Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-301

alzheimer's disease (ad) is a progressive, neurodegenerative brain disorder which affects over 37 million people worldwide with an estimated global cost of over $600 billion in 2010 [1, 2]. ad is a growing socioeconomic and financial burden due to its strong correlation with ageing; around 1 in 3 people aged over 80 years have ad, which means that a rapid rise in ad cases is anticipated as life expectancy continues to increase. although several therapeutics are currently available to slow disease progression, there is currently no way to halt or prevent ad. ad is characterized by the presence of extracellular senile plaques and intracellular neurofibrillary tangles in the brain. the major constituents of senile plaques are the amyloid- (a) peptides, which are derived from the proteolytic processing of the amyloid precursor protein (app) within lipid rafts. the a peptide, notably a142, is highly aggregation prone and self-assembles to form a heterogeneous mixture of oligomers and protofibrils, ultimately depositing as fibrils in senile plaques. an accumulating body of evidence indicates that soluble a oligomers, which correlate strongly with disease onset and severity, are the major neurotoxic species in ad [58]. although a oligomers are neurotoxic at nanomolar concentrations and cause ad-related memory deficits, the cellular mechanisms of toxicity are poorly characterised. recently, several neuronal receptors which bind a oligomers have been identified, including the cellular prion protein (prp) and glutamate receptors [10, 11] among others. interestingly, these receptors reside primarily within, or partition into, cholesterol-rich microdomains within the plasma membrane known as lipid rafts. the three steps which underlie a oligomer-mediated neuropathology in ad, are (1) a production, (2) a assembly into oligomers and (3) a oligomers interacting with neuronal receptors. crucially, all three of these processes occur in lipid raft domains of the plasma membrane which are considered to play a key role in the development of ad. in this paper, we will outline the pivotal role that lipid rafts play in linking together the generation, self-assembly and toxicity of a oligomers, which underlie the development of the neuropathology in ad. a major focus will be upon the interaction between a oligomers and their putative cellular receptors. the multitude of different lipids and proteins within the plasma membrane were once thought to be distributed homogeneously across the entire lipid bilayer, as proposed by the fluid mosaic model in 1972. however, the plasma membrane is now known to be more akin to a sea of disordered phospholipids, in which float microdomains with distinct lipid compositions, known as lipid rafts. lipid rafts are small (10200 nm), heterogeneous and highly dynamic assemblies that are enriched in specific components, namely cholesterol and sphingolipids (figure 1) [14, 15]. biochemically, lipid rafts are defined by their relative insolubility in nonionic detergents at low temperature, conferring upon them the alternative name, detergent-resistant membranes (drms). lipid rafts are also known as liquid-ordered domains because the highly saturated sphingolipid acyl chains enable closer lipid packing, and therefore more restricted lateral movement, than the mainly unsaturated acyl chains of the phospholipids in the surrounding nonraft regions of the membrane. functionally, lipid rafts serve to compartmentalise cellular processes by concentrating certain proteins and lipids within the same microenvironment. lipid rafts are particularly enriched in glycosyl-phosphatidylinositol (gpi)-anchored and acylated proteins due to the preferential intercalation of the saturated acyl chains into the liquid-ordered environment. other proteins can also associate with lipid rafts either directly or through binding to other cofactors or ligands. the dynamic clustering and pinching off of lipid rafts regulates the spatial and temporal assembly of signalling and trafficking molecules, forming short-lived but vital signalling platforms. lipid rafts are implicated in various essential cellular functions, including signal transduction, cell adhesion and protein/lipid sorting. of particular relevance here are cell signalling, sorting and axon guidance, as these processes are essential for neural development and synaptic plasticity [19, 20]. crucially, neuronal lipid rafts are also required for the maintenance of dendritic spines and healthy synapses, which are vital for neural communication including learning and memory; processes which fail in ad. the observation that lipid rafts are much more abundant in mature hippocampal neurons than in other cell types emphasises their physiological importance within the memory centre of the healthy brain, and may explain why hippocampal neurons are a primary target for a oligomer toxicity and destruction in ad. lipid rafts are involved in the regulation of app processing and the generation of the a peptide which is the driving force in ad pathology [23, 24]. for comprehensive reviews detailing the involvement of membrane rafts in ad and a production, the a peptide is produced by the lipid raft dependent amyloidogenic processing of its precursor protein, app (figure 1). the amyloidogenic cleavage of full-length app is initiated by the -site app cleaving enzyme-1 (bace1), a transmembrane aspartic metalloprotease. a large, soluble ectodomain (sapp) is released to leave behind a membrane-anchored c-terminal fragment (c99) which retains the intact a sequence. the second amyloidogenic cleavage of app involves a -secretase complex which contains presenilin-1 or presenilin-2 (the catalytic component), presenilin enhancer-2 (pen2), nicastrin and anterior pharynx defective-1 (aph1). the -secretase complex cleaves the remaining c99 stub to release a peptides of between 3942 residues in length, depending upon the precise cleavage site, along with the app intracellular domain (aicd). although the majority of full-length app is localised to nonraft regions of the plasma membrane, where nonamyloidogenic cleavage by the -secretases adam 9, 10, and 17 precludes a formation, a subset of both app and bace1 partitions into lipid rafts along with -secretase components. both bace1 and the -secretase subunits undergo posttranslational s-palmitoylation which aids their targeting to lipid raft domains. in the case of app, a direct interaction with cholesterol the major component of lipid rafts was recently identified. high cholesterol increases the partitioning of app, along with bace1 and -secretase components, into lipid rafts. a large body of evidence points towards lipid rafts being the physiological site of amyloidogenic a production by bace1 and the -secretase complex. for example, both the copatching of app and bace1 by cross-linking antibodies and the exclusive targeting of bace1 to lipid rafts by the addition of a gpi-anchor significantly increased app cleavage at the -secretase site. furthermore, enrichments in lipid raft components, namely cholesterol and ganglioside gm1, promote the generation of a [31, 33]. all four of the -secretase subunits are also enriched and active within lipid raft fractions derived from human brain [34, 35] and lipid raft-type membranes in vitro [36, 37]. in the brain, the majority of a is found within detergent-resistant, glycolipid-enriched rafts, along with -secretase components. the composition of lipid rafts purified from ad brains has been shown to be abnormal, with the rafts being more ordered and more viscous, which implies that the modulation of lipid raft composition may present a therapeutic avenue for modulating ad-related neuropathology. this has led to a number of researchers investigating whether depleting lipid raft components could lower a production and therefore prevent ad. cholesterol, being a major component of lipid rafts and a risk factor for ad, was the obvious choice to target. for a recent review of the involvement of cholesterol in ad, cholesterol depletion has indeed been shown to reduce app partitioning into lipid rafts which precludes its interaction with bace1 and -secretase components, thus lowering a production. hypercholesterolaemia is linked to increased a production and deposition in the brain, both in humans [4345] and in rodents [4648] and is linked to an increased risk of developing ad. cholesterol depletion also lowers a production in cultured cells and one study showed that a 70% reduction in cholesterol in living hippocampal neurons was sufficient to completely abolish a production. taking this into account, cholesterol-lowering drugs known as some retrospective epidemiological studies have shown that the administration of statins, which lower cholesterol levels, can reduce the incidence of dementia, including ad [5153]. however, other studies have shown no correlation between statin usage and dementia and the effect of statins upon disease progression and cognitive decline in ad patients has been challenged. intriguingly, it was revealed recently that a production actually reduces cholesterol in cultured cells of neuronal origin by increasing efflux, possibly acting as a chaperone to remove excess cholesterol from the brain to the circulation. although a reduction in cholesterol may go some way towards reducing a levels in the brain, much longer-term epidemiological studies and clinical trials initiated before significant neuronal loss and cognitive function are apparent are required in order to further elucidate the effects of lowering cholesterol levels upon ad onset and neuropathology. lipid rafts contain many essential components other than cholesterol, such as sphingolipids, and it is likely that the modulation of just one factor will not completely abolish a production in vivo. it is important to remember that cholesterol metabolism in the brain is largely isolated from the rest of the body by the blood-brain barrier. as nearly all of the cholesterol in the brain is synthesised in situ, the modulation of cholesterol levels within neurons represents a more difficult pharmaceutical challenge and the blood-brain barrier permeability of the drugs used needs to be considered. furthermore, even if cholestxerol depletion mediates a reduction in a levels, a oligomers effect neurotoxicity and memory impairments at low nanomolar concentrations. therefore, residual levels of a production may be sufficient for continued a oligomer-mediated toxicity. the a peptide is natively unfolded and, under certain conditions, it aggregates to form a heterogeneous mixture of soluble oligomers, protofibrils and fibrils. it was accepted for a long time that the a fibrils that deposit in neuritic plaques, which are observed post mortem in diseased brains, were responsible for neurotoxicity in ad. a fibrils have been reported to induce neuronal dysfunction and cell death, although fibrils are less potent neurotoxins than soluble forms of a [60, 61]. interestingly, fibrils have been found to become more neurotoxic upon fragmentation, raising the possibility that soluble species released from fibril ends may underlie their neurotoxicity. a plethora of studies have now demonstrated that levels of soluble a oligomers in the brain correlate much better than plaques or fibrils with ad onset, progression and severity [5, 6, 8, 63, 64]. within the last fifteen years, a large number of studies from research groups worldwide have reported the existence of many different oligomeric assemblies from various sources, including ad brain and cerebrospinal fluid (csf) samples, secreted into the conditioned medium of cultured cells or prepared artificially from recombinant or synthetic a peptides. a heterogeneous range of sizes and peptide conformations have been observed among these natural and artificial a oligomers, including dimers and trimers [66, 67], tetramers, hexamers and the dodecameric a*56, globulomers, ring-shaped annular protofibrils and higher molecular weight a-derived diffusible ligands (addls) which can comprise hundreds of monomeric subunits [9, 70] (figure 2). however, despite the disparity in size and source, a oligomers appear to share important functional properties. notably, both natural and synthetic a oligomer preparations bind to hippocampal neurons and cells of neuronal lineage, causing a loss of dendritic spines, neurotoxicity, the inhibition of long-term synaptic potentiation (ltp: an electrophysiological correlate of learning and memory) and impairments in working memory at nanomolar concentrations [64, 67, 68, 7073]. the preferential binding and toxicity of a oligomers towards neurons in the hippocampus may explain why a oligomers correlate with ad severity and disease progression [9, 68, 70]. a is a physiological peptide which is present in the brain tissue and csf of healthy subjects throughout life, without necessarily causing neurodegeneration [7476]. many studies have shown that monomeric, nonaggregated a does not cause the neurotoxic effects that are mediated by a oligomers. in fact, monomeric a has recently been reported to have neuroprotective roles in the brain [77, 78]. the aggregation of a is necessary for its toxicity and the emerging picture is that soluble a oligomers are the proximate neurotoxins in ad [8, 80]. the aggregation of a is therefore a critical step in the development of ad pathogenesis, and one in which lipid rafts appear to play a fundamental role. neuronal sensitivity to a-induced toxicity has been found to be dependent upon a binding to the cell membrane and a has been identified in lipid rafts from cultured cells and from human and rodent brains. soluble a dimers accumulate rapidly, and have been found at elevated levels, in lipid raft fractions isolated from human and transgenic mouse model ad brains. importantly, a has been shown to accumulate in presynaptic terminals in ad cortex where it colocalises with the lipid raft markers cholesterol and ganglioside gm1. taken together, these data suggest that a accumulation and aggregation within lipid rafts may underlie ad neuropathology. as cholesterol is a major component of lipid rafts, it was postulated to facilitate a oligomerisation on neuronal membranes. the brain is particularly enriched in cholesterol, harbouring over 23% of the body's total complement but comprising only around 2% of total body mass. however, the role of cholesterol in promoting the assembly of a is controversial and conflicting evidence has been presented in recent years. the main difficulty is being able to distinguish between the key role of cholesterol in building the lipid raft domains necessary for a production and the suggested role of cholesterol in promoting a oligomerisation. as discussed previously, raised cholesterol has been linked to ad; is this solely due to an increase in total lipid raft composition of the plasma membrane which increases amyloidogenic processing of app to yield more a peptide or due to a direct effect on a oligomerisation? a growing body of evidence suggests that certain components of lipid raft domains may play a much more sinister role in catalysing the conversion of the aggregation-prone a peptide to its neurotoxic, oligomeric states. cholesterol is known to modulate the interaction of the a peptide with lipid bilayers. further, a oligomers isolated from ad patients associate with drms in a cholesterol-dependent manner, and cholesterol depletion reduces the aggregation of a. it is currently unknown, however, whether this latter effect is due to a direct interaction between a and cholesterol, or due to the overall depletion in lipid raft domains and/or the subsequent change in composition and properties brought on by a reduction in cholesterol. conversely, a recent study revealed that increasing the level of cholesterol in human neuroblastoma cells actually reduced the ability of synthetic a oligomers to bind, in spite of the colocalisation of the a oligomers with the lipid raft component ganglioside gm1. these data agree with the authors ' previous finding that an increased level of membrane cholesterol exerts a protective effect against a oligomer toxicity. in the more recent study it was proposed that a fluctuation in cholesterol levels may alter the physical properties of lipid rafts thereby modulating oligomer binding. cholesterol can also facilitate a aggregation through the structural modification of other lipid raft components. a recent study using reconstituted membranes revealed a structural role for cholesterol in modulating the conformation of glycosphingolipids. depending on the type of glycosphingolipid, cholesterol can either facilitate (such as for ganglioside gm1) or inhibit the interaction of a peptides with lipid rafts through fine-tuning of the glycosphingolipid conformation. this reinforces the notion that a binding to, and aggregation upon, neuronal lipid raft domains can not be ascribed to a single component, but rather that multiple players are likely to be involved. in fact, mounting evidence suggests that gangliosides within lipid rafts appear to be the main driving force behind the oligomerisation of a on neuronal membranes. the development of ad within certain brain regions has been found to correlate with increased ganglioside levels. gangliosides are glycosphingolipids with one or more sialic acid moieties attached to the sugar chain. gangliosides are found predominantly in the central nervous system, where they are enriched in lipid rafts due to the preferential packing of their saturated acyl chains within the liquid-ordered phase. a study in 1995 revealed that a population of membrane-bound a tightly bound to gangliosides exists in ad brains. more recently, exogenously-applied a was shown to bind to neuronal membranes and to redistribute into lipid rafts where it colocalised with ganglioside gm1 in a time-dependent manner. gm1 facilitated the binding and accumulation of a oligomers at lipid raft domains and appeared to be required for the a oligomer-mediated lipid peroxidation of drms. ganglioside gm1 contains just one sialic acid moiety and plays important physiological roles in neuronal function. a appears to interact with the sialic acid moiety of gangliosides such as gm1 and these bound aggregates can go on to seed further a aggregation. the interaction between sialic acid and a induces a conformational rearrangement of the a peptide chain which may potentiate a oligomerisation. drms derived from ganglioside-rich rat brain, but not from liver, were found to promote the oligomerisation of a. further, this study revealed that the removal of cholesterol or protein from these raft fractions did not prevent a aggregation, providing evidence that neither cholesterol nor protein is essential for this process. however, lipid raft fractions containing very low levels of gangliosides still retained some a oligomerisation ability, and therefore ganglioside-independent aggregation mechanisms can not be ruled out. when the first synthetic a oligomers were prepared from a142 peptide by the klein laboratory in 1998, it was observed that their binding to hippocampal neurons and cultured nerve cells was abolished by treating the cells with trypsin. this, coupled with the low oligomer concentration (5 