriate conditions of humidity may last as long as several weeks and thus they be available for a new susceptible host. we have to stress that more than 90% of infections have an asymptomatic course and are frequently auto-limited at different periods of time. after intestinal infection there is no evidence of induction of a long-lasting protective immune response, and in endemic areas, individuals may have several periods during the year of re-infection and clearance of infection. in relation to the susceptibility of hiv and aids patients to the invasive forms of infection, contradictory evidence exists; however, morbidity seems to be more related to the particular prevalence of the e. histolytica strain with invasive phenotypes than to the specific immunological status of the patient.[2427] as for the invasive behavior of e. histolytica, some authors consider this trait not to be typical. on the contrary the natural history of invasive intestinal amoebiasis is an acute event, characterized by the presence of diarrhea that occurs days or weeks after exposure in our personal experience lasting no more than four to five weeks. although there are reports of occurrence years after exposure, in this case we presume the cause and effect relationship is extremely difficult to corroborate. intestinal amoebiasis is basically an acute disease in which the most frequent symptoms are abdominal pain (colic) and the presence of diarrhea with mucus and/or blood, or a clear dysenteric syndrome. however, fever and other systemic symptoms are infrequent. severe forms of invasive amoebiasis can be observed in young children (< 5 years), pregnant woman, the elderly, and particular those with chronic diseases, such as diabetes mellitus, and in individuals being treated with immunosuppressants or those with immunodeficiency disorders. those severe forms of amoebiasis are colon ameboma, fulminant necrotizing colitis, and toxic mega colon. the appearance of symptoms, such as severe dysentery and pain with signs of peritoneal irritation (rebound), intense tenesmus, fever (> 38c), tachycardia, hypertension, nausea, and anorexia are suggestive of the previously mentioned severe forms of intestinal amoebiasis. the mortality rates of dysenteric syndrome due to e. histolytica are less than 1%, but mortality due to complications increases up to 75%.[2931] fortunately in the last few decades such complications are uncommon. the intestinal amoebiasis form known as chronic non-dysenteric colitis is the most frequent form of amoebiasis in people of all ages, characterized by non-specific symptoms. symptoms more relevant in this instance are periods of abdominal pain (colic) and auto-limited episodes of diarrhea alternating with constipation. however, both non-dysenteric amoebic colitis and irritable bowel syndrome are controversial themes in the clinical practice. where endoscopy examination is available, colonoscopy can be of great help in clinical diagnosis of invasive intestinal amoebiasis. this procedure allows for microscopic examination of samples taken directly from the characteristic flask-shaped ulcer produced by e. histolytica and from other sites of mucosal lesions. microscopic observations of this type of material are described in the diagnostics section and in figure 2. on the other hand, colonoscopy detects the presence of lesions related to the mentioned severe forms of intestinal amoebiasis and allows for differential diagnosis of other pathologies, such as inflammatory bowel disease or colon carcinoma. d) intestinal biopsy obtained from the edge of flask-shaped ulcer where large numbers of trophozoites (he and pas stained, 60) are clearly visible. e) biopsy obtained from the edge of amoebic liver abscess (he and pas stained, 20). notice the presence of trophozoites, hepatocytes, and the large number of inflammatory cells. what circumstances define the extra-intestinal invasive behavior of some e. histolytica strains? this remains unknown today. for example, we do not know the frequency of extra-intestinal invasion after intestinal colonization with virulent e. histolytica. however, this seems to be an infrequent event as suggested by the low morbidity rates of amoebic liver abscess and other extra-intestinal forms of invasive amoebiasis compared with the prevalence rates of asymptomatic infections and intestinal disease. while amoebic liver abscess is a disease that can affect individuals of all ages, in some endemic areas the incidence rates are higher in both children under 5 years and young adults (2045 years). males are also more prone to developing amoebic hepatic abscess than females (1 female for 46 males). after exposure, 80% of patients display symptoms over a few days to 46 weeks. the most common symptoms suggestive of amoebic liver abscess are fever (38c), chills and diaphoresis, anorexia and abdominal pain in the right upper quadrant that increases during inspiration. pain also frequently radiates to shoulder and back. nausea has also been referenced but diarrhea is only occasionally mentioned (50% of cases). hepatomegaly can be detected during digital percussion of the hepatic area and is always related to the dimensions of the abscess; patients can also display peritoneal signs (abdominal guarding or rebound). absence of intestinal noises, jaundice, and pleural or pericardial rub are symptoms that should elicit alarm related to the rupture or imminence of rupture of the hepatic abscess. in general, the right hepatic lobule is the most frequently affected due to the portal circulatory system of the right colon. laboratory findings suggestive of amoebic liver abscess are the presence of leukocytosis, neutrophilia, increased globular sedimentation velocity, and high levels of alkaline phosphatase. thoracic x-ray data useful in the diagnosis of amoebic abscesses, as well as other types of hepatic abscesses, include elevation of the right hemidiaphragm, atelectasis, or pleural effusion [figure 3a]. ultrasound is the gold standard technique for diagnosis of amoebic liver abscess, as its positive predictive value (ppv) is around 95% (85100% depending on analyzed series). although contrast computed tomography (ct scan) [figures 3d and 3e] have a ppv up to 95% due to a higher definition capacity, ultrasound is considerably less expensive compared to ct scan technology, which is of tremendous importance to countries with limited medical and economic resources. ultrasound reveals hypoechoic areas that can be single or multiple with round edges [figure 3b and 3c]. several authors have mentioned the presence of a large single abscess as a frequent characteristic of a amoebic liver abscess. however, this characteristic is not a sine qua non of amoebic abscesses, and in our medical practice we have seen multiple abscesses more frequently than we had first assumed. early lesions due to amoebic invasion of hepatic parenchyma are multifocal in nature (micro-abscesses) as a consequence of tissue destruction and necrosis by proteases from e. histolytica and neutrophil recruitment to the site of infection. the advantage of ct scans and magnetic resonance is detection of small abscesses and the high definition of the images. moreover, other techniques not always available in endemic countries (e.g. gallium scans) can help differentiate between amoebic (cold images) and pyogenic abscesses (hot images). thus, the difference is based on the absence (amoebic) or presence (pyogenic) of white blood cells in the abscess. additionally, we have to mention that in endemic countries the frequency of mixed abscesses (pyogenic and amoebic) is considerable; in our practice this frequency is approximately 17% (non-reported data). another important fact in medical practice is the coincidence of previous symptoms with the presence of high levels of serum anti-amoebic antibodies more than 90% of amoebic liver abscess patients develop this type of antibody response. however, in cases of fast development of amoebic abscess these antibodies may not be present. a) thoracic x-ray of a patient with amoebic liver abscess showing the elevation of the right hemi-diaphragm. ultrasound images of: b) single large amoebic abscess and c) three amoebic hepatic abscesses. d) contrasted computed tomography (ct) scan of a single abscess and e) three clear amoebic liver abscesses etiological diagnosis of intestinal parasitic diseases has been mainly performed using direct or concentration techniques for microscopic examination of fecal specimens. while technically simple in approach, these techniques require the expertise of highly qualified technicians in the morphological identification of ova, cysts, and helminths to be feasible, and the sensitivity and specificity is no more than 80%. while this technique can not differentiate between the three entamoeba species already mentioned, in some endemic communities this is the only diagnostic technology available. on the other hand, during the last 10 years diagnostics in amoebiasis have changed dramatically, considerably improving sensitivity and specificity. some of the current techniques are based on immunological strategies, such as elisa and different modalities of polymerase chain reaction (pcr), with clear advantages in bedside diagnosis and in clinical laboratories of health institutions. even though some of these diagnosis procedures are also suitable for large epidemiologic trials, it is mandatory to make a careful selection of the diagnosis test when the test has to be applied in the field. in particular, the election has to be directed to those procedures that do not need special conditions for sample preservation or pretreatment of specimens in the working field. in our experience, immunologically based diagnostics tests for detection of anti-amoebic secretory antibodies in feces or detection of intestinal amoebic antigens through polyclonal or monoclonal specific antibodies (elisa) are excellent tests in hospitals where fresh specimens (feces) can be obtained. results are reproducible and reliable. in contrast, in epidemiological trials, these techniques can be biased when samples are more than 18 hours old. tables 1 and 2 have a list of diagnostic tests that have proven to be useful in clinical and laboratory diagnosis of intestinal and extra-intestinal amoebiasis in first and second level health institutions. microscopy and immunoassays for e. histolytica detection pcr assays for e. histolytica and/or e. dispar detection the who/paho recommendations published in 1997 contain in detail the actions that who country members have to observe with regard to e. histolytica species infection. they highlight the characterization (when possible) of e. histolytica and e. dispar (we now add e. moshkowskii) to be treated properly. in accordance with the who recommendation only e. histolytica it is also important to remember that in some endemic countries, mixed infections (e.g. e. histolytica and e. dispar) are frequent, and that only those infected with e. dispar should be excluded for anti-amoebic treatment. table 3 shows treatment schedules that have proven to be highly effective in both intestinal and extra-intestinal invasive amoebiasis. in cases of large amoebic abscesses in which imminence of rupture or distances of less than 1 cm between the abscess wall and liver surface prevail, ultrasound-guided puncture is indicated. the procedure allows for the establishment of a differential diagnosis with other liver pathologies, especially pyogenic liver abscess, which is common in clinical practice. treatment of amoebiasis disease in our experience, patients with amoebic liver abscess may not excrete e. histolytica/e. however, some of these patients are asymptomatic cyst passers after treatment with systemic anti-amoebic drugs, such as metronidazole. in such cases, treatment has to include luminal anti-amoebic drugs. at present, evidence of low susceptibility or resistant strains of either e. histolytica or e. dispar species to metronidazole gastrointestinal infections are responsible for morbidity and mortality rates of children and young adults worldwide. in africa, diarrhea is responsible for 2575% of all childhood illnesses. infection and intestinal diseases with icd10 code a00-a09 are the second cause of disease in children under 10 years old in mexico, and intestinal amoebiasis ranks with some annual variations 5 and 6 in the list of the 20 major causes of disease in mexico (http://www.dgepi.salud.gob.mx/anuario/index.html #). causes of diarrhea in endemic areas include a large variety of enteropathogens (viruses, bacteria, and parasites). in mexico, parasitic intestinal infections are multiple infections that constitute approximately 40% of analyzed individuals in which it is possible to detect more than one pathogen together with commensal parasites that are an indicator of fecalism. prevalence of parasitic infection in three different communities in the state of morelos, mexico, are shown in table 4, one of which is a strictly rural population (amacuzac) and two (tlaltizapan and xoxocotla) are suburban communities. the relevance of these results lies in the high frequency of mixed parasitic infections detected in the studied populations. a remarkable low prevalence of soil-transmitted helminthiasis was also observed and could be the consequence of a biannual anti-parasitic treatment of school children with albendazole. this policy was implemented by the health ministry since the 1990s. however, there are emerging parasites with an increasing prevalence in the last 10 years, including blastocystis hominis and in some areas cryptosporidium spp. in south africa intestinal mixed infection is present in 46% of patients with diarrhea and 33% in school children. furthermore, mixed intestinal infections due to bacteria, parasites, and viral pathogens are the major forms of intestinal infection in developing countries. however, cheun et al recently published a splendid study on diarrheal patients in hospitals in korea. the study documented the presence of enteropathogenic bacteria, parasites, and viruses in mixed infections, and highlighted the importance of diarrheal disease associated with protozoan infections. the major association of e. histolytica positive samples was with rotavirus type 1[10.3(6.114.6) positivity/100 infected individuals, 95% ci], astrovirus [9.3(5.213.4) positivity/100 infected individuals, 95% ci], pathogenic escherichia coli [7.2 (3610.0) positivity/100 infected individuals, 95% ci] and clostridium perfringens [10.3(6.014.6) positivity/100 infected individuals, 95% ci]. as the authors mentioned, the question is whether mixed infections with protozoa are more likely to induce serious diarrhea. prevalence rates of parasite intestinal infections in morelos, mexico efforts in the near future have to be directed on studies focusing the interactions of microorganism in the intestinal environment. this knowledge will have a positive impact in clinical and laboratory diagnosis of diarrheic syndrome, its treatment, and thereafter the implementation of more reliable control schedules.

in accordance with the 1997 documents of the world health organization (who), amoebiasis is defined as the infection by the protozoan parasite entamoeba histolytica with or without clinical manifestations. the only known natural host of e. histolytica is the human with the large intestine as major target organ. this parasite has a very simple life cycle in which the infective form is the cyst, considered a resistant form of parasite: the asymptomatic cyst passers and the intestinal amoebiasis patients are the transmitters; they excrete cysts in their feces, which can contaminate food and water sources. e. histolytica sensu stricto is the potentially pathogenic species and e. dispar is a commensal non-pathogenic entamoeba. both species are biochemical, immunological and genetically distinct. the knowledge of both species with different pathogenic phenotypes comes from a large scientific debate during the second half of the 20th century, which gave place to the rapid development of diagnostics technology based on molecular and immunological strategies. during the last ten years, knowledge of the new epidemiology of amoebiasis in different geographic endemic and non-endemic areas has been obtained by applying mostly molecular techniques. in the present work we highlight novelties on human infection and the disease that can help the general physician from both endemic and non-endemic countries in their medical practice, particularly, now that emigration is undoubtedly a global phenomenon that is modifying the previous geography of infectious diseases worldwide.

PMC3125031

pubmed-208

engaging in high levels of physical activity is a key strategy for successful maintenance of weight loss. a study of nearly 4,000 participants in the national weight control registry (nwcr), the largest longitudinal study of successful weight loss maintainers, indicated participants expend 2,621 2,252 kcal per week through physical activity, which is equivalent to approximately 60 minutes of moderate-intensity physical activity per day. additionally, long-term followup of participants in behavioral weight loss programs has shown that those who are most successful at maintaining their weight loss report activity levels similar to those of nwcr participants [3, 4]. many individuals, particularly those who are obese, are insufficiently active, and increasing physical activity can be a challenge [5, 6]. thus, strategies that assist individuals in adopting and sustaining high levels of physical activity to help facilitate a healthy body weight are needed. prior studies have identified multiple strategies for increasing physical activity adoption and maintenance, such as providing home or clinic-based exercise programs, increasing access to active behaviors (e.g., adding exercise equipment in the home), and reducing access to sedentary behaviors (e.g., limiting time to watch television), using pedometers to track activity and progress toward physical activity goals, and accumulating exercise throughout the day in multiple short bouts (10 min) [11, 12]. performing a variety of different types of activities may be another strategy to increase physical activity levels. the national health and nutrition examination survey (nhanes) showed that individuals who reported engaging in a variety of different activities (i.e., walking+other leisure-time activities) were more likely to meet national physical activity recommendations compared to those who reported no variety (i.e., only walking). likewise, in an 18-month behavioral weight loss intervention, overweight participants who reported physical activity variety (i.e., 2 different activities) at 6 months had higher self-reported activity-related energy expenditure and a lower body mass index (bmi) at 18 months than those who did not report physical activity variety (i.e., only 1 activity). thus, while the above findings suggest that physical activity variety may contribute to higher physical activity levels within the context of behavioral weight loss treatment, it is unclear whether physical activity variety is associated with higher physical activity in individuals who have achieved long-term success in controlling their body weight. in the current study, we examined the relationship between physical activity variety, defined as the number of different types of self-reported moderate-to-vigorous activities performed in one week, and minutes spent in objectively measured moderate-to-vigorous physical activity (mvpa) in two groups of individuals who have successfully maintained their body weight long-term: (1) weight loss maintainers with previous history of overweight/obesity and (2) normal-weight individuals without a history of overweight. normal-weight participants were included as a comparison group given that weight loss maintainers represent a unique group of individuals who report strict adherence to multiple behavioral strategies in order to maintain their body weight. due to their unique characteristics and history, it is possible that the association between physical activity variety and mvpa could be different for weight loss maintainers and normal-weight individuals. however, based on previous research showing a relationship between physical activity variety and higher physical activity levels across diverse groups and settings [14, 15], we predicted that engagement in a greater variety of moderate-to-vigorous activities would be associated with higher mvpa daily minutes in both the weight loss maintainer and normal-weight groups. participants were enrollees in the cross-sectional lite study that compared weight control behaviors of weight loss maintainers and normal-weight controls. a convenience sample of men and women was recruited through advertisements placed in national and local publications intended for a general audience. persons interested in participating were asked to either call a toll-free number or to visit a website. participants were recruited from across the united states, although most were from new england, california, and the washington, dc area. weight loss maintainers had a history of overweight or obesity (bmi 25) but were currently normal weight (bmi=18.524.9), having maintained a 10% loss of their lifetime maximum body weight for at least 5 years. normal-weight participants had a current bmi between 18.5 and 24.9 and no history of overweight or obesity. participants in both groups were weight stable (10 lb) for at least 2 years prior to enrollment. of 813 individuals who responded to advertisements and a brief online screening tool, the study protocol was approved by the miriam hospital institutional review board, providence, ri, usa. participants reported information about age, gender, marital status, ethnicity/race, type of employment, and education. weight and weight history were assessed via self-report methods that have been previously validated. questions on the paffenbarger physical activity questionnaire regarding average number of city blocks walked per day, and weekly frequency and duration of sports and recreational activities performed were used to determine variety or number of different activities performed during the past 7 days. only activities that were performed at a moderate or vigorous intensity and for 10 minutes in duration were included given that engagement in these activities is considered necessary for improving health and achieving a healthy body weight [1, 12]. the intensity of sports and recreational activities was determined using the paffenbarger coding scheme. for walking to be counted as an activity, participants had to report walking the equivalent of at least 12 blocks per day (i.e., 1 mile at a moderate intensity). treadmill walking reported as a sports and recreational activity was not distinguished as a separate activity from walking 12 blocks/day. climbing stair flights, walking<12 blocks/day, and sports and recreational activities that were performed for<10 minutes were not considered to contribute to variety. monrovia, ca, usa) was used to objectively measure daily minutes spent in mvpa. this device converts accelerations or movements from vertical, horizontal, and anterior-posterior planes into counts, with greater magnitude or intensity of acceleration over a given time period generating a higher number of counts. participants were sent the device in a postage-paid envelope with instructions on how to activate the device and wear it on their waistband during all waking hours for 7 consecutive days, except while bathing or swimming. each device was programmed with the participant's personal data (sex, age, height, and weight) and set to capture movements continuously in 1-minute intervals. the rt3 has shown to be a strong predictor of oxygen consumption during sedentary and treadmill activities [20, 21] and a more precise measure of physical activity at the group level compared to its tri-trac predecessor. consistent with previously documented methods for analyzing rt3 data, a minimum of 4 days on which the device was worn for 10 hours each day was required for data to be considered valid [23, 24]. rt3 nonwear times, defined as periods of 30 consecutive minutes of zero counts (permitting intervals of up to 2 consecutive minutes registering 1100 counts/min), were deleted from analysis. the remaining time was partitioned according to intensity level. based on previous rt3 validation research and a recent study that used the rt3 to compare mvpa patterns in weight loss maintainers, normal-weight, and obese groups, we computed time spent in mvpa using a threshold of 984 counts/min. descriptive statistics are presented in tables as means sd for continuous measures and percentages for categorical responses. chi independent t-tests were conducted to assess differences between the groups on demographic characteristics, weight, accelerometer daily wear time, mvpa minutes/day, and reported variety/number of different types of moderate-to-vigorous activities performed. linear regression was used to examine the associations of physical activity variety and group status (weight loss maintainers versus normal weight) with objectively measured mvpa minutes/day, adjusting for age, gender, years of education, marital status, bmi, and accelerometer daily wear time. logistic regression was used to assess whether physical activity variety and group status were associated with achieving the 250 mvpa minutes/week recommendation for optimal long-term weight maintenance. for this analysis, mvpa minutes/week was calculated by multiplying average daily mvpa minutes by 7 (days). of 413 participants who were sent an accelerometer and the ppaq, 394 (95%) met valid accelerometer wear requirements and provided complete data on the ppaq. the characteristics of these 226 weight loss maintainers and 169 normal-weight participants are presented in table 1. both groups were similar in age (48.8 12.9 years), gender (84% female), marital status (66% married), race/ethnicity (94% caucasian), employment status (82% employed), and job type (95% in professional or clerical positions). a greater proportion of normal-weight participants was college educated, compared to the weight loss maintainers. both groups were normal weight, although the weight loss maintainers had a slightly higher bmi. on average, weight loss maintainers had lost nearly 29 kg and maintained 10% weight loss for 13.7 9.6 years. there were no differences in accelerometer wear time between the groups, with the weight loss maintainers and normal-weight participants wearing the accelerometer for an average of 14.8 2.0 hours/day on 7.5 0.9 days. as reported previously, weight loss maintainers spent an average of 6 minutes more per day in mvpa, compared to normal-weight participants (58 versus 52 min/d). the variety/number of different activities performed by the weight loss maintainers and normal-weight participants was similar (1.8 1.2 versus 1.7 1.2, p=0.52). additionally, when participants who reported no moderate-to-vigorous activities were excluded, the variety/number of activities performed by wlm (n=180) and nw (n=141) remained similar (2.2 1.0 versus 2.0 1.0, p=0.10). we next examined the independent and joint associations of physical activity variety and group status with mvpa minutes per day. given that the physical activity variety group status interaction was not significant (p=0.73), the results of the main effects linear regression model for mvpa minutes per day are shown (table 2). greater physical activity variety (p<0.001) and weight loss maintainer status (p<0.05) were independently related to greater daily time spent in mvpa, after adjustment for demographic characteristics (age, gender, educational level, marital status, current bmi) and daily accelerometer wear time. figure 1 presents estimated mvpa minutes per day in the weight loss maintainer and normal-weight groups by reported number of different moderate-to-vigorous activities performed. across both groups combined, the number of moderate-to-vigorous activities ranged from 0 to 4, with 73 participants (18.5%) reporting 0 activities, 105 reporting 1 activity (26.6%), 112 (28.4%) reporting 2 activities, 74 reporting 3 activities (18.7%), and 30 (15.4%) reporting 4 or more activities. each 1 unit increase in the number of different moderate-to-vigorous activities performed was associated with an additional 9.4 1.3 daily minutes spent in mvpa, representing an additional 56.2 8.3 kcal expended per day based on rt3-derived estimates. similarly, logistic regression analyses showed that greater physical activity variety (or=1.78 [1.372.30], p<0.001), weight loss maintainer status (or=0.23 [0.080.69], p=0.002), and lower bmi (or=0.81 [0.690.95], p=0.01) were independently associated with meeting the 250 mvpa minutes/week guideline for optimal weight maintenance. the physical activityvariety group status interaction was not significant (p=0.25). given the continuing obesity epidemic and growing evidence that indicates greater amounts of physical activity are needed for successful long-term weight control, it is important to identify strategies that can assist individuals in adopting and maintaining high levels of physical activity. this study examined whether performing a greater variety of different types of moderate-to-vigorous physical activities was related to greater time spent in mvpa among weight loss maintainers and normal-weight individuals without a history of overweight/obesity. we found that, independent of group, greater variety was associated with higher daily mvpa minutes and meeting the 250 mvpa minutes per week recommendation for optimal long-term weight maintenance. these findings are consistent with previous studies of the general population and in overweight/obese individuals undergoing behavioral weight loss treatment. however, the present study is the first to show a relationship between greater physical activity variety and higher objectively measured mvpa duration and energy expenditure in two groups of individuals who have had long-term success in maintaining a normal body weight. we found that for each additional different type of moderate-to-vigorous activity performed, participants on average spent an additional 9 minutes in mvpa and expended 56 more kcal per day. thus, for example, participants who reported engaging in 3 different activities during the previous week spent on average an additional 18 minutes in mvpa and expended 112 more calories per day compared to participants who reported engaging in only 1 activity. while our findings do not imply causation, they do warrant additional longitudinal research to examine whether incorporating variety into a physical activity routine may be an efficacious strategy to achieve higher mvpa levels for enhanced weight control. the relationship between greater physical activity variety and engagement in higher mvpa levels may be potentially explained by a number of physiological and psychological factors. for example, alternating different physical activities that involve different muscle groups and energy systems (aerobic, anaerobic) might promote greater exercise consistency by affording more time for recovery and decreasing risk of overuse injuries [13, 26]. participating in a variety of activities may also facilitate greater exercise adherence via increased enjoyment and decreased boredom [13, 26]. greater access to a variety of activities may increase the likelihood that individuals will find an exercise activity or a combination of exercise activities that they like and will perform regularly. additionally, research based on the behavioral economics model suggests that motivation to exercise is enhanced when individuals can choose from a variety of physical activities versus only one physical activity [28, 29]. consequently, adding a variety component to a physical activity prescription may aid individuals in achieving and maintaining high levels of physical activity. future research is needed to investigate potential mechanisms that underlie the relationship between variety and higher mvpa levels. whereas increased variety of healthy physical activities is associated with greater time spent in mvpa, it is also possible that decreased variety of unhealthy sedentary activities might contribute to lesser time spent being sedentary and higher overall physical activity levels. given that sedentary behaviors, independent of physical activity, have shown to be detrimentally associated with bmi and other cardiometabolic risk factors [30, 31], future studies that examine the association between variety and sedentary behaviors are needed. the cross-sectional nature of our study does not allow us to determine whether greater variety contributes to higher mvpa levels or alternatively whether individuals with higher mvpa levels naturally incorporate more variety into their physical activity routine. as variety in physical activity is rarely measured, the importance of factors such as the time frame for assessing variety (i.e., a week, month, year) and frequency of occurrence of different activities within the time frame (i.e., once a week, twice a month) are not known. while the use of an objective measure of physical activity is a strength of this investigation, it is important to note that hip-worn accelerometers like the rt3 used in this study may be limited in their ability to accurately estimate the intensity of activities not performed on flat surfaces. thus, it is possible that mvpa was underestimated in individuals who more frequently engaged in activities that involved an incline or greater upper body movement. additionally, the accelerometer count threshold we used to identify mvpa was determined in a leaner, younger male sample and thus may have affected validity in our older, largely female sample. given the homogeneity of our sample with respect to gender (female) and race (white non-hispanic), our results may not be generalizable to men or other ethnic populations. similarly, participants in this study were all normal weight and had high physical activity levels on average. thus, future investigations should examine the potential importance of variety for increasing physical activity in overweight and inactive populations. finally, it is important to note that just as altering the variety of different types of activities performed could potentially increase mvpa duration and energy expenditure, so could altering the frequency, intensity, and duration of a single activity, independent of changes in physical activity variety. in summary, this study examined the relationship between physical activity variety and objectively measured mvpa levels in weight loss maintainers and normal-weight individuals who both had long-term success in maintaining their body weight. in both groups, physical activity variety was related to greater engagement in mvpa and likelihood of accumulating 250 mvpa minutes/week, consistent with physical activity guidelines for optimal long-term weight maintenance. future studies are needed to test whether incorporating variety or different types of activities (e.g., walking and cycling) can facilitate engagement in higher levels of mvpa within interventions aimed at promoting and maintaining physical activity.

given the importance of physical activity (pa) for weight control, identifying strategies to achieve higher pa levels is imperative. we hypothesized that performing a greater variety of self-reported moderate-to-vigorous activities (mvpas) would relate to higher objectively measured mvpa minutes in two groups who were successfully maintaining their body weight: weight loss maintainers (wlm/n=226) and normal-weight individuals (nw/n=169). the paffenbarger questionnaire and rt3 accelerometer were used to determine variety/number of different mvpas performed and mvpa minutes, respectively. the variety/number of different activities performed by wlm and nw was similar (1.8 1.2 versus 1.7 1.2, p=0.52). regression analyses showed that greater variety (p<0.01) and wlm status (p<0.05) were each positively related to greater mvpa minutes/day and meeting the 250 mvpa minutes/week guideline for long-term weight maintenance. the association between greater variety and higher mvpa was similar in nw and wlm. future studies should test whether variety can facilitate engagement in higher mvpa levels for more effective weight control.

PMC3306916

pubmed-209

recently we reported on an analysis of the infrared spectrum of c2f4. by observation of many combination and difference bands, including many from two c-containing isotopologues, and by comparison with mp2 and density-functional calculations, all 12 fundamentals could be assigned, although only five are ir active. the geometry was deduced from ro-vibrational analysis of strong ir active bands and by comparison with theoretical calculations. however, it is also instructive to correlate anharmonic constants with some peculiarities of the reactions of c2f4. accordingly, in this work more anharmonic constants (altogether 54) are derived from the spectra, and a complete set (78) is calculated. the earlier vibrational assignments of c2f4 were reported at a time when the unusual properties of this molecule were barely known. explained this property by positing that the electron attraction of fluorine leads to a preference of sp- over sp-type carbon: radical addition converts both c atoms from sp to sp hybridization, which stabilizes the primary product, lowers the transition state, and thus accelerates the reaction. alder reactions, for example, which was again explained by stabilization of radical intermediates. (borden also presented an alternative but related description based on delocalization of unpaired radicalic electrons to accepting*orbitals of cf groups.) the preference for carbon sp hybridization can also be expected to lower the force constants for the pyramidalization (wagging) vibrations (7, 8) and/or increase their anharmonicity. furthermore, torsion (4) should be facilitated by rehybridization and in fact quantum chemistry confirmed this for a 90 twist. another spectacular property of c2f4 is how readily it can dissociate thermally to two cf2 molecules. a c=c bond energy of only 2.95 ev is derived, less than that of a typical c c single bond (4 ev). the low dissociation energy is caused by stabilization of the resulting two difluorocarbenes by back-bonding from nonbonding fluorine electrons to the empty carbon p-orbital. this also explains why cf2 has a singlet ground state which is more stable than the triplet (by 2.458 ev, taken from the band origin of the phosphorescence spectrum). whereas in the previous work, only cc stretching is considered as the dissociation coordinate, it was argued in ref (16) that pyramidalization must also be involved. this idea is supported in the present work by the large value found for the anharmonic constant x18 coupling cc stretch with trans pyramidalization. the magnitude of x18 as compared to the much smaller x17 (coupling cc stretch with cis pyramidalization) also supports a valence-bond analysis of weak double bonds, which was reviewed in ref (19). the samples in natural isotopic abundance were either taken from commercial c2f4 (hoechst), that contained a trace of the cyclic dimer, or prepared from c2f4br2+zn in a high-boiling alcohol (diethylene glycol); the comparison allowed for recognizing absorptions of impurities. a sample enriched in c to 50% was prepared from chclf2 by co2 laser isotope separation with enriched cf2 as the primary product. ir spectra of c2f4 in natural isotopic abundance and isotopically enriched were recorded between 370 and 4000 cm with 0.2 cm resolution by a perkinelmer ftir spectrometer in garching. at the synchrotron lab, the isotopically enriched sample was measured at moderate 0.1 cm resolution in the far ir region from 100 to 600 cm (capturing the band at 210 cm), and at high resolution for the ir active cf stretch bands, see ref (1). the present work focuses on anharmonic constants of c2f4. only where the constants were expected to be different for ccf4 and c2f4 (e.g., in the case of fermi resonance) theoretical values of the anharmonic constants xij were obtained from anharmonic vibrational frequency calculations performed using gaussian 03 revision c02 at the mp2 level using dunning-type correlation-consistent (cc-pvtz) orbitals. the molecular force field at this level of theory was shown in the previous study to reproduce the fundamental wavenumbers and the isotopic shifts of c2f4 very satisfactorily (for details, see ref (1)), and hence was an appropriate choice for computing xij values. the calculations were performed for each of the c2f4, ccf4, and c2f4 isotopologues. the spectra were measured previously and the fundamentals extracted from them, using a limited number of anharmonic constants (from combination and hot bands) where necessary. for convenience table 1 lists the fundamentals again. in this work we derived a large set of experimental anharmonic constants from combination bands and in particular for the lower-wavenumber vibrations from hot bands, and report a complete set of theoretically computed values. symmetry types refer to a d2h molecule with z axis along the cc bond and the y axis perpendicular to the plane, as used in ref (1) for easier comparison with the c2v symmetric ccf4; the more conventional designation with x axis along the cc bond and z axis perpendicular to the plane is given in parentheses. revised value (instead of 210 cm), based on a more definite assignment of a hot-band structure and x10,10, see supporting information. band origins from high-resolution spectra; low-resolution values are 1338.4 and 1187.0. upright: experimental values. in parentheses: values calculated by mp2/pvtz. where two values or a range are given for the experimental data, it may indicate (a) a dependence of the effective xij on the involved levels due to perturbations (fermi resonances, section 4.4) or (b) an uncertainty due to error limits (e.g., where broad bands are involved) or an uncertain assignment. a preferred value is indicated by bold face. for further details on the derivation of each xij and some isotopic data, the anharmonic constants xij were calculated from observed combination and difference bands by assuming that anharmonic shifts are additive: for binary combination bands (i j) and for overtones we used1and2with obvious extensions for more complicated combinations. (the xij values are mostly negative, as usual.) the left-hand side of these equations should be read as wavenumber of (name). for hot bands (satellite transitions near i that originate from a thermally populated lower level j) we used3again with obvious extensions. one can often observe sequences of equidistant q branches, corresponding to hot bands starting from higher levels mj, or combination of such sequences (from mj+nk). equation 3 implies that the distance of a (first) hot band from the fundamental directly indicates the corresponding anharmonic constant. combination bands allow for a direct assignment, whereas hot bands must be identified by their intensity (controlled by the boltzmann factor). in a number of cases the supporting information (si) compiles the sources for each xij in table s2, whereas table s1 lists the observed bands (with hot bands) and their isotopic shifts. two examples of hot bands, whose shifts are dominated by the large x18 anharmonicity, are shown in figure 1. absorbance spectra demonstrating the large x18 derived shifts for hot-bands originating in 8. the spectra were recorded in the garching laboratory, with pressure and path length of 2 bar and 10 cm (for the lower trace of each panel), and 140 mbar and 4 m (upper trace), respectively. for levels involving more than two quanta of vibration, anharmonic shifts this helped to decide between different assignments of combination bands in a few cases where the harmonic sums were similar to each other. however, such additivity need not apply when the levels involved are subject to fermi resonance, producing shifts that depend on the separation of nearby interacting levels. we use eqs 13 to obtain the experimental values, and hence, table 2 reports phenomenological xij, some of which show a spread in the values suggestive of fermi resonances (in particular x18, x26, and x77). fermi resonances can also be recognized if the apparent xij or the hot-band structure depends on the isotopologue. for c2f4, fermi resonances were identified (see section 4.4 and si) between:5 and 2+6 (discussed already in ref (1)),1 and 5+6 (indicated by the hot-band structure of 1-combinations, which are different in the mixed isotopologue),2 and 27 (causing irregularities in overtone levels of 7, also contributing to the large magnitude of x27 and x77).2 and 23, identified from the mp2 calculations. 5 and 2+6 (discussed already in ref (1)), 1 and 5+6 (indicated by the hot-band structure of 1-combinations, which are different in the mixed isotopologue), 2 and 27 (causing irregularities in overtone levels of 7, also contributing to the large magnitude of x27 and x77). 2 and 23, identified from the mp2 calculations. the mp2/cc-pvtz calculations reproduced the observed wavenumbers and isotopic shifts very well. supporting the overall vibrational analysis exceptions are 15 (x22, x28, x29, x2,10, x2,11, x36, x3,10, x45, x59, x5,11, x66, x68, x77, x88, x10,11) out of 54 cases where an observed value is available for comparison. some of these will be discussed below. as already described in the introduction, the peculiar reactions of c2f4 have to do with cc stretching and carbon pyramidalization. the discussion will focus on these coordinates (sections 4.14.3). for a planar geometry, cc dissociation correlates c2h4 and c2f4 with a pair of carbenes in their lowest triplet states (figure 2a). because the energy of forming these products is practically the same for the two molecules, one could also expect that the potential energy curves coincide and the cc stretch force constants are equal. in fact, already early force-field calculations showed no substantial difference (889 n/m for c2f4 and 940 furthermore, the short cc distance (132 pm, which is 1 pm shorter than in ethylene) and the high cc stretch wavenumber (1873.8 cm, compared to 1625.4 cm for ethylene) do not point to a weakened bond. as early as 1965, the low dissociation energy of c2f4 was attributed to switching over to a channel producing two singlet carbenes and to the stabilization (by 2.458 ev, see introduction) of singlet cf2 by back bonding, so that this channel is energetically favored by 4.9 ev. this path hence leads over an avoided crossing of potential surfaces (figure 2a). if the avoidance is strong, one could expect an influence at least on the anharmonicity x11 (1 is dominated by cc stretching), even if not on the force constant at the bottom of the potential energy well. table 2 shows that the magnitude of x11 (calculated 7.8 cm) is not unusually large for such a high-frequency vibration, though noticeably larger than for ethylene (x22=2.3 cm). that the increase in magnitude is only moderate can be taken as a sign that the avoidance along this coordinate is not very strong. hence, the back reaction (recombination) will have a high barrier in planar geometry. whereas the measured recombination barrier is not, in fact, zero, it is only minor (9 kj/mol=0.09 ev). so, a lower-energy path must lead around the barrier, out of the drawing plane of figure 2a, that is, with distortion different from cc stretch. potentials for ground-state cc dissociation of c2f4, leading over an avoided crossing to two singlet carbenes. in (a) it is assumed that the one-sided pyramidalization (q7+q8) begins only after overcoming the barrier, whereas (b) shows the preferred path, where this distortion is already fully developed on the barrier and is preceded by a trans pyramidalization (q8), while the cc distance is steadily increasing. it was argued in ref (16) that recombination of two cf2 molecules should be easiest if one of them points with its filled n orbital to the empty p orbital of the other. hence, the dissociation path will change from pure cc stretch to include also pyramidalization (figure 2b), and the potential should be lowered in energy in the direction of q7 (the coordinate of 7) and/or q8. in turn in fact x18 has an unusually large magnitude, although x17 is in the normal range (table 2). (the magnitude of x18 is not caused by secondary effects such as fermi resonance, as we shall see in section 4.4.3.) we can conclude that on stretching the cc bond the molecule first bends toward trans pyramidalization (q8) (figure 2b). the one-sided nonplanar bending (figure 2) is a superposition of q7 and q8. the reason why q8 is active earlier than q7 can be understood by a valence-bond model for weak double bonds. in this model several symmetric arrangements of carbenes (a c of scheme 2) were considered: whereas with two triplet carbenes all arrangements (a d) lead to bonding interaction, with two singlet carbenes bonding occurs only in the trans-bent case (c); this corresponds to a double donor one can add that the cis-bent case with singlet carbenes would lead only to antibonding (scheme 2d). malrieu and trinquier derived a criterion for trans-bending (deriving even the angle) by comparing the standard double-bond energy with the singlet their findings were confirmed by many examples, in particular with heavier-element homologues. we can apply this rule not only to the equilibrium geometry of c2f4 but also to its dissociation path, if we consider in the comparison the double-bond energy that is reduced on extension of this bond. the rule thus predicts that on cc extension c2f4 is distorted from planar geometry to a trans-bent structure, and this rationalizes the large magnitude of x18. in the triplet case, the interaction can be bonding in all arrangements. in the singlet case, (a) is antibonding, (b) nonbonding, (c) bonding, (d) antibonding. more recently, borisov et al. found evidence for trans pyramidalization on extension of the cc bond also from molecular orbital calculation (at high level: mller plesset perturbation theory of second, third and fourth order): the authors found that the onset is relatively sudden on cc extension to 142 pm and that the distortion lowers the energy appreciably. (the large x18 anharmonicity is an indication that this pyramidalization already begins not far from the s0 minimum. in fact, a cc stretch by 10 pm from 132 to 142 pm is just about the vibrational amplitude in the 1= 1 level.) although borisov et al. did not find an energy minimum with such a distortion, they suggested that it plays a crucial role in the low-energy real intermediate found by buravtsev, kolbanovskii et al. in thermal reactions of c2f4 and recombination of cf2 (see ref (31) and literature quoted therein and section 4.3). one could suppose that in order to lower the activation energy for dissociation the only necessary deviation from simple cc stretching is distortion toward the 8 coordinate (q8). however, there is experimental evidence that the asymmetric pyramidalization (corresponding to superposition of q7 and q8 as in figure 2b) is already crucial in the transition state: the pre-exponential factor found in the rate of thermal c2f4 dissociation (2.8 10 s) is clearly larger than would be typical for a simple bond splitting (10 s). this corresponds to a raised entropy of activation, such as that which happens if an additional degree of freedom is activated in the transition state. the most plausible candidate is free internal rotation, as it can be expected in the asymmetric structure with a single dative bond but not in symmetric geometry with double donor acceptor bond. this picture is also consistent with a stepwise cleavage of the double donator acceptor bond on c2f4 dissociation and its stepwise formation on cf2 recombination. it is worth noting that the molecule with one-sided pyramidalization has an electron distribution (figure 2b) that is zwitterionic and correlates in planar geometry with the 2ag state with two electrons excited to *, as already pointed out in ref (16). a fully analogous dissociation path can also be expected for the other systems considered by malrieu and trinquier. in fact, according to ref (32) ground-state (ir induced) dissociation of diazomethane (h2cnn) follows a path with a pyramidalized methylene group to produce n2+singlet ch2; the out-of-plane deformation was experimentally confirmed. in the backward reaction, n2 points with its n electron pair to the empty p orbital of the singlet methylene (see refs (32 and 33) for a calculated potential in two dimensions, which would look similar for c2f4). hence, the out-of-plane deformation on dissociation of c2f4 is not an isolated phenomenon. applying their energetic criterion to the equilibrium geometry of c2f4, trinquier and malrieu found that this molecule is not far from the limit, where it would become nonplanar, and suggested that the 8 force constant may be significantly lower than that of ethylene. this is in fact confirmed in the following way: analytical expressions for a valence force field model for planar x2y4 were given by herzberg. besides the masses mx and my, bond lengths l1 (for xx) and l2 (xy) and the angle (half of yxy), both 7 and 8 only depend on the force constant for pyramidalization (k/l2). with equilibrium distances and angles from ref (1) and i=(2ci) one derives this force constant from 7 and 8 (with identical results for c2f4 and c2f4):4both values should be identical in this valence-force field model. in fact for ethylene, the value is 22.9 n/m, whether derived from 7 or 8. the pyramidalization force constant derived from 7 of c2f4 is slightly higher than in ethylene (by 17%), but the same quantity derived from 8 is only 49% of the ethylene value. (of course, these values are not quantitatively meaningful, as the discrepancy highlights that a pure valence-force field model is not sufficient for wagging of c2f4.) so in fact the restoring force for the 8 vibration is significantly smaller than in ethylene and than that expected on the basis of the same pyramidalization force constant as for 7. this is consistent with the prediction of the valence-bond model favoring the trans-bent geometry. the slightly raised force constant for 7 could be due to repulsive nonbonding interaction in cis pyramidalization. such a geometry would be involved in the hypothetical transition state of the diels alder addition of c2f4 to butadiene, a reaction that has not been observed. it was argued that an increased energy associated with this distortion might contribute to inhibiting the reaction. however, an increase in the force constant of only 17% is hardly sufficient to support this explanation, and the other effects discussed in ref (7), in particular the competing fast radical reactions, are probably more important. applying again the force-field formulas of herzberg, the force constant for torsion, k/l2, is found to be 30.3 n/m for both ethylene and tetrafluoroethylene. that is, near the potential minimum the c=c bond in c2f4 behaves just like a normal double bond. consequently, the torsional barrier at a 90 twist (which is a measure of the bond strength) would be identical for both molecules (2.8 ev) if the two c cf2 groups remained planar; this was confirmed by a high-level calculation. however, pyramidalization lowers this barrier by 0.57 ev (at mp2 level, consistent with ref (35)). if this stabilization is activated early along q4, it could give rise to substantially negative values for x44 and especially for x47 and x48. however, x44 and x47 are actually slightly positive (0.8 and 0.3 cm) and x48 has no unusual magnitude (0.7 to 1.05 cm). evidently, the stabilizing effect of pyramidalization becomes effective only at high torsional angles. the corresponding values for ethylene are 2.4, 8.9, and 7.2 cm, respectively. the nondiagonal anharmonicities xi4 and x4j are generally smaller in magnitude than in ethylene. but this may simply have to do with the relative vibrational amplitudes, which are much larger for torsion of ch2 than of cf2 due to the relative masses. in the twisted-pyramidalized structure of c2f4, the triplet (t1) is only 0.013 ev lower than the singlet (s0). it can therefore act as a real intermediate and undergo radical-type reactions, further assisted by its low energy that is calculated at 2.1 ev. this has been a widespread interpretation of some peculiarities of c2f4 reactions (see, for example ref (7)). however, buravtsev, kolbanovskii et al. found in shock-tube experiments (with c2f4 diluted by ar and adiabatically compressed) an intermediate at much lower energy (0.8 to 1 ev) with uv and visible absorption (235 and 500 nm) (see refs (31,36, and 37) and the literature quoted there). they supposed it to be a singlet diradicaloid of c2f4 with a geometry corresponding not to an energy minimum but to a point on a slope of the potential (see, for example ref (31)). however, as these points are not stationary there are too many (nearly) isoenergetic locations with shifted electronic transitions, so that the electronic absorption would be smeared out. it was therefore suggested that the observed intermediate is another low-energy isomer, tetrafluoro-ethylidene cf3cf (electronic absorption in an ar matrix:). however, its energy (1.9 ev) seems to be nearly as high as that of the twisted-pyramidalized triplet. (in one study the twisted-pyramidalized c2f4 triplet is calculated at 0.90 ev, but computational details are not given, and previous theoretical results are not discussed.) some more anharmonicities of table 1 have unusually large magnitudes or show a range of values and/or deviate from prediction. in many of them fermi resonances play a role, as will be explained here. in section4.4.3, however, it is shown that x18 is hardly influenced by such effects and its large magnitude mainly results from the overall shape of the potential energy surface. fermi resonances mix two nearby levels of the same symmetry, which differ by three units in the quantum numbers. the fermi-induced repulsion of the levels depends in a nonlinear way on both the magnitude of the fermi interaction parameter and on the original (i.e., unperturbed) energetic distance of the levels. this separation will, in general, change (a) on isotopic substitution and (b) on adding a quantum of another vibration (i.e., in analogous combination bands; similarly also in higher overtones, in which case a quantum number dependence must also be taken into account). another method of characterizing fermi resonance interactions relies on intensity borrowing caused by the mixing of levels. according to the mp2 calculations, the great majority of xij change by 1 cm on isotopic substitution the few exceptions are listed in table 3 and are compared to experimental values. identified (fr13) and the interpretation in the line influenced by is based on the assumption that an xij is affected by such a resonance if at least one of the levels i and j is involved in the fermi interaction. the table shows that the calculated isotopic shift is sometimes much larger than in the experiment, for instance x26, x27. also x56 for c2f4 is probably too large, as the two observed bands 5+6+11 and 5+6+12 are close to their harmonic positions (table s1 in si). it seems that at the present level of theory, the calculation does not reliably reproduce the fermi resonance induced shifts, at least the stronger ones. this is not surprising given the highly sensitive and nonlinear dependence of fermi shift on the unperturbed level separations. the same deficiency will also affect those xij connected with at least one level (or a combination thereof) involved in a resonance listed above (examples in figure 3a). in fact, 10 of the 15 deviations listed at the end of section 3 can be attributed in this way to the resonances fr1 and fr2 with possible contributions of fr3. the exceptions are x36, x3,10, x66, x68, and x88. in all 42 other cases it is worthwhile to consider the two strongest fermi resonances, fr1 (2/27) and fr2 (5/2+6), in c2f4 in some detail. the effect of these resonances is summarized in figure 3. some levels involved in fermi resonances and observed transitions. solid arrows: ir, broken arrows: raman; double arrows (with interaction matrix element) indicate repulsion between level pairs. the anharmonic shifts involving x77 are only nominal, because the fermi perturbation is strong: 6x77 =18.1 is less than 3 times (= 8.2) and 4x77 is only 9.9. (but 2x77+4x77=6x77, as is obvious from the level scheme, and the raman anharmonic shifts practically coincide with those from the ir spectra.) (b) three-level fermi resonance 5/2+6/27+6 and their combinations with 9 for c2f4 and c2f4. the indicated level energies are from the spectra except those in parentheses, which are calculated. the broken horizontal lines are the estimated unperturbed positions (see the si), and the signed numbers are the calculated shifts. the 16.4 cm magnitude of the interaction term (with its expected dependence on quantum numbers) has been derived from band shifts and intensities for a series of levels built on 2/27 for all three isotopologues. bands for 27+x (x=9, 11) borrow their entire intensity from 2+x. the detailed analysis is provided in si. it is also evident that x77, x27 and x22 are affected by the fermi resonance (and probably other x2i, if the level separations differ) and that x77 is level dependent because of the varying separation. the fermi term is almost entirely responsible for the +8.2 cm shift of 27 for c2f4 and those of the heavier isotopologues (table 3 under fr1). in the latter the fermi-induced shift is increased, because the levels 2 and 27 (before perturbation) are closer together than in c2f4 and are practically degenerate in c2f4. the success of these calculations shows that the additional mixing of 2 with 23 (fr3) is apparently a weak perturbation at most. the fermi resonance fr2 between 5 and 2+6 was qualitatively discussed in ref (1). a more complete understanding of the resonance shifts and pattern of intensity borrowing requires the three-level scheme shown in figure 3b; this figure also shows combinations with 9, as they are all ir active and were directly observed. analysis based on this model has enabled the magnitude of the fermi term to be determined as 11 cm; the fr1 term of 16.4 cm was used without change. significantly, the model predicts varying fr shifts that even differ in sign (originating from the different repulsions in figure 3b) and can thus account for the unusual isotopic shifts observed between c2f4 and c2f4. it explains a substantial deviation of the observed isotopic shift 5=51.9 from the value of 5=43.1 expected from the teller redlich product rule, which is valid for harmonic oscillators. additionally the relative intensities of combination bands and their isotopic dependence are well predicted. it is also remarkable that according to the model the largest part of the anharmonicity x26 is due to fermi resonance. as described in ref (1), the lower symmetry in ccf4 leads to strong mixing of 5 with 9 (which are nearly degenerate in c2f4). the two levels repel each other (even in the harmonic approximation) and give rise to two infrared-active transitions. it is sometimes difficult to disentangle them and their combination bands from the spectra. if the large magnitude of some anharmonicities is caused by fermi resonance, a crucial question is whether this might also be the case for x18. if so, the conspicuous value of x18 could be largely a matter of the character of the resonance and less a consequence of global features of the potential for dissociation, which we considered in section 4.1. in fact, weak perturbations of the 1 level and its combinations by the 1/5+6 fermi resonance are indicated by the slight x18 dependence on the level and on isotopic substitution and the change of the hot-band structure of 1 combinations in ccf4, as explained in the si. a quantitative estimate of the strength of the 1/5+6 interaction can be deduced from the intensities of 5+6 combinations relative to those of the corresponding 1 combinations, assuming that the former borrow their full strength from the latter. the 5+6+12 band (2444.3 cm) has 12% the strength of the 1+12 band (2428.7 cm), see figure 1a. similarly, the 5+6+11 shoulder (3072 cm) is<1% as intense as 1+11 (3056.2 cm) and clearly visible only with longer path length than shown in figure 1b. from both observations, one can estimate a fermi term (w) of no more than 2.5 cm, causing a shift (and consequent change in x18) of<0.5 cm. this is actually an upper bound, because such weak bands can also be expected without intensity borrowing. hence, fermi resonance affects the magnitude of x18 only by a little (by<3%), and we can maintain the conclusions of section 4.1 on the shape of the potential. a large set of anharmonic constants of c2f4 was derived from spectroscopic data, and a complete set was calculated. most of the calculated and experimental values agree very well, and nearly all deviations can be attributed to fermi resonances. the values were used to interpret peculiarities of the potential and reactions of this molecule. the facile thermal cc dissociation of c2f4 is due to curve crossing of the ground state (1ag) with the two-electron excited zwitterionic 2ag state. the crossing barely alters the properties of the potential curve (cut purely as a function of cc stretch) near the equilibrium geometry; the force constant for cc stretching (1 in c2f4, 2 in c2h4) is nearly identical for the two molecules. only a slightly larger magnitude of the anharmonicity x11 compared to the corresponding x22 of ethylene provides a hint of a weakly avoided crossing in planar geometry of c2f4. however, the large magnitude of x18 leads us to conclude that the dissociation path bends early toward q8, i.e. to trans pyramidalization of the two carbon atoms (figure 2b). this is rationalized by a valence-bond model, which describes the stretched cc bond as a double donor acceptor bond (scheme 2c). it is also consistent with the tendency of fluorine to induce sp hybridization at carbon, although this preference alone would also allow cis pyramidalization, q7, which is not involved early in dissociation. on further cc stretching, one of the two donor acceptor bonds breaks, and the pyramidalization becomes fully one-sided already in the transition state (figure 2b). in this way, free internal rotation of the cf2 groups becomes possible, providing an additional degree of freedom that rationalizes the high pre-exponential factor in the rate constant of dissociation. this structure with perpendicular arrangement of the two cf2 groups appears very plausible for the back reaction. thus, one cf2 group approaches with its filled n orbital the empty p orbital of the other cf2 group (figure 2b). the easy trans pyramidalization on minor cc stretching is probably also the reason that the corresponding 8 force constant is lowered, although all other force constants are similar to those in ethylene. the preference of fluorine for sp hybridization at carbon has been invoked to explain not only the easy radical addition and other reactions, but also the low-lying, twisted-pyramidalized triplet, which is nearly isoenergetic with the singlet that has a saddle point there. this is indicated by x44, x47, and x48, which have no unusual values. very recently, high-level theoretical studies investigated electronic ground and excited states of c2f4 and their dependence on some coordinates, mainly to discover the fate of this molecule after electronic excitation and make comparisons with a corresponding time-resolved experiment (ref (16)). for the ground state, the stabilizing effect of pyramidalization in the twisted molecule was confirmed. interestingly, the excited molecule enters the s1/s0 conical intersection from the 2ag state, where the molecule has a large one-sided pyramidalization, a 90 cc twist and a cc bond length (1.51) similar to that of a single bond. in the present work, the transition state for s0 dissociation was said to result from avoided crossing of the 2ag and 1ag (i.e., s0) states, also with large one-sided pyramidalization but at longer cc distances and perhaps without twist. it would be interesting to check whether these geometrical differences are large enough to generate an excited-state barrier, because evidence was found in ref (16) that cc dissociation does not begin in the excited state.

compared to ethylene and its nonfluorinated derivatives, c2f4 is peculiar in many reactions. it very easily adds to radicals and prefers formation of four-membered rings over diels alder reactions. this has been rationalized by the preference of fluorine for carbon sp3 hybridization, which is possible on opening of the double bond. another property, the thermal dissociation of the c=c bond, has been explained by the stabilization of the product (cf2) by back-bonding. here, it is attempted to correlate such properties with vibrational constants, in particular for c=c stretching and twisting and for carbon pyramidalization. the only force constant found to be lowered compared to ethylene is that for trans pyramidalization (8), and cc bond softening on 8 distortion is indicated by the conspicuously large magnitude of anharmonic constant, x18. both observations can be rationalized by a valence-bond model that predicts a trans bent structure on weakening the cc bond. conclusions are drawn about the dissociation path and peculiarities of the potential. other anharmonicities, both experimental and calculated and some in 12c13cf4 and 13c2f4, are also discussed. in particular some strong fermi resonances are identified and their effects accounted for.

PMC4141698

pubmed-210

cytomegalovirus (cmv) is one of the most common congenital viral infections in many regions. in the united states it occurs in 0.51% of live births, or approximately 40,000 infants annually. the manifestations of cmv infection cover a broad spectrum ranging from asymptomatic to severe systemic disease resulting in significant morbidity and mortality. 90% of infants with congenital cmv are asymptomatic at birth. despite being asymptomatic at birth, up to 7% of these children will develop sensorineural hearing loss (snhl) that can be unilateral or bilateral, fluctuating or progressive, and range from mild to profound [2, 3]. approximately 10% of infants with congenital cmv are symptomatic at birth, and 40% of these patients will develop snhl [1, 2]. hearing loss is the most common manifestation of congenital cmv infection making cmv a leading cause of nonhereditary congenital hearing loss. given the relatively large number of children potentially affected by cmv-related hearing loss and the wide range of manifestations of congenital cmv infection, it is difficult to predict how a child with symptomatic cmv will perform with a cochlear implant (ci). previous studies suggest that children with symptomatic cmv derive auditory benefit from cis, albeit at a slower rate than other children. the degree to which these children benefit remains somewhat controversial as there is variation in the development of language skills after ci [59]. the objective of our study was to examine the relationships between intracranial radiographic abnormalities and preimplantation developmental assessment (including head circumference) with postimplant audiometric and language outcomes in children with symptomatic congenital cmv who have undergone cochlear implantation. this study was a retrospective review of children with a diagnosis of symptomatic congenital cmv who underwent cochlear implantation between 2004 and 2010 at a tertiary pediatric cochlear implant center. congenital cmv was diagnosed for most children via urine culture of the virus during the first two weeks of life. diagnosis was also made based on the identification of hearing loss coupled with brain image findings. medical charts of these patients were reviewed for pre- and postimplantation evaluations and central nervous system imaging findings. data regarding preimplantation developmental assessments included the diagnoses of developmental delay and/or other disabilities, nonverbal intelligence quotients or developmental quotients (iq/dq), and head circumference (hc) at the preoperative visit. results from computed tomography (ct) and/or magnetic resonance imaging (mri) scans of the brain were reviewed, and the findings were classified by type and location of anomaly. postimplant audiometric behavioral testing, which was performed using validated and developmentally appropriate testing techniques, was collected. this data included frequency-specific thresholds and speech awareness or speech reception thresholds (sat/srt). pure tone averages (pta) were calculated by an average of 4 frequencies (0.5, 1.0, 2.0, and 4.0 khz). children's developmental disability diagnoses were classified according to the areas of cognition, motor, vision, and language. cognitive disability was diagnosed using nonverbal cognitive measures such as the leiter international performance scale and supported by evaluating adaptive functioning with the vineland adaptive behavior scale. these evaluations were completed by psychologists with knowledge of testing deaf/hard of hearing children. if the nonverbal iq was not available, a nonverbal developmental quotient was used. this nonverbal or adaptive quotient was obtained from a developmental pediatrician with expertise in hearing loss as a part of the precochlear implant assessment. for this study, the diagnosis of cerebral palsy (cp) was made based on neurologic examination, patterns of persistent primitive reflexes, abnormalities in tone and reflexes, and presence of abnormalities on mri of the brain. the diagnosis of pervasive developmental disorder not otherwise specified was made by interdisciplinary evaluations with speech pathology and psychology using standardized measures to evaluate autism spectrum disorders. standardized language assessment scores, using the preschool language scale (4th edition) were available on eight subjects who returned for speech therapy after implantation. this study was approved by the institutional review board at cincinnati children's hospital medical center. data distributions were reported using medians with ranges (for continuous data) and frequencies with percentages (for categorical data). characteristic differences between children with hc<5th percentile and>5th percentile were tested using wilcoxon rank sums test for continuous data and chi-square or fisher's exact test for categorical data. biserial correlations were conducted to understand the association between presence and location of brain abnormalities with audiometric and language outcomes. the wilcoxon rank sums test was also used to explore statistical differences regarding factors (e.g., iq/dq) that may be associated with presence and location of brain abnormalities. due to the small sample size, exact p values are reported. table 1 lists the fifteen cmv-positive children (9 females and 6 males) who received a ci during the study timeframe. two additional subjects with cmv were excluded from this analysis: one subject had not returned for any postimplant visits and one child had normal cns imaging (thought not to be symptomatic cmv). the median age at time of identification of hearing loss was 5 months (range 162 months), and the median age at implantation was 28 months (range 1296 months) (table 2). the median iq/dq for the study population was 65 (range 2390); 9 (60%) children had an iq/dq<70. seventy-three percent (n=11) of children had a diagnosis of cognitive impairment and 13 children (87%) had a motor delay or disability; 9 had a diagnosis of cp. over half (60%, n=9) of these children carried a diagnosis of more than one developmental disability and nearly half (47%, n=7) had both a cognitive disability, and cp. seven children (47%) had a head circumference (hc) less than the fifth percentile (table 2). children with a hc<5th percentile had a significantly lower median iq/dq than children with a hc 5th percentile (42 versus 77, p=0.003). all children with hc<5th percentile had cognitive disabilities compared to only 50% of children with a hc 5th percentile. additionally, the children with a hc<5th percentile had slightly poorer postimplant pta (38 db versus 27 db, p=0.02) and sat/srt (30 db versus 23 db, p=0.04) compared to children with larger heads. all children included in the study had central nervous system abnormalities present on imaging studies (table 3). twelve children had mri imaging (all with identified abnormalities) and 13 ct imaging of the brain with identified abnormalities. eighty percent (n=12) had calcifications, which occurred most frequently (53%) in the periventricular region (table 4). additional imaging findings included ventriculomegaly in 53%, migrational abnormalities in 33% (n=5), and encephalomalacia in 27%. all four children with encephalomalacia and all 3 children with cerebellar abnormalities had a diagnosis of cp. in addition to cp, 3 of the 4 children with encephalomalacia and all 3 children with cerebellar abnormalities also had a cognitive disability diagnosis. in fact, the children with cerebellar abnormalities had a lower nonverbal iq/dq than children without cerebellar abnormalities (35 (range 2350) versus 68 (range 2790), p=0.048). calcifications in the temporal lobes were associated with poorer post-ci pta (biserial correlation rb=0.57, p=0.04). the median (range) receptive language score was 21 (327), and expressive language score was 28 (1777). the iq/dq was highly correlated with both receptive (spearman rho=0.9, p=0.002) and expressive (spearman rho=0.86, p=0.007), as having a head circumference<5th percentile (point biserial correlation rb=0.75 and 0.68 resp.). periventricular calcifications were associated with lower receptive language (rb=0.75, p=0.03) and expressive language (rb=0.84, p=0.008) among children with post-ci assessments. because the iq/dq was associated with both periventricular calcifications (rb=0.53, p=0.04) and hc<5th percentile (rb=0.73, p=0.002), the relationship between these factors and language appears to be, at least in part, driven by iq/dq scores. one of the challenges in children with congenital cmv is predicting the sequelae they will develop and the extent of neurological and developmental deficits they will incur. previous studies have shown that brain imaging may be a good predictor of adverse neurodevelopmental outcomes. in one study of children with symptomatic congenital cmv, 90% of the children with an abnormal ct scan developed at least one sequela compared to 29% of those with a normal scan. greater than two-thirds of all children with congenital cmv had mri abnormalities and, of these, cortical malformations, ventriculomegaly and hippocampal dysplasia correlated highly with poor neurologic outcome. found that microcephaly was the most specific predictor, and abnormality on head ct was the most sensitive predictor of poor cognitive outcomes in this patient population. in a study of children with a diagnosis of snhl, 80% of the cmv positive children had abnormal brain mri scans compared with only 33% of cmv negative children. children with calcifications had a slightly poorer median post-ci pta compared to children without calcifications. interestingly, the location of the abnormalities also seemed to correlate with worse language outcomes. the parietal lobe processes sensory information and houses our language abilities, and the temporal lobe regulates emotion, hearing, language, and learning, which could explain why language outcomes are poorer in children with abnormalities in these regions. children with cerebellar anomalies also had lower receptive and expressive language levels than the other children. although the cerebellum has been largely thought to control balance, there may be other aspects of learning and development which depend on this entry point of sensory information to the higher cortical areas. the authors have implicated the cerebellum to be involved in temporal processing, language production and comprehension, spatial reasoning, and visual attention [1821]. in our 3 patients with cerebellar lesions, it is not clear if it is the location of the lesions in the cerebellum or the severe cognitive delay that resulted in worse outcomes. with only 3 patients, it is not possible to draw additional conclusions regarding cause and effect in this group. in addition to looking at the associations between cns imaging findings and post-ci outcomes, our study also looked for correlations between preimplantation developmental assessment and cochlear implant performance in these patients. although there is a relative paucity of relevant studies in the literature, previous studies have demonstrated that children with cognitive delay seem to derive benefit from ci, albeit at a slower rate than nondelayed children [22, 23]. although children with cochlear implants who have more significant developmental delay have poorer outcomes than children with only mild delay, the biggest predictor of language development among children with implants and disabilities is a measure of nonverbal cognitive ability. unfortunately, when compared to appropriately matched developmentally delayed children without hearing impairment, children with cis had lower receptive and expressive language skills, which were not commensurate with their cognitive potential. although children with multiple handicaps may progress slower and to a lesser extent than typically developing children, these children still derive benefit from the auditory stimulation provided by a ci but may require additional post-ci intervention to optimize benefit [2729]. as we found in our study, the majority of children with symptomatic congenital cmv have associated developmental disabilities. the variability of neurocognitive deficits in these children warrants the examination of this group separately from other children with developmental disabilities. as with children with developmental disabilities, children with symptomatic congenital cmv appear to derive benefit from ci albeit at a slower rate. ramirez inscoe and nikolopoulos demonstrated mixed results for speech perception and intelligibility with 50% of children with congenital cmv performing more poorly than controls, 31% performing similarly, and 19% performing better than controls. these children did, however, derive auditory benefit from ci. in their study of 13 children with symptomatic congenital cmv, 73% of implanted children achieved closed-set word recognition, and 63% achieved open-set word recognition. children with congenital cmv have also demonstrated both improved pure-tone hearing thresholds and improved language perception and production as well as useful speech comprehension albeit lower than matched controls. another study of 11 children with congenital cmv found that 9 of the 11 carried a diagnosis of psycho-neurological disorders (including attention deficit hyperactivity disorder, mental retardation, autism, and pervasive developmental disorder). although hearing thresholds were similar among children in this group, post-ci performance varied widely depending upon the concomitant diagnosis. our findings were consistent with these previous studies in that our patients did demonstrate overall improvement in post-ci thresholds. our results indicate that head size was significantly related to iq/dq and that children with microcephaly (hc<5th percentile) were more likely to have cognitive disabilities than those without microcephaly. the microcephalic children also had significantly poorer post-ci pta and sat/srt as well as worse receptive language. these findings indicate that microcephalic children do not achieve the same degree of auditory benefit as the children with normal head size. the mean age at last audiometric followup did vary between the microcephalic and nonmicrocephalic groups (46 versus 59 months). this difference would not be expected to affect the results of audiometric testing as all testing was performed using developmentally appropriate behavioral methods that should account for the difference in age. given that the majority of the children (73%) had developmental delay and nearly half were considered multiply handicapped, it is notable that head circumference was a better predictor of post-ci outcome than specific developmental delay diagnosis. this is not entirely surprising as head circumference relates to brain growth, which can impact developmental outcomes. although our study has limitations including its retrospective nature and small sample size, it provides data that may further efforts to identify factors which may help predict which children with congenital symptomatic cmv will benefit from ci. the presence of cerebellar anomalies or greater than one cns abnormality on imaging correlates with poorer outcomes after ci. the location of cns abnormalities, including calcifications, may play a role in audiometric and language outcomes after ci. early measurements such as brain imaging findings, head circumference, and iq/dq may allow for more accurate counseling of families regarding anticipated postimplantation performance in children with symptomatic congenital cmv.

objective. to examine the association of intracranial radiographic abnormalities and developmental measures with outcomes in children with congenital symptomatic cytomegalovirus (cmv) and cochlear implants (ci). design/methods. it was a retrospective review of 15 children implanted from 2004 to 2010. preimplant nonverbal intelligence quotient/developmental quotient (iq/dq) and head circumference (hc) were obtained. computed tomography and magnetic resonance imaging of the brain and post-ci audiometry and language assessments were reviewed. results. eleven children (73%) had cognitive delay. most had>1 developmental disability. median iq/dq was 65 (2390). all had imaging abnormalities. most imaging abnormalities were in parietal (60%) and temporal (60%) lobes. children with hc<5th percentile had poorer median post-ci pta (38 db versus 27 db, p=0.02). periventricular calcifications were associated with lower receptive (rb=0.75, p=0.03) and expressive (rb=0.84, p=0.008) language. because iq/dq was associated with periventricular calcifications (rb=0.53, p=0.04) and small hc (rb=0.73, p=0.002), their relationships with language appear partially driven by iq/dq. conclusions. the location of brain abnormalities appears to correlate with worse outcomes after ci. these findings may allow for more accurate counseling of parents regarding anticipated postimplantation performance.

PMC3671708

pubmed-211

. there have been significant achievements regarding to the millennium development goals (mdgs) as a global development target. the indicators showed reflection of these achievements, such as decreasing global poverty rate, increasing the number of children going to school, decreasing child death rate, increasing access to clean water, and also increasing malaria, hiv/aids, and tuberculosis control investment. mdgs were evaluated in the year 2015, and there will be remaining new challenges to sustain the achievement at post-2015 era. numerous important issues have been raised by united nation (un), which are poverty and hunger elimination, improving health and education, sustainable cities, combating climate changes, and also ocean and forest conservation. in mdgs, hiv/aids, malaria, and major diseases are clearly mentioned as global development goals. in this case, there will be plenty of diseases that are not a major concern of the world. questions were raised concerning neglected tropical disease (ntd) which is definitely out of the highlight. will these diseases be included in the ambitious post-mdgs sustainable development? the new sustainable development goals (sdgs), known also as the global goals, had been established after world leaders gathered on 25 september 2015, at the united nations in new york to adopt the 2030 agenda for sustainable development and the broader and further agenda than the mdgs. mdg explicitly stated that hiv/aids, malaria, and tuberculosis will be efficiently controlled at the end of the year 2015. the big three are the diseases that attract priority from sponsors, researchers, and policy makers [2, 3]. this situation is not the same as ntd, which has not gained any priority from them and even worsened. the term of neglected in ntd referred to the fact that these tropical diseases are not being considered as important diseases. ntd result in long life's deformities and handicaps, decrease productivity and economical status, and also end up many social consequences and stigmatization. though ntd is commonly found in tropical countries, it is not identical with tropical diseases. poverty as one of ntd determinants frequently occurs in rural area, slums, and marginalized populations living nearby the equator. ntd in this area are closely associated with poverty and limited resources, such as clean drinking water access, poor sanitation, and healthy housing. ntd may decrease child health, increase the health expenses and risk of ineffective treatment, decrease productivity, and result in education default. their potential to spread in developed countries is low, because ntd are closely related with local vector and intermediate host distribution which are specifically associated with geographic region. the technology and resource to control, prevent, and eliminate ntd are available, but not for the developing countries. who has included 17 diseases caused by bacteria, virus, and protozoa into ntd (figure 1). helminths caused diseases that dominated ntd: taeniasis, dracunculiasis, echinococcosis, trematodiasis, filariasis, onchocerciasis, schistosomiasis, and soil-transmitted helminthiasis. the ministry of health of indonesia reported only five ntd that can be found in indonesia, that is, leprosy, filariasis, schistosomiasis, soil-transmitted helminth, and yaws. however, this review describes more than those five diseases and aims to address the magnitude of the problem of ntd in indonesia. leprosy is an infectious disease is caused by mycobacterium leprae, a road shaped bacteria classified in the same genus as mycobacterium tuberculosis leprosy may be complicated with deformity and handicap, which may decrease the ability of the patient to work in daily life. leprosy was a serious problem in indonesia at 1980, with 126,221 cases in 1985. it was noted that the significant improvement in leprosy control was because of massive promotion of leprosy prevention and multidrug therapy (mdt) intervention in more than 5,600 primary health centers in indonesia. however, the new leprosy case finding in 2000 was not significantly different with year 2013 (table 1). fourteen provinces and 160 districts, which mostly are located in java island, reported prevalence of>1 per 10,000 population in 2009. leprosy epidemical indicators were significant, such as deformity grade 2 10.5%, leprosy cases in children 12.01%, and 82.43% multibacillary (mb) cases [10, 1315]. the problems of leprosy in indonesia are summarized as follows: early detection.development of more effective treatment.development of more effective vaccine.understanding immunopathogenesis of peripheral nerve damage.management of chronic erythema nodosum leprosum (enl).deformity and stigmatization.deformity and stigmatization are serious problems among leprosy patients in indonesia. survey conducted in subang district (west java); gresik and malang district (east java); bone and gowa district (south sulawesi) showed that deformity in leprosy patients occurred in 76.7% of patients. almost 60% respondents were experienced handicaps during their life, including participating to social activity. mdt has significant impact to decrease leprosy prevalence globally. however, there are various substantial operational and technical problems among countries and territory. resistance of m. leprae is a serious problem because of limited effective antimicrobes for leprosy. resistance against dapsone, that was applied as monotherapy, was initially reported in 1964 at malaysia. since then, resistance to dapsone and other drugs was reported. theoretically, combination of more than two drugs with different action mechanism will reduce the probability of resistant in mycobacteria. national surveillance of m. leprae resistance against mdt should be established to provide accurate data. sporadic and partial reports were not sufficient to measure the problems and establish the programs to reduce the prevalence and spread of resistance against mdt. phenotypic testing is the basic method for susceptibility testing of antimicrobial agents. even in the new proof of concept which combines the classical growth-based phenotypic test and dna based approach, pure culture of bacteria efforts were documented to culture m. leprae in artificial media and animal models [24, 25]. mutations in the folp1, rpob, and gyra genes are responsible for resistance to dapsone, rifampicin, and ofloxacin, respectively. to test the susceptibility of m. leprae against particular antibiotics, screening in north maluku and north sulawesi showed that resistance to dapsone occurs as 0.8% in new cases and 10% in relapse cases, while rifampicin occurs with 3.3% in new cases and 20% in relapse cases. there is higher prevalence of dapsone and rifampicin resistance among relapse cases comparing with new cases. it was noted that the incidence of resistance against dapsone and rifampicin in indonesia almost did not change between the time monotherapy was introduced and after mdt was recommended by who [29, 30]. yaws is a treponema pallidum subspecies pertenue infection, which may develop as chronic and recurrent disease. yaws is nonsexually transmitted treponemal infection, which is latent and asymptomatic for years with positive serology result. small portion (10%) of the patients will undergo bone destruction leading to deformities. diagnosis of yaws is commonly based on the clinical findings and serology [31, 32]. confirmatory diagnosis of yaws is using serological test, which includes nontreponemal agglutination tests, such as rapid plasma reagin (rpr) and venereal disease research laboratory (vdrl) test, and also treponemal tests such as treponema pallidum hemagglutination assay (tpha), treponema pallidum particle agglutination tppa, and fluorescent treponemal antibody-absorption (fta-abs). the accuracy of yaws serological test is hampered in the area which syphilis, caused by t. pallidum subspecies pallidum, is endemically circulated. yaws was reported in 68 (14%) of 497 districts in indonesia, mostly in the eastern part of indonesia. east nusa tenggara province reported 2,800 cases in 2012, which is scattered at 566 small islands in this region. however, it gradually decreases to 5,319 cases in 2011 and 3,476 in 2012 [10, 34]. there are several obstacles to eradicate yaws in indonesia: geographically the yaws patients are in a remote area including rural and small islands which are not easy to handle, difficulty to give benzathine penicillin for children, and also local political condition that is somehow counterproductive to the programs. who planned to eradicate yaws globally in 2020 with adoption of morges strategies. this program intends to introduce a mass treatment in the endemic regions by using azithromycin. however, benzathine penicillin can be used as back up in case of azithromycin is not indicated, treatment failure, or in places where azithromycin is not available. this treatment followed an active survey every six months to detect and treat the remaining cases [32, 34]. the ministry of health launched yaws eradication program, aimed to eradicate yaws in 2013, one year later than who target. there were several approaches conducted, such as active screening new cases and contacts, empowering community, improving the capacity of health worker to diagnose and manage yaws, and intersectoral collaboration approaches. access to health service is limited in the yaws endemic area, which obstacle the passive screening program. reported a survey among health workers in primary health center, elementary school teachers, and parents in muna, southeast sulawesi. they were asked about yaws to measure their knowledge about sign and symptoms, causative agent, and therapy for yaws. another report from southwest sumba showed clean water and healthy behavior is the risk factor for yaws. these reports showed that comprehensive intervention is needed to boost the community participation for yaws eradication. reporting system for yaws incidence is very important to support the best intervention for yaws eradication. learning the fact that their knowledge about yaws is remarkably low, it may diminish the validity of yaws reporting system. insufficiency of this sector may result in delay of yaws eradication and increasing yaws contact population. yaws eradication problem in indonesia is summarized as follows: early detection by health workers.geographical problem of endemic area.surveillances and reporting system.inadequate confirmatory laboratory test. dengue virus consists of four serotypes: denv1, denv2, denv3, and denv4. these viruses are responsible for infectious diseases with width spectrum of clinical manifestation: dengue fever (df), dengue hemorrhagic fever (dhf), and dengue shock syndrome (dss) [38, 39]. dengue virus infection is an arbovirus disease, which in indonesia is primarily transmitted by aedes aegypti and aedes albopictus. the incidence of dhf significantly increased since reported initially in 1968 (0.05/100.000) to 3540/100,000 in 2013. however, in 2010, there was an extreme surge of dhf incidence to 86/100,000. the significant increasing of dhf incidence was parallel with decreasing of case fatality rate (cfr), which is 41% in 1968 to 0.73% in 2013. however, it was noticed that from 1999 there was a trend of shifting to adults. dhf incidence described here is believed not to be able to draw a clear picture of all denv infections.. however, the proportion of those three clinical manifestations still becomes an enigma, although the awareness to the diseases, surveillance programs, diagnostic tools, and management of denv infection in indonesia have been significantly improved. it has been realized that controlling adult mosquitoes is prone to fail reducing denv transmission. the vector control approach should aim to interrupt the transmission cycle at an early phase through immature mosquito control, which is including larvae and pupae stages. immature mosquitoes control is believed to be more effective. the vector control approach is still considered effective while vaccine and prophylaxis remedies continuously develop. it seems that the socioecological approach is the best candidate to be implemented in an endemic country, such as indonesia. community and intersectoral approach are significantly important fundamentals of integrated public health strategies for dengue vector control [47, 48]. as dengue infection has wide spectrum of clinical manifestation, the clinical diagnosis is confusing. there are guidelines issued by who to respond to the need of applicable tool for clinician: who classification system and dengue and control study (denco) revised clinical management. the study concerning the two guidelines showed that in surabaya, indonesia, the denco revised clinical management guideline superior in detection of severe dengue cases. however, in a study in semarang, indonesia, the denco guideline has failed to show its superiority. it is true that the denco guideline needs to be adjusted in terms of geographic and age-related variations issues. there are many factors that may be related with clinical manifestation of dengue virus infection, including human genetics involvement which is still controversially related with population, race, and geography [54, 55]. several methods are available for laboratory test confirmation of denv infection: virus isolation, genome detection, antigen detection, and antibody detection. the first three methods are direct detection methods which were considered as more specific and able to confirm earlier onset of denv infection. the antibody detection is widely used in the field because they are easy to perform and less expensive, though it is not as powerful as direct detection especially in secondary infection [50, 56]. rabies is an acute, progressive, incurable viral encephalitis disease that is transmitted from animal, mainly dogs, to human. it is caused by rabies virus (rabv), a member of the family rhabdoviridae, genus lyssavirus. the highest incidence is concentrated in asia and africa. despite the fact that rabies is 100% vaccine-preventable infectious disease, it potentially threatens over 3 billion people in the world. however, poor surveillance, underreporting, frequent misdiagnosis, and poor coordination among sectors may lead to underestimation of the burden of the disease. ten countries of asean have been declared rabies-free asean by 2020 in the occasion of the thirty-fourth meeting of the asean ministers on agriculture and forestry (34th amaf), on september 2012. rabies was reported in 24 provinces out of 34 provinces in indonesia. reported human rabies in indonesia is small (206 cases in 2010 and significantly decreased to 119 cases in 2013) compared to thousands of cases reported in other countries such as india, china, and other asian countries. to control rabies transmission, indonesian government uses one health approach which facilitates the multidisciplinary participation in management of zoonosis diseases. however, kalimantan and sulawesi, other islands of indonesia, are the most plausible hypothetical origin of the bali rabv strains. totally there were 133 reported human deaths because of rabies in bali from 2008 to september 2011. this significantly decrease of rabid human death within 3 years is a good model of rabies control for other regions or countries. it was proposed that this success is mainly because of mass vaccination program for dogs, which is the primary (98%) vector of rabies in bali. however, the number of reported humans bitten by dogs remained over 4,000 per month. the preparedness to human rabies should be maintained, as the threat of human rabies escalation is still high. lymphatic filariasis (lf) is caused by worms inhabiting the lymphatics [6365]. approximately 65% of total cases are found in the southeast asian region [6668]. lf cases were found in all provinces of indonesia. in 2009, there were 11.914 lf cases reported. the number of total cases was steadily reported until 2013. there were 11.912 cases registered in 2013. lf prevalence in indonesia varied from 0.5 to 27.6%, in which the highest rates were found in maluku, papua, west papua, east nusa tenggara, and north maluku provinces. three lymphatic parasites are prevalently circulating in indonesia: wuchereria bancrofti, brugia malayi, and brugia timori [69, 70], which are transmitted by mosquitoes of five genera the site of adult-worm parasitism is within the lymphatic vessels, most commonly involving the extremities and male genitals [64, 65, 70]. the disease predominantly afflicts poor people in both urban and rural areas with limited resources condition, where mosquitoes as a vector might be found in high density [64, 68]. who launched global program to eliminate lymphatic filariasis (gpelf), which relies on mass drug administration (mda) approach [68, 71]. the main goal of the program is to hamper transmission of disease between mosquitoes and human beings, mainly through mass drug distribution of diethylcarbamazine (6 mg/kg) or ivermectin (150200 g/kg) combined with albendazole (400 mg) [68, 71]. it is recommended that all people at risk are involved in this program, since patients with asymptomatic infection may have abnormal lymphatics, and that early treatment may prevent subsequent lymphatic damage [66, 69]. the efficacy of six annual rounds of mda was studied in alor island, eastern part of indonesia. microfilaria rates of b. timori decreased significantly after mda intervention, from 26% to 0.17%. the prevalence of filarial-specific igg4 antibodies was significantly decreased from 80% to 6%. the lf national plan has implemented mda campaigns in 2002. however, due to financial and human resource constraints, districts often provide only partial coverage of the at-risk population within the district. in 2009, the challenge of mda implementation in indonesia is not the efficacy of the drugs which were given to the community. it seems that the infrastructure is the key of the implementation, which includes the availability of transportation and physical access to the target population, reliable data bases, and competence health workers. the other challenge was to gain the trust from the community member to boost the compliance of drug administration. currently, mda has been scaled up in a geographically scattered way to address high prevalence areas and political needs. medical professionals, donors, universities, and ngos have played a critical role in finding new cases, assessing disease burden and supporting trainings and mda campaigns. prevention of lf depends on mosquito vectors control, which has had limited success because development of mosquitoes resistance against insecticides. urbanization of vast areas of tropical asia, including indonesia, has resulted in a concomitant rise in the prevalence of both w. bancrofti and b. malayi varieties of filariasis, carried by mosquitoes that breed in nonsylvatic habitats [68, 73]. schistosomiasis is a chronic water-borne infection caused by trematodes schistosoma, mainly found in developing countries in africa, south america, the caribbean, the middle east, and asia [69, 74, 75]. in indonesia it is found in three isolated areas of central sulawesi province, namely, lindu, napu, and bada valleys. except for schistosoma haematobium that is responsible for urinary tract disease, the human schistosomes primarily affect the intestine and liver. clinical manifestations of the disease are recognized as fever with dysenteric symptoms and loss of appetite, as well as physical growth and cognitive delay in children [69, 77, 78]. disease prevalence fluctuated between 0.3% and 4.8% in napu valley and between 0.8% and 3.6% in lindu valley. however, the prevalence of schistosomiasis in both areas tended to increase during the 20082011 period. the parasite transmission cycle involved domestic and wild animals as reservoir [76, 79]. in 2012, who approved the goal of eliminating schistosomiasis in endemic countries. it focused on improving sanitary conditions and large-scale distribution of the antiparasitic drug, praziquantel to high-risk target groups, such as school-age children, child bearing age women, and individuals involved in frequent contact with contaminated fresh water. praziquantel is well-tolerated, associated with few side effects, and has a very high therapeutic index. moreover, a single dose praziquantel administration is usually sufficient to kill all adult worms [69, 78]. schistosomiasis control in indonesia has faced many difficulties even though the endemic areas are very limited [79, 81]. the core strategy of mda should be coupled with education to the local community, rat and snail surveillance, and support to the environmental management programs including introduction of latrines and suitable water sources. in the future, there should be emphasis to understand the social dynamics and social change related to schistosomiasis, which may provide more information about concrete issues to control transmission of schistosomiasis. lack of intersectoral coordination and collaboration may have occurred, possibly leading to increase transmission and reinfection rates, and be prone to control failure. soil-transmitted helminthiasis (sth) is an infection with one or more intestinal parasitic worms: roundworms (ascaris lumbricoides), whipworms (trichuris trichiura), or hookworms (necator americanus and ancylostoma duodenale). the tropical climate of indonesia is highly favourable to support the circulation of soil-transmitted helminths in the country. there are sporadic reports regarding the prevalence of the sth which come from scattered part of the country. the prevalence of sth was reported ranging from 40 to 70% in 80s to 90s. however, the estimated prevalence of sth was decreased in 2005: ascaris (15.2%), trichuris (12.9%), and hookworms (8.4%). the survey conducted by ministry of health in elementary schools located in 33 provinces of indonesia showed prevalence of sth was 31.8%. india (64%) and indonesia (16%) together are contributing 80% of the regional's burden. drugs used for deworming, albendazole, and mebendazole are effective and inexpensive to control sth transmission and reinfection. the mda programme for elimination of lf which is implemented by using combination of albendazole with ivermectin or diethylcarbamazine seems to have synergistic effect to decrease the prevalence of sth. the program targeted preschool and elementary school age. however, until this moment the country still struggles to combat sth. in conclusion, there were efforts and programs concerning ntd that were planed and implemented in indonesia. many factors may contribute to the rendering of ntd elimination in indonesia, such as high population, wide range geographic of the archipelago, and limited resources. by the end of 2015 ntd

the world will enter the postmillennium development goals 2015 era. the achievements of the millennium development goals (mdgs) as a global development target need to be evaluated. a sustainable new reasonable target is important for neglected tropical diseases (ntd) elimination in indonesia. this review describes the ntd situation in indonesia and highlights problems beneath the ntd transmission. multidisciplinary approach is a promising strategy to help the marginalized people.

PMC4852117

pubmed-212

walking is one of the recommended modes of exercise for obese individuals because of its merits in terms of safety, accessibility, and popularity, as well as proven efficacy in weight management1, 2. however, walking over a terrain of repetitive uphill and downhill inclines in activities such as mountain climbing can cause excessive fatigue and muscle damage3. in particular, repetitive eccentric contractions of the lower limb muscles during downhill walking places sarcomeres under excessive tensile stress. this stress can destroy sarcomeres by extending them beyond their normal length, sometimes involving a local inflammatory reaction, and can thereby lead to delayed onset muscle soreness or exercise-induced muscle damage. the indexes reflecting such conditions are serum creatine kinase (ck) and lactate dehydrogenase (ldh) levels4, 5. it has been reported that the use of a pole during walking over an uneven terrain could improve gait stability and balance, and that its use during downhill terrain walking can reduce the load and stress on the lower limbs (such as the ankle, knee, and hip joints)6,7,8. however, previous studies on the effects of a pole during downhill walking have been limited to the kinetic aspects such as the reduction of knee joint forces or the load on the lower extremity joints. meanwhile, it has been suggested that increases in peripheral cartilage oligomeric matrix protein (comp) levels after exercise could serve as a biomarker of cartilage degradation and damage9, and pruksakorn et al. in addition, according to a comparative study by andriacchi et al. that measured the maximum flexion of the lower extremity joints during various routine activities, the flexion of the knee joint was approximately 4 times greater during walking down stairs than during walking over level ground11. taken together, such previous reports suggest that the use of a pole during downhill walking may alleviate the burden on lower extremity joint cartilages; however, thus far, there has been no report examining this potential benefit. accordingly, this study aimed to investigate the effect of the use of a trekking pole on muscle and cartilage damage and fatigue during downhill walking. the study specifically examined obese women who had less muscle mass than men and whose heavy weights were likely to increase the burden on their lower limb muscles and joints during walking. eight obese women (average age of 21.1 1.8 years, average height of 164.8 4.9 cm, average weight of 61.8 7.7 kg, average body fat percentage of 33.9 1.4%, and average resting heart rate of 69.6 3.7 beats/min) with body fat percentages ranging from 30.0 to 36.1 volunteered as subjects for this study. the study conformed to the standards set by the latest revision of the declaration of helsinki, and all subjects read and signed a written informed consent statement consistent with the guidelines of the department of physical education at yonsei university. height and body composition were measured using a stadiometer (seca213; seca, hamburg, germany) and a bioimpedance analysis (bia) device (inbody720; biospace, seoul, korea), respectively. resting heart rate was measured in a seated position using a heart rate monitor (polar a5; polar, kempele, finland). each of the eight subjects participated in a total of two trials: one np trial (walking without using a trekking pole), and one tp trial (walking using a trekking pole). with the treadmill angle set to a decline of 15% based on a study by perrey and fabre12, the participants were subjected to 30 minutes of walking at an exercise intensity of 50% of their heart rate reserve. the experiment used a crossover design to minimize the adaption from the repetitive exercise trials, and each trial was separated by 7 days to avoid any transient effects on the physiological and psychological conditions of the subjects. an adjustable-length trekking pole (6342011; leki, hamburg, germany) was used, and the length was initially set at 70% of the user s height so that the elbow angle was maintained at 90 when the user was standing on level ground. when the pole was used for downhill walking, its length was increased by approximately 5 cm. using a 22-gauge needle, a serum separator tube (becton dickinson, franklin lakes, nj, usa), and a ethylenediamine tetra-acetic acid tube (becton dickinson), 7 ml of blood was collected from the antecubital vein of each subject at the pre-walking baseline (pwb), immediately after walking (iaw), and 2 hours post-walking (2hpw). collected blood samples were centrifuged for 15 minutes at 3,000 rpm and then stored at 80 c until analysis. the serum ck and ldh levels were determined using a clinical chemistry analyzer (ektachem dtscii; eastman kodak, rochester, ny, usa). the serum comp levels were determined with an enzyme-linked immunosorbent assay (elisa) using a commercially available human comp elisa kit (anamar ab, lund, sweden). the absorbance was measured at 450 nm with a microplate reader (molecular device, palo alto, ca, usa). the plasma lactate levels were determined using a clinical chemistry analyzer (ektachem dt 60; eastman kodak, rochester, ny, usa). data are presented as the mean standard deviation (sd) unless otherwise stated. for identifying differences in normally distributed results, when significant group by time interactions occurred, simple main effects were assessed using one-way anova and independent t-tests. the biomarker levels measured are presented in table 1table 1.peripheral biomarkers after downhill walking with the use of trekking poles (tp) and without their use (np)variabletrialpwbiaw2hpwck(u/l)np260.3 39.1349.1 37.9302.9 42.0tp256.1 42.0312.5 44.9270.9 34.5ldh(u/l)np351.5 77.8453.4 70.6377.0 84.0tp354.9 79.3385.1 71.2363.5 64.6comp(u/l)np9.6 2.013.6 3.812.0 2.8tp9.9 2.213.2 3.610.0 np: no trekking pole trial; tp: trekking pole trial; pwb: pre-walking baseline; iaw: immediately after walking; 2hpw: 2 hours post-walking; *p<0.05 vs. pwb .. the serum ck, serum ldh, serum comp, and plasma lactate levels were significantly increased iaw when compared with those at the pwb in trials np and tp (p<0.05). in addition, in trial np, the serum ck, serum ldh, and serum comp levels were significantly increased at 2hpw when compared with those at the pwb (p<0.05). np: no trekking pole trial; tp: trekking pole trial; pwb: pre-walking baseline; iaw: immediately after walking; 2hpw: 2 hours post-walking; *p<0.05 vs. pwb. exercise-induced muscle damage increases in situations involving eccentric muscle contractions, such as during downhill walking and/or running4. this study measured the levels of serum ck, ldh, and comp to investigate the effect of the use of a trekking pole on muscle and cartilage damage during downhill walking. the results demonstrated that the levels of ck, ldh, and comp were significantly higher iaw and 2hpw than at the pwb in the case of the np trials. in the case of the tp trials, however, the levels 2hpw were significantly lower than those for the np trials and actually returned to their level at the pwb. the rationale could be that the use of a trekking pole alleviated the temporary muscle and cartilage damage induced after downhill walking. this result is in accordance with those of previous studies; howatson et al. showed significantly lower serum ck levels at 24 hours after mountain climbing in an experimental group that used trekking poles than in the control group, suggesting that the use of trekking poles could alleviate muscle damage during recovery3. in addition, exercise-induced increases in joint load have been shown to cause a temporary increase in serum comp levels after walking or running by promoting catabolism, in particular, in cartilages such as the articular cartilage in the knee9, 13. bohne and abendroth-smith suggested that the use of a trekking pole during downhill walking could be effective for reducing such loads on the lower extremity joints7. according to the results of some previous studies, the use of a trekking pole could reduce lower limb joint forces by as much as 25%, enabling a 13 kg reduction of load per stride during downhill walking3, 14. however, as for the plasma lactate levels in this study, no significant difference was observed with the use of a trekking pole. the rationale is that although the use of a trekking pole reduced forces on the lower limbs, it increased the activity of the upper limbs and consequently maintained a similar fatigue level in the whole body. this interpretation is supported by the report that plasma lactate concentration was a biomarker reflecting peripheral muscle fatigue during exercise15, as well as by the suggestion of fritschi et al. that, although the use of a pole during walking could reduce vertical knee joint forces, it could increase upper limb muscle activation16. in conclusion, downhill walking can cause muscle and cartilage damage, and it is suggested that the use of a trekking pole can reduce temporary muscle and cartilage damage after downhill walking .

[ purpose] this study investigated the effect of the use of trekking poles on muscle and cartilage damage and fatigue during downhill walking in obese women. [subjects and methods] subjects included eight obese women who had a body fat percentage greater than 30. subjects performed downhill walking without a trekking pole (np) and with a trekking pole (tp) at 50% heart rate reserve for 30 minutes on a treadmill. the treadmill was set at a 15% downhill declination. blood samples were collected to examine muscle damage (serum creatine kinase [ck] and lactate dehydrogenase [ldh] levels), cartilage damage (serum cartilage oligomeric matrix protein [comp] levels), and fatigue (plasma lactate levels) at the pre-walking baseline (pwb), immediately after walking (iaw), and 2 hours post-walking (2hpw). [results] the ck, ldh, comp, and lactate levels were significantly increased iaw when compared with those at the pwb in both trials. in addition, in the np trial, the ck, ldh, and comp levels were significantly increased at 2hpw when compared with those at the pwb. [conclusion] downhill walking can cause muscle and cartilage damage, and our results suggest that the use of a trekking pole can reduce temporary muscle and cartilage damage after downhill walking.

PMC4905913

pubmed-213

periampullary diverticula (pad) refer to extraluminal outpouchings of duodenal mucosa that develop within the radius of 2 to 3 cm from the ampulla of vater (1). pad are largely asymptomatic but they sometimes can cause both pancreaticobiliary and non-pancreaticobiliary complications. rarely, obstructive jaundice can develop secondary to pad in the absence of choledocholithiasis or tumor and is termed lemmel's syndrome (2). recently, the authors experienced an unusual case of abdominal pain and obstructive jaundice due to extrinsic compression of mid common bile duct (cbd) by distended pad filled with pus-like material as a result of impacted intradiverticular enterolith at the pad orifice. an 81-yr-old woman presented to the emergency department on august 3, 2012 with nausea, vomiting, fever (38.4), and diffuse abdominal pain of 4 days ' duration. she had undergone subtotal gastrectomy with billroth ii anastomosis due to peptic ulcer perforation 10 yr ago. on physical examination, there was tenderness on her right upper quadrant but murphy's sign was equivocal. her white blood count was increased to 11,170/l (neutrophil 83.0%) and crp was elevated to 2.392 mg/dl. the results of her liver function test were as follows: total bilirubin, 2.37 mg/dl; aspartate aminotransferase, 88 iu/l; alkaline phosphatase, 349 iu/l; and -glutamyl transpeptidase, 571 iu/l. to evaluate the cause of diffuse abdominal pain with liver enzyme elevation in a cholestatic pattern, abdominal ct scan was taken. the axial images of the ct scan demonstrated distal cbd stone with upstream bile duct dilatation (fig. however, on coronal reconstructed images, the stone was not located within the bile duct but inside the pad and the distended diverticulum was compressing the mid cbd (fig. 1b, 1c). magnetic resonance cholangiopancreatography (mrcp) also revealed mid cbd compression and absence of choledocholithiasis (fig. these findings were confirmed on endoscopic retrograde cholangiopancreatography (ercp) which showed normal biliary orifice (fig. 2a) with impacted dark brown pigment stone (henceforth enterolith) at the pad orifice (fig. when the enterolith was pushed into the diverticulum by cannulation catheter and contrast dye was injected (fig. 2c, 3a), old blood clots and pus-like fluid gushed out from the opening (fig. biliary cannulation combined with endoscopic sphincterotomy (est) was also performed to explore the cbd for other possible causes of obstructive jaundice but no stone, stricture or obstruction by tumor could be found. on endoscopic nasobiliary drainage (enbd) tubogram, stenosis at mid cbd was also shown to be resolved, likely because the pad had been decompressed (fig. 3b). after confirming that no other pathology was present, intradiverticular enterolith was crushed and removed by dormia basket on the following day (fig. the patient no longer complained of abdominal pain, her liver enzyme was normalized, and she was discharged without any complication. she had been well until 6 months after enterolith removal, when the patient visited the outpatient clinic with vague abdominal discomfort. laboratory examination only revealed slightly increased total bilirubin to 1.96 mg/dl, but a large cbd stone was found on abdominal ct scan (fig. when the cbd stone was removed by ercp, the stone proved to be brown pigment sludge stone that typically forms in the presence of ascending infection (fig. follow-up ercp was performed again after 6 months but there was no recurrence of cbd stone or enterolith. diverticula of the gastrointestinal tract are outpouchings of all or part of the intestinal wall which can occur anywhere throughout the alimentary tract. the most common site of gastrointestinal diverticula is colon followed by duodenum, which was first described by chomel in 1710 (3). the detection rate of duodenal diverticula ranges from 1% to 27% depending on the diagnostic modalities used and the average age at the time of diagnosis (1). among duodenal diverticula, pad is the most common type comprising about 70% to 75% of all duodenal diverticula (1). most pad are asymptomatic but complications can occur in about 5% of cases and they include bleeding, perforation, diverticulitis, pancreatitis, choledocholithiasis, cholangitis, jaundice, enterolith or bezoar formation, intestinal obstruction, etc. among these complications, hepatocholangiopancreatic disease can seldomly occur in the absence of choledocholithiasis and is termed lemmel's syndrome (2). first, diverticulitis or direct mechanical irritation of pad may cause chronic inflammation of ampulla and lead to chronic fibrosis of papilla (papillitis chronica fibrosa) (4). third, distal cbd or ampulla can be directly compressed mechanically by pad that is usually filled with enterolith or bezoar (6, 7). in our case, enterolith that formed within the pad did not directly compress the distal cbd but it obstructed the pad orifice instead. this obstruction combined with inflammation of the diverticulum and collection of pus-like material within the obstructed pad seems to have expanded the pad with resultant extrinsic compression of mid cbd (fig. therefore, the enterolith, bezoar, or food material within the pad is frequently evacuated and thus, the symptom could be intermittent. however, pad in our case had a narrow opening, likely due to repeated inflammation of the pad, and this seems to have hindered the clearance of entrapped enterolith out into the duodenal lumen. enterolith formation within the duodenal diverticula is known to be facilitated in the static environment such as a blind loop after gastrectomy or proximal portion of stricture formed by crohn's disease or tuberculosis (8). in our case, blind loop created by billroth ii anastomosis seems to have provided a static environment favoring enterolith formation within the pad. during enterolith removal, cbd was also explored to search for other possible source of obstructive jaundice such as cbd stone since primary biliary stone is known to occur more frequently in the presence of pad (9, 10). one possible mechanism behind increased occurrence of primary cbd stone in these patients involves colonization and overgrowth of -glucuronidase producing bacteria within the pad that spread into the bile duct, which in turn leads to deconjugation of bilirubin glucuronides and eventually results in precipitation of calcium bilirubinate gallstones (11). although cbd was explored in our case, no other etiology of obstructive jaundice could be identified other than extrinsic compression by distended pad. however, primary bile duct stone newly developed on follow-up ercp performed 6 months later (fig. the most plausible explanation is that est performed during cbd exploration at the time of enterolith removal has permitted the occurrence of ascending infection with resultant brown pigment stone formation. diagnosing lemmel's syndrome could be challenging, but being aware of this condition is important to avoid mismanagement and it begins with identification of pad. scan and mrcp, pad appear as thin-walled cavitary lesions situated on the medial wall of the duodenum 2nd portion that typically contain gas. however, pad are sometimes filled with fluid and can frequently be mistaken for pancreatic pseudocyst, pancreatic abscess, cystic neoplasm in the pancreas head or even metastatic lymph node (12, 13). therefore, high index of suspicion is mandatory to arrive at a correct diagnosis in these patients. in our case, enterolith within the pad on axial images was at first mistaken for distal cbd stone due to its distal location combined with upstream dilatation of the bile duct (fig. however, upon careful scrutinization of the coronal reconstructed images, it became evident that the stone was located within the pad (fig. treatment is generally not recommended in asymptomatic patients or would be conservative management in pauci-symptomatic patients. nevertheless, since most patients with lemmel's syndrome present with symptoms related to biliary obstruction (i.e. jaundice, abdominal pain, and cholangitis) as a result of extrinsic compression of cbd, some form of treatment is advocated. therapeutic options in this situation run the gamut from endoscopic extraction of entrapped material, extracorporeal shock wave lithotripsy to surgery (diverticulectomy or biliodigestive anastomosis) (7, 14, 15). the patient in our case was also successfully treated endoscopically by fragmenting and removing enterolith using a dormia basket. it should be kept in mind that not all forms of lemmel's syndrome are caused by extrinsic compression of cbd by bulging pad. if the underlying mechanism of lemmel's syndrome is likely to be due to papillitis chronica fibrosa or sphincter of oddi dysfunction as mentioned above, the simplest and the most appropriate management would be to perform est (16). in conclusion, lemmel's syndrome is a rare cause of obstructive jaundice that should be included in the differential diagnosis of biliary obstruction when pad is present. maintaining a high index of suspicion is imperative to establish an accurate diagnosis since it can mimic other cystic or solid lesions around the pancreas head. symptomatic patient can be successfully managed endoscopically in many instances but recourse to surgical management would be necessary in selected cases.

duodenal diverticula are detected in up to 27% of patients undergoing upper gastrointestinal tract evaluation with periampullary diverticula (pad) being the most common type. although pad usually do not cause symptoms, it can serve as a source of obstructive jaundice even when choledocholithiasis or tumor is not present. this duodenal diverticulum obstructive jaundice syndrome is called lemmel's syndrome. an 81-yr-old woman came to the emergency room with obstructive jaundice and cholangitis. abdominal ct scan revealed stony opacity on distal cbd with cbd dilatation. ercp was performed to remove the stone. however, the stone was not located in the cbd but rather inside the pad. after removal of the enterolith within the pad, all her symptoms resolved. recognition of this condition is important since misdiagnosis could lead to mismanagement and therapeutic delay. lemmel's syndrome should always be included as one of the differential diagnosis of obstructive jaundice when pad are present.graphical abstract

PMC4055825

pubmed-214

body mass index is a simple index of weight for height that is frequently used in the assessment of nutritional status. a low bmi, or underweight status, is often associated with an increased risk of mortality in seriously ill or hospitalized older adults [1, 2]. conversely, a high bmi, indicative of overweight or obesity, is associated with an exacerbation in age-related physical and cognitive decline [3, 4] and with an increased prevalence or risk of many chronic health conditions common in older adults such as diabetes, hypertension, and cardiovascular disease [35]. such associations are typically determined across the entire spectrum of older adults (aged 60 +), with no further demarcation within this age classification. our finding of a much higher prevalence of several nutritional deficiencies in centenarians as compared with octogenarians [6, 7], suggests that there is considerable heterogeneity in nutrient status in the older adult age group. likewise, there may also be considerable heterogeneity within the older adult age group with regard to chronic health conditions. thus, it is not known whether the associations between underweight or overweight/obesity and chronic health conditions as observed in previous studies of older adults extend to the very old. dietary intake patterns featuring a high intake of nutrient-dense foods such as cereals, fruits, vegetables, and low-fat meat and dairy products have been associated with a number of favorable health outcomes in adults including a decreased prevalence of obesity [8, 9], lower rates of weight gain over time, and better quality of life and improved survival. in contrast, low-nutrient dense dietary patterns with high intakes of sweets, desserts, and high-fat dairy products have been associated with higher rates of obesity and poor nutritional status in older adults. studies comparing energy intakes and dietary intake patterns of centenarians to younger older adult cohorts have generally observed lower energy and/or fat intake in the centenarians, while dietary preferences of centenarians are considerably more varied and dependent of the region of study likely reflecting cultural patterns and cohort differences rather than longevity-related differences per se (reviewed). nonetheless, there can be considerable variation of body weight status within a given group of centenarians, though to our knowledge the extent to which this may be associated with potential differences in dietary intake patterns or selected health conditions has not been explored. thus, the objectives of this study were to explore associations (1) between bmi and dietary habits and (2) between underweight or overweight/obesity and health status in a population-based multiethnic sample of centenarians (98 years and above) from northern georgia in the usa. it was hypothesized that overweight/obesity, but not underweight, would be associated with poorer dietary habits and that both overweight/obesity and underweight, as well as dietary habits, would be associated with specific health conditions in this population. this study was a secondary analysis of data collected by the georgia centenarian study, a population-based multidisciplinary study conducted in 44 counties in northern georgia (usa) from 2002 to 2005. the original study included 244 centenarians (defined as age 98 and older). the sampling procedures and data collection methods briefly, recruitment of participants from skilled nursing facilities was based on estimates of the institutionalized population of the area according to the 2000 u.s. census tabulations. the community dwelling participants resided in private residences and personal care homes and were recruited from voter registration lists. participants were recruited to match census figures for gender and race/ethnicity (white or black; all were non-hispanic) and were interviewed by trained personnel in their place of residence. all questionnaires and procedures were approved by the university of georgia institutional review board on human subjects. information regarding age, gender, race/ethnicity, living arrangements, health conditions (cardiovascular disease, diabetes, hypertension, etc.), and behaviors (including tobacco and nutritional supplement use) were obtained from each participant (or his/her caregiver) by self-report. questions regarding food intake, appetite, and weight change were adapted from the mini-nutritional assessment [15, 16] and the response categories for food intake represented current frequency of consumption of food groups, including dairy products (milk, yogurt, and cheese); meat, fish, or poultry; orange/yellow vegetables; green vegetables; citrus and noncitrus fruit and juice. the total food score, ranging from 0 to 5, was based on comparisons with the dietary guidelines for americans 1,600-calorie meal pattern for sedentary older adults, as previously described. body weight and height were measured by interviewers, obtained from charts or via self-report. in addition, knee height was measured on the right leg, unless contraindicated, to the nearest 0.1 centimeter and used to predict stature as per the formulas of chumlea et al.. body mass index (bmi) was calculated as weight (kg)/height (meters). bmi calculated from observed/recorded height and weight was highly correlated with bmi calculated from predicted stature and observed/recorded weight (r=0.877; p<.0001). bmi calculated from observed/recorded height and weight was used to form three bmi classifications based on the national institutes of health criteria for overweight/obesity and defined as underweight 20 kg/m, normal weight>20 and<25 kg/m, and overweight/obese 25 kg/m. triceps skinfold (tsf) was measured on the right arm, unless contraindicated, by caliper to the nearest 0.1 millimeter. mid-arm circumference (mac) was measured on the right arm, unless contraindicated, to the nearest 0.1 centimeter., burlington, nc) and anemia was defined as hemoglobin<12 g/dl for females or<13 g/dl for males. participants missing data for primary variables of interest were excluded from the present analyses. from the original sample of centenarians, 11 individuals were excluded due to missing data for bmi (n=7; includes one double-amputee), food intake patterns (n=1), average grip strength (n=1), and/or systolic/diastolic blood pressure (n=3). overall characteristics of the 233 centenarians included in the study are given in table 1. compared to the included centenarians (n=233), the excluded centenarians tended to be older (102.6 3.6 versus 100.5 1.9 yrs; p=.052), but did not differ in gender (90.9% [excluded] versus 84.6% female), race/ethnicity (72.7% versus 79.0% white), or place of residence (36.4% versus 43.4% skilled nursing facility). means, standard deviations, medians, range of values, and/or frequencies were calculated. differences between participants with different bmi classifications were assessed with the wilcoxon rank sum test for continuous variables and chi square analysis for categorical variables. the level of significance was set at p<.05. because the food groups provide calories, a series of logistic regression analyses were performed with bmi 20 or bmi 25 as the dependent variable and gender, race/ethnicity, living arrangements, and reported intake of specific food groups as the independent variables. in addition, because bmi can play a causative role as a risk factor for chronic disease, a second series of logistic regression analyses was performed with diabetes, anemia, or other chronic health conditions as the dependent variable and race, gender, residence, and bmi 20 or bmi>25 as the independent variables (model 1). a final series of logistic regression analyses was performed with diabetes, anemia, or other chronic health conditions as the dependent variable and race, gender, residence, total fruit, and vegetable intake and bmi 20 or bmi>25 as the independent variables (model 2). p-values are unadjusted for multiple comparisons, because all comparisons were preplanned. approximately one-third (31.3%) of the centenarians included in the final analytical sample had a bmi of 20 (underweight), 43.8% were classified as being in the normal weight range, and 24.9% met the nih classification for overweight/obesity (bmi 25). triceps skin fold (tsf) and mid-arm circumference (mac) of centenarians in the lowest bmi classification averaged below the 5th percentile for females 80+years in usa based on 20032006 nhanes data. both parameters increased with bmi classification in a stepwise manner (data not shown) and were highly correlated with bmi (pearson correlation coefficient between bmi and tsf=0.482; and between bmi and mac=0.624; p<.0001 for both). chi-square analysis indicated that those with a bmi 20 were more likely to be women, live in a skilled nursing facility, eat a modified food diet, have experienced a weight change in the past three months, and have anemia as compared to centenarians classified as normal weight or overweight/obese (table 2). conversely, those with a bmi 25 were more likely to be black, diabetic, have a higher systolic blood pressure, and/or have a diastolic blood pressure 90 mm as compared to centenarians classified as underweight or normal weight. there were no differences according to bmi classification with regard to history of cvd, cancer, stroke, depression, or past or current tobacco use. bivariate analysis of diet intake patterns suggested that centenarians with bmi 20 had the highest total food scores and were more likely to report eating two or more servings of meat, fish, and poultry per day and three or more total servings of fruit per day as compared with centenarians in the other bmi classifications. in contrast, those with a bmi 25 were more likely to report eating less than one serving of citrus or noncitrus fruit per day, less than four servings of orange/yellow vegetables per week, or three total servings of fruit and vegetables per day (table 2). a series of logistic regression analyses indicated that when controlled for gender, race, and place of residence the odds of having a bmi 25 were about two to three times higher in centenarians with lower intakes of citrus and noncitrus fruit (less than one serving per day), orange and yellow vegetables (less than four servings per week), or total fruits and vegetables (less than three servings per day), but were not related to intake of the meat group or dairy group (table 3). similar analyses with bmi 20 as the dependent variable, failed to show any significant association with dietary intake categories (table 3). finally, associations between bmi classifications and chronic health conditions were determined in a series of logistic regression analyses that included either bmi 20 or bmi 25 as an independent variable (table 4). when controlled for gender, race, and place of residence, the odds of having anemia, based on blood hemoglobin values, were over twofold higher in centenarians with bmi 20 versus those with bmi>20 whereas the odds of self-reported cvd tended to be reduced in those in the underweight classification (bmi 20; p=.053). the latter finding became significant in regression models further controlled for total fruit and vegetable intake (model 2; p=.048). in analyses controlled for gender, race, and place of residence, the odds of having self-reported diabetes or systolic blood pressure 140 mmhg were approximately three- and twofold higher, respectively, in centenarians with bmi 25 versus those with bmi<25. being overweight/obese (bmi 25) also tended to increase the odds of having diastolic blood pressure>90 mmhg (approximately three-fold; p=.055) or cardiovascular disease (approximately twofold; p=.074). further controlling for total fruit and vegetable intake (model 2) strengthened the associations between bmi 25 and diabetes and systolic blood pressure>140 mmhg, and resulted in a significant association between bmi 25 and diastolic blood pressure 90 mmhg. there were no associations between bmi 20 or bmi 25 and stroke, depression, or cancer in any of the regression models. to our knowledge, this is the first study to explore associations between dietary patterns and body weight status in the oldest old segment of the population. prevalence of overweight/obesity in this population-based study of centenarians was approximately 25%, which was considerably below the prevalence for these conditions in the overall population of older adults, aged 60 and above, in the usa at the time of data collection (69%;). in analyses controlled for gender, race, and place of residence, several parameters indicative of a low frequency of fruit and vegetable intake were associated with overweight/obesity (bmi 25), whereas there were no associations between frequency of intake of meat, dairy, and fruits and vegetables and being underweight (bmi 20). other findings include strong associations of underweight with anemia and of overweight/obesity with diabetes and high blood pressure, extending knowledge of such associations to the very old. the present research was part of a large, multidisciplinary study across a range of cognitive, mental, physical, and health-associated domains exploring the role of various factors pertinent to the survival and functioning of centenarians. to decrease testing burden for participants, dietary intake data focused on frequency of intake of specific food groups selected based on the dietary guidelines for americans and age-related associations with nutritional deficiencies and chronic diseases [16, 17]. notably, we observed that based on frequency of intake and regardless of bmi classification, a large percentage of centenarians were not meeting the dietary guidelines for many food groups, with the exception of green and orange/yellow vegetables. this later finding is consistent with an apparent preference for sweet potatoes and green vegetables reported for an earlier convenience sampling of georgia centenarians [23, 24]. such preferences likely are reflective of the traditional diet of the southeastern usa, rather than longevity-related differences in dietary patterns, and may not be replicable in other regions and cultures. our initial analysis indicated a greater intake of meat and total fruits in the underweight centenarians, suggesting that they were eating better than those in the normal weight and overweight/obese classifications. the underweight centenarians also had the highest total food scores, suggesting that they were meeting more of the recommended servings for specific food groups. however, almost twice as many underweight centenarians lived in skilled nursing facilities as compared to the community, and there was no association between low bmi and dietary groups after controlling for race, residence, and gender. in a specific comparison between centenarians residing in skilled nursing facilities and in the community, johnson et al. reported that those in skilled nursing facilities were more likely to eat three or more meals a day and to have a higher frequency of intake of most food groups. they suggested that such differences may be due to (1) the requirement that skilled nursing facilities serve meals that meet dietary guidelines and other federal nutrition policies [25, 26], (2) the inability of the methodology used to distinguish between food that was served and food that was eaten, and (3) barriers faced by community dwelling centenarians or their caregivers in purchasing, preparing, or consuming appropriate food to meet their nutritional needs. thus, associations in centenarians between low bmi and dietary status may be quite complex and influenced considerably by place of residence. in the present study, there was an increase in the relative risk for being overweight/obese in centenarians reporting the lowest frequency of intake of some nutrient dense foods including orange/yellow vegetables and citrus and noncitrus fruits. these observations are consistent with previous studies finding associations between lower reported or inferred consumption of fruits and/or vegetables and increased prevalence of overweight/obesity in children and young to middle-age adults [5, 2830]. interestingly, other studies in adults have indicated that increased consumption of fruits and vegetables may be an effective strategy for decreasing energy consumption and for increasing and maintaining weight loss [29, 31, 32]. in addition to potential beneficial effects on body weight, there is considerable evidence in other age groups that high consumption of fruits and vegetables may offer protective effects against and/or to reduce the relative risk of cardiovascular disease, hypertension, diabetes, and certain cancers [3340]. we observed that centenarians in the highest weight category (bmi 25) reported eating lower amounts of certain types of fruits and vegetables than their nonoverweight/nonobese counterparts and also appeared to be at greater risk for diabetes, high blood pressure, and cardiovascular disease. this suggests that a high intake of fruits and vegetables may be beneficial for maintaining optimal weight, and perhaps decreasing risk of chronic disease, even at very advanced age. however, additional, ideally longitudinal, research collecting more detailed food intake data is needed to support this contention. in addition, as social isolation, missing teeth, digestion difficulties, poor self-reported health, cost and preparation issues have been identified as barriers to fruit and vegetable intake in older adults [4143], research is needed to determine if and to what degree these or other potential barriers may be influencing the intake of fruit, vegetables, and other low energy, high nutrient dense foods in the very old. clinically defined anemia was present in greater than 60% of the centenarians in the lowest bmi grouping. after controlling for demographic covariates, a strong association remained between low bmi and anemia but not with other health conditions and indicators. accordingly, low bmi had been identified as an independent correlate or risk factor for anemia in some previous studies in older adults and clinical populations [4446], but not in others. although older adults with a low bmi are considered to be at nutritional risk [47, 48], it can not be assumed that the anemia observed in underweight older adults is primarily of dietary or nutritional etiology. indeed, our previous studies indicate a similar prevalence of anemia in vitamin b12-deficient and vitamin b12-adequate in georgia centenarians and a high prevalence of inflammatory anemia, either alone or in combination with nutritional deficiencies, in this population. nonetheless, as anemia is associated with increased mortality in acute and chronic disease states, particularly in those underweight [50, 51], it is important to monitor and treat this condition, as appropriate, in the very old. in summary, this secondary analysis provides evidence of an inverse association between fruit and vegetable intake and body weight status in a population-based study of centenarians. in addition, both underweight and overweight emerged as potential risk factors for various chronic diseases, emphasizing the importance of monitoring weight and of maintaining a healthy weight, even at very advanced ages. a major strength of the study is the inclusion of a population-based sampling of centenarians with greater diversity in race, place of residence, and functional status than would be typically obtained with a convenience sample. limitations of the study include the relatively small sample size, lack of information regarding physical activity, and reliance on data of frequency of intake for only a few food groupings rather than the use of a more extensive food frequency questionnaire including individual foods and serving sizes as per our earlier convenience study of centenarians [23, 24]. absence of intake data on key dietary components including grains/cereals and sweets/desserts necessitated the use a series of nonindependent binary logistic regression models instead of a more complex, single multinomial logistic regression to explore potential associations between bmi and dietary intake patterns. thus, specifically designed studies including more detailed information of dietary intake, physical activity data, and additional chronic disease indicators are needed to verify associations, or lack thereof, between dietary intake patterns, weight status, and chronic health conditions in the very old. furthermore, as dietary habits and other characteristics of this sample from georgia likely differ from those of centenarians from other countries and cultures, our findings need replication in other population groups .

associations between body mass index (bmi) and dietary patterns and health conditions were explored in a population-based multiethnic sample of centenarians from northern georgia. bmi 20 and 25 was prevalent in 30.9% and 25.3% of study participants, respectively. in a series of logistic regression analyses controlled for gender and place of residence, the probability of having bmi 25 was increased by being black versus white and having a low citrus fruit, noncitrus fruit, orange/yellow vegetable or total fruit and vegetable intake. the probability of having bmi 20 was not associated with dietary intake. when controlled for race, gender, residence, and total fruit and vegetable intake, bmi 25 was an independent risk factor for diabetes or having a systolic blood pressure 140 mmhg or diastolic blood pressure 90 mmhg, whereas bmi 20 was a risk factor for anemia. given the many potential adverse consequences of under- and overweight, efforts are needed to maintain a healthy weight, even in the oldest old.

PMC3124838

pubmed-215

the aspergilli are filamentous fungi, which are multicellular eukaryotes with a relatively simple life cycle. many of them have long been used in food production, industrial fermentation, and agriculture. on the other hand, a few, such as a. fumigatus, a. flavus, a. niger, a. nidulans, and a. terreus, are opportunistic fungal pathogens, causing life-threatening invasive aspergillosis (ia) in immunosuppressed patients [1, 2], in which a. fumigatus is the predominant pathogen [35]. the crude mortality for ia is 6090% and remains around 2942% even when treatment is given. the main reasons for patient death are late diagnosis and the low efficiency of the drug therapies available to treat ia. it maintains cell shape and provides osmotic protection [7, 8] and has therefore been recognized for a long time as an ideal drug target. indeed, several cell-wall-targeted drugs, such as echinocandins, caspofungin, micafungin, and anidulafungin, have been introduced as therapies. for example, echinocandins, which inhibit synthesis of -1,3-glucan, a crucial component of the cell wall are effective in the treatment of invasive fungal infections including ia. unfortunately, the echinocandins also trigger an increase of chitin [9, 10], which partially compensates for the loss of -1,3-glucan and reduces the efficiency of treatment due to the complicated mechanism of cell wall biogenesis in a. fumigatus. therefore, a more profound understanding of the mechanisms of cell wall biosynthesis in a. fumigatus would help to improve the efficiency of drug therapies, especially for drugs which target the cell wall. the cell wall of a. fumigatus is composed of a unique -1,3/1,4-glucan skeleton with chitin and galactomannan covalently linked to the nonreducing ends of -1,3-glucan. the cell wall is mainly coated with gpi proteins, which contain n- and o-glycans [11, 12]. while there is no doubt that glycosylation is involved in cell wall organization, the functional importance of protein glycosylation in cell wall organization has, until recently, remained poorly understood. however, during the past few years, it has become increasingly evident that glycosylation is vital for cell wall synthesis and thus vital for growth and morphology of a. fumigatus. basically, all eukaryotes possess three types of protein glycosylation, n-glycosylation of asparagine residues, o-glycosylation of threonine and serine residues, and glycosylphosphatidylinositol-anchoring (gpi-anchoring) of the c-terminus of some proteins. humans lacking individual glycosyltransferases suffer from severe congenital diseases, known as carbohydrate-deficient glycoprotein syndromes (cdgs) [1214]. clearly, the sugar components of proteins play a major role in embryonic and postembryonic development of humans as well as of all higher eukaryotes. however, the molecular details leading to cdgs are only vaguely understood. during the past 20 years it is now known that carbohydrates play increasingly important roles in regulating the development of higher organisms. however, the mechanism by which carbohydrates play a role in development and disease is still unclear. our knowledge of protein glycosylation comes mainly from investigation of the model yeast s. cerevisiae and of mammalian cells. although investigation of the model yeast has been very useful in elucidating the biochemical features of protein glycosylation at the cellular level, they can not reveal the complicated functions of glycosylation in the development of multicellular eukaryotes. therefore, investigation of glycosylation in the multicellular fungus a. fumigatus not only helps understand the mechanism of cell wall synthesis in this species but also provides insights into the role of glycosylation in the development of multicellular eukaryotes. this paper concentrates on protein glycosylation in a. fumigatus, which will be discussed with respect to the enzymatic pathways involved and their functional importance. furthermore, the utility of a. fumigatus as a model for glycosylation during development of multicellular eukaryotes will be outlined. the cell wall of a. fumigatus is mainly composed of -1,3-glucans that are highly branched with -1,6 linkages. together they constitute a three-dimensional network with a large number of nonreducing ends, to which chitin, galactomannan, and -1,3/1,4-glucan are covalently anchored. the cell wall is mainly coated with gpi proteins, which contain n- and o-glycans derived primarily from the process of glycosylation [11, 17]. deletion of gel2 leads to slower growth, abnormal conidiogenesis, an altered cell wall composition, and reduced virulence [18, 19]. it has been proposed that gel2p is responsible for the elongation of -1,3-glucan side chains of -1,3/1,6 branched glucan to provide new nonreducing ends. ecm33p is also involved in maintaining proper cell wall architecture though its function is unknown. disruption of ecm33 results in morphogenetic aberrations such as defects in conidial separation, increase of chitin in conidial cell walls, rapid conidial germination, and increased virulence [20, 21]. it is clear that glycoproteins are directly, as structural components of the cell wall, and indirectly, as enzymes required for cell wall synthesis, involved in maintaining proper cell wall architecture in a. fumigatus. increased chitin synthesis has been known as an important compensatory response to cell wall stress both in s. cerevisiae and filamentous fungi [2226]. in s. cerevisiae, the cell wall is required to maintain cell shape, which is essential for the formation of a bud and hence cell division. the yeast cell remodels its rigid structure to accommodate cell expansion during vegetative proliferation, mating pheromone-induced morphogenesis, and nutrient-driven filamentation through the cell wall integrity (cwi) signaling pathway. cell wall defects or damage induces the cells to activate the cwi pathway to survive, and the compensatory mechanism characterized by an increased chitin content is triggered. the cwi signaling pathway in s. cerevisiae is activated in response to low osmolarity, thermal stress, or mating pheromone and polarized growth. it is comprised of a family of cell surface sensors coupled to the small g-protein rho1p, which activates the cwi mapk cascade via protein kinase c (pkc1p). this signaling cascade activates the expression of genes encoding for cell wall proteins that stabilize the cell wall. meanwhile, activated rho1p also activates a set of additional effectors such as bni1p and bnr1p formin proteins, skn7p transcription factor, and the sec3p exocyst component, which regulate a diverse set of processes including -glucan synthesis at the site of cell wall remodeling, gene expression related to cell wall biogenesis, organization of the actin cytoskeleton, and secretory vesicle targeting to the growth site. a family of cell surface sensors is responsible for detecting and transmitting the status of the cell wall to rho1p. these sensor molecules include wsc1p (hcs77p/slg1p) [2931], wsc2p and wsc3p, and mid2p and mtl1p [32, 33]. among these cell wall stress sensors, wsc1p and mid2p appear to be the most important and serve a partially overlapping role in cwi signaling. reduced o-mannosylation leads to incorrect proteolytic processing of these proteins, which in turn results in impaired activation of the pkc1 pathway and finally causes cell death in the absence of osmotic stabilization. more recently, n-glycan is found to be directly involved in mid2p sensing. it has been shown that both the extent of the n-linked glycan and its distance from the plasma membrane affect mid2p function. these observations demonstrate that n- and o-glycosylation are important for cwi sensing and thus important for cell wall biogenesis and polarized growth in yeast. the presence of a. fumigatus genes encoding for proteins homologous to the yeast rho1p, rho3p, and cdc42p suggests a similar mechanism for the cwi pathway. indeed, it has been recently shown that afcdc42/cdc42, afrho1/rho1, and afrho3/rho3 are highly expressed in the mutant devoid of cwh41p (glucosidase i), which suggests an activation of these genes induced by cell wall damage. also, increased expression and activation of the a. fumigatus mpkap, an ortholog of the s. cerevisiae mpk1p, is also induced by cell wall damage [38, 39]. it is becoming clear that, as in yeast, defects in cell wall integrity also trigger the cwi mapk cascade in a. fumigatus. on the other hand, in contrast to yeast, little is known about the cell wall stress sensors in a. fumigatus. in the last release of the a. fumigatus genomic database (http://www.aspergillus.org.uk/indexhome.htm?secure/sequence_info/index.php~main), only one protein (afua_5g09020) is annotated as a homologue of the wsc4p, which does not appear to contribute to cwi signaling in yeast. therefore, the a. fumigatus cell wall stress sensor molecule remains to be identified and investigated. the precursor of all mannose residues found in galactomannan, glycoprotein, and gpi anchor in a. fumigatus is gdp-mannose. the activation of mannose initiates from formation of mannose 6-phosphate (man-6-p), which occurs by one of two routes: direct phosphorylation of mannose by hexokinase or interconversion from fructose 6-phosphate (fru-6-p) via phosphomannose isomerase (pmi), and the latter pathway requires three enzymes: pmi, phosphomannomutase (pmm), and gdp-mannose pyrophosphorylase (gmpp). fru-6-p is converted to man-6-p by pmi, and then man-6-p is converted to mannose 1-phosphate (man-1-p) by pmm. subsequently, man-1-p is ligated with the guanosine 5-triphosphate molecule (gtp) to form gdp-mannose by man-1-p guanylyltransferase [4063]. the interconversion of man-6-p and fru-6-p catalysed by pmi is the first committed step in the synthesis of man-containing sugar chains and provides a link between glucose metabolism and mannosylation. pmi deficiency is the cause of carbohydrate-deficient glycoprotein syndrome type ib (cdg-ib, omim 602579) in humans, but the clinical symptoms and aberrant glycosylation can be corrected with dietary mannose supplements. genes encoding for pmis have been investigated in several fungal species, such as s. cerevisiae, candida albicans, a. nidulans, and cryptococcus neoformans [4851]. the pmi mutant shows a significantly reduced growth rate at high concentrations of mannose. biochemical and genome-wide analysis reveals that excess mannose leads to an accumulation of man-6-p, which mainly inhibits the activity of phosphoglucose isomerase (pgi) and thus represses glycolysis, protein biosynthesis, and cell wall biogenesis. the a. nidulans mana1 mutant exhibits abnormal ballooning of hyphal tips and eventually ceases to grow. disrupted man1 mutant of c. neoformans leads to poor capsule formation, reduced polysaccharide secretion, morphological abnormalities, and attenuated virulence. in a. fumigatus, pmi activity is essential for viability and plays a central regulatory role in both glycosylation and energy production. deletion of the a. fumigatus pmi1 gene leads to uncoupling of the link between energy production and glycosylation and accumulation of man-6-p, which then results in defects in cell wall integrity, conidiation, and morphology. although extracellular mannose can rescue the growth of pmi deficient mutants in a. fumigatus, both lower and higher concentrations of mannose lead to a reduction in the levels of -glucan in the cell wall and an accumulation of man-6-p. the phenotypes associated with the mutant under mannose starvation are mainly due to an insufficient supply of gdp-man required for cell wall synthesis. the abnormal morphology associated with the pmi1 mutant under mannose-replete conditions is mainly ascribed to an accumulation of man-6-p, which can not efficiently enter glycolysis, instead becoming trapped in a cycle of dephosphorylation and rephosphorylation resulting in depletion of intracellular atp. it should be pointed out that the pmi in a. fumigatus mainly catalyzes the conversion of fru-6-p to man-6-p, and its binding affinity for man-6-p is similar to that of yeasts but different from the ones from bacteria or animals (table 1). this suggests that it may be possible to design a specific inhibitor for fungal pmis. several gmpps have been identified and characterized in different species [5559]. in s. cerevisiae and c. albicans, gmpp is essential [60, 61], while in leishmania mexicana gmpp is not required for viability. repression of gmpp in yeast leads to pleiotropic phenotypes including cell lysis, failure of cell separation, impaired budding and hyphal switching, clumping and flocculation, and cell wall defects. repression of expression of a. fumigatus gmpp srb1, a homologue of yeast srb1/psa1/vig9, leads to hyphal lysis, a defective cell wall, impaired polarity maintenance, and branching site selection, as well as rapid germination and reduced conidiation. in contrast to yeast, inducible repression of srb1 expression in a. fumigatus does affect the ability to direct polarity establishment and septation. these reports imply that mannose activation is specifically crucial for the synthesis and organization of the cell wall and thus essential for survival of fungal species. this further suggests that glycosylation is essential for the viability of pathogenic fungal species such as a. fumigates, and inhibitors that specifically block mannose activation in fungi may be potential drugs to treat fungal infections. n-glycosylated proteins contain oligosaccharides that are n-glycosidically linked to the -amido group of asparagine. this type of glycoprotein has been intensively studied in many model systems from yeast to human cells with respect to their structure, biosynthesis, and function. it has been shown that the formation of the highly variable n-linked oligosaccharides is initiated by the assembly of a lipid-linked oligosaccharide glc3man9glcnac2-pp-dol by a series of glycosyltransferases located on the cytoplasmic and luminal faces of the er membrane. the most complete understanding of biosynthesis of the lipid bound precursor has been obtained from s. cerevisiae and from mammals. as far as it is known, the corresponding reactions proceed almost identically in other eukaryotes. subsequently, the dol-pp-linked glc3man9glcnac2 is transferred as a whole to an asparagine residue within an n-x-t/s consensus sequence of a nascent peptide, which is catalyzed by the oligosaccharyltransferase (ost), and then the n-glycosylated proteins are modified in a species-specific manner and transferred through the secretory pathway to the cell surface where they either get exported or anchored to the plasma membrane, to the extracellular matrix, or to the cell wall (figure 1). the ost complex consists of at least eight different subunits, including ost1p, ost2p, wbp1, stt3p, swp1p, ost4p, ost5p, and ost3p/ost6p [6467]. although the function of each subunit is still unclear, stt3p is believed to be the catalytic subunit [6870], and its homologues are found in almost all eukaryotes. it appears that the a. fumigatus stt3 is also essential as no viable knockout mutant has been recovered. repression of the stt3 gene in a. fumigatus leads to a severe retardation of growth and a slight defect in cell wall integrity. further analysis shows that repression of stt3 upregulates expression of the genes responsible for glucan and chitin synthesis, especially gel1, gel2, fska, chse, and chsg. indeed, an increase of cell wall mannoprotein and chitin was observed following repression of the stt3 gene. however, this upregulation of chitin is not accompanied by an activation of the mpka kinase. indeed, only the unfolded protein response (upr) is induced. as the upr has been shown to be involved in cwi signaling in a. fumigatus, it is likely that upr, instead of the mpka-dependent cwi signaling pathway, is the major compensatory mechanism induced by repression of the n-glycosylation in a. fumigatus. once glc3man9glcnac2 is transferred to proteins, the n-glycan is processed sequentially in the er and golgi. n-glycan processing is initiated by the removal of the glucose residues catalyzed by er glucosidase i and glucosidase ii. in mammalian cells, n-linked glycan plays a decisive role as a quality control (qc) of the folding of secretory proteins, which is composed of calnexin, calreticulin, udp-glucose: glycoprotein glucosyltransferase (gt) and glucosidase ii (gii) and is essential for cellular survival [7577]. n-glycans initially serve to increase the hydrophilicity of the as-yet-unstructured nascent polypeptides. subsequently, the two outermost glucose residues of the n-glycan are removed by the sequential action of glucosidase i (gi) and gii to the monoglucosylated form, which is recognized and bound by calnexin, a type i er membrane lectin, and calreticulin, its soluble relative. for many glycoproteins, the interaction with calnexin or calreticulin slows down the rate of folding but increases efficiency. gii-catalyzed removal of the third glucose residue follows the dissociation of folding substrates from calnexin and is required for release of native polypeptides from the er and transport to their final destination. the folding sensor gt adds back a terminal glucose to promote reassociation of nonnative polypeptides released from calnexin, thus prolonging their retention in the er folding environment. cycles of de-/reglucosylation might be protracted until the polypeptide released from calnexin fulfills quality control requirements. when correct folding is not achieved, an er-specific n-glycan-dependent pathway of degradation removes the misfolded proteins. when n-glycosylation is inhibited, the most commonly observed effect is the generation of misfolded, aggregated proteins that fail to reach a functional state [75, 76]. before entering the qc system, the outermost glucose residue of the n-glycan is trimmed by er glucosidase i. a human inherited glucosidase i deficiency has been reported to result in neonatal birth with severe generalized hypotonia and dysmorphic features. unlike mammalian cells, s. cerevisiae lacks a calnexin cycle and gt and only has an effective mannosidase i-dependent erad system [80, 81]. the yeast glucosidase i (cwh1p) is encoded by the cwh41 gene. mutational defects in the cwh41 gene cause severe and selective instability of glycoprotein kre6p, a putative golgi glucan synthase required for -l,6-glucan synthesis [23, 83, 84]. some filamentous fungi have been proposed to possess n-glycan-dependent qc of glycoprotein folding based on fungal genome sequence data. recently, evidence that filamentous fungi possess an n-glycan-dependent qc system has been reported in a. fumigatus [37, 86]. indeed, calnexin (aas68033), glucosidase ii, and gt have been annotated in the last release of the a. fumigatus genomic database (figure 2). zhang et al. reported that deletion of the cwh41 gene in a. fumigatus results in defective n-glycan processing of the proteins secreted by a. fumigatus. although afcwh41 is not essential for hyphal growth and virulence, a severe reduction in conidial formation, abnormalities of polar growth and septation, and a temperature-sensitive deficiency of cell wall integrity were documented. also, the genes encoding rho-type gtpases (rho-type gtpase/cdc42) were upregulated, which suggests that the cwi pathway was activated in the mutant. after processing by two er -glucosidases, the n-glycan is further processed by the action of various 1,2-mannosidases, which can remove one or more of the four 1,2-linked mannose residues. in mammalian cells, man9glcnac2 is converted to man5glcnac2 by the action of er and golgi -mannosidases, which is the precursor for complex, hybrid, and high-mannose n-glycans. in s. cerevisiae, a specific er 1,2-mannosidase converts man9glcnac2 into man8glcnac2, which is elongated in the golgi to form an outer chain containing up to 200 residues of mannose [89, 90]. a. saitoi and trichoderma reesei have been found to produce n-glycan structures containing five mannose units (man5glcnac2), suggesting further processing of the man9glcnac2 precursor [91, 92]. the n-glycans on mature secreted glycoprotein produced by a. fumigatus are man6glcnac2, man7glcnac2, and man8glcnac2, in which man6glcnac2 is the major glycoform. these observations demonstrate that n-glycan synthesis in filamentous fungi seems to differ from that in yeast and is similar to that in higher eukaryotes (figure 3). although small n-glycans are commonly found on glycoproteins of a. fumigatus, hex5-13hexnac2 glycans on the galactomannoproteins, and man5-9glcnac2 as well as galf1man5-7glcnac2 structures on other secreted glycoproteins have been identified in a. fumigatus [93, 94]. the enzyme (udp-galp mutase) required to synthesize the requisite udp-galf donor has been shown to be an important factor in biosynthesis of the cell wall in a. fumigatus, while the gene/enzyme responsible for the transfer of galf has not been identified. recently, the a. fumigatus och1, a key mannosyltransferase for synthesis of elaborated protein n-glycans in yeast, has been identified. deletion of the och1 gene results in a reduction of sporulation in the presence of high calcium concentrations. this evidence suggests that polymannosylated n-glycans exist in a. fumigatus and certain proteins engaged in sporulation require n-glycan outer chains to be fully functional. the -mannosidases have been classified into two groups: class i and class ii [102, 120, 121]. class i -mannosidases include er man9-mannosidase, endomannosidase, and golgi mannosidase i. class ii -mannosidases include the lysosomal mannosidases, golgi mannosidase ii, yeast vascular mannosidase [98, 99], and er -mannosidase ii [122, 123]. several golgi -mannosidases have been cloned and characterized from penicillium citrinum [124, 125], a. saitoi, a. oryzae, t. reesei, and a. nidulans [102, 129]. these enzymes are all monomeric with a molecular weight of 5060 kda and show the maximal activity in the semiacidic condition (ph 46). class i -mannosidase is known to play an important role in the processing of mannose-containing glycans. in drosophila melanogaster, deletion of the golgi mannosidase i (mas-1) results in viable progeny, and the null organisms synthesize the same range of oligosaccharides as the wild-type ones, albeit at different ratios. in s. cerevisiae, disruption of the er -mannosidase gene does not prevent outer chain synthesis. in the last release of the tigr database (http://www.aspergillus.org.uk/indexhome.htm?secure/sequence_info/index.php~main), nine a. fumigatus genes are annotated to encode -mannosidases, including xp_749038.1, xp_754794.1, xp_751252.1, xp_751819.1, xp_752444.1, xp_752825.1, xp_753592.1, xp_751114.1, and xp_750572.1. among them, msdsp (xp_752825.1) has been identified to encode a class i 1, 2-mannosidase and acts on man8glcnac2 to produce man6glcnac2. deletion of the msds gene leads to a defect in n-glycan processing, as well as a reduction of cell wall components (including -glucan, -glucan, mannoprotein, and chitin) and reduced conidiation.. in mammalian cells, free oligosaccharides (fos) are generated by ost-mediated hydrolysis of glc3man9glcnac2-pp-dolichol in the lumen of the er or peptide n-glycanase (pngase)-mediated de-n-glycosylation of newly synthesized glycoproteins either in the er or the cytosol. fos that are liberated in the lumen of the er can be transported into the cytosol, where they are trimmed by an endo--d-n-acetylglucosamine h (endo h)-like enzyme and the -mannosidase man2c1p in order to yield an oligosaccharide, man5glcnac, that can be imported directly into lysosomes to be degraded (figure 4) [122, 123, 131135]. in humans and cattle [137139], a deficiency in -mannosidase results in the lethal disease mannosidosis, a rare lysosomal storage disease with a collection of clinical symptoms including progressive mental retardation, impaired hearing, dysostosis multiplex, immune defects, elevation of serum and urinary oligosaccharide levels, and an enlargement of lysosomes in most cell types resulting from the accumulation of undegraded oligosaccharides. the rat man2c1p is involved in oligosaccharide catabolism of misfolded glycoproteins in the lumen of the er which have been retrotranslocated into the cytoplasm for proteolytic disposal [131133]. a proteolytically cleaved version of the rat man2c1p has been found in the lumen of the er where it is believed to be involved in the early stages of glycoprotein maturation (also called er -mannosidase ii) (figure 4) [122, 123]. the yeast cytosolic -mannosidase ams1p, a counterpart of man2c1p, is also involved in the processing of fos. since the yeast png1p is mainly localized to the cytosol, it is proposed that the png1p-generated fos may both be generated and processed in the cytosol. the role of the yeast ams1p is to aid in recycling macromolecular components of the cell under nutrient deprivation. interestingly, after its synthesis in the cytosol, the ams1p is translocated into the vacuole by the cytosol-to-vacuole targeting pathway, which suggests a common feature shared by the s. cerevisiae ams1p and its mammalian counterparts. however, the yeast ams1p only participates in recycling or utilizing of oligosaccharide but not in processing of n-glycan (figure 4). it should also be noted that no structural studies have been performed on the products that can be generated from man8glcnac2 by ams1p, and the ultimate fate of such products remains obscure. on the other hand, two png1p-independent fos pools, man3glcnac2 and man8glcnac2, are also seen in s. cerevisiae. the pool comprising small fos (man3glcnac2) appears to be disposed of by unknown enzymes in the vacuole. the pool containing mainly man8glcnac2 may be generated and disposed of along the secretory pathway. similarly, a. nidulans -mannosidase iic is also proposed to be involved in oligosaccharide catabolism. both a. nidulans-mannosidase iic and s. cerevisiae ams1p are not essential for normal cellular function since disruption of these genes has no visible effect on growth or morphology [98, 99, 102]. in contrast to its counterpart in yeast or a. nidulans, the a. fumigatus ams1p is required for normal cellular function. deletion of the a. fumigatus ams1 leads to a severe defect in conidial formation, especially at a higher temperature. these results show that the afams1 gene is required for morphogenesis and cellular function in a. fumigatus. the involvement of the afams1 gene in polarized growth demonstrates that the processes involved in fos regulation are important for a. fumigatus. it is likely that the ams1p is involved in cell wall synthesis and thus polarity through the cwi pathway. therefore, probably the afams1 mutant could serve as a simple model to investigate the mechanism of -mannosidosis. functional analyses of the genes required for n-glycosylation reveal that protein n-glycosylation is important for cell wall synthesis, morphogenesis, and polarized growth in a. fumigatus. 2-d gel analysis reveals that deletion of the cwh41 gene encoding glucosidase i in a. fumigatus leads to er stress, which induces overexpression of hsp70 and calnexin chaperone and activates the erad. meanwhile, the proteins required for actin rearrangement are found to be underexpressed or missing, which is consistent with the observation of random localization of actin fibers in the mutant. these observations, for the first time, clearly suggest that n-glycosylation contributes to proper folding and trafficking in a. fumigatus. it appears that proteins involved in cell wall biosynthesis in a. fumigatus are more dependent on the n-glycan-dependent folding system. as in yeast, cell wall defects also trigger the cwi signaling pathway in a. fumigatus, which activates downstream effectors that regulate cell wall biogenesis and polarized growth. zhang et al. [37, 86] have proposed that the proteins required for cell wall synthesis or cell wall stress sensing are substrates of a. fumigatus cwh41p and require glucose trimming for their proper localization and function. misfolding of these proteins would cause cell wall defects, which then leads to activation of the erad and rho-type gtpases-mediated cwi pathway. moreover, activation of cdc42 in the cwi pathway also activates sepa, an upstream organizer of actin ring formation at septation sites, and thus causes abnormal polarized growth associated with the afcwh41 mutant (figure 5). although the phenotypes associated with different n-glycosylation mutants vary, the finding that all of these mutants exhibit phenotypes associated with cell wall defects, abnormal polarization, and morphological changes can all be explained by this proposed model. obviously, more investigations are needed to identify and characterize all of the proteins affected by n-glycosylation in a. fumigatus. this information would be key to understanding the complex compensatory mechanisms participating in cell wall biosynthesis in a. fumigatus, which would serve as a basis to develop new antifungal therapies, as well as help to elucidate the molecular mechanism of human diseases associated with defects in glycosylation. o-mannose glycosylated proteins were first discovered in yeast and filamentous fungi, and recently this type of glycoproteins has also been described in mammals. the o-mannosylation most likely occurs in all animals, with the exception of nematodes (e.g., caenorhabditis elegans); it is also not detected in plants (arabidopsis thaliana, oryza sativa). however, it has also been discovered in one bacterial species (mycobacterium tuberculosis). in mammalian cells, the inner o-linked mannose is elongated with the first addition of a n-acetylglucosamine and then various sugars. in the case of yeast, the o-mannose type carbohydrate chain starts with a serine/threonine-linked mannose, which is extended to an oligomannose chain. in a. fumigatus, the o-linked glycans on cell wall mannoproteins are found to be glc1, 6man, galf1, 6man1, 6man, galf1, 5galf1, 6man1, 6man and galf1, 5[galf1,5]3 galf1, 6man, while only a single mannose residue was detected on secreted proteins. a further type of protein o-glycosylation, in which a single -o-linked glcnac residue is linked to serine and threonine occurs in animals, plants, and filamentous fungi, but not in s. cerevisiae. for this type of protein modification, protein o-mannosylation is initiated by a family of protein o-mannosyltransferases (pmts) that are evolutionarily conserved from yeast to human [145, 146]. in s. cerevisiae a total of seven pmt family members (scpmt17p) are present [104, 147], which fall into three major groups of homology: (i) pmt1/5/7, (ii) pmt2/3/6, and (iii) pmt4. genes with significant homology to pmts have been cloned in humans, mice, and drosophila [148150]. specific protein substrates that are o-mannosylated by scpmt1p, scpmt2p, or scpmt4p have been described in s. cerevisiae [151153]. in comparison with s. cerevisiae, the pmt family is less redundant in higher eukaryotes. in drosophila only two pmt family members are present (rotated abdomen and twisted) [149, 150]. the same is true for mice and humans (pomt1 and pomt2) [148, 150]. mutations in human pomt1, a homologue of the yeast pmt4, cause walker-warburg syndrome (wws), which is characterized by severe congenital muscular dystrophy, neuronal migration defects, and structural abnormalities of the eye. targeted deletion of pomt1 in mice results in embryonic lethality due to defects in the formation of the reichert's membrane, the first basement membrane to form in the embryo. mutations of the drosophila pmt homologues alter muscle structures and the alignment of adult cuticle. the pmt family is crucial for viability, cell wall integrity, and morphogenesis in several fungal species, such as s. cerevisiae, s. pombe, c. albicans and c. neoformans, a. nidulans, and a. fumigatus [108, 109, 111115, 145, 156]. in s. cerevisiae, single pmt1 mutants fail to grow in anaerobic conditions on some media. the pmt1,2,3-triple mutants grow only in osmotically stabilized medium, whereas the pmt1,2,4- and pmt2,3,4-triple mutants are not viable in any conditions, indicating that pmt protein activity is essential in s. cerevisiae, although individual genes are dispensable. c. albicans contains five pmt genes. the pmt1 mutants are viable, but they are defective in undergoing cellular differentiation from yeast to a true hyphal growth form under some conditions. the virulence of the pmt1 null mutant is significantly attenuated, which is likely due to reduced o-glycosylation of the c. albicans adhesin als1p. the pmt phenotypes are closely linked to alterations in cell wall components, including cell wall mannoproteins and polysaccharides. in s. pombe only one member of each pmt subfamily is present, namely, oma1, oma2, and oma4. deletion of oma2, as well as simultaneous deletion of oma1 and oma4 is lethal. characterization of the viable s. pombe oma1d and oma4d single mutants shows that reduced o-mannosylation results in abnormal cell wall and septum formation, therefore severely affecting cell morphology and cell-cell separation. in c. neoformans, recently, willger et al. showed that pmt2 is an essential gene, and the double pmt1pmt4 deletion is lethal. filamentous fungi, such as a. fumigatus, a. nidulans, neurospora crassa, and fusarium gramineum, contain only three pmt genes that belong to the pmt1, pmt2, and pmt4 subfamilies, respectively [107, 108, 113]. all single pmt mutants in a. nidulans are viable but showed reduced growth at elevated temperatures and defects in morphogenesis [111, 112]. the double deletion pmta/pmtc (orthologues of the pmt2 and pmt4) and pmtb/pmtc (orthologues of pmt1 and pmt4) are synthetically lethal. have shown that a single deletion of a. fumigatus pmt1 results in temperature-sensitive phenotypes. when the a. fumigatus pmt1 mutant was grown on solid complete medium at 37c, no difference was found between the mutant and the wild type. a strongly retarded growth, however, was observed when this mutant was grown at 42c and 50c. this temperature-sensitive phenotype could be complemented by the addition of 1 m sucrose in the media. further analysis shows that the mannoprotein, -glucan, and chitin in the cell wall of the mutant grown at 37c are increased, while -glucan is reduced. when the a. fumigatus pmt1 mutant was cultured at 42c, the -glucan was increased, while the -glucan was decreased, and the mannoprotein and chitin content remained unchanged. moreover, deficient conidiation and reduced germination have been documented at 42c. as compared with the s. cerevisiae pmt1 mutants, the a. fumigatus pmt1 mutant, as well as the c. albicans and s. pombe pmt1 mutants, shows more severe defects in cell wall integrity. this significant phenotype could be explained by the fewer members of pmt family presented in a. fumigatus, c. albicans, and s. pombe. however, in a recent study by mouyna et al., the a. fumigatus pmt1 mutant does not show any visible phenotype. in the report by zhuo et al., the pmt1 deletion mutant was constructed by replacement of the entire coding region of the pmt1 in a. fumigatus strain cea17 (pyrg) with a pyrg cassette. therefore, the genetic background of the pmt1 null mutant is pyrg pmt1, while in the report by mouyna et al., the pmt1 mutant was constructed by transformation of a. fumigatus strain ku80 with a deletion cassette containing the e. coli phleomycin phosphotransferase gene (phle). therefore, the major differences may be due to the different genetic background of the strains used in these two reports. the single pmt2 or double pmt1pmt4 deletion(s) are lethal [114, 115]. fang et al. reported that reduced expression of pmt2 leads to retarded growth, cell wall defects, abnormal polarity, and reduced conidiation; however, no temperature-sensitive growth was found. interestingly, this is the first time that pmt2p is revealed to be involved in polarized growth. these observations suggest that a. fumigatus pmt2p is required for cell wall synthesis and morphogenesis and its function is distinct from that of a. fumigatus pmt1p. disruption of a. fumigatus pmt4 leads to abnormal mycelial growth, poor conidiation, and abnormal polarity. although an increased sensitivity to echinocandin, a 1,3-glucan synthase inhibitor, was observed in the a. fumigatus pmt4 null mutant, glucan synthase activity and 1,3-glucan content were not affected. in contrast to its counterpart in c. albicans, a. fumigatus pmt4 is not required for full virulence. the different functions associated with different a. fumigatus pmts are likely due to their different substrate specificities. further investigation of the pmt mutants will be helpful for understanding their molecular mechanism, which will not only increase our understanding of the function of o-mannosylation in a. fumigatus, but also may deepen our understanding of the molecular basis of the human walker-warburg syndrome (wws) which features mutations in pomt1, a homologue of a. fumigatus pmt4p, and results in a failure of polarized growth during neuronal migration. gpi anchoring is a conserved glycosylation process in eukaryotes, which enables many cell surface proteins such as cell surface enzymes, receptors, and adhesion molecules to be covalently anchored to the cell membrane. the core structure of the gpi anchor consists of a lipid group, myoinositol, glucosamine, several mannose residues, and a phosphoethanolamine group, which ultimately connects the gpi anchor to the protein via an amide bond. although the number of mannose groups and the position of side-chains on the gpi anchors vary widely between species, a common core structure of etnman3glcn-pi is conserved in all gpi-anchored proteins found in protozoa, yeast, plants, and mammals (figure 6). gpi anchoring is not essential in mammals at a cellular level as several gpi-deficient cell lines have been established. however, an acquired gpi-anchoring deficiency in haematopoietic stem cells causes paroxysmal nocturnal haemoglobinuria, a rare but serious human disease. also an overexpression of pig-p, a protein of unknown function required for gpi anchor synthesis, has been noted in fetal down syndrome brain. in contrast to mammals, gpi anchor synthesis is essential in s. cerevisiae. in s. cerevisiae, many gpi-anchored proteins are known to be involved in morphogenesis and cell wall organization. one type is the gpi-mannoproteins covalently linked to cell wall -1,6-glucan which play important biological functions in filamentation, mating, flocculation, or adhesion to the external matrix [161167]. the second type are the gpi proteins associated with the plasma membrane which possess enzymatic activities able to modify cell wall polymers and are involved in altering cell morphology, such as -glucanase and -glucosyltransferase [168170]. recent studies in a. fumigatus suggest that at least nine gpi-anchored proteins are common to filamentous fungi and yeast. five of them are homologues of putative gpi-anchored yeast proteins that have been shown to play a role in cell wall morphogenesis. the gpi anchor is assembled at the er in multiple steps catalyzed by the concerted actions of approximately 20 proteins. the first step of gpi anchor synthesis is initiated by the transfer of n-acetylglucosamine (glcnac) from udp-glcnac to phosphatidylinositol (pi), which is catalyzed by the glycosylphosphatidylinositol-n-acetyl-glucosaminyltransferase (gpi-gnt) complex. the mammalian gpi-gnt complex consists of seven proteins, including pig-a, pig-h, pig-c, pig-p, gpi1, pig-y, and dpm2. all except dpm2 have structural and functional counterparts in s. cerevisiae, where they are known as gpi3p, gpi15p, gpi2p, gpi19p, gpi1p, and eri1p, respectively. pig-a/gpi3p is believed to possess the catalytic domain because gpi3p binds a photoactivatable udp-glcnac analog and is a member of glycosyltransferase family 4 of retaining glycosyltransferases. the roles of the other subunits in the gpi-gnt complex are as yet unclear, but they may mediate regulatory interactions. in yeast, gpi anchoring is essential for viability and plays an important role in the biosynthesis and organization of the cell wall. a gpi3 temperature-sensitive mutant is not viable at 37c [116, 117]., it is postulated that the introduction of mutations in gpi3/gpig-1 genes allows for minimal level of product function and survival when growing the mutant cells below the restrictive temperatures. however, the mechanism, by which the defect in gpi anchoring leads to a lethal phenotype in these two species, is poorly understood. it has been shown that a. fumigatus gpi anchors possess five mannose residues with a phosphoethanolamine linked on the first three residues [174, 175]. the a. fumigatus pig-a gene, the homologue of the gpi3/pig-a gene in yeast, has been investigated. also, an increased content of -glucan and mannoprotein was observed in the mycelial cell wall of the afpig-a mutant. unlike the temperature-sensitive or conditional lethal phenotype seen in the yeast gpi3 mutant, afpig-a can survive at temperatures from 30c to 50c. completely blocking gpi anchor synthesis in a. fumigatus afpig-a leads to cell wall defects, abnormal hyphal growth, rapid conidial germination, and aberrant conidiation. in vivo assays therefore, the gpi anchor seems not essential for viability, but required for cell wall integrity, morphogenesis and virulence in a. fumigatus. indeed, this is the first report that a deficiency in gpi-anchor synthesis does not lead to a temperature-sensitive or conditional lethal phenotype in microbes, which provides an opportunity to identify the basic function of gpi anchoring in fungi. during the past 50 years, proteins and nucleic acids have dominated the field of biology. the enormous advances in the analysis of complex carbohydrates have enabled us to investigate the structure and function of carbohydrates, and the field has developed enormously. it is now known that carbohydrates play very important roles, especially in the regulation of development of higher organisms. however, the mechanisms by which carbohydrates play a role in development and diseases are still poorly understood. our knowledge of protein glycosylation comes mainly from the investigation of s. cerevisiae and mammalian cells. although investigations of the model yeast and mammalian cells have been very useful in elucidating the biochemical features of protein glycosylation, these investigations at the cellular level can not reflect the complicated functions of glycosylation in the development of multicellular eukaryotes. therefore, more model systems have been introduced, such as caenorhabditis elegans, drosophila melanogaster, and mice. however, these model systems are still too complex since deletion of individual glycosyltransferase genes in these systems sometimes leads to fetal death or nonvisible phenotypes. as compared with s. cerevisiae, c. elegans, d. melanogaster, or mice, a. fumigatus seems to be an ideal model for investigation of the function of glycosylation since a. fumigatus is a multicellular eukaryote with a relative simple life cycle, in which it undergoes a series of developmental events that require polarized growth. recent progress shows that a. fumigatus has evolved an intact n-glycan-dependent qc system, which is present in mammalian cells but not in yeast. disruption of either processing or degradation of n-glycan in a. fumigatus leads to phenotypes such as cell wall defects and abnormal polarity. based on investigations of s. cerevisiae and filamentous fungi, it is likely that glycosylation first evolved to ensure synthesis of the fungal cell wall and only later did the n-glycan-dependent qc system evolve to ensure precisely controlled cell wall synthesis and polarized growth which are important for multicellular development. however, this hypothesis is controversial.. showed that the n-glycan-dependent qc system is functional in entamoeba, trichomonas, cryptococcus, and s. pombe, but is not functional in some fungi such as giardia and plasmodium, theileria, encephalitozoon, toxoplasma, cryptosporidium, and tetrahymena. they proposed that the n-glycan-dependent qc system was likely present in the common ancestor of extant eukaryotes and was secondarily lost from some eukaryotes. for example, the s. cerevisiae kre5 is believed to be the gt ortholog that no longer glucosylates misfolded glycoproteins but is instead thought to be involved in -1,6-glucan synthesis. of course, the possibility that the s. cerevisiae kre5 is the ancestor of gt can not be excluded. it remains unclear where is the evolutionary origin of glycosylation, what is the basic function of glycosylation at the early stages of evolution, and how glycosylation is regulated. definitely, the answers to these questions will enable us to understand the basic function and regulation of glycosylation in the development of multicellular eukaryotes and help to understand more complex functions in higher eukaryotes. on the other hand, the investigation of a. fumigatus is also a key to understanding complex compensatory mechanisms of cell wall biosynthesis and may provide a new strategy for drug development. during the past few years, the framework of the biosynthetic pathways of glycosylation in a. fumigatus has been delineated. functional analyses of some of the genes in this pathway have shown that glycosylation is required for cell wall synthesis, polarity, morphogenesis, and cellular function in a. fumigatus (figure 7 and table 2). however, a detailed understanding of this pathway remains unknown, such as details regarding the synthesis of the n-glycan precursor, the precise molecular mechanism of n-glycan processing, qc of protein folding, and modification of the gpi anchor. moreover, the molecular mechanisms by which glycosylation plays a role in morphogenesis and development of a. fumigatus are vaguely understood. therefore, the future direction would be looking for those key proteins that are affected by glycosylation and identifying the signal transduction pathways that link glycosylation and development, through genetic, biochemical, cell biological, and proteomic studies.

glycosylation is a conserved posttranslational modification that is found in all eukaryotes, which helps generate proteins with multiple functions. our knowledge of glycosylation mainly comes from the investigation of the yeast saccharomyces cerevisiae and mammalian cells. however, during the last decade, glycosylation in the human pathogenic mold aspergillus fumigatus has drawn significant attention. it has been revealed that glycosylation in a. fumigatus is crucial for its growth, cell wall synthesis, and development and that the process is more complicated than that found in the budding yeast s. cerevisiae. the present paper implies that the investigation of glycosylation in a. fumigatus is not only vital for elucidating the mechanism of fungal cell wall synthesis, which will benefit the design of new antifungal therapies, but also helps to understand the role of protein glycosylation in the development of multicellular eukaryotes. this paper describes the advances in functional analysis of protein glycosylation in a. fumigatus.