nm) required for neurotoxicity, implied that specific protein receptors were responsible for the binding of a oligomers and for the subsequent transduction and amplification of neurotoxicity. indeed, a recent study found that a oligomer binding to neurons was saturable with an estimated apparent kd of ~0.4 nm. this finding implied that one or more high-affinity receptors are responsible for a oligomer binding and subsequent neurotoxicity. immunofluorescence microscopy has revealed that a oligomers bind to dendritic spines of hippocampal neurons where they colocalise with postsynaptic markers [9, 98, 99]. interestingly, a oligomer binding to neurons has a punctate appearance, which is reminiscent of the appearance of lipid raft localised proteins. several putative neuronal receptors for a have been identified in recent years, namely proteins that are related to mechanisms of memory and neuroprotection in the brain. noteworthy, all of these receptors either reside primarily within, or can partition into, lipid raft domains at the surface of neurons. lipid rafts may therefore hold the key to understanding how the deleterious effects of a oligomers are transduced through binding to specific receptors within these microdomains. in 2009, laurn and colleagues reported that the cellular prion protein (prp) is a specific, high-affinity neuronal receptor for a142 oligomers. prp is a gpi-anchored protein that is expressed at high levels in the brain, particularly at synapses and axons, where it resides in lipid rafts. the misfolded form of the prion protein (prp) is infamous for being the causative agent in mad cow disease (bovine spongiform encephalopathy, bse) and its human equivalent, creutzfeldt-jakob disease (cjd). although the correctly-folded prp is critical for prion disease pathogenesis, its physiological function remains enigmatic, with potential neuroprotective roles in oxidative stress defence, metal ion homeostasis and antiapoptosis. in a search to identify neuronal receptors for a oligomers, laurn et al. screened a mouse brain expression library of 225,000 cdna constructs from which only two positive clones, both encoding full-length prp, were isolated that were able to bind a oligomers with high affinity and specificity. interestingly, the prp homologues shadoo and doppel were found not to bind a oligomers to any significant degree. a further, more focussed screen of 352 clones encoding transmembrane proteins identified amyloid- precursor-like protein 1 (aplp1) and transmembrane protein 30b (tmem30b) as weak a receptors, although their specificity for oligomeric a was poor. the 7 nicotinic acetylcholine receptor (nachr7) and the receptor for advanced glycation end products (rage) were also assayed due to their previously reported affinities for a peptides [103, 104], although neither displayed high-affinity a oligomer binding. therefore, prp was the only identified receptor to display both high affinity and high specificity for a oligomers. a direct interaction between prp and a oligomers was confirmed and the core oligomer binding region of prp was narrowed down to amino acids 95110, a positively charged cluster rich in lysine residues. prp was also shown to mediate the inhibition of ltp that is induced when hippocampal slices were incubated with a oligomers at nanomolar concentrations. a follow-up in vivo study revealed that the presence of prp is required for the a oligomer-mediated memory impairments in an ad model mouse. taken together, these data indicate a strong association between a oligomers binding to prp within lipid rafts of hippocampal neurons and the induction of memory deficits that are characteristic of ad. nevertheless, there has been some dispute over the role of prp in transducing the deleterious effects of a oligomers in vivo, as other studies have reported data which oppose this theory. first, balducci and colleagues reported that although a oligomers bind tightly to prp they cause impairments in long-term memory in mice independently of prp. in this study, the effects of synthetic a oligomers upon wild-type mice were observed, whereas gimbel et al. further, the synthetic depsipeptide and the oligomer preparation method utilised by balducci et al. differed from those used by gimbel and coworkers, raising the possibility that prp does not have the same binding affinity for all types of a oligomers. second, the aguzzi group crossed an ad mouse model, which suffers from a-dependent memory deficits in the form of ltp impairment, with mice expressing either wild-type prp, a secreted form of prp (lacking its gpi anchor) or no prp. they found that the presence or absence of wild-type prp had no effect upon the a-mediated inhibition of ltp. however, expression of the secreted form of prp was found to suppress the impairment in ltp, which the authors proposed may be due to the potential chelation and subsequent degradation of a oligomers by soluble prp in the extracellular milieu. third, kessels and coworkers reported the influence of prp upon hippocampal neurons expressing a c-terminally truncated form of app in a viral expression construct. the same loss of dendritic spines and inhibition of ltp were observed in the presence and absence of prp, suggesting that a-mediated synaptic defects do not require prp. however, laurn and colleagues have emphasised the differences in the model system utilised by kessels and coworkers in their study which may account for the opposing data, namely the viral expression of app, a higher concentration of a oligomers and a difference in the observed suppression of synaptic plasticity. further investigation is needed to clarify the role of prp in modulating the a oligomer-mediated impairments in memory and ltp. differences in the oligomer preparations, age and genotype of the mouse models, the nature of the promoter elements driving gene expression and the particular memory tests employed by the different authors may account for the discrepancies in the data. the binding of a oligomers to prp is not the first time that prp has been linked to ad. senile plaques from a subset of ad patients were observed to contain prp and abundant a deposits have been observed in some cjd cases. furthermore, the met/val 129 polymorphism in the prnp gene that encodes prp is a risk factor for early-onset ad. in 2007, we demonstrated that prp negatively modulates a production through inhibition of the app cleaving enzyme, bace1. these data, along with the recent discovery that prp binds to a oligomers and transduces their deleterious effects, raises the intriguing possibility of a feedback loop. we propose that, physiologically, prp maintains a production at a low level through bace1 inhibition, but in ad this interaction may be disrupted by a oligomers binding to prp and causing its segregation from bace1. therefore, a oligomers binding to prp may also promote their own production through the ablation of bace1 inhibition by prp. more recently, levels of prp have been shown to be reduced in ad brains [115, 116] possibly arguing against prp being involved in mediating the neurotoxic effects of a oligomers, at least in the terminal stages of the disease. it is important to note that laurn and colleagues reported that the removal of prp from hippocampal neurons only reduced a oligomer binding by approximately 50%. this suggests that other receptors not identified in the expression library screen due to nonpreferential binding conditions or a low affinity for the particular type of a oligomers that were used, and/or nonprotein lipid raft components, may play equally crucial roles in a oligomer binding and neurotoxicity. glutamate receptors, which possibly exist in a complex with prp, represent a candidate interacting partner for a oligomers which could explain the deleterious effects upon hippocampal synaptic plasticity. synaptic failure and impairments in synaptic plasticity are hallmarks of early ad neuropathology [100, 118, 119]. ltp and long-term depression (ltd) are mechanistic dimmer switches which facilitate synaptic plasticity by strengthening or weakening communication across a synapse, respectively, with ltp being essential for hippocampal-dependent learning and memory [120, 121]. numerous lines of study have confirmed that soluble a oligomers from various sources, including those isolated from ad brains, disrupt hippocampal ltp in vitro and in vivo and cause impairments in learning and memory [9, 67, 70, 107, 122, 123]. although not all studies agree, it has also been demonstrated that a oligomers can provoke ltd which opposes ltp [67, 124, 125]. neuronal receptors which modulate ltp and/or ltd are therefore likely candidates for the specific binding of a oligomers. additionally, glutamate receptor dysfunction has been implicated in ad which is characterised by memory deficits caused by impaired synaptic plasticity. glutamate receptors consist of two classes; ionotropic (cation-specific ion channels) and metabotropic (g-protein-coupled). n-methyl-d-aspartate receptors (nmdars) constitute a major class of glutamate receptors in the mammalian brain which localise to the postsynaptic membrane of excitatory synapses. the membrane channel is usually blocked by mg ions which are displaced when synaptic transmission results in depolarisation and glutamate release and binding. nmdar channel opening leads to the rapid influx of ca which triggers ltp induction. longer-term effects which maintain the reinforced synapse include the activation of -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (ampars), altered gene expression and kinase activity and the growth of new dendritic spines. interestingly, nmdar activation can also stimulate ltd, having the opposing effect of synapse weakening, and this appears to depend upon the nature of the stimulus and the subtype of nmdar involved. nmdars localise to lipid raft domains where they interact with flotillins [131, 132] although they can move laterally between raft and nonraft domains in response to cues including phosphorylation. statins, which deplete cellular cholesterol thus reducing lipid raft formation, have been shown to reduce the localisation of nmdars to lipid raft domains, which has a neuroprotective effect. mounting evidence points towards a central role for nmdars in the modulation of a oligomer toxicity. soluble a oligomers inhibit nmdar-dependent ltp [70, 135] and exhibit postsynaptic binding to hippocampal neurons which express nmdar subunits glun1 and glun2b. a reduction in nmdar subunits glun1 and glun2b crucially, a recent study has confirmed that a oligomer-mediated early synaptic dysfunction depends upon the activation of glun2b-containing nmdars. a oligomers were found to decrease the nmdar-dependent influx of ca into dendritic spines, and to reduce dendritic spine and synapse density in a mechanism which involve the subsequent phosphorylation of tau. nmdar antagonists, including one which is specific for glun2b subunits, were able to reverse the a-induced loss of dendritic spine density [100, 137, 139]. these effects are consistent with a oligomers blocking the nmdar-mediated stimulation of ltp whilst promoting nmdar-mediated ltd. in addition, a oligomers have been shown to stimulate the excessive generation of reactive oxygen species (ros) through an nmdar-dependent mechanism, suggesting a link between aberrant ros regulation and a-induced cognitive impairment. furthermore, evidence to confirm a direct interaction between a oligomers and nmdar subunits has recently been presented. partial colocalisation was observed between nmdar glun2b and a oligomers in hippocampal slices, which increased upon the addition of glutamate, although the maximum colocalisation was less than 50%. however, an indirect model proposed by venkitaramani and colleagues suggests that the a oligomer-mediated decrease in glun2b-containing nmdars results from the former binding to -7 nicotinic acetylcholine receptors (7nachr), which activates striatal-enriched tyrosine phosphatase (step), in turn stimulating nmdar internalisation. more recent data has revealed elevated levels of step in a mouse model of ad and in human ad brains, and that the removal of step abrogates the a-mediated reduction in nmdars at the cell surface. whether or not a oligomers interact with nmdars directly, growing evidence suggests that nmdars play an important role in transducing the deleterious effects of a oligomers upon synaptic functionality. the mglur5 metabotropic glutamate receptor plays important regulatory roles in neuronal calcium mobilisation and the modulation of ltp and excitatory postsynaptic potentials in hippocampal neurons [144, 145]. recently, mglur5 was identified as a novel a oligomer receptor in a study of the behaviour of fluorescently-labelled a oligomers on hippocampal neurons and their interaction with neuronal receptors. the a oligomers bound to excitatory synapses where their mobility decreased as they aggregated to form larger clusters over time. consistent with previous data, a oligomers caused a removal in nmdars from synapses and were found to coimmunoprecipitate with nmdar subunits. interestingly, the a oligomers also formed complexes with mglur5 receptors, which caused their lateral redistribution into dendritic spines followed by ca dysregulation. renner and colleagues also observed a time-dependent increase in lipid raft-localised mglur5s which suggests that a oligomers reduce the mobility of mglurs, causing their aberrant aggregation within pathological signalling platforms. when mglur5 was removed from mouse hippocampal neurons, a oligomer binding was reduced by approximately 80% and the loss of nmdars from the cell surface was prevented. metabotropic glutamate receptors have been implicated previously in the pathogenesis of ad and other neurodegenerative disorders. impaired mglur signalling in the cortex of ad patients has been shown to correlate with ad-related neuropathological changes. a recent study revealed that the a peptide upregulates the expression of mglur5s in astrocytes, protective nonneuronal cells which are implicated in ad pathogenesis and inflammation. increased levels of mglur5s were observed in the brains of down's syndrome patients; a disease in which elevated levels of a result from the triplication of the app gene. various other lipid raft-associated proteins have been reported to effect a-mediated synaptic dysfunction. for instance, the removal of nerve growth factor receptors (ngfrs), including trka and p75 neurotrophin receptor, from cells treated with gm1-induced a oligomers caused a significant reduction in oligomer-mediated cytoxicity. ngfr dysfunction and aberrant ngf signalling is associated with ad and increased a production [152, 153]. although no direct interaction has been shown to our knowledge, it is possible that interplay between a oligomers and ngfrs may form part of a positive feedback loop which serves to reinforce a oligomer production, whilst blocking ngf signalling with deleterious effects upon neuronal survival. physiologically, ngf binds to trka causing the translocation and clustering of receptors within lipid rafts. the binding of a oligomers to trka and other ngfrs may therefore cause aberrant lipid raft clustering which prevents or disrupts the formation of the normal signalling platforms. recent research proposes that impaired insulin signalling may be involved in ad, even leading to the hypothesis that ad represents a third type of diabetes. insulin receptors, which are robustly expressed in hippocampal neurons, were found to bind a oligomers and to undergo internalisation from dendritic spines. perturbations in insulin signalling in the brain caused by a oligomers may impair memory and ltp. interestingly, insulin receptor subunits are also enriched in lipid raft domains in hippocampal neurons. the emerging picture is that lipid rafts accommodate multiple receptors for a oligomers, namely prp along with nmdar, mglur5 and possibly other, lower affinity receptors. interestingly, there is evidence to suggest that these three lipid raft-associated receptors interact together. it has also been reported that prp inhibited nmdar function in hippocampal neurons and coimmunoprecipitated with nmdar subunits. the functional and physical links between these a oligomer receptors suggest the existence of a multi-component, a oligomer binding raft complex, comprising of prp, mglur5 and nmdar (figure 3). whether the formation of this complex is required for oligomer binding, or whether the interaction of a oligomers with the individual proteins induces its assembly, is a chicken and egg situation. one possible hypothesis is that a oligomers promote the clustering of prp and glutamate receptors into pathological mega-scaffolds which induce both toxic loss- and gain-of-function downstream effects. for instance, the aberrant localisation of glutamate receptors may impede neuronal signalling mechanisms including ltp, while the clustering or internalisation of nmdars may promote their ltd-inducing functionality. the combined effects of oligomer binding upon more than one glutamate receptor is likely to be a large disturbance in ca homeostasis which results in pathological signalling cascades. interestingly, the prp-mediated response to oxidative stress is thought to induce signalling cascades which can modulate ca flux and synaptic plasticity. furthermore, a oligomers may cause the internalisation or loss of function of components such as prp thus reducing neuroprotection against oxidative stress at the cell surface. the clustering of a oligomers at lipid raft domains may also cause damage to physiologically important signalling rafts, thus impairing neuronal function. furthermore, the a oligomer-induced redistribution of neuronal proteins into lipid rafts may influence their nonraft interacting partners, with additional deleterious effects upon neuronal function and integrity. neuronal lipid rafts are crucial modulators of a production and aggregation, leading to the accumulation of neurotoxic a oligomers in the brain which drive ad pathology. recent evidence now incriminates lipid rafts as pathological signalling platforms in which a oligomer receptors, such as prp and glutamate receptors, cluster. a oligomer binding appears to induce the aberrant localisation of these proteins with deleterious effects upon their physiological functions including hippocampal ltp, which underlies memory, and defence against oxidative stress. in this way, lipid rafts appear to be directly responsible for the transduction of a oligomer-mediated memory impairments and neurotoxicity which characterise ad. lipid rafts are not only implicated in ad but may also be the key to a range of neurodegenerative proteinopathies, including parkinson's disease, huntington's disease, amyotrophic lateral sclerosis and prion diseases (reviewed in). indeed, lipid raft disruption protects neurons against the toxicity of other oligomers besides a and lipid rafts may therefore represent generic platforms for oligomer-mediated neurotoxicity. understanding the cell biology of the downstream effects of amyloid oligomers binding to neuronal lipid raft proteins may uncover potential therapeutic targets for the prevention of ad and other neurodegenerative diseases.