PMC3184424

pubmed-216

coronary artery disease (cad) remains the principal cause of mortality and morbidity around the world [1, 2]. although the mechanisms are still not entirely resolved, previous studies have demonstrated that an imbalance between t-helper 1- (th1-) mediated and th2-mediated immune functions contributes to the development of atherosclerosis. recently, th17, which are a newly defined subset different from th1 and th2, reactive to autoantigens are involved in the pathogenesis of several autoimmune diseases [4, 5]. in addition to th1, th2, and th17 lineage, regulatory t cells (tregs), a special subset of cd4 t cells, inhibit atherosclerosis development by attenuating activated t cell responses [6, 7]. inspiringly, previous clinical and experimental studies from our laboratory have found that th17/tregs functional imbalance exists during atherogenesis, indicating that the imbalance of th17/tregs plays a critical role in cad [8, 9]. hence, these findings have showed that cd4 t cell subpopulations play an important role in the initiation and progression of atherosclerosis. it is well known that cd4 t cells are divided into different subsets depending on the cytokines they produce. interferon- (ifn-), the principal cytokine of th1 cells, is proinflammatory and exacerbates atherosclerotic disease, while the th2 cytokine such as interleukin- (il-) 4 is considered to be mainly atheroprotective and can neutralize th1 cytokine activity [1012]. moreover, hashmi and zeng have found that il-17 and il-17 induced cytokines (il-6 and il-8) were significantly increased in acs patients. interestingly, tregs exert antiatherosclerosis partly by secretion of anti-inflammatory cytokine transforming growth factor (tgf-1), which can in turn induce the expression of forkhead box transcription factor p3 (foxp3) and promote differentiation of tregs derived from cd4cd25 t cells [15, 16]. therefore, these findings suggest that cytokines as those mentioned above are also essential for the formation and progression of the atherosclerotic plaque. the galectin family is characterized by conserved carbohydrate recognition domains (crd) that can bind glycosylated proteins. galectins are involved in a wide range of biologic processes such as cell adhesion and migration, proliferation and apoptosis, tumor biology, and regulation of the immune system. galectin- (gal-) 9 is a member of the galectin family of carbohydrate-binding proteins comprising two carbohydrate recognition domains connected by a linker peptide. gal-9 is mainly expressed by eosinophils, endothelial cells, macrophages, dcs, kupffer cells, vascular endothelial cells, intestinal epithelial cells, and in particular t lymphocytes. furthermore, gal-9 is believed to function predominantly as a multifaceted player in adaptive and innate immunity, especially in t cell development and homeostasis [2023]. accumulating evidence shows that gal-9 induces apoptosis in subsets of differentiated t cells, particularly in th1 and th17 cells, and stimulates the activity of tregs [19, 2428]. indeed, treatment with recombinant gal-9 moderated the progression of experimental autoimmune encephalomyelitis (eae), arthritis, and diabetes in animal models [19, 2931], by reducing the number of th1 and th17 cells and downregulating circulating ifn- levels. t cell immunoglobulin mucin- (tim-) 3 has been identified as a receptor for gal-9. although gal-9 can function in a tim-3-independent fashion, the immune-regulatory effects of gal-9 are largely attributed to gal-9-tim-3 pathway [3235]. more recently, foks et al. demonstrated that anti-tim-3-ab administration promoted atherosclerotic plaque formation, which indicated that tim-3-gal-9 pathway may be concerned with the development of atherosclerosis. thus, it is reasonable to postulate that gal-9 may be involved in atherosclerosis based cad. in addition, several findings strongly support the original experimental observations that gal-3 plays an important role in the underlying heart failure (hf) processes and that elevation of gal-3 is associated with disease progression and poor outcome in hf [3739]. herein, we investigate serum gal-9 levels in chinese patients with cad, and the severity of coronary arteries stenosis was evaluated by gensini score. furthermore, ifn-, il-4, il-17, tgf-1, high-sensitivity c-reactive protein (hs-crp), and the classical atherosclerosis risk factors were evaluated. additionally, th1, th2, th17, and cd4cd25foxp3 tregs differentiation were detected in pbmc cultures exposed to gal-9. 232 patients presenting at the department of cardiology of huazhong university of science and technology affiliated union hospital between jan. 2013 with suspected or established cad were recruited, including 149 males and 83 females. they were divided into four groups: (1) the control group, which consisted of 50 subjects with nca (28 men and 22 women, mean age 56.7 11.7); (2) sap group (25 men and 15 women, mean age 62.4 10.0, inclusion criteria: typical chest discomfort that was associated with horizontal or downsloping st-segment depression>1 mm in an exercise test); (3) nsteacs group (60 men and 30 women, mean age 60.6 9.9, which included unstable angina pectoris (uap) and non-st-segment elevation myocardial infarction (nstemi), inclusion criteria: chest pain at rest with definite ischemic electrocardiographic changes, t-wave inversions and/or st-segment changes, or typical ischemic chest pain which persists for more than 20 min, elevated serum myocardial necrosis markers concentration and dynamic evolution, but not the typical st-elevation electrocardiogram); (4) stemi group (36 men and 16 women, mean age 54.1 12.3, inclusion criteria: myocardial infarction that was confirmed by a significant increase of serum creatine kinase mb, troponin i levels, and elevation of st-segment). furthermore, all participants underwent coronary angiography after admission and completed a standardized questionnaire about previous and present illness, medication history, and smoking status. cardiovascular-interrelated factors, such as age, body mass index (bmi), gender, and ejection fraction (ef) were estimated via physical examination, ultrasonic cardiography (ucg), and electrocardiogram (ecg), respectively. patients with the following characteristics were excluded from study enrollment: valvular heart disease, thromboembolism, autoimmune diseases (systemic lupus erythematosus, rheumatoid arthritis, etc.), collagen disease, disseminated intravascular coagulation, severe liver and kidney disease, symptomatic heart failure, trauma or surgery, or malignant disease. the study was approved by the ethics committee of tongji medical college of huazhong university of science and technology, and all participants were provided written informed consent prior to study entry. two experienced cardiologists, who were not aware of the patients ' clinical and biochemical results, visually examined angiographic images to assess the extent and severity of cad. cad diagnosis was made according to the presence of 50% stenosis in 1 main coronary artery. the stenosis severity of cad was assessed by gensini score as previously described. in the ami group, the blood was drawn with a 21-gauge needle for clean venipuncture of an antecubital vein and the samples were collected into sodium heparin vacutainers (becton-dickinson). after centrifugation, the serum obtained was stored at 80c until further use to measure the concentration of gal-9. the level of gal-9 was measured by elisa according to the manufacturer's instructions (r&d systems). in addition, the levels of ifn-, il-17 (bolingkewei biotechnology, china), il-4, hs-crp (huijia biotechnology, china), and tgf-1 (fumeng gene biotechnology, china) were measured by elisa, following the manufacturer's instructions. the minimal detectable concentrations were 28 pg/ml for gal-9, 1.8 pg/ml for ifn-, 1.8 pg/ml for il-17, 0.4 pg/ml for il-4, 22 pg/ml for hs-crp, and 8 pg/ml for tgf-1. the intra-assay and interassay coefficients of variation for all elisa were<5% and<10%, respectively. all the other biochemical measurements, including serum total cholesterol (tc), triglyceride (tg), low-density lipoprotein cholesterol (ldl-c), high-density lipoprotein cholesterol (hdl-c), apolipoprotein a-i (apoa-i), apolipoprotein b (apob), lipoprotein(a), creatinine, fasting plasma glucose (fpg), uric acid, and cardiac troponin i (ctni), were carried out by the biochemical laboratory of our cardiovascular institute using standard methods. peripheral blood mononuclear cells (pbmcs) from nca (excluded from hypertension, diabetes, and dyslipidemia) were isolated by ficoll-hypaque density gradient centrifugation (pharmacia lkb technology, uppsala, sweden). cells from the interphase were collected and washed twice with dulbecco's phosphate buffered saline (d-pbs). remaining erythrocytes were removed using lysis buffer (4.14 g nh4cl, 0.5 g khco3, and 18.6 mg na2edta in 500 ml water, ph=7.4 and sterilized) for 5 min on ice. pbmcs were resuspended in rpmi1640 (lonza, verviers, belgium) supplemented with 2.5% fcs, penicillin (100 u/ml)/streptomycin (100 u/ml), and sodium pyruvate (1 mm, sigma). pbmcs were stimulated with anti-human cd3 and anti-human cd28 antibodies (both 2 g/ml, sanquin) in the presence of recombinant gal-9 (m) (0.010.1 m, prospec-tany technogene ltd., israel) for 24 h. cells were allocated into tubes and washed once in phosphate buffered saline (pbs). for tregs analysis, the cells were incubated with anti-cd4-fitc-hab and anti-cd25-apc-hab (bd pharmingen). after the surface staining, the cells were stained with anti-foxp3-pe-hab (bd pharmingen) after fixation and permeabilization according to the manufacturer's instructions. for analysis of th1, th2, and th17 cells, the cells were stimulated with phorbol myristate acetate (pma, 20 ng/ml, alexis biochemicals, san diego, ca) and ionomycin (1 g/ml, alexis biochemicals) for 4 h in the presence of 2 mol/ml monensin (alexis biochemicals). the incubator was set at 37c under a 5% co2 environment. after culture for 4 hours, the cells were collected for staining according to the instructions. fixation and permeabilization were necessary before staining with anti-ifn--pe-, anti-il-4-pe-, or anti-il-17-pe- hab (bd pharmingen). continuous variables are summarized as mean standard deviation (sd), and categorical data are presented as percentages. the shapiro-wilk test was used to assess the normality of distribution of continuous variables. in order to compare two groups, continuous variables were tested using the independent samples t-test for normally distributed data and the mann-whitney u test for nonnormally distributed data; the chi-square test was used for categorical variables. when three or more groups were compared, one-way anova was used. if significance was found, newman-keuls test was performed for post hoc analysis to detect the difference among groups. multiple stepwise regression analysis was used to evaluate the influence of different variables on gal-9 and to adjust for covariates. independent factors were sex, age, ctni, and the metabolic-related variables including bmi, fpg, lipid profiles, and hs-crp. to determine the independent predictors for the presence and severity of cad, all the conventional risk factors associated with cad were tested in multiple stepwise regression analysis. the prevalence of smoking and the levels of tg, lipoprotein(a), fpg, creatinine, hs-crp, and ctni were significantly higher in patients with cad compared to patients with nca group (all p<0.05). however, other biochemical results, including tc, hdl-c, ldl-c, and uric acid, were similar between nca and cad patients. compared with stemi group, patients in sap and nsteacs groups showed markedly higher hdl-c levels and age and lower levels of lipoprotein(a), fpg, hs-crp, and ctni (all p<0.01). compared to patients with sap, the use of aspirin, -blockers, and statins was rare in patients with acs (all p<0.05), whereas the levels of lipoprotein(a) and hs-crp were markedly higher in patients with acs (all p<0.01). a significant increase of creatinine levels was observed in patients with stemi compared with nsteacs group (p<0.05) and an obvious decrease of uric acid levels was found in patients with stemi compared to sap group (p<0.01). unexpectedly, the distribution of hypertension, diabetes mellitus, dyslipidemia, and family history was similar among patients with acs and sap. among the total 232 study participants, serum gal-9 levels ranged from 1733.86 to 5259.39 pg/ml. compared with the nca group, patients with cad had significantly lower levels of gal-9 (3283.55 587.59 versus 3565.97 544.37 pg/ml, p<0.05; figure 1(a)). in addition, we found that serum gal-9 levels were significantly lower in the stemi (3126.36 637.7 pg/ml) than those in the sap group (3607.91 541.35 pg/ml) or the nca group (stemi versus sap and nsteacs versus sap, all p<0.01; stemi versus nca and nsteacs versus nca, all p<0.01; figure 1(b)). interestingly, serum gal-9 levels did not differ significantly between patients with nsteacs and stemi (p>0.05), nor was there a difference between the sap and nca groups (p>0.05; figure 1(b)). as shown in figure 2, serum il-17, il-4, ifn-, and tgf-1 were detected in each group. the il-17 and ifn- concentrations in patients with stemi (il-17, 57.16 16.14 pg/ml; ifn-, 13.43 5.29 pg/ml) and nsteacs (il-17, 47.68 14.46 pg/ml; ifn-, 11.28 4.23 pg/ml) were significantly higher compared with those in patients with sap (il-17, 26.94 9.09 pg/ml; ifn-, 6.05 2.41 pg/ml) and nca groups (il-17, 24.00 10.14 pg/ml; ifn-, 5.83 2.12 pg/ml) (all p<0.01; figures 2(a) and 2(c)). il-4 concentrations showed no difference in any of the groups (stemi, 7.25 3.82 pg/ml; nsteacs, 7.22 3.87 pg/ml; sap, 8.12 4.48 pg/ml; nca, 6.83 3.25 tgf-1 concentrations in patients with stemi (4.08 2.13 ng/ml) and nsteacs (4.73 2.71 ng/ml) were significantly lower than those in patients with sap (8.03 3.88 ng/ml) and nca (9.02 4.86 ng/ml) (all p<0.01; figure 2(d)). importantly, gal-9 levels were negatively correlated with il-17 (r=0.45, p<0.001; figure 3(a)) and ifn- (r=0.53, p<0.001; figure 3(c)) but positively associated with tgf-1 (r=0.58, p<0.001; figure 3(d)). however, gal-9 levels showed no correlation with il-4 concentrations (r=0.04, p=0.528; figure 3(b)). to detect the involvement of gal-9 in the induction of differentiation of human cd4 t cells gal-9 expanded the number of cd4cd25foxp3 tregs (control, 6.99 1.61%; gal-9 (0.01 m), 9.24 2.04%; gal-9 (0.03 m), 10.27 3.04%; gal-9 (0.1 m), 11.24 3.23%) and decreased the development of th17 (control, 0.628 0.239%; gal-9 (0.01 m), 0.418 0.171%; gal-9 (0.03 m), 0.214 0.064%; gal-9 (0.1 m), 0.059 0.015%) dose dependently (figures 4(c) and 4(d)), with resulting increase in secretion of tgf-1 (control, 165.3 48.6 pg/ml; gal-9 (0.01 m), 227.8 72.4 pg/ml; gal-9 (0.03 m), 312.9 81.7 pg/ml; gal-9 (0.1 m), 528.1 97.4 pg/ml) and suppressed il-17 production (control, 132.4 23.6 pg/ml; gal-9 (0.01 m), 110.3 25.7 pg/ml; gal-9 (0.03 m), 81.9 18.0 pg/ml; gal-9 (0.1 m), 56.6 13.8 however, the development of th1 and th2 cells and secretion of ifn- and il-4 in the supernatant were similar in the gal-9 untreated and treated pbmcs (figures 4(a), 4(b), and 4(e)). as we expected, gal-9 levels were found to be negatively correlated with hs-crp (r=0.37, p<0.001; figure 5(a)), the gensini score (r=0.23, p=0.001; figure 5(b)), fpg (r=0.15, p=0.027; figure 5(c)), and lipoprotein(a) (r=0.16, p=0.012; figure 5(d)) but positively associated with creatinine (r=0.21, p=0.002; figure 5(e)) and age (r=0.14, p=0.028; figure 5(f)). to determine which variables were independently associated with gal-9, multiple stepwise regression analysis using gal-9 as the dependent variable identified sex, age, bmi, fpg, tc, tg, hdl-c, ldl-c, hs-crp, lipoprotein(a), creatinine, uric acid, ctni, and therapeutic use of statins as independent variables. after adjustments, only hs-crp (b=72.158, p<0.001), lipoprotein(a) (b=8.333, p=0.045), creatinine (b=5.228, p<0.001), and use of therapeutic statins (b=362.29, p<0.001) retained significance for independently predicting gal-9 (table 3). in order to determine which variables gensini score was the dependent variable, and sex, age, bmi, fpg, lipid profiles, gal-9, hs-crp, uric acid, traditional risk factors, and statins were independent variables. after adjustments, only gal-9 (b=0.145, p=0.011), age (b=0.276, p<0.001), and lipoprotein(a) (b=0.280, p<in the present study, we found that participants with cad had lower serum gal-9 levels compared with nca. furthermore, serum gal-9 levels in the acs group were significantly lower than those in the sap or nca group. moreover, gal-9 was found to be independently associated with hs-crp, lipoprotein(a), and creatinine. notably, gal-9 suppressed t-helper 17 (th17) and expanded regulatory t cells (tregs) as analyzed within the activated cd4 t cell population, resulting in decreased il-17 production and increased secretion of tgf-1. to the best of our knowledge, this is the first study to investigate the relation of serum gal-9 levels with the presence and the severity of coronary arteries stenosis. mor et al. have reported that cd4cd25 tregs deficiency enhanced atherosclerotic lesion development in ldlr mice, and adoptive transfer of cd4cd25 tregs attenuated the initiation and progression of atherosclerosis in apoe mice [42, 43]. moreover, our laboratory has detected that th17/treg functional imbalance exists in patients with acs, suggesting a potential role for th17/treg imbalance in plaque destabilization and the onset of acs [8, 9]. of note, gal-9 is a multifunctional modulator of t cell immunity with apoptotic effects on th17 cells and stimulatory activity on tregs in autoimmune diseases. in line with this publication, we found that gal-9 was able to induce cd4cd25foxp3 tregs development and inhibit th17 differentiation in activated pbmcs of nca. therefore, we speculated that gal-9 plays an immune-regulatory role in atherosclerosis via its effects on tregs and th17 cells. acs patients have significantly higher il-17 and il-17 induced cytokines (il-6 and il-8), while the pleiotropic cytokine ifn- is a proinflammatory regulator that is expressed at high levels in atherosclerotic lesions. in addition, it has been demonstrated that increased expression of tgf-1 is a stabilizing factor in human atherosclerotic plaques. in this study, we also found that il-17 and ifn- concentrations in patients with stemi and nsteacs were significantly higher compared with those in patients with sap and nca, while tgf-1 concentrations in patients with stemi and nsteacs were significantly lower than those in patients with sap and nca. these results again confirmed that inflammatory cytokines mentioned above have differential effects in atherosclerosis based cad. interestingly, gal-9 levels were showed to be negatively correlated with il-17 and ifn- but positively associated with tgf-1. furthermore, we found that gal-9 was able to increase secretion of tgf-1 and decrease il-17 secretion in activated pbmcs. consequently, our data in vitro imply a protective role for gal-9 in atherosclerosis via expanding tgf-1 and suppressing il-17 secretion. however, the precise effect and mechanism of gal-9 in atherosclerosis are still to be elucidated in atherosclerosis animal models. surprisingly, we found that the development of th1 cells and secretion of ifn- in the supernatant were similar in gal-9 untreated and treated pbmcs, since zhu et al. reported that gal-9 induces apoptosis in th1 cells. this discrepancy may be ascribed to the diverse concentrations of gal-9 and different incubation periods. additionally, il-4 concentrations in the supernatant showed no difference in gal-9 untreated and treated pbmcs. this result further confirms that the effect of il-4 is still controversial [45, 46], reflecting its dual pro- and anti-inflammatory character. moreover, there are numerous publications showing that gal-9 has proinflammatory effects in addition to its immune-suppressive effects, especially through its actions on cells of the innate immune system like dc and nk cells [47, 48]. thus, these results indicate that gal-9 has bidirectional effects like many immune-regulatory molecules. our data showed that cad patients had lower serum gal-9 levels than those without cad, and gal-9 was independently associated with the gensini score in patients with cad. these results suggest that low serum gal-9 levels are associated with the presence and the severity of coronary arteries stenosis. previous studies have elucidated that serum biomarkers are recognized as important tools for prediction, diagnosis, risk stratification, and therapeutic decision-marking for patients with cad. accumulating studies demonstrated that atherosclerotic lesion instability and rupture induced by inflammation are the major mechanisms of acs [50, 51]. recently, a large number of clinical experiments have reported that hs-crp is not only a biomarker of inflammations and atherosclerosis, but also a marker of atheromatous plaque vulnerability [5254]. in our study, patients with acs had higher serum hs-crp levels compared to patients with sap. of note, gal-9 was found to be independently associated with hs-crp. hence, low serum concentrations of gal-9 may take part in the onset of acs and may act as a predictor of atheromatous plaque vulnerability. however, whether a causal relationship exists between the two processes is still to be studied. several lines of evidence indicate that lipoprotein(a) is an independent risk factor for patients with cad [55, 56]. all these findings together suggest that gal-9 might be a potential independent biomarker of cad. interestingly, our data showed that serum gal-9 levels were higher in patients of cad complicated with t2 dm than those of cad without t2 dm (data not shown). 's study reporting that serum gal-9 levels are elevated in the patients with type 2 diabetes (t2 dm) and chronic kidney disease (ckd). however, serum gal-9 levels were decreased in cad and elevated in the patients with t2 dm. this paradox could be attributed to the fact that atherosclerosis is highly multifactorial, tregs and gal-9 being only some factors among many others. the exact mechanism is still to be elucidated but different diseases may have divergent immune states. worth noting is the fact that the serum gal-9 level seems relatively higher in our study than in the previous studies [22, 57]. the differences among these studies might be explained, at least partly, by different experimental designs, different number and characteristics of participants recruited, ethnical differences, medical treatments, lack of standardization of methods for the determination of serum gal-9 levels, and different ways in which samples were handled. nevertheless, several limitations of the present study should be considered. firstly, the number of study participants (232) was relatively small. secondly, given the cross-sectional design of the study, the causal relationship between gal-9 level and the severity of coronary artery stenosis can not be determined. thirdly, different methods of assessment of the coronary stenosis and the criterion for diagnosis of the diseased artery may lead to another result. finally, although we accounted for confounding of traditional cardiovascular risk factors, a potential for uncontrolled or residual confounding that could influence the relationship between gal-9 and cad would be plausible. in conclusion, we have shown that low serum gal-9 levels are associated with the presence and the severity of coronary arteries stenosis. importantly, gal-9 can expand cd4cd25foxp3 tregs and inhibit th17 development in activated pbmcs, leading to increased secretion of tgf-1 and decreased il-17 secretion. our observations provide evidence of the role of gal-9 in cad and that gal-9 is an independent negative predictor of acs, which may also at least partially explain the protection of gal-9 against coronary atherosclerotic plaque vulnerability. large-scale population-based clinical studies and further experimental studies are needed to elucidate the exact effect and potential biological mechanisms of gal-9 in the pathogenesis of cad and to evaluate whether gal-9 is a potential novel biomarker of cad.

background. recently, several studies suggest that galectin-9 (gal-9) might play a pivotal role in the pathogenesis of autoimmune diseases. however, the exact role of gal-9 in atherosclerosis remains to be elucidated. methods. serum gal-9, high-sensitivity c-reactive protein (hs-crp), interferon- (ifn-), interleukin- (il-) 4, il-17, and transforming growth factor- (tgf-) 1 were measured. the effect of gal-9 on peripheral blood mononuclear cells (pbmc) was investigated in patients with normal coronary artery (nca). results. the lowest level of gal-9 was found in the st-segment elevation myocardial infarction (stemi) group, followed by the non-st-segment elevation acs (nsteacs), the nca, and the stable angina pectoris (sap) groups, respectively. additionally, gal-9 was found to be independently associated with hs-crp, lipoprotein(a), and creatinine. notably, gal-9 was also noted to be an independent predictor of the gensini score. moreover, gal-9 suppressed t-helper 17 (th17) and expanded regulatory t cells (tregs), resulting in decreased il-17 production and increased secretion of tgf-1. conclusions. serum gal-9 is associated with not only coronary artery disease (cad), but also the severity of coronary arteries stenosis. gal-9 can expand tregs and suppress th17 development in activated pbmc, implying that gal-9 has the potential to dampen the development of atherosclerosis and may be a new therapy for cad.

PMC4667018

pubmed-217

sedation is often required in young children in order to obtain good diagnostic cross-sectional imaging like computed tomography scan (ct scan) and magnetic resonance imaging (mri). sometimes sedation is also needed for older children with complex neurodevelopmental disorders, such as autism and attention deficit hyperactivity disorder. moderate sedation is unable to guarantee patient compliance; therefore, a deeper level of sedation is required [1, 2]. the success of sedation for mri has typically been measured by two factors: the safety of sedation procedure (lack of adverse events) and its effectiveness (completion of diagnostic examination). it can be challenging to obtain the deep sedation level required to prevent the patient's movement while maintaining respiratory and hemodynamic stability. therefore, it is very important to select the appropriate drugs and dosage to achieve those objectives. dexmedetomidine is a highly selective adrenoceptor agonist with a distribution half-life of six minutes and an elimination half-life of two hours. five prospective trials have evaluated the efficacy of dexmedetomidine for sedation during noninvasive radiologic imaging [812]. dexmedetomidine can be associated with side effects of hypotension, bradycardia, and transient hypertension with loading dose. dexmedetomidine has been used at our institution since 2006 for mri and other noninvasive radiologic procedures. the purpose of this retrospective study is to present our institutional experience with dexmedetomidine in relation to efficacy and related side effects. collection of quality assurance data includes patient demographics, adverse events, physiologic variables, drug dosages, the time required to sedate the patient, time needed to obtain the imaging study, and recovery time. after approval by the institutional review board, we conducted a retrospective analysis of all patients who received sedation for mri from july 2007 to december 2012. institutional sedation policies are based on guidelines by the joint commission on accreditation of health care organization and american academy of pediatrics and were closely followed [13, 14]. vital signs including pulse oximetry, heart rate, noninvasive blood pressure monitoring, and nasal capnography (with concomitant oxygen delivery via the nasal cannula) are continuously monitored and documented every five minutes throughout sedation. at the start of sedation, intravenous dexmedetomidine was bolused at 2 g/kg over 10 minutes followed by a continuous infusion of 1 g/kg/h. most of the patients were sedated by the end of the bolus; if not, a second bolus of 2 g/kg was repeated over another 10 minutes prior to the start of the maintenance infusion. patients who continue to move after the second bolus or while the procedure is in progress, can compromise the quality of imaging and were given additional medications like midazolam or fentanyl as per physician discretion. mg/kg to a max of 2 mg and for fentanyl was 0.5 mcg/kg1 mcg/kg to a max of 50 mcg. the goal was to achieve a minimum ramsay sedation score (rss) of 4 as assessed by a sedation nurse. rss is a clinically derived sedation score generally accepted as a tool for assessing the depth of sedation. usually, a score of 4-5 is targeted to ensure appropriate sedation for diagnostic imaging studies [11, 16]. peak onset of the sedation was defined as the time from the start of the loading dose to achievement of a ramsay score of 4. procedure time was the time of achieving the required ramsay score to the end of the procedure (stoppage of drug administration). discharge time was defined as time from the end of the procedure to actual time when the patient was discharged home. normal ranges for heart rates, blood pressure, and respiratory rates for data analysis were based on the published normal of fleming et al. [17, 18]. a trained registered nurse provided continuous assessment and monitoring while the procedure was in progress under the direct supervision of a pediatric intensivist. monitoring was continued until the patient was awake with a minimum aldrete score of 9 points, and the patient has tolerated clear liquids prior to discharge [19, 20]. all the parents were provided with written discharge instructions and a direct phone number for further assistance or to report any adverse effects. database records were analyzed using dedicated statistical software sas v9.3 (sas institute, cary, nc). changes in the vital signs associated with the use of dexmedetomidine from the baseline were evaluated and compared using student's t-test and mann-whitney rank-sum test, depending on the distribution of the data. the entire study cohort was divided into three groups depending on dexmedetomidine bolus and additional medications received. dexmedetomidine group a received one bolus; dexmedetomidine group b received two boluses; dexmedetomidine group c received one or two boluses and additional medications. three groups were compared with respect to age, weight, blood pressure, heart rate, procedure time, and discharge time using analysis of variance. incidences of bradycardia and hypotension were analyzed with fisher's exact test, due to low cell counts. discharge time of bradycardia and hypotensive patients was compared with normal cohorts using the t-test. the most common indications included seizure disorder, developmental delay and behavioral disorder, autism, and neoplasia. 382 (70.2%) of the total patients received one-time bolus, while two boluses were given to 162 patients (29.8%). in the population of 544 patients, additional medications (fentanyl or midazolam) were required in 117 (21.5%) for spontaneous movements to avoid motion artifacts that can compromise mri quality (54 patients with one-time bolus and 43 patients with two boluses). dexmedetomidine-induced vital sign changes from baseline for the whole group are shown in figure 1. hypotension (systolic blood pressure 20% below the normal limits) was observed in 100 patients (18.4%) and transient hypertension (systolic blood pressure>20% above age-specific high limits) was observed in 137 of the patients (25.2%). there were 210 (38.6%) patients who had a significant decrease in respiratory rate, that is,>20% from the baseline, but no desaturation, upper airway obstruction, or apnea events were observed and the decrease was minimal in 403 patients (74%). most of the patients received prophylactic supplemental oxygen to maintain oxygen saturation>95% as per protocol, which makes it impossible to determine the actual incidence of desaturation at room air. patients were divided into three groups based on numbers of dexmedetomidine boluses and additional medications received. comparisons of blood pressure, heart rate, and other clinical measures between these groups of patients are shown in table 2. procedure time was significantly shorter in dexmedetomidine group a (40.31 19.40 min, p<0.0001) compared to the other two groups. oxygen, dose, maximum dbp, maximum respiration rate, and initial spo2 had statistically significant (but clinically insignificant) differences between groups. the occurrence of hypotension among all three groups did not reach a statistically significant value (p=0.82). decrease in blood pressure from the baseline was frequently observed; however, medical intervention was not needed to correct it. the incidence of hypotension was usually noticed to be towards the completion of procedure or after stopping the infusion, with a mean procedure time of 48.73 25.46 minutes. initial transient hypertension occurred in 137 patients approximately 20 minutes after the dexmedetomidine bolus and lasted for<15 minutes. in the population of 544 patients, 165 children (30.9%) had heart rates below the age-specific normal awake range during sedation (based on the published normal of fleming et al.). only in 21 children (3.9% of total cohort) did the lowest recorded heart rate fall>20% below the given baseline average range. bradycardia (hr<60/min), as defined according to pediatric advance life support (pals) guidelines, was observed in 10 children (4.5%) mostly in the age range of 13 years (figure 2). all the patients with bradycardia were continuously monitored and assessed by the supervising intensivist for normal blood pressure and oxygen saturation of 95% or above. no patient required treatment. the incidence of bradycardia was high in patients in the age range of 13 years compared with the rest of the cohort. the precise etiology of the bradycardia observed in this analysis can not be delineated as electrocardiogram monitoring is known to be significantly distorted by the magnetohydrodynamic (mhd) effect and is nondiagnostic within the bore of any mri magnet. time to discharge when dexmedetomidine was used alone was 92 25 versus 94 37 min when additional medications were used (p=0.46). average discharge time among 165 children with bradycardia was longer and statistically significant compared to the other 372 children in the study population without bradycardia (99.08 32.57 min versus 89.74 25.54 min, p=0.0012, student's t-test). gender was not associated with any change in discharge time (p=0.30) (table 3). the ideal drug would allow optimal imaging, while maintaining hemodynamic and respiratory stability. as reported in previous studies, this occurred more frequently in hyperactive, uncooperative, and older children [4, 22]. dexmedetomidine, a selective alpha 2 adrenoceptor agonist, has a very safe therapeutic window with respect to respiratory depression. this quality offers a distinct advantage in procedural sedations, where the patient is not immediately accessible to the medical team. there are various studies demonstrating that dexmedetomidine is a good option for procedural sedation [10, 12]. interestingly, the dose used varies greatly indicating an open debate regarding the best dosage. previous studies indicate that infusion of relatively low dose dexmedetomidine 0.10.7 /kg/h provides effective sedation [2327]. in a study conducted on eight healthy volunteers receiving dexmedetomidine infusion of 0.20.6 /kg/h, the visual analog sedation scores and bispectral index scores dropped by 3060%. however, this level of sedation will likely not be conducive to pediatric mri sedation, where higher doses of dexmedetomidine will be needed to accomplish the necessary sedation level. while dosing started low in initial reports, a recent one found that higher doses are required and have been well tolerated. a comparison of pentobarbital and chloral hydrate was performed by rooks et al. in 498 children for mri sedation. several clinical trials have compared dexmedetomidine to propofol for pediatric procedural sedation. in a trial of 60 children undergoing mri, onset, recovery, and discharge time were all significantly shorter in the propofol group. adverse effects such as lower blood pressure and heart rate and respiratory rate were also found more in the propofol group. dexmedetomidine safety and efficacy for sedation during noninvasive radiologic procedures have been evaluated in four prospective trials [1, 810]. all of these studies reported that the use of high dose dexmedetomidine as a sole sedative resulted in high quality radiologic imaging with less use of additional rescue medicines. our study also demonstrated that the use of high dose dexmedetomidine as sole agent is effective for mri sedation. we used fentanyl and midazolam as rescue medicines in 117 (21.5%) of our patients to avoid imaging artifacts, suggesting that these agents make a significant contribution to the sedation strategy for a sizeable minority of patients. in our study, the heart rate decreased significantly from baseline during sedation. this is an expected effect of anxiolysis and reflects higher baseline heart rate values from anxiety. other studies reported a decrease in heart rate<20% from the baseline that was considered to be clinically insignificant in 86 (26%) patients. to have a true comparison with previously published data, we use the same definition of bradycardia; that is, the lowest recorded heart rate during sedation fell>20% below the given baseline average range. using that definition, the incidence of bradycardia in our study was 3.9% (21 children) in total cohort comparable to 4% as reported by mason et al. more importantly, during those periods of bradycardia, all patients maintained normal blood pressure and normal oxygen saturation (95% or higher). treating bradycardia in normotensive children with glycopyrrolate has been reported to be associated with hypertensive episode, which could be beneficial to children who are hypotensive and bradycardic at the same time. similar to our findings, previous investigators have also reported the occurrence of transient hypertension with bolus administration of dexmedetomidine. in our study, the occurrence of hypotension associated with high doses of dexmedetomidine was about 18%, observed immediately after stopping the infusion or towards the end of the procedure. none of the children needed any intervention, consistent with observation reported in other studies [12, 31]. respiratory events make up a large proportion (5.5%) of sedation complications in children. in some studies, rapid administration of large loading doses has been described to cause respiratory complications [3234]. a loading dose of dexmedetomidine given over 2 minutes has been reported to cause irregular respiration, apnea, slight hypoxemia, and hypercapnia. however, similar to ours, several other studies have reported trivial effect of dexmedetomidine on respiration [12, 34, 36] which is consistent with the notion that the risk of respiratory depression is minimal with careful dexmedetomidine sedation. despite these supporting lines of evidence, monitoring of respiratory function during the administration of dexmedetomidine in those receiving midazolam or fentanyl, which may depress respiratory function, appears warranted. our reported discharge time of 92 minutes with dexmedetomidine only and 94 minutes when additional medicines were used is comparable to the 90 minutes ' discharge time of heard et al.. observed a recovery time of 47 minutes and mason et al. reported recovery times ranging from 24.8 minutes to 35.2 minutes, depending on the dose of dexmedetomidine used. in some studies, recovery time is the time lapsed until the patient meets the discharge criteria, while in our study, like few others, discharged time is defined as the actual time of leaving the recovery room to go home. discharge time of children experiencing bradycardia was longer than that for those who did not. in our study, 165 children with bradycardia had a mean discharge time which was statistically significant and longer than the other 372 children in the study without bradycardia (99.08 minutes versus 89.74 minutes; p=0.0012). this probably could be due to the prolonged monitoring of these patients until the bradycardia resolved. recovery time previously reported after sedation with propofol for mri has been 17 8 minutes, almost half of the recovery time when dexmedetomidine was used as a sole agent. in a second trial, forty children between the ages of 1 and 10 years were randomized to receive either a combination of midazolam+dexmedetomidine or propofol only for sedation during mri. the fast recovery times of propofol must be weighed against the fact that it induced deeper sedation with significant hypotension and oxygen desaturation. taking the results of these comparison trials as a whole, dexmedetomidine appears to provide a useful alternative to propofol for procedural sedation in children, with a longer time of recovery but a lower incidence of adverse effects. this is a good alternative to propofol for patients with soy and egg white allergy and also in institutions where use of propofol is strictly limited to be used by anesthesiologists. it could be asserted that the reported efficacy is due to the use of an intensivist based specialized sedation team rather than to dexmedetomidine itself. this is reasonably true to some extent as specialization and experience should increase both success and efficiency. in spite of that, this can be stated with confidence; much of the reported success is specifically a function of dexmedetomidine. this is a descriptive study and few, if any, conclusions can be drawn about safety because the occurrence of serious sedation related side effects is fortunately rare. additional prospective studies of the sedation for mri in children using a greater number of patients are warranted to provide a true idea of safety. in summary, high dose dexmedetomidine is an attractive and effective medication in children for mri sedation. when using high dose dexmedetomidine as the only agent for pediatric mri, it is not unusual to observe heart rate and blood pressure outside the established awake normal values. in our experience, these changes were pretty benign and were not associated with any adverse event. we conclude and recommend that, from hemodynamics and respiratory perspective, higher dose dexmedetomidine was well tolerated and is effective to use for successful completion of mri, in the majority of pediatric patients.

objective. to determine the efficacy and safety of high dose dexmedetomidine as a sole sedative agent for mri. we report our institution's experience. design. a retrospective institutional review of dexmedetomidine usage for pediatric mri over 5.5 years. protocol included a dexmedetomidine bolus of 2 g/kg intravenously over ten minutes followed by 1 g/kg/hr infusion. 544 patients received high dose dexmedetomidine for mri. a second bolus was used in 103 (18.9%) patients. 117 (21.5%) required additional medications. efficacy, side effects, and use of additional medicines to complete the mri were reviewed. data was analyzed using student's t-test, fisher's exact test, and analysis of variance (anova). main results. dexmedetomidine infusion was associated with bradycardia (3.9%) and hypotension (18.4%). none of the patients required any intervention. vital signs were not significantly different among the subgroup of patients receiving one or two boluses of dexmedetomidine or additional medications. procedure time was significantly shorter in the group receiving only one dexmedetomidine bolus and increased with second bolus or additional medications (p<0.0001). discharge time was longer for children experiencing bradycardia (p=0.0012). conclusion. high dose dexmedetomidine was effective in 78.5% of cases; 21.5% of patients required additional medications. side effects occurred in approximately 25% of cases, resolving spontaneously.

PMC4326345

pubmed-218

clozapine remains an ultimate option for patients with treatment resistant schizophrenia (kane 2012). efficacy of clozapine against positive symptoms of schizophrenia was confirmed in numerous studies and meta-analyses (chakos et al. 2001), including analysis published by the cochrane library (asenjo lobos et al. however, treatment with clozapine is associated with very severe metabolic side-effects (newcomer 2005). clozapine-induced weight gain is very common (wetterling 2001), and so is impaired fasting plasma glucose levels. in patients with schizophrenia weight gain is associated with impaired physical functioning and negative body appraisal (bachmann et al. 2012), both of which affect quality of life. while treatment with clozapine may reduce mortality by reducing suicide rate, mortality due to clozapine-associated weight gain will diminish reduction in the suicide rate almost entirely over 10 years by the increased mortality associated with weight gain of 10 kg (fontaine et al. also, obesity is linked with numerous secondary health problems (pressure overload on lungs, joints and bones) and is an important risk factor for life-threatening diseases, such as cardiovascular disease, type 2 diabetes and certain cancers. several mechanisms are considered as taking role in clozapine-induced weight gain, including antagonism at histamine h1 receptors (kroeze et al. various receptors, including aforementioned 5-ht1b and 5-ht1c, regulate activity of the hypothalamic nuclei (particularly the arcuate nucleus (arc), which plays the key role in appetite regulation). activity of arc is also regulated by several hormones of anorexigenic properties: leptin, pancreatic polypeptide (pp), cholecystokinin (cck), glucagon-like peptide-1 (glp-1), oxyntomodulin (oxm), peptide yy (pyy) and the first discovered orexigenic substance-ghrelin (druce et al. 2004). agouti-related peptide (agrp) is one of the hypothalamic hormones that works by increasing appetite and decreasing metabolism and energy expenditure, thus leading to weight gain. it was identified in 1997 based on its sequence similarity with agouti signaling peptide (asip), a protein synthesized in the skin that controls coat color. compared with asip, agrp is physiologically expressed in the hypothalamus (shutter et al. agrp is also expressed in the adrenal gland, testes, kidneys, and lungs. agrp induces obesity by antagonism of the melanocortin receptors (mc3-r and mc4-r, subtypes implicated in weight regulation, via metabolism and appetite control) (ollmann et al. these neurons make peptides that potently stimulate food intake not only by increasing neuropeptide y (npy) signaling, but also by reducing melanocortin signaling via the release of agrp (morton and schwartz 2001). activity of the agrp/npy neurons is modulated by leptin, released from the adipose tissue, and insulin. the adiposity signals (insulin and leptin) are secreted in proportion to body fat content and act in the hypothalamus to inhibit anabolic and stimulate catabolic, effector pathways (schwartz et al. the increase of food intake following a single central administration of agrp is sustained for up to a week (hagan et al. 2000), while the response to npy is sustained over hours, rather than days. this study was undertaken with the purpose to determine if patients with schizophrenia on clozapine monotherapy have higher fasting levels of agrp compared with healthy control. in order to provide more accurate measurements, biochemical and anthropometric measurements were combined with body composition determined using bioelectric impedance analysis (bia), which provides accurate measurements of body fat, lean mass and body water (bosy-westphal et al. this is the first study to investigate such combination of these parameters in subjects with schizophrenia treated with clozapine. data for 24 european caucasian adult hospitalized patients with paranoid schizophrenia (295.30 according to dsm-iv, f20.0 according to icd-10) was included into the study. these subjects were on clozapine monotherapy for at least two months prior the assessments with a minimum dose of 100 mg/day. most patients was in stable phase of the disease (i.e. no acute psychosis). control group was 24 healthy subjects and was gender- and age-matched with patients in the clozapine group. health status of the control subjects was determined on the basis of basic physical examination, including vital signs and an interview. all patients and volunteers included in the study expressed their written informed consent for participation in this study. the blood samples for the chemistry panel were collected between 7 am and 8 am, after ensuring at least 8 h of overnight fasting. glucose, lipids, calcium and uric acid levels were measured using a dirui cs-400 analyzer (dirui, china). homocysteine chemiluminescence assessments were performed using an immulite 2,000 analyzer (siemens, germany), insulin immunochemistry assessments were performed using a cobas e411 analyzer (roche diagnostics, switzerland) and albumin levels were assessed using a cobas integra 800 analyzer (roche diagnostics, switzerland). levels of agrp were measured in blood serum using elisa (enzyme-linked immunosorbent assay) method. prior to assays, serum samples were stored at 80 c for up to 6 months. elisa assays were performed using commercial kits (intra-assay: cv<10 %, inter-assay: cv<12 %) manufactured by raybiotech (usa), according to protocol provided by its manufacturer (all samples were 2-fold diluted). metabolic syndrome and abdominal obesity were defined according to international diabetes foundation (idf) criteria (alberti et al. kg/m, 2530 kg/m and 30 kg/m were defined as normal weight, overweight and obesity, respectively. raised triglycerides (tga) level 150 mg/dl and/or total cholesterol (tc) 200 mg/dl and/or reduced hdl cholesterol level<40 mg/dl for men and<50 mg/dl for women and/or raised ldl cholesterol level 135 mg/dl were interpreted as dyslipidemia. corrected calcium was calculated using the formula: corrected calcium [mg/dl] =measured total calcium [mg/dl] +0.8 (4.0 serum albumin [g/dl]). insulin resistance was estimated from fasting glucose and insulin results by homeostasis model assessment and quicki index, using the formula: homa1-ir=(fasting plasma glucose [mg/dl] insulin [mu/l])/405. homa2-ir index was calculated using a calculator downloaded from http://www.dtu.ox.ac.uk. quicki index (lower numbers reflect greater insulin resistance) was calculated using the formula: 1/(log (fasting insulin [mu/l ])+log (fasting plasma glucose [mg/dl ])). height was measured with a wall-mounted height measure to the nearest 0.5 cm. weight was measured with a spring balance that was kept on a firm horizontal surface. subjects wore light clothing, stood upright without shoes and weight was recorded to the nearest 0.5 kg. body mass index (bmi) was calculated as body weight in kilogram divided by the height in meter squared (kg/m). waist, abdominal and hip circumference was measured using a non-stretchable fiber measuring tape. waist-to-hip ratio (whr) was calculated as waist circumference divided by hip circumference. whr cut-off points were defined according to who recommendations (0.85 for women and 0.9 for men). fat mass index (fmi) was calculated as total body fat in kilogram divided by the height in meter squared (kg/m). excess body fat according to fmi classification ranges were defined as fmi>6 for men and fmi>9 for women body composition was measured using a maltron bf-906 body fat analyzer (maltron, uk), single frequency bioelectrical impedance analyzer to determine resistance and reactance at 50 hz. standard operating conditions were observed by a trained operator including preparation of the participant, electrode placement and operation. the measurement using bia was taken immediately prior to anthropometry measurements with participants lying supine, in a rested state. simple descriptive statistics (means, standard deviations, 95% confidence interval [ci ]) were generated for all continuous variables. for discrete variables number of patients and percentages are given. skewed variables were transformed to follow normal distribution using log, square root, inverse square root or square transformation. means, standard deviations, and confidence intervals are reported for non-transformed variables, results of tests are reported for transformed or non-transformed variables. if transformation resulted in normal distribution, two-tailed t-test was used to assess inter-group differences, otherwise variables were analyzed using mann associations were tested by pearson s (for variables with normal distribution) or spearman's (for other variables) correlation coefficients. the significant level was set at p<0.05. for group of patients treated with clozapine the mean age was 38.812.6 and 39.912.3 for the control group (p =0.62). in both groups there were 12 men and 12 women. in the clozapine group 12 subjects smoked cigarettes and 8 in the control group (p =0.38). the mean duration of monotherapy with clozapine was 60.579.4 [95% ci: 27.094.1] months and mean clozapine dose was 341.1148.6 [95% ci: 278.4403.8] mg/day. detailed results for anthropometric measurements and laboratory tests are shown in table 1. table 1results of anthropometric measurements and laboratory testsclozapine n =24control n =24weight [kg]78.114.2(72.184.1)72.615.1(66.278.9) p =0.08 t =1.38bmi [kg/m]27.13.6(25.528.6)24.83.5(23.326.2) p =0.01 t =2.25fmi [kg/m]8.93.1(7.610.2)7.73.0(6.49.0) p =0.09 t =1.38abdominal circumference [cm]96.59.4(92.5100.4)85.511.6(80.690.3) p<0.001 z =3.58waist circumference [cm]91.112.1(86.096.2)82.410.6(77.886.8) p =0.005 z =2.66hip circumference [cm]99.08.4(95.5102.5)95.97.1(92.998.9) p =0.08 t =1.39whr0.920.08(0.880.95)0.860.08(0.820.89) p =0.005 z =2.66sbp [mm hg]121.713.6(115.9127.4)136.717.9(129.1144.2) p =0.001 z =3.26dbp [mm hg]81.28.5(77.684.8)82.812.1(77.687.9) p =0.30 t =0.50uric acid [mg/dl]4.51.4(3.95.1)4.31.3(3.74.8) t =0.57homocysteine [mol/l]14.5 4.4(12.616.4)13.6 5.0(11.515.7) p=0.25 t=0.67tc [mg/dl]194.2 53.2(171.7216.6)216.6 65.3(189.0244.1) p=0.06 t=1.54hdl [mg/dl]43.5 12.6(38.248.8)55.1 14.3(49.161.1) p 41.9(104.8140.3)128.3 39.7(111.5145.0) p=0.29 t =0.54tga [mg/dl]140.3 120.4(89.4191.1)104.3 81.4(69.9138.6) p=0.07 t=1.50fpg [mg/dl]103.5 31.7(90.1116.8)87.8 11.7(82.892.7) p=0.03 t =1.88insulin [u/ml]11.8 8.2(8.3-15.3)7.7 3.2(6.3-9.1) p=0.02 t =2.08homa1-ir3.3 3.4(1.84.7)1.7 0.8(1.32.0) p=0.009 t =2.46homa2-ir1.6 1.1(1.12.1)1.0 0.4(0.81.2) p=0.01 t =2.26quicki0.15 0.01(0.140.15)0.16 0.01(0.150.16) p=0.007 t =2.52corrected calcium [mg/dl]8.6 0.9(8.29.0)8.7 p=0.37 t =0.33data given as: mean standard deviation (95% ci)bmi=body mass index; fmi=fat mass index; whr=waist-to-hip ratio; sbp=systolic blood pressure; dbp=diastolic blood pressure; tc=total cholesterol; hdl=high density lipoproteins; ldl=low density lipoproteins; tga=triglycerides; fpg=fasting plasma glucose; homa1-ir=homoeostasis model assessment of insulin resistance 1; homa2-ir=homoeostasis model assessment of insulin resistance 2; quicki=quantitative insulin sensitivity check index results of anthropometric measurements and laboratory tests data given as: mean standard deviation (95% ci) bmi=body mass index; fmi=fat mass index; whr=waist-to-hip ratio; sbp=systolic blood pressure; dbp=diastolic blood pressure; tc=total cholesterol; hdl=high density lipoproteins; ldl=low density lipoproteins; tga=triglycerides; fpg=fasting plasma glucose; homa1-ir=homoeostasis model assessment of insulin resistance 1; homa2-ir=homoeostasis model assessment of insulin resistance 2; quicki=quantitative insulin sensitivity check index we have found no inter-group differences for body composition analysis. detailed results for bia analysis are shown in table 2. lean body mass was higher in men in the whole study sample (60.16.4 [95% ci: 57.4-62.8] vs. 43.85.4 [95% ci: 41.546.1] kg, t=9.56, p<0.001) and in the clozapine group (59.65.7 [95% ci: 56.063.3] vs. 45.37.0 [95% ci: 40.9-49.8] kg, t=5.48, p<0.001). similarly, basal metabolic rate was higher in men in the whole study sample (1,707.7182.3 [95% ci: 1,630.71,784.6] vs. 1,337.3138.4 [95% ci: 1,278.8-1,395.7] kcal/day, t =7.92, p<0.001) and in the clozapine group (1,701.2138.2 [95% ci: 1,613.41,789.0] vs. 1,362.7173.0 [95% ci: 1,252.71,472.5] kcal/day, t=5.29, p<0.001). n=24control n=24total body fat [kg]25.6 8.8(21.829.2)22.4 8.7(18.726.1) p=0.10 t=1.25total body fat [%] 32.6 8.4(29.136.2)28.9 7.1(25.831.8) p=0.06 t=1.67lean body mass [kg]52.5 9.6(48.456.5)51.4 10.8(46.855.9) p=0.36 t=0.36lean body weight [%] 67.6 8.1(64.271.0)71.1 7.1(68.174.1) p=0.07 t =1.61total body water [l]38.4 7.0(35.441.3)37.7 7.9(34.340.9)p=0.36 t=0.35total body water [%] 49.9 5.4(47.652.1)52.1 5.2(49.854.2) p=0.09 t=1.42basal metabolic rate [kcal/day]1,532.0 p=0.39 t=0.26data given as: mean standard deviation (95% ci) results of body composition analysis data given as: mean standard deviation (95% ci) there were no significant difference for fasting serum levels of agrp between the clozapine group and the control group (15.008.65 [95% ci: 11.3418.65] vs. 15.336.82 [95% ci: 12.4518.22] pg/ml, t =0.32, p =0.37), see fig. 1. women had significantly lower levels of agrp in the whole study group (12.535.65 [95% ci: 10.1414.92] vs. 17.808.66 [95% ci: 14.1421.45] pg/ml, t =2.47, p =0.009) and in the control group (12.905.77 [95% ci: 9.2216.57] vs. 17.777.14 [95% ci: 13.2322.31] pg/ml, t =1.82, p =0.04), but the difference was not significant for the clozapine group (12.175.75 [95% ci: 8.5115.83] vs. 17.8210.28 [95% ci: 11.28-24.36] pg/ml, t =1.64, p =0.06). fig. 1mean fasting agrp serum levels [pg/ml] in subjects on clozapine and in the control group (p =0.37; horizontal bars indicate means). mean fasting agrp serum levels [pg/ml] in subjects on clozapine and in the control group (p =0.37; horizontal bars indicate means). for the whole study group significant correlations of agrp levels were found for total body fat [%] (r =0.34, p =0.02), lean body mass [kg] (r =0.38, p =0.006), lean body mass [%] (r =0.34, p =0.02), body water [l] (r =0.38, p =0.006), body water [%] (r =0.34, p =0.02) and homocysteine levels (r =0.29, p =0.04). for the clozapine group significant correlations of agrp levels were found for total body fat [%] (r =0.48, p =0.02), basal metabolic rate (r =0.42, p =0.04), lean body mass [%] (r =0.49, p =0.01), body water [%] (r =0.49, p =0.01). for the control group significant correlations of agrp levels were found only for basal metabolic rate (r =0.42, p =0.04). in the clozapine group there were no significant differences for agrp levels between subjects with or without excess body fat (based on fmi value) (p =0.59), idf-defined metabolic syndrome (p =0.33), smokers and non-smokers (p =0.15), subjects with bmi<25 kg/m and with bmi 25 kg/m (p =0.09), subjects with and without impaired fasting glucose (p =0.16), subjects with and without abdominal obesity (p =0.11), subjects with and without dyslipidemia (p =0.09), and subjects with and without homa-1ir defined insulin resistance (p =0.07). in the control group there were no significant differences for agrp levels between subjects with or without excess body fat (based on fmi value) (p=0.20), idf-defined metabolic syndrome (p=0.44), smokers and non-smokers (p=0.35), subjects with bmi<25 kg/m and with bmi 25 kg/m (p =0.12), subjects with and without impaired fasting glucose (p =0.36), subjects with and without abdominal obesity (p =0.10), subjects with and without dyslipidemia (p =0.37), and subjects with and without homa-1ir defined insulin resistance (p =0.13). in the whole study group there was no significant differences for agrp levels between subjects with or without excess body fat (based on fmi value) (p =0.30), idf-defined metabolic syndrome (p =0.43), smokers and non-smokers (p =0.29), subjects with bmi<25 kg/m and with bmi 25 kg/m (p =0.39), subjects with and without impaired fasting glucose (p =0.29), subjects with and without dyslipidemia (p =0.11), and subjects with and without homa-1ir defined insulin resistance (p =0.33). there was a significant difference for agrp levels between subjects with or without abdominal obesity (13.466.50 [95% ci: 9.0917.83] vs. 16.926.93 [95% ci: 12.7321.11] pg/ml, t =1.80, p =0.04). the main objective of the present study was to find out whether there is a significant difference in fasting serum levels of agrp peptide between patients with schizophrenia on clozapine monotherapy and age- and sex-matched healthy controls. we have found the difference was not significant (clozapine: 15.008.65, control: 15.336.82 pg/ml, p =0.37). we do not know pre-treatment values, so we can not determine whether and how this parameter changed during therapy with clozapine. to our knowledge, no data are available on the effect of clozapine on blood agrp concentrations in humans. limited data are available for olanzapine, which has clinical and pharmacological properties similar to clozapine. results of these studies show that treatment with olanzapine does not affect agrp levels (basoglu et al. however, in animal study it was demonstrated that administration of olanzapine or clozapine upregulates npy and agrp and downregulates proopiomelanocortin in the arcuate nucleus of the hypothalamus (ferno et al. we do not know studies demonstrating correlation between blood levels of agrp and levels in the hypothalamus, but since it was showed recently that agrp neurons are unique among hypothalamic neurons by being the predominant neuronal subtype situated outside the blood brain barrier (olofsson et al. 2013), we may assume that changes in hypothalamic expression are reflected in changes in blood levels. the finding that women had significantly lower levels of agrp in the whole study group (12.535.65 vs. 17.808.66 pg/ml, p =0.009) and in the control group (12.905.77 vs. 17.777.14 pg/ml, p =0.04), but not in the clozapine group (12.175.75 vs. 17.8210.28 pg/ml, p =0.057), might indicate that the testes are important source of agrp, as shown previously (shutter et al. however, several more recent studies showed no difference between men and (gavrila et al. 2001), therefore it may indicate that plasma agrp levels reflect central agrp concentrations. it was previously reported that total level of agrp is higher in obese subjects (katsuki et al. 2001), although in another study it has been demonstrated that agrp levels were lower in normal weight group compared with women with anorexia, probably due to increased leptin levels (moriya et al. we did not measure levels of leptin or acylated ghrelin, but we found in the same group of patients that there were no differences for desacyl ghrelin levels between patients taking clozapine and control group (wysokiski et al. while there was a significant difference in bmi values between the clozapine group and the control group, we found no differences between both groups for fmi values. compared with bmi, fmi is a better indicator of central obesity since it is much more sensitive to body fat content (kelly et al. moreover, there were no differences for any of the bia results between both groups. these indicate that there was a substantial similarity between both groups in terms of body fat content, which is important considering that agrp levels may affect or result more from the amount of adipose tissue than from body weight per se. on the other hand, we have found negative correlations between agrp levels and total body fat (r =0.34 and 0.48 in the whole study group and clozapine group, respectively). these may indicate the effect of leptin on the expression of agrp, but require further studies. additionally, there were positive correlations with lean body mass (r =0.38 and 0.49 in the whole study group and clozapine group, respectively), body water (which amount is negatively correlated with the amount of body fat: r =0.96, p<0.001) (r =0.34 and 0.49 in the whole study group and clozapine group, respectively) and basal metabolic rate (r =0.42 both in the clozapine group and control group), also being in line with the above-mentioned mechanism. in animal studies it has been found that high-fat diet leads to decreased expression of agrp in the hypothalamus, probably in the mechanism moderated by leptin (staszkiewicz et al. we have no detailed data on diet patterns of our study subjects, but reports are consistent that patients with schizophrenia consume higher amounts of high-fat foods compared with healthy population (dipasquale et al.. this might be one of the reasons why we have found no differences between our study groups. also, level of physical activity (usually lower in hospitalized patients) might affect mechanisms regulating agrp levels. finally, another important factor is the effect of treatment mediated by other anabolic or catabolic neuropeptides. here, two most important peptides are leptin (which decreases agrp levels) and ghrelin (which has opposite effect) and have also been studied most extensively (sentissi et al. 2008). since both leptin and ghrelin (andrews 2011) may regulate activity of agrp/npy neurons in the arcuate nucleus, effects of antipsychotics on these neuropeptides must be taken into consideration. therefore, a study focused on interactions within this regulatory system would be very important for better understanding of this problem. based on our results however, the low number of study subjects limited the probability of finding inter-group differences due to lack of statistical power. due to the cross-sectional study design causal relationships can not be established and the effect of previous antipsychotic treatment can not be excluded. dual-energy x-ray absorptiometry (dxa) should be used to measure body composition and adipose tissue mass more accurately. due to complex structure of interactions between anabolic and catabolic neuropeptides, a longitudinal study comparing these interactions are crucial for understanding mechanisms of treatment-induced weight gain.

aim: agouti-related peptide (agrp) is one of the hypothalamic hormones that works by increasing appetite and decreasing metabolism, thus leading to weight gain. the aim of the study was to find out if agrp level in subjects with schizophrenia on clozapine monotherapy is higher compared with healthy controls. methodology: we determined fasting serum agrp levels in 24 subjects with schizophrenia on clozapine monotherapy and 24 healthy, age- and sex-matched controls. biochemical and anthropometric measurements were combined with body composition analysis. results: there was no difference for agrp levels between patients taking clozapine and control group (15.008.65 vs. 15.336.82 pg/ml, p =0.37). we found negative correlations between agrp levels and total body fat (r =0.34 and 0.48 in the whole study group and clozapine group, respectively) and positive correlations with lean body mass (r =0.38 and 0.49 in the whole study group and clozapine group, respectively), body water (r =0.34 and 0.49 in the whole study group and clozapine group, respectively) and basal metabolic rate (r =0.42 both in the clozapine and control groups). there were no correlations with age, height, weight, body mass index, fat mass index, abdominal, waist or hip circumferences, waist-hip ratio, blood pressure, total cholesterol, hdl, ldl, triglycerides, uric acid, glucose, insulin, clozapine dose or treatment duration, duration of treatment with antipsychotics and markers for insulin resistance. conclusion: we can not conclude that treatment with clozapine is associated with increased level of agrp. we did not find previously described differences in agrp levels between obese and non-obese subjects or associations between agrp and various metabolic parameters.

PMC4351436

pubmed-219

it is widely accepted that mutation is the main causal factor for diverse tumorigenesis [1, 2]. the recent development of next-generation sequencing (ngs) technologies has revolutionized the speed and throughput of dna sequencing, which facilitates the discovery of new driver mutations. for example, the arid1a gene is mutated in 83% of gastric cancers with microsatellite instability and the sf3b1 gene is somatically mutated in 9.7% of chronic lymphocytic leukemia patients [4, 5]. in colorectal cancers, although the majority of recurrent mutations have been previously known, some novel mutations, such as the mutations in the sox9 and fam123b genes, were also identified by ngs technology, which may have implications for colorectal tumorigenesis. in melanoma, approximately 40% was found to have causal mutations affecting b-raf function. along with the well-known driver mutations, the novel mutations identified by ngs will be useful for predicting the prognosis and molecular characterization of cancers [8, 9]. recently, a number of mutation calling tools, such as varscan, genome analysis toolkit, and mutect, have been developed to detect single-nucleotide variants (snvs) or indels from ngs data. however, snv calling from a single cancer case is not the final step for defining clinically meaningful mutations. to define the pathogenic snvs in human cancers, a commonly used approach is to identify the phenotype-associated recurrent mutations in the study group. due to the data size burden of ngs output, profiling the mutations associated with a certain phenotype or prognosis in a study group by a researcher who does not have a bioinformatics background or facilities is very difficult. currently, there is no user-friendly tool supporting methods for the detection of recurrent or phenotype-specific mutations. in this study, in order to support the definition of recurrent mutations or phenotype-specific mutations from ngs data of a group of cancers with diverse phenotypes, we aimed to develop a user-friendly tool, named mutation arranger for defining phenotype-related snv (map). map software was designed as a standalone program, compatible in microsoft windows environments with a user-friendly graphic interface, and compiled codes of map can be easily installed. both variant call format and its annotation files, such as annovar output, can be used as input files for map. when a user loads the input file, called sample descriptor file (gsf), map software displays the sample set information and filter options (fig. 1). once data are loaded, the user can filter the data using the ' analysis options ' tab in map software based on annotation information. by using the sample set and analysis options summary metrics include the mutation status for each sample, total mutation frequency, p-values for differences between phenotype groups based on clinical information, genomic position, reference/observed sequence, and additional information, such as read depth by default. map software also displays more detailed information in summary metrics based on the user-selected ' analysis options. ' in the ' analysis result ' tab, map software provides the frequency- or p-value-based filter function. this functionality supports detection of the recurrent mutations in study subjects and identification of the phenotype-specific mutation that occurs significantly in a certain phenotypic subclass. then, map software represents the user-selected mutations graphically in the ' visualization ' tab. to sort the variants by genomic position, p-value, or frequency, users can use the sort function in the ' analysis result ' tab. details of the program download, installation, and analysis procedures are available in the user manual. the major steps of map are as follows. -generating mutation summary metrics in study subjects- determination of recurrent mutations by frequency- determination of phenotype-specific mutations by association test- graphical illustration of user-selected mutations -generating mutation summary metrics in study subjects-determination of recurrent mutations by frequency-determination of phenotype-specific mutations by association test-graphical illustration of user-selected mutations mutation calling files from genome analysis toolkit can be used directly as input files for ' sample descriptor. ' alternatively, manually prepared standard variant call format is also available. annotation information files, such as annovar outputs, can be used as input files for sample descriptor. gsf is a comma-separated values text file that describes the input files, such as gatk output files and annovar output files, and phenotype information. when users load the input file, map software displays the sample set information and filter options in the ' source ' tab. if any file is not prepared properly, map software informs the user in the ' sample set files ' tab. after data are loaded, the user can filter the data using the ' analysis option ' tab based on annotation information. based on user-selected filters in the ' analysis options ' tab, summary metrics represent additional annotation information, such as gene name, function, known variant, and amino acid change. the additional annotations can be hidden using the snp filter option in the ' analysis option ' tab. these mutation metrics are exported into a comma-separated values text file for further investigation. in the ' analysis result ' tab, map software defines the recurrent mutations in study subjects by frequency. the frequency threshold can be determined arbitrarily by the user in the ' frequency filter ' function. map also defines the phenotype-specific mutations using the mutation metrics and phenotype information. phenotype-specific mutations that occur more frequently in one of two clinical conditions (e.g., drug-responder vs. non-responder) are determined by chi-square test under the user-defined significance level. the graphic user interface is implemented in the software for users to easily handle large-scale data or access the analysis result (fig. 2b and 2c). the recurrent or phenotype-specific mutations can also be demonstrated visually in heat-map style. for example, the left and right of the heat-map represent the sample name and mutational spectrum, respectively. the bottom of the heat-map represents the gene name by color for mutational spectrum. frequency or p-value plots are represented on top of the heat-map (fig. 2b and 2c). map is a user-friendly program with multiple functions that supports the determination of recurrent or phenotype-specific mutations and provides graphic illustration images to the users. its operation environment, microsoft windows, enables more researchers who can not operate linux to define clinically meaningful mutations with ngs data from cancer cohorts.

next-generation sequencing (ngs) is widely used to identify the causative mutations underlying diverse human diseases, including cancers, which can be useful for discovering the diagnostic and therapeutic targets. currently, a number of single-nucleotide variant (snv)-calling algorithms are available; however, there is no tool for visualizing the recurrent and phenotype-specific mutations for general researchers. in this study, in order to support defining the recurrent mutations or phenotype-specific mutations from ngs data of a group of cancers with diverse phenotypes, we aimed to develop a user-friendly tool, named mutation arranger for defining phenotype-related snv (map). map is a user-friendly program with multiple functions that supports the determination of recurrent or phenotype-specific mutations and provides graphic illustration images to the users. its operation environment, the microsoft windows environment, enables more researchers who can not operate linux to define clinically meaningful mutations with ngs data from cancer cohorts.

PMC4330268

pubmed-220

proliferative vitreoretinopathy (pvr) remains the major complication after retinal detachment surgery [13]. pvr was identified as an independent clinical entity in 1983 by the retina society terminology committee and a classification was created, based on the condition formerly named massive vitreous traction or massive periretinal proliferation [57]. this classification divided pvr into four stages, a, b, c, and d, apparently by increasing its severity, from minimal to massive pvr (table 1). nevertheless, this classification had numerous limitations. it did not consider the location of the vitreoretinal traction and the magnitude of the contraction. in addition, some of the stages provide a false idea of severity; for instance, d4 caused by a localized epiretinal membrane could be more easily treated by surgery than a c1 caused by intraretinal changes [8, 9]. in 1989, the silicone study group introduced a new classification including some characteristics, such as the location, anterior or posterior, and the type of contraction (table 2). classification was then updated in 1991 according to modifications proposed by the silicone study group and also by other authors (table 3). this classification appears to be difficult to use in clinical practice and may not offer any special advantage for decision-making in relation to the treatment of the disease. moreover, the classifications might have prevented advances in the understanding of the disease pathogenesis. for instance, because the retina society committee defined pvr as a proliferative disease, many treatments based on the inhibition of cell proliferation were developed for more than 20 years, none of which appears to have produced a significant clinical advance. therefore, a review of both the classification and the pathogenesis of pvr appears to be appropriate to aid the development of new treatments. there is a clinical impression that over the last 15 years clinicians have abandoned current pvr classifications. thus, the purpose of this study has been to evaluate the current use of pvr classifications in papers dealing with clinical practice and therapy as an indirect measure of the degree of usefulness of existing classifications. a search in pubmed for papers published between january 2000 and january 2014 was undertaken by two independent researchers. inclusion criteria comprised human studies published in english, french, and spanish on pvr or retinal detachment with specific mention to pvr. prospective randomized and nonrandomized clinical studies, retrospective clinical studies, short series, and pilot studies were included. a manual search of related articles was also performed through references reported in each article. we also analyzed how the different authors interpreted the classifications, comparing the results they provided with the original description. therefore, we investigated if they used all the characteristics (grade [a, b, c], pvr localization, extension in hours, and type) of the updated retina society classification or if they were used only partially. furthermore, it was also noted whether classifications were used both before and after an eventual pvr pharmacological or surgical treatment. data were extracted using a custom-made data sheet performed with agreement between authors. preliminary search identified a total of 219 publications, 81 of which were eliminated as they did not fulfill the inclusion criteria. 35 articles (25,4%) did not undergo detailed analysis because there was no reference to the type of pvr classification used by the authors or because no classification was used (generic terms such as initial or severe pvr or simply pvr were adopted, without using any grading system). 103 publications (74,6%) used standardized pvr classifications and they were analyzed in detail. the most used classification was the updated retina society classification (58 cites; 56,3%), followed by the first retina society classification (35 cites; 33,9%). in addition, 3 authors (2,9%) used modified or customized classifications [1315]. in 4 publications (3,8%), errors in the stated classification were identified [13, 1618]: in two papers [16, 18], the authors cite the updated retina society (91) but in fact they used the first retina society classification (83), koerner et al., after citing the updated retina society classification used a customized one, and roldn-pallars et al. cite the two retina society classifications at the same time. among the papers using the updated retina society classification, the most documented was grade c pvr (48 articles, 83%), while grades b and a were less frequently documented (15 (26%) and 7 (12%) articles, resp.). of the publications documenting only c grade, the classification of subtypes was infrequently used. in 5 of 48 publications (10,4%), there was a full c grade description in terms of localization (anterior or posterior), extension (in clock hours), and type (focal, diffuse, subretinal, circumferential, or anterior displacement). a similar finding was observed when authors used the first retina society classification (35 papers): only c and d grades were frequently reported (27 and 10 papers, resp.), while grades a and b were infrequently used (4 and 7 articles, resp.). when the silicone study classification was used, only grade c was mentioned (in 2 out of 4 articles). finally, there were 2 publications (1,9%) in which the standard classifications were used to assess changes in pvr status after any treatment, reporting pvr grade before and after it [19, 20]. the remaining authors used the classifications only to describe pvr status, rather than using them to analyze the improvement or worsening of the previous stage after the applied treatment. classifications of pvr were developed to provide clinicians with a useful tool to compare results of treatments. they are, to date, purely descriptive and do not reflect the pathobiology of this complex vitreoretinal disease. the original classification of 1983, which was relatively simple to use, induces errors in the estimating severity in some cases. as mentioned, d grades were based on the ophthalmoscopic appearance of the detached retina, and experience demonstrated that some of these cases could be relatively easily solved by peeling localized epiretinal membranes although, in some cases, classified as c, intraretinal severe changes prevent reattachment, unless complicated surgical techniques were used. subsequent classifications [10, 11] were more detailed and therefore more complicated to use on a routine basis. they incorporated the anterior pvr forms, which add severity to the case, but until now no one has incorporated the intraretinal changes, observed in many surgical retinal samples [8, 9], which may prevent the anatomical reattachment of the retina and require retinectomy. another important limitation is that they do not provide information on the activity of the process, although it has been observed that pvr progresses through several stages [13]. this may be crucial in estimating the risk of reproliferation after surgery or when surgeons schedule removing silicone oil, and no data on the chronology of events is included in any classification. furthermore, current classifications are not prognostic and do not correlate with visual prognosis or anatomical success after surgical treatment. moreover, some of these classifications can be difficult to use in clinical practice, due to their complexity (grade, localization, extension, type, etc.) and because they may not provide useful information they have been largely abandoned by clinicians. our findings in this study demonstrate that, in clinical research, investigators are using them inconsistently and reporting limited observations of stages (mostly grade c). some authors simply do not use any, preferring generic terms, such as minimal, moderate, and severe pvr [21, 22]. furthermore, early stages of pvr (named as grades a and b), which are common to all classifications, are not used, and most authors refer only to most advanced stages, basically grade c [20, 23]. moreover, the presence of classification errors could indicate that there is confusion concerning their use [13, 1618]. an important relevant finding is that only a limited number of clinicians appropriately and fully use the current updated classification of 1991 [2427], while the majority of authors avoid using the added characteristics of localization, extension, and type, limiting the description to the grade. in addition, many colleagues still use the first reported classification, probably because although it presents many limitations, it is easier to use compared to the last version [23, 28]. additionally, some authors decided to use alternative classification, probably to avoid problems evaluating pvr stages. the use of multiple classifications makes the efficient communication between clinicians and the comparison of different studies very problematic. as mentioned, one of the aims of this study was to evaluate the usefulness of these classifications for pvr management with surgery and other adjunctive treatments. unfortunately, many ophthalmologists did not use the normalized classifications for comparing the outcomes using non-clearly defined terms such as pvr recurrence [29, 30]. our findings showed the inconsistent and limited use of the current pvr classifications suggesting that it may be of benefit to produce a revised classification incorporating, if possible, the new knowledge on pvr which has been published since 1991, pointing out new potential targets for therapeutic agents distinct from those, mainly proliferative agents, targeted by the original description of this disease. thus, it is possible that we could reduce its prevalence after retinal detachment surgery and to improve the anatomical and functional results of this disease which resists the attempts of both basic researchers and clinicians for more than 30 years.

purpose. to evaluate the current and suitable use of current proliferative vitreoretinopathy (pvr) classifications in clinical publications related to treatment. methods. a pubmed search was undertaken using the term proliferative vitreoretinopathy therapy. outcome parameters were the reported pvr classification and pvr grades. the way the classifications were used in comparison to the original description was analyzed. classification errors were also included. it was also noted whether classifications were used for comparison before and after pharmacological or surgical treatment. results. 138 papers were included. 35 of them (25.4%) presented no classification reference or did not use any one. 103 publications (74.6%) used a standardized classification. the updated retina society classification, the first retina society classification, and the silicone study classification were cited in 56.3%, 33.9%, and 3.8% papers, respectively. furthermore, 3 authors (2.9%) used modified-customized classifications and 4 (3.8%) classification errors were identified. when the updated retina society classification was used, only 10.4% of authors used a full c grade description. finally, only 2 authors reported pvr grade before and after treatment. conclusions. our findings suggest that current classifications are of limited value in clinical practice due to the inconsistent and limited use and that it may be of benefit to produce a revised classification.

PMC4939352

pubmed-221

the number of total joint arthroplasties (tjas) performed has increased steadily in recent years, with projected numbers for the coming years rising further. consequently according to recent data, peri-prosthetic joint infection (pji) incidence constitutes between approximately 0.3% and 1.7% of all total hip arthroplasties (tha), and between 0.8% and 1.9% of all total knee arthroplasties (tka). pji can be classified in intra-operative, early post-operative, acute haematogenous and chronic infections, according to both timing and cause of infection. the risk factors potentially correlated with acute pji infection can be divided into pre-operative (usually related to patient comorbidities), peri-operative and post-operative, which are mainly linked to the behaviours of the surgeon and the hospital staff. conversely, chronic infections are less influenced by the conduct of the surgeon, as they are most often related to haematogenous diffusion of bacteria. the aim of this paper is to review the recent literature, summarising the most relevant risk factors that the surgeon can modify in order to reduce the incidence of peri-prosthetic joint infection. several studies demonstrated that some comorbidity can be associated with an increased risk of pji. the american academy of orthopaedic surgeons (aaos) reported on the different risk factors for pji and developed a guideline for pji prevention and treatment. in 2013 consensus for definition, prevention and management of pji, as an update to the previous guidelines. potential risk factors for development of surgical site infection or peri-prosthetic joint infection after elective total joint arthroplasty, according to the international consensus on periprosthetic joint infection bmi, body mass index; hba1c, glycated haemoglobin. although the majority of these conditions must be considered as non-modifiable factors, many preventive measures may be adopted to reduce their impact on the development of pji. table 2 summarises the modifiable and non-modifiable factors related to pji, including some preventive measures to manage reversible medical comorbidities, according to the existing literature. pre-operative modifiable and non-modifiable risk factors; measures the surgeon can adopt to reduce impact of risk factors on development of pji pji, peri-prosthetic joint infections; bmi, body mass index; hba1c, glycated haemoglobin; mrsa, methicillin-resistant staphylococcus aureus; s. aureus, staphylococcus aureus other potential pre-operative risk factors are intra-articular corticosteroid injections and any infectious disease, particularly urinary tract infection (uti) and nasal colonisation with staphylococcus (s.) aureus. the relationship between steroid injections and post-operative pji was evaluated in several studies. papavasiliou et al reported an incidence of only 2% of infections in a series of 114 tkas, but all of the infected tkas had previously been treated with an intra-articular corticosteroid injection within the 11-month period prior to surgery. conversely, desai et al stated that the incidence of infection did not increase in patients with prior steroid injection treatment. the correlation between post-operative utis and pji has been demonstrated. however, the association between pre-operative bacteriuria and early deep infections remains uncertain. the presence of symptoms of a uti in association with urinary leukocyte counts greater than 1 10/ml and a bacterial count greater than 1 10/ml should be the only indication for surgical delay. conversely, in asymptomatic patients it is still possible to proceed with tja by treating those patients with urine colony counts greater than 1 10/ml. different authors confirmed that being a high-level nasal carrier of s. aureus is an important and significant independent risk factor for developing ssi with s. aureus. nasal application of mupirocin is widely accepted as treatment for nasal carriers of s. aureus. in a recent randomised controlled trial (rct), mupirocin treatment resulted in a simple, safe and cost-effective intervention that can reduce the risk of ssi. different intra-operative components may play an important role as risk factors for developing pji (table 3).the first six hours following surgery are the most important regarding infection, as during those hours the numbers of bacteria multiply exponentially. maintaining a low blood level of bacteria in this period is critical, and for this reason prophylactic antibiotics are infused to decrease bacterial multiplication and to extend this golden period. the pre-operative dose of antibiotics should be administered within one hour before the surgical incision; this can be extended to two hours for vancomycin and fluoroquinolones. most authors agree that a single pre-operative prophylactic infusion of cefazolin (1 gr if<80 kg; 2 gr if>80 kg) is a good choice. however, recent studies have demonstrated that targeted use of vancomycin and cefazolin among patients undergoing revision tka significantly reduced the rate of overall infections, in particular of mrsa. surgeons should consider additional antibiotic administration if the surgery time is twice the length of the half-life of the antibiotic, or whenever the blood loss exceeds 2000 ml and fluid resuscitation is over 2000 ml. to reduce pji infection rate, some authors advocate using antibiotic-loaded bone cement (albc) for the cementation. however, it was demonstrated that routine use of albc does not change the pji rate, though it may be useful in the reduction of the pji rate in high-risk patients (for example those with diabetes or immunosuppression). intra-operative factors potentially associated with pjis pji, peri-prosthetic joint infections surgical site preparation also plays a role in reducing pji rate. some authors have confirmed the reduction of pji in patients who underwent pre-admission surgical site preparation using chlorhexidine washing. different studies have evaluated the best solutions for surgical site preparation to reduce pji. in a rct conducted by darouiche et al, it was demonstrated that a chlorhexidine alcohol solution was more protective than povidone iodine against both superficial and deep infections. this is probably due to the more rapid action, persistent activity despite exposure to bodily fluids, and residual effect of chlorexidine compared with povidone. the preparation of the surgical site often includes using plastic adhesive drapes and sterile stockinette. however, a recent cochrane review showed no evidence that adhesive drapes reduce surgical site infection rates. the bactericidal action of incision drapes containing iodine is inferior to conventional skin preparation solutions, so using incision drapes as a substitute for conventional skin preparation is not recommended. furthermore, boekel et al concluded that the surgical field for tka can be contaminated by proximal microbial spread from the unprepared foot with the use of a sterile stockinette drape. the risk of pji is also directly correlated with the length of the surgery, which should be less than 2.5 hours as a reasonable cut-off point. zhu et al, in their meta-analysis, concluded that increased operative time is associated with a higher risk of pji development (or=2.18, ci 95% 1.39-3.42, p=0.003). however, these data may also be correlated with the high complexity of long procedures. furthermore, the surgeon s surgical volume may be directly associated with pji: surgeons with low volumes may have higher rates of infection. hand care is another crucial point in reducing pji infection; hand surgical scrub recommendations were previously published by the centers for disease control and prevention. in particular, surgeons should remove debris from underneath the fingernails using a nail cleaner under running water, and either an antimicrobial soap or an alcohol-based hand rub should be used persistently for at least five minutes. different studies evaluated the number of glove changes necessary to reduce the risk of pji. of note, beldame et al recommended: renewing outer gloves after draping (before placing a cutaneous adhesive); opening the instrumentation secondarily, with a new glove change after handling instruments which may cause perforations; renewing outer gloves after each surgical stage. no strong evidence is available in the literature regarding the appropriate number of glove changes. different authors recommended double gloving to reduce the risk of inner glove perforation, but no correlation with pji has been demonstrated. the role of the personal protection system (pps) in preventing pji is still debated. kearns et al demonstrated that the external surface of the pps can not be assumed to be sterile after removal from the original packaging, and they suggested the need to change gloves if the pps is touched or adjusted during the procedure. other authors agree with the consideration of pps as more a personal protection than equipment specifically to reduce pji. light handles can be a source of contamination, and surgeons must minimise their handling as far as possible. furthermore a limited number of portable devices such as mobile telephones and tablet computers in the operating room is recommended, although no evidence in the literature is able to link their use to increased risk. as airborne pathogens are a potential source of infection, the location and length of time that surgical instruments remain exposed for this reason, all instruments should be opened in operating rooms with clean air systems. these basins are repeatedly used during a surgical procedure and should therefore be considered a potential source of contamination. anto et al demonstrated that 23.8% of specimens from splash basins tested positive for bacterial contamination, and they suggested that surgeons should stop using them. a recent systematic review showed no conclusive results regarding the utility of laminar flow in reducing pji rate. other authors agree that, despite the number of previous studies demonstrating the efficacy of laminar flow, more recent research has failed to prove this efficacy. ultraviolet light seems to be more effective when compared with laminar flow in reducing pji; however it is characterised by potentially unacceptable health costs to operative personnel. a level iii study showed that the number of door openings had a role in increased infection rate. surgeons may also play a role in reducing the rate of pji using power-pulsed lavage or wound lavage at surgery. in a level iv study, different post-operative variables may also play a role as risk factors for pji development. antibiotic prophylaxis for other surgical procedures before and after tja, such as dental care or urological procedures, seems to play a role as a despite the lack of literature demonstrating the relationship between dental procedures and pji, the current recommendation of the aaos is to use antibiotic prophylaxis in patients with a tja who are undergoing dental procedures, as well as any other invasive procedure. furthermore, patients should be aware that any infection is a potential source of haematogenous dissemination. as previously reported by different authors, patients with tja who have an active infection anywhere in the body are at risk of developing a pji. for this reason, a prompt diagnosis and management of those infections is a mandatory prevention mechanism. there is still debate regarding the association between blood transfusion and pji. in a level ii study, pulido et al demonstrated that transfusion with allogenic blood is an independent risk factor for pji. patients receiving allogenic transfusions were 2.1 times more likely to develop pji compared with patients receiving no transfusion. in their study, innerhofer et al concluded that allogenic filtered transfusion is an independent variable for pji prediction (or 23.65; ci 95%, 1.3-422.1; p=0.01). furthermore, the centers for disease control and prevention guidelines defined peri-operative allogeneic transfusion as a potential risk factor for developing pji, but concluded that the interpretation of the existing literature is difficult due to variations in assessment criteria. however, different measures can be adopted to reduce the need for blood transfusion, such as pre-operative screening for anaemia and its treatment, intra-operative accurate haemostasis, minimisation of surgical time and use of tranexamic acid. haematoma and persistent wound drainage were also related to an increased pji rate; these conditions should be treated promptly with antibiotic prophylaxis, a decrease in anticoagulation dose, surgical evacuation of the haematoma, irrigation and debridement and modular component exchange. recently, more advanced surgical bandages such as hydrofibre absorbent dressings were proposed, with the aim of reducing the medication to allow for better wound healing and to prevent bacteria from entering the wound site from the external environment. in a level ii study, cai et al concluded that advanced surgical dressings such as hydrofibre may contribute to a reduction in the incidence of acute pji. infection represents a major challenge in tja, and is costly and demanding to manage for both surgeons and patients. the main risk factors involved in pji development are divided into pre-operative, intra-operative and post-operative factors. the surgeon can act to reduce the impact of some reversible comorbidities, for example controlling glycaemia in diabetic patients or improving malnutrition. various intra-operative risk factors such as operating theatre traffic, use of light handles, pulsed lavage or number of glove changes may also be related to infection. post-operative risk factors include transient bacteraemia related to dental procedures or other infections, wound care and blood transfusion as well as haematoma, and wound drainage should be controlled with care. no benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.

total joint arthroplasty (tja) is one of the most common orthopaedic procedures. nevertheless, several complications can lead to implant failure.peri-prosthetic joint infections (pji) certainly represent a significant challenge in tja, constituting a major cause of prosthetic revision. the surgeon may have an important role in reducing the pji rate by limiting the impact of significant risk factors associated to either the patient, the operative environment or the post-operative care.in the pre-operative period, several preventive measures may be adopted to manage reversible medical comorbidities. other recognised pre-operative risk factors are urinary tract infections, intra-articular corticosteroid injections and nasal colonisation with staphylococcus (s.) aureus, particularly the methicillin-resistant strain (mrsa).in the intra-operative setting, protective measures for pji include antibiotic prophylaxis, surgical-site antisepsis and use of pre-admission chlorhexidine washing and pulsed lavage during surgery. in this setting, the use of plastic adhesive drapes and sterile stockinette, as well as using personal protection systems, do not clearly reduce the risk of infection. on the contrary, using sterile theatre light handles and splash basins as well as an increased traffic in the operating room are all associated with an increased risk for pji.in the post-operative period, other infections causing transient bacteraemia, blood transfusion and poor wound care are considered as risk factors for pji.cite this article: ratto n, arrigoni c, rosso f, bruzzone m, dettoni f, bonasia de, rossi r. total knee arthroplasty and infection: how surgeons can reduce the risks. efort open rev 2016;1: 339-344 doi: 10.1302/2058-5241.1.000032.

PMC5367521

pubmed-222

diabetic retinopathy (dr) is a leading cause of visual impairment and blindness in developed countries. the decrease in vision is due to diabetic macular edema (dme) and proliferative diabetic retinopathy (pdr) [1, 2]. the control of the blood glucose level, vitreous surgery, and photocoagulation are the major treatments used to prevent dr from progressing to the pdr stage. currently, intravitreal injections of antivascular endothelium growth factor (vegf) or steroids have become the primary therapy for dme [35]. however, the use of a single therapeutic agent is not effective in all cases, and additional treatments or different agents are needed. the blood retinal barrier (brb) consists of two anatomical parts; the inner brb is located within the endothelial cells of the retinal capillaries, and the outer brb is located between the retinal pigment epithelial (rpe) cells. an intact brb is required for an efficient and regulated control of fluids in the subretinal space and for the maintenance of healthy rpe and retinal cells. a breakdown of the outer brb results in an increase in the paracellular permeability between the rpe cells, and the leakage can cause retinal edema. the tight junctions (tjs) of the rpe cells are intercellular junctions located at the apical ends of the rpe cells, and they are integral structural components of the brb. tjs are made up of three tj related proteins, for example, the zonula occludens-1 (zo-1), occludin, and claudin. recent studies have shown that interactions between inflammatory cells and retinal cells are critical for the development of intraocular neovascularization [1012]. the results of these studies also demonstrated that, in eyes with pdr, an elevation of vegf was significantly correlated with the levels of several cytokines including interleukin- (il-) 6, il-8, and the monocyte chemoattractant protein-1 (mcp-1). another study showed that the levels of these cytokines were also strongly correlated with each other which suggest that there are common pathways involved in the inflammatory processes. in addition, various cytokines have been shown to be related to the maintenance of the conformation of the tj proteins. lecithin-bound iodine (lbi, jolethin, daiichi pharmaceutical co., tokyo, japan) has been used clinically to reduce the antigen-induced immune responses in children with bronchial asthma. lbi acts on the peripheral blood mononuclear cells and downregulates the il-4-induced ige synthesis, which suggests that lbi have anti-inflammatory properties [15, 16]. in patients with eye diseases, lbi has been used for the absorption of retinal or vitreous bleeding, vitreous opacities, and improvement of central serous choroidopathy. the purpose of this study was to determine whether lbi will alter the integrity of the tjs of arpe-19 cells in culture. lbi (jolethin, daiichi pharmaceutical co., tokyo, japan) was dissolved in distilled water and diluted to the appropriate concentration for each experiment. an earlier study showed that lbi solutions contain 48.250.3% lecithin-iodine, approximately 10% free lecithin, and 40% phosphatidylinositol. rabbit polyclonal anti-zo-1 antibody (sc-10804) was purchased from santa cruz biotechnology (santa cruz, ca), and alexa 594 anti-rabbit igg was purchased from invitrogen (molecular probs, eugene, or). rabbit anti-mcp-1 antibody (# 2029) was purchased from cell signaling technology (danvers, ma) and rabbit anti-eotaxin (ccl-11) antibody (ab133604) was purchased from abcam (cambridge, ma). cells from a human retinal pigment epithelium cell line, arpe-19, were grown in dulbecco's modified eagle's medium/ham's f-12 supplemented with 10% fetal bovine serum (fbs, hyclone laboratories, inc., logan, ut), 50 units/ml penicillin, and 50 g/ml streptomycin in an air-5% co2 atmosphere with constant humidity. prior to the experiments, cells were placed in serum-free media and pretreated with 50 g/ml of lbi or 250500 pg/ml of antibody (anti-mcp-1 antibody and anti-chemokine (c-c motif) ligand-11 (ccl-11) antibody) for 24 h. to mimic hypoxic conditions, arpe-19 cells were incubated for 4 h with 100 m of cocl2 (sigma, st. louis, mo), which is a chemical hypoxia-inducing agent. after the incubation, optimum concentration of lbi was defined as 50 g/ml because over 100 g/ml of lbi seems to be toxic (data not shown). for the immunofluorescence studies, cells were grown to a density of 2 10 cells/ml on 12 mm cover slips and fixed in 10% tricarboxylic acid for 10 min at 4c. they were then treated with 0.5% triton x-100 for 15 min. to detect the presence of zo-1, the cultured rpe cells were exposed to rabbit polyclonal anti-zo-1 antibody as the primary antibody and alexa 594 anti-rabbit igg as the secondary antibody. samples were examined and photographed with a fluorescence microscope (bz-9000; keyence, osaka, japan, and eclipse 50i, nikon, tokyo, japan), and the intensity of fluorescence was quantified with a bz-ii analyzer (keyence). the levels of the bioactive molecules in the conditioned medium were determined by human il-6, il-8, and mcp-1 elisa kits (r&d systems, minneapolis, mn) and ccl-11 elisa kit (biosensis, thebarton, south australia, australia). all experiments were repeated at least three times and values are presented as the means standard deviations. data were analyzed by two-way nonrepeated analysis of variance (anova) followed by bonferroni post hoc tests for the comparison of the means. we first determined whether the lbi pretreatment affected the changes in the conformation of the tj proteins caused by the hypoxic stress induced by cocl2. immunofluorescence microscopy showed that there appeared to be a disruption of tjs with cocl2 treatment (figures 1(a) and 1(b)). when the arpe-19 cells were pretreated with lbi before the addition of cocl2, the disruption of the tight junctions was not detected (figures 1(c) and 1(d)). the signal intensity measurements showed that there was a significant decrease with the cocl2 addition compared to the control. but there was no significant change in the lbi pretreated group (29244.6 2981.2 in controls; 5787.7 4126.4 with cocl2; and 27189.0 11231.1 with cocl2 after lbi pretreatment; p<0.05, nonrepeated anova, n=5, figure 1(e)). because disruption of tjs is detected as a decrease of signal intensity, these results indicate that lbi pretreatment can protect the tjs of the outer brb from hypoxic stress. because lbi pretreatment protected the conformation of the tj proteins from hypoxic stress, we hypothesized that lbi will block different inflammatory molecules that are secreted from cells during hypoxia. the results of the elisa measurements of the conditioned culture media (n=5) indicated that il-8 was not significantly changed after the addition of cocl2 or after pretreatment with lbi (control, 6.9 0.1; with cocl2, 6.8 0.1; and with cocl2 after lbi pretreatment, 6.9 0.1 pg/ml; figure 2(a)). although the level of il-6 was increased after addition of cocl2 which was decreased by lbi pretreatment, these changes were not significant (control, 10.4 1.6; cocl2 addition, 15.0 6.7; and cocl2 addition after lbi pretreatment, 13.3 7.6 pg/ml; figure 2(b)). the level of mcp-1 increased significantly after the addition of cocl2, and it was significantly decreased after the addition of cocl2 after lbi pretreatment (control, 279.7 68.3; with cocl2, 340.8 43.3; and with cocl2 after lbi pretreatment, 182.6 23.8 pg/ml, p<0.05; nonrepeated anova; figure 2(c)). a similar tendency was observed for ccl-11 (control, 12.5 6.1; with cocl2, 15.2 12.9; and with cocl2 after lbi pretreatment, 5.46 1.9 pg/ml; p<0.05; nonrepeated anova; figure 2(d)). these results indicated that there is an increase of the mcp-1 and ccl-11 secretion under hypoxic stress, and all are suppressed by lbi pretreatment. to confirm that lbi effectiveness is related to suppression of mcp-1 or ccl-11, cells were pretreated with anti-mcp-1 or anti-ccl-11 antibody for 24 hrs. the tj disruption from hypoxic stress was reduced with pretreatment (figures 3(e) and 3(f)). these results indicated that both mcp-1 and ccl-11 were important to protect tjs from hypoxic stress and support the effectiveness of lbi. vegf is a major antigen factor and is biogenic permeability factor which can increase the vascular permeability endothelial cell-cell junctions. finally, to confirm that lbi pretreatment can protect tjs from direct vegf induced stress, after lbi pretreatment but after pretreatment of lbi, this disruption was decreased which indicates that lbi can also protect tjs from vegf induced damage. but there still remain patients who do not respond to the anti-vegf therapy and who had a reduction of their vision even after therapy. it must also be noted that the cost of anti-vegf therapy is quite high and continuous injections to control the dme can become an economic issue. combination therapies have also been proposed that can enhance the efficacy and may minimize the cost of anti-vegf therapies. for example, photocoagulation can extend the interval of anti-vegf injections resulting in a reduction in the number of injections [21, 22]. if new drugs or treatments can be approved, this will make it easier and less expensive to use combination therapies. moreover, adjunctive therapies that include oral kallidinogenase could also be used for combined therapy [23, 24]. our results showed that the hypoxic stress induced by exposure of arpe-19 cells to cocl2 caused a disruption of the tight junctions and that lbi pretreatment can protect the tjs from the hypoxic stress. hypoxic stress also enhanced the secretion of mcp-1 and ccl-11, and this enhancement can be suppressed by lbi pretreatment. hypoxia has been reported to produce alterations in the tight junction proteins that are correlated with the vascular permeability increases. the integrity of the brb is dependent on tj-associated proteins such as occludin, claudin, and zo-1. the function of zo-1 is to link the transmembrane protein, occludin, to the actin cytoskeleton. under hypoxic conditions, the phosphorylation of zo-1 is enhanced which is related to the damage of the tight junctions. mcp-1 is associated with a breakdown of the brb [3032], and it also induces a disruption of the tjs by the caveolae that are dedicated to the internalization of the tj proteins, such as zo-1. because mcp-1 is also increased in the vitreous of patients with dr, it probably plays an important role in the progression of dr and dme. in the photocoagulation-induced mouse model of retinal neovascularization, it was reported that an increase in mcp-1 contributes to the postischemic inflammation and dr progression [34, 35]. mcp-1 has been recently postulated to have a direct effect on angiogenesis even though there is no link with macrophage recruitment. ccl-11 also promotes the recruitment of vascular endothelial cells and relates the conformation of the tight junctions. interestingly, there is also an increase of ccl-11 in the proliferative membranes obtained from eyes with pdr. so these cytokines relate to zo-1 and maintain tight junctions on diabetic retina. in the photocoagulation-induced retinal neovascularization or light-exposed mouse models, the levels of not only mcp-1 but also ccl-11 are increased in the rpe [3941]. these increases were related to the remodeling of f-actin that occurred after light damage and caused proinflammatory changes in the rpe cells. these findings support our results that showed that the hypoxia-induced stress affected the expression of cytokines especially mcp-1 and ccl-11. the suppression of these cytokines by lbi leads to the protection of these cells from disruption of the tight junctions. steroids are also commonly used for dme therapy because their anti-inflammatory property helps to protect the tissues from neovascularization or vascular permeability increases. similarly, the effect of lbi on the suppression of the postischemic inflammation may be an additional contributor when used as either a primary or adjunctive dme therapy. mainly in japan and china, lbi has been approved for the treatment of various retinal diseases including central serous chorioretinopathy, vitreous hemorrhage, or vitreous opacity for a long time. in addition, both lecithin and iodine are commonly used in food materials indicating the safety of lbi. thus, the possibility exists that lbi can be even used as a safe adjunctive therapy with an anti-vegf drug to treat dme. further investigations into the use of lbi in conjunction with anti-vegf therapy need to be undertaken to determine the effectiveness of lbi in preventing the development or progression of dme. our findings showed that lbi pretreatment reduced the levels of mcp-1 and ccl-11 and blockage of them also results in protection of tjs. however, no significant changes were detected in the levels of il-6 and il-8, which are the major cytokines related to neovascularization. in ischemic retinas, il-8 causes increases in the vegf and mcp-1 levels but it is dependent on tnf-. because il-8 has been shown to be secreted from either monocytes or macrophages and because our experiments were limited to arpe-19 cells in culture, there is the possibility that the results may not hold under in situ conditions. though we observed that vascular permeability improved after oral lbi administration for diabetic mice model (data not shown), it is not clear whether this is the result of hypoxia improvement the same as we show here using arpe-19. in addition, lbi pretreatment can also protect tjs from direct vegf induced damage which results in tj disruption. further investigations will need to be undertaken to definitively explain these phenomena. in conclusion, our data demonstrate the therapeutic potential of lbi for protecting the integrity of the tight junctions from hypoxia-induced stress. these data suggest a new aspect on the clinical use of lbi in the treatment of dme.

aim. we investigated whether lecithin-bound iodine (lbi) can protect the integrity of tight junctions of retinal pigment epithelial cells from hypoxia. method. cultured human retinal pigment epithelial (arpe-19) cells were pretreated with lbi. to mimic hypoxic conditions, cells were incubated with cocl2. we compared the integrity of the tight junctions (tjs) of control to cells with either lbi alone, cocl2 alone, or lbi+cocl2. the levels of cytokines in the conditioned media were also determined. results. significant decrease in the zonula occludens-1 (zo-1) intensity in the cocl2 group compared to the control (5787.7 4126.4 in cocl2 group versus 29244.6 2981.2 in control; average standard deviation). but the decrease was not significant in the lbi+cocl2 (27189.0 11231.1). the levels of monocyte chemoattractant protein-1 (mcp-1) and chemokine (c-c motif) ligand 11 (ccl-11) were significantly higher in the cocl2 than in the control (340.8 43.3 versus 279.7 68.3 pg/ml for mcp-1, and 15.2 12.9 versus 12.5 6.1 pg/ml for ccl-11. with lbi pretreatment, the levels of both cytokines were decreased to 182.6 23.8 (mcp-1) and 5.46 1.9 pg/ml for ccl-11). blockade of mcp-1 or ccl-11 also shows similar result representing tj protection from hypoxic stress. conclusions. lbi results in a protective action from hypoxia.

PMC4906216

pubmed-223

obstructive sleep apnea (osa) is a common public health problem worldwide and it has been shown to be associated with an increased incidence of cardiovascular complications such as death, stroke, or myocardial infarction. the 2014 american heart association/american stroke association guideline recommends that patients with stroke/transient ischemic disorder (tia) showed be worked up for osa. in this study, patients who had osa and stroke had an improved outcome with continuous positive airway pressure. extrapolating data from western population and implementing in the asian populations may not be possible as there are differences in genetic and anatomical factors. for example, the cutoff point for obesity based on body mass index (bmi) criterion for western population is 30 kg/m meanwhile the bmi for asian population is 25 kg/m. it is also evident that there are differences in anatomical factors between asian and caucasian population such as retrognathia and oropharyngeal width which are main risk factors for osa. alternatively, the stop-bang questionnaire developed by chung et al. has been widely used as a sensitive screening tool for osa. the stop-bang acronym stands for: snoring history, tired during the day, observed stop breathing while sleep, high blood pressure, bmi more than 35 kg/m, age more than 50 years, neck circumference more than 40 cm and male gender. the authors recommended that if a patient had 3 or more criteria mentioned above, it is strongly suggestive for osa. however, the cut-off values of this questionnaire are based on the data from caucasians, therefore we hypothesized that to use it in asian population, some adjustments are needed. we compared the clinical features in the stop-bang questionnaire between osa-induced hypertension patients and healthy control subjects. the study was conducted in the faculty of medicine, khon kaen university (thailand). the study protocol was approved by the ethics committee for human research, khon kaen university. osa induced-hypertension patients were diagnosed by: i) met the criteria of hypertension; ii) having average apnea-hypopnea index (ahi) by polysomnography more than or equal 5 times/hours and iii) no evidence of other secondary hypertension. the control subjects filled up the modified berlin questionnaire and epworth sleepiness scale less than 10 and defined as low risk for osa with low scores. demographic data and clinical features of both osa-induced hypertension patients and healthy subjects were recorded and compared. the clinical features included age, gender, bmi, neck circumference, mallampati classification, torus palatinus, and torus mandibularis. the mallampati classification was defined by asking the subjects to protrude their tongue as much as possible and classified as class 1 to 4. the sample size of the study population was calculated by using the proportion comparison between osa and healthy subjects using winpepi program. the proportion of osa was 0.35 and the healthy control was 0.07 with deviation of 5%, power of 90%, and missing data of 10%. the sample size was calculated to be 102 subjects (osa 34 subjects and healthy control 68 subjects). due to the incompleteness of the database of medical students, 120 healthy controls were selected by systematic sampling from the database (total of 1174 medical students). baseline and clinical characteristics of the participants in both groups were compared using descriptive statistics. univariate logistic regression analyses were applied to calculate the crude odds ratios of individual variables for having osa. all clinically significant variables or p<0.20 by the univariate analyses were included in subsequent multivariate logistic regression analyses. analytical results were presented as crude odds ratios (or), adjusted or, and 95% confidence intervals (ci). significant risk factors were calculated for the best cut-off points by the receiver operator characteristic curve (roc curve). data analyses were performed with stata software (college station, tx, usa) and spss software (chicago, il, usa). in this study, 42 osa-induced hypertension patients and 82 control subjects who had a complete set of clinical data were included. all clinical features of both groups the osa-induced hypertension patients were significantly older (59.5 vs 21.0 years), with higher proportion of males (64.3 vs 59.8%), more obese (78.6 vs 6.1%), higher incidence of mallampati class 3 or more (54.8 vs 24.4%), larger neck circumference (41.3 vs 32.0 cm), higher incidence of torus palatinus (26.6 vs 0%) and of torus mandibularis (9.5 vs 0%). by multiple logistic regression analysis, only two factors bmi and neck circumference, the adjusted odds ratios for both factors were 1.49 (95% ci: 1.06, 2.09) and 1.67 (95% ci: 1.11, 2.51), respectively. by the roc curve analyses, the best cut-off points for the bmi and the neck circumference were 24.5 kg/m (figure 1a) and 36 cm (figure 1b). the sensitivity and the specificity for bmi cut-off point were 97.2% and 91.4%, whereas those for the neck circumference were 94.7% and 82.9%. the present results showed that the stop-bang questionnaire needed to adjust the cutoff values of the bmi and neck circumference suitable for thai population. subjects should referred for polysomnography if positive at least 3 questions: s, snoring history; t, tired during the day; o, observed stop breathing while sleep; h, high blood pressure; b, bmi more than 25 kg/m; a, age more than 50 years; n, neck circumference more than 36 cm; g, male gender (modified from chung et al.). for the criteria of obesity for asians, the cut-off of the bmi should lower from 35 kg/m to 24.5 or round up to 25 kg/m. the cut-off of the neck circumference also should be lowered from 40 cm to 36 cm for asians. proposed the cutoff points of 24.1 kg/m for the bmi and 35.5 cm for the neck circumference for japanese population. using stop-bang questionnaire is very suitable for thailand and other developing countries due to limited availability of polysomnography, the standard diagnostic tool for osa. this low cost tool can select appropriate patients for referral to sleep center for further polysomnography. healthy control subjects were not performed polysomnography to exclude osa. however, both the berlin questionnaire and the epworth sleepiness scale were used to exclude osa, which has a sensitivity and specificity of 0.86, 0.95 and 0.49, 0.80, respectively. even though the age is a significant factor by univariate logistic regression, it was not included in the subsequent multivariate regression. this is because the difference of age group composition between the osa and the healthy control subjects. further studies, therefore, are needed to confirm the results of this study and to identify the appropriate cut-off point using the age- and sex-matched controls. also, to increase their sensitivity and specificity, osa patients with other complications than hypertension should be included and compared. whether simple measurement of the neck circumference and the bmi calculation are sufficient to identify osa patients in routine practice by primary health care personnel including physicians, nurses and volunteers should be examined in further study. osa has been proved to be a contributing factor for major cardiovascular diseases; stroke, hypertension, sudden death, and also coronary artery disease. treatment of osa may reduce large economic burden from prevention of the morbidity and mortality from stroke and acute coronary syndrome. in conclusion, the appropriate cut-off points for the bmi and the neck circumference for stop-bang questionnaire were 25 kg/m and 36 cm for asian people. all hypertensive patients should have their bmi and neck circumference measured to detect the risk factors for osa. public health campaign for osa screening is also needed to reduce morbidity and mortality from osa complications.

obstructive sleep apnea (osa) is a common public health issue. if left untreated, osa may cause a large health economic burden from cardiovascular complications particularly stroke. the diagnosis of osa can be made by polysomnography, but its availability is limited in the developing countries in asia. stop-bang questionnaire is a good screening tool but may need some adjustment for asian population. stop-bang stands for: snoring history, tired during the day, observed stop breathing while sleep, high blood pressure, body mass index (bmi) more than 35 kg/m2, age more than 50 years, neck circumference more than 40 cm and male gender. we compared clinical features in stop-bang questionnaire between 42 osa induced hypertension patients and 82 healthy control subjects in the faculty of medicine, khon kaen university, thailand. the best cutoff point for the bmi and the neck circumference were 24.5 kg/m2 and 36 cm, respectively. the sensitivity and specificity of the bmi cutoff point were 97.2% and 91.40, while those of the neck circumference were 94.7% and 82.9%. in conclusion, the appropriate cutoff points of bmi and neck circumference for thai stop-bang questionnaire were 25 kg/m2 and 36 cm.

PMC4830364

pubmed-224

triple-negative breast cancer (tnbc) is characterized by absence of expression of the estrogen (er) and progesterone receptors (pr) and no human epidermal growth factor receptor 2 (her2)/neu gene amplification [1, 2]. unlike hormone receptor-positive and her2-overexpressing breast cancers, tnbc is unresponsive to endocrine therapy and her2-targeted agents, respectively, thereby limiting available systemic treatment options to conventional cytotoxic chemotherapy [1, 2]. patients with tnbc are more likely to have visceral or brain metastases and short relapse-free survival compared with those with other breast cancer subtypes [3, 4, 5, 6]. while chemotherapies have been effective for treating early-stage disease, with pathologic complete response (cr) rates exceeding those of hormone receptor-positive subtypes, patients with metastatic disease have shorter disease-free survival progressing rapidly through several lines of chemotherapy. thus, response to chemotherapy has not translated to improvements in progression-free (pfs) or overall survival (os) in the metastatic setting, and the overall prognosis for tnbc remains poor [3, 7]. the median os of patients with metastatic disease is relatively short, with reports between 9 and 13.3 months [3, 4, 5, 6]. an unmet clinical need exists for more effective therapies for tnbc, particularly in the metastatic setting. taxane-based chemotherapy has demonstrated activity in patients with tnbc [1, 2]. in the phase iii eastern cooperative oncology group 2100 trial in which 91% of the patients had her2-negative disease, 51% of the patients were pr negative and 37% were er negative, the addition of bevacizumab to solvent-based paclitaxel demonstrated significantly improved median pfs compared with solvent-based paclitaxel alone (11.8 vs. 5.9 months, respectively); however, this did not translate into a significant improvement in median os for the combination arm. nab-paclitaxel, a novel formulation albumin-bound paclitaxel with a mean particle size of 130 nm, was initially designed with the intent to improve the therapeutic index of solvent-based taxanes [9, 10]. currently, nab-paclitaxel is indicated for the treatment of breast cancer after failure of combination chemotherapy for metastatic disease or relapse within 6 months of adjuvant chemotherapy. a phase ii study examined the combination of nab-paclitaxel, bevacizumab, and gemcitabine as first-line therapy for patients with her2-negative metastatic breast cancer. in this small cohort of patients with stage iv tnbc, the clinical benefit rate as defined by cr, partial response, and stabilization of disease was 85%. additionally, in this study, there were no significant differences in pfs or os between triple-negative and hormone receptor-positive patients. this work reports on a patient with metastatic tnbc enrolled in this phase ii study of nab-paclitaxel, bevacizumab, and gemcitabine who experienced a long-term complete remission lasting just under 2 years and a pfs from diagnosis of nearly 3 years. in june 2007, a 52-year-old woman was diagnosed with invasive ductal carcinoma. the patient initially presented with chest pain, and a subsequent breast examination revealed a mass in the left breast and a palpable sternal mass. a lumpectomy and axillary lymph node dissection were performed at an outside institution and results revealed a moderately differentiated, infiltrating ductal carcinoma, high nuclear grade, measuring 4 cm in maximal diameter, with metastases to 2 of 24 axillary nodes. further staging also revealed sternal and mediastinal metastases, and a computed tomography (ct) scan revealed bilateral pulmonary nodules (fig. tumor samples were negative for er and pr, and positive (+ +) for her2 by immunohistochemistry. however, fluorescent in situ hybridization results were negative for her2 gene amplification, and the patient was diagnosed with triple-negative primary metastatic/stage iv breast cancer. the patient was initially seen at the university of miami sylvester comprehensive cancer center and enrolled in the phase ii study of nab-paclitaxel, bevacizumab, and gemcitabine for her2-negative metastatic breast cancer. she was treated on study with gemcitabine 1,500 mg/m by 30-min infusion, followed by nab-paclitaxel 150 mg/m by 30-min infusion, then bevacizumab 10 mg/kg by 30-min infusion once every 2 weeks in a 4-week cycle. the patient experienced pain relief after 5 weeks on the study (2 infusions). serial ct scans, performed every 2 months, demonstrated progressive reduction in the size of all target lesions (fig. she showed a complete clearance of lesions in all imaging studies, which was confirmed on at least 2 separate occasions approximately 2 months apart according to response evaluation criteria in solid tumors. one dose reduction, as required by the study protocol, occurred in november 2008 on cycle 12, due to treatment-related fatigue. the dose of gemcitabine was reduced to 1,250 mg/m, nab-paclitaxel to 125 mg/m, with no modification of the bevacizumab dose, and treatment was continued once every 2 weeks on a 4 week cycle. throughout her treatment, she experienced no major side effects and continued to work uninterrupted except for visits for chemotherapy and evaluation, and her treatment-related fatigue was successfully managed with the dose reduction. the patient maintained her response and continued to receive treatment for just over 2 years. after 12 months on study, follow-up was performed every 3 months. in may 2010, the patient had documented disease progression by ct scan. metastases were found in the lung, bone, and lymph nodes. as specified in the study protocol, the patient discontinued study treatment due to disease progression. she received her last dose of nab-paclitaxel, bevacizumab, and gemcitabine on may 28, 2010. three weeks after progressing, the patient received capecitabine at a dose of 2,000 mg/m orally twice a day for 2 weeks in 3-week cycles and showed minor response. however, therapy was stopped due to unacceptable toxicity, including diarrhea, dehydration, and severe palmar plantar erythrodysesthesia. after 2 months, she initiated therapy with ixabepilone, with a minor radiographic response. from august 2010 to december 2010, she received 8 cycles of treatment with ixabepilone (30 mg/m) administered intravenously every 3 weeks. in december 2010, the patient requested a chemotherapy holiday. beginning in november 2011, the patient was treated with eribulin 1.1 mg/m intravenously on days 1 and 8 of a 3-week cycle. treatment was discontinued in march 2012 due to rapid disease progression with development of central nervous system metastases. she was transferred to hospice care where she died a month later. throughout the course of her disease, she received zoledronic acid at 4 mg intravenously every 4 weeks beginning in november 2007 when she began the phase ii study. in may 2010, she continued to receive denosumab throughout her chemotherapy holiday from december 2010 to november 2011 until discontinuing therapy in march 2012 after being transitioned to hospice care. patients with metastatic tnbc have a very poor prognosis. in a large analysis of 255 patients diagnosed with tnbc at the md anderson cancer center between 1985 and 2004, the median os of patients with recurrent disease was only 1.0 year (95% ci, 0.81.2 years) for tnbc patients, significantly shorter than the median os of 2.3 years (95% ci, 1.92.7 years) for those with other breast cancer subtypes (hr, 2.5; 95% ci, 1.83.5; p<0.001). other studies have reported median os times for patients with recurrent or metastatic tnbc between 9 and13.3 months [4, 5, 6]. while median os has not been specifically assessed in a large patient population initially presenting with metastatic tnbc, it is likely to be similarly poor. additionally, patients with metastatic tnbc exhibit progressively shorter response durations to successive lines of therapy. in a retrospective analysis of 111 patients with tnbc (14% of whom presented with metastatic disease at diagnosis), the median duration of response was only 12 weeks (range, 073.1 weeks) to first-line therapy, 9 weeks (range, 0120.9 weeks) to second-line chemotherapy, and 4 weeks (range, 059 weeks) to third-line chemotherapy. there is an unmet clinical need for effective therapies that prolong survival for patients with metastatic tnbc. in the absence of curative therapies for metastatic disease, the goal of therapy is primarily palliative in nature, leveraging systemic treatment with minimal toxicity to both prolong os and at the same time enhance quality of life by delaying the onset of cancer-related symptoms. numerous studies have shown that the combination of gemcitabine and a taxane is an effective regimen that is well tolerated with good response rates. the case described here is of a patient with metastatic tnbc treated with first-line combination chemotherapy consisting of nab-paclitaxel, bevacizumab, and gemcitabine every other week. after only 5 weeks and 2 infusions, the patient experienced significant symptom relief from her pain from bone metastases, including the sternum. following 7 months of treatment, she achieved a complete remission that, with continuous therapy, persisted for nearly 2 years for an overall progression-free period from initial diagnosis of 2 years and 7 months. following progression, subsequent lines of therapy were able to produce only limited efficacy in disease control. following her initial progression-free interval of almost 2 years in cr with nab-paclitaxel, bevacizumab, and gemcitabine therapy, subsequent treatment with capecitabine then ixabepilone resulted in short progression-free intervals of only 2 months and 4 months, respectively. while ixabepilone did provide a pfs benefit, it was very modest. from her initial diagnosis in june 2007, the patient survived nearly 5 years, which is greatly improved compared to reported median survival of 913.3 months for stage 4 tnbc [3, 4, 5, 6]. with the aim to enhance quality of life, systemic treatments with minimal toxicity while the patient did experience treatment-related fatigue while on nab-paclitaxel, bevacizumab, and gemcitabine combination therapy, this was easily managed with a dose reduction. in addition to a lengthy complete remission, the patient was able to work uninterrupted throughout her treatment period, a factor that may significantly elevate quality of life for many patients. this patient initially received treatment as a participant in a phase ii study of nab-paclitaxel, bevacizumab, and gemcitabine as first-line therapy for her2-negative metastatic breast cancer. a large proportion (13 of 29) of the patients enrolled in this study had triple-negative disease. overall, this subset of patients demonstrated promising outcomes, with 38% achieving a complete radiographic response and 85% experiencing clinical benefit. most notably, survival outcomes were almost identical between tnbc patients and those with hormone receptor-positive disease. additionally, severe adverse events appeared to be less frequent in the overall study population relative to results in other published chemotherapy studies in patients with metastatic breast cancer. this case study demonstrates the potential for triplet chemotherapy with nab-paclitaxel, bevacizumab, and gemcitabine to elicit prolonged responses, potentially prolong os, and improve quality of life for patients with metastatic tnbc. this combination shows promise for the treatment of tnbc and should be the subject of further investigation in larger randomized trials.

this is a case study of a 52-year-old female patient diagnosed in june 2007 with primary metastatic invasive ductal carcinoma of the left breast and synchronous metastases in the bone, lymph nodes, and lung. biopsy results of the tumor tissue were negative for the estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 (her2). in november 2007, she participated in a phase ii study of metastatic her2-negative breast cancer. treatment consisted of systemic chemotherapy with gemcitabine 1,500 mg/m2, nab-paclitaxel 150 mg/m2, and bevacizumab 10 mg/kg once every other week. the patient experienced pain relief in her sternum after 5 weeks of chemotherapy, and her analgesic therapy was discontinued. after 7 months, the patient achieved a complete radiographic response, which was maintained for nearly 2 additional years. she continued receiving treatment throughout this period, requiring 1 dose reduction due to fatigue. the patient experienced no other adverse events, including neuropathy, and continued working uninterrupted throughout her treatment. the patient was discontinued from the study in may 2010 after disease progression, almost a full 3 years after diagnosis. the patient showed minimal response to subsequent therapies but had disease stabilization and died from her disease in april 2012. median overall survival for patients with metastatic triple-negative breast cancer is between 12 and 13.3 months. this patient survived nearly 5 years following diagnosis. this case exemplifies how therapy with nab-paclitaxel, bevacizumab, and gemcitabine may prolong survival, with minimal toxicity, in select patients with triple-negative metastatic breast cancer.

PMC3551390

pubmed-225

in humans, type i interferons are encoded by ~16 genes and individual genes encoding,, and. their gene products are highly structurally related and all bind to a single receptor (ifnar) consisting of heterodimeric r1 and r2 subunits. in contrast, ifn- consists of 3 genes, ifn-1, 2 and 3 (formally, il-29, il-28a and il-28b) that are more related to the il-10 family than to interferon. ifn- binds a receptor (ifnlr) composed of a unique ifnlr1 and a shared il-10r2 subunit. while stats 1 and 3 are promiscuously activated by a variety of other cytokines and growth factor receptors, stat2 is selectively recruited to the ifnar and ifnlr. stat2 recruitment and activation by both receptors involves tyrosine phosphorylation of stat2 by jak kinases and subsequent oligomerization with stat1 and irf-9. although a fraction of stat1:stat2 heterodimers can translocate to the nucleus and bind atypical gamma activated sequence (gas)-like elements, the canonical interferon-stimulated gene factor-3 (isgf3) complex of stat2:stat1:irf-9 regulates a large fraction of the interferon pathway genes. thus, stat2 is central to the induction of these genes in response to both ifn-/ and ifn-. in some cases, type ii interferon, ifn-, can mobilize the antiviral response in a stat2-dependent manner. although there is no evidence for direct recruitment of stat2 to the ifn-r, ifn- signaling can drive the formation of an isgf3-like complex containing stat2, inhibit viral replication and induce expression of ifn-/ target genes, perhaps through the pairing of phosphorylated stat1 with latent stat2. regardless of its mode and route of activation, stat2 acts as the gatekeeper to the antiviral response, which is underscored by the severe susceptibility of stat2 knockout mice to viruses ranging from influenza to dengue. type i and iii interferon, while produced in different amounts by distinct cell populations, regulate the expression of an overlapping set of interferon stimulated genes (isgs). some examples include 25-oligoadenylate synthase (oas), which decorates viral rnas with branched polyadenosine, and rna endonuclease l, which promptly degrades rnas containing these polyadenosine modifications. most isgs, however, have not been well characterized, and some of these genes are so enigmatic that they do not contain any canonical secondary structures that could aid in predicting their function. over 300 isgs have been identified by microarray and genomic analysis, which is curious given the magnitude of antiviral activity exhibited by select individual isgs. for example, mxa potently inhibits the replication of a wide range of viruses and can do so in the absence of other isgs or interferon signaling if ectopically expressed. not all isgs exhibit such robust effects individually; nonetheless, when combined with other isgs, the host can mount an impressive arsenal of anti-viral proteins that could conceptually block every step in the viral life cycle. however, like oas and mxa, most isg expression requires interferon signaling through stat2. thus, while there are three major nodes to drive interferon secretion (tlrs, rig-i and nlrs) and two pathways available to drive stat2 activation (ifn-/ and ifn-), there is only one stat2. in addition to its role in interferon mediated antiviral effect, stat2 also confers anti-proliferative and apoptotic activities on a variety of cell types in response to both type i and iii interferon. this activity is perhaps one of the most fundamental actions of interferon to inhibit viral spread by blocking the replication of virally infected cells. however, much attention has been focused on the use of ifn-/ to inhibit cancer outgrowth and metastasis given its unique ability to inhibit proliferation of a variety of tumor cell types. stat2 is a critical signaling intermediate that regulates much of the apoptotic and anti-proliferative effects of ifn-/ and ifn-. further, mutations within stat2 that protract its ligand-mediated phosphorylation can drive cells down the apoptotic pathway. a variety of genetic mutations have been identified in humans that affect ifn-/ and ifn- production, including mutations in nemo, tyk2 and tlr3. further, functional defects in the human unc93b1 gene, which controls signaling via tlr3, 7, 8 and 9, results in dramatic reductions in ifn-/ and ifn- secretion in response to ligands that activate these receptors. however, these subjects are susceptible to only a few types of viral infections, mainly encephalitis caused by herpes simplex virus. this restriction in viral susceptibility may reflect the inherent redundancy in driving ifn-/ and ifn- production through alternative pathways such as rig-i and nlrs. in contrast, to date, no mutations have been found that block responsiveness to type i or iii interferons in humans, particularly within either the ifn-/ receptors or stat2. yet, defects in a variety of genes that affect both ifn- production and responsiveness have been characterized including ifngr1, ifngr2, stat1 and il-12rb1. thus, it is interesting to speculate that mutations that affect ifn- responsiveness, while debilitating, can be tolerated; yet, mutations that cripple ifn-/ or ifn- responsiveness such as stat2 are perhaps lethal. a cascade of cytokines regulate processes of inflammation that drive both local and systemic activation of immune cells, and this process can be initiated by both pathogen sensing as well as sterile tissue injury. when discussing the role of stats in inflammation, it is perhaps more accurate to discuss their function in the context of distinct cytokine receptors, as most of the stat family members can be activated by multiple cytokines. for example, stat3 can be activated by both il-6 and il-10, yet their biological activities are diametrically opposed and counterregulatory with il-6 contributing to inflammation and il-10 blocking inflammation. while ifn-/ can induce local inflammation under certain circumstances, it does not mediate the intense forms of inflammation seen with tnf- or il-1. initially, ifn-/ was thought to act similarly to il-12 in driving th1 development through the recruitment and activation of stat4, thereby driving th1-mediated inflammation. indeed, stat2 was shown to be involved in recruiting stat4 to the human ifnar. however, our recent findings demonstrated that although stat4 is transiently activated by the human ifnar, it is not sufficient to promote th1 development. further, distinct ifn- subtypes can drive stat4 activation to the murine ifnar, which can occur in mouse cells even in the absence of stat2, yet still does not promote either th1 or tc1 development compared with the effects of il-12. nonetheless, ifn-/ may regulate some aspects of inflammation that play a more supportive rather than direct role. ifn-/ (as well as ifn-) is a potent regulator of the chemokine cxcl10 (ip-10), which recruits activated effector t and nk cells to sites of infection. thus, direct pathogen sensing by epithelial and endothelial cells can lead to recruitment of inflammatory cells via autocrine responses to ifn-/. ifn-/ also activates nk cells directly by driving lytic activity and ifn- secretion. further, recent studies by tracey and colleagues demonstrated that the ifn-/-induced kinase, pkr, regulates an alternative pathway for inflammasome activation. as a result, the induction of pkr by ifn-/ can lead to potent secretion of hmgb1 and other leaderless cytokines that are dependent upon inflammasome-mediated cleavage. although ifn-/ regulates these processes, a formal test for the direct role stat2 in driving these responses has not been performed in stat2 knockout mice. however, a recent study by gamero and colleagues demonstrated reduced skin and colonic chemokine and cytokine expression in stat2 knockout mice in two models of chemically induced carcinogenesis. these results suggest that stat2 may directly contribute to carcinogenesis by promoting expression of proinflammatory cytokines and chemokines. in summary, stat2 participates in some aspects of inflammation by autocrine responses to ifn-/ and downstream induction of inflammatory chemokines and cytokines. given the critical nature of the interferon pathway in viral defense, it is not surprising that viruses have evolved to antagonize the antiviral state induced by type i and type iii interferons. the different antagonistic mechanisms include inhibition of interferon production, interferon signaling and inhibition of interferon induced antiviral proteins. stat2 in particular is a target of many viral proteins, which in some cases determines viral host range. here we discuss the viruses that have particularly acquired the ability to subvert the interferon signaling pathway by targeting stat2 (summarized in table 1). viruses from a broad array of genera have developed unique ways to subvert the interferon response, and such examples include herpes simplex virus 2 (hsv-2), mouse cytomegalovirus (mcmv) and lymphocytic choreomeningitis virus (lcmv). however, the paramyxoviridae family of viruses contains perhaps the most replete examples of how viruses have subverted the interferon response pathway by targeting stat2. the henipavirus (nipah and hendra virus) are newly emerging zoonotic pathogens causing acute respiratory disease in both human and other animal populations. each of these viruses along with other members of the paramyxoviridae family express a v protein, which is encoded by a polycistronic gene segment (p gene) that utilizes unique overlapping reading frames. the v protein from measles, nipah and hendra viruses can bind to stat2 and prevent the interferon response via sequestration of stat2 in the cytoplasm. however, the modes of interaction of the v protein from measles mediate this interference by distinct mechanisms from that of henipahviruses. while the v proteins of these viruses contain a conserved c-terminal domain (ctd), only the measles virus requires the ctd for binding and targeting stat2 as means of interference with interferon signaling. in contrast, the nipah virus v protein can also bind stat2 in a stat1 dependent manner through distinct regions of the v protein mapping outside the boundary of the ctd. these complexes are unable to translocate to the nucleus, thus sequestering stat2 to the cytoplasm and inhibiting efficient interferon signaling. the hendravirus v protein also operates in a similar manner to nipah virus, although the distinct interaction with stats have not been mapped. in addition, the nipah virus v protein has been shown to contain a nuclear export signal (nes) that enables the v protein to shuttle between the cytoplasm and nucleus. nonetheless, binding of stat1:stat2 complexes by nipah v protein is sufficient to prevent ifn-/ signaling even in the absence of the nes. therefore viruses belonging to the same family have evolved to target stat2 using diverse mechanisms in order to evade interferon response in the host. respiratory syncytial virus (rsv) is a member of the paramyxovirus family and causes severe flu and cold like symptoms in humans, particularly in children. rsv antagonizes the interferon-signaling pathway through two virally encoded nonstructural proteins, ns1 and ns2. together, ns1/2 form a complex with stat2 and drive ubiquitin-mediated proteasomal degradation. binding of stat2 with this complex requires the c-terminus of ns2, while ns1 acts as an e3 ligase that targets stat2 for degradation. in a similar manner to rsv, the rodent pathogen sendai virus (sev) encodes a c protein that antagonizes ifn-/ signaling at all phases of the infection process by interacting with stat1 and blocking activation of stat2. finally, the human parainfluenza virus 2 (hpiv2) is an rna virus of the paramyxoviridae family that causes upper and lower respiratory infections. in human, hpiv2 blocks type i interferon signaling by selectively inducing degradation of stat2 but not stat1. the degradation of stat2 is independent of ifn-/ signaling, and like other members of this family of viruses, the v protein mediates the degradation of stat2. post-translational degradation of stat2 protein by hpiv2 v protein was blocked by proteasome inhibitors indicating a role for proteasomal degradation. in contrast, the v protein of parainfluenza virus 5 [piv5, previously known as simian virus v (sv5)], another member of the same family of viruses, preferentially induces stat1 degradation in a stat2-dependent manner in human. the c-terminal domain of this v protein is highly conserved across the members of rubulavirus genus of the paramyxoviridae family that includes both hpiv2 and piv5. although piv5 can target human stat1 via stat2, mouse stat2 does not interact with the piv5 v protein. thus, mouse stat2 restricts piv5 v protein interaction leaving the interferon response pathway intact. as such, piv5 is unable to efficiently replicate in mice due to an intact interferon response. transgenic mice expressing human stat2 restores the ability of piv5 v protein to mediated degradation of stat1. likewise, expression of human stat2 in mouse embryonic fibroblasts permits antagonism of endogenous murine ifn-/ signaling by both piv5 and hpiv2 v proteins. thus, the requirement for stat2 interaction for antagonism of interferon response limits the host range of piv5. dengue virus (denv) is another example of how host-pathogen co-evolution has become a host range-determining factor. dengue virus is a mosquito-borne rna virus that causes dengue fever, dengue hemorrhagic fever and dengue shock syndrome in humans. denv belongs to the genus flavivirus and has been shown to replicate efficiently in a variety of human immune cells including monocytes, macrophages, b cells and dendritic cells (reviewed in ref. initial studies with denv replicons expressing all of the non-structural proteins demonstrated reduced ifn- stimulated genes concomitant with a reduction in endogenous stat2 protein levels. in later studies, denv ns5 was found to directly bind to and promote ubiquitin-mediated degradation of human, but not mouse stat2. mouse stat2 expression in human cell lines restored the ifn-dependent block in virus production. ns5 interaction with human stat2 was mapped to the coiled-coil domain of human stat2 containing a species-specific sequence between residues 181301. as ns5 failed to bind mouse stat2, replacement of this region of mouse sequence with the human counterpart restored ns5 binding to the chimerized mouse molecule. in parallel studies, denv ns5 was found to specifically antagonize ifn-, but not ifn- signaling by binding to and inhibiting stat2 phosphorylation. recently, schoggins et al. have demonstrated that overexpression of stat2 in stat1-deficient fibroblast can limit denv replication without any significant isg expression. collectively these studies demonstrate that denv is able to establish infection in human due to its ability to surmount human antiviral response via stat2 degradation and blocking phosphorylation that may be circumvented in humans through augmented stat2 expression. however, murine stat2 has evolved to disengage this mechanism of stat2 antagonism by denv and thus restricting denv host range to humans. given the central role of stat2 in the induction of isgs, it is perhaps surprising that only a restricted subset of viruses have adapted their mechanism of innate subversion to target stat2. for some viruses, stat2 determines the host range across species, and this is particularly evident with dengue virus, discussed above. however, closer examination of the stat2 gene and protein product reveals some important insights into how viruses shape the evolution of their hosts. in this section, we will explore how stat2 has emerged as a highly divergent member of the stat family while retaining its ability to exclusively regulate the interferon response in each species. the stat family can be traced as far back to rudimentary stat-like genes that exist in slime molds (d. discoideum), thus suggesting that the current members that exist in mammals (stats 1, 2, 3, 4 5a, 5b and 6) arose from a common ancestral gene through duplication. in mammals, the seven stat family members are located as clusters in 3 genomic locations: in humans, stats 1 and 4 on chr. 17 and stats 2 and 6 on chr. 12. considering their syntenic arrangement across species, how conserved are the various stat members in mammals? within the ensemble database, there are seven species, including human, for which the full-length sequences are available for six of the seven stat family members. an alignment of these sequences reveals remarkable similarity (> 95% for most pair-wise comparisons) for each of the stat genes except stat2 (fig. 1). stat3 is the most highly conserved member, retaining>98% sequence similarity comparing human with both mouse and rat. however, human stat2, while being relatively well conserved with macaque and chimpanzee, diverges significantly when paired with mouse, rat, horse and elephant. a phylogenetic analysis further reveals the degree to which stat2 has diverged even within the non-human primate species when compared with the human counterpart (fig. 2). moreover, stat2 s dimerization partner stat1 displays roughly 5-fold greater sequence similarity than stat2 within primates (based on sequence identity within the phylogenetic analysis in fig. the full length protein sequences of stats 1, 2, 3, 4, 5a and 6 were aligned against the human sequence for each of the species shown in the radar plot. the clustal alignment algorithm within macvector was used for the alignment, and the percent sequence similarity to human in pair-wise comparisons is plotted in the graph. the full length sequences of stat1 and stat2 for each species shown were aligned with the clustal algorithm within macvector. phylogenetic analysis was performed with this alignment, and the scale indicates the absolute numbers of sequence differences across the length of the dendrogram. within each stat family member, the sh2 domain is the most highly conserved segment of the gene across species, and stat2 is no exception to this (fig. however, just beyond the sh2 domain, the c-terminal transactivation domain of stat2 diverges so significantly that only small segments of conservation are retained at the distal end of the protein. most striking is the disruption of the structure and insertion of a mini-satellite segment within the c-terminus of mouse stat2 that contains a repetitive element papqvlle. this element has no significant similarity to any other protein in the database, and mouse is the only species that harbors this sequence. the sequences of stat2 from the indicated species were aligned beginning with residue 651 of human stat2. the sh2 and c-terminus of stat2 is indicated along with the conserved tyrosine residue (y690), which is phosphorylated in responses to ifn-/ signaling. the divergence in stat2 was first appreciated when mouse stat2 was cloned and sequenced over 12 years ago. at that time, it was known that stat2 interacted with other transcription factors to regulate expression of various isgs, and one of those factors was cbp. demonstrated that while the c-terminus of mouse was significantly different than human, cbp could still interact with the c-terminus of both mouse and human stat2 and functionally cooperate to regulate transcription. in addition, stat2 was also found to be required for recruitment of stat4 to the human, but not mouse ifnar. further, the human stat2 c-terminus was found to be required for this recruitment in human cells, and the significant divergence in this region partially explained the difference in signaling between the two species. however, the interaction was perhaps indirect as replacement of the mouse c-terminus with the human counterpart via knock-in failed to restore significant ifn-/-dependent stat4 activation in mouse t cells. nonetheless, these animals still responded normally to ifn-/ by activating isgf3 and by driving the expression of isgs. these types of domain-swapping experiments reveal some very interesting aspects of stat2 biology. despite drastic differences within the c-terminus, this domain still maintains a physical interaction with cbp and perhaps many other transcription factors whose evolution has remained relatively constant compared with stat2. indeed, the c-terminus of stat2 is relatively unstructured compared with other domains within the protein. however, when bound to the transcriptional activator zinc binding (taz) domain of cbp, the human stat2 c-terminus undergoes dynamic folding to create a stable tertiary structure, thereby stabilizing its bound conformation to the taz domain. unfortunately, the structure of the c-terminus from other species such as mouse with the cbp taz domain has not been solved. nonetheless, stat2 displays remarkable plasticity in both its proximal receptor activation and downstream gene transactivation capabilities regardless of the remarkable structural differences that exist, particularly within the c-terminus. thus, even though stat2 has diverged at a much greater rate than other stat family members, the interactions that stat2 must maintain to mediate its function are still preserved and presumably contain enough inherent flexibility to accommodate large changes in stat2 s structure. considering the central role that stat2 plays in regulating the intracellular anti-viral response, it represents an important target for viral interference. while speculative, it is likely that lethal pandemic viruses drive stat2 evolution, in some cases, by targeting stat2 directly. perhaps the unique haplotypes that have been identified in stat2 among east asians and shared with neanderthal point to recent selection events in human evolution. regardless, the survival of each species, including humans, to viral assaults thus depends upon the flexibility of stat2 to maintain distinct physical interactions, which preserve its function in driving the interferon response.

stat2 is unique among the stat family of transcription factors in that its activation is driven predominantly by only two classes of cell surface receptors: type i and iii interferon receptors. as such, stat2 plays a critical role in host defenses against viral infections. viruses have evolved to target stat2 by either inhibiting its expression, blocking its activity, or by targeting it for degradation. consequently, these viral onslaughts have driven remarkable divergence in the stat2 gene across species that is not observed in other stat family members. thus, the evolution of stat2 may preserve its activity and protect each species in the face of an ever-changing viral community.

PMC3670274

pubmed-226

for patients with operable breast cancer, the major prognostic determinant is whether there has or has not been spread to the axilla and the number of involved axillary nodes. initially it was suggested that breast cancer first spreads locoregionally via lymphatics to the axillary lymph nodes and then metastasises more distantly. in accordance with this concept, subsequently fisher postulated that the extent of micrometastases at diagnosis of breast cancer is an indicator of outcome, with biological behaviour of cancer predetermining the likelihood of progression of the disease. nowadays gene expression profiling arrays can delineate tumour types with different prognoses. the surgical approach for breast cancer treatment evolved from the extensive radical mastectomy and the patey modified radical mastectomy to breast conserving and minimally invasive techniques. traditionally the surgical management of breast cancer comprised wide local resection of the primary tumour and axillary lymph node dissection (alnd). axillary status is the most important prognostic factor in breast cancer providing staging information and therefore largely defining treatment strategy. diagnostic imaging modalities such as ultrasound, magnetic resonance mammography, positron emission tomography, and 99 m technetium (tc) sestamibi scintimammography are not reliable for staging the axilla, particularly with lymph node metastases<0.5 cm [8, 9]. clinically palpable lymph nodes prove to be false positive in 2530% of patients and about 40% have positive results after ultrasound with or without fine-needle aspiration node negativity. studying 24,740 women with invasive breast cancer, carter et al. showed that approximately 80% with tumour size<1 cm, 50% with up to 5 cm, and 30% with>5% had negative axilla, a fact suggesting that metastases do not occur exclusively via the axillary lymph nodes, but rather lymph node status serves as an indicator of the tumour's ability to spread. additionally, it has been recently shown that the molecular profile of the primary tumour is a more significant prognostic indicator in terms of disease-free survival (dfs) and overall survival (os) than lymph node metastases. the combination of the introduction of population-based mammographic screening for breast cancer, modern imaging methods, and increased public awareness resulted in patients being diagnosed more often with smaller-size tumours and less likelihood of axillary lymph node metastases. it is evident now that 6070% of patients with early breast cancer are node negative at the time of diagnosis and alnd puts them at significant risk of short- and long-term morbidities without benefit. alnd is associated with acute complication rates of 2030% including seroma formation, local swelling, numbness, impaired shoulder movement, neuropathy, infection, and chronic lymphoedema rates of 737%. in a prospective study by petrek et al. evaluating a cohort of 923 women with 20 years follow up, it was shown that breast-cancer-related lymphoedema following alnd occurred maximally in the first 3 years following surgery; however, up to 23% of patients may still develop arm swelling during the rest of their lives. several randomised studies have established that sentinel node biopsy (snb) is a safe and accurate procedure for detecting tumour cells in sln and predicting the status of the other axillary nodes (non-sln). although accuracy and appropriateness of snb were disputed by the finding of 510% false-negative cases when snb was followed by axillary dissection at high-risk patients for axillary nodal disease [13, 18], false-negative snb results seem to have decreased with the increasing experience of surgeons, and it is expected that the utilisation of snb in the future will be increased. a meta-analysis of seven prospective randomised controlled trials by kell et al. demonstrated that snb is equivalent to alnd for the detection of lymph node metastasis with the additional advantage of reduction of up to 75% in morbidity in patients with early stage breast cancer. furthermore, a trend towards an improved detection of ln metastases was shown when snb is used. patients undergoing snb have a 22% higher odds ratio of having a positive sln, due to the more intensive pathological examination which utilises multiple sections and immunohistochemistry (ihc). in contrast, the false-negative cases seen after axillary dissection are probably due to the inability of the pathologist to perform serial sections and ihc on the 2030 lymph nodes found in a complete axillary clearance specimen. studies have shown that sln is the only positive lymph node in 3867% of patients when alnc followed. interestingly, it has been reported that only 48% of patients with negative alns have internal mammary lymph node involvement (imn) whereas 2550% of patients with affected alns have also imn metastases [23, 24]. dissection of imn is not recommended because of the high morbidity and the uncertain benefit on survival. the recently published outcomes of nsabp b-32 trial established the efficacy of sln biopsy alone with no further alnd in 5611 breast cancer patients with clinically negative lymph nodes. women with invasive breast cancer who were randomly assigned to either sln resection plus alnd (group 1) or to sln resection alone with alnd only if the slns were positive (group 2), after 8 years of followup, showed statistically equivalent overall survival, disease-free survival, and regional control. patient followup is still continuing for longer-term assessment of survival and regional control. moreover, a closer look into mature studies focused on axillary relapses and overall survival is in agreement with current findings favouring slb. the national surgical adjuvant breast and bowel project (nsabp) b04 randomised study compared breast cancer patients with clinically negative alns managed either by radical mastectomy, total mastectomy with axillary radiation, or total mastectomy alone. the results clearly defined that alnd decreases the risk of locoregional relaps; however, no significant differences in survival were found among the treatment groups. this study has been criticised because of the variability of numbers of lymph nodes resected in the total mastectomy alone arm and the lack of statistical power to detect a small difference in outcome. indeed, a meta-analysis has suggested that inadequate axillary treatment may lead to not only an increased risk of local relapse but also a 5% reduction in survival. as a result of increasing detection of early breast cancer and the high rate of micrometastases and itcs (itcs) found in the detailed pathological examination of sln, a new debate has opened about the consequent necessity of alnd in these patients. this has arisen because of better understanding of breast cancer behaviour and improved efficacy of combined therapeutic modalities. in this paper we report the current guidelines concerning the management of the axilla after slnb and review the different aspects arising from recent studies on the role of micrometastases and itc clusters in sln on decision making. the american society of clinical oncology (asco) expert panel conducted a systematic review of the literature available through february 2004 on the use of snb in early-stage breast cancer in order to develop guidelines for the management of the axilla (http://jop.ascopubs.org/content/1/4/134), and these are similar to those of the national institute of health and clinical excellence (nice) recommendations in uk (http://www.nice.org.uk/nicemedia/live/12132/43413/43413.pdf). alnd is the standard of care in those with a macrometastatic or micrometastatic positive sln to maximise local control. if the sln is negative, a calnd (calnd) is not necessary. itcs detected by ihc are of unknown clinical significance, and when identified, the sln is regarded as negative and no further alnd is required. although ihc is often used, it is not included in routine sln evaluation for breast cancer at this time. asco and nice recommendations for slnb, alnd alone and managing of the axilla after slnb are summarised in table 1. in contrast the german guidelines do not recommend axillary clearance for 1-2 sln positive in patients with t1 and t2 tumours (http://www.ago-online.de). it has been suggested that slnb should be carried out by an experienced team in order to minimise false negativity and improve the predictive value of the procedure. the american joint committee on cancer (ajcc) in the sixth edition of the cancer staging manual defined a lymph node metastatic tumour with maximum diameter >2 mm as macrometastasis (pn1), when the diameter of deposit is 0.22 mm as micrometastasis (pnmi), and a lesion of single tumour cells or small cell clusters with diameter<0.2 mm as itcs [pn0(i+)]. itcs are not distinguishable by h&e staining but detected only with immunohistochemistry (ihc) or molecular methods. moore et al. suggested that the presence of itcs was unrelated to known prognostic variables and partly the result of instrumentation and manipulation of the tumour. the management of patients with minimal sln involvement is problematic. in a meta-analysis of 25 studies of patients with sln micrometastases, in approximately 20% there was nonsentinel node disease falling to 9% when the sln involvement was detected by ihc. furthermore, the consequent effect on dfs and os remains controversial, so the biological relevance and clinical significance is a matter of debate. amaros investigates the benefit of a calnd in comparison to treatment with axillary radiotherapy (art) in patients with sln-positive breast cancer. a recently published substudy evaluated the identification rate and the nodal involvement of the first 2,000 patients between 2001 and 2005 who entered from 26 european institutions. the sentinel node identification rate was 97% which is high considering the relatively early days of this procedure. 34% were sln positive of whom 63% had macrometastases, 25% had micrometastases, and 12% had itcs. in the calnd arm non-sln involvement was identified in 41% of patients with macrometastases and in 18% of patients with either micrometastases or itcs. several studies have investigated the significance of occult metastases, such as micrometastases or small clusters of tumour cells in association with non-sln involvement and the impact of calnd on disease-free survival and overall survival, and the larger ones are summarised in table 2 [3743]. although the majority show no prognostic impact of itcs in the sentinel node, a large dutch investigation with 5-year followup indicated that women with itcs who received adjuvant chemotherapy had a significantly better event-free survival compared with untreated cases with itcs. furthermore, a finnish study showed a worse 5-year breast-cancer-specific survival for those with itc compared with node negative cases. in the largest published multicenter retrospective study of 187 sln-itcs patients undergoing calnd, houvenaeghel et al. reported an incidence of 16% non-sln involvement. the difference in the risk of non-sln involvement between sentinel nodes with itcs (16%) and those with micrometastases (14%) was not statistically significant. however it was not apparent whether the presence of non-sln metastases should affect the therapeutic decision in these patients. the authors proposed that calnd could be avoided in patients with tubular, colloid, or medullary small primary tumours (pt1) with a risk of non-sln involvement approximately 5%. mirror is a large dutch cohort retrospective study which assesses the impact of sln-itcs and micrometastases on 5-year disease-free survival in patients with favourable primary tumour characteristics. according to recent published data, both patients with snb micrometastases and those with itcs who did not undergo calnd experienced a far higher 5-year axillary recurrence rate, 6% in comparison to 1% of snb-negative patients who did not undergo calnd. additionally, both patients with sln micrometastases and itcs had approximately 5-year disease-free survival improved by 10% with adjuvant systemic therapy. mirror findings support an aggressive treatment approach in patients with either sln micrometastases or itcs. many investigators have studied the incidence of non-sln involvement in patients with sln micrometastases to define which patients may need further axillary treatment. wada and imoto. collected 22 studies from 1999 until 2006 referring to the frequency of sln micrometastases in patients with breast cancer and the prevalence of non-sln involvement in those patients after alnd. the frequency of sln micrometastases was 38% with non-sln micrometastases ranging from 0 to 57%. additionally, a wide range of non-sln macrometastases was found (018%). because the prevalence of non-sln micrometastases was low, the prognostic impact was unclear. the wide range of results arose from the different numbers of patients involved, variations in number of pathological sections examined, and differences in tumour stage and grade. results of studies in which patients with micrometastases in snb and who were not treated by completion axillary node clearance are summarised in table 3 [38, 4854]. most of the studies had small numbers and relatively short followup and tended to conclude that there was no benefit from completion axillary node clearance. the largest study; however, found a significantly worse disease-free survival for women with micrometastases who did not undergo calnd.. de boer et al. conducted a systematic review of 58 studies conducted from 1977 to 2008 included 297,533 patients, aiming to define the prognostic relevance of micrometastases and itcs in patients with breast cancer. using random-effect meta-analysis they showed that the presence of aln metastases<2 mm in diameter detected on single-section examination was associated with poorer overall survival. moreover the presence of occult metastases on retrospective examination of aln-negative patients by step sectioning and/or immunohistochemistry (n=7740 patients) was associated with poorer 5-year disease-free and overall survival. outcomes from sentinel lymph node biopsy studies were not assessable due to small patient groups and short followup. the international breast cancer study group trial ibcsg-23-01 is a randomised multicentre study designed to determine the significance of minimal ln metastasis in patients with breast cancer. the trial was initiated in april 2001, and it compares survival between patients with sln micrometastases who undergo slnb alone with those who receive calnd. it is known that the extent of macrometastases in sln is strongly correlated with non-sln involvement. the long-term effect of the residual axillary disease in the sentinel-lymph-node-positive patient on local and systemic recurrence has not been clearly defined for patients receiving modern radiotherapy and chemotherapy. older studies of patients with symptomatic breast cancers have shown that inadequate axillary surgery does lead to reduced overall survival [5760]. the study set out to randomise 1900 women with breast cancer and 15 involved snln to either calnd or observation. all had a lumpectomy and tangential breast irradiation, but systemic therapy was at the discretion of the treating centre. after a median followup of 6.3 years, the relapse-free survival for the alnd group was 82% compared with 84% for the observation group, and the overall survival was 92% in both groups. unfortunately the trial stopped accrual after 891 cases had been entered which makes it underpowered to detect a 5% difference in outcome. an additional aspect to be considered is that the guy's wide excision studies showed no difference between the wide excision group and the radical mastectomy group at 10 years whereas after 25 years there was a significantly worse relapse-free and overall survival in the wide excision group with inadequately treated axillae. in a retrospective study, takei et al. confirmed the importance of calnd in sln-positive patients with high nuclear grade and hormone-negative breast cancer. it was noticed that of 459 patients with macrometastatic disease treated with calnd, after a median follow-up period of 34 months, the axillary recurrence rate was only 0.6%. bilimoria et al. studied a cohort of 403,167 patients with clinically node-negative breast cancer that underwent slnb from the us national cancer data base (19982005). of the 97,314 (24%) patients identified with nodal metastases, 28% had no further surgical intervention in the axilla and 72% underwent calnd. after a median followup of 63 months, it was found that in all patients and separately in those with macroscopic and microscopic nodal disease, the unadjusted axillary recurrence rate and overall survival were comparable. after adjustment for clinicopathological differences, there was a trend towards a lower risk of axillary recurrence and death in patients with macroscopic nodal involvement undergoing calnd. for those with micrometastases, recurrence rates were similar in those undergoing either slnb alone or calnd. of 26,986 patients with slnb-positive breast cancer from the seer database (surveillance, epidemiology, and end results), 16% had no further axillary treatment and 84% had calnd. after a median followup of 50 months, although a higher rate of ipsilateral regional recurrence was noticed in patients who underwent slnb alone, no statistically significant differences in overall survival (os) between patients who underwent slnb alone versus complete alnd were found. the investigators suggested that in patients with small, low-grade primary tumours, positive er status, older age and who have received segmental mastectomy, calnd may be omitted. hwang et al. reviewed the outcome of 3,366 patients with invasive breast cancer who underwent slnb from 1993 to 2005. of 750 sln-positive patients, 65%, 45.9%, and 34.2% were pn1, pn1mi, and pn0 (i+), respectively. of these patients, 196 had no further axillary surgery due to clinician and patient preference. according to clinicopathological variables, adjuvant treatment was applied and locoregional and distant recurrence and survival were studied. after a median followup of 29.5 months, no patient had an axillary recurrence, one had supraclavicular lymph node recurrence, and three patients developed metastatic disease to the lung or bone. the median time to recurrence was 32 months. notably the patients with distant metastases had t3 grade iii invasive carcinoma. despite the low axillary recurrence rate, authors suggested that it is not possible from these results to conclude definitively that calnd should be abandoned for these patients. several factors correlated with the likelihood of additional non-sln metastasis have been investigated in an effort to distinguish which patients could avoid extensive axillary surgery. characteristics of the primary tumour, such as size [40, 66], grade, hormone receptor and her2 profile, tumour type, multifocality, mean proliferative fraction, and lymphovascular invasion [68, 69], have all been studied. additional features of the involved slns, such as size of metastases, number of positive slns, ratio of positive to resected slns, and the extracapsular spread have been also examined [21, 61, 7072]. particularly patients with minimal sln metastases are at a significantly lower risk to have further non-sln invasion than those with sln macrometastases (1324% versus 4579%). however, none of these characteristics individually can determine a subset of patients for whom alnd is unnecessary. molecular profiling of metastatic foci different from the primary tumour could be used as indicator for the selection of patients who might benefit of completion axillary dissection. the most important prognostic factors for the presence of non-sln metastases in patients with minimal sln involvement are presented in table 4. several mathematical models have been developed to predict the risk of non-sln involvement in patients with sln-positive breast cancer. these include four nomograms: the memorial sloan-kettering cancer center (mskcc), (https://www.mskcc.org/mskcc/html/15938.cfm), mayo (https://www.mayoclinic.org/breast-cancer/sentinelbiopsy.html), cambridge, and stanford (https://www3-hrpdcc.stanford.edu/nsln-calculator/). there are three scoring systems, the tenon, mda, and saidi, and two recursive partitioning (rp) tools developed by kohrt et al.. the institut curie studied 588 consecutive patients with positive slns who underwent alnd to compare the actual rate of non-sln metastases with those predicted by breast cancer nomogram of memorial sloan-kettering cancer center (mskcc). while the predicted rate in non-sln macrometastases was relatively accurate, when the nomogram was applied to the 213 slns that contained only micrometastases, the predicted rate 59% was far away from the actual rate 44% of non-sln micrometastases detected by ihc. consequently, the authors concluded that a different predictive model should be created for patients with micrometastases. molecular tests based on technology such as oncotype dx (genomic health, redwood city, calif, usa) or other multigene arrays developed prognostic and predictive markers aiming to personalize surgical and adjuvant treatment of early breast cancer. an accurate, intraoperative sentinel lymph node test probably could help in avoidance of delayed axillary dissections. molecular tests may be proved more sensitive than current intraoperative tests but have not yet been validated. osna is an automated assay for the detection of cytokeratin message, ck19 mrna, present in approximately 98% of breast cancers. it provides an opportunity to make an intraoperative diagnosis of sentinel node involvement within 30 minutes, avoiding frozen section and allowing a one-stage procedure. larger verification studies in which half of the bisected sentinel node was sent for histology and the other half homogenised for osna are shown in table 5 [71, 72, 7981]. the usual reason for discordance between histopathology and osna was an uneven distribution of nodal metastases (tissue allocation bias). the studies indicate a good concordance between results of histopathology and osna. indeed in a study conducted by osaka, comparing osna with frozen section, it is likely that in time osna will replace histopathological examination of sentinel lymph nodes because of its ease, accuracy, and potential for enabling almost all patients to have a one-stage operation for early breast cancer. recent studies aiming to determine if calnd is beneficial in patients with sln-positive breast cancer and even more in patients with minimal sln involvement have reached contrary conclusions. limitations in the published studies include the methods of pathological evaluation of lymph nodes and that the number of additional non-sln-positive nodes is usually not known thus lymph node step sectioning and ihc lead to increased identification of minimal metastases upstaging 9% to 25% of patients who initially were considered node negative [83, 84] and did not have further axillary surgery. the different rates of recurrence may be due to the molecular type of cancers and so that patients with sln metastases may also have different risks of metastatic involvement. finally it is possible that not all minor tumour foci in axillary lymph nodes progress to local recurrences. according to al-hajj et al., only a minority of cancer cells potentially give metastases and most itcs are not viable and do not have the ability to form new tumours. there may be two different breast cancer cell populations, true stem cells that have the capacity to develop metastases and the nonstem cells that never grow and are finally destroyed. at the level of everyday clinical practice, with both promising and disappointing results of the published studies, most breast surgeons will hardly ever take the risk of avoiding completion axillary dissection in breast cancer patients even with minimal sentinel lymph node metastases. many are seeking to find a balance between the needs of the majority to have minimal axillary surgery with minimal postoperative morbidity against the possibility that a minority will suffer relapse, morbidity, and possible increased mortality from undertreatment. results from ongoing phase iii trials will perhaps provide new guidelines for the treatment of patients with micrometastases or itcs. a predictive model which estimates accurately the likelihood of additional disease in the axilla might help tailor surgical therapy to the needs of the individual patient and identify those most likely to benefit from completion or alnd. genetic assays defining prognostic markers and new intraoperative tests detecting accurately sln involvement will help in early therapeutic decision making in the future. it is important that premature decisions to restrict axillary surgery are not made on a basis of early results from underpowered clinical trials.

sentinel lymph node biopsy (slnb) is a safe and accurate minimally invasive method for detecting axillary lymph node (aln) involvement in the clinically negative axilla thereby reducing morbidity in patients who avoid unnecessary axillary lymph node dissection (alnd). although current guidelines recommend completion alnd when macro- and micrometastatic diseases are identified by slnb, the benefit of this surgical intervention is under debate. additionally, the management of the axilla in the presence of isolated tumour cells (itcs) in slnb is questioned. particularly controversial is the prognostic significance of minimal slnb metastasis in relation to local recurrence and overall survival. preliminary results of the recently published z0011 trial suggest similar outcomes after snb or alnd when the sn is positive, but this finding has to be interpreted with caution.

PMC3262558

pubmed-227

labor wellbeing refers to all efforts of employers, trade unions, voluntary organizations, and governmental agencies, which help employees feel better and perform (work) better. it is a comprehensive term that refers to the physical, mental, moral, and emotional wellbeing of an individual including intra and extra mural facilities. although wellbeing includes a wide range of programs and services in organizations, the focus of this study is on the employee assistance programs and employee group services, which are provided by employers according to the real needs of the employees. hence, it is necessary for organizations to identify the real needs, as a base to provide a wellbeing package for their employees through wellbeing need assessment techniques. wellbeing need assessment is a systematic process of gathering information to determine and address the needs or gaps between the current conditions and the desired conditions. a need can be a desire to improve the current performance or to correct a deficiency. the wellbeing needs assessment includes two main targets; exploring the effectiveness of the delivered services and exploring those wellbeing needs that are not fulfilled by an organization. davis and gibson emphasize on the importance of a comprehensive wellbeing needs assessment, both for obtaining the required information needed to design the appropriate interventions and also for providing the basic required information to evaluate the effectiveness of the wellbeing program. wellbeing assessments are vital for the determination of the economic and social needs of employees and for the best decisions to be taken in response to such needs. reviewing the human resources management literature showed an absence of attention given to the employee's benefits. moreover, various expectations of employees in the field of wellbeing services caused organizations, especially the human resources (hr) offices, to face many challenges (chen et al.). therefore, for keeping employees satisfied with the wellbeing services, all challenges had to be truly and effectively met (hyde et al.). research indicated that satisfaction of the employees was not positively correlated with the benefits of the welfare package (e.g. dreher, ash, and bretz). dencker, joshi, and martocchio argued that individual differences in benefit preferences emerged from particular employment relationships, with individuals having greater experience. the tehran university of medical sciences (tums), including 69 research centers, 25 hospitals, 11 educational and health care centers, three health networks, and 10 faculties with more than 2020 faculty members and 19,000 students (tums 2012), requires an improved comprehensive system for delivering the wellbeing services (financial, insurance, healthcare services, educational and training services, etc.). taking a look at the functions of the university's wellbeing services system; it uncovers a gap between the employees real needs and what is delivered to meet their needs. it is because of the lack of a participatory strategic wellbeing delivery plan that is based on prioritized wellbeing needs (requirements). as the first step to make a strategic plan is identifying the needs, the main purpose of this study is to assess the wellbeing services of the staff working in tums first to see if they are satisfactory enough or they need to be changed, and second, to help decision-makers develop services that are essential to improve the well-being of employees, as also the quality and effectiveness of the tums's wellbeing delivery system. what are the services used and to what extent they have been satisfactory? this question aims to explore the reasons why they are not delivered. the second question is, what type of services are essential to be provided by the university? with respect to the main purpose of this research, the wellbeing delivery system of tums is assessed with a thorough answering of the questions mentioned above. the research design was a cross-sectional survey (2008-2009) using a structured non-disguised questionnaire. the sample size was 98 with a 95% level of confidence and absolute error of 0/01. cluster sampling based on the occupational scope as the main variable, was used as the sampling method, with regard to the existence of different occupational scopes. data was collected from 98 officers working at different departments of central organizations of tums (tehran university of medical sciences) including logistics, education, research and technology, student and cultural affairs departments. the research participants were assured of the confidentiality of their personal information at the beginning of the questionnaire. the questionnaire included 45 questions (43 close-ended questions and 2 open-ended questions1) organized into two separate parts (cranach alpha=0.85): according to table 1, within the first part, the respondents were supposed to mark the wellbeing services if they had ever used any of them. those who used the services were supposed to show their level of satisfaction by choosing from almost satisfied, almost dissatisfied, and full dissatisfied, and those who had never used the services, were supposed to express their reasons by choosing from poor announcement, unwillingness to receive the service, undesirability of the service, and undesirability of the receiving process of the service. main parts and the main purpose of asking questions for each part in the second part, the respondents were provided with a list of not delivered wellbeing services to choose which of them is essential, neither essential nor non-essential or non-essential. for making sure if the questionnaire was valid content-wise, first a comprehensive collection of wellbeing services delivered both in tums and in other organizations was identified according to the comprehensive definition of wellbeing services. next, according to the main purpose of the research, they were put into classified groups to form the research tool. furthermore, to make sure about the appropriateness and transparency of each question and also the whole tool, in addition to its comprehensiveness, the questionnaire was sent to five professionals and experts in the relevant field. the reliability of the questionnaire was determined after thoroughly calculating the cronbach alpha, which was reported to be around 0.85. subsequently, after improving and clarifying the instrument, the participants of sample group were asked to fill in the questionnaire. the data was gathered by means of filled questionnaires, and were analyzed with the excel software and spss, by calculating the frequency rate of the staff that used the welfare services and those who did not use the services. in addition, the t-test was used to calculate the satisfaction score for each service used by the staff. among all the 98 respondents, almost 46 employees with a mean satisfactory score of 48.46 used the existing services, for which the satisfactory rate was distributed as shown in table 2. satisfactory scores of categorized wellbeing services the result shows that financial services, including loans for buying a car, emergency loan, loan for buying commodities, awards for staffs children, and two other kinds of non-profit loans in comparison with other categories is considered as the most satisfactory service (average t=61.83). among respondents who did not use the categorized services (52 persons on an average), as shown in the table 3, the most frequents reasons for not receiving services was, staff's unwillingness to receive the service (38.75 in average) and poor announcement (unawareness on the wellbeing services) (37.6 in average). frequency rate of reasons for not receiving welfare services table 4 presents the frequency of wellbeing services and necessity (delivered by other public/private organizations), which were asked to be judged by respondents (to be added or replaced by the delivered wellbeing services list), as follows: frequency distribution of wellbeing services necessity educational subvention for children of the staff, who were under their patronage is the only non-financial service, with the highest frequency (92.85), identified as the most necessary wellbeing service among all. among other services that were mentioned by respondents (61 persons of the sample group), the provision of discount cards for using other organizations services (frequency=12), providing employees with free health care services (frequency=7), and contracting with adult higher education institutions (frequency=6) had the most frequency among other items. as mentioned, the objectives of the study were to measure the staff's satisfaction with the wellbeing services received, identify the reasons for not receiving the existing wellbeing services, identify the wellbeing services that were not delivered, but were essential as per the staff, and then ask the staff about other wellbeing services that were possible to be delivered and sort them according to their priority. with regard to the first purpose, the results showed that almost half of the respondents used the wellbeing services provided by the wellbeing office of the university, among which almost half of them were satisfied with the services. the results suggested that not only were most of the staff not interested in using the provided services, but also more than half of those respondents who used them were not really happy. with regard to the second purpose, the results showed that among those who did not use the services, most of them decided not to use it by themselves. this was recommended to be surveyed in a separate study in the future. as was evident, it can be concluded that the functional desirability of the wellbeing service delivery system of tums was not evaluated as satisfactory enough, because of the almost high dissatisfaction level of services that were used. with regard to the third purpose, the results indicated a big gap between the required wellbeing services (by employees) and what was provided by the office, as almost all the respondents agreed with the necessity of services such as health, education, and safety. the existing gap can result from lack of managerial attention to differences in the demographical characteristics and expectations of employees. consistent with the arguments of boudreau and ramstad, dencker et al. argued that market segmentation of employees (offering market segments have different benefits) may strengthen the benefits return-on-investment. one of the most significant reasons for the dissatisfaction and unwillingness of employees to use the services refers to the different priorities and type of services they prefer to include, according to their individual differences. need assessment as a useful technique can help planners to pay more attention to employee's priority differences in wellbeing services and what they really need to include, by designing the appropriate interventions, as davis and gibson emphasized. considering the employees as the most important organizational stakeholders makes them to participate in the wellbeing decision-making process, such as, asking them to add what services they prefer to be included within the wellbeing package. although the wellbeing service delivery system of tums has not been effective enough to meet the real needs of the staff by delivering the appropriate services, the most prioritized service type preference of most respondents can be identified. as in the first place the satisfactory score of educational and training services among those who used them was rather high, and second, the most necessary identified services were related to educational services, and of course, among the identified wellbeing service priorities, provision of educational opportunity was one of the preferences with high frequency, therefore, it was clear that educational and training opportunities were important for a majority of the respondents. the findings show that the functional desirability of tums wellbeing services is not satisfactory enough by the staff's view point. the following conclusions can be drawn from the present study; the first major finding is the existence of a big gap between the required wellbeing services (by employees) and what is provided by the wellbeing office of tums. the second and the most obvious finding of this study is the importance of the educational and training opportunities from the point of view of the staff, which has not been paid attention to by the wellbeing service provider in tums. although we tried to assess the overall quality and functional desirability of the wellbeing service delivery system of tums, some further studies are required in the researcher's view. it is recommended that the factors that cause dissatisfaction and unwillingness to use services in employees be identified, and also the real needs and wellbeing requirements (based on employees preferences, job categories, genders, age, and other considerable individual and social factors) as a strategic basis for redesigning the current wellbeing service delivery system that appears not to be desirable enough in the employees view, be determined.

background: reviewing the human resources management literature shows an absence of attention given to the employee's benefits. taking a look at functions of the tehran university of medical sciences wellbeing services system, it uncovers a gap between employees real needs and what is delivered to meet their needs. so it requires an improved comprehensive system for delivering wellbeing services (financial, insurance, health care services, educational and training services, etc). wellbeing need assessment can helps planners to identify vital needs of employee and response to them effectively. moreover it can be used to evaluate the effectiveness of the current services which are delivered. thus, the aim of this study is to assess wellbeing services of staffs working in tums to (1) evaluate the satisfactory rate of services which are delivered, and (2) exploring those wellbeing needs which were not fulfilled by the organization. material and methods: being a cross-sectional and analytic-descriptive survey including 98 responding participants, it is conducted by a questionnaire collecting employees demographic information, their satisfactory rate of the implemented services, and determines unfulfilled wellbeing needs which were not already covered. result:results indicated that services related to financial, educational, non-financial, insurance, occupational health and tourism/recreational services were the most satisfactory services successively. staff's unwillingness to receive services and poor announcement (unawareness on the wellbeing services), were found to be the most frequent reasons for not receiving the existing wellbeing services. conclusion:to increase the satisfaction rate and responsiveness to the real needs of the staff, the current delivery system of wellbeing services in the tums should be redesigned by defining new wellbeing packages.

PMC4355841

pubmed-228

a biloma is a rare abnormal accumulation of intrahepatic or extrahepatic bile caused by traumatic or spontaneous rupture of the biliary tree1, 2). it is most commonly caused by surgery, percutaneous transhepatic cholangiography (ptc), percutaneous transhepatic biliary drainage (ptbd), and abdominal trauma11, 12). we report here a patient who complained of chills, fever and right upper quadrant abdominal discomfort. a 78-year-old woman presented to the emergency room with her guardian, with acute fever and chills that developed the day before admission. the patient was diagnosed with diabetes a few years previously, but this was not being treated. on admission to the emergency room, the vital signs were as follows: blood pressure 70/40 mmhg, heart rate 118/min, respiratory rate 30/min and temperature 40.3. the patient appeared to be in acute distress; she was lethargic, the sclerae were slightly yellow and the conjunctivae were pale. the abdominal examination revealed slight tenderness in the right upper quadrant, but there was no palpable mass. the laboratory studies were as follows: wbc 52,400/mm, hb 12.3 g/dl, platelets 90,000/mm, ast 153 iu/l, alt 135 iu/l, alkaline phosphatase 255 iu/l, total bilirubin 2.07 mg/dl, total protein 5.9 g/dl, albumin 3.0 g/dl, bun/cr 25/1.9 mg/dl, esr 25 mm/hr, and crp 20.4 mg/dl. the serum electrolyte levels were normal except for an elevated potassium 7.0 mmol/l. the abga data were as follows: ph 7.24, pao271 mmhg, paco2 19 mmhg, hco3 15.1 the hepatitis viral marker tests, including hbsag, anti-hbs ab and anti-hcv, were all negative. standard x-rays on the day of admission revealed lung infiltrates and no specific findings in the abdomen. the abdominal computed tomography (ct) revealed a 9.58.5 cm subcapsular cyst with a clear boundary in the left hepatic lobe and enlargement of the intrahepatic bile duct around the cyst. although the left hepatic lobe had some atrophic findings, there were no significant signs of an enlarged bile duct or abnormal gallbladder (figure 1). on the day of admission after the computed tomography, the abga revealed a ph 7.05, pco2 64.8 mmhg, po2 73.3 mmhg, hco3 the patient was intubated and put on a respirator; she was treated with antibiotics and vasopressors. on the second day of admission, percutaneous drainage with an 8.5 fr pigtail catheter, under the guidance of an abdominal ultrasound was performed for diagnosis and treatment. we removed 565 ml of fluid that was dark brown in color. for a diagnosis, biochemical tests were carried out on the bile, and these tests revealed a total bilirubin of 22.3 mg/dl and a direct bilirubin of 18.9 mg/dl. the leukocyte count was 4,560/mm, and gram staining showed a gram negative bacillus. on the third day of admission, her vital signs were as follows: blood pressure 100/65 mmhg, heart rate 110/min and temperature 37.2. there was 200 ml of drained bile, the s-fibrinogen was 894 mg/dl (200-415), the d-dimer was 9,040 ng/ml (0-255), and the fdp was elevated up to 97 ug/ml (normal range: 0-5). on the eighth day of admission, the patient's mental status improved, the vital signs were stable and voluntary respirations recovered. on the thirteenth day of admission, pancreatico-biliary magnetic resonance imaging (mri) revealed a biloma that was connected to the intrahepatic bile duct (figure 2). on the sixteenth day of admission, the biloma that was connected to the intrahepatic duct and common bile duct was noted again via a tubogram performed with a catheter. over time, the amount of bile drainage decreased. on the twentieth day of admission, 64 ml of bile was drained, the leukocyte count was 340/mm and there were no signs of bacteria on culture or gram staining of the bile. the follow-up ct showed that the size of the cyst had decreased to 5.44.6 cm and the density around the cyst had increased. the amount of drainage did not decrease afterward, and the connection between the biloma and the bile duct was still noted. on the 25th day of admission, the drainage tube was blocked and follow-up of the bilirubin in blood and the size of the biloma were assessed. on the 29th day of admission, follow-up ct showed a marked decrease in the size of the cyst (figure 3), and the serum bilirubin was normal (0.22 mg/dl). on the 34th day of admission, the drainage tube was removed after evaluating the size and connection of the biloma via a catheter tubogram (figure 4). they reported a case with extrahepatic bile leakage after trauma to the upper right quadrant of the abdomen; the bile did not cause peritonitis, but it accumulated in an encapsulated form. this concept was later applied to all cases with biliary tract lacerations caused by bile leaks that formed a capsule inside or outside of the liver1). the mechanism of encapsulation is explained by a large amount of bile leaking at a fast pace that causes biliary peritonitis, or a small amount of bile leaking at a slow pace that causes mild inflammation. this leaked fluid is simultaneously trapped by the greater omentum and mesentery, where it becomes encapsulated2). although the amount of bile leaked may be minor, the occurrence of an inflammatory reaction contributes to the appearance of a growth in size of the biloma3). as diagnostic techniques continue to develop, more cases of biloma are being reported, but cases of spontaneous biloma and biloma accompanied by other diseases have rarely been reported to date. from 1979 to 1997, 25 cases of spontaneous biloma were analyzed by fujiwara; the underlying causes included choledocholithiasis (16 cases), cholangiocarcinoma (2 cases), acute cholecystitis (1 case), liver infarction (1 case), hepatic abscess (1 case), nephrotic syndrome (1 case), obstructive jaundice (1 case), sickle cell anemia (1 case), and tuberculosis (1 case)4). in korea, there have been two cases of choledocholithiasis accompanied by a biloma, and they were treated by nonsurgical methods5, 6). there is one report of a case of biloma after trauma7), and 1 case of a biloma after endoscopic retrograde cholangiopancreatography (ercp)8). one of the patients with a choledocholithiasis who suffered a nontraumatic intrahepatic rupture of the bile duct, had a surgical repair9). the causes of biloma include trauma to the liver, which is the most common cause, abdominal surgery, endoscopic surgery and percutaneous catheter drainage10-13). currently, the term biloma is generally used to describe intrahepatic or intraperitoneal focal biliary stasis14). the clinical symptoms of a biloma are nonspecific, and they can range from no symptoms to abdominal pain and distention, jaundice and fever; leukocytosis can also be present15). in the case there were complaints of sudden chills, fever, upper abdominal discomfort and sensations of abdominal distention. physical examinations showed tenderness in the upper right area of the abdomen, slight jaundice, hypotension, leukocytosis and fever over 40. the size and location of the biloma are determined by the cause of the rupture of the bile duct, the location and speed of bile leakage and the rate the bile is reabsorbed by the peritoneum2). fujiwara reported that the locations for bile leakage included the left hepatobiliary duct (8 cases), the gallbladder (5 cases), the right hepatobiliary tract (2 cases), the common bile duct (1 case), and unknown (9 cases); the locations where the bilomas formed were the left lobe (11 cases), the right lobe (10 cases), and the upper abdomen (4 cases). vazquez analyzed 21 cases of biloma and found that 16 cases occurred in the upper abdominal area near the liver and five in the left upper abdominal area4). the diagnosis of a biloma can be assisted by surgery, a history of trauma with abdominal ultrasonography, abdominal ct and mri. a definite diagnosis can be made by a 99mtc-disida scan, percutaneous aspiration or by ercp1, 2). abdominal ultrasonography shows a mass of low echogenicity with a clear border in the liver, and the follow up tests show changes in size16). the abdominal ct will give a more accurate view of the location of the biloma and show its relationship to the surrounding organs. a standard ct view will show a low-density mass in the liver at a ct number lower than 20. ultrasonography and abdominal ct are sometimes unable to differentiate bilomas from seromas, lymphoceles and angiomas. mris or hepatobiliary scans can be useful when continuous bile leakage is present, but they are not diagnostic when continuous leakage is not present7, 17). radiological image-guided aspiration tests, when testing for bilirubin, can be diagnostic18). when the aspirated substance is a clear yellow liquid, then microbiological tests must be done to rule out an infection. ercp can be used to determine the location and severity of an active bile leak. however, the presence of small biliary cysts or bilomas, located in the lower areas of the liver that can be hidden by gastrointestinal shadows, can be difficult to diagnosis19). we were able to identify a cystic lesion by abdominal ct; a tubogram and magnetic resonance cholangiopancreatography (mrcp) were used to confirm a bile leak from the common bile duct. the fluid obtained by the transabdominal ultrasonography assisted percutaneous cyst drainage containing 22.3 mg/dl of total bilirubin and 18.9 mg/dl of direct bilirubin; these findings confirmed the diagnosis of a biloma. treatment for bilomas that have a diameter of only a few centimeters is not always necessary; these lesions can be watched. however, most bilomas require treatment. in the past, surgery was the main approach to treatment. currently, there are a much wider variety of options such as percutaneous catheter drainage, endoscopic sphincterotomy (est), endoscopic nasobiliary drainage (enbd) and endoscopic drainage4, 6, 15, 19, 20). surgery is now performed only in cases with a persistent bile leak or for treatment of underlying disease. in this case, a spontaneous biloma with bacterial infection was found after the patient presented in septic shock. after percutaneous drainage was performed, the amount of bile excreted did not decrease to lower than 64 ml per day. as there was no difficulty in flow through the common bile duct, the biochemical tests performed after removal of the drainage catheter showed no increase in total bilirubin or any increase in the size of the biloma, thus demonstrating a rare case of recovery.

a " biloma " is a loculated collection of bile located outside of the biliary tree. it can be caused by traumatic, iatrogenic or spontaneous rupture of the biliary tree. prior reports have documented an association of biloma with abdominal trauma, surgery and other primary causes, but spontaneous bile leakage has rarely been reported. a spontaneous infected biloma, without any underlying disease, is a very rare finding. we recently diagnosed a spontaneous infected biloma by abdominal computed tomography and sonographically guided percutaneous aspiration. the patient was successfully managed with percutaneous drainage and intravenous antibiotics. we report here a case of infected biloma caused by spontaneous rupture of the intrahepatic duct, and review the relevant medical literature.

PMC2687696

pubmed-229

primary hyperhidrosis is a common disease that is characterized by excessive sweating of face, palms, or axilla, occurring in 0.6-3% of a population (1, 2). since kux performed endoscopic thoracic sympathetic surgery (3), it has been popular during the past few decades as the surgical treatment of choice for facial, palmar, and axillary hyperhidrosis (4-6). although endoscopic thoracic sympathetic surgery offers permanent cure for hyperhidrosis, it is often accompanied by serious complications, such as compensatory hyperhidrosis. in order to decrease compensatory hyperhidrosis, endoscopic thoracic sympathetic surgery has attempted to reduce the extent of resection of the sympathetic nerve, but these procedures did not significantly decrease the occurrence of compensatory hyperhidrosis (7). we performed sympathetic nerve reconstruction surgery using intercostal nerve in 19 patients with severe compensatory hyperhidrosis after endoscopic thoracic sympathetic surgery and evaluated the results of the procedure. from february 2004 to august 2007, we performed endoscopic thoracic sympathetic surgery in 184 patients with primary hyperhidrosis. among theses patients, reconstruction surgery of sympathetic nerve using intercostal nerve was performed in 19 patients with severe compensatory hyperhidrosis after endoscopic thoracic sympathetic surgery. fourteen patients were male and 5 were female (median age: 28 yr, range: 19-61). this study was approved by the institutional review board of our hospital (irb no: 3-20080021). all procedures of reconstruction surgery were performed under general anesthesia with a single lumen endotracheal tube. the patients were in a semi-fowler position with their arms extended. in 18 patients except for one patient with severe pleural adhesion, starting on the left side, two separate skin incisions were made along the previous thoracoscopic scars and thoracoscopic ports were placed. after co2 gas insufflation into the thoracic cavity with less than 10 mmhg of pressure to deflate the lung, the pleural space was inspected with 5-mm thoracoscope. the intercostal neurovascular bundle was dissected in lengths of 5-7 cm and the distal part was resected. after the proximal and distal part of previously operated sympathetic nerve was exposed, the nerve sheaths of proximal and distal part of exposed sympathetic nerve and harvested intercostal nerve end were removed with an electro-surgical tip cleaner (surgisite, ethicon, gargrave, skipton, uk). the intercostal nerve end was placed between the proximal and distal part of the exposed sympathetic nerve and the fibrin glue was applied to contact surface of the sympathetic and intercostal nerve (fig. the same procedure was repeated on the right side. in cases of sympathetic nerve clipping, this procedure was performed after clip removal. in one patient with severe pleural adhesion we reviewed the clinical charts of all patients who underwent sympathetic nerve reconstruction surgery using the intercostal nerve. patients were followed by telephone questionnaire on the effects of the surgery and postoperative complications. the degree of improvement of compensatory hyperhidrosis was graded as " definite ", " mild ", or " absent ". " definite " means that patients felt fully satisfied after the reconstruction surgery, " mild " means that patients felt satisfied to a certain extent, and " absent " means that patients felt no improvement. median interval between the sympathetic nerve reconstruction surgery and questionnaire was 22 (range: 1-45) months. in one patient (patient number 17 in table 1), digital infrared thermographic imaging was performed preoperatively and postoperatively. primary hyperhidrosis patients were composed of 9 facial, 8 palmar, and 1 axillary, and one patient had both facial and palmar hyperhidrosis. initial endoscopic thoracic sympathetic surgery for primary hyperhidrosis was t3 sympathicotomy in 5 patients; t2 sympathicotomy in 8; t2, 3 sympathicotomy in 1; t2, 3, 4 sympathicotomy in 1; t2 clipping in 2; t2, 3 clipping in 1; and t2 clipping with t3 sympathicotomy in 1 patient. the median interval between the first endoscopic thoracic sympathetic surgery for primary hyperhidrosis and sympathetic nerve reconstruction surgery was 47 (range, 4-111) months. r3 intercostal nerve was used for sympathetic nerve reconstruction surgery in 15 patients, r4 intercostal nerve in 2, r2 intercostal nerve in 1, and r3 with r5 intercostal nerve in 1 patient. three patients replied that the effects of reconstruction were " definite ", 6 responded with " mild ", and 8 said " absent ". postoperative complications were numbness of the chest wall in 2 patients, chest wall pain in 2 patients, and temporary ptosis in 1 patient in whom ptosis spontaneously resolved after 3 months. preoperative and postoperative digital infrared thermographic imagings performed in one patient showed the thermal change in chest and back. since kux advocated thoracoscopic sympathetic surgery (3), recent developments in thoracoscopy and specialized instruments have facilitated the procedure. and, it became the treatment of choice for hyperhidrosis because of its low morbidity, short hospital stay, and excellent cosmetic results (6). although it has many advantages, some patients suffer from compensatory hyperhidrosis, which is by far the most common and disagreeable complication after endoscopic thoracic sympathetic surgery. according to the previous reports, compensatory hyperhidrosis occurs in 59.8-90% of patients after sympathetic surgery (8-10). the mechanism of compensatory hyperhidrosis is not clear, but it seems to be associated with compensation for thermoregulatory function (11, 12). because the incidence and degree of compensatory hyperhidrosis appear to be related to the extent of resection of the sympathetic chain, some clinicians have suggested that the extent of resection should be limited (13). for these reasons, many treatment methods, such as different level sympathectomy or sympathicotomy, ramicotomy, and clipping, have been attempted to reduce the extent of resection (14-18), although the effects of these methods remain controversial. in mild compensatory symptoms, antiperspirants including aluminum-based compounds, iontophoresis, and systemic or topical anticholinergic drugs can be used. however, if the symptoms are severe, the management is more difficult and results are unsatisfactory. since philipeaux and vulpian reported the first experimental nerve graft in 1870, many successful nerve grafts were reported in the field of orthopedic surgery. in the field of thoracic surgery, schoeller et al. (19) reported successful phrenic nerve reconstruction using sural nerve in patient with mediastinal tumor resection. telaranta reported that reconstruction of the sympathetic chain using sural nerve graft diminished compensatory sweating in a male patient who underwent sympathicotomy for palmar hyperhidrosis (20). miura et al. (21) reported that sympathetic nerve reconstruction surgery using the intercostal nerve was useful after resection of the sympathetic nerve involved by tumor. although the sural nerve is the most commonly used for nerve graft, the intercostal nerve has several advantages over the sural nerve. first, the intercostal nerve has more sympathetic nerve fibers than the sural nerve, hence the intercostal nerve is more appropriate for sympathetic nerve reconstruction surgery. second, the sural nerve can be used only as free graft but the intercostal nerve can be used as pedicled graft and harvested as a neurovascular bundle. therefore, a sufficient blood supply in the graft can be maintained. so, an additional incision is not needed and donor site morbidity decreases. in our experience, thoracoscopic intercostal nerve could be harvested in all patients except 1 patient with severe pleural adhesion, leading us to believe that the intercostal nerve is a useful graft for sympathetic nerve reconstruction surgery. epineural and fascicular sutures are the most used for nerve anastomosis, but the foreign body reaction caused by suture material to nerve is another possible problem (22, 23). some reports demonstrated the successful nerve anastomosis using fibrin sealant without suture technique (24, 25). if microscopic suture technique is used in sympathetic nerve reconstruction surgery, it inevitably needs thoracotomy. the type of anastomosis performed in this procedure is the modification of end-to-side neurorrhaphy where axonal sprouting occurs (26). the nerve is generally anastomosed in the original direction, but the free graft should be prepared to be anastomosed in the original direction in this operation. some reports revealed the anastomosis in reverse orientation did not influence the nerve conduction (27, 28). in the questionnaire on the effects of sympathetic nerve reconstruction surgery, nine patients replied " definite " or " mild ". in 3 patients who replied that the results were " definite ", compensatory sweating decreased and anhidrosis of the affected areas after endoscopic thoracic sympathetic surgery improved. patients, who replied mild improvement, complained still uncomfortable compensatory hyperhidrosis, although amount and frequency of perspiration decreased. these results of the reconstruction surgery were not different between variables such as age, sex, affected area, and interval from endoscopic thoracic sympathetic surgery due to the small number of cases in this study. the digital infrared thermographic imaging is a useful tool in evaluation of body temperature distribution. in the image, before and after sympathetic nerve reconstruction, we performed the digital infrared thermographic imagings in 22 yr-old man complaining of compensatory hyperhidrosis in chest after t3 sympathicotomy. after the reconstruction surgery, trunk temperature has increased, and this result corresponded with patient's symptom. even though the number of patients is not sufficient for data analysis, outcome of the reconstruction surgery did not correlate with the interval between the sympathetic surgery and reconstructive surgery. to evaluate the exact effects of sympathetic nerve reconstruction, more cases and longer postoperative complications of the reconstruction surgery were seen in 5 patients; prolonged chest wall pain which was tolerable in 2 patients, and numbness of chest wall in 2 patients. in addition, because compensatory hyperhidrosis depends on climate and season, the timing of a questionnaire survey is important. in this study, the questionnaire was performed on october when it is relatively cool and dry in korea., our results suggest that sympathetic nerve reconstruction with intercostal nerve may be one of the useful surgical methods in severe compensatory hyperhidrosis patients. the reconstruction surgery must be decided very carefully in highly selected patients with severe compensatory hyperhidrosis.

we performed sympathetic nerve reconstruction using intercostal nerve in patients with severe compensatory hyperhidrosis after sympathetic surgery for primary hyperhidrosis, and analyzed the surgical results. from february 2004 to august 2007, sympathetic nerve reconstruction using intercostal nerve was performed in 19 patients. the subjected patients presented severe compensatory hyperhidrosis after thoracoscopic sympathetic surgery for primary hyperhidrosis. reconstruction of sympathetic nerve was performed by thoracoscopic surgery except in 1 patient with severe pleural adhesion. the median interval between the initial sympathetic surgery and sympathetic nerve reconstruction was 47.2 (range: 3.5-110.7) months. compensatory sweating after the reconstruction surgery improved in 9 patients, and 3 out of them had markedly improved symptoms. sympathetic nerve reconstruction using intercostal nerve may be one of the useful surgical options for severe compensatory hyperhidrosis following sympathetic surgery for primary hyperhidrosis.

PMC2844605

pubmed-230

in march 2014, an unprecedented outbreak of ebola virus disease (evd) began in western africa that as of july 2015 is ongoing and has claimed more than 11000 lives. the current outbreak is caused by viruses belonging to the species of the zaire ebolavirus, a member of the filoviridae family. filoviridae are enveloped, filamentous viruses with lengths that may reach>1000 nm. ebola virus can be excreted in bodily fluids, including vomit, stool, blood, saliva, semen, and breast milk. ebola virus loads of up to 10 genome copies ml have been reported in blood, 10 genome copies ml in stool, and 10 genome copies ml in urine; however, the conversion between genome copies and infectious units is unknown. once infected, individuals may produce up to 9 l of liquid waste per day, primarily watery diarrhea. ebola virus is considered a potential bioterrorism agent. in response to the evd epidemic, both the world health organization (who) and the u.s. centers for disease control and prevention advised direct disposal of ebola-contaminated liquid waste into sewage systems (wastewater collection and treatment systems) and latrines without disinfection. initial recommendations were made on the basis of an expected limited persistence of ebola virus in the environment, as ebola virus is an enveloped virus, and a lack of strong evidence for a waterborne transmission route. as stated by a who guidance document, ebola virus is likely to inactivate significantly faster in the environment than enteric viruses with known waterborne transmission (e.g., norovirus, hepatitis a virus). however, as has been noted in a recent review, the persistence of enveloped viruses in the water environment varies by>2 orders of magnitude. recommendations for ebola virus-contaminated wastewater disposal were met with debate (e.g., refs (1618)) because of uncertainty about ebola virus persistence within wastewater matrices and the lack of a risk-based analysis for waste handling. wastewater handling recommendations have since been revised to recognize uncertainty in this area and to recommend disinfection of latrines and holding of wastewater prior to handling to allow ebola virus inactivation. additionally, some facilities have opted to provide additional disinfection prior to disposal of liquid waste into sewer systems. recent research found both ethanol and hypochlorite to be effective disinfectants for ebola virus dried on surfaces; however, the disinfection kinetics of ebola virus within liquid matrices remains unknown. various wastewater disinfection approaches have been recently suggested for pathogen control in an outbreak setting. currently, no data on ebola virus persistence in wastewater exist, hindering risk estimation and examination of potential environmental exposure routes. the necessity of evaluating ebola virus persistence in wastewater matrices has previously been highlighted, as wastewater in ebola virus outbreak settings may be temporarily held in open containers or disposed of in open sewers. historically, the transmission of ebola virus via environmental routes (droplets, aerosols, or fomites) has been thought to be unlikely due to epidemiological evidence and environmental sampling. the primary ebola virus transmission route is via direct contact with bodily fluids. transmission has previously occurred without known direct contact with infected individuals, providing supporting evidence that ebola virus transmission may be possible via large droplets. the potential for transmission of ebola virus via wastewater is currently unknown. to address uncertainties regarding ebola virus persistence in wastewater, we have conducted an initial evaluation of ebola virus persistence within wastewater to address uncertainty and inform ongoing risk assessments. a current ebola virus outbreak strain from guinea (makona-wpgc07) was spiked to two end concentrations (10 and 10 tcid50 ml) into a domestic wastewater (untreated sewage) sample. the ebola virus-containing wastewater was sampled for 8 days, and the viability of ebola virus was determined in these samples. study results are presented, and study limitations and implications are discussed, as well as recommendations for an ongoing research agenda. untreated wastewater was collected from an anonymous regional wastewater treatment facility in western pennsylvania that receives wastewater from seven communities (combined population of approximately 60000). the total raw wastewater flow to the treatment facility is<10 mgd (million gallons per day). the wastewater was frozen at 80 c to minimize compositional changes prior to analysis. wastewater characteristics (table 1) were determined at an epa-certified analysis facility (microbac laboratories, marietta, oh). the region from which the sample was collected uses a combined sewer system that experiences significant infiltration, and the determined composition is typical for the region. ebola virus cultivation experiments were conducted at rocky mountain laboratories under bsl4 conditions. wastewater samples were shipped to rocky mountain laboratories overnight on ice. upon receipt, samples were sterilized with 5 mrad of -irradiation. sterilization was performed to limit cell culture death due to wastewater microbial activity leading to a false positive. stock virus (ebola virus guinea makona-wpgc07, 10 tcid50 ml) was handled as described previously. ebola virus was diluted in wastewater to achieve two separate virus titers (10 and 10 tcid50 ml), and both experiments were completed in triplicate. the ebola virus concentration in sewage has not been previously measured or estimated; thus, two separate concentrations were utilized to cover possible concentration scenarios. tcid50 is an end point dilution series that is used to determine at what dilution 50% of the infected wells produce cell death. an approximation of focus-forming units (ffus) can be made from a poisson distribution utilizing the formula tcid50 0.69, assuming each ffu is formed from a single virus. spiked wastewater was then distributed into three labeled vials for each concentration, and samples were taken daily for 8 days. tests were conducted at 20 c and 40% relative humidity. at each time point, including the time zero measurement, 50 l of wastewater from the bulk wastewater vial was added into 450 l of dulbecco s modified eagle s medium (dmem, sigma) supplemented with heat-inactivated fetal bovine serum (fbs, gibco) to a final concentration of 2%, pen/strep (gibco) to a final concentration of 50 units/ml penicillin and 50 g/ml streptomycin, and l-glutamine (gibco) to a final concentration of 2 mm in an appropriately labeled 2 ml screw top vial and frozen at 80 c. negative controls were 50 l of nonspiked wastewater in 450 l of dmem. to perform the titrations, a 96-well 1.1 ml well dilution plate (axygen, corning, ny) was prepared. the thawed sample (400 l) was placed in the top row of the plate and a 10-fold dilution conducted by passing 40 l of sample into 360 l of dmem. next, 100 l from each well of the dilution plate was transferred to a 96-well cell culture plate seeded with vero cells. the cells were incubated with virus dilutions for 1 h; then the medium was removed from the two highest concentrations and rinsed two times with pbs, and 200 l of fresh culture medium was added. fresh culture medium (100 l) was also added to the remaining wells in the plate. the plates were incubated at 37 c for 7 days, inspected for the cytopathic effect (cpe), and scored. the natural logarithm of c/co tcid50 was plotted and fit with a linear trendline for estimation of the inactivation constant (k). a literature review was then performed to compare observed inactivation to other environmental matrices. ebola virus was spiked into wastewater at two concentrations and assayed for 8 days to determine persistence in a wastewater matrix. the time zero time point was measured immediately following addition of ebola virus to the wastewater. no viable ebola virus was recovered from samples spiked with 10 ebola virus tcid50 ml after the initial time zero sampling. virus viabilities from the initial 10 ebola virus tcid50 ml concentration are shown in figure 1 and detailed in table s1. ebola virus titer was rapidly reduced (approximately 99%) within the first day of the test, consistent with an inability to identify infectious ebola virus from the initial sample with 10 ebola virus tcid50 ml on day 1. persistence of an initial ebola virus concentration of 10 tcid50 ml in domestic wastewater (untreated sewage) (a) including the time zero time point and (b) excluding the time zero time point to mitigate potential aggregation effects. fit inactivation constants (k) were determined to be 1.08 when including time zero and 0.35 when excluding time zero. error bars are 1 standard deviation. there was a rapid decrease (approximately 99%) in ebola virus titer within the first day of the test. in addition to inactivation, viral particle aggregation or adsorption to wastewater particles may play a role in the apparent rapid viral decrease and enhanced viral persistence. in this case first, aggregated particles would not be detected as multiple infectious units, resulting in an apparent rapid decrease. second, it has been previously recognized that aggregation increases viral persistence and resistance to inactivation stressors. similarly, viral association with particles has been recognized to provide protection from inactivation, including association of viral particles with wastewater solids. mechanistically, particle association is believed to protect viral particles from inactivation by shielding them from environmental stressors and is dependent on the organism and particle type. utilizing the current assay, it can not be determined if the initial rapid decrease in viral titer was due to viral inactivation or aggregation. aggregation would result in an apparent viral titer decrease as each viral aggregate would function as an infectious unit in the cell culture assay. to address this uncertainty, we plotted two inactivation curves, both including (figure 1a) and excluding the measured time zero point (figure 1b). a linear trendline, as has been previously suggested for viral and ebola virus persistence, showed a lower fit (r=0.59 including the time zero time point, and r=0.67 excluding the time zero time point) than that previously observed for ebola virus in deionized water (r>0.91), but a fit better than that previously observed for ebola virus in human blood (r<0.29). the inactivation constant (k) was determined to be 1.08 when including the time zero time point and 0.35 when excluding the time zero time point. on the basis of the model fit, the t90 (time for 90% inactivation) would be 2.1 days including the time zero time point and 6.6 days excluding the time zero time point. the observed ebola virus inactivation in wastewater was slower than that observed for deionized water, which required 1.8 days for 90% inactivation at 21 c. the observed ebola virus inactivation in wastewater was more rapid than that reported for human blood, which required 20 days for a 90% inactivation, and results are consistent with recent studies that identified viable ebola virus to persist in infected macaque blood for>8 days. in general, ebola virus was found to be less persistent in wastewater than model enteric viruses. while the t90 for ebola virus in wastewater was found to be<1 day, the t90 for hepatitis a is greater than 17 days and the t90 for enteric adenovirus is 33 days; however, the t90 for poliovirus is 5 days, which is between the observed t90 values including or excluding the time zero time point. the results demonstrate a more rapid initial viral titer decrease but overall enhanced persistence of ebola virus in wastewater compared to the proposed enveloped surrogate bacteriophage phi6. this study has two primary limitations that may alter the persistence of ebola virus compared to what may be observed in the field. first, the tested wastewater was more dilute than would be expected in typical latrine waste. in general, interaction with constituents within the wastewater (e.g., ammonia) would be expected to contribute to more rapid inactivation of viruses; however, the true effect of these constituents on ebola virus persistence is unknown. second, the wastewater was frozen to minimize compositional changes and disinfected (-irradiation) prior to utilization to limit microbial activity resulting in false positive viral cell culture. microbial activity within wastewater matrices would be expected to contribute to more rapid inactivation of infectious viral particles; however, the true effect of microbial activity on ebola virus persistence is unknown. microbial activity reduces viral persistence through both the production of metabolites detrimental to viral persistence and direct usage of the viral particles as a nutrient source. additionally, the influence of other environmental characteristics (e.g., temperature, ph, and mixing) on ebola virus persistence is unknown and may contribute to altered environmental behavior. as such, we believe these results to be an upper bound for ebola virus persistence in wastewater matrices. subsequently, we caution extrapolation of these results without a holistic assessment of all factors, including wastewater composition, dilution, and potential exposure routes. the results of this study suggest a potential exposure route to infectious ebola virus via wastewater; however, any assessment of potential exposure routes must consider the effects of wastewater composition, dilution of contaminated wastewater, and inactivation of ebola virus during treatment and holding. additionally, the possibility for ebola virus transmission via wastewater and subsequent infection remains unknown. the who updated guidelines in january 2015 to recommend holding of latrine waste for 1 week prior to further handling or transport. the objective of this holding period is to allow ebola virus die-off. on the basis of these results, it would be reasonable to approximate a three-log (i.e., 99.9%) removal of ebola virus due to this holding period. the resulting risk would ultimately depend upon the initial ebola virus concentration in wastewater, potential for exposure, and susceptibility to infection via wastewater exposure. the wastewater travel times for wastewater via a sewer system to a centralized sewage treatment works would typically be<1 day, depending on system dynamics. further assessment is necessary to determine ebola inactivation and dilution within this period and potential human exposure routes, including workers within the sewer system and ebola virus persistence within wastewater sludges. the greatest exposure risk would be expected for persons in contact with contaminated wastewater prior to significant dilution, treatment, or holding. these results demonstrate a persistence of ebola virus in wastewater greater than what has previously been suggested and the potential of a wastewater exposure route to infectious ebola virus. while ebola virus was found to be generally less persistent than enteric viruses in wastewater, the identified survival period suggests value in a nuanced evaluation of wastewater exposure risks during an epidemic response. specifically, these findings highlight the value of a precautionary approach to wastewater handling within an outbreak scenario, in response to both ebola virus and other emerging viruses.

in the wake of the ongoing 2014/2015 ebola virus outbreak, significant questions regarding the appropriate handling of ebola virus-contaminated liquid waste remain, including the persistence of ebola virus in wastewater. to address these uncertainties, we evaluated the persistence of ebola virus spiked in sterilized domestic sewage. the viral titer decreased approximately 99% within the first test day from an initial viral titer of 106 tcid50 ml1; however, it could not be determined if this initial rapid decrease was due to aggregation or inactivation of the viral particles. the subsequent viral titer decrease was less rapid, and infectious ebola virus particles persisted for all 8 days of the test. the inactivation constant (k) was determined to be 1.08 (2.1 days for a 90% viral titer decrease). due to experimental conditions, we believe these results to be an upper bound for ebola virus persistence in wastewater. wastewater composition is inherently heterogeneous; subsequently, we caution that interpretation of these results should be made within a holistic assessment, including the effects of wastewater composition, dilution, and potential exposure routes within wastewater infrastructure. while it remains unknown if ebola virus may be transmitted via wastewater, these data demonstrate a potential exposure route to infectious ebola virus via wastewater and emphasize the value of a precautionary approach to wastewater handling in an epidemic response.

PMC4613737

pubmed-231

pulmonary nodules and lung tumours move substantially during respiration with significant differences according to the tumour localization. respiratory tumour motion is a big challenge for radiotherapy, especially for high precision techniques. an additional target dose escalation which is deemed necessary for a curative approach of lung cancer is limited as so far as tumour motion is not sufficiently quantified and integrated into modern treatment planning. thus, the risk of side effects within the surrounding normal tissue is unacceptably high. radiation pneumonitis and the development of lung fibrosis are the physiological reactions of the lung which are not acceptable in severely ill patients. thus modern techniques of adaptive radiotherapy will greatly benefit from devices which take lung and tumour motion into account in radiotherapy planning. the final objective is an additional increase in the radiation dose within the tumour volume together with maximum protection of the adjacent normal lung parenchyma. a basic requirement is the accurate measurement and quantification of the mobility of pulmonary tumours. but also for follow-up examinations of patients with pulmonary tumours, a confident registration of the respiratory level is important in order to achieve easy identification and valid measurements. integration of the knowledge about lung and lung tumour motion is essential for planning of high precision radiotherapy. four-dimensional imaging using computed tomography (4d-ct) is under development for optimization of radiotherapy by integration of motion [24]. these developments also include online imaging with a linac-integrated cone beam ct. the particular advantages of magnetic resonance imaging (mri) are the high soft-tissue contrast, differentiation of tumour and atelectasis, the possibility to choose the optimal plane for motion quantification and the possibility to integrate further dynamic parameters, e.g. lung perfusion or o 2 quantification, into one imaging session. the temporal resolution is already reasonably high for monitoring lung tumour motion in real-time. novel mri techniques allow for non-invasive acquisition of the motion of lung and pulmonary tumours during the respiratory cycle with high spatial and temporal resolution [8, 9]. continuous improvements and new developments in mr scanner technology, such as high performance gradient systems and pulse sequences, have made this possible and address the inherent challenges of mri of the chest, such as low proton density with an unfavourable signal to noise ratio and short t2 relaxation times with substantial susceptibility artefacts. parallel imaging techniques make use of the different spatial sensitivities for the receiver coils in order to employ them for the simultaneous acquisition of image data, significantly reduce the phase encoding steps and achieve a marked improvement in spatial and temporal resolution. thus, important requirements were met to measure the respiratory movement of the lung quantitatively. fast-low-angle-shot (flash) sequences with a temporal resolution of one image per second demonstrate chest wall motion per se and postoperative changes of respiratory motion, i.e. changes of the cranio-caudal distance before and after lung volume reduction surgery. modified true-fast-imaging-with-steady-state-precession (truefisp) sequences, widely used in cardiac mri, were successfully applied in volunteers (fig. 1). by adding a mathematical model, a continuous quantitative measurement of lung volume was achieved, which again showed a high correlation with spirometry. after successful tests in volunteers, dynamic mri was transferred to patients with solitary pulmonary tumours in order to visualise lung tumour motion by mri in two dimensions (fig. quantification was performed by measuring the cranio-caudal distance and the diaphragmatic length over time. again, the results showed good correlations with the forced expiratory capacity in 1 s. the diaphragmatic length was particularly useful in the assessment of respiratory mechanics and the respective effects of pulmonary tumours. in such studies the truefisp sequence was superior to a flash sequence due to its higher t2 signal. the respiratory motion of patients with a pulmonary tumour showed a significant difference between the tumour bearing and the non-tumour bearing hemithorax. in addition, the location of the nodule had a marked effect on the regional mobility of the lung. thus, mri is capable of providing important complementary quantitative regional information, which might be especially useful during follow-up. depending on size and location of the tumour, differences in motion were observed in the three axes (x-, y-and z-direction). for this assessment pulmonary nodules were grouped as cranial, middle and caudal according to giraud et al. especially, the cranio-caudal motion (y -direction) showed a significant dependence on tumour size and location. small tumours in the caudal lung area can move up to 5 cm during maximum respiration. but also during shallow breathing, nodules in the lower lung zone exhibited a mean dislocation of 9.5 mm in the cranio-caudal direction and 6.6 mm in the anterior posterior direction (fig. theoretical calculations for 20 patients with pulmonary nodules demonstrated that this information for treatment planning might already lead to a marked increase of the target dose. a sufficient safety margin might not be larger than 3.4 mm for the upper, 4.5 mm for the middle, and 7.2 mm for the lower lung zone. this is substantially smaller than the conventional safety margin of 5 or 10 mm, respectively, and might allow for an additional dose escalation especially in the upper lung zone. but it has to be mentioned that an individual quantification of the tumour motion is recommended as the interindividual differences in tumour motion are high. simultaneous application of markers on the external chest wall demonstrated correlation and influencing factors between internal and external motion. further developments in parallel imaging technology, especially view sharing techniques, have resulted in a further improvement in temporal resolution. this advantage can be applied to establish a three-dimensional flash sequence for a continuous volumetric visualisation of respiratory motion of lung and tumours. in fig. 4, the 3d-flash sequence is compared to the 2d-truefisp sequence. a 3d-flash data set contains 52 slices with isotropic 3 mm voxels and a temporal resolution of one data set per second. motion of pulmonary nodules can be visualised and quantified in all three axes in order to be transferred in potential treatment concepts. segmentation of such data sets, however, is still demanding and time-consuming and can not be recommended for clinical use, yet. besides the mere information about tumour motion, three-dimensional techniques also allow for quantification of changes in tumour volume during the respiratory cycle. changes in tumour volume are associated with deformations and changes of the main rotation axes of the nodules. although this is not real rotation, the rotation of the axes can add up to 30 and impressively reflects the degree of deformation. however, this information seems to be highly important, e.g. for further improvements in position and adaptation of collimators in radiotherapy. in addition, the knowledge about deformation of nodules and changes in volume during the respiratory cycle has substantial impact on the accuracy of volume measurement during the follow-up of pulmonary nodules and attempts to calculate nodule doubling times. radiotherapy very quickly leads to a significant, often temporary reduction of motion of the treated hemithorax when compared to the situation prior to radiotherapy. this ipsilateral reduction is compensated for by an increased motion range of the contralateral lung. obviously, such changes between right and left lung can not be detected by global lung function tests. further studies are warranted to demonstrate which patients might benefit from preventive treatment, e.g. to prevent clinical aggravation. additional split lung analysis is feasible revealing important insights into differences between right and left lungs undetectable by global pulmonary function tests. motion of pulmonary tumours can be measured in two or three dimensions, effects of respiration on volume and shape can be calculated. however, presently the evaluation of such data sets is extremely time-consuming. substantial portions of this paper and the figures were originally published in plathow c, meinzer hp, kauczor h-u. respiratory cycle from maximum expiration to maximum inspiration within 1 s. top row shows a healthy volunteer with synchronous movement of both lungs. bottom row shows a patient with lung cancer on the left and subsequently reduced motion range of the left lung. lung motion is reflected by measuring the distance from the apex to the top of the diaphragm (l). cranio-caudal lung tumour motion is measured with regard to the intervertebral space t 6/7 (1); antero-posterior motion with regard central anterior margin of the spine (2); and medio-lateral motion with regard to the centre line of the spinal processus (3). maximum lung tumour motion (mm) during shallow breathing in cranio-caudal (cc), medio-lateral (ml) and antero-posterior (ap) direction depending on tumour localization in the upper, middle or lower lung zone. top row, 2d-truefisp sequence; middle row, 3d-flash sequence with a temporal resolution of one volume data set per second; bottom row, volume segmentation of lung and tumour from the 3d-flash data set.

novel technology has made dynamic magnetic resonance imaging (mri) of lung motion and lung tumour mobility during continuous respiration feasible. this might be beneficial for planning of radiotherapy of lung tumours, especially when using high precision techniques. this paper describes the recent developments to analyze and visualize pulmonary nodules during continuous respiration using mri. besides recent dynamic two-dimensional approaches to quantify motion of pulmonary nodules during respiration novel three-dimensional techniques are presented. beyond good correlation to pulmonary function tests mri also provides regional information about differences between tumour-bearing and non-tumour bearing lung and the restrictive effects of radiotherapy as well as the compensation by the contralateral lung.

PMC1805066

pubmed-232

a 21-month-old male patient, 75 cm in height and 10 kg in weight, experienced tricuspid valve regurgitation (tvr) and was scheduled to undergo tricuspid valve plasty. the tvr was discovered in a follow-up test 1 year after he had undergone ventricular septal defect repair surgery. before tricuspid valve plasty, a tee was performed, which showed a level 3-4 tvr and severe right ventricular hypertrophy. atropine, thiopental sodium, and vecuronium were administered to induce anesthesia and muscle relaxation. a catheter was placed at the left radial artery to measure the constant blood pressure and analyze the abga (table 1). there were complications due to the adhesion of the svc and ivc near the surgical site. therefore, a 20 fr and 22 fr cannula was placed on them, respectively. 2 u of packed red blood cells (prc), albumin, and mannitol was used as the priming solution. immediately after activating the cardiopulmonary bypass, the measured hematocrit level was 27.5%. the acid-base balance management mid-surgery was performed with an -stat. during extracorporeal circulation, the body temperature was aimed at a moderately low degree of 25. the perfusion rate was kept at 0.5-1.0 l/min. after tricuspid valve surgery, the patient was weaned from the cardiopulmonary bypass by reducing the perfusion rate of the machine and starting mechanical ventilation. the total anesthesia, surgery and extracorporeal circulation time was 510 minutes, 420 minutes and 180 minutes, respectively. the amount of blood loss was estimated to be 800 ml. during surgery, 600 ml of a crystalloid solution, 3 u prc and 2 u platelets were administered. however the patient's eyes could not focus, and his upper and lower limbs experienced intermittent convulsions. brain computed tomography revealed findings indicative of a cerebral infarction in the occipital lobe (fig. eeg was performed, which showed no abnormal findings of alpha rhythm loss, which is customary in cortical blindness. phenobarbital was administered until 19 days after surgery under the suspicion of a connection between the ocular deviation and the convulsions. the convulsions did not return, but the reaction to light or objects in front of the eyes did not trigger an avoidance response from the patient. there were no hopeful clinical signs of a visual recovery but fundoscopy showed normal findings. on the postoperative day 28, when the flash visual evoked potential (fvep) and mri had been planned, the patient's eyes refocused. he was able to recognize the objects in front of his eyes, could walk and avoid things in his path, and was able to recognize his guardians. post surgery visual loss or reduction can be caused by a variety of factors, and occurs 0.1% to 1% of cases. visual loss is caused by damage to any connecting striate area between the cornea and occipital cortex. direct pressure on the eyeball, indirect increase in ocular tension due to improper positioning and blood vessel damage can cause central retinal artery occlusion or ischemic optic nerve damage, which can lead to visual loss. in addition, a severe decrease in blood pressure, emboli, and thrombus mid- or post-surgery can cause an infarction in the occipital cortex, which can lead to cortical blindness. visual loss after a cpb might be caused primarily due to emboli, severe low blood pressure, acute anemia, hypoxia or a combination of these factors. in the present case twenty seven cases were cortical blindness, of which 22 cases occurred after cardiac surgery (81%). aldrich et al. reported a retrospective study of 25 patients, where the causes of cortical blindness were natural ischemic stroke in 8 patients (32%), cardiac surgery in 5 patients (20%), cerebral angiography in 3 patients (12%), non-surgery in 4 patients (16%), seizure in 2 patients (8%), and other factors, such as damage to the head and peritoneal dialysis, in 3 patients (12%). there were also cases of temporary cortical blindness reported after post-cardiac surgery angiography. in the case of children, the early indicators of brain damage after surgery are age, the complexity of surgery, metabolic acidosis, increase in lactate, and artery acidosis. diagnosing cortical blindness is simple when the patient makes a complaint but as in our case, a pediatric patient has limited ability to communicate. therefore, conducting an eeg, fvep, angiography, and funduscopy can assist in making a diagnosis. in this case, the eeg did not show the abnormal finding of a loss in alpha rhythm. however, computed laminography revealed an infarction in the occipital cortex we checked for visual loss with light and objects to test the patient's avoidance response but he did not respond properly. however, microemboli caused by extracorporeal circulation can obstruct the blood flow in the cerebral vessels, particularly in the watershed area. braekken et al. reported that cardiac surgery using extracorporeal circulation causes microemboli in most cases. in addition, in patients with neural damage, there are more cases of transcranial doppler detection of microembolic signals in the right middle cerebral artery than in patients without. microemboli mid-surgery occurs most often when blocking the aorta (18%) and unblocking the aorta (13%). rodriguez and belway stated that in pediatric cardiac surgery, the likelihood of microemboli can increase with increasing time of extracorporeal circulation depending on the oxygenator, circuit, adnexa parts, and components. the surgery in this case was not complicated, but may have increased the likelihood of microembolization due to the long extracorporeal circulation time. however, we should have been more careful in the selecting the -stat and ph-stat method. nevertheless, the strength of the ph-stat should have been considered regarding neural sequelae. the cpb priming solution in pediatric patients, unlike adults, can cause blood thinning, which can lead to possible ischemic organ failure. aldrich et al. reported that conditions, such as the age below 40, no diabetes or high blood pressure, and no impairment in cognitive skills, language skills or memory, indicate a good prognosis for visual recovery. in addition, eeg tests can assist in a diagnosis but are not helpful in accurately predicting the prognosis. in this study, two weeks after the surgery, he recovered his speech and cognitive skills, so we did expected a good prognosis. the patient's vision recovered rapidly from postoperative day 28 and he could be discharged. other tests such as a fvep were not performed, so the precise extent of the recovery rate is unknown. considerable effort is required to reduce neural sequelae after pediatric cardiac surgery, such as visual loss. the cpb machine's circuit components and type choice should be made on what can best prevent the likelihood of emboli. a pediatric transesophageal scan and cerebral oxymeter can help in the early identification of neural side-effects. a transesophageal scan plays an important role in eliminating emboli, so it should be prepared for all suitable pediatric patients. the pathological difference between an adult and pediatric cardiopulmonary bypass should be recognized, and proper measures should be followed. when cortical blindness is suspected, the ophthalmologist and neurologist should perform a combined examination, being cautious of permanent sequelae. in conclusion, with the reported visual loss in our pediatric patient, surgeons should consider the possibility of visual loss and cerebrovascular injury after a cardiac surgery using cardiopulmonary bypass.

visual loss occurring after pediatric cardiac surgery employing cardiopulmonary bypass (cpb) is relatively rare but the risk is substantial. compromised cerebral perfusion due to a cpb related micro-embolization and inflammatory vascular changes as well as reduced oxygen carrying capacity in hemodilution and hypothermia during cpb might be major contributing factors to the development of postoperative visual loss after cardiac surgery with cpb. a case of immediate but transient postoperative visual loss was encountered in a 21-month-old male who underwent tricuspid valve surgery. despite routine intraoperative measures to maintain an adequate perfusion pressure throughout the procedure, postoperative computed tomography revealed a subacute infarct in his occipital lobe. recovery began on postoperative day 28, and the patient's vision was restored by 31 days.

PMC2908231

pubmed-233

neonatal period (the first 28 days after birth), which is the period of various physiological adaptations to the extrauterine life, is a vulnerable time. more than 10 million children die before the age of 5 years, 8 million of whom die before the age of 1 year and more than half of these deaths occur in the first 4 weeks after birth. about 98% of the neonatal deaths occur in developing countries. according to the world health organization (who), the rate of deaths is 30 times more in the countries with the highest rate compared to the countries with the lowest rate. according to the reports of ministry of health and medical education, the index of neonatal death in iran is 16-20 deaths out of 1000 survived births, which is higher than that in developed countries. who has urged iran to halve its neonatal death rate by 2015. risk factors in studying neonatal death are categorized into three groups: prenatal, intrapartum, and postnatal factors. all over the world, infection, preterm delivery, and birth asphyxia contribute to about 87% of neonatal deaths. in most societies, congenital malformations and premature birth babies with low birth weight (lbw) and extremely lbw account for 6-7% and 1% of babies death, respectively. these causes, however, are the second and third reasons, respectively, which are responsible for one half of the neonatal deaths. prematurity is responsible for about 60-80% of neonatal deaths all over the world in babies without congenital anomalies. in many cases, neonatal diseases are caused by respiratory problems, of which hyaline membrane disease (hmd) can be mentioned as the foremost. about 1.3% of all neonatal deaths are caused by hmd or its complications in premature newborns. have mentioned five main causes of neonatal death, including prematurity, internal bleeding, septicemia, respiratory distress syndrome, and congenital anomalies, while gheibi et al. have reported prematurity (68%), hmds (51%), asphyxia (13%), sepsis (13%), and congenital cardiac malformations (8%) as the most important causes of neonatal death. the baby's gender has also been considered as an important factor in his or her death. one of the most important issues in babies death is suitable management and timely referral of newborn babies with high-risk levels and being hospitalized in neonatal intensive care unit (nicu). nicu is a critical section in a hospital, dealing with infections (e.g. septicemia, pneumonia, surgical infections, and other infections) that are difficult to control. in the usa, management, appropriate care, and supportive cares are the important factors in preventing babies death. rostami et al. have reported that the rescue chances of the babies who have received preventive nasal continuous positive airflow pressure (ncpap) are three times higher than the other babies. considering that an analytical and comprehensive study has not been done about the role of neonatal risk factors and the therapy given for hospitalized neonatal death in west azerbaijan, the study is case control study, wherein the case group included 250 died babies who were hospitalized in the nicu during 2007-2009. the control group also included 250 newborn babies who were hospitalized in the same unit and were discharged alive and healthy after they were given appropriate treatment. only the newborn babies from shahid motahhari therapy-training center were selected in order to homogenize the sample and eliminate some threatening factors (factors involved in referral, death, etc.). data collection was carried out through a researcher-designed questionnaire which was designed based on other studies and scholars points of view. inclusion criteria included the babies complete profiles, and the criteria for exclusion included their incomplete profiles. the questionnaire contained six sections (mother's and baby's demographic information, causes of hospitalization, during-treatment complications, therapeutic actions, and causes of death) for alive babies and five sections for dead ones. chi-square test, odds ratio (or), and logistic regression were applied to analyze how the variables were related. based on single-variable analysis, neonatal risk factors affecting the newborn babies hospitalized in the nicu are as follows: 51.6% of case babies and 18.3% of control babies had first-minute apgar score of less than 6, which proved to have a significant correlation with babies death (p<0.001). about 9.6% of babies of case group and 2.4% of babies in the control group had during-birth asphyxia which proved to have a significant correlation with neonatal death (p=0.001) [table 1]. the distribution of independent variables by independent variables; p value based on chi-square test in this study, one of the factors causing death of babies hospitalized in the nicu was hmd; 77.6% of case babies and 44.8% of control babies suffered from this disease (p<0.001). fourteen percent of case babies and 2% of control babies had sepsis which showed a significant relation with babies death (p<0.001). moreover, 58.8% of case babies and 71.5% of control babies were born through cesarean section which also proved to have a significant effect (p<0.001) [table 1]. congenital anomalies have been recognized as one of the significant risk factors of death of babies hospitalized in the nicu. eight percent of case babies and 2.8% of control babies were reported to have congenital anomalies (p<0.001) [table 1]. regarding therapeutic actions, the results of the study also showed that having ncpap played a significant role in decreasing death of babies hospitalized in the nicu (p<0.001). there was also a significant relation between supportive cares and neonatal death (p<0.001). increased number of pregnancies also had a significant effect on neonatal death (p<0.001) [table 1]. variables like lbw, baby's gender, blood group, history of preterm labor, and consanguinity had no significant role in the death of neonates hospitalized in the nicu. in order to gauge the key effects of the mentioned factors, the adjusted or calculated from advanced logistic regression model was measured through advance selection method. the results showed that the or of neonatal death was 4.02 times greater for neonates with first-minute apgar score of less than 6 compared to those with first-minute apgar score of 6 and more, for asphyxia, the or was 6.16, for hmd it was 4.08, and for sepsis it was 6.42. applying ncpap and multiparity led to a decrease in the death of neonates hospitalized in the nicu [table 1]. in the present study, the most important neonatal risk factors affecting neonatal death were found to be sepsis, birth asphyxia, hmd, first-minute apgar score of less than 6, congenital anomalies, and delivery method. in our study, the most common risk factor for neonatal deaths was sepsis which raised the risk of death by infection to 6.42 times more than the other causes., sepsis and its complications were reported to be the first cause of death, but in the investigations of nayeri et al. and amin et al., sepsis had higher ratings. this may be due to the factor that premature babies are prone to infection, but it should be more investigated because of the high number of deaths resulting from it. this spread of sepsis has been reported to be in 1-10 cases out of 1000 live births, but 10-50% of deaths occur because of it. the second risk factor in the present study was at birth asphyxia, which is in line with tariq and kundi's study which mentioned sepsis and neonatal asphyxia as the main causes of death, but in the studies carried out by sereshtedari et al., it was the cause of the 16% deaths in 18 provinces of the country, in bangladesh approximately 26% of neonatal deaths are caused by asphyxia. the other serious clinical problem is respiratory difficulty, and in this study, it manifested as respiratory distress and hmd. in our study, it was the third risk factor of infant death. the study of abdul in malaysia showed that this problem with sepsis is the most important cause of infants death. there is also a second leading cause of infant death in tariq and kundi's study, and respiratory distress syndrome which were studied by kumar et al. in india, jehan et al. in pakistan, naghavi in 18 provinces of iran, javanmardi et al. in isfahan, amani et al. in ardebil, and in the studies of nayeri et al. in tehran and sereshtedari one of the causes of infant death, low apgar score at birth, is increasingly mentioned in many studies to be a risk factor. low apgar score at birth could be correlated to factors such as neonatal infections, birth asphyxia, meconium aspiration, respiratory distress syndrome, and other causes which may result in infant mortality. in our study, ncpap was applied in the control group two times more than in the case group, which resulted in a decrease of babies death by 0.43. in their study, rostami et al. also reported that applying preventive ncpap to newborn babies will increase their survival chances by three times. congenital anomalies was found to be in the second position in the studies of sharifi, hematyar and yarjo, javanmardi et al. in esfahan, and naghavi's study in 18 provinces. it was mentioned as the second and first cause in the studies of sareshtedati et al. and's study, congenital anomalies and infection were mentioned as the leading factors of infant death. the rate of abnormalities in our study compared with other studies, which shows that it is a less important factor in the incidence of neonatal death. this may be due to high morbidity and mortality caused by other factors such as immaturity, lack of attention and careful examination at the time of birth, lack of screening for neonatal abnormalities, and not performing autopsy in dead neonates. death rate in babies with lbw is about 40 times higher than in babies with normal weight. unlike these studies this finding is in correlation with that of nayeri et al. in the present study, normal vaginal delivery was higher in the case group than that in the control group. this finding shows that cesarean section can be better when there is an emergency case or prematurity. although emergency cesarean section is performed to save the lives of the mother and baby, the selection is not always uncomplicated. in a study, it has been reported that two-third of babies who died were born through cesarean section. in our study, despite the high level of infant mortality in males, there was no significant relation between gender and the cause of death. an important risk factor that was investigated in this study was the number of pregnancies. the results of this investigation showed that death rate decreased as the number of pregnancies increased. number of births higher than 5, pregnancy number above 3, and high rate of birth were mentioned as effective factors causing babies death in studies conducted by shirvani and khosravi, chaman et al., and titaley et al., respectively. appropriately carrying out care and supportive cares can be effective factors in preventing babies death. in our study, 51.6% of case babies and 2.3% of control babies had received supportive care from birth. higher death rate in case babies can be due to bad physical conditions and other threatening factors. the results of the study show that incorrect methods of transfer can increase the death rate. in this study, special attention was devoted to increasing the care standards in order to decrease the death rate. according to the results of the study that took into consideration factors such as age, occupation, consanguinity, blood group, preterm delivery background, and sex in two groups with equal distribution, it can be concluded that factors related to accompanying diseases and care during delivery play a significant role in neonatal death. therefore, regarding the fourth goal of millennium development, decreasing babies death to two-fourths by 2015 in countries with high rate of mortality, it seems to be better to spot pregnancies with high risk of babies death through pre-delivery care and to transfer mothers who are likely to bear premature or sick babies to centers that have nicus. in cases where it is impossible to specify whether a delivery is risky before birth, the subsequent hospitalization problems can be prevented by providing appropriate conditions of transfer and therapeutic actions in intensive care units. the major risk factors in this study (sepsis, asphyxia during birth, hmd, congenital anomaly, and apgar score less than 6 in the first minute of birth) are considered as the major complications of preterm labor and preterm infants. so, strict preventive programs should be undertaken for premature preterm labor and preterm infants; taking care of the infants in four stages (before conception, during pregnancy, during delivery, and thereafter) can be highly effective as well.

background: a newborn is highly fragile whose death can be caused by embryonic, intrapartum, and postpartum factors. identifying the causes of death is the first step to be taken in order to decrease the death rate. the present study was aimed at finding out how neonatal factors and therapeutic actions affect death of newborn babies. materials and methods: the is a case-control study where the case group included 250 dead neonates who were hospitalized in the neonatal intensive care unit during 2007-2009. the control group also included 250 newborn neonates who were hospitalized in the same unit and were discharged alive and healthy after they were treated appropriately. researcher-designed questionnaires including demographic characteristics of mothers and infants, causes of hospitalization, treatment and its complications, and causes of death were used to collect the required data. chi-square test, odds ratio (or), and logistic regression were applied to analyze how the variables were related. p<0.05 were considered significant. statistical analyses were carried out using software spss 16.0. results:the results of advanced logistic regression model showed that first-minute apgar less than 6 (or=4.02), existence of birth asphyxia (or=6.16), hyaline membrane disease (or=4.08), and sepsis (or=6.42) increased the death rate of neonates hospitalized in the intensive care unit, and applying nasal continuous positive airway pressure and multiparity decreased the death rate of newborn babies. there was no significant correlation between variables such as low birth weight, consanguinity, blood group, pr eterm labor history, and baby's gender, and the death rate of neonates. conclusions:the results of the study show that factors such as low apgar score, asphyxia, hyaline membrane disease, sepsis, prematurity and congenital anomalies, and method of delivery have a positive effect on the death of neonates. they also prove that suitable management and carrying out appropriate therapeutic actions and intensive care decrease the death rate of newborn babies.

PMC4223965

pubmed-234

lung cancer remains the leading type of cancer worldwide and in latin america [1, 2]. the disease burden is significantly high, with around 2.5 million new cases per year and 1.5 million deaths worldwide. the two main histological subtypes of lung cancer are small-cell lung cancer (sclc), which comprises 15% of cases, and non-small-cell lung cancer (nsclc) accounting for 85% of cases which include adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. among all newly diagnosed nsclc cases, adenocarcinomas are the most frequent subgroup following by squamous cell carcinomas [6, 7]. cigarette smoking is the major risk factor for lung cancer but around 1020% of cases are found in never smokers; also wood-smoke is a major risk factor in countries like mexico [811]. surgery is the selected treatment for early stage nsclc with the greatest probability of long-term survival in such patients. in advanced nsclc, conventional therapies are based on chemotherapy and radiotherapy but with low efficacy. over the last decade, there have been advances in the study of molecular pathways underlying tumor development leading to the development of targeted therapies such as tyrosine kinase inhibitors (tkis) and antibodies directed against the two main actionable genes in nsclc up to now: mutations in the epidermal growth factor receptor (egfr) gene targeted by tkis like gefitinib [13, 14], erlotinib [9, 15, 16], and afatinib [1719] and translocations involving the anaplastic lymphoma kinase (alk) gene treated with the tki crizotinib, alectinib, and ceritinib. benefits have been shown in a subset of 1520% of patients harboring egfr mutations which correlate with definite clinical characteristics: adenocarcinoma histology, female sex, asian ethnicity, and nonsmokers [2325]. despite these improvements in therapeutic strategies, early diagnosis is very difficult; most cases are diagnosed at an advanced stage and cancer metastasis is very frequent; therefore, there is still an exceedingly low 5-year survival rate of 1124% [2628]. the immunotherapy approach has opened new therapeutic options in advanced nsclc with the advent of antibodies against immune checkpoints [29, 30]. recently, the anti-programmed death-1 (pd-1) antibodies nivolumab and pembrolizumab have been approved in the treatment of advanced metastatic nsclc based on results from clinical trials after prior chemotherapy [31, 32]. both antibodies block signaling through pd-1 and may restore antitumor immunity with benefits in overall survival [33, 34]. for example, nivolumab, a fully human monoclonal antibody, has recently shown greater overall survival than docetaxel. these antibodies exhibit a reasonable toxicity profile but they should be administered in selected patient populations based on biomarkers such as pd-l1 expression to avoid serious immune-mediated adverse effects. although these checkpoint inhibitors have proven efficacy in patients, their mechanism of action implies side effects as the onset of autoimmune diseases and a series of endocrine disorders [37, 38]. this is the rationale for further research into other molecular and cellular factors of the immune system that could be effectively targeted to develop novel therapeutic strategies for the management of advanced nsclc. recent findings indicate that inflammation plays a key role in tumor progression and survival across several cancer types. cancer related inflammation affects many aspects of malignancy including proliferation, survival, angiogenesis, and tumor metastasis. inflammatory components in the development of the neoplasm include diverse leukocytes populations, like macrophages and neutrophils, which respond immediately to inflammatory stimulus. immunoregulatory cytokines secreted in a proinflammatory environment also contribute to tumor growth and metastases and identify patient subsets in advanced nsclc with differential prognosis. both macrophages and neutrophils are increased in patients with lung cancer; this is associated with poor clinical outcomes, suggesting that these cells might have important tumor-promoting activities [43, 44]. tumors escape phagocytosis and immune response through overexpressing cd47 that interacts with the signal regulatory protein alpha (sirp) preventing engulfment. macrophages within the tumor microenvironment are called tumor-associated macrophages (tams). tams have a complex relationship with tumor cells; at an early stage they attack tumor cells avoiding tumor spread; however, over time they begin producing reciprocal growth factors and establish a symbiotic relationship with tumor cells. macrophages are polarized into two functionally distinct forms m1 and m2, mirroring the th1 and th2 nomenclature of t cells. differentiation of the m1 macrophages is induced by interferon-, lipopolysaccharides, tumor necrosis factor (tnf), and granulocyte-monocyte colony-stimulating factor. the m1 macrophages produce high levels of interleukin- (il-) 12, il-23, tnf, il-1, il-6, cxc ligand 10 (cxcl10), inducible nitric oxide synthase (inos), human leukocyte antigen- (hla-) dr, and reactive oxygen and nitrogen intermediates [47, 48]. differentiation of the m2 macrophages is induced by il-4, il-10, il-13, il-21, activin a, immune complexes, and glucocorticoid. the m2 macrophages express high levels of il-10, il-1 receptor antagonist, cc ligand 22 (ccl22), scavenger, mannose receptor, galactose receptor, arginase i, and cd163 antigen, reduce the expression of inos, and inhibit antigen presentation and t cell proliferation [47, 49]. factors that shift tams towards a m2 phenotype include the location of tams within the tumor microenvironment, tumor stage, and type of cancer. nevertheless, it is still not fully defined whether the diversity within the tam population is due to the maturation of unique monocytic precursors or due to various factors within the local tumor microenvironment. the m2 macrophages have been found to encourage the growth of various tumour cells in vitro and to increase tumor cell survival [51, 52]. studies suggest that in solid tumors established and progressively growing tams are reprogrammed to induce immune suppression in situ in the host through cytokines, prostanoids, and other humoral mediators [54, 55]. il-1 and il-6 expression in tams differs in ovarian cancer compared to peripheral blood monocytes. tams in the ovary produce low levels of il1 and increase the release of il-6, which contributes to elevated acute phase proteins and increased malignancy. there is an association between the number of macrophages and prognosis in a variety of human tumors. tam infiltration increased in carcinomas of breast, cervix, and bladder and correlates with a poor prognosis. however, in prostate, lung, and brain, increasing tams is associated with regression of tumors. tams can regulate the development of new blood vessels within tumors. in hypoxic sites, they stimulate the production of enzymes and extracellular matrix molecules that regulate endothelial cell activity by stimulating factors such as vascular endothelial growth factor (vegf), basic fibroblast growth factor (bfgf), tumor necrosis factor- (tnf-), transforming growth factors- and (tgf-,), interferons, thrombospondin, il-8, and epidermal growth factor (egf). innate immunity in lung involves alveolar macrophages (ams) which act as a barrier avoiding penetration of pathogens. conversely, macrophages contribute in part to the pathogenesis of lung disease due to toxic particles ingestion, releasing lysosomal enzymes that can kill the macrophage itself, or contribute to the recruitment of new macrophages inducing chronic inflammation. clinical evidence has indicated that the activation of alveolar macrophages by sio2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. exposure to cigarette smoke activates nf-e2-related factor 2 (nrf2) in macrophages and reduces neutrophil recruitment, reduces ams phagocytic ability and expression of several important recognition molecules, and impairs clearance of apoptotic cells through oxidant-dependent activation of rhoa [60, 61]. in current smokers, the exposure to cigarette smoke affects several important recognition molecules on ams and downregulates cd31, cd91, cd44, and cd71 on these cells. ams with defective phagocytosis lead to chronic inflammation and significantly increase the likelihood of developing chronic obstructive pulmonary disease, lung injury, and cancer (figure 1). the infiltration of alveolar macrophages promotes the death of tumor cells in those sites of primary tumor growth and/or metastasis in lung. the antitumor activity of alveolar macrophages from lung cancer patients decreases with increased metastasis, tumor size, and development of pleural invasion. the onset of malignant disease triggers the immune response recruiting tams into the tumor site. high numbers of intratumor tams have been linked with invasion, angiogenesis, hypoxia, and early occurrence of metastasis in different tumor types including lung cancer [48, 50] (figure 2). in patients with nsclc, the m1 macrophage phenotype has been associated with the expression of il-1, il-12, tumor necrosis factor- (tnf-), and inos and also has been correlated with extended survival time. in a study, m1 tams were identified using cd68 and inos markers in tumor compared to nontumor tissue in nsclc patients. results indicate that inos expression is lower in tissues from patients with adenocarcinoma and squamous cell carcinoma compared to nontumor tissues but surprisingly this was not the case in large cell lung carcinomas. the classically activated m1 macrophages produce effector molecules such as reactive oxygen intermediates, reactive nitrogen intermediates, and tnf, to limit tumor growth. overall there is an association of m1 tams with better lung cancer prognosis. at the other end are the alternatively activated m2 macrophages which have been correlated with tumor initiation, progression, metastases, by secretion of matrix-degrading enzymes, angiogenic factors, and immunosuppressive cytokines chemokines, inhibiting inflammation [65, 67, 68]. m2 macrophages polarized by cigarette smoke lead to proliferation, migration, and invasion of alveolar basal epithelial cells, and exposition to these cigarette smoke-induced m2 macrophages also significantly increased the cell population in g2/m phase causing proliferation in lung cancer cells. in nsclc, the concentration of macrophages m2 was 70% in comparison with 30% m1. density of macrophages m1 in the tumor islets, stroma, or islets and stroma was positively associated with patient's survival time. also, neutrophils are also polarized into n1/n2 subgroups, n1 being proinflammatory, while n2 is anti-inflammatory. n1 and n2 represent a dichotomy in neutrophil subpopulations present in patients and animal models with cancer where they play distinctive roles in the pathogenesis of disease. they displayed an activated phenotype that included chemokine receptors as ccr5, ccr7, cxcr3, and cxcr4. also, tans produced proinflammatory factors mcp-1, il-8, mip-1, and il-6, as well as the anti-inflammatory il-1r antagonist. also, tans exhibit high activated phenotype compared with peripheral neutrophils. in cancer patients, tans could drive antitumoral immunity through regulating cytotoxic t lymphocytes. in early stages of lung cancer disease, tans increased t cell ifn- production and activation and increase t cell proliferation. the blockage of tgf- is able to polarize n2 tans to n1 tans in murine models of mesothelioma and lung cancer. if apoptotic neutrophils within the tissues are not removed in an efficient and timely manner, they will become necrotic and release cytotoxic granule proteins that may perpetuate host tissue damage. thus, neutrophils apoptosis and clearance is a critical limiting factor for the successful resolution of inflammation. in colon adenocarcinoma cell line, so far, the possible mechanisms by which neutrophils are increased in nsclc patients have not been described; despite this, these cells are dysfunctional; increased levels of il-8 could explain this accumulation; however, the mechanisms by which this occurs are not known. neutrophils are recruited to tumor sites through transendothelial migration involving the cd47:sirp recognition (signal regulatory protein alpha) creating an inflammatory environment. malignant cells escape phagocytosis displaying high levels of cd47 on their surface which binds to sirp in macrophages and dendritic cells. after binding to sirp, cd47 induces a dephosphorylation cascade preventing phagocytosis through impaired synaptic myosin accumulation. in this way, cd47 can regulate the function of cells in the monocyte/macrophage lineage [8082]. cd47 is a ubiquitous cell-surface molecule from the immunoglobulin (ig) superfamily that interacts with sirp, thrombospondins, and integrins. cd47 was first isolated in association with integrin in neutrophil granulocytes and was later shown to regulate integrin function [84, 85]. it plays a role in cellular processes like proliferation, apoptosis, adhesion, and migration and in immunological processes such as inflammatory response, immune response, and tumor immunity [87, 88]. this receptor is recognized as a marker of self highly expressed by circulating hematopoietic stem cells, red blood cells, macrophages, macrophages neutrophils, and many cancer types. cd47 has also been identified as a tumor marker, and its dysregulation contributes to cancer progression and evasion of antitumor immunity [9194]. cd47 is expressed ubiquitously whereas its counter-receptor sirp is more abundant in myeloid-lineage cells such as macrophages, neutrophils, and dendritic cells. several processes are regulated through the cd47:sirp signaling system of macrophages, including phagocytosis mature red blood cells (rbcs) in the spleen, phagocytosis of senescent cells and apoptotic bodies, rejection of transplants of hematopoietic stem cells (hscs), and immunosurveillance thereby preserving tissue integrity and function [9699]. remarkably, there are many factors positively regulating phagocytosis while sirp-cd47 is the only negative regulator preventing self-phagocytosis. cd47 is critical for transepithelial and transendothelial migration of neutrophils or polymorphonuclear leukocytes (pmn) facilitating diapedesis through endothelial cells while targeted cd47 deletion decreases neutrophil extravasation [100, 101]. the sirp-cd47 interaction initially recruits pmns to tumor sites or sites of injury but later negatively regulates these cells to end the inflammatory response. however, in a postacute stage of inflammation, neutrophils experience cleavage of the cytoplasmic signaling domains of sirp, correlating with increased recruitment and neutrophil-associated damage. truncated sirp acts like a decoy, able to bind cd47 but not signaling intracellularly therefore maintaining the inflammatory microenvironment and being a caveat for cd47 targeted therapies [102105]. additionally, sirp binding to cd47 in vitro downregulates cd18 as marker of neutrophil activation thus playing a role in the inflammatory activation state of pmns [106, 107]. the dual role of cd47 in promoting inflammation through neutrophil migration and recognition of self through blocking phagocytosis in macrophages plays a role in the development of cancer and later in tumor immune evasion. loss of cd47 induces phagocytosis by macrophages in vitro and blocks tumor development and metastasis in vivo. this receptor is strongly overexpressed in several cancer types including both hematological and solid tumors [80, 91, 109, 110]. a high cd47 expression has been a poor prognostic factor for patients with these diseases [80, 111, 112]. cd47 is also highly expressed in tumor initiating cells (tics) or cancer stem cells (csc) where it is a marker of more aggressive tumor cells, with higher metastatic potential, and less sensitive to engulfment by macrophages, thereby escaping from immune surveillance while increasing cell proliferation through activation of the pi3k/akt pathway [92, 113116]. therefore, cd47 becomes an attractive target for therapeutic approaches with both antitumor and anti-inflammatory properties and anti-cd47 antibodies are being tested with positive results in preclinical and clinical settings [80, 111, 112, 117]. in lung cancer and in several types of cancers including breast, bladder, colon, pancreatic, and hematological cancers, blocking cd47 in tumor cells the cd47:sirp interaction is involved in the pathogenesis of lung cancer and other cancer types when tumors release cytokines promoting tumor growth and stimulating the conversion of macrophages from m1 to m2 phenotype. systemic administration of nanoparticles with anti-cd47 sirna showed efficient inhibition of lung metastasis to about 30% of controls. in patients with lung metastasis, the number of circulating tumor cells (ctc) with the phenotype epcam(+)cd44(+)cd47(+)met(+) were associated with poor overall survival and increased metastasis and cd47 was a marker associated with the fraction of metastasis-initiating cells within the pool of ctcs. antisense suppression of cd47 in squamous lung tumors prior to irradiation showed benefit obtaining a 71% tumor size reduction. this protection could possibly be exerted through thrombospondin-1 signaling to recover from radiation stress, revealing a strategy to protect normal tissues from radiation damage using anti-cd47 antibodies which could be useful in the application of combined radiation with targeted therapies in lung cancer. there is a close relationship between macrophage, neutrophil infiltration, and upregulation or cd47 with poor prognosis and lack response to treatment. nowadays, therapies are developed to block the interaction of tumor cells with macrophages through cd47, thereby offering an opportunity to turn tams against nsclc cells by allowing the phagocytic behavior of resident macrophages. also, anti-cd47 could regulate the recruitment of neutrophils into tumor and diminish the chronic inflammation figure 3. inhibition of csf-1 receptor, which is essential for macrophage differentiation significantly increased survival and suppressed established tumors, accompanied by decreased m2-like tam. treatment with metformin is able to reduce the metastases in vivo, through blocked matrix metalloproteinase-9 and expression of mmp-2, maintaining the components of the extracellular matrix, avoiding the separation of tumor cells, inhibiting the growth and metastasis of tumors. also, metformin prevented m2-polarization of macrophages regulated ampk1 and, besides, inhibited il-1 induced release of the proinflammatory cytokines il-6 and il-8 in macrophages [124, 125]. glycodelin (gene name paep) is a proliferation suppressor and apoptosis inducer of t cells, monocytes, b cells, nk, and regulated pulmonary immune response in asthmatic inflammation. however, atypical expression is observed in squamous cell carcinomas and adenocarcinomas of nsclc. in vitro, silencing by sirna-transfection of paep in two nsclc cell lines resulted in significant upregulation of immune system modulatory factors such as pdl1, cxcl5, cxcl16, mica/b, and cd83 as well as proliferation stimulators edn1 and hbegf. this kind of therapy provides a mechanism to overcome tumor immunosurveillance. as mentioned above, currently the only fda-approved immunotherapies for the treatment of nsclc are nivolumab and pembrolizumab. these antibodies inhibit checkpoint molecules such as ctl-4 and pdl-1, improving the survival and response to treatment. ctla-4 is thought to regulate t cell proliferation early in an immune response, primarily in lymph nodes, whereas pd-1 is upregulated in current smokers and suppresses t cells. these antibodies switch on immune system cells mediated by t cells, increasing their ability to recognize and destroy cancer cells [128, 130]. monoclonal antibodies specific for tumor cell antigens, coupled with appropriate cytokines, may provide rational basis for designing trials to employ the neutrophil cytotoxic potential as adjuvant therapy in cancer patients. chronic inflammation seems to play a major role in the onset and development of cancer. understanding the interaction between the cellular and molecular factors that mediate inflammation in nsclc, including the rather unexplored components of innate immunity such as macrophages and neutrophils, can elucidate novel targets affecting key oncogenic pathways in this malignancy and allow preventing cancer cell proliferation, angiogenesis, and metastasis. inhibiting cd47 as promoter of neutrophil extravasation and migration may reduce inflammation thereby preventing cancer, and blocking the antiphagocytic signal of cd47 on the surface of tumor cells can overcome immune suppression, harnessing the immune system to target malignant cells more effectively. on the other hand, the potential side effects should be addressed by careful selection of patient populations based on biomarkers such as tumor cd47 overexpression.

inflammation is a component of the tumor microenvironment and represents the 7th hallmark of cancer. chronic inflammation plays a critical role in tumorigenesis. tumor infiltrating inflammatory cells mediate processes associated with progression, immune suppression, promotion of neoangiogenesis and lymphangiogenesis, remodeling of extracellular matrix, invasion and metastasis, and, lastly, the inhibition of vaccine-induced antitumor t cell response. accumulating evidence indicates a critical role of myeloid cells in the pathophysiology of human cancers. in contrast to the well-characterized tumor-associated macrophages (tams), the significance of granulocytes in cancer has only recently begun to emerge with the characterization of tumor-associated neutrophils (tans). recent studies show the importance of cd47 in the interaction with macrophages inhibiting phagocytosis and promoting the migration of neutrophils, increasing inflammation which can lead to recurrence and progression in lung cancer. currently, therapies are targeted towards blocking cd47 and enhancing macrophage-mediated phagocytosis. however, antibody-based therapies may have adverse effects that limit its use.

PMC4749813

pubmed-235

subjective cognitive complaints (scc) are quite prevalent among older adults, with some estimates suggesting that between 25% and 50% of all older adults have self-perceived memory impairment [1, 2]. in clinical practice, it is often difficult to assess the veracity and severity of subjective cognitive complaints, primarily because such complaints vary widely from individual to individual. as a result, clinicians and caregivers perhaps do not consider subjective complaints to have the same weight as objective findings. however, studies have shown that subjective complaints may be valid indicators of current and future cognitive impairment. a recent study by amariglio and colleagues showed that certain subjective complaints, such as i have trouble finding my way around familiar streets, are correlated with impairment in delayed recall, naming, and semantic fluency. a review conducted by jonker and colleagues showed that memory complaints may be predictive of dementia or alzheimer's disease onset within two to four years, especially in individuals with a diagnosis of mild cognitive impairment (mci). subjective cognitive complaints also have clinical implications that are outside the realm of cognitive function. a review by mol and colleagues found that scc correlated with depression, anxiety [4, 5], and low level of well-being, even in the absence of objective cognitive impairment. scc and objective cognitive function in older patients with and without major depression and found no changes in objective cognitive function between the two groups, but significantly more scc in the depressed group. scc have also been correlated with decreased functional ability, even when depression is controlled for. although the direction of causality between many of these variables remains unclear, scc should be considered in a clinical setting because of their associations with objective impairment, dementia, depression, low quality of life, and functional ability. previous research in the area of scc has largely focused on memory complaints [13, 7, 8]. in the current study, we have broadened the scope of scc in order to examine other areas of cognition that have shown impairment following complaints. the most common method appears to be a single, dichotomous, yes or no assessment of complaints (e.g., do you find that you have trouble with your memory ?) [713], or a combination of similar yes or no questions [3, 14, 15]. furthermore, most of the existing literature on scc examines community-dwelling, healthy, and older populations [3, 7, 9, 12, 16]. subjective cognitive complaints, in addition to predicting the onset of a neurodegenerative process, may yield important information about areas of impairment, specifically in patients with mild disease. two such disorders are mild cognitive impairment (mci) and its vascular equivalent, vascular mild cognitive impairment (vamci). differences in functional impairment between individuals with mci and those with vamci, which may be overlooked by objective cognitive testing, may be predicted by an analysis of significance of scc. in the current study, we compared the profile of scc in individuals with a diagnosis of mci to those with vamci using the neuropsychological impairment scale (nis). the nis is a comprehensive scale-based questionnaire, which may elicit differences in presence and severity of scc between the two groups. we hypothesized that the severity of subjective cognitive complaints would not differ between the two groups, because objective cognitive functioning is similar. however, we hypothesized that the specific types of scc might differ between mci and vamci, due to the differing pathologies of these two disorders. twenty patients with mci and twenty patients with vamci matched on demographic characteristics (age, education) were recruited from the memory disorders clinic at st. patients are referred to the clinic by their primary or secondary care physicians, for assessment and diagnosis of cognitive impairment. patients typically undergo a standardized history and a standardized cognitive exam as part of the workup. in addition, routine blood work including tsh, b12, and rbc folate is done to rule out reversible causes of dementia. as well, most patients receive structural imaging (either computed tomography (ct) or magnetic resonance imaging (mri)) and in some cases functional imaging (single photon emission computed tomography (spect)). for this study, only patients clinically diagnosed with either mci or vamci were recruited. the diagnostic criteria for mci describe cognitive impairment which is more severe than normal aging but less severe than dementia and typically not associated with serious impairment in everyday functions. vamci is described as the vascular equivalent of mci, thereby indicating a similar level of objective cognitive performance despite possible differences in mechanism and etiology. currently, there are no specific neuroimaging or vascular criteria that are necessary for a diagnosis of vamci. some patients underwent mri scans instead of ct scans as part of their clinical visit. as we used different imaging modalities we could not compare degree of white matter disease across study subjects in a quantifiable manner. rather, patients were assigned to the vamci group if scans showed evidence of white matter lesions, lacunar infarcts, and/or moderate to severe microangiopathic change. cognitive testing and data intake occurred during the patients ' initial visits to the clinic. follow-up visits to the memory disorders clinic were not considered for this cross-sectional analysis. subjective cognitive complaints were assessed using the neuropsychological impairment scale (nis) [20, 21]. the nis is a questionnaire consisting of 95 complaints, such as i am forgetful and i am easily distracted. subjects rated these statements on a five-point likert scale according to applicability and intensity. when scored, the nis divides complaints into seven domains: critical items (e.g., head injury, stroke, and dizziness), cognitive efficiency (e.g., confusion, mental slowness), and attention, memory, frustration tolerance, verbal learning, and academic skills (e.g., counting change, learning new tasks). the nis also includes three scores that give a general, comprehensive picture of complaints: the global measure of impairment (gmi) score is a simple sum of all domain subscores; the total items circled (tic) score indicates how many complaints are reported; and the symptom intensity measure (sim) score indicates the average intensity of complaints. the nis also includes three validity checks: defensiveness, inconsistency, and affective disturbance. thus, the nis can detect if subjects are overly defensive or inconsistent; and the affective disturbance validity check controls for levels of depression and other emotional disturbances. the mini-mental state examination (mmse) was used to measure cognitive performance from a general perspective. the bna consists of five subcategories: memory, attention, naming, visuospatial function, and executive function. functional ability was objectively assessed using the older american resources and services (oars) activities of daily living questionnaire. this questionnaire assesses fourteen activities of daily living (adls): seven basic adls (eating, dressing and undressing, grooming, walking, getting in and out of bed, bathing, and going to the bathroom) and seven instrumental adls (using the telephone, traveling, shopping, preparing meals, doing housework, taking medications, and handling money). subjects were asked about their own ability to perform the above adls; where possible, informants who knew the subjects well were asked to supplement and verify responses. mean scores for each group (mci and vamci) were compared via an independent samples t-test. age, education, and other demographic factors were also compared between the two groups. the mci and vamci groups were matched on demographic measures such as age, years of education, and hollingshead two-factor index of social position (table 1). functional ability, as measured by the oars questionnaire, was also similar between the two groups (p=0.919) (table 2). objective cognition function was measured by the mmse and the bna (table 2). mmse scores were similar between the two groups (p=0.330), which implies similar levels of general cognitive function. overall bna scores were also similar between the mci and vamci groups (p=0.177). scores from subcategories of the bna were also compared between groups to look for specific areas of cognitive impairment (table 2). performance on all subcategories of the bna (attention, memory, naming, visuospatial function, and executive function) was similar between mci and vamci groups. performance on the individual tasks which comprise the above five subcategories was also similar between groups, with the exception of the explaining proverbs task (p=0.034). on this task, which falls into the subcategory of executive function, mci subjects averaged a better score than vamci subjects (3.15 compared to 2.30). despite similar performance on objective functional and cognitive measures (oars, mmse, and bna), the mci and vamci groups achieved markedly different results when subjective cognitive complaints were assessed by the nis. in general, vamci subjects had significantly higher scores on the nis than mci subjects (table 3); higher scores indicate greater scc. the nis global measure of impairment (gmi) score gives a broad, comprehensive view of complaints. the vamci group averaged a gmi score of 117.0, compared to just 79.3 for the mci group (p=0.050). a qualitative analysis of the total items circled (tic) scores shows that vamci subjects had a greater number of complaints than mci subjects (52.8 compared to 44.2); however this difference was not statistically significant (p=0.136). the symptom intensity measure (sim) scores reveal that vamci subjects ' complaints were greater in severity than those of mci subjects (2.0 compared to 1.7); however, again, this difference was not statistically significant (p=0.065). thus, we can not attribute the difference in gmi scores to just one cause. rather, it is likely that difference in gmi scores stems from differences in both complaint quantity and complaint severity. quantitatively, the vamci group had higher scores in all seven domains of the nis (table 3). four of these domains yielded differences in scores that were statistically significant: critical items (p=0.017), cognitive efficiency (p=0.043), memory (p=0.046), and verbal learning (p=0.027). the nis also includes three validity checks to test for defensiveness, affective disturbance, and inconsistency. in our sample of subjects, there was no statistical difference in any of the above variables between the mci and vamci groups (table 3), confirming that the complaints were valid. although vamci subjects had qualitatively higher scores on the three validity measures, their scores were not significantly different from those of the mci group. mci and vamci are clinical conditions that precede the development of neurodegenerative disorders including alzheimer's disease and vascular dementia, respectively. apart from differences on neuroimaging there has been very little study of how these two clinical conditions differ in terms of their subjective and objective clinical profiles. taken altogether, our findings from the mmse, bna, oars, and nis show that despite similar levels of functional ability and objective cognitive function, vamci subjects have significantly more scc than mci subjects. our findings support the existing view of mci and vamci as disorders with similar presentations with regard to objective function, but ultimately different etiologies. as previously discussed, mci and vamci subjects were matched on age, education, and social status and achieved statistically similar scores on the mmse and bna. the one component of the bna that differed between the two groups was the explaining proverbs task; however, this seeming disparity may have resulted from differences in cultural background. in our sample of patients from the diverse city of toronto, 17 out of 40 subjects (unfamiliarity with english proverbs certainly confounded this result and may explain this difference observed on the bna. leaving aside this single anomaly, our findings show that mci and vamci subjects had comparable levels of objective cognitive function. however, our findings from the nis questionnaire show that vamci subjects had more subjective cognitive complaints than their mci counterparts. this discrepancy suggests that vamci patients are exhibiting particular cognitive deficits, which are not identified by the bna, or that vamci patients are more sensitive to and aware of mild deficits in these particular areas. the nature of vamci-specific deficits may be determined from the domains in which vamci patients report greater complaints: critical items, cognitive efficiency, memory, and verbal learning. the critical items domain references events in a patient's history that are evident predictors of cognitive difficulty: dizziness, concussion, head trauma, stroke, and so forth. vamci subjects reported greater complaints in this domain than mci subjects; this finding may be explained by simply considering the diagnostic criteria of vamci compared to those of mci. as mentioned above, history of clinical stroke can differentiate vamci from mci. a vamci patient is more likely than an mci patient to have experienced stroke or stroke-like symptoms, so he/she is more likely to have complaints in the critical items domain. vamci subjects ' greater complaints in the memory, verbal learning, and cognitive efficiency domains may be explained by examining the pathology of vamci, which differs from that of mci upon neuroimaging. a study by vannorsdall et al. found that white matter hyperintensities in both periventricular and subcortical regions correlated with poorer working memory. found that deep white matter hyperintensities correlated with decreased performance on verbal fluency tasks, while periventricular hyperintensities were not associated with any particular domain. white matter lesions have also been correlated with slowed information processing [25, 27]. recent research has demonstrated that this decrease in processing speed may be specific to white matter lesions in the anterior thalamic radiation. our analysis may be hampered by the limitations of our cognitive testing methods. in this study, the mmse and bna may have suffered from ceiling effects, which would have masked any differences in cognitive function between the mci and vamci groups. however, the advantages of the mmse and bna are numerous and informed our decision to use these tests. in addition, more sensitive cognitive testing would not have been possible at the study facility, given the amount of time allotted for a clinical visit. the differences we have found in scc between mci and vamci groups may suggest a need for alternate cognitive testing methods, which, unlike the mmse or bna, would elicit different results between the two groups and would not suffer from ceiling effects. our study has demonstrated that vamci patients may be exhibiting particular cognitive deficits in memory, verbal learning, and cognitive efficiency, separate from those exhibited by mci patients. these deficits may be explained by the greater white matter burden in vamci patients, as compared to age-matched mci patients. further research should be done to elaborate on the nature of vamci-specific deficits, particularly in the domains we have identified in this study. as well, vamci-specific deficits should be related to neuroimaging findings, in order to associate deficits with particular locations and severities of white matter disease. finally, tools for more sensitive cognitive testing must be developed, so that we may identify vamci-specific cognitive deficits.

objective. vascular mild cognitive impairment (vamci) is differentiated from mild cognitive impairment (mci) by the presence of vascular events such as stroke or small vessel disease. typically, mci and vamci patients present with subjective complaints regarding cognition; however, little is known about the specific nature of these complaints. we aimed to create a profile of subjective cognitive complaints in mci and vamci patients with similar levels of objective cognitive performance. methods. twenty mci and twenty vamci patients were recruited from a memory disorders clinic in toronto. subjective cognitive complaints were assessed and categorized using the neuropsychological impairment scale. results. mci and vamci patients achieved similar scores on measures of objective cognitive function (p>0.100). however, the vamci group had more subjective complaints than the mci group (p=0.050), particularly in the critical items, cognitive efficiency, memory, and verbal learning domains of the neuropsychological impairment scale. conclusions. our findings support the idea that vamci and mci differ in their clinical profiles, independent of neuroimaging. vamci patients have significantly more subjective cognitive complaints and may be exhibiting particular deficits in memory, verbal learning, and cognitive efficiency. our findings promote the need for further research into vamci-specific cognitive deficits.

PMC3830842

pubmed-236

the 42 participating spanish hospitals were selected according to earss criteria (1,7). the total catchment population was 9 million people, or 22.5% of the spanish population. the first blood e. coli isolates obtained from each patient between 2003 and 2006 were included. each laboratory identified the strains and tested their susceptibilities according to standard microbiologic procedures; all used commercial microdilution systems. susceptibility data were interpreted according to clinical laboratory standards institute criteria (8). for epidemiologic purposes, intermediate susceptibility to amc was considered as resistance. multidrug resistance was defined as resistance to>3 of the following antimicrobial agents: ciprofloxacin, gentamicin, cotrimoxazole, and cefotaxime. to assess the comparability of susceptibility test results, an external quality assurance exercise (uk national external quality assessment scheme) was performed yearly. hospital-acquired infections were defined as infections acquired at least 48 hours after hospital admission. outpatient consumption of penicillin/-lactamase inhibitors (world health organization code j01cr02) for the period 20022006 was assessed from the especialidades consumo de medicamentos database, which showed retail pharmacy sales of all medicines acquired with national health system prescriptions and covered nearly 100% of the spanish population (5). the information was tabulated, and the number of units was converted into defined daily doses (ddd) of active drug ingredients according to who methodology (9). the number of ddd per 1,000 inhabitants per day (dids) was calculated for each active drug ingredient. differences in the antimicrobial resistance prevalence between different groups were assessed by fisher exact test. association was determined by calculation of the odds ratio (or) with 95% confidence intervals (ci). statistical analyses were performed by using graphpad prism version 3.02 software (graphpad software, inc. participating hospitals reported data on 9,090 cases of e. coli bacteremia during the study period, corresponding to the same number of patients; 4,526 (49.8%) were male patients and 4,564 (50.2%) were female patients. a total of 1,531 cases (16.8%) were diagnosed in 2003; 2,526 (27.8%) in 2004; 2,438 (26.8%) in 2005; and 2,597 (28.6%) in 2006. of the total number of isolates, 328 (3.6%) were obtained from children<14 years of age; 2,857 (31.4%) were obtained from patients>15 and<64 years of age; and 5,909 (65%) were obtained from patients>64 years of age. there were 3,384 (37.9%) isolates implicated in hospital-acquired infections and 5,540 (62.1%) in community-acquired infections; information was missing for 166 cases. of the 9,090 e. coli isolates tested, 1,136 (12.5%) were nonsusceptible to amc, 5.1% were resistant, and 7.4% were intermediate. the prevalence of amoxicillin/clavulanic acid nonsusceptibility in relation to gender, age, infection origin, and resistance to other antibimicrobial drugs is detailed in the table.*the most prevalent phenotypes included multidrug resistance to ciprofloxacin, cotrimoxazole, and gentamicin, which was detected in 73 nonsusceptible amc isolates (36.9% of multiresistant isolates and 6.4% of isolates overall), and resistance to ciprofloxacin, cotrimoxazole, and cefotaxime was detected in 55 isolates (27.8% of multiresistant isolates; 4.9% of isolates overall). multidrug resistance was more prevalent in nosocomial (23.5%) than in community-acquired isolates (15.1%; or 1.99, 95% ci 1.462.72; p<0.0001). among nonsusceptible amc isolates, susceptibility to other antimicrobial drugs, including ciprofloxacin, gentamicin, cefotaxime, and cotrimoxazole, was more frequent in community- (28.7%) than in hospital-acquired isolates (13.3%; or 1.68, 95% ci 1.272.22; p=0.0003). the overall rate of invasive e. coli nonsusceptibility to amc increased from 9.3% (2003) to 15.4% (2006) (test for trend 36.51; p<0.0001) (figure 1); this increase was observed in 64.3% of the participant hospitals. this increase was also detected in both intermediate and resistant isolates, with annual distributions of 5.6% and 3.8%, respectively, in 2003; 6.8% and 4.8% in 2004; 7.5% and 5.4% in 2005; and 9.4% and 6% in 2006. evolution of amoxicillin-clavulanic acid nonsusceptibility of escherichia coli from blood isolates, spain, 20032006. amc nonsusceptibility according to age groups increased over the study period as follows: children<14 years of age (10.6% in 2003, 14.6% in 2004, 14.3% in 2005, and 16.3% in 2006); patients>15 and<64 years 9.6% in 2003, 11.2% in 2004, 11.7% in 2005, and 13.3% in 2006); patients>64 years (8.8% in 2002, 11.3% in 2004, 15.9% in 2005, and 16.3% in 2006). the prevalence of amc nonsusceptibility in community-acquired infections increased from 8.9% (2003) to 15.6% (2006) (test for trend 29.43; p<0.0001). amc nonsusceptibility in nosocomial infections increased from 9.2% (2003) to 15.2% (2006) (test for trend 11.94; p=0.0006). in the final 2 years of the study period (20052006) this increase was due to community-acquired e. coli isolates only; the nonsusceptible proportion varied from 11.5% (2005) to 15.6% (2006) (or 1.42, 95% ci 1.161.74; p=0.0009) in community-acquired isolates compared with 15.4% (2005) to 15.2% (2006) in hospital-acquired isolates (figure 1). community-acquired infection probably included healthcare-associated infections, a recently described epidemiologic category distinct from both community-acquired and nosocomial status. in this study, the number of blood isolates of e. coli producing extended-spectrum -lactamase (esbl) was 614 (6.7%); 188 of them (30.6%) were nonsusceptible to amc. when esbl-producing e. coli isolates were excluded from analysis, amc nonsusceptibility increased from 8.4% (2003) to 14.3% (2006) (test for trend 34.39; p<0.0001) in total isolates; from 8.2% (2003) to 14.5% (2006) (test or trend 25.23; p<0.0001) in community-acquired isolates; and from 8.9% (2003) to 13.3% (2006) (test for trend 6.35; p=0.012) in hospital-acquired isolates (figure 1). the proportion of isolates highly susceptible to amc (mic<4 mg/l) steadily decreased over the study period as follows: 70.2% (2003), 70% (2004), 64.8% (2005), and 57.4% (2006) (test for trend 99.36; p<0.0001). community consumption of penicillin/-lactamase inhibitors, predominantly amc, increased 34.7% from 2000 to 2006 (figure 2), whereas total antimicrobial drug consumption remained relatively constant (19.6 dids in 2000 compared with 19.1 dids in 2006). after amc, the most used -lactam antimicrobial agents in the community in spain were amoxicillin, cefuroxime, and cefixime; their consumption did not vary or slightly decreased from 2002 through 2005 (6). evolution of consumption of outpatient penicillin/-lactamase inhibitors (world health organization code j01cr02), spain, 20002006. the increased amc resistance of e. coli isolates from blood observed in this study is of serious concern from clinical and epidemiologic standpoints because amc is the first-choice antimicrobial treatment for many invasive e. coli infections. increased amc resistance coincided with growing amc consumption at the community level. in urinary infections, previous treatment with amc is a risk factor for the development of amc resistance (10). amc resistance mechanisms (-lactamase overproduction, ampc cephalosporinase hyperproduction, and inhibitor-resistant penicillinases) (11) might be favored by strong amc consumption.

to determine the evolution and trends of amoxicillin clavulanic acid resistance among escherichia coli isolates in spain, we tested 9,090 blood isolates from 42 spanish hospitals and compared resistance with trends in outpatient consumption. these isolates were collected by spanish hospitals that participated in the european antimicrobial resistance surveillance system network from april 2003 through december 2006.

PMC2600377

pubmed-237

a 51-year-old caucasian female was referred to our institution because of an abnormal nodule detected in her right lung. this had at first been detected four months earlier when she underwent an urgent hartmann procedure due to refractory adenocarcinoma of the sigmoid colon (pt4n1 stage). due to the urgency of the surgery, the patient was not staged prior to the surgery but was initially staged after the operation. the only pathologic finding in the computed tomography (ct) of the lung was a nodule in the lower right lobe of 2.5 cm at its longest dimension (fig. she received 4 cycles of chemotherapy for the sigmoid adenocarcinoma before she was referred to us for excision of what was believed to be a single metastatic nodule. although the radiologic findings supported a benign tumor, neither positron emission tomography-ct nor any other procedure to attempt to diagnose the nodule was performed due to the patient's willingness to undergo complete removal of the mass even if it were benign. the patient underwent video-assisted thoracoscopic (vats) wedge excision of the tumor. the specimen of the resected lung contained a firm intrapulmonary white-colored well-defined mass with dimensions of 2.52.32.2 cm. microscopically, the tumor had a " patternless pattern, " with proliferation of bland spindle cells in alternating hypocellular and hypercellular areas, accompanied by a collagenous stroma (fig. the tumor had no evidence of increased mitotic activity (0 to 1 mitoses per 10 high power fields using an olympus bh-2 microscope, with a 40 field, 0.5 mm diameter, and area of 0.196 mm), any significant atypia, or necrosis. immunohistocemically, the tumor cells were positive for vimentin, cd34 (fig. 2c), and bcl-2. the index of cellular proliferation with the antibody ki-67 is low and estimated at<1% of the cellular population. immunohistochemistry staining of the tumor cells was negative for alfa-smooth muscle actin (sma), muscle specific actin (hhf-35), h-caldesmon, cd117 (c-kit), s-100 protein, epithelial antigens (wide spectrum cytokeratins [ae1/ae3] and epithelial membrane antigen), and thyroid transcription factor-1. solitary fibrous tumors (sfts) were first pathologically described by klemperer and rabin in 1931. to the present, sft is the preferred term for an uncommon, but histomorphologically distinctive spindle cell neoplasm, that was identified in the past as fibrous mesothelioma, localized fibrous mesothelioma, localized fibrous tumor, localized mesothelioma, pleural fibroma, solitary fibrous mesothelioma, or submesothelial fibroma. there are reports of sfts arising either from mediastinal, diaphragmatic, or parietal pleura, or from within a lung fissure and in various extrapleural locations, such as the retroperitoneum, mediastinum, thyroid gland, nasal cavities, meninges, or parietal surfaces of the intra-abdominal viscera. less than 20 cases of intraparenchymal sfts have been reported in the english literature [1-5]. to prove and establish the fact that these lesions are indeed of pulmonary origin, it is important to consider the clinical, radiologic, and pathologic findings to demonstrate the lack of continuity with the visceral pleura and to exclude an endophytic growth in a pleural-based lesion. hypoglycemia and seizures can be encountered in some cases due to secretion of insulin-like growth factor ii by the tumor [1-3,5]. hemoptysis due to sft as well as hypertrophic osteoarthropathy secondary to sft of the lung has also been reported. there is no association with smoking or asbestos exposure. due to its non-specific symptoms, it can potentially mimic solitary pulmonary metastasis, as was the case with our patient. on gross examination, histologically, it is associated with variable patterns, the most common being the " patternless pattern. " the cytologic features consist of cellular areas composed of spindled to ovoid cells with scanty cytoplasm, occurring either solely or in groups. immunohistochemistry plays a substantial role in supporting the diagnosis made by morphologic features and is also helpful in differentiating these tumors from mesothelioma, neurofibroma, and other spindle-cell lesions. a differential diagnosis of intrapulmonary sft includes, among other lesions, pulmonary adenofibroma, benign neural neoplasms, leiomyoma and leiomyosarcoma, synovial sarcoma, spindle cell thymoma, spindle cell carcinoid tumor, nerve sheath tumor, fibrosarcoma, sarcomatoid carcinoma, and sarcomatoid mesothelioma. the morphologic features and immunohistochemical profile of sft are sufficiently distinct to allow separation from such conditions in the majority of the cases. several studies have reported positivity of tumor cells with cd34 antibody in almost 100% of cases, and with cd99 antibody in 70% of cases, whereas bcl-2, sma, and epithelial membrane antigen are positive in 20% to 35% of the cases. the histologic criteria for classifying the malignant variants of sft of the lung and pleura were described by england et al. in 1989 and vallat-decouvelaere et al. in 1998. they established the following features suggestive of malignancy: 1) more than 4 mitoses per 10 high-power fields, 2) presence of necrosis, 3) hemorrhage, 4) hypercellularity as detected by nuclear crowding and overlapping, 5) nuclear atypia, 6) pleomorphism, 7) stromal or vascular invasion, and 8) size exceeding 10 cm.. the absence of these characteristics does not exclude malignant behavior. on the other hand, encapsulation, pedunculated and resectability with free surgical margins are considered to be favorable prognostic factors even in histologically malignant variants. positive margins are associated with an aggressive clinical course and high rates of local recurrence and metastasis. resection with free margins is considered to be the treatment for sft located either in the lung or on the pleura. wedge resection may be accomplished by vats or standard thoracotomy, according to the anatomic position and size of the lesion and the experience of the surgeon. adjuvant therapy may have a place in recurrent or systemic disease, but its benefit is undefined. in general, sfts have an unpredictable course, depending on their potential for malignancy. in large series, the recurrence rate of benign sfts is reported to be low (1.4%), while the recurrence rate of malignant variants is reported to be higher (range, 9% to 19%). a staging system based on pedunculated versus sessile attachment and malignant versus benign histology that predicts recurrence has been proposed by perrot et al. (table 1). due to the possibility of local recurrence and/or distal metastasis after surgical removal of the primary sft, long-term follow-up is recommended. local recurrence detected early is amenable to reoperation and resection, with good long-term results. the long-term survival rate for both benign and malignant variants is reported to be more than 90% [1-3,6]. in conclusion, sfts are neoplasms that usually arise from the pleura. an intraparenchymal or endobronchial location is a rare occurrence. resection with clear margins is curative and final diagnosis and prognosis can be defined only after surgical resection. the prognosis of patients with rare sfts of the lung depends on the completeness of the tumor resection. variants of sfts of the lung that are malignant or suspected to be malignant should be managed as lung cancer with regard to the surgical resection of the tumor and follow-up strategy.

solitary fibrous tumor is a rare spindle cell mesenchymal tumor entity, with either benign or malignant behavior that can not be accurately predicted by histological findings. an intrapulmonary site of origin is even rarer. we report a case of a 51-year-old woman in whom an abnormal nodule in the lower right lung was detected during staging for sigmoid adenocarcinoma. the nodule was excised and pathological examination revealed an intrapulmonary solitary fibrous tumor.

PMC3756163

pubmed-238

malakoplakia is a rare chronic inflammatory disease that occurs most commonly in the genitourinary tract, especially the urinary bladder. most patients have associated conditions characterized by some degree of immunosuppression, as seen in solid-organ transplants, autoimmune diseases requiring steroid use, chemotherapy, chronic systemic diseases, alcohol abuse and poorly controlled diabetes.1) despite some characteristic histological features including the presence of large histiocytes with clusters of michaelis-gutmann (mg) bodies, malakoplakia of the kidney is difficult to diagnose because of its rarity and varying histological pictures.2) to our knowledge, there have been no case reports of malakoplakia of the kidney in a secondary adrenal insufficiency from korea. here, we report an unusual case of renal malakoplakia involving the perirenal space and extending to the descending colon in a 65-year-old korean woman with secondary adrenal insufficiency and diabetes mellitus. in march 2010, a 65-year-old woman was transferred from the national police hospital (nph) to our facility, shinchon severance hospital (seoul, korea) via the emergency room (er), presenting with a decreased level of consciousness. according to her medical history, she had hypertension, diabetes mellitus for 10 years, recurrent cystitis, and degenerative arthritis. she had been taking dexamethasone (5 mg, once a day) for the degenerative arthritis for approximately five years up to the time of admission. three weeks before the admission, she had been hospitalized at nph due to drowsy mentality for 3 or 4 hours. on the day of admission at nph, she presented with a fever (38.8) and dyspnea. the patient was given antibiotics (ceftriaxone and azithromycin) for 14 days, on suspicion of community-acquired pneumonia. thereafter, her presenting symptoms were improved, but she complained of consistent pain in the left lower quadrant of the abdomen. abdomen-pelvis computed tomography (ct) scan was performed, which showed the mass-like lesion in the left renal area suspecting abscess. while being treated with ciprofloxacin, she developed a decreased level of consciousness. upon physical examination on the day of the admission to our hospital, her initial vital signs were as follows: blood pressure 134/71 mm hg, pulse rate 95 bits per minute, body temperature 36.4, and respiration rate 18 breaths per minute. her breathing sound was clear, and her heart sound was normal without any murmurs. laboratory studies had the following results (reference values): low sodium (na) levels of 112 mmol/l (135.0-145.0), potassium (k) 3.4 mmol/l (3.5-5.5), chloride (cl) 77.0 mmol/l (98-110), total co2 21.0 mmol/l (24-30), low serum osmolality 240.0 mosm (289.0-308.0), and normal urine osmolality 315.0 (50.0-1200). initial urinalysis results showed 3-5 white blood cells/high-power field and yeast-like organisms. in the radiological examination, there was no acute ischemic lesion in the brain magnetic re sonance imaging and angiography with neck angiography (3d), and no specific finding on the chest x-ray. sodium replacement therapy for hypotonic euvolemic hyponatremia had been started from the day of admission. at that stage, secondary adrenal insufficiency due to exogenous steroid was suspected. a low dose adrenocorticotropic hormone (1 g cosynthropin) stimulation test was conducted to diagnose the secondary adrenal insufficiency. the stimulation test showed that there was adrenal insufficiency; basal level of cortisol 8.56 g/dl, peak level during the hour-long test 13.94 g/dl (table 2). steroid hormone (hydrocortisone sodium succinate; solucortef) was replaced. on the third day after admission, her general condition including clear consciousness was improved, with a normal level of serum sodium (136 mmol/l), and her steroid hormone dosage had been gradually tapered down and was maintained at 7.5 mg (5 mg, 2.5 mg two times a day) of prednisolone acetate. however, the patient complained of myalgia, which was accompanied with leukocytosis (white blood cell count 13,650 g/l [neutrophil 84.9 %]). radiological reading of the abdomen-pelvic ct conducted on the second day after admission showed that there was an ill-defined inflammatory lesion with multifocal abscess pockets in the left perirenal space, which was suspected of actinomycosis of the descending colon, extended to the left kidney (figure 1a). compared to the abdomen-pelvic ct finding performed outside, the lesion seemed to have decreased slightly in size. urinalysis was repeated and showed many white blood cells per high-power field and yeast-like organisms, which was confirmed as yeast in the urine culture. considering the laboratory and radiologic findings, intravenous antibiotic treatment was started (ubacillin 1,500 mg a day) for suspected actinomycosis. no specific lesion was found at the colonoscopy performed to confirm the diagnosis of actinomycosis. on the 12th day after admission the histology of the lesion showed a collection of foamy histiocytes also known as von hansemann cells with von-kossa stain positive spheres (michelis-gutmann body) (figure 2). the patient presented dysuria and urgency, and antibiotic treatment was changed to oral ciprofloxacin (500 mg a day). on the 15th day after admission, she was discharged, as her presenting symptoms and laboratory findings were improved. about 4 months after discharge, the patient was readmitted presenting with general weakness for one month. the findings of the abdomen-pelvic ct conducted upon readmission (figure 1b) showed that the extent of the malakoplakia in the perirenal space had decreased since 9 week prior, as she had been taking the oral antibiotics. she has had follow-up in our outpatient clinic ever since, taking oral trimethoprim-sulfamethoxazole. malakoplakia is an uncommon but distinctive type of chronic granulomatous inflammation. upon microscopic examination, malakoplakia is characterized by the presence of sheets of histiocytes with granular cytoplasm (von hansemann cells) and the formation of intracellular bacterial inclusions called michaelis-gutmann bodies.3-7) the pathogenesis is poorly understood, but it is thought to result from acquired bactericidal defects in macrophages occurring mostly in patients with chronic debility or immunosuppression, a kidney transplant requiring steroids, or azathioprine.8,9) these observations suggest that an altered immune response may play a role in the pathogenesis of the disease. individuals with diabetes mellitus have a greater frequency and severity of infection. from the earliest reports on studies of adrenocortical function, there has been impressive evidence that adrenocortical hormone, and more specifically cortisol, is essential for normal immunity. otherwise, prednisone, triamcinolone, dexamethasone and similar commercially popular steroids have the dangerous side-effect of lowering resistance to infection, which is common to all known glucocorticoids.10) according to previous studies, gram-negative bacteria, particularly escherichia coli, have been isolated from involved sites of genitourinary malakoplakia in more than two-thirds of patients.11) bacteria other than yeast were not isolated in the urine culture in the present case with cystitis because the patient was on antibiotic therapy before admission to our hospital. although we did not carry out a detailed investigation of the patient's immunity, we believe that unilateral renal malakoplakia extending to the perirenal space and the descending colon, as observed in the present case, may result from an interaction between various factors such as bacterial infection, impaired host immune response and diminished leukocyte function under the influence of a systemic illness such as secondary adrenal insufficiency and diabetes mellitus. the common presenting features of malakoplakia of the kidney are high fever, loin tenderness, and a palpable mass with a history of urinary tract infection.8) based on the reported studies, the degree of decreased kidney function varies up to acute renal failure.12,13) ultrasound and ct features are variable and only briefly mentioned in many reviews. features include enlarged kidneys,14) focal hypoechoic renal masses that simulate abscesses15) and heterogeneous masses that calcify, show central areas of necrosis and are mistaken for tumors.16) the imaging appearance of malakoplakia is therefore non-specific, and malignant renal tumor is a common misdiagnosis. the final diagnosis of malakoplakia is usually attained only upon histopathologic examination of the excised specimen. there is no established treatment for patients with malakoplakia. however, there are treatment options for malakoplakia that include antibiotics, surgical excision, or a combination of both, depending on the site and extent of involvement. some researchers have suggested that such antibiotics as trimethoprim-sulfamethoxazole and ciprofloxacin were beneficial because of their ability to penetrate intracellularly.8,17-20) we started the treatment with ciprofloxacin. during follow-up in the outpatient clinic, we changed the antibiotic treatment to trimethoprim-sulfamethoxazole due to the patient's continued complaint of cystitis symptoms. in conclusion, renal malakoplakia should be taken into account in the differential diagnosis of a patient who presents with urinary tract infection, fever, abdominal pain, and abscess-like lesion in ultrasonography or ct, especially if the patient concerned has diabetes mellitus and a long history of use of exogenous steroids. it is considered that family physicians ' early diagnosis would enable prompt treatment and regular monitoring, leading to avoidance of long-term morbidity and mortality.

malakoplakia is an uncommon but distinctive type of chronic granulomatous inflammation that occurs most commonly in the genitourinary tract, especially the urinary bladder. most patients have associated conditions characterized by some degree of immunosuppression, as seen in solid-organ transplants, autoimmune diseases requiring steroid use, chemotherapy, chronic systemic diseases, alcohol abuse and poorly controlled diabetes. we report an unusual case of the renal malakoplakia that involved the perirenal space, extending to the descending colon in a 65-year-old korean woman with secondary adrenal insufficiency and diabetes mellitus.

PMC3383148

pubmed-239

ghrelin, a 28-amino-acide peptide, is a potent stimulator of growth hormone release that has been implicated in the control of food intake and energy homeostasis in human begins and rodents [15]. ghrelin is not secreted into the gastrointestinal tract like digestive enzymes but into blood vessels to circulate throughout the body. ghrelin causes weight gain by increasing food intake and reducing fat use [7, 8]. ghrelin has effects on nutrient intake and growth hormone (gh) release, subsequently on physical development and growth. tumor necrosis factor (tnf-) and interleukin-6 (il-6) are pleiotropic cytokines with numerous immunologic and metabolic actions [10, 11]. il-6 is generally considered to be an important cytokine in the network of cytokines that regulate immune reactions and acute phase responses. the relationship between congenital heart disease (chd), malnutrition, and growth retardation is well documented. infants with congenital heart disease are prone to malnutrition for several reasons including decreased energy intake, increased energy requirements, or both. different types of cardiac malformations can affect nutrition and growth to varying degrees. although nutritional and growth status were investigated in children with cyanotic and acyanotic heart disease, serum ghrelin levels have not been established. the objective of this study is to investigate and compare the functional role of ghrelin on the regulation of energy balance in children with cyanotic and acyanotic congenital heart disease and the association of ghrelin with tnf-, il-6, that were not entirely confirmed in literature by now. the study was conducted on 47 children with acyanotic chd, 21 children with cyanotic chd, and 25 healthy children. all patients ' cardiac diagnoses were made on the basis of clinical and laboratory examinations. body mass index (bmi) was calculated as the ratio of body weight (kg) and squared height (m). all blood samples were drawn at 08-09 am and stored 20c until the procedure. serum ghrelin, tnf-, and il-6 levels were analyzed with elisa kits (tnf-, il-6 kit was purchased from bio-source international inc. (camarillo, calif, usa); ghrelin kit from phoenix international, inc, usa). the given data were compared between groups using one-way anova, followed by post-hoc; bonferroni test. in 47 acyanotic patients, mean age was 30.518.4 months, in 21 cyanotic patients was 28.415.6 months and in 25 control subjects was 31.115.1 months. age and anthropometric data of the patients and the control subjects are shown in table 1. there was no significant difference between groups (the acyanotic patients, the cyanotic patients) in terms of mean age, weight, height, bmi. serum ghrelin levels were significantly higher than in acyanotic and cyanotic groups compared to in the control group (p<.0001) (table 3). serum ghrelin levels in the acyanotic patients were significantly higher than in the cyanotic patients (p<.0001). tnf- levels were significantly higher than in cyanotic and acyanotic patients with chd compared to in the control groups (p<.001, p<.0001, resp.). serum tnf- values were higher in the acyanotic patients compared to the cyanotic patients with chd (p<.001). serum il-6 levels were higher than in cyanotic and acyanotic patients with chd compared to in the control groups (p<.0001, p<.001, resp.). in both acyanotic and cyanotic groups, serum ghrelin levels were negatively correlated with bmi (r=.549, p<.05 and r=.688, p<.01, resp.) tnf- levels were not related to bmi in the acyanotic and cyanotic patients with chd. ghrelin levels were also correlated with tnf- in the acyanotic and cyanotic groups (r=.485, p<.05 and r=.573, p<.01, resp.) ghrelin levels were not related to il-6 in the acyanotic and cyanotic patients with chd (r=.263, p>.05 and r=.398, p>.05, resp.). inadequate caloric intake, malabsorption, and increased energy requirements caused by increased metabolism may all contribute. however, inadequate caloric intake appears to be the most important cause of growth failure in chd [13, 15, 16]. patients with acyanotic heart disease had a greater growth deficit in weight, and those with cyanotic heart disease had a greater growth deficit in stature as demonstrated by both decreased height and weight. although growth impairment is most pronounced in infants with cyanotic chd, growth failure does not correlate well with the degree of hypoxia. in this study, the cyanotic patients had a more pronounced retardation in both height and weight than in the acyanotic patients [13, 17]. ghrelin is accepted as a good marker of the nutritional state, mainly in situations of malnutrition, like anorexia nervosa, owing its fast recovery after weight gain. the inverse correlation between ghrelin levels and bmi we observed the mentioned correlation, both in children with cyanotic heart disease and in children with acyanotic heart disease. although the cyanotic patients had a more pronounced retardation in both height and weight than in the acyanotic patients, we found that serum ghrelin levels significantly elevated in the acyanotic patients than in the cyanotic patients (p<.0001). growth failure in cyanotic children has not been shown to be proportional to the severity of cyanosis, suggesting that multiple factors are involved in the pathogenesis of their growth disturbance. alteration of endocrine mediators of growth has been implicated as a possible mechanism of growth failure in cyanotic patients. cyanotic newborn lambs have decreased levels of serum insulin-like growth factor i without a corresponding decrease in growth hormone or hepatic growth factor receptors. weintraub et al. reported that while insulin-like growth factor i levels were linearly related to height and weight in patients with cyanotic lesions, no such correlation was found in their cyanotic patients. these studies suggest that chronic tissue hypoxia may have independent role in growth failure. we found that serum tnf- significantly increased in the cyanotic patients and in the acyanotic patients. similarly, serum il-6 was increased in both groups but the change was more distinctive in the cyanotic patients. tnf- and il-6 appear to be important cachectic process mediators, although this association is not completely established [23, 24]. cachexia results in decreased muscle strength and function and compromised immune function [25, 26]. this syndrome is likely to occur in children who have chronic congestive heart failure, chronic shunt hypoxemia. in addition to inadequate calorie and protein intake, there is evidence that this syndrome may be caused by circulating tumor necrosis factor, which stimulates catabolism. in the present study, ghrelin correlated to positively with tnf-, in acyanotic patients and cyanotic patients with chd. the relation of ghrelin with tnf- raises the possibility of the direct effect of tnf- upon ghrelin or the impact of heart failure severity upon both ghrelin and tnf-. nagaya et al. have shown that plasma ghrelin level is increased in cachectic patients with congestive heart failure as a compensatory mechanism in response to anabolic-catabolic imbalance. in conclusion, serum ghrelin level is elevated in cyanotic and acyanotic patients with chd. increased ghrelin levels additionally, the relation of ghrelin with cytokines may be explained by the possible effect of chronic congestive heart failure and chronic shunt hypoxemia.

background/aim. ghrelin has effects on nutrient intake and growth. the cause of growth retardation in congenital heart disease is multifactorial. the aim of the present study is to investigate the ghrelin in congenital heart disease and the association of ghrelin with tnf- and il-6. materials and methods. we measured serum ghrelin, tnf-, and il-6 levels using spesific immunoassay in 68 patients (47 acyanotic, 21 cyanotic with congenital heart disease) and in 25 control subjects. results. in comparison to controls, serum ghrelin, tnf- levels were significantly higher in acyanotic patients and cyanotic patients with congenital heart disease (p<.0001). in acyanotic and cyanotic patients with congenital heart disease, there was a positive correlation between ghrelin and tnf- (r=.485, p<.05 and r=.573, p<.01, resp.). conclusion. serum ghrelin levels is elevated in acyanotic and cyanotic patients with congenital heart disease. increased ghrelin levels represents malnutrition and growth retardation in these patients. the relation of ghrelin with cytokines may be explained by the possible effect of chronic congestive heart failure and chronic shunt hypoxemia.

PMC2220042

pubmed-240

enteric viruses are major etiologic agents of acute gastroenteritis among infants and young children worldwide. rotavirus, norovirus, adenovirus, and astrovirus are the recognized viral causes of pediatric gastroenteritis. the world health organization (who) data showed that each child practically has viral diarrhea irrespective of race and socioeconomic status within the first 5 years of life and this has great economic burden for the system of public health services and all society [2, 3]. viral intestinal infections are the most common cause of acute infectious diarrhea in the pediatric group and accounted for approximately 70% of episodes of acute infectious diarrhea in children. there is paucity of information as regards viral enteropathogens of diarrhea in many developing countries including nigeria. the reason(s) attributed to this may be as a result of the poor health care system in the country where important health issues are taken for granted such as the aforementioned case. thus, as a result of the nonperformance of viral tests for diarrheal patients, information on viral enteropathogens is lost and thus measures to implement control strategies become difficult. against this background, this study was carried out to ascertain the prevalence of rotavirus, adenovirus, and norovirus infection in young children with diarrhea in two primary health centers in edo state, nigeria. it also aimed at assessing the coinfection rates of the viral agents, age, seasonal distribution of infection, and the association between clinical symptoms and viral diarrhea. this study was carried out in two primary health centers located in ikpoba-okha local government area of edo state, nigeria. the health centers attend to the primary health needs of the people within and around the locality. cases attended to include malaria, diarrhea, immunization of infants and children, antenatal and postnatal cases, and other minor health issues within the scope of the health personnel. the two primary health centers are aduwawa and evbomodu primary health centers and they are neighboring communities with a fast growing population made up of indigenes with new residents from the main city alongside other inhabitants from other parts of the country. a total of two hundred and eighty-two (282) stool specimens comprising 223 diarrhea and 59 nondiarrhea stool specimens were collected from children aged between 0 and 36 months attending two primary health centers. as regards children with diarrhea, males were 121 while females were 102. verbal informed consent was obtained from patients or guardian of the children prior to sample collection. the samples were collected from patients at the time of clinic visit as well as other times when the child defecates. sterile wide mouth specimen containers were used for specimen collection and they were processed within 6 hours of collection. rotavirus, adenovirus, and norovirus were detected by the immunochromatographic technique (ict). rotavirus and adenovirus were detected using vikia rota-adeno rapid test device manufactured by biomerieux, france. briefly, 2 drops of liquid stool specimen was added to the specimen dilution buffer and shaken vigorously to homogenize. two drops of the diluted sample was transferred to the sample well of the test device (cassette) and was timed for 10 minutes. similarly, norovirus was detected using rida quick norovirus (ni403) test device manufactured by r-biopharm ag, germany. briefly, 1 ml of sample dilution buffer (diluent) was placed in a separate labeled test tube and 100 ml of liquid stool was added to it and shaken vigorously to homogenize. this was allowed to settle for 2 minutes and 250 l of the supernatant was placed in a clean labeled test tube. six drops of conjugate 1 was added to the test tube and was shaken vigorously to homogenize. the mixture was emptied into the sample well of the test device and incubated for 10 minutes at room temperature. four drops of conjugate 2 was added to the reaction window of the test device and incubated for 1 minute at room temperature. 10 drops of wash buffer was added to the reaction window and was allowed to stay until the buffer was completely absorbed. six drops of substrate was added to the reaction window and timed for 3 minutes. statistical analysis was carried out using odd ratio and chi-square () tests. a total of 223 children with diarrhea were tested for three viral agents (rotavirus, adenovirus, and norovirus). a total of 95 (42.6%) were positive for at least one viral agent while none of the 59 children without diarrhea was positive for any viral agent. the overall result showed that rotavirus had a prevalence of 63 (28.3%) (table 1). the sex distribution of enteric viruses showed that males had 54 (44.6%) positive cases while females had 41 (40.2%), and this was not statistically significant (p=0.60). age group distribution of infection showed that 712 months had the highest infection rate with 48 (58.5%) and was closely followed by 06 months which had 32 (50.8%). there was a statistical significance between age group and infection (p<0.0001) (table 2). the pattern of coinfecting viruses showed rotavirus-adenovirus mixed infection as the most prevalent with 12 (5.4%) (table 3). the seasonal pattern of enteric viruses showed that rainy season had 60 (46.9%) while dry season had 35 (36.8%), and this was not statistically significant (p=0.17). the distribution of enteric viruses according to health centers was not statistically significant (p=0.89) (table 4). the distribution of viral agents with respect to clinical symptoms is showed in table 5. the prevalence of rotavirus, adenovirus, and norovirus infections was investigated among children with diarrhea. the results of this study when compared to other studies carried out in nigeria and other parts of the world showed that the incidence of viral agents varied from one locality to another. the 28.3% of rotavirus in this study is lower than 55.9% in ilorin, nigeria, 35% in jos, nigeria, 33.3% in two districts in nigeria, and 39% in ghana. it is higher than 27% in zaria, nigeria, 28.1% in edo state, nigeria, 9.2% in botswana, and 16.9% in korea. the 19.3% of adenovirus in this study is lower than 22.3% in northwestern nigeria and 23.0% in tanzania. it is higher than 6.7% in nigeria, 3.0% in south africa, and 7.8% in botswana. the 3.6% of norovirus in this study is lower than 37.3% in nigeria, 16.4% in ghana, 39% in brazil, 11.6% in korea, and 15% in ghana. the differences among studies reporting viral infections in different countries might be explained by the different age group, seasonal variations, and viral detection methods used. there was a statistical significance between infection and age group (p<0.0001). age group of 712 months had the highest prevalence of viral diarrhea with 48 (58.8%). this is consistent with the report of moyo et al., who also found 712 months as the group with the highest infection. the reason for this may be due to the fact that it is the period of activities for many children. crawling and walking stages are at this period and in the process, children could pick harmful materials into their mouth especially in unhygienic conditions. it was observed in this study that, within the first year of life, viral infection rate was 84.2% and in the second year, it was 97.9%. this is in accordance with other studies where infection was most prevalent in children within the first 2 years of life [11, 16, 19, 20]. the relatively low prevalence of viruses among older children could be partly due to immunity acquired through previous exposures. in this study, coinfection rate was 7.6%, and rotavirus-adenovirus coinfection was the highest with 12 (5.4%). this, however, did not agree with the reports of chung et al. and koh et al., who had rotavirus-norovirus mixed infection as the most prevalent. the seasonal pattern of viral infection was not statistically significant (p=0.17), though infection was more during the rainy season (46.9%) than in the dry season (36.8%). reports from nigeria have showed that viral diarrhea occurs throughout the year but with variations with respect to seasons [8, 13, 16]. viral diarrhea with respect to the two primary health centers did not show statistical significance (p=0.89), as infection rates for evbomodu and aduwawa health centers were 43.0% and 42.1%, respectively. the most commonly associated clinical symptom observed in this study with rotavirus, adenovirus, and norovirus positive cases was vomiting with 55.6%, 55.8%, and 75.0%, respectively. this finding is similar to other studies [2325] where vomiting was the most commonly associated symptom with viral diarrhea. rotavirus positive patients with respect to clinical symptoms such as fever, dehydration, and abdominal pain were low in this study compared to other studies [23, 26, 27] which reported high percentage of clinical symptoms. similarly, for adenovirus positive patients, fever, dehydration, and abdominal pain were low compared to other studies with moderate symptoms [13, 24, 28, 29]. however, as regards norovirus positive patients, fever, dehydration, and abdominal pain were also low, but other studies with norovirus showed moderate to high clinical symptoms [25, 30, 31]. thus, the differences in clinical symptoms with viral diarrhea as seen from the different studies may be attributed to seasonal variations, geographical location, nutritional status of the patients, and type of viral pathogens causing the infection. coinfection of viral agents was found to be 7.6% and the most common clinical symptom was vomiting. this is worrisome considering the burden of these viruses on the young children in this locality. the fact that viral diagnostic tests are not routinely done or rarely done in any of the hospitals in this locality means that such vital information on viral diarrhea is missed out due to the poor attention given to health care in the country. thus, there is need to test stool specimens of clinically confirmed diarrheal patients for enteric viruses as this will go a long way in reducing the wasteful use of antibiotics which are used as blind treatment for persistent diarrhea that may be of viral origin. finally, the primary health care centers should be provided with all the necessary diagnostic test materials to address cases of viral diarrhea.

enteric viruses have been shown to be responsible for diarrhea among children during their early childhood. this study was carried out to determine the prevalence of rotavirus, adenovirus, and norovirus infection in young children with diarrhea in two primary health centers in edo state, nigeria. a total of 223 stool specimens were collected from children aged 036 months with clinical signs of diarrhea and 59 apparently healthy age-matched children as control. these specimens were investigated for three viral agents using immunochromatographic technique (ict). the overall results showed that at least one viral agent was detected in 95/223 (42.6%) of the children with diarrhea while the control had none. the prevalence of rotavirus was 28.3%, adenovirus 19.3%, and norovirus 3.6%. there was a significant association between age group and infection (p<0.0001). seasonal pattern of enteric viruses was not statistically significant (p=0.17). the overall coinfection rate was 7.6% and rotavirus-adenovirus coinfection had the highest with 5.4%. rotavirus was the most prevalent viral agent. coinfections are not uncommon among the population studied. the most commonly associated clinical symptom of viral diarrhea in this study was vomiting. viral diagnostic tests are advocated for primary health care facilities in this locality.

PMC4430648

pubmed-241

alpha ()2-adrenoceptor agonists have been used as adjuvant to anesthetic agents in peri-operative period for its several beneficial actions. these drugs improve hemodynamic stability during endotracheal intubation and surgical stress by its central sympatholytic action, and thus reduce anesthetic and opioids requirements. dexmedetomidine, the pharmacologically active d-isomer of medetomidine, is highly selective and specific 2-adrenoceptor agonist. the analgesic effect of dexmedetomidine is qualitatively different as compared to opioids and can be used as an alternative to opioids in general anesthesia. the anesthetic sparing effect of dexmedetomidine demonstrated in earlier studies is confounded by the use of opioids. opioids, when used as analgesic in general anesthesia, are known to decrease mac value of sevoflurane. inhalation agents were titrated based on either hemodynamic criteria and/or bispectral index values in studies done earlier, and none of them demonstrated the effect of dexmedetomidine alone on requirement of sevoflurane with the use of entropy as a measure of depth of anesthesia. the primary objective of our study was to evaluate the effect of continuous infusion of dexmedetomidine alone, without use of opioids, on sevoflurane requirement during general anesthesia with continuous monitoring of depth of anesthesia by entropy analysis. the study protocol was approved by ethical committee of the institute, and written informed consent was obtained from all patients included in the study. the study population comprised of 60 patients, aged 18-55 years, with american society of anesthesiologists (asa) status of 1 and 2, undergoing major elective surgical procedures. we excluded patients older than 55 years, those with a history of psychiatric/neurological illness, cardiovascular disease, hypertensive patients, morbid obese patients, pregnant and nursing women, with known allergic reaction to any of the study medication, recent use of sedatives or analgesics, and with significant laboratory abnormalities. the consenting patients were randomly allocated into one of the two anesthetic groups based on the simple randomization table generated: group a (control group): sevoflurane-fentanyl and group b (test group): sevoflurane-dexmedetomidine. after arrival in the operating room, glycopyrrolate 0.004 mg/kg and ondansetron 0.15 mg/kg intravenous (iv) were given as pre-medication in both the groups. the patients in group b received dexmedetomidine(2 ml diluted in 48 ml of saline) iv in a dose of 1 mcg/kg over10 minutes through infusion pump prior to induction. monitoring consisted of continuous electrokardiogram (ekg), non-invasive blood pressure (nibp), pulse oximetry (spo2), co2 expired fraction (etco2), sevoflurane inspired fraction (fisevo), sevoflurane expired fraction (etsevo), and electroencephalograph (eeg) analysis by entropy (response and state entropy). after the start of drug infusion, heart rate (hr), blood pressure (bp), respiratory rate (rr), spo2, and entropy were measured at 5 and 10 minute. patients in group a received fentanyl 2 g/kg intravenous slowly, 2 minutes prior to induction. after pre-oxygenation for 10 minutes, general anesthesia was induced with thiopentone sodium 5 mg/kg iv slowly., dexmedetomidine infusion was continued between 0.2 and 0.8 mcg/kg/h depending on hr, bp, and entropy value changes. anesthesia was maintained with sevoflurane to a maximum of 2.5% end tidal to maintain heart rate and blood pressure within 20% of baseline value and entropy value between 40 and 60. the anesthesiologist was permitted to treat hemodynamic events, defined as heart rate and blood pressure more than 20% of baseline, in spite of increasing sevoflurane concentration to 2.5% and dexmedetomidine infusion to 0.8 mg/kg with supplemental analgesia in the form of fentanyl 1 mcg/kg. if rise in heart rate and blood pressure persisted further after supplementation with fentanyl, anesthesiologist was permitted to administer incremental doses of metoprolol 2-5 mg. ephedrine 5 mg iv was given for fall in heart rate and blood pressure more than 20% of baseline. in the group b, dexmedetomidine was stopped approximately 15-20 minutes before completion of surgery, diclofenac sodium aqueous 1 mg/kg was given iv in both groups at the time of skin closure. reversal of neuromuscular blockade was achieved with neostigmine 0.05 mg/kg and glycopyrrolate 0.008 mg/kg iv slowly. tracheal extubation was done when respiration was satisfactory and adequate muscle tone was achieved. hr and bp were recorded before induction, at the time of induction, intubation, and then at 5, 10, 15, 30, 45, and 60 minute after intubation and at extubation.depth of anesthesia was evaluated by entropy (state entropy, response entropy) analysis (datex-ohmeda s/5 avance workstation, ge healthcare, helsinki, finland) at 5, 10, 15, 30, 45, and 60 minute after intubation and at extubation.end tidal concentration of sevoflurane was assessed with anesthesia gas assessment module e-caiovx at same interval as entropy analysis. hr and bp were recorded before induction, at the time of induction, intubation, and then at 5, 10, 15, 30, 45, and 60 minute after intubation and at extubation. depth of anesthesia was evaluated by entropy (state entropy, response entropy) analysis (datex-ohmeda s/5 avance workstation, ge healthcare, helsinki, finland) at 5, 10, 15, 30, 45, and 60 minute after intubation and at extubation. end tidal concentration of sevoflurane was assessed with anesthesia gas assessment module e-caiovx at same interval as entropy analysis. statistical analysis was conducted with epi info software (version 3.5.3, 2011, centers for disease control and prevention, atlanta, ga, usa) for windows statistical package using unpaired t-test for continuous variables with normal distribution. the non-parametric kruskal-wallis test was used for variables not normally distributed. for categorical variables, chi-square test was used. the two groups were similar regarding age, sex, weight, and asa physical status [table 1]. pre-induction heart rate, systolic and diastolic blood pressures were similar between two groups (p>0.05). the depth of anesthesia as assessed by response entropy (re) and state entropy (se) was comparable between two groups at all time points during maintenance period (p>0.05). the re and se was maintained between 40 and 60 during the period of observation. the fisevo concentration was significantly less in group b as compared to the group a at all time points (p<0.05) [figure 1]. the average etsevo concentration during anesthetic maintenance was 1.35% and 1.72% in the group b and a, respectively. a significant decrease of 13% to 33% of etsevo concentration was seen with group b from 5 min to 60 minutes post-intubation (p<0.05) during surgery [figure 2]. fraction of inspired sevoflurane at different time interval (pi-post-intubation, fi-fraction of inspired) end tidal sevoflurane at different time intervals (pi-post-intubation) during anesthesia maintenance, group b showed a statistical significant decrease in heart rate, systolic and diastolic blood pressure from baseline at all time points as compared to the group a (p<0.05). an average 6.5% fall in heart rate from baseline in group b as compared to 3.7% rise in the group a, 8% fall in systolic blood pressure from baseline as compared to 3.6% rise in the group a, and 8.16% fall in diastolic blood pressure from baseline as compared to 3.3% rise in the group a was observed [figures 3 and 4]. changes in sbp and dbp at various time points post-intubation (pi-post-intubation, sbp-systolic blood pressure, dbp-diastolic blood pressure) changes in hr at various time points post-intubation (pi-post intubation, hr-heart rate) in our study, none of the patients in either group required supplemental analgesia or anti-hypertensive drugs intra-operatively. bradycardia was observed in 2 patients in group b within 10 mins post-extubation, which promptly responded to atropine 0.6 mg iv. the major observation in our study was that dexmedetomidine infusion as an adjuvant in general anesthesia causes decreased requirement of sevoflurane without compromising adequate depth of anesthesia, thus it has anesthetic-sparing property. a study done on patients undergoing hysterectomy showed a 30% reduction of maintenance concentration of isoflurane. similarly, a reduction in 35% to 50% in isoflurane concentration with low or high dose of dexmedetomidine was found in a study on healthy human volunteers. this larger reduction in isoflurane requirement seen as compared to our study might be due to difference in study population (healthy human volunteers vs. patients posted for elective surgery) and the type of stimulus (tetanus nerve stimulus vs. surgical stimulus). the results of our study results are consistent with that of the study done by fragen, et al. in elderly patients, which showed a 17% reduction. dexmedetomidine by its sympatholytic action decreases heart rate and blood pressure, thus assessing the depth of anesthesia by hemodynamic parameters would be unreliable in evaluating its effect on requirement of inhalational agent. several electroencephalogram-dependent indices such as bispectral index and entropy have been used to measure the depth of anesthesia. entropy is a useful monitor for measuring the electroencephalographic effects of increasing and decreasing sevoflurane concentration and assessing the depth of anesthesia. analogous to the bispectral index, entropy displays a high degree of specificity and sensitivity in assessing consciousness during anesthesia. using bispectral index to assess the depth of anesthesia, magalhes et al. showed decreased requirement of sevoflurane with continuous infusion of dexmedetomidine during general anesthesia. in our study, we used entropy to measure the depth of anesthesia, thereby eliminating the bias of evaluation by hemodynamic parameters as in earlier studies. use of dexmedetomidine produces intra-operative and post-operative opioids-sparing effect. dexmedetomidine by its sympatholytic action attenuates symapthoadrenal response to tracheal intubation. in patients undergoing laparoscopic tubal ligation, a 33% decrease in morphine use post-operatively was observed when dexmedetomidine was used at a dose of 0.4 mcg/kg. dexmedetomidine when administered as infusion at a dose of 0.5 mcg/kg/h has specific analgesic effect and provides visceral pain relief. in morbidly obese, dexmedetomidine produces a greater decrease in sympathovagal balance intra-operatively than fentanyl along with better post-operative analgesia. dexmedetomidine, when used as sole substitute for remifentanil in ambulatory gynecologic laparoscopic surgery, provides better peri-operative hemodynamic stability and post-operative analgesia. dexmedetomidine provides similar intra-operative hemodynamic response and better post-operative analgesia compared to remifentanil in patients undergoing supratentorial craniotomy. use of opioids along with dexmedetomidine would confound its effect on requirement of inhalation agent. hence, in our study, fentanyl was not administered in dexmedetomidine group b, and we found a 21.5% decrease in the etsevo, in contrast to 33.12% decrease in study done by magalhes e et al. where fentanyl was used. one limitation of our study was that we included both laparoscopic as well as open surgeries. to conclude, the continuous infusion of dexmedetomidine, as adjuvant in general anesthesia, significantly decreases the requirement of sevoflurane for maintaining adequate depth of anesthesia. studies measuring plasma concentration of dexmedetomidine should be undertaken to establish the precise correlation between its dose and inhalational agent's requirements.

background: dexmedetomidine, a 2 agonist as an adjuvant in general anesthesia, has anesthetic and analgesic-sparing property.aims:to evaluate the effect of continuous infusion of dexmedetomidine alone, without use of opioids, on requirement of sevoflurane during general anesthesia with continuous monitoring of depth of anesthesia by entropy analysis. materials and methods: sixty patients were randomly divided into 2 groups of 30 each. in group a, fentanyl 2 mcg/kg was given while in group b, dexmedetomidine was given intravenously as loading dose of 1 mcg/kg over 10 min prior to induction. after induction with thiopentone in group b, dexmedetomidine was given as infusion at a dose of 0.2-0.8 mcg/kg. sevoflurane was used as inhalation agent in both groups. hemodynamic variables, sevoflurane inspired fraction (fisevo), sevoflurane expired fraction (etsevo), and entropy (response entropy and state entropy) were continuously recorded. statistical analysis was done by unpaired student's t-test and chi-square test for continuous and categorical variables, respectively. a p-value<0.05 was considered significant. results:the use of dexmedetomidine with sevoflurane was associated with a statistical significant decrease in etsevo at 5 minutes post-intubation (1.49 0.11) and 60 minutes post-intubation (1.11 0.28) as compared to the group a [1.73 0.30 (5 minutes); 1.68 0.50 (60 minutes)]. there was an average 21.5% decrease in etsevo in group b as compared to group a. conclusions:dexmedetomidine, as an adjuvant in general anesthesia, decreases requirement of sevoflurane for maintaining adequate depth of anesthesia.