lipid rafts are membrane microdomains, enriched in cholesterol and sphingolipids, into which specific subsets of proteins and lipids partition, creating cell-signalling platforms that are vital for neuronal functions. lipid rafts play at least three crucial roles in alzheimer's disease (ad), namely, in promoting the generation of the amyloid- (a) peptide, facilitating its aggregation upon neuronal membranes to form toxic oligomers and hosting specific neuronal receptors through which the ad-related neurotoxicity and memory impairments of the a oligomers are transduced. recent evidence suggests that a oligomers may exert their deleterious effects through binding to, and causing the aberrant clustering of, lipid raft proteins including the cellular prion protein and glutamate receptors. the formation of these pathogenic lipid raft-based platforms may be critical for the toxic signalling mechanisms that underlie synaptic dysfunction and neuropathology in ad.

PMC3014710

pubmed-302

in dentistry, the concept of aesthetics is extremely subjective and is related to beauty, harmony and the needs of the patient. the interactions between new restorative materials and techniques allow the reproduction of dental structures, restoring form and function in such a way that restorative procedures become imperceptible. nevertheless, during the evaluation of aesthetically compromised teeth, we encounter unfavorable clinical situations of great complexity, characterized by deep invasions of the mineralized structures. the reproduction of the optical characteristics of the teeth, such as translucency, opalescence and fluorescence, requires a considerable knowledge of restorative techniques and the materials currently available. dental enamel defects have been associated with a broad spectrum of aetiologies, including genetic and epigenetic factors such as systemic, local and environmental factors. a serious disturbance that occurs during the stages of enamel formation will impact the quality and/or quantity of the enamel formed, depending on the phase of amelogenesis that is affected and the duration of the stimulus on the ameloblasts. the consequence of this disturbance in the formation of the organic enamel matrix is enamel hypoplasia, which can be characterized as small grooves, depressions and cracks in the enamel surface that can be viewed in mild cases. this article presents a case report of a restorative treatment of enamel hypoplasia using hybrid composite resin to mask color alteration and enamel defects of the anterior upper teeth. a 22-year-old female patient was referred to the dental clinic, reporting a visual discomfort from the presence of irregularities and discoloration in the maxillary incisors. dental history and clinical examination revealed that she had a soft form of enamel hypoplasia [figure 1]. clinical examination also evidenced an enamel defect in the maxillary lateral and central incisors, with rough surfaces with irregular limits that principally involve the middle third of the crown [figure 2]. initial clinical aspect of the maxillary incisors a buccal view of the central and lateral incisors with hypoplastic alterations the clinical situation revealed that it was not possible to re-establish aesthetics and function without the use of a restorative procedure. the position and pattern of the enamel irregularities, the occlusion and a tooth remnant with a large substrate suggested that a composite resin restoration would be a reliable option for this case. the patient was systemically healthy, presented an overall plaque index and gingival index of below 10% and the restorative area was free from visible plaque. a slight enameloplasty, using a spherical 1015f diamond bur (kg sorensen, so paulo, brazil) and manual instruments, was performed on both the irregularities and the limits of the tooth defect [figures 3 and 4]. the regularization of the defects created a good substrate that was favorable for adhesive restorations. delimitation of the tooth irregularities with graphite enameloplasty with a spherical diamond bur for smoothing out defects the color was recorded using the vitapan classical scale (vita zahnfabrik, bad sckingen, germany), and the shade a2/a3 was considered as the initial color. briefly, the dental surface was acid etched (35% phosphoric acid) [figure 5], rinsed for 30 s and dried with absorbent paper. a two-component adhesive system (adhese, ivoclar vivadent ag, schaan, liechtenstein) was applied on the dentin and the enamel and was light-cured for 10 s with an intensity of 1400 mw/cm (radii led curing light, sdi, australia) [figure 6]. the dental surface was acid etched (35% phosphoric acid) a two-component adhesive system was applied on the dentin and on the enamel a combination of the incremental and stratified layering technique was used to fill the tooth using a highly aesthetic nanohybrid composite resin, ips-empress (ivoclar vivadent ag). the composite was added in increments of 1.52 mm and was light-cured after every layer, according to the manufacturer's instructions. first, the dentin was simulated with a thin layer of a microhybrid composite (da3) and a final layer with an enamel composite (ea2), which was placed with a fine #2 brush (cosmedent, chicago, usa) for fine detailing/texturizing to simulate the enamel, increasing the final brightness of the restoration [figure 7]. a clinical view of the central incisor immediately after the restorative procedures the contouring was refined using 30-blade carbide trimming burs (9714ff, kg sorensen), and the final polishing was performed with a high-luster polishing paste (opal l, renfert gmbh, hilzingen, germany) using goat-hair brushes and cotton buffs (renfert gmbh). four months after the restoration, a good final aspect was observed and the lateral smile view exhibited an imperceptible restoration [figures 8 and 9]. with the valuation of aesthetics, minimally invasive restorative techniques have provided an expansion of the current conservative philosophy. nevertheless, during the evaluation of aesthetically compromised teeth, we encounter adverse clinical conditions of great complexity, marked by the invasion of the mineralized structures at depth. enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel and remaining certain areas susceptible to decay; it is responsible for a major proportion of lesions. the irregularities present in a hypoplasia provide favorable conditions for the retention of plaque and the early development of caries lesions, which progress and reach deep into the enamel and the dentin. one of the signs of hypoplastic lesions is diminishing enamel luster and dental surfaces that have become eroded with cavitations and irregular wear because of the loss of the microanatomy affecting the color, morphology and texture of teeth. on some occasions, hypoplasia is mistaken for fluorosis; however, enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel, triggered by diseases, systemic disorders, trauma and infections in the pulp of deciduous teeth. it manifests with partial or complete absence of the enamel, which can be systemic (when it affects a group of teeth) or local (when it has asymmetric distribution and is relegated to a single tooth). because it is neither fully transparent nor fully opaque, some modern composites provide optical similarities consistent with natural teeth, yielding satisfactory levels of opalescence, value and chroma. it is important to consider that the final restoration is dependent on both the thickness and the varying degrees of translucency and opacity of the several layers of the composite. of all dental structures describe a minimally invasive technique performed in cases of enamel hypoplasia based on enamel microabrasion and complemented with composite resin restorations. the procedures employed are simple, but they require knowledge of the real causes of the staining and comprehension of restorative techniques. various treatment protocols may be performed, depending on the level of involvement and the severity of the lesions. composite resin restorations are fully capable of reproducing the appearance of a natural tooth with highly aesthetic outcomes. in this context, the main goal of the treatment of enamel hypoplasia is to re-establish the anatomical harmony between occlusion, function and aesthetics and to restore patient self-esteem, promoting social and psychological benefits. in conclusion, this case report demonstrates that restorative rehabilitation, in addition to promoting health, may provide a more favorable aesthetic appearance for the smile, matching the tooth polychromatic and raising the self-esteem of the patient.

enamel hypoplasia is a developmental defect of the enamel that is produced by a disturbance in the formation of the organic enamel matrix, clinically visible as enamel defects. disorders that occur during the stages of enamel development and maturation reduce the amount or thickness of the enamel, resulting in white spots, tiny grooves, depressions and fissures in the enamel surface. the complexity and intensity of the dental deformity lesions will conduct the ideal treatment-associating conservative techniques. this article presents a case report of a restorative treatment of enamel hypoplasia using hybrid composite resin to mask color alteration and enamel defects. an aesthetic appearance that respects the tooth polychromatic and the self-esteem of the patient can be achieved with this approach.

PMC3354799

pubmed-303

pekinensis) is a diploid (2n=2x=20) dicot with a genomic size of 550 mb (http://www.brassica.info/resource/). the species originated in china and now has become one of the most important and widely cultivated leaf vegetables in asia. the tight leafy head is the main edible part. after a long history of domestication, chinese cabbage evolves into different cultivars with a variety of characteristics, such as rosette leaf morphology, heading leaf morphology, leafy head shape, size, and structure, flowering time, nutrient composition, and resistance to biotic and abiotic. a better understanding of the molecular mechanism of evolution of chinese cabbage and further development of marker-assisted selection (mas) will accelerate the selection process of improved cultivars to meet the growing consumers and environmental needs. although progress has been made in underlining the molecular mechanism [25], many aspects are still unclear. molecular markers have been widely used to study the genetic basis of important traits and map regulatory genes in plants. markers tightly linked with important agronomic traits can potentially be used for molecular breeding to develop improved cultivars. many molecular markers and genetic maps of chinese cabbage have been reported previously [625]. however, there is still a great need to develop novel molecular markers for construction of high-density linkage maps for genetics and molecular studies of important traits in chinese cabbage. simple sequence repeat (ssr) markers or microsatellite markers are among the most important markers in plants. ssrs have been widely used in genetic mapping and molecular breeding in plants because they are highly abundant and have significant polymorphism. other factors, like accessibility for detection, reliability, and codominance, also make them perfect markers for such purposes. ssrs found in transcribed sequences are called expressed sequence-simple sequence repeats (est-ssrs). compared with genomic-ssrs detected in noncoding sequences, est-ssrs are more efficient for qtl mapping, gene targeting, and mas. as transcribed sequences are more conserved than noncoding sequences, the transferability of est-ssrs is better than genomic-ssrs [2830], which can be utilized for cross genome comparison and evolutionary analysis [27, 31]. additionally, abundant ests were generated in recent years with the development of next-generation sequencing approaches, making identification of est-ssrs more practical and cost-efficient. many est-ssrs have been identified in chinese cabbage [16, 20, 25, 3336]. because whole genome sequencing of chinese cabbage is still underway, new est-ssrs could also be identified for further studies such as high-density genetic linkage map construction, gene/qtl mapping, and cultivar identification. in our previous study, the whole transcriptomes were analyzed for the rosette leaves and folding leaves of a typical heading chinese cabbage, namely, fushanbaotou, using a solexa/illumina rna-seq platform, and a large-scale est database was generated. in this study, we further assembled those ests from the rl and fl libraries into nonredundant unigenes. a total of 10,420 est-ssrs were identified, among which 2744 est-ssrs are detected for the first time, according to the ssr marker database for brassica (http://oilcrops.info/ssrdb). we characterized these identified est-ssrs and designed 7877 pcr primer pairs for 1561 est-ssrs. furthermore, serving as a validation purpose, we tested polymorphisms of 24 est-ssrs. we expect this study can pave the road for further investigation of new est-ssr markers and for construction of high-density genetic maps. for est-ssr identification and primer design, a typical heading chinese cabbage, namely, fushanbaotou, was used in this study. for primer assessment and ssr polymorphism analysis, a panel of twenty-four cultivars of chinese cabbage was used, including nineteen morphologically diverse cultivars of brassica rapa l. ssp. pekinensis (b. pekinensis l.) and five brassica rapa l. chinensis (b. chinensis l.). leaves were collected after they were grown for two weeks from ten seedlings of each cultivar and were pooled together for dna extraction. we assembled the clean read dataset presented by wang et al. from the rl and fl libraries according to the methods described by wang et al. using the trinity software (http://trinityrnaseq.sourceforge.net/). redundant sequences were removed and overlapping unigenes were assembled into continuous sequences by the tigr gene indices clustering (tgicl) tools. similarity was set at 94% and an overlap length was set at 100 bp. parameters were set with a minimum number of 12, 6, 5, 5, 4, and 4 repeat units for identification of mono-, di-, tri-, tetra-, penta-, and hexanucleotide motifs, respectively. primer length ranged from 18 to 28 bp (with an optimality at 23). the physical positions of the est-ssrs identified in the study were determined by aligning the ssrs and flanking sequences (50 bp at each side) to the brassica rapa (chiifu-401) reference genome (http://brassicadb.org/brad/) using blastn. new est-ssrs were identified by comparing with previously reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb). the dna sample of the chinese cabbage fushanbaotou was used as template to detect the availability of ssr primers designed above. the dna samples of those aforementioned twenty-four cultivars of chinese cabbage were used as templates for ssr polymorphism analysis. the polymorphisms of est-ssrs were validated by 6% denaturing polyacrylamide gel electrophoresis, 12% nondenaturing polyacrylamide gel electrophoresis, and sequencing. high quality clean read data from the rl and fl libraries by wang et al. a total of 99,684 and 95,411 contigs were obtained, with an average length of 333 and 342 bp and a median length (n50) of 531 and 536 bp, from the rl and fl libraries, respectively (table 1). contigs from the same transcript were detected with paired-end reads, as well as the distances between these contigs. using the trinity software package, we assembled these contigs into unigenes, in which ns were removed. a total of 46,294 and 48,473 unigenes from the rl and fl libraries were obtained with an average length of 707 and 680 bp and a median length (n50) of 1000 and 980 bp, respectively (table 1). size distribution of the contigs and unigenes is consistent with the rl and fl libraries as shown in figure 1, indicating that our illumina sequencing solution is reliable and reproducible. unigenes from the two samples were combined; redundant unigenes were removed; and the rest was assembled with tgicl to form a single dataset, which represents 40.7 mb of sequence and contains a total of 51,694 nonredundant unigenes, with an average read length of 788 bp, and a median read length (n50) of 1154 bp (table 1). the sequences of the unigenes are listed in table s1 (see supplementary material available online at http://dx.doi.org/10.1155/2015/473028). the length of 24,271 nonredundant unigenes (46.95%) is between 200 and 500 bp; the length of 13,613 (26.33%) is between 501 and 1,000 bp, and the length of 13,810 (26.72%) is longer than 1,000 bp (figure 1). a total of 10420 est-ssrs were detected with the microsatellite software (misa; http://pgrc.ipk-gatersleben.de/misa/) in 8571 unigenes, accounting for 16.6% of total nonredundant unigenes (tables 2 and s2). the mean ssr density is one per 3.9 kb, corresponding to one for every 5.0 nonredundant unigenes. 1502 unigenes (17.5%) harbored more than one ssr and 666 ssrs (6.4%) were present in compound formation that had more than one repeat type (table 2). the ssrs with tri- and dinucleotide repeat motifs were the most common (4,405, 42.27%; 4,043, 38.80%, resp.), followed by mono- (1,644, 15.78%), hexa- (126, 1.21%), penta- (112, 1.07%) and tetra- (90, 0.86%) nucleotide repeat motifs (figure 2). the most common two repeat motif types accounted for 81.07% of the total ssrs detected, and the rest repeat motifs types only accounted for 18.93%. the iterate number of repeat units in an est-ssr ranged from 4 to 25. the occurrence frequency of est-ssts with different iterate numbers was found to be unequal either. est-ssrs with iterate number of 5 (2832, 27.18%) were the most common ones, followed by 6 (2739, 26.29%), 7 (1368, 13.13%), 8 (703, 6.75%), 12 (542, 5.20%), and 9 (480, 4.61%) (table s3). a dinucleotide containing est-ssrs with a maximum of 25 repeat units was identified. for est-ssrs with more than 10 repeat units, the mononucleotide repeat motifs were the most abundant, accounting for 93.46% of these est-ssrs. the lengths of est-ssr sequences ranged from 12 to 65 bp (table s4). the longest one is a pentanucleotide containing est-ssr with 65 bp in length. the lengths of most est-ssrs are from 12 to 20 bp, accounting for 91.47% of the total est-ssrs, followed by est-ssrs with 2130 bp in length (874 ssrs, 8.39%). only 13 est-ssrs were identified with over 30 bp, accounting for 0.12% of the total est-ssrs. a total of 124 est-ssr motifs were identified, including 2 mono-, 3 di-, 10 tri-, 13 tetra-, 33 penta-, and 63 hexanucleotide repeat units containing est-ssrs. the dominant motif identified in our est-ssrs was ag/ct (3,519, 33.8%), followed by a/t (1,562, 15.0%), aag/ctt (1,445, 13.9%), agg/cct (776, 7.4%), atc/atg (627, 6.0%), aac/gtt (392, 4.4%), acc/ggt (392, 3.8%), ac/gt (349, 3.3%), and agc/ctg (317, 3.0%) (figure 3). the other 115 motifs have low frequency, accounting only for 9.3% of total est-ssrs. physical locations of the est-ssrs were assigned by searching against the nonredundant (nr) protein database of ncbi (http://www.ncbi.nlm.nih.gov/) and the brassica database (http://brassicadb.org/brad/) using blastx. our results showed that 4329 est-ssrs (44.4%) were located in coding regions (cdss), 3456 (35.5%) in 5-utrs, and 1297 (13.3%) in 3-utrs (figure 4, table s4). locations of the remaining 672 est-ssrs (6.9%) were not successfully assigned (figure 4, table s4). for the est-ssrs localized in the cds region, trinucleotide repeats were the most common ones, accounting for 62.72% of the total est-ssrs localized in this region, followed by dinucleotide repeats (897, 20.72%), mononucleotide repeats (325, 7.51), and compound formation (287, 6.63%) (table s4). dinucleotide repeats (1909, 55.24%) were the dominant types in 5-utrs, followed by trinucleotide repeats (730, 21.12%), mononucleotide repeats (483, 13.98%), and compound formation ones (214, 6.19%) (table s4). mono-, di-, and trinucleotide repeat est-ssrs were the top three types found in 3-utrs, accounting for 35.08%, 30.07%, and 28.60% of the total est-ssrs localized in these regions, respectively. the est-ssrs and the flanking sequences (50 bp on each side) were aligned to the brassica rapa (chiifu-401) reference genome (http://brassicadb.org/brad/) using blastn to determine their physical positions. new est-ssrs were identified by comparing with the earlier reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb). a total of 2744 new est-ssrs (26.3%) were identified in the study. of the 7676 known ssrs (73.6%), 2317 est-ssrs (22.2%) show polymorphism with different repeat numbers, and 5359 (51.4%) were exactly the same with the earlier reported ssrs based on the brassica rapa (chiifu-401) genomic sequence (table s2). a total of 7877 pcr primer pairs from the unique sequences flanking 1561 est-ssr loci were designed according to the criteria described in section 2 using primer 3 (table s5). for each est-ssr locus, a maximum of 5 alternative primer pairs was designed. the other 8859 est-ssrs, which had no appropriate pcr primer pairs designed as their flanking sequences, did not fulfill the primer design criteria mentioned above. for the 1561 est-ssrs with pcr primers designed, pcr primers of those aforementioned 24 loci with n 20 bp were selected for primer synthesis and amplification evaluation in chinese cabbage fushanbaotou. nineteen (79.2%) of these 24 est-ssr loci successfully yielded pcr amplicons in fushanbaotou. we sequenced these nineteen pcr amplicons and found that the amplicons in thirteen loci were exactly the same as expected; two were longer than the expected size, and four were shorter (table 3). size deviation of five est-ssrs loci with the expected sizes (br-es6, br-es7, br-es8, br-es12, and br-es18) was due to the variations of ssr repeat motifs (table s6). one amplicon (br-es16) deviated from the expected sizes and had an additional 86 bp containing a (tc)9 motif near the ssr repeat motif region (table s6). nineteen effective primer pairs were used for polymorphism validation for these aforementioned 24 chinese cabbage cultivars. the results showed that 17 loci (89.5%) were polymorphic (figure 5). a total of 56 alleles at the 17 polymorphic loci were identified and the average number of alleles per ssr locus was 3.29 with a range between 2 and 6. a maximum of 6 alleles was detected for br-es16 and br-es18 loci. br-es6 and br-es11 had no polymorphic allele in all 24 cultivars in this study (figure 5, tables 3 and s4). of the 17 polymorphic loci, twelve loci were polymorphic in all cultivars of b. pekinensis l. and b. chinensis l. three loci (br-es2, br-es9, and br-es19) had no polymorphism in the cultivars of b. pekinensis l. but had polymorphism in the cultivars of b. chinensis l., while two loci (br-es4 and br-es7) were polymorphic in the cultivars of b. pekinensis l. but were not polymorphic in the cultivars of b. chinensis l. (figure 5, table s8). we sequenced the polymorphic alleles of the 17 polymorphic loci and found that polymorphisms of 9 loci (br-es1, br-es4, br-es7, br-es8, br-es10, br-es14, br-es17, br-es18, and br-es19) were because of different iterate numbers of ssr repeat motifs. in another 6 polymorphic loci (br-es2, br-es3, br-es12, br-es13, br-es15, and br-es16), the most polymorphic alleles were found in the repeat motifs with additional changes in other regions (table s7). for example, compared with the allele br-es3-160 bp in fushanbaotou, the polymorphic alleles br-es3-163 bp and 145 bp had different iterate numbers of the tag/atc repeat motif, while the polymorphic allele 99 bp had not only a different number of the repeat motif, but also a deletion in another region (table s7). the other two polymorphic loci, br-es5 and br-es9, had polymorphisms that are not related with the repeat numbers of ssr motifs (table s7). illumina paired-end rna sequencing is one of the fast immerging next-generation sequencing (ngs) technologies. because of its advantages in high-throughput, high accuracy, and low cost, illumina paired-end sequencing has been widely used for de novo transcriptome sequencing and assembly and transcriptome quality and quantity analysis in many plants [37, 38, 42, 43]. in our previous study, the transcriptome of rosette and folding leaves in chinese cabbage was analyzed using the illumina paired-end rna sequencing technology, and abundant clean reads and ests with high quality were obtained. the large quantity of clean reads would increase coverage depth of transcriptome nucleotide, enhance sequencing accuracy, and provide useful information for developing new tools for genetic mapping and molecular breeding of chinese cabbage. in this study, we further assembled the clean reads into contigs and unigenes from the rl and fl libraries, respectively. the parameters for both contigs and unigenes between the two libraries had no significant differences (table 1), indicating our illumina sequencing solutions have high reliability and reproducibility. the unigenes of the two libraries were further assembled and a total of 51,694 nonredundant unigenes were obtained from the 40.7 mb sequence data. we discovered more nonredundant unigenes than those in previous studies [35, 36], which represent a large portion of the chinese cabbage transcriptome and are important for a comprehensive understanding of est-ssrs. a total of 10,420 ssrs with over 12 bp were identified from the deep transcriptome sequence dataset of chinese cabbage. the frequency of occurrence of ssrs is slightly higher than those reported in previous studies on chinese cabbage (about 8.415.6%) [20, 3436] and also higher than those of other dicotyledonous species such as peanut (6.8%), sweetpotato (8.2%), sesame (8.9%), pigeonpea (7.6%), grapes (2.5%), pepper (4.9%), and flax (3.5%), but it is lower than those of coffee (18.5%), radish (23.8%), and caster bean (28.4%). detection of est-ssrs depends on a number of factors such as genome structure, tools and parameters for est-ssrs detection and exploration, and size of dataset for unigene assembly. the frequency of ssrs with different sizes of repeat units is not evenly distributed in plants. previous studies showed dinucleotide ssr loci are the most abundant class in safflower, pigeonpea, and sesame, whereas trinucleotide repeats are the most frequent ones in barley, sweetpotato, jatropha curcas, iris, pepper, caster bean, flax, cucurbita pepo, and radish. in ramie and wheat, dinucleotide and trinucleotide trinucleotide (4405, 42.3%) was found to be the most common repeat motif class in chinese cabbage, followed by dinucleotide (4043, 38.8%) (figure 2). however, on the genomic level, of chinese cabbage, dinucleotide is the most common repeat motif, followed by trinucleotide. we found the most dominant mononucleotide repeat motif in chinese cabbage was a/t (1,562, accounting for 15.0% of the total est-ssrs), which is consistent with previous reports for chinese cabbage and for other plants such as arabidopsis, rice, wheat, radish, castor bean, gossypium raimondii, oil palm, and eggplant. for dinucleotide motif, ag/ct was the most common repeat motif, accounting for 87.0% of the total dinucleotide est-ssrs. it is in close agreement with the results in previous studies for genic ssrs in chinese cabbage [20, 36] and those in most other plants such as sweetpotato, iris, sesame, and radish. the ag/ct repeat motif was also the most dominant repeat among all the est-ssrs identified in this study, accounting for 33.8% of the total est-ssrs. however, for genomic-ssrs in chinese cabbage, at/ta is the most common dinucleotide motif. the aag/ctt (1,445, 13.9%) motif was the most frequent motif among trinucleotide est-ssrs in the study, which is consistent with the results in previous studies in chinese cabbage [25, 36] and many dicot species, for example, arabidopsis, soybean, peanut, sweetpotato, radish, and sesame. in many monocot species such as maize, barley, and sorghum [66, 67], ccg/ggc is the most dominant trinucleotide repeat motif. it is considered a specific feature of monocot genomes due to the high gc content in monocot genomes. of all 10420 est-ssrs identified in this study, more than 70% have been identified and presented in the ssr marker database (http://oilcrops.info/ssrdb), among which over half were exactly the same with the earlier reported ssrs based on the brassica rapa (chiifu-401) genomic sequence (table s2). 2317 est-ssrs (22.2%) with polymorphism in different repeat numbers could further be used for identification of chiifu-401 and fushanbaotou and for genetic linkage map constructions using these two cultivars as parents. a total of 2744 new est-ssrs (26.3%) were identified in the study, which, in combination with previously discovered est-ssrs, could be used for high-density genetic linkage map construction, gene/qtl mapping, cultivar identification, and so forth. in the present study, 79.2% of the est-ssrs primer pairs selected for primer evaluation successfully generated high quality amplicons, indicating that the ests from the high-throughput rna sequencing of chinese cabbage transcriptome are suitable for specific primer design. the unsuccessfully designed primer pairs may be due to splice sites, large introns, chimeric primer(s), or poor quality sequences. we found that all amplicons contained the expected ssrs and the ssrs in 13 amplicons were exactly the same as predicted (table s6). the deviation of est-ssr pcr amplicons from the expected size is likely due to the presence of introns, large insertions or repeat number variations, a lack of specificity, or assembly errors. in the present study, we found five of six amplicons with unexpected sizes had different iterate number of ssr repeat units, while the other one had a 86 bp insertion near the expected ssr repeat motif region (table s6). these results suggested that the unigenes assembled from the high-throughput rna sequencing of chinese cabbage transcriptome are reliable, and the est-ssrs identified in our dataset could be used for further studies, such as genetic mapping and cultivar identification. most of the est-ssr loci (accounting for 89.5% of the tested loci) were found to be polymorphic among the 24 tested cabbage cultivars. the mean number of alleles per ssr locus was 3.29 with a range between 2 and 6 (table 3), indicating that polymorphism of est-ssrs in chinese cabbage is relatively high. most of the polymorphisms of the tested est-ssr loci are due to the variations of ssr repeat motifs in this study. there were only two loci where the polymorphisms were not related to the ssr repeat motif variations (table s6). the results indicate that the est-ssrs identified and the pcr primers designed in this study could further be used for constructing high-density genetic linkage maps, mapping quantitative trait loci, assessing germplasm polymorphism and evolution, marker-assisted selection, and cloning functional gene in chinese cabbage. in summary, we assembled a large set of clean reads with high quality derived from the chinese cabbage transcriptome using high-throughput rna sequencing technology with a solexa/illumina platform. a total of 51,694 nonredundant unigenes were obtained from 40.7 mb sequence data, providing substantial knowledge for est-ssr identification and characterization. 10,420 est-ssrs were identified and characterized, and pcr primer pairs for 1561 est-ssrs were designed. by comparing with previously reported ssrs in the ssr marker database for brassica (http://oilcrops.info/ssrdb), we identified a total of 2744 new est-ssrs. primer pairs for 24 est-ssrs were selected for primer evaluation, and 79.2% of the 24 est-ssr loci successfully generated high quality amplicons. among the effective primers, 89.5% of them showed polymorphism in 24 cultivars of chinese cabbage. the est-ssrs developed in this study, in combination with previously reported est-ssrs, will provide valuable resources for constructing high-density genetic linkage maps, mapping quantitative trait loci, assessing germplasm polymorphism and evolution, marker-assisted selection, and cloning functional gene in chinese cabbage. to our knowledge, this is the first successful attempt to develop large quantity of est-ssrs with high quality based on the transcriptome of chinese cabbage using high-throughput rna sequencing technology.