PMC3788228

pubmed-242

primary pleuropulmonary synovial sarcoma (ppss) is a rare soft tissue malignancy representing only 0.1%-0.5% of all primary lung malignancies. the frequency of cardiac metastasis from soft tissue sarcomas ranges from 3.5% to 35% with only two cases of metastatic synovial sarcoma of the heart reported: one involving the right ventricle and the other the left ventricle. both cases had a primary tumor in the extremities rather than in the lungs without focusing on the imaging findings of these rare lesions (2-4). we report a case of ppss that eventually metastasized to the heart in a 17-year-old female. a 17-year-old female presented with dull pain in the left upper chest alternating with brief periods of chest discomfort lasting a few months. she had no serious medical or surgical history and grew up in normal residential and social environments. all laboratory data including blood tests, standard biochemical tests, and urinalysis were within normal limits. chest radiographs (figure 1a and b) revealed a well-defined round mass in the left upper hemithorax. the mass was at an obtuse angle to the chest wall and was approximately 8 cm long. chest ct (figure 1c-e) confirmed a well-defined oval-shaped mass with heterogeneous enhancement in the left upper hemithorax abutting the pleura. in the pre-contrast image, the lesion showed homogeneous soft tissue attenuation and a lack of calcification, but a small amount of high-attenuation fluid was present in the left pleural space, suggestive of hemothorax. after contrast enhancement, the mass showed heterogeneous enhancement, with attenuation similar to that of the back muscles, and contained subtle low densities suggestive of necrosis or hemorrhage. the mediastinal and hilar lymph nodes were not enlarged. in the scanned portion of the abdomen f-18 fluorodeoxyglucose positron emission tomography-ct (18f fdg pet/ct) revealed increased fdg uptake in the mass, with a maximum standardized uptake value of 31.7 (figure 1f). from these imaging findings, the diagnoses of a localized fibrous tumor of the pleura, malignant mesothelioma, metastatic pleural malignancy, and rare primary pulmonary sarcoma (e.g., pleuropulmonary synovial sarcoma, fibrosarcoma, leimyosarcoma, sarcomatoid carcinoma, malignant nerve sheath tumor, hemangiopericytoma, and malignant fibrous histiocytoma) were considered. these diagnoses were based on the tumor s appearance as a sharply marginated, heterogeneously enhanced mass with low attenuation foci and no involvement of the bone or calcifications. ct-guided core needle biopsy of the mass yielded two samples of yellowish gelatinous material. microscopic examination showed relatively uniform spindle-shaped cells with occasional mitoses arranged in tight fascicles. the tumor cells were immunoreactive to vimentin and cd99 and were focally positive for epithelial membrane antigen (ema), suggesting a monophasic synovial sarcoma. medical and surgical oncologists agreed to treat the tumor with surgical resection and to initiate a combination chemotherapy regimen consisting of five cycles of vincristine, doxorubicin, and cyclophosphamide, alternating with four cycles of ifosfamide and etoposide. a thoracotomy was performed, and the mass was found to arise from the visceral pleura and to adhere to the left first to third intercostal spaces, with invasion into the left first intercostal muscle with adjacent hemothorax. the surgical specimen consisted of an 8.0 6.5 5.5 cm well-circumscribed but unencapsulated tumor. the tumor was whitish-yellow, soft, and fleshy with cystic degenerative changes and hemorrhage. histologically, the tumor was composed of densely packed, cellular sheets of spindle cells, and some of the tumor cells were arranged in intersecting fascicles in a herringbone pattern, suggesting fibrosarcoma-like changes (figure 1 g-h). the tumor cells were relatively uniform with ovoid nuclei, scant cytoplasm, and occasional mitotic figures. immunohistochemical staining revealed immunoreactivity of the tumor cells to cytokeratin, ema, and cd99 but not to cd34 or desmin (figure 1i-j). a final diagnosis of a monophasic synovial sarcoma from the visceral pleura was made based on the histological and immunohistochemical findings. she was discharged after surgical resection without complications, after which she underwent adjuvant chemotherapy and radiotherapy. the patient remained stable for 28 months until follow-up contrast-enhanced chest ct revealed a 1.6 cm low attenuation nodule with poor enhancement in the left pericardial area and a small amount of left pericardial and pleural fluid (figure 2a). subsequent 18f fdg pet/ct showed slightly increased fdg uptake in the developing nodule with suspected metastasis. five months after discovery, follow up contrast-enhanced chest ct demonstrated a well-circumscribed polycyclic marginated mass with heterogeneous enhancement in the left pericardial region that had enlarged from 1.6 cm to 5.1 cm (figure 2b). although mri is the most accurate technique for demonstrating cardiac mass, oncologists found the following mri might be ineffective for choosing further treatment for the pericardial mass due to high cost. they had no choice but to do surgery for the mass whether to perform mri or not. therefore, they agreed to operate surgical resection to treat pericardial mass without obtaining cardiac mri. the tumor specimen was a 6.0 5.0 2.0 cm well-circumscribed, whitish-yellowish, fleshy to rubbery mass with zones of necrosis and hemorrhage. the tumor was lateral to the left ventricular wall with invasion into the pericardium, myoendocardium, and endocardium of the left ventricle. microscopically, the tumor contained tight clusters and fascicles of spindle cells with scant cytoplasm, identical to the ppss, confirming a metastatic synovial sarcoma with left pericardial, myoendocardial, and endocardial involvement. after metastatectomy, the patient received adjuvant chemotherapy and radiotherapy. the patient s postoperative period was complicated by recurrent pneumonia. ppss is a rare mesenchymal spindle cell malignancy representing a type of pulmonary sarcoma that comprises 0.1%-0.5% of all primary lung malignancies. typically, it arises from the chest wall, lung parenchyma, pleura, or mediastinum, but rarely at the level of the bronchial tree, and during the fifth decade of the patient s life (1). the 5-year survival rate varies from 36% to 76% (6). a small but increasing number of cases of ppss have been reported over the past decades (5), but very few of these cases have involved cardiac metastasis. cardiac metastasis from soft tissue sarcomas varies from 3.5% to 35%, with only two cases of metastatic synovial sarcoma of the heart reported: one involving the right ventricle and the other the left ventricle. both of those cases had a primary tumor in the extremities but not in the lung without focusing on the imaging findings of these rare lesions (2-4). additionally, a literature review of soft tissue sarcomas included only 105 cases of cardiac metastasis. in that review, the predominant histological type was leiomyosarcoma (22%) followed by rhabdomyosarcoma (19%), and liposarcoma (9%); 27% of the cases were unspecified. that report suggested that the clinical manifestation of cardiac metastasis can be subtle, as one-third presented with congestive cardiac failure, which led to other complications such as embolism, tumor thrombus, cardiac tamponade, and arrhythmia (2). in our case, the patient was initially asymptomatic except for dull chest pains with only pericardial effusion on follow-up chest ct. symptoms frequently associated with these tumors are chest pain, dyspnea, and cough; up to 40% of patients are asymptomatic (7). the radiological features of ppss are summarized as follows: chest radiographs typically demonstrate a well-defined pleural-based or parenchymal mass-like lesion occasionally associated with ipsilateral pleural effusion. generally, the contralateral lung is not involved. ct and magnetic resonance imaging (mri) are relatively useful tools for evaluating ppss, although the findings are nonspecific. the most common ct finding of ppss is a well-defined, heterogeneously enhancing mass often with combined ipsilateral pleural effusion. the inner low-density area often contains necrosis, hemorrhage, or fibrous components. associated lymphadenopathy as well as calcifications, cortical bone destruction, or tumor infiltration of the chest wall and musculature are infrequent. ppss often exhibits heterogeneous high signal intensity on t2-weighted images and iso- or low signal intensity on t1-weighted images. after administering gadolinium differential diagnoses for ppss include metastasis from the extrapulmonary synovial sarcoma, a primary tumor such as a pleural fibroma or mesothelioma, or other primary sarcomatous or sarcomatoid neoplasms. the typical clinical and radiologic features can help narrow down the differential diagnosis of ppss. a history of asbestos exposure and the presence of pleural plaques are indicative of malignant mesothelioma. metastatic disease rarely manifests as a large solitary pulmonary lesion, although many other rare primary sarcomatous or sarcomatoid neoplasms can not be distinguished reliably from ppss based on clinical and radiologic features alone (5). monophasic synovial sarcomas are much more common, representing 94% of ppss, and are composed of uniform spindle cells. the surrounding plump spindle cells have hyperchromatic nuclei with scant cytoplasm resembling the tumor cells of monophasic synovial sarcoma. immunohistochemically, most synovial sarcomas show focal expression of cytokeratin and ema. furthermore, 30% are protein s-100 positive, 60%-70% cd99 positive, and 75%-100% bcl-2 positive (8). the prognosis of ppss remains uncertain but is usually poor. the 5-year survival rate varies from 36% to 76% depending on the patient s age, tumor size, and tumor resectability (6). there is no recommended treatment for ppss, but the mainstay of treatment for all soft tissue sarcomas is surgical resection. aggressive surgery can reduce the tumor size before or after chemotherapy, and complete surgical excision seems to improve the survival of patients with ppss. combination chemotherapy consisting of doxorubicin and ifosfamide has been associated with higher rates of survival in patients with synovial sarcoma (6). in summary, ppss is a very rare, aggressive malignancy that must be considered in the differential diagnosis of lung and pleural malignancies. the imaging findings of ppss are nonspecific, and ppss is difficult to confirm based on imaging; detailed immunohistochemical staining is required for definitive diagnosis. ppss with cardiac metastasis is also extremely rare, and only two such cases have been reported. however, cardiac metastasis of ppss can lead to immediate or delayed death; therefore, early detection and appropriate management are very important to extend survival.

primary pleuropulmonary synovial sarcomas are rare soft tissue malignancies; combined metastatic involvement of the heart is extremely rare. in this case report, a 17-year-old female presented with a history of chest pain. chest radiographs revealed a round mass in the left upper hemithorax, and computed tomography (ct) showed a well-defined heterogeneous enhancing mass abutting the pleura. a core needle biopsy revealed malignant spindle cells. surgical resection was performed, and a final diagnosis of primary pleural synovial sarcoma, monophasic fibrous type, was made. the patient underwent radical irradiation and chemotherapy and remained stable for 28 months until a follow-up chest ct showed a poorly enhancing nodule in the left pericardial region that enlarged after 5 months. surgical resection was performed. histological examination confirmed metastatic cardiac involvement from a primary pleural synovial sarcoma. we report this unusual case of a primary pleural synovial sarcoma metastasis to the heart.

PMC5118976

pubmed-243

cervical cancer is the third most common cancer after breast and colorectal cancer and the fourth leading cause of death among women in malaysia(1-3). it remains to be one of the major cancers that burden worldwide particularly in under-developed and developing countries (cervical cancer incidence rate increased with age after 30 years and has its peak at ages 65-69 years. according to ethnicity in malaysia, women of indian ethnic group have the highest incidence for cervical cancer followed by chinese and malay (3). majority malays are muslims, thus lower incidence of this cancer was observed. in iran, there are almost no extramarital sexual relations and they depend strongly on family-based traditions (7) the five-year survival exceeded 70% in korea (810), 55% in turkey (11) and it can be as low as 17% which was in uganda (12). there were various prognostic factors established in many studies such as stage, age, lymph node involvement and tumor size (1316). in kentucky, between january 2001 and may 2010, a study of 381 cervical cancer patients who were referred to tertiary care centre found that stage of disease was a significant prognostic factor for overall survival (17). meanwhile, a study of 44,182 patients diagnosed with cervical cancer between 1993 and 2002 in korea, found that both stage and histological type of cervical cancer were important factors for survival (18). to our knowledge, the analysis from published studies was often limited to the frequently used cox proportional hazard regression model when examining the relationship of the survival distribution to covariates (17, 1921). this is perhaps due to the fact that although baseline hazard is not specified in cox model, the parameter can still be estimated. the objective of this study was to determine the effects of explanatory variables on the survival of cervical cancer patients using parametric regression model. in some cases, parametric models are more informative than the cox model such as the baseline hazard and survival estimates are known (can be estimated). several examples of parametric models can be found in the following studies (2227). zhu et al. have compared the cox and weibull model in modeling the gastric cancer data and found that the weibull model gave more a precise results in than the cox model (28). the weibull model has gained popularity in modeling survival data due to its flexibility in the shape parameter that can accommodate a decreasing, constant and increasing hazard. furthermore, the suitability of the weibull model can be easily assessed using a log-cumulative hazard plot. in this study, a stratified weibull model was used since there was a time-dependent covariate that caused the proportional hazard assumption vio-lated. the study design was retrospective in nature in which patients records were reviewed retrospectively to obtain the data. the husm, located in kubang kerian, kelantan has been long regarded as the referral centre for the east coast region of malaysia. the inclusion criteria were histopathologically and clinically diagnosed with cancer of cervix between 1 july 1995 and 30 june 2007, and received at least one treatment related to cervical cancer in husm. patients who were died due to other competing causes of death (not cervical cancer), or with incomplete data were excluded from this study. ethical clearance was obtained from research and ethics committee of university sains malaysia (reference number: usmkk/ppp/jepem [205.4 (2.4)]). the variable of interest was time (in months) which was measured from the patient was diagnosed with cervical cancer up to the time of death. factors that were considered in the analysis were ethnicity (non malay, malay), lymph node involvement (negative, positive), metastasis (with metastasis, without metastasis), histology (squamous cell carcinoma, adeno cell carcinoma), primary treatment (surgery, radiotherapy and/or chemotherapy), age at diagnosis (< 40, 40 59, 60) and stage (stage i&ii, stage iii&iv). international federation of gynecology and obstetrics (figo) system was used in staging patients with cervical cancer. data analysis was performed using the statistical package tibco spotfire s-plus version 8.1. the suitability of the weibull model for the data was assessed using a plot of the log of the negative log of the estimated survivor function against log time or log-cumulative hazard plot. univariate analysis was conducted using the simple weibull regression analysis to identify the possible prognostic factors individually. significant factors from the univariate analysis were further analyzed by the weibull multivariate analysis to model the prognostic factors. model selection procedure was based on the forward variable selection method with statistical significance set at =0.10. the proportionality of the hazards was assessed using the test based on schoenfeld (29). as the proportional hazard assumption was not satisfied, a stratified model was used instead (30) and in measuring the goodness of fit of the model, deviance residuals were used. 1 shows a study flow diagram which summarizes the steps of the statistical analysis performed. the study flow diagram the log-cumulative hazard plotshows a straight line which suggests that the distribution of survival time considered follows weibull distribution (fig. patients characteristics and the incidence rate ratio were tabulated in table 1. about 74% of total patients the ratio of the risk of death for patients who were diagnosed in stage iii&iv compared to the risk of death for patients in group stage i&ii was 1.44. meanwhile, the risk of dying of patients in with metastasis group was 1.55, greater than patients who had no metastasis. the results from the univariate analysis are presented in table 2. from this analysis, based on the forward selection procedure in multivariate analysis, two variables namely stage and metastasis was found to be significant factors (table 3). however, it was noted that metastasis (p=0.032) did not satisfy the proportional hazard assumption and a stratified model was then considered. it is worthwhile to note that while the stratification allows separate baseline hazard function to each metastasis group, the coefficient of the predictor variables are assumed to be the same within each metastasis group (29). the first stratum consists of patients without metastasis and the second stratum were patients who do have metastasis. parameter estimates of the stratified model were performed and the output is given in table 4. the log-cumulative hazard plot characteristics of patients treated in husm (n=120) univariate analysis of weibull model with prognostic factors multivariate analysis of weibull model with prognostic factors output of weibull model under stratification the hazard ratio for variable stage stratified on metastasis the estimated scale parameters () for the first and second stratum were 1=1.11 and 2=0.733 respectively. the risks of death for cervical cancer patients were estimated by finding the regression coefficient (j) j=j, and the hazard ratio (j) j=exp(j) where j=1,2 denotes the stratum. for the first stratum, patients who were diagnosed at stage iii&iv are at 2.30 times the risk of death as those in stage i&ii. meanwhile, for the second stratum, patients in stage iii&iv group were more likely to die (3.53 times) than patients in stage i&ii. the index plot of deviance residuals (rdi) was performed to identify the presence of subjects who was poorly predicted by the model (31). 3 shows that the residuals are roughly symmetrically distributed around zero and most of the residuals are between -2 to 2. outliers and influential observations are not observed in the plot thus implying a good fit of the model. in this study, the weibull model was used instead of the cox model because the log-cumulative hazard plot has confirmed that the survival time followed the weibull distribution. multivariate analysis through forward selection method found that the most feasible model to describe the survival of cervical cancer patients was dependent upon the covariates namely, stage and metastasis. as the metastasis variable did not meet the proportional hazard assumption, the stratified weibull model was applied. this study found that patients who were diagnosed at stage iii&iv have greater risk of death compared to those who were diagnosed at early stage, stage i&ii for both stratum, with and without metastasis. it is worthwhile to note that a study of 515 cervical cancer patients by dueas-gonzlez et al. showed a significant result for advance stage iii&iv with adjusted hazard ratio of 1.54 (95% ci= 1.11- 2.14) (16), indicating that patients with advanced stage of disease had a 54% higher risk of progression or death at any time than earlier stage patients. after applying the stratified model, this study found that the prognosis of cervical cancer patients was dependent upon the stage at diagnosis. these findings provide useful knowledge on the understanding of the survival of cervical cancer patients. besides, this study also demonstrates the solution to time-dependent covariates problem, or when the proportional hazards assumption is violated. cervical cancer dataset that comprise of the national data may be obtained to give a more general prognosis and a better description of the survival pattern of all cervical cancer patients in malaysia. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.

abstractbackgroundcervical cancer is the third most common cancer among women in malaysia. the objective of this study was to estimate the effect of explanatory variables on survival time of cervical cancer patients receiving treatment at a hospital in malaysia. methodsin this retrospective record review study, cervical cancer data obtained from hospital universitisains malaysia (husm) was analysed. the data comprises of 120 patients who had been diagnosed as cervical cancer between 1st july 1995 and 30th june 2007, and obtained treatment from the hospital. the outcome variable was survival time (in months) from cervical cancer diagnosis to death. a stratified weibull model was applied to study the effect of explanatory variable on survival time when there was time-dependent covariate in the model. resultsstage of disease and metastases were important prognostic variables. however, metastasis had been stratified because this variable did not satisfy the proportional hazard assumption. in without metastasis stratum, patients who were diagnosed at stage iii&iv are at 2.30 times the risk of death as those in stage i&ii. meanwhile, in with metastasis stratum, patients in stage iii&iv group had 3.53 times the hazard faced by patients in stage i&ii. conclusionthe prognosis of cervical cancer patients was dependent upon the stage at diagnosis, after the stratification of the metastasis variable. a poorer prognosis on survival was observed for patients in stage iii&iv than those in stage i&ii.

PMC4453897

pubmed-244

cocaine and other amphetamine-like psychostimulants have been a significant part of the human pharmacopoeia for thousands of years. however, the appearance of these substances in western societies has been relatively recent, cocaine having debuted as both a local anesthetic and a psychostimulant in the 19th century. over the course of the next century, it became increasingly clear that the amphetamine-like psychostimulants carried serious abuse liability, as well as producing a prominent paranoia-like syndrome among many individuals who chronically used this class of drugs. the abuse liability of these drugs has resulted in sociological use patterns that have been described as epidemics, such as the methamphetamine epidemic in japan in the 1950s, the cocaine epidemic in the united states in the 1980s, and the crack cocaine epidemic of the 1990s. the high abuse liability of this class of drugs relies on both pharmacological properties and the sociological characteristics of how the drugs are introduced into various societies around the world. this article will not significantly address the sociology of psychostimulant abuse, which involves diverse events ranging from the use of amphetamines by japanese soldiers in world war ii, to the formulation of crack as a less expensive version of cocaine in the united states, to the introduction of prescription formulations to regulate eating habits or to treat attention deficit-hyperactivity disorder. rather, we will review the basic pharmacology of amphetamine-like drugs, integrate these molecular mechanisms into the brain circuitry of reward, and describe how these drugs are thought to create pathological changes in reward and learning circuitry finally, this knowledge will be amalgamated into a vision of future pharmacotherapies for treating psychostimulant addiction. the defining mechanism of action of amphetamine4ike psychostimulants as a class of drugs with high abuse liability is the ability to bind to dopamine transporters (dat). dopamine transporters are a member of a class of proteins that eliminate monoamines, including dopamine, from the synaptic cleft after neuronal release. this protein has a high affinity for dopamine relative to other monoamines, such as norepinephrine or serotonin, and while all the readily abused psychostimulants bind to dat, they may also bind to the other monoamine transporters with greater or lesser affinity. to some extent, the relative profile of binding by individual drugs to the different transporter proteins explains different characteristics of the drugs. most striking, for example, is 3,4-methylenedioxymethamphetamine (mdma) which has a relatively higher affinity for serotonin transporters, and is thereby a mild hallucinogen and neurotoxic to serotonin axon terminals, while methamphetamine binds more avidly to dat, which explains its greater toxicity at dopamine terminals, as well as its propensity to induce paranoid psychosis-like symptoms. while the binding to other monoamine transporters contributes to the antidepressant and hallucinogenic characteristics of some psychostimulants, it is the binding to dat that provides the major influence on abuse liability, which is the focus of this review. there are two major categories of interaction by ampetamine-like psychostimulants with dat, but in all cases the end result is to inhibit the elimination of dopamine from the synapse and thereby increase the quantity and half-life of synaptic and extrasynaptic dopamine levels. the first mechanism is typified by cocaine and methylphenidate that bind to dat, but are not transported into the presynaptic terminal as surrogate dopamine. therefore, when these drugs bind to dat the increase in extracellular dopamine relies primarily on normal synaptic release, which is more amenable to physiological feedback regulation. the second mechanism is typified by amphetamines, and involves not only binding to dat, but also translocation into the cell in place of dopamine. in addition, these drugs enter dopamine synaptic vesicles, where the fact that these compounds are basically charged degrades the ph gradient necessary to sequester dopamine into the vesicle. this in turn results in a large buildup of dopamine in the cytosol, thereby reversing the direction of dat to release dopamine into the extracellular space rather than facilitating its removal regardless of the precise interaction with dat by individual amphetamine-like psychostimulants, this class of drugs dramatically elevates extracellular dopamine, and this action is thought to be the initiating molecular event that reinforces drugseeking behaviors, ultimately culminating in addiction. thus, when an organism encounters a novel stimulus, whether a positive stimulus such as a food reward or a negative stimulus such as a stressor, the activity of dopamine cells in the ventral tegmental area, and dopamine release in axon terminal fields in the prefrontal cortex, nucleus accumbens, and/or amygdale, are altered. an important characteristic of this brain-environment interaction is that the ability of a given stimulus to increase dopamine cell firing and release decreases with repeated presentation of the stimulus. however, it can be shown that if a motivationally neutral stimulus (such as a light or tone) is associated with the motivational event in such a manner that the neutral stimulus predicts arrival of the motivational event, the ability of the motivational stimulus to release dopamine is transferred to the neutral stimulus. thus, the neutral stimulus now causes dopamine release in a manner predicting arrival of a motivationally relevant event. based upon these data, the role for dopamine release in the mesocorticolimbic brain regions is twofold: (i) to cue the organism that a novel motivationally relevant event is occurring and that adaptive behavioral responses need to be engaged (eg, approach a reward or avoid a stress); (ii) once the behavioral response is established, dopamine release is antecedent to the appearance of the motivationally relevant event and is triggered by environmental associations that the organism has made with the event as part of learning the adaptive behavioral response. in this way, dopamine serves to alert and thereby prepare the organism for an impending important event. the primary differences between psychostimulant-induced dopamine release and release associated with normal learning about important environmental events such as rewards and stressors is: (i) since psychostimulants block the elimination of dopamine through dat, the level of dopamine achieved far exceeds what is possible from a biological stimulus; (ii) in contrast to biological stimuli that cease to release dopamine once an approach or avoidance response to that stimulus has been learned, psychostimulants continue to release large amounts of dopamine upon every administration (with the possible exception of extended binging that can temporarily deplete dopamine stores). thus, with psychostimulants, each administration releases dopamine into mesocorticolimbic regions, causing further associations to be made between the drug experience and the environment. in this way, it is thought that the more a psychostimulant is administered, the more learned associations are made with the environment and the more effective the environment becomes at triggering craving and drug-seeking. it is this overlearning of drugseeking behaviors by progressive associations formed between repeated drug-induced dopamine release and the environment that is thought to lead to increased vulnerability to relapse. as outlined above, psychostimulant-induced dopamine release is responsible for reinforcing behaviors designed to seek and administer the drugs. the dopamine projections involved in this process are outlined in figure 1a, and as indicated, the most critical projection in this regard is the projection from the ventral tegmental area dopamine cells to the nucleus accumbens. for example, if psychostimulant-induced release of dopamine in the nucleus accumbens is impaired, this affects the acquisition of drug-seeking behaviors, and can markedly influence the amount of drug taken in a well-trained subject. thus, the learning of a task to obtain the drug and the amount of drug taken in a given session is strongly regulated by dopamine release in the accumbens. however, when an animal has been withdrawn from repeated psychostimulant use, and drug-seeking is initiated by an environmental stimulus such as a cue previously paired with drug delivery, or a novel stressor, it is dopamine release in the prefrontal cortex and amygdala, respectively, that mediates the reinstatement of drug-seeking. thus, relapse can be induced by dopamine release in prefrontal and allocortical brain regions, and reflects the aforementioned physiological role of dopamine release as a predictive antecendent to stimulus (drug) delivery. what this implies is that chronic release of dopamine by repeated psychostimulant administration may be modifying cortical and allocortical regulation of behavior. figure 1b shows that the cortical and allocortical regulation of behavior is primarily mediated by glutamatergic projections. these projections are to subcortical structures, such as the nucleus accumbens and dopamine cells in the ventral tegmental area, as well as between the cortical and allocortical regions. thus, when dopamine is released into the prefrontal cortex or amygdala by a drug-associated cue or stressor, this is thought to stimulate glutamatergic projections between the prefrontal cortex and amygdala, as well as glutamatergic outputs to the accumbens and ventral tegmental area. a variety of studies have linked this activation of corticofugal glutamate transmission with craving in psychostimulant addicts or drug-seeking in animal models of addiction. the neuroimaging literature clearly shows metabolic activation of regions of the prefrontal cortex, including portions of the anterior cingulate and ventral orbital cortices, and the amygdala during cue-induced craving for amphetamine-like psychostimulants. interestingly, while a cue or low dose of psychostimlant markedly increases metabolic activity in the prefrontal cortex and amygdala, in the absence of a learned drug association the prefrontal cortex is hypoactive. the reduction in basal metabolic activity is taken to indicate a potential deficit in cognitive ability to regulate relapse, and recent cognitive testing in psychostimulant addicts confirms the presence of certain cognitive dysfunctions related to impulse control and switching behaviors in an adaptive manner to changing environmental circumstances. a strong role for activation of both the prefrontal cortex and amygdala thus, pharmacological inhibition of either of these regions prevents the reinstatement of drug-seeking in animals withdrawn from drugs that have undergone extinction training. moreover, a marked release of glutamate is measured in the nucleus accumbens of animals initiating drug-seeking in response to a stressor, and this glutamate is derived from increased activity in the projection from the prefrontal cortex to the nucleus accumbens. one final set of studies to be considered regarding cortical glutamate is the recent evidence that as drug-seeking becomes more compulsive there is a gradual shift to greater reliance on corticostriatal habit circuitry, and less involvement of prefrontal to accumbens circuitry. this possibility is supported by animal models in two ways: (i) if animals that have been trained to self-administer cocaine are left in abstinence for an extended period, drug-seeking is augmented, and in this case inhibition of the prefrontal cortex or amygdala no longer inhibits drug-seeking induced by drug-associated stimuli. however, inhibition of the dorsolateral striatum is still effective at blocking drug-seeking; (ii) as training of an animal in drug-seeking paradigms progresses it is possible to show a gradual increase in dopamine released into the caudate in favor of release into the nucleus accumbens. this is illustrated in figure 1a, showing that dopamine release into the caudate can regulate habitual behaviors. on one hand, these data point to the possibility that in treating compulsive relapse we should be focusing on regulation of corticostriatal habit circuitry, including glutamate input to the caudate from sensorymotor cortex and dopamine input from the substantia nigra. however, these studies have been conducted in rats in whom the frontal cortex is poorly evolved, and given the marked activation produced in the prefrontal cortex and amygdala by drug-associated stimuli in psychostimulant addicts, the conclusion that compulsive relapse is entirely derived from corticostriatal habit circuitry may be an oversimplification. indeed, it has been argued that a primary role for therapy in treating addiction is to strengthen prefrontal regulation of drug-seeking behaviors, whether through psychosocial interventions or pharmacotherapy. given the apparent critical role played by glutamatergic affrents to the nucleus accumbens in initiating drugseeking or craving, recent studies have identified a number of enduring cellular changes in glutamate transmission that may be critical pathological neuroadaptations to psychostimulant use, and may serve as targets for pharmcotherapeutic intervention. in general the neuroplasticity can be categorized as postsynaptic, presynaptic and nonsynaptic (ie, residing predominantly in glia). however, since these processes are intimately related to each other, it is perhaps best to consider all the adaptations as changes in glutamate homeostasis, the end result of which is a psychostimulant-induced enduring change in the fidelity of communication between the prefrontal cortex and the nucleus accumbens, and the regulation by this projection of corticostriatal habit circuitry. it has been proposed that this loss of fidelity results in a weakening or loss in the capacity of psychostimulant addicts to cognitively intervene in habitual behaviors, thereby making drug-seeking more difficult to control and increasing the vulnerability to relapse. as mentioned above, drug-seeking is associated with a large release of prefrontal glutamate into the nucleus accumbens. the large release of glutamate during drugseeking is all the more remarkable because it was discovered using microdialysis. which is not a very sensitive measure of glutamate transmission. indeed, when animals are trained to seek a biological reward, such as food, microdialysis can not measure glutamate release. thus, the large psychostimulant-induced release of glutamate has been hypothesized to be a pathological and perhaps critical mediator of relapse. this hypothesis is supported by the fact that treatments interrupting synaptic glutamate release also inhibit drug-seeking. this includes a variety of pharmacological treatments that have the potential to be developed into pharmacotherapeutic agents, as outlined below. perhaps in part a consequence of the massive synaptic glutamate release occurring during psychostimulantseeking behavior, a number of marked changes in postsynaptic glutamate transmission have been measured in animals withdrawn from chronic cocaine or amphetamine administration. perhaps among the most dramatic importantly, this appears to be accompanied by an increase in the insertion of a-amino3-hydroxy-5-methylisoxazole-4-propionic acid (ampa) glutamate receptors into the membrane of spiny neurons in the accumbens, and is associated with an increase in electrophysiological sensitivity to ampa receptor stimulation (as measured by the ampa: n-methyl d-aspartate [nmda] ratio). moreover, a number of other proteins regulating the fidelity of postsynaptic glutamate transmission are altered after chronic cocaine use, including proteins that regulate the structure and function of the protein scaffolding in which the glutamate receptors are embedded, including postsynaptic density (psd)-95 and homer proteins, among others. also, in addition to ampa ionotropic glutamate receptors, signaling through metabotropic glutamate receptors is downregulated. finally, this psychostimulant-induced postsynaptic neuroplasticity is associated with changes in the biochemical machinery regulating spine formation, notably an increase in actin cycling and formation of factin (a primary structural protein regulating spine morphology and the insertion of proteins into and out of the membrane). taken together, these findings indicate that significant changes have been produced by psychostimulants in the way that synaptically released glutamate will be interpreted by postsynaptic cells. thus, there remain many apparent contradictions in the literature regarding changes in specific proteins, and in the overall direction of synaptic grading (ie, is postsynaptic glutamate transmission augmented or inhibited by chronic psychostimulant administration). therefore, for now it is probably not prudent to speculate on the type of drug development that may arise from this particular direction of research into psychostimulant-induced changes in glutamate signaling. as outlined above, given our current state of knowledge it is more likely that pharmacotherapeutic restoration of normal glutamate release may be a more successful approach than manipulating postsynaptic proteins responsible for and/or associated with changes in the fidelity of postsynaptic glutamate transmission. in part, this is due to the relatively contradictory status of the emerging literature on postsynaptic plasticity. moreover, it has been hypothesized that the adaptations in presynaptic glutamate release may be at least partly causal in the postsynaptic adaptations, posing the possibility that if the pathological release of glutamate can be successfully ameliorated, postsynaptic normalization may follow. pharmacotherapeutic targets for regulating the pathological synaptic glutamate release seen in the accumbens of psychostimulant-seeking animals can be placed into two categories: (i) targets based upon psychostimulant induced changes in proteins regulating synaptic glutamate release; (ii) proteins that produce a general decrease in excitatory transmission. compounds in the first category are likely to be the most specific for psychostimulant addiction, and perhaps carry the least number of unwanted side effects, while the latter category may be less selective not only regarding effects on other addictive drugs, but also in terms of unwanted side effects. neuroplasticity produced by chronic cocaine administration that could potentially contribute to pathological glutamate release includes downregulation of cystine-glutamate exchange, downregulation of glial glutamate transporters, and downregulation of release-regulating presynaptic metabotropic glutamate receptors (mglur2/3). importantly, these three changes are interrelated due to the cystine-glutamate exchanger and glutamate transporter regulating extrasynaptic glutamate tone on release regulating mglur2/3. drugs have been examined in animal models of psychostimulant addiction, and to a lesser extent in clinical trials with cocaine addicts that regulate one or more of these processes. for example, n-acetylcysteine upregulates cystine glutamate exchange, and has been shown in animal models to prevent synaptic glutamate release associated with drug-seeking, restore inhibitory tone on synaptic release through activation of mglur2/3, and to inhibit the desire for cocaine in a double-blind cue-reactivity trial in non-treatment-seeking cocaine addicts. also, mglur2/3 agonists have proven effective at inhibiting cocaine seeking in animal models; however, unlike nacetylcysteine, food-seeking was inhibited at only a 3- to 10-fold increase in dose relative to inhibiting cocaineseeking. although no studies have yet evaluated regulating glutamate transport in drug-seeking models of psychostimulant addiction, recent reports of the use of -lactam antibiotics to increase glutamate transporter membrane insertion poses an interesting possibility for pharmacologically overcoming the cocaine-induced downregulation of glutamate transporters. finally, while the mechanism is not clear, modafinil has been reported to increase extracellular glutamate levels, which would restore tone on release inhibiting mglur2/3. notably, modafinil has been found to successfully decrease cocaine relapse in a number of clinical trials. the primary drugs in the category of nonspecific inhibitors of synaptic glutamate release include a variety of -aminobutyric acid (gaba)-mimetic compounds. these range from relatively specific agonists at gabab receptors, such as baclofen, which inhibit synaptic glutamate release to a host of less selective compounds known to increase gaba transmission via interactions with synthetic or elimination mechanisms, such as topiramate or vigabatrin. for all of these compounds there is preclinical and clinical data to support some potential efficacy. however, as predicted, especially for the nonselective gabamimetics untoward side effects, such as sedation, are reported. this review has endeavored to transport the reader from the initiating molecular actions of amphetamine-like psychostimulants on dopamine systems in the brain to enduring neuroplasticity produced in glutamate transmission responsible for communicating from prefrontal and allocortical brain regions through the nucleus accumbens to motor regulatory systems. moreover, by examining molecular neuroplasticity produced in excitatory synapses by chronic psychostimulant administration, it is possible to make some deductions about potential pharmacotherapeutic interventions. indeed, there already exists an emerging literature supporting this approach in developing potential pharmacotherapies for treating psychostimulant addiction. importantly, this is a nascent and emerging science, and while much has been discovered, the cutting edge of discovery into the neuroplasticity produced by psychostimulants is understandably contradictory. as further discoveries are made that allow us to understand the nature of these contradictions, it should follow that additional targets will emerge to provide potential novel pharmacotherapies for treating psychostimulant addiction.

although the pharmacology of amphetamine-like psychostimulants at dopamine transporters is well understood, addiction to this class of drugs has proven difficult to deal with. the reason for this disconnection is that while the molecular mechanism of amphetamine action is critical to reinforce drug use, it is only the first step in a sequence of widespread neuroplastic events in brain circuitry. this review outlines the affect of psychostimulants on mesocorticolimbic dopamine projections that mediate their reinforcing effect, and how this action ultimately leads to enduring pathological neuroplasticity in glutamatergic projections from the prefrontal cortex to the nucleus accumbens. molecular neuroadaptations induced by psychostimulant abuse are described in glutamate neurotransmission, and from this information potential pharmacotherapeutic targets are identified, based upon reversing or countermanding psychostimulant-induced neuroplasticity.

PMC3202508

pubmed-245

arachnoid cysts are benign, non-neoplastic and extra-axial lesions; most of them are clinically silent and unchanged in size. in previous studies112131524), the incidence of arachnoid cysts has been estimated to range between 0.3% to 1.7%. however, the advanced neuroimaging techniques have facilitated the diagnosis of arachnoid cysts, which, in turn, has led to an increase in the number of patients2121415). in some cases, an arachnoid cyst arouses symptoms and its clinical presentations vary according to the size and location of the cyst. the most frequent symptom is headache, which is caused by the local mass effect, increased intracranial pressure (icp), and/or hydrocephalus15). above this, seizures, cognitive dysfunction, developmental delay, and intracranial hemorrhage can be also presented. in this report, we describe a case where a patient with a posterior fossa arachnoid cyst complained of visual field defect, visual disturbance, and mild headache; no ataxia and unsteady gait were reported. the patient's visual symptoms rapidly deteriorated in a week and, consequently, the patient's vision got worse. a 39-year-old male patient presented at our emergency room after a traffic accident and the brain computed tomography (ct) scan indicated an incidental arachnoid cyst on posterior fossa. at that time, the patient complained only of facial abrasions and the left knee pain, but not of headache or visual disturbance. in eight months, however, he revisited our department of ophthalmology to check the decreased visual acuity, visual field defect, and headache. on the ophthalmologic examination, bilateral papilledema (fig. 2a) were found. after the transfer to the department of neurosurgery, we rechecked brain ct scans (fig. the diameter of the patient's arachnoid cyst did not change compared to the previous ct scans; however, the slightly enlarged third ventricle was compressing the optic chiasm and the suprasellar area. since visual complications were expected, we recommended an emergency operation. one week later, he came back to the hospital with nearly complete visual loss. his right eye was completely blind, whereas his left eye recognized only light (fig. a conventional suboccipital craniectomy was performed on the patient lying on the operating table in the prone position. after the dural incision, the arachnoid cyst was exposed and cystic fluid was expelled. arachnoid membrane was carefully dissected and the arachnoid cyst was fenestrated to cisterna magna for connecting with the cerebrospinal fluid (csf) flows. arachnoid membrane which covering the foramen of magendie was also fenestrated and the csf flows was running properly (fig. 4). excluding the brain tumor, the collected membrane was sent to the pathologic laboratory. in high power field microscopy under the hematoxylin and eosin stain, the cystic membrane was composed by membranous fibrocollagenous tissues without tumor cells. one week afterwards, we checked the brain ct scans and the removal of the cyst and the decreased ventricle size were confirmed. on the ophthalmologic examination, the papilledema and visual field were slightly improved; however, the patient's visual acuity did not improve. upon the tenth day after the operation, the patient was discharged and, during the next one month, he was subject to the steroid therapy. in five months after the operation, papilledema (fig. nevertheless, visual acuity and visual field improved slowly and slightly (fig. 2c). the blind right eye improved to recognize the light and the blurred left eye improved to acknowledge the silhouette of an object; thus, it did not fully recovered to the prior, normal condition. their prevalence has been reported to amount to approximately 1% of all intracranial mass lesions112152430); however, advanced neuroimaging techniques and the widespread use of ct and mri imaging have led to an even higher incidence of report of these lesions1249121619203031). one recent study, al-holou et al.1), reviewed 48417 brain images and identified 661 (1.4%) arachnoid cysts. this report found that the prevalence of arachnoid cyst in children was 2.6%, slightly higher than in adults, and men (1.8%) have a high prevalence than women (1.1%). the most common locations were middle fossa (34%), retrocerebellar (33%), and cerebral convexity (14%)124). despite the increased identification of arachnoid cysts, the natural history and mechanism of enlargement has not been well defined1131524). nevertheless, when arachnoid cysts give rise to any symptom, headache is the most common complaint. in addition to headache, gait imbalance, seizure, and visual changes can also be presented according to the location and size of the arachnoid cyst. various operation techniques, such as cyst excision1517), stereotactic aspiration1825), endoscopic cyst fenestration512), ventriculocystostomy26), and cystoperitoneal shunt810152728), have been introduced and the main purpose of such operations is similar, namely, a direct decompression of the arachnoid cyst or making the connection between the cyst and the csf flows for spontaneous resolution. generally, visual symptoms occur in the patients with suprasellar arachnoid cysts, because the arachnoid cyst is adjacent to the optic nerves7). the patients with posterior fossa arachnoid cysts usually do not complain of visual symptoms, as the cyst is not adjacent to the optic nerves. however, a posterior fossa arachnoid cyst can indirectly disrupt the csf flows and, in turn, the disruption increases the whole ventricle size and the icp. in our case, the enlarged third ventricle was compressing the optic chiasm with cephalocaudal direction on the ct scan (fig. the compressed superior part of optic chiasm led to the defect of inferior visual field (fig., visual acuity was affected by the papilledema, which was caused by the increased icp. consequently, both visual acuity and visual field were influenced by the posterior fossa arachnoid cyst. when the patient first visited our department of ophthalmology, his visual symptoms and headache were not severe and the patient could walk and drive. besides, the brain ct scan showed no changes as compared to previous ct scans, so we could not predict a risk of rapid deterioration. the patient's refusal to have an operation and the surgeon's wrong prediction delayed the appropriate on-time treatment; ultimately, the patient's vision was severely damaged during the critical seven days. after the operation, the patient's visual acuity, visual field, and papilledema were slightly improved; however, we regard that the patient's vision will unfortunately not fully recover. unlike gait disturbance and ataxia, visual symptoms do not frequently occur in the patients with posterior fossa arachnoid cysts; this is so because the cyst is located away from the optic nerves. however, the disruption of csf flows can indirectly induce visual symptoms and these symptoms can rapidly deteriorate. considering the results of our case, it should be emphasized that the patients with posterior fossa arachnoid cysts could develop a rapid neurologic deterioration. therefore, in the event of the development of symptoms, an early intervention or close observation are crucial.

posterior fossa is a site next to the middle fossa where arachnoid cyst frequently occurs. generally, most arachnoid cysts are asymptomatic and are found incidentally in most cases. although arachnoid cysts are benign and asymptomatic lesions, patients with posterior fossa arachnoid cysts often complain of headaches, gait disturbance, and ataxia due to the local mass effects on the cerebellum. we observed a patient with a posterior fossa arachnoid cyst who had visual symptoms and a headache, but did not have gait disturbance and ataxia. we recommended an emergency operation for decompression, but the patient refused for personal reasons. after 7 days, the patient revisited our hospital in a state of near-blindness. we suspected that the arachnoid cyst induced the hydrocephalus and thereby the enlarged third ventricle directly compressed optic nerves. compressed optic nerves were rapidly aggravated during the critical seven days; consequently, the patient's vision was damaged despite the operation. considering the results of our case, it is important to keep in mind that the aggravation of symptoms can not be predicted; therefore, symptomatic arachnoid cysts should be treated without undue delay.

PMC4877559

pubmed-246

cities around the world can look very different if you compare the living conditions for the residents. however, it is not only different cities that can have completely diverse standards of infrastructure and social security. living in the slums compared to more wealthy neighbourhoods, will expose the inhabitants to different risks. traditionally cities can offer many advantages compared to rural settings, but under certain circumstances they can rather be a health hazard. the rapid migrations of people to cities can lead to overcrowding, which can generate slums or shanty towns. these slums are characterized by poor housing, lack of fresh water, and bad sanitation facilities (2). all of these shortages can be a threat to the residents health and be a possible breeding ground for infectious diseases. the location of slums are often outside of the city centres, in more hazardous locations and the population feels a lack of social and economic opportunities compared with other residents. in sub-saharan africa, 62% of the urban population in 2012 lived in shanty towns (2). for example, in 2009, 96% of the urban population in central african republic lived in these slums (6). in kenya's capital nairobi, 60% of the population lives in slums, and child mortality there is 2.5 times greater than other parts of the city (9). the community and health care services have great challenges to provide the entire population with equal and adequate service. the collected parties need to be aware of the differences in threats with respect to infectious diseases, both at the local and governmental levels. infections have been linked to slums in dar es salaam, tanzania, with high population density and low income (10). in several other countries, cholera incidence is the highest in urban regions with high population density (11, 12). differences in prevalence of asymptomatic carriers of antimicrobial drug-resistant diarrhoeagenic escherichia coli have also been found in brazil between slum settlements and more wealthy parts of the community 13). the poor infrastructure in the slum can be a barrier for improvement, but at the same time targeted interventions for safer water and better sanitation facilities could potentially have a profound effect of the overall health. overcrowded housing in high-density populations in the slums can be a breeding ground for infectious diseases such as tuberculosis. the rate of tuberculosis has traditionally been higher in urban centres compared to rural (14, 15). studies in slum settlements in dhaka city, bangladesh, indicate a high prevalence of tuberculosis, which was almost twice as high compared to the overall national average and four times higher than the overall urban levels (16. however, different patterns can be seen in different countries; for example, in poland the rates of tuberculosis have shown only slightly lower incidence in rural population compared to urban, 21.9 per 100,000 versus 22.4 per 100,000 respectively (17). tuberculosis in the united states has declined in the twentieth century, and several factors such as improved nutrition status, socioeconomic status, overall public health, and new drug regimens have been thought to play a major role. however, in the mid-1980s a resurgence occurred which reached its peak in 1992, especially in urban areas among the homeless and incarcerated population (18). the knowledge regarding symptoms, transmission, and prevention has been shown to be greater among the urban population in pakistan's punjab province compared to the rural population. health-seeking behaviour was also better among the urban population, in the aspect of when to seek medical advice for early diagnosis and potential treatment (19). information about infectious diseases and how they spread in the community can help the individuals to protect themselves, but knowledge about the slums and the infectious diseases panorama is also crucial for local physicians. they need to know how to look for the correct diagnosis, even if their diagnostic tools might be limited. the rapid influx of migrants can lead to overcrowding and local governments might not be able to provide safe housing, drinking water, and adequate sewage facilities, all of which are potential health hazards and must be taken into account for safe city planning. today more than half of the world's population, almost 4 billion people, have access to piped water connected to their homes. since 1990, well over 2 billion people have gained improved drinking water facilities, and almost 2 billion people have access to improved sanitation. however, more than 700 million people still lack access to improved sources of safe drinking water, and in sub-saharan africa half of the population lack such facilities. globally however, 1 billion people in the world still practice open defecation. in this group, 90% live in rural areas, but the actual amount of residents from urban settings is gradually increasing. between 1990 and 2012, the group in urban settings which lacked sanitation actually significantly increased from 215 million to 756 million, which could be explained by population growth (20). much of the hard work to improve sanitation facilities has benefited large population groups, but the rapid influx of new urban residents shows that there is still much hard work to be done. residents who are subject to overcrowding and who lack access to safe drinking water or proper sanitation can be more susceptible to soil-transmitted helminths (21). these infections are among the most important causes of physical and intellectual growth retardation in the world and have a major impact on public health (22). good hygiene practices and good sanitary conditions have lowered the prevalent levels of contamination. in the brazilian city of salvador, with a population of 2.5 million, an improvement of sewerage coverage from 26 to 80% of the households led to an estimated overall reduction of diarrhoeal diseases of 22% (23). neglected tropical diseases can cause substantial health problems in developing countries, and some of these diseases have a faecal-oral transmission pathway. examples of such diseases could be schistosomiasis, trachoma, and soil-transmitted helminthiases. in many countries, however, the focus is on treatment by medication and not improved sanitation. the reason could be that it would be much more expensive to carry out the necessary infrastructural improvements (24). safe drinking water and proper sanitary facilities must be taken into account in city planning. factors like this can potentially have a profound positive effect in lowering infectious diseases with a faecal oral route. one example of this is for chagas disease, which is a parasitic infection caused by the protozoan trypanosoma cruzi. an important mode of transmission is vectorial infected bites of triatomine bugs. living in close contact to domestic animals and poor hygienic habits chagas disease affects an estimated 8 million people every year, and is an important health challenge in latin america. in recent decades, progress has been made to reduce the burden of disease, by vector control, screening blood donors, improved housing, and epidemiological surveillance. chagas disease is a growing health problem in non-endemic areas because of population movements (26). it is estimated that 300,000 individuals in the united states are infected (27) and the most affected country in europe, spain, is thought to have 45,00067,000 cases (28). the example of chagas disease shows that physicians who practice in countries where the disease is not present must be aware of the travel history of the patient to connect the potential symptoms to the correct diagnosis. the environment in urban cities has proven to be favourable for the rat population (rattus spp.) and close encounters between rats and humans can lead to transmission of zoonotic infectious diseases., rickettsia typhi, streptobacillus moniliformis, bartonella spp., seoul hantavirus, and angiostrogylus cantonensis (29). new york city has one of the largest populations of rats in the united states. it has been shown that encounters between rats and humans have been linked to proximity to open public spaces and subway lines, the presence of vacant housing units, and low education of the population (30). information like this can be useful for health officials when they launch specific control initiatives. the changes in human population with increased urbanization and urban poverty has also altered our perception of some zoonoses linked to the rat population. leptospirosis has traditionally been perceived as a primarily rural disease, but the incidence in urban centres is increasing (31, 32). in chinese cities, the incidence of seoul hantavirus haemorrhagic fever with renal syndrome has been linked to urban growth, growing rat population, and increase rat human contact (33). large megacities all over the world have large rat populations, but the surveillance and local knowledge seem to be inadequate. a better understanding of how to prevent uncontrolled growth in rat population can potentially lead to a decline of these zoonotic diseases. the growing trend of urbanization around the world has shifted some infectious diseases, which have traditionally been perceived as rural, to urban settings. the world health organization (who) has published a list of 17 neglected tropical diseases. several of them have now become a reality in the urban environment, these diseases are something the practicing physicians in these areas have to be aware of (34). many of the diseases on the list are present in the developing world, which sometimes lack the opportunity to solve these problems by themselves. one of the neglected infectious diseases is lymphatic filariasis (lf) with 2 billion people at risk, and 394.5 million in urban areas. one of the main reasons is the lack of proper sanitation facilities (35). lf still has its major impact in rural settings, but the increasing urbanization in the developing world has made lf an infectious disease that also has to be considered elsewhere. one of the parasite species wuchereria bancrofti has been located in many urban areas and has the potential for transmission in this environment. moreover, one of the vectors for the parasite is the mosquito culex quinquefasciatus, which thrives in these surroundings, especially in overcrowded areas with poor sanitary and draining facilities. however, within one city the transmission can vary substantially depending on the standard of the sanitary conditions. the mosquito vector culex spp can be found in large parts of central and south america, east africa, and asia (36). another vector which has adapted to urban surroundings is the mosquito aedes aegypti, which is a key component for dengue transmission. dengue is on who's list of neglected tropical diseases, and is on the rise worldwide. the number of infections has drastically increased in the tropical regions of the world in the last 40 years. recent studies have estimated 390 million cases each year, and the burden is the highest in india with one-third of all the new infections (37). several factors have played a big role in the escalation, such as urbanization, globalization, and lack of mosquito control. aedes aegypti lay their eggs in artificial water containers made by humans, which is a key component in the urban transmission cycle. the adaption of dengue through its vector has made dengue an infectious disease on the clear rise (38). thailand is a country with all four serotypes of dengue virus, and the epidemics of dengue haemorrhagic fever have shown a possible correlation to originate from the urban capital of bangkok and then spread geographically in an outward manner to more rural settlements and provinces. a model to understand this mechanism could lead to more effective use of the health systems in the affected areas (39). dengue has become a global problem and is no longer restricted to the developing world. despite better knowledge, it seems tough to control the vector, which has adapted to the urban environment and living close to people. an efficient vaccine is not yet commercially available, but could be a powerful factor in the fight against the global dengue epidemic. often several different factors need to be favourable for a vector-borne disease to adapt to the conditions in an urban environment. for example, west nile virus (wnv) infection is an infectious disease which has become a reality in the urban environment. the primary vector is the mosquito culex pipens, which lay their eggs in water resources which are often man-made. however, for a successful transmission cycle wnv also need the american robin (turdus migratorius), which has several broods per season and hatchlings are more susceptible to wnv infection than adult birds (40). the county of dallas, texas, experienced an epidemic of wnv infections in 2012. surveillance reports revealed 25% of the cases in the united states were found in dallas county (41). it shows for a vector-borne disease to have a successful transmission cycle several different factors need to be in place to affect the human population. leishmaniasis is a disease caused by the protozoa leishmania, which affects 12 million and threatens 350 million people in 88 different countries. when rural migrants bring their domesticated animals to urban settings, often slums, they create favourable conditions for an urban transmission (43). it has been shown that it is a growing health problem and the ongoing urbanization has contributed to the increase (44). if the different vectors can adapt to the urban environment and man-made resources, the potential health implications can be of major concern. control programs and adequate surveillance is of importance, but in rapidly growing cities and slums it can be tough to implement such measures. emerging infectious diseases can also make the jump to stable transmission in the urban surroundings and surveillance of these can potentially prevent major health concerns and high cost for the health care services. who can play a major role in the fight for better control and knowledge. many of the countries in the developing world do not have the proper resources and the problem is not concentrated to one region, but is a global concern. numerous of the neglected tropical diseases play a major role in the developing world, which is currently experiencing a much faster pace of urbanization compared to the developed world. the who's call for help is important and, for example, dengue is now turning into a global crisis. safe and targeted assistance can be a huge factor for overall health; such assistance could be an effective vaccine or safe and easy vector control programs. the basis of large population groups in a restricted area can provide the perfect conditions for different epidemics. international travel has connected the world in the last century, and this mobility creates a potential threat of many emerging diseases. international tourist arrivals have shown an exceptional growth from 25 million in 1950 to 1,087 million in 2013. according to the latest forecast from the world tourism organization, international tourism arrivals will continue to increase, and in 2030 the figure is expected to be 1.8 billion (45). with the pace of modern travel, highly contagious infectious diseases can be a potential threat in a completely different setting compared to the original outbreak. urban population and the density of residents can meet the criteria for a new epidemic and create a public health disaster, if not taken seriously. international trade and travel can potentially also contribute to the occurrence of a worldwide pandemic. sars is thought to originate from the sars-like coronavirus (scov) of bats and reached the human host in china due to hunting and trading of bats for food (46). investigations have found this scov from the himalayan palm civets in live-animal markets in the region. the first cases of sars reportedly occurred in individuals who handled these animals to prepare exotic food, and the virus is thought to have crossed over to their human host (47). it spread in urban dwellings in large cities and in well-equipped city hospitals. public fear of travelling led to considerable economic losses that affected entire countries (48). the example of sars shows that food markets in southern china can be the origin of a worldwide health crisis. travel routes around the world have connected the urban world and large megacities like never before. accordingly it is important to take necessary preventive measures before the epidemic gets out of control, and here big organizations like who, but also governments, play an important role. early action is of utmost importance, and functional surveillance programs needs to be in place. the zoonotic disease dengue is endemic in most tropical and subtropical regions, which often are also popular tourist destinations. the burden of disease is on the rise, and estimations are that in returning travellers from southeast asia, dengue is now a more frequent cause of febrile illness compared to malaria (49). dengue is now an urban health problem, which is one of the major reasons why the rise is exceptional. the worldwide spread of certain antibiotic resistant staphylococcus aureus has been linked to tourism, which shows the potential impact on international health (50, 51). faecal colonization with esbl-producing enterobacteriaceae has also been linked to international travellers in several studies (5254). the physician needs to take into account the recent travel activities of the patient to better evaluate the current condition and need for potential treatment and care. global travel shows no signs of decline and the interconnected megacities around the world make global surveillance even more important when it comes to contagious infectious diseases. measurements to stop the spread need to be taken at the original location, but knowledge about the specific disease needs to be passed on to the global community and local health workers in other parts of the world. this global surveillance and alert system needs to be fast and efficient to, if possible, reduce the impact. the expected rise of travel makes it critical for the future global health and the possibility to react in time for possible threats. rapid and sometimes uncontrolled urbanization can, in certain circumstances, lead to closer encounters with wildlife. human influence on the ecosystems creates meeting points for new and potential zoonotic diseases, which could have a profound impact for both local and global health. new housing in the outskirts of big cities can potentially be meeting points for new and already known zoonotic diseases. of 335 emerging infectious diseases, which have been recognized between 1940 and 2004, more than 60% have been zoonotic diseases (55). living in close contact to domesticated animals and hunt for bush-meat can also be risk factors for an infectious disease to make the jump from the animal host to humans. major deforestation creates closer contact between humans and bats and even primates, who can potentially be host for new viruses. a better understanding, surveillance, and prevention of zoonotic diseases would be of great value, to both prevent and manage this upcoming threat for global health. hot spots for this transmission have been found and they often correlate where the process of urbanization is on the clear rise (56). even if it is not always the urban population who is at the front of new encounters with wildlife, it can still have an effect on urban health. the trend of people moving to cities are at the highest, where many of these new encounters with ecosystems take place, and infectious diseases can be introduced to these growing urban environments. the sometimes uncontrolled growth of cities pushes residents to untouched ecosystems when new housing expands. ebola virus disease (evd) has had a profound impact on the world in 2014. since the spring of 2014, the hub of the epidemic has been the three countries in western africa: sierra leone, liberia, and guinea. it all began in december 2013 in guinea, in the providence of guckdou, in the eastern rainforest region. the disease transmission in the capital of conakry is thought to be the first major urban setting for evd (57). who was first notified of the evd outbreak in march 2014, and on august 8, the who declared the current situation as evd outbreaks in central africa had been limited in size and geographical spread to a few hundred persons, mostly in remote areas and not large urban settings (59). the centre of the epidemic (guinea, liberia, and sierra leone) has, as many of their neighbouring countries, a large population living in rural settings; only 36, 49, and 40% of their population live in urban centres (6062). the population is, however, highly interconnected in these countries with travel and cross-border traffic, with good road access between rural and urban settings. these communications have made the magnitude of the evd epidemic possible. despite cases of evd in nigeria and lagos, a megacity with 20 million inhabitants, the transmission has been limited, which proves that implementation of control measures can limit the transmission (63). the mortality rate has been high in previous outbreaks, up to 90% (64). the fatality rate in the west africa epidemic has been estimated to around 70% for guinea, liberia, and sierra leone when data for patients with recorded definitive clinical outcomes (63). this unprecedented epidemic points out the importance of better surveillance, understanding, and preventions measures for this potentially deadly virus. ebola virus (ebov) is thought to be a zoonotic disease, and fruit bats are under investigation to be the natural reservoir. ebov sequences have been found in these animals near the human outbreaks which implies where the virus might originate from (65, 66). closer contact with humans and fruit bats are thus risks for a new global health crisis and the severity of an ebola epidemic has already been witnessed. the high costs, both from an economic and overall health perspective, have affected entire countries and have even cost lives on the other side of the earth. different factors, such as education, direct primary care services, and the governments capacity for rapid response to upcoming health threats, can contribute to the opportunities in a city. however, in many cities the poor can find it difficult to access proper health care, due to the cost of such services. in more rural areas, the problem can instead be the distance to the nearest clinic, which in reality makes it impossible for prompt and efficient treatment (2). malaria has historically been and is still a major health concern in large parts of the world. who estimates 198 million cases (124283 million) of malaria and 584,000 deaths (367,000755,000) in 2013. the highest mortality rates have been shown to be closely linked to poor countries with a low gross national income (gni) per capita (67). estimations have been made that nearly 25% of the total african population, 200 million, currently live in urban settings where malaria transmission is a reality. the annual incidence is estimated at 24.8103.2 million cases of clinical malaria among the urban population in africa (68). the relationship between the malaria mosquito vector and the human host determines the burden of morbidity and mortality. this interface is dependent on many different factors and the degree of urbanization is an important one. increased urbanization and decreased transmission have correlated in several different studies (69). however, whether it was the increased urbanization that led to a reduction in transmission or the malaria reduction that led to development that promoted urbanization of societies is a challenge to determine (70). a clear connection has been shown between reduced transmission of plasmodium falciparum and urbanization; however, for plasmodium vivax it is less obvious. for p. vivax, a connection has been found globally and in asia and africa; inconsistent results, however, were found in the americas. several possibilities could explain these incoherent results, such as more widespread transmission of p. vivax, lower transmission intensity, the wide distribution in asia, and high prevalence of duffy negativity in africa, which protects against p. vivax (71). the overall decrease of the burden of malaria has been a positive effect of urbanization, but the exact mechanisms are not yet known. coverage of measles vaccination in indonesia have shown to be 68.5% in rural areas, compared with 80.1% in urban regions (72). studies in nigeria have shown that sometimes the coverage can actually be better in more rural areas, and it might be explained by better mobilization and participation in the delivery of immunization services (73). in a study in uganda, 58% of the urban group compared to 53% in the rural areas were fully immunized, but polio vaccine was given to 51% in the urban group and 52% in the rural group (74). immunization coverage can also vary considerably among different settings, not only between rural and urban surroundings, but also between urban, rural, and slum settlements. in changdigarh, a union territory of india, full immunization of children at the age of 2 was 30% in slums, 74% in urban, and 62.5% in rural settings (75). it shows that there can be a wide variety of reasons for immunization status among the population in different regions and countries of the world. high coverage can prevent epidemics in large cities and save many lives; however, immunization needs to be available both for the rural and urban population to achieve the greatest benefit. a study in tanzania has compared the knowledge about certain zoonotic diseases among general practitioners in urban and rural areas. the rural practitioners had poor knowledge of how sleeping sickness is transmitted and clinical features of anthrax and rabies. laboratories in rural areas are often poorly equipped and can not always diagnose certain zoonotic diseases, which could limit the doctors capability for correct diagnosis and treatment (76). the knowledge about sexually transmitted diseases (stis) among bangladeshi adolescents was higher among people in urban areas compared to rural, both in general and hiv and aids (77). the same results about hiv and aids have been found among a canadian population (78). studies in chengdu and shanghai, china, have shown risk perception about stis and hiv and aids is profoundly changed in rural-to-urban migrants (79, 80). the same result has been shown in a study among rural-to-urban migrants in ethiopia 81). the rapid influx of migrants moving to cities makes it hard to get adequate information to all the different groups in the society. to educate the public is one of the many challenges for local governments and health officials. campaigns to improve the public knowledge are useful to fight the threat of infectious diseases. residents need to be aware of symptoms of infectious diseases to gain knowledge about when to seek health care and when it is safe to treat yourself. knowledge about food storage, waste management, vector control, and sanitary facilities are all aspects that can lower the burden of communicable diseases. these campaigns can sometimes be easier in the urban environment because of the density of the population. urbanization is an ongoing process in the world at the moment, but the pace of the process is not universal. the developed countries, which have traditionally been thought of as high-income countries, are already urbanized, and it is in the developing world that the rapid rise is taking place. infectious diseases still have a big impact on the global health, and urbanization is now altering the characteristics of these diseases. living conditions in cities are overall better in urban environments compared to rural settings; better housing, sanitation, ventilation, and social services all play an important role in this improvement. certain pathogens can, however, adapt to the different conditions and thus create a new challenge for both local governments and the global community. the capacity for surveillance, control programs, prevention, and public knowledge programs is far better in cities. but some countries do not have the resources and because these diseases can be of global concern, it is also the international community's responsibility to help and support with knowledge and resources. the rapid urbanization has also interfered in previously untouched ecosystems. these new settlements create new and closer encounters with wildlife, which can be a potential source of zoonotic diseases. these can be both previously known or new pathogens, which make the shift from their animal host to generate infections in humans. surveillance is of primary importance to monitor the burden of disease and will give both local authorities and the global community a chance for a quick response to public health threats. the author have not received any funding or benefits from industry or elsewhere to conduct this study.

the world is becoming more urban every day, and the process has been ongoing since the industrial revolution in the 18th century. the united nations now estimates that 3.9 billion people live in urban centres. the rapid influx of residents is however not universal and the developed countries are already urban, but the big rise in urban population in the next 30 years is expected to be in asia and africa. urbanization leads to many challenges for global health and the epidemiology of infectious diseases. new megacities can be incubators for new epidemics, and zoonotic diseases can spread in a more rapid manner and become worldwide threats. adequate city planning and surveillance can be powerful tools to improve the global health and decrease the burden of communicable diseases.

PMC4481042

pubmed-247

the effect of family on workforce is an important though often overlooked issue for work organizations, with implications for the morale, stability and productivity of the workforce. presumably men and women do not shed their family roles, relationships and experiences the moment they don their work clothes. indeed, the logic underlying many corporations ' decisions to offer employer-based family support, such as child care and flexible working schedules, may be that such benefits will enhance employees ' abilities to handle family matters and in so doing will enhance their work performance, commitment and satisfaction. this line of reasoning views the relationship between work and family as a reciprocal process in which work and family influence each other in a circular or feedback fashion. indian families are undergoing change, which in turn influences the environment in the basic unit. the family environment has been bombarded with new expectations, the media, high cost of living and a striving for better quality of life. although not much literature is available on the aspect of how family stress has influenced the productivity of the indian workforce, the author is of the opinion that absenteeism, alcoholism, gambling, heavy debts among employees are a reflection of bruised familial systems. the dual-earning couple is a new prototype that reflects the increasing educational and career aspirations of women. a significant proportion of these women in the workforce comprises of wives and mothers whose employment status demands a radical change in their pattern, activities, commitments and responsibilities, requiring a reassessment of the family environment. in india the proportion of women in the workforce in 1981 was 19.67% and it rose to 22.73% in 1991, further rising to 25.68% in 2001. on the flipside, psychosocial studies have shown that dual-earning couples in india have a poorer quality of marital life compared to single-earning couples,[46] in their study found that work-family conflict was expressed in 63% of thematic appreciation test (tat) stories written by women, whereas men's stories did not reflect this conflict. sources of stress in the lives of working women emerged from a lack of time to attend to multiple roles, presence of young children (6-12 years) in the family and additional responsibility at work in the form of promotions. the most common outcome of stress for the working woman was found to be poor mental and physical health resulting in depression, anxiety, asthma and colitis.[911] rajadhyaksha[79] studied dual-career as opposed to dual-earning couples in two metropolitan cities in india and found that in a dual-career family where husbands and wives were presumably matched in terms of their career involvement, work-family role conflict and organizational role stress were not significantly different among husbands and wives. for instance, women experienced more conflict between their job and home roles, while men experienced more conflict between their job and spousal roles. in the present day, the young indian adult is exposed to an entirely new pattern of living and a new set of mores, values and standards that are being widely accepted but which stand in contrast to those which were promoted by their parents and grandparents. the ambiguous values children and adolescents observe today in india, coupled with the increasing gap between aspirations and possible achievement, have led to a greater sense of ' alienation. ' parents too appear ill-prepared to cope with rapid social change, having grown up in hierarchically structured and interdependent social groups that included the extended family and kinship network, as well as caste groups that provided stability and solidarity. parents who seem modern in their child-rearing practices get anxious when their offspring breach established social codes. inter-generation conflicts related to marriage, career choice or separate living arrangements result in the tendency to fall back on tradition. subtle changes in family patterns, especially with regard to the use of authority within the family, as well as an increased focus on individual autonomy,[1617] are also likely to influence members ' expectations with regard to marriage and their choice of a spouse. educated middle class families are now more hesitant to make decisions for their offspring with regard to marriage, education and employment. changes have also been noticed with regard to a greater focus on the husband-wife relationship rather than the parent-child relationship. with an increased onus of responsibility falling on the individual rather than on the entire family, gore calls ' choice anxiety' increased autonomy and increased choice that have led to increased anxiety. ambiguity with regard to issues like respect for elders, role of the eldest son, love marriages, working wives, etc., is an inevitable fallout of the changes within the indian family. relationship-focused education for young adults in the workforce has not been on top of the agenda for india's policy makers. india's policies on family and child welfare have been focused more in terms of health care, nutrition, reproductive health, sexuality and venereal disease. however, one can not forget that young adults of marriageable age from ' first-generation urban-educated families ' are facing relationship-based problems due to changing dynamics within the indian family. these include shifts in loyalty from filial obligations to lean more towards conjugal ties and issues of power and gender role allocations. marriage is traditionally seen as means for procreation, but there are slow changes in perception among adolescents towards viewing it as a means of companionship. with couples migrating to cities for better job prospects, there is a decreased availability of the informal support provided by the extended family in the past, resulting in young couples having to develop greater problem-solving and coping skills on their own. this in turn weighs heavily on an employee's ability to focus completely on tasks at work. it is essential to bridge the gap between what their families of origin considered as an ideal or happy marriage and what they now desire from a spouse and family life. the author conducted individual interviews with family-intervention experts in bangalore city in order to better understand the changing family patterns that they were observing. among the professionals, there were two clinical psychologists, two psychiatric social workers, two psychiatrists and one divorce lawyer. the key person interview (kpi) cue statements to initiate discussions with the experts were as follows [table 1]: description of key person interview participants changes that you are seeing in the nature of problems that families are coming to you with in comparison to the nature of problems brought up a decade agoname some culture-specific areas that need to be kept in mind while preparing the family life education programsome areas that you feel need to be essentially covered by a family life education program for single young adults. changes that you are seeing in the nature of problems that families are coming to you with in comparison to the nature of problems brought up a decade ago name some culture-specific areas that need to be kept in mind while preparing the family life education program some areas that you feel need to be essentially covered by a family life education program for single young adults. it is interesting to note that among the changes noticed by family experts in relation to the aspect of family issues, is the ability to recognize issues early on in the marriage and to seek help for the same. another important change noticed by the experts was that a larger number of young couples who were either engaged or in a relationship were now seeking professional help in order to help them make the right choice of a partner or to resolve issues that they were afraid would snowball into a larger issue post-marriage. an interesting perspective put forward by the legal expert in family law was that he was seeing an increasing number of divorces that were occurring as early as the third or sixth month of marriage, with both partners willing to go in for a divorce by mutual consent. this, he said, was in stark contrast to what he encountered some 10 years ago, when most couples would go through a long-drawn-out battle with much mud-slinging or would want to keep trying to make things work. the recognition of sexual dissatisfaction by, and the unwillingness to stay in a marriage on the part of, the female spouse was also another prominent change that experts were noticing. a long-distance relationship, with spouses staying in different cities and meeting on the weekends, was also another trend that was being noticed. themes from key person interview with family experts leadership and decision-making issues in the joint family largely arose due to the inability to face up to, or communicate with, authority figures within the family, thus leading to frustration and passive aggression. talking about one's sexual needs was another cultural peculiarity that often created rifts within couples or forced couples to try and work things out. it is also interesting to note that the family experts were able to clearly point out the need for any family life education program to be sensitive to indian culture in terms of how it viewed the role of the joint family. experts also pointed out the program had to be careful about how it portrayed communication within the family and had to keep in mind the factor of ' respect ' that indian families often prescribe to. the third column clearly gives the areas that these family experts felt a family life education program should cover. the experts felt that adaptability was an important skill that the new indian spouse was quickly losing. gender sensitivity in terms of acceptance of changing work and family roles of the female spouse by the male spouse was another important area that the experts talked about. discussions with these family-intervention experts brought out the following areas as possible aspects to be included in family life education program for the younger-generation workforce: gender sensitivityparenting skillsconflict resolution skillsadaptability to changebalancing work and the familycommunication skillssocialization and social supportmoney managementchoosing a life partnersexuality and intimacydealing with violence and addiction conflict resolution skills adaptability to change balancing work and the family socialization and social support choosing a life partner sexuality and intimacy dealing with violence and addiction the experts definitely seemed to sense the need for some form of education or training for the young indian adult who is either contemplating family life or is a new entrant into marriage or parenthood. family issues that eat into employees ' ability to perform or affect his cognitive and emotional state of being need to be addressed. a promotive and preventive strategy rather than a curative one would have to be adopted for this purpose. relationship-focused family life education programs for the target group of employees at the workplace may actually serve to fulfill this purpose, whereby employees, through group interaction and experiential learning, can be taught skills to deftly handle family-life conflicts either by themselves or through the support of mental health professionals. thus a mental health professional need not be there merely to diffuse a difficult situation arising out of deviance of an employee. he or she may act as a preventive agent of avoiding such deviance from arising, by tackling the problem at the root by pre-equipping the family with the necessary psychoeducation and skills.

the article presents the premises for the need to develop a relationship-focused family life education program for young adult employees. the article explores the changing trends in the indian family unit and their impact on the workforce. the author also presents the findings from interviews with family-intervention experts and their recommendations for the contents of such a program.

PMC2923417

pubmed-248

surgical resection of tumors is a common therapeutic procedure, especially for early-stage localized, and potentially curative, disease. while surgery can ultimately cure many patients, such as those with early-stage disease, distant macroscopic metastasis can emerge in others months to years later (demicheli et al. it has been reported that 25%30% of colorectal cancer patients who have no visible metastasis at the time of diagnosis will develop distant metastases within 5 years after primary tumor resection, which in some cases may be related to the effects of the surgery (van der bij et al., 2009). similarly, high risk of recurrence for early-stage breast cancer patients following mastectomy has been reported in an analysis of 1,173 patients who underwent mastectomy with no subsequent adjuvant systemic therapy (demicheli et al., 1996). mechanisms to explain distant metastasis following primary tumor resection include (1) the presence of residual tumor cells or tissue at the resected site (ando et al., 2003, minsky et al., 1988), (2) the recruitment of inflammatory cells and platelets to the resected site that promote wound healing and cell proliferation (ceelen et al., 2014, hofer et al., 1999, retsky et al., 2012), and (3) increased local and systemic effects that can induce an angiogenic switch in remote dormant tumors (bono et al., 2010, retsky et al., 2012, takemoto et al., 2012). previous studies have revealed that hypoxic tumor cells stimulate angiogenic-related factors via hif1-, leading to increased tumor invasion (paraskeva et al., 2006, hif1- expression in tumors can also upregulate lysyl oxidase (lox) (erler et al., 2006), a member of the secreted copper-dependent amine oxidases known to covalently crosslink collagens and elastin in the extracellular matrix (ecm) (barker et al., 2012). lox is expressed by different cell types, including tumor cells and stromal cells within the tumor microenvironment (decitre et al., 1998). it has been shown that increased lox expression in tumors accounts for the recruitment of cd11b bone-marrow-derived cells (bmdcs) at distant organs, contributing to the formation of a niche and facilitating a pre-metastatic microenvironment for tumor cell seeding (erler et al., 2009). however, the contribution of lox to tumor cell seeding and subsequently to metastasis soon after surgery is unknown. the host response to anti-cancer therapy and its contribution to tumor (re)growth and metastasis has been evaluated following chemotherapy (daenen et al., 2011, gingis-velitski et al., 2011), radiotherapy (barcellos-hoff et al., 2005, 2015), and various molecularly targeted drugs (beyar-katz et al., 2016) (for a review, see shaked, 2016). here, we evaluated remote (pulmonary) changes in lox expression and activity in response to surgery and their contribution to tumor cell seeding and metastasis. increased metastases after localized tumor resection in some cases could be due to systemic changes that affect various host tissues in response to surgery. previous clinical studies indicated that both systemic and local angiogenesis are induced in response to surgery when compared to laparoscopy (bono et al., 2010). to test whether our surgical mouse model induces angiogenesis, we performed a surgical procedure in non-tumor-bearing mice involving a 1 cm incision in the peritoneum followed by suturing. thereafter, we evaluated the levels of circulating bone-marrow-derived proangiogenic cells over time and the extent of local angiogenesis following surgery. a significant increase in the number of viable circulating endothelial cells (cecs) and endothelial progenitor cells (ceps) likewise, increases in microvessel density in matrigel plugs, in vitro human umbilical vein endothelial cell (huvec) microvessel tube formation, and microvessel sprouting from murine aortic rings were observed in the presence of plasma obtained from post-surgery mice compared to control (figure s1b the surgical procedure in our mouse model mimics host angiogenic effects reported in certain clinical circumstances. we next evaluated the host-derived effects of surgery on tumor cell seeding and growth in metastatic sites. we employed an experimental lung metastasis assay using the murine emt/6-gfp+ breast cancer cell line. control mice and mice that previously underwent surgery were intravenously injected with tumor cells, which subsequently seeded in the lungs. mortality rates were increased in post-surgery mice compared to controls (figure 1a). similarly, recipient mice injected with 100 l plasma from donor mice that had undergone surgery exhibited an increased mortality rate in comparison to mice injected with control plasma (figure 1b), indicating that a host effect, expressed within the plasma, in response to surgery rather than the actual surgical procedure is responsible for the observed effects. to directly assess tumor cell seeding in the lungs, regardless of any host responses that may affect tumor cells per se while seeding and proliferating at the metastatic sites, a pulmonary metastatic assay (puma) was performed using the emt/6-gfp+ cell line. in this assay, the potential of tumor cell seeding is solely dependent on tumor cells binding to the lungs and not systemic effects that could affect tumor cell proliferation. the number of gfp+ tumor cells present in the lungs of mice that underwent surgery was substantially elevated in comparison to control mice (figures 1c and 1d). taken together, our results suggest that enhanced tumor cell seeding is a result of remote changes occurring, in part, in the pre-metastatic (lung) tissue in response to surgery. ecm remodeling is one of the main factors that can facilitate tumor cell seeding; lox mediates collagen crosslinking and therefore is a key regulator of ecm remodeling (barker et al., 2012). recent studies have shown that lox is expressed by tumor cells, and serves as a key enzyme promoting metastasis by contributing to a pre-metastatic niche (cox et al., 2015, erler et al., 2006, erler et al., 2009). in our model, we found that lox expression and activity were significantly upregulated at the hypoxic surgical site in the wounded peritoneum in comparison to control peritoneum (figures 2a2c). specifically, high-magnification images of the surgical site revealed intracellular lox expression of peritoneal myofibers (figure s2a). furthermore, lox expression and activity, quantity of newly synthesized collagen, and fibrillar collagen expression were all significantly higher in the lungs of mice that underwent surgery than in the lungs of control mice (figures 2d2i). notably, high lox extracellular staining was located mainly in the lung stroma surrounding the bronchioles in post-surgery lungs when compared to control lungs (figure 2j). however, high-magnification images detected intracellular lox expression in different cell types, with no noticeable differences in expression pattern between control and post-surgery lungs, suggesting that the major source of lox in the lungs of post-surgery mice is from the remote surgical site (figure s2b). in addition, a significant decrease in lox expression and activity was found in the liver of mice that underwent surgery compared to control mice, whereas no significant changes were observed in the spleen (figures s2c and s2d). importantly, 24 hr after surgery, the percentage of cd11b cells in the pre-metastatic lungs of post-surgery mice was comparable to that in control mice (figures s2e and s2f), ruling out the possibility of the formation of a reported pre-metastatic niche at this early time point (erler et al., 2009, kaplan et al., 2005, these results indicate that the immediate effects of surgery are primarily associated with ecm remodeling. in order to strengthen the hypothesis that lox is a major contributor to metastatic seeding in the lungs within hours of surgery, a puma, which measures cell seeding in the lungs, was carried out on mice 24 hr after they were injected with recombinant lox, the function of which was evaluated by a lox activity assay (figure s2 g). an increased number of metastatic cells was found in the lungs of mice injected with recombinant lox compared to control mice injected with pbs (figures 2k and 2l). the seeding of cells in collagen and ecm is regulated in part by integrin signaling pathways (larsen et al., 2006). one of the major readouts of integrin signaling is paxillin, a scaffold protein connecting focal adhesion kinase to the actin cytoskeleton (turner et al., 1990, zaidel-bar et al., 2007). we therefore sought to determine the level of phospho-paxillin (p-pax) in mcf-7 breast carcinoma cells, a cell line with minimal lox expression (kraft-sheleg et al., 2016), in response to plasma from control or post-surgery mice. mcf-7 cells were seeded on collagen, laminin, or fibronectin, all of which are ligands of integrins (heino and kpyl, 2009), in the presence or absence of plasma from control or post-surgery mice. increased expression of p-pax was observed with all three ligands in the presence of plasma from post-surgery mice compared to control, with laminin producing the weakest effect (figures 3a and 3b). in addition, when the same experiment was performed using plasma from post-surgery mice depleted of lox, the expression of p-pax was found to be lower than the post-surgery non-depleted plasma group (figures 3c and 3d), suggesting that lox expression mediates focal adhesion signaling. furthermore, expression of p-pax was higher in the lungs of mice that underwent surgery than in control mice, an effect that could be inhibited by treating the mice with -aminoproprionitrile (bapn), an irreversible competitive inhibitor of all lox family members (bondareva et al., 2009) it should be noted that all three ligands are substrates of lox as assessed by the oxidation assay, whereas laminin was the least effective substrate, in line with the results shown in figures 3a3d (figure s3a). taken together, increased lox activity in the lungs soon after the mice undergo surgery contributes to tumor cell seeding via focal adhesion signaling, suggesting interactions between integrins and lox ligands in the remodeled ecm. as lox contributes to the seeding of tumor cells in the lungs, we next studied the effects of lox inhibition in mice using bapn. plasma from control mice or mice that underwent surgery was injected into recipient naive mice. after 24 hr, the recipient mice were injected with emt/6-gfp+ cells to obtain the experimental lung colonization metastasis assay described above. bapn monotherapy did not affect the percentage of gfp+ cells in the lungs of control mice. in contrast, the increase in percentage of gfp+ cells in the lungs of mice injected with plasma obtained from the post-surgery mice was completely abolished by the bapn therapy (figures 4a and 4b), and their mortality rate was reduced, as assessed in a parallel experiment (figure 4c). no significant changes in mortality rate and percentage of gfp+ cells in the lungs of control mice treated with bapn or pbs control were found (figures 4b and 4c). importantly, escalating doses of bapn in a range of 010 mg/ml did not contribute to tumor cell apoptosis (figure s3b), suggesting that the therapeutic effect of bapn is related to the inhibition of lox activity. furthermore, inhibiting lox using specific anti-lox activity-inhibiting antibodies similarly reduced tumor cell seeding in the lungs of mice injected with plasma from post-surgery mice, indicating that the effect is largely regulated by lox. of note, it is not clear why blocking lox in control mice increased metastatic cell seeding (figures 4d4f). it is possible that other bypass pathways may play a role similar to mmp9 inhibition in control mice as previously described (gingis-velitski et al., 2011, moreover, fibrillar collagen and newly synthesized collagen quantities in the lungs of mice 3 days after localized peritoneal surgery were significantly increased when compared to lungs obtained from post-surgery mice treated with bapn or anti-lox antibodies (figures 4g4i). of note, both anti-lox and bapn reduced lox activity in the lungs, while control rabbit immunoglobulin g (igg) had no effect (figures s3c and s4, respectively). to further strengthen our results, we wished to rule out the possibility that inflammation-induced pulmonary vessel permeability mediates the increased tumor cell seeding in the lungs at this early time point. evans blue assay performed on mice 24 hr after they underwent surgery revealed that pulmonary vessel permeability was not significantly different in post-surgery mice compared to control mice (figure s5a), suggesting that tumor cell seeding was not affected by inflammation. additionally, the number and percentage of tumor cells (emt/6-gfp+) seeded in the lungs 20 min after tail vein injection of 2 10 cells (10-fold higher than the number of cells injected in the puma) were significantly higher in post-surgery mice than in control mice. this effect was dramatically reduced when the mice were also treated with bapn as assessed by microscopic imaging of lung specimens and flow cytometry of single-cell suspensions from dissociated lungs (figures s5b and s5c). taken together, lox-induced ecm remodeling accounts for tumor cell seeding in the lungs of post-surgery mice. the fact that plasma derived from post-surgery mice had the same effect on tumor cell seeding as surgery itself suggested it entails the factor mediating this activity. therefore, lox levels were evaluated in the plasma of control and post-surgery mice. the plasma of post-surgery mice exhibited significantly elevated lox levels compared to plasma from control mice, suggesting that lox upregulation in the plasma may affect tumor cell seeding in the lungs (figure 5a). to test this possibility, we depleted lox from plasma of control mice and mice that underwent surgery and assessed tumor cell seeding using puma in recipient mice injected with the different plasma samples. whereas lox depletion did not affect tumor cell seeding in the control group, it significantly decreased tumor cell seeding in the surgery group (figures 5b and 5c). in a parallel experiment, plasma was obtained from untreated wild-type mice or bapn-treated lox heterozygous mice (mki et al., the plasma was then injected into mice, and survival was assessed in an experimental lung metastasis assay. however, in the surgery group, survival times were increased when lox was inhibited (figures 5d and 5e; statistical significance [p =0.043] was reached when comparing surgery with surgery +lox depletion groups). collectively, our results suggest that lox in the plasma from post-surgery mice promotes tumor cell seeding, and its depletion inhibits collagen synthesis and ecm remodeling. to bolster the possibility that our results may be clinically relevant, we employed two different experimental approaches. in the first, we used a more clinically relevant tumor mouse model of metastasis, in which spontaneous metastases appear in the lungs after resection of a primary orthotopic 4t1 murine breast cancer. to inhibit lox, bapn-treated mice exhibited significantly extended survival and reduced lung metastasis in comparison to mice that did not receive treatment after surgery (figures 6a6d). in the second approach, plasma was drawn from colorectal cancer patients at baseline and 24 hr after they underwent abdominal surgery (n =6). the plasma was injected into mice, and metastases were evaluated using emt/6-gfp+ cells in an experimental lung metastasis assay. in five out of six cases, the post-surgery plasma induced higher numbers of lung metastases in comparison to baseline plasma (figures 6e and 6f). such post-surgical plasma also induced ecm remodeling and increased fibrillar collagen expression as well as lox activity in the lungs in a manner similar to that found in mice that underwent abdominal surgery (figures 6 g, s6a, and s6b). importantly, pooled plasma obtained from patients that underwent surgery that was depleted of lox did not increase metastatic seeding in the lungs as assessed by puma (figures 6h and s6c). the notion that tumor cells remaining at the site of a surgical resection can re-grow and sometimes even spread may contribute to inferior outcomes in both clinical and preclinical scenarios (coffey et al., 2003, delisser et al. we find that the host, in response to surgery, conditions potential metastatic sites to facilitate tumor cell seeding. we demonstrate that mice that undergo abdominal surgery and are subsequently injected with tumor cells via the tail vein succumb to extensive metastatic lesions earlier than controls. these mice exhibit structural changes in the ecm at the site of metastasis due to an increase in newly synthesized collagen. lox activity and expression are substantially enhanced in the lungs of mice following surgery, as well as in mice pre-conditioned with plasma from donor mice that underwent surgery. accordingly, we find that the surgery is associated with release of lox to the circulation from the hypoxic wounded site, which in turn induces the formation of the pre-metastatic sites. such pro-metastatic effects are abolished following lox inhibition (e.g., using bapn, neutralizing antibodies for lox, or lox depletion from plasma). notably, antibodies only neutralize extracellular lox and therefore act primarily on the ecm rather than on lox intracellular targets. lox has been implicated as a key enzyme contributing to the pre-metastatic niche promoting the recruitment of cd11b cells to future metastatic sites measured within weeks after primary tumor cell implantation (erler et al., 2009). furthermore, increased activity of lox and collagen crosslinking have been shown to promote fibrosis and subsequent metastasis (cox et al., 2013). in our study, we focused on the immediate contribution of lox to metastasis by means of ecm remodeling, which promotes the seeding of tumor cells in the lungs within hours following surgery. at this time point, no changes in cd11b cells colonizing the pre-metastatic sites were observed, and there was no significant difference in pulmonary permeability, suggesting that inflammation at this early time point did not contribute to tumor cell seeding. however, it should be noted that clinically, the use of ketorolac (an analgesic drug with non-steroidal anti-inflammatory properties) in surgery resulted in superior disease-free survival of breast cancer patients who underwent mastectomy compared to patients who underwent mastectomy but were not treated with ketorolac (retsky et al., 2012). have demonstrated that lox is a key regulator of metastasis that is induced by hypoxia. lox expression in hypoxic tumors correlates with increased incidence of metastasis in patients with breast and head and neck cancers. accordingly, the blockade of lox in mice bearing orthotopic breast cancers results in decreased tumor cell invasiveness and metastasis (erler et al., 2006). in addition, bone metastasis of triple negative breast cancer cells is associated with hypoxia and lox activity (cox et al., 2015). family members promote endothelial cell activity and angiogenesis in tumors and support ecm remodeling (baker et al. therefore, antiangiogenic therapy, which induces hypoxia in tumors (blagosklonny, 2001), may lead to increased lox expression. as a result, alterations in ecm may take place in distant sites (e.g., lungs or liver) that can decrease the therapeutic response to therapy. these effects may also explain why, at least pre-clinically, antiangiogenic drugs sometimes promote metastasis (ebos et al., 2009, pez-ribes et al., 2009, the question remains why lox has a significant effect on ecm remodeling in the lungs while its expression and activity in other organs are reduced or do not change in post-surgery mice when compared to control mice. it is possible that the high oxygen concentration in lung tissue contributes to lox enzymatic activity. abundant microvessel networks in the lungs contribute to increased oxygen availability, which in turn promotes lox enzymatic activity (barker et al. this may explain the increased lox enzymatic activity in the lungs compared to other organs. thus, the level of ecm remodeling could be higher in lung stroma than in other tissues. mice bearing tumors that spontaneously metastasize exhibit a reduced mortality rate when lox is inhibited following surgery. additionally, mice preconditioned with plasma from post-surgery colorectal cancer patients exhibit an increased number of metastatic cells in the lungs compared to mice injected with the same plasma that was depleted of lox or plasma at baseline (before surgery). taken together, in addition to the known metastatic effects of lox (barker et al., 2012), our study reveals that lox induction contributes to the rapid formation of a permissive niche for metastatic cell seeding in response to surgery. murine lewis lung carcinoma (llc), emt/6 and 4t1 mammary adenocarcinoma, and human mcf7 breast carcinoma cell lines were purchased from the american type culture collection (atcc). all cells were grown in dmem, supplemented with 10% fetal calf serum, 1% l-glutamine, 1% sodium pyruvate, and 1% streptomycin, penicillin, and neomycin in solution (10 mg/ml, biological industries). some of the cell lines (as indicated below) were stably transfected with gfp or mcherry vectors (clontech laboratories, 632379 and 631985, respectively). the cells were passaged in culture for no more than 4 months after being thawed from authentic stocks and were regularly tested and found to be mycoplasma-free. the use of animals and experimental protocols were approved by the animal care and use committee of the technion. balb/c female mice (harlan), 810 weeks of age, were orthotopically injected with 0.5 10 mcherry-expressing 4t1 (4t1-mcherry+) to the mammary fat pad. tumor size was assessed regularly with vernier calipers using the formula, width length 0.5. an experimental pulmonary metastatic model was obtained using female balb/c or c57bl/6 mice, 810 weeks of age, intravenously injected through the tail vein with 2.5 10 gfp-expressing emt/6 (emt/6-gfp+) or gfp-expressing llc (llc-gfp+) cells, respectively. mice were not randomized after surgery except in the case of the clinically relevant tumor model (4t1 mouse model). the experiments were not blinded to the investigator; however, they were blinded to the mouse health care attendant who carried out daily health checks and reported on mice at endpoint. 10-week-old female lox c57bl/6 heterozygous mice described previously (mki et al., 2002) were used in some experiments. mice were anesthetized using an induction of 4% isoflurane, followed by maintenance anesthesia with 1.5% isoflurane. a 11.5 cm incision in the peritoneum was then performed, followed by suturing with silk. for resection of primary 4t1 tumors, when tumors reached 150200 mm ,. of note, all mice (control and surgery groups) received anesthesia and analgesic buprenorphine at a concentration of 0.04 mg/kg for three sequential days according to the institutional ethical protocols. 8- to 10-week-old balb/c or c57bl lox mice underwent the surgical procedure (as above) or left as control. after 24 hr, blood was drawn by cardiac puncture using citrate tubes, and plasma was separated. plasma was injected intraperitoneally into recipient mice at a volume of 100 l/mouse. in some experiments, bapn (sigma-aldrich) was injected intraperitoneally at a dose of 100 mg/kg daily for seven consecutive days, or as indicated in the text, as previously described (bondareva et al., 2009). the antibodies were intraperitoneally injected at a dose of 20 mg/kg as previously described (erler et al., 2006). control rabbit igg antibodies (jackson immunoresearch laboratories) were injected intraperitoneally at a dose of 20 mg/kg. recombinant lox (origene) was injected intraperitoneally at a dose of 25 g/kg, as previously described (cox et al., 2015). the human study was approved by the ethic committee at the european institute of oncology (eio), milan, italy, and all patients signed an informed consent. plasma from colorectal cancer patients, who underwent open abdominal surgery, was provided by the department of pathology at the eio. blood from the patients (n =6) was collected at baseline (before surgery) and 24 hr after surgery. blood was drawn from anaesthetized mice by cardiac puncture and collected in edta tubes, and red blood cells were lysed. lung samples or matrigel plugs were prepared as single cell suspensions as previously described (adini et al., 2009, gingis-velitski et al., 2011). cecs, ceps, emt/6-gfp, and 4t1-mcherry+ were analyzed by flow cytometry as previously described (shaked et al., 2005). frozen lung sections or matrigel plugs were immunostained as previously described (gingis-velitski et al., 2011). plates coated with collagen (20 g/ml), fibronectin (20 g/ml), or laminin (20 g/ml) were incubated with plasma from control, post-surgery mice or plasma from post-surgery mice depleted of lox. after 4 hr, the plasma was washed and mcf7 cells (7 10/well) were seeded and cultured for 24 hr. mcf7 cells were then removed, and lysates were prepared to evaluate paxillin and p-pax expression by western blotting. the assay was performed as previously described (mendoza et al., 2010). collagen production in lung lysates was quantified using the sircol collagen assay kit (biocolor) in accordance with the manufacturer s instructions. details are provided in supplemental experimental procedures. to visualize ecm and collagen, a two-photon microscopy and a second harmonics generation system lungs from the different groups as indicated in the text were frozen in optimal cutting temperature (oct) and sliced at a thickness of 150 m in pbs. the slices were imaged using a two-photon microscope 2pm: zeiss lsm 510 meta nlo, equipped with a broadband mai tai-hp-femtosecond single box tunable ti-sapphire oscillator, with automated broadband wavelength tuning 7001,020 nm from spectraphysics, for two-photon excitation. for second harmonic imaging (shg) to detect collagen, a wavelength of 800 nm was used (detection at 400 nm). data were collected (n =3 mice/group). for quantification measurements, images were analyzed using imagej 1.41k. to avoid edge effects (attenuation of the shg signal at the top and bottom of the section), only the central image of each z mean gray value limited to threshold of each image was calculated for each image and averaged over a set of at least five fields of view. lox activity was evaluated as previously described (siegel, 1974, siegel et al., 1970). briefly, a reaction solution containing 50 mm sodium borate (ph =8.2) and 4 u/ml horseradish peroxidase was mixed with lung extracts to obtain a protein concentration of 250 g/ml. the lysate extracts were obtained from mice treated with bapn, anti-lox, recombinant lox, or rabbit polyclonal antibody using the same concentrations as above. furthermore, lysate extracts of lungs or peritoneum obtained from control mice or mice that underwent surgery were treated with bapn, anti-lox antibodies, recombinant lox, or rabbit polyclonal antibody and used as controls for the lox activity assay. the enzymatic reaction was started by adding substrate mixture containing 50 mm sodium borate (ph =8.2), 100 mm n-acetyl-3,7-dihydroxyphenoxazine (amplex red; molecular probes, invitrogen), and 20 mm 1,5-diaminopentane. in some experiments, 500 m bapn was added to the mixture as a negative inhibitory control. the production of h2o2 by lox results in fluorescent resorfurin production, which can be measured (excitation at 540 nm and emission at 580 nm wavelengths). the fluorescent reaction was measured every 5 min for 1.5 hr at 37c using a fluorimeter (fluo star galaxy). lox expression in plasma and organ lysates (50 g protein) was evaluated by elisa (cloud-clone-corp. sec580mu) in accordance with the manufacturer s instructions. to analyze the activity of lox on different substrates, the oxidation assay was performed as previously described (kraft-sheleg et al., 2016, zaffryar-eilot et al., 2013). briefly, the lox activity assay was performed as above using lung lysates from control mice at a concentration of 200 g/ml. the only modification is that the substrate (1,5-diaminopentane) used in the lox activity assay was replaced with collagen (1 mg/ml), fibronectin (1 mg/ml), or laminin (1 mg/ml). the fluorescent reaction was measured every 5 min for 1.5 hr at 37c using a fluorimeter (fluo star galaxy). a representative plot out statistical significance of the in vitro experiments was determined by either two-tailed student s t test for a comparison between two groups or one-way anova for multiple groups followed by tukey ad hoc statistical test using graphpad prism 5.0. for the lox activity assay and human experiment results, a comparison between control/baseline and the related group was calculated based on paired student s t test. the number of replicates for each experiment is provided in supplemental information and/or figure legends. in the in vitro experiments, estimate of variance was performed and parameters for the statistical test were adjusted accordingly. in the in vivo/ex vivo studies, n =37 mice/group (as specified in the figures) was used to reach statistical significance. the sample size for each experiment was designed to have 80% power at a two-sided of 0.05. for the calculation of mouse survival, a kaplan-meier survival curve statistical analysis was performed in which the uncertainty of the fractional survival of 95% confidence intervals was calculated. c.r .- t., p.h., and y.s. conceived and designed all experiments .

summarysurgery remains the most successful curative treatment for cancer. however, some patients with early-stage disease who undergo surgery eventually succumb to distant metastasis. here, we show that in response to surgery, the lungs become more vulnerable to metastasis due to extracellular matrix remodeling. mice that undergo surgery or that are preconditioned with plasma from donor mice that underwent surgery succumb to lung metastases earlier than controls. increased lysyl oxidase (lox) activity and expression, fibrillary collagen crosslinking, and focal adhesion signaling contribute to this effect, with the hypoxic surgical site serving as the source of lox. furthermore, the lungs of recipient mice injected with plasma from post-surgical colorectal cancer patients are more prone to metastatic seeding than mice injected with baseline plasma. downregulation of lox activity or levels reduces lung metastasis after surgery and increases survival, highlighting the potential of lox inhibition in reducing the risk of metastasis following surgery.

PMC5413586

pubmed-249

these conditions may be life-threatening (e.g. oral cancers) or not, progressing (caries, periodontitis, etc.) or not, dealing with aesthetics (staining in anterior teeth such as molar incisor hypomineralisation (mih)) or pain (pulpitis, mih in posterior teeth, etc.). ohrqol is highly subjective and has to be assessed within the framework of patients conditions, sociocultural environments and own experiences and states of mind: because ohrqol is related to daily life and is unique to each individual, even patients with severe conditions can report having good quality of life. furthermore, quality of life is by itself multi-faceted, showing variation over time for each individual. ohrqol should therefore be assessed longitudinally to take into account changes over time, using versatile tools. this means having relevant questions with well-defined items and being able to analyse answers in a good way. many limitations can be found to the current validation testing, including relevance of the questions, validity and sensitivity to change, risk of misinterpretations (role of the ethnocultural environment), problems of translation of english questionnaires and difficulty to interpret the significance of a psychometric measurement when reported simply as a numerical score or a mean [1, 2]. this latter point is of importance since the same score can be obtained from people answering in a different way to a majority of questions. finally, patient-based outcome measures (as named by fitzpatrick et al.) should provide the opportunity to measure the extent or intensity of the changes in ohrqol. various psychometric instruments have also been used to measure ohrqol (tables 1 and 2) [1, 4]. these are based on different criteria that enable them to be more or less patient- or expert-centred. some are generic (ohip1-49, ohip-14, oidp, oh-qol, sf-362) and can be considered as core indicators; others are adapted to specific conditions/domains (orthognathic qol questionnaire, sooq for orthodontic surgery, ohip-aesthetic,3 ohrqol for dental hygiene) or populations (cohqol and child-oidp for children, gohai for elderly people, etc.). table 1conceptual and structural basis of psychometric instruments used in dentistry (adapted from brondani and mcentee) instrumentsacronymstructural originsempirically basedconnotation of questionsnumber of questionssocial impacts of dental diseasesiddsipyesn14oral health impact profileohipicidhyesn49geriatric (generic) oral health assessment indexgohaiicidh and sipyesn and p12oral health-related qol instrumentohrqlmultiplenon36oral impact on daily performancesoidpicidhnon8dental impact on daily livingdidlsipyesn and nt and p36dental impact profiledipsipyesn and nt and p25oral health-related quality of life measureohqolmultiplenon3oral health quality of life inventoryoh-qolsipunclearp15rand dental questionnaireunspecifiedsipnon3oral health questionnaireunspecifiedicidhunclearn and nt and p70oral health quality of life ukohqol-ukicidh2yesn and p16subjective oral health status indicatorssohsimultiplenon and nt34liverpool oral rehabilitation questionnairelorqunclearnon40self-rated oral healthsrohicidhnon and p3dentaldentalunclearnon15dental health status quality of life questionnaireds-qolgeneric qol instrumentnon and punclearn 1/4 negative, nt neutral, p positive, sip sickness impact profile, icidh international classification of impairments, disabilities and handicapsinformation derived from open-ended interviewssome indicators present shorter or extended forms other than the original versionhealth-related models: natural history of disease model and sipdeveloped from existing measures (rand, oral facial pain index, etc.). table 2oral health outcome measures developed before 2007 (adapted from locker and allen) pre-1997 (presented at the 1997 conference) social impacts of dental diseasegeneral (geriatric) oral health assessment index (gohai)dental impact profile (dip)oral health impact profile (ohip)oral impacts on daily performances (oidp)subjective oral health status indicators (sohsi)oral health-related quality of life measuredental impact on daily living (didls)oral health quality of life inventoryrand dental questionspost-1997ohqol-ukchild oral health quality of life questionnaire (cohqol)child oidpohrqol for dental hygieneorthognathic qol questionnairesurgical orthodontic outcome questionnaire (sooq) conceptual and structural basis of psychometric instruments used in dentistry (adapted from brondani and mcentee) n 1/4 negative, nt neutral, p positive, sip sickness impact profile, icidh international classification of impairments, disabilities and handicaps information derived from open-ended interviews some indicators present shorter or extended forms other than the original version health-related models: natural history of disease model and sip developed from existing measures (rand, oral facial pain index, etc.). oral health outcome measures developed before 2007 (adapted from locker and allen) the ohip, also called ohip-49, is the most widely used, and this has enabled investigators to modify forms that can be subsequently adapted to populations or conditions. the initial 49-question form was constructed to assess the social impact of oral disorders. each of the set of 49 statements represented one of seven domains: it is mainly expert-centred and constructed to select items according to their fit with a conceptual framework rather than on the basis of their importance to the patients from whom they were derived. a shorter version of ohip restricted to 14 items (ohip-14) was later proposed. one major question is to know if we need to use either a generic questionnaire, an adapted form of a generic questionnaire or to construct a new questionnaire specific to the population or condition to be studied. constructing or using one of these specific questionnaires may lead to many questions, for example, (1) is it made specifically for the purpose of research or for clinical practice? or (2) how to adapt each questionnaire to local languages and cultures? this may subsequently lead us to consider the impact of dentin hypersensitivity (dhs) or exposed cervical dentin (ecd) on ohrqol of those individuals being assessed. very few studies have been devoted to this aspect of dhs/ecd as recently shown, with only two papers written in english specifically dedicated to the evaluation of ohqol in dhs/ecd patients. one paper provided results using a generic questionnaire and the second paper constructed a specific questionnaire to evaluate ohqol in dhs/ecd patients but provided no epidemiological results. these studies are more extensively described in an accompanying paper. in the future, studies using validated questionnaires specifically constructed to evaluate the impact of the condition on ohqol should be employed. these questionnaires should be patient-centred and derived from interviews with patients who are expected to complete the questionnaire [4, 10]. furthermore, if these studies also attempt to evaluate the efficacy of desensitising agents in reducing dhs/ecd and its subsequent impact on ohqol, then it is imperative that the condition should be clearly diagnosed by trained and calibrated dentists experienced in conducting clinical studies using recognised and accepted clinical criteria for the evaluation of dhs/ecd. due to the cultural and language differences between countries, there is also a need of norm or reference value(s) for each population to be studied. for example, when constructing a questionnaire for a non-english-speaking population, the questionnaire should be initially written in english, then translated by two people of the designated native (foreign) language and subsequently translated back into english by two native english-speaking people to identify any potential issues that may have arisen from the translation. finally, as indicated above, any future study attempting to evaluate the efficacy of a desensitising agent in reducing dhs/ecd and its subsequent impact on ohqol should be conducted by experienced and calibrated examiners using established guidelines for conducting dhs/ecd clinical studies. such studies should also be based on a randomised clinical study design and include both placebo or control groups. patients suffering from dhs/ecd have been reported to have a significantly impaired ohrqol; this may however be improved following treatment with a desensitising agent as reported by several authors. it is therefore of the upmost importance that the use of the ohrqol as a quality control tool in the dental office be established in robust clinical studies. furthermore, because of its ability to reflect a patient s satisfaction with any proposed treatment, it may prove to be a valuable asset for practitioners when assessing their patients quality of life before, during and after treatment of various clinical conditions such as dhs/ecd.

objectivesoral health-related quality of life (ohrqol) can be considered as the scientific expression of that part of a person s well-being that is affected by his/her oral health. the aim of this paper was to evaluate how to use the data available in the field of research to make a link between ohrqol and dentin hypersensitivity (dhs) in the dental office. materials and methodsresearch papers in the field of ohrqol and dhs and reviews and research papers about ohrqol were used for analysis in this short review, with a particular insight on the instruments used to evaluate ohrqol. resultsvarious psychometric instruments have been used to measure ohrqol that are more or less patient- or expert-centred. some are generic, others are adapted to specific conditions/domains or populations. the impact of dhs or exposed cervical dentin (ecd) on ohrqol has been assessed in very few studies. it is therefore of the upmost importance that the use of the ohrqol as a quality control tool be established in robust clinical studies. conclusions/clinical relevancefuture studies evaluating the impact of the dhs/ecd on ohqol or evaluating the efficacy of desensitising agents should respect some key points, including study design (randomization, placebo/control group, etc.), validated specific questionnaires and trained calibrated practitioners.

PMC3585693

pubmed-250

the direct conversion of solar energy to a chemical fuel is an essential part of future sustainable energy systems that are independent of fossil reserves. hydrogen is an environmentally benign energy carrier of high-energy density and can be produced by photocatalytic water reduction. platinum and other noble metals can serve as heterogeneous hydrogen evolution catalysts; however, their limited earth abundance and cost precludes further development and/or large-scale applications. on the other hand, organometallic compounds are attractive catalysts for this transformation considering the variety of complexes that can be prepared, the synthetic ease with which electronic properties (and hence catalyst activity) can be modulated, and the ability to study their mechanisms in detail. in nature, hydrogenase enzymes, especially those containing fe2 active sites, efficiently catalyze proton reduction to molecular dihydrogen. models of the [fefe]-hydrogenases can act as biomimetic hydrogen evolution catalysts, although they often suffer from limited stability, especially when catalysis is driven photochemically in conjunction with photosensitizers. the necessity of an external matrix to stabilize the catalyst is thus evident. metal organic frameworks (mofs), also referred to as porous coordination polymers, have emerged as an intriguing class of microporous crystalline materials due to their intrinsic topology and porosity and have been studied for a range of applications in gas storage/separation, chemical sensing, drug delivery, and catalysis. unlike other porous materials such as zeolites, the organic ligand component of mofs allows for functionalization of internal channels and/or cavities either through direct solvothermal synthesis or by postsynthetic modification reactions that include the metathesis of metal ions and organic linkers under relatively mild conditions. hupp, cohen, and others have reported on this postsynthetic exchange (pse) phenomenon (also termed solvent-assisted linker exchange, sale), including in highly robust mofs, such as the materials of the institute lavoisier, zeolitic imidaozolate framework, and university of oslo (uio) materials. all of these materials are considered to be inert with exceptionally high thermal and chemical stability, and can provide a robust platform for the incorporation of potentially labile molecular catalysts. incorporation of catalytic sites into mofs has resulted in heterogeneous catalysts that promote a wide range of organic reactions. the heterogeneous nature of mof catalysts allows for their easy separation, reusability, and enhanced stability. in the context of light-to-fuel conversion schemes, homogeneous photosensitizers such as ir polypyridine complexes and porphyrins have been incorporated in mofs and were shown to drive photochemical hydrogen production catalyzed by pt nanoparticles. organometallic ir and re catalysts have been incorporated as the ligand linker part of the mof and were shown to catalyze ce-promoted water oxidation and photochemical co2 reduction, respectively. although excellent proof-of-concept studies, in both cases, resource-limited precious metal catalytic sites were used. moreover, the scope of these reports is somewhat limited, as the solvothermal procedures that were used for the synthesis of the mofs require organometallic units that are thermally robust. herein, we describe the incorporation of an organometallic fe2 complex that bears structural resemblance to the active site of [fefe] h2ases into a mof. [fefe](bdt)(co)6 (2) (bdt=benzenedithiolate) has previously been shown to be an effective proton reduction catalyst in electro- and photochemical schemes. decoration of complex 2 at the bdt ligand with two carboxylates results in complex 1 which can be introduced into mofs by pse of 1,4-benzenedicarboxylate (bdc) ligands, which is a common ligand linker in many mofs (figure 1). pse thus allowed for the introduction of a thermally unstable [fefe](bdt)(co)6 moiety into the thermally stable zr(iv)-based uio-66 mof (figure 2). x-ray absorption spectroscopy (xas) was used to confirm the coordination environment of the fe2 site in the mof. importantly, uio-66-[fefe](dcbdt)(co)6 was found to be a highly active hydrogen production catalyst in photochemical arrays with [ru(bpy)3] as a photosensitizer and ascorbate as an electron donor. the catalytic performance of the mof exceeds that of an analogous homogeneous reference system. [fefe] hydrogenase active site model complexes [fefe](dcbdt)(co)61 and [fefe](bdt)(co)62 and the bdc ligand 2,3-dimercaptoterephthalic acid was prepared from benzene-1,2-dithiole via lithiation and carboxylation and directly converted to complex 1 ([ fefe](dcbdt)(co)6, dcbdt=1,4-dicarboxylbenzene-2,3-ditiolate) by combining the ligand with fe3(co)12 in thf. single crystal x-ray analysis of complex 1 shows the usual distorted octahedral coordination sphere around the fe ions, with the dcbdt ligand perpendicular to the fe fe bond vector (see also esi). the uio-66 framework, consisting of zr(iv)-based secondary building units (sbus) and bdc ligand (zr6o4(oh)4(bdc)6), was chosen for the incorporation of complex 1 because of its exceptionally high structural stability with respect to water and weak acids. highly crystalline uio-66 was synthesized under solvothermal conditions using zrcl4, bdc, and benzoic acid (as a crystal growth modulator) in dmf for 24 h, followed by washing with meoh and activation under vacuum. field-emission scanning electron microscopy (fe-sem) shows an octahedral morphology of the resultant uio-66 crystals with a particle size ranging from 200 to 500 nm (figure 3). fe-sem image of (a) uio-66 and (b) uio-66-[fefe](dcbdt)(co)6. scale bar is 1 m. attempts to directly include 1 during solvothermal synthesis (> 50 c) resulted in decomposition of the cluster, presumably due to the labile bonds between the fe centers and the highly electron-deficient dcbdt ligand. taking advantage of the structural homology of the bdc and dcbdt ligands in complex 1 (figure 1), we employed pse as a mild functionalization approach to introduce complex 1 into uio-66 (figure 2). optimization of the pse conditions revealed that the use of deoxygenated, ultrapure water (room temperature for 24 organic solvents, including meoh, dmf, and chcl3, gave lower incorporation, consistent with previous observations on the solvent dependence of pse. as expected from the attempted solvothermal syntheses, pse at elevated temperatures (> 50 c) gave results that also suggested partial decomposition of 1. interestingly, it was found that pse was facilitated by using a highly microcrystalline form of uio-66 that was synthesized in the presence of a benzoic acid modulator. in contrast, conventionally synthesized uio-66 (without modulator) resulted in a less crystalline material and a less efficient exchange process. the linker-exchanged material, uio-66-[fefe](dcbdt)(co)6, was isolated as an orange microcrystalline powder after washing thoroughly with fresh meoh and activation under vacuum. g/cm, measured with nitrogen at 77 k. this value is close to the bet surface area of pristine uio-66 (1475 89 g/cm), suggesting a true pse process between 1 and the framework, and not simple trapping of the iron complex in the mof pores (which would be expected to produce a much lower surface area). n2 absorption/desorption isotherms of uio-66 and uio-66-[fefe]dcbdt(co)6 do indicate a modest decrease in pore size distribution (figure s1). uio-66 is known to possess two pore types, tetrahedral and octahedral cages, with pore widths of 8 and 11, respectively (figure s2). pristine uio-66 gave a median pore width of 11.8, while after incorporation of 1, a reduction in the median pore width to 10.9 was observed, consistent with incorporation of the [fe2s2] functionality in uio-66-[fefe]dcbdt(co)6. powder x-ray diffraction (pxrd) patterns before and after pse confirmed the retention of the crystalline uio-66 framework (figure 4a). fe-sem showed that uio-66-[fefe](dcbdt)(co)6 possesses a nearly identical particle size and octahedral particle morphology compared to uio-66, again indicative of a pse mechanism (figure 3). asterisks indicate remaining benzoic acid (modulator) and the black square indicates dcbdt. the degree of pse was characterized by energy-dispersed x-ray spectroscopy (edx), elemental analysis (ea), thermogravimetric analysis (tga), and proton nuclear magnetic resonance spectroscopy (h nmr). the ratio of heavy elements in uio-66-[fefe](dcbdt)(co)6 was determined to be 3.52:1:1.01 (zr: fe: s, normalized to fe) via edx, which suggests that 14% of bdc in uio-66 was exchanged for [fefe](dcbdt)(co)6 (figure s3). the expected 1:1 fe/s ratio determined by edx also further supports that the cluster is intact within the mof. treatment of uio-66-[fefe](dcbdt)(co)6 with dilute hf/d-dmso was used to digest the mof but also decomposed [fefe](dcbdt)(co)6 to dcbdt. integration of the proton resonances for bdc and dcbdt in the h nmr confirmed the degree of pse at 14% (figure 4), giving an overall formula for uio-66-[fefe](dcbdt)(co)6 as zr6o4(oh)4(bdc)5.1([fefe](dcbdt)(co)6)0.92ch3oh. based on this given formula, c/h/n/s elemental analysis also confirmed the degree of functionalization [c(%): 32.75 (obs), 32.80 (calcd); h(%): 1.75 (obs), 1.68 (calcd); n(%): 0.00 (obs), 0.00 (calcd); s(%): 2.97 (obs), 2.84 (calcd)]. unlike pristine uio-66, which displays only one major decomposition step at 400 c, the tga trace of uio-66-[fefe](dcbdt)(co)6 exhibits two decomposition steps at 80200 and 350400 c, respectively (figure 4). the first mass loss is likely due to partial thermal liberation of the carbonyl ligands attached to fe centers (obs: 7%; calcd: 7.2%). both bdc and [fefe](dcbdt)(co)6 start to decompose at 350 c, leading to a combination of zro2 and fe2o phases (obs: 46.3%; calcd: 43.6%, percent weight residual mass). to confirm that compound 1 was being incorporated into the framework lattice to give uio-66-[fefe]dcbdt(co)6, additional experiments were performed to exclude the possibility that compound 1 was merely trapped in the pores of the mof. in one experiment, compound 2 (figure 1) contains the same cluster core but lacks the coordinating carboxylate ligands required for mof formation and hence pse. incubation of uio-66 with compound 2 showed no evidence of substantial incorporation into the mof as shown by a lack of color change (figure s4) and a low iron content in the edx analysis (figure s5). in a second experiment, pse between uio-66 and 1 was performed in d2o, and the presence of bdc was observed in the reaction solution, as determined by h nmr (figure s6), indicative of displacement of bdc by 1. importantly, uio-66 in d2o in the absence of 1 does not show release of free bdc into solution. these nmr observations are also indicative of a ligand metathesis process and argue against simple inclusion of 1 into the pores of the mof. finally, as stated above, performing pse between uio-66 and 1 in other solvents (meoh, dmf, and chcl3) was not efficient, achieving negligible incorporation (< 2%), consistent with the known solvent dependence of pse processes. if complex 1 was only being included into uio-66 via sorption into the pores, then inclusion would not be expected to be strongly solvent dependent. taken together, these experiments provide strong evidence, consistent with reported pse studies, that the iron cluster is becoming part of the uio-66 framework via a ligand pse process and that the data do not support simple inclusion of the cluster into the pores of the mof. in order to further demonstrate the incorporation of the intact fe2s2 dinuclear cluster into the mof, we employed fourier-transformed infrared spectroscopy (ftir) and diffuse reflectance uv vis spectroscopy. ftir of uio-66-[fefe](dcbdt)(co)6 exhibited three prominent co stretching vibration bands at 2078, 2038, and 2001 cm, while no such absorption bands were observed for pristine uio-66 material between 2100 and 2000 cm (figure 4). moreover, the relative intensity of these three characteristic bands was identical to that of free 1, suggesting the dinuclear cluster is intact in the mof. solid-state uv vis spectroscopy of uio-66-[fefe](dcbdt)(co)6 also showed a characteristic absorption at 350 nm, which is consistent with the spectral features of 1 (figure s7). due to the potentially labile nature of [fefe](dcbdt)(co)6, we sought to provide data to confirm the coordination environment of fe2s2 core in the mof. fe k-edge extended x-ray absorption fine structure spectroscopy (exafs) was performed on both 1 and uio-66-[fefe](dcbdt)(co)6. as shown in figure 5, fourier-transformed exafs in r space revealed nearly identical coordination environments of the fe centers in [fefe](dcbdt)(co)6 before and after pse into the uio-66 framework. both sets of data were best fit using the first and second neighboring atoms of fe from the single-crystal x-ray structure obtained for [fefe](dcbdt)(co)6, where fe centers occupy a distorted octahedral geometry (see esi). exafs of uio-66-[fefe](dcbdt)(co)6 suggests three carbon atoms from carbonyl groups and two sulfur atoms bridging the dinuclear fe2 center at distances of 1.7961.814 and 2.2832.285, respectively (table 1). importantly, these bond lengths are in good agreement with the crystallographic data of 1 (see esi), showing 1.7971.811 (fe c) and 2.2552.257 (fe s). in addition, x-ray absorption near-edge structure indicates a common fe(i) oxidation state of the cluster within the framework and in 1 (figure s8). fe k-edge exafs fourier transforms and exafs spectra (inset) for (a) 1 and (b) uio-66-[fefe](dcbdt)(co)6. solid black lines show the experimental data, dashed red lines show the fits based on crystallographic data of 1, and dotted gray lines show the fitting window. fitting data having observed that pse could be used to incorporate complex 1 into a robust mof, we explored the suitability of this material as a catalyst in photochemical hydrogen production schemes. thus, uio-66-[fefe](dcbdt)(co)6 was suspended in a 1.0 m acetate buffer solution of [ru(bpy)3] photosensitizer (0.5 mm), and ascorbate electron donor (100 mm) at ph 5. as depicted in figure 6, the projected sequence for photocatalytic proton reduction by uio-66-[fefe](dcbdt)(co)6 commences with the reductive quenching of photoexcited [ru(bpy)3] by the electron donor ascorbate with a rate constant of 1 10 m s. following the analysis of schmehl et al., 14% of*[ru(bpy)3] excited states can be expected to form the [ru(bpy)2(bpy)] reductant ([ ascorbate]=0.1 m; (*[ru(bpy)3 ]) =500 ns). charge recombination between photogenerated [ru(bpy)3] and oxidized ascorbate can be expected to occur close to the diffusion limit and will compete with the productive heterogeneous electron transfer (et) between [ru(bpy)3] and uio-66-[fefe](dcbdt)(co)6. the driving force for the et can be estimated at 300 mv from the electrochemically obtained reduction potentials, assuming that the reduction potential of the fe2 site in uio-66-[fefe](dcbdt)(co)6 is similar to that obtained for complex 1 in solution. from solution studies, it is well established that the electrochemical reduction of 1, and its bdt derivative 2, is a two-electron process due to inverted electrochemical potentials. assuming that the fe2 complex in uio-66-[fefe](dcbdt)(co)6 shows similar reductive chemistry as complex 2 in solution, the driving force for electron transfer from a second photogenerated [ru(bpy)3] to the previously produced monoreduced fe2 site in the mof will be even>300 mv. the dianionic fe2 site 1 a second plausible pathway to 1 is through disproportionation of two singly reduced 1 in the mof. this disproportionation is thermodynamically feasible as evidenced by the inverted electrochemical potentials of the 1/1 and 1/1 couples. reaction scheme for the photocatalytic reduction of protons. as demonstrated in figure 7, uio-66-[fefe](dcbdt)(co)6 is indeed a proton reduction catalyst. under the reaction conditions described above, hydrogen production is observed and can be quantified with a hydrogen specific solid-state sensor (see esi for details). it is thus clear that heterogeneous electron transfer between photogenerated [ru(bpy)3] and uio-66-[fefe](dcbdt)(co)6 can compete with homogeneous charge recombination with oxidized ascorbate. the fe2 sites within the mof can be reduced in a light-driven reaction and are themselves catalysts for the reduction of protons to molecular hydrogen. as the rate of electron transfer from photogenerated [ru(bpy)3] decreases exponentially with distance, it can be assumed that only fe2 sites that reside within a few nm from the surface of the mof particles will be viable acceptor sites. the de facto concentration of operating catalysts in the mof may thus be substantially smaller than the total concentration of 1 in the mof. comparing the activity of uio-66-[fefe](dcbdt)(co)6 with that of a homogeneous reference system that contains complex 1 at concentrations similar to the total amount of fe2 complex in uio-66-[fefe](dcbdt)(co)6 shows that the activity of the former is not only preserved but actually exceeds that of the latter, both in terms of initial rate as well as overall amount of produced hydrogen. control experiments without uio-66-[fefe](dcbdt)(co)6 or with unmodified uio-66 (which does not contain [fefe](dcbdt)(co)6) do not show meaningful amounts of hydrogen generation (figure 7). photocatalytic hydrogen production in the presence of uio-66-[fefe](dcbdt)(co)6 (blue trace, 5 mg mof, 0.59 mol catalyst), complex 1 (red, 0.59 mol), uio-66 (black, 5 mg mof), and background (gray). conditions: 1 m acetate buffer ph 5, 100 mm ascorbic acid, 0.5 mm [ru(bpy)3]. quantitative comparison between the homogeneous and heterogeneous hydrogen production systems must be done with great care, as hydrogen production in both systems is not limited by an intrinsic step of the catalytic cycle but by insufficient photoproduction of the [ru(bpy)2(bpy)] reductant. nevertheless, figure 7 clearly shows that the heterogeneous system outperforms the homogeneous one both in overall hydrogen production as well as initial rate. as shown in a recent study, the photoproduction of [ru(bpy)2(bpy)] is not strongly influenced by homogeneous complex 2(39) and probably also not by uio-66-[fefe](dcbdt)(co)6. the amount of available reductant can thus considered to be comparable in both systems. also, the heterogeneous et rate constant ket, het in figure 6 is presumably not higher than the corresponding ket, hom in the homogeneous reference system. therefore, the reasons for the superior catalytic performance of uio-66-[fefe](dcbdt)(co)6 compared to that of the homogeneous reference system must be due to differences in the catalyst. a trivial but nevertheless important rationale for the increased hydrogen production yield in the mof is the stabilization of the catalyst when inside the framework. supporting this notion, it was found that uio-66-[fefe](dcbdt)(co)6 recovered after 1 h of photocatalysis still shows the characteristic co bands in the ir spectrum (figure s10). in contrast, and in accordance with published work, complex 1 decomposes under identical photocatalysis conditions, as evidenced by the lack of any ir signals in the typical co region. as for all photochemical reduction schemes based on [ru(bpy)3], one-electron photochemistry needs to be coupled to a two-electron catalytic process. with the limited availability of reductant, most productive et events will produce singly reduced fe2 sites (1), while dianionic fe2 species (1) are unlikely to be formed by an encounter with a second equivalent of [ru(bpy)2(bpy)] due to the low concentrations of both species. as discussed above, it is thermodynamically feasible that two 1 sites disproportionate to form the catalytically active 1 site that reacts with two protons to form hydrogen. disproportionation as well as protonation needs to occur before the reduced species recombine with oxidized ascorbate. here, the fe2 site in uio-66-[fefe](dcbdt)(co)6 has an undisputable advantage over the homogeneous system, as its incorporation into the mof spatially protects from unproductive charge recombination. moreover, the presence of many fe2 sites within the mof may promote disproportionation as soon as two monoreduced sites are present. it is these kinetic advantages that explain the higher initial hydrogen production rates in uio-66-[fefe](dcbdt)(co)6. we employed pse as an efficient and mild approach to obtain the first mof that contains a multinuclear, organometallic, nonprecious-metal-based proton reduction catalyst. the resulting uio-66-[fefe](dcbdt)(co)6 is a hybrid material that combines the advantages of molecular catalysts with a highly ordered and stable inorganic support. [fefe](dcbdt)(co)6 (1) is among the most complex structure that has ever been introduced into a mof, and its presence and molecular integrity within the uio-66 framework could be confirmed by exafs, ftir, and other methods. uio-66-[fefe](dcbdt)(co)6 exhibits high efficiency for photochemical hydrogen evolution, exceeding that of the homogeneous reference system in terms of rate and total hydrogen production yield. incorporation of the fe2 complex in uio-66-[fefe](dcbdt)(co)6 results in a higher stability under the photocatalysis conditions, protects reduced species from nonproductive charge recombination, and may promote disproportionation reactions to produce catalytically active dianion 1.

a molecular proton reduction catalyst [fefe](dcbdt)(co)6 (1, dcbdt=1,4-dicarboxylbenzene-2,3-dithiolate) with structural similarities to [fefe]-hydrogenase active sites has been incorporated into a highly robust zr(iv)-based metal organic framework (mof) by postsynthetic exchange (pse). the pse protocol is crucial as direct solvothermal synthesis fails to produce the functionalized mof. the molecular integrity of the organometallic site within the mof is demonstrated by a variety of techniques, including x-ray absorption spectroscopy. in conjunction with [ru(bpy)3]2+as a photosensitizer and ascorbate as an electron donor, mof-[fefe](dcbdt)(co)6 catalyzes photochemical hydrogen evolution in water at ph 5. the immobilized catalyst shows substantially improved initial rates and overall hydrogen production when compared to a reference system of complex 1 in solution. improved catalytic performance is ascribed to structural stabilization of the complex when incorporated in the mof as well as the protection of reduced catalysts 1 and 12 from undesirable charge recombination with oxidized ascorbate.

PMC3829681

pubmed-251

aging is part of the natural process of human development, and it brings multiple biopsychosocial changes that cause a slow and progressive deterioration of body functions that are essential to life. among these functions that undergo important mostly irreversible changes is hearing.1 hearing loss is considered one of the three most common conditions in the elderly,2 with occurrence of 5 to 20% in 60-year-olds, increasing to 60% in people over 65 years old.1 3 in brazil, 60% of the elderly have some degree of hearing loss.4 the term used to describe hearing loss associated with aging is presbycusis, which causes a decrease in hearing sensitivity and a reduction in the ability to understand speech. this occurs due to several degenerative and physiologic changes that affect the inner ear, impairing hearing at high frequencies and affecting communication, especially in noisy environments.1 2 4 5 6 7 other factors associated with the natural degeneration process, such as exposure to loud noise, ototoxic agents, and sequelae of otitis media caused by medical problems and treatments, can contribute to lifelong aggravation of the loss.4 8 9 difficult communication associated with hearing loss can lead to social and emotional consequences, especially for the elderly, who have several limitations related to aging that can impact their quality of life, increasing social isolation in addition to causing emotional disorders such as depression.1 4 5 8 10 11 hearing loss associated depression can be even more harmful in the elderly. thus, recommended intervention by hearing aid adaptation contributes to the prevention of emotional disorders such as depression.12 depression is defined as a mental disorder that causes feelings of sadness, pessimism, hopelessness, difficulty concentrating, and difficulty making decisions and initiating tasks, among other symptoms.13 despite being very common in the elderly, it can not be attributed solely to aging. studies in so paulo (brazil)14 and florianpolis (santa catarina, brazil)15 showed that the factors associated with depression in the elderly are: female, unmarried or widowed, altered cognitive function, dependence, use of many medicines, very old (over 80 years), low education, poor economic status, cognitive impairment, fair or poor self-rated health, functional dependency, and chronic pain. other causes include smoking, comorbidities (endocrine, vascular, neurologic, oncological), and negative changes in relationships with family and friends.15 hearing loss may be associated with depression to be a debilitating, chronic disorder.16 17 18 the main goal of an auditory rehabilitation program in elderly patients is to minimize the effects caused by sensory deprivation of hearing and reinstate the patients in their family and society, helping them cope with the disadvantages and limitations caused by hearing loss.3 monaural adaptations are commonly performed even in cases of bilateral hearing loss, whereas the most appropriate should be binaural adaptation. the reasons for that may be related to factors such as rejection to the use of two hearing aids, financial issues, aesthetic reasons, problems with manual dexterity, very asymmetric losses, and central processing issues.19 given such reality, this work intends to analyze the effects of unilateral adaptation of hearing aids on the symptoms of depression and the social activity constraints of elderly subjects with hearing impairment. this is a prospective interventional study of elderly individuals of both sexes with recommended use of hearing aids at a hearing center in porto alegre. inclusion criteria were signature of the free and informed consent; 60 years or older; good health (seniors able to commute to the research location, conduct tests, and answer questionnaires); new hearing aid users with monaural fitting; and participation in all phases of the research. exclusion criteria were initiation of antidepressant therapy during the study and a history of cognitive and/or neurologic disorders. the study was divided into two phases. in phase 1, subjects responded to an interview with questions on demographics and health (general and hearing). pure tone audiometry was performed to determine the airway tone thresholds (frequencies 250 to 8,000 hz) and bone conduction (frequencies 500 to 4,000 hz) in a vocal booth, using an ad-229e interacoustics audiometer (assens, denmark). the presence and degree of hearing loss were classified according to the world health organization by analyzing mean airway tone threshold in the frequencies of 500, 1,000, 2,000, and 4,000 hz.20 after that, seniors were asked to answer two questionnaires individually, without the intervention of third parties: the geriatric depression scale (gds) and the hearing handicap inventory for elderly short version (hhie-s). the gds, an instrument validated for portuguese and composed of 15 yes-or-no questions, is used to detect depression symptoms in the elderly. thus, scores less than 5 points indicate absence of symptoms, scores of 5 to 10 indicate mild to moderate symptoms, and scores of 11 or more indicate severe symptoms of depression.21 after completing the first phase, participants answered a summarized version of the hhie-s. the questionnaire was prepared in 198222 and translated and adapted to brazilian portuguese.23 it contains 10 questions that aim to assess the impact of hearing loss on the emotional and social status of elderly people. all 10 questions provide three choices of answers: for each yes answer, 4 points is assigned; each sometimes, 2 points; and each no, 0 points. the total score ranges from 0 to 40 points, and the higher the score, the greater subjects ' self-perception of social activity constraints: 0 to 8 points indicate no social activity constraints; 10 to 23 points, mild to moderate social activity constraint; and 24 to 40 points, significant social activity constraints.8 22 after testing, the participants were subjected to the selection and unilaterally hearing aid adaptation processes thirty days after purchasing the device, they returned to the hearing center to participate in the second phase of the research. in phase 2 the research project was approved by the research committee and by the ethics and research committee of the institution (protocol 266.060). patients who agreed to participate signed an informed consent and had their rights guaranteed for confidentiality, nonidentification, and withdrawal of participation. the results were analyzed using the statistical package for social science version 20.0 (ibm, ny, usa). to examine associations of categorical data, the chi-square and student t test for paired samples were used. all statistical tests were nonparametric tests, and always observed exact p value (not asymptotic), which are the best measures to statistically evaluate a study when the sample is restricted. the chi-square test considered the p value of fisher exact test, and for the kappa coefficient of agreement, the exact p value (not asymptotic) was observed. the sample consisted of 13 elderly patients with hearing loss, ages from 60 to 90 years (mean 72.85 11.05 years), 10 women (76.9%) and 3 men (23.1%). table 1 shows data on the characterization of sample in terms of age, gender, mean thresholds, and degree of hearing loss. table 2 depicts an association analysis between the gds classification of phases 1 and 2, indicating that there was no significant association between the variables in the periods before and after the adaptation (p=0.615). thus, of the 6 patients (46.2%) who initially had mild symptoms of depression, only 2 (15.4%) of them continued to have mild symptoms. all seniors who initially had severe symptoms of depression (15.4%) also started to lose some symptoms of depression in phase 2. hhie classification analysis in phases 1 and 2 of the study are presented in table 3. no significant association was found for these variables in the periods before and after the adaptation (p>0.999). thus, the only senior who had mild to moderate social activity constraints in the first phase showed reduction in the second phase. after prosthetization, participants who had severe social activity constraints in phase 1 started to show no social activity constraints or mild to moderate social activity constraints. only 1 (7.7%) the lack of association between the classification of the gds and hhie on the two phases is an important point, because it shows that there were different results in both assessments (before and after hearing aid adaptation)that is, on the sample studied, unilateral prosthetization resulted in benefits for patients. table 4 shows the scores obtained by the subjects in the instruments used for evaluation in the two phases of the research. there was significant difference between the gds (p=0.031) and hhie (p<abbreviations: gds, geriatric depression scale; hhie-s, hearing handicap inventory for elderly short version. the analysis of the survey data showed that the age of the individuals analyzed varied from 60 to 90 years. another study that examined the degeneration of the auditory system in the course of aging had a sample with similar age and results.4 we had a greater number of female participants. although it has been found that men often have more problems related to hearing loss than women,24 they also have a lower perception of their disability compared with women,1 25 26 which explains why women seek health services more often26 27 and why there is a greater number of female participants in this study. another fact to be noted is that, in terms of population, there is a greater number of older women in brazil, a fact known as feminization of aging.28 there was a prevalence of moderate hearing loss in both the right and the left ears, agreeing with other published studies that refer to this as being the most commonly found degree of hearing impairment in the elderly.2 9 25 the data show that many seniors had some degree of depression symptoms before prosthetization (table 2). after unilateral hearing aid adoption, there was improvement in symptoms for most of them. thus, a hearing aid, even when unilateral, promoted elimination or reduction of symptoms of depression in the sample studied. this result had already been described in the literature,2 but we emphasize that the result was obtained with bilateral prosthesis. thus, the adaptation of a single amplifying device can also generate benefit for elderly patients, which is important for the reduction of one of the most prevalent problems in the aging population, depression. the data show that all participants had some degree of social activity constraints before using a unilateral hearing aid (table 3). after 30 days of hearing aid use, 12 (93.3%) and 13 (100%) participants showed absence or reduction of social activity constraints, respectively. results show evidence of the positive effects of hearing aid use, even if unilateral, helping to reduce the impact that hearing loss has on social relationships and on the quality of life of the elderly.9 results are consistent with another study that examined the short-term benefits of amplification in new users.29 the data also show a significant difference in scores obtained in phases 1 and 2 of the gds (p=0.031) and hhie-s (p<0.001), confirming a reduction or elimination of depression symptoms and social activity constraints in elderly patients, agreeing with other published studies (table 4).2 8 11 29 30 again, it is important to highlight that in the studied group, unilateral prosthesis resulted in substantial benefits not only regarding hearing but also in other matters essential for the well-being and quality of life of individuals. the findings reinforce the importance of hearing aid use in elderly patients, because many times family and social relationships are affected by the hearing impairment. the adaptation to amplification devices, albeit unilaterally, has proved to be effective in reducing symptoms of depression and social activity constraints. moreover, the length of time between assessments was 30 days, shorter than that considered ideal for auditory acclimatization, and even then, benefits occurred, confirming the importance of auditory rehabilitation in elderly. results show that unilateral hearing aid contributed to the elimination or reduction of depression symptoms and of social activity constraints in elderly participants in this research sample group.

introduction hearing loss is one of the most common problems in the elderly population. besides compromising oral communication, it directly affects social relations and prevents elderly patients from living actively in society, possibly leading to the onset of depression or other conditions. objective to analyze the effects of unilateral adaptation of hearing aids on symptoms of depression and the social activity constraints of elderly subjects with hearing impairment. methods the sample consisted of elderly subjects with hearing loss who did not use hearing aids. data were collected in two phases. initially, all participants underwent an audiological assessment and answered the hearing handicap inventory for elderly (summarized version) and the geriatric depression scale. all subjects participated in the selection and hearing aid adaptation processes and became monaural hearing aid users. after 30 days of hearing aid use, they were assessed with the same instruments. the results of the questionnaires before and after hearing aid adaptation were compared. results the sample consisted of 13 individuals, between 60 and 90 years old (mean 72.85 11.05 years). data analysis showed that there was significant improvement in social activity constraints (p<0.001) and in symptoms of depression (p=0.031). conclusion results show that, in the sample studied, unilateral hearing aid adaptation reduced social activity constraints and depression symptoms.

PMC4490931

pubmed-252

ameloblastomas are rare benign odontogenic tumours, most commonly found in a patient s lower jaw. although rarely metastatic, the growth of these lesions can result in defects in the jaw easily destroying surrounding bony tissues. for this reason, the treatment is often excision of the lesion, with wide excision margins, resulting in the absence of a part, or all, of the mandible. the surgical approach for correction of this mandibular defect is often reconstruction of the mandible in view of inserting dental implants at a later date. despite surgical advancements,, bone grafting with non-vascularized bone remains a good option where facilities for soft tissue flaps are not readily accessible. creating an effective wound closure and reducing the incidence of infection is an important stage in the success of the operation, and has been combated here by tissue expanding the submucosa, using osmed pellets, prior to surgery. this is a relatively new technique to the mandibular region and has the potential to revolutionize the success of microsurgeries in this area. in this report, i describe a woman who underwent a repair of her mandibular defect by a combination of innovative techniques, in order to reduce the risk of complications and get her back to an aesthetically pleasing level. a 35-year-old lady presented to the craniofacial surgeons looking for a permanent fixture to the bony defect in her lower-right mandible. in 1991 she had her first operation to remove the ameloblastoma and then had it further excised 6 years later due to a reoccurrence. this resulted in an absence of teeth from the canines back and removal of bone down to the inferior alveolar nerve. the patient has since been clear of any further reoccurrences and wears lower dentures for aesthetic reasons. she has no significant past medical history nor family history, nor does she have any known drug allergies. she does not smoke or drink alcohol. on clinical examination, the patient experiences mild parasthesia in the distribution of her right inferior dental nerve, particularly the lateral aspect of the lower lip. on examination, there is clear absence of teeth on the lower-right side from the canines back (to include the premolar, molar and wisdom teeth) and presence of healthy oral mucosa with laxity to move the submucosa medially. there is a loss of the vertical height of the posterior body of the mandible of about 50% and the vestigial remnants of the lingual plate are just palpable and visible on plain radiograph and ct. scans show that the superior margin of the resection is well corticated under the inferior dental nerve (fig., the patient wishes to get dental implants. the surgical approach taken, prior to the implants, (b) ct scan of head imaging of the patient's mandibular defect pre-surgically. (a) radiolocal image of patient's jaw. (b) ct scan of head the patient was initially given the option between a bone graft or vascularized tissue (free fibular flap) and informed of the complications a bone graft carries a risk of rejection and vascularized tissue needs an increased amount of post-operative care to ensure that the tissue remains vascularized. the patient was not keen on a free flap and given the fact that the bony deformity was<5 cm, non-vascularized iliac bone graft was deemed to be sufficient to carry out this operation. the first step was achieving significant tissue expansion (> 2 cm) using osmed pellets, guided into the submucosa and kept over the alveolar ridge for several months (fig. (c) osmed pellets before insertion into the submucosa image of patient's oral cavity during insertion of osmed pellets. (a) incisions made in the submucosa. (c) osmed pellets before insertion into the submucosa two months later, the patient underwent the main bulk of her operation. the osmed pellets were removed from the subperiosteum (fig. 3a and b) and the iliac bone graft was taken, made up of cortical and cancellous bone and placed to one side (fig. an epidural catheter was placed inside the soft tissue of the graft site and left overnight. it had a continuous fusion of a local anaesthetic to improve post-operative pain and encourage early mobilization. (b) open site where iliac bone graft is harvested from (c) cortical and cancellous iliac bone submucosa after adequate tissue expansion. (b) open site where iliac bone graft is harvested from (c) cortical and cancellous iliac bone previously, using ct scans, a titanium construct was made to guide the outline of the bone graft and complete the missing height and width of the mandible. once fitted to the patients jaw, it was packed with the bone graft and screwed down into position (fig. a slight groove was made on the mandible to allow space for the inferior dental nerve to lay, so that the construct did not compact the nerve and cause functional problems. figure 5:titanium construct packed with iliac bone graft and screwed into position on the lower mandible titanium construct packed with iliac bone graft and screwed into position on the lower mandible to complete the surgery, the periosteum was sutured over the construct and then the buccal muscosa was sutured over again to form a double-layered closure (fig. 6a c).the purpose of this was to prevent infection and rejection, by ensuring that there was an increased distance between the foreign object (titanium construct) and the outside environment. the dental implants are scheduled to be inserted several months after this operation. figure 6:image of patient's surgical site. (c) image of post-surgical site image of patient's surgical site. bony defects in the maxillofacial area are a huge problem in clinical orthodontics, caused by a wide range of injuries and diseases presenting as either cosmetic or functional defects and in some instances both. it is the importance of accounting for the anatomical, functional and aesthetic aspects that make the reconstruction so challenging. often patients suffering from ameloblastomas undergo resection as treatment and are left with bony defects that require reconstruction. in this case, the intention was to realize an aesthetically pleasing appearance for the patient and it has been shown that bone grafting with subsequent dental implants is a successful method. as in this case, it is recommended that non-vascularized autogenous bone grafting can be used when a two-layer watertight closure is attainable. sources of bone could have been harvested from either local or distant sites but in this case, an extra-oral site (iliac bone) was used as a moderate amount of bone was needed. the surgery lasted 5 h and incorporated several novel techniques to improve the outcome of the operation. the use of osmed pellets was innovative, as pellets of this size have only recently been experimented on goats maxilla. as well as allowing for space to put the construct, the pellets allowed for a tension-free closure. otherwise, the result would have been a high-tension closure, leading to rapid breakdown of the graft providing an entrance for infection, a common complication occurring when titanium plates are exposed. advantages of the osmed tissue expanders are that the material is safe with a low complication rate and low risk of infection due to small incision site and minimal trauma. the titanium construct is another relatively novel approach and was invaluable in the success of this surgery, as it guided reconstruction of the mandible, allowing for dental implants to be put in at a later date. at present, an alloplastic material such as titanium is often used for mandibular reconstruction as it is resistant to corrosion, adaptable and biocompatible. although the insertion of dental implants is the end goal for this surgery, the importance of this case report is to highlight the novel techniques involved in making this surgery a success. the use of small osmed pellets in the submucosa of the mouth to cause sufficient tissue expansion and create a tension-free closure, combined with the titanium construct packed with grafted iliac bone to rebuild the jaw was an approach recommended by the doctors for the repair of bony defects of<5 cm. i suggest prudent management of future cases post-operatively to ensure a continued success of the graft.

this case report describes a 35-year-old caucasian radiographer who presented with a significant mandibular bony defect following multiple excisions of an ameloblastoma. as a result, there was an absence of teeth on the lower-right mandible and a clear defect in the mandible. the treatment objectives were to rebuild the mandibular defect, with a long-term view of inserting dental implants. in a novel approach outlined in this presentation, tissue expansion of the submucosa, a titanium construct and an iliac bone graft were used to rebuild the patient s jaw. this surgical technique is recommended for the reconstruction of bony defects.