simple sequence repeats (ssrs) are among the most important markers for population analysis and have been widely used in plant genetic mapping and molecular breeding. expressed sequence tag-ssr (est-ssr) markers, located in the coding regions, are potentially more efficient for qtl mapping, gene targeting, and marker-assisted breeding. in this study, we investigated 51,694 nonredundant unigenes, assembled from clean reads from deep transcriptome sequencing with a solexa/illumina platform, for identification and development of est-ssrs in chinese cabbage. in total, 10,420 est-ssrs with over 12 bp were identified and characterized, among which 2744 est-ssrs are new and 2317 are known ones showing polymorphism with previously reported ssrs. a total of 7877 pcr primer pairs for 1561 est-ssr loci were designed, and primer pairs for twenty-four est-ssrs were selected for primer evaluation. in nineteen est-ssr loci (79.2%), amplicons were successfully generated with high quality. seventeen (89.5%) showed polymorphism in twenty-four cultivars of chinese cabbage. the polymorphic alleles of each polymorphic locus were sequenced, and the results showed that most polymorphisms were due to variations of ssr repeat motifs. the est-ssrs identified and characterized in this study have important implications for developing new tools for genetics and molecular breeding in chinese cabbage.

PMC4609433

pubmed-304

prostate cancer becomes one of the most common cancers in developed and developing countries [13]. it is because life expectancy rised; age is one of the prostate cancer risk factors. moreover there is wide availability of prostate-specific antigen (psa) serum test, which makes possible to diagnose clinically silent, low stage disease. number of such patients is growing and makes management of this disease even harder in every day oncology care; optimal management is still controversial. there is a wide range of treatment methods and one of the most important outcome risk factors is local tumor control. there are risk categories, in which are propositions of treatment (table 1). very low risk category was introduced by national comprehensive cancer center (nccn) in 2010. risk categories and treatment options according to nccn prostate specific antigen density if predicted probability of nodal involvement is 2% neoadjuvant, concomitant or adjuvant in selected patients without fixation radical prostatectomy (rp) remains one of basic curative therapy for prostate cancer, especially for low and inermediate risk patients. complications include perioperative short- term side effects as blood loss, wound infection or from anesthesia, and long-term, postoperative, as incontinence or impotence [58]. three-dimensional conformal radiotherapy (3dcrt), dynamic techniques like intense-modulated (imrt) or arc radiotherapy and extracranial stereotactic techniques allow to prepare normal tissue sparing plans with clinical target volume (ctv) high dose prescription. not only photon beams, but also particles, e.g. protons are used for highly conformal irradiation. every day image-guided radiotherapy (igrt) use, especially with intraprostatic seed markers, makes possible dose escalation and less toxicity with smaller margins contouring. brachytherapy, combined with external-beam radiotherapy (ebrt) or alone, remains one of best tools for absolute dose escalation inside prostate. due to low alpha/beta ratio for prostate cancer these protocols are favorable, in which hypofractionation is used. both low-dose (ldr) and high-dose rate (hdr) brachytherapy (bt) are used in prostate cancer patients. 27 kev, half-life: 59 days) or palladium-103 (pd; mean photon energy 21kev, half-life: 17 days) hdr brachytherapy is, particularly, based on iridium-192 (ir; mean photon energy 400 kev, half-life: 74 days) stepping source, which is driven into temporary implant catheters by computer-controlled unit. it also makes high dose escalation possible, but interstitial implant is needed [12, 13]. radiotherapy complications are acute and late, mostly in bladder and rectum, like incontinence, diarrhea, urinary stricture, impotence and proctitis. outcome is similar to surgery, however tolerance of treatment seems better for radiotherapy excluding proctitis rates, which are higher in irradiated patients. patient for rt are usually those, who can not undergo surgery, older than 65 years or with locally advanced disease, e.g. extracapsular spread [5, 14, 15]. patients with shorter life expectancy or inconvinced to treat their disease are recommended for psa testing at least every six months, digital rectal examination (dre) at least every twelve months and, especially those with longer life expectancy, for repeated prostate biopsy at least every year. if there is disease progression observed, then patient should undergo clinical evaluation to choose optimal treatment option. although clinical progression is still not well defined and requires physician judgement and treatment option should be chosen wisely after patient discussion with his doctor [5, 16]. comparative analysis of psa free survival outcomes by prostate cancer results study group has been published, recently. it contains comparison of results from 848 articles selected from over 18000 published between 2000 and 2010. only radical treatment was considered containing bt (including hdr), ebrt (including imrt), rp, proton thereapy, hifu and cryotherapy. pcrsg agreed unanimously for study inclusion criteria as: patient stratification into pretreatment groups (according to d'amico, zelefsky or nccn), psa free time endpoint (astro, phoenix, psa<0.2 ng/ml for rp), both clinical and pathological staging, minimum of 72 gy ebrt (imrt or 3dcrt), results published in peer-review journals only, minimum median follow-up of 5 years. morover minimum patients number for each risk group was accepted as 100 for low and intermediate and 50 for high risk group. results of this study suggest that bt alone, particularly seed implant, provides superior psa free survival in low risk patients. ebrt combined with bt seems to be equal to bt alone, and better than ebrt alone or rp, in intermediate risk group. combined irradiation (ebrt with bt) with or without androgen deprivation therapy seems to be superior for high-risk patients. although these results are encouraging to choose bt as an element of managment, it should be remembered that selection bias may play main role, mostly in intermediate risk group. according to lack of large, randomized studies these may help to choose ultimate treatment decision both for physician and his patient. bt seems to be superior option for dose escalation and psa control in prostate cancer patients. this is also reason to recall guidelines of european and north american societies on prostate cancer brachytherapy, both hdr and ldr. european association of urology states that transperineal bt alone qualification criteria are: clinical stage between t1c and t2a, without nodal involvment or metastases, six or less gleason score diagnosed with sufficient number of random biopsies, initial psa level of 10 ng/ml or less, no more than 50% of biopsy cores with cancer, prostate volume of less than 50 cm and a good ipss (< 20 fair tolerance;<9 good tolerance). ldr-bt is recommended both by eau and gec/estro as safe and effective in low risk group of prostate cancer patients with life expectancy longer than 5 years. post-turp patients should avoid this procedure, however if turp was performed several years earlier some patients can undergo ldr-bt after careful evaluation. hdr-bt is recommended as a dose escalation technique combined with ebrt for patients with intermediate or high risk of failure with life expectancy longer than 5 years. the exclusion criteria are: prostate volume bigger than 60 cm (hormonal downsizing to reduce benign prostate hyperplasia is indicated), transurethral resection of prostate within six months, infiltration of external sphincter of the bladder neck, significant urinary obstructive symptoms (residual urine volume>50 cm, ipss>12 and qmax<15 cm/s), technical issues (pubic arch interference, trus prostate-rectum distance less then 5 mm, lack of proper positioning of patient, anaesthesia or complementary ebrt contraindications). moreover these guidelines state that hdr-bt alone should be considered as an investigational treatment with proper fractionation. salvage hdr-bt should be also performed in a prospective clinical trial, only. abs states that hdr-bt provides highly conformal treatment with less irradiation for pelvic organs-at-risk and excellent outcome. all patients should be considered for these aproach, particularly for intermediate and high relapse risk patients as an irradiation boost or as a monotherapy for low risk patients. prior rectal surgery or pelvic irradiation, i.e. rectal cancer treatment, in prostate cancer patients should be carefully evaluated and complications and outcome risk factors should be discussed with special hdr-bt center expertise. inflammatory bowel disease patients should be considered for hdr-bt if not suitable for rp, asymptomatic and not required treatment for at least 0.5 to 10 years. hdr-bt alone seems to be better than ebrt alone or combined with hdr boost, because of smaller bowel volumes irradiated. turp should be performed at least 90 days before hdr-bt, an aerated gel should be given into urethtra to outline its shape and special attention should be given to not exceed 110% of prescription dose. most feasible glands for hdr-bt are those beneath 50 cm, but abs guidelines allow to treat larger ones. pubic arch interference, baseline urinary function and application technique (fixed template or freehand) should be carefully considered. patients should be informed about potential risks of erectile dysfunction or acute and late urinary side effects. abs states that absolute contraindications include preexisting rectal fistule, impossibility of anaesthesia and no proof of malignancy. absolute contraindications include poor performance status and life expectancy shorter than 10 years, spinal or general anaesthesia not possible, large post turp defects and lack of rectum, which makes trus impossible. ipss value over 20 points can correlate with increased urinary toxicity and needs careful evaluation. prostate volume over 60 cm is not a contraindication and even with pubic arch interference can be considered for ldr-bt with short adt course (3-4 months) to downsize the gland. also freehand implantation is acceptable, but experienced practitioners should perform ldr-bt in such cases. abs states that ldr-bt alone should be done in low risk patients and as option for intermediate group. ebrt and permanent seed combination is considered as standard of care for high risk patients. hdr-bt, according to gec/estro-eau recommendations, should be done under trus guidance with template, its proper fixation and treatment planning software. additional imaging with ct or mri after implantation may be used. clinical target volume (ctv) for hdr-bt can be whole gland (prostate surface) with homogenous needles distribution or with addition of visible tumor boost inside ctv. prostate surface dose prescription differs among cancer centers and is between 6 to 10 gy per fraction with total dose of 12-20 gy in 2 to 4 fractions combined with ebrt of 45 to 54 gy in 6-7 weeks. organs-at-risk doses should not exceed 120% of mtd for urethra and less then 6 gy per fraction for rectum. those doses should be precisely stated and valuated in clinical trials with long follow-up including penile bulb maximum dose. proximal tips of catheters should be visualized and images should be taken at least 9 mm above and below ctv. organs-at-risk should be confined including rectum, urethra, bladder and penile bulb. minimum of 14 catheters should be placed or more, particularly if boost within boost is planned. especially urethra piercing should be avoided. at least 90% of ctv should be covered with prescribed dose with aiming 95% of ctv. hdr-bt boost is given in one to six and hdr-bt alone in three to six fractions. due to wide heterogeneity of fractionation schedules, oar constraints are based on experienced hdr centers references, e.g. from less then 105% to less then 125% for urethra. ldr-bt should be performed under trus guidance according to gec/estro guidelines. if possible gross tumor volume (gtv) should be delineated on pre-treatment scans. ctv should contain whole prostate with 3 mm margin in all directions except posterior (rectal wall) and cranial (bladder neck) if needed. dose prescription to 100% isodose should be 145 gy for i and 125 gy for pd seeds. at least 95% of ctv should be covered with 100% isodose with no more than 50% of ctv with isodose 150%. maximum dose in 2 cm for rectal wall should be no more than 145 gy and in 0.1 cm less than 200 gy. 150% of prescribed dose should cover less than 10% of urethra volume and 130% of this dose should cover less than 30% of its volume. it should be done as a preplanning, either as a separate procedure or on the implanting day in operational room. main procedure should be performed with trus and template; patient position and probe angle should be similar to preplanned. minimum is biplanar, high resolution (5-12 mhz) trus with dedicated planning software. team should consist at least of trained radiation oncologist and qualified medical physicist, but presence of urologist, certified dosimetrist or other supportive staff is appropriate. abs does not suggest any seed deposition technique, however it should have excellent outcome, be reproducible and with optimal dosimetry. both stranded and loose seeds can be chosen for implantation. i and pd implants showed excellent outcomes, so abs do not favor any of them. ldr-bt alone prescription dose to ptv should range from 140-160 gy for i seeds and 110-125 gy for pd. if combination of ebrt and seed implantation is planned, i ptv dose should be between 108-110 gy and pd ptv dose should be between 90-100 gy. ebrt dose should be 41.4-50.4 gy (1.8 gy/day, but 2 gy/day is also acceptable). ldr-bt is usually performed 0-8 weeks after ebrt, but there is no evidence for optimal sequence of these. reverse approach is also accepted, which may theoretically be better, because of simultaneous irradiation from implant and ebrt and possibility of adjusting ebrt if needed. dose constrains for organs at risk should not exceed 150% of prescribed dose in 5% and 125% of prescribed dose in 30% of urethral volume in the preplan. prescribed dose should be in less then 1 cm of rectum on day 1 dosimetry and in less then 1.3 cm on day 30. although ct performed immediately or one day after the implantation has several positives, e.g. early detection of dosimetric problems, but after implant oedema can derive dosimetric underestimations. it is 12-20 days after implantation for pd and 23-37 days for i. erectile function organs at risk e.g. penile bulb are still not agreed, though there are no recommendations on these. both ldr and hdr-bt patients should be seen 6 weeks after implantation (last one for temporary implants) according to gec/estro recommendations. should be examined every 3 months, every 6 months until 5 years after treatment and then annually. dre, psa test, side effects evaluation (urinary, rectal, potency toxicity and ipss) and trus should be done [18, 20]. abs suggests to follow-up hdr-bt patients every six months for first 2-3 years, and then at least annually. it should consist of dre, psa test and toxicity evaluation (urinary, rectal and sexual function). phoenix definition of biochemical relapse is recommended, although case individual assessment is required and patient should be informed about psa bounce. ldr-bt patients should be seen every six to twelve months with regular intervals. post bt rectal biopsies or urinary instrumentation should be avoided and all of the risks and benefits should be considered [21, 22]. brachytherapy is supreme tool in prostate cancer management with a wide range of options in every risk group (table 2). excellent outcomes and relatively small irradiated volume seems more beneficial than any risk of intraoperative implantation, particularly in wisely selected patients. feasibility of seeding or catheterization is basic for choosing appropriate candidates for bt, however there are articles describing series of patient with non-fitting anatomy, i.e. prostate smaller than 20 cm or bigger then 50 cm or post turp patients [24, 25]. assesment should consist of careful clinical examination including dre, patient's history (i.e. urologic, prior pelvic rt, surgery or trauma, inflammatory bowel disease, connective tissue dissorders), pretherapy psa serum level, biopsy proven cancer with gleason score and clinical staging. trus stays basic imaging, but ct and mri are also very useful, either before procedure and as a planning guidance. new abilities of mri, i.e. spectroscopy and diffusion, and 11c pet-ct should be discussed more in next recommendations [2628]. gec/estro and eau recommendations on prostate cancer treatment with temporary implants with stepping sources are from 2005 and on permanent seeds from 2000 with 2007 update. although general approach for bt, both hdr and ldr, has not particular differences across the world, european recommendations need an update. recommendations comparison for gec/ estro and abs [18, 2022] under investigation for high risk patients to institutional review board

prostate cancer, due to wide availability of psa tests, is very often diagnosed in early stage, nowadays. this makes management of this disease even harder in every day oncology care. there is a wide range of treatment options including surgery, radiotherapy and active surveillance, but essential question is which treatment patient and oncologist should decide for. due to recent publication of prostate cancer results study group, in which brachytherapy is one of supreme curative options for prostate cancer, we decided to overview most present european and north american recommendations. national comprehensive cancer network, american society for radiation oncology, american brachytherapy society, european association of urology and groupe europen de curiethrapie of european society for therapeutic radiation oncology guidelines are overviewed, particularly focusing on hdr and ldr brachytherapy.

PMC3552635

pubmed-305

only 2030% of patients with group a beta hemolytic streptococcus (gabhs) pharyngitis presents with classical symptoms of the disease. reliance on clinical judgment alone has a poor predictive value and results in 80% to 95% overestimation of disease [2, 3]. diagnostic strategies for acute gabhs pharyngitis are thus based on epidemiological factors, signs, and symptoms, as well as the result of throat cultures (tcs). several studies have shown that the use of throat culture leads to more judicious use of antibiotics [57]. physicians prescribe antibiotics for acute pharyngitis as they are concerned that patients with this complaint may be suffering from gabhs infection that if left untreated might develop suppurative complications, such as, tonsillar abscess or nonsuppurative complications, such as, rheumatic fever [6, 8]. antibiotics, however; confer only minor symptomatic benefits for gabhs sore throat. they shorten the duration of symptoms by merely half a day on average [8, 9]. more recent studies have shown that antibiotic use only reduced the incidence of rheumatic fever by a mere 0.5 cases per 100,000. the importance of preventing rheumatic fever has lessened as the incidence of rheumatic fever and rheumatic heart disease has declined significantly in the last 20 years, from a mean annual incidence of 13.4 per 100,000 to 5 per 100,000. prevalence has decreased as well from 5.7 per 1,000 in the eighties to 0.5 per 1,000 in 2000 [8, 10, 11]. this failure probably stems from the fact that about 20% of children with gabhs is infected with bacteria which contain m protein, a virulence factor located on the surface of the bacterial wall that confers resistance to commonly used antibiotics. newer beta-lactamase-resistant antibiotics did not prevent this treatment failure [13, 14]. review of the literature from 1945 to 1999, which includes 10,484 cases of gabhs sore throat, found that antibiotic treatment reduced the occurrence of acute otitis media, a common complication of this disease, by a mere 25%, compared to the placebo group and sinusitis by only 50%. rheumatic fever, a nonsuppurative complication, was reduced by less than 33%, compared to placebo [8, 10, 11, 15]. in addition to the uncertainly in the scientific literature, parents seem to be uncertain regarding the benefits of antibiotic treatment for acute gabhs pharyngitis and tend to stop treatment earlier than prescribed. in a pilot study, we randomly followed 75 children with gabhs pharyngitis for 6 months and have found that more than 75% of them did not complete ten days of antibiotics. this finding led us to conduct a multisite, prospective cohort observational study, the results of which are reported here. the goal of this study was to determine whether noncompliance with antibiotic treatment affects short-term or long-term complications. two central, primarily rural, and agricultural regions of the largest health maintenance organization (hmo) in israel, comprising approximately one million patients. using a standard protocol, we located from our computerized data base 107,840 patients, aged 6 months to 18 years, who were examined by their primary care physician for upper respiratory tract infection, tonsillitis, pharyngitis, sore throat, tonsillopharyngitis, neck pain, cervical lymphadenopathy, pta, rpa, from january 1, 1999 until december 31, 2000. we then accessed the charts of 78,473 of these children who were diagnosed with infected throat or one of the differential variants, excluding all children diagnosed as having viral upper respiratory infections. 47,000 of these patients were formally diagnosed with acute pharyngitis or acute tonsillitis and received a prescription for antibiotics, indicating that their physician suspected bacterial disease. in the index visit, 35,000 of these children had at least four out of five symptoms in the modified centor criteria used for this study and nadir modified breese epidemiological and clinical score card (ecsc) that has 91% sensitivity and 98% specificity when the score was above 15 (score between 4 and 36) for the diagnosis of gabhs [1719]. colonies yielding beta-hemolysis were grouped for surface carbohydrate assessment by using a latex bead agglutination test (figure 1). of the 6336 children (with positive cultures with 4 or more centor criteria and 15 or higher ecsc), 4,775 parents consented to enroll their children to the study (figure 1). excluded from the study were children who were diagnosed as gabhs chronic carriers or who had suffered from post-gabhs complications; had any chronic illness, such as, renal or hepatic impairment; had bleeding disorder; had congenital or acquired immunodeficiency or suffered from malignancy. initial patient/parent contact was made by one of the authors (m. sarrell) within 3 to 5 days of the initial positive throat culture. at that time, initial information regarding the illness and whether a prescription for antibiotics was given by the primary care physician. the attending physicians of the two thousand study patients were contacted by email within 48 hours of the enrollment by one author (m. sarrell). the physicians were requested to inform the authors of any additional cultures taken during therapy, and to request that they obtain two additional throat cultures and engage in improve adherence strategies by providing information, counseling, reminders, reinforcement, and if needed personal attention or supervision. while repeated cultures are not routinely recommended for asymptomatic patients who have completed a course of antimicrobial therapy, in light of the poor compliance with treatment in the pilot study, performance of such follow-up cultures was considered important for the purposes of the study. the first follow-up culture was performed within 10 to 14 days of the initial positive culture regardless of treatment status. the purpose of this culture was verification of antibiotics treatment failure or persistence of gabhs in the oropharynx of the untreated patients. the second additional throat culture was taken between days 21 and 30 after the initial positive culture, regardless of treatment status, to ascertain the presence of residual gabhs or recurrences. treating physicians were also requested to obtain blood for liver enzymes, renal function tests, and urine analysis from all the participants and to perform annual follow-up evaluation thereafter. a second patient/parent contact was made by our study coordinator within 10 to 14 days of initiation of antibiotic treatment. she collected information about demographic characteristics, past medical history, febrile status, need for repeat throat culture during the treatment period (that was not part of the study protocol), and type of medication prescribed. during this contact she obtained information about the number of days of actual treatment, omission compliance and complications, the patients/parents perceived as deriving from the treatment (or lack thereof). the computerized charts of the participants were searched within 2 to 4 weeks of the second patient/parent contact for additional information, including demographic characteristics, medical and environmental history, initial clinical data, such as, in-office fever evaluation, results of the physical examination, additional culture taken, type of antibiotics used, and disposition of prescription received. a second search of the computerized medical charts was performed by our research assistant between 30 and 90 days of initiation of medical treatment, to ascertain that the 2 requested throat cultures were obtained. relapse or recurrence of clinical or bacterial pharyngitis, suppurative or nonsuppurative complication, or even whether the participants complained of any sore throat within 30 days of completion of treatment were also evaluated. in order to assure that all possible short-term complications that occurred within 90 days of the index case were obtained, an additional comprehensive search of the hmo database was done within 120 days of the second computer search. we ascertained that findings that were either not available on the original computerized chart or were seen by other than their primary care physician, (e.g., emergency departments, patients that relocated), were not overlooked. the charts of the participants were then reviewed by one of the authors on a yearly basis, from january 2000 to january 2010, noting possible late nonsuppurative complications of gabhs infection. no patients were lost to followup, even if they had changed physicians, due to our ability to track them through the centralized database to their new physician or another hmo. the children that were enlisted to the army (and thus not members of any hmo during their military service) were contacted either through their former attending physician or the military physician. minor treatment failure was defined as any clinical or bacterial recurrence of pharyngitis during the short-term follow-up period and its correlation to compliance with treatment. major treatment failure was defined as retropharyngeal or peritonsillar abscess or long-term complications, such as rheumatic fever. suppurative complications were chosen as a model, because the nonsuppurative complications (rheumatic heart disease, arthritis, carditis) have been practically eradicated in our region. this cohort study was designed to analyze rare events (according to the cioms classification 110 events per 10,000 children years). the annual incidence of peritonsillar abscess (pta) in our region is 24 cases per 100,000 and the incidence of retropharyngeal abscess (rpa) is 57 cases per 100,000. power calculations suggested 6,500 to 7,000 person-years of intervention would be needed to detect a 22% difference in pta and rpa between the fully treated (ft) and partially treated (pt) arms of the study population. furthermore, one-sided alpha of 0.025, a statistical power of 95%, and the pta/rpa incidence given above showed that approximately 19,000 children-years would be needed to show the noninferiority of ft versus pt. since the primary outcome of interest is the pta/rpa hazard ratio between ft and pt. the null hypothesis to be tested is hr pta/rpa>2 (i.e., the pta/rpa hazard ratio for ft versus pt is higher or equal to 2). the pta/rpa hazard ratio was calculated for ft versus pt. for purposes of analysis, participants were divided into four subgroups based on length of treatment: 1st subgroup (untreated), those who did not receive any treatment, 2nd subgroup (partially treated), children that received antibiotics for 1 to 3 days, 3rd subgroup (mostly-treated), children treated for 4 to 6 days, and 4th subgroup (fully-treated) children treated between 7 to 10 days. data are presented as proportions (with 99% confidence intervals [cis]), means (with sds), or medians (with interquartile ranges), using pearson tests, student's tests, or fisher exact test. comparisons of length of treatment according to time and treatment were assessed using the repeated measures and analysis of variance and the paired t test. a 2-tailed p value of.05 was used to determine the statistical significance of differences observed between groups and to calculate confidence intervals around differences in sample means and odds ratios. we used the mcnamara test to measure the changes between the groups and their subgroups regard to the length of antibiotic treatment. over half of their children (1023, 51%) were between the ages of 6 months and 6.9 years, and over half 1,039 (52%) were female. the majority of children (1,821, 91%) were prescribed penicillin or amoxicillin, allergic or intolerant to penicillin were treated with cephalosporin 25 (1.5%), erythromycin 109 (5.5%), and azithromycin 45 (2.5%), all medication were prescribed twice daily for 10 days, except azithromycin once daily for 5 days. no statistical correlation was found between the type of antibiotics, the children received, or the demographic characteristics and the complications found in the later medical examinations. only 196 children (9.8%) actually completed 10 days of antibiotic treatment. despite having received a prescription from their physician, two hundred and thirteen participants (11%) did not start taking any treatment whatsoever, including those who did not even purchase antibiotics. as shown in table 1 a no statistical correlation was found concerning length frequency and duration, palatability, number of daily dose of treatment, but a statistically significant difference was found between all the subgroups concerning the length of antibiotics treatment (p <the majority of children (1192, 59.6%) had 3 days or less of fever, defined as any rectal temperature less than 38.5c or oral temperature less than 37.8c. the majority of children (1591, 80%) received medication for four to six days at the most (partially treated subgroup). as illustrated in table 1, the association between the duration of fever and the number of days of treatment was statistically significant (p<.0001). of the 306 (15.3%) children with clinically diagnosed recurrent tonsillopharyngitis, only 236 (12.3%) had positive gabhs findings on the throat culture taken within 10 to 14 days after conclusion of the primary infection. an additional thirty-four (1.7%) had a positive second study culture (taken 2130 days after the index positive gabhs culture). of note is the fact that the majority (156, 66%) of the positive study culture at 1014 days were found among the subgroup treated for 7 to 10 days. no such positive results were found in the subgroup treated for 1 up to 3 days. furthermore, no positive gabhs throat cultures were found on the second study culture in the untreated group. the majority (26, 76%) of positive gabhs cultures were in the mostly treated subgroups. as illustrated in table 2, these findings were both statistically significant (p<.0001) (table 2). cervical lymphadenitis, acute otitis media, and impetigo were the only suppurative complications noted. 110 (5.5%) children developed cervical lymphadenitis, most (52, 47%) among the 6 to 7 days treatment subgroup and 33 (33%) among the 4 to 5 days treatment subgroup, a significant difference among the treatment subgroups (p<.0001). additionally, no children developed nonsuppurative complications during 10 years of followup nor did any of the children develop iga nephropathy during the follow-up period. furthermore, they were no association between the five modified centor criteria and development of complication, even when stratified by type of antibiotics or the season of the year. altogether, 304 (15%) new onset cases of acute otitis media (aom) were diagnosed within 30 days of the initial diagnosis. however, only 31 (10%) of those were in the untreated subgroup, as compared to 141 (46%) in the 7 to 10 days treatment subgroup, 98 (38%) in the 4 to 6 days treatment subgroup and 98 (33%) in the 1 to 3 days subgroup, a statistically significant difference among the all treatment subgroups (p<.0001). attempting to elucidate the possible causes for the differences between the recurrence of gabhs and the length of antibiotic treatment or clinical score on enrolment or illness severity, a multivariate stepwise logistic analysis was performed. the duration of fever was the most significant predictor for such recurrence, age under 6 years being less significant, while treatment for 7 to 10 days had no significant influence on the recurrence of gabhs. of note is that the contribution of the duration of fever was apparent even after controlling for the concomitant influence of age, gender, medical history, single- or two-parent home, type of antibiotics or the season of the year, and concomitant illnesses, such as, conjunctivitis, otitis media, upper respiratory infection, gastroenteritis, or lymphadenitis, which may have otherwise explained the influence of the length of treatment in relation to those illnesses (table 3). this study found a very poor parent/child compliance to antibiotic treatment prescribed for symptomatic, culture-positive gabhs tonsillopharyngitis. 11% of children did not start taking any treatment at all, and only 10% completed a full course of treatment. the reason for this low rate of compliance is unclear, but it coincides with other reported studies [14, 16]. we speculate that a large proportion of lack of compliance is the parent's sensation that antibiotics are potentially dangerous and overprescribed [18, 19]. despite this poor compliance, in our study as in others, there was a very low rate of suppurative complications. furthermore, despite the poor compliance, we found no increase in the incidence of acute rheumatic fever, the most dreaded complication of gabhs, in our patients. in fact, since the year 2000, the incidence of rf in our region has declined from 2.2 per 100,000 to 0.2 per 100,000 in 2008, according to the epidemiological department of the israeli ministry of health. this is in concordance with other developed countries, including, the united states, where the original recommendation for 10 days of antibiotic treatment of gabhs originated. in that country, currently there are only 10 cases of rf per 100,000 patients with gabhs pharyngitis, and only 1 case per 10,000 patients with acute rheumatic fever develop rheumatic heart disease [2022]. in fact, concomitant with the increased use of antibiotics, recurrence of gabhs in the usa rose from 9% and 10.7% in the years 1975 to 1979, respectively, to 25.9% and 37.5% in the years 1995 to 1996, despite the decline in acute rheumatic fever. 14% of patients in our study had a recurrent infection, proven by a gabhs-positive throat cultures. this percentage is similar to other studies which found that penicillin failed to eradicate gabhs from the throat in approximately 13% to 26% of the patients evaluated [23, 24]. the majority of recurrences in our study were in the younger group (mean age of 10.2 years, and 60% of them younger than 9.9 years). this is consistent with other published studies where such recurrences were more frequent among children aged 1 to 8 years than among children aged between 13 and 19 years [24, 25]. historically, prescribing 10 days of oral penicillin began in the 1950s, substituting the intramuscular injections of long-acting parenteral penicillin, based on surrogate markers of eradication of gabhs from the tonsillopharynx. however, no study has conclusively proven that this practice unequivocally prevents acute rheumatic fever [26, 27]. even though orally prescribed penicillin appeared to be equally effective for clinical and laboratory resolution of signs and symptoms, it is difficult to administer and expensive, considering the staggering financial burden of approximately 140 office visits per annum per 1,000 children younger than 15 years [28, 29]. substituting azithromycin or cephalosporins for penicillin was found to produce better bacteriological and clinical results and also required a shorter course of treatment [30, 31]. our results may not apply to adults, sick people, or chronic gabhs carriers. it does not address the optimal length of treatment required to achieve appropriate eradication of the microbe or whether complete eradication is required at all. the method of pill/doses counts is not a good measure of adherence, but due to it simplicity and empiric nature it was found adequate for this study. we were unable to assess the true variation of the incidence of acute rheumatic fever, due to the fact that this disease has been practically eradicated from our population. our data suggest that the large majority of parents/patients stop administering antibiotics to their children who suffer from gabhs prior to the completion of the recommended course. a more judicious use of antibiotics would promote and improve compliance, cut costs, and prove more convenient to parents and children alike .