PMC3578664

pubmed-253

glycogen synthase kinase-3 (gsk-3), an evolutionarily conserved ubiquitous serine threonine kinase consisting of and isoforms, is a multifaceted protein with diverse cellular and neurophysiological functions. the main structural difference between gsk-3 and gsk-3 isoforms lies in the n- and c-terminal regions, while their sequences within the kinase domain are highly homologous. a growing body of evidence indicates that gsk-3 is pro-apoptotic and that its dysfunction may be linked to the pathophysiology of mood disorders, schizophrenia, diabetes, and various neurological/neurodegenerative diseases, among others (for review, meijer et al., 2004 ;, 2007; chiu and chuang, 2010; li and jope, 2010). gsk-3 inhibition has attracted widespread attention as one of the critical therapeutic targets whereby lithium exerts its effects on mood stabilization, neurogenesis, neurotrophicity, neuroprotection, anti-inflammation, and others (for review, rowe and chuang, 2004; rowe et al., 2007; beurel et al., 2010). pharmacological inhibition or gene knockout/knockdown of this kinase mimics the anti-depressant and anti-manic effects of lithium observed in rodent models (gould et al., 2004; kaidanovich-beilin et al, 2004, 2009; obrien et al., 2004; rosa et al., 2008; omata et al., 2011). the activities of gsk-3 are negatively regulated by phosphorylation of gsk-3 at ser21 and gsk-3 at ser9. gsk-3 can be inhibited by lithium through direct binding to the atp-dependent magnesium-sensitive catalytic site of the enzyme (klein and melton, 1996; stambolic et al., 1996), and/or indirectly through enhanced serine phosphorylation of gsk-3 isoforms by multiple mechanisms (figure 1). lithium has been shown to enhance gsk-3 serine phosphorylation by activation of protein kinase a (pka; jope, 1999; liang et al., 2008), or phosphatidylinositol 3-kinase (pi3-kinase)-dependent akt (chalecka-franaszek and chuang, 1999) and protein kinase c- (kirshenboim et al., 2004 it has also been reported that lithium can disrupt the -arrestin-2pp2a akt complex that dephosphorylates/inactivates akt, thereby enhancing gsk-3 serine phosphorylation (beaulieu et al., 2005). moreover, it has been proposed that lithium can interrupt auto-regulation of gsk-3 via disinhibition of the inhibitory action of inhibitor-2 complex on protein phosphatase-1 (pp-1; zhang et al., 2003). this article reviews the findings supporting the role of gsk-3 inhibition in mediating lithium s neuroprotective effects against excitotoxicity in both cultured neurons and animal models of ischemic stroke. lithium, a competitive inhibitor of magnesium, directly inhibits atp magnesium-dependent catalytic activity of gsk-3. lithium can indirectly increase this serine phosphorylation of gsk-3 through pi3-kinase-mediated phosphorylation/activation of akt, pi3-kinase-mediated activation of pkc, and camp-dependent activation of pka. lithium can also increase the serine phosphorylation of gsk-3 by disrupting the -arrestin-2 (arr2)pp2a akt complex that dephosphorylates and inactivates akt. in addition, by disinhibiting the inhibitory action of inhibitor-2 (i-2) on protein phosphatase-l (pp-1) that dephosphorylates gsk-3 at serine residues, lithium s direct inhibition of gsk-3 interrupts this auto-regulation of gsk-3 and further decreases gsk-3 activity. lines with solid arrows represent stimulatory connections; lines with flattened ends represent inhibitory connections. we have designed isoform-specific small interfering rnas (sirnas) to distinguish the functional and regulatory differences between the two gsk-3 isoforms in rat cerebral cortical neuronal cultures (liang and chuang, 2007). transfection with sirna for gsk-3 or gsk-3 or with dominant-negative mutants specific for either isoform produced almost complete protection against glutamate-induced, n-methyl-d-aspartate (nmda) receptor-mediated excitotoxicity. the sirna-induced neuroprotection was associated with enhanced n-terminal phosphorylation in both gsk-3 isoforms. moreover, transfection with or isoform-specific dominant-negative mutants of gsk-3 mimicked lithium-induced neuroprotection against glutamate excitotoxicity. these results strongly suggest that both gsk-3 and are involved in glutamate-induced neuronal death and that both isoforms are the initial targets of lithium-elicited neuroprotection. gsk-3 has also been implicated in neuronal development, maturation/differentiation, and aging in the mammalian cns (spittaels et al., 2002; kim et al. substrates phosphorylated by gsk-3 include metabolic, signaling, and structural proteins as well as transcription factors. it is known that inhibition of gsk-3 results in activation, and sometimes suppression, of an array of transcription factors (for review, grimes and jope, 2001; jope and roh, 2006; chiu and chuang, 2010). among the long list of transcription factors regulated by gsk-3 are cyclic amp response element binding protein (creb), nuclear factor-b (nf-b), activating protein-1 (ap-1), heat-shock factor-1 (hsf-1), -catenin, t-cell factor (tcf)/lymphoid enhancer factor (lef), and p53. dysfunction of gsk-3-mediated phosphorylation of transcription factors is believed to relate with the pathophysiology of various pathological conditions (for review, chiu and chuang, 2010). we found that gsk-3 silencing activated camp response element (cre)- and nf-b-responsive transcription more robustly than gsk-3 silencing (liang and chuang, 2006). dna array further identified two novel gsk-3-regulated transcription factors, early growth response-1 (egr-1) and smad3/4, both of which play important roles in growth, differentiation, survival, and plasticity of brain cells (harada et al., 2001; derynck and zhang, 2003; lee and kim, 2004; droguett et al., 2010). specifically, the binding activity of egr-1 was down-regulated by sirna for gsk-3, but was up-regulated by sirna for gsk-3 (liang and chuang, 2006). by using sirnas or dominant-negative mutants specific to gsk-3 isoforms, inhibition of gsk-3 the differential roles of gsk-3 isoforms are further supported by the opposite effects of gsk-3 and sirnas on the protein levels of plasminogen activator inhibitor type-1 (pai-1), a smad3/4-regulated gene product. these results demonstrate that selective silencing or inhibition of the two gsk-3 isoforms could produce different and sometimes opposite effects on the regulation of certain transcription factors including novel gsk-3 targets (liang and chuang, 2006). for example, the disruption of gsk-3 in mice is embryonic lethal, despite the normal expression of gsk-3, indicating that the presence of isoform can not compensate for the loss of isoform (hoeflich et al., 2000). transfection and sirna studies suggested that gsk-3 inhibition decreased the processing of -amyloid (a) precursor protein to form a140 and a142, while gsk-3 appeared to have a lesser role (phiel et al., 2003). in addition, gsk-3, but not gsk-3, is required for interferon--induced activation of signal transducer and activator of transcription-3 (beurel and jope, 2009). together, these findings underscore important similarities and differences between the roles of gsk-3 isoforms and in cell survival as well as transcription, and suggest that the development of isoform-specific inhibitors may be essential for therapeutic intervention of gsk-3-related neuropathological conditions. we have also explored lithium s effects on smad3/4-dependent transcriptional activity and the underlying mechanisms. smad3/4 is a down-stream mediator of the signaling pathway triggered by transforming growth factor- (tgf-), and plays a prominent role in regulating the expression of proteins involved in neuronal survival, differentiation, and synaptic plasticity (for review, gomes et al., 2005). treating cultured cortical neurons with therapeutically relevant concentrations of lithium significantly decreased smad3/4-dependent transactivation and protein levels of pai-1, a tgf--responsive smad3/4-dependent gene product (liang et al., 2008). of particular relevance to the therapeutic efficacy of lithium, pai-1 has been implicated in the etiology and progression of neurodegenerative diseases and mood disorders (for review, pawlak et al., 2003; lithium s effects on smad3/4 likely result from cross-talk of signaling pathways between camp/pka and pi3-kinase/akt/gsk-3. we have shown that lithium-induced smad3/4 suppression involved gsk-3 inhibition through the activation of pka and cell survival factor akt followed by the phosphorylation of gsk-3 at ser9 and creb at ser133 (liang et al., 2008). creb binding protein (cbp) and p300 are known to be co-activators of creb. our data further demonstrated that over-expression of p300, but not cbp, completely antagonized lithium-induced reduction of pai-1 promoter activity. a series of experimental data support the notion that, in smad3/4 signaling, the inhibitory effects of lithium are due to complex formation of activated creb and p300, which results in limited interactions of p300 with the transcription factors/smad complexes. this in turn prevents efficient smad3/4-dependent transcription of smad3/4-dependent genes such as pai-1 and p21 (figure 2). transcriptional activations triggered by stimulation of cell surface tgf- and bdnf receptors are mediated by smad3/4- and pi3-kinase/akt-dependent pathways, respectively. lithium treatment-induced inhibition of gsk-3, directly and indirectly via camp-dependent activation of pka as well as bdnf-stimulated activation of pi3-kinase/akt pathways, potentiates bdnf-induced phosphorylation/activation of creb. this in turn increases cre-mediated transactivation and expression of survival factors such as bdnf and bcl-2. enhanced gene transcription triggered by bdnf, via sequestration of transcriptional co-activator p300, suppresses smad3/4-dependent transactivation and subsequently decreases the expression of tgf--responsive genes, pai-1, and p21. lines with solid arrows represent stimulatory connections; lines with flattened ends represent inhibitory connections. dashed lines represent pathways with reduced activity as a result of lithium treatment. lithium-induced neuroprotection against glutamate excitotoxicity was first noted in rodent primary neuronal cultures of cerebellar granule cells (cgcs), cerebral cortical neurons, and hippocampal neurons (nonaka et al., 1998). this experimental paradigm was selected because glutamate-related excitotoxicity has been implicated in many neurodegenerative diseases including stroke (for review, chuang, 2004; chiu and chuang, 2010). our pioneering studies have shown that glutamate-induced, nmda receptor-mediated excitotoxicity was robustly reduced by extended lithium chloride pretreatment (57 days) in cultured rat cgcs and cortical neurons, partly via inhibition of nmda receptor-mediated calcium influx (nonaka et al., 1998; hashimoto et al., 2002a). moreover, these effects of lithium were likely due to the attenuation of constitutive phosphorylation at tyr1472 of the nr2b subunit of nmda receptors, possibly as a result of inhibiting src tyrosine kinase (hashimoto et al., 2002a, 2003). although glutamate-induced excitotoxicity in cultured cortical neurons was blocked by treatment with either lithium or mk-801 (an nmda receptor antagonist), the src kinase inhibitor su6656 only partially diminished this toxicity (hashimoto et al., 2003), suggesting that other components are involved. in cgcs, lithium-induced neuroprotection against glutamate excitotoxicity was associated with up-regulation of the anti-apoptotic protein bcl-2, down-regulation of the pro-apoptotic proteins p53 and bax, and suppressed release of cytochrome c from mitochondria (chen and chuang, 1999), whereas the involvement of gsk-3 in the regulation of nmda signaling by lithium treatment is currently unclear and requires further investigations. cyclin-dependent kinase 5 (cdk5) also regulates signaling mediated by nmda receptors, either directly through phosphorylation of the nr2b subunit or indirectly through phosphorylation of psd-95 (morabito et al., 2004; zhang et al., 2008 when it binds to p25 (the product of calpain-mediated cleavage of p35), cdk5 becomes pro-apoptotic and its activity is dysregulated (lee et al., p25 accumulation was observed in neurons in response to glutamate or oxidative stress, and also in the brains of several animal models of neurodegenerative diseases. sustained activation of cdk5 in neurons has been implicated in many neurodegenerative diseases (cruz and tsai, 2004; dhariwala and rajadhyaksha, 2008). in cultured rat cgcs, lithium pretreatment prevented colchicine-induced apoptosis and associated increase in cdk5 expression and fragmentation of p35 into p25 (jorda et al.. additionally, pretreatment with lithium also attenuated intracellular calcium increase, calpain activity, cdk5 activation, and cellular death in primary cultured hippocampal neurons and rat striatum following the treatment of 3-nitropropionic acid (crespo-biel et al., 2009), a succinate dehydrogenase inhibitor (for review, brouillet et al., 1999). therefore, lithium-induced inhibition of calpain and cdk5 activation may also contribute to protection against glutamate excitotoxicity. prior to changes in gene expression, lithium rapidly and transiently activated the cell survival pi3-kinase and its down-stream target, akt-1, through phosphorylation at ser473, thereby reversing glutamate-induced inactivation of this signaling pathway in cgcs (chalecka-franaszek and chuang, 1999). activated akt is known to affect several anti-apoptotic targets including bcl-2 associated death promoter (bad), creb, members of the forkhead family, and procaspase-9 (for review, neri et al., 2002; nicholson and anderson, 2002; huang and reichardt, 2003). in addition, lithium also triggered ser21 phosphorylation of the isoform of gsk-3 (and hence resulted in inhibition), and this effect was prevented by a pi3-kinase inhibitor (chalecka-franaszek and chuang, 1999). another signaling pathway affected by lithium is the mitogen-activated protein (map) kinase pathway. one of the down-stream targets of map kinase is creb, a transcription factor that is involved in learning and memory, and promotes the expression of bcl-2 as well as brain-derived neurotrophic factor (bdnf; for review, finkbeiner, 2000). in cgcs, toxic concentrations of glutamate-induced an nmda receptor-dependent decrease in creb phosphorylation at ser133 and creb-driven transcriptional activity (kopnisky et al., 2003). concurrent with its neuroprotective effects, long-term (but not acute) lithium treatment suppressed glutamate-induced dephosphorylation of creb. we also found that glutamate rapidly activated c-jun-n-terminal kinase (jnk) and p38 kinase in cgcs, resulting in a robust increase in ap-1 binding (chen et al., 2003a). these two kinases are also activated by a variety of apoptotic insults (for review, mielke and herdegen, 2000), and ap-1 has been known to be activated by different stress factors as well. experiments using lithium and curcumin, a selective ap-1 inhibitor, suggest that nmda receptor-mediated apoptotic death requires concerted action of jnk and p38 to enhance ap-1 binding, and that lithium s neuroprotection is mediated, at least in part, by suppressing the jnk and p38 kinase pathways. as one of the major neurotrophins, bdnf is essential for cortical development, synaptic plasticity, and neural survival, and is likely a key mediator of the clinical efficacy of anti-depressants and anxiolytic drugs (for review, woo and lu, 2006). the notion that bdnf plays a key role in neuronal survival is supported by our observation that bdnf and neurotrophin-4 (nt-4), but not nt-3, completely protected immature cgcs from apoptosis induced by cytosine arabinoside (leeds et al., 2005). it was first reported that chronic treatment with lithium increased the expression of bdnf in the rat brain (fukumoto et al., 2001), and we have documented that bdnf protein levels were increased in cortical neurons following lithium treatment (hashimoto et al., 2002b). we hypothesized that this bdnf up-regulation and subsequent activation of its receptor trkb might play a critical role in mediating the neuroprotective effects of lithium. in confirmation of this hypothesis, we found that lithium s neuroprotection against glutamate excitotoxicity was blocked by a trkb inhibitor, k252a, or by a neutralizing antibody against bdnf, and was mimicked by exogenous bdnf in rat cortical neurons. in addition, lithium increased intracellular levels of bdnf and this was followed by activation of trkb. furthermore, lithium-induced neuroprotection was prevented in cortical neurons from heterozygous (+ /) or homozygous (/) bdnf knockout mice (hashimoto et al., 2002b). rodent bdnf has a complex genomic structure that makes it an ideal target for multiple and complex regulation. we found that treatment of rat cortical neurons with therapeutic concentrations of lithium (e.g., 1 mm) caused a significant increase in the levels of bdnf exon iv-containing mrna, while levels of exon i, ii, or vi-containing mrna remained unchanged (yasuda et al., 2009). it is known that exon iv-containing bdnf transcripts are expressed in response to kcl-induced depolarization in rat cortical neurons (tao et al., 2002). this transcriptional activation requires utilization of the promoter region 80 bp up-stream from the transcription initiation site of exon iv-containing three calcium responsive elements (cares; chen et al., 2003b). we generated various bdnf promoter iv deletion constructs to investigate whether lithium treatment causes an increase in bdnf promoter iv activity, and, if so, which region of promoter iv confers the sensitivity to this drug. we identified that the drug-induced up-regulation of exon iv-containing bdnf transcript was associated with a significant increase in the activity of bdnf promoter iv and total bdnf protein. to our surprise, the lithium-responsive element(s) in promoter iv resides in a region up-stream from the cares responsible for depolarization-induced bdnf induction (170 to 704 bp). moreover, activation of bdnf promoter iv occurred in cortical neurons depolarized with kcl and depletion of these three cares failed to abolish lithium-induced activation. importantly, we found that lithium-induced activation of promoter iv was mimicked by pharmacological inhibitors of gsk-3 (sb216763, sb415286, inhibitor i, and inhibitor vii) or by transfection with specific sirna for gsk-3 or gsk-3. additionally, their dominant-negative mutants also mimicked lithium-induced activation of promoter iv. these results demonstrate that gsk-3 is the initial target of lithium to selectively activate bdnf promoter iv and that bdnf induction by lithium involves a novel responsive region in promoter iv of the bdnf gene. lithium-induced, gsk-3-dependent bdnf promoter iv activation could be a part of the molecular mechanisms underlying its neuroprotective effects and as such, possibly accounts for the therapeutic actions in bipolar patients. it should be noted that in addition to lithium, other gsk-3 inhibitors have been shown to almost completely block glutamate-induced excitotoxicity in rat cortical neuronal cultures (liang and chuang, 2007). these include atp-competitive inhibitors, sb216763 and sb415286, and atp-non-competitive inhibitors, inhibitor i and vii. as mentioned in the preceding section, glutamate-induced death of cortical neurons was mitigated by silencing of gsk-3 and/or, or both isoforms, or inhibition of gsk-3 activity via transfection with dominant-negative mutants of gsk-3/ isoforms (liang and chuang, 2007). studies from other laboratories also supported the roles of gsk-3 inhibition in protecting neurons from glutamate neurotoxicity. for example, stimulation of nmda receptors in cultured rat hippocampal or cortical neurons activated gsk-3 by pp-1-mediated serine dephosphorylation of gsk-3 (szatmari et al., 2005). treatment of primary rat cortical neurons with -amino-3-hydroxy-5-methyl-4-isoxazole propionate (ampa), lithium or sb216763 blocked glutamate-induced caspase-3 activation and excitotoxicity, and the protective effects of ampa required pi3-kinase akt-dependent serine phosphorylation of gsk-3 (nishimoto et al., 2008). further, in organotypic cultures of chick embryo spinal cord, lithium prevented kainate-induced excitotoxic death of motoneurons by targeting gsk-3, and this neuroprotection was associated with cytopathological changes (caldero et al., 2010). stroke is the third leading cause of death in the united states and a major global cause of serious long-term disability in adults. ischemic strokes represent approximately 87% of all cases, while the rest are hemorrhagic strokes (roger et al., 2011). in addition to physical deficits, stroke victims also suffer from vascular depression and dementia, both of which are difficult to treat with conventional medicine. it is becoming clear that there is a substantial increase in extracellular glutamate in the brain following cerebral ischemia, and that a significant portion of ischemia-induced brain damage is mediated by over-stimulation of nmda receptors. shortly after ischemia, the interruption of cerebral blood flow depletes oxygen and glucose and subsequently prevents atp production. inadequate atp supply will cause the malfunction of atp-dependent ion pumps and alter the ion concentration gradient across the neuronal membranes. the resulting failure to transport glutamate leads to an accumulation of glutamate in the extracellular space and over-stimulates nmda receptors, which leads to a toxic influx of calcium and in turn drives the activation of damaging calcium-mediated intracellular enzymes. this cascade of events ultimately results in mitochondrial failure, production of reactive oxygen species, neuroinflammation, and cell necrosis and apoptosis (allen and bayraktutan, 2009; deb et al., 2010). gsk-3 has been strongly implicated in the neuronal cell death caused by cerebral ischemic insult. one study in rats subjected to transient middle cerebral artery occlusion (mcao) demonstrated a rapid increase in the expression of cytoplasmic and nuclear gsk-3 protein in ipsilateral lamina i, ii, v, and vi in young rat brains, whereas in lamina v and vi in old rat brains (sasaki et al. although the phosphorylation status of gsk-3 was not mentioned, these findings implicate a role of gsk-3 in cerebral ischemic injury. it is well known that gsk-3 can be phosphorylated at serine and tyrosine residues in which ser9 phosphorylation renders it inactive, while tyr216 phosphorylation is necessary for its functional activity (hughes et al., 1993). discrepancies exist in the literature regarding changes of ser9 and tyr216 phosphorylation levels following cerebral ischemia. the phosphorylation levels of gsk-3 at ser9 and akt at ser473 were reported to be markedly enhanced in the vulnerable hippocampal ca1 region, but not in the ischemia-resistant ca3 region in rats subjected to transient global cerebral ischemia, while there was no change in levels of tyr216 phosphorylation or total gsk-3 (endo et al., 2006). levels of gsk-3 ser9 phosphorylation were also increased shortly after permanent focal cerebral ischemia and decreased to basal levels or even lower 24 h after ischemic onset (sasaki et al., 2006; gao et al., 2008 however, it has also been reported that transient focal cerebral ischemia in rats caused an increase in gsk-3 tyr216 phosphorylation in degenerating cortical neurons with no alteration in ser9 phosphorylation (bhat et al., 2000). this discrepancy may stem, in part, from the difference of ischemic severity and ischemic models across various studies. it appears that transient focal cerebral ischemia tends to activate gsk-3 and subsequently to induce apoptotic cell death. in contrast, gsk-3 is inactivated shortly after permanent focal cerebral ischemia or global cerebral ischemia, which in turn may promote survival of vulnerable neurons. ischemia both gsk-3 and gsk-3 mediated the expression of a lethal protein, neuronal pentraxin 1 (russell et al., 2011). in light of these findings the beneficial effects of lithium in rodent cerebral ischemic models demonstrated by us and others support this notion. in an initial study, long-term lithium pretreatment at therapeutically relevant doses decreased brain infarct volume, reduced apoptotic cell death and improved behavioral performance after permanent cerebral ischemia-induced by mcao (nonaka and chuang, 1998; xu et al., 2003). in a subsequent study, we demonstrated that subcutaneous injection of rats with lithium at therapeutic doses (e.g., 0.5 and 1.0 meq/kg) after the onset of transient mcao markedly decreased infarct volume, reduced tunel-positive dna damage, and suppressed neurological deficits measured by sensory, motor, and reflex tests (ren et al., 2003). the time window for these beneficial effects was at least 3 h after the onset of ischemia. heat-shock protein 70 (hsp70), a well-established cytoprotective factor against apoptosis, was induced in the ischemic penumbra where neuronal recovery takes place. post-insult treatment with lithium increased the dna binding activity of hsf-1 to the heat-shock element, superinducing hsp70 which inhibits brain ischemia-induced apoptosis (ren et al., 2003). lithium-elicited gsk-3 inhibition is likely associated with hsf-1 activation and hsp70 induction (bijur and jope, 2000). notably, post-insult lithium treatment mitigated apoptosis and brain damage by preventing gsk-3 and erk dephosphorylation, suppressing calpain and caspase-3 activation, and inhibiting mitochondrial release of cytochrome c and apoptosis-inducing factor in a neonatal hypoxic these findings suggest that lithium-induced gsk-3 inhibition contributes to its anti-apoptotic effects under ischemic conditions. in addition, it was found that lithium pretreatment largely suppressed ischemia-induced exploratory behavioral changes and memory impairments in gerbils after global cerebral ischemia (bian et al., 2007). these behavioral benefits were associated with an increase in the number of viable cells and a decrease in apoptotic cells in the ca1 hippocampal area of ischemic gerbils. moreover, lithium-induced neuroprotection in the ischemic brain was accompanied by down-regulation of pro-apoptotic p53 in the ca1, and up-regulation of anti-apoptotic bcl-2 and hsp70, both of which are targets of gsk-3. it is likely that lithium protection against ischemia-induced injury involves multiple mechanisms. in the rat hippocampus, lithium was reported to inhibit ischemia-induced nmda receptor hyperactivation by inhibiting nmda subunit 2a tyrosine phosphorylation and its interactions with src and fyn through psd-95 (ma and zhang, 2003). lithium also attenuated hypoxia-induced serine dephosphorylation of gsk-3 and in the mouse brain (roh et al., 2005). additionally, in organotypic cultures of rat hippocampus subjected to oxygen and glucose deprivation, lithium showed neuroprotection in conjunction with hsp27 activation (cimarosti et al., 2001). post-ischemic inflammation is a dynamic process involving a complicated set of interactions between inflammatory cells and molecules (iadecola and alexander, 2001). a recent study documented the anti-inflammatory effects of lithium in a neonatal rat hypoxic ischemic model. post-insult lithium treatment significantly reduced total tissue loss following hypoxia ischemia, and this beneficial effect of lithium was associated with inhibiting microglia activation and attenuating levels of pro-inflammatory cytokines or chemokines, such as interleukin-1 and chemokine ligand 2 (li et al., 2011). hsp70 over-expression can inactivate the key inflammatory transcription factor nf-b by stabilizing the nf-b-ib complex, and thereby preventing nuclear translocation of activated nf-b subunits in a mouse mcao model (zheng et al., 2008). besides anti-inflammation, lithium also increased proliferation and differentiation of hippocampal neural progenitor cells in both non-ischemic and ischemic brains without altering the relative levels of neuronal and astrocytic differentiation, and this effect lasted at least 7 weeks after hypoxia ischemia in neonatal rats (li et al., in line with this finding, chronic lithium pretreatment was found to increase the generation and survival of newborn cells in the hippocampal dentate gyrus, and did not affect the neuronal or astrocytic differentiation of these newborn cells in a transient four-vessel occlusion model (yan et al. erk1/2 phosphorylation following ischemia was enhanced by lithium treatment, while erk1/2 inhibitor u0126 prevented the effects of lithium in increasing brdu-positive cells and improving spatial learning and memory (yan et al., 2007). in fact, chronic lithium treatment has been demonstrated to increase activity in the mek/erk pathway in vivo, and lithium s neuroprotection has been suggested to depend on the induction of this signaling pathway (einat et al. in addition, it was reported that activation of erk associates with and phosphorylates gsk-3 at the thr43 residue, which primes this kinase for its subsequent phosphorylation at ser9 by p90rsk, resulting in inactivation of gsk-3 and up-regulation of -catenin (ding et al., 2005). therefore, lithium might affect gsk-3 phosphorylation through the mek/erk pathway, which in turn inhibits this kinase via rsk. gsk-3 is also negatively regulated by the wnt/-catenin signaling pathway and, accordingly, activating the canonical wnt pathway has been shown to contribute to adult hippocampal neural progenitor cell proliferation triggered by lithium treatment (wexler et al., 2008). in a collaborative study, the neurohemodynamic aspects of recovery induced by delayed chronic lithium treatment were assessed using functional magnetic resonance imaging (mri; kim et al., 2008). rats were subjected to transient mcao and then injected with lithium (licl, 1 meq/kg, s.c.) this delayed lithium injection was followed by daily injections, and on day 15, an mri scan was performed to monitor changes in blood oxygen level dependence (bold) and functional cerebral blood volume (fcbv) responses using electric stimulation of forelimbs. the mean activated volume ratio and total activation magnitude ratio between ipsilateral and contralateral cortices for both bold and fcbv were significantly higher in the lithium-treated than in the saline-treated rats. the lithium-induced increase in fcbv in the peri-infarct regions suggests a possible vascular transformation. indeed, the size and distribution of immunohistochemical staining of cd31, a microvasculature marker, were enhanced by lithium treatment in the peri-infarct regions. co-localized with cd31, the tissue staining of matrix metalloproteinase-9 (mmp-9) was also much more pronounced following lithium treatment, suggesting mmp-9-dependent neurovascular remodeling in the recovering brain area. moreover, treatment of cultured rat brain endothelial cells with lithium in a follow-up study was also found to increase the protein levels of vascular endothelial growth factor (vegf) via a mechanism involving the pi3-kinase and gsk-3 signaling pathways (guo et al., since vegf has been linked to angiogenesis, neurogenesis, and neuroprotection (for review, fan and yang, 2007), vegf over-expression may contribute to lithium s ability to promote neurovascular remodeling and to induce functional recovery after ischemic stroke. ample evidence supports the therapeutic potential of mesenchymal stem cells (mscs) in several human diseases including stroke. however, it is increasingly recognized that the effectiveness of msc transplantation is limited by their poor migration toward disease target sites such as ischemic brain regions. in a recent study, we investigated whether treatment of mscs with lithium and another mood stabilizing drug, valproic acid (vpa), would enhance cell migration (tsai et al., 2010). we found that treatment of mscs with lithium (2.5 mm for 1 day) selectively elevated the transcript and protein levels of mmp-9 and its enzymatic activity. these effects were mimicked by pharmacological inhibition or gene silencing of gsk-3. lithium treatment also potentiated stromal cell-derived factor-1 (sdf-1)-dependent msc migration across the extracellular matrix, which was suppressed by two mmp-9 inhibitors, doxycycline and gm6001. short-term (3 h) exposure of mscs to a relatively high concentration (2.5 mm) of vpa markedly increased the transcript and protein levels of cxc chemokine receptor 4 (cxcr4). vpa-induced cxcr4 expression required its ability to inhibit histone deacetylases (hdacs), including the hdac1 isoform, and involved histone hyperacetylation at the cxcr4 gene promoter. vpa treatment enhanced sdf-1-mediated msc migration, which was completely blocked by amd3100, a cxcr4 antagonist. notably, combining lithium and vpa treatment further increased msc migration, and the additive enhancement of migration was completely blocked by the co-presence of amd3100 and gm6001. our results suggest that lithium and vpa stimulate msc migration through distinct targets and mediators: gsk-3mmp-9 and hdac cxcr4, respectively (tsai et al., 2010). in a follow-up in vivo study, mscs were primed with lithium and/or vpa and then injected into the tail vein of transient mcao rats 24 h after ischemic onset. priming with lithium or vpa increased the number of mscs homing to the cerebral infarcted regions such as the cortex and striatum 2 weeks after transplantation, and co-priming with lithium and vpa further enhanced this migratory effect (tsai et al., 2011). mcao rats receiving lithium- and/or vpa-primed mscs showed improved functional recovery, reduced infarct volume, and enhanced angiogenesis in the infarcted penumbra regions. these beneficial effects of lithium and vpa priming were reversed by pharmacological inhibition of mmp-9 and cxcr4, respectively, suggesting that these effects were likely mediated by lithium-induced mmp-9 up-regulation and vpa-induced cxcr4 over-expression. together, these findings raise the potential utility of using mscs primed with inhibitors of gsk-3 and hdac to enhance the migration and homing capacity for transplantation into stroke victims. in addition to lithium, other pharmacological gsk-3 inhibitors have been shown to exert neuroprotective effects against cerebral ischemia by various groups. a specific gsk-3 inhibitor, chir025, was demonstrated to protect cultured hippocampal neurons from glutamate excitotoxicity and to attenuate death of cortical neurons following oxygen glucose deprivation, an in vitro model of cerebral ischemia (kelly et al., 2004). moreover, chir025 reduced infarct size in focal cerebral ischemic rats, but did not affect tunel-positive neurons or caspase-3/9 activities, although bcl-2 expression was increased. gsk-3 enzymatic activity was markedly elevated after transient mcao in rats, and this gsk-3 activation was blocked by jugular vein injection of gsk-3 inhibitor viii (koh et al., 2008). pre- or post- (up to 2 h) mcao injection with inhibitor viii also reduced blood glucose levels, infarct size, caspase-3 activity, and water content in the ipsilateral brain hemisphere. furthermore, ischemia-induced inflammation-related signals such as cox-2 over-expression and neutrophil infiltration were alleviated by this gsk-3 inhibitor. prophylactic or therapeutic administration of a gsk-3 inhibitor tdzd-8 reduced infarct volume and cerebral injury in the rat hippocampus after transient ischemia (collino et al., 2008). this was accompanied by suppression of ischemia-induced oxidative stress, apoptosis, and neuroinflammation. delayed treatment with compound i, a gsk-3 and cdk inhibitor, decreased tunel-positive cells in the ipsilateral hippocampus and striatum of adult (but not juvenile) mice subjected to hypoxic these neuroprotective effects of compound i were associated with long-lasting functional recovery. finally, gsk-3 inhibition by sb216763 counteracted oxygen glucose deprivation-induced mitochondrial biogenesis impairment and reduced mitochondrial reactive oxygen species generation in primary cortical neurons (valerio et al., 2011). when systematically administrated to permanent mcao mice, sb216763 decreased infarct volume and restored the loss of mitochondrial dna, thus supporting a novel role of gsk-3 inhibitors in stimulating the renewal of functional mitochondria following ischemic stroke. a growing body of evidence supports that lithium, a mood stabilizer used to treat bipolar disorder, has neuroprotective properties in both cellular and in vivo experimental settings. one of the major targets of lithium is gsk-3, a serine/threonine kinase implicated in the pathogenesis of diverse cns disorders. lithium inhibits gsk-3 activity by direct binding to the enzyme or indirectly by enhancing serine phosphorylation of both and isoforms through multiple mechanisms. lithium has been used as a prototype drug to seek evidence for the involvement of gsk-3 inhibition in lithium-induced protection against excitotoxicity in cultured neurons and animal models of cerebral ischemic stroke. lithium at therapeutically relevant concentrations robustly protected primary brain neurons from glutamate-induced, nmda receptor-mediated excitotoxicity. the neuroprotective effects of lithium were associated with gsk-3 inhibition, and were mimicked by other pharmacological gsk-3 inhibitors, by silencing gsk-3 and/or isoforms, or by expression of isoform-specific dominant-negative mutants. these results support the roles of gsk-3 inhibition in lithium-elicited protection against excitotoxicity. lithium rapidly activated the cell survival pi3-kinase akt signaling pathway to enhance gsk-3 serine phosphorylation and to block glutamate-induced akt inactivation as well as apoptosis. lithium also caused an increase in the expression of cytoprotective bcl-2 and suppressed glutamate-induced up-regulation of pro-apoptotic p53 and bax, resulting in blocking cytochrome c release from mitochondria. bdnf promoter iv was selectively activated by gsk-3 inhibition using lithium or other drugs or through gene silencing/inactivation of either isoform. this effect on however, there is a gap in the understanding of how gsk-3 inhibition causes an increase in bdnf promoter activity. in addition, lithium s neuroprotective effects were associated with inhibition of nmda receptor-mediated calcium influx and suppression of p38/jnk and ap-1 activation, thus reducing apoptosis. this effect appears to stem from inhibition of src/fyn kinase to suppress nr2b tyr1472 phosphorylation of the receptor. it remains to be explored as to whether this lithium-induced action on nmda receptors is related to gsk-3 inhibition. the potential roles of these other targets in mediating the neuroprotective effects of this drug also deserve future investigation. it is well known that glutamate overflow and nmda receptor hyper-stimulation are early events following cerebral ischemia. in rodent ischemic models, pre- or post-insult treatment with therapeutic doses of lithium decreased infarct volume, caspase-3 activity and apoptotic cells in the injured brain. the beneficial time window of lithium is at least 3 h after the ischemic onset. up-regulation of hsp70 and bcl-2 as well as down-regulation of p53 likely contributed to the protective effects of lithium in the ischemic conditions, thus supporting similar underlying neuroprotective mechanisms in the excitotoxic cellular models and animal models of ischemic stroke. limited data suggested that lithium might also display anti-inflammatory effects by inhibiting ischemia-induced microglia activation and pro-inflammatory factors release. delayed and chronic injections of lithium improved functional mri responses such as increases in bold and fcbv. indeed, lithium was found to induce two pro-angiogenic factors, mmp-9 and vegf in a gsk-3-dependent manner. lithium has also been reported to stimulate erk1/2 activity and to enhance proliferation of hippocampal neural progenitor cells and memory performance after ischemia. finally, lithium promoted migration of mscs in vitro by up-regulation of mmp-9 through gsk-3 inhibition and this migratory effect was potentiated by co-treatment with vpa, another mood stabilizer. notably, transplantation of lithium vpa co-primed mscs into ischemic rats markedly increased msc migration to the injured brain regions, decreased infarct size and improved the neurological performance. lithium-induced stem cell migration, neurogenesis, and angiogenesis all likely contribute to functional recovery. figure 3 illustrates proposed molecular events leading to lithium-induced beneficial effects following cerebral ischemia. it should be noted that several other gsk-3 inhibitors have also been reported to exert beneficial effects in rodent ischemic models and their actions were accompanied by suppression of ischemia-increased gsk-3 activity. accordingly, gsk-3 inhibitors have therapeutic potential to treat stroke and other excitotoxicity-related neurodegenerative diseases. lithium has been used in bipolar patients over 60 years and its clinical profiles are well understood. therefore, lithium is a prime candidate for use in clinical trials of new therapies for stroke victims. the neuroprotective effects of lithium against cerebral ischemia are proposed to result from its interactions with cell survival and apoptotic machinery. a significant portion of brain damage following cerebral ischemia is caused by an increase in extracellular glutamate and subsequent over-stimulation of nmda receptor-mediated toxic increase in intracellular calcium. this signaling pathway plays a critical role in mediating glutamate-induced caspase activation and apoptosis. lithium at therapeutically relevant concentrations inhibits nmda receptor-mediated calcium influx, which in turn decreases subsequent activation of jnk, p38 kinase, and transcription factor ap-1. inhibition of intracellular calcium increase also attenuates the activity of calpain and calpain-mediated activation of pro-apoptotic cdk5/p25 kinase. on the other hand, lithium can directly and indirectly reduce the activity of constitutively activated gsk-3 by multiple mechanisms, leading to disinhibition of several transcription factors, such as creb and hsf-1, and resulting in induction of major cytoprotective proteins such as bdnf, vegf, mmp-9, hsp70, and bcl-2. a decrease in gsk-3 activity further reduces the activity of pro-apoptotic protein p53 and its downregulating effect on bcl-2. bdnf, via activating its cell surface receptor and the down-stream erk and pi3-kinase/akt pathways, induces neuroprotective effects in part by inhibiting gsk-3 and stimulating creb. induction of bdnf is an early and essential step for neuroprotection and is involved in lithium-induced neurogenesis. in addition, superinduction of hsp70 by lithium treatment not only inhibits brain ischemia-induced apoptosis, but also contributes to the anti-inflammatory effects of lithium through inactivation of nf-b. counteraction of gsk-3 inhibition of vegf and mmp-9 by lithium enhances angiogenesis and neurovascular remodeling. taken together, these effects of lithium in reducing apoptosis, suppressing inflammation, enhancing angiogenesis and neurogenesis, contribute to behavioral improvement and functional recovery after ischemia. lines with solid arrows represent stimulatory connections; lines with flattened ends represent inhibitory connections. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

the mood stabilizer lithium inhibits glycogen synthase kinase-3 (gsk-3) directly or indirectly by enhancing serine phosphorylation of both and isoforms. lithium robustly protected primary brain neurons from glutamate-induced excitotoxicity; these actions were mimicked by other gsk-3 inhibitors or silencing/inhibiting gsk-3 and/or isoforms. lithium rapidly activated akt to enhance gsk-3 serine phosphorylation and to block glutamate-induced akt inactivation. lithium also up-regulated bcl-2 and suppressed glutamate-induced p53 and bax. induction of brain-derived neurotrophic factor (bdnf) was required for lithium s neuroprotection to occur. bdnf promoter iv was activated by gsk-3 inhibition using lithium or other drugs, or through gene silencing/inactivation of either isoform. further, lithium s neuroprotective effects were associated with inhibition of nmda receptor-mediated calcium influx and down-stream signaling. in rodent ischemic models, post-insult treatment with lithium decreased infarct volume, ameliorated neurological deficits, and improved functional recovery. up-regulation of heat-shock protein 70 and bcl-2 as well as down-regulation of p53 likely contributed to lithium s protective effects. delayed treatment with lithium improved functional mri responses, which was accompanied by enhanced angiogenesis. two gsk-3-regulated pro-angiogenic factors, matrix metalloproteinase-9 (mmp-9) and vascular endothelial growth factor were induced by lithium. finally, lithium promoted migration of mesenchymal stem cells (mscs) by up-regulation of mmp-9 through gsk-3 inhibition. notably, transplantation of lithium-primed mscs into ischemic rats enhanced msc migration to the injured brain regions and improved the neurological performance. several other gsk-3 inhibitors have also been reported to be beneficial in rodent ischemic models. together, gsk-3 inhibition is a rational strategy to combat ischemic stroke and other excitotoxicity-related brain disorders.

PMC3152742

pubmed-254

ionizing radiation is a well-known carcinogen in humans, and breast is one of the most sensitive organs to radiogenic cancer. the rate of breast cancer in postwar japan was among the lowest in the world, but breast cancer contributed a disproportionately large fraction of the radiation-related cancer burden in atomic bomb survivors [2, 3]. the data from the hiroshima and nagasaki survivors provides strong evidence for increased breast cancer following single acute doses of 20 cgy and linearity with increasing dose [36]. also, an increase in the incidence of breast cancer has been observed in areas affected by the chernobyl accident, which resulted in radioactive contamination of large areas of belarus and ukraine. a twofold increase in risk was observed when comparing the most (> 40 msv cumulative dose) and least contaminated regions. interestingly, the increase appeared 10 years after exposure and was most prominent in women exposed at younger age. more than 50,000 women in the united states have been treated with chest radiation (20 gy) for a pediatric or young adult cancer. children treated from cancer with radiotherapy have a 2.9 relative risk of subsequent malignancy compared to those who were not [8, 9]. a systematic review of 14 studies concluded that risk of breast cancer increased as early as 8 years following chest radiation and did not plateau with increasing length of follow-up. studies estimating low-dose radiation-induced cancer risk from diagnostic x-rays and ct scans have found a small but significant increased lifetime risk [11, 12]. while the benefits of diagnostic x-ray and ct scans outweigh potential individual lifetime risk, their use should be justified and alternatives considered. we know remarkably little of molecular mechanisms that may be protective or risky for breast cancer after exposure to low-dose ionizing radiation (ldir). identification of transcriptomic changes induced by ldir in mammary tissue will be valuable to elucidate the molecular mechanisms associated with radiation-induced breast cancer. long noncoding rnas (lncrnas), which initially were thought of as transcriptional noise, are emerging as key regulators of a multitude of cellular processes by taking part in epigenetic, transcriptional, and posttranscriptional regulation of gene expression [13, 14]. the lncrnas have a weaker evolutionary constraint and lower levels of expression compared to the protein-coding transcripts [15, 16] but exhibit more tissue specific expression than the protein-coding genes. recently, a number of studies have shown that lncrna expression can be deregulated in human cancers [17, 18]. as the functions of individual lncrnas in cancer are beginning to be elucidated, they are being categorized and referred to as either tumor suppressor or oncogenic lncrnas, in the same way as traditional protein-coding cancer genes. however, the relevance of lncrnas in the cell and tissue response to ionizing radiation has not yet been characterized. in this study, we used agilent sureprint g3 microarrays to profile lncrna and mrna from mammary glands of balb/c mice 2, 4, and 8 weeks after irradiation and of spret/eij mice 4 weeks after irradiation with 10 cgy of x-radiation. we identified lncrna and mrna expression signatures for each time point after irradiation in comparison to sham. of the total 1338 lncrnas identified to be differentially expressed after ldir in either balb/c or spret/eij, 1337 had a significantly correlated expression pattern with at least one mrna that was also differentially expressed after ldir. our results indicate lncrnas may exert a partial or key role in the regulation of coding rna expression induced by radiation. balb/c and spret/eij mice were purchased from jackson laboratory, housed four per cage under a 12 hr light and 12 hr dark cycle, and fed with lab diet 5008 chow and water ad libitum. the mice were irradiated whole body at 8-9 weeks of age to a single dose of 10 cgy using a precision x-ray inc rad320 320 kvp x-ray machine, operated at 300 kv, 2 ma. mammary tissues were collected for gene expression profile at 2, 4, and 8 weeks after irradiation. all animal experiments were performed at lawrence berkeley national laboratory and the study was carried out in strict accordance with the guide for the care and use of laboratory animals of the national institutes of health. the animal use protocol was approved by the animal welfare and research committee of the lawrence berkeley national laboratory. agilent sureprint g3 mouse ge 8x60k microarrays were used according to the manufacturer's protocol (arrays contained 39,430 entrez gene rnas and 16,251 lncrnas). genes that were differentially expressed between sham and irradiated were identified by the unpaired student's t-test with a p value cut-off of 0.05 (p value<0.001 for baseline strain comparison) and a fold-change criteria of more than 1.5. for each of the 8 experimental treatment groups, the average expression values of the 3 biological replicates significantly correlated pairs of mrna and lncrna were calculated using a standard permutation test. in brief, for each potential mrna and lncrna pair, the 8 mrna values were randomly rearranged and a correlation coefficient was calculated between the 8 mrnas and 8 lncrnas values. the p value reported in this work represents the percentage of permutations leading to a higher correlation than the original correlation between the 8 mrnas and 8 lncrnas values. in other words, the lower the p value is, the more likely the mrna and lncrna pair is not randomly associated. gene lists were annotated with biological functions using ingenuity pathway analysis (ipa), kegg pathway analysis (http://bioinfo.vanderbilt.edu/webgestalt/) and david go gene ontology (http://david.abcc.ncifcrf.gov/; p 0.05). annotations for the various shapes used in the ipa networks in figures 13 are shown in figure s3 in supplementary material available online at http://dx.doi.org/10.1155/2015/461038. to identify potential lncrnas and mrnas that may determine susceptibility to radiation-induced breast cancer, we profiled two inbred strains of mice with differing genetic susceptibilities: balb/c mice as more sensitive and spret/eij as more resistant. balb/c mice carry two dna-pkcs polymorphisms with reduced catalytic subunit activity and defective nonhomologous-end-joining of double strand breaks. we identified 195 lncrnas as upregulated and 95 lncrnas as downregulated in balb/c in comparison to spret/eij (fold-change 1.5; p value<0.001) (figure 1(a); table s1). additionally, 582 mrnas were upregulated and 402 mrnas were downregulated in balb/c in comparison to spret/eij (fold-change 1.5; p value<0.001) (figure 1(b); table s1). gene ontology analyses of differentially expressed genes between balb/c and spret/eij showed significant enrichment for metabolic processes (p=5.9e 06), ion binding (p=3.00e 08), and chemokine signaling (p=0.02) (figure 1(c); table s2). our analyses identified significant strain differences in gene expression between balb/c and spret/eij mammary tissues. we found significant differences in the expression of a number of chemokines including cxcl10, ccl6, and ccl25, which were expressed at higher levels in mammary tissues of the more sensitive and susceptible balb/c mice and which have previously been associated with breast cancer progression when over expressed. to identify lncrna and mrna expression changes induced by low-dose ionizing radiation (ldir), we profiled lncrna and mrna expression from mammary glands of balb/c mice 2, 4, and 8 weeks after irradiation and of spret/eij mice 4 weeks after irradiation with 10 cgy of x-radiation. for balb/c mice, a total of 357, 480, and 335 lncrnas and 550, 911, and 389 coding rnas were identified to be differentially expressed at weeks 2, 4, and 8 after ir in comparison to sham (fold-change 1.5; p value<0.05), respectively (figure 2(a); table s1). for spret/eij, a total of 327 lncrnas and 424 mrnas were identified as differentially expressed at week 4 after irradiation in comparison to sham (fold-change 1.5; p value<0.05) (figure 3(a); table s1). few coding-rnas and lncrnas were found to be differentially expressed at different time points (figure s1(a) and s1(b)) and between balb/c and spret/eij (figure s1(c)). to determine the biological functions associated with the ldir response, we excluded genes whose levels fluctuate in the mouse mammary gland across the estrous cycle. we recently mapped transcript-level changes across the estrous cycle in the murine mammary gland using rna sequencing and defined a comprehensive estrous variable gene signature of 3893 genes whose levels fluctuate in mammary glands of balb/c mice. comparison of our mapped ldir genes in mammary glands of balb/c and spret/eij mice with the estrous signature revealed an approximate 20% overlap in balb/c (figure 2(b)) and 9% overlap in spret/eij mice (figure 3(b)). nonoverlapping and differentially expressed ldir genes for each of the time points were then computationally mapped to biological functions, pathways, upstream regulators, and networks. these analyses suggested that the ldir response signatures in mammary glands of balb/c mice transitions between time points and is distinct from the ldir response in spret/eij mice. two weeks after ldir exposure pathways and biological functions significantly enriched in mammary glands of balb/c mice compared to sham irradiated mice included chemokine signaling (p=0.01), ccr3 signaling in eosinophils (p=0.05), cellular movement (3.92e 04<p<3.41e 02), and cell death and survival (1.29e 03 gene interaction networks were enriched for tissue and endocrine system injury (figure 2(c) top panel) and significant predicted upstream regulators (table s3) include gli2 (p=5.29e 04) and satb1 (p=1.98e 03). similar to the two-week ldir response, gli2 was predicted to be an upstream regulator (p=4.52e 03; table s3). gata3 and stat6 were among other significant upstream regulators associated with the four-week low-dose response (table s3). we furthermore observed that the mammary gland of balb/c mice four weeks after ldir was enriched for inflammatory response genes (1.84e 05<p<1.45e 02), cell-cell signaling (2.79e 05<p<1.60e 02), while gene interaction networks were enriched for lipid metabolism (figure 2(c) middle panel). interestingly, similar responses were observed in mammary glands of spret mice at 4 weeks after ldir including inflammatory response functions (1.69e 03<p<4.49e 02), cell-cell signaling (5.54e 04<p<4.49e 02), suggesting that the functional response is similar across strains and is independent of the gene transcript response. at 8 weeks after ldir we observed downregulation of genes involved in mammary gland development including progesterone receptor, prolactin, amphiregulin, and wnt4 (figure 2(c) bottom panel; table s3). to identify lncrnas potentially regulating the expression of coding rnas in response to radiation, correlation coefficients on expression data were calculated for each coding rna and lncrna that were identified as differentially expressed after ldir. a permutation-based algorithm was then used to determine which correlations were statistically significant (p<0.05; table s4). we observed that nearly all ldir modulated lncrnas were correlated with at least one of the ldir modulated coding mrnas (figure 4(a)). to determine whether these correlations were driven by estrous variations, we only considered genes whose expression levels were not overlapping with our previously determined estrous signature (figure 2(b)). again, we observed that nearly all differentially expressed lncrnas were correlated with at least one differentially expressed mrna suggesting that estrous cycling does not affect the strong correlation between lncrna and mrna expression after ldir. to test the robustness of these correlations, we compared the number of lncrnas associated with at least one mrna at three different p values (p<5e 02, p<5e 03, and p<5e 04). at p<5e 02 or p<5e 03, nearly all (97100%) differentially expressed lncrnas were found to be correlated with at least one mrna (table s5). at p<5e 04, corresponding to a correlation coefficient>0.9, we still observed a significant fraction (6381%; table s5) of lncrnas correlated with mrnas. representative correlation networks of lncrnas are shown in figure 4(b) (p<5e 03) for each of the timepoints. we furthermore observed that the same lncrna correlates with different gene sets across different time points (figure s2). taken together these data show that ldir induces coordinated changes in lncrna and mrnas and suggests a critical role for lncrnas in mediating the low-dose radiation response. in this study, we demonstrate that genetic background strongly influences the expression of lncrnas and their response to low-dose radiation by transcriptomic analysis of mouse mammary glands using microarrays that contain both lncrnas and coding rnas. we have identified a number of lncrnas that are significantly changed after exposure to ldir at three different timepoints after radiation exposure. moreover, the changes in the expression of lncrnas are significantly correlated with the expression of coding rnas, suggesting that lncrnas may coordinate the tissue response to radiation via regulation of coding mrnas. however, the specific regulatory mechanism of this control requires further investigation, and knock-out and overexpression of the lncrna genes in mice and other model systems should be performed to increase our understanding of the regulatory mechanisms in response to ldir.

long noncoding rnas (lncrnas) are emerging as key regulators of diverse cell functions and processes. however, the relevance of lncrnas in the cell and tissue response to ionizing radiation has not yet been characterized. here we used microarray profiling to determine lncrna and mrna expression in mammary glands of balb/c and spret/eij mice after low-dose ionizing radiation (ldir) exposure. we found that unirradiated mammary tissues of these strains differed significantly in baseline expressions of 290 lncrnas. ldir exposure (10 cgy) induced a significant change in the expression of many lncrnas. the vast majority of lncrnas identified to be differentially expressed after ldir in either balb/c or spret/eij had a significantly correlated expression pattern with at least one ldir responsive mrna. functional analysis revealed that the response to ldir in balb/c mice is highly dynamic with enrichment for genes involved in tissue injury, inflammatory responses, and mammary gland development at 2, 4, and 8 weeks after ldir, respectively. our study demonstrates that genetic background strongly influences the expression of lncrnas and their response to radiation and that lncrnas may coordinate the tissue response to ldir exposure via regulation of coding mrnas.

PMC4353441

pubmed-255

olfactory neuroblastoma (onb) is a rare malignant tumor arising from the olfactory epithelium of the nasal cavity and the paranasal sinuses. the anatomic origin in the superior nasal cavity leads to nonspecific symptoms that make early diagnosis difficult. direct extension of the tumor into the anterior cranial fossa, either at presentation or at disease recurrence, is common. onb is mostly a locally aggressive tumor that can spread to lymph nodes but metastatic involvement of bone, bone marrow, and other organs was also reported. the most commonly used staging system proposed by kadish is currently based on computer tomography and magnetic resonance imaging. in stage a, the tumor is limited to the nasal cavity, in stage b the tumor extends to paranasal sinus, and in stage c the tumor is extending over the nasal cavity and sinus and/or metastasized distantly. a histological grading system based on microscopic findings proposed by hyams at 1988 showed a clear correlation of survival with histological differentiation of disease. however most authors believe that craniofacial resection followed by rt offers the gold standard treatment in this disease. despite aggressive therapies, local, regional relapse, and distant metastasis occur frequently and often after extended periods of follow-up. data for this case series were acquired retrospectively from the files of division of medical oncology, cerrahpasa medical faculty, istanbul university. additional information regarding the clinical course and outcome was collected from the patients ' charts and phone calls to the patients, their relatives, and their general practitioners. in this study, we have reviewed 19 cases of olfactory neuroblastomas treated over 24-year period and analyzed the clinical features, treatment outcomes, and prognostic factors. the data of nineteen patients of olfactory neuroblastomas treated and followed up between 1986 and 2010 at division of medical oncology, cerrahpasa medical faculty, istanbul university, were analyzed retrospectively. patient characteristics, initial symptoms, tumor extent, histologic features, primary therapy, tumor recurrence, and treatments of recurrent disease were determined. patients were staged according to the kadish staging system. a single pathologist with expertise in head and neck neoplasms reviewed the histological specimens. local ethics committee's approval and patients ' or their next of kin's informed consent were taken before the study. treatment response was assessed by clinical examinations and computed tomography (ct) or magnetic resonance imaging (mri). survival rates were calculated from diagnosis to the death of the patient using the kaplan-meier life table method. the madian age at diagnosis was 46 (range: 19 to 68 years). tumor staging was kadish stage a in 3, stage b in 5, and stage c in 11 patients. four patients had metastasis of cervical lymph nodes, two brains, one bone marrow, one bone and lung metastases, and one bone, mediastinal lymph node, and liver metastases at the time of diagnosis. tumor localization, clinical symptoms, and presentations at the time of diagnosis are listed in table 1. median time from onset of first symptoms until diagnosis was 8.8 months (range: 1.829 months). the common presenting symptoms were nasal obstruction (53%), epistaxis (31%), rhinorrhea, and facial pain (26%). patient treatments consisted of surgical resection, radiation therapy, and chemotherapy (ctx) (table 3). initial treatments included surgery alone in three patients, radiotherapy (rt) with or without ctx in five, surgery plus postoperative rt in seven and multimodality therapy (surgery plus postoperative ctx plus postoperative rt) in three, and finally ctx alone in one. in 14 patients, four of these patients had also radical neck dissection due to cervical lymph nodes involvement. nasal tumor resection in 2 patients, maxillectomy plus orbital exenteration in 1, and external ethmoidectomy (ee) in 1 were also used as surgical treatments. of these 14 patients who underwent surgical tumor resection, 4 were treated with surgery alone, 5 with adjuvant radiation therapy after surgery, 2 with adjuvant ctx after surgery, and the remaining 3 with radiation therapy and ctx after surgery. of the remaining 5 patients, four in advanced stage and one in early stage refused surgical treatment. radiation therapy was administered to two of the patients, radiation therapy followed by ctx to the other two, and ctx alone to one patient. the average radiation dose was 57.9 gy and the ctx was chosen from cisplatin-based regimens. as a part of the primary treatment modality, 12 patients underwent radiation therapy, so did the five relapsed patients. as a part of primary treatment modality 8 patients received ctx, so did the three relapsed patients. fifteen patients died of tumor progression during the follow-up, of whom 9 were at an advanced stage (stage c) by the time of diagnosis and 6 at an early stage (stage a/b). kadish stage c patients had a significantly poorer outcome compared to the stage a/b patients (2-year survival rate: 71 versus 25%, resp. histopathologically high-grade patients (grade 3/4) had a significantly poorer outcome when compared to the lower grade (grade 1/2) patients (2-year survival rate: 16 versus 50%, resp. primary tumor extensions to orbital area had a significantly poorer outcome compared to the tumors with no extension to orbital area (2-year survival rate: 22 versus 60%, resp. there was no statistically significant difference in survival rate between male and female patients (2-year survival rate: 40 versus 44%, resp. patients with age<45 years had no poorer outcome compared to patients with age>45 years (2-year survival rate: 41 versus 43%; p=.059). brain and bone marrow involvements showed poorer outcome compared to those without such involvement (median survival rate: 9.1 versus 28.8 months, resp.; survival rate was not significantly different among pateints of kadish c when stratified according to initial treatment (p=.8). locoregional recurrence developed in 6 and distant metastasis in 6 patients. during the follow-up period, these groups exhibited distant metastasis to the brain, spinal cord, bone, bone marrow, meninges, and lungs. as a treatment for recurrence and metastasis, reoperation of primary site plus radiation therapy in 4 patients and radiation therapy alone in 4 patients were offered. onb is a rare malignant tumor that comprises 4,65% of malignant nasal and paranasal tumors. some 1000 cases have been reported in the english literature since it was first introduced in 1924. the incidence rate is bimodal, with peaks in the second and third decades of life and in the sixth and seventh decades of life and equal among females and males. as for our study, the age at diagnosis was most common in the fourth decade and female-to-male ratio was equal. the average time between the appearance of the first symptom and the diagnosis was reported as 6 months and this period was similar also in our group. the most common symptoms at the initial diagnosis were defined as unilateral nasal obstruction and epistaxis in the literature. this tumor may be misdiagnosed as an undifferentiated small cell carcinoma, melanoma, rhabdomyosarcoma, or other small blue cell neoplasms. hyam proposed a grading system with grades 14 based on the presence or absence of seven different histopathological parameters. these are growth, architecture, mitotic activity, necrosis, nuclear pleomorphism, rosette formation, and fibrillary stroma.. staining paterns for neuron-spesific enolase, chromogranin, synaptophysin, s-100, and epithelial markers can be helpful. there is evidence that histological grade of onb influences biologic behavior, particularly because it relates to disease progression, local recurrence, and metastasis. for the well-differentiated tumors a slower disease progression and less tendency for local recurrence have been described. in our study, the 2-year survival rate of this grade i/ii-iii/iv disease was 16 versus 50%, respectively. more aggressive treatment, such as surgery, radiation, and intensive ctx, may be useful for patients with grade iii/iv disease. a meta-analysis showed that the median overall survival at 5 years is 45% in 390 patients. the distribution of onb from 21 studies according to kadish staging system was 12% at stage a, 27% at stage b, and 61% at stage c. the mean 5-year survival is 75% for stage a, 68% for stage b, and 41% for stage c. the conclusions of the university of virginia stated that kadish stage is predictive of disease-related mortality. however, in the series of the mayo clinic it was found that kadish stage did not affect the outcome. danish clinicopathological study found that the staging system of kadish was able to stratify into prognostically significant groups. in our study, the 5-year survival rate of these tumors was 26% and median survival time was 23 months. the distribution of onb according to kadish staging system was 16% at stage a, 26% stage b, and 58% stage c. however, in our study, the 5-year survival rates of these stage groups were inferior compared to those reported in other studies. the cause of this poor result was presentation of 5 patients with distant metastases (26%; 2 brain, 1 bone marrow, 2 other sites), 4 patients (21%) with cervical lymph node metastasis, 12 patients (63%) with high-grade histology at the time of diagnosis, and inability to evaluate the surgical margins of the resected tumors. the survival rate of node positive patients is 29% compared with 64% of node negative patients. distant metastases have been described in the pancreas, the liver, mediastinum, bone marrow, lungs, leptomeninges, skin, and breasts [11, 12]. cervical nodal metastases can develop in 17 to 33% of patients and distant metastases in 10 to 40% of patients over the course of disease metastatic disease at presentation occurs in 10 to 50% of patients, depending on the study [6, 13, 14]. we found the local recurrence rate to be 31.5% and distant metastasis 31.5% after initial surgery. during the follow-up periods these groups exhibited distant metastases to the brain, spinal cord, bone, bone marrow, meninges, and lungs. patients who had brain and bone marrow metastases had poorer prognosis than others having metastatic deposits of other sites. involvement of the orbit is a serious prognostic factor, but when the orbital periosteum is affected without penetration into the orbital structures themselves, the eye may be preserved by resection and grafting of the periosteum without an adverse effect on survival as compared with orbital clearance. irrespective to the most sophisticated imaging, involvement of the dura and orbital periosteum can accurately be determined only at surgery. in our study, this group's (8 patients) survival rate is poorer than those with no involvement of the orbita (p=.042). the institute of laryngology and otology, university college london, published a study of 42 patients treated over 23 years. overall and disease-free survival rates were 77 and 61% at 5 years, and 53 and 42% at 10 years, respectively. late recurrences were seen. based on this experience, combined therapy with craniofacial resection and radiation therapy is recommended by this group. in a retrospective study of 47 patients treated at multiple centers in germany from 1979 to 2001, the 5-year overall survival and event-free survival rate were 64% and 50%, respectively. patients who received multimodality therapy had a significantly better event-free survival rate compared with those who did not receive multimodality therapy (74 versus 41%). the authors recommend a combination therapy including ctx, surgery, and postoperative radiation therapy for kadish stage c patients. in our study, initial treatment included surgery alone in three patients, rt with or without ctx in five, surgery plus postoperative rt in seven, and multimodality therapy (surgery plus postoperative ctx plus postoperative rt) in three, only ctx in one patient. however, in our study choice of treatment modality did not show a statistically significant difference in survival rate. the reasons for that might be including low number of patients in the study, being 5 distant site metastasis, 4 cervical lymph node metastasis at the time of diagnosis, only one orbital exentration (although there were 8 orbital involvement), and 12 patients exhibiting high grade histology and inability to evaluate surgical margins in resected tumors. in conclusion, advanced tumor stage, the initial histopathologic grade of iii/iv, and involvement of orbita, brain, or bone marrow metastasis were the statistically significant poor prognostic factors, whereas age, sex, and treatment modality were not prognostic factors .

objective. the aim of this study was to evaluate clinicopathological findings and the efficacy of the treatment modalities used in patients with olfactory neuroblastomas. study design. retrospective record review. setting. istanbul university, cerrahpasa medical faculty, medical oncology outpatient clinic. subjects and methods. there were 3 stage a tumors, 5 stage b and 11 stage c according to the kadish staging system. there were 5 grade i/ii and 12 grade iii/iv according to the hyams ' histopathologic system. involvement to orbita was detected in eight patients at the time of diagnosis. results. the median follow-up period was 23.7 months. the 5-year survival rate for the whole group was 26%. the stage a/b groups exhibited a better survival rate than the c group with 2-year survival rates being 25 versus 71% respectively (p=.008). the grade i/ii groups exhibited a better survival rate than the grade iii/iv groups with 2-year survival rates being 50 versus 16% respectively (p=.001). the group who had orbital involvement exhibited a poor survival rate than the group of patients who had no involvement of the orbital. conclusion. in our study, tumor stage, histopathologic grading, involvement of the orbita, brain and bone marow metastases were the statistically significant prognostic factors .

PMC3197260

pubmed-256

network-driven spindle-like oscillations are a functional hallmark of the developing cerebral cortex. during late prenatal and early postnatal stages of development, spontaneous spindle-like oscillations have been identified as physiological activity patterns in various neocortical areas of different mammalian species [14]. in humans, so-called delta brushes can be observed in eeg recordings from preterm babies already at gestational week 28, that is ~12 weeks before normal birth of a full-term neonate (for review see). in ac-filtered eeg recordings, delta brushes are brief rhythmic delta waves (0.31.5 hz) of 50300 v amplitude with a superimposed burst of fast rhythm (> 8 hz, the brush). it has been suggested that delta brushes in human preterm infants correlate with so-called spindle bursts recorded in rodents during the early postnatal period. from a developmental point of view, these early spontaneous activity patterns in developing rodent and human cerebral cortex are probably of similar or even identical origin. rats and mice are altricial-born in a far less mature condition than humans. in rodents the degree of neocortical development at the day of birth (postnatal day [p] 0) can be compared to the stage of human cortex between gestational weeks 28 and 32 and the cerebral cortex of a p12p14 rat is comparable to that of the full-term newborn human baby [6, 8]. in preterm infants born between gestational weeks 28 and 32, milh et al. and colonnese et al. recorded eeg signals containing spontaneous and stimulus-evoked delta brushes with oscillatory activity in the frequency range of 8 to 25 hz, suggesting that spontaneous delta brushes may represent a physiological neocortical activity pattern of the human fetus in utero. in the cerebral cortex of rodents, spindle bursts (beside short gamma oscillations) constitute the majority of spontaneous activity during the first postnatal week (figure 1). these spindle bursts resemble in their appearance spindles recorded in the adult brain during sleep. these sleep spindles are one of the hallmarks of human stage 2 sleep for comprehensive overviews the reader is referred to recent reviews by lthi and by mccormick et al.. however, in humans sleep spindles appear 4 to 9 weeks after birth, which is much later than the disappearance of delta brushes around the end of the first postnatal week, thus excluding the hypothesis that delta brushes or spindle bursts gradually develop into sleep spindles. in addition, the frequency profile of spindle bursts and delta brushes displays a rather broad frequency distribution up to 25 hz, whereas sleep spindles present oscillations in a narrower band of ~1015 hz. the present review focuses on spindle burst activity in the cerebral cortex of the developing rat during the first postnatal week and summarizes our current understanding (i) on the functional properties of spindle bursts, (ii) the mechanisms underlying their generation, (iii) the synchronous patterns and cerebral networks associated with spindle bursts, and (iv) the physiological and pathophysiological role of spindle bursts during early cortical development. two distinct activity patterns can be observed in the neonatal rat cerebral cortex in vivo: gamma oscillations and spindles bursts (figures 1 and 2) [1419]. gamma oscillations have a duration of 100 to 300 ms, a frequency of 30 to 40 hz and appear spontaneously every 10 to 30 s (figures 1 and 2(b)). the properties and functional role of gamma oscillations as well as the mechanisms underlying their generation spindle bursts are characterized by their spindle-like oscillatory appearance, have a duration of 0.5 to 3 s and a frequency in the range of 8 to 30 hz, and occur spontaneously every ~10 s (figures 1 and 2(a)). as recognized in full-band direct-current (dc) coupled recordings, spindle bursts are nested in slow (delta) waves, which in infant rats, and preterm human babies [22, 23] have been termed spontaneous activity transients (sats). spindle bursts have been described in primary somatosensory cortex (s1) including barrel cortex [14, 1619], in primary visual cortex (v1) [10, 15], in primary motor cortex (m1), and in prefrontal cortex of anesthetized and awake rats during the first postnatal week. in s1, spontaneous and stimulus-evoked spindle bursts can be observed as early as p0 [17, 18]. in rats, the incidence of spindle bursts declines during the second postnatal week and sporadic spindle bursts are obscured by the ongoing neocortical activity. likewise in humans, delta brushes are replaced by more continuous eeg activity at birth of a full-term infant. this gradual developmental shift from a highly synchronized state of spontaneous activity to a desynchronized state seems to be a fundamental network property of the cerebral cortex during early neonatal stages. spindle bursts synchronize the activity of a local neuronal network of 200 to 400 m in diameter, which resembles the dimension of a whisker-related neocortical column in the immature barrel cortex (figure 3) [18, 25]. using a combination of voltage-sensitive dye imaging and high-density multielectrode recordings in p0-p1 rat barrel cortex in vivo, yang et al. could demonstrate that this early spontaneous activity constitutes the later emergence of the whisker-related barrel field map. these data indicate that spontaneous activity patterns at this early age form functional precolumns, supporting the concept of the existence of ontogenetic columns in the radial unit hypothesis. further support for this hypothesis comes from in vivo two-photon calcium imaging in the barrel cortex of both anesthetized and nonanesthetized newborn mice, demonstrating highly synchronous spontaneous burst activity, reminiscent of spindle bursts, in local networks of 100 to 200 m in diameter. these data strongly indicate that early spindle bursts, and probably also gamma oscillations (for review), synchronize early neocortical networks into functional columns at a developmental stage when the upper layers 2/3 have not even been formed (i.e., in rats at p0). at this developmental stage, thalamocortical afferents have not reached layer 4 and instead transiently innervate the subplate (for review [28, 29]). thalamic afferents form transient glutamatergic synapses with surprisingly mature properties including ampa and nmda receptors [3032]. in vitro studies in acute brain slice preparations and in intact whole cortical hemisphere preparations have demonstrated that oscillatory network activity in the frequency range of spindle bursts depend on an intact subplate [34, 35]. selective removal of the subplate in s1 in vivo causes a significant decline in the occurrence of spontaneous spindle bursts and disturbances in the development of the cortical architecture in the barrel cortex. these data further support the hypothesis that spindle bursts in developing cerebral cortex fulfill an important role in the maturation of the neocortical architecture. in the next section we will discuss the network and molecular mechanisms underlying the generation of spindle bursts in neonatal cerebral cortex. the rodent cerebral cortex develops rapidly during late prenatal and early postnatal stages and at least four different activity patterns may occur sequentially between birth and the end of the first postnatal week (for review). furthermore, the cortex shows a mediolateral and anterior-posterior gradient in development and within the same neocortical area neurons in upper layers 2/3 are ~2 days younger compared to lower cortical layers. many inconsistencies in the literature on the properties of spontaneous activity patterns in newborn rodents and their underlying mechanisms can be explained by the fact that these important developmental differences are often ignored. in addition, 2 days in early rodent cortical development make a large difference, so that the neocortex of a p0 rat (without layer 2/3) can not be compared to that of a p2 rat (with almost complete lamination). already in newborn (p0-p1) rat barrel cortex in vivo, mechanical stimulation of a single whisker elicits in field potential recordings and to some extent detectable also in voltage-sensitive dye imaging (vsdi) a sequence of an early gamma oscillation followed by a spindle burst (figure 3(b)). at this age, the thalamocortical activity reaches the developing cortical network largely via the subplate [17, 31, 32] and is amplified by an intrinsic gap-junction coupled network within the subplate and cortical plate [28, 34]. spontaneous and evoked delta brushes can be observed in premature human neonates of 2832 weeks postconceptional age, a developmental stage when the human cerebral cortex resembles that of a newborn rat. impressive examples of large delta brushes are provided in the supplementary eeg videos of milh et al., demonstrating that a single touch elicits a large oscillatory response in the somatosensory evoked potential (sep) recorded above the contralateral parietal cortex. in mature human cortex, seps with smaller amplitudes and shorter durations can be only obtained after averaging of at least 100 epochs. thus, in both species, rats and humans, at a comparable stage of cortical development mechanical stimulation of the sensory periphery elicits in s1 spindle bursts and delta brushes, respectively. simultaneous multielectrode recordings in the barrel cortex and in the ventral posteromedial nucleus (vpm) of the somatosensory thalamus of p0-p1 rats in vivo have demonstrated that the majority of spontaneous cortical spindle bursts and also gamma oscillations are not generated within s1, but rather in subcortical structures or outside of s1 (figures 4(a) and 4(b)). at this age a local, functionally defined lesion in the vpm blocks the whisker stimulation-induced cortical responses and also profoundly reduces the spontaneously occurring cortical burst activity, further demonstrating that the majority of the spontaneous spindle bursts in p0-p1 rat barrel cortex are generated in subcortical structures of the whisker-to-barrel cortex pathway (for further information see). silencing the sensory periphery by injection of lidocaine into the whisker pad causes a significant reduction in the occurrence of spontaneous spindle bursts and gamma oscillations by ~50% (figure 4(c)), indicating that during this developmental period at least half of the spontaneous burst activity in s1 is related to activity in the sensory periphery. a similar peripheral generation of spontaneous burst activity may occur in human preterms and fetuses between gestational weeks 28 and 32 [9, 22]. similar to the spindle bursts in s1, spontaneous spindle bursts in v1 are also largely generated in the sensory periphery. (for review), provide the primary drive for spindle bursts in newborn rat v1, as demonstrated by simultaneous recordings from the retina and v1. intraocular injection of forskolin, which augmented retinal waves, increased the occurrence of v1 spindle bursts, and removal of the retina reduced the spindle bursts frequency. as in the somatosensory system, spindle bursts in v1 can be also evoked by stimulation of the sensory periphery. however, since rod- and cone-mediated visual signaling is not functional in rats during the first postnatal week, spindle bursts can not be evoked by light flashes before p8. at that age, the neocortical response in v1 consists of an early visual evoked response followed by an evoked spindle burst. similar responses could be observed in v1 of preterm infants once photoreceptor mediated light responses occur in the retina (for review). whereas a large amount of experimental data has shown that retinal waves provide the main trigger for the cortical v1 spindles bursts, it is not completely understood which pacemaker drives the spontaneous activity in s1 and how spontaneous activity is generated in the somatosensory periphery. in p3p6 rats spontaneous whisker movements occur during active sleep and are correlated with activation of whisker-related cortical columns in the barrel cortex. in newborn rats the proprioceptive feedback from self-generated myoclonic movements trigger spindle bursts in s1 (for review). spontaneous limb movements of the human fetus during the third trimester of gestation, or those of the preterm infant associated with delta brushes in s1, are similar to these twitching movements of the neonatal rat and can be also triggered by sensory feedback. kreider and blumberg have demonstrated in 1-week-old rats that the mesopontine region plays a central role in the generation of myoclonic twitching. have shown in newborn rats that spatially confined spindle bursts in s1 are triggered in a somatotopic manner by sensory feedback signals from spontaneous muscle twitches. these spontaneous movements are generated by neuronal networks in the spinal cord, but spindle bursts persisted at a reduced frequency after sensory deafferentation (spinal cord transection) in s1, indicating that spindle burst activity can be also generated in neocortical or thalamocortical circuits during this early period of development. this assumption is also supported by the observation that silencing of the sensory periphery causes only a ~50% reduction in the occurrence of spontaneous spindle bursts (figure 4(c)). however, since it can not be excluded that the remaining portion of spindle bursts actually conveys activity from adjacent or distant sensory areas (transmitted via inter- and intrahemispheric connections, see next chapter), the outcome of this experiment may underestimate the contribution of the sensory periphery. simultaneous monitoring of forepaw movements, vsdi, and extracellular multielectrode recordings in s1 and m1 of p3p5 rats under light urethane anesthesia have demonstrated that tactile forepaw stimulation triggers spindle bursts in s1, followed by gamma and spindle bursts in m1 (figure 5). focal electrical stimulation of corticospinal tract neurons in layer 5 of m1 mimicking physiologically relevant 40 hz gamma or 10 hz spindle burst activity reliably elicited forepaw movements, indicating that m1 cortical spindle bursts are capable of triggering muscle twitches at this age. however, only 23.7% of the spontaneous bursts in m1 triggered forepaw movements and were followed by spindle bursts in s1 (figures 5(b)(a) and 5(c)), indicating that only a fraction of m1 activity transients triggers motor responses directly. in 40.7% of the cases, spontaneous movements preceded the burst activity in m1 and s1 (figures 5(b)(b) and 5(c)), suggesting that this activity may arise from subcortical regions in the brainstem or spinal cord. the remaining 35.6% of the m1 bursts were unrelated to any movements (figure 5(c)). the finding that 23.7% of the movements were triggered by m1 bursts as observed by an et al. is in contrast to previous observations, which demonstrated that dissection of neocortical inputs fails to suppress muscle twitches in rat pups. in summary, these data indicate that neocortical spindle bursts in newborn rodents (and delta brushes in human fetus during the third trimester or in preterms) are generated by central pattern generator (cpg) circuits in spinal cord, brainstem, and motor cortex (for cpg circuits in mature brain see [4244]). neuropharmacological studies provided insights into the molecular mechanisms underlying the generation and modulation of neocortical spindle bursts. in vivo and in vitro data suggest that gabaergic synapses are not crucial for the generation of spindle bursts or spindle burst-like activity, respectively, but are essential for their spatial confinement to a cortical (pre-) column. in contrast, spindle bursts depend on intact glutamatergic synapses including alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (ampa) and n-methyl-d-aspartate (nmda) receptors [34, 45]. carbachol-induced spindle-like oscillations in p0p3 mouse neocortex in vitro and spindle bursts in p0p2 rat in vivo are blocked or significantly reduced by different gap junction blockers, indicating that electrical synapses are critically involved in the generation of spindle bursts at this neonatal period. however, minlebaev et al. reported for p1p3 rats a significant increase in the occurrence of spontaneous spindle bursts in s1 following application of the gap-junction blocker mefloquine. single-cell recordings revealed additional insights into the mechanisms underlying the generation of spindle bursts. spindle bursts in v1 and s1 are accompanied by a barrage of glutamatergic and gabaergic postsynaptic currents (pscs) that are phase-locked to the spindle oscillations (figure 6). in prefrontal cortex, glutamatergic and gabaergic synaptic inputs to excitatory pyramidal neurons are phase locked to the theta-band component of the spindle, while pscs of inhibitory interneurons are phase locked to the higher beta and gamma frequencies, suggesting that excitatory and inhibitory neurons differentially modulate the distinct components of the spindle bursts. further, the application of cnqx eliminates the glutamatergic pscs and completely blocks the occurrence of spindle bursts, indicating a major causal role of ampa-receptor mediated glutamatergic inputs in the generation of spindle bursts. additional insights have been obtained by experiments in which subplate cells were selectively ablated in s1 shortly after birth. in these animals these in vivo results support previous in vitro studies, in which spindle bursts elicited by cholinergic stimulation were suppressed after removal of the subplate (see below) [34, 35]. taken together, these data suggest that thalamocortical inputs relayed and amplified by the subplate [28, 29]play an important role in the generation of spindle bursts (e.g., [17, 45]). spindle bursts in the cerebral cortex of newborn rats can be elicited [34, 35] and modulated by cholinergic mechanisms. in vitro, spindle burst-like oscillations can be reliably induced by activation of muscarinic acetylcholine receptors, predominantly of the m1 and m5 type. in vivo, spindle bursts in v1 are decreased by ~50% following the application of the muscarinic receptor antagonist atropine. furthermore, blockade of acetylcholine esterase with physostigmine or direct stimulation of the cholinergic basal forebrain nuclei augmented the occurrence v1 spindle bursts, indicating that the cholinergic system facilitates spindle burst activity in developing cerebral cortex. as discussed above, spatially confined spindle bursts in newborn rat cortex synchronize a local neuronal network resembling a neocortical (pre-) column (figure 3). beside these intra-areal synchronization, spindle bursts are also synchronized between different cortical regions within one hemisphere (intrahemispheric). as described above, a tight functional correlation in spontaneous and stimulus-evoked spindle burst activity exists between s1 and m1 cortex (figure 5). spindle bursts with similar properties as those in v1 and s1 have been also recorded in vivo in the prefrontal cortex of urethane-anesthetized rats older than p2. the same authors demonstrate that the hippocampus drives this early activity in the prefrontal cortex. beside this intrahemispheric synchronization between different cortical regions, spindle bursts also interact between both hemispheres (interhemispheric). in vivo simultaneous recordings of spontaneous activity in homotopic cortical areas in both hemispheres at the same stereotaxic coordinates and depth have demonstrated that the amount of interhemispheric synchronization in newborn rats is initially rather low and increases during the first postnatal week. this interhemispheric communication of spindle burst activity depends on an intact corpus callosum. in this regard, in unanesthetized newborn rats callosotomy doubled the occurrence of spontaneous spindle bursts, suggesting that the corpus callosum modulates functionally inhibitory interactions between homotopic regions in both hemispheres during the occurrence of spindle burst activity. experiments in p2p15 rats demonstrated that this callosotomy-induced disinhibition is a transient feature of early development that disappears abruptly after p6. it is not surprising that intra- and interhemispheric interactions of spontaneous activity in the spindle burst frequency range can be also observed in developing human cerebral cortex at early stages. using eeg and functional magnetic resonance imaging (fmri) omidvarnia et al. electric resting-state network that shows functional intra- and interhemispheric interactions in the 815 hz frequency range. in summary, several in vitro and in vivo studies have demonstrated that spindle bursts represent elementary states of intra- and interhemispheric synchronization in the very immature cerebral cortex. an increasing amount of experimental and clinical data strongly indicate that spindle bursts play an important role in the physiological development of the cerebral cortex. experimental evidence indicates that spindle bursts may be particularly suited to interfere with early neurodevelopmental processes, and thus disturbances in spindle burst activity may cause long-term structural and functional disorders. at early stages of development spontaneous and sensory-evoked activity patterns influence a variety of developmental processes, such as neurogenesis, apoptosis, neuronal migration, cellular differentiation, network formation, and myelination (for review, see). it is not completely understood how electrical activity controls these different developmental processes and whether distinct activity patterns, such as spindle bursts, play a specific role. however, for the control of apoptotic cell death of immature neurons in vitro and in vivo the essential role of spontaneous network bursts to provide antiapoptotic signals has been demonstrated [52, 56, 57]. for this activity-dependent control of neuronal survival the phosphatidylinositol 3-kinase pathway plays an important role, while the mapk/extracellular signal-regulated kinase or the calcium/calmodulin-dependent protein kinase pathway is not directly involved. since one spontaneous spindle burst is associated at the single neuron level with 510 action potentials and the frequency of spontaneous spindle bursts is ~5 per minute [16, 17], a single neuron discharges with 2550 action potentials per minute. under in vitro conditions this discharge frequency supports neuronal survival of developing neocortical neurons, suggesting that spontaneous spindle bursts in vivo provide an important physiological signal for the control of neuronal survival versus apoptosis in the neonatal cerebral cortex. notably, spindle burst and gamma activity provides an ideal physiological stimulus for the activity-dependent release of bdnf, an important antiapoptotic signal. balkowiec and katz demonstrated for neuronal cultures that 3060 min of electrical burst stimulation (50 pulses at 2050 hz at intervals of 20 s) increased extracellular bdnf levels by 20-fold, whereas stimulation patterns at lower frequency (albeit producing the same number of extracellular electric shocks) were ineffective (for review, see). these data indicate that spontaneous spindle bursts represent a physiological trigger for the release of bdnf, which plays an important role in several aspects of development (for review, see). using in vitro and in vivo models it has been recently shown that an experimentally induced inflammation by application of the endotoxin lipopolysaccharide induces rapid (< 2 h) alterations in the pattern of spontaneous spindle bursts and gamma oscillations in neonatal rodent cerebral cortex, which subsequently leads to increased apoptotic cell death. these inflammatory effects are specifically initiated by the microglia-derived proinflammatory cytokine tumor necrosis factor alpha and to a lesser extent by the chemokine macrophage inflammatory protein 2. thus, inflammation causes a fast dysfunction in the pattern of spontaneous burst activity, which subsequently leads to increased apoptotic cell death, most likely by disturbances in the release of survival factors such as brain-derived neurotrophic factor (bdnf) acting on neurotrophin tropomyosin-related kinase b/c receptor. furthermore, removal of the subplate massively reduced spindle burst activity and led to a persistent loss of the typical barrel-like whisker representation within layer 4, indicating that spindle bursts play a role in the development of the neocortical architecture. in summary, these experimental data suggest that any disturbances in the spontaneous activity of the developing cerebral cortex (including spontaneous spindle bursts) induce acute dysfunctions, which may cause long-term disorders. however, it remains to be elucidated whether spindle burst in particular can be causally related to neurodevelopmental disturbances. it has been recently shown in extremely preterm infants that the properties of neocortical bursts recorded with eeg and their scaling relationships correlate significantly with later cognitive development. these clinical data suggest that analyses of burst shapes obtained in eeg recordings from preterm and full-term newborn babies may have diagnostic use in neonatal intensive care units and predict the clinical outcome. while it is generally accepted that early electrical activity shapes the maturation of neocortical circuits, it remains an open question whether the specific properties of spindle burst are required or fulfill a distinct role in development. in this regard, it is possible that the spatiotemporal patterns of spindle bursts translate into a local molecular signal which fulfills an important developmental role. in particular as gaba does not seem to be necessary for the generation or maintenance of spindle bursts, and since gaba is essential for neuronal differentiation [64, 65], it is tempting to speculate that spindle bursts control the spatially confined release of gaba in developing local networks. another unresolved issue is that both spindle bursts and gamma oscillations can be observed during the same period of early development. they can be observed in early postnatal rodent brain from the day of birth (; also see) and occur spontaneously as well as after sensory stimulation. moreover, both can be observed mainly during the critical periods of the primary sensory areas, although spindle bursts probably persist for slightly longer periods. in addition, spindle bursts and early gamma oscillations in newborn cortex are proposed to rely on thalamocortical inputs, in contrast to gamma oscillations in adult cortex which depend on perisomatic gabaergic inhibition. beside their differences in duration, occurrence, and frequency (see above), spindle bursts and gamma oscillations in newborn cortex reveal a number of additional distinctions. in the immature barrel cortex the vast majority (> 90%) of spontaneously occurring spindle burst spans several barrel-related columns, whereas the majority (~70%) of spontaneous gamma oscillations are restricted to a single or two barrel related columns. in line with these observations, gamma oscillations evoked by tactile stimulation are also closely related to a single functional column, while evoked spindle bursts span over more than one column. thus, one reason for the coexistence of spindle bursts and gamma oscillations during early postnatal development might be a distinct role in neocortical maturation. gamma bursts may reflect local information processing mostly within a single functional column, thus supporting the maturation of a column related network. in contrast, spindle bursts probably reflect larger local network events and may thus serve to promote the connectivity between neighboring columns. although spindle bursts as well as gamma oscillations are spatially confined to a small network in one neocortical area, it is unclear to what extent and how this activity connects to other cortical and subcortical regions (e.g., see [18, 19]). further, it remains to be studied whether the immature brain shows a spindle burst related resting state and how this network state is altered by sensory activation or by pathophysiological events. finally, it would be most interesting and important to correlate specific patterns of spontaneous activity (e.g., delta brush) recorded by means of full-band direct-current eeg in preterm und full-term human neonates with the acute functional state and with the further development of the child, as impressively done by vanhatalo and colleagues [62, 67]. spatially confined spindle bursts and delta brushes represent the most prominent physiological activity patterns in the developing cerebral cortex of newborn rodents and preterm human infants, respectively. spontaneous and stimulus-evoked spindle bursts can be observed in various neocortical areas of different mammalian species and play important roles in the early development of cortical networks. however, it remains to be studied in more detail how exactly spindle bursts influence the maturation of the cortex and how a potential long-term dysfunction due to disturbances in spindle burst activity can be prevented by early intervention. since this important type of brain activity is already present in the human fetus in utero (either spontaneously occurring or related to sensory inputs from the uterine environment), a better understanding of the physiological relevance of spindle burst oscillations is of major clinical relevance.

spontaneous and sensory evoked spindle bursts represent a functional hallmark of the developing cerebral cortex in vitro and in vivo. they have been observed in various neocortical areas of numerous species, including newborn rodents and preterm human infants. spindle bursts are generated in complex neocortical-subcortical circuits involving in many cases the participation of motor brain regions. together with early gamma oscillations, spindle bursts synchronize the activity of a local neuronal network organized in a cortical column. disturbances in spindle burst activity during corticogenesis may contribute to disorders in cortical architecture and in the activity-dependent control of programmed cell death. in this review we discuss (i) the functional properties of spindle bursts, (ii) the mechanisms underlying their generation, (iii) the synchronous patterns and cortical networks associated with spindle bursts, and (iv) the physiological and pathophysiological role of spindle bursts during early cortical development.

PMC4806652

pubmed-257

atrazine, 6-chloro-n2-ethyl-n4-isopropyl-1, 3, 5 atrazine, 4-diamine, is a selective herbicide that has been extensively used in corn production to control many broad-leaf and some grassy weeds. atrazine has long-term reproductive and endocrine-disrupting effects and a probable human carcinogen. international agency for research on cancer (iarc) has concluded atrazine as a group 2b carcinogen. the maximum contaminant level (mcl) for atrazine in drinking water established by the usepa is 3.0 gl. atrazine is moderately persistent in the environment and despite its low solubility, water resources contamination, it has become an international issue. the major dissipation route for atrazine is biodegradation, runoff, and leaching [4, 5]. the rate of biodegradation of atrazine is reduced due to the adsorption, and desorption, and its bioavailability is the rate-limiting step in biodegradation. bioaugmentation is the addition of acclimated indigenous bacteria that can degrade the contaminant at accelerated rates. the bacteria are isolated from the heavily polluted soil in the laboratory through the enrichment process. the enrichment culture technique developed a mixed consortium of bacteria that are able to degrade the herbicide. a research was done by dehghani and colleague confirmed that atrazine biodegradation was enhanced in kavar corn field soil compared to the other soils that had not been exposed to the herbicide. therefore, several applications of atrazine on soil resulted in an enhancement of atrazine degradation. the addition of nutrient causes an increase of microbial populations, thereby, increasing the number of indigenous microorganisms capable of degrading the pollutant. n-containing compounds such as atrazine have been shown to serve as sources of nitrogen. in theory, addition of high c/n should induce nitrogen limitation and increase selective pressure for utilization of recalcitrant n sources like s-triazines, which contain n that can be used by certain bacteria and microbial consortia. cometabolic biotransformation can be enhanced by an increase in microbial activity which is stimulated by addition of organic matter. in the past few decades, intensive use of agricultural fertilization and herbicides has contributed to increasing concentration of n and herbicides. mixed microbial consortia [8, 11] and strains have been isolated from soils and with a capability to complete the mineralization of the ring. the agrobacterium strain j14, rhodococcus erythropolis, pseudaminobacter, and nocardioides can use atrazine as sole carbon and nitrogen source [1214]. laboratory experiments indicated that addition of carbon to soil inhibited atrazine biodegradation, but inorganic phosphate stimulates atrazine biodegradation. atrazine degradation rate was increased by addition of carbon sources to pure and mixed bacterial culture. ostrofsky and his coworkers (2001) found that cyanuric acid amendment increased atrazine mineralization by stimulation of general microbial population and activity. in liquid culture and in the presence of simple carbon sources, (1996) showed that the effect of n addition varies with the form and amount of added n. however, another study showed that the utilization of atrazine by pseudomonas adp in the presence of exogenous nitrogen (nh4, no3, urea and glycine) was not affected in a great amount by the presence of exogenous nitrogen. degradation of atrazine (about 87%) by p. adp and a. radiobacter was unaffected by the presence of n source, whereas no degradation occurred with bacterium m91-3 in media containing urea or nh4-n. another study reported that mineralization of atrazine by indigenous soil bacteria was inhibited by the addition of inorganic nitrogen. a study showed that addition of other organic amendments containing nitrogen suppressed atrazine. however, there are some limitations to the use of acclimated microbial cultures to degrade organic compound in a real field. physiochemical conditions of soils, and competition with native microorganisms, may destroy or reduce the inoculums and limit its degradative capacity. brandon and his coworkers (1997) showed that atrazine biodegradation was higher in liquid cultures than soil. he found that bacterial consortium in soil culture degraded 78% and 21% of atrazine at initial concentrations of 0.046 and 0.23 moles in 100 days. however, in liquid cultures, 90% and 56% of atrazine degraded in 80 days, respectively. in liquid culture, since fars is an agricultural province and enjoys the top rank in wheat and corn production in the country in recent years, atrazine has been widely used as a selective herbicide to control broad-leaf and grassy weeds in agricultural corn fields. the high incidence of atrazine to contaminate water resources and the increasing concern about the toxicological properties of atrazine has made researches directed toward bioremediation of atrazine in polluted sites. therefore, the main objectives of this research are evaluating the effects of carbon and nitrogen sources on atrazine biodegradation using mixed bacterial consortium isolated from corn field soil located in south of shiraz (kavar) and determining the efficiency of atrazine biodegradation process in soil culture. kavar corn field soil with a long history of atrazine application in fars province of iran has been explored for their potential of atrazine biodegradation. soil samples for liquid cultures were taken from south of shiraz (kavar) corn field with a long history of atrazine application (more than 10 years) in fars province. soil samples for soil cultures were also taken from a field in bajgah which has been under alfalfa cultivation for 3 years and has not received atrazine in the past 10 years. disturbed soil samples were collected from 0 to 20 cm of soil depth with a hand-driven soil auger and stored at 4c until they were used. the soil samples were air-dried and passed through 2 mm sieve to be prepared for further microbiological examinations. other soil characteristics such as soil solution ph and organic matter content were determined. the soil texture in kavar corn field was loam and the amount of sand, silt, and clay distribution were in order of 47.44%, 31.5% and 17.06%. the native soil characteristics at kavar site was fine loamy, mixed, thermic typic haploxerepts. at bajgah field, the soil texture was clay-loam and the amount of sand, silt and clay distribution were in order of 28.7%, 33.3% and 32.0%. the native soil characteristics at bajgah site was fine loamy, mixed, and thermic, typic calcixerepts. the soil samples were transported to the laboratory in zipped plastic bags and were kept frozen at 20c until they were ready for chemical analysis. the soil samples were thawed and air-dried at dark in room temperature and screened through a 2.0 mm sieve for maintaining homogeneity of soil in order to reduce the variability of adsorption data. 30 ml of dichloromethane was added to 10 g of the soil sample and shaken in a reciprocal shaker for 20 minutes. after filtration, the organic phase was transferred to a separating funnel and then atrazine was back extracted with 20 ml hcl (0.01 n). afterwards, the liquid phase was collected and transferred to a 15 ml glass vial and stored in a refrigerator prior to electrochemistry analysis. square wave voltammetry with the hanging mercury drop electrode (auto lab type analyzer equipped with metrohm va stand 663 and gpes 4.9 software) was used in this study to determine atrazine residual concentration in soil samples. atrazine recovery percent from soil with this method of extraction was 98%. in order to isolate mixed bacterial consortiums capable of growth on atrazine as a carbon source, the selective enrichment culture and basal salt medium were prepared as described in rousseaus ,. ten grams of wet soil was inoculated into 90 ml of atrazine medium and supplemented with sodium citrate and delvocid (25 mg l) after autoclaving. delvocid was used to prevent the growth of fungi and ph was also adjusted to 7.5. cultures were incubated aerobically on a reciprocal shaker (150 rpm) at room temperature in dark to preclude photolysis reactions. all enrichment cultures were subcultured on the same medium at one-week interval. from a one-week-old culture, 10 ml after culture was subculture for 30 and 300 days under conditions of nitrogen limitation, the remained atrazine after inoculation of the media for 10 days was quantified by electrochemistry. the bacterial consortium was harvested by centrifugation (6000 g at 40c for 20 minutes) washed twice with 0.1 ml phosphate buffer (ph=7.3). different carbon compounds such as glucose (g), sodium citrate (sc), sucrose (su), starch (st) with three replications each at a concentration of 2 g l, and also the combination of these mentioned carbon sources such as g+sc, st+su, su+sc, st+sc, su+g, and st+g each at a total concentration of 2 after inoculation of the media supported with carbon sources, they were incubated at room temperature and placed in dark for 10 days. control and blank without bacteria inoculation and no carbon sources (ncs) were also used for this study. after 10 days, the remained atrazine was measured. to measure the influence of nitrogen sources on the efficiency of atrazine biodegradation by the bacterial consortium in liquid culture, nitrogen sources as routine fertilizers were added to atrazine mineral salt broth containing sucrose and sodium citrate. ammonium nitrate and urea as fertilizers were applied to corn field at a concentration of 600825 and 200400 kg ha, the nitrogen percent for these fertilizers were 34% and 46%, respectively. urea was added to atrazine minimal salt media at a concentration of 138690 mg after inoculation of the media supported with nitrogen sources, they were incubated at room temperature in dark for 10 days. a laboratory experiment was arranged to measure the influence of ph on the efficiency of atrazine biodegradation by the bacterial consortium in liquid culture. a different ph from 5.5 to 8.5 with three replications was used in atrazine mineral salt broth containing sucrose and sodium citrate and no nitrogen sources. atrazine degradation rate by the bacterial consortium was measured in 100 ml capped erlenmeyer flask containing soil samples. ten grams of soil sample was brought to the desired soil moisture (7% and 25%) by the addition of sterile deionized water. the experimental design consisted of 36 flasks with 12 treatment and three replications for each treatment. the initial atrazine concentrations of 1.3 and 6.7 mg g soil are corresponded to 0.5 and 2.5 kg ha, respectively. however, atrazine concentration of 20 mg g soil is related to 7.5 kg ha(4.43 kg a. i. ha) which is considered a relatively high atrazine concentration and might have occurred due to an accidental spillage. after one day of incubation to allow herbicide sorption to the soil, inoculation with 300 l phosphate buffer containing the selected bacterial consortium was added to soil to yield 7.5 10 bacterial cell g soils as determined by plating on soil extract agar. the soil samples were mixed until they were homogeneously wet and then incubated at room temperature in dark until the end of the experiment. soil moisture was maintained constant through the incubation by weighing and correcting for any weight loss by adding sterile deionized water. to maintaining high population of atrazine degraders, the inoculation with the consortium was made every 5 days over a 30-day period for a total of 6 inoculations. soil samples at the initial atrazine concentration of 6.7 mg g soil were extracted at the incubation time of 2, 10, 20, and 30-day and analyzed to determine the remained atrazine concentration at each time interval. by using a mixed bacterial consortium with a high capability of atrazine degradation isolated from kavar corn field soil, the effect of different carbon sources on atrazine biodegradation was studied (figure 1). according to this figure, the percentage of atrazine biodegradation rate for different carbon sources was in the range of 9.47% to 87.72%. a blank sample did not adequately support the growth of consortium bacteria (due to low turbidity), and the rate of atrazine degradation is lass than 3%. linear regression showed that there was a significant difference between different carbon sources and atrazine biodegradation rate (p<0.001). the effect of different nitrogen sources on atrazine biodegradation was shown in tables 1 and 2. according to table 1, the percent of atrazine biodegradation rate decreased from 87.72% to 29.58% as the ammonium nitrate concentration increased from 0.0 to 900 kg ha soil. the rate of atrazine biodegradation for ammonium nitrate decreased quickly when the concentration of ammonium nitrate increased from zero to 600 kg ha soil, after that the reduction rate of atrazine degradation was getting slower. the same trend has been observed for atrazine biodegradation in the presence of urea. according to table 2, the percentage of atrazine biodegradation rate decreased from 87.72% to 26.76% as the urea concentration increased from 0.0 to 500 kg ha soil. for urea, atrazine biodegradation rate under nitrogen amendment showed an initial sharp decreasing slope and then reaching constant with relative slower rate. variations of ph on atrazine degradation rate were examined when sucrose and sodium citrate were used as a carbon source, while there was no nitrogen source available (figure 2). according to regression analysis, it can be concluded that there was a significant difference between ph and atrazine biodegradation (p<0.05). table 3 showed the effect of initial atrazine concentration and soil moisture on the biodegradation of the inoculated soil. according to data on this table, after 30 days of incubations atrazine degradation rate for noninoculated soil samples was low and atrazine reductions were only 7% to 19%. however, for inoculated soil samples, degradation rate was higher and its reductions were 19.572%. the inoculated soil samples at 25% soil moisture at initial concentration of 1.3, 6.7, and 20 mg g soil, atrazine reductions were 69.5%, 60.5% and 30.5% within 30 days of incubation, respectively. figure 3 showed that atrazine biodegradation rate during the different time intervals in soil culture. figure 4 depicted the plot of the semilogarithm of initialized atrazine concentration (c/c0) versus time. during the 30 days of incubation period, atrazine concentration decreased from an initial concentration of 6.7 mg gsoil to a final concentration of 2.67 mg gsoil. only a 5% decrease in atrazine concentration however, figure 3 showed that at 20 days 40% of the atrazine had degraded. after that a very slow increase in atrazine degradation was observed and remained constant until the end of the incubation period. assuming a pseudo-first-order reaction for the disappearance of atrazine, a plot of the natural logarithm of initialized atrazine concentration (c/c0) versus time resulted in a rate constant equal to 0.0328 d (figure 4). the t1/2 for atrazine calculated from the plot was 21.13 d. the initial slow degradation rate of atrazine was followed by a much faster degradation rate that lasted about 5 day and then the degradation rate became slower and finally remained constant until the end of incubation period. carbon sources of sodium citrate and sucrose had the highest atrazine biodegradation rate. according to data, mandelbaum and his coworkers (1993a) used sodium citrate and sucrose as the carbon source. according to data in this research, the percentage of atrazine biodegradation rate with no carbon sources was only 5.5%. past studies showed that carbon in atrazine ring can not be used by many bacteria as energy sources; however, carbon in alkylated group provided carbon for bacterial growth. the low amount of atrazine can not support bacterial growth, and therefore, a supplemental carbon was needed. according to data on tables 1 and 2, atrazine utilization is repressed under nitrogen-sufficient growth condition and activated under nitrogen limitation. many investigations also showed a negative effect of nitrogen amendment on atrazine biodegradation by indigenous populations in soils [34, 35]. however, other study reported that organic nitrogen supplied in dairy manure increased atrazine mineralization. data regarding the effect of ph shows that as ph increased from 5.0 to 7.0, the rate of atrazine biodegradation increased. however, as ph increased from 7.0 to 8.5 this caused a reduction rate in atrazine biodegradation. atrazine biodegradation rates were significantly enhanced in the inoculated soils as compared to uninoculated control soils. after 30 days, the percent of atrazine reduction was only 12% for uninoculated soils at initial atrazine concentration of 6.7 mg g soil and the soil moisture of 25%. however, soil that was inoculated every 5 days with the bacterial consortium had reduced atrazine up to 60.5% at the same initial atrazine concentration and the soil moisture by day 30 (table 3). as initial atrazine concentration increased from 1.30 to 20 mg g soil, the percentage of atrazine reduction decreased from 69.5% to 30.5% (inoculated soils and soil moisture 25%). the decrease in atrazine reduction at 20 g g soil was possibly due to the result of complex interaction between microbial activity and nutrient availability. therefore, unbalanced nutrient supply and not atrazine toxicity was probably responsible for the decrease. figure 3 showed that atrazine degradation rate increased as time passed. according to (table 3), enhanced atrazine biodegradation rates occurred with an increase in soil moisture from 7% to 25%. the percent of atrazine reduction increased from 32.5% to 69.5% as the soil moisture increased from 7% to 25% (at initial atrazine concentration of 1.30 mg g soil). many researchers found that higher atrazine biodegradation rate occurred with an increase in soil moisture. soil moisture influences microbial processes through direct effect (e.g., water availability) or indirect effects, for example, solute diffusion, chemical availability, and aeration. therefore, the positive effect of increasing soil moisture was probably due to increased microbial mobility, solute diffusion, and chemical availability which all had an indirect effect on atrazine degradation. in this study, more than 60% of atrazine was degraded in 30 days of incubation periods (figure 3). atrazine degradation exhibited a half-life of approximately 21.13 d. in conclusion, our results confirmed that atrazine biodegradation was higher in liquid cultures than soil. the mixed bacterial consortium in soil culture degraded 69.5% of atrazine at initial concentrations of 1.3 mg g soil in 30 days. however, in liquid cultures, 87.72% of all atrazine degraded in 10 days. results of this study suggested that atrazine bioremediation in soil utilizing atrazine-degrading bacterial consortium could be accomplished across a wide range of atrazine concentration if the soil moistures swere enough and also nutrient availability was balanced, too. the bacterial consortium with the ability to degrade atrazine provided a good opportunity for increasing the degradation rate of this herbicide through bioaugmentation. it is very important to note that these bacteria in the controlled laboratory conditions (with the addition of carbon and nitrogen sources and without the interaction of environmental factors) had been able to use atrazine. however, there are some limitations to the use of acclimated microbial cultures to degrade the herbicide in a real field. therefore, it is highly recommended that the feasibility of atrazine degradation to be studied by the bioaugmentation of mixed bacterial isolates to the real contaminated soil. the mixed bacterial consortium successful in laboratory studies may fail in the real field because of their sensitivity to high concentrations of other compounds.

atrazine herbicide that is widely used in corn production is frequently detected in water resources. the main objectives of this research were focused on assessing the effects of carbon and nitrogen sources on atrazine biodegradation by mixed bacterial consortium and by evaluating the feasibility of using mixed bacterial consortium in soil culture. shiraz corn field soil with a long history of atrazine application has been explored for their potential of atrazine biodegradation. the influence of different carbon compounds and the effect of nitrogen sources and a different ph (5.58.5) on atrazine removal efficiency by mixed bacterial consortium in liquid culture were investigated. sodium citrate and sucrose had the highest atrazine biodegradation rate (87.22%) among different carbon sources. atrazine biodegradation rate decreased more quickly by the addition of urea (26.76%) compared to ammonium nitrate. based on the data obtained in this study, ph of 7.0 is optimum for atrazine biodegradation. after 30 days of incubation, the percent of atrazine reduction rates were significantly enhanced in the inoculated soils (60.5%) as compared to uninoculated control soils (12%) at the soil moisture content of 25%. in conclusion, bioaugmentation of soil with mixed bacterial consortium may enhance the rate of atrazine degradation in a highly polluted soil.

PMC3603203

pubmed-258

microleakage between the root canal filling and root-canal walls may adversely affects the results of root-canal treatment.1 apical leakage is considered to be common cause of endodontic failure.2 hence, different endodontic filling materials, sealers and techniques have been introduced to the dental community in an attempt to improve apical seal.1 various materials have been used in root canal treatment in an attempt to achieve success. but, a combination of gutta-percha and a sealer are used most commonly. gutta-percha is considered an impermeable core material; therefore, leakage through an obturated root canal is expected to take place at the interfaces between the sealer and dentin or the sealer and gutta-percha, or through voids within the sealer.3 apical sealing is desirable to prevent passage of bacteria and their endodotoxin apically. in vitro evaluation of apical dye penetration is used to estimate the sealing ability which is corresponding to in vivo amount of micro leakage with particular sealer.2 many techniques were used to evaluate the leakage of sealers such as; colored dye penetration radio labeled tracer penetration dissolution of hard tissue clearing of teeth, spectrometry of radioisotopes electrochemical and gas chromatography. however, many studies showed no significant difference between these techniques.1 the aim of this in vitro study was to quantitatively evaluate the sealing properties of three different root-canal sealers; tubliseal, sealapex and ah26 using a spectrophotometric method. thirty-six extracted sound mandibular molar natural teeth specimens with complete root and free from caries or cracks were collected, stored, disinfected and handled as per the recommendations and guidelines laid down by occupational safety and health administration and centers for disease control and prevention.4 the teeth were then placed in 0.9% physiologic saline solution for ten days prior to access cavity preparation. the samples were divided into three experimental groups; group i: sealapex, group ii: tubliseal and group iii: ah26 with 12 samples in each group. the samples were then coated with nail varnish all over the root surface except 2 mm around the apical foramen. 2 ml of freshly prepared 2% methylene blue dye was taken in each vial and the apical third of the root was suspended in the dye for 72 h. samples were washed with distilled water, nail varnish removed and then placed in 20 ml of 35% nitric acid for 72 h. standard solutions of 1%, 0.5%, 0.2%, 0.05%, 0.02% and 0.01% of methylene blue in 35% nitric acid were prepared and stored for 72 h. the standard solutions and the nitric acid solutions were filtered and centrifuged for 1 min after 72 h. the supernatant was subjected to spectrophotometric analysis using a filter of 670 nm. the amount of leakage was extrapolated from a standard linear regression curve constructed from stock standard methylene blue dye solutions. obtained data were statistical analyzed with kruskal wallis and mann whitney u-tests using spss software version 20 (ibm). the results of the quantitative evaluation of the sealing properties of the three root-canal sealers are shown in table 1., tubliseal showed a significant difference (p>0.005). in comparison to sealapex comparisons made between tubliseal and ah26 showed no significant difference (table 2, chart 1). mean and standard deviation values of volumetric dye penetration in groups with reference to transmission. three-dimensional obturation of the root canal system with a fluid impervious seal is an important factor for successful endodontic therapy. the root canal filling should seal the canal both apically and coronally to prevent the passage of microorganism to apex or vice versa.5 most reliable method is the use of gutta-percha cones with sealer cement. sealers based on zinc oxide-eugenol (tubliseal), calcium hydroxide (sealapex), epoxy resins (ah26) were included in the present study. in present quantitative dye leakage study, tubliseal demonstrated least dye leakage in comparison with other experimental groups (table 1). our results were in contrary to study by masoud and saleh where they found more microleakage in tubliseal group than other groups.6 sealapex is a calcium hydroxide type sealer. calcium hydroxide used as root canal sealer since it stimulates periapical tissues in order to maintain health or promote healing and secondly for its antimicrobial effects.7 it has been observed in some studies that, calcium hydroxide sealers showed a significant volumetric expansion during setting because of water absorption, which increases its solubility. the present in vitro investigation indicated maximum leakage value with sealapex among the experimental groups. in a contradictory to our results, cobankara et al. (2006) observed sealapex with better apical sealing than the other sealers (ah plus and rc sealer) at 7, 14, and 21 days.3 ah26 is an epoxy resin based sealer that provides easy handling characteristics, good flow, good sealing to dentin and prominent antimicrobial activity.6 kumar et al. observed more micro leakage with zinc oxide-based sealer and least with resin based sealers, this is contradictory to our study.8 in our study, there was no statistical significant difference between tubliseal and ah26 in micro leakage. observed least amount of dye penetration for ah plus and endorez group.9 even though, the current study did not indicate any statistically significant difference between ah26 and sealapex, it is time to question the overall efficacy of calcium hydroxide sealers on the grounds that the reparative and the calcification capabilities attributed to calcium hydroxide are generally desirable before completing the obturation. ah26, resin based sealer provided a better apical seal when compared with sealapex even though the results were statistically not significant. it mixes easily, flows well, and has ample working time, good radio-opacity, comparable solubility, good adhesion and good biocompatibility.3 in the present study, there was no significant difference between group ii and iii and group i and iii. did nt find any significant difference between the tested three groups; sealer 26, enfoflas and resin group. but they observed higher microleakage in sealer 26 group compared with control.11 joseph and sing evaluated the apical sealing with four root canal sealers; ah26, sealapex, endoflas fs and ah plus and observed no significant differences between all groups except between ah plus and endoflas.5 nagas et al. observed significantly lower overall leakage with ah plus group, whereas no difference was found between master cone points.12 kopper et al. observed significant dye penetration for ah plus, endofill and sealer 26.13 cobankara et al. observed better sealing values for roekoseal after 21 days when compared to ketac-endo and ah plus, and there was no statistically significant difference.1 dultra et al. found no statistical difference between groups for apical leakage (endofill, ah plus, endorez and epiphany).14 in addition, before accepting a new material for routine clinical use further experiments should also be performed to evaluate the other aspects of the materials physical and biological properties such as biocompatibility, solubility, disintegration, radio-opacity and dimensional stability. however, these in vitro studies do provide comparative information of the relative performance of sealers tested under the same conditions in each particular study and clinicians can use this information to possibly choose a better sealer. in the present study, tubliseal sealer showed least microleage compared with sealapex and ah26 sealer. it is important to remember before declaring any root canal sealer as most acceptable that the results of the dye penetration studies indicate only the relative sealing ability of root canal fillings in vitro and they do not indicate their ability to prevent the penetration of bacteria into filled root canals in vivo.

background: the aim of this study was to quantitatively analyze the amount of dye leakage with ah26, sealapex and tubliseal sealers in endodonticaly treated teeth. materials and methods: a total of 36 extracted mandibular molar specimens were divided into three groups; group i: sealapex, group ii: tubliseal, group ii: ah26 with 12 samples in each group. standard access cavity and biomechanical preparation was done with step back flare technique. obturations were done using respective sealers in the three different groups. then, samples were subjected to spectro photometric analysis using a filter of 670 nm. spectrophotometric analysis was performed to quantitatively analyze the amount of dye leakage with all three sealers. results:tubliseal exhibited the least microleakage. in comparison to sealapex, tubliseal showed a significant difference. compared to sealapex, ah26 showed no significant difference. comparisons made between tubliseal and ah26 showed no significant difference. conclusion:in the present study, tubliseal sealer showed least microleage compared with sealapex and ah26 sealer.

PMC4377145

pubmed-259

targeting type 4 phosphodiesterase (pde4) has been recognized as a promising approach to managing copd by relieving the symptoms, slowing the progress of the disease, increasing exercise tolerance, reducing exacerbation rate, and improving quality of life (giembycz 2001, 2005; mehats et al 2003; spina 2003, 2004; lagente et al 2005; lipworth 2005; soto and hanania 2005) the pressing need to develop drugs that control symptoms and reduce mortality (pauwels et al 2001; gold 2005) and the billion-dollar marketing potential for management of copd have pushed the r&d of pde4 inhibitors into the product development pipelines of major pharmaceutical companies in the recent years. the early clinical trial data for the second-generation pde4 inhibitors cilomilast (ariflo, glaxosmithkline, usa) and roflumilast (daxas, altana, germany) all pointed to a successful introduction of a novel non-steroid anti-inflammatory therapy to clinicians in combating severe copd (gamble et al 2003; rabe et al 2005) nevertheless, while the progression of developing cilomilast has idled at the approvable stage for more than two years, the announcement of the termination of the agreement to develop roflumilast between altana and pfizer has raised concerns about the therapeutic efficacy of selectively inhibiting one or two isoenzymes in the pde4 family for copd management (pharmiweb 2005). in the early six-month record phase iii trial, roflumilast (500 mg daily) clearly improved lung function (ie, increased fev1 by+97 ml) and significantly reduced exacerbations (acute worsening of symptoms) compared with placebo (rabe et al 2005). however, in the follow-up one-year phase iii trials using exacerbations as one of the key endpoints, the results from the european copd ratio study that included 1513 patients with severe and very severe copd have failed to repeat the previously claimed efficacy. in addition, the new trial data confirmed that the pde4 inhibitor roflumilast s efficacy was considerably lower than the approved therapies such as fluticasone/salmeterol (a combination therapy of glucocorticosteroid and long-acting 2-agonist) and tiotropium bromide (long-acting anticholinergic). the unexpectedly low long-term efficacy on exacerbation rate from roflumilast therapy made the r&d community re-examine the role of targeting pde4 in copd because one of the highest unmet needs in treating the disease is to reduce or eliminate exacerbations (pharmiweb 2005). in november of 2005, altana announced the withdrawal of the european marketing authorization application (maa) for roflumilast and decided to wait for more clinical trial data for submission of a future maa (altana 2005a). this holdup no doubt sets back the r&d of the most promising pde4 inhibitor in development for copd. copd is a complex disease with pathophysiological features including inflammation (neutrophils, macrophages, cd8+lymphocytes infiltration, and inflammatory mediator tnf- and il-8 release), airway obstruction (smooth muscle contraction, elevated cholinergic tone), respiratory bronchiolar alveolar vasculature remodeling (loss of elastic recoil, alveolar destruction, and fibrosis), pulmonary hyperinflation, gas-exchange abnormalities, and pulmonary hypertension. the progressive loss of lung function leads to reductions in patients quality of life and results in exacerbations, cor pulmonale, and death. it is believed that the chronic non-infectious inflammation underlies the pathogenesis and the steady progression of the disease (pauwels 2001; gold 2005). the pathological changes in the patients with copd are not fully reversible and it often takes many years for a patient at risk (cough, sputum production) to progress into suffering from mild airflow limitation, to moderate, severe, and very severe copd (with chronic respiratory failure). in the absence of a magical therapy that can stop the disease progression and reverse the abnormalities of pulmonary function, the management, including drug therapy, for copd is long-term care. inhibition of pde4 has been established as an effective and reliable approach to increasing intracellular camp (conti et al 2003) that underlines the signaling mechanisms for the treatment of copd. in recent years, numerous in vitro, in vivo, and clinical trial studies demonstrated that pde4 inhibitors (eg, rolipram, cilomilast, and roflumilast) relax airway smooth muscles to increase air flow (holbrook et al 1996; bundschuh et al 2001) and improve pulmonary circulation (schermuly 2000; de witt 2000), inhibit bronchiolar alveolar vasculature remodeling, and fibrosis (kumar et al 2003), reduce neutrophils macrophages/cd8+t cells infiltration and pro-inflammatory mediator release (kumar et al 2003; profita et al 2003; wollin et al 2005), improve patients exercise capacity and quality of life, and prevent the progressive loss of pulmonary function (rabe et al 2005; gamble et al 2005). with all these preferred outcomes, it seems that the pde4 inhibitors in development (cilomilast and roflumilast) would be an ideal armory for the healthcare community to combat copd. why, then, has the long-term trial with roflumilast failed to produce the expected results? it could be due to a dose regimen (500 mg daily) that was effective for patients with moderate to severe copd (rabe et al 2005) but not adequate for those patients suffering from severe and very severe copd (altana 2005b) or the intrinsic low efficacy of the narrow-spectrum pde4 inhibitors. developing pde4 inhibitor as a therapy for copd is based on the fact that theophylline dilates airway smooth muscles and improves pulmonary function by inhibition of pde activity (barnes 2003; spina 2004) the dose-limiting adverse reactions (nausea, emesis, cardiac arrhythmias) with the non-selective pde inhibitor theophylline and the first-generation pde4 inhibitor rolipram (huang et al 2001; lagente et al 2005) directed the r&d of pde inhibitors to discover the second-generation of pde4 inhibitors cilomilast and roflumilast that have been successfully brought to the final stage for administration approval (spina 2003, 2004; lipworth 2005) based on the fact that the emetogenic reaction to pde4 inhibition is due to reticence of the pde4d isoenzyme (lamontagne et al 2001; robichaud et al 2002), several researchers in the field proposed to develop isoform-specific pde4 inhibitors that reduce or completely avoid disturbing pde4d activity and therefore do not trigger the emetic responses in the nervous system (giembycz 2002; robichaud et al 2002; card et al 2004). structural studies have provided evidence that the folding of catalytic domains of pde4 has a conformation involved in binding of selective inhibitors with a common scheme: (i) a hydrophobic sub-pocket sandwiching an inhibitor in the active site; (ii) hydrogen bond(s) to an invariant glutamine controlling the orientation inhibitor binding (therefore the affinity or potency) (lee et al 2002; huai et al 2003; card et al 2004) (figure 1). the scaffold of individual pde4 isoenzyme and the structure of a given selective inhibitor govern isoenzyme-selective inhibition, depict the binding affinity, and determine the therapeutic window and rank order of potency in clinical use for the treatment of copd. enhancement of isoenzyme selectivity is critical for reducing side-effects of the pde4 inhibitors. the strength of the interaction (hydrogen bond) between the oxygen group(s) of an inhibitor and the amide nitrogen group of glutamine (gln) 369 for pde4d and gln 443 for pde4b plays a pivotal role in determination of the potency and isoenzyme selectivity of an inhibitor (lee et al 2002; huai et al 2003; card et al 2004). in addition, selective pde4 inhibitors such as cilomilast and roflumilast have additional functional groups that can utilize the remaining empty space of the pocket to yield extra binding energy (increasing potency) and result in greater isoenzyme selectivity (lee et al 2002; huai et al 2003; card et al 2004) for example, while cilomilast s additional functional groups interact with 10 almost identical residues that form the hydrophobic sub-pocket in pde4d and pde4b, the oxygen atoms of the cyclopentyloxy and methoxy groups of cilomilast form two hydrogen bonds with the gln369 of pde4d, whereas there is only one hydrogen bond being formed between the methoxy group of cilomilast and the gln 443 of pde4b (card et al 2004; comparing http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xom&template=ligands.html&l=1.1 with http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xlx&template=ligands.html&l=1.1). this difference may partially explain the fact that cilomilast is approximately 10-fold more selective for pde4d than for pde4b, despite over 90% identity between the pde4b and pde4d catalytic domains. (giembycz 2001; odingo 2005) roflumilast shows a better fitting to the hydrophobic sub-pocket in the pde4d catalytic site than cilomilast (card et al 2004; comparing http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xom&template=ligands.html&l=1.1 with http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xoq&template=ligands.html&l=2.1), which depicts the experimental finding that roflumilast inhibits pde4d 338-fold more potently than cilomilast (table 1). as for pde4b inhibition, roflumilast s cyclopropylmethoxy and difluoromethoxy oxygen groups form two hydrogen bonds with gln 443 of pde4b (card et al 2004; comparing http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xmu&template=ligands.html&l=1.1 with http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/getpage.pl?pdbcode=1xlx&template=ligands.html&l=1.1), which may partially explain its 585-fold greater inhibition potency than cilomilast toward pde4b (table 1). the dichloropyridyl substitution of roflumilast also increases its potency compared with cilomilast in terms of pde4b inhibition (card et al 2004). the rank order of potency for inhibition of pde4 activity and lipopolysaccharide-stimulated tnfa release, for relaxing bronchoconstriction in guinea pigs, and the daily doses for treatment of copd by roflumilast, cilomilast, rolipram, and theophylline are summarized in table 2. by improving the inhibition ratio on pde4b/pde4d, roflumilast indeed lowers the emetic profile without compromising its therapeutic efficacy in comparison to cilomilast (huang et al 2001; spina 2003) the pde4b-specific single-molecule targeting can undoubtedly reduce or eliminate an inhibitor s unwanted effects. however, this approach may compromise the efficacy of a pde4 inhibitor because airway and vascular smooth muscles express multiple pde4d isoforms (eg, d1, d2, and d5) and pde4d plays a crucial role in bronchoconstriction and vascular smooth muscle contraction (liu et al 2000; baillie et al 2001; mehats et al 2003). an agent without 4d inhibition may end up lacking sufficient therapeutic efficacy for controlling copd (spina 2004). the beneficial effects on copd via relaxing airway smooth muscles and anti-inflammation mediated by pde4 inhibition with cilomilast and roflumilast have been emphasized and reviewed extensively (spina 2004; lagente et al 2005; lipworth 2005; soto 2005). improving pulmonary circulation has not been considered as an important therapeutic approach for managing patients with copd. however, the facts are 1) during copd exacerbations, pulmonary hypertension (ph) is increased, 2) the presence of ph is recognized as the single strongest indicator of prognosis in copd patients among the numerous clinically used lung function parameters (doi et al 2003; alp et al 2006), and 3) clinically, the higher the pulmonary arterial pressure, the shorter the life expectancy of copd patients (barbera et al 2003). although inhaling nitric oxide vasodilator can worsen gas exchange because of altered hypoxic regulation of ventilation-balance (barbera 1996) in patients with stable copd, and vasodilators are considered as contraindications for copd patients, in their preliminary clinical trial, alp et al (2006) demonstrated that reduction of pulmonary vasculature resistance using the pde5 inhibitor sildenafil was able to significantly improve the exercise capacity (6-minute walk test) of patients suffering from severe copd. a double-blinded, placebo-controlled, crossover clinical trial of sildenafil in patients (n=10) with copd is going on to evaluate the effect of pde5 inhibition on patients exercise function, pulmonary function, and quality of life (national institutes of health). although there is a lack of reports about cilomilast- or roflumilast-caused pde4 inhibition on the improvement of pulmonary circulation, in isolated perfused lung preparations, intravascular or transbronchial administration of subthreshold doses of the wide-spectrum pde4 inhibitor rolipram synergistically amplified the pulmonary vasodilatory response to inhaled pgi2 and concomitantly improved ventilation more interestingly, in anesthetized cats, de witt et al (2000) found that rolipram was more potent than either siguazodan (pde3 inhibitor) or zaprinast (pde5 inhibitor) in reducing pulmonary lobar arterial pressure. when the tone in the pulmonary vascular bed was raised to a high steady level with a constant infusion of the thromboxane mimic u46619 (9,11-dideoxy-11, alpha9alpha-epoxymethano prostaglandin f2), intralobar injections of rolipram caused dose-related decreases in systemic arterial pressure and pulmonary arterial pressure. the preference reduction in pulmonary arterial pressure by inhibition of pde4 suggests that administration of pde4 inhibitors may benefit copd patients by increasing ventilation (airway relaxation) and improving alveolar perfusion (vasodilation), therefore improving blood gas exchange capacity and patients pulmonary function. thus, it is highly likely that the maximal therapeutic efficacy of targeting pde4 in the treatment of severe copd depends upon three effectors of downstream intracellular camp elevation: 1) anti-inflammation (lipworth 2005), 2) airway relaxation (spina 2004), and 3) vasodilation. sacrificing any one of these effectors with an isoenzyme-specific narrow-spectrum pde4 inhibitor will compromise the effectiveness of the therapy. how, then, is the dose-limiting dilemma (nausea, vomiting, diarrhea, and arteritis) (giembycz 2005; spina 2004; lipworth 2005) associated with the wide-spectrum pde4 inhibition overcome? the fact that there are over 60 pde isoenzymes encoded by 21 human pde genes and at least 16 pde4 isoenzymes from 4 pde4 genes (soderling and beavo 2000; conti et al 2003; houslay and adams 2003; huai et al 2004) may render it highly possible that searching for isoenzyme-specific pde4 inhibitors will yield low-efficacy agents. in addition, mechanisms for upregulation of pde4 activity by camp-induced pde4 gene expression and pka-catalyzed phosphorylation activation of pde4 isoforms (conti et al 2003; wallace et al 2005) may very likely reverse an isoenzyme-specific, pde4 inhibitor-produced elevation of intracellular camp level, and therefore the associated biological beneficial effects. noticing the low therapeutic ratio and insufficient clinical efficacy of the current generation of pde4 inhibitors (cilomilast and roflumilast), giembycz (2005) assumed that one potential means of improving the therapeutic ratio and safety of pde4 inhibitors may lie in the development of compounds that have broader phosphodiesterase specificity and suggested dually targeting pde4 and pde1, pde3, or pde7 to enhance clinical efficacy. this approach seems to revisit the previously well-described pde inhibitors such as theophylline or zardvarine (schmidt et al 2000; barnes 2003). it may lead to the dose-limiting drawback cycle again, because it is known that targeting camp-specific pde3 is associated with an increase in morbidity and mortality in heart failure patients (packer et al 1991). in a news feature on pharmiweb.com, there is a remark about pfizer s development of an inhaled dual-action pde4/spiriva (long-lasting muscarinic antagonist tiotropium) combination product for copd (pharmiweb 2005). this combined dual action modality is a favorable approach for managing patients with severe copd considering the presence of bronchoconstricting and inflammatory pathologies in the disease. in general, moderately targeting two mechanisms to reach the therapeutic goal should be more effective and safer than exploiting a single mechanism to its extended degree. we have proposed to co-administer ca channel antagonist (cca) to overcome pde4 inhibitor-caused adverse effects, especially emetic responses (wang and wang 2005) because 1) stimuli that upregulate the camp pathway can increase the excitability of the neurons in the locus coeruleus (lc) that plays an important role in mediating neuronal emesis (nestler et al 1999; takeda et al 2001); 2) the pde4d isoform is localized to neurons in the structures of the medulla including lc (lamontagne et al 2001), which are consistent with a role for pde4d in the emetic response; and 3) the lc neurons fire action potentials spontaneously, resulting from endogenous properties of the membrane conductance to a persistent inward ca current, which can be blocked by diltiazem (williams et al 1984; tokuyama and ho 1996; filosa and putnam 2003). thus, in the presence of cca, even when a complete inhibition of pde4d leads to an elevation of camp in the lc neurons, the lc cells will not be able to fire action potentials due to a blockade of the depolarizing l-type ca currents, therefore eliminating the intrinsic dose-limiting emetic pharmacological profile of the wide-spectrum pde4 inhibition. in addition, ccas also relax airway smooth muscles and exhibit anti-inflammatory effects, which may synergistically augment a pde4 inhibitor s therapeutic effects on copd (worley and kotlikoff 1990; szabo et al 1997; brown et al 2004). the clinical use of ccas in treatment of pulmonary hypertension in patients with copd further support the combination therapy of a pde4 inhibitor and a cca (sajkov et al 1997). one concern regarding the combined therapy is the possible difference between the pharmacokinetics of the two drugs that may compromise the expected outcomes. this pitfall can be eliminated by developing an agent with two pharmacophores in one chemical structure, therefore being able to simultaneously target two therapeutic mechanisms such as l-type ca channels and pde4s (wang and wang 2005). we believe that it is worthwhile to carry out a randomized clinical trial to evaluate the safety and efficacy of dually targeting pde4 and ca channels in managing the patients with severe copd. the unsatisfied efficacy of using pde4 inhibitor roflumilast in treatment of severe and very severe copd has raised concerns in the r&d community about the administrative approvability for the highly expected novel therapeutic modality in combating copd. the extensive in vitro, in vivo, and clinical trial study data and the established clinical beneficial effects (anti-inflammation, bronchorelaxation, pulmonary vasodilation) associated with pde4 inhibition strongly validate targeting pde4 for controlling copd. development of an inhaled dual-action therapy such as pde4 inhibitor and muscarinic antagonist may be a correct approach to bringing a pde4 inhibitor to the demanding market. the other approach is using cca to overcome pde4 inhibitor-caused adverse effects, especially emetic responses and simultaneously enhance pde4 inhibitor s anti-inflammatory and bronchorelaxation, pulmonary vasodilation effects. of course, development of a dual agent that has with two pharmacophores in one chemical structure, therefore being able to target pde4 and l-type ca channels should also be able to improve the therapeutic window of pde4 inhibition and may make available a new therapeutic approach to managing copd.

targeting type 4 phosphodiesterase (pde4) for treatment of copd has multilevel benefits to patients by reducing inflammation, relieving bronchoconstriction, and improving pulmonary circulation. the isoenzyme-specific narrow spectrum pde4 inhibitors such as cilomilast and roflumilast may have limited clinical efficacy in managing severe and very severe copd. development of dual therapy by combining pde4 inhibition with ca2+channel antagonism may introduce an effective novel armory for physicians to manage patients with severe copd.

PMC2707810

pubmed-260

long-acting beta-2 agonists such as salmeterol and formoterol are important controller medications in the maintenance therapy of chronic stable asthma, used as an add-on drug to inhaled corticosteroid. however, their usefulness in the management of acute attacks of asthma has recently been recognized, and they are approved for use as reliever medication in europe. short-acting 2 agonists are the preferred drugs as the initial bronchodilator for acute asthma because of their rapid onset of action. however, due to short duration of action they require frequent administration. formoterol is a unique bronchodilator having rapid onset and long duration of action with a favorable safety profile. so it can be an ideal alternative to short-acting 2 agonists in the management of acute asthma exacerbation by providing rapid bronchodilatation and reducing the need for frequent administration. onset of action of formoterol is similar to salbutamol (13 min), and 8090% of brochodilatation occurs by 510 min of inhalation. duration of action is up to 12 h. however, duration of systemic effects with formoterol is found to be as short as salbutamol. arformoterol ([ r, r] formoterol) is a single isomer form of formoterol, which is available in india recently. this study compares the efficacy and safety of arformoterol and salbutamol delivered by nebulization in the management of acute non-severe asthma. a total of 50 patients attending the emergency room or chest opd of a tertiary care hospital with acute non-severe asthma over a 6-month period from january 2010 to june 2010 were selected for this study. the inclusion criteria were as follows: (a) age>18 years; (b) british thoracic society definition of acute non-severe asthma; and (c) ability to perform forced expiratory maneuver. the following patients were excluded from the study: (a) patients presenting with acute severe/acute life-threatening/near-fatal asthma; (b) patients with a previous diagnosis of chronic obstructive pulmonary disease (copd); (c) history of hypersensitivity to 2 agonists; and (d) pregnant or lactating women. the study was approved by the institutional ethics committee, and informed consent was obtained from each patient. the age, sex, duration of asthma symptoms, and present controller medications were recorded. the pulse rate, respiratory rate, and spo2 (measured with fingertip pulse oximeter, model 6500, nidek medical, kolkata, india) were also recorded at the time of initial assessment. baseline peak expiratory flow rate (pefr) was measured with a peak flow meter (peak flow master, cipla ltd., patients were then assigned by random number allocation to either of the two groups, that is, salbutamol or arformoterol group according to the medication given to them. in the salbutamol group, 5-mg salbutamol respules were administered through oxygen driven (6 l/min) nebulizer (pulmo mist ii nebuliser, nidek medical, kolkata, india) at 20-min intervals for 1 h amounting to a total of 15 mg. in the arformoterol group, total 45 g of the drug was administered as 15 g respules every 20 min through the same nebulizer. the drugs were administered in a double-blind manner. to eliminate the effects of other drugs on the treatment outcome pefr was also measured 5 min after each dose. at each time, best of the three pefr measurements was recorded. differences in mean pefr between the two groups were analyzed by unpaired t-test. one-sample test was used to compare pefr before and after each dose of the drug to determine whether there was significant improvement in either group. among 50 patients satisfying the inclusion criteria, 25 patients received salbutamol and 25 patients received arformoterol therapy. baseline characteristics of the patients (n=50) receiving salbutamol and arformoterol therapy from the table, it is evident that the demographic profile and baseline pefr in the two groups were comparable. in both the groups, pefr showed significant increase over the baseline values and the increase was evident after each dose of the drug. the increases in pefr after the first and the second dose were significantly more with arformoterol than with salbutamol, but the increase in pefr after the third dose was similar in these two groups. the comparison of improvement following the therapy with salbutamol and arformoterol is shown in table 2. improvement in pefr after each dose of bronchodilator when compared with the baseline both drugs were well tolerated; no major adverse effect was noted in either group. as arformoterol is the only long-acting 2 agonist available in india as a nebulizing solution, we have used this drug considering the fact that the clinical pharmacology will be similar with formoterol. our study has shown that both salbutamol and arformoterol are equally effective as a reliever medication as nebulizing solution in acute non-severe asthma. improvement in pefr was demonstrated in both the groups and following each dose of the drugs. the absolute increase in the pefr after the first and the second dose were more with arformoterol than with salbutamol, but the increase in the pefr after the third dose was similar with these two drugs. relatively, hydrophilic drugs such as salbutamol have a rapid onset of action due to their ability to reach the 2 receptor from the aqueous phase. the aqueous portion rapidly activates the 2 receptor, whereas the lipophilic portion is taken up into the cell membrane from which it diffuses slowly to stimulate 2 receptor over a prolonged period. several studies have shown the efficacy of formoterol in acute non-severe asthma, acute severe asthma, exercise induced bronchospasm, childhood asthma, and copd.[1317] most of the studies have used formoterol with terbuhaler, aerolizer, or metered dose inhaler. however, studies using formoterol nebulization are lacking. although few studies have shown clinically significant improvement in lung function (fev1) with formoterol when compared with salbutamol, most studies have shown a comparable efficacy. safety of formoterol is also well documented even at high doses in patients with asthma and copd. although it is a long-acting drug, systemic effects with formoterol are as short as salbutamol. in few studies, the impact of high-dose formoterol on heart rate, blood pressure, serum potassium, electrocardiogram changes, and arterial blood gas were assessed which showed identical changes comparable with salbutamol we did not study these parameters but evaluated only the side effects reported by the patients. the side effects were very few, non-severe, and comparable between these two drugs. dryness of mouth was the most reported side effect of formoterol inhalation in one study, but we found oral irritation and headache as common side effects. the sample size is relatively small which limits our ability to detect small but potentially significant differences. this study is restricted to patients of acute non-severe asthma only; efficacy and tolerability of arformoterol in other acute settings such as acute severe asthma and acute exacerbation of copd are yet to be explored. the side effect profile studied by us was only on the basis of the self-reported symptoms of the patients, and objective assessment and laboratory abnormalities were not assessed. we also did not follow the patients after discharge; so long-term efficacy and safety were not studied. further studies are thus needed to clarify the efficacy, actual dose, dose frequency, cost-effectiveness, and long-term safety of arformoterol in acute exacerbations of asthma and copd with different levels of severity.

arformoterol, a long-acting beta-2 agonist, has a rapid onset and long duration of action. its role as rescue medication in acute asthma attack is undetermined. to compare the efficacy and tolerability of arformoterol with salbutamol nebulization, a study was conducted among 50 patients with acute non-severe asthma. patients were randomly assigned to group 1 (n=25) and group 2 (n=25) who received three doses of salbutamol and arformoterol nebulization, respectively, at 20-min intervals. the peak expiratory flow rate (pefr) was measured at the baseline and 5 min after each dose. the demographics and baseline characteristics were comparable between the two groups. the mean pefr significantly increased in both these groups when compared with the baseline. the increases in the pefr in two groups were similar after the third dose. the adverse effects in both these groups were minor. arformoterol was as effective and safe as salbutamol in acute non-severe asthma.

PMC3153715

pubmed-261

hepatic angiomyolipoma (haml) is a rare benign mesenchymal liver tumor first described by ishak in 1976; it belongs to a group of perivascular epithelioid cell tumors called pecoma. until date, approximately 300 cases have been reported [310]; however, its natural history has not been clarified. the tumor composed of blood vessels, smooth muscle, and adipose cells and due to the variety of predominance of these tissues, its patterns in imaging studies have resulted in a difficulty in diagnosis and misdiagnosis of the tumor as hepatocellular carcinoma (hcc) in some cases [6, 11]. therefore, the preoperative correct diagnosis has been difficult; however, recent advances in imaging diagnosis through a combination of ultrasonography (us), computed tomography (ct), magnetic resonance imaging (mri), and angiography and specific immunohistochemical analysis of this tumor using human melanoma black-45 antigen (hmb-45) staining have resulted in accurate diagnosis and it is reported that the current accurate preoperative diagnosis was made in 25%52% of cases [8, 9]. the majority of these tumors are believed to be clinically benign during a mean follow-up period of 6.8 years; however, an increasing number of cases and aggressive changes including growth in size, recurrence after surgical resection, metastasis, and invasive growth pattern into the parenchyma and along the vessels have been reported. in this paper, we have focused on the characteristic features of this tumor shown in imaging studies and by histological analysis, summarized these cases showing aggressive patterns, and discussed management of the patients and indications for surgical treatment. most cases were found as incidental liver tumors upon health screening or imaging examinations for other diseases. it usually follows a benign clinical course while some patients visited hospitals with unspecific symptoms of abdominal discomfort, fullness, and other such complaints. more than half of the renal aml are considered to be associated with tuberous sclerosis which features the loss of heterozygosity at tsc1 (9q34) and tsc2 (16p13), while it is estimated to be 515% in the liver. thus the etiology of most of these tumors in the liver is unknown; most cases have no history of liver diseases or specific symptoms, and no changes in laboratory data are seen. moreover, serum levels of the tumor markers alpha-fetoprotein, protein induced by vitamin k absence or antagonist ii, carcinoembryonic antigen, and carbohydrate antigen 19-9 were normal. since this tumor is composed of various tissues, such as lipomatous, myomatous, and angiomatous tissue in various proportions, the imaging studies show a wide array of features depending on the predominance of each tissue. the tumor showing the predominance of lipomatous tissue is likely to be correctly diagnosed; however, myomatous and angiomatous variant poses diagnostic problems since it is difficult to be distinguished from malignant tumors. us images may vary depending on the tissue components affected by the tumor. high echogenic lesions can be observed because of lipomatous and myomatous tissue, and angiomatous tissue may result in low echoic lesions in tumor images (figure 1(a)). if the tumor has predominance of lipomatous tissue, the differential diagnosis with hepatic hemangioma is difficult by sonography alone. color doppler sonography shows punctiform or filiform vascular distribution pattern if the tumor has predominance of angiomatous tissue. recent reports showed the diagnostic effectiveness of contrast-enhanced us (ceus) [10, 13]. reported that ceus revealed the typical imaging characteristics of haml, that is, an inhomogeneous hyperenhancing pattern in the arterial phase and prolonged enhancement during the portal and kupffer phases. plain ct showed homogeneous or heterogeneous low-density lesions, and contrast-enhanced dynamic ct showed highly enhanced lesions in the arterial phase, prolonged enhancement in the portal phase, and, occasionally, defective lesions in the late venous phase depending on the component of the tumor tissue. a density of less than 20 hounsfield units in plain ct is useful to determine the involvement of lipomatous tissue. the difficulty is, however, to diagnose the tumor that is myomatous tissue and angiomatous variant. for this point, modification of size of region of interest in ct was reported to be effective for accurately diagnose renal angiomyolipoma from renal cell carcinoma. abdominal angiography showed marked tumor staining in the arterial phase, which remained in the portal phase (figure 1(b)). in some tumors, drainage of the hepatic veins can be observed in the late vascular phase. the first phase of ct during hepatic arteriography showed significant hypervascular lesions in the tumor (figure 1(c)), and the second phase showed the remains of staining and defective lesions in other areas (figure 1(d)). ct during arterial portography showed areas of defective tumors (figure 1(d)). mri is considered to be the best modality to determine the components of the tumor. hyperintensity on the t2-weighted image and hyper- or hypointensity on the t1-weighted image are observed depending on the component of tumor tissue [810]. lipomatous lesions may be determined as hyperintensity on the t1-weighted image; they may also be determined by the chemical shift imaging technique. contrast-enhanced dynamic mri using gadolinium or the hepatocyte-specific contrast agent gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid showed early enhancement in the arterial phase followed by the prolonged enhancement in the portal phase and defective lesions in the hepatobiliary phase. macroscopic and magnifying glass view of the tumor showed a soft, white to yellow, and well-circumscribed tumor and range in size from 0.1 cm to greater than 36 cm. no signs of chronic inflammation or fibrosis were seen in the surrounding liver tissue. because haml comprises lipomatous, myomatous, and angiomatous tissues, microscopic examination showed a mixture of blood vessels, specialized smooth muscle cells, and adipose cells with atypical changes in classic haml (figures 2(a) and 2(b)). this variation of mixture levels in one tumor reflected the differences in imaging studies and made accurate diagnosis difficult. it is believed that majority of the hamls behave in a benign fashion and even if some cases showed invasive growth pattern into the adjacent hepatic parenchyma, portal triad (figure 2(c)), and hepatic vein. tumor cells, especially myomatous cells, were stained positive for hmb-45 in most tumors (figure 2(d)), for cd34 in the endothelial cells of the blood vessels and for smooth muscle actin in spindle smooth muscle cells. hmb-45 is an antibody that reacts with an oncofetal premelanosome-associated glycoprotein 2, found in neoplastic melanocytes. also cd63, cd67, desmin, s100, and ema may also be positive but not specific. these cells were negative for cytokeratin 18, cytokeratin 19, cam 5.2, hepatocyte paraffin-1. therefore, the identification of lipomatous, myomatous, and angiomatous tissue by a positive reaction to hmb-45 currently provides the only evidence of haml [46, 18] and can be useful for defining from the other liver tumors such as hcc after the tumor biopsy and surgical resection followed by these immunohistochemical stainings. although favorable prognosis can be expected for this tumor since the majority of the tumors are benign, however recently, the number of reports of haml showing malignant potential has increased [3, 5, 8, 9, 12, 1624] which revealed significant growth, recurrence, metastasis, and poor prognosis summarized in table 1. among those cases, deng et al. reported in their case that haml showed atypical angiomatous, epithelioid components with pleomorphic and frequent mitosis in the center of the large tumor displayed p53 immunoreactivity, and mutation at exon 7 for p53 and resulted in vascular invasion, distant metastasis, and fatal outcomes. these results indicate that the hmb-45 staining, mitotic analysis by mib-1 (ki67), and p53 reactivity following the fine-needle biopsy of the tumor might be useful for the diagnosis of the tumor and its malignant potential. since haml usually follows benign clinical courses, the majority of the cases can be conservatively treated. however, as not a few cases showed aggressive pattern in their courses [3, 5, 8, 9, 12, 1624] and because of the low level of accurate diagnoses by imaging studies, and because of the possibility of dissemination of tumor cells into the peritoneal cavity if a tumor is malignant, tumor biopsy has been avoided, and many hamls have been surgically resected [3, 8, 9]. with the increasing number of resected samples, careful comparisons of imaging studies and pathological findings therefore, once haml has been diagnosed by imaging studies, a fine-needle biopsy should be performed to make an accurate diagnosis and to confirm the predominance of the tissue components, the existence of pleomorphic nuclei with high proliferation activity, p53 immunoreactivity, and mutation in p53 if possible. if the aggressive patterns such as vascular invasion, high proliferation of the tumor cells, p53 immunoreactivity were marked, or when the imaging findings and biopsy can not provide a definitive diagnosis, or if the patients have abdominal symptoms, surgical resection should be considered. haml is considered to be a benign mesenchymal tumor, and nonsurgical treatment with conservative management involving close followup is therefore suggested for patients with asymptomatic tumors smaller than 5 cm, which have been proved to be a typical haml by fine-needle aspiration biopsy. as a fact the renal angiomyolipoma often showed perirenal invasion, involvement of the renal vein, and the inferior vena cava, that are not considered as signs of malignant behavior and the angiomatous, epithelioid monophasic or pleomorphic variant might be associated with the aggressive behavior and cellular atypia, mitotic activity, and metastatic lesions are the criteria for the malignant renal angiomyolipoma. however, due to the difficulties in diagnosis by imaging studies, many hamls have been surgically resected and have been followed closely for a long period. in addition, by careful analysis of these recent cases [3, 5, 8, 9, 12, 1624] summarized in table 1, it was revealed that, although rare, hamls may have malignant potential, which may be distinguished by aggressive patterns characterized by (1) significant changes in size in short period; (2) a change of tumor composition (cases 1, 2, 5, and 6) [9, 16, 17, 19]; (3) metastases to the other organs (cases 1, 9, and 10) [17, 22, 23]; (4) recurrence after curative surgical resection (cases 3, 7, 9, 10, 11, 12, and 13) [3, 8, 18, 20, 2224]; and (5) invasive growth into the vessels (cases 2, 4, 8, 9, and 10) [12, 17, 2123]. ohmori et al. reported the first possibly malignant case, which showed that a significant increase in the tumor size resulted in liver dysfunction. fatal progression was observed in nine cases listed by multiple recurrences [3, 8, 18, 20, 2224] and metastases to the liver, peritoneum, retroperitoneal region, gastrohepatic omentum, pancreas, and lung [17, 22, 23]. the cases reported by chang, rouquie, and us underwent surgical resection, with a suspicious of aggressive patterns and no recurrence has occurred. we also reported that portal thrombosis, that is, high-grade portal vein invasion, found in five cases in table 1 (cases 2, 8, 9, 10, and 11) [3, 17, 2123] may be a clinical marker of the malignant potential and transformation of haml as it resulted in a significantly aggressive disease and fatal course in 4 cases with multiple recurrences and metastases. this finding might be able to be detected by imaging studies as similar to hcc. in addition, pathological findings of atypical epithelioid component with high proliferation activity, p53 immunoreactivity, and mutation in p53 might be predictive markers for malignant transformation. based on these reports, as recommended by previous papers [3, 8, 9], long-term follow-up of haml is necessary after its diagnosis by imaging studies and biopsy specimens and curative surgical treatment. the majority of hamls behave as a benign tumors and conservative follow-up may be recommended; however, with increasing number of the reports showing potentially malignant behavior, prompt surgical resection is essential for better prognosis of this tumor. we have reviewed noninvasive imaging studies and the role of histological diagnosis showing distinctive characteristics of haml to increase the rate of accurate diagnoses. in addition, we summarized the cases that showed progressive patterns of the tumor and concluded that a careful followup of the tumor even after the final diagnosis is necessary. we propose that tumor resection is indicated in the following scenarios: (1) the patients show symptoms; (2) the tumor shows an aggressive growth; (3) the tumor shows invasive growth into the vessels evidenced by fine-needle biopsy or imaging studies; (4) the component of the tumor shows atypical epithelioid pattern, high proliferation activity, and/or p53 immunoreactivity; and (5) a definitive diagnosis can not be made by imaging and pathological studies from malignant tumors.

angiomyolipoma (aml) is a benign mesenchymal tumor that is frequently found in the kidney and, rarely, in the liver. the natural history of hepatic aml has not been clarified, and, because of the similar patterns in imaging studies, such as ultrasonography, computed tomography, and magnetic resonance imaging, some of these tumors have been overdiagnosed as hepatocellular carcinoma in the past. with an increase in the number of case reports showing detailed imaging studies and immunohistochemical staining of the tumor with human melanoma black-45, the diagnostic accuracy is also increasing. in this paper, we focused on the role of noninvasive imaging studies and histological diagnosis showing distinctive characteristics of this tumor. in addition, because several reports have described tumor progression in terms of size, recurrence after surgical resection, metastasis to other organs, and portal thrombosis, we summarized these cases for the management and discussed the indications for the surgical treatment of this tumor.

PMC3540709

pubmed-262

the sentinel node is defined as the first tumour-draining lymphatic filter, and its involvement by metastatic disease should predict the global nodal status of the specific patient. skip metastasis in the context of a normal sentinel node is described as a very rare event. in patients with clinically node-negative disease, sentinel lymph node biopsy (slnb) had become the gold standard staging procedure, followed by axillary lymph node dissection (alnd) performed selectively in patients with previously proven (by slnb) sentinel node metastases. considering the therapeutic consequences, involvement of the sentinel node by metastatic disease in breast cancer patients is of great interest to the breast surgeon in order to plan the surgical approach. unfortunately, the physical examination of the axillae can be inaccurate in identifying pathologic lymph nodes. the same is also true for the pre-treatment imaging (with or without interventional procedures on the axillary node), characterized by a poor negative predictive value [48]. using gamma probe combined with ultrasound- (us) guided percutaneous core needle biopsy (cnb) could increase the accuracy of identifying the sentinel node and allow a proper histopathologic diagnosis in order to avoid further slnb. the purpose of this pilot study was to assess this new pre-operative diagnostic approach. main inclusion criteria were: women 18 years old, invasive breast carcinoma, with no clinically positive axillary node and no history of any other malignancy. multicentric cancer and previous excisional biopsy were exclusion criteria. the sentinel node occult lesion localization (snoll) was performed in all patients the day before surgery. a dose of 510 (generally 7) mbq of technetium 99-labelled human albumin nanocolloid particles in 0.3 ml saline were administered by us-guided percutaneous injection in the area immediately surrounding the breast lesion, followed by injection of 0.2 ml saline using a 22 g needle. we used nanocolloid particles with a size range of 5100 nm (nanocoll, ge healthcare). after injection, antero-posterior and lateral lymphoscintigraphic projections were obtained to identify the presence of a sentinel node and to define whether the radiocolloid has shifted to other possible sites of drainage, such as the internal mammary, intramammary, contralateral axillary or supraclavicular nodes. the hot spot was identified over the skin by the handheld gamma probe (navigatog gps rmd) and was examined using ultrasound logos hi vision gold (hitachi) using a breast-dedicated linear array transducer. the radiologist performing the us-guided biopsy established which lymph node corresponds to the hot spot under gamma probe guidance. we evaluated suspect us findings such as cortical thickening, especially if focal, markedly hypoechoic cortex, absence of the fatty hilum, large expansion, irregular shape, round shape, extracapsular tumoral extension or increased peripheral blood flow at power doppler. lymph nodes with at least 2 of these criteria were considered pathologic, and we excluded suspicious lymph nodes. patients were placed in a supine or contralateral-side-down oblique position on the table, with the ipsilateral hand placed behind the head. biopsies were performed in all patients by a single radiologist with more than 10 years experience in ultrasonography. cnb was performed with an automatic 18 g needle (bard core biopsy instrument, tempe, usa) after local anesthesia with 2% mepivacaine. all biopsies with a free-hand technique were performed under us guidance with direct visualization of the needle entering into the cortex of the node to confirm position of the needle tip in the appropriate location. only 1 pass the percutaneous biopsy was performed only if the lymph node corresponded to the hot spot. we considered the biopsy procedure to be successful when the obtained sample contained a large portion of solid non-fatty tissue and/or sank in formalin to be stained with haematoxylin and eosin. the skin above the first radioactive node was marked by the radiologist with an indelible ink tattoo to assist the surgeon. the puncture zone was compressed and the presence of complications such as local pain or hematoma was evaluated. the next day, in the operating room, radioactive lymph nodes were detected in all cases using the same gamma probe that was used to detect the hot spot for the us-guided pre-operative imaging. surgical slnb was performed in all cases, followed by alnd in cases of positive percutaneous biopsy. the surgeon was able to recognize the sentinel lymph node biopsy marked by the radiologist with the skin mark and correlate with the results of the standard slnb (validate the ability of the preoperative diagnostic method to correctly identify the sentinel node). because the most frequent tumor site is the upper-outer quadrant of the breast, the surgeon generally used the same type of incision of the breast to identify the sentinel node using the gamma probe guide when the conservative surgery was performed. in different cases, the surgeon used a separate incision guided by the skin marker performed by the radiologist. the final histopathological diagnosis of slnb was compared with the results of the cnb of the sentinel node. the accuracy of percutaneous biopsy guided by us and gamma probe over the skin in the pre-operative staging was correlated with final pathologic reports of slnb. information on histological type and grade and biological characteristics (eg, receptor status or peritumoral vascular invasion of the primary carcinoma) were obtained from the pathology report of the breast specimen. for the pathological staging of the axillae, this study used the guidelines and terminology proposed by the seventh edition of the american joint committee on cancer staging manual. main patient characteristics are shown in table 1 and include age, type of surgery, location of primary breast cancer, nodal stage at percutaneous biopsy, pathological nodal stage, and biological features of the breast tumor. sentinel node identification was successful in all patients, although there were no suspicious nodes at us examination. the hot spot was detected over the skin by gamma probe in all 10 patients, and was examined using us-guided cnb in all patients. multiple sentinel nodes were not detected and no patient had the sentinel node draining to different possible sites. there were no major complications (eg, clinically important bleeding, nerve injury, or infection) related to the cnb procedure. one patient experienced a small amount of bleeding, which was stopped by simple local compression; this was considered a minor complication. in all patients, nodal metastases were found at final diagnosis in 2 of 10 patients (table 1). the definitive histopathological report of slnb expressed the presence of 1 micrometastasis that was not observed in the frozen section at the extemporary analysis. in the second patient, micrometastases were observed in the para-sentinel node at slnb, but no macrometastasis in the sentinel node were found. in all the surgically excised sentinel lymph nodes, the pathologist documented the sign of the previous core needle biopsy, verifying that the biopsied lymph node was really the sentinel node. in women with early breast cancer, slnb has proved to be a safe and accurate method for evaluating axillary disease, and is associated with less morbidity than complete alnd. nevertheless, slnb is not a problem-free procedure. patients with documented lymph node involvement at the slnb usually require further alnd as a second step during the same surgical procedure, favoring scar tissue formation and edema, and increasing the rate of complications and the surgery time. hospital stays are also increased in case of slnb+alnd compared with alnd alone as suggested by goyal et al.. pre-operative knowledge of an axillary metastatic sentinel lymph node could avoid the intraoperative slnb. in fact, in cases with positive preoperative lymph node cnb, a complete alnd can be performed directly as a primary procedure. the obvious advantages of this approach are suggested by several authors that used different methods to localize the abnormal lymph node before surgery. had avoided slnb in 30% of patients with a final pathology of metastatic lymph node by performing fine needle aspiration cytology (fnac) of the abnormal sonographic axillary node. sever et al10 proposed the use of intradermal peritumoral microbubble us contrast agents injection and lymphatic imaging to identify and localize the sentinel node in the preoperative stage. many studies report a moderate diagnostic sensitivity of the percutaneous biopsy of a morphologically abnormal axillary lymph node and an even lower sensitivity in cases where the biopsied lymph node has an unaltered appearance and the procedure is performed randomly. but how can you differentiate the sentinel node from a regular lymph node especially when the pathological sentinel node is not always the largest one or the morphologically abnormal one ?. found metastatic involvement in 12% of the lymph nodes with normal sonographic appearance, and declared that us-guided biopsy would miss the sentinel node in 36% of the cases, resulting in false-negative axillary cnb, partly due to failure to identify the lymph node or the abnormal region of the lymph node to biopsy. furthermore, there is little information in the literature regarding the accuracy criteria for performing an axillary us. adding gamma probe over the skin could increase the sensitivity of percutaneous us-guided biopsy, providing a good approximation of detection of true sentinel lymph node. theoretically, it is well established that a negative sentinel lymph node is currently equivalent to disease-free axillae. the majority (about 70%) of women with clinically negative axillae will prove to be microscopically negative as well. on the other hand, it is also documented that a certain percentage of the false-negative sentinel node cnbs are for micrometastases or isolated tumor s cells. there is no current evidence showing that submicroscopic metastases predict an adverse outcome or that they require treatment. several authors [1820] demonstrated the absence of axillary recurrence during long-term follow-up in patients with sentinel node micrometastasis in which alnd was not performed. several studies were done, and one of the most recent addressing this question participated in an ibcsg trial that compared complete alnd (used in cases with positive slnb) to follow-up (in patients with node-free macrometastasis disease). similarly, we speculate that patients with micrometastases and false-negative sentinel node proved by cnb, gamma probe and us-guided biopsy, may not need intraoperative slnb, particularly since follow-up with ultrasonography, and eventually pet, could detected early axillary disease that can be adequately treated later by therapeutic axillary dissection. nevertheless, avoiding the morbidity of slnb must be weighed against the risk of harboring axillary micrometastases that may potentially seed occult metastatic disease after a percutaneous biopsy. in the clinical context, considering a patient s expected life span and associated health problems, this situation might be defined as a minimal acceptable risk. slnb has also a false-negative rate (5% according to veronesi et al.) and this is the reason why these patients are generally subject to regular follow-up with clinical and us examination of the axilla. we also suggest that cases with negative sentinel node percutaneous gamma probe and us-guided biopsy should be similarly monitored. several studies reported that the sensitivity of us in identifying axillary adenopathy has been increased by cytology sampling of the suspicious lymph node; the approach is limited by the high rate of false-negatives results of the aspiration tecnique. in other words, the unacceptably high rate of false-negatives results makes nodal fnac an unreliable method that can not be used to avoid intraoperative slnb. as known, there are a number of possible reasons for a false-negative result at fnac: inadequate specimen sampling, a low number of metastatic lymph nodes, small-sized metastasis, and failure to visualize true sentinel lymph node during the us examination of the axilla. the aim of this study was to verify the feasibility of this innovative method to detect and to biopsy the sentinel node in order to improve confidence in identification of the metastatic lymph node in the preoperative phase. in our opinion the decision to use large cnb rather than fnac was made because the amount of tissue taken is greater than with the latter, providing a high negative predictive value. it is reasonable that increasing the volume of tissue obtained from 1 step by cnb can be more effective than multiple samples of fnac to obtain a final diagnosis. the sensitivity of the method could be increased by performing several cnbs (23 or 35 samples according to garcia-ortega) from the cortex of the presumed sentinel node. do not recommend the use of cnb because of the potential complications of this procedure (eg, bleeding and nerve damage); previous reports have shown that such interventional procedures in all breast cancer patients are not cost-effective. on the other hand, complications can be reduced if the procedures are performed by an experienced, dedicated breast radiologist (within the breast unit). this feature is of major importance because, in early the stage, the lymph nodes usually have normal findings at us, and they are frequently small in size. consequently, the cutting needle must be sampling only the cortical layer if performed in a technically adequate way. the second element is identification of the axillary sentinel lymph node preoperatively using the gamma probe over the skin. combining the use of the gamma probe, with which the true sentinel node can be identified with reasonable confidence, and the us-guided cnb that can avoid the sampling error dictated by the reasons mentioned above (in case of fnac), the diagnostic sensitivity should, theoretically, increase. as a minimally invasive staging procedure, us-guided lymph node biopsy under percutaneous gamma probe surveillance seems attractive because it provides information during the preoperative period that could allow avoidance of intraoperative slnb if the sentinel node is negative, and hence, avoid alnd in case of micrometastasis or isolated tumor s cells. the most relevant predictive factor for sentinel node metastases is the primary carcinoma peritumoral vascular invasion. it could be suggested that whenever this pathology (or other findings) finding is found in association with a negative percutaneous sentinel node biopsy performed under us gamma probe guidance, intraoperative slnb should be mandatory. have reported the pre-operative use of gamma probe over the skin to detect axillary sentinel node under us guidance. the latter had evaluated the sentinel node s location using the gamma probe and then marked it with a hook wire, while motomura used the gamma probe combined with fnac to obtain the sample. to our knowledge, no other published study evaluated gamma probe-assisted sonographic localization combined with cnb of the presumed sentinel node as a one -step procedure in the pre-treatment phase of breast cancer patients. first, this is a pilot study that analyzed the feasibility of a new pre-treatment method proposed for detecting the sentinel node. second, the patient population is small because this is a pilot study, hence the results do not have a statistical impact. however, the concepts presented could improve the quality of lymph node sampling, particularly in early breast cancer patients. this could be particularly useful in cases that need slnb before neoadjuvant chemotherapy. the pre-treatment sentinel node evaluation technique described in this pilot study had shown a perfect concordance with the histological findings, even if the number of subjects enrolled in this study was relatively low. the accuracy and the clinical implications of the method in conclusion, gamma probe-assisted sonographic localization associated with cnb of the sentinel node in early breast cancer patients could be a feasible and accurate new method. further studies should investigate the definitive role of this method in pre-treatment breast cancer staging. particularly, it is necessary to investigate the clinical impact of this method in avoiding slnb, especially in cases when percutaneous sentinel node cnb is negative, without primary carcinoma peritumoral vascular invasion, in clinically node-negative breast disease patients.

summarybackgroundthe aim of this pilot trial was to study the feasibility of sentinel node percutaneous preoperative gamma probe-guided biopsy as a valid preoperative method of assessment of nodal status compared to surgical sentinel lymph node biopsy. material/methodsthis prospective study enrolled 10 consecutive patients without evidence of axillary lymph node metastases at preoperative imaging. all patients underwent sentinel node occult lesion localization (snoll) using radiotracer intradermic injection that detected a hot spot corresponding to the sentinel node in all cases. gamma probe over the skin detection with subsequent ultrasonographically guided needle biopsy of the sentinel node were performed. the percutaneous needle core histopathological diagnosis was compared to the results of the surgical biopsy. resultspreoperative sentinel node identification was successful in all patients. conclusionsthe combination of preoperative gamma probe sentinel node detection and ultrasound-guided biopsy could represent a valid alternative to intraoperative sentinel node biopsy in clinically and ultrasonographically negative axillary nodes, resulting in shorter duration of surgery and lower intraoperative risks.

PMC3560653

pubmed-263

lymphangioleiomyomatosis (lam) is a rare idiopathic disease that exclusively occurs in women of childbearing age, and this disease is characterized by the proliferation of abnormal smooth muscle cells in the lungs and along the thoracic and abdominal lymphatics (1-3). the disease primarily affects the lungs in the majority of cases, but extrapulmonary lam occasionally occurs with or without subsequent involvement of the lungs. lam involvement of the uterus is extremely rare and there have been only a few such reported cases (2-7), and the imaging findings of uterine lam have only been briefly mentioned in two reports (2, 5). in this article, we report the cross-sectional imaging findings of extensive lam involving the uterus and pelvic cavity in a 29-year-old woman with tuberous sclerosis complex (tsc) and we propose that certain imaging features and the clinical history may suggest the diagnosis. to the best of our knowledge, this is the first report of the imaging findings of lam involvement of female pelvic organs. when she was ten years old, she was diagnosed with tsc based on her history of seizure and mental retardation. five years previously, she underwent a pelvic magnetic resonance imaging (mri) study for the evaluation of menometrorrhagia and dysmenorrhea. the mr images showed several small (less than 3 cm) intramural and subserosal hemorrhagic lesions in the uterus and hematometra (fig. adenomyotic cysts and uterine leiomyomas with red degeneration were considered in the differential diagnosis based on the imaging at that time. endometrial drainage was performed for the hematometra, but no further treatment such as hormonal therapy was done. for the current visit, her serum ca-125 level was 204.01 u/ml, the ca 19-9 level was 50.11 u/ml and the hemoglobin level was 8.7 g/dl. 1c) showed multiple, large, lobulated, thick-walled cystic masses involving the uterus and the entire pelvic cavity, and these masses extended to the lower abdomen. the attenuation of the cystic masses was higher than that of simple fluid, which suggested hemorrhagic contents. both kidneys were enlarged by multiple, various sized masses with attenuations matching fat and soft tissue, which are findings compatible with angiomyolipomas. pelvic mr imaging showed huge, irregularly-shaped, cystic masses involving the uterus and parauterine pelvic cavity, and these masses were predominantly hyperintense on the fat-saturated t1-weighted image (fig. 1d) and they were heterogeneously hypointense and hyperintense on the t2-weighted image (fig. these cystic masses were thought to originate from the uterine myometrium on the sagittal t2-weighted image (fig. multiple loculated fluid collections with fluid-fluid levels were seen in the cul-de-sac. on the contrast-enhanced t1-weighted image markedly enlarged lam involving the uterus with extension to the pelvic cavity was suggested as the most probable diagnosis based on the follow-up imaging and clinical findings. the chest ct showed numerous, well-defined, thin-walled cysts that were diffusely distributed throughout the lungs (fig. 1 g). because the cysts were regularly round in shape and there was no associated nodular lesion, pulmonary lam was the suggested diagnosis, but she had no pulmonary symptoms. brain mr imaging showed multiple cortical and subcortical tubers as well as several subependymal nodules in the bilateral lateral ventricles, and this represented tuberous sclerosis (fig. the intraoperative findings revealed that the uterus was enlarged and distorted by multiple subserosal and intramural hemorrhagic cystic masses. the cystic masses also involved both adnexae, the pelvic side wall and the omentum. there were severe adhesive changes between the cystic lesions and the sigmoid colon and bladder. microscopic examination revealed that the tumor was composed of atypical smooth muscle cells (lam cells) arranged in short fascicles around dilated lymphatics and a ramifying network of endothelium-lined spaces (fig. immunohistochemical staining showed that the tumor cells were diffusely positive for smooth muscle actin and they were strongly multifocally positive for human melanin black-45 (hmb-45) (fig. the patient's hospital course was uneventful and she was discharged on the tenth postoperative day. lam results from the proliferation of abnormal-appearing smooth muscle cells in the lymph vessels, which causes dilatation and obstruction in the lymph vessels and this results in cystic collections of chylous material (1). these smooth muscle cells are classified in the family of perivascular epithelioid cells (pec), which is a cell type that is constantly present in a group of tumors, including lam, sugar tumors of the lung and pancreas, renal angiomyolipomas and clear cell myomelanocytic tumor of the falciform ligament (8, 9). these so-called " pecoma " all express hmb-45 (8). lam occurs in about 30% of the women with tuberous sclerosis complex (tsc), which is an autosomal dominant multisystem neurocutaneous disorder of highly variable penetrance, and it is characterized by hamartomas, seizure and mental retardation (1). due to the striking similarities in the pathological processes between the lam and tsc, lam has been considered a forme fruste of tsc, and lam is classified as a tsc-associated or sporadic form (5, 10). lymphangioleiomyomatosis predominantly affects the lung parenchyma and this is characterized by pulmonary cysts seen on ct. the extrapulmonary manifestation of lam is uncommon and this is mainly located in the retroperitoneum, pelvic cavity and the posterior mediastinum along the lymphatic channels (1-7). in a large study of 80 patients with pulmonary lam (11), the ct imaging findings of retroperitoneal lam were described as a low-attenuating (3-25 hounsfield unit [hu]), multilobulated mass, and the ultrasound findings were reported as a cystic mass with a thick echogenic rind. uterine involvement of lam is extremely rare, and to the best of our knowledge, only eight cases of pathologically proven uterine lam have currently been reported (2-7). six cases of uterine lam occurred in patients with the stigmata of tsc, and two patients did not have stigmata of tsc. most uterine lams were microscopic and they are incidentally found in patients undergoing evaluation for extrauterine disease (2). menorrhagia and/or pelvic pain have been reported in half of the cases, the same as in our case (2-7). the imaging findings of uterine lam were briefly mentioned in two gynaecological reports (2, 5). (2) reported that uterine lam simulated high-stage endometrial stromal sarcoma, and the ct finding of uterine lam was described as a large uterine mass, which was thought to be a fibroid. however, the surgery revealed multiple subserosal and intramural hemorrhagic nodules ranging in size from 2.5 to 4.0 cm and bloody ascites due to tumor perforation. (5) recently reported on a 5.5-cm hypervascular tumor between the uterus and the right ovary that showed low signal intensity on the t1-weighted mr image and intermediate signal intensity on the t2-weighted mr image. this mri finding is quite different from that of retroperitoneal lam and it is rather similar to that of uterine leiomyoma. the pathological examination in that case revealed multiple intramural leiomyomas and several fragments of irregular soft masses composed of hmb 45 positive lam cells. the most remarkable aspects of our case are the initial involvement of lam in the uterus that gradually grew into the pelvic cavity and the intratumoral bleeding. intratumoral bleeding may be caused by overdistention and rupture of the cysts. although the ct findings showed highly attenuating cystic masses involving the uterus and pelvic cavity, the mr imaging confirmed the hemorrhagic cystic nature of the masses by their signal intensity and the mr imaging exactly localized the masses. these imaging findings are consistent with the known imaging findings of retroperitoneal lam. however, if a patient is without a clinical history of tsc, then uterine intramural and subserosal leiomyomas with hemorrhagic and cystic degeneration, adenomyotic cysts and/or endometrial cysts, and malignant uterine and/or ovarian tumors with hemorrhage should be considered in the differential diagnosis. in summary, we report here on the extraordinary radiological findings of lam involving the uterus and pelvic cavity in a young woman with tsc. although uterine lam is rare, radiologists should consider the possibility of this disease when they see multiple cystic uterine or parauterine masses with or without internal hemorrhage in a patient with a history of tsc or pulmonary lam.

lymphangioleiomyomatosis (lam) is a rare idiopathic disease and this is characterized by a proliferation of abnormal smooth muscle cells in the lungs and in the lymphatic system of the thorax and retroperitoneum. the female genital tract is rarely affected by lam. we report here on the ct and mr imaging findings of extensive lam involving the uterus and pelvic cavity, and this was seen as multiple cystic uterine and parauterine masses with internal hemorrhage in a young female with tuberous sclerosis complex.