background. uncertainty exists concerning the necessity of 10-day antibiotic treatment of group a beta hemolytic streptococcus (gabhs) pharyngitis. objective. to assess the incidence of gabhs recurrence and suppurative and nonsuppurative complications in relation to compliance. methods. (design). prospective cohort observational study. (subjects). 2,000 children aged 6 months to 18 years with sore throat and positive gabhs culture. (main outcome measures). recurrence of symptomatic culture positive gabhs pharyngitis, incidence of suppurative, and long-term, regional, nonsuppurative complications of gabhs pharyngitis, over a ten year period. results. 213 (11%) of the children received no treatment. most children received antibiotics for only 46 days (in correlation with the duration of fever, which in most cases lasted up to 3 days). three hundred and six (15.3%) children had clinically diagnosed recurrent tonsillopharyngitis; 236 (12.3%) had positive gabhs findings within 10 to 14 days and thirty-four (1.7%) within 2130 days after the index positive gabhs culture. the remaining 1.3% had no positive culture despite the clinical findings. almost all recurrences [236 (11.6%)] occurred within 14 days and 156 (7.6%) in the fully treated group. the presence of fever during the first 3 days of the disease was the most significant predictor for recurrence. other predictors were the age younger than 6 years and the presence of cervical lymphadenitis. no increase in the incidence of nonsuppurative or suppurative complications was noted during the 10-year follow-up period, compared to the past incidence of those complications in israel. conclusions. our data suggests that the majority of children discontinue antibiotics for gabhs tonsillopharyngitis a day or two after the fever subsides. the incidence of complications in our study was not affected by this poor compliance.

PMC3388424

pubmed-306

adenoid cystic carcinoma (adcc) is a malignant salivary gland tumor that was first described by billroth in 1859 under the name cylindroma attributing to its cribriform appearance formed by the tumor cells with cylindrical pseudolumina or pseudospaces. the term adenoid cystic carcinoma was introduced by ewing (foote and frazell) in 1954. adcc is a relatively rare malignant salivary gland tumor comprising less than 1% of all malignancies of head and neck. it is the 5 most common malignancy of salivary gland origin, representing 5-10% of all salivary gland neoplasms. the parotid and submandibular glands are the two most common sites for adcc accounting for 55% of the cases. among the major glands, adcc accounts for 8.3% of all palatal salivary gland tumors and 17.7% of malignant palatal salivary gland tumors (afip series). the other less common sites are lower lip, retromolar tonsillar pillar area, sublingual gland, buccal mucosa and floor of the mouth. the nose and paranasal sinuses represent the next most common sites for minor gland adccs. the tumor is most often clinically deceptive by its small size and slow growth, which actually overlies its extensive subclinical invasion and marked ability for early metastasis making the prognosis questionable. the three recognized histological variants of adcc are cribriform, tubular and solid although, cribriform is the most commonest and solid is the least commonest. it is not uncommon to have more than one histopathologic pattern in a single neoplasm and rather all three patterns can be observed in the majority of tumors. the main reason for histological typing is to assess the prognostic difference between histologic types. tubular pattern (well differentiated) is believed to have the best prognosis compared to the cribriform pattern (moderately differentiated) and solid pattern (poorly differentiated). a 60-year-old male patient reported to the department of oral and maxillofacial surgery with a chief complaint of pain and discharge in the upper left back region of the jaw since one and half years. according to the patient one year prior to our consultation, he got the maxillary molars extracted from a local dentist due to pain and mobility of the teeth in that area. upon consultation patient revealed that the pain continued to exist even after the extraction. the patient is a known hypertensive and is on medication since three years for the same. the patient had smoking habit, which he quit only a couple of years ago. intraoral examination revealed a solitary erythematous swelling with diffuse borders involving the left posterior portion of hard palate and was also seen involving the soft palate on the same side. the swelling was seen extending from mesial aspect of first premolar to 1 cm posterior to tuberosity on left side, involving the palatal area but not crossing the midline [figure 1]. intraorally, the lesion was seen involving the hard and soft palate but not crossing the midline the swelling was nontender. the clinical differential diagnosis included a benign or malignant neoplasm of minor salivary glands, a neoplasm of maxillary sinus. ct scan showing complete obliteration of left maxillary sinus an incisional biopsy of palate and sinus lining was performed. islands of uniform cells arranged in cord-like pattern with hyperchromatic nuclei were seen enclosing round to oval pseudocystic spaces in the stroma. the tumor cells are also seen arranged in the form of solid islands [figure 4] and ductal pattern [figure 5]. focal areas showed small cords and longitudinal tubules of isomorphic cells set in a background of densely hyalinized stroma [figure 6]. variable-sized cribriform spaces formed by small deeply basophilic cells imparting swiss cheese pattern solid pattern composed of nests of basaloid cells and mitotic figures tubular pattern characterized by ductal structures formed by layers of isomorphic basaloid cells tubules of isomorphic tumor cells set in a densely hyalinized stroma a diagnosis of adcc (cribriform pattern) was established. the patient was treated by wide surgical excision with clear margins and hemi-maxillectomy of left maxillary region with post-radiotherapy. the present case was staged as t4n0m0 based on american joint committee on cancer as a guide to prognosis. the patient was under regular follow-up and is free of the disease at one-year follow-up. adenoid cystic carcinoma most often presents a diagnostic and treatment challenge owing to the rarity of the lesion. most findings regarding adcc are actually based upon studies with a small number of patients and there is a need for further information regarding its clinical behaviour as well as treatment modalities and their results. adcc may occur at any age although in most cases the patients age ranged from 24 to 78 years. the age of patients affected with major salivary gland tumors has been shown to be younger (mean 44 years) compared to the age of those who developed tumors of the minor glands (mean 54 years) and shows female predilection (f: m 1.2:1). pain is a common and important finding, occurring early in the course of the disease before there is a noticeable swelling. palate is more commonly involved generally the area of greater palatine foramen. among the malignant neoplasms of minor salivary glands, the most common was mucoepidermoid carcinoma (21.8%) followed by polymorphous low grade adenocarcinoma (plga) (7.1%) and adccs of the minor glands have been reported to have worse prognosis than those of the major salivary glands. tumors involving the nose, paranasal sinuses and maxillary sinus have the worst prognosis as they are usually detected with higher stages at the time of diagnosis. tumors of minor salivary glands usually have the tendency to infiltrate extra glandular soft tissues and bone thereby allowing increased dissemination of the tumor. lymph node involvement is uncommon (< 5% of cases) and is usually due to contiguous spread rather than lymphatic permeation or embolization. the differential diagnosis of adcc includes plga, basal cell adenoma (bca), mixed tumor and basaloid squamous cell carcinoma (bsc). the cribriform pattern so typical of adcc may also rarely be seen in bca, mixed tumor and plga, and the distinction between plga and adcc is more challenging. a polymorphous architecture characterizes plga whereas adcc has a more limited range of histologic patterns with no more than three patterns. plga shows uniform cell population with cytologically bland, round or oval vesicular nuclei and pale eosinophilic cytoplasm where as cells in adcc have clear cytoplasm, angular, hyperchromatic nuclei and may show mitotic activity. the ki-67 index is reported to be 10 times higher in adcc compared to plga. smooth muscle markers of myoepithelial differentiation are positive in adcc but negative in plga. though plga may form solid areas, they lack the overall high-grade feel associated with adcc. occasional foci in pleomorphic adenoma (pa) can resemble adcc but the presence of typical myxochondroid matrix and plasmacytoid or spindle shaped cells helps to avoid confusion. cribriform structures may sometimes be observed in bca and such cases can be differentiated from adcc on the basis of gradual structural alteration from areas typical of bca. the peripheral palisading and focal squamous differentiation with whorling pattern present in bca are not usually encountered in adcc. the basement membrane material secreted by bsc tends to dissect between tumor cells rather than form crisp cribriform spaces seen in adcc. focal keratinization, attachment to rete pegs, and presence of surface squamous dysplasia or carcinoma in situ helps to distinguish it from adcc. immunohistochemical studies demonstrated that the pseudocysts are positive for periodic acid schiff reagent (pas) and alcian blue and contain basement membrane components such as type iv collagen, heparin sulfate and laminin isoforms. epithelial cells are positive for carcinoembryonic antigen (cea) and epithelial membrane antigen (ema). duct lining cells are positive for c-kit (cd117) and myoepithelial cells are positive for s-100 protein, calponin, p63, smooth muscle actin and myosin. expression of s-100, glial fibrillary acidic protein (gfap) and neural cell adhesion molecule have been correlated with the presence of perineural invasion. molecular genetic data: alterations in chromosomes 6q, 9p and 17p12-13 are the most frequent cytogenetic alterations reported. hypermethylation of the promoter region of the p16 gene was associated with higher histologic grades of malignancy. possible treatment modalities available for the treatment of adcc are surgery, radiotherapy, chemotherapy and combined therapy. it requires excision with the widest surgical margins possible as tumor cells extend well beyond the clinical and radiographic margins. neutron therapy, which involves larger particles of greater energy can achieve reasonable local control as a primary therapeutic modality. main factors associated with patient survival are anatomic location, primary lesion size, presence or absence of metastasis at the time of diagnosis, perineural invasion and histological variant. distant metastasis occurs in 25%-50% of patients and lung is the most common involved site. the 5-year survival rate after effective treatment is 75%, but long-term survival rates are low (10 years-20% and 15 years-10%). the present patient was recalled at every 6-month interval in view of the sinus involvement and propensity for distant metastasis. lesions involving the sinus tend to have a poor prognosis due to its infiltrative growth and distant metastasis.

adenoid cystic carcinoma is an uncommon, slow growing malignant salivary gland tumor that is characterized by wide local infiltration, perineural spread, propensity to local recurrence and distant metastasis. in this paper, the authors present a case of adenoid cystic carcinoma affecting the palate and involving the maxillary sinus in a 60-year-old male patient along with a brief review of literature.