PMC3052620

pubmed-264

ts is a key enzyme in the de novo synthesis of dtmp, an essential precursor of dna, which catalyses the methylation of dump to dtmp. the critical role of ts in the nucleotide metabolism has made it an important target of a variety of chemotherapeutic agents including 5-fu, 5-fu prodrugs as capecitabine, and novel folate-based ts inhibitor such as raltitrexed and pemetrexed, used in the treatment of colorectal and other solid tumours. resistance to fluoropyrimidines and other ts inhibitors may occur through a variety of mechanisms including elevated intracellular ts levels resulting from increases in ts transcription and translation. in crc patients the ts intratumoural expression may predict for the sensitivity to 5-fu and other ts inhibitor-based chemotherapies [5, 6] and may also be an important prognostic marker. high ts expression in early stage crc patients seems to predict for poorer overall survival in both chemotherapy-treated and untreated patients following surgery. also, metastatic crc patients with high ts levels are unlikely to respond to infusional treatment with 5-fu, whereas patients with low ts levels have higher than average response rate [8, 9]. in a previous study, however, we demonstrated that higher ts levels are favourable prognostic factors for disease free and overall survival. to date the real value of the ts level as prognostic factor is doubtful and some authors are in disagreement about it. the ts gene, containing 7 coding exons, is located in chromosome 18q, for which a high percentage of monosomic loss has been reported to be cell-cycle dependent, although some recent evidence points are more oriented towards proliferation-dependence. it can be predicted that mutations in the ts gene might result in a modification of its structure and then in its ability to interact with the fluoropyrimidines. this prediction has been born out in a variety of studies [1215]. s. h. berger and f. g. berger reported that the human colon tumour cell line hct116 produces a variant structural form of ts, in addition to the common form found in all colon cell lines tested. among the ts overproduction derivatives of hct116, cells overexposing the novel forms are more resistant to fdurd, compared with cells overexpressing the normal form so, an association between drug response and altered ts structure could suggest that the novel ts form, which is encoded by a variant structural ts gene, confers relative resistance to fdurd; this was supported by preliminary kinetic data indicating that this novel form has a reduced affinity for fdump. this variant form presents a replacement of an evolutionary conserved tyrosine by a histidine at residue 33 of the ts polypeptide [17, 18]; this mutation represents the only difference between the two ts forms and must account for the structural and functional differences between them. in an our previous paper we performed the analysis of the ts structure in patients bearing crc to try to demonstrate the presence of that specific mutation, but we did not find it in any patient. here, we intend to proceed on the use of sequencing techniques to see if any ts variant form could be present in human cancer samples from patients who underwent surgery for primary colorectal cancer and previously untreated and try to find relationship between any hypothetical ts variant form with the 5-fu treatment. we performed the ts-dna gene sequence in 68 cancer samples from patients of different dukes ' stages (a, b, and c) and histological grade but we did not find any change in the ts-dna structure. ts structure was assessed in a series of 68 patients who underwent surgery for primary colorectal carcinoma confirmed histologically and previously untreated. the following exclusion criteria were applied: history of other neoplasias apart of crc and death occurring within 30 days following surgery and due to postoperative complications. the tumours were staged and graded according dukes ' system and their clinicopathological features were summarised in tables 1, 2, and 3. the samples at surgery were divided in two parts: one was frozen at 80 until analysis, and the other portion was embedded in paraffin to confirm histologically the absence of contamination by normal and necrotic tissue and lymphocytes. genomic dna was extracted from tumour and mucosa samples with a commercial kit purchased from qiagen (kjvenlo, the netherlands) and stored at 20. the ts gene of tumour and mucosa samples was amplified in seven different pcr reactions using dna primers of 1620 bases in length placed in the adjacent intronic regions of exons 1, 2, 3, 4, 5, 6, and 7 and listed in table 4. amplification was performed using a perkin elmer model 2400 thermal cycler (boston usa). reaction mixture included 5 l of 10% dimethylsulfoxide, 5 l of 10 buffer, 1.5 l of 1.5 mm mgcl2, 1 l of 10 mm dntps, 200500 ng of genomic dna, 200 pmol of both upstream and downstream primers, and 1 units of taq dna polymerase, in a final volume of 50 l. amplification was run for 35 cycles with each cycle consisting in a denaturation step at 95c for 1 minutes, a primer annealing step at 51c for 1 minute, and an extention step at 72c for 2 minutes. pcr was terminated by incubation at 72c for 10 minutes. the length of the amplification products ranged from 180 to 310 bases. dna samples, generated with independently repeated pcr products, were sequenced with the sequitherm excel ii dna sequencing kit (epicenter, madison, wi) on a li-cor 4000 (mwg-biotech, ebersberg, germany) sequencer. the enzyme structure obtained by sequencing the ts genomic dna of each sample was performed in 68 patients with operable crc, untreated with previous chemotherapy. primary tumours and corresponding colonic mucosa were obtained from each patient and the ts genomic structure was performed on each of them, after histological control. 7 patients had g1 histological grade, 36 had g2, and 25 had g3 histological grade; 10 patients had dukes ' a tumours, 27 patients had dukes ' b, and 31 patients had dukes c cancers. the median age of patients was 67 years; 30 patients were male and 38 female. in all the tumour samples evaluated we did not find any ts-dna variant structure in tumour: all a, b, and c dukes ' patients showed stable ts-dna, and also in the germline genome no ts-dna variants have been observed. the structure of the macromolecular target of a cytotoxic drug is a critical determinant of cellular sensitivity to that drug. recently, ts has become the subject of several studies aimed to elucidate a possible clinical role of ts detection either as determinant of drug resistance or as prognostic marker of the disease and predictive factor of the treatment. many studies are currently examining the real value of ts expression levels as a prognostic factor, but in the mean time significant uncertainty prevails; whatever its prognostic influence, to date no studies have been able to establish a cut-off all of these in vitro studies have promising implications in the study of the role of ts in clinical practice. moreover, the unclear meaning of levels not only as a prognostic indicator but also as marker predictive of resistance could be due to mechanisms different from over expression, as mutation. in fact some authors focused their attention on the ts structure with a double aim: development of a new classes of ts-inhibitors with a different mechanism of action and generation of ts mutants to develop gene-therapy strategies. berger and coworkers showed that a single naturally occurring change, a tyr to his replacement, in the primary structure of the ts molecule confers relative resistance to the ts-directed antimetabolite fdurd in hct 116 cells. the tyr to his mutation is the only difference between the altered form of ts and the normal form and, therefore, must be responsible for the diminished effectiveness of the enzyme as a drug target. the data in those studies, together with previously published experiments, strongly favour the notion that the tyr to his ' mutation is responsible for the relative fdurd resistance of cell line hct 116 [15, 16]. however, as noted earlier, it is quite possible that factors in addition to this mutation contribute to the phenotype of hct116 and other colon cell lines. the frequency of the tyr33 to his33 mutation in the normal and in the pathological human populations is unknown. the altered ts may exist as a polymorphism in humans; alternatively, it may have spontaneously arisen during tumorigenesis or during establishment of the cell lines in culture. distinguishing among these possibilities will be of great utility in assessing whether variant forms of ts identified in cultured cell lines are segregating in the human population and have an impact upon clinical response to 5-fluorouracil therapy in cancer patients. on the basis of this knowledge we hoped to see if in human crc samples it could be possible to find the same tyr33 to his33 substitution in the ts structure and eventually to correlate this finding with some clinicopathological parameters such as age and sex, tumour size and location, histological grade, dukes ' stage, 5-fu and raltitrexed treatment, and disease free and overall survivals, to see if that point mutation could be considered a reliable marker of drug resistance and of prognosis. in those samples we did not find that point mutation at the codon 33. in this study we intend to proceed on the use of sequencing techniques to see if any ts variant form could be present in human cancer samples from patients who underwent surgery for primary colorectal cancer (crc) and previously untreated and try to find a relationship between any hypothetical ts variant form with the 5-fu treatment and prognosis. we performed the ts-dna gene sequence in 68 cancer samples from patients of different dukes ' stages (a, b, and c) and histological grade, but we did not find any mutation in the ts-dna structure. the conclusions that could be drown are that in dukes ' a, b, and c crcs there are no changes in the ts-dna gene structure and that the evaluation of the ts expression is the main crc prognostic and drug response marker. what remains is to evaluate the ts gene structure of the d metastatic dukes ' crcs: in these tumours it might be possible to find ts-dna structural changes related with their higher genomic instability and this fact could give an explanation of the 5-fu drug resistance and worse prognosis.

thymidylate synthase (ts) catalyzes methylation of dump to dtmp and it is the target for the 5-fluorouracil (5-fu) activity. barbour et al. showed that variant structural forms of ts in tumour cell lines confer resistance to fluoropyrimidines. we planned to perform the whole ts gene structure by means of sequencing techniques in human colorectal cancer (crc) samples to try to identify the presence of any possible ts variant form that could be responsible of fluoropyrimidines drug resistance and of the worse prognosis. we performed the ts-dna gene sequence in 68 crc from patients of a, b, and c dukes ' stages and different histological grade, but we did not find any mutation in the ts-dna structure. in the future we intend to widen the ts structure analysis to the metastatic crcs, because due to their higher genomic instability, they could present a ts variant form responsible of the fluoropyrimidines drug resistance and the worse prognosis.

PMC2915790

pubmed-265

nevus lipomatosus cutaneous superficialis (nlcs) was first described by hoffman and zuhrelle in 1921.1 it s a rare idiopathic hamartomatous benign condition characterized by the presence of an ectopic mature adipose tissue within the dermis. it is classified into two clinical variants: the classical form, usually composed of multiple and grouped skin-colored, pedunculated and cerebriform nodules that often coalesce to form a plaque and a second more rare form, presenting as a solitary dome-shaped sessile papule or nodule.24 we report here eight cases of nlcs in order to assess the epidemiologic, clinical, and pathological features, as well as the management of this uncommon neoplasm. this study was a retrospective case series including all patients with histopathologically documented nlcs, who attended the dermatology department of charles nicolle hospital in tunisia during the last 14 years; between january 1997 and december 2010. for each patient, we recorded the following data: age, sex, duration of the lesions, their localizations, number, and size as well as their management and evolution. ethical approval and informed consent eight patients with nlcs were observed, three males and five females, aged between 7 and 41 years. in patients number 4, 5, 7, and 8, lesions had begun during childhood (at 1, 4, 5, and 6 years respectively). for the other four patients (number 1, 2, 3, and 6) lesions had begun in the third to fourth decade of life. clinical presentation was that of the classical form in seven patients and of the solitary form in one patient (patient number 3). in four patients it was one of the limbs which had the lesion, and in the other four patients it was the trunk (figure 1: patient 8; figure 2: patient 5). soft, skin-colored voluminous tumor (10 cm x 7 cm) of the left buttock composed of multiple nodules with a cerebriform surface. histopathological features were typical of nlcs showing ectopic mature adipose tissue in the dermis (figure 3). table 1 summarizes the main epidemiologic, clinical and pathological features, and management of nlcs in all eight patients. table 1epidemiologic, clinical and pathological features, and management of nevus lipomatosus cutaneous superficialis (nlcs) in all eight patients. patientsexage (years)durationlocationclinical aspecthistopathologytreatment1m381 yearleft buttockplaque of several soft skin-colored nodules of 1 cm to 2 cmmature adipose tissue in reticular dermis without connection to the hypodermissurgical resection2f383 monthsrigth thighmultiple soft yellowish papules coalescing into plaquesectopic mature adipocytes in reticular dermisabstention3f391 yearleft shoulderone soft skin-colored nodule of 1 cmlobular proliferation of fat tissue in the dermissurgical resection4m76 yearsright shoulderlarge (6 cm x 2 cm) soft skin-colored verrucous plaque composed of nodules and papulesectopic mature adipocytes in reticular dermissurgical resection5m2420 yearslumbar area1 cm to 3 cm-grouped soft skin-colored papulesepidermal acanthosis, ectopic mature adipocytes in papillary dermissurgical resection6f3210 yearsthighmultiple soft skin-colored papules coalescing into a 5 cm plaqueepidermal acanthosis; hyperkeratosis; dermal proliferation of mature adipocytessurgical resection7f149 yearsflanklarge (6 cm x 2 cm) soft skin-colored plaque composed of nodulesthinned epidermis, ectopic mature adipose tissue in reticular dermissurgical resection8f4135 yearsleft buttocksoft, skin-colored voluminous tumor (10 cm x 7 cm) composed of multiple nodules with a cerebriform surfacenormal epidermis, mature fat cells in reticular dermis without hypodermis connectionsurgical resectionf=female; m=male. epidemiologic, clinical and pathological features, and management of nevus lipomatosus cutaneous superficialis (nlcs) in all eight patients. nlcs is more commonly present from birth, but can appear later in life; there is neither sex predilection nor familial trend in this disorder.1 in this study, there were five cases in which the lesion appeared in the first three decades, and in three cases nlcs appeared after 35 years. two clinical patterns of nlcs exist; a multiple form or classical type, and the solitary form. in the classical type, lesions are congenital or they develop usually during the first two to three decades of life.5,6,7 it consists of multiple papules, skin colored or yellowish, coalescing into plaques with zosteriform, linear or segmental distribution. the lesions are slow-growing, with a smooth or cerebriform surface, and can reach a large size if left untreated. the largest size reported so far has been 40 cm x 28 cm.8 the most common sites are the pelvic girdle, the lower trunk, the gluteal region, and the thigh. the second clinical pattern of nlcs is a solitary papule or nodule mimicking skin tag,8 usually appearing later than the classical form, during the third to sixth decades of life.3,6,9 it can occur at any site, including unusual ones like the scalp, the eyelid, the nose, and the clitoris.1,1013 solitary form was also called pedonculated lipofibroma by mehregan et al. because of its distinctive clinicopathologic features in comparison with the multiple form.9,14 among the presented cases, there were seven cases with the classical form and one case with the solitary form (case 3), whilst in another tunisian study the solitary type was predominant: 11 cases out of 13.15 nlcs have an indolent and asymptomatic course. recently, a case of ulnar nerve entrapment accompanied by numbness and straining in the forearm, caused by nlcs, was reported and was treated by partial excision for symptomatic recovery.16 occasionally, nlcs may ulcerate after external trauma or ischemia. in two previously reported cases, surface of nevus was studded with multiple open comedons,2,17 and foul-smelling discharge may be associated.2 nlcs has been reported in association with other cutaneous disorders; follicular papules and hypertrophic pilo-sebaceous units,18 angiokeratoma of fordyce,4 scattered leukoderma, caf-au-lait macules,2 and hemangioma.4 in our study, no associated skin abnormalities were present. to our knowledge, there are no systemic abnormalities or malignant transformation described with nlcs. nlcs should be clinically differenciated from nevus sebaceous, neurofibroma, lymphangioma, focal dermal hypoplasia, cylindroma, trichoepithelioma, and angiolipoma. histopathological evaluation is required for diagnosis showing ectopic mature adipocytes, intermingled with collagen bundles, and proliferating around the periadnexial adventitial dermis and the perivascular area. mature fat cells proliferate in reticular dermis and may extend to the papillary dermis.2,6,7 in the most characteristic feature of nlcs, there is usually no connection to the subcutaneous fat tissue; for some authors this condition is necessary to establish diagnosis of nlcs.6 several studies documented increased vascularity in the subpapillary and papillary dermis; epidermal changes have been reported, like mild to moderate acanthosis, basket weave hyperkeratosis, increased basal pigmentation, and focal elongation of rete pegs.3 adnexal structures may be reduced,3 and abnormal folliculosebaceous structures were reported in some cases such as sebaceous trichofolliculoma, folliculosebaceous cystic hamartoma, and dermoid cysts.7,19 in our study, diagnosis of nlcs was based on characteristic clinical aspects and confirmed by typical histopathological features. the genetic background of nlcs is still unknown, only one cytogenetic study was reported recently showing a 2p24 deletion.20 the pathogenesis of nlcs remains unknown. several theories have been proposed: hoffman and zuhrelle postulated that fat deposition in the dermis is secondary to degenerative changes (metaplasia) in the connective tissue.3 other authors hypothesized that adipocytes originate from the pericytes of dermal vessels.2,21 for others, fat cells represented a true nevus that resulted from the focal heterotopic development of adipose tissue.22 treatment is usually not necessary unless for cosmetic reasons. the treatment of choice is surgical excision, which is curative, and post surgical recurrence is rare. patients unwilling for surgery may undergo cryotherapy which yields partial but satisfactory results.8 recently, a case of classic nlcs successfully treated with co2 laser was reported with no recurrence during a follow-up period of 12 months.23 in this retrospective study, we did nt investigate chromosomal abnormalities to identify the genetic biomarkers of this congenital pathology, since cytogenetic analysis was reported in only one previous study.20 physicians should be aware of this rare condition because early recognition enables more conservative resection of the tumor and less invasive reconstruction of the defect. nlcs is a rare skin malformation; we report herein a large case series of eight patients where the classical form is predominant. our study may give additional data about epidemiological and clinical pattern of this hamartoma. further studies are needed, especially prospective studies, by using chromosomal analysis to reach conclusions about the role of the genetic abnormalities in the development of this hamartoma.

introductionnevus lipomatosus cutaneous superficialis (nlcs) is a rare benign hamartomatous skin tumor characterized by dermal deposition of mature adipose tissue. it s classified in two types: the classical form with multiple soft, pedunculated, cerebriform papules and nodules that coalesce into plaques, and the solitary form that consists of a solitary papule or nodule. in this study, eight cases of nlcs are reported. methodsthe study was a retrospective case series including all patients with histopathologically documented nlcs who attended the dermatology department of charles nicolle hospital between january 1997 and december 2010. the objective of our study was to determine the epidemioclinical characteristics, the histopathologic features, and the treatment of this hamartoma. patients included three males and five females aged between 7 and 41 years. resultsin four cases hamartoma was present since childhood, and in the other four cases it appeared in the third and fourth decades. classical form was noted in seven cases and the solitary form in one case. lesions involved limbs in four patients and trunk in four patients. seven patients underwent surgical excision, and for one case no treatment was proposed. conclusionthe multiple or classical form is largely predominant in our study. habitually, nlcs has an asymptomatic course. treatment is usually not necessary unless for cosmetic reasons; surgical excision is curative and recurrence after is rare.

PMC3437641

pubmed-266

the use of chemotherapy in the treatment of cancer has opened new possibilities for improvement of the quality of life of cancer patients. despite its success, treatment with some of the most effective anticancer drugs, the mechanism of cisplatin (cis-diamminedichloroplatinum (ii) or cddp) induced nephrotoxicity has gradually been elucidated. studies have shown an increase in lipid peroxides in the renal tissue of cddp-administered animals, a decrease in reduced glutathione levels, and the induction of metallothionein, an antioxidant. these changes have been considered to result from the generation of reactive oxygen species (ros). studies using chemiluminescence or electron spin resonance (esr) have shown that cddp generates oh radical [5, 6]. nephrotoxicity involves kidney damage or dysfunction arising from direct or indirect exposure to drugs and industrial or environmental chemicals. cisplatin (( cis-diamminedichloroplatinum (ii) or cddp)), an anti-neoplastic drug have been reported to induce nephrotoxicity. the kidney which is the major route of cisplatin excretion also accumulates it to a greater degree than other organs [6, 8]. oxidative stress, inflammation, and apoptosis are some of the mechanisms already established to explain cisplatin induced acute kidney injury. a number of strategies have been proposed for the prevention/management of cisplatin induced nephrotoxicity, since there is no specific treatment, with the use of some synthetic drugs which have been popular. however, these drugs have some associated risks and side-effects, hence, the need for natural alternatives of plant origin (plant foods/extracts) with little or no side-effect. plants have limitless ability to synthesize aromatic substances such as polyphenols, mainly flavonoids, and phenolic acids, which exhibit antioxidant properties due to their hydrogen-donating and metal-chelating capacities. polyphenols are secondary metabolites of plants and are widely distributed in plant-derived foods, such as cereals, legumes, nuts, vegetables, and fruits, and in beverages such as green or black tea, and fruit juice. tannic and gallic acids are two commonly phenolic acids that are structurally related. tannic acid, a naturally occurring plant polyphenol, is composed of a central glucose molecule derivatized at its hydroxyl groups with one or more galloyl residues, whereas gallic acid is a trihydroxybenzoic acid, also known as 3,4,5-trihydroxybenzoic acid, which is widely distributed in green tea, red wine and grapes, witch hazel, sumac, oak bark, and other plants. considerable amounts of experimental data on the antioxidant activity of both tannic acid and gallic acids with emphasis on structure-function antioxidant activity have been reported. also, several authors have demonstrated that tannic acid and other polyphenols have antimutagenic and anticarcinogenic activities [1316]. extensive studies have been carried out on the protective effect of cotreatment and posttreatment of phenolic acids against cisplatin induced nephrotoxicity. hence, this study was carried out to investigate and compare the protective effect of administration of both tannic and gallic acids on normal and cisplatin induced nephrotoxicity in rats. male albino rats weighing 110185 g used for this experiment were purchased from a private animal colony, ikere-ekiti metropolis. the rats were maintained at 25c on a 12 hour light/dark cycle with free access to food and water. they were acclimatized under these conditions for two weeks prior to the commencement of the experiments. the experimental study was approved by the institutional animal ethical committee of the university of ado-ekiti, nigeria. chemicals such as tannic acid, gallic acid, oxidized and reduced glutathione, hydrogen peroxide (h2o2), dithionitrobenzene (dtnb), thiobarbituric acid (tba), and adrenaline were purchased from sigma chemical co. (st. ethanol, acetic acid, h2so4, sodium carbonate, sodium citrate, sodium azide (nan3), sodium chloride, potassium dichromate, tris-hcl buffer, sodium dodecyl sulphate (sds), and ascorbic acid were sourced from bdh chemicals ltd. may-grnwald, giemsa, and hematoxylin and eosin (h&e) stains were purchased from hi-media labs, mumbai. all the kits used for bioassay were sourced from randox laboratories ltd., crumlin, county antrim, uk. except stated otherwise, all other chemicals and reagents were of analytical grades and the water was glass-distilled. after two (2) weeks of acclimatization, 80 male rats were randomly divided into eight (8) groups of ten animals each: group i served as a normal control and received saline (0.85 w/v%) orally for 7 consecutive days and on the 7th day, 1 hr after receiving the oral saline dose, the rats received a single i.p. group ii served as toxicant group and received saline (0.85%) orally for 7 consecutive days. ga was orally administered at two doses, 20 and 40 mg/kg body weight (bwt), to groups iii and iv, respectively, for 7 consecutive days. also, ta was orally administered at two doses, 20 and 40 mg/kg body weight (bwt), to groups vi and vii, respectively, for 7 consecutive days. on the 7th day of pretreatment, a single i.p. dose of cisplatin (7.5 mg/kg bwt) after oral treatment of ga and ta was given to the animals in groups ii, iii, iv, vi, and vii. groups v and viii received only higher dose (40 mg/kg) of ga and ta orally for 7 consecutive days, respectively, and on the 7th day 1 hr ga and ta treatment received a single i.p. injection of saline (0.85%) to ensure that groups v and viii received only the higher dose of ga and ta; this was done in order to test that the higher dose did not produce any kind of toxic effects. the doses of ta and ga used were actually selected on the basis of preliminary dose escalation studies to determine the minimum dose of ta and ga required to produce an observable effect (data not shown). uric acid, urea, and creatinine were determined using commercially available kits (randox laboratories uk). tissue malondialdehyde (mda) content was determined as described by ohkawa et al.. tissue antioxidant parameters were also determined; superoxide dismutase (sod) by the method of alia et al., catalase (cat) by the method of sinha, reduced glutathione (gsh) by the method of ellman, and glutathione peroxidase (gpx) by the method of rotruck et al.. at the end of the experiment, whole blood of the sacrificed rats were collected into edta bottles and centrifuged at 800 g for 10 min to separate the plasma. the plasma was then decanted into plain sample bottle and stored in a refrigerator prior to analysis. the rat's tissues (kidney) were rapidly isolated, placed on ice, and weighed. the tissue was rinsed in cold (0.9% w/v) normal saline (1: 3, w/v) and subsequently homogenized in sodium phosphate buffer (ph 7.4) with (1: 5 bt w/v) using mortar and pestle as homogenizer and the homogenates were centrifuged at 4,000 g. the uric acid concentration was determined using colorimetric method as described by collin and diehl and morin and prox. briefly, 20 l of distilled water was added to 20 l of the sample which was mixed with 1 ml of hepes reagent (50 mm phosphate buffer, 4 mm 3,5-chloro-2-hydroxybenzenesulfonic acid) and enzyme reagent (0.25 mm 4-aminophenazone, peroxidise, and uricase). thereafter, the mixture was incubated for 5 min at 37c and the absorbance at 520 nm was taken against reagent blank within 30 min. the urea concentration was determined using colorimetric method as described by searcy et al.. briefly, 10 l of sample was added to 0.1 ml of sodium nitroprusside 6 mm sodium nitroprusside, 1 g/l urease) after which the mixture was incubated for 10 min at 37c. 2.5 ml of 120 mm diluted phenol and 2.5 ml of 27 mm sodium hypochlorite solution containing 0.14 n sodium hydroxide which was then added to the reaction mixture. thereafter, the mixture was incubated for 15 min at 37c and the absorbance at 546 nm was taken against reagent blank within 8 hours. the creatinine concentration was determined using colorimetric alkaline picrate method as described by jaffe method. briefly, 50 l of distilled water was added to 2 ml of working reagent (35 mm picric acid and 0.32 m sodium hydroxide) before 50 l of sample was added. the absorbance at 492 nm was taken twice, firstly after 30 sec and secondly after 2 min. the creatinine concentration was subsequently calculated against the standard, using change in the sample absorbance (absorbance). arginase activity was determined by the measurement of urea produced by the reaction of ehrlich's reagent according to the modified method of kaysen and strecker. the reaction mixture contained 1.0 mm tris-hcl buffer, 1.0 mm mncl2 (ph 9.5), 0.1 m arginase solution and 500 ml of the enzyme preparation. the mixture was incubated for 10 mins at 37c. the reaction was terminated by the addition of 2.5 ml ehrlich reagent (2.0 g of p-dimethylaminobenzaldehyde in 20.0 ml of concentrated hydrochloric acid and made up to 100 ml with distilled water). superoxide dismutase (sod) was determined by the method of alia et al.. 50 l of supernatant was treated with 1000 l of 50 mm carbonate buffer (ph 10.2) and 17 l of adrenaline (0.06 mg/ml). the absorbance was read at 480 nm in spectrophotometer for 2 minutes at 15-second intervals. sod activity was expressed as ui per 100 g protein (480=4.02 mmcm). the reaction mixture (1.5 ml) contained 1.0 ml of 0.01 m phosphate buffer (ph 7.0), 0.1 ml of tissue homogenate, and 0.4 ml of 2 m h2o2. the reaction was stopped by the addition of 2.0 ml of dichromate-acetic acid reagent (5% potassium dichromate and glacial acetic acid were mixed in 1: 3 ratio). then, the absorbance was read at 620 nm: cat activity was expressed as moles of h2o2 consumed/min/g protein.. 1 ml of supernatant was treated with 500 l of ellman's reagent (19.8 mg of 5,5dithiobisnitrobenzoic acid in 100 ml of 0.1% sodium citrate) and 3.0 ml of 0.2 m phosphate buffer (ph 8.0). the activity of glutathione peroxidase (gpx) was assayed by the method of rotruck et al.. the reaction mixture containing 0.2 ml of edta (0.8 mm, ph 7.0), 0.4 ml of phosphate buffer (10 mm), and 0.2 ml of tissue homogenate was incubated with 0.1 m of h2o2 and 0.2 ml of glutathione for 10 min. the activity of gpx was expressed as l mol glutathione oxidized/min/g protein. the lipid peroxidation assay was carried out using the modified method of ohkawa et al.. briefly, 300 l of tissue homogenate, 300 l of 8.1% sds (sodium dodecyl sulphate), 500 l of acetic acid/hcl (ph=3.4), and tba (thiobarbituric acid) were added, and the mixture was incubated at 100c for 1 thereafter, the thiobarbituric acid reactive species (tbars) produced was measured at 532 nm and calculated as malondialdehyde (mda) equivalent. one-way analysis of variance was used to analyze the results and duncan multiple tests were used for the post hoc analysis. statistical package for social science (spss) 10.0 for windows was used for the analysis. as evident from table 1, administration of a single dose of cisplatin (7.5 mg/kg bwt) caused a significant increase in the biomarkers of renal function (creatinine, urea, and uric acid) when compared with the control group that received only saline (0.85% w/v). however, pretreatment with gallic and tannic acids orally at two doses, 20 and 40 mg/kg body weight, respectively, shows a significant (p<0.05) improvement of renal function due to a decrease in the creatinine, urea, and uric acid levels when compared with the induced group (group 2). also, administration of a single i.p dose of cisplatin (7.5 mg/kg bwt) caused a significant decrease in the biomarkers of oxidative stress [superoxide dismutase (sod), catalase (cat), glutathione peroxidase (gpx), and reduced glutathione (gsh)] when compared with the control group that received only saline (0.85% w/v) (table 2). however, pretreatment with gallic and tannic acids orally at two doses, 20 and 40 mg/kg body weight, respectively, shows a significant (p<0.05) improvement in the body's antioxidant status by an increase in the activities of superoxide dismutase (sod), catalase (cat), glutathione peroxidase (gpx), and reduced glutathione (gsh) when compared with the induced group (table 2). likewise, there was a significant (p<0.05) increase in the malondialdehyde (mda) content in rat kidney administered a single i.p dose of cisplatin (7.5 mg/kg bwt). however, both pretreatment with gallic and tannic acids orally at two doses, 20 and 40 mg/kg body weight, respectively, shows a significant (p<0.05) reduction of mda content in rat kidney when compared with the induced group (figure 1). figure 2 revealed that administration of a single i.p dose of cisplatin (7.5 mg/kg bwt) caused a significant (p<0.05) increase in arginase activity when compared with the control group that received only saline (0.85% w/v). however, pretreatment with gallic and tannic acids orally at two doses, 20 and 40 mg/kg body weight, respectively, shows a significant (p<0.05) decrease in arginase activity when compared with the induced group (group 2). photomicrographs of kidney sections from various treatment groups are shown in figures 3, 4, and 5. histopathological examination of sections from rat kidney administered a single i.p dose of cisplatin (7.5 mg/kg bwt) shows severe and generalized tubular epithelial cell necrosis associated with diffuse tubular lumina when compared with the control without cisplatin. however, pretreatment with gallic and tannic acids orally at two doses, 20 and 40 mg/kg body weight, respectively, shows a marked improvement on kidney damage. about 25% of most commonly used drugs in intensive care units (icus) are potentially nephrotoxic and are recognized as considerable health and economic burden worldwide. among them, cisplatin, when used in cancer chemotherapy, induces renal impairment and acute renal failure by induction of reactive oxygen species, tubulointerstitial inflammation, and apoptosis. although various studies have been reported on the benefits of several agents in cisplatin induced renal toxicity, the basis of nephroprotection remains elusive. this makes the search for strategies to prevent nephrotoxicity constitute an active area of investigation. hence, it is reasonable to assume that a reinforcement of antioxidant defense of renal tissue by exogenous antioxidant such as phenolic acids should be a strategy to protect the kidney from the oxidative damage. in the present study, we compare the protective effect of administration of gallic and tannic acids (two commonly phenolic acids that are structurally related) of the same dosage against normal and cisplatin induced renal injury in rats for the first time by attenuating renal oxidative stress. the elevations of key kidney function biomarkers such as creatinine, uric acid, and urea have been suggested to be indicative of reduced renal functions [30, 31]. thus, estimation of plasma creatinine and uric acid has been employed as key test to assess kidney function [30, 31]. in the present study, the observed elevation in plasma creatinine, urea, and uric acid levels in induced rats this finding is consistent with that reported by earlier studies [32, 33]. however, the restoration of the plasma creatinine, urea, and uric acid level in rats treated with both gallic and tannic acids (table 1) suggests that both phenolic acids have the ability to prevent kidney damage and protect the kidney against nephrotoxicity. this, however, may be a function of their antioxidant properties and ability to inhibit arginase activity (figure 2). cisplatin increased arginase activity in the rat's kidney, while the pretreatment with both gallic and tannic acids at two doses (20 and 40 mg/kg bwt), respectively, for 7 days resulted in a decrease in kidney arginase activity (figure 2). arginase is a hydrolytic enzyme responsible for the conversion of l-arginine to l-ornithine and urea. ornithine is an important biosynthetic precursor of polyamines which have been implicated to facilitate cell proliferation in certain cancer cells. another important enzyme, endothelium nitric oxide synthase (enos), competes with arginase for the same substrate, arginine. the no produced plays an important role in both regulating renal hemodynamics and modulating inflammatory and proliferating response to various stimuli. therefore, inhibition of arginase activity slows the progression of renal failure in renal ablation. the increase in the kidney and plasma mda content (figure 1) in the induced rats suggests lipid peroxidation. this agreed with earlier studies where administration of cisplatin caused inflammation and lipid peroxidation [6, 7]. this could be as a result of increased hydrogen peroxide concentration produced in the kidney due to the depletion of antioxidant enzymes: superoxide dismutase (sod), reduced glutathione (gsh), and catalase (cat) activity (table 2). this also is consistent with earlier study where depletion of sod, cat, and gpx in rats resulted in increased mda concentration due to lipid peroxidation. the depletion of these antioxidants suggests that cisplatin induced nephrotoxicity could be a result of oxidative stress or suppression of the antioxidant enzymes, as previously reported by earlier studies [3537]. however, the reduced kidney and plasma mda content (figure 1) and restoration of sod, gsh, and cat activities (table 2) in pretreated rats suggest an improvement in the in vivo antioxidant status, which may be a function of the antioxidant properties of the phenolic acids (gallic and tannic acids) therefore, the observed decrease in the kidney gsh level (table 2) in the induced rats suggests cisplatin induced nephrotoxicity, which is associated with a drastic reduction in kidney gsh content. this finding is consistent with earlier studies where gsh depletion was suggested to be due to the interaction of cisplatin with the molecules contain sulfhydryl groups [39, 40]. however, restoration of gsh levels in the pretreated rats suggests the antioxidant and nephroprotective properties of the phenolic acids (table 2). furthermore, histopathology study revealed normal glomerulus and tubules with intact renal architecture in normal (figure 3(a)), gallic (figure 5(a)), and tannic acid (figure 5(b)) group without cisplatin injection. degenerated tubular structures with vacuolization and loss of architecture were seen in cisplatin induced group (figure 3(b)). pretreatment with both gallic and tannic acids at two doses (20 and 40 mg/kg bwt), respectively, for 7 days resulted in excellent protection against nephrotoxicity induced by cisplatin and showed predominant normal kidney morphology (figures 4(a), 4(b), 4(c), and 4(d)). the results of the present study revealed that oxidative stress and apoptosis/necrosis play an important role in pathogenesis of cisplatin nephrotoxicity. gallic and tannic acids, two important pharmacologically active phenolic compounds, reduced cisplatin induced functional and histological renal damage. furthermore, they suppressed the generation of ros, lipid peroxidation, and oxidative stress in kidney tissues. these results indicated that both gallic and tannic acids exhibit nephroprotective effect and the possible mechanism of action by which they exert this effect could be due to their antioxidant properties and inhibition of arginase activity. however, tannic acid exhibited better nephroprotective potential than gallic acid which may be due to the glycosidation with a glucose moiety.

cisplatin (cis-diamminedichloroplatinum (ii) or cddp), used in the treatment of many solid-tissue cancers, has its chief side-effect in nephrotoxicity. hence, this study sought to investigate and compare the protective effect of gallic acid (ga) and tannic acid (ta) against cisplatin induced nephrotoxicity in rats. the rats were given a prophylactic treatment of ga and ta orally at a dose of 20 and 40 mg/kg body weight for 7 consecutive days before the administration of a single intraperitoneal (i.p.) injection of cisplatin (cp) at 7.5 mg/kg bwt. the protective effects of both ga and ta on cp induced nephrotoxicity were investigated by assaying renal function, oxidative stress biomarkers, and histopathological examination of kidney architecture. a single dose of cisplatin (7.5 mg/kg bwt) injected i.p. caused a significant increase in some biomarkers of renal function (creatinine, uric acid, and urea levels), with a marked elevation in malondialdehyde (mda) content accompanied by a significant (p<0.05) decrease in reduced glutathione (gsh) content (103.27%) of kidney tissue as compared to control group. furthermore, a significant (p<0.05) reduction in kidney antioxidant enzymes (sod, catalase, gpx, and gst) activity was observed. however, pretreatment with oral administration of tannic acid and gallic acid at a dose of 20 and 40 mg/kg body weight, respectively, for 7 days prior to cisplatin administration reduced histological renal damage and suppressed the generation of ros, lipid peroxidation, and oxidative stress in kidney tissues. these results indicate that both gallic and tannic acids could serve as a preventive strategy against cisplatin induced nephrotoxicity.

PMC4897306

pubmed-267

while it is true that not all patients are able to dialyse themselves at home, it is a sad fact that many are never given the chance, despite the fact that patient choice has never been more discussed as an answer to almost any health care problem. although studies suggest that renal physicians and nurses regard home dialysis as the best treatment, it is in decline in most european countries, yet in-centre hospital-based dialysis is the most expensive and most disempowering option available. the practical barriers to home therapy vary from unit to unit but need to be identified and overcome if patients are to benefit from self-management. however, it can be difficult to convince both staff and patients if they have no direct experience or training in this aspect of renal replacement therapy. patient pathway to (relative) freedom a step which can be made much easier if staff are familiar with the stages of change model and have a basic understanding of motivational interviewing. pre-emptive living donor transplantation should always be promoted as the first-line treatment for kidney failure. however, where that is not possible, patients must receive timely, adequate and unbiased information and advice regarding the complete array of dialysis options available, including home-based peritoneal dialysis (pd) and haemodialysis (hd). interestingly, a comparison of survival in canadian patients treated with nocturnal hd or deceased donor kidney transplantation showed no difference between the two treatments, suggesting that this intensive dialysis modality may be a bridge to transplantation, or even a suitable alternative, in the absence of an available living donor. traditionally around the world, medical and nursing staff, sometimes in conjunction with a social worker, will. a clear example of this was evident in the 1990s, when the uk had a large pd population simply because space in hospital hd facilities was limited at that time, and home hd had shrunk to the extent that most uk units no longer had viable programmes. since that time, in-centre hd facilities in the uk have expanded enormously, such that in some areas supply exceeds demand and the pd population has approximately halved in number. therefore, many patients currently are not able to choose home hd and patient selection presumably does not generally occur. staff are unlikely to be able to advocate a therapy of which they have no experience and are even less likely to advocate one which they perceive to be unavailable. therefore, health service managers and commissioners also have an enabling role and must embrace the value of self-care by providing the practical resources required. understandably, a patient may never be adequately informed about home hd or assisted automated peritoneal dialysis if these modalities are not operating in the unit concerned. many patients will assume that they are not suitable for a home therapy if it is not offered to them, without realizing why it has not been offered. ideally, every patient should learn about every dialysis modality, accepting that it is probably pointless to discuss pd with a patient who has previously had major abdominal surgery. if this were done, then some patients would inevitably demand the creation of home services where none currently exists, and in one or two uk units, this has already happened. experience within our own service suggests that where a dialysis unit enables and actively encourages self-management, patients will tend to select themselves, and if well motivated may overcome significant difficulties, such as needle phobia, housing problems and literacy issues, to exceed the expectations or predictions of even quite experienced dialysis staff. patients then become advocates themselves and can provide other patients with the necessary motivation to consider a home treatment, such that they approach staff, rather than vice versa. interestingly, the general consensus among nephrologists in canada, usa and uk in 2006 was that 45% of patients are suitable for a home therapy, and if you question the staff in your local hd unit, very few would wish themselves to be dialysed in-centre if the need arose. despite this, the reality is that pd numbers are in decline and home hd is virtually non-existent in many areas. selection to medical and nursing staff simply does not work and that many capable patients are not finding their way through there is much in our health care culture that expects care and treatment to be administered by caring and expert professionals, and this expectation is present in the providers of health care as much as it is in the recipients. there are of course individual differences in both staff and patients willingness to embrace self-care, but if we assume that cultures and individual preferences are not fixed, then we may find ways to move people along the self-care continuum. often, patients contemplating the need for renal replacement therapy are understandably and predictably hoping that dialysis will be done for them and will probably shy away from the thought of doing it at home. clearly, it is easier and quicker to point them in the direction of in-centre hd than to embark on a difficult and time-consuming discussion around self-care home dialysis and training. to undertake this task, the staff must first be themselves totally convinced that home treatment is in the patient s best interest if not, the patient will rapidly detect any hint of uncertainty and further discussion is probably futile. this also means that all members of staff with whom the patient comes into contact must be equally capable of espousing some or all of the benefits of home therapy, from nurse, to doctor, to social worker, to dietician and others. in other words, ethos must be that home therapy is not only viable but preferable and beneficial for those who are able to pursue it. for a unit s staff to be able to talk to patients with confidence requires direct experience of home dialysis, but obviously in many units which do not have a full range of home therapies, this may initially be impossible. under these circumstances, collaboration with another unit may enable staff to gain the training and experience required to be able to talk with authority and instill confidence in the patient. visiting patients in their home environment is an essential part of training for both medical and nursing staff. it is known that patients who start dialysis after adequate preparation tend to select a home therapy [5, 6]. this is encouraging, but in some instances, education can default to telling the patient a series of facts, and once the full list of facts is ticked off, the patient is expected to make a choice. yet, we all know from our own educational experiences that this approach alone is insufficient. on the face of it, it seems plausible that suitable patients would accept the benefits of a home therapy, once they have been educated as to the reasons for the recommendation, and staff may be bemused when they do not do so. this aspect of everyday human behaviour has been most extensively studied in the field of smoking cessation, where it is recognized that someone who has accepted the need to quit is much more likely to be successful than someone who has not, despite both being aware of the future health benefits. the stages of change model suggests that, for most people, a change in behaviour occurs gradually, with the patient moving from being uninterested, unaware or unwilling to make a change (pre-contemplation), to considering a change (contemplation), to deciding and preparing to make a change (preparation then action). therefore, before a patient is able to begin to engage in discussion about any dialysis therapy, they must have reached a point of acceptance that dialysis is necessary. if they are not at this point, then any attempt at education will be largely futile, especially if it is simply repeated when it may be counter productive and alienating. even once they have accepted, the need to change a patient may still not be able to engage in the process of change due to real and significant hindrances, such as needle phobia, general anxiety, low mood or fatigue. 5the goal for chronic kidney disease patients at the pre-contemplation stage is to begin to think about the likely 5need for dialysis in the future and where the dialysis should take place. the task for physicians is to empathetically engage the patient in contemplating this change to their life. during this stage, patients may appear argumentative, hopeless or in denial, and the natural tendency is for physicians to try to convince them with more facts, which usually engenders resistance. figure 1 describes the stages of change which anyone confronting a life changing event, such as the need to start dialysis, must pass through in order to come to terms with their new situation. asking the patient to indicate which rung of they ladder they feel they are on can be a helpful first step. bringing a patient to the stage of taking action in a defined timescale is of great importance since progressive renal disease will not wait, and it is clear that those who start dialysis in an unplanned fashion fare less well. on the other hand, a patient who has reached the action stage may be able to select themselves for either home or hospital therapy as they begin to understand what is, and is not, desirable and possible given their specific circumstances. the uk national institute for health and clinical excellence (nice) produced guidance on home compared to hospital hd for patients with end-stage renal failure in 2002. suitable for home hd should be offered the choice of having hd in the home or in a renal unit. the definition of practical characteristics of patients suitable for home hd according to nice guidance 2002 although these guidelines are entirely clear and sensible, the manchester experience is that the definition of enthusiastic and determined patients who might initially have been deemed unsuitable are found to be not only capable but successful home dialysers. indeed, the current feeling is that very few physical disabilities preclude home treatment if the patient is keen to proceed, and level of enthusiasm is a more reliable guide. once a patient has arrived at the point of choosing a home therapy, the pathway to their first dialysis at home must be as smooth and pot-hole free as possible. this requires some resources and infrastructure to be already in place, and if they are not, then all but the most determined patient is likely to be put off. many patients commitment at this stage is fragile and if the path is too rough or steep, or not well signposted, they may understandably decide to turn back. therefore, from this point on, communication, planning and action must be slick and efficient in order to build the patient s confidence. the experience and confidence of the staff is crucial so that even if the patient is unsure of the process, they feel fully able to trust the team around them and to know who to turn to for reassurance or answers. it requires staff to engage with patients in conversations about what is important to them and what they value in more general terms (e.g. freedom, independence, safety, quality and quantity of life) and about what the complex hindrances to self-care may be so that an individualized response to these sorts of questions can move patients along the self-care continuum. when faced with the spectre of dialysis treatment, most of us would not naturally opt for a home therapy. traditional methods of patient selection have not prevented a steady decline in home therapies over the past two decades, yet most dialysis unit staff say they would opt for a home therapy for themselves. the stages of change model coupled with basic motivational interviewing techniques can enable staff and patients to engage with each other in a more meaningful way such that many patients will be better able to understand the benefits of self-management and treatment at home. practical infrastructure barriers must also be tackled in order to smooth the pathway to home dialysis.

pre-emptive living donor transplantation should always be promoted as the first-line treatment for kidney failure. where that is not possible, patients must receive timely information and advice regarding all dialysis options available, including home-based peritoneal dialysis and haemodialysis. where a dialysis unit enables and actively encourages self-management, patients will tend to select themselves, and if well motivated may overcome significant difficulties to exceed the expectations or predictions of dialysis staff. patients then become advocates themselves and can provide other patients with the necessary motivation to consider a home treatment, such that they approach staff, rather than vice versa. for staff to be able to talk to patients with confidence requires direct experience of home dialysis, but in units which do not have a full range of home therapies, this may initially be difficult. visiting patients in their home environment is an essential part of training for both medical and nursing staff. before a patient is able to begin to engage in discussion about any dialysis therapy, they must have reached a point of acceptance that dialysis is necessary. if they are not at this point, then any attempt at education will be largely futile. once a patient has arrived at the point of choosing a home therapy, the pathway to their first dialysis at home must be as smooth and problem-free as possible.

PMC4421456

pubmed-268

the conventional definitions of pediatric adiposity depend on a measured body mass index (bmi, kg/m) interpreted relative to a reference distribution (bmi normative growth charts) for sex and age [13]. because it has body weight in its numerator, bmi reflects generalized (total-body) enlargement with a simplified correction (as height) for skeletal size. pediatric adiposity has been defined alternatively by abdominal size, most commonly a waist circumference, because increased truncal adipose tissue is correlated better than generalized adiposity with cardiometabolic dysfunction [4, 5]. since waist circumference is a regional measurement, it reflects specifically only abdominal or central enlargement. thus, waist circumference also requires interpretation relative to its own reference distribution for sex and age. comparisons of risk assessments in youth have generally found little difference between bmi and waist circumference in the ability of these indicators to identify cardiometabolic risk [6, 7]. the waist-to-height ratio (whtr) is an adiposity indicator with waist circumference in the numerator and a simplified correction (as height) for skeletal size. whtr does not depend on sex- or age-specific reference criteria [810]. in a large sample of us sixth-graders, we examined the performance of bmi z-score (bmiz, referenced to cdc 2000 growth charts for the united states) and whtr for the purpose of cardiometabolic risk assessment. participants came from the baseline enrollment (sixth-grade students in 2006) of the healthy study, a cluster-randomized, controlled, primary prevention trial designed to improve indicators of adiposity and glycemic dysregulation among us middle-school children [12, 13]. seven research centers recruited 42 middle schools with at least 50% of students eligible to participate in the federally subsidized national school lunch program or belonging to an ancestral minority group at increased risk of type 2 diabetes (hispanic, non-hispanic black, or native american). a detailed protocol and background details about the healthy study are available for download at http://www.healthystudy.org/. we restricted a priori our analytic sample to students with integer ages of 11 or 12 years who were able to participate in physical education and did not have known diabetes. from 5950 eligible enrollees, we excluded 13 students due to missing or invalid data for the adiposity indicators (height, weight, and waist circumference). additional 239 students were excluded for lack of outcome cardiometabolic risk variables, and 216 were excluded for lack of information on pubarche (an adjustment variable associated with adrenarche, growth pattern, and insulin resistance) [1416]. participant ancestry (hispanic, non-hispanic black, non-hispanic white, other) and sex were self-reported. the study was approved by each research center's institutional review board, and informed consent from parents and assent from students were obtained prior to data collection. from measured height and weight, we calculated the sex- and age-specific bmiz based on the centers for disease control and prevention 2000 growth charts [11, 17]. waist circumference was measured to the nearest 0.1 cm on bare skin just above the iliac crest following procedures of the national health and nutrition examination survey, and the whtr was calculated. blood pressure was recorded three times using an omron automated blood pressure monitor (with appropriate-size cuff) after the participant sat quietly for 5 minutes. pubarche was identified dichotomously from the participants ' response to a standardized question on the appearance of underarm and pubic hair. fasting blood samples were processed onsite and shipped to the healthy central blood laboratory (northwest lipid research laboratories, university of washington). insulin was measured by an immunoenzymometric assay using a tosoh 1800 autoanalyzer; the interassay and intra-assay precision analysis consistently showed a coefficient of variation (cv)<10%. the assay had low cross-reactivity with human c-peptide (0%) and proinsulin (2%). the homeostasis model assessment of insulin resistance (homa-ir) was calculated from glucose (mg/dl) and insulin (u/ml) concentrations using the following formula: (1)homa-ir=(glucose0.05551)(insulin)22.5. measurements of total plasma cholesterol, cholesterol in the lipoprotein fractions, and triglycerides were performed enzymatically on the roche modular-p autoanalyzer using well-standardized methods. the interassay cvs were consistently<1.5% for total cholesterol and triglycerides and<2% for hdl cholesterol. we calculated the total-to-hdl cholesterol ratio (tc/hdlc), a variable that strongly predicts cardiovascular disease in adults and may be more strongly associated than ldl-cholesterol or hdl-cholesterol concentrations with pediatric adiposity [22, 23]. in addition to stratification by sex, we chose a priori to stratify our analyses by high fatness or lower fatness because the ability of adiposity indicators to identify adipose tissue mass, ectopic fat, and cardiometabolic risk variables may be stronger among children in a higher fatness category [2326]. as defined for this report, the high-fatness level included students who were above the sex-specific median value for both bmiz and whtr; any student below the median for either adiposity indicator was designated lower fatness. for each fatness level, we prepared sex-specific, linear-regression models adjusted for ancestry (4 categories) and pubarche (yes/no) to estimate the associations of continuous adiposity indicators with the continuous cardiometabolic risk factors (outcomes). since blood pressure varies with height in children [27, 28] our models for blood pressure outcomes included an additional adjustment for height which was entered as a continuous variable. for all variables except bmiz, we calculated descriptive statistics without using reference-based corrections for sex or age. for indicators or outcomes that departed markedly from a normal distribution (whtr, homa-ir, tc/hdlc, hdl cholesterol, triglycerides, and (only for lower-fatness students) diastolic blood pressure), we transformed the variable by loge or inverse square root to approach normality prior to their use in regression models. our adjusted models estimated standardized beta coefficients (change in the outcome variable (in standard deviations) associated with change of one standard deviation in the adiposity indicator) for each cardiometabolic risk factor. cary, nc) was used to account for variability both within and between the school clusters. in these mixed models, the proportion of variation explained (r) by each adiposity indicator was calculated as the full model r minus r for a model omitting the adiposity indicator. to compare linear slopes among ancestral groups, mixed-regression models estimated nonstandardized, beta-regression coefficients; interactions were tested between each adiposity indicator and the three ancestries represented prominently in our sample (hispanic, black, and white). characteristics of the analytic sample are presented by sex in table 1. as expected for sixth-grade students, following further stratification by fatness level, the distributions of adiposity indicators and ancestry are summarized in table 2. compared to the high-fatness groups in our sample, the lower-fatness groups had bmi and whtr distributions that resembled more closely the general population of us youth in the same age range [31, 32]. within the high-fatness subpopulations of either sex (table 3), adiposity indicators explained 19%28% of the variation in homa-ir, 4%9% of the variation in circulating lipids (tc/hdlc, hdl cholesterol, triglycerides), and 5%9% of the variation in diastolic blood pressure. adiposity indicators explained<3% of the variations in systolic blood pressure and fasting glucose. for each outcome variable in these high-fatness subpopulations, the effect sizes (standardized beta coefficients) associated with bmiz were similar to those associated with whtr. within the lower-fatness subpopulations of either sex (table 4), adiposity indicators explained 8%13% of the variation in homa-ir and 2%7% of the variation in circulating lipids. for tc/hdlc and triglycerides, the standardized beta coefficients tended to be weaker for bmiz (0.130.20) than for whtr (0.170.28). adiposity indicators in these lower-fatness subpopulations explained<1% of the variations in systolic blood pressure, diastolic blood pressure, and fasting glucose. a comparison between the two levels of fatness (table 3 versus table 4) demonstrates that for either adiposity indicator the associations with homa-ir were stronger among the high-fatness students (beta coefficients 0.430.52) than among the lower-fatness students (0.300.37). similarly, both adiposity indicators were associated with diastolic blood pressure more strongly among high-fatness students (0.230.32; p<0.001 for each of 4 beta coefficients) than among lower-fatness students (0.030.05; p>0.05 for each of four beta coefficients). for identification of lipid outcomes, however, we found steeper beta coefficients only among high-fatness boys (compared to lower-fatness boys) whose adiposity was assessed by bmiz. for both sexes assessed by whtr, the associations between adiposity indicators and risk variables were not notably different between the hispanics, non-hispanic blacks, and non-hispanic whites except when related to blood pressure outcomes. although adiposity explained 5%7% of variation in diastolic blood pressure in the complete sample of high-fatness girls (table 3), this relationship was extremely weak for high-fatness girls who were black, as indicated by slope point estimates close to zero (figure 1). however, for high-fatness girls who were hispanic or white, bmiz and whtr had significant associations (p<0.05) with diastolic pressure. among high-fatness boys systolic blood pressure was not significantly associated with bmiz or whtr for high-fatness blacks of either sex, but the association was present for high-fatness students who were hispanic or white. an ancestral contrast (blacks compared to whites) related to systolic blood pressure was significant, however, only among the high-fatness girls assessed by bmiz (figure 1; p<0.01). in this large sample of middle-school students at increased risk of obesity and type 2 diabetes, we found that adiposity indicators bmiz (with reference to cdc 2000 growth charts) and whtr (without reference to sex and age) had similar utility for identifying adverse levels of cardiometabolic variables. our findings are generally consistent with previous published reports, most of which were based on populations that had a wider age range or included less ancestral diversity. earlier cross-sectional studies that compared continuous whtr against bmi either without a normative growth reference [3335] or with reference-based bmi z-scores/percentile ranks [23, 36] generally found that whtr provided stronger associations with lipid outcomes, but bmi was superior for blood pressure outcomes. a recent report on sixth-grade students from switzerland found that bmiz (referenced to cdc 2000 growth charts) and whtr provided associations with blood pressures that were weak but nearly identical. in studies of youth from the southern us, bmiz provided a slightly stronger association than whtr with homa-ir and fasting insulin, a relationship that was complicated by nonlinearity. nationally representative, cross-sectional data from the us demonstrated that whtr at ages 417 years was more strongly associated than bmiz with resting heart rate. a longitudinal analysis from the same survey of adolescent and young-adult participants found that categorical whtr predicted all-cause mortality before age 55 better than categorical bmiz (baseline ages 1218 years) or bmi (ages 1939). from the united kingdom, a large study recently reported that whtr and bmiz obtained at ages 79 years had similar associations with cross-sectional and prospective cardiometabolic risk factors in adolescence. given an approximately equal utility of bmiz and whtr for pediatric health assessments, we should consider how these adiposity indicators might perform in different settings or in the future. bmiz values reported in the research literature depend on standardized protocols for measuring height and weight using calibrated, high-quality scales. in nonresearch settings, however, staff training and time pressures might not be so favorable to careful measurements. the dependence of bmiz on normative growth references can be problematic because bmi-for-age reference values can yield discrepant inferences between populations, time periods, and ethnicities within a single country. worldwide bmi growth reference based on large datasets from six countries, but subsequent reviews found that this international growth reference provided no advantage over national bmi growth references for the definition of excessive fat mass in youth or prediction of subsequent cardiovascular risk in adulthood. the world health organization (who) more recently developed a bmi-based growth reference, the utilization of which has been described as a cumbersome task in need of simplification. surveys from various clinical settings have found generally that the use of bmi-for-age reference values is suboptimal [4750]. advocates of the whtr must address problems associated with the available protocols for measuring waist size. while tape measures are inexpensive and generally need little calibration, protocols for circumference measurement are still unfamiliar to many pediatric practitioners or clinic assistants. our study carefully measured the waist circumference just above the iliac crest, an anatomic location endorsed by prominent researchers in the united states [18, 51] and canada. the who, however, recommends measuring waist circumference at the approximate midpoint between the lower margin of the last palpable rib and the top of the iliac crest. minimal waist, and other sites [54, 55]. in an anthropometric study of diabetic youth, the iliac-crest protocol and who protocol demonstrated comparable reproducibility, but these alternative protocols yielded notable differences in the absolute value of a waist circumference obtained from the same participants. a study of overweight youth found that the who waist-circumference protocol had a stronger association than the iliac-crest protocol with cardiometabolic risk, and studies of adult waist circumference have likewise suggested an advantage for the who protocol [5860]. it follows that the whtr values calculated from the iliac-crest and who protocols should not be casually substituted for each other. it is possible that if our healthy study had adopted the who instead of the iliac-crest protocol for its baseline anthropometry, the re-calculated whtr indicator might have demonstrated stronger associations with cardiometabolic risk variables than those we report in this paper. standardization of a single waist-circumference protocol would probably advance the widespread adoption of the whtr as a low-cost adiposity indicator [55, 61]. as an alternative to the circumference, some pediatric investigators have described waist size in selected participants by measuring the external diameter sagittally (back-to-front) in the supine position [6264]. protocol might further enhance studies that are cross-sectional or involve short-term follow-up of central adiposity, but this anthropometric method needs to be tested in larger datasets that represent general youth populations. the physiological importance of tissues accumulated in the waist may help to explain why whtr was more closely associated than bmiz with variations in the levels of circulating lipid markers among our lower-fatness participants (table 4). an increase in waist size primarily marks expanding amounts of adipose tissue, including notably the visceral depot which is most strongly associated with an adverse metabolic phenotype [5, 65]. variation in the waist circumference can explain more than 64% of the variance in the area or volume of visceral adipose tissue. an increase in bmi, by contrast, may substantially mark also the variations in gain of muscular weight or subcutaneous fat patterning that precede adulthood. along with the changes in fat mass, these variations in lean mass or superficial adipose tissue contribute to the bmi calculation while contributing relatively little to metabolic risk. although high-fatness hispanic and white girls in our study demonstrated the expected associations between adiposity and blood pressure, we found among the high-fatness black girls (but not black boys) that neither bmiz nor whtr had a significant association with blood pressure outcomes (figure 1). in comparison to young hispanics and whites, young blacks tend to have abdominal adipose tissue relatively less in the visceral depot and more in the abdominal subcutaneous regions. another study has also reported that black girls ' waist circumference around the same age was unrelated to their diastolic blood pressure. since both the bmiz and whtr indicators demonstrated similar patterns of nonassociation with black girls ' blood pressure, it may be that this absence of a correlation with blood pressure is due to factors operating primarily outside the abdominal region. perhaps black girls benefit from an increased capacity to expand their lower-body (gluteofemoral), subcutaneous, adipose-tissue stores in a manner that would increase their total body weight yet protect them from cardiometabolic risk [7073]. if this protective characteristic of black girls extends into their later years, it could help explain why adult black women in the us experience no increased cardiometabolic risk or mortality until their bmi reaches approximately 33 kg/m. if a well-standardized waist measurement comes into widespread use for clinical assessments of pediatric adiposity, patients and their families may improve their intuitive understanding of how excess adiposity contributes to adverse health risk. pediatric health care providers, too, may find it more useful to recognize risk associated with a waist increment (corrected for height) than with a weight increment (corrected for height squared). adoption of the whtr could optimize both patient education and the tracking of risk. compared to bmi, the whtr allows a simpler calculation without the necessity of squaring the child's height. of interest to those concerned with child adiposity and cardiometabolic risk observed in different cultures or distinct time periods, the whtr will facilitate comparisons based directly on anthropometric observations without using normative reference tables that may not be suitable to all populations [7779].

convention defines pediatric adiposity by the body mass index z-score (bmiz) referenced to normative growth charts. waist-to-height ratio (whtr) does not depend on sex-and-age references. in the healthy study enrollment sample, we compared bmiz with whtr for ability to identify adverse cardiometabolic risk. among 5,482 sixth-grade students from 42 middle schools, we estimated explanatory variations (r2) and standardized beta coefficients of bmiz or whtr for cardiometabolic risk factors: insulin resistance (homa-ir), lipids, blood pressures, and glucose. for each risk outcome variable, we prepared adjusted regression models for four subpopulations stratified by sex and high versus lower fatness. for homa-ir, r2 attributed to bmiz or whtr was 19%28% among high-fatness and 8%13% among lower-fatness students. r2 for lipid variables was 4%9% among high-fatness and 2%7% among lower-fatness students. in the lower-fatness subpopulations, the standardized coefficients for total cholesterol/hdl cholesterol and triglycerides tended to be weaker for bmiz (0.130.20) than for whtr (0.170.28). among high-fatness students, bmiz and whtr correlated with blood pressures for hispanics and whites, but not black boys (systolic) or girls (systolic and diastolic). in 11-12 year olds, assessments by whtr can provide cardiometabolic risk estimates similar to conventional bmiz without requiring reference to a normative growth chart.

PMC4123559

pubmed-269

the bucky shuttle being the combination of nanosize carbon structures fullerene and nanotube, has many possible applications: nanoscale storage cells, devices for directed medicine transfer and containers for effective and safe gas storage [7-13]. nanosize containers and capsules of various shapes that allow reaching a higher safety level and mass content of gas stored have been investigated for a number of years [11-13]. the engineering of nanostructured carbon opens the ways for the production of nanocapsules of complex structural shapes [14-16]. in this work, the processes of methane molecule adsorption, storage and desorption by the nanocapsule are investigated with molecular-dynamic modeling method. the nanocapsule-specific structure defines its adsorption qualities: at the storage stage under normal conditions, the nanocapsule contains the amount of methane that was adsorbed at normal temperature and under 40 mpa. the nanocapsule desorption takes place at the temperature elevation up to 350 k. there is no need to apply electric field during storage and desorption. methane adsorption, storage and desorption processes were modeled with the method of molecular dynamics. the values of hydrogen and carbon atom charges in methane molecule were obtained using the combination of hartree fock and becke exchange with lee yang the following atom charge values in methane molecule were obtained: carbon atom 0.628204 mulliken and hydrogen atom+0.157051 mulliken. 1. nanocapsule for natural gas storage, consisting of storage chamber, junction and blocking chamber the nanocapsule consists of three parts: storage chamber, junction and blocking chamber. the junction consists of the nanotube (10,10) and nanotube (8,8), moreover, the nanotube (8,8) is connected with the storage chamber, and nanotube (10,10) with the blocking chamber. the blocking chamber is opened and closed by the transfer of the k@c60 endohedral complex under electrostatic field action. the charge of+1|e| of the k@c60 endohedral complex is uniformly distributed over the c60 shell. the nanotube (8,8) in the junction prevents the k@c60 from entering the storage chamber. the nanotube (8,8) diameter is rather large for the penetration of methane molecules, but small for the transition of the k@c60. each hole in the blocking chamber is formed as a result of removing 24 carbon atoms. dangling the holes obtained are large enough for free penetration of methane molecules into the nanotube internal space. the experiment on obtaining similar holes with the application of electron beams is described in. it is shown that the beams can be focused on the area 1 in diameter. the holes in the nanotube can exist at the temperatures up to 400 k; when the temperature elevates, the hole diameter in the nanotubes considerably decreases due to the motion and fusion of single vacancies [8-10]. during modeling, it is imitated that the nanocapsule is placed on the substrate, i.e., the nanotube base is fixed the nanocapsule left end the change in the nanotube diameter is also possible with the methods of nanostructural engineering. the charged endohedral complex k@c60 moves in the blocking chamber and junction under the action of external electric field. the electric field direction defines the nanocapsule state in the operation cycle: methane adsorption, its storage and desorption. the value of external electric field intensity, required for the k@c60 to move, equals 3.045 10 v/m. the motion of charged fullerene in the nanotube with the help of electric field is described in detail in. the nanocapsule operation can be split into several stages: methane adsorption, storage and desorption. at the adsorption stage (fig. 2), the k@c60 endohedral complex is retained at the end of the blocking chamber under the action of van der waals forces. the methane molecules from the environment freely penetrate through the three holes into the blocking chamber and adsorb into the external space of the storage chamber. adsorption stage (t= 300 k, p=40 mpa) the calculations are based on the following formula (1): where number of methane molecules, nc number of carbon atoms in the nanotube, mass of one methane molecule and mc mass of one carbon atom. figure 3 demonstrates the nanocapsule filling dynamics with methane at 300 k and under 40 mpa. it is clearly seen that 4 ps is enough to complete the filling of the nanocapsule storage area. thermodynamic conditions are p=40 mpa and t=300 k to block methane molecules in the storage chamber, it is necessary to move the k@c60 ion into the junction with the help of electric field as shown in fig. 4. external thermodynamic conditions are t=300 k and p=40 mpa. further motion of the k@c60 is blocked by the junction narrow part nanotube (8,8). nanocapsule closing stage (t=300 k, p=40 mpa) figure 5 demonstrates the dependencies of the change in the k@c60 position and its kinetic energy under the electric field action in the blocking chamber upon time. a sharp increase in the k@c60 kinetic energy equaled to 0.254 ev is observed at 0.5 ps, at the same time the velocity reaches 327 m/s.=1 ps, the k@c60 kinetic energy decreases significantly, reaching 0.000255 ev and further up to 15 ps its value does not considerably increase. this is explained by minor oscillations of the k@c60 near the right end of the blocking chamber. the k@c60 is retained due to van der waals forces. under the constant action of electric field, the k@c60 kinetic energy increases again and reaches 0.61 ev at t=16.5 ps, i.e., the k@c60 breaks off the blocking chamber and moves to the storage chamber to block its entrance. results of molecular-dynamic modeling of the k@c60 motion in the blocking chamber under the electric field action at the adsorption stage. the k@c60 ion position with respect to the initial (time=0 ps) ion position as a function of time. the change in the k@c60 ion kinetic energy as a function of time in the time period from t=16.5 ps to t=26.5 ps, the considerable attenuating oscillations of the kinetic energy conditioned by the k@c60 motion along the blocking chamber walls adjacent to the junction entrance are observed. in this time period, each peak of the k@c60 kinetic energy corresponds to the time moments after passing the pentagonal rings in the structure of the blocking chamber. under the electric field action, the k@c60 penetrates into the right end of the junction nanotube (10,10)and blocks the outlet of methane molecules from the storage chamber. during the penetration, a considerable increase in the kinetic energy is observed, its maximum value reaches 0.63 ev at t=32 ps. after the k@c60 passes the nanotube (10,10), the kinetic energy sharply decreases conditioned by the k@c60 deceleration in the portion of the nanotube (8,8). in the interval from t=41.5 ps to t=48.5 ps, the insignificant fluctuations of the k@c60 position connected with the compressed gas pressure from one side and electric field action from another the value of the k@c60 kinetic energy does not exceed 0.033 ev. in the process of methane molecules adsorption, the maximum velocity of the k@c60 motion is 515.5 m/s (t=32 ps). when transferring to the storage stage, the electric field switches off, and external thermodynamic conditions are brought to normal. the k@c60, which is located in the junction, moves to the blocking chamber under the methane pressure. however, its transfer is insignificant (d~5 a) that is conditioned by the necessity to overcome the considerable energy barrier (e=90 kcal/mol) to move to the blocking chamber. the calculations made show that there are no abnormal extensions of bonds between carbon atoms in the nanocapsule. methane storage stage (t=300 k, p=0.1 mpa) at the desorption stage when the temperature elevates from 300 k up to 350 k and the external pressure is normal, the k@c60 endohedral complex in the junction is pushed into the blocking chamber under the expanding methane pressure, as shown in fig. methane under pressure in the storage chamber freely desorbs into the external space through the holes in the blocking chamber. the availability of three holes in the blocking chamber and their configuration allow forcing out methane molecules and preserving the required rigidity of the construction. the holes are located in such a way that the k@c60, moving under the electric field action in the blocking chamber, is unable to block all its holes at once. the k@c60 in the blocking chamber does not prevent methane desorption as the gas molecules flowing out do not touch it, and it is retained near the wall of the blocking chamber adjacent to the junction inlet nanotube (10,10) due to the action of van der waals forces without the external electric field involved. methane desorption stage (t=350 k, p=0.1 mpa) figure 8 demonstrates the dependencies of the k@c60 location stage and its kinetic energy upon time at the temperature elevation from t=300 k up to t=350 k at the stage of the k@c60 desorption into the blocking chamber. at 3 ps, the significant increase in the k@c60 kinetic energy equaled to 2.05 ev (the k@c60 velocity reaches 930 m/s) is observed. the k@c60 kinetic energy is consumed for overcoming the considerable energy barrier (e=90 kcal/mol) formed under the action of capillary forces. when the k@c60 passes the energy barrier, the kinetic energy decreases considerably to 0.41 ev (t=5 ps). after passing the junction at 7 ps the k@c60, kinetic energy increases again and when the k@c60 gets into the blocking chamber, the oscillations between its walls are observed. each zero value of the k@c60 kinetic energy in the interval from 7 to 23 ps corresponds to the k@c60 impact against the blocking chamber wall. then, the insignificant impacts of the k@c60 against the blocking chamber wall with further state stabilization near one of the pentagonal rings of the blocking chamber are observed (fig. 7) the maximum kinetic energy is 2.05 ev, which is considerably smaller than the known value (200 ev) required for carbon nanotube destruction. the availability of even insignificant number of methane molecules in the blocking chamber considerably decreases the velocity of the k@c60 motion, and, respectively, the kinetic energy of the k@c60 impact against the blocking chamber wall. results of molecular-dynamic modeling of the k@c60 transfer at the temperature elevation up to 350 k. k@c60 ion position with respect to the initial (time=0 ps.) the change in the k@c60 ion kinetic energy as a function of time the methane molecules desorption process is shown in fig. the desorption stops at 25.4 ps, there are 53 methane molecules in the storage chamber, which is 1.38 mass% we demonstrated the functioning of the nanocapsule of complex structural shape for methane storage using the method of molecular dynamics. an obvious advantage of the nanocapsule is its operation cycle: methane is adsorbed under the elevated pressure (40 mpa) and at normal temperature with further blocking of methane molecules by the k@c60 endohedral complex in the nanocapsule with the external electric field, the storage is performed in normal external conditions, and methane desorption is performed at temperature elevation up to 350 k, at which methane molecules push out the k@c60 and are desorbed from the nanocapsule. methane content in the nanocapsule at the storage stage is ~11.09 mass%. at the storage and desorption stages, the electric field is not used, this significantly simplifies the use of nanocapsules in automobile applications. the multiple techniques of nanostructural engineering developed are the prerequisites for the creation of similar nanocapsules. calculations are made in interdepartmental supercomputer center of the russian academy of science (moscow).

the processes of methane adsorption, storage and desorption by the nanocapsule are investigated with molecular-dynamic modeling method. the specific nanocapsule shape defines its functioning uniqueness: methane is adsorbed under 40 mpa and at normal temperature with further blocking of methane molecules the k@c601+endohedral complex in the nanocapsule by external electric field, the storage is performed under normal external conditions, and methane desorption is performed at 350 k. the methane content in the nanocapsule during storage reaches 11.09 mass%. the nanocapsule consists of tree parts: storage chamber, junction and blocking chamber. the storage chamber comprises the nanotube (20,20). the blocking chamber is a short nanotube (20,20) with three holes. the junction consists of the nanotube (10,10) and nanotube (8,8); moreover, the nanotube (8,8) is connected with the storage chamber and nanotube (10,10) with the blocking chamber. the blocking chamber is opened and closed by the transfer of the k@c601+endohedral complex under electrostatic field action.

PMC2894144

pubmed-270

we explore, in mice, the possibility of diagnosing an early-melanoma tumor and following its growth by analyzing the changes that occur throughout the pathological process in vocs excreted in urine and feces. we report here total of 29 potential biomarker candidates of melanoma; 25 of these are novel, and 4 have been previously reported by other research groups in relation to vocs detected from cultures of human melanoma cells. the chemical identity of only 24 of the 29 possible biomarker candidates was revealed with high confidence. this study will contribute to the development of a noninvasive and reliable diagnostic procedure to detect melanoma in the urine of patients. melanoma accounts for less than 2% of all skin cancers, but for the vast majority of deaths from skin cancer. in the united states alone, it is estimated that 76,100 individuals will be diagnosed with melanoma during 2014 and that 9,710 patients will die from it. early detection of malignant melanoma is the key factor in reducing mortality from this cancer. although histopathological examination is the gold standard for diagnosis of melanoma, additional, noninvasive approaches should be developed. here, we explore the possibility of exploiting volatile organic compounds (vocs) to develop such an approach; hundreds of vocs are emitted from the human body and usually reflect the metabolic condition of the individual. therefore, pathological processes, such as cancer, are expected to influence the voc fingerprint of patients either by changing the ratio between different vocs or by producing new vocs. it has been reported that dog scan identifies, by using their olfaction sense, melanoma on the skin of patients or melanoma samples hidden on healthy subjects. used gas sensor array (also known as an electronic nose) to differentiate between melanomas and nevus lesions. those authors compared the lesion with the adjacent skin region to reduce the skin headspace variability. collected biopsy samples and compared the vocs released from melanoma tissue to those released from nevus and normal tissue, using matching skin as a control. those authors found 32 potential biomarker candidates; the concentration of 9 vocs increased in the presence of melanoma, and 23 vocs were detected only when melanoma cells existed and were not detected in normal cells. the authors used the nist 2.0 mass spectral database, with a 60% quality factor for chemical identification of the possible biomarker candidates; however, they did not report the quality factor obtained for the different compounds by mass spectrometry (ms). in a recent study, kwak et al. compared human melanoma cells to normal melanocytes cultured in vitro. by using gas chromatography- (gc-) ms, those authors found increased levels of both isoamyl alcohol and isovaleric acid in the headspace over melanoma cells. the authors also found that the melanoma cells produced some unique compounds, such as dimethyldisulfide and dimethyltrisulfide. in the present study, we analyzed the vocs emitted from the urine and feces of mice before (healthy group) and after (cancer group) subcutaneous injection of b16 melanoma cells. the present work will serve as a basis to analyze possible vocs in human patients. we expect some voc to be shared between the species and new and different vocs to be detected. the sample classification used in the present study is summarized in table 1. the analysis of the urine samples of healthy and tumor-bearing mice revealed some differences in the vocs composition. there was no significant difference between the first two samples (samples a and b), which were taken before the injection of the b16 melanoma cells, and the first sample taken after injection (sample c). in the second sample taken after the injection (sample d), a significant difference was found in the observed vocs, although tumors were not yet palpable. in the last two samples (samples e and f), tumors were palpable in all mice, and the chromatographic spectra were significantly different from those obtained in earlier samples. therefore, the samples were classified into three groups: healthy, early-melanoma, and late melanoma. typical urine chromatograms obtained from one mouse before (sample b) and after injection (sample e) are shown in figure 1. some peaks in the chromatograms were present only in the tumor-bearing mice, and the area under some peaks was markedly higher or lower in the tumor-bearing mice compared to the healthy mice. by using the nist'08 and wiley mass spectral libraries, total of 120 vocs were identified in urine and 139 vocs in feces were identified in all mice samples, with an 80% quality factor (qf). after subtracting the vocs that were found in the background samples, a statistical analysis reduced the numbers of these peaks to 16 vocs in urine and 13 vocs in feces, which could serve as possible biomarker candidates. in addition, three vocs in urine and two vocs in feces, with a qf in the range of 6079%, were also included as possible biomarker candidates. of the 19 possible biomarker candidates in urine, three compounds were detected only in the tumor-bearing mice (table 2), three vocs were detected only in the healthy and early-melanoma-bearing mice (table 3), and 13 vocs were detected in markedly higher concentrations in the tumor-bearing mice as compared with the healthy group (table 4). similarly, from the 15 possible biomarker candidates found in the headspace of feces, two vocs were detected only in the tumor-bearing mice (table 5) and 13 vocs were found with a markedly higher (12 vocs) or lower (1 voc) concentration in the tumor-bearing mice than in the healthy group (table 6). to examine the significance of the changes in the concentrations of compounds during the different melanoma stages (see tables 4 and 6), a two-tailed paired t-test was carried out. as can be seen in table s1 in supplementary material available online at http://dx.doi.org/10.1155/2015/841245, some of the vocs that were identified as possible biomarker candidates in the current study have already been reported previously by other research groups as being predictive for melanoma and other cancers. the four potential melanoma-related biomarkers that have already been reported are isopropyl palmitate (rt=18.41, qf=72%), 1-hexadecanol (rt=14.54, qf=93%), benzaldehyde (rt=6.94, qf=97%), and dimethyl sulfone (rt=6.21, qf=94%). 1-hexadecanol and isopropyl palmitate, a derivate of palmitic acid, were detected only in the urine of tumor-bearing mice. these findings are consistent with a previous study, which reported a 35-fold increase in the level of 1-hexadecanol in the case of melanoma (as compared with a matching skin sample) and that isopropyl palmitate was found only in the melanoma sample. the authors suggested that these compounds may reflect an increased de novo synthesis of fatty acids, which is a crucial metabolic alteration that cancer cells require for synthesis of a new plasma membrane. de novo synthesis of fatty acids could be caused by the hyperactivity of the oncogenic fatty acid synthase (fasn), a common phenotype in cancer pathogenesis. benzaldehyde levels in feces were 132% higher in the tumor-bearing mice than in the healthy group (p=0.004), but it is important to notice that the increases were from the early-melanoma stage to the late melanoma stage (p=0.002), and not from the healthy group to the early-melanoma stage. in other words, benzaldehyde could be a useful possible biomarker candidate for predicting melanoma, but not in its early stage. the levels of dimethyl sulfone in urine showed a 199% increase from the healthy to the tumor-bearing mice groups (p=0.026). as shown earlier, significantly higher amounts of this compound were found in metastatic melanoma cells, as compared with normal cells. this finding suggests that the metabolism of sulfur-containing amino acids by melanoma cells differs from that in normal cells. the gc-ms analysis of headspace in b16 melanoma cell cultures yields 12 vocs that were not detected in the headspace of the materials in the phosphate buffered saline (pbs) and fresh growth medium without cells (table 7). the compounds that were identified were isopropyl myristate (rt=16.76, qf=93%), decane (rt=7.43, qf=93%), 2,4-dimethyl-1-heptene (rt=4.67, qf=93%), and hexadecane (rt=14.7, qf=95%). as described above, the concentrations of isopropyl myristate were higher in both urine and feces of tumor-bearing mice. decane and two chemically similar compounds, 1-hexadecene and 2,4-dimethyl-heptane, were previously reported to be present only in melanoma samples. the difference between 1-hexadecene and 2,4-dimethyl-heptane to hexadecane and 2,4-dimethyl-1-heptene (resp.) is in the presence or absence of a single double bond. hakim et al. studied two hydrocarbons, decane and 2,4-dimethyl-1-heptene, that were reported as potential biomarkers of lung cancer and suggested that these compounds are probably the outcome of oxidative stress. as mentioned above, the tumor was palpable only in the last two samples (late melanoma). an average lesion volume of 1664 mm (n=2) was measured three days after the last sample was taken (see figure s1). among all possible biomarker candidates that were found in the urine and feces, three compounds in urine (figures 2(a)2(c)) and two compounds in feces (figures 2(d)-2(e)) three of these compounds were all ketones, that is, 5-methyl-2-heptanone (rt=6.87, qf=91%), 6-methyl-2-heptanone (rt=6.71, qf=94%), and 6-methyl-3-heptanone (rt=6.67, qf=97%). the quality factor of the two compounds found in the feces headspace was smaller than 80%; hence they are referred to only by their retention time: rt=8.9 and rt=18.41. 6-methyl-2-heptanone has been found in the blood of patients with liver cancer and 6-methyl-3-heptanone was found in the urine of mice with lung cancer. in addition, other chemically similar ketones, such as 2-heptanone and 6-hydroxy-6-methyl-3-heptanone, were also detected in urine samples from mice with lung cancer tumors. partial least square discriminate analysis (pls-da) models of urine and feces were built with the simca p+ software. each model included three latent variables that were calculated by the software and are, in fact, weighted linear combinations of the 12 possible biomarker candidates that most contributed to the separation between the three groups (all the compounds in tables 26, except compound 2 in table 2, compound 3 in table 3, compounds 3 and 912 in table 4, compound 1 in table 5, and compounds 5 and 6 in table 6). the models are shown in figures 3 and 4 for the urine and feces models, respectively. the urine model exhibited good predictability of the mouse condition (healthy or sick) with a 92.3% sensitivity, 100% specificity, a 93.1% negative predictive value (npv), and a 100% positive predictive value (ppv). the model for feces gave less significant results, with an 80.8% sensitivity, a 96.3% specificity, an 83.9% npv, and a 95.5% ppv. it is important to note that eight out of nine mice were correctly predicted with an early-melanoma by using the urine model, whereas the feces model did not clearly discriminate between healthy and early-melanoma mice. the present study constitutes a novel proof-of-concept for the detection and monitoring of melanoma in urine and feces samples of mice at an early stage. our urine statistical model correctly predicted eight out of the 9 mice bearing an early-melanoma, indicating that mice at that stage can be detected and distinguished from healthy mice and from mice bearing a late melanoma. while other research groups [6, 7] focused on comparing human melanoma to normal and nevus skin biopsies, we attempted to distinguish between mice with an early-melanoma and healthy mice. our model was able to distinguish between melanoma bearing mice and healthy mice with sensitivity of 92% and specificity of 100%, as compared to studies of other groups on human samples (e.g., 70% sensitivity and 90% specificity reported by and 89% sensitivity and 90% specificity reported by). these differences might be related to the low variability in the vocs of mice all having similar genetics and environment, as compared to those of humans. the results of this study also indicate a marked difference between healthy mice and mice bearing a late melanoma, whereas the difference between healthy mice and mice bearing an early-melanoma is less clear. one possible explanation for this finding is that the concentration of the new compounds, which are products of the altered metabolism of the melanoma cells or of the normal cells that it affects, is below the detection threshold of our gc-ms system. in addition, the angiogenesis in mice bearing an early-melanoma is limited and, therefore, metabolites induced by melanoma cell do not disperse efficiently and are thus hard to detect. to overcome these concentration-dependent limitations, one should concentrate on detecting the compounds (potential biomarker candidates) that are responsible for the differences between healthy and late melanoma one should also develop methodologies to detect vocs directly from the regions of skin showing suspicious lesions; a step in this direction has been taken by detecting differences in human melanoma cell line signatures by ftir spectroscopy [15, 16]. some of the potential biomarker candidates that were identified in the present study were previously reported to be predictive for melanoma and other malignancies (table s1). those reports strengthen the validity of our findings and imply the existence of cancer type-specific biomarkers and of common cancer biomarkers. some of the potential biomarker candidates are cross species compounds; namely, they are found in both mice and human melanoma cells; therefore, similar experiments with human melanoma cell lines as xenografts should be conducted to confirm these data. two additional possible biomarker candidates that may be good candidates to identify melanoma are dehydroabietic acid (rt=21.7) and 2-hexanone (rt=3.78). it could be a pollutant from the sawdust, although it was not detected in the background samples. another possibility could be wrong identification of this compound by the code used ms database search (qf=81%). importantly, isopropyl myristate, the concentration of which increased in the urine and feces of tumor-bearing mice, was also found in the vapor phase of the b16 melanoma cells culture. this finding suggests that isopropyl myristate is a valid direct product of melanoma cell metabolism for further study. other compounds that were found in the headspace of the melanoma cell cultures were not detected in the urine or feces samples, and vice versa. this is attributed to the differences between the tumor cells microenvironment in a culture as compared to a tumor in the animal. we assume that there may be also contribution from the tumor microenvironment since tumor cells affect other cells in the tissue. at this point, the origin of the specific molecules we detected can not be determined. the observed increase in the concentration of ketones as a function of tumor growth suggests that ketogenesis pathways, incorporating various ketone formations, may be involved in the model of melanoma cancer. therefore, monitoring these ketones could help in tumor follow-up in melanoma patients. finally, to substantiate the findings in this study, we plan to perform an extended study with larger number of mice focusing on the urine vocs. in addition, to correlate more precisely between tumor size and voc concentration one should collect samples more often (every 24 days) and correlate the biomarkers to tumor volume as measured with a caliper. a different way of measuring is by expressing gfp or luciferase in the b16 cells and following their volume with an imaging device such as mri. despite the differences between mouse and human metabolism, possible biomarker candidates found in mice urine and feces if the possible biomarker candidates were formed in biochemical processes related to the activity of cancer cells, we can expect to find some overlap between biomarkers found in human and mice. urine and feces samples from nine mice were collected, twice before (healthy group, n=18) and four times after (cancer group, n=35, one mouse died before the last sample was obtained) subcutaneous injection of b16 melanoma cells. compounds from these samples were separated and identified by using headspace solid phase microextraction (hs-spme) and gc/ms. in addition, vocs above a culture of b16 melanoma cells were also collected and analyzed. comparison between vocs content of the two first samples of each mouse, collected before b16 melanoma cell injection, showed high repetition of peaks in the chromatograms of each mouse. comparison of peak repetition in the chromatograms of different mouse in the two preinjection samples shows a markedly reduced degree of repetition (see figure s2 in the supplementary material). these findings clearly indicate that the metabolism characteristics of each mouse have large influence on the observed chromatograms. consequently, we did not use a control group but compared the chromatograms of each mouse after b16 melanoma cell injection to those obtained before injection. female c57bl/6j inbred mice, 12 weeks old and weighing 1820 g, were obtained from harlan laboratories (jerusalem, israel). all mice were maintained at the animal resource center of ben-gurion university of the negev, in a controlled environment (illumination, temperature, and humidity) free of specific pathogens. all animal experiments described in this work were approved by the ben-gurion university committee for the ethical care and use of animals in experiments. each individual mouse was kept in a separate cage (9 cages total) under the same housekeeping conditions. the first samples were taken after a week of acclimation (at the age of 13 weeks). b16f10 cells were cultured in an rpmi 1640 medium supplemented with 10% heat-inactivated fetal calf serum (fcs), 100 u/ml penicillin, 100 mg/ml streptomycin, and 2 mm l-glutamine (biological industries, israel). b16f10 cells (10 cells) were seeded in a 10 cm diameter tissue culture dish. after 48 h, the medium was collected and centrifuged to eliminate cells and cell debris, and the cells were harvested by 0.23% trypsin and washed once in medium and two more times in phosphate buffered saline (pbs). b16f10 cells were harvested by 0.23% trypsin and washed once in medium and two more times in pbs. one hundred microliters, containing a total of 2 10 b16f10 cells in pbs, was injected subcutaneously to the left flank of each of nine c57bl/6 mice. mice with tumors that reached the size of 1.5 cm diameter were sacrificed by co2. urine and feces samples were collected into vials with a pipette from the new disposable plastic table cover. at the end of the sample collection we could not find in the literature a component in the urine or feces that allow the prediction of the hydration state of mouse (similar to creatinine in human urine). we found 8 vocs that showed up in all the chromatograms; however, their peak areas did not show any correlation to the total chromatogram area and they could not be used to monitor hydration state of the mice. thus, it was assumed that there should not be significant variations in mice hydration state since they were kept in identical conditions (temperature and humidity) with unlimited access to food and water. moreover, urine and feces samples were collected from all mice at the same time. it should be noted that the amount of urine and feces that were collected from the different mice varied, not enabling a direct comparison between amounts of different vocs of different mouse. static headspace sample extraction was achieved by exposing a 65-m polydimethylsiloxane/divinylbenzene (pdms/dvb) spme fiber (supelco, bellefonte, pa, usa) to the headspace for 10 min at 60c. following the extraction, the fiber assembly was transferred to the gc injection port for desorption at 250c for 5 min, with the split valve closed for 2 min. gc-ms analyses were performed by using an agilent 6890 series gc system (agilent, usa) connected to an agilent 5973 network mass selective detector (agilent, usa). the bench top system was fitted with an spme injection sleeve 0.75 mm i d quartz liner (supelco, bellefonte, pa, usa). the analytical column was a zebron zb-5msi fused-silica capillary column, 30 m 0.25 mm i d 0.25 m film thickness (phenomenex, torrance, ca, usa). the carrier gas was 99.9995% pure helium (maxima, ashdod, israel) passed through a moisture trap (model mt-200-2s) and an agilent hydrocarbon/moisture trap (model hmt200-2) (agilent, china) at flow rate of 1.0 ml min. the gc was operated under the following temperature program: 50c for 3 min, ramp of 12c min to 240c, held at 240c for 5 min, ramp of 50c min to 260c, then held at 260c for 1 min, giving a total run of 25.23 min. for gc-ms, following electron ionization, ions were scanned as the total ion current (range: 10500 m/z at 2.97 scans s). at both the beginning and end of each gc/ms analysis session the headspace over a calibration mixture (containing equal amounts of chloroform, toluene, and dodecanethiol) the test is based on examination of retention time and peak shape of the solvents used in the calibration mixture. compounds were assigned a chemical identification by means of spectral library matching, using the nist'08 and wiley libraries. the databases search was performed using the chemstation software (by agilent) that was used to control and operate the gc/ms system. the assignment of chemical identity by the software is accompanied by a quality factor (qf). the qf is also termed in some cases as matching factor. a library search procedure that identifies structural features of an unknown compound this procedure first retrieves library compounds whose spectra are most similar to the spectrum of the unknown compound. the algorithm then deduces structural features of the unknown compound from the chemical structures of the retrievals. the significance and reliability of each retrieved spectrum are weighted according to its similarity to the spectrum of the unknown compound. there are different procedures to estimate the reliability of the chemical identification of a gc peak (see, e.g., stein). the exact algorithm used to obtain the qf in the chemstation software is not described in the documentation (it is considered as a commercial secret); however, the manual states that qf larger than 80% is considered to be reliable. below this value of qf the reliability of the assignment is too low and the peaks are designated by their retention time only. a gc-ms analysis produces a complex chromatogram, where each peak represents a different volatile compound and the area below the peak is proportional to the amount of the compound in the sample. this threshold was used to ensure that all volatiles with low concentration are detected but noise is eliminated. to obtain estimates of the concentration of each compound, the peak area this normalization is performed by the chemstation software (by agilent) used to operate the gc/ms. the total chromatogram area used in the normalization is available in the output file; hence, the actual peak area of any individual feature can be calculated. examination of the variations in total chromatogram area shows that the standard deviation is 17% of the mean value, a quite narrow distribution. the data analysis described in the present study we repeated some of the analysis using the actual area of the peaks in the chromatograms and found almost identical results to those obtained by the normalized data. some of the volatiles in the chromatogram were eluted at multiple rts and, therefore, we used only the rt with the best match. in addition, to overcome peak shifting across different chromatograms, we first grouped peaks in the same time window (0.3 s) and then grouped adjacent peaks in adjacent time windows that hit the same match. each identified volatile was compared to all the background volatiles (room air, plastic table cover, vial, vial septum, spme fiber, sawdust, and mouse food) to ensure that differences were not due to a background alternation. a partial least squares discriminant analysis (pls-da) was conducted with the simca p+ code (version 12.0.1.0, by umetrics ab, ume, sweden) to test whether mice with melanoma could be diagnosed by using the potential urine or feces biomarkers. each chromatogram vector was defined as a member in one of three classes, healthy, early-melanoma, and late melanoma in urine samples, and in one of two classes, healthy and melanoma in the feces samples. two mice chosen arbitrarily were scanned three days after the last sample was taken to confirm the existence of the tumor and to estimate its volume. t1-weighted scanning images were acquired at 1 t by means of an aspect m2 high performance mri system (aspect imaging technologies ltd., israel), by using a gadolinium-dtpa contrast agent (dotarem, 1 ml/kg body weight plus 0.05 ml for catheter).

melanoma is the most malignant type of skin cancer. early detection of melanoma is thus critical for patient prognosis and survival. at present, examination by a skilled dermatologist followed by biopsy of suspicious lesions is the diagnostic gold standard. the aim of the present study was to examine an alternative and noninvasive method for the diagnosis of melanoma at an early stage. we identified and compared the volatile organic compounds (vocs) in mouse urine and feces, before and after a subcutaneous injection of b16 melanoma cells. we identified a total of 16 vocs in urine and 13 vocs in feces that could serve as potential biomarkers. statistical analysis significantly discriminated between the cancer and control groups. these results should be validated in a larger-scale animal study, after which a study could be designed in patients to develop a melanoma biomarker.

PMC4437384

pubmed-271

genome-wide association studies (gwass) have emerged as a powerful non-biased technique for identifying pathways related to human diseases with complex genetic architecture. understanding such complex diseases requires a broad understanding of the relevant functional nodes regulating disease-relevant pathways. genes do not function in isolation, and it is clear that both gene-gene and gene-environment interactions contribute to disease susceptibility (barreiro et al., 2012; cadwell et al., 2010; silver et al., 2013). more than 140 genetic risk loci have been identified for crohn s disease, a chronic inflammatory condition affecting the gastrointestinal tract (franke et al., 2010; these studies have highlighted the contribution of multiple immune and cellular pathways to crohn s disease pathogenesis, particularly those involved in microbial defense (jostins et al., 2012; lassen et al., 2014; murthy et al., 2014; sadaghian sadabad et al., 2014). atg16l1 (autophagy-related protein 16-like 1) is a component of the core autophagy machinery, and the atg16l1 t300a polymorphism confers a modestly increased susceptibility to crohn s disease despite its relatively high prevalence in the population (franke et al., 2010). autophagy is a pro-survival intracellular degradation pathway that functions as a key mediator of a number of processes including central metabolism, cell signaling, cell death, and carcinogenesis, as well as both innate and adaptive immunity (deretic et al., 2013; yang and klionsky, 2010). the atg16l1 t300a polymorphism has been associated with both impaired antibacterial autophagy and altered production of cytokines by peripheral blood mononuclear cells (pbmcs) in response to immune stimuli (lassen et al., 2014; recent studies have demonstrated that the mechanism underlying these alterations is linked to increased susceptibility of atg16l1 t300a to caspase-mediated cleavage and thus lower levels of functional atg16l1 (lassen et al. the autophagy pathway is important for defense against a number of intracellular pathogens and pathobionts including salmonella enterica serovar typhimurium, shigella flexneri, listeria monocytogenes, enterococcus faecalis, and mycobacterium tuberculosis (benjamin et al., 2013; castillo et al., 2012; gutierrez et al., 2004; huett et al., 2012 ;, 2013; ogawa et al., 2005; tattoli et al., 2012 ;, cytoplasmic bacteria are first marked for degradation primarily by ubiquitination (deretic et al., 2013). recent studies have identified key roles for the e3 ligases lrsam1 and parkin in recognition and ubiquitination of cytoplasmic bacteria; however, there are likely additional cellular e3 ligases that provide specificity to this pathway (huett et al., 2012; ubiquitinated bacteria are then recognized by the adaptor proteins p62, optineurin, and ndp52, leading to the recruitment of lc3 and the autophagy machinery (cemma et al., 2011; thurston et al., 2009; wild et al., the autophagy pathway targets only a subpopulation of bacteria within a cell, and little is known about the molecules involved in the selective recognition and targeting of bacteria for autophagosomal degradation, despite the important pathological consequences of this process. in this study, we approached the question of the impact of the atg16l1 t300a risk variant by searching for associated responsiveness quantitative trait loci (reqtls), which are defined as the effects of genetic variation on transcriptional responses of cells (barreiro et al., 2012). given that functionally similar genes are often transcriptionally coregulated, using multiple immune stimuli in genetically defined cell populations along with reqtls has enabled the identification of differential effects on molecular circuits (gat-viks et al., 2013). in the current study, we perform stimulus-specific perturbational profiling in pbmcs, quantitative mass-spectrometry-based (ms) proteomics, and genome-wide rna expression analysis to identify antibacterial genes that are functionally related to atg16l1. using these approaches, we demonstrate a role for clec12a in antibacterial autophagy and pinpoint a functionally relevant interaction node of clec12a with an e3 ligase complex that is important for this function. to identify molecules involved in the atg16l1-t300a-dependent antibacterial autophagy pathway, we used perturbational profiling to measure differential gene regulation in the setting of stimulation with pathogen-associated molecular patterns and bacterial challenge. given that mounting evidence indicates an important role for the involvement of host-microbiota interactions and bacterial defense pathways in crohn s disease (knights et al., 2013; we selected a panel of three stimuli to perturb pbmcs from healthy individuals homozygous for the ancestral atg16l1300 t allele or the 300a risk allele (rs2241880). the nod2 ligand muramyl dipeptide (mdp) was selected based on the previous association of this stimulus with crohns-disease-specific pathways (hugot et al., 2001; mdp can also modulate signals mediated through tlr2 activation, a pathway that has been implicated in crohn s disease and experimental colitis (netea et al., 2004; we therefore also used the tlr2 ligand pam3cys, as well as the bacterium borrelia burgdorferi, from which these lipopeptides were initially isolated, to elicit both nod2-dependent and -independent responses. using microarrays to assess genome-wide rna expression profiles, we found that baseline gene expression was similar between individuals harboring the non-risk and risk alleles. furthermore, upon exposure to innate immune ligands, we observed strong genotype-independent induction of proinflammatory cytokines and chemokines after hierarchical clustering (figures 1a and s1a). 2012), we next used factorial design analysis to examine whether transcriptional responses to pam3cys, borrelia, or mdp differed between groups stratified by the 300 t non-risk and 300a risk alleles. using multiple immune stimuli in genetically defined pbmcs along with reqtls has enabled differential effects on molecular circuits to be determined (gat-viks et al., 2013). our analysis identified 20 atg16l1300a-dependent reqtls under at least one stimulation condition (figures 1b and s1b). thus, perturbational profiling of human immune cells revealed genotype-specific responses to stimulation. we focused additional analysis on the autophagy pathway, the cellular degradation system that has been implicated in risk of crohn s disease by gwass, which identified predisposing alleles in atg16l1 and irgm (immunity-related gtpase family m) (rioux et al., we and others have reported that the atg16l1 t300a polymorphism is associated with impaired antibacterial autophagy as well as altered production of cytokines by pbmcs in response to immune stimuli (lassen et al., 2014; murthy et al., 2014). additionally, tlr simulation, particularly through tlr2, has been shown to induce antibacterial autophagy (anand et al., 2011; 2010). to determine whether any of the identified genes might be associated with autophagy, we generated protein interaction networks anchored on core autophagy proteins as well as autophagy-associated components previously identified from a high-confidence interaction network derived from a systems-wide autophagy proteomics study (behrends et al., 2010). of the genes identified, rab24 was previously reported to have a direct effect on autophagy (behrends et al., 2010; munaf and colombo, 2002), and three additional gene products (hck, fez1, and fyn) interacted with the autophagy network via known protein-protein interactions (figure s1c). these observations demonstrate that the atg16l1 t300a polymorphism is associated with transcriptional modulation reflecting known protein-protein interactions with the autophagy network. given the previously described role for atg16l1 and irgm in antibacterial autophagy (singh et al., 2006), we next used sirna to evaluate whether any of the identified atg16l1300a-dependent reqtls affected antibacterial autophagy. of the 20 genes identified, 13 had detectable expression in hela cells and were suppressed by single sirnas (figure s1d). antibacterial autophagy was assessed in sirna-treated cells using infection with s. typhimurium, a model pathogen that is degraded by autophagy (birmingham et al., 2006). knockdown of three of these genes (clec12a, rab24, and evi2b) resulted in significantly decreased salmonella-autophagosome colocalization (figures 1c, 1d, and s1e). we next tested whether rab24, evi2b, or clec12a play a role in classical autophagy using an lc3 flux assay, in which levels of lipidated lc3-ii are compared to lc3-i by western blot. in this assay, an increase in the ratio of lc3-ii to lc3-i corresponds to an increase in autophagic flux. knockdown of rab24 and evi2 resulted in decreased lc3-ii accumulation when cells were treated with torin 1, an mtor inhibitor and inducer of bulk autophagy, suggesting that these genes are involved in classical autophagy; knockdown of atg16l1 served as a control in these experiments. knockdown of clec12a did not impair lc3-ii accumulation under these conditions, suggesting that clec12a functions specifically in antibacterial autophagy (figure 1e) (thoreen et al., 2009). additionally, to confirm that the antibacterial autophagy phenotype seen with clec12a knockdown was not due to off-target effects, we employed a knockdown rescue approach (huett et al., 2012) by generating two sirna-resistant constructs that express full-length clec12a during knockdown of endogenous gene expression (figure 1f). the autophagy defect caused by sirna against clec12a was rescued by overexpression of the appropriate clec12a construct (figures 1 g and 1h), demonstrating that the decrease in antibacterial autophagy was specific to a reduction in clec12a expression and not due to off-target effects of sirna. additionally, sirna targeting clec12a did not alter bacterial entry, suggesting the observed effect was specific to the autophagy pathway (figure s1f). given our findings that immune cells harboring the atg16l1300a allele exhibited reduced induction of clec12a under immune stimulation conditions and that clec12a is required for efficient lc3-salmonella colocalization (figure 1), we next investigated whether a genetic interaction exists between the atg16l1 t300a snp and clec12a with respect to antibacterial autophagy. to investigate this hypothesis, we generated an atg16l1 knockout (ko) hela cell line using the crispr-cas9 system (ran et al. loss of atg16l1 expression was confirmed in single hela clones (figure s2a). as expected, atg16l1 ko cells were unable to convert lc3-i to lc3-ii under basal or stimulatory conditions (figure s2b) and had negligible lc3-bacteria colocalization (figure 2). to determine the effect of the t300a coding polymorphism, we stably transduced atg16l1 ko cells with 300 t (atg16l1 ko +atg16l1300 t) or 300a (atg16l1 ko +atg16l1300a) alleles, achieving equivalent expression levels of atg16l1 in these lines (figure s2a). as expected, we found that basal autophagy was restored in both atg16l1 ko +atg16l1300 t and atg16l1 ko +atg16l1300a cell lines, with modest impairment of antibacterial autophagy in the atg16l1 ko +atg16l1300a cells, consistent with published findings (figure 2) (conway et al., 2013; lassen et al., 2014; murthy et al., 2014). targeting clec12a with sirna resulted in impaired antibacterial autophagy in the atg16l1 ko +atg16l1300 t cell line similar to wt cells. we observed a more-pronounced impairment in atg16l1 ko +atg16l1300a cells, suggesting functional interaction of the t300a polymorphism and reduced clec12a expression. clec12a is a c-type lectin receptor (clr) belonging to a family of transmembrane proteins that recognize pathogen-associated molecular patterns and engage downstream immune signal transduction pathways (dambuza and brown, 2015; osorio and reis e sousa, 2011). clec12a is highly expressed in human myeloid cells (figure s3a), and targeting antigen to clec12a results in enhanced antigen presentation on dendritic cells in mice (lahoud et al., 2009; recent studies have demonstrated that clec12a binds to uric acid crystals and helps to dampen inflammation through its itim motifs; however, it remains unclear whether this is the only ligand for clec12a (neumann et al. to determine whether clec12a plays a role in pathogen defense in vivo, we used clec12a mice. bone-marrow-derived macrophages (bmdms) from wt or clec12a mice were infected with a strain of listeria (egde) known to be susceptible to autophagy in primary macrophages (anand et al., 2011; birmingham et al., 2007; huett et al., consistent with the salmonella infection results in sirna-treated cells, clec12a bmdms displayed lower levels of bacterial colocalization with lc3 compared with wt bmdms (figures 3a and 3b). additionally, clec12a bmdms did not show differences in torin-1-induced autophagy, suggesting that bulk autophagy is normal in these cells (figure s3b). taken together, these data suggest that clec12a functions selectively in the antibacterial autophagy pathway for multiple pathogens in both mouse and human cells. we next investigated whether clec12a plays a role during infection with intracellular pathogens in vivo. wt or clec12a mice were pre-treated with streptomycin and then infected with salmonella (conway et al. four days post-infection, stool was collected from infected mice and colony-forming units (cfus) were measured. clec12a mice had significantly higher cfu levels compared to wt mice (figure 3c). clec12a mice also exhibited increased systemic bacterial dissemination as assessed by measuring cfus in spleens (figure 3d). this increase in cfu was associated with a more-severe clinical disease score as assessed by overall appearance, piloerection, mobility, and posture (figure 3e), as well as decreased survival (figure 3f). taken together, these data suggest that clec12a plays a role in intracellular microbial defense both in vitro and in vivo. to further demonstrate the precise role for clec12a in antibacterial autophagy, we next tested whether knockdown of clec12a altered intracellular bacterial replication. using knockdown of atg16l1 as a positive control, we found that knockdown of clec12a in hela cells resulted in significantly increased intracellular replication of salmonella (figure 4a), demonstrating that clec12a is required for restriction of intracellular bacterial replication. s4a) were predominantly membrane associated and could be found surrounding intracellular dsred-labeled salmonella at both early and late time points after infection. association of clec12a with salmonella peaked at 30 min post-infection and declined gradually, whereas lc3-salmonella colocalization peaked 60 min after infection, consistent with previous data (figure 4b) (huett et al., 2012). live cell imaging confirmed that gfp-clec12a surrounds bacteria and then dissociates at approximately 1 hr post-infection (figure s4b), consistent with the time course of peak lc3 colocalization. given the early association of clec12a with bacteria, we next determined whether clec12a was present at sites of bacterial entry into the host cell. we found that gfp-clec12a colocalized with bacteria and ruffled actin, an indicator of recent bacterial entry, suggesting that clec12a associates with bacteria concomitant with bacterial cellular entry (figure s4c) (lhocine et al. we confirmed that clec12a colocalizes with salmonella and rab5, a marker of early endosomes (figure s5a). however, clec12a recruitment was also readily detected around salmonella without colocalization of rab5, suggesting that clec12a is not exclusively associated with endosomes (figure s5a). next, we evaluated the colocalization of clec12a with galectin 3 and galectin 8, which are both known to bind to sites of bacterial-induced intracellular membrane damage as well as sites of sterile membrane damage (thurston et al., 2012). clec12a colocalized with both galectin 3- and galectin 8-salmonella complexes (figure 5a). these data confirm that clec12a associates with bacteria early after infection concomitant with membrane damage. clec12a also colocalized with the antibacterial autophagy adaptor ndp52 (figure 5b) as well as the autophagosome proteins gfp-lc3, the atg8 homolog gabarapl2, and atg16l1 (figures 5c and 5d). in all cases, these proteins surrounded intracellular bacteria in conjunction with either endogenous clec12a or gfp-clec12a (figures 5b5d). of note, expression of gfp-clec12a gave a more-intense fluorescent signal and demonstrated increased levels of clec12a puncta within the cells, regardless of stimulation or bacterial infection. physical interactions between clec12a and lc3, gabarapl2, and atg16l1 were also confirmed by co-immunoprecipitation (figure s5b). we first determined whether knockdown of clec12a altered recruitment of ubiquitin to bacteria. at 1 hr post-infection, sirna knockdown of clec12a significantly reduced salmonella-ubiquitin colocalization (figures 5e and 5f). consistent with this observation, recruitment of ndp52 to salmonella was also decreased upon sirna knockdown of clec12a (figures 5 g and 5h). colocalization of salmonella with galectin 3, galectin, 8, and p62 were unchanged in cells treated with clec12a sirna (figures s5c s5e). these data reveal clec12a as an early bacteria-associated factor that binds to the autophagy machinery and helps initiate antibacterial autophagy through the ubiquitin-ndp52 pathway. recently, clec12a has been shown to be a receptor for dead cells (neumann et al., 2014). we hypothesized that clec12a could also recognize sites of membrane damage triggered by vacuolar disruption after bacterial entry (tattoli et al. galectin 3 served as a marker of damaged endosomes (thurston et al., 2012). gfp-clec12a colocalized with galectin 3 puncta after hypertonic shock and treatment with polyethylene glycol (peg) (figure 5i). these results demonstrate that clec12a is recruited to sites of membrane damage and could explain the high proportion of clec12a recruitment early after bacterial entry. to develop a more-integrated model of clec12a function in pathogen response, we utilized time course rna-seq data and targeted quantitative proteomics to pinpoint clec12a-dependent protein interactions that may be important for pathogen response. first, we employed 3 rna-seq to quantify the transcriptome of listeria-infected wt or clec12a bmdms at various times post-infection. using this approach, we identified genes with statistically significant differences (fdr-adjusted q value 0.05) in fold-change response to listeria infection between wt and clec12a bmdms at any time point post-infection (figure 6a). of note, expression of lamp1, a lysosomal membrane protein and marker of salmonella-containing vacuoles, was significantly downregulated in clec12a bmdms, suggesting endomembrane dynamics might be perturbed in these cells. we next performed clustering and pathway analysis using an expanded list of 674 nominally significant genes that were differentially regulated in clec12a bmdms at baseline as well as in response to listeria. genes were grouped into ten clusters using short time-series expression miner (stem), where each cluster represents one of the predefined model profiles in stem that capture potential distinct patterns of infection response (figure 6b; table s1) (ernst and bar-joseph, 2006). differences in these model profiles represent distinct regulation patterns of gene expression. gene ontology enrichment analysis was applied to assess the functional significance of each cluster of genes. the top scoring pathway that was differentially regulated in clec12a bmdms was the negative regulation of the intracellular signal transduction pathway that includes key signaling components such as ndufs3, tmem161a, and mapkapk5, among others (cluster 2; table s1). additionally, antifungal response genes (s100a9, myd88, and ptx3; cluster 6) were also differentially regulated in the clec12a bmdms. selective upregulation of glucose transport (ppbp and sorbs1; cluster 7) but downregulation of lipid transport (scarb1, slmo1, and soat2; cluster 5) in clec12a cells suggested preferential regulation of metabolism by clec12a in response to listeria infection. these results highlight the central role of clec12a in pathogen-induced defense pathways and suggest how deficiencies in clec12a could result in impaired bacterial defense. next, we sought to identify important transcriptional nodes that control these responses by integrating known transcription factor-dna interaction data with our temporal gene expression profiles of infected wt and clec12a bmdms into a unified model. to identify important regulation points in the clec12a pathway, we used dynamic regulatory events miner (drem), which searches for clec12a-dependent bifurcation events, defined by a transition in which a set of genes that were previously coregulated instead show divergent response/regulation profiles (figure s6a) (schulz et al., 2012). based on an extension of a hidden markov model, the analysis identified egr1, a transcription factor involved in transcriptional response to pathogens (de grado et al., 2001; mcdermott et al., 2011), as the earliest stage regulator that induces clec12a-dependent downregulation of specific genes (figure s6a). interestingly, egr1 is also known to be induced by either amino acid deprivation or er stress, which are both stimuli known to trigger autophagy (shan et al., 2014). these data suggest that reduced expression of egr1 target genes could contribute to the reduced pathogen response and autophagic targeting of bacteria in clec12a bmdms. other notable transcriptional regulators identified in our analysis that are known to be important for pathogen response include rela, nfe2, hif1a, and arnt2. taken together, this analysis suggests that deletion of clec12a results in an alteration of the response to pathogens at the transcriptional level and identifies key regulators involved in this response. to further understand the role of clec12a in antibacterial autophagy, we next applied an integrated systems approach using quantitative ms-based proteomics and coupled these results with our transcriptomic profiling analysis to uncover functional clec12a interactions relevant to bacterial defense (figure 6c). proteomic interactors were defined as those that demonstrated significantly increased binding to flag-clec12a relative to flag vector alone after immunoprecipitation (table s2). interactome analysis identified highly connected nodes within the clec12a interactors (figure s6b). a specific interaction between clec12a and lc3 or atg16l1 was not identified by ms-based proteomics; however, this may reflect the fact that a meaningful interaction between these proteins occurs only under stimulation and represents a fraction of the total cellular pool of these proteins. to identify clec12a protein interactions that may lead to the measured transcriptomic changes in response to bacterial infection, we used a network optimization approach to identify high-probability sub-networks, composed of signaling and transcriptional factor interaction cascades (figure 6c) (basha et al., 2013). we then used a hypergeometric test to rank order clec12a-interacting proteins with the most significantly enriched set of target genes within the network to identify relevant functional nodes (table s3). some of the key transcriptional regulators identified in these sub-networks overlapped with those identified by drem analysis, including rela, tp53, hif1a, and egr1. this analysis pinpointed the ubiquitin-like protein, nedd8 (neural precursor cell expressed, developmentally downregulated 8), as both a clec12a interactor and a regulator of egr1. these results suggest that the interaction between clec12a and nedd8 is a functional interaction and contributes to an early clec12a-dependent transcriptional response. this integrated approach also linked an e3 ubiquitin ligase complex that includes cul3 (cullin 3) and the substrate adapters klhl9 (kelch-like family member 9) and klhl13 (kelch-like family member 13) to clec12a-dependent transcriptional responses controlled by the transcription factors cebpb and cebpd (table s3) (chen et al., 2014). importantly, proteomic interactome analysis demonstrated a physical interaction between nedd8, klhl13, cul3, and klhl9, indicating that this is a functional e3 ligase complex that interacts with clec12a (figure 6d). nedd8 is a target of some cycle-inhibiting factors (cifs), which are virulence factors produced by bacterial pathogens that alter the host cell cycle (crow et al., 2012; jubelin et al., cif can associate directly with nedd8-modified cullin-ring complexes and inhibit their activity (crow et al. we therefore investigated whether cul3, nedd8, klhl9, and klhl13 had roles in antibacterial autophagy similar to clec12a (huett et al. 2013). upon sirna knockdown in hela cells, klhl9, klhl13, and nedd8 had a dramatic effect on both lc3-salmonella colocalization and bacterial replication, consistent with a role for these proteins in antibacterial autophagy (figures 6e and 6f). human genetics provides a powerful tool to identify and understand physiologically relevant host responses to pathogens given that host-pathogen interactions are known to have a role in many complex diseases. gene-gene interactions and environment-gene interactions add to the complexity of identifying causal genes and variants from gwas data, as well as determining how these variants affect pathogenesis. pathway-specific perturbational profiling and integrated systems approaches have previously been used in genetically defined organisms to identify genetic nodes of regulation underlying disease (gagneur et al., 2013; gat-viks et al., 2013; smith and kruglyak, 2008; zhang et al., 2013). using this strategy, we uncovered bacteria- and bacterial-ligand-specific programs affected in healthy individuals homozygous for the t300a polymorphism in the autophagy gene atg16l1. interestingly, 15% of the t300a-dependent response genes were found to play a role in autophagy pathways, highlighting important snp-pathway interactions. our network analysis identified the clr family member clec12a as a gene that is less responsive upon tlr2 or bacterial stimulation in individuals carrying the atg16l1 300a snp. pursuing the functional implication of this snp-environment interaction, we identified a role for clec12a in antibacterial autophagy and demonstrated that clec12a controls microbial replication in vitro and in vivo. using cells engineered to express the crohn s disease non-risk or risk allele of atg16l1, we interrogated the snp-gene interaction with clec12a to demonstrate an exacerbated effect on antibacterial autophagy in the setting of the disease-associated snp. these findings are consistent with clec12a functioning at an early step in the antibacterial autophagy pathway at the level of pathogen recognition caused by membrane damage, with atg16l1 functioning downstream at the level of autophagosome formation. these data suggest a model in which individuals who carry the 300a risk allele have reduced clec12a responsiveness that serves to compound defects in antibacterial autophagy. these results highlight how non-redundant genes in the same pathway can be identified through ligand-specific transcriptional regulation. clrs are a large family of pattern recognition receptors, many of which are important signaling mediators in antimicrobial defense (drummond and brown, 2013). clec12a was recently shown to be a receptor for uric acid crystals and dead cells (neumann et al., 2014), and we extend this finding to demonstrate that clec12a also recognizes sites of intracellular membrane damage triggered by bacterial entry (tattoli et al., 2012; additionally, we show that clec12a likely serves as an adaptor to help recruit ubiquitin and ndp52 to sites of vacuolar damage caused by bacteria and thus induce antibacterial autophagy. these data suggest parallels between the functions of galectins and clrs as early sensors of damage in selective autophagy pathways. additionally, a dendritic cell clr, dngr-1, regulates endocytic handling of necrotic cell antigens to modulate cross-priming, suggesting that clrs could function broadly in the selection of endocytic cargo (zelenay et al., 2012). recent data also indicate a role for another clr, clec16a, in mitophagy, indicating that these lectins can function broadly to control target selectivity in autophagy (soleimanpour et al., 2014). here, we integrated time course rna-seq data and quantitative proteomics to identify relevant clec12a-dependent protein interactions that are involved in antibacterial autophagy. we identified an e3 ligase complex including klhl9, nedd8, and klhl13 that interacts with clec12a and is required for antibacterial autophagy. transcriptomic data suggested that the association of clec12a with this e3 ligase complex is important for the clec12a-dependent response to bacterial infection. virulence factors produced by some bacteria are known to directly target neddylated cullin-associated ubiquitin ligase activity, suggesting that these proteins might be broadly involved in inhibiting bacterial pathogenesis (jubelin et al., 2010). additionally, klhl9 has been previously associated with early onset autosomal dominant distal myopathy, a disease in which alterations to the autophagy pathway are thought to contribute to pathophysiology (cirak et al., 2010). taken together, these data identify a role for the recently evolved substrate adapters klhl9 and klhl13 as well as nedd8 in the restriction of bacterial infection. previous studies have suggested roles for the e3 ligases smurf1, lrsam1, and parkin in pathogen-specific autophagy (huett et al., 2012; manzanillo et al., 2013; orvedahl et al., 2011). recent studies have also highlighted roles for other e3 ubiquitin ligases in the control of bulk autophagy. these include a role for rnf5 in regulating the levels of atg4b (kuang et al., 2012), a role for cullin-5 and cullin-4 in autophagy regulation through ambra1 (antonioli et al., 2014), and a role for rnf216 in autophagy regulation through beclin1 (xu et al., 2014) additionally, several members of the trim family of proteins can act as a platform for assembly of the autophagy machinery (mandell et al., expression of rnf5 and rnf216 were also shown to increase pathogen susceptibility through autophagy (kuang et al., 2012; xu et al., 2014). taken together with our data, these findings demonstrate that e3 ubiquitin ligases play an important role in regulating autophagy at different stages of the pathway. specifically, e3 ubiquitin ligases create selectivity in autophagy regulation by recognizing and integrating specific signals from pathogens and cellular states. utilizing e3 ligases to tightly control the response to pathogens is likely a highly conserved mechanism of innate defense (pollier et al., 2013). here, we use integrated genomics to demonstrate a role for clec12a in antibacterial autophagy and identify an e3 ligase complex that provides insight into the selectivity of pathogen degradation. our in vivo results highlight a strong role for clec12a in the restriction of microbial replication. it is possible given this dramatic effect that clec12a functions not only in antibacterial autophagy but in other pathogen defense pathways as well. this study highlights how perturbational profiling can be used to study pathways underlying immunity and pathogen defense and illustrates the potential of combining whole-genome experimental data sets to understand functional gene interactions within a relevant pathway. for perturbational profiling, blood was collected after written informed consent (or waiver as approved by the institutional review board) from healthy volunteers at radboud university nijmegen medical centre (runmc). the study was approved by the institutional review boards and was performed in accordance with the declaration of helsinki. separation and stimulation of pbmcs from healthy individuals was performed as described previously (netea et al., 2004). microarray hybridization and genotyping of volunteers was performed as previously described (smeekens et al., 2013). factorial design analysis was performed as described previously (cadwell et al., 2010). s. typhimurium infections of hela cells and gentamicin protection assays were performed as previously described (huett et al., 2012). for entry assays, cells were infected for 20 min, washed, fixed in 4% paraformaldehyde for 15 min at room temperature, and stained as described below. for antibacterial autophagy assays in sirna-treated cells, rnai knockdown for 48 hr was performed as described above on hela cells plated on glass coverslips and infected as above. autophagy was induced in hela cells by treatment for 4 hr with 100 nm torin-1, 10 g ml of e64d-pepstatin a (sigma-aldrich), or mock treatment with dmso. cells were treated with sirna for 48 hr as described above and then autophagy was induced followed by cell lysis (25 mm tris [ph 7.5], 0.5% np-40, 150 mm nacl, and protease inhibitors [roche]). western blotting to demonstrate lc3 lipidation was performed after equalization of protein amounts and sds-page on an anykd polyacrylamide gel (bio-rad). following transfer to immobilon-p membranes (millipore), detection was performed using rabbit anti-lc3 primary (sigma-aldrich), mouse anti-actin (sigma-aldrich), and appropriate fluorescent secondary antibodies (li-cor biosciences) as previously described. the second exon of atg16l1 was targeted in hela cells using the px330 plasmid crispr system as described (ran et al., 2013). all animal studies were conducted under protocols approved by the subcommittee on research animal care (srac) at massachusetts general hospital. clec12a mice were obtained from the laboratory of g.d.b. at the university of aberdeen. clec12a mice were produced by conventional gene targeting of exons 14 on a c57bl/6 background (p. redelinghuys, a. augello, r.a. protocols for bacterial growth and infection were performed as previously described, with slight modification (barthel et al., 2003; conway et al., 2013). quantitative proteomics using itraq labeling of peptides was performed as described previously (lassen et al., 2014; mertins et al., 2014). hela cells were reverse-transfected with plasmid expressing gfp-clec12a on glass coverslips in 12-well plates the night before the assay. osmotic lysis of endosomes was accomplished by exposing cells to hypertonic medium (0.5 m sucrose in pbs with 10% peg100) for 10 min. cells were washed twice with 1 pbs and then incubated in 60% pbs for 3 min as described previously (thurston et al., 2012). cells were returned to complete medium for 20 min and then fixed with ice-cold methanol.

summarythe polymorphism atg16l1 t300a, associated with increased risk of crohn s disease, impairs pathogen defense mechanisms including selective autophagy, but specific pathway interactions altered by the risk allele remain unknown. here, we use perturbational profiling of human peripheral blood cells to reveal that clec12a is regulated in an atg16l1-t300a-dependent manner. antibacterial autophagy is impaired in clec12a-deficient cells, and this effect is exacerbated in the presence of the atg16l1300a risk allele. clec12a/ mice are more susceptible to salmonella infection, supporting a role for clec12a in antibacterial defense pathways in vivo. clec12a is recruited to sites of bacterial entry, bacteria-autophagosome complexes, and sites of sterile membrane damage. integrated genomics identified a functional interaction between clec12a and an e3-ubiquitin ligase complex that functions in antibacterial autophagy. these data identify clec12a as early adaptor molecule for antibacterial autophagy and highlight perturbational profiling as a method to elucidate defense pathways in complex genetic disease.

PMC4507440

pubmed-272

takayasu arteritis (ta) is a chronic inflammatory arteritis affecting the aorta and its main branches. the disease has a world-wide distribution, but has a high prevalence in japan. although there are no population based studies from india, reports have shown than the prevalence may be as high as in japan. most of the patients diagnosed to have this condition are women in their second and third decades of life. the occurrence of the disease in young children and infants is extremely rare with only a few cases reported all over the world. the present case report is about a 2-year-old female patient who was brought to the hospital with a history of incidentally detected hypertension of 2 months duration. she was born out of a non-consanguineous marriage and had an uneventful antenatal and postnatal course with normal developmental milestones and she had received vaccinations according the national immunization program, which includes bacillus calmette-guerin (bcg). on examination, she was afebrile, active and well-nourished; her weight was 16 kg and height was 80 cm. blood pressure was 140/90 mmhg, which was more than the 99 percentile for her height. her renal functions were normal (blood urea: 8.4 mg/dl; serum creatinine: 0.39 mg/dl). serum sodium was 133.5 mmol/l, s. potassium 3.3 mmol/l, s. calcium 9.9 mg/dl and s. phosphurus 3.94 mg/dl. erythrocyte sedimentation rate (esr) was 20 mm/1 h and c-reactive protein was 6 mg/dl. the size of the right kidney was 7.1 cm 3.6 cm and that of the left kidney was 6.1 cm 2.9 cm. computed tomography aortogram showed critical stenosis of the left renal artery, at a length of 8 mm from the origin, a short segment stenosis of the right renal artery at its origin, a tight focal stenosis at the origin of the celiac artery with post-stenotic dilatation, mild stenosis at the origin of the superior mesenteric artery and narrowing of the abdominal aorta at the level of renal arteries; there was no para-aortic lymphadenopathy [figure 1]. the diameter of aorta at the level of diaphragm, renal arteries and just above bifurcation into iliac arteries were 6.2 mm, 5.2 mm and 6.6 mm respectively, proving that there was a narrowing at the level of renal arteries followed by post-stenotic dilatation. with these angiographic findings, in this infant with hypertension, a diagnosis of ta was made according to the european league against rheumatism/pediatric rheumatology international trials organization/pediatric rheumatology european society (eular/printo/pres) criteria-2008. the child is being treated with nifedipine 5 g thrice daily and clonidine 50 mg thrice daily and her blood pressure is 90/55 mmhg. computed tomography angiogram showing bilateral renal artery stenosis and narrowing of abdominal aorta (arrows: a: short segment stenosis of right renal artery, b: stenosis of left renal artery with small left kidney, c: narrowing of the abdominal aorta at the level of renal arteries) ta, also known as pulseless disease, occlusive thromboaortopathy and martorell syndrome, was first systematically described by a japanese ophthalmologist mikito takayasu. the disease remains an enigma as the exact cause of the disease is still not elucidated. a human leucocyte antigen (hla) association and viral etiology have also been postulated. the clinical presentation of ta includes three phases: the early phase or prepulseless phase characterized by nonspecific systemic features such as malaise, arthralgia, weakness, weight loss and low grade feverthe pulseless phase characterized by claudication, amaurosis or diplopia and renovascular hypertensionthe occlusive phase characterized by transient ischemic attack, stroke, aortic regurgitation, cardiac failure, renovascular hypertension and claudication. the early phase or prepulseless phase characterized by nonspecific systemic features such as malaise, arthralgia, weakness, weight loss and low grade fever the pulseless phase characterized by claudication, amaurosis or diplopia and renovascular hypertension the occlusive phase characterized by transient ischemic attack, stroke, aortic regurgitation, cardiac failure, renovascular hypertension and claudication. the diagnosis of ta in children is based on the eular/printo/pres criteria [table 1]. diagnostic criteria for takayasu arteritis in children ta is certainly underdiagnosed and underreported from india, due to the fact that the disease may not present with classical features and the imaging modalities are available only in tertiary care centers. a study that compared the clinical manifestations of ta in india and japan reported that there was a significant variation in the manifestations of the disease in the two countries. in contrast to japanese patients in whom proximal aorta involvement (takayasu conference classification-type i and ii) was common, in indian patients descending and abdominal aorta involvement (type iv) was common. moreover, hypertension was the most dominant sign in indians compared with pulse lessness in the japanese. it was also noted that the age at diagnosis of the disease was almost a decade earlier in indians compared to japanese (28 10 vs. 37 14 years, p<0.01). in an indian study, it was found that aortoarteritis was the most common cause of renovasular hypertension and accounted for 59.4% of all cases. however, the mean age of the subjects was 27 years and the youngest child was 5 years of age. to the best of our knowledge, there are no reports from india of a case of ta in an infant. our patient had type iv disease, with the involvement of abdominal aorta, coeliac, superior mesenteric and both renal arteries. although it is suggested that glucocorticoids are the mainstay of treatment in the early or prepulseless phase, other immunosuppressive agents like methotrexate, azathioprine and anti-tumor necrosis factor agents have also been used, especially in steroid resistant cases. however, no evidence is available for benefit of therapy in the pediatric age group. however percutaneous intervention is less likely to succeed when stenosis or occlusions affect lengthy portions of an artery or the artery is heavily scarred. an angioplasty to the left renal artery was attempted in this case, but was unsuccessful. hence it was decided to continue medical management with anti-hypertensives as blood pressure could be controlled with medications and she was not given steroids as there were no clinical or laboratory indicators of an active inflammatory disease in this infant. although the world-wide prevalence of ta is very low, it is more prevalent in asian countries like japan and india. the clinical manifestations of the disease in india are different from that seen in japan. type iv disease involving abdominal aorta and renal arteries is more common in indians and hypertension is the most common sign. if the disease is active, steroids can be tried and the lesions amenable to angioplasty may be corrected by a percutaneous transluminal angioplasty.

takayasu arteritis (ta), a chronic inflammatory arteritis affecting the aorta and its main branches, is a rare condition mainly affecting young women in the second and third decades of life. occurrence of ta in infants is extremely rare, with only less than 10 cases reported all over the world until date. we report a case of a 2-year-old girl who presented with hypertension and was diagnosed to have ta with bilateral renal artery stenosis and this is probably the youngest case reported from india.

PMC4119343

pubmed-273

the increasing prevalence of childhood obesity, especially in preschool aged children [1, 2], has stimulated research targeting critical periods of growth. according to freinkel's hypothesis of fuel-mediated teratogenesis, the intrauterine environment can influence changes in gene expression and affect the development and maturation of fetal organs and tissues [3, 4]. the postnatal period up to 2 years of age is also a critical period of growth. indeed, rapid infant weight gain is associated with an increased risk of obesity and metabolic consequences later in life [58]. these include metabolic parameters such as in utero glucose exposure [911], maternal prepregnancy body mass index (bmi) [1214], and maternal insulin sensitivity during pregnancy. in a cohort of low-income children, maternal obesity during pregnancy more than doubled the risk of obesity in children. maternal diet and physical activity during pregnancy [1619], as well as smoking may impact offspring risk of obesity and metabolic risk [2023]. however, there is a paucity of literature examining these risk factors in very young children. in particular, breastfeeding has a protective role against the development of obesity [2427]. harder et al. reported a dose-dependent association between breastfeeding and risk of obesity, where each month of prolonged breastfeeding decreased obesity risk in the child. beyond the first few months of life, breast-fed infants gained less weight than formula-fed infants. another study showed weight gain from 6 to 12 months was less in infants exclusively breastfed for 5 months compared to 2 months. earlier introduction to complementary foods may also contribute to increased risk of childhood overweight [14, 31], however the evidence is inconsistent. additionally, reduced physical activity and increased screen time (television and video) are associated with obesity risk in older children, although limited data is available in infants [33, 34]. there is little known about the impact of maternal and infant lifestyle on weight gain and adiposity at 1 year of life. the effect of screen time in infants on weight gain and adiposity has not been included as a potential factor in prior statistical models. there is also little information on the effect of maternal physical activity on weight outcomes of offspring. the objective of our study was to determine how maternal physical activity, maternal insulin sensitivity (isogtt), prepregnancy bmi, infant feeding practices (breastfeeding duration, age of introduction of formula, and complementary foods), and screen time contribute to infant weight gain and adiposity at 1 year of age. the study protocol was approved by the research ethics board at mount sinai hospital and the hospital for sick children. participants were recruited for this prospective cohort study at the time of antepartum gestational diabetes mellitus (gdm) screening and were consented to be followed into the postpartum. all consenting women then completed a 3-h oral glucose tolerance test (ogtt) in late 2nd or early 3rd trimester. venous blood samples were drawn at baseline, 60, 120, and 180 min after ingestion of a standard 100 g glucose load. the pregnant women were then classified into 3 glucose tolerance groups: (1) gdm, as defined by the national diabetes data group (nddg) criteria (requires at least two of the following: fasting glucose 5.8 mmol/l, 1 h postload glucose 10.6 mmol/l, 2 h postload glucose 9.2 mmol/l, or 3 h postload glucose 8.1 mmol/l); (2) gestational impaired glucose tolerance (gigt), defined as meeting only one of the above criteria; (3) normal glucose tolerance (ngt), defined as not meeting any of the nddg criteria. parental demographics, medical history and anthropometrics were collected during pregnancy at the time of the ogtt. data collected included maternal age, maternal prepregnancy weight, maternal and paternal ethnicity, family history of diabetes, socioeconomic status, and maternal physical activity indices. maternal isogtt was calculated from the ogtt using the matsuda index, which is well correlated with insulin sensitivity derived from the euglycemic-hyperglycemic clamp method. physical activity was assessed using the baecke questionnaire, which has been validated in several populations including women of child-bearing age [37, 38]. the questionnaire was completed during the ogtt, with participants reporting on their physical activity in the year preceding the pregnancy. the baecke questionnaire measures three domains of physical activity: (i) occupation-associated activity (work index); (ii) sport-related physical activity (vigorous/sport index); (iii) leisure-time physical activity not including sports (leisure index). the work index quantifies the exertion related to occupational activities, including sitting, standing, lifting, and walking, as well as effects on the individual (e.g., fatigue and perspiration). the sport index characterizes vigorous/sport activity with respect to intensity (using the updated compendium of physical activities). these indices were calculated on a scale from 15, where 5 represented the highest level of physical activity for each category. for example, a score of 3 out of 5 for leisure index might indicate sometimes walking or cycling for 1530 min and seldom watching television. mean parental education score and occupation score was calculated on a scale of 17 and 19, based on the hollingshead index, an established surrogate index of socioeconomic status. a maximum averaged parental score of 62 indicated the highest level of education and profession. infant information collected at birth included length of gestation, gender (male or female), and birth weight. at the 1 year visit, infant weight and length were measured, and weight-for-length z-score was calculated according to the world health organization (who) 2006 child growth standards to provide a surrogate measure of adiposity. the infant lifestyle questionnaire was completed by the mothers when the infants were 3 and 12 months of age and provided information on exclusive breastfeeding duration, age of introduction to formula and cereal, and screen time based on predictors found to be important for the development of obesity (average daily exposure to tv or video viewing, meals eaten while tv is on, tv in bedroom) [34, 42]. infants born<37 or>42 weeks, twins, or those with medical illnesses that required prolonged hospitalization were excluded from the analysis. bivariate analysis of continuous variables with infant weight gain and weight-for-length z-score were assessed by spearman's correlation analysis. independent samples t-test or one-way analysis of variance (anova) and post hoc analysis (fisher's least significant difference) were used to test differences in the outcome variables with maternal glucose tolerance group (gdm, gigt, or ngt), gdm status (yes/no), family history of diabetes (yes/no), infant gender (male/female), ethnicity (caucasian or non-caucasian), age of introduction to formula (at birth, 15 months, 6 months or never), and average daily screen time divided into 3 categories (no screen time,<60 minutes, and 60 minutes). we converted age of introduction to formula into a categorical variable because although exclusive breastfeeding duration and age of introduction to formula are similar variables, they are not synonymous because some infants were never formula-fed (n=80). variables determined to be significant from bivariate analyses, concurrently with variables known to influence infant weight gain and adiposity, were entered into multiple linear regression models. two separate models were created for weight gain from birth to 1 year and weight-for-length z-score at 1 year. nonmodifiable risk factors (infant age, sex, ethnicity, birth weight, and family history of diabetes) were forced into the model and modifiable risk factors (maternal prepregnancy bmi, gdm status, maternal physical activity indices prior to pregnancy, socioeconomic status, maternal log isogtt, infant exclusive breastfeeding duration, age of introduction to formula, age of introduction to cereal, and daily screen time) were entered according to the forward stepwise method. descriptive characteristics and lifestyle measures are presented in table 1 for mothers and infants at 1-year postpartum (n=246). from the time of consent postnatally to the 1-year followup visit, 62 (20%) of the original 311 infants were lost to followup. there were no significant differences in gdm status, prepregnancy bmi, maternal education, or maternal physical activity between mothers retained in the study versus those lost to followup. no significant differences were found for infant weight gain and weight-for-length z-score based on the mother's gdm status (yes/no) or glucose tolerance group during pregnancy (gdm, gigt, or ngt). independent samples t-tests also showed no significant differences in the infant outcomes for family history of diabetes (yes/no) and infant ethnicity (caucasian or non-caucasian). males had greater weight gain than females (p<0.001), however no differences between males and females for weight-for-length z-score were found (p=0.636). one-way anova showed significant differences in infant weight gain for age of formula introduction (p=0.001) and screen time (p=0.032) (figure 1). similar trends for age of formula introduction were found for infant weight-for-length z-score at 1 year (p=0.012). however no differences were found between 0,<60 min, or 60 minutes of daily screen time (p=0.19). spearman's correlation analysis (table 2) showed a negative association for infant weight gain with maternal pregravid vigorous/sport index (p=0.031), exclusive breastfeeding duration (p<0.001), and an earlier age of introduction to cereal (p=0.02). weight-for-length z-score was positively associated with maternal prepregnancy bmi (p=0.003) and birth weight (p<0.001), and negatively associated with maternal log isogtt during pregnancy (p=0.031) and maternal pregravid vigorous/sport index (p=0.006). maternal pregravid vigorous/sport index was also positively correlated with isogtt during pregnancy (p<0.001), as expected from previous data. each month of prolonged exclusive breastfeeding reduced weight gain by 116.4 g, after adjustment for infant age, sex, infant ethnicity, family history of diabetes, and maternal pregravid vigorous/sport index (p<0.001). after adjustment, each unit increase in maternal pregravid vigorous/sport index decreased weight gain by 218.6 g (p=0.016). in total, 33% of the variance in the model for weight gain was explained by the sample. infant birth weight, infant ethnicity, and family history of diabetes did not significantly predict infant weight gain at 1 year. additionally, socioeconomic status, maternal prepregnancy bmi, maternal isogtt, gdm status, maternal pregravid work index, maternal pregravid leisure index, infant age of introduction to formula, and infant screen time did not emerge in the model when entered. for weight-for-length z-score, an increase in one unit of maternal prepregnancy bmi (kg/m) was associated with an increase in weight-for-length z-score of 0.03 (p=0.016), or one standard deviation change on the who child growth standards, after adjustment. thus, mothers with a greater prepregnancy bmi were more likely to have heavier infants normalized for length. in addition, each month of prolonged exclusive breastfeeding and unit increase in maternal pregravid vigorous/sport index decreased weight-for-length z-score by 0.08 (p=0.010) and 0.20 (p=0.031), respectively. infant sex, infant ethnicity, and family history of diabetes were not significantly associated with infant weight-for-length z-score. variables that did not emerge in the model included: socioeconomic status, maternal isogtt, gdm status, maternal pregravid work index, maternal pregravid leisure index, infant age of introduction to formula, and infant screen time. approximately, 19% of the variance in the model for weight-for-length z-score was explained by the sample. these findings demonstrate that maternal pregravid physical activity, prepregnancy bmi, and infant feeding practices have a significant influence on infant weight gain and adiposity. weight gain from birth to 1 year was negatively predicted by infant female sex, maternal pregravid vigorous/sport activity, and exclusive breastfeeding duration and positively predicted by infant age at time of 1 year visit. weight-for-length z-score at 1 year was negatively predicted by maternal pregravid vigorous/sport activity and exclusive breastfeeding duration and positively predicted by birth weight, infant age at time of 1 year visit, and maternal prepregnancy bmi. factors that have been previously shown to influence infant weight gain and weight-for-length z-score, such as socioeconomic status or gdm status, were not significant in our model. this may be due to the fact that women in this study tended to have excellent glycemic control, which was evidenced by normal birth weight in the gdm pregnancies. the effect of maternal prepregnancy bmi on infant adiposity is consistent with existing literature [1214, 31]. in mothers with ngt or gdm, maternal prepregnancy bmi was significantly associated with childhood overweight in both groups, even after adjustment for maternal glucose status and infant birth weight. furthermore, knight and colleagues reported that the impact of maternal fasting plasma glucose in nondiabetic mothers on infant growth was transient, while maternal prepregnancy bmi and paternal bmi remained correlated with offspring bmi at 2 years of age. thus, the authors suggested that parental obesity, shared environment, or genetic factors had a greater influence on childhood bmi than maternal fasting plasma glucose during pregnancy. after controlling for confounding factors, maternal pregravid vigorous/sport activity significantly predicted infant weight gain. the mean pregravid vigorous/sport index in our study was 2.4, which suggests that 1530 min of walking or cycling per day in mothers prior to pregnancy may be beneficial for decreasing obesity risk of offspring. maternal log isogtt did not predict infant growth at 1 year, after adjusting for maternal physical activity indices. prior analyses by our group showed pregravid vigorous/sport activity was an independent predictor of maternal isogtt and reduced glucose intolerance in pregnancy. taken together, pregravid physical activity may affect infant weight gain through a mechanism that partly involves maternal isogtt, however, these results suggest that maternal lifestyle may have a greater impact on infant weight gain than maternal glucose tolerance group or isogtt. although daily screen time was not a significant predictor of infant weight gain or adiposity in our multivariate analyses, it was unsettling to find that more than half of the infants in our study were already exposed to television at 1 year of age and 11% of infants watched more than 2 hours of television per day. infants with 60 minutes of screen time each day were heavier at 1 year of age than infants with 0 or<60 minutes of daily screen time. one possible explanation may include decreased overall activity levels in infants exposed to television for longer periods of time. preschool children, more than 2 hours of television per day was associated with a higher risk of overweight and at risk for overweight and greater adiposity. despite the known effect of screen time on bmi in childhood [4547], there is currently limited information on the effect of screen time under 2 years of age. the mechanisms to explain the effects of breastfeeding compared to formula feeding may include different physiological and behavioural factors. several studies [2427], however not all [32, 48, 49], suggest that breastfeeding has a protective role on later obesity risk. after adjusting for confounding variables, infants exclusively breast fed for a longer duration had reduced weight gain and adiposity at 1 year. this may be influenced by the unique metabolic factors in breast milk compared to formula, such as breast milk leptin [50, 51] and adiponectin that may induce earlier satiety. the higher protein content of formula may also contribute to increased adiposity in formula fed infants. koletzko and colleagues demonstrated that infants given formula with high protein content compared to infants given formula with low protein content resulted in increased weight at 2 years of age with no effect on infant length. it is thought that the higher protein consumption results in higher insulin secretion and stimulates the expression of insulin-like growth factor i (igf-i), leading to more adipogenic activity and adipocyte differentiation [54, 55]. additionally, behavioural differences between breast-fed and formula-fed infants may affect infant energy intake. studies have shown that there is less maternal control and a greater response to the infant's hunger and satiety cues with breastfeeding compared to formula feeding [56, 57]. there is also a lower frequency of meals and a higher uniformity of feeding volumes in formula-fed infants compared to breast-fed infants. although some studies have reported the timing of cereal introduction as a positive predictor of infant weight gain, it did not emerge in our multivariate analyses. in a recent study, huh and colleagues noted that the timing of the introduction of solid foods on the odds of obesity at 3 years of age varied by breastfeeding status. infants that were introduced to solid foods before 4 months and were never breast fed or stopped breastfeeding before 4 months had a sixfold increase in the odds of obesity compared to infants breast fed for more than 4 months. since our study population was introduced to cereal later than 4 months (5.5 1.1 months) altogether, our findings on infant feeding suggest that exclusive breastfeeding duration may be more predictive of infant weight gain and adiposity than age of formula or cereal introduction. this study should be viewed in context of certain strengths and limitations. due to the assessment of glucose tolerance in the late 2nd or 3rd trimester of pregnancy, we can not completely exclude the possibility that some individuals may have received treatments following ogtt that could affect in utero glucose exposure and isogtt on infant outcomes. although data was available on the type of intervention (diet therapy or other), glycemic control during pregnancy could not be determined. other limitations included the lack of data on maternal diet and maternal physical activity during pregnancy in our study. proposed that maternal energy intake influenced energy intake in children more than intrauterine exposure to diabetes, which suggests maternal energy intake should be included in future studies. additionally, our study population had a large proportion of caucasian infants and highly educated parents, and it is unclear whether results may be extended to other ethnic backgrounds or families with lower socioeconomic status. loss to followup was 20%, and although there were no differences in maternal factors between those who left and remained in the study, feeding practices of the infants may have differed. we were also unable to report on infant physical activity due to challenges in capturing physical activity accurately and objectively in infants. nevertheless, we examined maternal and infant lifestyle variables that have not been previously studied together, providing further insight into the effects of the maternal and infant environment on weight gain and adiposity while controlling for important confounding variables. in summary, increased maternal pregravid physical activity and longer exclusive breastfeeding duration may have a critical influence on reducing infant weight gain and adiposity as early as 1 year of age. results from this study support the recommendation for exclusive breastfeeding in infancy, and suggest maternal physical activity may also influence postnatal outcomes. future directions include examining the additive effects of maternal diet during and after pregnancy, infant physical activity, and sedentary time on infant weight gain and adiposity. the evaluation of paternal physical activity may also provide insight into the impact of family lifestyle on infant growth. longitudinal followup of these children will examine the effects of maternal and infant factors on bmi and adiposity in early childhood beyond 1 year of age.

increasing evidence supports the contribution of intrauterine environmental exposures on obesity risk in offspring. few studies have included maternal and infant lifestyle factors. our objective was to study the impact of maternal physical activity, infant feeding, and screen time on offspring weight gain and adiposity. in a prospective cohort study, 246 mothers underwent testing during pregnancy to assess glucose tolerance status and insulin sensitivity. anthropometry and questionnaires on physical activity, infant feeding, and screen time were completed. multiple-linear regression was performed to examine the impact of maternal and infant factors on infant weight gain and weight-for-length z-score at 1 year. infant weight outcomes were negatively predicted by maternal pregravid vigorous/sport index and exclusive breastfeeding duration. after adjustment, each unit increase in maternal pregravid vigorous/sport index decreased infant weight gain by 218.6 g (t=2.44, p=0.016) and weight-for-length z-score by 0.20 (t=2.17, p=0.031). each month of exclusive breastfeeding reduced infant weight gain by 116.4 g (t=3.97, p<0.001) and weight-for-length z-score by 0.08 (t=2.59, p=0.01). maternal pregravid physical activity and exclusive breastfeeding duration are associated with weight gain and adiposity as early as 1 year of age.

PMC3463916

pubmed-274

we recently demonstrated that diabetes directly induced dental caries in rats and mice, although a direct association between the 2 was less evident and conflicting in humans [14]. we demonstrated that dental caries were produced using noncariogenic diets with a low concentration of sugar in diabetic rodent models [57], although many studies usually add large amounts of sugar to the diet to induce dental caries [8, 9]. in addition, early studies on the production of experimental dental caries have reported the effects of physical properties of cariogenic diets with high concentrations of sugar on dental caries. these studies mainly used finely ground cariogenic diet [1013] because it is more cariogenic compared to a coarsely ground diet in rodents. moreover, hard and coarse foods have the ability to prevent caries [1417]. thus, modifying the dietary formulation may possibly enhance or reduce caries development in diabetic animals. however, no reports have investigated the effects of the physical properties of non-cariogenic standard diets on dental caries in diabetic animals. currently, 2 types of non-cariogenic standard diet formulations (i.e., powdered and pelletized diets) are widely used in experimental rodents. in the present study, we compared the effects of these diets on the development of dental caries in a diabetic rodent model focusing on the difference in hardness between the powdered and pelletized diets. six-week-old female f344 rats were supplied by japan slc, inc. the animals were housed in stainless-steel cages at a temperature of 2026c and a relative humidity of 4070% under a 12/12 h light/dark cycle, that were ventilated with filtered fresh air. to prevent infection, the animals were allowed free access to tap water and fed with a widely used standard pelletized or powdered diet (charles river formula 1 (crf-1); oriental yeast co., ltd., the animals were handled according to the principles for all experimental procedures outlined in the guide for the care and use of laboratory animals prepared by our institution (setsunan university) and the japanese association for laboratory animal science. the glucose levels in the fresh urine were measured semiquantitatively using urine test paper (wako pure chemical industries, osaka, japan) daily from day 1 to day 3 after dosing, once every week for 1 month after the first week, and once every month thereafter. the blood glucose levels in the tail vein samples were also measured semi-quantitatively using the glucose oxidase method (glutest e; sanwakagaku, aichi, japan) once every month from the fourth week after alloxan injection. blood samples obtained from the tail vein and fresh urine were collected from 1:00 to 4:00 p.m. the severity of hyperglycemia was defined as follows: normal,<200 mg/dl; mild,>200 mg/dl; moderate,>300 mg/dl; or severe,>400 mg/dl. the severity of glycosuria was defined as follows: normal,<100 mg/dl; mild,>100 mg/dl; moderate,>250 mg/dl; or severe,>500 mg/dl. the experimental design is shown in figure 1. ten rats, aged 7 weeks, were given a single dose (35 mg/kg body weight) of alloxan (sigma-aldrich japan, tokyo, japan) via tail vein injection. the dose of alloxan was determined as the given dose at which a rat survives for a long period after the onset of diabetic symptoms. after the confirmation of hyperglycemia and glucosuria following the dosing of alloxan, five rats were given a pelletized crf-1 diet (diabetes-pelletized diet group) and the remaining 5 rats were given a powdered crf-1 diet (diabetes-powdered diet group). as a control, each of the 5 intact rats was fed a pelletized or powdered crf-1 diet (control-pelletized diet group and control-powdered diet group). the animals were euthanized by exsanguination under deep anesthesia at the end of the observation period. subsequently, the mandible was removed and fixed in 10% neutral-buffered formalin (ph 7.4). after a 24 h fixation, the occlusal, buccolingual, and proximal surfaces of all of the molar teeth were intensively observed under a binocular stereoscope. soft x-ray images of the mesiodistal plane were taken under conditions of 35 kv and 2 ma for 4 min. the molar teeth were classified into 5 groups according to caries characteristics by observing and analyzing the radiographs: no radiolucent change (grade 0), radiolucent area only on the occlusal surface of the crown (grade 1), radiolucent areas on occlusal surface and either of the mesiodistal surfaces of the crown (grade 2), radiolucent areas over the entire surface of the crown (grade 3), and radiolucent areas over most of the surface of the dental root (grade 4). the mean score of the caries was used as indicator for comparing the severity of the carious lesions between the groups. after soft x-ray examination, a histopathological examination was performed on the mandible in all of the rats. after fixation with 10% neutral-buffered formalin, the sample was decalcified in a 5% solution of ethylenediaminetetraacetic acid 4 na (edta 4 na) for 2 weeks at 4c. after decalcification, the specimens were trimmed, dehydrated in a sequential ethanol series using an automated processor, and embedded in paraffin wax. serial 7 m thick sections on the mesiodistal plane were made through the centers of all of the molars and then stained with hematoxylin and eosin for examination using light microscopy. the severity of the caries lesion was graded as follows: slight, dentin caries localized in occlusal surface of dentin; mild, dentin caries extended into the dental pulp with pulpitis and/or pulp necrosis; moderate, dental crowns were partially decayed; and severe, dental crowns were completely decayed (only the molar roots remained). the wilcoxon rank-sum test was employed to compare the differences in the mean scores of the caries lesions using soft x-ray examination between the groups. the chi-square test was used to determine the caries incidence using soft x-ray examination and the incidence of histopathological lesions in each group of rats. severe hyperglycemia (> 400 mg/dl) and glucosuria (> 500 mg/dl) continued from the day after alloxan injection to the last monitoring day in all of the rats in the alloxan-treated groups. in addition, the blood glucose levels ranged from 78 to 120 mg/dl (normoglycemia), and the urine glucose levels were less than 100 mg/dl in the control groups. typical macroscopic appearances of carious molars in diabetic rats are shown in figures 3(a), 3(b), and 3(c). macroscopically, the dental caries developed mainly in occlusal fissures and were identified as partial coronal defects of the molars in alloxan-treated diabetic rats (figure 3(b)). the carious lesions expanded horizontally, until the crown of the carious molar was completely invisible (figures 3(b) and 3(c)). in contrast, control nondiabetic rats showed no changes in any of the molars (figure 3(a)). soft x-ray images of the carious lesion in diabetic rats are shown in figures 3(d), 3(e), and 3(f). in all of the alloxan-treated diabetic rats, radiographically, the dental caries progressed both horizontally and vertically. in diabetic rats fed with a pelletized diet, the carious lesion was mainly characterized as grade 2 (figure 3(e)) or 4 type (table 1). in addition, the diabetic rats fed a powdered diet demonstrated carious lesions that were nearly of grade 4 type (figure 3(f)). in the control non-diabetic rats, there was no change in the molar teeth (table 1, figure 3(d)). the histopathological characteristics of the carious lesion in diabetic rats are shown in figures 3(g), 3(h), and 3(i). histopathological carious lesions were detected in the crown as eroded dentin with bacterial colonization in alloxan-treated diabetic rats. in diabetic rats fed with the pelletized diet, many of the molars were moderately affected and the dentin caries spread over a wide area of the dental crown (figure 3(h)). in the diabetic rats fed with the powdered diet, the dental caries were markedly worsened and the crowns were nearly completely decayed (figure 3(i)). the incidence of caries teeth on the basis of each scoring in the soft x-ray examination is shown in table 1. the incidence of dental caries in the diabetic rats fed on both the pelletized and powdered diets was apparently higher (p<0.01) compared to the non-diabetic control rats (table 1). in the diabetic rats fed with the pelletized diet, 96.7% of their molar teeth were affected with dental caries, and the mean caries score was 2.7. in addition, in the diabetic rats fed with the powdered diet, all of their molars (100%) were affected with caries, and the mean caries score was 3.7, which was significantly higher (p<0.01) than the diabetic rats fed with the pelletized diet (table 1, figure 4). no radiolucent lesions were observed in any of the molars in control non-diabetic rats. the incidence of histopathological carious lesions on the basis of each grade is summarized in table 2. histopathologically, the severity of the carious lesions in the diabetic rats fed with a powdered diet was significantly enhanced compared to the diabetic rats fed with the pelletized diet (table 2). in control non-diabetic rats, slight carious lesions, which were macroscopically and radiographically normal, were detected in a few animals; however, there were no differences observed between the non-diabetic rats on the pelletized and powdered diets (table 2). the physical properties of foods such as hardness, adhesiveness, and cohesiveness are closely related with the caries-producing potential [19, 20]. moreover, the development of caries is known to be profoundly affected by food hardness, and hard and coarse foods can exert a detergent activity during mastication, which is effective in the prevention of caries [17, 19]. furthermore, a lower degree of caries was reported in animals fed with the hardest food diet. in the present study, the severity of caries in diabetic rats was enhanced in the powdered diet group compared to the pelletized diet group. it was clear that food hardness affected the development of dental caries in diabetic rats fed on a non-cariogenic diet. hard foods are known to help flush away or neutralize undesirable material within the dental plaque and exert a cleaning effect on smooth surfaces by direct mechanical friction. therefore, cariogenicity will be higher in diabetic rats fed with a powdered diet than in those fed with a pelletized diet. in this study, a high incidence and severity of dental caries was confirmed in the alloxan-treated diabetic rats fed with 2 types of standard diets with a low concentration of sugar. furthermore, the mean caries score of the diabetic rats fed on the pelletized diet at 52 weeks after alloxan dosing in this study was almost 2-fold compared to animals at 26 weeks after alloxan dosing described in a previous report, strongly suggesting that the duration of hyperglycemia may affect caries development in diabetic animals. in this study, dental caries developed and extended to all of the molars in diabetic rats fed on both the pelletized and powdered diets. thus, the effect of food hardness on the different diets in caries development in diabetic rats may become clearer when the dental caries mildly develop during the more early stages. in conclusion, food hardness could have an effect on the development of dental caries in diabetic rats, and appropriate consideration of the food formulation should be made in experimental caries studies using diabetic rodent models.

we have previously shown that dental caries may be produced in diabetic rodent models fed with noncariogenic standard diets; however, many studies usually add large amounts of sugar to the diet to induce dental caries. moreover, the physical properties of cariogenic diets have been reported as an important factor in the formation of caries. the aim of this study was to clarify the effect of the hardness of non-cariogenic diets on the development of dental caries in diabetic rodents. seven-week-old female f344 rats were divided into 4 groups: intact rats fed with a standard pelletized or powdered diet and alloxan-induced diabetic rats fed with a standard pelletized or powdered diet. all of the rats were sacrificed at 52 weeks of age for morphological examinations on their dental tissue. dental caries had developed and extended to all the molars in the diabetic rats that were fed with both the pelletized and powdered diets. moreover, the lesion was significantly enhanced in the powdered diet group compared to that in the pelletized diet group. in conclusion, food hardness is an important factor influencing the development of dental caries in diabetic rats.

PMC3674722

pubmed-275

we collected all possible literature from the year 1972 (when kfd was first described) to the present day conducting a medical search on kikuchi fujimoto disease (kfd) in english language. we included publications in authorized medical journals including original and review articles/theses, editorials, case reports and brief communications. kfd is an extremely uncommon disease but cosmopolitan with higher japanese and asiatic prevalence.1,2 however, sporadic cases have also been reported from europe. in asian woman kikuchi s disease is rare and benign cause of cervical lymphadenopathy.3 the disease, most often, happens to occur in young adults below 40 and seldom in children.4 at first, little female predominance was considered, but the recent literature regards it as male to female ratio 1:1.1,5 a current study on the patients with kfd conducted in taiwan reports the average age of 21.5 cardiac, hepatic and pulmonary involvement raises the morbidity. however, role of viruses (epstein-barr virus and others) in the pathogenesis of kikuchi s disease is controversial and unremarked.1 on the other hand, unger and coworkers are in favor of viral etiology as kfd manifests certain viral features ie, atypical lymphocytosis, certain histologic features, flulike respiratory prodrome and no response to antibiotic therapy.7 also, kikuchi s disease has been reported in patients with aids.8 like systemic lupus erythematosus (sle), lymphocytes and histiocytes in the patients with kikuchi s disease show tubular reticular structures in their cytoplasm on electron microscopy.9 it has been opinioned that in genetically susceptible individuals, kfd may belong to exuberant t-cell mediated immune response provoked by variety of stimuli.1 even though course of cell death in kfd needs to be studied and emphasized, ohshima and his associates remarked apoptotic cell death might be involved in the pathogenesis of kfd.10 regarding to this study, proliferating cd8 t-cells may kill or be killed in the apoptotic process of this disease using fas and perforine pathways. kikuchi s disease begins as an acute or sub-acute condition, developing over two to three week period. tender cervical lymphadenopathy is the characteristic feature (56%98%) of kfd, predominantly involving the posterior cervical triangle. size of the enlarged lymph nodes ranges from 0.5 cm to 4 cm (occasionally 6 cm). 59% patients represent painful lymphadenopathy and 1%22% patients undergo generalized lymphadenopathy.4,7,9,11 kfd, more or less, rarely involves mediastinal, peritoneal or retroperitoneal regions of the body.2 fever (30%50%) associated with upper respiratory symptoms, sore throat, night sweats, weight loss, headache, rash, nausea, vomiting, and leukopenia (about 50%) are the other manifestations of the disease. 12,13 atypical lymphocytes have been reported in the peripheral blood film of patients with kfd. extranodal involvement is rare; however, skin, eye and bone marrow affection has been reported.1 nevertheless, kfd is linked to sle and autoimmune conditions as lymphocytes and histiocytes in the patients with kikuchi s disease show tubular reticular structures in their cytoplasm on electron microscopy.1,14 additionally, extranodal involvement in kfd is associated with frequent systemic symptoms. anecdotal reports bring to light the unusual features of kfd like haemophagocytic syndrome and carcinoma15 along with fatal multicentric disease. nervous system involvement (septic meningitis, acute cerebellar ataxia, and encephalitis) rarely happens to occur.16 regarding joint involvement, a case of 14 year old boy with kfd is in the record.17 in patients with kikuchi fujimoto disease, an excisional biopsy of the involved lymph nodes is the investigation of choice. coagulative necrosis with ample karyorrhetic debris in paracortical areas of the involved lymph nodes is the characteristic histologic feature of kfd. other baseline investigations are reported unaffected. nevertheless, laboratory results of some kfd cases have reported anemia, little rise in esr and even leukopenia. one third individuals with kfd have shown atypical lymphocytes in their peripheral blood films.5 predominantly, t-cells (cd8+t-cells) are found in kfd. however, neutrophils are found absent and scarce plasma cells may or may not be present. according to kuo, histopathologic features can be classified in three stages: proliferative, necrotizing, and xanthomatous.18 proliferative stage expresses various histiocytes, plasmacytoid monocytes and lymphoid cells containing karyorrhetic nuclear fragments, and eosinophilic apoptotic debris. necrotizing stage shows a degree of coagulative necrosis while xanthomatous stage is predominantly stuffed with foamy histiocytes. it must be born in mind that in the individuals with kfd, atypical reactive immunoblastic component is common and can be mistaken for lymphoma.4 histiocyte-associated antigens (lysozyme, myeloperoxidase and cd68) are also expressed by histiocytes in kfd. kfd is an extremely rare disease and the differential diagnosis can be established on the basis of enlarged lymph nodes which are associated with many other disorders. it is necessary to born in mind the differential diagnosis of kfd as its treatment dramatically differs from other disorders. lymphoma (non-hodgkin s lymphoma), tuberculosis, sle, plasmacytoid t-cell leukemia, kawasaki s disease, and myeloid tumor are included in the differential diagnosis of kfd.1 sometimes, because of similar clinical and histological features, it becomes problematic to differentiate kikuchi fujimoto disease from lymphadenitis associated with systemic lupus erythematosus (sle). however, it has been reported that kfd is associated with sle. in order to exclude sle, all the necessary investigations of sle (c3, c4, anf, anti-sm, and le cells) are required. early recognition of kikuchi fujimoto disease is of prime importance to save the patient from undergoing extensive investigations related to malignant lymphoma and other related disorders.8 histopathologic features like presence of abundant reactive histiocytes and absence of reed-sternberg cells favor kfd. sometimes, kfd may express histiocytes resembling with signet-ring cells and can be confused with signet-ring carcinoma. however, metastaic adenocarcinoma contains cells with atypical nuclei and mucin debris instead of cellular debris. kikuchi fujimoto disease (histiocytic necrotizing lymhadenitis) is a self-limiting condition that resolves spontaneously within 1 to 4 months of period. however, studies reveal recurrence of the disease in 3%4% of the patients.9 additionally, sle may happen to occur some years later. no hereditary risk has been documented in kfd.8 most of the time symptomatic relief is offered for the local and systemic complains of the disease. lymph node tenderness and fever is treated with analgesics, antipyretics, and nsaids. sometimes, but rarely, steroids can be used temporarily, especially in severe extranodal involvement or generalized clinical course.19 in order to run an excisional biopsy of the enlarged lymph nodes, surgical consultation may be prerequisite. individuals with kikuchi fujimoto disease should be examined systemically and they must be under regular follow-up in order to monitor the manifestations of sle. the course of cervical lymphadenopathy is benign and resolves spontaneously. very few cases have been reported as fatal. however, no standard or specific treatment of kfd has been recommended. kikuchi fujimoto disease is an idiopathic, extremely rare, more or less worldwide, and often under-diagnosed condition; predominantly involving the posterior cervical lymph nodes. early recognition of kikuchi s disease is of prime importance to avoid extensive and expensive investigations related to malignant lymphoma other related disorders. in order to avoid misdiagnosis, awareness of this disease

in order to determine the clinical significance of kikuchi fujimoto disease (histiocytic necrotizing lymhadenitis) and to review the literature available on this condition, we selected the medicine research papers in english language published between the years 1972 to 2011.kikuchi fujimoto disease (kfd) is an uncommon, cosmopolitan, benign and self-limiting condition with higher japanese and asian prevalence. most of the sufferers of kfd are young people who seek treatment because of having acute tender cervical lymphadenopathy, low grade fever and night sweats. coagulative necrosis with ample karyorrhetic debris in paracortical areas of the involved lymph nodes is the characteristic histologic feature of kfd. diagnosing kfd is crucial as it can be mistaken for malignant lymphoma and sle.kfd was put forth first time in 1972 by dr. masahiro kikuchi and by funimoto as lymphadenitis with reticular proliferation, histiocytes and abundant nuclear debris. it is a rare benign condition of lymph nodes and most of the clinicians and pathologists are unfamiliar with it. kfd is self-limiting disease (within 1 to 4 months), however, patients should be followed up regularly as it may crop up again or progress to sle. analgesics and antipyretics help to ameliorate the symptoms.

PMC3399407

pubmed-276

human parvovirus (hpv) b19, being first discovered and introduced in 1975, is a non-enveloped single-stranded dna virus from the parvoviridae family. the virus is transmitted by respiratory droplets and the prevalence is estimated to be high since most of the individuals are infected by the age of 15. the clinical syndrome associated with hpv b19 strongly depends on the host; for instance those suffering from hemolytic disorders, including sickle cell disease, hereditary spherocytosis (hs), autoimmune hemolysis, thalassemias, and paroxysmal nocturnal hemoglobinuria (pnh) are susceptible to aplastic crisis. the virus has a predilection for infecting the erythroid progenitor cells of the bone marrow resulting in their lysis and aplastic anemia. thus, the bone marrow in these patients appears without erythroid precursors but with normal myeloid series. the hpv b19 induced aplastic crisis can unmask several hereditary hematological disorders that have been normally compensated. among these conditions, when hpv b19 infects the bone marrow erythroid cells of these patients, decompensation occurs and thus the patient presents with signs and symptoms of abrupt onset severe anemia. several similar sporadic cases have been reported by now, but familial hpv b19 induced aplastic crisis leading to the diagnosis of hs in all family members is a very rare condition being only reported three times in the literature. we herein, report hpv b19 induced aplastic crisis in an asymptomatic and undiagnosed family of three with hs demonstrating pancytopenia on peripheral blood. a 3.5-year-old girl, the youngest child of a 4-member family, was presented with severe pallor and high fever without localizing sign with 5 days duration. on physical examination, she had jaundice in the sclera and the spleen was palpable about 3 cm below the costal margin. the following day, her 14-year-old brother presented with high fever of unknown origin and severe pallor. on physical examination, he was febrile (39 c) and had a mild prominence of frontal and maxillary bones and jaundiced sclera. physical examination revealed an enlarged spleen with the tip of spleen palpated about 3 cm below the costal margins. the hematological indices of the three patients admitted to our department with severe pallor and fever of unknown origin according to the family history and positive findings on physical examination (jaundice and splenomegaly), a work-up for hemolytic anemias, including hb electrophoresis, osmotic fragility, and autohemolysis test was performed for each patient. the results were consistent with the diagnosis of hs. knowing hpv b19 as the most common causative agent in the development of aplastic crisis in hemolytic anemias; specifically hereditary spherocytosis polymerase chain reaction (pcr) for hpv b19, dna was performed which was positive in all three patients (figures 1 and 2). bone marrow aspiration of the girl revealed normal marrow cellularity with mild erythroid hyperplasia and clusters of erythroid nests heralding the recovery of the erythroid series already affected by parvovirus b 19 infection. in contrary, cellularity was severely decreased in all three lineages in the boy implicating suppression of all hematopoietic lineages. both siblings received intravenous immunoglobulin (ivig) in a dosage of 1 gr/kg along with blood transfusion, twice for each. the girl recovered after 3 days with reticulocytosis of 16%, while the boy recovered 8 days later with reticulocytosis of 8%. their mother also had to receive blood transfusion because of having hb of 3.6 gr/dl. pcr for parvovirus b19. from left to right; the siblings, their positive and negative control, and the ladder. these family members were typical examples of the occurrence of aplastic crisis due to hpv b 19 complicating hs simultaneously in a family. only three previous reports have shown that hpv b19 can induce aplastic crisis and unmask the hs in a family. previously, green et al. in 1984 reported an adult sibling pair with hs who developed aplastic crisis after a febrile illness, which was further diagnosed to be hpv b19 infection. the diagnosis of hpv b19 was developed based on specific igm antibody in their sera, as pcr was not available. they also found that the children of one of the patients also developed hpv b19 induced aplastic crisis, which was resolved with supportive care. these two adult patients were treated by blood transfusion and supportive care and were discharged after 6-8 days of hospital care. in a similar report, mclellan and rutter in 1987 reported hpv b19 induced aplastic crisis in two teenage sisters leading to the diagnosis of hs. they also had a history of splenectomy in their mother at the age of 11 years. they both were diagnosed to have hpv b19 and underwent splenectomy and supportive care until recovery. in 1962, chanarin et al. reported aplastic crisis in 3 members of a family (2 sisters and the father). the 10-year-old girl presented with 7 days history of fever of unknown origin, jaundice, and dark urine. the same illness was reported in 2-year-old sister and 32-year-old father who both had hs. the 10-year-old girl was treated with repeated transfusions, splenectomy, and supportive care for 92 days. based on laboratory investigations, the authors first assumed that the megaloblastic hematopoiesis accompanied by urinary excretion of large amounts of urocanic acid following oral dose of histidine hydrochloride was responsible for aplastic crisis in these patients with hs. however, the authors reached the conclusion that hpv b19 was responsible for the aplastic crisis in this family with hs. as hpv b19 was first discovered in 1975 and this family was reported in 1962, thus the etiology was misdiagnosed. in the present study, we described a family with hs that all three members developed aplastic crisis secondary to hpv b19 infection leading to the detection of asymptomatic hs. those patients with hs, who remain undiagnosed, usually have mild hemolysis and the disease remains undiagnosed until the compensation is interrupted because of some environmental stressors such as infections. the distinguished feature of our report is the occurrence of some degrees of leukopenia, neutropenia and thrombocytopenia in two of our patients (the mother and his son). there are few reports of mild transient pancytopenia due to hpv b19 infection and recent report on persistent severe aplastic anemia in a previously healthy adult. however, none of them occurred in members of a single family and one of them was persistent in a healthy subject. one of the theories behind the etiology of transient pancytopenia in hpv b19 infections is that the virus could be responsible for the temporary arrest of hematopoiesis that leads to aplastic crisis in persons with chronic hemolytic anemia. the other hypothesis is the occurrence of hpv-associated hemophagocytosis leading to pancytopenia. among our three patients, two showed transient pancytopenia with more severity in the 14-year-old boy; nevertheless, they did nt show any evidence of hemophagocytosis in bone marrow aspirate. according to available reports in the literature indicating probable efficacy of ivig in the treatment of patients with hpv b19 infections and its effect on replication on virus however, we can not draw any conclusion on whether the fast recovery of the patients was a positive impact of ivig or spontaneous recovery of hpv b 19 that is expected in hs patients, albeit happened very soon in our patients. hpv b19 induced aplastic crisis in a family leading to the diagnosis of hereditary hs is a very rare reported event in the literature. the distinguished feature of this report is that all affected members of a family developed some degrees of transient pancytopenia, not only anemia, all simultaneously in the course of their disease. however, it was transient and the recovery happened very soon in all of them within 10 days, which was attributed to the usage of ivig.

human parvovirus (hpv) b19 induced aplastic crisis in a family leading to the diagnosis of hereditary spherocytosis (hs) is a very rare condition being barely reported in the literature. we herein report a 4-year-old girl, her brother, and their mother who all presented with progressive pallor and jaundice after a febrile illness. the hpv b19 was diagnosed using polymerase chain reaction (pcr) and positive serology for specific anti-hpv b19 igm. they were further diagnosed with having hs. the clinical importance of this report is that in the case of an abrupt onset of unexplained severe anemia and jaundice, one should consider underlying hemolytic anemias mostly hereditary spherocytosis complicated by hpv b19 aplastic crisis. herein, we report the occurrence of this condition, simultaneously in three members of a family. the distinguished feature of this report is that all affected family members developed some degrees of transient pancytopenia, not only anemia, all simultaneously in the course of their disease.

PMC4567607

pubmed-277

primary mitochondrial disorders due to impaired oxidative phosphorylation (oxphos) are a well-established cause of severe disability and precocious death in both children and adults (koopman et al., 2012). no effective therapies are currently available for these conditions, but encouraging results have recently been obtained by stimulating mitochondrial biogenesis acting on either the ppar system (wenz et al., 2008) or the amp-kinase (ampk)/pgc1 axis (viscomi et al., 2011). importantly, these approaches can in principle be extended to several mitochondrial diseases with different genetic causes, as they do not point to the correction of a specific defect but are based on a more general strategy aimed at increasing the overall residual activity of the respiratory chain. additional targets able to activate the mitochondriogenic program and boost mitochondrial function are sirtuins 17 (houtkooper et al., 2012), the mammalian orthologs of the yeast silent information regulator (sir) 2 gene (imai et al., 2000; sirtuins have different subcellular localization, sirt1 and sirt6 being mainly found in the nucleus, sirt2 in the cytosol, sirt3sirt5 in mitochondria, and sirt7 in the nucleolus. sirtuins are important regulators of several proteins, including key metabolic players, acting as either deacetylases or adp-ribosylases (houtkooper et al., 2012). the most-investigated member of the family is sirtuin1 (sirt1), a nad-dependent type iii nuclear deacetylase that utilizes nad as a cosubstrate to remove acetyl groups from lysine residues of a target protein. known targets of sirt1 are the tumor suppressor p53, the myocyte-specific enhancer factor 2 (mef2), the forkhead box o (foxo), and pgc1, all of which regulate transcriptional programs related to increased mitochondrial function (andreux et al., 2013). sirt1 activity is directly regulated by nad availability, by substrate-dependent activation, raising the hypothesis that nad acts as a metabolic sensor. for instance, both nad levels and sirt1 activity increase in mammalian tissues in response to energy/nutrient stresses such as exercise (cant and auwerx, 2009, 2010) and fasting (cant and auwerx, 2010; chen et al. recent studies have shown that sirt1 activation can prevent diet-induced obesity in mice. this effect was achieved by increasing the content of nad in cells and tissues essentially through (1) dietary supplementation of suitable nad precursors, such as nicotinamide riboside, nr (cant et al., 2012), or (2) inhibition of nad-consuming enzymes, such as the poly(adp-ribose) polymerase 1, parp1 (bai et al., 2011). here, we have tested the therapeutic efficacy of these strategies on a genetic mitochondrial disease model, the sco2 knockout/knockin (sco2) mouse (yang et al., 2010). sco2 encodes a metallochaperone involved in the formation of the copper redox centers into nascent complex iv (cytochrome c oxidase, cox) (leary et al., 2009). mutations in this gene lead to infantile fatal encephalocardiomyopathy (papadopoulou et al., 1999). most of the patients carry at least one allele encoding the common mutation p.e140k, corresponding to the p.e129k mutation in the knockin murine sco2 allele. the second knockout allele in this animal model is functionally null (yang et al., 2010). while homozygous knockout individuals are embryonic lethal, the sco2 mice show a predominantly myopathic phenotype characterized by exercise intolerance and associated with ubiquitous cox deficiency. to test the effects of persistent increase of the nad pool on the sco2 mouse, we first crossed it with a constitutive parp1 mouse (de murcia et al., 1997), which shows increased levels of nad in skeletal muscle (bai et al., 2011). the sco2-parp1 double mutants showed reduced fasting blood glucose levels, body weight and epididymal white adipose tissue (wat) compared to sco2 littermates, whereas no differences were observed between wt and parp1 littermates (see figure s1 available online). the endurance motor performance of sco2-parp1 double mutants, sco2, parp1, and wt littermates (four animals per group) was monitored weekly by a standard treadmill test for 4 weeks starting at 2 months of age. while sco2 mice showed markedly reduced motor performance compared to wt littermates throughout the observation time, the double mutant individuals performed as well as the wt and parp1 littermates (figure 1a). biochemically, significant reduction of complex iv activity and, to a lesser extent, complex iii as well (yang et al., 2010), was measured in skeletal muscle of sco2 mice. in the muscle homogenate of sco2-parp1 double mutants, these activities were comparable to that of parp1 and wt littermates, whereas complex i and ii activities were even higher (figure 1b; table s1). accordingly, the intensity of the histochemical staining specific to cox was increased in skeletal muscle of the double mutants, compared to the sco2 mutants (figure 1c). the activities of complex iii and iv (figure 1d; table s2) were also increased in the brains of double mutants relative to sco2 animals, but remained significantly lower than those measured in parp1 and wt littermates; the histochemical reaction to cox was concordant with the biochemical data (figure 1e). to test the effects of pharmacological intervention, we first administered nr to sco2 mice and wt littermates (n =4/group), as a food admix (400 mg/kg) (cant et al., 2012) for four weeks. metabolic parameters in the treated groups, including reduced blood glucose, plasma fatty acids, and epididymal wat, mirrored those of parp1 mice (figure s2), confirming that nr, or its derivative nmn, was pharmacologically active in vivo. nr-treated sco2 mice significantly improved their motor performance compared to the vehicle-treated sco2 group, rapidly achieving the levels of motor endurance displayed by treated and untreated wt mice (figure 2a), which showed no difference to each other. these results suggest that nr treatment increases mitochondrial function in the sco2 mice through nad activation of sirt1 (cant et al., 2012). accordingly, the nad/nadh ratio was significantly increased (figure 2b), and the ratio between acetylated and total foxo1, a direct target of sirt1, was clearly reduced (figure 2c) in skeletal muscle of nr-treated versus vehicle-treated sco2 and wt animals. we did not observe differences in mtdna content (data not shown) and citrate synthase (cs) activity (figure 2f), but mrna levels of several genes related to either fatty acids oxidation (fao), including acox and cd36, or oxidative phosphorylation (coxi, coxii, coxiv, coxva) were significantly increased in nr-treated versus vehicle-treated sco2 but not in wt animals (figure 2d). tfam, a key factor of mtdna transcription, was also increased, and ucp3 and pdk4, which were downregulated in sco2 mice, returned to control levels upon nr treatment. as expected, we found no change in transcripts specific to pgc1, which is activated posttranscriptionally by sirt1, and to two pgc1 partners, nrf1 and nrf2. accordingly, western blot immunovisualization demonstrated increased levels of several nuclear- and mitochondrial-dna-encoded oxphos-related proteins in nr-treated versus vehicle-treated skeletal muscle samples (figure 2e). in the same specimens, mitochondrial respiratory chain activities were significantly increased (figure 2f; table s3) in nr-treated versus vehicle-treated sco2 mice, but not in wt animals. the histochemical staining for cox reflected the biochemical results (figure 2 g). in both c. elegans and mammalian cells, nr-dependent sirt1 activation can induce the mitochondrial unfolded protein response (mtupr), a stress-response protective mechanism which can improve mitochondrial function (durieux et al. we found that the mtupr-specific transcripts clpp, hsp60, and sod2 were significantly increased in muscle samples of nr-treated sco2 mice, whereas sod3, which is unrelated to mtupr, was unchanged (figure 2h). no effect of the nr treatment was observed on the mitochondrial respiratory chain activities in the brain of our animals (table s4). next, we administered a pan-parp inhibitor (mrlb-45696, ic50 for parp <1 nm; pirinen et al., 2014, in this issue of cell metabolism) at 50 mg/kg as a food admix for 4 weeks. in mrlb-45696-treated sco2 mice, we observed metabolic effects similar to those of nr treatment (figure s3). weekly treadmill tests showed progressive increase, up to normal, of the motor endurance in mrlb-45696-treated sco2, whereas no change was seen in wt mice (figure 3a). the nad/nadh ratio was significantly increased in treated versus untreated wt, but not in the sco2, animals (figure 3b), whereas the acetylated/total foxo1 ratio was reduced in both treated groups (figure 3c), indicating activation of sirt1 by mrlb-45696. similar to nr, mrlb-45696 increased the mrna expression levels of oxphos- and fao-related genes in both sco2 and wt mice, whereas mtdna content (data not shown) and cs activity (figure 3f) remained unchanged. in treated sco2 but not in wt animals, western blot analysis showed increased content of mitochondrial respiratory chain subunits (figures 3d and 3e), which was paralleled by significantly increased mitochondrial respiratory chain activities (figure 3f; table s3). histochemistry for cox showed increased staining in treated versus vehicle-treated sco2 mice (figure 3 g). again, we found that expression of the mtupr genes hsp60, clpp, and sod2 was significantly increased, unlike the mtupr-unrelated gene sod3 (figures 3h and 3i). in contrast to the nr treatment, the mrlb-45696 treatment determined significant increase of cox transcripts (figure 4a), and respiratory chain activities in the brain (figure 4b; table s4). the intensity of cox staining was increased as well (figure 4c). similar results were obtained in both skeletal muscle and brain by using pj34, a commercially available pan-parp inhibitor (figures s3 and s4; table s4). the nad pool is set by the balance between de novo and salvage biosynthetic pathways and utilization by nad-consuming enzymes. nad is synthesized de novo from tryptophan, but the main source of nad is from salvage pathways (houtkooper et al., 2010). these require the uptake of other nad precursors from the diet, including nr. upon its entry in the cell, nr is phosphorylated by nr kinases into nicotinamide mononucleoside (nmn), which is then converted to nad by nmn adenylyltransferase (bieganowski and brenner, 2004). nad biosynthesis and cellular levels are also controlled by a circadian clock related to the feeding/fasting cycle. for example, in the mitochondrial compartment nad levels regulate sirtuin 3, a deacetylase targeting respiratory chain subunits (peek et al., 2013), while in the nucleus nad is a substrate of both parp1 and sirt. parp1, the highest consumer of nad in mammalian tissues, is activated upon binding to damaged or abnormal dna (durkacz et al., 1980) and catalyzes the formation of poly(adp-ribose) polymers (par) using nad as a substrate, onto different acceptor proteins, including parp1 itself (adamietz, 1987). ablation of the parp1 gene, supplementation of nr or administration of parp inhibitors (parpi) can expand the nad pool and activate sirtuins, particularly sirt1, a master regulator of mitochondrial homeostasis. these effects can protect mice from high-fat (hf)-induced metabolic disease (cant et al., we have shown here that these treatments can correct the biochemical and clinical phenotype of the sco2 mouse, a model of genetically determined mitochondrial disease. increased transcription of genes related to both oxphos and mtupr was associated with activation of oxidative metabolism, increase of mitochondrial respiratory chain activities, and normalization of the endurance motor deficit, displayed by naive sco2 animals. notably, these effects were hardly seen in wt littermates, suggesting that mitochondrial dysfunction sensitizes muscle and possibly other tissues to activators of mitochondriogenic programs. increased mitochondrial function can be achieved in wt animals only by much longer-term treatments (> 6 months) (pirinen et al., 2014). in contrast with previous results, we found no change in mtdna copy number and cs activity in nr- or parpi-treated versus untreated animals, possibly because of the shorter timeframe of our experimental protocol (4 weeks) compared to that of other studies (12 weeks). this observation suggests time-dependent activation of different mitochondriogenic programs, with induction of oxphos- and fao-related genes occurring much earlier than stimulation of mitochondrial proliferation and increase in mtdna content. likewise, prolonged nr supplementation up to 6 months induced mitochondrial biogenesis in the brain and improvement of cognitive dysfunction of an alzheimer disease mouse model (gong et al., 2013). while we observed hardly any effect of nr in our 4 week trial, two pan-parp inhibitors did correct the respiratory chain defect in the brains of our sco2 mice. this observation is particularly relevant, as the brain is an exquisite target of mitochondrial dysfunction, and progressive encephalopathy is the most frequent clinical presentation of mitochondrial disease in infancy and childhood. our work supports the idea that the increase of nad levels in critical tissues is an effective therapeutic option for mitochondrial disease. nr is a natural vitamin with no known adverse effects, which could be administered as a dietary supplement, particularly in case of isolated mitochondrial myopathy. our results are concordant with very recent works reporting beneficial effects of nad precursors in mouse models characterized by reduced nad/nadh ratio, such as aging (gomes et al., 2013) or complex i deficiency (karamanlidis et al., 2013) initially shown to boost oxidative metabolism in diet-induced models of obesity, parp1 ablation or inhibition has recently been reported to remarkably rescue pharmacological models of liver cirrhosis, partly by correcting the associated mitochondrial impairment (mukhopadhyay et al., 2013). several parp inhibitors are currently under clinical trial as anticancer molecules, and seem to be associated with relatively mild side effects (bundred et al., 2013; tutt et al., however, more work is needed to evaluate their use in chronic conditions such as primary mitochondrial disorders in view of their potential genotoxic effects. mouse tissues were homogenized in 15 volumes of 10 mm potassium phosphate buffer (ph 7.5). mitochondrial-enriched fractions were collected after centrifugation at 800 g for 10 min in the presence of protease inhibitors, and frozen and thawed three times in liquid nitrogen. aliquots, 70 g each, were run through a 12% sds-page and electroblotted onto a nitrocellulose membrane, which was then matched with different antibodies. carlo besta neurological institute, in accordance with guidelines of the italian ministry of health. mice were maintained in a temperature- and humidity-controlled animal-care facility, with a 12 hr light/dark cycle and free access to water and food. a standard treadmill apparatus (columbus instruments, columbus, oh) was used to measure motor exercise endurance, as described in viscomi et al. series of 8 m thick sections were stained for cox and sdh, as described (sciacco and bonilla, 1996). muscle quadriceps samples stored in liquid nitrogen were homogenized in 10 mm phosphate buffer (ph 7.4), and the spectrophotometric activity of ci, cii, ciii, and civ, as well as cs, was measured as described (bugiani et al., 2004). note that in all panels the activity of cii has been multiplied by 10 for visualization clarity. nad was extracted using acidic and alkaline extraction methods, respectively (yang and sauve, 2006). tissue nad was analyzed with mass spectrometry as previously described (yang and sauve, 2006). mtdna content and transcripts analysis was carried out by sybr green real-time pcr, as described (viscomi et al., 2011).

summarymitochondrial disorders are highly heterogeneous conditions characterized by defects of the mitochondrial respiratory chain. pharmacological activation of mitochondrial biogenesis has been proposed as an effective means to correct the biochemical defects and ameliorate the clinical phenotype in these severely disabling, often fatal, disorders. pathways related to mitochondrial biogenesis are targets of sirtuin1, a nad+-dependent protein deacetylase. as nad+ boosts the activity of sirtuin1 and other sirtuins, intracellular levels of nad+ play a key role in the homeostatic control of mitochondrial function by the metabolic status of the cell. we show here that supplementation with nicotinamide riboside, a natural nad+ precursor, or reduction of nad+ consumption by inhibiting the poly(adp-ribose) polymerases, leads to marked improvement of the respiratory chain defect and exercise intolerance of the sco2 knockout/knockin mouse, a mitochondrial disease model characterized by impaired cytochrome c oxidase biogenesis. this strategy is potentially translatable into therapy of mitochondrial disorders in humans.

PMC4051987

pubmed-278

irinotecan is commonly used in combination with oxaliplatin as a component of folfirinox chemotherapy for several gastrointestinal malignancies. the purpose of this case report is to describe a patient who developed acute paralysis and aphasia while receiving her initial infusion of irinotecan. a 67-year-old woman with newly diagnosed metastatic pancreatic adenocarcinoma presented for her first cycle of folfirinox chemotherapy. during her infusion of irinotecan, she developed acute onset of generalized weakness, paralysis of all extremities, and nonfluent aphasia with complete inability to communicate. this episode was self-limited and resolved within 2 h. prior to subsequent infusions she received intravenous repletion of potassium and had no recurrence of symptoms. in selected cases, coadministration of irinotecan and oxaliplatin may result in severe generalized weakness and aphasia, which may be triggered by underlying electrolyte disturbances. irinotecan is a topoisomerase i inhibitor derived from camptothecin, an alkaloid compound extracted from deciduous trees indigenous to eastern asia. its antineoplastic activity is mediated by its inhibition of double-stranded dna replication through stabilizing the cleavage complexes of topoisomerase i. its most common use is in the treatment of colorectal cancer. however, since 2010, it has been combined with 5-fluorouracil, leucovorin, and oxaliplatin in the regimen known as folfirinox, which has been utilized as an effective therapy in patients with metastatic pancreatic cancer as well as other cancers. the most commonly cited adverse effects of irinotecan include late-onset diarrhea and bone marrow suppression, with clinically significant neutropenia and thrombocytopenia. a less frequent, acute cholinergic syndrome with resultant symptoms of diaphoresis, hypotension, anxiety, and abdominal cramping with diarrhea may result in severe discomfort and dehydration that can be life-threatening. atropine is commonly administered with the chemotherapy infusion both for the prevention and treatment of this syndrome. oxaliplatin is a third-generation platinum derivative that has shown to be an effective therapy in several malignancies, most commonly gastrointestinal cancers. side effects of oxaliplatin include a dose-limiting severe peripheral sensory neuropathy that is chronic in onset. less commonly, acute sensory disturbances that may be modulated by cold temperatures may occur. these effects are thought to be mediated by an interaction with voltage-gated sodium channels in peripheral nerves. here we report the case of a patient with a rare complication of combination therapy with irinotecan and oxaliplatin, i.e. severe generalized weakness, paralysis, and aphasia, and provide a synopsis of the current literature as well as a proposed therapeutic approach. a 67-year old asian woman with a history of poorly controlled diabetes presented with newly diagnosed metastatic pancreatic adenocarcinoma. in november 2013, she received her first cycle of palliative chemotherapy using folfirinox (oxaliplatin 85 mg/m, irinotecan180 mg/m, leucovorin 400 mg/m iv, and 5-fu 2,400 mg/m iv by continuous infusion over 48 h without a bolus, with dexamethasone 10 mg and ondansetron 12 mg iv as premedication). prior to beginning therapy with folfirinox, her electrolyte levels were checked, which revealed mild hypokalemia (3.5 meq/l, normal values 3.55.0) with normal serum sodium and calcium (na 137 mmol/l, ca 8.7 mg/dl). halfway through the irinotecan infusion, she developed acute onset of generalized weakness, paralysis of all extremities, and nonfluent aphasia with complete inability to communicate. throughout this, she was awake, alert, and aware of her surroundings, with stable vital signs. at this time, the infusion was stopped and she was given a second dose of atropine 1 mg as well as an iv bolus of 1 l normal saline. she was monitored carefully and observed to return close to her baseline status within 12 h. neither the infusion of irinotecan nor the 5-fu infusion was restarted, and she was discharged to her home with appropriate follow-up. she returned 2 weeks later for cycle 2 of her folfirinox therapy and felt completely well. prior to initiating the infusion, her electrolyte levels were checked, which showed a low-normal potassium level of 3.7 she received 20 meq iv kcl supplementation leading to an improvement in the potassium level to 4.4 meq/l immediately preceding the infusion. she was then given her second cycle of folfirinox with identical doses of the drugs as in the first cycle and was able to complete all of the therapy without recurrence of the symptoms previously experienced at her initial infusion. she was able to continue on therapy without event for a total of 3 cycles before she transferred her care to an institution closer to her home and was lost to follow-up. to date, there have been 9 reported cases of significant central nervous system toxicity during or following the administration of irinotecan, both with and without concurrent oxaliplatin administration. all of these cases involved the development of dysarthria, with 2 of them leading to a complete motor aphasia and 1 case with associated ataxia [1, 2, 3, 4, 5]. in each case, these symptoms developed with the initial infusion of irinotecan and completely resolved with time. the duration of symptoms ranged from as little as 15 min to as long as 8 h. the duration of symptoms appeared to be related to the dose of irinotecan, with doses<200 mg/m having a quicker return to baseline (1545 min) in comparison to larger doses of>200 mg/m (28 h). irinotecan and its primary active metabolite, sn-38, bind strongly to plasma proteins and tissues resulting in high plasma distribution. in animal models, irinotecan and its metabolites have been found to cross the blood-brain barrier into the central nervous system. in 2 patients in whom neurologic symptoms developed during irinotecan administration, hamberg et al. examined the pharmacokinetics of irinotecan and sn-38 and found both of these values to be within the normal range. the acute onset of symptoms shortly after beginning irinotecan infusion also suggests that the manifestation of these symptoms is not dose or duration dependent. therefore, it is unlikely that altered systemic clearance of irinotecan mediates the presence or absence of neurologic symptoms in these patients. the degree of severe generalized weakness seen in our patient following administration of irinotecan has not previously been reported in the literature. though no imaging of the brain was performed in our patient, ct and mri performed in prior similar cases have failed to show any evidence of stroke or other acute cns abnormalities to explain the clinical presentation. our patient was found to have mild hypokalemia (3.5 meq/l) prior to chemotherapy (which may have been even lower following hydration and drug administration), which may have contributed to her profound weakness and inability to move and speak while maintaining a normal sensorium. one case of acquired fanconi syndrome (characterized by proximal tubular dysfunction resulting in electrolyte wasting of potassium, calcium, phosphate, and uric acid) has been reported following combination therapy with capecitabine, irinotecan, and bevacizumab, but a single offending agent was not identified. correcting our patient's electrolytes prior to the subsequent infusions and ensuring continued stability of these values throughout the infusion was the only change in the treatment plan and resulted in no recurrence of symptoms. we postulate that close monitoring and repletion of potassium was the factor that prevented further neurologic symptoms. as irinotecan alone has not previously been implicated in electrolyte-based neurologic complications, we also consider that the findings in our patient were not caused by irinotecan alone, but rather by combination therapy with oxaliplatin as administered in folfirinox. two prior case reports have noted the acute onset of severe neurologic deficits (including generalized weakness, limb weakness, dysarthria, ophthalmoparesis, and coma) during and shortly after the administration of oxaliplatin, which our patient received prior to initiation of irinotecan [8, 9]. in both reported cases, mmol/l) and much more severe in the case reported by basso et al. (k 1.7 meq/l), which appears to correlate with the severity of symptoms. in these cases, symptoms developed during the oxaliplatin infusion or within 15 min of completion. our patient tolerated her oxaliplatin therapy without complications during the infusion, but it is possible that the coadministration of oxaliplatin and irinotecan may have increased the risk of developing these reversible neurologic effects. if this is the case, those patients receiving combination folfirinox therapy may be at significantly higher risk of developing neurologic side effects than those receiving folfox therapy alone. from our experience in this patient, and from our review of the literature, we conclude that in selected cases, the coadministration of irinotecan and oxaliplatin (as is used in folfirinox) may result in severe generalized weakness and aphasia. we believe that a careful correction of these abnormalities into the upper ranges of normal as needed, both prior to beginning and during the infusion of oxaliplatin/irinotecan, may prevent this reaction. while the symptoms may be transient and self-limited, they may equally be severe. without knowledge of their etiology and the appropriate therapy, patients may be denied further treatment or may be reexposed to a serious adverse reaction.

backgroundirinotecan is commonly used in combination with oxaliplatin as a component of folfirinox chemotherapy for several gastrointestinal malignancies. the purpose of this case report is to describe a patient who developed acute paralysis and aphasia while receiving her initial infusion of irinotecan. case reporta 67-year-old woman with newly diagnosed metastatic pancreatic adenocarcinoma presented for her first cycle of folfirinox chemotherapy. during her infusion of irinotecan, she developed acute onset of generalized weakness, paralysis of all extremities, and nonfluent aphasia with complete inability to communicate. this episode was self-limited and resolved within 2 h. prior to subsequent infusions she received intravenous repletion of potassium and had no recurrence of symptoms.discussionin selected cases, coadministration of irinotecan and oxaliplatin may result in severe generalized weakness and aphasia, which may be triggered by underlying electrolyte disturbances. careful monitoring and correction of potassium may help prevent this reaction.

PMC4376921

pubmed-279

pleomorphic carcinoma is an aggressive tumour initially described in the lung by nash and stout. in the 4th edition of the world health organization (who) classification of tumours of the lung, pleomorphic carcinoma is defined as a poorly differentiated (squamous cell carcinoma or adenocarcinoma) or undifferentiated carcinoma in which at least 10% spindle and/or giant cells are identified, or as a carcinoma constituted purely of spindle and giant cells. primary sites of occurrence of extrapulmonary pleomorphic carcinomas have been described in other organs such as the stomach, thyroid, gallbladder, pancreas, kidney, liver, bladder, and colon. to the best of our knowledge, only one report described a case of giant cell carcinoma of the colon resembling that observed in the lung. based on the recommendations of the nomenclature committee on cell death, mitotic catastrophe is defined as a tumour-suppressive mechanism occurring during or after aberrant mitosis leading to cell death or cell senescence. histological patterns of micro- and multinucleation have been used as morphological markers for the detection of mitotic catastrophe [5, 6]. a high frequency of multinucleated giant cells is characteristically found in pleomorphic carcinomas. in this report, we present an additional case of primary pleomorphic carcinoma of the colon, and we underline similarities to and differences from pulmonary pleomorphic carcinoma. the possibility of the pleomorphic component as morphological expression of mitotic catastrophe is finally discussed. a 65-year-old caucasian woman with a medical history of hypercholesterolaemia, chronic obstructive pulmonary disease, and paroxysmal tachycardia was admitted to the surgery unit of the university hospital g. martino (messina, italy) in 2013 for abdominal obstructive symptoms (colicky pain to the right iliac fossa as well as borborygmi), change in bowel habits (diarrhoea), asthenia, and severe weight loss since 6 months. there was no nausea or vomiting. on physical examination, a globular and tympanic abdomen, painless at superficial and deep palpation, was evident. she reported a history of adequate food intake with regular bowel habits, alcohol consumption (< 20/30 g daily), and smoking. there was no family history of gastrointestinal malignancy, although familiality for bladder carcinoma was reported. abdominal ultrasonography highlighted an exophytic/stenosing mass at the level of the ascending colon. afterwards, colonoscopy also revealed an exophytic/stenosing malignant neoplastic mass in the caecum, subsequently confirmed through histological evaluation of biopsy. carcinoembryonic antigen (value for smokers<10.0 ng/ml) and carbohydrate antigen 19-9 (value<35 iu/ml) were within normal limits. a contrast-enhanced computed tomography scan showed no evidence of liver or distant metastases. routine haematoxylin-eosin sections were made from formalin-fixed, paraffin-embedded tissue. sections were also stained with periodic acid-schiff and alcian blue at ph 2.5. additional sections collected on silanized, coated slides were used for the immunohistochemical stains, using the dako envisiontm flex, high ph detection system together with autostainer instruments. the commercial source, clone, and dilution of the primary antibodies are detailed in table 1. macroscopic examination of the resected colon revealed an endophytic/ulcerative lesion measuring 7 cm in its greatest dimension, invading the caecum nearly to the ileocaecal valve. microscopically, the tumour was a poorly differentiated adenocarcinoma with a grade 4 pleomorphic component that occupied up to 10% of the whole tumour section. the pleomorphic component showed trabeculae and nests of neoplastic cells possessing eosinophilic cytoplasm, as well as irregularly shaped vesicular nuclei with a single large eosinophilic nucleolus. giant cells containing multiple nuclei, micronuclei, and prominent eosinophil nucleoli were also found (fig. the micronuclei appeared as round chromatin fragments with a diameter less than one third of the diameter of the nucleus. 1b) and large geographical necrotic areas with sharp boundaries with respect to the viable tumour tissue (fig. only 1 out of the 44 harvested perivisceral lymph nodes presented carcinomatous metastasis (pt3, pn1, clinical stage in accordance to the 2009 ptnm system). the histochemical stains were negative for periodic acid-schiff and alcian blue in all of the pleomorphic neoplastic cells. on the immunohistochemical stains, these cells were diffusely and strongly positive for ceap, ckae1/ae3, ck7, and vimentin, but they were negative for ck20, smooth muscle actin, desmin, synaptophysin, and -human chorionic gonadotropin. 2b), whereas p53 labelling was shown in more than 90% of the tumoural nuclei (fig. we described a rare case of pleomorphic carcinoma of the right colon showing opposing clinicopathological features. although it was classified as a grade 4 tumour, it was characterized by a pushing growth pattern and presented only one lymph node with metastasis. these data confirm that classic grading of colorectal carcinoma is insufficient to predict a prognosis, and that further parameters such as growth patterns are needed. accordingly, several recent studies have shown that colorectal carcinomas with pushing margins are associated with superior disease-free survival rates when compared with tumours with infiltrative margins. the present tumour had some of the morphological features described in giant cell carcinoma of the lung, such as pleomorphic tumour cells, malignant giant cells, atypical mitoses, and coagulative necrosis. however, pleomorphic carcinoma of the lung has been reported to have a poor prognosis, whereas in our case, the patient has been well without evidence of recurrence or metastases 2 years after the operation. many studies suggested that pleomorphic tumours are a heterogeneous group of neoplasms arising in different anatomical sites (e.g. lung, uterus, breast, central nervous system) characterized by variable morphological features and prognoses [8, 9, 10, 11]. in particular, a certain percentage of patients affected by them were found to be long-term survivors despite the anaplastic morphology of their primary neoplasms [8, 10, 11]. the differential diagnosis of pleomorphic carcinoma includes adenocarcinoma with a choriocarcinomatous component as well as mixed adenoneuroendocrine carcinoma [7, 12, 13]. a choriocarcinomatous component usually is characterized by immunoreactivity to -human chorionic gonadotropin, which was not found in our case, while the latter was excluded by the lack of expression of neuroendocrine markers such as synaptophysin and chromogranin [12, 13]. in our case, multinucleated tumour cells contained not only abnormally large giant nuclei but also those that are abnormally small, in the form of micronuclei. the presence of micronuclei is usually overlooked in the reports of pleomorphic carcinoma in the current literature. micronuclei derive from chromosomes and/or chromosome fragments that have been irregularly distributed between daughter nuclei after abnormal mitosis. besides micronucleation and multinucleation, we interpret these findings as a morphological expression of mitotic catastrophe, a particular type of cell death occurring in tumour cells after aberrant mitosis [5, 6, 14]. after mitotic catastrophe, tumour cells may continue to divide and thus develop polyploidy and/or aneuploidy. ki-67 is an antigen of cell proliferation frequently used in routine histopathological diagnostics as a prognostic factor in more malignancies. specifically, it is an epitope of a nuclear and nucleolar protein of 360 kda only expressed in nuclei of cells in active proliferation, i.e. during cell cycle phases g1, s, g2, and m, but not in the quiescent phase, i.e. in cell cycle phase g0 [17, 18]. normally, p53 acts as a guardian of the genome, protecting cells against cancer via two main ways: by determining cell cycle arrest at g1 and g2/m and by inducing cellular apoptosis [19, 20]. nuclear p53 immunohistochemical positivity in tumour cells suggests mutation in the p53 gene [21, 22]. thus, immunohistochemical overexpression of p53 and ki-67 constitutes further evidence of mitotic catastrophe in the pleomorphic component of our case of colonic neoplasm. ionizing radiation and different classes of cytotoxic agents induce cell death through mitotic catastrophe [15, 18]. histological recognition of mitotic catastrophe could be useful to predict an eventual pharmacological modulation (induction or inhibition) of tumour cell death. therefore, mitotic catastrophe has recently gained attention as a potential therapeutic target in neoplasms [23, 24, 25]. in summary, we reported a case of colorectal carcinoma with clinicopathological features partially similar to pleomorphic cell carcinoma of the lung, a neoplasm associated with a bad prognosis. in particular, this tumour presented only one lymph node with metastasis, and the patient is still well 2 years after the operation. this case presented morphological and immunohistochemical features compatible with mitotic catastrophe, a form of non-apoptotic cell death due to aberrant mitosis. the inclusion of mitotic catastrophe as part of a microscopic evaluation may be useful for understanding the pathogenesis of this rare entity and for new cancer treatment modalities. no further ethical approval was necessary to perform histology and immunohistochemistry in the case included in this report.

pleomorphic carcinoma is an aggressive neoplasm defined by the world health organization (who) as a poorly differentiated (squamous cell carcinoma or adenocarcinoma) or undifferentiated carcinoma in which at least 10% spindle and/or giant cells are identified, or as a carcinoma constituted purely of spindle and giant cells. although this entity has initially been shown in the lung, it has been described also in extrapulmonary locations, with only one report for a colonic site. a 65-year-old woman developed a caecal tumour. gross examination revealed an endophytic/ulcerative mass 7 cm in length. microscopically, the tumour was a poorly differentiated adenocarcinoma with a pleomorphic component that occupied more than 10% of the specimen. the tumour shared these histopathological findings with pulmonary giant cell carcinoma but differed in other clinicopathological features such as a pushing growth pattern, stage pt3n1, and an uneventful outcome 24 months after operation. the pleomorphic component showed morphological and immunohistochemical features compatible with mitotic catastrophe, a non-apoptotic cell death occurring in cycling cells after aberrant mitosis. these features included multinucleation, micronucleation, atypical mitoses, foci of geographic necrosis, as well as immunohistochemical overexpression of p53 and ki-67. the interpretation of the pleomorphic component as morphological expression of mitotic catastrophe may be useful in comprehending the pathogenesis of this rare neoplasm, and it may have practical implications as a potential cancer therapeutic target.

PMC4939675

pubmed-280

las fracturas por fragilidad asociadas a la osteoporosis suponen un gran coste econmico y personal para la sociedad. la ingesta de calcio farmacutico o diettico es necesaria para aumentar la densidad mineral y prevenir fracturas por fragilidad. aunque los productos lcteos son una buena fuente de calcio, los pacientes que no pueden digerir la lactosa tienden a evitarlos y tienen un mayor riesgo de fractura que la poblacin general. informes anecdticos indican que las personas que no digieren bien la lactosa, al consumir leche cruda, tienen una gran reduccin de sntomas en comparacin con la leche pasteurizada. el mecanismo de la reduccin notificada en los sntomas, de ser verdad, se desconoce. el propsito del estudio actual era hacer una encuesta a las personas que beben leche cruda para determinar sus motivaciones relacionadas con la salud para consumir leche cruda, sobre todo en relacin con la mala digestin de la lactosa. 153 de 1527 miembros de una comunidad que compra leche cruda complet una encuesta online en relacin a la leche cruda. el motivo principal que los encuestados citaron para beber leche cruda fue que crean que era ms sano; el 30% notific ciertas molestias gastrointestinales al beber leche pasteurizada, aunque casi todos (99 %) notificaron consumir leche cruda sin molestias. a pesar de los informes de molestias gastrointestinales, un profesional mdico haba diagnosticado intolerancia a la lactosa en solo el 5% de los encuestados, y solamente al 1% se le haba diagnosticado intolerancia a la lactosa mediante el mtodo de referencia de prueba de hidrgeno en el aliento. el motivo principal para beber leche cruda es su valor saludable percibido, no su digestibilidad. aunque la leche cruda parece ser digerida ms fcilmente que la pasteurizada en la muestra de nuestra encuesta, se desconoce el mecanismo de digestibilidad. the popular media occasionally present anecdotal stories regarding the benefits of consuming raw dairy products. yet we found no reports in the literature supporting the anecdotal reports that lactose maldigesters are able to consume raw milk without discomfort. also unreported or under debate in the literature is the mechanism that allows maldigesters of pasteurized milk to consume raw milk without discomfort. if the enzyme is present in raw milk, it is very heat labile and would be denatured during the milk pasteurization process. naturally occurring lactobaccili and lactococci, which are killed during pasteurization, another proposed mechanism of lactose maldigestion is that milk from cows with the a1 -casein variant (commonly european breeds) contains a peptide called -casomorphin-7 that reportedly can cause an immune response, lactose intolerance symptoms, and other health-related issues. these claims are not well substantiated in the literature and are controversial. further complicating the issue, raw milk is often produced and sold from small family farms that typically use jersey or guernsey cows and pasture their cows on grass. jersey and guernsey cows typically have the a2 -casein variant, whereas holstein cows (primarily used in large industrial dairies) have the a1 variant. so what are perceived by some to be the benefits of raw milk may have as much to do with the type of cow (a1 vs a2) and husbandry (pastured and grass-fed vs confined and ration-fed) as with the manner in which the milk is pasteurized (or not). we intend to clinically evaluate the digestibility of raw milk vs pasteurized milk, but to guide the design of our study, we need more background information. therefore, we surveyed consumers of raw milk to determine the health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. we developed an online survey of 16 questions, which was available from december 7, 2012, until january 31, 2013. the director of a raw milk buying consortium in maryland sent an email to its 1527 members, inviting them to complete our online survey. because trafficking in raw milk intended for human consumption is against the law in maryland, survey responses were anonymous. this study was approved by our institutional review board, and respondents were informed that completing the survey served as informed consent. most of the 153 respondents (response rate of 10%) were females between 30 and 50 years of age (table). of the 153 respondents, 74% reported drinking at least one glass of raw milk per day. results of survey of raw milk drinkers although instructed to choose only one response, 11 respondents chose one of the letter selections, then added a comment under other (please specify). we sought to differentiate those who consumed raw milk because they considered it more healthful than pasteurized milk from those who consumed it because they found it easier to digest. the concept of easy to digest was based on the absence of bloating, gas, diarrhea, and cramping. we queried on the digestibility of drinking milk under three conditions: (1) the reaction to drinking pasteurized milk before switching to raw milk; (2) the reaction experienced currently when drinking raw milk; and (3) the reaction of drinking pasteurized milk after having switched to raw milk. we also asked if there was a transition period at the onset of drinking raw milk to identify if some colonic adaptation had occurred as a result of drinking raw milk. we sought to identify subjects who had been diagnosed by a medical professional as lactose intolerant and if the diagnosis had been confirmed by a hydrogen breath test (hbt). we asked about the digestibility of other dairy products, namely yogurt, cheese, and ice cream. it has long been known that in parts of the world where prevalence of lactose maldigestion is high, those populations nevertheless consume large quantities of yogurt. fermented products such as cheese and dairy products with live cultures (yogurt) are more easily digested than other dairy because of the presence of microbial -galactosidase. in an attempt to learn more about the potential role the -casein variant (a1 vs a2) has on milk digestibility, we asked from what breed of cow the raw milk came and what type of diet the cows were fed, if the participants knew. lastly, we sought to assess the importance of calcium in the motivation for consuming raw milk. lactose intolerance is related to reduced milk consumption and therefore reduced calcium intake, which is associated with an increased risk for osteoporotic fractures. we analyzed differences in reported discomfort from drinking raw vs pasteurized milk and in drinking pasteurized milk before and after drinking raw milk for significance (p<.05) using mcnemar's test. of the 16 questions on the survey, only four were answered by all respondents, but all were answered by at least 148 (96.7%) (table). of the 153 respondents, most (86) cited that they consumed raw milk because they believed it to be more healthful and easier to digest.: 12 said raw milk tasted better than pasteurized milk; 8 cited social/environmental concerns such as supporting local farmers, it is better for the cows, etc; 6 cited that they had allergies to pasteurized milk; two claimed it cured unspecified ills; and six cited individual reasons such as i grew up on it or [i] do n't eat processed food. 71 respondents reported no discomfort from drinking raw or pasteurized milk. two reported discomfort from drinking raw and pasteurized milk, and one commented that he/she does not consume cow milk but instead drinks goat milk. fifty-nine respondents claimed no discomfort after drinking raw milk but discomfort from drinking pasteurized milk. one reported no discomfort from drinking pasteurized milk but did report discomfort from drinking raw milk. eighteen consumed raw milk without discomfort but reported they do no drink pasteurized milk. considering the number of respondents who cited discomfort drinking milk, it was surprising that only 5 (3%) respondents were diagnosed as lactose intolerant and only 1 (0.7%) was confirmed lactose intolerant by means of an hbt. in terms of symptoms between before and after beginning to drink raw milk, responses included, (70); do not have discomfort drinking pasteurized milk (41); and still get discomfort drinking pasteurized milk (28). twenty-six respondents reported no discomfort from drinking pasteurized milk, but nevertheless they do not drink pasteurized milk. four reported no previous discomfort but did report discomfort since beginning to drink raw milk. five respondents reported previously having trouble drinking pasteurized milk but no symptoms since drinking raw milk. two respondents reported not drinking pasteurized milk but symptoms when they did drink pasteurized milk. there was no significant reduction in discomfort of the respondents between the before and after drinking raw milk periods. in the current study, survey results suggest that the motivation for raw milk consumption is complex. we hypothesized that one motivation for raw milk consumption was to avoid symptoms associated with lactose maldigestion. yet almost half of the respondents indicated that they had no ill effects after drinking pasteurized milk. despite the number of respondents indicating some gastrointestinal (gi) discomfort when having previously consumed pasteurized milk, only 5 (3%) respondents were diagnosed as lactose intolerant, and only 1 (0.7%) was confirmed lactose intolerant by means of an hbt. these findings suggest that the symptoms of lactose intolerance were mild enough to not warrant the respondents ' seeking a medical diagnosis or that the respondents self-diagnosed and sought alternatives to pasteurized milk. diagnosing lactose maldigestion and the severity of the maldigestion would seem straightforward using the hbt. it is intriguing that a sizable percentage of those exhibiting lactose maldigestion symptoms have not been diagnosed by a medical professional as being lactose intolerant. it would be interesting to determine the hbt diagnosis of those who report gi discomfort. some indicate that what is self-diagnosed as lactose intolerance/maldigestion may be a misinterpretation of gi dysbiosis or irritable bowel syndrome. it may also be a self-fulfilling diagnosis because those who consider themselves to be lactose maldigesters tend to avoid dairy, which causes a change in the gut microbiota, making the bacteria less adept at decomposing lactose. others have found that those diagnosed as lactose maldigesters could ingest modest amounts of milk per day without incident and that symptoms associated with lactose maldigestion were misattributed. the underlying mechanism by which lactose in raw milk may be more readily digested, if in fact that is the case, is more difficult to determine. the predominant bacteria in raw milk are lactococcus lactis (strains of which are used commercially as starter cultures in cheese making), but the bacteria are virtually eliminated when milk is pasteurized. it is likely that these native bacteria account for the alleged enhanced digestibility of raw milk over pasteurized milk, but we found no report in the literature of a direct clinical comparison. in one study, yogurt with active bacterial colonies fed to maldigesters was more readily digested than pasteurized yogurt or milk with active cultures. therefore, yogurt maintains the stomach at a higher ph than milk, which protects the bacteria. in one study, heating yogurt and reintroducing live bacteria up to 10 bacteria/ml concentrations was not as effective as standard yogurt with 10 bacteria/ml in reducing h2 in lactose maldigesters. furthermore, certain strains of active bacteria appear to be more efficient than others at digesting lactose. exposing the intestinal microflora to lactose allows the lactose-fermenting non hydrogen-producing organisms to thrive. the resulting colonic adaptation results in lactose being metabolized to short-chain fatty acids and lactate instead of hydrogen, which is the main component in flatus. this colonic adaptation may confound the study results, which is why we included the question regarding discomfort from drinking pasteurized milk after the respondent had been consuming raw milk. our results did not indicate any evidence of colonic adaptation, but our results may be skewed because most respondents, after drinking raw milk, reported never drinking pasteurized milk, so it is impossible to know how they would react to pasteurized milk consumption. other investigators have suggested a placebo effect instead of colonic adaptation because clinical symptoms of maldigestion (eg, bloating, diarrhea) decreased in lactose-treated and control groups. yet objective analysis of h2 excretion decreased significantly in the lactose-exposed group compared with controls, suggesting some adaptation. in our survey, 95% of the respondents reported eating yogurt with active cultures at least once a month. our survey did not ask if the yogurt with active cultures consumption was similar before and after raw milk consumption, so it is unknown what role yogurt might have in colonic adaptation in our survey group. however, after the survey, we learned that some of the respondents made their own cheese and ice cream from raw milk. therefore, it is unknown what percentage of responses was associated with pasteurized commercial cheese and ice cream compared with raw-milk cheese and ice cream. when asked about drinking raw milk, almost 99% of respondents indicated no ill effects. this result suggests that, in the 20% to 30% who initially reported gi discomfort drinking pasteurized milk, the symptoms abated when consuming raw milk. although these findings might argue the case that raw milk is more easily digested, it is unlikely that the result would apply to all who experience gi discomfort when consuming pasteurized milk because of a selection bias in our data set. it is unlikely that those who would experience gi discomfort from drinking raw milk would be part of a raw dairy buying club. thus, there is likely an overestimate of those lactose maldigesters who would benefit from raw milk. that 99% of the respondents could drink raw milk without incident is high but consistent with the published finding that 82% of patients diagnosed as lactose intolerant after ingesting pasteurized milk were capable of ingesting raw milk without incident. the patients in that survey were self-reporting their diagnosis by a healthcare professional, but the definition of healthcare professional was unclear. nevertheless, the information contained in that report is the best currently available for comparison. the current finding suggests that, at least among the group of survey respondents, milk is an important source of calcium. one might surmise that for those who are not able to digest milk easily, milk as a source of calcium may be eliminated from their consideration. in terms of osteoporosis prevention, it should be noted that calcium absorption from milk was not affected by lactose maldigestion status. the reduction in calcium intake in patients with lactose maldigestion more than 75% of the respondents reported consuming at least one glass of milk per day. the size of the glass was not specified, so it is unknown what magnitude of nutrients would be available for ingestion on a daily basis. finally, the role of a1/a2 -casein variant in cow genetics and the role of husbandry on digestibility remain elusive. almost 90% of the respondents reported that their milk came from grass-fed cows. although these results are consistent with expectations of the cows and husbandry that are associated with raw milk for human consumption, it is unknown how reliable the reporting of this information is. more than half of the respondents readily admitted not knowing from which breed of cow their milk came.

background: fragility fractures associated with osteoporosis extract a large financial and personal toll on society. pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. the mechanism of the reported reduction in symptoms, if true, is unknown. the purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. methods:an online survey regarding raw milk was completed by 153 of 1527 members of a raw milk buying community. results:the primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. conclusions:the primary motivation for drinking raw milk is its perceived health value, not its digestibility. although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

PMC4268642

pubmed-281

it negatively influences the child's quality of life and is an important cause of absence from school and also a significant factor in health-related costs among children and adolescents. its prevalence varies greatly from 5.9 to 82%, depending on the definition criteria and the age of the patients. the international headache society classifies headaches into primary and secondary type in classification of headache disorders 2 edition (ichd-ii). primary headache is not attributed to any other disorder. in the majority of patients with primary headache, general and neurological examinations are normal and primary headaches include migraine, tension-type headache, cluster headache, autonomic cephalalgias and other primary headache disorders. frequency of headache increases with age in this population. in the present study we aimed to determine epidemiologic characteristics and compare socioeconomic and some clinical factors related to primary headaches in children/adolescents (4-15 year olds) presented to neurology clinics of tabriz university of medical sciences. the institutional review board at tabriz university of medical sciences approved the study protocol. after obtaining a written informed consent from parents, children with 4-15 years of age and with the diagnosis of primary headache (migraine or tension-type headaches) who presented to the neurology clinics affiliated to tabriz university of medical sciences, tabriz, iran from march 2009 to october 2011 were included in this cross-sectional study. a total of 190 patients fulfilled the criteria for enrollment in the study and their demographics were collected. we noted the type of headache, history of atopy, asphyxia during labor (according to the history of admission in the neonatal intensive care unit after birth due to respiratory problems based on the parents report and review of the previous medical records) and breast feeding, family history of headache, presence of headache triggers and the socioeconomic status of the family. diagnosis of migraine and tension-type headache was based on the international headache society diagnostic criteria for the primary headache disorders. socioeconomic status was determined according to the total monthly family income (< 7,000,000 rl vs=7,000,000 rl) based on the index of statistical center of iran for grand cities in the years of study in addition to the highest level of education of the father (< or=high school vs.>or=college). statistical analysis was conducted with spss, version 16.0 for window (spss, chicago, il). data were expressed as meansd for quantitative variables and as numbers and percentages for categorical variables. statistical analysis was performed using the chi-square test for categorical variables and the student's t test for numerical variables. eighty eight patients (46.3%) had migraine and 102 patients (53.7%) had tension-type headache. the distributions of gender and age groups in patients with migraine or tension-type headache are shown in table 1. the distributions of gender and age groups in patients with migraine or tension-type headache data are presented as numbers no significant differences were seen in the distribution of gender between the patients with migraine and tension-type headache. migraine and tension-type headache had comparable frequency in different age groups of male patients (p=0.1 and 0.07, respectively). in female patients the frequencies of both migraine and tension-type headache were significantly higher in the age group of 10-15 years as compared to the age group of 4-9 years (p=0.03 and 0.04, respectively). there was no significant differences regarding the prevalence of migraine or tension type headache between different genders in the same age group. the most common clinical presentations of aura in patients with migraine are demonstrated in table 2. the comprehensive data regarding the epidemiologic characteristics of patients with migraine or tension-type headache in our study group are shown in table 3. the clinical presentations of aura in patients with migraine the characteristics compared between patients with migraine and tension-type headache as triggering factors for headache; or: odds ratio; ci: confidence interval history of asphyxia during labor was more prevalent among patients with migraine as compared to the tension-type headache (p=0.007, or=3.24). history of headache in parents was also significantly higher in patients with migraine as compared to tension-type headache (p=0.001, or=3.19). moreover, the prevalence of atopy was significantly higher in patients with migraine (p=0.01, or=5.70). prevalence of feeding with formula during infancy did not differ between the patients with either migraine or tension-type headache (p=0.9). the low socioeconomic status was more prevalent in patients with migraine headache (p=0.003, or=2.38). in our study primary headache was more common in older age group which is consistent with danold's findings which showed that frequency of headache increases with age. tension type headache in patients was more frequent than migraine which is comparable with findings of kroner-herwig et al. the main finding in the present study was that gender can not predict the type of primary headache in younger children, as no gender differences were seen between the patients with migraine or tension-type headache in the age group 4-9 years. this finding is in contrast to previous report by krner-herwig et al which showed that being female was a significant predictor for three main subtypes of primary headaches a few other studies showed that the prevalence of migraine was higher in the males. our results also demonstrated that the frequencies of migraine and tension-type headache were comparable in different age groups of male patients, whereas female patients in the age group 10-15 years had higher frequency of both types of headache especially migraine as compared to the age group 4-9 years. this finding reveals that female adolescents had higher risk for developing primary headache specially migraine as compared to female children. these results agree with those reported by krner-herwig et al who showed that children with migraine were significantly older than children in the other groups. it could be due to hormonal effect as the trigger of migraine headache in the female adolescents. it was previously shown that primary headache in children is closely related to history of headache in their parents. our results demonstrated that when a parent showed combined headache, the risk of developing migraine in his or her child is more conspicuous as compared to the tension-type headache. this finding is consistent with previous reports by fallahzadeh et al and krner-herwig et al which showed a stronger association between family history of headache and being afflicted by migraine as compared to tension-type headache in children. our study also demonstrated that if the patients with history of peripartum asphyxia would develop primary headache it would more probably be of migraine type. these results partly agree with those reported by maneyapanda et al who found an association between chronic migraine headache and significant perinatal insult due to neuroplasticity and its induced hyperexcitability. however, it is recommended to design prospective studies to compare the frequency of primary headache (either migraine or tension-type headache) in patients with or without perinatal insults to elucidate the role of peripartum asphyxia as a risk factor for developing primary headaches. we also showed that atopy is more prevalent in patients with migraine as compared to tension-type headache. also ozge et al found an association between atopy and both migraine and episodic tension-type headaches. it has been shown that alteration in several interleukins occurs in migraine which supports an association between migraine and atopic disorders. although it was shown by pogliani et al that breast feeding has a protective role against primary headache disorders, our results showed that children and adolescents with history of formula feeding during infancy have comparable prevalence of developing either migraine or tension-type headache. our results showed that socioeconomic status of the patients could significantly influence the frequency of migraine in comparison to tension-type headache. ayzenberg et al in a study on 2725 adults in russia, showed that low socioeconomic status is associated with higher frequency of primary headache disorders. moreover, katsarava et al in another study on 1145 adult patients in the republic of georgia showed that low socioeconomic status and female gender are risk factors for development of migraine, not tension-type headache. moreover, the possible role of psychological factors and behavioral characteristics influencing primary headaches could have been considered. while some variables have been checked by the present report, further prospective studies with larger sample sizes are needed to provide more comprehensive data regarding associated factors in childhood primary headache.

objectiveheadache is one of the most common neurologic problems in children and adolescents. primary headache including migraine and tension-type headache comprises the vast majority of headaches and are associated with marked incidence, prevalence, and individual and social cost. we aimed to assess demographic characteristics and to compare some factors related to primary headaches in children/ adolescents presented to neurology clinics of tabriz university of medical sciences. methodschildren from 4 to 15 years of age with the diagnosis of primary headache (migraine or tension-type headaches) who presented to the neurology clinics affiliated to tabriz university of medical sciences, tabriz, iran from march 2009 to october 2011 are included in this cross-sectional study. data regarding the type of headache, history of atopy, peripartum asphyxia, and breast feeding, family history of headache and the socioeconomic status of the family were collected. the diagnosis was based on the international headache society diagnostic criteria for the primary headache disorders. findingsone hundred ninety children (107 females) with primary headache (88 patients with migraine and 102 patients with tension type headache) enrolled in the study. peripartum asphyxia, history of atopy, family history of headache and low socioeconomic status (ses) were more common in patients with migraine (p-values: 0.007, 0.01, 0.001, 0.003; respectively). conclusionphysicians need to extent their knowledge regarding the primary headaches. peripartum asphyxia, history of atopy, headache in parents and low ses have been shown in the present study to be more prevalent in patients with migraine as compared to tension-type headache.

PMC4006502

pubmed-282

a total of 30 mabs that were either developed or in-licensed by companies are currently undergoing evaluation in late-stage studies (tables 1 and 2). five of these (brodalumab, mabp1, moxetumomab pasudotox, tildrakizumab, rilotumumab) transitioned into phase 3 studies during the period from late 2012 to april 2013. brodalumab (amg827, amgen; khk4827, kyowa hakko kirin), a human igg2 targeting the interleukin (il)-17 receptor, is undergoing evaluation in three phase 3 studies (amagine-1, -2, and -3) of patients with psoriasis. the amagine-1 study (nct01708590) is evaluating the efficacy, safety, and effect of withdrawal and retreatment with brodalumab in patients with moderate-to-severe plaque psoriasis. in this study, either of two doses (140 mg or 210 mg) or placebo is administered subcutaneously (sc) every two weeks until week 12, when patients are rerandomized to placebo or continued treatment. the estimated primary completion date for the study is march 2014. in the amagine-2 (nct01708603) and amagine-3 (nct01708603) studies, the efficacy and safety of induction and four maintenance regimens of brodalumab compared with placebo and ustekinumab in patients with moderate-to-severe plaque psoriasis is being evaluated. these studies have estimated primary completion dates of august and september 2014, respectively. note: table compiled from information available as of april 25, 2013. abbreviations: cd, cluster of differentiation; il, interleukin; pcsk9, proprotein convertase subtilisin/kexin type; sle, systemic lupus erythematosus. note: table compiled from information available as of april 25, 2013.*in-licensed; national cancer institute is sponsoring the phase 3 study in hairy cell leukemia patients. abbreviations: all, acute lymphoblastic leukemia; cll, chronic lymphocytic leukemia; hgf/sf, hepatocyte growth factor/ scatter factor; nhl, non-hodgkin lymphoma; nscl, non-small cell lung; vegfr2, vascular endothelial growth factor receptor 2. a first phase 3 study (nct01767857) of mabp1 (xilonix, xbiotech, inc.), a human mab targeting il-1, was recruiting patients as of march 2013. the study will evaluate overall survival of metastatic colorectal cancer patients with cachexia who are administered the mab as a monotherapy. the effects of mabp1 administered intravenously (iv) every two weeks, plus best supportive care will be compared with those of megestrol acetate administered daily plus best supportive care. the difference between the study arms in median overall survival from baseline to 18 mo will be compared. the recombinant immunotoxin moxetumomab pasudotox (cat-8015, astrazeneca) is undergoing evaluation in a phase 3 study (nct01829711) of patients with relapsed/refractory hairy cell leukemia. the study is sponsored by the national cancer institute (nci); the mab is currently licensed to astrazeneca. in 2004, nci licensed moxetumomab pasudotox to genencor, inc. the mab was then acquired in 2005 by cambridge antibody technology, which was itself acquired by astrazeneca in 2006. moxetumomab pasudotox comprises a mouse disulfide stabilized variable fragment with the variable heavy domain fused with a 7-mer linker and the pseudomonas aeruginosa exotoxin a pe38 fragment. in the phase 3 study, patients will receive 40 g/kg of the immunotoxin administered iv over 30 min on days 1, 3, 5 of each 28 d cycle until complete response, progressive disease, initiation of alternate therapy or unacceptable toxicity is observed. initiated in march 2013, the study s estimated primary completion date is december 2014. two phase 3 studies of tildrakizumab (sch900222/mk-3222, merck), a humanized mab targeting the p19 subunit of il-23, are recruiting patients. initiated in december 2012, nct01722331 is a 64-week study to evaluate the efficacy and safety/tolerability of sc administration of tildrakizumab in patients with moderate-to-severe chronic plaque psoriasis. patients receive 100 mg or 200 mg tildrakizumab at week 0 and week 4, and then every 12 weeks until study end or participant discontinuation. patients receive the same doses of tildrakizumab, but the study includes 50 mg etanercept as well as placebo as comparators. the two phase 3 studies have estimated primary completion dates of june and july 2015, respectively. rilotumumab (amgen) is a human igg2 targeting human hepatocyte growth factor/scatter factor (hgf/sf) that blocks binding of hgf/sf to its receptor met, thereby inhibiting the met signaling pathways. the mab is undergoing evaluation in a phase 3 study (nct01697072) of chemotherapy (epirubicin, cisplatin and capecitabine) with rilotumumab or placebo for untreated advanced met-positive gastric or gastresophageal junction adenocarcinoma. rilotumumab or placebo is administered iv at doses of 15 mg/kg every 21 d. the primary outcome measure is overall survival in a time-frame of three years. initiated in october 2012, the estimated primary completion date for the study is december 2015. recently announced results for three late-stage studies of two mabs for cancer (farletuzumab, naptumomab estafenatox) and tabalumab, a mab treatment for autoimmune disorders, indicate that clinical endpoints were not met. farletuzumab (morab-003, morphotek/eisai) is a humanized igg1 mab that targets human folate receptor, which is overexpressed in most epithelial ovarian cancers, as well as some forms of endometrial, breast, renal, lung and colorectal cancers. the primary endpoint of progression-free survival (pfs) was not met in the phase 3 far-131 study (nct00849667) of farletuzumab in combination with carboplatin and a taxane in patients with platinum-sensitive epithelial ovarian cancer in first relapse. patients received placebo or farletuzumab at either 1.25 mg/kg or 2.5 mg/kg weekly for ~six cycles. although the primary endpoint was not met, a trend toward improved pfs was observed in some patient subsets in a post-hoc analysis. the safety and efficacy of farletuzumab in combination with a platinum containing doublet in chemotherapy-nave subjects with stage iv adenocarcinoma of the lung are being evaluated in a phase 2 study (nct01218516). as announced in january 2013 by active biotech ab, initial results of a phase 2/3 study (nct00420888) of naptumomab estafenatox (abr-217620, anyara) in combination with interferon as a treatment for advanced renal cell carcinoma indicated that the study did not achieve its primary clinical endpoint of overall survival in the intention-to-treat cohort. a confounding factor was the presence of high levels of pre-formed anti-drug antibodies found in a majority of patients in this, but not previous, studies. a doubling of pfs and overall survival occurred in the 25% of patients who had low or normal levels of base-line il-6 and expected levels of anti-drug antibodies. naptumomab estafenatox is composed of an antigen-binding fragment (fab) that targets metastasis-associated 5t4 fused to a mutated form of staphylococcal enterotoxin a (sea/e-120). phase 3 studies of tabalumab (ly2127399, eli lilly and co.) as a treatment for ra have been discontinued due to lack of efficacy. tabalumab, a human igg4 targeting b-lymphocyte stimulator, was being evaluated in five phase 3 studies of ra patients. tabalumab in combination with bortezomib and dexamethasone is also being evaluated in a phase 2/3 study (nct01602224) of patients with previously treated multiple myeloma. historically, ~50% of mabs in the commercial clinical pipeline have been studied as cancer agents; however, ~67% of the current cohort of mabs at phase 3 is in studies for non-cancer indications (table 1). these 20 mabs are human or humanized, with more than half (55%) targeting an interleukin or an interleukin receptor. the mabs are being developed as treatments for immunological disorders such as ra, sle, ms and psoriasis, but also for hypercholesterolemia, cachexia and alzheimer disease. reflecting the overall greater challenge of demonstrating safety and efficacy in cancers, the molecular types of the 10 mabs in late-stage studies of cancer (table 2) are more diverse than those for non-cancer indications. of particular note is the inclusion of a toxin in three molecules (naptumomab estafenatox, moxetumomab pasudotox, inotuzumab ozogamicin) and use of less than a full-length sequence for three molecules (naptumomab estafenatox, moxetumomab pasudotox, onartuzumab). the majority (70%) of the 10 product candidates are in studies of solid tumors, with the remainder undergoing evaluation as treatments for hematological cancers. the number of anti-cancer mabs at phase 3 is likely to increase in the next 35 y as more adcs move into and through the clinical pipeline. mabs will continue to track the progress of antibody therapeutics in clinical study throughout 2013, and we look forward to reporting on results that may be released during the year in which are the antibodies to watch in 2014 ?

the transitions of antibody therapeutics to late-stage clinical development, regulatory review and the market are proceeding at a rapid pace in 2013. since late 2012, two monoclonal antibody (mab) therapeutics (itolizumab, trastuzumab emtansine) received their first approvals, first marketing applications for three mabs (vedolizumab, ramucirumab, obinutuzumab) were submitted to regulatory agencies, and five mabs (brodalumab, mabp1, moxetumomab pasudotox, tildrakizumab, rilotumumab) entered their first phase 3 studies. the current total of commercially-sponsored antibody therapeutics undergoing evaluation in late-stage studies is 30. recently announced study results for farletuzumab, naptumomab estafenatox, and tabalumab indicate that clinical endpoints were not met in some phase 3 studies of these product candidates.

PMC3906304

pubmed-283

in order to proliferate, cells must accurately transmit their chromosomes from one generation to the next. in eukaryotes, the chromosomes are confined to the nucleus, the perimeter of which is defined by the nuclear envelope. the nuclear envelope is made of a double membrane; the outer nuclear membrane is continuous with the endoplasmic reticulum (er) and contains many of the same proteins. the inner nuclear membrane contains a distinct set of proteins, some of which interact with chromatin. the outer and inner nuclear membranes are fused at sites of nuclear pore complexes (npcs), macromolecular structures that allow selective passage of proteins, rna and other molecules to and from the nucleus. in most eukaryotes, underlying the inner nuclear membrane is a network of proteins, called the nuclear lamina, made of lamins and lamin-associated proteins. this network provides rigidity to the nucleus and contributes to chromatin organization and other nuclear processes. interestingly, neither plants nor fungi have a lamin-based nuclear lamina, although other structures may serve a similar purpose. of note alterations in nuclear shape and size are characteristic of aging and certain disease states, such as various types of cancer. thus, understanding how nuclear shape is regulated and identifying genes that contribute to nuclear morphology are of interest from both a medical and a basic biology standpoint. the nuclear envelope not only serves as a diffusion barrier but also as a physical barrier separating the chromosomes from cytoplasmic structures. in most animal cells these cytoplasmic structures include the centrosomes, which function as microtubule organizing centers that nucleate spindle microtubules necessary for chromosome segregation. however, just before mitosis, the nuclear envelope stands between these microtubules and the chromosomes. different cell types have adopted different strategies to facilitate the access of chromosomes by microtubules: at one end of the spectrum are cells of most metazoans, in which nuclear envelope components, including the two nuclear membranes, the npcs and the nuclear lamina with their associated proteins, disperse during each and every mitosis (fig. this type of mitosis is called open mitosis, and it necessitates the reassembly of the nuclear envelope around a full complement of chromosomes in each of the daughter cells once chromosome segregation is completed. parenthetically, the mechanism that ensures the formation of only a single nucleus at the end mitosis, as opposed to several nuclei each encompassing a subset of chromosomes, is not known. at the other end of the spectrum are certain fungi in which the centrosome equivalents, called spindle pole bodies, are either permanently embedded in the nuclear envelope (such as in budding yeast) or are embedded in the nuclear envelope prior to mitosis (such as in fission yeast). these cells undergo what is called closed mitosis, which occurs without nuclear envelope breakdown, as spindle microtubules that assemble within the nucleus can readily access the chromosomes. however, during closed mitosis, the nucleus must elongate in a manner that is coordinated with chromosome movement as chromosome segregation takes place (fig. the chromatin (blue) is contained within the nuclear envelope (light green). as cells enter mitosis, the nuclear envelope disassembles, allowing spindle microtubules (purple lines) nucleated by centrosomes (purple spheres) to align the chromosomes on the metaphase plate. (b) closed mitosis. shown is mitosis as it occurs in s. cerevisiae. the spindle pole body (purple) is embedded in the nuclear envelope throughout the cell cycle. after spindle pole body duplication, an intra-nuclear spindle is formed (s. cerevisiae chromosomes do not condense enough to visualize individual chromosomes or a metaphase plate). during anaphase, the nucleus elongates and the nuclear envelope expands as the sister chromatids move away from each other. (c) functionally open, structurally closed mitosis. a term defined by sazer to indicate a breakdown in the diffusion barrier while maintaining an intact nuclear envelope. shown is mitosis as it occurs in aspergillus nidulans. as in s. cerevisiae, during interphase the spindle pole body is embedded in the nuclear envelope. as cells enter mitosis the nuclear pores (dark green) partially disassemble, significantly reducing the diffusion barrier between the nucleus and cytoplasm. as in closed mitosis, the bulge in the center of the elongated nucleus during anaphase contains the nucleolus, which is left behind during chromosome segregation. schizosaccharomyces japonicus cells form an intra-nuclear spindle as in cells undergoing closed or partially open mitosis. however, during anaphase, the nuclear envelope ruptures as the nucleus elongates without nuclear envelope expansion. the historic definition of open vs. closed mitosis was based on cytology: during open mitosis the nuclear envelope disappears, opening the nucleus and exposing its content to the cytoplasm, while in closed mitosis the nuclear envelope remains intact. from a functional standpoint, the presence or absence of a nuclear envelope affects at least two processes: the free diffusion of molecules between the cytoplasm and the nucleus (which occurs during open, but not closed, mitosis) and the presence of a physical barrier between the chromosomes and cytoplasmic structures (which exists in closed, but not open, mitosis). over the years, mitotic divisions that fall somewhere in between open and closed have been described, warranting a brief discussion on how these forms of mitosis should be defined. in aspergillus nidulans, which was originally defined as undergoing closed mitosis, npcs partially disassemble as cells enter mitosis, disrupting the diffusion barrier between the nucleus and the cytoplasm, while maintaining a physical barrier between the chromosomes and cytoplasmic structures (fig. a breakdown in the diffusion barrier also occurs during a brief period in anaphase of meiosis ii of the fission yeast schisosaccharomyces pombe. unlike the situation in a. nidulans, however, the change in permeability in s. pombe meiosis ii occurs at only a short window of nuclear division and is not accompanied by changes in either npc composition or nuclear membrane integrity. this led sazer to define this type of division as functionally open but structurally closed, a term that can also be applied to a. nidulans mitosis. other types of mitosis involve a partial opening in the nuclear membrane itself. in schisosaccharomyces japonicas, the nuclear envelope does not expand during mitosis, nor does it disassemble. as a result, the nuclear envelope ruptures as the intra-nuclear spindle elongates (fig. interestingly, rupturing is not a result of forces exerted by the spindle, but rather a programed cell cycle event, the regulation and mechanism of which remain to be discovered. in the early embryonic divisions of the nematode caenorhabditis elegans the nuclear envelope is breached in pro-metaphase, allowing diffusion of cytoplasmic proteins into the nuclear space. a similar phenomenon is seen during drosophila syncytial divisions, where the nuclear envelope displays a partial disassembly of nuclear pore complexes and fenestrations near the centrosomes, thereby allowing microtubules to access the chromosomes. live cell imaging suggests that just as in closed mitosis, the nuclear envelope during drosophila syncytial divisions expands as the spindle elongates. in these three cases, however, mitosis is not structurally closed, as nuclear envelope integrity is breached and cytoplasmic structures, such as microtubules, can enter the nucleus. consequently, the term functionally open but structurally closed may not fully apply when describing these types of mitosis, and several studies have previously referred to these mitoses as semi-open mitosis. we propose to use partially open mitosis as term that encompasses all forms of mitosis that are neither fully closed nor fully open, but that exhibit a change in the diffusion barrier at some point during mitosis that may or may not be accompanied by visible structural change to the nuclear envelope. among unicellular eukaryotes there are many variations of nuclear envelope behavior during mitosis (for more examples see refs. 16 and 17), and undoubtedly additional forms of mitosis still remain to be discovered. it is likely that the various types of mitosis have evolved to adapt to a particular environment, although it is currently not known what kinds of selective pressure shaped the different modes of mitosis. a possible driving force is the position of the centrosome, namely in the cytoplasm vs. embedded in the nuclear envelope, which likely coevolved with nuclear envelope behavior. in addition, the evolution of mitosis could have been affected by the need to eliminate rate-limiting diffusion barriers between the nucleus and the cytoplasm as occurs during open and partially open mitosis, but is either not a problem or is somehow overcome in closed mitosis. it is conceivable that, during syncytial divisions, partially open mitosis evolved to overcome the diffusion barrier and microtubule accessibility problems, while protecting chromosomes from aberrant attachments to microtubules from neighboring nuclei. the evolution of different forms of mitosis remains an unresolved, yet fascinating, question. closed mitosis appears at first glance to be an economical solution to the issue of microtubule-chromosome accessibility: nuclear envelope breakdown is circumvented, the chromosomes do not get entangled with cytoplasmic structures, and cells do not have to reassemble the nuclear envelope at the end of mitosis, risking leaving one or more chromosomes outside the nuclear perimeter. chief among them is how the nuclear envelope expands. in particular, how is the timing of nuclear expansion determined? is it a consequence of spindle elongation or is it an independent process regulated by the cell cycle machinery? and how are nuclear envelope components added? finally, what happens to nuclear envelope expansion if cells are delayed in mitosis, for example due to checkpoint activation? an insight into these questions came from a study by witkin et al. on the shape of the budding yeast nucleus. during normal growth, the budding yeast nucleus is round, except during mitosis when it elongates through the bud neck to accommodate chromosome segregation (fig. witkin et al. screened for genes that when deleted lead to alterations in nuclear shape, aiming to identify genes that affect nuclear envelope dynamics. the authors used a collection of roughly 5000 budding yeast deletion mutants (each deleted for a single non-essential gene), into which they introduced a nuclear gfp marker and a cytoplasmic rfp marker. this strategy then allowed them to screen visually for mutants that displayed abnormal nuclear morphology. one class of nuclear abnormalities was of nuclei that exhibited extensions, referred to as flares. further examination of these mutants revealed that this altered nuclear phenotype was not due to a direct involvement of the deleted genes in nuclear morphology, but rather due to the activation of a checkpoint pathway (e.g., the dna damage checkpoint or the spindle assembly checkpoint) that induced a mitotic delay. in other words, the mutations isolated in the screen likely increased the formation of intracellular damage, which, in turn, led to a mitotic delay through checkpoint activation. indeed, other conditions that induced a mitotic delay (e.g., depolymerizing microtubules with nocodazole; inhibiting the anaphase promoting complex) also led to the formation of a nuclear flare. interestingly, the nuclear flare formed due to a mitotic delay was confined to the nuclear envelope region adjacent to the nucleolus (fig. 2b, and see below), which normally forms a crescent-shaped structure at the nuclear periphery (fig. are images taken 20 min apart of budding yeast cells expressing a gfp-tagged nucleoplasmic marker (pus1) and an rfp-tagged nucleolar marker (nsr1). importantly, the change in nuclear morphology was specific to a cell cycle delay in mitosis; witkin et al. found that nuclei of cells arrested in s phase or g2 were mostly round. moreover, the formation of the nuclear flare in cells treated with nocodazole began at the same time as nuclear elongation in untreated cells and was dependent on phospholipid synthesis. however, phospholipid synthesis alone was not sufficient to induce flares, as g2 arrested cells accumulated just as much phospholipid as mitotic arrested cells. taken together, these results suggest that nuclear expansion during closed mitosis of budding yeast is independent of spindle elongation, but rather occurs in response to a cell cycle cue that signals mitotic entry. first, what regulates nuclear envelope expansion? as noted above, the process is independent of spindle elongation, much like nuclear envelope rupture in s. japonicus. thus, in these yeasts there are likely targets of the cell cycle machinery that affect nuclear envelope dynamics during mitosis the synthesis of phospholipids, the main components of the nuclear membrane, is required for nuclear envelope expansion, as shown previously for both budding and fission yeast. moreover, at least one enzyme that negatively regulates membrane expansion, pah1, is regulated by cdk1 phosphorylation (ref. the observation that a nuclear flare forms when checkpoint pathways are activated suggests that phospholipid synthesis is not subjected to checkpoint regulation. however, phospholipid synthesis is unlikely to be the only cell cycle target required for nuclear expansion, because g2-arrested cells accumulate just as much phospholipid as mitotic-arrested cells, yet they do n't form a flare (ref. 18; note, however, that it is currently not known whether nuclear envelope of g2 cells also expands, but without forming a flare). it is tempting to speculate that the cell cycle target may be a protein or a process that is responsible for allocating membrane addition specifically to the nuclear envelope, either by localized phospholipid synthesis or by drawing membrane from the er preferentially during mitosis. spindle elongation may also play a role in nuclear envelope expansion: although the surface area of the nucleus increases during a mitotic arrest in the absence of a spindle (i.e., during an arrest induced by nocodazole), it is possible that spindle elongation contributes to the rate, and perhaps magnitude, of nuclear envelope expansion. observed that nuclear envelope expansion during a mitotic arrest occurs in a curious fashion: rather than expanding isometrically, thereby generating a larger sphere, the flare occurs at the nuclear envelope that is adjacent to the nucleolus (fig. whether this occurs in other organisms that undergo closed mitosis is currently not known, as cell cycle analyses typically use dna staining, rather than a nuclear envelope marker, to follow cell cycle progression. nonetheless, the flare induced by a mitotic arrest is similar to the nuclear expansion observed when the pah1 pathway is misregulated. pah1 converts phosphatidic acid to diacylglycerol. in the absence of pah1 (or in the absence of its activators, the nem1 and spo7 phosphatase complex) the overall levels of certain phospholipids increase, the er loses its tubular shape in favor of membrane sheets, and the nucleus forms a flare at the nuclear envelope adjacent to the nucleolus. why, then, in both pah1 pathway mutants and in a mitotic arrest is the expansion of the nuclear envelope specific to the region adjacent to the nucleolus? campbell et al. showed that in a spo7 mutant, if the nucleolus is reduced to a tiny sphere the flare still forms, with the diminished nucleolus often at the base of the flare. whether the nucleolus, or its remnant, affects the adjacent nuclear envelope remains unknown. alternatively, there may be a structure that prevents nuclear envelope expansion around the entire nuclear envelope except in the region adjacent to the nucleolus. there are indeed budding yeast nuclear membrane proteins that are excluded from the nucleolus; none of the ones tested had properties consistent with an inhibitor of membrane expansion (our lab, unpublished), but other such proteins may still exist. since the nuclear envelope is continuous with the er, it is quite possible that phospholipids are synthesized at the nuclear envelope itself. if this were the case, it is conceivable that the nuclear envelope adjacent to the nucleolus would have a higher capacity for phospholipid synthesis, or that membrane is added throughout the nuclear envelope, but, as mentioned above, there may be a mechanism that resists expansion everywhere except adjacent to the nucleolus. alternatively, the membrane could come from the er, and if this were the case then the cell would have a mechanism for allocating membrane from the er to the nuclear envelope specifically during mitosis. it is currently not known whether the er expands during a mitotic arrest, and if so, at what rate. thus, the mechanisms driving nuclear envelope dynamics, and in particular nuclear envelope expansion, remain to be uncovered. the study by witkin et al. highlights the dynamic nature of the nuclear envelope during the cell cycle. the observations in this study support a model whereby the nuclear envelope adjacent to the nucleolus is the preferential site of expansion during a mitotic delay. it is interesting that phospholipid synthesis is not under checkpoint control; consequently, a cell delayed in mitosis needs to somehow deal with increased nuclear envelope surface area in the absence of chromosome segregation. we can envision at least three possibilities: first, sequestering the added nuclear envelope to the region adjacent to the nucleolus could preserve inter-chromosomal interactions that would otherwise be disrupted were the nucleus to expand isometrically. second, yeast cells are known to maintain a constant nuclear to cell volume ratio by a yet unknown mechanism. it is possible that by confining the extra nuclear envelope to a flare, rather than distributing it throughout the entire nuclear surface, the cell is better able to regulate its nuclear volume. finally, the nuclear envelope adjacent to the nucleolus may be the region of initial nuclear envelope expansion even under normal growth conditions, but in the absence of spindle elongation this expansion is not distributed throughout the entire nuclear surface. regardless of the mechanism, the appearance of a nuclear flare suggests that the budding yeast nuclear envelope has domains of distinct properties. how these domains differ in their ability to expand is not known. isolation of mutants that fail to produce a flare during a mitotic arrest will likely shed light on the mechanism that designates distinct nuclear envelope domains and on the function of flare formation. finally, can observations in closed mitosis illuminate processes related to the nuclear envelope in cells that undergo open mitosis? as in closed mitosis, the nuclear envelope of metazoans must also expand, not during mitosis but during interphase, immediately following nuclear envelope reassembly. much like in yeast, the source of membrane, and both the temporal and spatial regulation of this process, are unknown. moreover, in certain cancer cells nuclei become larger and multi-lobed, and during aging the nuclear envelope appears if so, do changes in the nuclear envelope have consequences for cell function? despite the different modes of mitosis in budding yeast and mammalian cells, cell cycle processes have often proved to be based on conserved proteins. thus, studies on nuclear envelope dynamics in budding yeast will likely shed light on processes related to nuclear envelope formation, tumorigenesis and aging in higher eukaryotes.

in eukaryotes, chromosomes are encased by a dynamic nuclear envelope. in contrast to metazoans, where the nuclear envelope disassembles during mitosis, many fungi including budding yeast undergo closed mitosis, where the nuclear envelope remains intact throughout the cell cycle. consequently, during closed mitosis the nuclear envelope must expand to accommodate chromosome segregation to the two daughter cells. a recent study by witkin et al. in budding yeast showed that if progression through mitosis is delayed, for example due to checkpoint activation, the nuclear envelope continues to expand despite the block to chromosome segregation. moreover, this expansion occurs at a specific region of the nuclear envelope- adjacent to the nucleolus- forming an extension referred to as a flare. these observations raise questions regarding the regulation of nuclear envelope expansion both in budding yeast and in higher eukaryotes, the mechanisms confining mitotic nuclear envelope expansion to a particular region and the possible consequences of failing to regulate nuclear envelope expansion during the cell cycle.

PMC3810332

pubmed-284

green tea, unfermented and made from the leaves of the camellia sinensis plant, is one of the most popular beverages consumed across the world [13]. the property and chemical components of green teas are influenced by many factors, such as tea species, harvest season, climate, geographical locations, and processing. in china, among various factors, the geographical origin is recognized as an important aspect of tea. because of the similar tea species, cultivation and processing conditions in a specific tea-producing area, many teas are named after their geographical origins. longjing tea is a green tea produced in xihu and its surrounding areas (hangzhou, china). as a famous green tea with protected designation of origin (pdo), longjing is recognized as one of the top green teas for its special appearance (flat and straight leaves), flavor, and taste. however, little information has been available on the feasibility of discriminating longjing from its three specific subproducing areas, namely, xihu, qiantang, and yuezhou. as the quality and prices of longjing tea from the above three producing areas are different, it is necessary to develop effective analysis methods for discrimination of longjing from different subproducing areas. because of the similarity (processing, appearance, and taste) among different subproducing areas, the specific geographical origins of longjing are usually distinguished by sensory analysis. however, because it is very expensive and may take years to train a tea taster, it would be more efficient to use some nonhuman techniques. recent years have witnessed increased applications of electronic tongue technology to analysis of wines, milk, tea, beer, juice, and so on [710]. in these applications, a very good time stability and sensitivity, a good correlation between human and electronic tongue judgment has been observed, which makes it a promising alternative to human sensory analysis of teas. this paper was focused on developing a rapid analysis method for discriminating specific subproducing areas of longjing tea by electronic tongue and chemometrics. robust principal component analysis (robpca) [11, 12] was used to detect outliers in each class. partial least squares discriminant analysis (plsda) was used to develop the classification model. 155 longjing samples were collected from the local tea plantations in xihu (32 samples, class a), qiantang (59 samples, class b), and yuezhou (64 samples, class c). all the samples were preserved in a cool (about 4c), dark, and dry place with integral packaging before preparation of tea extract. six gram of each sample was added with 250 ml boiling deionized water and infused for 10 min. the infusion was then filtered into a beaker and cooled to the room temperature (25c) by water bath for electronic tongue analysis. the detection system consists of one reference electrode (ag/agcl) and 7 liquid cross selective sensors (zz, ba, bb, ca, ga, ha, and jb). the cross-sensitivity and selectivity of the sensor array are listed in table 1. the sensors array analyzed the solutions of tea samples with sampling interval of 1 s. each sample was measured for 150 s, which can ensure a stable response. all the data analysis was performed on matlab 7.0.1 (mathworks, sherborn, ma, usa). the responses of the 7 sensors reported at 150 s were used for the subsequent data analysis. outliers in the data would degrade the classification models and prediction performance, so robust principal component analysis (robpca) was used to detect outliers in each class of samples. robpca can obtain robust projections of the original data points and avoid the masking effects caused by multiple outliers. with the computed robust score distance (sd) and orthogonal distance (od), robpca can classify an object into one of the four groups: regular points (with small sd and small od), good pca-leverage points (with large sd and small od), orthogonal outliers (with small sd and large od), and bad pca-leverage points (with large sd and large od). with outliers deleted, the duplex algorithm was used to divide the measured data into a training set and test set. duplex algorithm can obtain a test set of samples distributed uniformly in the range of training samples. for multiclass classification, plsda can be performed by regressing each column of a dummy response matrix y on the measured data x by pls. for the ith (i=1, 2, and 3) column in y, an element is set a value of 1 if the corresponding object is from class i; otherwise, it is assigned a value of 0. for prediction, a new sample is classified into class i when the ith element of its predicted response vector is nearest to 1. monte carlo cross validation (mccv) was used to estimate the number of components in plsda by minimizing the mean percentage error of mccv (mpemccv): (1)mpemccv=i=1bnii=1bmi, where b is the numbers of mccv data splitting, mi is the number of prediction objects, and ni is the number of wrongly predicted for the ith mccv data splitting. model sensitivity and specificity of prediction for each class were used to evaluate the performance of classification models: (2)sensitivity=tptp+fn, specificity=tntn+fp, where tp, fn, tn, and fp represent the numbers of true positives, false negatives, true negatives, and false positives, respectively. for classification, objects in each class were denoted as positives and the other two classes were denoted as negatives. the average electronic tongue features for each class of longjing tea are shown in figure 1. seen from figure 1, the features of the three classes have very similar response patterns. the features of class b and c are very similar and different from those of class a, especially in the responses of ga and ha. robpca was used for outlier detection with a significance level of 0.05. because each class of tea has a different probability distribution, robpca models were performed separately on each class. figure 2 demonstrates the robpca plots for the three classes. for each class, a robpca model with three principal components (pcs) three pcs explained 89.7, 91.5 and 92.1 percents of the total variances of each class, respectively. for outlier diagnosis, bad pca-leverage points, good pca-leverage points and orthogonal outliers were excluded to obtain a representative data set distributed in the entire range of measured samples. the numbers of objects with large sd and od were denoted. as a result, for class a, two orthogonal outliers (objects 1 and 26) and two good pca-leverage points (objects 15 and 31) were deleted; for class b, four orthogonal outliers (objects 1, 19, 24, and 43) were deleted; for class c, three orthogonal outliers (objects 12, 17, and 29) and one bad pca-leverage point (object 55) were deleted. the duplex algorithm was then performed to divide the remaining 143 tea samples into training and test objects. finally, 95 samples (class a, 18; class b, 37; and class c, 40) were used for training and 48 samples (class a, 10; class b, 18; and class c, 20) for prediction. plsda model was developed and mccv was used to select the number of latent variables (lvs). for mccv, the original 95 training samples were randomly split into training (50%) and test objects (50%) for 100 times. the training and prediction results of a three-component plsda are demonstrated in figure 3. the sensitivity/specificity of plsda for classes a, b, and c was 1.000(10/10)/1.000(38/38), 1.000(18/18)/0.967(29/30), and 0.950(19/20)/1.000(28/28), respectively. the training accuracy was 1 and for prediction only one object from class c was wrongly assigned to class b, indicating the effectiveness of electronic tongue for classification of longjing tea samples. rapid and effective discrimination of longjing green tea from different subproducing areas was performed using electronic tongue and chemometrics. the sensitivity/specificity of plsda for classes a, b, and c was 1.000/1.000, 1.000/0.967, and 0.950/1.000, respectively. electronic tongue and chemometrics can provide a rapid and reliable tool for discriminating the specific producing areas of longjing. compared with human sensory analysis, this method is easier to perform and the more attractive economically. in the future studies, the comparison of chemical methods, for example, lc/uv/ms, to the electronic tongue analysis will be performed to investigate the statistical correlation between the chemistry and the tastes of longjing tea.

the feasibility of electronic tongue and multivariate analysis was investigated for discriminating the specific geographical origins of a chinese green tea with protected designation of origin (pdo). 155 longjing tea samples from three subareas were collected and analyzed by an electronic tongue array of 7 sensors. to remove the influence of abnormal measurements and samples, robust principal component analysis (robpca) was used to detect outliers in each class. partial least squares discriminant analysis (plsda) was then used to develop a classification model. the prediction sensitivity/specificity of plsda was 1.000/1.000, 1.000/0.967, and 0.950/1.000 for longjing from xihu, qiantang, and yuezhou, respectively. electronic tongue and chemometrics can provide a rapid and reliable tool for discriminating the specific producing areas of longjing.

PMC3728527

pubmed-285

the original technique of staining the anterior capsule with trypan blue (tb) in eyes with no red reflex involves the injection of the dye with a cannula after filling the anterior chamber with an air bubble.1 the stability of the anterior chamber can be compromised by air escaping when the cannula is introduced and the dye is injected. moreover, the superficial tension of air bubble and capillary action between tb and the metal cannula can force the dye to build up within the aqueous meniscus surrounding the air bubble, making selective staining of the capsule difficult. several techniques using viscoelastic substances as an alternative to air have been presented to increase the stability of the anterior chamber.25 however, staining under viscoelastic material can be time-consuming and expensive, as it requires the mechanical spreading of tb onto the anterior capsule and the replacement of the viscous solution when an excessive diffusion of dye affects its transparency. we present an under-air staining technique of the anterior capsule using one drop of tb injected with a 30 g needle through the peripheral cornea. our procedure prevents the exit of air during the injection of the dye, resulting in increased stability of the anterior chamber. moreover, it allows selective staining of the capsule using the needle and avoids an excessive buildup of tb in the anterior chamber. connect a 30 g needle to a 2.25 ml luer lock syringe containing trypan blue 0.06% (visionblue; dutch ophthalmic research center international, zuidland, netherlands). make a standard side-port incision with a 15 blade. use a 25 g cannula connected to a 5 ml syringe to inject a big air bubble in the anterior chamber. introduce the 30 g needle bevel-up in the anterior chamber through the peripheral cornea between the side-port incision and the site chosen for the corneal tunnel. push the needle forward in the air bubble right between the anterior capsule and posterior corneal surface until the tip reaches the center of the pupil. unlike what occurs using a cannula, the air can not escape from the anterior chamber. inject gently, allowing the tb volume to grow within the needle bevel (figure 1). rotate the syringe 90, letting the drop fall on the anterior capsule (figure 2). the needle tip allows precise control on the injected dye, similarly to a dropper. if the staining is not sufficient, it is possible to inject one more drop of tb on the unstained area. once the needle is removed, the perforation will close spontaneously in a few seconds, and if necessary an absorbent stick can be used to stop tiny leakages of air and/ or dye. inject viscoelastic substance in the anterior chamber through the side-port incision, allowing the air and the leftover dye to exit the eye. tb is the most used dye to perform capsulorhexis in eyes with no red reflex.6 the main staining techniques involve tb injection under air,1 under viscoelastic material,25 or directly under aqueous humor. an air bubble within the anterior chamber reduces the contact between the dye and the corneal endothelium and allows the delivery of undiluted tb onto the anterior capsule. however, the air bubble makes the anterior chamber unstable and prone to collapse when the cannula is introduced to inject the dye. in such an event, the anterior chamber has to be reinflated, thus increasing the duration of surgery. moreover, sudden reductions in volume of the anterior chamber can cause narrowing of the pupil and damage to the corneal endothelium. to prevent the air bubble from escaping the anterior chamber, it has been proposed that a small amount of high-density viscoelastic material be placed near the side-port incision.7 in our technique, we inject the dye in the anterior chamber, introducing a 30 g needle through the peripheral cornea. in this way, the air can not escape from the side-port incision, as often occurs when a cannula is used. once the needle is pulled out, the corneal perforation spontaneously closes in a few seconds. when the dye is injected with a blunt cannula through the side-port incision, the superficial tension of the air bubble spreads the dye into the thin liquid layer between the air and the anterior capsule.8 in this phase, a meniscus of tb forms between the metal cannula and the anterior capsule due to the capillary action and adhesive forces. to obtain the right staining, the anterior capsule must be swept thoroughly with the cannula, allowing the meniscus of tb to contact the largest possible area. if too much dye is injected, it can migrate back between the cannula and the capsule, escaping from the paracentesis, or it could build up in the aqueous meniscus surrounding the air bubble. to avoid this, toprak et al8 modified a cannula by bending it to increase the surface contact between the dye and the capsule. in our procedure, we use a very sharp-tipped needle, which reduces the adhesive forces with tb and allows the drop of dye to fall easily over the anterior capsule. many authors have described alternative staining techniques based on viscoelastic substances instead of air.25 these techniques have the advantage of making the anterior chamber more stable and of better dosing the amount of injected dye. however, when the anterior chamber is filled with viscoelastic substance, it is difficult to deliver the dye onto the capsule. the surgeon has to mechanically spread the dye on the largest possible surface of the capsule, and at times the dyed viscoelastic material or pockets of dye can affect the visibility of the capsule beneath. to avoid these problems, special cannulae have been proposed.2,4 rarely, an exchange of the viscoelastic material is needed to restore the transparency before the capsulorhexis. we injected tb with a 30 g needle in seven consecutive patients with white cataract and normal anterior chamber depth. in this small group of patients, we have not observed intra- or postoperative complications. after surgery, all patients showed marked improvement in their visual acuity. in six patients, we performed a regular capsulorhexis after injecting only one drop of dye. in a single patient, one more drop of tb had to be injected to build up the staining of the capsule. an additional corneal access and a sharp needle in the anterior chamber are the major disadvantages of our technique. in eyes with shallow anterior chamber or with excessive posterior pressure, the use of the 30 g needle technique could be dangerous and should be avoided. in conclusion, in a small series of seven patients, the staining of the anterior capsule using tb under air with a 30 g needle allowed for enhanced stability of the anterior chamber and the use of the smallest quantity of dye.

the original technique of staining the anterior capsule of the lens with trypan blue involves the injection of an air bubble in the anterior chamber. a drawback of this technique is the possible instability of the anterior chamber caused by the sudden exit of air when the dye is injected with the cannula through the side-port incision. other staining techniques that use viscoelastic substances to increase the stability of the anterior chamber and to dose the injected dye have been described. the authors present an under-air staining technique of the anterior capsule using one drop of trypan blue injected with a 30 g needle through the peripheral cornea. this procedure prevents the air bubble from escaping the anterior chamber and allows fast and selective staining of the capsule.

PMC3563348

pubmed-286

population aging can be considered as the most evident and dynamic aspect of modern demography, influencing the economy and public health in a significant way. the world has experienced a modest increase in the population above 60 years of age over the last six decades from 8% to 10%. however, there were 204 million elderly in the world. in 1998, this number more than doubled, totaling 579 million; in 2011, the figure reached was 893 million.1 over the next four decades, experts expect this age group to grow to 22% of the world population, which would correspond to 2.4 billion of elderly by the middle of this century.2 in this sense, many elders will likely face health problems inherent to aging, as well as challenges in maintaining their independence. however, the elderly can stay healthy and active in society in an independent and sustainable manner,3 and the work of professionals and researchers in the multidisciplinary health field that serve this group is fundamental in achieving this state. at the same time, it is essential that the government create and apply public policies that enable and sustain educational and awareness actions regarding people qualification and the fulfillment of the population basic needs. as for the health of the elderly, changes in body balance (postural instability) have received much attention, as it is one of the symptoms that most affect their lives. body balance is the result of a harmonious interaction among different systems in the human body: vestibular (inner ear posterior labyrinth), visual, and somatic-sensorial (cutaneous, muscular, and articular receptors) systems. this interaction is accomplished through processes of the neural system, which organizes and executes a rapid response by means of the musculoskeletal system.4 the aging process is associated with a decrease in the ability to keep balance, especially in situations where responses of the balance keeping systems to unexpected disturbances during free moving and the avoidance of obstacles are necessary. sensorial, motor, and adaptive balance components become vulnerable as degenerative, infectious, or damaging processes accumulate. although small alterations in any of the systems that comprise balance keeping do not result in significant disturbances, the involvement of multiple components may lead to severe deficits in postural stability conservation.5 6 the aging process may alter the dynamic posture keeping system. this condition is a contributing factor to falls among the elderly, albeit not the main cause.7 impairment of the vestibular system is also believed to be a factor that leads the elderly to lose balance, through the aging process of this systes organs.8 alterations to postural stability are also followed by dizziness. this can be defined as any sensation of change in the body balance and can be rotational (vertigo) or non-rotational (unbalance, oscillation, vacillation, etc.). both types may or may not be caused by specific vestibular system disturbances.9 the presence of dizziness may cause falls, which are associated to the main cause of death in the elderly group. some authors also associate dizziness to partial or full inability to perform social, professional, family activities, in addition to causing physical and psychological damage, such as loss of self-confidence, depression, deficit in concentration, and performance, thus negatively interfering in the quality of life.10 11 however, it is still difficult to know if psychological problems pre-exist or are a result of vestibular complications.11 balance disturbances and anxiety disorders share central neural circuits involving monoaminergic components, this being the reason why anxiety is often associated with balance alterations. these neural circuits concentrate in a parabrachial nucleus network (vestibular system and visceral information processing convergence point), also involving avoidance, anxiety, and fear symptoms.12 physical insecurity triggered by dizziness and unbalance lead to psychological insecurity, irritability, loss of self-confidence, anxiety, depression or panic, a sense of being out of reality and depersonalization.13 depression which may be caused or made worse by body imbalance is a common condition in seniors. furthermore, it is associated to higher risk of morbidity and mortality, increase in health services usage, negligence in self-care, and higher risk of suicide.14 the main symptoms of depression are depressed mood and loss of interest or lack of pleasure in almost all activities, being characterized as a psychiatric syndrome. in the elderly, its manifestation occurs in a heterogeneous form regarding both the presentation aspects of its etiology and its treatment.15 studies relate the involvement in physical activities with a better general health condition and lesser occurrence of depression and falls in the elderly.16 17 physical activity is capable of improving mental and clinical conditions of depressed elderly. this is because physical activity stimulates cognitive, memory, and concentration functions, in addition to raising self-esteem, improving quality of life,18 and helping decrease scores indicative of anxiety and depression,19 favoring daily activities and promoting functional independence.20 furthermore, the physically active elderly show improvement of dizziness and vertigo symptoms,21 22 23 decreasing, as a result, the risk of falls and associated comorbidities. thus, the objective of this work is to verify the correlation between physical exercise, dizziness, probability of falls, and symptoms of depression in a group of middle-aged and elderly group. this is a transversal and observational study with approval from the institutios ethical committee (record n 216292011). the sample comprised adult and elderly individuals of both sexes who took part in university extension projects. the inclusion factors for subjects were non-institutionalized elderly with no history of neurological or cognitive alterations, who voluntarily accepted to take part in the research and signed the informed consent form (icf). assessment procedures included a medical history prepared for this study; the abridged version of the geriatric depression scale (gds); and anterior functional reach test. the medical history assessment included questions on individuals socio-demographic and health (age, gender, presence of diseases, treatment used), as well as questions about their practice of physical exercises (frequency, time of practice, type of physical exercise). as for assessing the results of the geriatric depression scale, each answer indicating depression scored one point. scores below five points indicated lack of depressive symptoms; 6 to 10 points indicated mild/moderate depressive symptoms; and 11 to 15 points meant severe depressive symptoms.24 for the functional range test was initially placed a tape measure on the wall, parallel to the floor, at the height of the acromion of each individual. the following were instructed to position themselves parallel to the wall, without lean on to it, with the parallels and bare feet in a comfortable position. the upper limb was positioned with bent shoulders at 90, extended elbows, wrists in a neutral, flat hand position. as a result, it was requested that incline forward as much as possible, hold for three seconds without taking the heels off the floor. taking as the third metacarpal of the individual parameter was recorded in centimeters anterior displacement on the tape. displacements smaller than 15.2 cm indicate the risk of falls four times higher compared to those who reached more than 25.4 cm, or is highly likely to falls. measures between 15.2 and 25.4 cm has an average probability of falls (twice as likely to fall than those who reach values greater than 25.4 cm). values greater than 25.4 cm indicate low probability of falls.25 the authors analyzed the data using descriptive statistics through measures of central tendency (mean and median) and variability (standard deviation and inner quartile ranges), as well as absolute and relative distribution (n -%). the symmetric continuous distribution was evaluated by the kolmogorov-smirnov test. for the bivariate analysis between qualitative variables, the authors used the pearson qui-square test () and continuity correction, which compares between observed (real) and expected frequencies. in contingency tables in which at least 25% of cell (quads) values presented expected frequency below five, they used fishes exact test. for continuous variables, when comparing two independent groups, the applied test was students t-test or, its non-parametric equivalent, the mann whitney test. multivariate analysis was accomplished through non-conditional binary logistic regression, by employing regressive procedures to test the hypotheses of association between cognitive decline and co-variables defined by the bivariate analysis (p 0.250), by obtaining the adjusted odds ratio (or). data received statistical treatment via spss 17.0 software (statistical package for social sciences for windows), adopting a significance level () of 5% for the decision-making criteria. the sample comprised of 90 individuals, aged 69.3 (6.8) in average, with minimum age of 59 years and maximum age of 84 years. the majority of investigated individuals was in the age group between 65 and 74 years (38.9%). results presented as n (%), with percentage obtained as based on total valid cases;: nr=5 (2.5%). the majority of individuals interviewed (65.8%) did not show depressive symptoms. regarding the anterior functional reach test, the majority of evaluated individuals indeed showed low probability of fall occurrence, with an average score of 28.2 cm (sd=9.2) points, varying from 0 to 44.5 cm (table 2). results presented as n (%), with percentage obtained as based on total valid cases,: nr=11 (12.2%);: nr=8 (8.8%). in the analyses done on dizziness complaints, the authors verified a significant association with age group (p<0.05), with the elderly aged 75 years or more presenting a higher probability of feeling dizziness, whereas the group aged between 65 and 74 years, this association was not verified (table 3). percentages obtained as based on total of each dizziness category;: pearson chi-square test with continuity correction;: t-student test for independent groups;: pearson chi-square test;: fisher's exact test through monte carlo simulation;*statistically significant test at 5%;** statistically significant test at 1%. moreover, it has been observed statistically significant association between the occurrence of dizziness and the presence of light/moderate depressive symptoms (p<0.01), as well as between the occurrence of dizziness and the average probability of falls (p<0.001). in terms of the association between the occurrence of dizziness and the results of the anterior functional reach test, the average in centimeters for the anterior reach (25.3 5.4) of elderly with dizziness showed to be significantly less when compared with the average of the group without dizziness complaints (30.1 10.6) (p<0.01). when comparing the occurrence of dizziness with gender, age, practice of physical exercise, and time of practice, we identified an independent relation, evidencing that dizziness is unrelated to any of these factors in the studied group. in the group of individuals that did not practice physical exercise, there was an association between the occurrence of dizziness and light/moderate depressive symptoms (p<0.001). however, in the same analysis done with the group that practiced some physical activity, the association between dizziness and depressive symptoms was not statistically significant (p>0.05) (table 4). another evaluation confirms the importance of physical exercise. keeping the remaining variation factors not considered in the analysis (gender, age) constant, the group that practices physical exercise was less prone to dizziness and depressive symptoms (table 4). we looked for and identified the variables that could respond in a more trustworthy form to the occurrence of dizziness. we performed the logistic regression analysis with an adjustment to minimize the number of explanatory variables employed and maximize model precision, through the backward model, to maximize the explanatory power of the study factor. through a model defined as saturated, we listed all variables with minimum significance level below 0.25 through bivariate analysis (table 3) as possible preceding factors for the presence of dizziness. they are the following: gender, age, age group, physical activity, gds score, dislocation in the anterior functional reach test, and balance. in this model, the variables for gender and age pointed out an independent relation to the occurrence of dizziness. according to the adjusted logistic regression model, the following were significant predictive factors for the occurrence of dizziness: non-practice of physical exercise, classifications of light/moderate depressive symptoms, and dislocation in the anterior functional reach test. results described in table 5 show that the elderly who do not practice physical exercise have 2.2 times higher risk of presenting dizziness than the group that practices some physical exercise. in relation to depressive symptoms, the significant risk of presenting dizziness occurred in the light/moderate degree, indicating that the elderly included in this classification had 4.5 times more chance of presenting dizziness than the group with absence of depressive symptoms. model parameters: pseudo-r=0.432; -2 log likelihood=80.208; hosmer and lemeshow (p=0.998); pearson's chi-square (= 9272; p=0.099); nagelkerke (r: 0.460); correct classification: 74.4% (dizziness: no=78.7%; yes=67.7%). as the number of elderly with severe depressive symptoms was very low, the light/moderate and serious groups were merged, by classifying the answer for symptoms as presence or absence. over this new variable, we once more calculated the risk of presence of depressive symptoms associated to dizziness, estimated at 2.1 times that of the group with absence of this symptom. the results verified that the group with medium probability of falls as the result for the anterior functional reach test had 4.0 times more chances of occurrence of dizziness than the group with low probability of falls. when age was kept constant, results indicated that the non-practice of physical exercise, the presence of depressive symptoms, and the result of the anterior functional reach test (indicating medium probability of falls) are factors associated to the occurrence of dizziness in the investigated sample. in the sample of this study, more than 60% of the individuals affirmed to not practice physical exercise, confirming other similar studies. the ministry of health of brazil26 made a survey, and verified that 53.7% of elderly men and 58.3% of elderly women were inactive. similar results were found in other study concerning the level of physical activity and its relationship with the environment (specifically, safety) with 1,656 elderly from florianpolis.27 by using similar parameters, pucci, reis, rech and hallal28 classified the majority of the individuals of their study as insufficiently active in leisure or walking activities. in this study, current studies highlight the prevalence of dizziness reports among the elderly population.29 30 31 32 approximately one in every five seniors currently presents dizziness or imbalance.29 in our research, 40% of the elderly reported sensation of dizziness. this finding is very similar to other studies done in brazil, in which the authors verified that the prevalence of dizziness in the elderly is substantial, having observed dizziness complaints from 45% of 391 elderly over 65 years of age interviewed.33 another study interviewed 516 elderly people, and confirmed self-reported dizziness in 42% of them.31 thus, dizziness is a common problem for the elderly population,11 34 35 as these individuals show a decrease in visual acuity during aging, and loss of balance due to the reduction of ciliated cells and vestibular neurons. this results in loss of functions from two important components responsible for keeping balance.36 furthermore, with age, the central nervous system capabilities become impaired, affecting the processing of vestibular, visual, and proprioceptive signals responsible for maintenance of body balance. age also reduces capacity of modifications of the adaptive reflexes, may be responsible for the occurrence of vertigo and/or dizziness in the geriatric population.35 the data from the studied sample evidenced that 33.7% of the elderly presented depressive symptoms. this prevalence is higher than that described by other authors,37 who report prevalence of 26.7% of depressive symptoms in a sample of elderly people residing in an urban zone. in turn, study reported depressive symptoms in 31% of the elderly evaluated, by also using the gds scale in active elderly who were part of a conviviality group, i.e., a similar sample to the one evaluated in this study. additionally, the cited authors verified that 4% of the evaluated elderly presented severe depressive symptoms, which was also similar to the obtained data.38 regarding anterior functional reach results, the average obtained was 28.2 9.2 cm. results were higher than those observed by previous studies,39 40 and lower than those obtained by another study.41 values found were similar to those observed in brazil,42 which also evaluated a sample of adult and elderly people. the sample of elderly people in the age group between 70 and 87 years of age presented functional reach values between 29.75 (men) and 27.13 (women). variations in the results of these studies can be explained through different factors, such as fall history, freight, strength, and flexibility of upper and lower limbs.42 this research verified a stronger presence of dizziness in the age group above 75 years (41.7%), a significant association (p=0.028) when compared with remaining age groups. such a finding is similar to that of the research with 1,273 elderly between 60 and 96 years of age, which verified reports of dizziness in 23.6% of all elderly evaluated. in this study, 17.8% of them were under 80 and 31% were over 80 years old.30 another longitudinal research with 620 elderly people verified that dizziness was a factor that depended on age, with prevalence of 27% in the elderly under 70, and over 54% in the group with 90 years of age or more. among the elderly that mentioned dizziness, 68.2% perceived this symptom daily or weekly.43 the bigger prevalence of dizziness in the age group above 75 years of age could be due to the generalized deterioration of health in older people44 or multifactor conditions, both medical and functional.43 it is worth mentioning that the presence of dizziness is directly related to the presence of falls in the elderly population;30 both conditions are considered geriatric syndromes that occur concomitantly to other harms to multiple systems of the body.5 this worsens with age. the elderly who suffer falls can have fractures as a consequence, which might require longer periods in bed. such condition is responsible for 70% of deaths resulting from accidents in individuals over 75 years in age.45 further to this, there was no significant difference when comparing the presence of dizziness complaints among the elderly who practiced physical exercise whith those who did not. these data were different from the expectations of the authors and the findings of ruwer et al,35 because, according to these authors, the complaint of dizziness is less prevalent in the elderly that practice physical exercise. nevertheless, with the adjusted logistic regression, it is possible to verify that the individuals who do not practice physical exercise are 2.2 times more likely of feeling dizzy than physically active individuals are. this result confirms studies that compared elderly people with and without dizziness and observed that those without complaints of dizziness were engaged in physical activity.46 these authors also verified that there was a relation between dizziness and depression, which attest to the data from our study. the research verified a significant association between light to moderate depressive symptoms and 4.5-fold increase in the risk of feeling dizziness. regarding the anterior functional reach test, this research verified a significant association between the probability of falls and reports of dizziness. the elderly with medium probability of falling are four times more likely to feel dizziness than the elderly with low probability of falls, as described in another study.47 the studies indicate that active elderly people are less prone to depression than the sedentary elderly.19 48 49 physical exercises help to reduce depression, aside from helping in its prevention. physical activity relates to less frequent mood disorders and may even help release some neurotransmitters, such as noradrenalin and serotonin.50 51 studies indicate that elderly people who practice regular physical activity mention less depressive symptoms than non-active or sedentary elderly people. analysis of social skills, social support, life quality and depression of elderly people in an extension project, family contexts and asylums indicated that the depressive symptom was present in 0% of practicing elderly people compare to 30% of the elderly who did not participate in the project. in the asylum, in turn, this percentage increased 40%.52 in other study about the intensity and prevalence of depressive symptoms in elderly women participating in an extension project, it was verified an absence of depressive symptoms in 80.6% of the sample.53 another study evaluated the effect of a program of aerobic physical exercise in the intensity of the ventilator threshold over depression and anxiety and life quality of healthy elderly people divided into a control and a experimental group. the elderly in the experimental group had a reduction in the scores of depression and anxiety and an increase in life quality, while in the control group no changes were observed.51 in the research on the freight of falling and its relation with balance and mobility tests, there was a moderate correlation.40 authors state that balance and mobility enable the stability necessary to maintain a standing position, for instance. therefore, maintaining adequate levels of such capabilities reduces the risk of falls, which are directly related to level of physical activity. the american college of sports medicine54 mentions that the level of physical activity is inversely related to the number of limitations in the elderly. brazilian authors analyzed the relation between health conditions, incidence of falls, and level of physical activity in 256 elderly people. results indicated an association between the level of physical activity and the incidence of falls and health conditions. in other words, the more frequent the practice of physical activity the less the occurrence of falls. muscular weakness, reduction in articular mobility, degraded synergy, programming mechanisms, and motor control difficulties are the variables present in low levels of physical activity, predisposing to falls in the elderly.55 the results of this study indicated the existence of an association between the practice of physical exercise, dizziness, probability of falls, and depressive symptoms in a group of non-institutionalized middle aged adults and elderly people, evidencing that physical activity is a beneficial factor for the aging population.

introduction dizziness is a symptom that can lead to falls, which, in turn, undermine ons independence and autonomy, leading to several comorbidities. the practice of physical exercise, however, can help prevent falls. objective the objective of this study is to confirm the association between physical exercise, dizziness, probability of falling, and depressive symptoms in a group of middle-aged adults and seniors. methods the authors evaluated subjects based on history, the geriatric depression scale, and functional reach test. results the sample consisted of 90 individuals with a mean age of 69.3 6.8 years. the authors found that 37.8% had been practicing exercise, 33.7% had depressive symptoms, and their probability of falling was above average in the functional reach test. conclusion the results of this study indicated an association between dizziness, exercise practice and depressive symptoms, indicating that physical activity is a beneficial factor for the aging population.

PMC4835334

pubmed-287

of those deaths, an estimated 7.3 million were due to coronary heart disease and 6.2 million due to stroke. a disproportionate amount of those deaths, over 80%, take place in low- and middle-income countries and occur at similar rates among men and women. not surprisingly, elevated blood pressure levels are a major cause of these diseases and are found at higher rates among low- and middle-income countries. the relationship between blood pressure levels and risk of developing cardiovascular disease is strong and well supported. in 2008, approximately one billion adults worldwide had uncontrolled hypertension (defined as systolic blood pressure 140 mm hg systolic and/or diastolic blood pressure 90 mm hg). given the increasing prevalence of hypertension worldwide and the associated risk for developing cardiovascular disease, public health interventions aimed at reducing blood pressure are crucial. many national and international agencies have acknowledged the role of lifestyle and diet, in particular sodium intake, on blood pressure levels. diets high in salt are now recognized as one of the leading risks to cardiovascular health in the world as they increase blood pressure in both children and adults. furthermore, a recent meta-analysis of randomized trials has demonstrated that modest reductions in dietary sodium intake are associated with significant reductions in blood pressure in both normotensives and hypertensives and a 20% reduction in cardiovascular events [4, 5]. a reduction in salt intake of 6 g/day lowered blood pressure by 7/4 mm hg diastolic in hypertensives and 4/2 mm hg in normotensives. this relationship has been empirically supported and is sufficiently strong to warrant recommendations for public health interventions aimed at substantially reducing dietary sodium intake. furthermore, sodium reduction is noted as one of the most cost effective and most easily implemented strategies to improve population health [513]. reducing dietary salt is recommended by the world health organization and many national governmental and nongovernmental health organizations. some agencies, however, do not promote a reduction in dietary sodium, namely, nongovernmental or commercial organizations such as the salt institute, as they are sponsored by either the food or salt industries [9, 11, 1417]. regardless, it is apparent that the risks associated with an increase in salt consumption, chiefly those related to an increase in blood pressure, are linear [3, 18]. most health economic models input relatively small changes in blood pressure that occur in those with normal and high blood pressure as estimated by short-term modest reductions in dietary sodium [7, 8, 19]. some models also include the gastric cancers that are positively associated with, and probably caused by, high-salt intake. typically, the health economic models do not include the potential impact of longer term irreversible increases in blood pressure, age-related increases in blood pressure, the epigenetic phenomena, whereby exposure to excess salt in utero may increase blood pressure in offspring, or that sodium may increase vascular and cardiac disease in the absence of changes in blood pressure [7, 8, 12, 1921]. the burden of disease studies also do not account for diseases that have a pathophysiological basis and close association with high sodium diets (i.e., increased severity and frequency of asthma attacks, increased calcium containing kidney stones, osteoporosis, or obesity related to the consumption of calorie containing beverages caused by sodium-induced thirst). hence the burden of disease associated with excess dietary salt is not only high, but may also be underestimated. the objective of this commentary is to review current sodium consumption worldwide, discuss cost-effective strategies to reduce dietary sodium, as well as briefly review the role of behavioural and policy-based environmental interventions in reducing dietary sodium on a population-based scale. humans evolved on diets consisting of natural plant and animal foods containing small amounts of sodium, typically less than 2 g/day [25, 26]. today, nearly all populations consume far greater quantities of salt than those provided in natural, unprocessed food diets. the world health organization currently recommends a daily consumption of less than 5 grams of salt, although some agencies recommend that no more than 1500 mg of sodium should be consumed per day [2729], calculated as 2/3 tsp of table salt. in most populations, sodium intake is 5.7 g or more/day after age 5, with many populations consuming and average of over 10 g/day [3032]. furthermore, within high sodium consumption countries, only a small proportion of individuals consume the recommended levels of salt. for example, in canada, a country with average salt consumption of 8.5 gm/day, 85% of men and 60% of women aged 9 to 70 consume over the upper recommended limit for salt and the vast majority (> 90%) are above the level recommended for individuals to consume [33, 34]. for example, one study found that in a population of overweight adults, a daily intake of sodium greater than 2300 mg/day was associated with a 61% increase in coronary heart disease mortality, an 89% increase in stroke mortality, and a 39% increase in all-cause mortality over a 19-year period. along with the other sodium-related illnesses discussed above (i.e., gastric cancers, kidney stones, etc.), it is clear that the economic costs associated with such illnesses can be substantial. in countries with developed economies, salt added during the processing of foods accounts for the vast majority of dietary salt (7580%). an additional 10% of dietary salt is accounted for by salt that is naturally occurring in foods, while the rest is accounted for by salt added at the table or during cooking. in low- to-middle income countries where populations may have limited access to processed foods, salt added at home, in cooking, or at the table, accounts for the majority of dietary salt. reducing dietary salt is estimated to save substantial health care costs [7, 10, 16, 30, 3741]. for example, reducing dietary salt by 3 g/day in the united states is estimated to save 194,000 to 392,000 quality adjusted life years and reduce health care costs $10 to $24 billion us dollars a year. in canada, reducing salt consumption to recommended levels is estimated to reduce the prevalence of hypertension by 30% and to save up to $430 million dollars per year just in direct hypertension management costs alone. in lower-income countries, programs aimed at reducing consumption of dietary salt through an intervention largely based on education are estimated to cost little (less than $0.40 usd per person per year), reduce premature deaths by close to 14 million in 10 years, and to be slightly more cost effective than strategies to reduce tobacco use (both highly advocated interventions) [8, 40]. although there is a general lack of awareness of salt as a health issue in many countries, some countries with established salt reduction programs show increasing awareness. for example, in canada, 80% of people diagnosed with hypertension are attempting to reduce dietary sodium. in addition, many food companies have developed low-salt options to their product lines for people to choose, with some companies reducing salt additives in their full product line. in developed economies, there are substantial barriers to free choice in those who chose to eat less salt [16, 44]. in most countries, it is often the case that nutritional information is available only on the company's website, by asking for and reviewing a binder on site, or only readily available after purchase. even in the united states and canada, countries with mandatory labelling of packaged foods, the labels are often difficult to interpret. also serving sizes may be variable and not comparable between products. in an unpublished study, we found that in a sample of over 100 people with diabetes who had received training on how to read a food label, not one could accurately answer how much of a processed food they could eat in a day when presented with the food label. in other countries, food labelling on packaged foods may not be mandatory and labelled foods may not be available. in remote regions and areas where populations vulnerable to the development of elevated blood pressure reside, low-salt alternative choices are typically not available. furthermore, these populations may not have the health literacy with which to make informed choices. food processors and manufacturers often use pervasive marketing techniques to create consumer demand for high-salt foods, which undermine efforts of public health and individual education interventions that attempt to reduce sodium intake. moreover, these marketing techniques are often directed towards children by making consumption of such foods seem fun. perhaps the greatest barrier to choosing and maintaining a low-sodium diet is that high-salt foods are ubiquitous and hence difficult for those who choose low-salt diets [16, 46]. in canada, high-salt diets are by and large perceived as unhealthy by the general population. however, it is often the case that the same people who recognize that canadians in general consume too much salt, believe that their personal consumption of dietary sodium is within the recommended amount. this suggests that even a relatively affluent, well-educated population may have difficulty identifying and avoiding high-salt foods even if they perceive it is a health issue and have chosen to follow a low-salt diet. some of the challenges of individual choice in selecting low salt diets is perhaps best illustrated by clinical trials where highly motivated patients are carefully and repeatedly trained how to select low-salt foods but generally can only sustain small reductions in salt intake long term [44, 48]. population-based approaches to reducing dietary salt may be effective in developed economies and have shown promising results for reducing blood pressure. in the late 1950s, the japanese government implemented a campaign to reduce salt intake given the high stroke mortality rates. ten years later, salt intake was reduced from an average of 13.5 to 12.1 g/day overall, and from 18 to 14 g/day in the northern regions. the reduction resulted in a decrease in average blood pressure and an 80% reduction in stroke mortality. in the 1970s, finland's government began a public education campaign and enforced regulations on food processing companies through a warning label on high-salt foods in order to reduce salt consumption across the country [50, 51]. more than 30 years later, the overall sodium intake in finland has decreased more than 40%, with a subsequent decrease in mean diastolic blood pressure of greater than 10 mm hg and an 80% decline in the mortality rate from heart disease and stroke. similar results were also seen on smaller scales in the dash (dietary approached to stop hypertension) trial conducted in the usa [3, 53]. this trial assessed three levels of dietary sodium intake on two diets (american diet versus dash diet) and demonstrated that reducing sodium in either diet resulted in lower blood pressure [3, 12, 53]. more recently in the united kingdom, reductions in the amount of salt added to foods, in conjunction with a social marketing campaign, have been associated with reduction in population salt intake. in developing economies widespread replacement of salt with a partial salt replacement (sodium, potassium magnesium combination) holds great promise [54, 55]. for example, a recent double-blind randomized controlled trial conducted in rural northern china found that replacing household salt with a reduced-sodium, high-potassium salt substitute for 1 year reduced systolic blood pressure by 5.4 mm hg. this low cost change in diet has shown promising outcomes for blood pressure reduction with little to no burden on the consumer. clearly both a mix of population approaches and behavioural approaches targeting individuals are required to reduce sodium intake to within recommended levels [10, 11, 15, 16, 33, 56]. similar methods have been successfully employed in reducing tobacco use. with respect to individually targeted efforts, for example, a variety of behavioural interventions, including brief physician smoking cessation counselling, was found to meaningfully increase smoking quit rates. however, it has become increasingly clear that education targeted towards individuals may be necessary, but not sufficient, to motivate long-term health behaviour change [59, 60]. for example, motivational interviewing, a directive patient-centred counselling approach focused on exploring and resolving ambivalence, which emerged as an effective therapeutic approach within the addictions field, has recently shown promise for other complex behaviour change problems such as weight loss in overweight and obese patients and adherence to antihypertensive medication. in contrast with recommendations for behaviour change delivered through education and advice giving, motivational interviewing differs in that motivation for change is elicited from individuals, rather than imparted by a healthcare provider. the mix of behavioural interventions and population interventions depends on the specific circumstances of both the individual and the population. in countries with developed economies, population-based approaches, and a reduction of salt additives to food, supplemented by public education campaigns, need to be the primary means of intervention to ensure that the healthy option that is low in salt is the easiest option a basic caveat of public health interventions. a universal reduction in salt additives during the manufacturing process has a strong potential to reduce health disparities in vulnerable populations while improving overall population health. behavioural interventions may be most important to ensure the population and especially policy makers understand and are supportive of the need to reduce dietary salt. however, for specific individuals with strong motivation or at a greater personal risk from consuming a diet high in sodium, intensive behavioural interventions may be efficacious. notably sole reliance on the individual behavioural approach is likely to have a smaller impact on a population basis, to be expensive, and to increase health disparity. in developing economies, where the majority of sodium intake comes from salt added at the table and in cooking, behavioural interventions are more likely to be effective in reducing overall intake than population-based means [8, 32]. in this case, the individual needs to understand the consequences of excess sodium intake and change their behaviors (i.e., eating habits) to reduce sodium intake. nevertheless, even in this partial replacement of table salt (sodium chloride) with various mineral salts (mixtures of sodium, potassium, and/or magnesium and calcium) has been shown to be highly effective to reduce overall sodium consumption and also reduce blood pressure [55, 65]. efforts to reduce dietary salt are also likely to reduce dietary iodine, therefore monitoring dietary iodine adequacy and revising the iodine content of salt is essential to maintain population health in most settings, including developed countries. population interventions that ensure widespread replacement of salt with a partial salt substitute that contains iodine may be the dominant strategy to reduce sodium intake on a large-scale basis in combination with behaviour change interventions. given the promising outcomes observed in recent randomized controlled trials and population-based interventions, reducing dietary sodium intake to modest levels (approximately 5 g/day) worldwide would result in a major improvement in overall health and reduce the costs associated with diseases connected to excess sodium intake. however, it is apparent that relying solely on interventions that target individual behaviour is not the ideal approach for reducing sodium consumption. while it may contribute to behaviour change among highly motivated individuals and increase the acceptability of population-based interventions, the latter approach seems better suited for this particular health behaviour.

excess intake of dietary salt is estimated to be one of the leading risks to health worldwide. major national and international health organizations, along with many governments around the world, have called for reductions in the consumption of dietary salt. this paper discusses behavioural and population interventions as mechanisms to reduce dietary salt. in developed countries, salt added during food processing is the dominant source of salt and largely outside of the direct control of individuals. population-based interventions have the potential to improve health and to be cost saving for these countries. in developing economies, where salt added in cooking and at the table is the dominant source, interventions based on education and behaviour change have been estimated to be highly cost effective. regardless, countries with either developed or developing economies can benefit from the integration of both population and behavioural change interventions.

PMC3259482

pubmed-288

lumbar spine instability has been reported to be the leading cause of chronic back pain1. an a abnormal vertebral joint creates mechanical lesions and pains in the lumbar spine, decreasing stability and increasing the range of motion, resulting in functional degeneration2. these negative patterns have a variety of forms such as aging, medical history, and exercise deficiency and present serious problems in the age group of 2040, due to developments of modern society and recent changes in various working forms of work3, 4. herniated nucleus pulposus (hnp) is a representative disease of the functional vertebral unit that occurs when the pulposus nucleus is exposed by rupture of the annulus fibrosus and it is a disease that causes chronic back pains5, 6. chronic back pain patients not only have weak deep muscles of the lumbar region and muscle imbalance compared to normal subjects, but also show reduction in the re-positioning ability which leads to problem with the stability of the spine, due to the reduction in proprioceptive sense, which causes lumbar pain and recurrence7, 8. they include exercises for increasing muscle strength, improving functions, and maintaining posture as well as preventing excessive movements of the lumbar spine9. exercise rehabilitation approaches for strength and stability are important even after surgical treatments, due to degeneration and restricted activities10, 11 and conservative methods of treatment by exercise have been recommended for the purpose of preventing recurrence of pain and improving functions12,13,14,15,16. thus, exercise therapies based on the stabilization exercises are considered to be necessary for preventing chronic pain and reductions in functional capabilities by the reduction of functional instability in various of type and the improvement of motor functional capabilities of the lumbar joints. therefore, this study aims to help adult women with lumbar disc herniation recover muscle strength and stability through 8-week lumber extension strength exercise programs, and to provide data for constructing an integrated exercise program. in this study, an 8-week exercise program for lumbar muscle extension strength and stabilization was performed by 26 females older than 20 with lumbar disc herniation. this study was approved by the hankuk university of foreign studies and the institution where it was performed, and it complied with the ethical principles of the declaration of helsinki. the purposes and process of the study were fully explained to the subjects and their consent was obtained before participation. the subjects mean sd was 27.2 4.4 years old their mean sd height was 162.3 5.1 cm and their mean sd weight was 55.4 7.1 kg. the programs was conducted for a total of 8 weeks, 60 minutes a session, twice a week, to improve strength and stabilize lumbar extension. the exercise program was divided into warm-up exercises, main exercises and cool-down exercises. the warm-up exercises and cool-down exercises were conducted focusing on the range of joint motion (rom) without pain, utilizing cycles and steppers for 10 minutes, alternately. for the purpose of improving the lumbar stability and resistance muscles, the main exercises were designed to be individually conducted in the form of a circuit training in which the number of repetitions increased gradually, utilizing sling and weight exercise equipment. a lumbar extension strength machine (medx, medx inc., ocala, fl, usa) was utilized for the evaluation of lumbar extensor strength. the maximum static muscular strength of lumbar extension was measured at 7 different angles of lumbar flexion: 0, 12, 24, 36, 48, 60, and 72 degrees. passive tests were conducted to determine whether to limit the range of motion before measurement. the tests were conducted 12 times at 45 lbs in accordance with the medx exercise measurement guidelines. the measurement was performed after fixing the pelvis and thigh of the subjects on the support. then, the motion of the lumbar spine was limited during measurement by adjusting the footrest. the subjects were asked to increasingly extend the lumbar spine by sufficiently considering the limited angular range of motion of the joints. the measurements were performed in the same manner at every angle by maintaining maximum muscle contraction for about 2 seconds. for the physical stability measurements, the total weight distribution index (wdi) was calculated by assessing the degree of interaction and coordination of the lower body through body away while maintaining a standing posture. for data processing, the statistical program spss (spss inc., the mean and standard deviation of the measurements was calculated for all metrics. to compare the difference between the pre-exercise and post-exercise state of the 8-week exercise program, the paired t-test was used and statistical significance was accepted for values of p<0.05. significant differences were observed in lumbar extension strength (les) between pre-exercise and post-exercise at every angle of lumbar flexion, but no significant difference was found in wdi (%) (table 1table 1.changes of the les and wdivariableanglepre-exercisepost-exerciseles (ft-lbs)061.8 33.880.1 31.6**1278.7 33.898.8 33.6**2487.6 36.5116.5 32.7***3698.6 35.9129.7 32.3***48104.7 35.0137.6 30.2***60113.1 36.9146.5 30.5***72122.3 40.1158.7 34.7***wdi (%) 5.9 3.35.0 2.8values are mean sd, les: lumbar extension strength, wdi: weight distribution index. the post-exercise les were found to be very significantly (p<0.01) higher than pre-exercise at 0 degree and 12 degree, and extremity significantly (p<0.001) higher than pre-exercise at 24, 36, 48, and 72 degrees of lumbar flexion. values are mean sd, les: lumbar extension strength, wdi: weight distribution index. this study attempted to identify the positive impacts that were exerted on extension muscle strength and stability by an 8-week extension strength exercise program which was performed by 26 females with lumbar disc herniation. hnp is caused by the annulus fibrosus that is squeezed into the spinal canal when the pulposus nucleus is torn due to a degenerative intervertebral disc. it has been reported that approximately 29% of the projected and escaped intervertebral discs are associated with the pulposus nucleus17. chronic back pains resulting from hnp aggravate the instability of the lumbar spine, causing degenerative changes, atrophy of muscle strength, and reduce flexibility and joint range of motion due to trunk damage and instability18, 19. lumbar herniated nucleus pulposus does not occur due to lumbar pain or disability, but more frequently occurs due to deterioration of the related muscles or functions interacting with them adjunctively8. in addition, it is said that the joint range of motion is limited due to the loss of muscle strength and flexibility caused by occupational factors, mode of action, specific changes in posture, or degenerative disease18. these musculoskeletal diseases can be generally improved by utilizing conservative treatments such as exercise9, 18. rehabilitation exercise therapies for muscular strength and stability are important even after surgery10, 16. various types of composite exercises and core exercises in addition to exercises for muscular strength and stability are currently being utilized8, 12. these exercise therapies help to stabilize the lumbar spine through lumbar and trunk dynamic stabilization and exercise modulation, and increase of muscle strength20. similar to the present study, a study analyzing the impacts of an 8-week functional exercise program for lumbar muscle strength, that was performed by 26 females with degenerative disc findings, found that there were significant differences between pre-exercise and post-exercise15 in lumbar muscle extension strength at all 7 angles of lumbar flexion, proving that exercise participation develops stability of the muscles around the lumbar spine. in addition, a study analyzing the effects of decompression therapy by 4-week joint mobilization that was performed for patients with lumbar herniated nucleus pulposus, reported improvements in joint range of motion in flexion and extension21, proving its effectiveness. similarly, a study of13 lumbar traction for patients with lumbar herniated nucleus pulposus, and a study11 of lumbar discectomy and stabilization exercises for patients with lumbar herniated nucleus pulposus, both reported improvements in flexion and extension. the improvements in functions pursuant to improved muscle strength and stability were statistically significant, as were the results of the studies cited above. therefore, prevention of excessive movement of the lumbar spine and trunk, in the patients with chronic back pains or lumbar herniated nucleus pulposus can be helpful in their daily life because they secure the joint range of motion, thereby improving strength and stability9. thus, the development of muscular strength for stabilization and integrated exercise for pain reduction and rehabilitation help to maintain the range of joint motion, muscle strength, and balance21,22,23. for the improvement and rehabilitation of inpaired capacity in daily life due to back pain-associated injuries experienced by about 80% of the population a higher occurrence rate8, 10 when recurrence is included muscle weakness, and loss15 of balance the development of an integrated exercise program is required. the above results indicate that improving muscle extension strength to enhance and improve the functions the patients with chronic back pain or lumbar herniated nucleus pulposus can help improve muscle functions and increase the range of joint motion thereby exerting a positive impact on physical stability.

[ purpose] the purpose of this study was to provide the data for constructing an integrated exercise program to help restore muscle strength and stability through extension strength exercise in adult females with lumbar disc herniation. [subjects and methods] an 8-week exercise program for lumbar muscle extension strength and stabilization was performed by 26 females older than 20 with lumbar disc herniation findings. [results] significant differences were found in lumbar extension muscle strength at every angle of lumbar flexion after participation in the 8-week stabilization exercise program; but there was no significant difference in the weight distribution index. [conclusion] an integrated exercise program aiming to strengthen lumbar spine muscles, reduce pain and stabilize the trunk can help to maintain muscle strength and balance. in addition, improvement in extension strength is expected to be helpful in daily life by securing the range of joint motion and improving the strength and stability.

PMC4905881

pubmed-289

human movement can be classified into walking and running, the latter of which easily fatigues the lower limb muscles1,2,3,4. during running, the lower limbs must cope with the repeated transient impact of vertical ground reaction force (grf), which is an abrupt collision force equal to about 1.5- to 3-fold the body weight5. such repeated impacts are considered to cause lower limb muscle fatigue via chronic irritation. the incidence of running injury is affected by the running velocity and distance ran. investigated 17,000 patients6 and found a significantly higher incidence of osteoarthritis in men who were involved in running>20 miles per week. koplan et al. found that the risk of injury increased with increasing weekly distance3. on the other hand, imai et al.7 found that the number of marathon athletes who stopped running within four hours was significantly high. running faster generally produces greater ground reaction force (grf) and imposes greater stress on various parts of the body8, 9. running injuries occur most frequently in the knee, foot/ankle, and lower leg according to taunton, et al.10, who found that the most common overuse injuries included patellofemoral pain syndrome, iliotibial band friction syndrome, and plantar fasciitis. running velocity is affected by various conditions including individual running ability. we postulated that the load imposed on the lower limbs would change at different running velocities. furthermore, because portion failure differs among individuals, the load applied to each muscle is probably not uniform. therefore, we analyzed muscle activity under free walking, jogging (8.7 km/h), and running (8.8 km/h) conditions on a treadmill. ten male students without leg injuries (age, 23.2 6.5 y; height, 170.4 5.7 cm; weight, 67.6 11.1 kg; bmi, 23.3 3.2) provided written informed consent to participate after receiving an oral and written explanation of the study and its purpose. the ethics review board at heisei college of health sciences approved this study (no. the participants did not routinely run but participated in recreational sports once or twice each week. muscle activity was measured by surface electromyography using a telemyo g2 and myoresearch xp (noraxon usa inc., scottsdale, az, usa) with disposable m-00-s blue sensor polymer electrodes (ambu a/s, ballerup, denmark) attached to the belly of the muscle while the participants moved on a gait trainer system 2 treadmill (biodex medical systems inc. muscle output was recorded at 30 frames/sec using a video camera to synchronize the movements with the electromyographic data. activity was assessed at the left vastus medialis, vastus lateralis, hip adductors, tibialis anterior, lateral head of gastrocnemius, medial head gastrocnemius, and soleus. maximum voluntary isometric contraction (mvc) was determined as manual resistance against a maximally contracted muscle. the participants walked, jogged, and ran for 10 minutes in random order, and the myogenic potentials were measured for 30 seconds 10 minutes later. analog signals of myogenic potential were processed using a band-pass filter (10500 hz) at a sampling frequency of 1,000 hz. the greater trochanter, lower limb joint space, and lateral malleolus of the left hip, knee, and ankle were marked with tape to measure the range of motion. one 30-second cycle of walking, jogging, and running recorded with the video camera was selected, and then initial contact, mid stance, toe off, and the range of motion of hip flexion, knee flexion, and ankle dorsiflexion were measured on printouts. in addition, using the time required for one cycle, stride was calculated. electromyographic data were analyzed using the average value of each muscle output and central frequency. the average activity was calculated from 30-second cycles of walking, jogging, and running, including both the swing and stance phases. these output values were divided by the mvc to determine the% mvc of each muscle. in addition, lower limb joint angles on printouts were measured using a protractor. the data were analyzed using a one-way analysis of variance, and statistical significance was accepted at p<0.05. the average walking, jogging, and running speeds were 3.6 0.4, 6.7 0.6, and 10.4 1.3 km/h, respectively. the average electromyographic activities of the vastus medial, tibialis anterior, medial head of the gastrocnemius, and lateral head of the gastrocnemius were significantly higher during jogging and running compared with walking. the hip adductors and vastus lateralis did not significantly differ (table 1table 1.average% mvc of muscles (n=10)walkingjoggingrunningvastus medialis12.52.735.85.3*38.84.6*vastus lateralis17.16.136.38.137.76.8hip adductors31.26.741.07.250.17.1tibialis anterior14.31.329.33.8*37.63.0*lateral head of the gastrocnemius16.03.042.68.5*40.86.2*medial head of the gastrocnemius30.83.758.17.6*63.35.3*soleus18.45.039.67.844.86.2*values are meansse.*p<0.05, vs. walking.). the maximal electromyographic activities of the vastus medialis during jogging and running and medial head of the gastrocnemius during running were significantly higher than during walking (table 2table 2.maximum% mvc of muscles (n=10)walkingjoggingrunningvastus medialis54.87.6105.915.2*135.711.5*vastus lateralis68.129.0103.117.0134.423.6hip adductors147.231.598.620.2137.320.0tibialis anterior54.16.385.820.787.87.9lateral head of the gastrocnemius69.014.4125.527.7136.515.1medial head of the gastrocnemius129.921.6190.427.8224.226.0*soleus103.351.8113.625.9179.028.6values are meansse. the central frequency did not significantly differ (table 3table 3.average central frequency of muscles (n=10)walkingjoggingrunningvastus medialis23.16.437.95.932.46.4vastus lateralis29.75.840.35.641.86.9hip adductors15.24.120.44.123.33.4tibialis anterior59.86.066.06.566.17.4lateral head of the gastrocnemius34.37.142.77.255.76.0medial head of the gastrocnemius50.07.362.59.963.19.2soleus61.27.645.18.259.711.8values are meansse). the angle of the knee at initial contact, mid stance, and toe off significantly differed, with the knee being more flexed during jogging and running than walking the knee being more flexed during running than jogging at mid stance and toe off (table 4table 4.average left lower limb joint angles (n=10)walkingjoggingrunninghip joint flexionic20.52.424.52.228.02.9ms10.51.623.51.5*28.51.7*to6.02.23.02.6*5.51.9*knee joint flexionic4.22.114.82.2*17.22.0*ms15.02.141.51.5*48.01.5*,**to57.11.338.92.4*25.42.4*,**ankle joint dorsiflexionic2.23.64.02.06.21.1ms6.51.320.01.7*22.01.3*to14.82.214.82.720.13.5values are meansse.*p<0.05, vs. walking.** p<0.05, vs. jogging. ic: initial contact, ms: mid stance, to: toe off). ic: initial contact, ms: mid stance, to: toe off the average lengths of the running stride were significantly longer than those of jogging and walking. also, that of jogging was significantly longer than that of walking (table 5table 5.average length of stride (n=10)walkingjoggingrunningstride (m)1.240.041.460.06*2.140.08*,**values are meansse. hreljac identified training, anatomy, and biomechanical factors as risk factors associated with running, since fast running generates considerable grf and training to run stresses the joints, muscles, and ligaments12. the present study investigated differences in the amount of muscle activity during walking, jogging, and running. all participants walked freely at their own pace and then jogged at 8.7 km/h and ran at 8.8 km/h. the central frequency of each muscle seemed to remain essentially unchanged between running and jogging compared with walking, and fatigue did not arise. the vastus lateralis and vastus medialis of the quadriceps not only act on the lower limb during running or walking but also suppress damage to the knee during weight-bearing in the stance phase. therefore, we speculated that the amount of muscle activity would increase as the grf increases. the averaged values of the vastus medialis were significantly higher during running and jogging compared with walking. brownstein et al.13 found that a knee position that is more flexed than extension is due to the amount of activity of the vastus medialis. the present study found that the knees were flexed significantly more during running and jogging compared with walking at initial contact and during mid stance. these findings support the notion that the vastus medialis works easily during jogging and running. in addition, kim et al.14 showed that the amount of activity in the vastus medialis rose in response to an elevated walking speed. furthermore, in a previous study15, we compared the muscle activity during jogging and walking at the same velocity. in this study, the activity of the vastus medialis during jogging was significantly higher, and the knee joints exhibited significant flexion during jogging. load was especially applied in the direction of internal rotation in the stance phase. a study by ono et al.17 showed that the output of the vastus medialis was increased in the lower leg during internal rotation. on the other hand, the output at 90 of flexion between knee extension from the vicinity of the vastus lateralis muscle did not significantly change13. in addition, the activity of the vastus lateralis muscle during walking was significantly higher, which could account for the small difference between walking and running. the average values of the adductor muscles did not significantly differ among walking, jogging, and running. along with the outer muscles of the hip joint such as the gluteus medius, the adductor muscles maintain the inner-outer intermediate position of the lower limb during running. the types of hip movement involved in running are primarily flexion and extension, with minimal adduction and abduction. in addition, because the treadmill floor is horizontal, the trunk is also likely to become upset. therefore, we considered that the adductor muscles do not play significant roles in walking, jogging and running. the averages values for the tibialis anterior muscle were significantly higher during running and jogging compared with walking. the tibialis anterior muscle contracts either centrifugally or isometrically before and after initial contact to control the foot to prevent falling18, 19. this muscle was significantly more contracted during running and jogging, perhaps because movement was faster. the average values of the lateral and medial heads of the gastrocnemius were significantly higher during running and jogging compared with walking. the gastrocnemius works from the loading response to the terminal stance between the stance phase18. the knee joint extends in the late stance phase of the running stride via plantar flexion of the ankle joint. the force exerted on the achilles tendon during running exceeds 12-fold the weight of the runner20. a large output by the gastrocnemius is required to advance the body during running. the average value of the soleus muscle was significantly higher during running than during walking. the soleus is a single joint muscle that runs from the proximal portion of the tibia and fibula to the achilles tendon. thus, the amount of muscle activity is not affected by the angle of the knee joint. because the knee flexes deeply in mid stance during running, more extension is required at toe off, and thus a large force is required for the triceps surae muscle. under such conditions, the soleus muscle works more easily than the gastrocnemius, which is a biarticular muscle. according to mann et al.21, the angle of the lower limbs and the amount of muscle activity increases during running at higher velocities compared with walking. the stance phase is longer than the swing phase during walking but is shorter during running. according to kluitenberg et al.22, grf on a treadmill and on the ground increases in the same way when aramptzis et al.23 reported that the mechanical power of the knee joint and ankle joint increases with increasing running velocity, and the present study found that, the stride was extended in accordance with the increase in velocity. we considered that exercise load is greater during running compared with walking due to these factors. the present study found that the amount of activity in the soleus muscle was significantly higher during running and jogging compared with the amounts of activity in the vastus medialis, tibialis anterior, and gastrocnemius muscle, which are involved in walking. therefore, it was suggested that an increase in velocity causes these muscles to carry a heavier load.