PMC3731973

pubmed-307

the quantity of trauma victims and the management involved in attending them leads to a great workload in most hospitals and places an enormous amount of pressure on the health care system. furthermore, traumatic injuries have been reported as the leading cause of death in the first 40 years of life and appear to be on the increase. during the last decade, interpersonal violence (ipv) was one of the main etiological factors of fractures of the maxillofacial complex. road traffic accidents remain the most important cause of maxillofacial trauma worldwide, although falls and assaults have become more significant in north america, brazil and europe. blunt and cutting wounds on the head and neck are also common. legal underreporting is common due to associations with alcohol abuse, illicit drug use, firearms and acts of violence against women, children, and the elderly, which generate fear, shame, low self-esteem and a sense of powerlessness. facial fractures associated to ipv have functional, aesthetic and psychological effects on the victims, as well as a socioeconomic impact on the health systems of many countries .these victims are more likely to suffer from depression, anxiety and post-traumatic stress disorder. epidemiological studies help to identify demands, develop prevention programs and structure an integrated care system. the aim of this retrospective study was to compare the peculiarities of maxillofacial injuries caused by interpersonal violence with other etiologic factors. this retrospective study involved data collected from clinical notes and surgical records of patients treated at seven different hospitals located in three different cities in so paulo state, brazil. the sample was selected based on analysis of medical records of facial trauma patients attended by the department of oral and maxillofacial surgery in the piracicaba dental school at the university of campinas from january 1999 to december 2012. a standardized form was designed to investigate the epidemiologic features of maxillofacial traumas, considering aspects such as age, gender, diagnosis, soft tissue lesions, facial injuries and general injuries. the exclusion criterion was incomplete information about the type of trauma on the medical chart. the origin of the facial trauma was classified as follows: traffic accidents (automobile and motorcycle); work accidents; sport accidents; falls; interpersonal violence; cycling accidents; pedestrian accidents and others. facial injury sites were classified as follows: upper (frontal bone); middle (maxilla, nasal bones, zygomatic-orbital complex, naso-orbital ethmoidal) and lower (mandible). mandibular fractures were described according to the anatomic site: condylar fractures; angle fractures; body fractures and fractures of symphysis. the present study was approved by the research ethics committee of piracicaba dental school, state university of campinas (fop/unicamp) under protocol number 75/2013. data were submitted to statistical analysis (simple descriptive statistics and chi-squared test) with the support of the statistical package for social sciences (spss 18.0 for windows, spss inc, chicago, il). binary logistic regression and the chi-square test were performed and the results were considered relevant when p<0.05. these included absolute frequencies (raw counts) and relative frequencies (proportions or percentages of the total number of observations). based on the 13-year study period, 3,724 patient referrals to the maxillofacial surgery department were enrolled in the present study. the median age at the time of admission was 29.2 years, with a standard deviation of 17.06 years. a total of 612 patients (16.4%) exhibited facial injuries related to ipv. in this group, male victims prevailed with 81% (n=496) and the mean age was 31.28 years, with a standard deviation of 13.33 years. weekly consumption of alcohol was reported by 32.4% and tobacco use was 43.8%. in total, 79 patients (12.8%) reported using non-injecting illicit drugs and 14 (2.2%) stated that they currently used injecting drugs. in 176 cases, isolated alveolar-dental injuries were observed in 35 patients. with regards to maxillofacial fractures, table 2 shows the distribution of diagnoses in the general sample and among patients who were victims of physical assault. distribution of patients with facial injuries according to etiological factors n=number of patients. distribution of facial injury diagnoses among a general sample and patients whose facial injury was associated with interpersonal violence (ipv) n=number of patients. in the cases of mandibular fractures, the anatomic regions most affected were the body and the mandibular angle, with 36 cases in each region, followed by the condyle (25 cases), symphysis (9 cases) and isolated mandibular ramus (2 cases). in 41 patients, fractures involving more than one anatomic region of the mandible lacerations and abrasions on the face were identified in 181 and 105 patients, respectively. table 3 displays the distribution of body injuries in these patients, when compared to the general sample. distribution of body injuries among patients with facial trauma and patients whose facial injury was associated with interpersonal violence (ipv) the calculation is based on whole sample (n=3724). the calculation is based on patients that involved with ipv (n=612). comparison of features of facial injury of victims of interpersonal violence (ipv) and other etiologic factors n=number of patients; =chi-square. a greater number of fractures and lacerations of the face was observed, although with fewer facial abrasions. with regards to the area of bone fractures, fewer injuries occurred in other regions of the body, mainly due to fewer injuries of the upper and lower limbs. however, patients that were associated with ipv exhibited a greater number of injuries to the neurocranium. binary logistic regression was performed to determine whether fractures in facial injuries were affected by gender, age (median 30 years), drug use, the presence of lacerations or the presence of abrasions. fractures were associated with gender: male patients are more at risk than females (or=1.61, p<0.002, 95% ci: 1.05 to 2.46). although motor vehicle accidents are still the main cause of maxillofacial fractures in some developing countries, recent data from developed countries have shown that ipv is the dominant cause. ipv is one of the leading causes of maxillofacial fractures and its prevalence in a population varies according to geographic region and appears to be associated with factors such as socioeconomic status, population density and age characteristics. the prevalence of male victims has been reported in most studies, ranging from 61% to 92%, as well as a mean age of approximately 30 years [10-14]. however, children are also affected and several studies have reported the patterns and severity of these injuries. this age group is susceptible to craniofacial trauma due to their greater cranial mass-to-body weight ratio. compared to adults, less 65 patients were under 18 years of age, although most of them (36 patients) were aged between 16 and 18 years. these patients mainly exhibited nasal bone (21 patients) and mandibular fractures (12 patients), results which are in accordance with the literature. the prevalence of male victims is influenced by cultural models of gender, defined as the set of attributes, values, roles and behavior patterns that are expected from a man in a particular culture. generally, the traits valued in this socialization are aggression, domination and exploitation of danger, which could contribute to their association with ipv. ipv among females is mainly associated with domestic violence. in the present study, it was not possible to determine the pattern of violence suffered. when the victim is female, the case should be investigated regardless of the site of the injury, as there is a greater possibility that they are the victim of physical aggression due to the vulnerability of the gender. another relevant factor is the differences in female participation in social activities, making them more (or less) prone to urban violence. patients who were victims of physical assault, unlike other etiologies such as sports accidents, are often affected by problems such as drug use and poverty. in the present study, we found high consumption rates of alcohol, tobacco and non-injecting drugs. its consumption results in an increase in confidence, followed by the subjective feeling of increased mental and physical capacity, as well as impaired judgment and coordination.. found that alcohol was involved in 87% of maxillofacial fractures caused by ipv, compared with 58% for motor vehicle accidents. studies have reported that fractures of the mandible are the most prevalent, followed by zygomatic complex fractures [17-19]. furthermore, we showed that the prevalence of mandibular and nasal bone fractures was higher in this group of patients. the literature indicates that trauma associated with ipv are less severe than those associated with other etiological factors due to the magnitude and speed of impact. despite this fact, patients in which ipv was the etiologic factor exhibited a higher prevalence of bone fractures when compared to all other patients treated. possibly, some patients with minor injuries do not seek medical care due to shame or fear. a high frequency of soft tissue lesions were found on the face, particularly lacerations. in the literature, the most common orofacial injuries are lip injuries, followed by other soft tissue injuries on the face, gingival and oral mucosa injuries, and teeth and/or periodontal injuries. the pattern of facial fractures is related to the type, direction and force of impact, as well as the anatomical features of the area. ipv injuries are usually caused by punches or kicks, for which the face is the main target region. the face is probably the target for most acts of physical aggression as it is easily reached, due to its location at the same height as the aggressor s raised arm. it has also been suggested that the aggressor either consciously or unconsciously wishes to affect the victim s self-esteem. males appear to be injured by more dangerous mechanisms and are more frequently injured by objects than females. the mandible, which is mobile and prominent on the face, is more susceptible to trauma. in the present study, the region of the mandibular angle has been considered the least resistant, mainly due to the presence of the mandibular third molar. these accidents often cause pan-facial, cranial, orthopedic, abdominal and cervical spine injuries, which may require multidisciplinary input, with significant interventions such as intubation, craniotomy and tracheostomy. conversely, ipv tends to be associated with isolated fractures, particularly in the mandibular region. the present study confirmed that most patients were affected by a fracture in only one region of the face. a lower prevalence of injuries was recorded for other parts of body. although the world health organization considers the response of health-care services to victims of violence to be an international priority, health professionals are generally not qualified to identify the injuries or council victims. the role of health professionals is to identify the etiology of the injury and, in cases of physical aggression, provide the victim with information on where to seek help. moreover, health professionals are not well prepared to ask sensitive questions and are unaware of victim-support institutions. the findings of the present study demonstrated that facial trauma caused by interpersonal violence seem to be associated with a higher rate of facial fractures and lacerations when compared to all other patients with facial injuries. male patients are more likely to exhibit severe injuries and exhibited a greater amount of bone fractures. prominent areas of the face and neurocranium should be carefully examined as they tend to be more prone to injuries. glaucia maria bovi ambrosano, associate professor, department of community dentistry, campinas state university piracicaba dental school, for statistical analysis assistance .

abstractobjectivesthe aim of this retrospective study was to compare the peculiarities of maxillofacial injuries caused by interpersonal violence with other etiologic factors. material and methodsmedical records of 3,724 patients with maxillofacial injuries in so paulo state (brazil) were retrospectively analyzed. the data were submitted to statistical analysis (simple descriptive statistics and chi-squared test) using spss 18.0 software. resultsdata of 612 patients with facial injuries caused by violence were analyzed. the majority of the patients were male (81%; n=496), with a mean age of 31.28 years (standard deviation of 13.33 years). these patients were more affected by mandibular and nose fractures, when compared with all other patients (p<0.01), although fewer injuries were recorded in other body parts (2=17.54; p<0.01); victims of interpersonal violence exhibited more injuries when the neurocranium was analyzed in isolation (2=6.85; p<0.01). conclusionsfacial trauma due to interpersonal violence seem to be related to a higher rate of facial fractures and lacerations when compared to all patients with facial injuries. prominent areas of the face and neurocranium were more affected by injuries.