[ purpose] the present study aimed to determine changes in muscle activity while moving on a treadmill at various speeds. [subjects] the activities of the left vastus lateralis, vastus medialis, hip adductors, lateral head of gastrocnemius, medial head gastrocnemius, soleus, and tibialis anterior of 10 healthy male university students were analyzed. [methods] university students walked, jogged, and ran for 10 minutes each in random order, and then myogenic potentials were measured 10 minutes later for 30 seconds. the flexion angle of the lower limb upon initial contact, mid stance, and toe off were measured. [results] the average walking, jogging, and running speeds were 3.6 0.4, 6.7 0.6, and 10.4 1.3 km/h, respectively. the average electromyographic activities of the vastus medial, tibialis anterior, medial head of gastrocnemius, and lateral head of gastrocnemius significantly differed. all muscles were more active during jogging and running than walking. only the soleus was more active during running than walking, and the activities of the hip adductors and vastus lateralis did not significantly differ. [conclusion] velocity is faster and the angles of the lower limbs and ground reaction force (grf) are larger during running than walking. the vastus medialis and soleus worked more easily according to the angle of the knee joint, whereas the tibialis anterior worked more easily at faster velocities and the medial and lateral heads of the gastrocnemius worked more easily with an increased grf.

PMC4339136

pubmed-290

the use of the kuntscher nail has been the most important advancement in trauma surgery. he had an acetabulum fracture and a femoral shaft fracture treated 30 years ago with a reamed kuntscher femoral nail. lateral hip approach was performed and after attempting to remove the nail with the specific tools being unsuccessful we decided to be more aggressive. firstly, we performed a simple unicortical osteotomy on the lateral side from the proximal part to below the callus in order to decompress the femoral canal without success. secondly, a trench in the greater trochanter around the proximal hole was performed to hit the nail from below which was still insufficient and furthermore, the hole broke when hitting the nail so we needed to drill a new hole distally. several cerclages closed the osteotomy and a bone graft was used to close the trench. with this case report, we present a new salvage technique to remove an incarcerated kuntscher nail when all the described methods have failed. the use of the kuntscher nailing system for the treatment of long bone fractures has been the most important advancement in trauma surgery in recent history. since its first implementation in a german hospital in the late 30 s, removal of a kuntscher nail is considered a routine procedure but could be really challenging. bone ingrowth or overgrowth, damage to the proximal threads of the nail, and broken nails or locking screws may complicate the removal of intramedullary nails. the biggest challenge appears when all the described methods result in failure of removal of the nail. this article presents a case of an incarcerated femoral nail and describes a salvage procedure for nail extraction after all previously described methods have failed. the patient was involved in a plane accident 30 years before sustaining a femoral shaft fracture treated with a reamed kuntscher nail and a posterior wall acetabulum fracture treated with open reduction and internal fixation with lag screws (fig.1). the patient came to our outpatient clinic complaining about inguinal pain and chronic leg pain with limitation of activities of daily living, although he was able to walk for more than one hour. on physical examination, the ipsilateral knee had full range of motion and the patient did not need any crutches to walk without limping. the postelmerldaubign scale was 14 points (4 for pain, 5 for walking and 5 for range of motion). as a part of the initial evaluation, a blood test with infection parameters was performed and was negative for infection. pre-operative radiographs showed a healed femoral fracture in all 4 cortices with an intramedullary kuntscher nail without locking screws and cortical thickening at the fracture site (fig. pre-operative x-ray of the pelvic ring: intramedullary kuntscher nail in the left femur and osteosynthesis with three screws in the posterior wall of the acetabulum. pre-operative x-ray of the distal part of the femur: fracture site healed and distal tip of the nail. the patient was informed about the incipient arthritis of the hip and the possibility to perform a one-stage or two-stage surgery. the surgical risks were discussed with the patient, including pain after hardware removal and failure to remove the nail, specially this last point because other surgeons had tried to do the same procedure few years before and had failed after many hours of surgery. firstly, remove the nail at all costs and depending on the outcome of this first surgery he would assess the hip replacement surgery. the patient was put in a lateral position and a lateral hip approach was done. the first step was to find the proximal tip of the nail which was found seated deep in the great trochanter. the initial device used to remove the nail was the conical extraction tool that was unsuccessful after several attempts. after the overgrowth bone was removed of the proximal part of the nail a hook extraction system was engaged with difficulty. however, the nail did not move after multiple hits with a 1 kg hammer and finally the hook broke itself. at this point, we decided to use the saw to perform a simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal (fig. 3). after this decompression osteotomy we tried to hit the nail from below with an impactor engaged in the proximal hole of the nail. however, the implant remained in the same position. clinicalintra operative image: simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal. after trying all these different ways to remove the nail being unsuccessful, we decided to continue the longitudinal osteotomy from proximal to distal in the lateral side of the femur. the nail was found in place with on growth and overgrowth in almost entire length of the nail. a new attempt to hammer the nail from below was performed and the nail started to move gradually until the proximal hole of the nail broke (fig. 4). after so many attempts, we did not give up and proceeded to drill a new hole distally with a diamond drill (fig. 5) to finish the nail removal. clinical intra-operative image: detail of the moment when the nail started to move gradually until the proximal hole of the nail break. clinical image. subsequently, several cerclages and a bone allograft was used to close the longitudinal osteotomy (fig. clinical intraoperative image: several cerclages closing the osteotomy with allograft bone used to close the longitudinal osteotomy. the patient was admitted to the hospital for pain and bleeding control. on the second day of hospitalization, the patient underwent a blood transfusion as his hemoglobin was reported to be 7.1 g/dl. the patient was discharged on day 4 after antibiotic prophylaxis, deep vein thrombosis prophylaxis with low-weight-molecular heparin and ambulation with crutches without weight bearing. at 8 weeks of follow-up the patient was satisfied at 1 year of follow-up with no complications and the x-ray showed complete healing of the longitudinal osteotomy (fig., the patient is free from pain in the leg with only sporadic hip pain, so there is no indication of hip replacement surgery for the time being various reasons have been described in the literature for nail incarceration, including excessive callus formation closing the intramedullary canal, ingrowth of bone into the nail, bone ingrowth through the locking holes and bent or broken nails. there are different techniques to remove retained intramedullary nails, most of these techniques are designed for broken nails, but others are for incarcerated nails. there is only one case similar to our case report by lindeque et al which describes removal of tibial nail using a large longitudinal osteotomy. we decided to perform a two-stage procedure especially due to the incipient arthritis of the hip. if our patient would have had advanced stage of arthritis, we could have considered a single-staged procedure with nail removal and hip replacement or a hip replacement without removing the nail. goosen et al treated a similar case in which they cut the proximal end of the nail to the length needed in order to implant a hip arthroplasty at the top of the nail. mont et al used this technique on fifteen patients with femoral implants or extraarticular deformities. however, despite the aggressiveness of the procedure, the patient had a good result, and the osteotomy healed normally with no complications. this is the first case published in the literature using this longitudinal osteotomy to remove a femoral nail. it is recommended to remove it as soon as it possible to minimize later complications.

introduction: the use of the kuntscher nail has been the most important advancement in trauma surgery. one of the problems is the difficulty to remove it. a new extraction technique is described in the present case report. case report: a 46-year-old man was referred for hip osteoarthritis. he had an acetabulum fracture and a femoral shaft fracture treated 30 years ago with a reamed kuntscher femoral nail. lateral hip approach was performed and after attempting to remove the nail with the specific tools being unsuccessful we decided to be more aggressive. firstly, we performed a simple unicortical osteotomy on the lateral side from the proximal part to below the callus in order to decompress the femoral canal without success. secondly, a trench in the greater trochanter around the proximal hole was performed to hit the nail from below which was still insufficient and furthermore, the hole broke when hitting the nail so we needed to drill a new hole distally. finally, the kuntscher nail was removed. several cerclages closed the osteotomy and a bone graft was used to close the trench. the patient had a good evolution at one year of follow-up. conclusion:with this case report, we present a new salvage technique to remove an incarcerated kuntscher nail when all the described methods have failed.

PMC5245924

pubmed-291

the prevalence of ulcerative colitis (uc) has increased each year for the past several decades. a large-scale population-based cohort study shows that the flare-up rate in women is 1.2 times higher than that in men. accordingly, female gender appears to be a risk factor for frequent uc flare-up. female patients often suffer from uc symptoms during pregnancy as uc symptoms generally start to appear then, and a definitive diagnosis of uc has been confirmed in younger individuals in their teens to thirties. it has been estimated that approximately 25% of female uc patients conceive after uc diagnosis. in addition, the risk of flare-up and the development of associated inflammation during pregnancy is known to be increased in both the remission and the active stages of inflammatory bowel diseases (ibd), including uc and crohn's disease. the first trimester is considered to be a particularly high-risk time for flare-up of uc. in contrast, two european cohort studies of 634 pregnancies in 303 women showed that pregnancy improves the disease course, with a reduction in flare-ups in subsequent years [2, 4]. therapeutic options are limited when flare-ups occur during pregnancy due to the concerns for the safety of fetus. according to previous reports and statements by the united states food and drug administration (fda) (http://www.fda.gov/drugs/developmentapprovalprocess/developmentresources/labeling/ucm093307.htm), 5-aminosalicylic acid (5-asa), corticosteroids and granulocyte and monocyte adsorptive apheresis (gma; adacolumn) however, we have often observed uc that is refractory to individual treatment with these drugs or with this modality, or to intensive therapeutic approaches that combine these drugs with this modality. intensive gma involving two gma sessions per week has recently been shown to be more efficacious than conventional weekly gma. furthermore, intensive gma also safely induced rapid remission in patients with moderately active uc inflammation. very recently, the drug tacrolimus was approved in japan for the treatment of patients with moderate or severe uc, regardless of whether the uc is dependent on or refractory to corticosteroids. tacrolimus is reportedly useful for the treatment of refractory uc due to its potent immunosuppressive properties, which induce inhibition of the transcription of the early activation genes encoding interleukin-2, tumor necrosis factor- (tnf-) and interferon- that are responsible for the development of inflammation. we report herein the case of a patient with severe uc that had developed during the first trimester of pregnancy and was refractory to combination therapy with high-dose corticosteroids and intensive gma, but was successfully treated with tacrolimus following cesarean section early in the third trimester. in july 2009, a 36-year-old pregnant woman was referred to our hospital for treatment of refractory uc. she had been diagnosed with uc (total colitis) at the age of 17. oral 5-asa (2,250 mg/day) had maintained her in remission up to the age of 31. subsequently, repeated flare-ups had occurred and she had been treated with corticosteroids or with the routine weekly gma. azathioprine (aza) administration was also tried, but had to be stopped due to aza-induced pancytopenia. then, oral 5-asa (2,250 mg/day) plus 3 mg betamethasone enema had induced and maintained remission up to 2008. in april 2009, at the age of 36 years, she became intentionally pregnant for the first time, while her uc was in remission with oral 5-asa at a dose of 2,250 mg daily. however, during pregnancy, the flare-up of her total colitis required daily intravenous administration of up to 80 mg/day prednisolone, oral 5-asa 2,250 mg/day and weekly gma for 10 weeks, followed by weekly lymphocytapheresis for 3 weeks under the management of a total parenteral nutrition program at the previous hospital. she underwent a blood transfusion due to the development of bloody bowel movements, which was followed by severe anemia with less than 8 g/dl of hemoglobin. antigenemia (c7-hrp) positivity against cytomegalovirus was transiently detected and subsequently spontaneously converted into a negative response. after referral to our hospital, the patient was orally administered 20 mg prednisolone and 2,250 mg mesalamine on a daily basis. physical examination revealed lower abdominal tenderness with repeated bloody stools (810 times a day). laboratory investigations revealed a white blood cell count of 9,900/l, hemoglobin 10.1 g/dl, c-reactive protein 2.41 mg/dl, serum albumin 2.9 g/dl and an erythrocyte sedimentation rate of 50 mm/h (table 1). a first sigmoidoscopy showed several deep longitudinal ulcerations with erythematous and edematous changes in the mucosa from the rectum to the sigmoid colon (fig. immunohistochemical findings and a polymerase chain reaction analysis of cytomegalovirus in colon biopsy specimens were also negative. upon discussion of the remaining therapeutic options, she was first maintained on 20 mg prednisolone and 2,250 mg 5-asa daily; these doses were increased to 40 mg predonisolone and 4,000 mg 5-asa daily in addition to 500 mg vancomycin daily for 1 week because of little improvement and stool culture positivity of clostridium difficile (though cultures were negative for c. difficile toxin). the patient also underwent intensive gma therapy (two sessions weekly), which was partially successful, resulting in almost complete disappearance of abdominal pain and a decrease in bowel movements to 35 times daily. however, her anemia was little improved and there was a gradual development of hypoalbuminemia to such an extent that transfusion of albumin was necessary every other day in order to maintain the serum level at 3.0 mg/dl, the recommended level for healthy development and safe delivery of a child. she was consequently unable to attain a further prolonged gestation and feared risks of blood-borne infections like hepatitis b, hepatitis c or aids viruses by repeated frequent blood transfusions. her first baby was prematurely delivered by cesarean section at 28 weeks and 1 day on september 9 (birth weight 1,008 g, length 35 cm) without any congenital malformations or neurological abnormalities. after cesarean section, the patient was started on oral tacrolimus (prograf), aiming for serum trough levels of 1015 ng/ml for 2 weeks, followed by tapered serum trough levels of 510 ng/ml. her condition quickly improved in the following weeks and complete remission was achieved by tapering the prednisolone dose. total colonoscopy showed scattered regenerating areas with faintly erythematous changes in the mucosa of the transverse colon and the rectum and the appearance of mucosal healing at other sites 3 months after oral tacrolimus administration was started (fig. tacrolimus is not currently approved in japan for maintenance therapy, and therefore tacrolimus administration was stopped. in clinical settings, therapeutic treatment for uc flare-up during pregnancy is limited because of concerns for the safety of the unborn child. we report herein the case of a patient with flared refractory uc during pregnancy who underwent a bridging therapy consisting of high-dose corticosteroids combined with intensive gma until it was impossible to prolong gestation any further. at that point, the incidence rates of flare-up and the development of uc during pregnancy reach approximately 30% during both the remission and the active stages. however, it has been reported that there is no evidence to suggest that pregnancy increases the relapse risk for patients with uc [2, 4]. there is also some evidence to show that pregnancy has a favorable effect on uc over time. a retrospective study of 111 ibd patients showed that increased parity is associated with a reduction in surgical resections. thus, while relapses do occur in pregnant patients, such episodes are apparently not more frequent than those in non-pregnant individuals. the key point regarding whether uc will re-emerge during pregnancy or not is the degree of activity of uc at the time of conception. therefore, although the present case was in remission at the time of conception, this remission may not have involved complete mucosal healing. currently used medications, such as corticosteroids, purine analogues, cyclosporine, tacrolimus and anti-tnf blockers, are all associated with an increased risk of opportunistic infection. multivariate analysis of a recent case-control study performed in ibd patients showed that the use of corticosteroids increased the likelihood of opportunistic infection with a calculated odds ratio of approximately 4 compared with the use of mesalamine. numerous studies have described an association between opportunistic enteric infections and exacerbation or relapse of uc. pathogens involved as potential triggers of uc flare-ups include c. difficile, campylobacter spp., escherichia coli, and cytomegalovirus. in particular, the risk of c. difficile-associated diarrhea is increased, not only by antibiotic exposure, but also by immune-compromising conditions in ibd patients, and there is therefore a strong focus on this risk during uc flare-ups. c. difficile-associated colitis in patients with ibd has a higher mortality than that in patients with c. difficile without a background of ibd. although neither toxin a nor b was detected in the present case, we eradicated c. difficle as a precautionary measure this treatment resulted in a partial response with 23 times fewer daily bowel movements than prior to eradication, suggesting that c. difficile infection might indeed be involved in the exacerbation of uc disease activity. repeated stool cultures and toxin analyses of c. difficile after eradication gave a negative result as did analysis of c7-hrp. pharmacologic management of uc currently relies on 5-asa, corticosteroids, immunomodulators (aza and 6-mercaptopurine (6-mp)), calcineurin inhibitors (cyclosporine and tacrolimus), and tnf blockade. regarding medication during pregnancy, the most important point is to maintain remission and inactivation of disease, since the greatest risk to pregnancy is active disease. another key principle to disease management during uc flare-up is to remember that therapeutic treatment is limited due to concerns regarding potential fetal complications. 5-asa remains the first-line therapy for induction and maintenance of remission for patients with mild to moderately active uc, based on an extensive history of efficacy and safety. prospective controlled trials and a population-based cohort study of pregnant patients who had been exposed to mesalamine did not suggest that 5-asa posed an increased risk to the fetus, despite the fact that mesalamine and its metabolite, acetyl 5-asa, are found in cord plasma. corticosteroid therapy is a well-established and effective treatment for patients with active uc. a large case-control study and a meta-analysis of the use of corticosteroids during the first trimester of pregnancy reported an increased risk of oral clefts in the newborns with an odds ratio of 3.35 (95% confidence interval 1.975.69) and a low overall risk of major malformations with an odds ratio of 1.45 (95% confidence interval 0.82.60). intensive leukocytapheresis (adacolumn, jimro and cellsorba; asahi medical company, tokyo, japan) is a relatively safe procedure that is widely used in japan for the treatment of active uc. a case report of a patient with uc at one center reported that gma was effective for severe uc by inducing remission with no fetal complications. immunosuppressive therapy using aza or 6-mp is sometimes useful for maintenance of remission in uc. pregnant patients treated with aza or 6-mp for ibd showed no incidence of pregnancy complications or congenital malformations. a cohort study that investigated the pregnancy outcome in female patients with crohn's disease showed a higher rate of congenital anomalies following antenatal exposure to aza compared with non-treated patients. thus, the safety of aza and 6-mp in the treatment of pregnant patients with ibd remains controversial. one report that investigated 100 pregnancies among transplant recipients showed a 68% live birth rate, 12% spontaneous abortion, 3% stillbirth, and 59% premature delivery. in contrast, a case report of a patient with uc described a successful pregnancy and delivery of a healthy baby with rapid remission and long-term maintenance. a meta-analysis of 15 studies of pregnancy outcomes after cyclosporine therapy reported no statistical difference in the rate of fetal malformations compared to that among the general population. a rapid clinical response to a tnf- inhibitor (infliximab) is obtained when this inhibitor is used for the treatment of uc. infliximab does not cross the placenta in the first trimester, but feasibly is likely to do so in the second and third trimesters, thus protecting the infant from infliximab exposure during the crucial period of organogenesis. this result suggests that infliximab treatment does not pose a significant risk of complications during pregnancy. the use of aza/6-mp, tacrolimus or cyclosporine during pregnancy has never been permitted in japan. furthermore, until june 2010, infliximab treatment was not approved for treatment of active uc. based on all of the above, we ultimately selected the following treatment regime: bridging therapy using 5-asa, corticosteroids, and intensive gma until it was impossible to further prolong gestation followed by a rescue therapy using tacrolimus after cesarean section. this therapy ultimately resulted in clinical remission. in conclusion, for pregnant uc patients, combined therapy consisting of high-dose corticosteroids and intensive gma is recommended until it is impossible to prolong gestation any further. when clinical remission can not be obtained, rescue therapy using tacrolimus after cesarean section may be useful. the authors declare that no financial or other conflict of interests exists in relation to the content of this paper.

a 36-year-old woman who had been diagnosed with ulcerative colitis at the age of 17 years was referred to our hospital because of severe abdominal pain and repeated bloody diarrhea that persisted during pregnancy despite combination therapy with high-dose corticosteroids and weekly granulocyte and monocyte adsorptive apheresis (gma). she underwent combination therapy consisting of high-dose corticosteroids, intensive gma (two sessions per week) and vancomycin, which was used to eradicate clostridium difficile, under total parenteral nutrition control until the estimated weight of her fetus reached 1,000 g. this combination therapy was partially successful, resulting in almost complete disappearance of abdominal pain and a marked decrease in stool frequency. however bloody diarrhea persisted and the patient developed anemia and hypoalbuminemia and was unable to prolong her gestation time. cesarean section was conducted at 28 weeks of gestation without any congenital abnormalities or neurological defects. oral administration of tacrolimus was begun 7 days after cesarean section, which was followed by rapid induction of remission. corticosteroids were then gradually tapered off. tacrolimus is one therapeutic option after cesarean section in pregnant patients who do not respond well to gma and high-dose corticosteroids for persistent active ulcerative colitis.

PMC3088739

pubmed-292

transitional cell carcinoma (tcc) of the urinary bladder can present as a non-muscle invasive or as a muscle-invasive lesion. the majority of patients (approximately 75%) present with non-muscle invasive tumors, which are limited to the mucosa (ta) or the lamina propria (t1) (1).. however, cis tends to behave more aggressively and is often found in association with high-grade non-muscle invasive tumors. prognostic factors in patients with non-muscle invasive bladder cancer have been the subject of numerous publications for many years (2-18). depending on a patient's characteristics, the probability of recurrence after transurethral resection (tur) at one year ranges from about 15% to 70% (2), and the probability of progression at five years ranges from about 7% to 40% (6). non-muscle invasive tumors may be managed with tur with or without intravesical therapy. however, not all non-muscle invasive bladder cancer patients have the same risk for disease recurrence and progression, and the absence of risk stratification between aggressive and indolent tumors contributes to potentially excessive frequent surveillance or unnecessary intravesical therapy. several studies have suggested risk tables for the recurrence and progression of non-muscle invasive bladder cancer (5, 7, 9, 10), but they can not calculate the probability of a certain event, such as the probability of recurrence within five years. the purpose of this study was to develop and validate prognostic nomograms for disease recurrence in patients with ta, t1 transitional cell carcinomas of the bladder. these nonograms will facilitate patient counseling, choosing the most appropriate adjuvant treatment after tur, and determining the frequency of follow-up in individual patients. thirty-eight training hospitals participated in this retrospective multicenter study. between january 1998 and december 2002, 3,060 patients with newly diagnosed they were treated with transurethral resection (tur) and diagnosed with ta or t1 tcc of the bladder based on the 2002 american joint committee on cancer (ajcc) tnm staging system (19). patients with prior histories of bladder cancer, non-tcc histology, primary cis, or a follow-up duration of less than 12 months were excluded. this cohort study was also limited to tumors whose grades were determined using the 1973 world health organization system. the median age was 63 yr (21-98), and the median follow-up duration was 44 months (12-97). the clinical and pathological data (local), including sex, age, tumor size (<3 cm or 3 cm), multiplicity (single or multiple), t category (ta or t1), tumor grade, presence of concomitant cis or squamous differentiation, and intravesical therapy were obtained from each hospital and merged. one-thousand and eighty-two patients were treated with intravesical therapy after tur, and drugs used for intravesical therapy were as follows: bcg in 827 patients, mitomycin-c in 108 patients, epirubicin in 135 patients, and other drugs in 12 patients. follow-up data were also obtained, including pathologically proven recurrence and time to first recurrence, which was defined as the time period between the date of initial diagnosis and the date of recurrence. patients who were still alive or who had died before a recurrence were censored at the date of the last available follow-up cystoscopy. we assessed the impact of various clinical and pathological features on time to first recurrence. the predictive accuracy of each univariate and multivariate logistic regression model was tested using the area under the receiver operating characteristics (roc) curve. all univariate and multivariate models were internally validated with 500 bootstrap re-samples as a means of calculating the most unbiased predictive accuracy. statistical significance in this study all statistical tests were performed using r software (r, version 2.4.1, the r project for statistical computing, http://www.r-project.org). three-year and five-year recurrence-free rates were 64.3% and 55.3%, respectively (fig. 1). on univariate cox proportional hazard analysis, age, tumor size, multiplicity, tumor grade, concomitant cis, and intravesical therapy had a significant influence on recurrence-free survival (p<0.05) (table 2). multivariate analysis revealed that age (hazard ratio [hr]=1.437, p<0.001), tumor size (hr=1.328, p=0.001), multiplicity (hr=1.505, p<0.001), tumor grade (hr=1.347, p=0.007), concomitant cis (hr=1.611, p=0.007), and intravesical therapy (hr=0.681, p<0.001) were independent predictors for disease-recurrence (table 3). based on this analysis, nomograms for the prediction of recurrence probabilities at three and five years were constructed (fig. the scales of the nomograms reflected the coefficients from the cox model rescaled to a user-friendly (100 point) range. the bootstrapping estimate of the predictive accuracy of the nomograms suggested that the area under the roc curve was approximately 0.599 at three years and 0.604 at five years. the results of bootstrap re-samples were 0.723 for the three-year estimation of the nomogram and 0.738 for the five-year estimation. the prognostic importance of various factors is not always consistent among various studies, and analyses of prognostic factors of the bladder tcc related to recurrence are sometimes difficult to compare (8). this difficulty may be due to differences in the choice of the variables analyzed, their coding, and, in multivariate analyses, the correlation among the factors (10). another important source of variability stems from differences in tumor status, especially between primary or recurrent tumors. this study showed that patient age, tumor size, multiplicity, tumor grade, cis, and intravesical therapy are significant predictors for recurrence in patients with ta, t1 tcc of the bladder. there was no difference in the time to the first recurrence between grade ii and grade iii tumors in the univariate analysis, so a dichotomized tumor grade (grade i vs. grade ii/iii) was used for the multivariate analysis (table 2). in addition, differences among intravesical instillation agents had no influence on time to first recurrence, and intravesical therapy was also simply dichotomized (not performed vs. performed) (table 2). of these, multiplicity and intravesical therapy following tur were the most influential determinants for prediction of recurrence in nomograms (fig. tumor grade, tumor size, and patient age were less strong predictors than the ones mentioned previously. concomitant cis was a relatively weak variable, especially in nomograms for five years (fig. 2). in addition, in this study, the study cohort was limited to tumors that were newly diagnosed between 1998 and 2002. nevertheless, tumor grade, t stage, concomitant cis, tumor size, intravesical therapy, tumor status (primary vs. recurrent), and recurrence rate among other factors were generally identified as independent prognostic factors for disease recurrence (2-18). in some studies, age, tumor location, and sex have also been regarded as independent risk factors (15, 17, 18). notably, our nomograms showed that age is a strong determinant for prediction of recurrence. younger patients appear to have a more favorable prognosis because they present more frequently with non-muscle invasive, low-grade tumors. however, studies have shown that the risk for disease progression is the same, grade-for-grade, in younger patients as in older ones (20, 21). in contrast, our results suggest that age has a prognostic impact independent from other factors. these observations are consistent with the work by shariat et al. we can not explain why the age factor plays an important role in disease recurrence. differences in genetic and molecular aberrations in bladder tumors and accumulation of these aberrations in older patients may relate to age. 2 may be useful for patient counseling because they predict the probability that the patient will encounter recurrent bladder cancer within the next three to five years. they are also effective tools for selecting patients for experimental adjuvant therapy because they are likely to be more prognostically accurate than the typical risk stratification approaches that form patient groups by placing cutoffs on variables. in the context of a randomized clinical trial this procedure could be accomplished by computing predicted probabilities for each patient, which would simultaneously consider all prognostic variables, and by comparing the predictions across treatment arms. in our study, we suggested two nomograms that were very similar, but there were some differences in the weight of risk score. the nomogram for three years would be more suitable for short-term studies, and the five-year nomogram may be helpful for long-term studies. additionally, nomograms may aid in determining the scheduling of follow-up visits, as patients at lower risk for relapse or a second primary tumor may require less stringent follow-up evaluations (23). the prediction for the area under the roc curve was approximately 0.599 for the three-year nomogram and was 0.604 for the five-year nomogram. despite being imperfect another limitation is that the nomogram predicts disease recurrence only within a maximum period of five years. the nomogram is additionally limited because it relies on postoperative variables, making it an inadequate preoperative patient counseling tool. it is important to remember that adjuvant therapy performed in this data set was a mixture of various intravesical therapies, and the decision as to which instillation drug should be chosen was left to the physicians. finally, experiencing a beneficial effect on intravesical therapy in this study does not mean that adjuvant intravescial therapy has to be performed in all cases of non-muscle invasive bladder tumors. the nomograms for non-muscle invasive bladder cancer in which a point system was used are very rare. (22) have reported that nomograms for non-muscle invasive bladder cancer can predict recurrence and progression, which included nuclear matrix protein 22 and cytology, as well as conventional predictors. we tested only conventional variables without ancillary markers, i.e., nuclear matrix protein 22. for this reason, the nomograms in our study may be more feasible in common clinical settings. in conclusion, current nomograms can be used to predict the probability of disease recurrence in patients with newly diagnosed ta, t1 transitional cell carcinoma of the bladder. they may be useful for patient counseling, clinical trial design, and patient follow-up planning.

we developed nomograms to predict disease recurrence in patients with ta, t1 transitional cell carcinoma of the bladder. thirty-eight training hospitals participated in this retrospective multicenter study. between 1998 and 2002, a total of 1,587 patients with newly diagnosed non-muscle invasive bladder cancer were enrolled in this study. patients with prior histories of bladder cancer, non-transitional cell carcinoma, or a follow-up duration of less than 12 months were excluded. with univariate and multivariate logistic regression analyses, we constructed nomograms to predict disease recurrence, and internal validation was performed using statistical techniques. three-year and five-year recurrence-free rates were 64.3% and 55.3%, respectively. multivariate analysis revealed that age (hazard ratio [hr]=1.437, p<0.001), tumor size (hr=1.328, p=0.001), multiplicity (hr=1.505, p<0.001), tumor grade (hr=1.347, p=0.007), concomitant carcinoma in situ (hr=1.611, p=0.007), and intravesical therapy (hr=0.681, p<0.001) were independent predictors for disease recurrence. based on these prognostic factors, nomograms for the prediction of disease recurrence were developed. these nomograms can be used to predict the probability of disease recurrence in patients with newly diagnosed ta, t1 transitional cell carcinoma of the bladder. they may be useful for patient counseling, clinical trial design, and patient follow-up planning.

PMC2526537

pubmed-293

endobronchial tuberculosis (ebtb) is a form of tuberculous infection that involves mainly the trachea and/or bronchi. the disease is often mistaken for more common lung diseases like pneumonia, asthma, lung cancer and other lung diseases. endobronchial stenosis is a common complication of ebtb despite the use of anti-tuberculous chemotherapy. we are presenting a case of ebtb that manifested with two endobronchial masses, which almost totally occluded the bronchial lumen and resulted in repeated episodes of post-obstructive pneumonia for more than a year prior to diagnosis. our patient was successfully treated with anti-tuberculous chemotherapy without the use of corticosteroids. repeated bronchoscopic examination after six months from initiating antituberculous treatment revealed complete resolution of the two lesions without residual bronchial stenosis. a 62 year old pakistani woman was admitted to hamad general hospital with history of fever for 10 days prior to admission. she denied any history of cough, hemoptysis, breathlessness, chest pain, nocturnal sweating or weight loss. prior to admission she was prescribed a seven-day course of amoxicillin that was changed to cephalexin by her family physician without improvement. for more than a year prior to this admission she had frequent visits to emergency room and a hospital admission for recurrent episodes of fever and cough that were diagnosed as community acquired pneumonia based on the radiographic finding of right lung opacity and the response to antibiotic therapy. three years earlier she was admitted for abdominal surgery due to a perforated duodenal ulcer and incidentally discovered to have type 2 diabetes for which she was commenced on glibenclamide. she had frequent visits to pakistan, the last of which was 2 years prior to her admission. eight months prior to her admission she was refused entry to canada because of abnormal chest radiograph. she was a housewife, life-long non-smoker, and never consumed alcohol. physical examination was remarkable for fever of 39.5 c and dull percussion note over the right lower and mid chest, without added sounds. laboratory investigations at admission revealed leucopenia of 1.8103/ul with neutropenia of 0.5103/ul and normal hemoglobin and platelet count. peripheral blood smear revealed marked leucopenia with severe neutropenia, few toxic, left-shifted neutrophils and reactive lymphocytes without malarial parasites seen (picture of severe infection or drug induced cytopenia). bacterial culture of the sputum, 3 sputum samples for acid-fast bacilli smear and culture and human immunodeficiency virus (hiv) testing were all negative. chest radiograph revealed right lower and mid zone non-homogenous opacity (figure 1). computerized tomography (ct scan) of the chest and abdomen revealed a soft tissue enhancing mass in the lumen of the right main bronchus that was associated with distal parnechymal consolidation and multiple lymph node enlargement (figure 2). chest radiograph showing opacification of the right lower zone ct scan of the chest showing right bronchial mass with post-obstructive consolidation (arrows) bone marrow examination revealed a cellular marrow without evidence of involvement by neoplastic or granulomatous process. bronchoscopy was done and showed two large endobronchial masses, one in the right main bronchus and the other in the right upper lobe bronchus with glistening, whitish surface (figure 3). endobronchial biopsy was taken from both masses and reveled caseating granuloma with presence of acid-fast bacilli on zeihl-nelsen staining (figure 4). bronchoscopic picture showing a mass in the right main bronchus and another one in the right upper lobe bronchus histopathologic slides showing caseating granuloma with acid-fast bacilli (arrow) bronchoalveolar lavage culture for acid-fast bacilli was negative. she was started on intravenous meropenem for 14 days and antituberculous chemotherapy in the form of rifampicin, isoniazide, ethambutol and pyrazinamide for 2 months, and then continued on rifampicin and isoniazide for further 4 months. a repeated bronchoscopy 6 months later revealed complete resolution of the endobronchial masses without evidence of bronchial stenosis (figure 5). bronchoscopic picture of the right main bronchus and the right upper lobe bronchus after six months of treatment showing disappearance of the masses with no residual stenosis the disease remained infrequently reported and was mainly a postmortem pathological diagnosis until the advent of bronchoscopy in the late 1920s. ebtb is defined as tuberculous infection of the tracheobronchial tree with microbial and histopathological evidence [3, 4]. this form of tuberculous infection continues to be an important health problem for three reasons; firstly, its diagnosis is frequently delayed, particularly in developed countries, as the decreased incidence itself diminishes the suspicion of tuberculosis. secondly, bronchial stenosis is a serious complication of the disease that may develop despite efficacious antituberculous chemotherapy and thirdly, it is often misdiagnosed as bronchial asthma or lung cancer. the exact pathogenesis of ebtb is unknown, however, direct extension from adjacent pulmonary parenchymal lesion, implantation of the organisms from infected sputum, dissemination from the blood or erosion of a lymph node into the bronchus have all been suggested as possible mechanisms of the disease [3, 8]. chung and lee identified seven subtypes of ebtb on bronchoscopic appearance; the actively caseating type (43.0%), the edematous-hyperemic type (14.0%), the fibrostenotic type (10.5%), the tumorous type (10.5%), the granular type (11.4%), the ulcerative type (2.7%), and the non-specific bronchitic type (7.9%). among these subtypes, the prognosis of tumorous ebtb was found to be most grave and unpredictable. the majority of the tumorous ebtb cases studied by chung and lee changed to fibrostenotic type within 3 months of treatment. tumorous ebtb is characterized by an endobronchial mass whose surface is covered by caseous material and totally or near totally occludes the bronchial lumen. this form of ebtb is frequently mistaken for lung cancer, adenoma or carcinoid tumors. the two most important goals when treating ebtb are to eradicate tubercle bacilli and to prevent bronchial stenosis. although anti-tuberculous chemotherapy is effective in controlling infection, it does not prevent residual bronchostenosis [5, 4]. oral corticosteroids have been used empirically to prevent bronchial stenosis, nevertheless, their role remains uncertain and controversial [9, 10]. many patients with ebtb will require aggressive treatment like repeated dilatation, the use of stents or even resection to treat bronchial stenosis. some previous studies have suggested that delay in diagnosis of ebtb is an independent predictor of the development of persistent airway stenosis. our patient presented with two tumorous growths that almost completely obstructed the lumens of the right main bronchus and right upper lobe bronchus and resulted in recurrent episodes of post-obstructive pneumonia for more than a year prior to diagnosis. considering the prognosis of tumorous type ebtb and the delay in diagnosis as a predictor for the development of bronchial stenosis, healing without stenosis in our case seems interesting. it may suggest that the exact mechanism behind the tendency of some patients and certain types of ebtb to develop bronchial stenosis is not yet completely understood. future research should focus on the pathogenesis of bronchial inflammatory reaction induced by ebtb in order to understand this mechanism.

endobroncheal tuberculosis is defined as tuberculous infection of the tracheobronchial tree with microbial and histopathological evidence. the disease is usually mistaken for other lung diseases including lung cancer. bronchial stenosis is a common complication of this type of tuberculosis despite the use of effective anti-tuberculous chemotherapy. we are presenting a case of endobronchial tuberculosis that simulated lung cancer and healed without residual bronchial stenosis.

PMC3074291

pubmed-294

medullary thyroid carcinoma (mtc) is a rare neuroendocrine cancer that originates from thyroid parafollicular calcitonin-(ct-) producing cells. mtc accounts for approximately 4% of all thyroid malignancies; approximately 75% of these cases occur in the sporadic form, and 25% occur in the hereditary form [13]. mtc usually has a favorable prognosis, with a 10-year survival rate of 70%80%, if it is diagnosed and treated at an early stage when the tumor is confined to the thyroid. unfortunately, most cases of mtc present at diagnosis with metastases to the local and regional lymph nodes and to distant organs, especially the lungs, liver, and bones. patients with metastatic mtc have a 10-year overall survival rate of 40%, and metastasis is the main cause of death in patients with mtc [4, 6]. locally advanced and distant metastatic diseases are incurable, as surgical resection and conventional radio- and cytotoxic chemotherapies are not effective against metastatic mtc [7, 8]. clinical trials of various combinations of chemotherapeutic drugs have yielded unsatisfactory results [9, 10]. however, research over the last years has led to a good understanding of the genetic defects and altered molecular pathways that are associated with the development of mtc. thus, multiple promising therapeutic agents that target these genetic alterations have been developed to treat progressive and advanced mtc. activating mutations of the tyrosine kinase receptor (tkr) rearranged during transfection (ret) this discovery has led to the development and introduction of targeted therapies, such as tyrosine kinase inhibitors (tkis) that target ret. several tkis directed toward ret kinase have been tested in vitro, preclinical, and clinical studies with promising results. unfortunately, these agents are not likely to be curative, as the longest duration of response observed was approximately 4 years, and the maintenance of agent-dependent effects may require continuous therapies, which are not without important side effects. the main reasons for the failure of these agents to cure mtc are the development of resistance to tkis that target the ret and other cell receptors and the activities of other signal transduction pathways that are involved in mtc tumorigenesis and progression but not directly targeted by tkis. in recent years, the discovery of mechanisms of resistance to tkis and of several other molecular events that contribute to mtc transformation and metastasis suggested that combinatory therapy may result in a more significant tumor growth inhibition. this has led to the development of novel compounds that have been used in several clinical trials, including tkis that can target multiple tkrs simultaneously in addition to ret and agents that can target other altered signaling pathways. other studies have demonstrated the potential for immunotherapy in combination with agents that target signal transduction pathways that are important for mtc growth. because the aim of these targeted therapies is to extend lifespan and increase the quality of life, it is very important to limit the toxicities of therapeutic agents, either alone or in combination. the possibility of testing these novel drugs in vitro (in primary thyroid cancer cells) and in vivo may help to improve the personalization of treatments. the role of the ret oncogene in the tumorigenesis of mtc has been characterized extensively. the ret gene encodes a transmembrane tyrosine kinase that binds to glial cell line-derived neurotrophic factor (gdnf) family ligands. ret signaling leads to the activation of the ras/mitogen-activated protein kinase (mapk) and the phosphatidylinositol 3 kinase (pi3k)/akt pathways and has key roles in cell growth, differentiation, and survival. activating point mutations of the tkr ret have been reported in nearly all hereditary cases of mtc; some of these mutations are included in the men2a, familial mtc, or men2b syndromes in which there is a genotypic/phenotypic correlation between the type of ret mutation and clinical features. germline mutations in the ret proto-oncogene are responsible for hereditary mtc, while somatic ret mutations are responsible for sporadic mtc. however, this paper will mainly focus on additional cellular signaling pathways other than ret responsible of mtc tumorigenesis and progression and potential targeted approaches for the treatment of advanced or metastatic mtc. although activating mutations of the tkr ret are believed to be the primary oncogenic event in the development of a majority of mtc cases, it is clear that ret cooperates with other signal transduction pathways to promote mtc tumorigenesis. in addition to ret, other kinase receptors may play a role in the development and progression of mtcs. similar to the ret receptor, the epidermal growth factor receptor (egfr) is a tkr that is associated with the regulation of cell growth, proliferation, and apoptosis. dimerization of the receptor following ligand binding results in transphosphorylation and the subsequent activation of several downstream signal pathways. egfr has been shown to be frequently overexpressed in various types of thyroid carcinomas, including mtc, and to play a role in cancer development and progression. in contrast, a recent report analyzing different mtc on tissue microarrays has demonstrated that only 20% of cases revealed moderate to strong reactivity for egfr, whereas the majority of the cases revealed weak and very focal positivity. with respect to the numbers of egfr gene copies in mtcs, the researchers did not detect amplifications but did find polysomes in 15% of the examined tumors. additionally, egfr was activated in a subset of mtcs, which suggests that this subset of patients might benefit from drugs that target also egfr. recent findings have shown that the ligand-induced activation of egfr can stimulate ret activation beyond signaling and growth stimulation. several egfr inhibitors have been shown to markedly inhibit the growth of the mtc tt and mz-crc-1 cell lines. because ret activation seems to be influenced by egfr, a recent study investigated whether egfr activation could be related to specific ret mutations in mtcs. the researchers found that tumors with the most aggressive ret mutations (in codons 883/918) exhibited reduced egfr expression compared to other ret mutations. it could be speculated that the most aggressive ret mutations are less dependent on egfr activation. in fact, in the work by croyle et al., in which cell lines with ret mutations in codon 634 and codon 918 were compared, the effect of egfr inhibition on the codon 918 mutated cell line appeared to be reduced, in agreement with the previous data. because the activation status of egfr seems to be related to ret activation however, no differences have been found in egfr activation between ret-positive and -negative tumors, which likely indicates that other molecular mechanisms lead to ret activation, such as increased ret gene copy numbers, altered promoter activity, or increased transcription in the ret mutation-negative tumors. these data suggest that egfr status determination in mtcs might be important but certainly deserves further investigations. the vascular endothelial growth factor receptor (vegfr) pathway is also important in the pathogenesis of mtc. there are three transmembrane receptors that mediate the angiogenic and lymphogenic effects of vegf: vegfr-1, vegfr-2, and vegfr-3. overexpression of vegf and vegfr-2 has been found in mtc compared to normal thyroid tissue. the vegf proteins (vegf-a, b, c, and d), which are secreted by tumor cells, act as ligands for the vegfr-2 receptors on endothelial cells and promote a signaling cascade through different pathways, such as plc--pkc-raf-mek-mapk and pi3k-akt, that stimulate cellular proliferation, migration, and survival and induce neoangiogenesis. angiogenesis is an essential alteration in cell physiology that predisposes the development of malignancy and is fundamental in tumor growth and metastasis. similarly to egfr, the overexpression of vegfr-2 in mtc has been shown to correlate with metastasis. several multitargeting tyrosine kinase inhibitors that block vegfr have shown promising clinical antitumor activity; unfortunately, in most thyroid carcinomas and other solid tumors, the antiangiogenic effects are often only transitory and really often may have late paradoxically protumorigenic effects. additionally, it seems that a modest significant association has been observed between vegfr-2 expression and ret mutation status in primary tumors. the met proto-oncogene codes for the tk receptor for the hepatocyte growth factor (hgf). met hyperactivation reportedly correlates with the metastatic abilities of tumor cells. met and hgf coexpression has been observed in a subset of mtc tumors and is associated with multifocality in mtc, which makes this interaction a potentially important target. in one report importantly, ret can induce the overexpression of c-met in this type of thyroid tumor. the fibroblast growth factor receptor 4 (fgfr4) has also been reported to be overexpressed in mtc cell lines. inhibition of fgfr phosphorylation with the small molecule fgfr inhibitor pd173074 resulted in an arrest of cell proliferation and tumor growth. moreover, the dual inhibition of ret and fgfr combined with tyrosine kinase inhibitors resulted in greater suppressions of cell proliferation in vitro and tumor control in vivo than that which was achieved with either agent alone. these data highlight ret and fgfr4 as therapeutic targets and suggest a potential role for the use of combined tyrosine kinase inhibitors in the management of inoperable medullary thyroid cancers. finally, the platelet-derived growth factor receptor (pdgfr) also seems to play a role in differentiated thyroid cancer, although its role and function have not been fully investigated in mtc. several other signal transduction pathways have been implicated as contributors to mtc tumor growth, as illustrated in two recent studies [5, 30]. these pathways include ret interactions with prb, p53, p18, and p27 as well as the phosphatidylinositol 3-kinase/akt/mtor and ras/raf/mek/erk pathways. ret interactions with tumor suppressor genes (a) prb and p53. the tumor suppressor genes rb1 (retinoblastoma; prb protein) and tp53 (p53 protein) are frequently mutated in human cancers, and it appears that, in cancer, both pathways must be inactivated to overcome senescence or apoptosis. there is extensive genetic evidence that the prb and p53 pathways are involved in mtc in rodents. further, the loss of tp53 further increased mtc formation in rb1-deficient mice [32, 33]. it has been shown that in mice, ret cooperates with the inactivation of prb/p53 to cause experimental mtc. prb/p53 mutant mice have been shown to acquire ret mutations that are analogous to activating germline mutations that are observed in human men2a and familial medullary thyroid carcinoma (fmtc). this suggests that murine mtc requires mutational dysregulations within both the ret and nuclear tumor suppressor gene pathways. however, mouse models may not mimic human disease, and a systematic analysis of the genes in the rb1 and tp53 pathways in human samples will help to clarify their roles in human mtc formation. this information may be important for the development of novel targeted therapeutic approaches for mtc. thyroid tumors show low expression of the cyclin-dependent kinase inhibitor (cdki) p27 (kip1), and recent evidence demonstrates that p27 is downregulated by the active ret mutant, ret/ptc1, which is found in papillary thyroid carcinomas. these data implicate decreased p27 activity as an important event during thyroid tumorigenesis. however, p27 mice develop men-like tumors only in combination with the loss of p18 (ink4c), another cdki. this suggests that p18 and p27 are functional collaborators in the suppression of tumorigenesis, that the loss of both is critical to the development of men tumors, and that both p18 and p27 are regulated by ret. the pi3k-akt-mammalian target of the rapamycin (mtor) cascade is important in tumorigenesis due to its ability to promote cell growth, proliferation, and survival. several examples provide evidence to support a role for the activation of the pi3k/akt/mtor signaling cascade in medullary thyroid cancer [3638]. several mechanisms have been shown to be involved in the activation of pi3k signaling in medullary thyroid cancer. a mutation of men2a (ret-men2a) has been shown to activate pi3k and its downstream effector, the serine/threonine kinase akt/protein kinase b. previous studies have demonstrated that a mutation of tyr-1062, which is the intracellular docking site for shc and enigma on ret, abolishes the ret-men2a transforming activity. these studies further revealed that the mutation of tyr-1062 abrogates the binding of the p85 regulatory subunit of pi3k to ret-men2a and subsequent stimulation of the pi3k/akt pathway. furthermore, retroviral transduction of rat fibroblasts with a dominant-interfering form of pi3k was shown to suppress ret-men2a-dependent transformation, whereas the overexpression of akt enhanced ret-men2a oncogenic potential. in summary, these data are consistent with the notion that ret-mediated cell-transforming effects are critically dependent on the activation of the pi3k/akt/mtor pathway. in cell lines, the pi3k-akt/mtor pathway has been shown to be important in the pathogenesis of men2b. ret-men2b (ret m918 t) is more effectively autophosphorylated at ret y1062 than is ret-men2a, which subsequently leads to increased constitutive activation of the ras/mitogen-activated protein kinase (mapk) and pi3k/akt/mtor signaling cascades. furthermore, previous data report other possible mechanisms of pi3k activation in thyroid carcinomas, such as the overexpression of rai (shcc/n-shc), which is a substrate of ret oncoproteins [5, 42]. finally, the loss of expression of the phosphatase and tensin homologue (pten) gene, a tumor suppressor gene, may have a role in the activation of pi3k/akt in thyroid tumors. the absence of functional pten protein expression has been observed in various cancer cells and has led to the constitutive activation of downstream components of the pi3k pathway, including the akt and mtor kinases. preclinical models showed that inactivation of these kinases is able to reverse the effects of pten loss. these data raise the possibility that drugs that target either these kinases or pi3k itself might have significant therapeutic activity against pten-null cancers. mutations in major nodes of this signaling cascade have been observed in human cancers; these mutations include gain-of-function mutations and amplifications of the genes encoding pi3k and akt [44, 45]. however, a recent study on a series of 49 mtcs has shown that the pi3k genes were not mutated, and that the activation of the pi3k pathway was significantly associated with the status of ret mutations. in fact, using protein expression analysis, the same authors confirmed that the akt/mtor pathway was highly activated in mtc, especially in cases with germline ret mutations. interestingly, this association was not dependent on the type of mutation (in either the codons of the juxta-membrane or of the tyrosine kinase portion of the receptors) but was dependent on the hereditary nature of the mutation. in contrast, medullary carcinomas with sporadic ret mutations or with wild-type ret were observed with heterogeneous expression of akt/mtor pathway molecules, which suggests the need for further elucidation of alternative activation mechanisms. in a recent study, the pi3k/akt/mtor pathway was shown to be activated in mtc, particularly in the metastatic lymph nodes, and this pathway was shown to sustain malignant features of different mtc cell models. moreover, it has been shown that the selective inhibition of the mtor pathway in a germline-ret-mutated mtc cell line can effectively decrease cell viability and block the phosphorylated status of mtor signaling molecules, which confirms previously published in vitro data. another study used metformin, which is an antidiabetic agent that decreases the proliferation of cancer cells through the 5-amp-activated protein kinase-dependent inhibition of mtor, in mtc cell lines to show that the growth-inhibitory effects on the cells were associated with the downregulation of both the mtor/6sk and perk signaling pathways. altogether, these results strongly suggest that mtor might be a very efficacious target in patients with advanced or metastatic mtc. noteworthy, mtor inhibitors are currently being used in clinical trials for the treatment of medullary thyroid carcinoma. ras-raf-mek-erk pathway. unlike hereditary mtc, in which ret mutations are the critical events, in sporadic mtc, the genetic or molecular biomarkers have not been fully established. ras is a frequently mutated oncogene in a broad spectrum of human tumors, including thyroid carcinoma, mainly in the follicular forms. in this context, investigators aimed to determine whether mutations in the ras oncogene could play a possible role in the carcinogenesis of sporadic mtc. the initial study analyzed 15 sporadic mtcs for mutations in known hot spots (codons 12, 13, and 61) of the h- and k-ras oncogenes by a direct sequencing technique, although no ras mutations were detected in any of the examined tumors. a different study on 49 mtc confirmed that ras mutations are a rare event in this type of tumor, regardless of ret mutational status. by contrast, different studies have demonstrated the presence of ras mutations in mtc. a mutational screening for h-, k-, n-ras, and braf in 13 sporadic and inherited mtcs revealed one sporadic ret-negative mtc (stage iii) with a mutation in the h-ras codon 13 (g13r). another study analyzed 188 hereditary and sporadic mtcs for ras mutational status, revealing a low prevalence of mutations, which were confined only to ret-negative sporadic mtc. furthermore, recent studies have reported a quite high prevalence of ras mutations in sporadic mtc, particularly in ret-negative mtc; 68% (17 of 25) of the ret-negative mtcs had mutations of ras compared to only 2.5% (1/40) of the ret-positive mtcs. these findings were confirmed by a different study that analyzed 17 sporadic mtcs by exome sequencing and found dominant and mutually exclusive oncogenic mutations in ret and ras (h- and k-ras) genes in 17 sporadic mtcs. as expected, most ras mutations corresponded to mutational hot spots in exons 2 and 3, although some mutations were also detected in exon 4. this study confirms that ret and ras mutations are mutually exclusive, and that they are probably 2 different oncogenic driver events in mtc. these results suggest that the activation of the proto-oncogenes ras and ret represents alternative genetic events in sporadic mtc tumorigenesis, and that more sensitive sequencing techniques such as next generation sequencing are necessary to detect mutations. for decades, the ras and raf families of oncogenes have been known to be transforming genes. however, in many normal cultured cell types, the sustained expression of activated ras or its downstream effector, raf, can elicit cell cycle arrest or senescence. the ras/raf-mediated growth arrest has been proposed as a defense mechanism against the inappropriate activation of the ras/raf signal transduction pathway [56, 57]. according to this hypothesis, spontaneous mutations in ras genes, which may occur stochastically in all cell types, would be innocuous for the organism because these mutations would lead to growth arrest or senescence. hence, for carcinogenesis to occur in response to ras/raf activation, the growth arrest response must be inactivated. the growth arrest response to ras/raf activation is not limited to normal cells. several tumor cell lines that were derived from different tumor types, including medullary thyroid carcinoma, also experienced growth arrest, usually accompanied by differentiation or senescence [5860]. these findings indicate that some tumors retain a capability for growth arrest in response to ras/raf activation. the mechanism by which ras or raf activation can induce growth arrest is not completely understood. some investigators have reported that ras or raf activation could induce the expression and secretion of a protein that mediated differentiation and g1 cell cycle arrest in mtc cells. by protein purification and mass spectrometry, this protein has been identified as the leukemia inhibitory factor (lif). stat3 activation was necessary for lif-mediated growth arrest and differentiation in mtc cells. in addition, the ras/raf/mek/erk pathway could also mediate growth arrest and differentiation by a second mechanism that is independent of lif/jak/stat3. this novel autocrine-paracrine mechanism, which mediates crosstalk between the ras/raf/mek/erk and the jak-stat pathways, defines a novel mechanism of ras/raf-induced cell growth arrest [61, 62]. the inactivation of gsk-3beta in tt cells by well-known gsk-3beta inhibitors, such as lithium chloride (licl) and sb216763, is associated with both growth suppression and a significant decrease in neuroendocrine markers, such as human achaete-scute complex-like 1 and chromogranin a. growth inhibition by gsk-3beta inactivation was found to be associated with cell cycle arrest due to an increase in the levels of cyclin-dependent kinase inhibitors, such as p21, p27, and p15. additionally, tt xenografts mice, treated with licl, showed a significant reduction in tumor volume compared with those that were treated with a control. therefore, gsk-3beta is a key downstream target of the raf-1 pathway in tt cells, and the inactivation of gsk-3beta alone is sufficient to inhibit the growth of tt cells both in vitro and in vivo. -catenin is a ubiquitously expressed multifunctional protein that plays an important role in cellular adhesion. a novel ret--catenin signaling pathway was found to be a critical contributor to enhanced cell proliferation and tumor progression in thyroid cancer. gujral et al. showed that ret could induce -catenin-mediated transcription, cell proliferation, and transformation in vitro and that -catenin nuclear localization and subsequent mediation of -catenin by ret are key secondary events in tumor growth and metastasis in vivo. this novel interaction suggests a mechanism that may underlie the broad and early metastatic potential of mtc. these data suggest an unrecognized role for -catenin signaling that may have implications for tyrosine kinase-mediated tumorigenesis in multiple tumor types and provide another potential target for therapeutic agents. in support, a recent study performed on tissue microarray observed that wnt pathway proteins, including wisp-1, wisp-2, and -catenin, were actively expressed in mtc. the nuclear factor kappa-b (nf-b) proteins, a family of transcription factors that are found virtually in all cells, are known to play crucial roles in the growth of many human malignancies. the ability of nf-b to target a large number of genes that regulate cell proliferation, differentiation, survival, and apoptosis provides clues towards its dysregulation during the processes of tumorigenesis, metastatic progression, and therapeutic resistance of tumors. nf-b is constitutively active in mtc through the ret-induced phosphorylation, ubiquitination, and proteosomal degradation of inhibitors of nf-b (ikb), which allows nf-b to enter the nucleus and bind to dna. nf-b is frequently activated in mtc, and the activation of ret by somatic or germline mutations may be responsible for nf-b activation in these tumors. these results suggest that the nf-b pathway may be an important target for drug development in mtc. a recent study examined the expression of proteins involved in angiogenesis, inflammation, apoptosis, cell cycle, cell-to-cell contact, and carcinogenesis using high-throughput tissue microarrays from 23 patients with mtc. these authors identified several novel potentially important protein targets such as cox-1/2, bcl-2a, gst-, gli-1, gli-2, gli-3, and bmi-1 that may be therapeutically targeted in mtc. for example, cox-1 and cox-2, which are two inflammation-related factors, were significantly expressed in these cases, suggesting that nonsteroidal anti-inflammatory drugs may provide benefit in some patients with mtc. then, the finding of antiapoptotic bcl-2a and gst- overexpression in mtc suggests that bcl-2a and gst- inhibitors might be a treatment option for patients with advanced or metastatic mtc. the same is applied to gli-1, gli-2, and gli-3, members of sonic hedgehog homolog (shh) pathway, and bmi-1, a cell-cycle marker that resulted overexpressed in these mtc samples. the studies of these markers, particularly the members of the shh, may improve our understanding of mechanism of resistance to current chemotherapeutic and/or tki regimens and identify novel potential therapeutic approaches. due to increased knowledge of the molecular pathogenesis of mtc, therapeutic agents that target specific altered pathways have been developed (figure 1). because the alterations of protein kinases and their pathways are involved in mtc development, several tyrosine kinase receptors inhibitors (tkis) have been tested in vitro, preclinical, and clinical studies. ret is certainly an attractive target for several types of tumors particularly for parafollicular c-cells-derived tumors, which are addicted to ret and its activity. tkis are small organic compounds that affect tyrosine kinase-dependent oncogenic pathways by competing with atp-binding sites of the tyrosine kinase catalytic domains. occupation of these sites inhibits autophosphorylation and activation of the tyrosine kinases and prevents the further activation of intracellular signaling pathways. several tkis that are directed against ret kinase have been developed for the treatment of mtc, but there is no currently available tyrosine kinase inhibitor specific to ret. however, several multitargeted tyrosine kinase inhibitors have demonstrated significant activity against ret (table 1), including vandetanib, sorafenib, motesanib, imatinib, and sunitinib [66, 68]. the inhibition of only one kinase receptor may induce the compensatory activation of other tks and consequent resistance to treatment with tkis [69, 70]. therefore, the simultaneous inhibition of multiple activated tks may be the best way to approach mtc [7173]. vandetanib (zd6474) is an oral tki that targets ret, vegfr-2, and -3, and at higher concentrations, egfr. vandetanib selectively inhibits pathways that are critical for tumor growth and angiogenesis without leading to direct cytotoxic effects on tumor or endothelial cells. most of the mutant ret oncoproteins have demonstrated sensitivity to vandetanib, while mutations in which valine 804 is substituted by either leucine or methionine (as observed in some cases of men2a) rendered the ret kinase significantly resistant to vandetanib. this resistance is likely due to steric hindrance, as the val804gly mutation increased the sensitivity of ret to vandetanib. when ret activity was inhibited, overstimulation of egfr was able to partially compensate for ret through a partial rescue of mapk pathway activation. the inhibition of egfr by vandetanib has been shown to prevent this rescue of mapk pathway activation. these data support the idea that the dual inhibition of ret and egfr is important, as it may overcome the risk of an escape by mtc cells from a blockade of ret through the compensatory overstimulation of egfr. in addition, the expression of egfr has been demonstrated in tumor-associated endothelial cells. in this respect, anti-egfr agents have been shown to block the proliferation and migration of endothelial cells. therefore, the anti-egfr activity of vandetanib might result in an additional direct antiangiogenetic mechanism. one phase ii clinical trial showed the antitumor activity of vandetanib (300 mg/day) in patients with hereditary mtc. in this study, 20% of the patients showed a partial response to vandetanib (> 30% reduction in tumor diameter), while an additional 53% of patients presented with disease stability at 24 weeks. only 1 patient showed disease progression while receiving this agent. of interest, this patient was not affected by any of two ret mutations correlated to vandetanib resistance in which valine 804 is substituted by leucine or methionine, but by y791f ret germline mutation. another clinical trial, in which 19 patients with hereditary mtc were treated with vandetanib (100 mg/day), showed similar results. vandetanib is the only tki approved for the treatment of symptomatic or progressive mtc in patients with unresectable locally advanced or metastatic disease. the approval of vandetanib in april 2011 by the us food and drug administration (fda) was based on the results of the phase iii clinical trial, study d4200c00058, in which 331 patients with unresectable locally advanced or metastatic mtc were randomly assigned to receive vandetanib (231) or a placebo (100). this study showed that the median progression-free survival duration (pfs) was 11 months longer in the group that received vandetanib than in the placebo control group and that 45% of the patients had an objective response rate (orr). common adverse events (any grade) occurred more frequently with vandetanib compared to the placebo and included diarrhea (56% versus 26%), rash (45% versus 11%), nausea (33% versus 16%), hypertension (32% versus 5%), and headache (26% versus 9%). the impact of overall survival of mtc patients treated with this compound is presently unknown. xl184 (cabozantinib) is an oral selective inhibitor of ret, c-met, and vegfr-2. the phase i trial results indicated that cabozantinib is active in patients with mtc, including those who harbor somatic ret mutations and are potentially at high risk for progression and death. a global phase iii pivotal study in mtc is ongoing (http://www.clinicaltrials.gov/ number nct00704730). sorafenib (bay 43-9006)is a multikinase inhibitor that targets braf, vegfr-2, vegfr-3, kit (a stem cell growth factor proto-oncogene involved in cell survival and differentiation), and pdgfr. a phase ii clinical trial, in which sorafenib (400 mg/twice daily) was given to 21 patients with metastatic medullary carcinoma, reported that of the patients with sporadic mtc, 87.5% achieved disease stability and 6.3% demonstrated partial responses. the treatment was prematurely terminated in mtc hereditary patients due to slow accrual. in a similar trial, recently, a study of sorafenib was conducted on advanced thyroid carcinoma patients, and partial responses were reported in six out of the 12 (50%) patients with mtc, although the small number of patients requires further prospective studies. sunitinib (su011248) is a small molecule inhibitor that targets many of the same protein kinases as sorafenib, including vegfr, pdgfr, kit, and ret. in a phase ii clinical trial, 33 patients with either well-differentiated thyroid carcinoma or mtc were treated with sunitinib. one patient had a complete response, 28% of the patients had partial responses, and 46% of the patients exhibited disease stability. the intermediate results of the phase ii thysu study also showed the efficacy of sunitinib in advanced medullary thyroid carcinoma. motesanib (amg 706) is a multikinase inhibitor that targets vegfr receptors 1, 2, and 3, pdgfr, and kit and exerts antiangiogenic and direct antitumor activities. a phase ii study performed in 91 patients with locally advanced or metastatic, progressive or symptomatic, mtc demonstrated that although the objective response rate was low, a significant proportion of the mtc patients (81%) achieved disease stability while receiving motesanib. a recent study investigated the effects of motesanib on wild-type and mutant ret activity in vitro and on tumor xenograft growth in a mouse model of mtc. the results of this study demonstrated that motesanib inhibited thyroid tumor xenograft growth, predominantly through the inhibition of angiogenesis and possibly via the direct inhibition of vegfr2 and ret, which were expressed in tumor cells. these data suggest that angiogenic pathways and specifically the vegf pathway are still important for mtc cells. imatinib (sti571) is a tki that inhibits ret, pdgfr, and kit. a phase ii trial in which imatinib was tested in metastatic mtc patients yielded disappointing results. the patients showed no objective responses; however, a minority of patients achieved disease stability. several tk inhibitors have been tested in clinical trials, but the most effective inhibitor and whether there is any specificity for particular ret mutations remain unknown. a recent study compared the effects of four tkis (axitinib, sunitinib, vandetanib, and xl184) on cell proliferation, ret expression and autophosphorylation, and erk activation in cell lines that express men2a (mtc-tt) and men2b (mz-crc-1) mutation. the findings showed that the inhibitors were specific for different mutations, with xl184 being the most potent inhibitor against the men2a mutation and vandetanib the most effective against the men2b mutation in vitro. no tk inhibitor was superior for all tested cell lines, which indicates that mutation-specific therapies could be beneficial in mtc treatment. one of the mechanisms for the resistance of mtc to chemotherapeutic drugs is multidrug resistance (mdr). mdr in cancer cells has been attributed to the overexpression of several plasma membrane atp-dependent efflux pumps, such as mdr-1. the enzyme cyclooxygenase (cox-2) has been shown to regulate mdr-1 expression in rat mesangial cells. furthermore, a study has shown that in vitro treatment of an mtc-derived cell line with rofecoxib, a cox-2 inhibitor, was able to sensitize mtc cells to doxorubicin. a recent study, performed in vitro, has shown that celecoxib, another cox-2 inhibitor, was able to induce both mtc cell apoptosis and sensitization to vinorelbine, thus enhancing the chemotherapeutic effect of this drug. a clinical trial, in which the in vivo activities of celecoxib were explored in mtc patients who can not benefit from available treatments, would be desirable after accounting for the possible cardiovascular risks of this drug. several other therapeutic agents are being investigated for their uses in the treatment of thyroid carcinomas, including mtc. these agents inhibit targets that are involved in development of mtc other than the tyrosine kinase receptors. we previously discussed that ras operates in a complex signaling network with multiple activators and effectors, which allows them to regulate many cellular functions such as cell proliferation, differentiation, apoptosis, and senescence. phosphatidylinositol 3-kinase (pi3k) is one of the main effector pathways of ras, regulating cell growth, cell cycle entry, cell survival, cytoskeleton reorganization, and metabolism. the presence of ras mutations in sporadic mtc and most importantly the frequent activation of the pi3k/akt/mtor pathway in several aggressive and metastatic mtcs strongly suggest that this cellular signaling pathway is a good candidate for targeted therapies against mtc. in fact, several in vitro evidences have demonstrated that the indirect blocking of this pathway, by pi3k inhibitors, or direct inhibition of mtor can mediate the induction of apoptosis and a decrease in cell viability in the mtc tt cell line. currently, there are several clinical trials in which patients with radioiodine-refractory differentiated and medullary thyroid carcinomas were recruited to test the efficacy of everolimus (rad001), a novel inhibitor of mtor, in combination with other drugs (nct01625520 and nct01270321). recently, researchers have developed a liposomal form of everolimus and have demonstrated the anticancer efficacy of this formulation against tt cells. studies have shown that metformin can decrease the proliferation of cancer cells through 5-amp-activated protein kinase-(ampk-) dependent inhibition of mtor. some researchers have reported growth inhibitory effects of metformin against mtc cell lines (tt and mz-crc-1), which were attributable to the downregulation of both mtor/6sk and perk signaling. the expression of the molecular targets of metformin in human mtc cells suggests that this drug may be potentially useful in the treatment of mtc. pi3k-akt-mtor and raf-mek-erk signaling have been shown to be important in the resistance of thyroid cancer cells to apoptosis and the promotion of tumor progression. in this context, targeted anti-vegfr therapy or raf inhibition may be ineffective if pi3k signaling remains intact. therefore, two promising drugs, raf265, a raf inhibitor that is active against vegfr2, and bez235, a pi3k inhibitor, were tested alone and in combination in preclinical mtc models that represented the key genotypes observed in refractory thyroid cancers. the study findings showed that a combination treatment with agents that inhibited both raf and pi3k pathways strongly inhibited growth both in vitro and in vivo. in addition, the investigators showed for the first time that raf265 potently inhibits the constitutively active ret, a form of the kinase that is observed in men2a. persistent ret activation, a frequent event in mtc, leads to the activation of the pi3k/akt/mtor, erk/mapk, and jak/stat3 pathways. recently, the efficacy of the jak1/2 inhibitor azd1480 against the growth of thyroid cancer was tested in vitro and in vivo in thyroid cancer cell lines that expressed oncogenic ret. the findings showed that azd1480 efficiently inhibited the growth and tumorigenesis of thyroid cancer cell lines that harbored oncogenic ret alterations, likely through the inhibition of pi3k-akt signaling; this result supports the use of this inhibitor in patients with thyroid cancer, particularly in those with advanced mtc, for whom there are no effective therapeutic options. thus, somatostatin (srif) peptide analogues in combination with tkis may be a promising approach for the treatment of these tumors. the presence of different combinations of srif receptor (sstr) subtypes in a given patient may explain the variable clinical response to srif analogues and may promote the search for more selective drugs with different affinities to the various receptor subtypes. the currently available somatostatin analogues (octreotide and lanreotide) act preferentially through the somatostatin receptor subtype 2 (sst2). in mtc, these compounds have been reported to exert antisecretive effects on calcitonin but unfortunately are not reported to have antiproliferative effects. pasireotide (som230) is a new somatostatin analogue that has a peculiar binding profile with high affinity for sst1, sst2, sst3, and sst5. preliminary data from a phase ii study of patients with metastatic carcinoma show that som230 is effective, and some clinical trials are exploring the efficacy of som230 alone or in combination with rad001 in patients with mtc (nct01625520 and nct01270321). the nf-b pathway is also a potential target for drug development, and a number of compounds have been developed to inhibit this pathway at different levels in cancer cells. studies have demonstrated that the proteosome inhibitor bortezomib exerted a promising antitumor effect in human mtc cells through the inhibition of ib degradation, which led to the inactivation of the transcriptional factor nf-b. patients are currently being recruited for a phase i/ii trial to study the combination of vandetanib plus bortezomib (http://www.clinicaltrials.gov/). immunization with tumor antigen-pulsed autologous dendritic cells (dcs) resulted in protective immunity and the rejection of various established human tumors. specifically, vaccination immunotherapy with calcitonin and/or carcinoembryonic antigen (cea) peptide-pulsed dcs was shown to result in the induction of a cellular, antigen-specific immune response in patients with mtc, which led to clinical responses in some patients. therefore, for the first time, a potential dc vaccination therapy was developed for patients with metastatic mtc. another study, which was performed in a transgenic mtc mouse model, has confirmed this finding. have reported on the in vitro findings of a vaccination trial in 5 mtc patients, who were treated with dcs that were generated using a new protocol, which consisted of granulocyte-macrophage colony-stimulating factor and interferon-alpha (ifn-dcs). these investigators demonstrated that immunization with ifn-dcs led to a tumor epitope-specific th1 immune response in mtc patients. furthermore, a pilot trial of 10 patients has assessed the safety and efficacy, in terms of immune responses and clinical activities, of the dcs. in this study monitoring of the patients included serial measurements of calcitonin tumor markers, radiological imaging, and immunological in vitro tests, including t-cell interferon-gamma detection and cytotoxicity assays. after a median followup of 11 months (range 726), 3 (30%) of the 10 patients exhibited disease stability, while 7 (70%) of the patients progressed during treatment. a combined treatment with different tumor cell lysate-pulsed dcs increased the likelihood of a calcitonin tumor marker response and should therefore be preferred over monotherapy with dcs pulsed with a single lysate. thus, immunotherapy may be a promising alternative therapy in combination with agents that target specific signal transduction pathways for aggressive forms of mtc that are resistant to classical therapies. a significant antitumor effect was also observed with radioimmunotherapy using an anti-cea i-f6 monoclonal antibody in mtc-bearing nude mice. nevertheless, no complete responses were observed. similarly to chemotherapy, drugs that target the tumor microenvironment might improve the efficacy of radioimmunotherapy. this hypothesis was confirmed by a recent study in which pretreatment of mice grafted with the tt human medullary thyroid cancer cell line with antiangiogenic therapies was found to improve the efficacy of radioimmunotherapy with acceptable toxicity. another independent study, which was conducted in a mouse model of mtc, has found similar results with the angiogenesis inhibitor bevacizumab. future investigations will be performed to better understand how antiangiogenic agents enhance the efficacy of radioimmunotherapy. epigenetic drugs are expected to target the two main mechanisms of epigenetic alterations, dna methylation and acetylation, and are regarded with increasing interest by both endocrinologists and oncologists. concluded trials of such drugs have shown that few patients with advanced thyroid cancer responded completely, which suggests that these treatments were effective at stabilizing progressive disease. therefore, definitive results from clinical trials will clarify the true effectiveness of epigenetic drugs in these tumors. epigenetic drugs, when used in combination with other target molecules, might significantly increase response rates to treatment in advanced thyroid cancer patients, either by relaxing the chromatin structure to make dna more accessible to the effects of a dna targeting drug or by acting synergistically with antimitotic drugs. thus, epigenetic therapy may be a promising novel approach for the treatment of some cases of mtc. tumor cells often devise strategies to bypass the effects of antineoplastic agents, and the selection of therapy-resistant clones is frequently the reason for treatment failure. one characteristic of endocrine cancer is a general resistance to conventional chemotherapies or radiotherapies that would normally lead to apoptosis of the cancer cells. mtc can develop resistances to cytotoxic drugs due to the expression of the multidrug resistance (mdr) 1 gene. drugs that can oppose this mechanism of resistance to traditional chemotherapies may increase the sensitivity of mtc tumor cells to chemotherapy. for example, celecoxib, a cox-2 inhibitor, has been shown to potentiate the chemotherapeutic effect of vinorelbine in mtc. therefore, the synergistic actions of a cytotoxic drug and a compound that increases the sensitivity of mtc cells to such a drug could provide a treatment method for patients who can not benefit from tkis. however, the most promising results in patients with chemotherapy and radiotherapy-unresponsive mtc were obtained with tkis. multitargeted tyrosine kinase inhibitors, which inhibit multiple rtks simultaneously, including ret, have been developed to bypass this potential resistance mechanism. one complication is that such inhibitors may not only be more effective for targeting receptors in tumor cells but may also exhibit greater toxicity. thus, the challenge is to balance the increased efficacy of these inhibitors with the potential for a broader array of side effects. moreover, some mtc patients can not take advantage of these therapies due to specific ret mutations that confer resistance to tkis (e.g., ret v804 confers resistance to vandetanib) [76, 114]. finally an important study reported the existence of cancer stem-like cells in mtc, which exhibit the features of self-renewal and of multiple lineage differentiation that is dependent on ret proto-oncogene receptor activity suggesting a potential mechanism of resistance to cytotoxic or tkis agents. most cases of metastatic mtc are incurable due to resistance to conventional chemo- and radiotherapies. in recent decades, the identification of genetic defects and altered cellular signaling pathways involved in human mtc tumorigenesis have led to the development of targeted therapies, of which the most important are tyrosine kinase inhibitors. however, the low rates of partial responses or complete responses and the short duration of responses in mtc patients who were observed while taking these drugs prompted researchers to develop new drugs and alternative therapies to be combined with multi-tkis and to reduce potential cross-toxicity effects. to this end, a recent study has shown synergistic effects with a combination of sorafenib and the mek inhibitor azd6244 against a human mtc cell line. concomitant use of a raf inhibitor, raf265, and a dual pi3k/mtor inhibitor, bez-235, was another effective combinatorial therapy against thyroid cancer in xenograft mouse models. the mtor cascade is emerging probably as one of the most important deregulated pathways in advanced and metastatic mtc and certainly deserves further study. targeting mtor in combination might be efficacious in patients with this tumor types. however, a complete overview of all signaling pathways, including their interactions, role of the activating gene mutations that contribute to mtc tumorigenesis, and mechanisms of intrinsic and acquired resistance to treatments, is required and will permit us to identify the best therapy for each patient. novel combined or sequential therapies request a further step in the knowledge of the cellular signaling of this tumor. finally, larger multi-institutional clinical trials to fully understand the clinical benefits of these therapies are warranted.

parafollicular c-cell-derived medullary thyroid cancer (mtc) comprises 3% to 4% of all thyroid cancers. while cytotoxic treatments have been shown to have limited efficacy, targeted molecular therapies that inhibit rearranged during transfection (ret) and other tyrosine kinase receptors that are mainly involved in angiogenesis have shown great promise in the treatment of metastatic or locally advanced mtc. multi-tyrosine kinase inhibitors such as vandetanib, which is already approved for the treatment of progressive mtc, and cabozantinib have shown distinct advantages with regard to rates of disease response and control. however, these types of tyrosine kinase inhibitor compounds are able to concurrently block several types of targets, which limits the understanding of ret as a specific target. moreover, important resistances to tyrosine kinase inhibitors can occur, which limit the long-term efficacy of these treatments. deregulated cellular signaling pathways and genetic alterations in mtc, particularly the activation of the ras/mammalian target of rapamycin (mtor) cascades and ret crosstalk signaling, are now emerging as novel and potentially promising therapeutic treatments for aggressive mtc.

PMC3594951

pubmed-295

the asialoglycoprotein receptor (asgpr) (also known as the ashwell receptor) mediates the capture and endocytosis of galactose- (gal) and n-acetylgalactosamine- (galnac) terminating glycoproteins. the relevance of this function has been the subject of much debate; the primary role may be the removal of potentially hazardous glycoconjugates arising from normal tissue turnover, tissue injury, disease, and other causes. studies using knock-out mice have provided evidence for direct involvement of the asgpr in removal of abnormally sialylated plasma glycoproteins. mice lacking the sialyltransferase st3gal4 showed prolonged bleeding which was attributed to asgpr-mediated clearance of at least one plasma hemostatic component, von willebrand factor (vwf), that showed decreased sialylation. findings in mice lacking the asgpr demonstrated that, during sepsis, the receptor removed components of hemostasis (vwf and platelets) that had been desialylated by bacterial neuraminidase and thereby allowed hemostatic adaptation that moderated disseminated intravascular coagulation and improved host survival. the asgpr may therefore be poised for rapid clearance of plasma glycoproteins that, for whatever reason, show decreased or abnormal sialylation. the highest level of expression of the asgpr is in the liver, in which it is located on the sinusoidal face of hepatocytes. low-level expression has been shown in various other cell types, such as, peritoneal macrophages in rat, human intestinal epithelial cells, mouse testis, and the rat thyroid gland. the galactosyl homeostasis theory proposes that the balance of both gal and galnac glycoconjugates is important for normal tissue physiology [1, 9]; whether or not expression of the asgpr at these other sites represents a need for localized constitutive control of such glycoconjugates is not known. a major area of interest focussing on the asgpr is the targeted gene transfer/delivery of drugs to the liver [10, 11]. for example, using galnac as a ligand on a sirna-containing complex, the latter was successfully targeted to hepatocytes after simple intravenous injection into the tail vein in mice. moreover, sirna-mediated knock-down of targeted genes was demonstrated within the hepatocytes. besides its potential importance in allowing liver-specific drug targeting, the asgpr is a key factor in the design and administration of glycoprotein pharmaceuticals more generally: the activity of the receptor can impact upon drug half life and thereby the window of therapeutic efficacy. human asgpr is composed of two types of subunit: a major subunit (asialoglycoprotein receptor 1, asgr1) and minor subunit (asialoglycoprotein receptor 2, asgr2). both subunits are type ii, single pass proteins that broadly comprise a cytoplasmic domain, transmembrane domain, and extracellular carbohydrate recognition domain (crd) [14, 15]. the subunits may exist as asgr1-asgr2 heterooligomers, asgr1homotrimers and homotetramers, and asgr2 homodimers and homotetramers. these different quaternary forms may allow for functional differences, such as, substrate specificity or rate of endocytosis [1, 16]. the genes encoding asgr1 and asgr2 (asgr1 and asgr2, resp.) are located on the short arm of autosome 17, approximately 58.6 kilobases (kb) apart. the genes are evolutionarily related but differ significantly in their structural organization: asgr1 comprises 8 exons and is approximately 6 kb long, asgr2 contains 9 exons occupying 13.5 kb of dna [14, 15]. until recently, asgr1 was thought to yield one transcript encoding a single protein. however, in 2010, liu et al. demonstrated the existence of two alternatively spliced transcripts. the longer transcript, t1, contains all 8 exons and is by far the more abundant; it encodes full-length asgr1 (isoform a, 291 aminoacids). the shorter transcript, t2, has an in-frame deletion of exon 3 resulting in the loss of 39 residues (isoform b, 252 amino acids). asgr2 gives rise to five transcripts (th2, t1, t2, t3, and t4) encoding four isoforms (a to d) that contain different in-frame deletions arising from alternative exon splicing events. isoforms a and c contain 5 aminoacids that serve as a proteolysis cleavage signal near the junction between the transmembrane domain and the crd. cleavage at this site results in secretion of the crd as a soluble protein [18, 19]. isoforms b and d lack this signal therefore they are not proteolytically cleaved but rather remain membrane bound where they may oligomerize with asgr1 isoform a to form native asgpr at the cell surface. the secreted forms of asgr1 and asgr2 are able to associate into soluble asgpr [17, 19]. there is evidence to suggest that the soluble receptor may bind free substrates in the circulation and carry them to the liver for uptake and degradation. aside from membrane attachment/secretion, it is not known whether further functional variation, such as, substrate specificity, may be associated with the different isoforms of asgr1 and asgr2. based on the observation above that the asgpr is expressed in rat peritoneal macrophages, it was considered possible that monocytes, the lineage precursor of tissue macrophages, may also express the receptor. to the best of our knowledge, the present study investigated the expression of asgr1 and asgr2 in human peripheral blood monocytes. the data showed that both asgr1 and asgr2 are expressed in human monocytes in the circulation, that expression can not be detected in lymphocytes and granulocytes, that the transcripts of both genes differ between individuals and that, in a given individual, the transcription profile for asgr2 is restricted to one of two patterns. the findings are of potential importance for health and disease in a variety of disciplines. genes, transcripts, and proteins are referred to by their formal scientific names as listed in the national centre for biotechnology information (ncbi), which complies with standardized international nomenclature. gene sizes, exon numbering, and so forth were obtained from the reference sequences listed in table 1. edta-anticoagulated whole blood in excess of that required for routine blood tests was anonymized and handled in accordance with medical research council guidelines. citrate- or edta-anticoagulated whole blood (5 ml) was centrifuged at 200 g for 10 minutes, ambient temperature to prepare platelet-rich plasma (prp). two-thirds of the volume of the prp was carefully removed from above the buffy coat, centrifuged at 1800 g for 10 minutes to pellet the platelets, and then the supernatant plasma returned to the original blood sample. as described above, the blood sample was loaded onto a discontinuous histopaque (sigma aldrich, dorset, uk) gradient comprising histopaque 1119 (2 ml, lower layer) and histopaque 1077 (3 ml, upper layer). following centrifugation at 800 g for 1 h at ambient temperature, the cells at the interface between the plasma and histopaque 1077 (monocytes and lymphocytes) were harvested; the cells at the interface between histopaque 1077 and 1119 (principally granulocytes with a small proportion of lymphocytes) were also harvested. harvested cells were washed by resuspension in 10 ml phosphate buffered saline ph 7.2 (pbs) followed by centrifugation at 250 g for 10 minutes at ambient temperature. the cell pellet was resuspended in pbs (0.7 ml) and an aliquot (0.2 ml) was diluted 1: 1 (v/v) with pbs and used for determination of cell counts on a pentra 120 (horiba abx, montpellier, france). citrate- or edta-anticoagulated whole blood (5 ml) was depleted of platelets as described above (separation of white blood cells). the blood sample (3 ml) was then loaded onto histopaque 1077 (3 ml) and centrifuged to separate the white blood cells (wbc) (400 g, 30 min, ambient temperature). the wbc interface was harvested, washed, and an aliquot used for determination of cell counts as described above (separation of white blood cells). the remaining cells, suspended in pbs, were separated according to forward scatter and side scatter light characteristics using a moflo high speed cell sorter (beckman coulter, high wycombe, bucks, uk). gating was restrictive rather than permissive: each gate was set only for the core population of cells that had the required scatter characteristics. in particular, the lymphocyte gate was set to minimise the possibility of small monocytes being harvested. purity checks were subsequently performed by reanalysis of aliquots of the sorted cells in the flow cytometer; purity was typically around 98%. all reagents and consumables for cell culture were supplied by invitrogen life technologies ltd, paisley, ireland. (human hepatocyte carcinoma) and thp1 (human acute monocytic leukemia) cells were cultured in rpmi1640 medium+l-glutamine, supplemented with 10% (v/v) fetal calf serum and containing penicillin (50 units/ml) and streptomycin (50 g/ml). cells were grown at 37c in water-saturated air (95%, v/v), co2 (5%, v/v) in 25 cm flasks. hepg2 cells (adherent cell line) were liberated from the flask wall mechanically using a plastic scraper and were separated by exposure to shear force. hepg2 has been shown by others to express high levels of the ashwell receptor and was used as a positive control in all relevant experiments. rna was extracted using rneasy kits (qiagen, west sussex, uk) according to the manufacturer's instructions. yield was determined spectrophotometrically and then 1.0 g was reverse transcribed into cdna using random hexamers and the high capacity cdna reverse transcription kit (life technologies ltd/applied biosystems, paisley, uk) according to the manufacturer's instructions. standard polymerase chain reactions (pcrs) typically contained approximately 30 ng cdna in a mixture of dntps (100 mol/l each), tris-hcl ph8.0 (10 mmol/l), mgcl2 (1.5 mmol/l), taq dna polymerase (1u) (applied biosystems, warwickshire, uk), and primers (figure 1) in a final volume of 25 l. all primers were used at 0.5 pcr was done using a 2720 dna thermal cycler (applied biosystems, warwickshire, uk). the primer sequences (5 to 3) were as follows: asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac primers were designed for rt-pcr according to the following criteria: (1) they flanked at least one intron; (2) they were specific for asgr1 or asgr2 transcripts, cross hybridization was not possible despite the sequence homology between the coding sequences of the two genes. n13f and n13r are, respectively, modified m13 universal and reverse sequencing primers as previously described. underlined nucleotides are not part of asgr1 or asgr2 sequence but are tails corresponding to n13f or n13r to facilitate sequence analysis. for nested pcr, the first-round product was then diluted 10-fold with water and 1 l of diluent was used as the substrate in the second round of pcr. pcr conditions were as follows: standard pcr: 94c for 30 s; 60c for 30 s; 72c for 1 min. nested pcr: 1st round 94c for 30 s; 60c for 30 s; 72c for 1 min 30 s. nested pcr: 2nd round 94c for 30 s; 60c for 30 s; 72c for 1 min.routinely, 30 cycles of amplification were used; however, for real time pcr, 55 cycles were employed. standard pcr: 94c for 30 s; 60c for 30 s; 72c for 1 min. nested pcr: 1st round 94c for 30 s; 60c for 30 s; 72c for 1 min 30 s. nested pcr: 2nd round 94c for 30 s; 60c for 30 s; 72c for 1 min. asgr1 and asgr2 transcript levels were measured using lightcycler faststart dna master sybr green i (roche products ltd, hertfordshire, uk) according to the manufacturer's instructions, with 3 mmol/l mgcl2 final concentration in the reaction. reactions contained 2 ng cdna per 20 l and relevant primers (figure 1). analyses were done in duplicate in a lightcycler ii using lightcycler v4.0 software (perkin elmer-applied biosystems, warwickshire, uk) using the following conditions: 94c for 10 min followed by 55 cycles comprising 94c for 10 s; 64c for 5 s; 72c for 10 s. pcr products were purified using the highpure kit (boehringer mannheim, nottingham, uk) and then sequenced using bigdye3.1 according the manufacturer's instructions (perkin elmer-applied biosystems, warrington, uk). sequencing primers were either the 5 pcr primer, 3 pcr primer, n13f or n13r according to the amplification product. sequencing reaction products were purified using qiaquick pcr purification columns (qiagen, west sussex, uk) and then electrophoresed on an applied biosystems 3130xl genetic analyser. agarose gel electrophoresis: the analyses used 2% (w/v) gels and 1x tbe buffer (tris (90 mmol/l), boric acid (90 mmol/l), edta (1.25 mmol/l), ph 8.0); visualization was done using ethidium bromide staining and uv light. polyacrylamide gel electrophoresis: gels comprised polyacrylamide (total acrylamide=5%, w/v; cross link=3.3%, w/v) and 1x tbe buffer, visualization was done using silver staining. the dna size standard pbr322/mspi (new england biolabs, hertfordshire, uk) was used for all electrophoretic analyses. initially, peripheral blood mononuclear cells (pbmcs) were harvested and screened for asgr1 and asgr2 expression without fractionation into monocytes/lymphocytes/granulocytes. rt-pcr of rna extracted from pbmcs demonstrated the presence of both asgr1 and asgr2 transcripts (figure 2(a)). these were also detected in the monocyte cell line thp1 (figure 2(a)). following these initial findings, pbmcs were fractionated in order to localize the cells in which asgr1 and asgr2 expression was present. histopaque gradients allowed separation of cells into monocytes+lymphocytes (m+l) and granulocytes+lymphocytes (g+l). these cell preparations typically contained 10% monocytes/90% lymphocytes (m+l) and 94% granulocytes/10% lymphocytes (g+l) (data not shown). using rt-pcr, asgr1 and asgr2 transcripts were detected in rna from the m+l fraction but not in rna from the g+l fraction (figure 2(b)). these findings were reproducible for blood samples taken from 3 different individuals (data not shown). the g+l fraction did not yield a product for the transcripts even after 50 cycles of rt-pcr amplification (figure 2(b)). some nonspecific products were obtained as a result of this high number of cycles; however, these did not interfere with the main result of the experiment (figure 2(b)). because lymphocytes were common to both cell fractions, and because the g+l fraction was reproducibly negative for asgr1 and asgr2 transcripts, the data suggested that expression of the two genes was localized to monocytes. to confirm this, monocytes and lymphocytes were formally cell sorted using flow cytometry, rna extracted and screened using rt-pcr. monocytes gave a positive result for both asgr1 and asgr2 transcripts, whilst lymphocytes did not give a pcr product, even after 50 cycles of amplification (figure 2(c)). this high cycle number resulted in the burst-through of some nonspecific products; however, these did not interfere with the interpretation (figure 2(c)). these data provide strong evidence for expression of asgr1 and asgr2 in monocytes but not in lymphocytes or granulocytes. the longer transcript (t1) encodes isoform a (full-length asgr1), the shorter transcript (t2) has an in-frame deletion of 117 nucleotides in the coding sequence resulting in a shorter isoform (isoform b) (figure 1(a)). the latter lacks the transmembrane domain and is secreted as a soluble protein. in the liver, t1 has been shown to be the predominant isoform, with very little t2 detectable. using a nested pcr approach to screen rna from the m+l cell fraction of peripheral blood, different individuals showed the presence of either t1 or of both t1 and t2 (figure 3). among the five individuals screened, none showed the presence of transcript t2 on its own. in combination with the data in figure 2 (which showed that asgr1 transcripts are detected in monocytes and not lymphocytes), these data suggest that the monocyte transcription profile for asgr1 differs between individuals. five transcripts have been described for asgr2, giving rise to four protein isoforms (figure 1(b)). using a rt-pcr designed to detect transcripts encoding different isoforms, the product profiles obtained for rna extracted from the histopaque m+l cell fraction differed among individuals. two distinct profiles were obtained, the first corresponded to transcripts encoding isoforms a, b, c, and d, the second to transcripts encoding isoforms b and d only (figure 4). asgr2 isoforms a and c can give rise to soluble protein via proteolysis between the transmembrane domain and the crd. isoforms b and d lack the proteolysis site and can not produce the soluble form. the data therefore indicate that in some individuals, monocytes may produce both soluble and membrane-bound asgr2, whilst in others, the soluble form is not produced by these cells. real-time pcr was optimized for primer pairs asg1rtf+asg1rtr, asg2rtf+asg2rtr (which, respectively, amplify all asgr1 and all asgr2 transcripts) and b2mrtf+b2mrtr (which amplify the reference target gene, b2 m). for each primer pair, a specific product was obtained that had a characteristic melting curve (figure 5). following pcr optimization, transcripts were measured using relative quantification, in which the target was asgr1 or asgr2, the reference was b2 m, the calibrator was hepg2, and the unknown was flow sorted monocytes or thp1. b2 m is a recommended reference target for quantitative pcr, having the advantages of a single transcript, no processed pseudogene and expression at similar levels in a wide range of tissues. flow-sorted monocytes and thp1 cells gave similar results: relative to expression in hepg2, asgr1 transcripts were between 1.53e-07 to 7.53e-06-fold less, whilst asgr2 transcripts were between 7.16e-05 and 3.78e-04-fold less. figure 5 illustrates relative quantification of asgr1 and asgr2 transcripts in cell-sorted monocytes. the ratio of expression of asgr1: asgr2 in monocytes and the monocyte cell line thp1 was approximately 1: 100. to ascertain whether thp1 would be a suitable cell line for future asgpr studies in monocytes, the coding sequences of the asgr1 and asgr2 transcripts produced by these cells were determined. a nested pcr strategy was used as follows: the first round of synthesis amplified the entire coding sequence plus some 5 and 3 flanking sequence and then second round pcrs amplified nested portions within the first round product. one of the nested portions contained the region that differed between transcripts and gave products of different size according to the transcript. these products were electrophoresed, excised from the gel, reamplified individually, and then sequenced, to give the sequence of each of the coding regions that differed between transcripts. thp1 asgr1 and asgr2 transcripts corresponded with previously described splice variants found in the liver (data not shown). the findings demonstrate that thp1 cells have the capacity to transcribe and process correctly, transcripts encoding functional isoforms of the asgpr. taken together with the results in figures 3 and 4, the data provide evidence that monocytes express correctly processed transcripts from both asgr1 and asgr2 and thereby have the potential to produce functional asgpr. the coding sequence for asgr1 in thp1 differed from the ncbi reference sequence (table 1) by a single nucleotide: c.267g>a, for which the monocyte cell line was homozygous (data not shown). this change is silent at the protein level (codon 89, aag, changes to aaa, both encoding lysine). the change is a naturally occurring variant (rs55714927) listed in the international snp database (dbsnp). the thp1 asgr2 coding sequence for any transcript did not differ to the corresponding ncbi reference sequence (table 1) (data not shown). in this study, expression of asgr1 and asgr2 was demonstrated in peripheral blood monocytes. for both genes, transcript profiles were obtained that corresponded with known splice variants found in the liver. to the best of our knowledge, this is the first report of the expression of correctly processed transcripts of asgr1 and asgr2 by human monocytes. in rat, a transcript encoding an asialoglycoprotein-binding protein was isolated from a peritoneal macrophage cdna library and was highly homologous to that of the rodent hepatic asgpr. the data were interpreted to indicate that the rodent macrophage asialoglycoprotein-binding protein and the liver asgpr were encoded by related genes; however, it now seems possible that alternative splicing may underlie the differences. the findings of the present study do not suggest expression of alternative asgpr-related genes in monocytes, rather they are entirely consistent with transcription of asgr1 and asgr2, as occurs in the liver. the various transcripts of asgr1 and asgr2 encode different isoforms of the proteins (figure 1). it is not known whether the isoforms differ in their specificity or functionality, however it is predicted that certain isoforms have the potential to give rise to soluble forms of each protein. asgr1 transcript t2 has an in-frame deletion of 117 bp that encode the transmembrane domain; the resulting isoform, th2 and t3 encode isoforms a (t1 and th2 ') and c (t3) which contain a proteolysis signal that, upon cleavage, gives rise to soluble protein. transcripts t2 and t4, respectively, encode isoforms b and d which lack the proteolysis signal and are membrane bound. the data presented here indicate that monocytes are able to express transcripts encoding soluble and membrane-bound isoforms of the asgpr proteins. asgr2 was found to give rise to two transcript profiles, only one of which was present in the monocytes from any given individual. one profile corresponded with transcripts encoding both soluble and membrane-bound asgr2 isoforms (a, b, c, and d), the other with membrane-bound asgr2 isoforms (b and d) only. this novel finding indicates a fundamental difference between individuals. the underlying basis for this and whether or not it has physiologic significance in health or disease merit further exploration. the level of asgr1 and asgr2 expression was considerably less in monocytes and the monocyte cell line thp1 compared with the liver cell line hepg2. it should be borne in mind that hepg2 expresses high levels of the receptor and the monocyte expression was relative to this. that monocyte transcripts were not rare within the cells was indicated by the fact that they were readily detected using rt-pcr at routine cycle numbers. low level of expression of the asgpr has been reported previously in certain nonhepatic tissues (rat macrophages, human intestinal epithelial cells, mouse testis, and rat thyroid gland). it would be relevant to explore whether asgr1 and asgr2 transcription alters upon monocyte activation. the relative expression of asgr1 and asgr2 in monocytes and thp1 (1: 100) differed notably from ratios reported in liver (1: 2 and 1: 6). the difference may be real, or it may reflect differences in methodology between studies or possibly a difference in the amplification efficiency of the primer pair used for asgr1 compared with that used for asgr2. the true relative expression of the two genes by monocytes therefore remains to be established. an important question arising from these results is whether monocytes translate asgr1 and asgr2 transcripts and produce functional asgpr. the restricted expression of the genes in monocytes, but not in lymphocytes or granulocytes, suggests the transcripts are not produced randomly but specifically. based on the fundamental principles of biology, this is likely to be for translation, it is difficult to think why else different transcripts encoding different isoforms may be produced by one specific cell type in the blood. the restricted tissue specificity for asgpr expression in the body, and the lower expression level observed at the nonhepatic locations, could signal a specific role or function at those sites. in the case of monocytes, the receptor could, at the very least, serve a scavenger function where there is infection or tissue injury. expression of correctly processed transcripts of asgr1 and asgr2 by circulating monocytes has potentially significant implications in several important areas. if monocytes express functional asgpr, they may contribute towards the normal physiological processes undertaken by the hepatocyte receptor. whilst hepatocyte asgpr is localized to the liver and relies upon the circulation to deliver ligands to it, the monocyte receptor would represent a mobile pool that can reach ligands in most parts of the body. monocyte asgpr may additionally interact with ligands in the blood, as does liver asgpr. thus, the monocyte receptor, if it is produced, may overlap functionally with that of the liver but may have additional physiological roles elsewhere in the body. hepatic asgpr has been shown to be directly involved in the normal turnover of an important protein of primary hemostasis, vwf. studies in knock-out mice indicated that the asgpr is engaged in the constitutive control of vwf level and can, additionally, remove hemostatic components (vwf and platelets) desialylated by bacterial neuraminidase, a possible survival mechanism in disseminated intravascular coagulation. the results in these studies were ascribed to the activity of the liver receptor; however, our data raise the possibility that monocytes may contribute to the relevant physiological processes via the asgpr. the findings have implications for the design of drugs targeting the liver via the asgpr and drugs that are cleared by this receptor [29, 30]. various strategies have been used, for example, conjugation of drug with galactosyl terminating molecules, as has been done with antiviral nucleoside analogues in the treatment of chronic viral hepatitis. besides drug targeting, strategies to deliver genes or other nucleic acids to the liver have also made use of the asgpr [1012]. relatively recently, successful in vivo delivery of sirnas to the liver in mice has been achieved via simple intravenous injection employing asgpr-specific conjugates containing galnac. pharmacological targeting of the asgpr could not be considered to be predominantly liver-specific if monocytes express the receptor. asgr1 and asgr2 are expressed in peripheral blood monocytes in humans. for both genes, monocytes have the ability to produce correctly spliced transcripts encoding each of the known protein isoforms. however, there are interindividual differences in the transcript profiles; of particular note, despite several possible asgr2 transcripts, just two combinations were found to occur. this observation indicates that, in any given individual, asgr2 mrna splicing is restricted to one of two profiles. quantitative studies indicate that expression of both asgr1 and asgr2 is lower in monocytes than in the liver, but none-the-less is readily detected in monocytes (in comparison to other blood cells in which expression could not be demonstrated). the liver may represent a static site to which blood carries glycoconjugates for asgpr-mediated removal, whilst monocytes may represent a mobile pool that can reach sites where the activity of the receptor is needed. the data presented here open various important avenues for future research, a notable one of which is the measurement and characterization of monocyte asgpr protein. the results for the cell line thp1 indicated it could be used as a model system for the investigation of monocyte aspgr function and activity. monocytes play a pivotal role in inflammation and immunity, the finding of asgpr transcripts within these cells offers new insight into their biochemistry and functional potential.

background. the asialoglycoprotein receptor (asgpr) is a hepatic receptor that mediates removal of potentially hazardous glycoconjugates from blood in health and disease. the receptor comprises two proteins, asialoglycoprotein receptor 1 and 2 (asgr1 and asgr2), encoded by the genes asgr1 and asgr2. design and methods. using reverse transcription amplification (rt-pcr), expression of asgr1 and asgr2 was investigated in human peripheral blood monocytes. results. monocytes were found to express asgr1 and asgr2 transcripts. correctly spliced transcript variants encoding different isoforms of asgr1 and asgr2 were present in monocytes. the profile of transcript variants from both asgr1 and asgr2 differed among individuals. transcript expression levels were compared with the hepatocyte cell line hepg2 which produces high levels of asgpr. monocyte transcripts were 4 to 6 orders of magnitude less than in hepg2 but nonetheless readily detectable using standard rt-pcr. the monocyte cell line thp1 gave similar results to monocytes harvested from peripheral blood, indicating it may provide a suitable model system for studying asgpr function in this cell type. conclusions. monocytes transcribe and correctly process transcripts encoding the constituent proteins of the asgpr. monocytes may therefore represent a mobile pool of the receptor, capable of reaching sites remote from the liver.

PMC3419429

pubmed-296

the prevalence of obesity in the united states has increased over the past several decades. according to the national health and nutrition examination survey (nhanes) results, between the years of 1988 and 1994, 22.9% of adults aged 20 years and older exceeded the criteria for adult obesity [body mass index (bmi) 30 kgm] (17). by the 20112012 survey, that percentage had increased to 35.1% (19). this represents more than a 50% increase in obesity prevalence among american adults aged 20 years and older over the course of two decades. perhaps more concerning is the prevalence of obesity among american youth, defined by the centers for disease control and prevention (cdc) as a bmi greater than or equal to the 95 percentile on the cdc growth charts (2). among children and adolescents aged 2 19 years, the prevalence of obesity increased from 5.5% between the years of 1976 and 1980 to 16.9% between 2007 and 2008 (18) and remained 16.9% between 2011 and 2012 (19). analyses of several large-scale data pools confirm that obesity contributes to the risk for development of many negative health outcomes including coronary heart disease, hypertriglyceridemia, hypercholesterolemia, hypertension, and type ii diabetes (20, 23). using secondary data, thompson and colleagues developed a model to analyze the relationship between bmi and several disease conditions in adults (23). notably, they found that the risks for hypertension and type ii diabetes are at least 2- and 3-fold higher for obese individuals with bmi values of 32.5 kgm and 37.5 kgm, respectively, as compared to normal-weight individuals with bmi values of 22.5 kgm. obesity-related health risks are not limited to adults. according to an analysis of bogalusa heart study data, the odds ratios between childhood obesity and many cardiovascular disease risk factors, including hypercholesterolemia, hypertriglyceridemia, hyperinsulinemia, and hypertension are between 2.4 and 12.6, indicating a strong, positive association between childhood obesity and these specific risk factors (8). finkelstein and colleagues estimated that in 2006, the annual per capita medical expenditure for an obese person was $1,429 (adjusted to reflect 2008 dollars) higher than for a person of normal weight, which represents 42% higher medical costs for obese individuals compared to individuals with normal body weights (5). data from over 3,000 counties and county equivalents across the united states indicate that in 2006, approximately 54 million individuals met the criteria for obesity (16). this equates to an extra $77 billion (adjusted to reflect 2008 dollars) in medical spending attributable to obesity in 2006 alone. beginning in the 2013 2014 school year, the president s council on fitness, sports&nutrition adopted the presidential youth fitness program to replace the president s challenge physical fitness test (22). this program aims to encourage healthy, active lifestyles among youth. as part of this program, schools use the presidential youth fitness program s fitnessgram to assess health-related fitness and use these data to inform physical education instruction. the fitnessgram scientific advisory board has developed four categories for classification of body composition: very lean, healthy fitness zone (hfz), needs improvement some risk (ni sr), and needs improvement high risk (ni hr). risk level was established based on body fat percentage, and body fat cutoff percentages were converted to corresponding bmi values. for ten-year olds, the ni hr category includes boys with a bmi 20.8 kgm and girls with a bmi 21.0 kgm (12, 13, 15). these bmi cutoff values are lower than those utilized by the cdc, which defines childhood obesity as having a bmi at or above the 95 percentile on sex-specific bmi-for-age growth charts (2). the corresponding bmi values that the cdc uses to indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years, 24.16 kgm for boys aged 10.50 10.99 years, 23.18 kgm for girls aged 10.00 10.49 years, and 23.35 kgm for girls aged 10.50 10.99 years (11). thus, using the cdc childhood obesity estimates could result in a substantial underestimation of the number of children at risk for negative health outcomes based upon bmi. children identified as obese by bmi have an increased risk of developing health complications that were previously thought to be limited to adults such as hypertension and type ii diabetes mellitus (3). these conditions are also well-known risk factors for the development of cardiovascular disease. obese children aged ten years and older are likely to remain obese into early adulthood (28), and therefore, accrue medical costs associated with obesity-related conditions. knowledge of the medical costs associated with childhood obesity can provide a basis by which to justify the cost of childhood obesity prevention and treatment efforts. to this end, finkelstein and colleagues analyzed the lifetime direct medical costs for an obese ten-year-old beyond the costs that a ten-year-old at a normal body weight would incur over his or her lifespan (7). the six investigations included in the meta-analysis each estimated longevity using a variety of factors such as probability of survival based on weight status (6), gender, and race (4, 14, 2325, 27). based upon this meta-analysis, two low- and high-end cost estimates were provided: one that accounted for adulthood weight gain among normal-weight children and one that compared against children who remained at normal weight through adulthood. results suggested that an obese ten-year-old, typically in the fifth grade, will incur between $12,660 (low-end; recommended) and $19,630 (high-end) of incremental direct medical costs when accounting for weight gain through adulthood and between $16,310 (low-end) and $19,350 (high-end) with a recommended cost estimate of $19,000 when contrasted with a child who remains at normal weight throughout adulthood (4, 7, 14, 23, 24, 27). using these recommended estimates along with results from the fitnessgram body composition classifications, the purpose of this analysis is to estimate the lifetime economic impact of childhood obesity for this single age cohort in the two most populous states, california and texas. fitnessgram data from the school years 20102011, 20112012, and 20122013 were obtained for california (1) and texas (21). these data were school-level and included boys and girls from all public school districts in these two states. the total number of fifth grade students tested for bmi in california and in texas and the number of fifth grade students in each bmi category were calculated for each of the three school years. the fitnessgram scientific advisory board has determined that bmi values at or above 20.8 kgm for ten-year-old boys and 21.0 kgm for ten-year-old girls represent high health risk (15). the california report included the total number of fifth graders tested for body composition as well as the number and percentage of students in each fitness zone. the texas report included data for each grade level and further separated the data by district and gender. the total number of fifth graders tested for body composition and the number and percentage of students in each fitness zone were calculated using excel. then, using the low, high, and recommended cost estimates suggested by finkelstein and colleagues (7), the lifetime direct medical costs attributable to obesity were calculated for students in the ni hr category for each of the three school years in california and in texas by multiplying the number of students in this category by the corresponding cost estimate per obese student the first set of estimates compared the direct medical costs for obese children against the direct medical costs for normal-weight children who gain weight as adults. the second set of estimates compared the direct medical costs for obese children against the direct medical costs for normal-weight children who remain at normal body weight as adults the results reflect the lifetime direct medical costs attributable to obesity for each fifth grade cohort over the three-year period in california and texas. the analysis used the costs estimated for a ten-year-old obese child; however, it should be noted that students in the fifth grade range from ages 911. the percentage of fifth grade students with bmi values in each category remained stable from the 2010 2011 school year through the 2012 2013 school year within each state (see table 1). just over half of fifth graders in each state were identified as having bmi values in the hfz, whereas at least one-third of fifth graders in each state were identified as having bmi values in the ni hr for bmi, and in texas, between 36.5 and 36.8 percent of students were categorized as ni hr for bmi during this timeframe. despite their geographical distance from one another, california and texas had comparable percentages of students in each category for each of the three school years. hr zone for each year in each state was multiplied by the estimated per capita lifetime direct medical costs of obesity previously established by finkelstein and colleagues (7). the resulting values represent the low, high, and recommended statewide lifetime costs of obesity for the ten-year-old cohorts accounting for adulthood weight gain (see table 2) and compared to children who maintain normal weight as adults (see table 3). using the presidential youth fitness program s fitnessgram body composition data, results indicate that in each of the two most populous states, childhood obesity for each cohort of fifth graders over the 3-year timeframe will cost between $1.4 and $3.0 billion (compared to normal-weight children who become overweight as adults) and $1.8 and $3.0 billion (compared to normal-weight children who remain at normal weight as adults) beyond the direct medical expenses for children of normal weight who remain at normal weight throughout adulthood. these results represent the costs solely for fifth graders in california and texas and not the additional accrued expenses for children of other ages as finkelstein and colleagues only estimated costs for the ten-year-old age group (7). additionally, these values represent only the direct medical costs and not indirect costs, such as absenteeism, which would result in higher estimates. throughout the three years for which data were analyzed, the number of fifth graders who presented with bmi values in the ni this underscores the need for the development of effective childhood obesity prevention and reduction efforts. fitnessgram results indicate that on average, 33.9% of fifth graders in california and 36.7% of fifth graders in texas have bmi values that place them at high risk for problematic health outcomes. the number of ten-year-olds in the us population was just over 4 million on july 1 each year from 2010 to 2012 (26). if the percentage of fifth graders with bmi values in the ni hr category in california and texas were extrapolated to the us population of ten-year-olds, this results in a potential lifetime economic burden of approximately $17 billion (accounting for adulthood weight gain) or $25 billion (not accounting for adulthood weight gain) in direct medical costs beyond that of individuals at a healthy weight for each single-year age cohort. in contrast to these findings, nhanes data from 2011 2012 indicate that 17.7% of children aged 6 11 were classified as obese by bmi according to the cdc standards (19). using this obesity estimate along with recommended cost estimates, the increased lifetime economic burden of obesity would be approximately $9 billion (accounting for adulthood weight gain) or $13.5 billion (not accounting for adulthood weight gain) in direct medical costs for each single-year age cohort. this discrepancy might be partially due to the method used for the determination of childhood obesity. the cdc defines obesity for youth ages 2 19 as having a bmi greater than or equal to the 95 percentile on sex-specific bmi-for-age growth charts (2). using this method, the minimum bmi values that indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years, 24.16 kgm for boys aged 10.50 10.99 years, 23.18 kgm for girls aged 10.00 10.49 years, and 23.35 kgm for girls aged 10.50 10.99 years (11). the bmi values that indicate childhood obesity per the cdc method are higher than those utilized in the fitnessgram to indicate high risk of excess adiposity-associated health problems. the fitnessgram scientific advisory board has identified body fat percentages that correspond with increased metabolic syndrome and cardiovascular disease risk factors in children and calculated the associated bmi values (9, 13). these bmi values, 20.8 kgm for ten-year-old boys and 21.0 kgm for ten-year-old girls, were identified as the cutoff values for high-risk bmi (15). meta-analysis conducted by javed and colleagues suggests that the cdc bmi standard to determine childhood obesity status compared to reference measures of adiposity defined as a high body fat percentage (i.e., dual-energy x-ray absorptiometry scan, hydrostatic weighing, or air-displacement plethysmography) is highly specific (pooled specificity=0.93) but less sensitive (pooled sensitivity=0.73) and thus might fail to detect excess body fatness in over 25% of cases (10). therefore, the lower bmi cutoff values used to determine high-risk bmi in the fitnessgram will increase the sensitivity of the childhood obesity estimate. while the fitnessgram is a useful tool to help identify children who are at increased risk based on bmi and researchers can use this information to estimate the economic impact of obesity, a limitation of this study is that fitnessgram results were not available for many states. is administered to students nationwide as part of the presidential youth fitness program, more data will become available and more rigorous analysis should be performed on nationwide data. however, the current analysis uses data from the two most populous states in the union and underscores the large economic impact of childhood obesity. using bmi data from the presidential youth fitness program s fitnessgram over a three-year timespan and the estimated lifetime direct medical costs associated with obesity as recommended by finkelstein and colleagues (7), results indicate that the estimated lifetime medical costs of childhood obesity in the two most populous states, california and texas, are between $1.4 and $3.0 billion for each single-year age cohort analyzed. this information can be used to encourage spending, resource development, and prevention program implementation to reduce obesity in these two states. further analyses should be conducted to estimate the economic burden associated with childhood obesity using the criterion-referenced fitnessgram bmi standards across the united states when data are available.

the prevalence of childhood obesity in the united states increased more than three-fold from 1976 1980 to 2007 2008. the presidential youth fitness program s fitnessgram is the current method recommended by the president s council on fitness, sports&nutrition for assessing health-related fitness factors, including body composition. fitnessgram data from california and texas, the two most populous states, over a three-year time span indicate that more than one-third of fifth grade students, typically ten-year-olds, are obese. previous studies report that an obese ten-year-old child who remains obese into adulthood will incur elevated direct medical costs beyond his or her normal-weight peers over a lifetime. the recommended elevated cost estimates are approximately $12,660 when comparing against a normal-weight child who gains weight as an adult and approximately $19,000 compared to a child who remains at normal weight as an adult. by applying these figures to fitnessgram results from california and texas, each group of fifth grade students in each of the two states will incur between $1.4 and $3.0 billion in direct medical costs over a lifetime. when the percentage of obese fifth graders is extrapolated to the rest of the united states 4 million ten-year-olds, this results in more than $17 billion (accounting for adulthood weight gain) or $25 billion (not accounting for adulthood weight gain) in added direct lifetime medical costs attributable to obesity for this single-year age cohort. this information should be used to influence spending decisions and resource allocation to obesity reduction and prevention efforts.

PMC4882466

pubmed-297

brown tumor is a non-neoplastic giant cell lesion characterized by increased circulating levels of parathyroid hormone (pth). it is usually an uncommon lesion occurring with the frequency of 4.5% in primary hyperparathyroidism (hpt) and 1.5-1.7% in cases of secondary hpt, with overall incidence of 0.1%. hpt can be classified into: primary, which occurs due to hyperplasia, benign or malignant neoplasm of one or more parathyroid gland. secondary hpt is caused as a result of hypocalcemia, vitamin d deficiency or secondary to chronic renal insufficiency, which acts as a stimulus for pth production. tertiary hpt is associated with renal failure and autonomous functioning glands in long-standing secondary hpt cases. the fourth type of hpt has been recognized, which occurs due to increased pth levels synthesized in patients with malignant diseases. we report an interesting and rather unique case of a brown tumor of maxilla and mandible developing after acute exogenous thyroxine poisoning in a young female patient under treatment for hypothyroidism and ectopic intrathoracic parathyroid adenoma. a 23-year-old female reported to our department with the chief complaint of a swelling on the left side of the lower jaw for past 4 months producing facial asymmetry. patient was a known hypothyroid and was under exogenous levothyroxine (l-thyroxine) therapy for the past 3 years. she gave history of l-thyroxine poisoning (approximately 4000 mcg stat dose) 4 months back after which she developed rapidly growing swelling on the left side of the jaw. extraoral examination revealed the presence of a well-circumscribed expansile swelling in the left mandibular body region measuring 5 cm 4 cm, which was hard, non-tender and non-mobile without any surface changes. intraorally, obliteration of buccal vestibule on the left side with intact normal mucosa was seen. no mobility, loss of vitality or tenderness was elicited with any teeth in the left quadrant. biochemical assay and blood analysis revealed an increased value of serum alkaline phosphatase (420 u/l; normal range: 100-172 u/l), serum pth (370.40 pg/ml; normal range: 50-300 pg/ml) and serum calcium (13.3 mgs/dl; normal range: 8.5-11.0 mg/dl). the serum phosphorus level was decreased (2.4 mg/dl; normal range: 2.7-4.5 mg/dl). cone beam computed tomography (ct) scan of the facial region revealed a well-defined soft tissue lesion within the left body of the mandible of approximately 3.5 cm 2.8 cm [figure 1a and d]. it also represented well-defined hypodense lesions in relation to the right body of the mandible measuring 2.5 cm 1.0 cm [figure 1d] and anterior maxilla, measuring 3.5 cm 3.6 cm [figure 1b]. there was also lytic lesion on the left side skull bone with generalized reduction in bone density [figure 1c]. a full body skeletal survey was also performed, which revealed no such lesions in long bones. (a) computed tomography scan (axial section) showing well-defined soft tissue lesion within the left body of the mandible. (d) 3d reconstruction showing bilateral lytic lesion within the body of the mandible and generalized reduction in the bone density (arrow indicating the lesion) ultrasound of neck failed to reveal any pathology in thyroid and parathyroid glands. to further assess the parathyroid gland status tc sestamibi-spect parathyroid scintigraphy was carried out, which demonstrated relatively prominent flow of activity toward left submandibular salivary gland region. abnormal ovoid region of intense tracer concentration in the anterior mediastinum in right paratracheal region was noted. the findings were suggestive of ectopic (intrathoracic) parathyroid gland with neoplastic changes in left submandibular salivary gland region [figure 2a]. (a) tc sestamibi-single photon emission computed tomography parathyroid scintigraphy image showing intense tracer concentration in right paratracheal region and left submandibular region. (b) computed tomography scan (axial section) showing well defined mass in intrathoracic prevascular space ct scan of the chest was taken, which revealed a moderate size nodular lesion showing heterogeneous enhancement in right prevascular space measuring 3.0 cm 2.4 cm [figure 2b]. the history, biochemical values and imaging reports corroborated with the clinical features of the brown tumor of hpt associated with pathologic ectopic parathyroid gland. an incisional biopsy of the mandibular lesion was performed under local anesthesia that revealed fibro collagenous tissue containing plenty of osteoclastic giant cells dispersed throughout the lesion with small fragments of reactive bone, the features consistent with reparative giant cell granuloma. thoracotomy was carried out and ectopic intrathoracic parathyroid gland was excised [figure 3a]. a combination of sharp and blunt dissection was used to excise the mass and it was delivered per oral in total [figure 3b]. post-operative serum calcium level was 10.6 mg/dl and pth level 11.90 pg/mg. intra-operative view of (a) ectopic parathyroid gland. (b) left mandibular lesion the intrathoracic mass and mandibular specimen was sent for histopathological examination. the intrathoracic mass revealed parathyroid neoplasm suggestive of atypical parathyroid adenoma [figure 4a]. the mandibular lesion presented a giant cell proliferation in the background of a variably fibrotic stroma. the giant cells were arranged in sheets with little intervening spindle cell stroma. at the periphery osteopenic bone trabecule these features were suggestive of brown tumor of hpt [figure 4b]. (a) histopathological section of mandibular lesion showing giant cell proliferation with variable areas of haemorrhage and hemosiderin deposition (h and e, 20). (b) histopathological section of parathyroid neoplasm composed of nuclear pleomorphism with cystic changes, suggestive of parathyroid adenoma (h and e, 20) pth plays a key role in calcium and phosphate balance between extracellular fluid and bones. brown tumor is relatively an uncommon lesion associated with hpt, which results in an abnormal osteoclastic and osteoblastic activity resulting in resorption and fibrous replacement of the bone. brown tumor is more commonly found in ribs, clavicles, pelvis, femur and facial bones. in craniofacial region mandible radiographically, this lesion appears as well-defined unilocular or multilocular radiolucencies causing cortical plate expansion and often thinning of the cortical plates. the density of jaw is decreased due to generalized demineralization of the medullary bones along with change in trabecule pattern giving a mixed radiopaque-radiolucent appearance. brown tumor mimics giant cell lesions and it can be distinguished from the latter based upon the clinical history and biochemical profile of the patient indicating hpt. due to overlapping clinical and radiological features, patients presenting in maxillofacial department with suspected giant cell lesion should undergo biochemical assay to rule out hpt. other differentials to be included are cherubism, aneurysmal bone cyst, paget's disease, langerhans cell histiocytosis, osteosarcoma and osteomyelitis. histopathologically, brown tumor reveals multinucleated giant cells in a background of spindle cell proliferation along with a large amount of hemosiderin deposition, vascularity and hemorrhage giving brown appearance to this lesion. the most interesting aspect of this case report is association of brown tumor with ectopic intrathoracic parathyroid gland with normal functioning anatomic parathyroid glands. ectopic parathyroid glands are uncommon, mainly arising due to abnormal migration of parathyroid tissue during embryogenesis. it has been reported that in almost 16% cases of hpt, ectopic parathyroid glands are present, which may often go unnoticed and are a cause for failed parathyroid exploration. the uniqueness of the case is further defined by its occurrence at a very young age (23 years) along with its bilateral presentation with simultaneous involvement of maxilla, mandible and skull bones in a brief period. this patient was hypothyroid, under thyroxine therapy for past 3 years with an episode of acute poisoning of l-thyroxine before the onset of swelling of the jaw. the routine biochemical examination of patient taken 3 months prior to the onset of swelling revealed normal serum calcium and phosphorus levels and hypothyroid state. unfortunately, consultant endocrinologist and physicians failed to observe any relation between the hyperparathyroid state of the patient and exogenous thyroxine. to best of our knowledge, no case of brown tumor of hpt with such aggressive behavior and wide spectrum of clinical findings associated with acute thyroxine ingestion has been reported in the past. hence, we assume that either bolus toxic dose of thyroxine or chronic state of hypothyroidism has caused a high pth and serum calcium levels resulting in a hyperparathyroid state causing bone remodeling events in the craniofacial region. few authors have reported that prolonged thyroid-stimulating hormone (tsh) stimulation may lead to hpt or a state of hpt in hypothyroidism and vice versa. this case report establishes a credible support for this hypothesis and brings out a definite correlation between tsh inhibition and onset of hpt. the treatment of brown tumor mainly focuses on correction of the underlying disorder and maintenance of normal pth and serum calcium levels. use of systemic or intralesional corticosteroid have been reported to reduce the size of the lesion. long-term follow-up of such lesion is mandatory as variable clinical behavior of the lesion following normalization of the pth and serum calcium levels has been reported. we have also adopted a similar protocol with surgical excision of the pathological ectopic parathyroid gland and mandibular tumor, which was causing severe disfigurement of the patient's face. pth and serum calcium levels were found to be normal within 3 days after surgery. follow-up radiographs of the patient has revealed marked regression in the craniofacial lesions. ultra sonographic scan, ct scan and full body skeletal survey in conjunction with complete biochemical analysis can be carried out to assess the pathological parathyroid gland and extent of lesions in long bones. latest imaging techniques such as tc-sestamibi scan and fluorine-fluorodeoxyglucose-positron emission tomography/ct have been proved to be an effective and useful diagnostic modality in assessing location and functioning of parathyroid glands. our patient represents a rare case of brown tumor with a wide spectrum of associated clinical findings. in conclusion, the management of the brown tumor should involve early diagnosis, complete biochemical assay and full body skeletal survey followed by normalization of pth, serum calcium and phosphorus levels and parathyroidectomy, if indicated. in the absence of any pathology of anatomic parathyroid this case emphasizes the need for periodic biochemical investigations in the hypothyroid patients on exogenous thyroxine therapy.

brown tumor is a giant cell lesion associated with hyperparathyroidism. it is a non-neoplastic condition and represents terminal stage of the remodeling process in hyperparathyroid state. we report a case of brown tumor with multiple lesions in craniofacial region associated with ectopic parathyroid adenoma revealed after acute l-thyroxine poisoning. this case report emphasizes on the need for routine biochemical investigations along with serum calcium, phosphorus and parathyroid hormone levels in patients on thyroxine therapy.

PMC4053678

pubmed-298

central nervous system drugs (58.7 %) were the most prescribed class of inappropriate medications in korean long-term care facilities.inappropriate medication use was associated with the number of co-medications and long-term care insurance grade 3, which means less dependence and a requirement of low-level care.effective management of nursing home residents belonging to long-term care grade 3 via reducing potentially inappropriate medications is considered. korea became an aging society in 2000, and in 2008, the prevalence of individuals aged 65 years or older was 10.3 %. in 2018, korea will become an aged society when 14.4% of its population comprise the elderly, and a super-aged society by 2026 [1, 2]. to overcome this situation, the korean government introduced a new social insurance scheme for long-term care (ltc) in july 2008. the ltc insurance program provides social services for elderly people with a few functional limitations. the purpose of this insurance system was to meet the markedly increased demand for elderly healthcare as a result of a rapidly aging population, elevated expectations for healthcare, and a change in the pattern of medical conditions in the elderly from acute illness to chronic disability. this insurance uses the ltc grade for denoting how much help is required for an elderly person in their daily lives. after the implementation of ltc insurance, the number of nursing facilities in korea also increased sharply from 1717 locations (68,581 people) in 2008 to 3751 locations (116,782 people). researchers have documented the widespread incidence of inappropriate medication use in elderly persons and reported an estimated prevalence from 4.8 to 45.6% [511]. the proper use of medicines and monitoring for adverse effects are important factors in the treatment of elderly patients. aging is associated with a reduction in first-pass metabolism and therefore an increase in the bioavailability and distribution of drugs, which increases the risk of adverse effects; these risks grow exponentially when a number of different drugs are used. because of the potentially serious consequences of exaggerated or incorrect prescriptions, screening tools have been created to detect inadequacies in drug prescriptions. in 2012, the american geriatrics society (ags) and an interdisciplinary panel of experts in geriatric care and pharmacotherapy reached a consensus on the 2012 ags beers criteria. fifty-three medications or medication classes encompass the final updated criteria, which are divided into three categories: potentially inappropriate medications (pims) or classes to avoid in older adults; pims or classes to avoid in older adults with certain diseases and syndromes that the listed drugs can exacerbate; and medications to be used with caution in older adults. elderly nursing home residents regularly receive complex multi-drug therapy because of the presence of both acute and chronic diseases. for this reason, there have been few reports dealing with the prevalence of pim prescriptions or their adverse effects on elderly patients in south korea [14, 15]. to our knowledge, there have been no reports on the prevalence of pim prescriptions in south korea ltc facilities using the 2012 version of the beers criteria. hence, we evaluate the frequency of inappropriate medication use in elderly patients admitted to nursing homes in korea by applying the newly revised 2012 ags beers criteria. a retrospective cross-sectional survey study was performed in patients aged 65 years or older, which produced a sample of 824 people admitted to 20 nursing facilities in northwest korea from january 2012 to february 2012. we excluded four patients who did not take any medications, 259 patients with incomplete medical records, and 32 patients who were not included in any ltci programs. we assessed the patients age, sex, co-medication, comorbidity, activities of daily living (adl), length of stay, grade of ltc insurance for seniors, and the bed size and business type of the ltc care facilities. the ltc grade is based on standards of five areas of physical functions (adl), cognition, behavioral changes (behavioral problems), demand on nursing care, and need for rehabilitation, and judgment standards made in consideration of service necessary according to the state of functions. on a checklist with a maximum score of 100, a score of 55 and over makes an individual eligible for insured care. categories of ltc grade are defined as follows: grade 1 (most severe)the elderly person has one of the following handicaps: he or she can not go to or get out of bed unaided; experiences behavioral difficulties, impaired judgment, and frequent memory loss as a result of severe brain injury; or completely needs full assistance with all the activities of daily life and records a ltc acknowledgment score of at least 95; grade 2 (severe)the elderly person can not eat, defecate nor dress themselves unaided; has impaired judgment and memory loss due to dementia; needs considerable help in moving or moving in a wheelchair; spends most parts of daily life in bed and records an ltc acknowledgment score of at least 75 but less than 95; grade 3 (moderate)the elderly person partially needs considerable ltc protection; some degree of help for eating, dressing/undressing, using the toilet, looking after himself or herself, performing household tasks, and performing their everyday activities outside the home; and records an ltc acknowledgement score of at least 55 but less than 75; no grade (mild)the elderly person needs some help in one or two activities of daily life, including bathing and dressing/undressing and records an ltc acknowledgment score of less than 55. prescriptions were assessed for the use of pims according to the 2012 ags beers criteria. we focused on evaluating 34 pims to avoid in older adults and one of the categories in the 2012 update to the ags s beers criteria. drug disease interactions and drugs to be used with caution in geriatric patients were also assessed using the beers criteria. anti-cholinergics include brompheniramine, carbinoxamine, chlorpheniramine, clemastine, cyproheptadine, dexbrompheniramine, dexchlorpheniramine, diphenhydramine (oral), doxylamine, hydroxyzine, promethazine, and triprolidine. cardiovascular medications include alpha blockers, alpha agonists, guanabenz, guanfacine, methyldopa, reserpine (> 0.1 mg/day), anti-arrhythmic drugs (class ia, ic, iii), and amiodarone. central nervous system drugs include tertiary tricyclic antidepressants, antipsychotics, barbiturates, and benzodiazepines. we calculated the descriptive statistics to illustrate characteristics of the study population by comparing persons on pims with those not on pims. the distributions of baseline descriptive statistics are expressed as proportions and means with standard deviations. in the case of categorical variables, cross-tabulations with chi-square tests were used in comparing the differences. for continuous variables, the statistically significant difference in means was determined by the independent t test. concurrent pim use was defined as the number of pim prescriptions within an individual incidence year. logistic regression analysis was performed to identify the risk factors for pim exposure where pim use (0 or 1) was the dependent variable and the independent variables included age, sex, adl, length of stay, number of comorbidities, number of co-medications, and grade of ltc insurance. use of pims has been consistently associated with female sex, higher number of medications, higher number of chronic diseases, and older age [1621]. all statistical analyses were performed using spss 18.0 for windows (spss inc., chicago, il, usa). this study recruited 529 patients; 221 of these did not use a pim, while the remaining 308 patients were currently taking pims. significant differences between those prescribed and those not prescribed a pim were found for sex, age, deductible class, number of different medications used, number of chronic conditions, total healthcare costs in the previous year, and number of concurrent pims. the average number of medications in the pim group was 4.0 2.3, while the non-pim group s average number of medications was 6.4 2.9 (p<0.001). in addition, the average number of comorbidities was 3.3 1.4 in the pim group and 3.8 1.5 in the non-pim group (p<0.001). the number of patients whose ltc insurance for seniors was grade 3 was relatively higher in the pim group than it was in the non-pim group. the six most commonly prescribed classes of medicines within the anatomical therapeutic chemical classification system were as follows: central nervous system (n=930; 36.4%), alimentary tract and metabolism (n=553; 21.6%), cardiovascular system (n=388; 15.1%), blood and blood-forming organs (n=236; 9.2%), respiratory system (n=115; 4.5%), and musculoskeletal system (n=72; 2.8%). table 2 presents the number of pims prescribed in ltc facilities. table 1general characteristics of the residents in long-term care facilitiesvariablesnon-pims [n=221 (%)] pims [n=308 (%)] p valueage (years)81.6 8.980.2 8.40.067sex (male)64 (29.0%)59 (19.2%)0.080number of co-medications4.0 2.36.4 2.9<0.001 03105 (47.5%)51 (16.6%) 4582 (37.1%)112 (36.4%) 6732 (14.5%)103 (33.4%) 82 (0.9%)42 (13.6%)number of co-morbidities3.3 1.43.77 1.5<0.001 0270 (31.7%)58 (18.8%) 352 (23.5%)90 (29.2%) 461 (27.6%)66 (21.4%) 538 (17.2%)94 (30.5%)number of adls1.2 1.21.3 1.20.405 adl bathing8 (3.6%)7 (2.3%)0.357 dressing52 (23.5%)62 (20.1%)0.348 eating132 (59.7%)209 (67.9%)0.054 toileting58 (26.2%)87 (28.2%)0.611 walking22 (10.0%)42 (13.6%)0.200length of stay (months)28.4 25.926.7 29.20.494grade of long-term care insurance for senior 138 (17.2%)31 (10.1%)0.008 283 (37.6%)100 (32.5%) 3100 (45.2%)177 (57.5%)bed size of long-term care facilities <2954 (24.4%)74 (24.0%)0.950 305966 (29.9%)96 (31.2%) 60101 (45.7%)138 (44.8%)business type of long-term care facilities corporation159 (71.9%)223 (72.4%)0.908 private operator62 (28.1%)85 (27.6%)values are presented as number (%) pim potentially inappropriate medication, adl activities of daily living p value applied to row 47 inclusive p value applied to row 912 inclusive p value applied to row 2022 inclusive p value applied to row 2325 inclusive p value applied to row 2627 inclusivetable 2number of potentially inappropriate medications in the residents of long-term care facilitiesnumber of potentially inappropriate medicationsnumber (%) 0221 (41.8)1189 (35.7)292 (17.4)320 (3.8)46 (1.1)51 (0.2)total529 (100.0) general characteristics of the residents in long-term care facilities values are presented as number (%) pim potentially inappropriate medication, adl activities of daily living p value applied to row 47 inclusive p value applied to row 912 inclusive p value applied to row 2022 inclusive p value applied to row 2325 inclusive p value applied to row 2627 inclusive number of potentially inappropriate medications in the residents of long-term care facilities the six most commonly prescribed classes of medications in our patients were as follows: central nervous system (n=271; 58.7%), anticholinergics (n=98; 21.2%), cardiovascular system (n=50; 10.8%), endocrine system (n=22; 4.8%), analgesics (n=9; 1.9%), and anti-parkinsonian drugs (n=9; 1.9 %) (table 3). specifically, the most common pim subtype was quetiapine (n=131; 28.4%), followed by chlorpheniramine (n=73; 15.8%), risperidone (n=30; 6.5%), zolpidem (n=27; 5.8%), and spironolactone (n=26, 5.6 %) (table 4). multivariate logistic regression analyses were applied, and the factors that exhibited significant associations with pim prescriptions are shown in table 5. table 3six most commonly prescribed potentially inappropriate medications classesmedications class (atc code)number (%) central nervous system (n05-n06)271 (58.7)anticholinergics (n04a)98 (21.2)cardiovascular system (c)50 (10.8)endocrine system (g03)22 (4.8)analgesics (n02)9 (1.9)anti-parkinsonian drugs (n04) 9 (1.9)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classificationtable 4prevalence of potentially inappropriate medications according to individual drugsdrugs (atc code)number (%) quetiapine (n05ah04)131 (28.4)chlorpeniramine (r06ab04)73 (15.8)risperidone (n05ax08)30 (6.5)zolpidem (n05cf02)27 (5.8)spironolactone (c03da01)26 (5.6)olanzapine (n05ah03) 21 (4.5)lorazepam (n05ba06)19 (4.1)alprazolam (n05ba12)16 (3.5)hydroxyzine (n05bb01)13 (2.8)cyproheptadine (r06ax02)12 (2.6)doxazosin (c02ca04)12 (2.6)sliding scale insulin (a10ab01)12 (2.6)amitriptyline (n06aa09)11 (2.4)megestrol (g03ac05)10 (2.2)meloxicam (n01ac06)9 (1.9)benztropine (n04ac01)7 (1.5)nifedipine (c08ca05)7 (1.5)diazepam (n05ba01)6 (1.3)clonazepam (n03ae01)5 (1.1)terazosin (g04ca03)3 (0.6)total462 (100)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classificationtable 5logistic regression analysis for potentially inappropriate medications used in the residents of long-term care facilitiesvariables standard error p valueadjusted or (95% ci)age0.0030.0120.8001.00 (0.981.02)sex (female)0.1360.3160.6661.15 (0.622.13)number of co-medications 031.00 450.9030.243<0.0012.47 (1.533.97) 671.6880.316<0.0015.41 (2.9110.06) 83.6000.761<0.00136.61 (8.24162.68)number of co-morbidities 021.00 30.4880.2710.0731.63 (0.862.76) 40.0740.2780.7910.93 (0.541.60) 50.4380.2940.1371.55 (0.872.76)grade of long-term care insurance for seniors 11.00 20.2710.3120.3851.31 (0.712.42) 30.7090.3440.0392.03 (1.043.99)adjusted for activities of daily living, length of stay, bed size and business type of long-term care facilitiesgrade of long-term care insurance for seniors made based on standards of five areas of physical functions (activities of daily living), cognition, behavioral changes, demand on nursing care, and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions. categories of ltc grade are defined as follows: grade 1 (most severe); grade 2 (severe); grade 3 (moderate) six most commonly prescribed potentially inappropriate medications classes medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classification prevalence of potentially inappropriate medications according to individual drugs medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults () means codes of anatomical therapeutic chemical (atc) classification logistic regression analysis for potentially inappropriate medications used in the residents of long-term care facilities adjusted for activities of daily living, length of stay, bed size and business type of long-term care facilities grade of long-term care insurance for seniors made based on standards of five areas of physical functions (activities of daily living), cognition, behavioral changes, demand on nursing care, and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions. categories of ltc grade are defined as follows: grade 1 (most severe); grade 2 (severe); grade 3 (moderate) the present study focuses on a growing public health problem: inappropriate medication prescriptions in ltc facilities. a disturbingly high level of pims were prescribed (58.2%), which is of concern, indicating room for improvement. a comparison with the results from studies conducted previously worldwide is not straightforward owing to variations in methods, such as data and duration of collection, study criteria, and characteristics of the population groups. despite these variations, this prevalence was similar to those observed in the usa, with values of 49% of elderly patients who were admitted with one or more of the seven most common medical diagnoses and 55.3% in those undergoing surgery during their hospitalization, and 56.1% of those in acute care hospitals in japan. the results described in the multivariate analysis regarding the factors associated with a potentially inappropriate prescription showed that the likelihood was determined by the number of drugs prescribed during the patient s hospitalization., the results of a logistic regression model showed that multiple diseases and a higher use of drugs during hospital stay predicted pim prescription. multivariate analyses also revealed that the number of drugs prescribed seemed to be one of the most important independent predictors for receiving an inappropriate medication [27, 28]. furthermore, inappropriate medication use was higher with the ltc insurance grade 3, which means less dependence and a requirement of low-level care. this can be explained by the fact that most of the residents in korean ltc facilities have been diagnosed with dementia or another neurodegenerative disorder. considering central nervous system drugs (58.7 %) were the most prescribed class of inappropriate medications, such prescriptions are used to manage behavioral and psychiatric symptoms. when interpreting the findings of the current study, some limitations to the methodology that could bias estimates are worth mentioning. the first limitation lies with the fact that the study was cross sectional, which does not allow us to identify the causal relationship of pim with associated factors in nature. second, the beers criteria have been examined extensively in research since their development and found to be effective in identifying pim and advising close monitoring of certain medications. however, evidence supporting the effectiveness of the beers criteria in consistently reducing the adverse effects of drugs or decreasing costs or mortality is lacking [29, 30]. the beers criteria does not take into account geriatric patients in palliative care or hospice, does not detect prescribing omissions, underuse of medications, inappropriate dosing of medications, or duplication of drug classes [31, 32]. third, although the information was gathered mainly from a chart review, recall bias may have been a problem because patients reported their current medications through a structured interview that took place before admission, including the duration of treatment and the dosage; this information may have been inaccurate. fourth, this sample is unlikely to be representative of all koreans because the study was conducted in one region of the country and, therefore, the ability to generalize the findings is questionable. central nervous system drugs (58.7 %) were the most prescribed class of inappropriate medications in korean ltc facilities. inappropriate medication use was associated with the number of co-medications and ltc insurance grade 3, which means less dependence and a requirement of low-level care. central nervous system drugs (58.7 %) were the most prescribed class of inappropriate medications. there was a relationship between inappropriate medication use and the number of co-medications. the frequency of inappropriate medication prescriptions was higher among patients whose ltc insurance for seniors was grade 3, which means less dependence and a requirement of low-level care. this retrospective study was carried out after obtaining the permission of the institutional review board of myoung-ji hospital in korea and has been performed in accordance with the ethical standards of the declaration of helsinki. kang soo lee, sang-hwan kim, and hee-jin hwang have no conflicts of interest to declare. kang soo lee, sang-hwan kim, and hee-jin hwang certify that no funding has been received for the conduct of this study and/or preparation of this manuscript.

backgroundelderly residents of long-term care facilities are more vulnerable to being prescribed inappropriate medications because of the high incidence of co-medication in this population resulting from the presence of multiple chronic diseases and also age-related changes in pharmacokinetics and pharmacodynamics. objectivewe evaluated the frequency of potentially inappropriate medications and factors influencing their frequency. methodsa retrospective cross-sectional study was conducted in 20 long-term care facilities located in the northwest regions of south korea for 824 patients aged 65 years and older who were assessed between january and february of 2012. potentially inappropriate medications were identified using the 2012 american geriatric society s beers criteria. we assessed the relationship between the frequency of potentially inappropriate medications prescribed and patient age, sex, co-medications, comorbidity, activities of daily living, length of stay, grade of long-term care insurance for seniors, and the bed size and business type of the long-term care facility. resultsof the 529 participants who satisfied our inclusion criteria, 308 (58.2 %) had received at least one inappropriate medication according to the 2012 beers criteria. the most frequently prescribed classes of inappropriate medications were central nervous system drugs (58.7%), anti-cholinergics (21.2%), and cardiovascular medications (10.8%). the most commonly used drugs were quetiapine (28.4%), chlorpheniramine (15.8%), risperidone (6.5%), and zolpidem (5.8%). inappropriate medication use was associated with the number of co-medications and long-term care insurance grade 3, which means less dependence and a requirement of low-level care. conclusionscentral nervous system drugs (58.7 %) were the most prescribed class of inappropriate medications. quetiapine was the drug most often given inappropriately (28.4%). there was a relationship between inappropriate medication use and the number of co-medications. the frequency of inappropriate medication prescriptions was higher among patients whose long-term care insurance for seniors was grade 3, which means less dependence and a requirement of low-level care.

PMC4674516

pubmed-299

in patients with chronic hepatitis and in those with liver cirrhosis, detection of increasing incidences of hepatocellular carcinoma (hcc) requires careful monitoring every 36 months using ultrasound sonography (us), computed tomography (ct), magnetic resonance imaging (mri), and frequent blood tests. once hcc is detected, patients experience repeated recurrence, despite the fact that a variety of hcc treatment methods have been developed, such as anti-viral agents, surgical treatment, percutaneous ethanol injection (peit), radiofrequency ablation (rfa), trans-catheter arterial chemoembolization (tace), and molecular-target drugs. in the last 10 years, tumor vaccines generated from patients ' own formalin-fixed hcc tissues the autologous formalin-fixed tumor vaccine (aftv) has been reported to reduce the recurrence risk of primary resected hepatitis b virus-background hcc by 81% 1. in one case, recurrence of multiple-recurrent hepatitis c virus (hcv)-back ground hcc was clearly suppressed long-term without any additional treatment 2. here, we report a case in which aftv injection resulted in suppression of multiple-recurrent hcv-background hcc recurrence. in this case, we detected a significant density of glypican-3 (gpc3)-specific cytotoxic t lymphocytes (ctl) in the blood at 12 months after the last intradermal injection of aftv. a 55-year-old female patient was diagnosed with hcv-related hepatitis in 2002. liver biopsy showed active chronic hepatitis accompanied by bridging fibrosis and necrotic inflammatory reactions. to reduce the activity of chronic hepatitis, the patient was treated with consensus interferon for 24 weeks. results showed complete remission of the hepatitis as liver transaminases normalized, as well as conversion of seropositive hcv to negative up to the present. when she was 57 years old, two 20-mm hccs were observed in left lobes s2 and s3, and a left hepatic lobectomy was performed in june 2004. in addition, two 10-mm hccs in s5 and s7 were treated with radiofrequency ablation (rfa) in september 2008. the 10-mm hcc in s5 was detected again in january 2011, and was treated with trans-catheter arterial chemoembolization (tace) and rfa. in january 2012, a new 10-mm hcc was found in s6, and a resection was done after treatment with rfa. pathologies obtained after the two hepatectomies showed poorly differentiated hcc in the 2004 specimen and moderately differentiated hcc in the 2012 specimen (fig.1). the liver function has been kept good and the bilirubin levels were<2 mg/dl. the patient did not hope liver transplantation but desired aftv therapy because of the rapid decline in the recurrence interval, that is, 51-, 28-, 12-, and 4-months. pathology and glypican-3 (gpc3) expression in hepatocellular carcinomas. (a) h&e staining and (b) gpc3 immunohistochemistry of representative tissue from a 2004-resected hepatocellular carcinoma (hcc) specimen of the present case. (c) h&e staining and (d) gpc3 immunohistochemistry from a 2012-resected specimen. gpc3 expression (b, d) was observed in areas with hcc (arrows), but not in cirrhotic areas (white stars). we prepared aftv as reported previously 3 using a total of 1.56 g of autologous hcc tissue recovered from formalin-fixed and paraffin-embedded tumors from the two operations. according to the therapeutic schedule employed 1, a single course of aftv therapy applied from september to october 2012 consisted of the following: (1) a delayed-type hypersensitivity (dth) test with immunoadjuvant-free fixed hcc fragments applied to a forearm was initiated 48 h before the first aftv injection to check for allergic reaction. (2) up to three rounds of aftv were injected intradermally into the upper arm at 2 week intervals. (3) a second dth test, performed 2 weeks after the last aftv injection to the other forearm, showed a positive dth response. (4) ultrasound sonography and blood tests for tumor markers which were conducted every 3 months, and computerized tomography every 6 months, revealed no evidence of recurrence or generation of new hcc lesions for more than 27 months. immunohistochemistry to detect gpc3 4 in the hcc specimen resected in 2004 revealed strong expression of gpc in the hcc lesion (fig.1b). we also detected gpc3 expression in the 2012 specimen resected after treatment with rfa (fig.1d). however, we did not observe any gpc3 expression within cirrhotic lesions in either specimen (fig.1b and d). to evaluate aftv-induced gpc3-reactive ctl, we carried out interferon--specific elispot assays as described previously 5, using a target human hcc cell line expressing gpc3 (sk-hep-1/gpc3). the cell line was developed from sk-hep-1/hla-a0201/2402 cells by transfecting with human gpc3-gene. a control cell line (sk-hep-1/vec) although hla subtypes of the patient and the target cell line differ (hla-a0206/3303 and hla-a0201/2402, respectively), hla-a2 (a0201)-restricted gpc3 epitopes are cross-reactive with hla-a0206, allowing detection of gpc3-specific ctl that are reactive to the target cell line 5. glypican-3-specific ctls were clearly observed in peripheral blood drawn 12 months after the first injection of aftv (average 21.5 spots against sk-hep-1/hgpc3 cells vs. nine spots against sk-hep-1/vec control cells) (fig.2). lymphocytes were prepared from the patient's blood drawn at 12 months after autologous formalin-fixed tumor vaccine (aftv) injection. we detected hla-a2-restricted glypican-3 (gpc3) peptide-specific cytotoxic t lymphocytes in the 12-month blood. sk-hep-1/hgpc3, human gpc3 gene-transfected sk-hep-1 cells (sk-hep-1 with hla-a a0201/2402), a human hepatocellular carcinoma cell line unable to express gpc3; sk-hep-1/vec, control vector gene-transfected sk-hep-1 cell line. effector cells (cd8 t cells), 1 10 cells/well; target cells (sk-hep-1 cells), 5 10 cells/well. gpc3, a heparan-sulfate proteoglycans linked to the outer surface of cell membrane via a glycosylphosphatidylinositol anchor 6, is frequently overexpressed in hcc 7,8 and in precancerous lesions in the liver 9. for this reason, a recombinant humanized monoclonal antibody against gpc3 10 and a gpc3-peptide vaccine 11 have been developed for treatment of hcc. treatments with these new agents were well tolerated, and noted measurable immune responses and antitumor efficacy. however, clinical outcome were not necessarily prominent in these phase i trials compared to the previous expectations derived from preclinical studies. autologous formalin-fixed tumor vaccine differs from these specified molecule-targeted agents in that the autologous tumor, containing a wide array of unidentified antigens, is the source of antigens. thus, ctl induced with aftv made from tumor tissue must be polyclonal by nature; for example, polyclonal ctl induced in vitro with a formalin-fixed carcinoembryonic antigen protein 12. at present, no one provided any evidence that the impure tumor antigenic formalin-fixed autologous hcc tissue is truly active to induce a specific cellular immune response against a specified tumor antigenic molecule. the present case is the first one we could identify gpc3-specific cellular immune response based on the autologous formalin-fixed hcc. while we detected gpc3-specific ctl in the patient's blood 12 months after aftv treatment, few gpc3-specific ctl were detected 16 months after the treatment (data not shown). these results may suggest that, although the conspicuous life span of gpc3-specific ctl in blood is<16 months, the immunoprotective effect of aftv continues beyond gpc3-specific ctl lifespan in blood, since this patient presently continued to show no evidence of hcc recurrence 32 months after the second resection of hcc. we consider two hypotheses to explain this continued protection: (1) the gpc3-specific ctl may have differentiated into memory t cells, which migrate to lymphatic tissues and are therefore not conspicuously detectable in peripheral blood. (2) the gpc3-specific ctl apoptosed after killing all target hcc cells in vivo, thereby eliminating all tumor antigens and preventing replicative stimulation to active ctl. this is the first case we could identify gpc3-specific cellular immune response based on impure tumor antigenic formalin-fixed autologous hcc tissue. present results suggest that aftv should be taken in consideration as one of treatment modalities in cases involving potential hcc derived from chronic hepatitis and liver cirrhosis.

key clinical messageautologous formalin-fixed tumor vaccine (aftv) suppressed re-recurrence for more than 32 months of multiple-recurrent hepatocellular carcinoma based on hepatitis c virus-induced liver cirrhosis in a case with previous recurrence interval, 51-, 28-, 12-, and 4-months. we detected glypican-3-specific cytotoxic t lymphocytes in the peripheral blood at 12 months after aftv.

PMC4498860

pubmed-300

techniques and equipment to accomplish endotracheal (et) intubation were the precursor to modern day invasive mechanical ventilation. in recent years, however, the popularity of the et tube has waned. clinically, the et tube is seen as an impediment to spontaneous breathing, a transit route for bacteria to the lower airway, and with the advent of noninvasive ventilation a device to be avoided when possible. of particular interest has been the effect of the et tube on work of breathing and methods to eliminate this work. commonly, pressure support ventilation (psv) has been suggested as the technique of choice for eliminating imposed work due to the et tube. more recently, the technique of automatic tube compensation (atc) has become available to specifically address this issue. in this issue of critical care, maeda and colleagues compare the technique of atc, as provided by the drager evita 4 (dragerwerks, lubeck, germany) and the puritan bennett 840 (carlsbad, ca, usa), versus psv in reducing imposed work of breathing in a lung model. before i comment on the merits of the study, clearly, before the advent of pressure support ventilation in the early 1980s, patients were successfully weaned using t-piece trials and intermittent mandatory ventilation, with no apparent untoward effects. in 1986, shapiro and coworkers presented data from three normal volunteers breathing through et tubes at a constant tidal volume of 500 ml. that report is widely quoted but is limited by the use of unintubated normal individuals and the requirement for a constant tidal volume during increasing respiratory rates. additionally, close review of the data demonstrates that with a size 8.0 et tube the work of breathing in joules per minute does not become excessive until minute ventilation exceeds 15 l/min. brochard and colleagues compared work of breathing during assisted ventilation, four levels of pressure support, continuous positive airway pressure, and after extubation in an effort to determine the role of pressure support in overcoming the imposed work presented by the et tube. that trial evaluated both patients with normal lungs and those with chronic obstructive pulmonary disease (copd). the authors concluded that the pressure support level that eliminated imposed work was between 3 and 14 cmh2o. interestingly, this was determined retrospectively by matching the work of breathing after extubation to the level of pressure support that resulted in equivalent work of breathing during mechanical ventilation. recent work suggests that the work of breathing postextubation may actually increase compared with work of breathing through the et tube, raising questions about the conclusion of the study by brochard and colleagues. weissman evaluated flow-volume loops in 18 postoperative patients intubated with size 7.0 and 8.0 et tubes and found that only ' minimal limitation to airflow ' occurred at volumes and frequencies associated with tidal breathing. that study is one of the very few that contemplate the idea that et tube resistance may not be important when the appropriate size is chosen and the patients pulmonary function has improved to the point that weaning may be considered. of course, there are numerous other studies that suggest that et tube resistance may represent a significant impediment to spontaneous breathing. however, it is important to note that although there remains concern about et tube resistance, and the literature is replete with lung model studies of increased work of breathing, there is not a single clinical trial that suggests that spontaneous breathing through the et tube results in untoward outcomes. the report by maeda and coworkers in this issue of critical care evaluates the two most popular methods of overcoming et tube resistance, namely psv and atc. the authors concluded that tube compensation could not overcome the pressure time product associated with triggering and that pressure support is as effective as atc at 100%. there are, however, tremendous disadvantages to a lung model study in comparing these techniques. calculating the pressure time product and work includes the work required to trigger the ventilator, which can only be overcome by direct measurement of tracheal pressure and triggering from the tracheal signal. this method has been proposed by many, and advanced by the group from gainesville. additionally, although the lung model allows consistency, it can not react to differences in gas delivery. in several human studies comparing psv with atc, the slow flow and longer inspiratory time associated with psv has been associated with dysynchrony. when used in a patient with copd, the patient's high airway resistance and increased compliance allow even small amounts of psv to cause hyperinflation and auto-peep (positive end-expiratory pressure). alterations in pulmonary mechanics, along with the preference of the copd patient for short inspiratory times and long expiratory times, result in neuromechanical dysynchrony during psv. the main proposed advantages of atc over psv are reduced work of breathing as patient demand varies, preservation of a normal, variable breathing pattern, and improved synchrony. in a recent trial of spontaneous breathing before extubation, haberthur and coworkers failed to show any advantage of atc over psv or t-tube trials. one issue not addressed in the study by maeda and coworkers is the role of expiratory compensation. one distinct difference in the operation of the drager evita 4 and puritan bennett 840 is that evita 4 provides both inspiratory and expiratory compensation for et tube resistance. in these cases, the airway pressure may be allowed to drop below peep to facilitate expiratory flow. new modes and new techniques are developed in the hope of resolving clinical problems and often concentrate on a short-term physiologic end-point. conventional wisdom suggests that the et tube is an impediment to efficient spontaneous breathing, yet clinical evidence during spontaneous breathing trials appears to argue to the contrary. the real question may be whether overcoming et tube resistance is necessary, not whether atc is as good as or better than psv. the future of atc, like many new techniques, may not be in overcoming et tube resistance, but as a method of support during spontaneous breathing that improves patient-ventilator synchrony as compared with psv. additional clinical studies are required to complement the excellent laboratory work by the group from osaka reported in this issue. atc=automatic tube compensation; copd=chronic obstructive pulmonary disease; et=endotracheal; peep=positive end-expiratory pressure; psv=pressure support ventilation.

concerns about the work of breathing imposed by the endotracheal tube have led clinicians to routinely use pressure support to overcome this resistive component. more recently, ventilator manufacturers have introduced systems to automatically overcome endotracheal tube resistance, regardless of tube diameter or patient demand for flow. despite the theoretical advantages, neither method appears to provide superior performance. stepping back, the real question may be, is overcoming endotracheal tube resistance really important ?

PMC270725