PMC4306322

pubmed-308

the influence of protecting groups on the reactivity and selectivity of glycosyl donors is a widely recognized and exploited phenomenon. the corresponding influence of protecting groups on the anomeric equilibrium, while evident for many years, is less widely studied and exploited. recent examples of the latter include the recognition that 2n,3o-oxazolidinones both facilitate anomerization in the 2-amino-2-deoxyhexopyranosides and stabilize the axial over the equatorial anomer, with similar effects being apparent in hexopyranosides carrying a 2,3-o-cyclic carbonate group, and the realization that cyclic 4,6-o-acetals modulate the anomeric effect in the hexopyranoses. our interest in the use of the n-acetyl-4o,5n-oxazolidinone protected sialyl donors, and their n-desacetyl counterparts, which have emerged as some of the most powerful and equatorially selective systems for the preparation of sialyl o-glycosides, as well as their c- and s-counterparts, prompted us to examine the effect of these systems on the anomeric equilibrium of sialyl glycosides. the magnitude of the anomeric effect is typically assessed either by mutarotation of anomeric hemiacetals or by the brnsted or lewis acid-mediated equilibration of glycosides, and such methods have been used to determine the position of the anomeric equilibrium in both n-acetyl neuraminic acid itself and its methyl glycoside, leading to the conclusion that the axial glycoside is significantly more strongly favored in the sialic acids (figure 1) than in glucose and that mutarotation of the hemiacetal takes place via a ring-opening mechanism. the attempted synthesis of a n-acetyl-4o,5n-protected sialyl hemiacetal 2 by hydrolysis of the corresponding thioglycoside 3 resulted in the formation of a complex mixture of the two anomers of 2 and of the acyclic form 4, and its hydrate 5, as determined by nmr spectroscopy, in which the latter two species predominated (figure 2). the complexity of the spectra together with the predominance of the open-chain forms revealed the strain placed on the pyranose forms by the presence of the trans-fused oxazolidinone ring, even if no distortion of the pyranose ring is evident from x-ray structures, and precluded use of the standard methods in this investigation. compounds employed in and arising from the mutarotation of an oxazolidinone-protected sialose derivative. accordingly, we turned our attention to the use of neutral methods for the equilibration of sialic acid glycosides such as would not involve the intermediacy of the anomeric hemiacetal and would be compatible with the readily cleaved activated oxazolidinone ring. precedent for the equilibration of anomeric stereochemistry through the reversible homolytic cleavage and reformation of anomeric c h, c co, and c te bonds, suggested that the answer might lie in radical reactions. the need to approximate as closely as possible the properties of o-glycosidic bonds suggested the synthesis and equilibration of o-glycosyl derivatives of sterically hindered n, n-disubstituted hydroxylamines by the fischer albeit less substituted than the systems required for the radical equilibration process, glycosyl hydroxylamines are found in nature in the enediyne antibiotics calicheamicin 16 and esperamicin 7, and simple hydroxylamines have been employed as glycosidic bond surrogates in neoglycoconjugates (figure 3). moreover, the distinct conformational preferences of the o-glycosyl hydroxylamine linkage have been advanced as a design element used by nature to assist in the binding of calicheamicin to the minor groove of dna.o-glycosyl hydroxylamines have been identified as metabolites of various drugs, including glucosides and glucuronides of the antioxidant 2,2,6,6-tetramethylpiperidin-1-ol. natural products featuring the o-glycosyl hydroxylamine moiety. in a preliminary communication we established the concept with sialyl glycosides of 2,2,4,4-tetramethylpiperidin-1-ol in a single solvent. in this article we report in full on the synthesis of the o-sialyl glycosides of two further hydroxylamines of differing steric bulk and conduct equilibration studies in three solvents spanning a broad range of polarities. the influence of the sialyl protecting groups, solvent polarity, and hydroxylamine steric bulk on the thermal equilibration reactions of the sialyl hydroxylamines are presented and afford insight into the influence of the trans-fused oxazolidinone group in sialic acid chemistry. the lack of kinetic selectivity of sialyl anomeric radicals is discussed from the viewpoint of their conformation, which is based on literature electron spin resonance data of cognate radicals. despite the presence of o-glycosyl hydroxylamines in various enediyne antibiotics and their use in neoglycoconjugates, literature methods for their synthesis are limited to the glycosylation of (i) various n-acylated hydroxylamines, e.g., n-hydroxyphthalimide and n-carboethoxy hydroxylamine, (ii) oximes, and (iii) nitrones, each with subsequent manipulation of the functionality at nitrogen. these methods are, however, not suitable for the synthesis of the sterically hindered o-glycosyl n, n-dialkylhydroxylamines required for this investigation, and we therefore turned to the design of alternative routes. a brief investigation of the direct glycosylation of n-hydroxy-2,2,6,6-tetramethylpiperidine with efficient sialyl donors such as developed previously in our laboratory was unfruitful, perhaps for reasons of steric hindrance, and we turned therefore to radical reactions and their relative indifference to steric constraints. previous workers have generated sialyl anomeric radicals for the purposes of c-sialoside formation by the action of stannyl radicals on sialyl chlorides, but we have preferred simple photolysis of a readily available s-sialyl xanthate ester 8. we note in passing that attempted photochemical equilibration of xanthate 8 resulted, in a process reminiscent of the barton fortunately, 254 nm photolysis of 8 through pyrex in a rayonnet photoreactor in the presence of the stable nitroxyl radicals tempo (10), tmio (11), and sg1 (12) resulted in the formation of the desired o-glycosyl hydroxylamines 1416 as reported in scheme 2. attempted application of this method to dbno 13(107) resulted only in the formation of the glycal 9. that the photolysis of 8 can be interrupted with appropriate radical traps before the formation of glycal 9 indicates that it takes place via a two-step process giving an initial radical pair followed by disproportionation (scheme 1). this observation, which is critical to the success of the project, differs from the original conclusion of the barton and porter laboratories regarding the photoelimination of thiobenzoate esters. those workers preferred a concerted elimination from a photochemically excited state of the thiocarbonyl ester on the basis of (i) the observation of a short-lived transient on irradiation of the thiobenzoate, and (ii) the inability to trap radical intermediates with (unspecified) radical traps. we also note, however, and more in line with the results observed here, that the photolysis of s-acyl xanthate esters is known to proceed with homolytic scission of the s-acyl bond resulting in acyl radical formation. returning to the synthesis of the o-glycosyl hydroxylamines, when the photolysis of 8 was conducted in the presence of tempo (10) the product 14 was obtained as an approximately 1:2 mixture, favoring the isomer (-) with the axial hydroxylamino residue, in 69% yield together with 10% of the glycal. with tmio (11), the adduct 15 was obtained in 72% yield as an approximate 1:2.2: mixture. photolysis in dichloroethane in the presence of racemic sg1 (12) gave only the glycal 9, but the anomeric radical could be intercepted in 45% yield when neat sg1 (12 equiv) was used as solvent. finally, photolysis in the presence of di(t-butyl)nitroxide in dichloroethane afforded only the glycal 9. given the use of racemic sg1, there are four potential diastereomers of 16, but the product was isolated as a mixture of two predominant but inseparable isomers, the major one of which we tentatively assign as an equatorial (-) adduct and the minor as an axial (-) adduct without commenting on the configuration at the stereogenic center adjacent to the phosphoryl group. the anomeric stereochemistry in each of the adducts 1416 is assigned on the basis of the j heteronuclear coupling constant between the anomeric carboxyl carbon and the axial methylene proton at c3 in the pyranose ring, which is diagnostic in the sialic acid glycosides. these assignments are also supported by noe measurements for the axial (-) anomer of 14 and subsequent members of the same series (vide infra), which reveal the spatial proximity of the axial h6 in the pyranose ring and one or more of the methyl singlets in the hydroxylamine moiety. resubmission of 14 to the photolysis conditions did not result in any change in the anomeric ratio consistent with the lack of a suitable chromophore, and indicating the products 1416 to be kinetic mixtures. rate constants for the trapping of alkyl radicals by nitroxyl radicals, while high (10 to 10 s), are nevertheless below the diffusion controlled limit for stabilized alkyl radicals and are dependent on steric bulk in both the radical and the trap. the stereoselectivities observed in the formation of 1416 therefore must factor in the inherent face selectivity of the intermediate radical 18 (figure 4) and the steric bulk of the trap, which according to bowry and ingold, follows the trend dbno>tempo>tmio on the basis of kinetic trapping data (sg1 not being included in the study). we conclude therefore that radical 18 shows a modest axial selectivity that can be overridden by the use of the presumably more bulky trap sg1. this modest axial selectivity is consistent with the work of paulsen and matschulat, who recorded an axial/equatorial trapping preference of 1.8:1 for the reaction of 18 with allyltributylstannane at 60 c in thf, but not with the work of nagy and bednarski, who reported an approximate axial/equatorial ratio of 1:1 for the same reaction conducted at room temperature under photochemical conditions. we depict radical 18 as a close to planar -radical with extensive delocalization onto the carboxyl oxygen resulting in two distinct conformers about the exocyclic c1c2 bond (figure 4) on the basis of literature esr data for simple model radicals. thus, esr studies of the tri-o-acetyl-2-deoxy-1-glucosyl radical 19 show it to adopt a chair conformation with an out of plane bend of 6 for the anomeric carbon consistent with a radical that is 90% sp hybridized. the methoxycarbonylmethyl radical 20 is a planar -radical with extensive delocalization onto the carboxyl oxygen and a barrier to rotation about the ch2co2me bond of 11 kcal mol, and the methoxy(methoxycarbonyl)methyl radical 21 displays esr parameters that closely mirror those of 20, including the hyperfine splitting ah indicative of coupling to the ester methyl hydrogens, which is diagnostic of extensive delocalization. finally, the close model radicals 22 and 23 also show esr spectral parameters consistent with those for 20, including hyperfine splitting by the ester methyl hydrogens and two distinct rotamers about the c5co2me bond. the two radicals 22 and 23, isomeric at the -position, adopt different conformations so as in each case to maximize the overlap of the -acetoxy group with the singly filled orbital, a phenomenon known as quasi-homoanomeric stabilization. it follows that when the -position is unsubstituted as in radicals 18 and 19, and the constraint of the quasi-homoanomeric interaction absent, the chair conformation will be retained. predicted structure of the intermediate radical 18 and literature structures of the model radicals 1923 with key esr parameters (hyperfine splitting constants a in mt). presumably, it is the close to -type, approximately planar structure of radical 18 and the presence of the anomeric carboxyl group that accounts for the low kinetic stereoselectivities in its reactions with radical traps, which contrast with the high axial selectivity seen in the chemistry of simple per acetylated glycosyl radicals, including 19, and their 1-alkoxy derivatives. thus, trapping of radical 18 along the axial direction, while favored on stereoelectronic grounds and leading directly to the chair conformation of the product, involves a 1,3-diaxial interaction between the axial h4 and h6 and the partially formed c2o bond, while equatorial trapping results in 1,3-diaxial interaction of h4 and h6 with the fully formed c2-co2me bond albeit while placing the incoming bulky hydroxylamine in the sterically more accessible equatorial position (figure 5). this latter mode only begins to predominate with the most bulky nitroxide trap, sg1 (12) and the formation of 16 (scheme 2). a similar rationale has been previously invoked for exo endo-selectivity, with competing steric interactions between a full covalent bond to a substituent at the radical center and partially formed covalent bond to an incoming trap for the bicyclic radical 24. competing transition states for the trapping of radical 18 showing 1,3-diaxial interactions with h4 and h6, and structure of the radical 24. with a series of glycosyl hydroxylamines in hand, and with a view to examining the influence of protecting groups on the anomeric equilibrium, a set of standard protecting group manipulations were applied to 14 and 15, as illustrated in scheme 3, giving a number of derivatives for subsequent equilibration studies. a series of equilibration reactions were then conducted by heating individually (0.050.1 m) solutions of substances 14, 15, and 3033 to 90 c in each of deuteriobenzene, deuterio-1,2-dichloroethane, and deuterioacetonitrile, with periodic monitoring by nmr spectroscopy until no further change was observed (table 1). attempted equilibration of the sg1 derivative 16 resulted only in the formation of the elimination product 9, for which reason, coupled with the problem of extra diastereomers arising from the stereogenic center in the aglycone, the sg1 series was not pursued further. a further compound, the n, n-diacetyl tempo glycoside 25 was also subjected to equilibration in deuterio-1,2-dichloroethane (table 1); however, further work with this compound was not conducted in other solvents, nor was the tmio analogue prepared. the mechanism of the equilibration process involves reversible homolytic scission of the glycosyl-hydroxylamine c o bond to an anomeric radical and a persistent aminoxyl radical (scheme 4). ingold radical effect that the recombination is intermolecular rather than intramolecular within the confines of the initial radical pair. the intermolecular nature of the process enables its use in combinatorial library generation, and for the present purposes it was readily demonstrated by a simple crossover experiment. thus, heating of 15 in the presence of an equimolar amount of tempo in 1,2-dichloroethane to 90 c for nine days, after which no further change was observed, resulted in the formation of an approximately 1:2 mixture of 14 and 15, both as a mixture of anomers favoring the -anomers. the predominace of the tmio sialosides 15 over the tempo sialosides 14 in this equilibrated mixture indicates the greater thermodynamic stability of 15 over 14, which is consistent with the less hindered, more tied back nature and therefore less persistent nature of the tmio radical 11 in comparison to the tempo radical 10. successful achievement of the equilibration process required rigorous exclusion of oxygen, which was achieved by copious sparring with argon, and possibly moisture, as with some batches of deuterioacetonitrile a further type of byproduct exemplified by 34 was observed (scheme 5). while this thermal oxidative decarboxylation process of a sialic acid glycoside is certainly interesting in view of other sialic acid decarboxylation processes, both oxidative and reductive, we have not pursed it further at present, especially as it could be avoided by degassing and use of fresh deuterioacetonitrile. first, as compared to sialic acid itself (figure 1) and to simple methyl sialosides the o-sialyl hydroxylamines studied all show an inverted preference for the equatorial over the axial glycosides. second, there is a solvent effect on the position of the anomeric equilibrium with the equatorial (-) anomers generally being more highly favored in the higher polarity solvents. third, the magnitude of this solvent effect is on the whole greater in the tmio series (table 1, entries 2, 5, and 7) than in the tempo series (table 1, entries 1, 4, and 6). fourth, the anomeric ratio at equilibrium is a function of the protecting groups employed with the same trends being seen for the both the tempo and tmio series of compounds. the general preference of the equatorial over the axial glycosides seen in table 1, which contrasts sharply with the strong anomeric effect in simple sialosides, reflects the significant steric bulk of the hindered hydroxylamine aglycones and the attendant destabilization of the axial glycosides through classical 1,3-diaxial interactions. this reversal of the anomeric preference between simple sialosides and those of hindered hydroxylamines does not detract from the validity of comparisons within the later series of compounds that form the core of this article. the observed solvent effect, which is consistent with the well-known general trend whereby the anomeric effect is greatest in less polar solvents, simply reflects the more polar nature of equatorial versus axial glycosides. the greater solvent dependence of the tmio series as compared to the tempo series of compounds presumably arises from the more polar nature of the tmio group relative to the tempo group, which is a function of the presence of the electron-withdrawing arene in the tmio moiety. the most consistent trend, which holds for both the tempo and tmio series of compounds and for all three solvents assayed, involves the change in anomeric ratio as a function of protecting groups at the o4 and n5 positions. thus, there is generally a greater preference for the equatorial glycoside, or a smaller anomeric effect, in the 4o,5n-oxazolidinone series (table 1, entries 4 and 5), than in the n-acetyl-4o,5n-oxazolidinone series (table 1, entries 6 and 7), which in turn show a greater equatorial preference than the 4o,5n-diacetyl series (table 1, entries 1 and 2). although less data is available, the 4o,5n,5n-triacetyl compounds (table 1, entry 3) appear to fall between the diacetyl and the n-acetyloxazolidinones. decreasing preference for the axial (-) sialoside as a function of protecting group. turning to the reasons underlying the general greater preference for the equatorial glycosides (figure 6) in the oxazolidinone series, we discount steric arguments based on a smaller steric clash between the aglycone and the o4 protecting group in the oxazolidinones because the usual exoanomeric effect conformation about the glycosidic bond will orient the aglycone toward the rear of the molecule and away from o4 (figure 7). indeed, the typical exoanomeric effect conformation with an n o anomeric c ring oxygen torsion angle of -60 is evident in the x-ray crystal structure of a calicheamicin derivative, in the x-ray structures of a simple o-glycosyl hydroxylamine, and of various o-glycosyl oximes and hydroxyimides, albeit a molecular mechanics-based computational paper appears to suggest a n o anomeric c ring oxygen torsion angle of 170. newman projection about the hydroxylamine n o bond showing the typical exoanomeric effect conformation of the o-glycosyl hydroxylamines. rather we suggest that the influence of the oxazolidinone on the anomeric effect is rooted in the highly polar nature of the oxazolidinone system with its strong dipole moment aligned with the axis of the carbonyl bond (figure 8). thus, as illustrated in figure 9, the oxazolidinone moiety exhibits a powerful electron-withdrawing effect in the mean plane of the pyranose ring due to the alignment of the carbonyl dipole with the polar c4o4 and c5n5 bonds. this is to be contrasted with the 4o,5n-diacetyl system in which, assuming the standard minimum energy conformations of the ester and amide groups with the latter apparent from the 180 h5c5n5nh torsion angle with jnh, h5=10 hz, the two carbonyl dipoles are oriented in opposite directions and approximately perpendicular to the c4o4 and c5n5 bonds resulting overall in a smaller electron-withdrawing effect. the electron-withdrawing effect of the n-acetyloxazolidinone system, while still powerful because of the alignment of the oxazolidinone carbonyl with the c4o4 and c5n5 bonds in the mean plane of the pyranose ring, is moderated by the orientation of the acetyl group, which, as is clear from the available x-ray crystal structures and literature data with simple models, is oriented so as to minimize the overall dipole (figure 8) at least in weakly polar environments. dipole moments (debye units) of open chain and cyclic carbonyl functionalities in nonpolar solvents. orientations of the key o4 and n5 protecting group carbonyl dipole moments in the o-sialyl hydroxylamines (side chains omitted for clarity). if the anomeric effect is understood in terms of donation of electron density from a lone pair (n) on the ring oxygen into the synperiplanar c o *orbital of the axial glycosidic bond, the influence of the oxazolidinone can be attributed to the lowering of the energy of the lone pair due to the presence of the strongly electron-withdrawing group, which in turn reduces the n*interaction and so diminishes the anomeric effect. in valence bond terms this equates to the destabilization of the double bond no bond resonance form owing to the increased energy of the oxocarbenium ion arising from the presence of the strongly electron-withdrawing protecting group (figure 10). it can also be argued in view of the high dipole moment of the oxazolidinone group that there is a dipolar component to the stabilization of the equatorial glycosides. thus, in the axial glycosides the vectors of the oxazolidinone dipole and the anomeric carbon oxygen bond dipole subtend an angle of approximately 90, whereas in the equatorial glycoside the angle subtended is approximately 60, suggesting that the equatorial glycosides will be more highly stabilized in less polar media, as is the case (table 1). a new method of equilibration of sialyl anomeric c o bonds has been developed on the basis of the fischer ingold persistent radical effect. this method enables the investigation of protecting groups on the anomeric equilibrium and is compatible with acid and base sensitive functionality. the trans-fused oxazolidinone moiety is found by this method to stabilize equatorial glycosides over their axial counterparts, i.e., to reduce the magnitude of the anomeric effect. this effect, which adds to a series of recent observations on the influence of cyclic protecting groups on the anomeric effect, is a manifestation of the strongly electron-withdrawing nature of the trans-fused oxazolidinone, (and by extrapolation trans-fused cyclic carbonates), which is a direct consequence of the highly dipolar nature of such heterocycles. the strongly electron-withdrawing nature of these groups manifest by the present study more than likely also plays an important role in the high kinetic selectivity observed in the trans-fused oxazolidinone (and cyclic carbonate)-directed -sialoside synthesis methods. the unusually poor kinetic diastereoselectivity of anomeric radicals in the sialic acid series is a function of the -type planar nature of these radicals coupled with the existence of competing 1,3-diaxial interactions in the diastereomeric transition states for the formation of both anomers.

a method for the investigation of the influence of protecting groups on the anomeric equilibrium in the sialic acid glycosides has been developed on the basis of the equilibration of o-sialyl hydroxylamines by reversible homolytic scission of the glycosidic bond following the dictates of the fischer ingold persistent radical effect. it is found that a trans-fused 4o,5n-oxazolidinone group stabilizes the equatorial glycoside, i.e., reduces the anomeric effect, when compared to the 4o,5n-diacetyl protected systems. this effect is discussed in terms of the powerful electron-withdrawing nature of the oxazolidinone system, which in turn is a function of its strong dipole moment in the mean plane of the pyranose ring system. the new equilibration method displays a small solvent effect and is most pronounced in less polar media consistent with the anomeric effect in general. the unusual (for anomeric radicals) poor kinetic selectivity of anomeric sialyl radicals is discussed in terms of the planar -type structure of these radicals and of competing 1,3-diaxial interactions in the diastereomeric transition states for trapping on the- and -faces of the radical.

PMC4004215

pubmed-309

duodenal ulcer perforation is still a common complication of chronic peptic ulcer disease. despite the wide spread use of anti-secretory and h. pylori eradication therapy most of the literature pertaining to the situation in the developed world, showed that the disease is largely confined to the elderly patients taking ulcerogenic medications.[15] the situation in the developed nations is summed up by johnson: the surgeon s major role in the management of peptic ulcer disease will be the performance of life-saving emergency operations in the elderly unfit patient. in contrast to the developing world, the patients are younger and have a long life-time of potentially useful activity ahead of them[18] as anti-secretory and anti-h. pylori eradication drugs are been freely used, we had expected an improvement in this disease condition. hence, we set out in this review to look at the prevalence, pattern of presentation, risk factors and management outcome in the study environment and we also set out to look at the management pattern if sufficient for a semi-urban area in a developing world. this review was conducted at the federal medical centre ido-ekiti, southwest nigeria. the case records of all patients with clinically established diagnosis of pdus, managed in this center from january 2004 to december 2011 were reviewed. the diagnostic protocol for every patient at presentation included: the clinical findings, abdominal ultrasound, and chest x-rays which in some cases gave further credence to the diagnosis. full blood count, urea and electrolytes, creatinine, and urinalysis results were documented. the patients were optimized for surgery with intravenous fluids, antibiotics, and urethral catheterization. clinical and intra-operative findings, treatment outcome and follow-ups were all evaluated. none of the patients had a prior diagnosis of their ulcer by an upper gastro-intestinal endoscopy (ugie) before presentation. although, 20 (66.6%) of them had peptic ulcer symptoms with, inadequate or no medical treatment. the remainder, 10 (33.3%) presented for the first time with perforation, with no prior treatment for peptic ulcer disease. the notable risk factor was the free abuse of herbal concoction (admixture of local gin, spices, roots and bitters) for body pains. fifteen patients took alcohol and only two took non-steroidal anti-inflammatory drugs [table 1]. a good proportion of the patients 76.6% were referred to us from private health institutions, while the rest came to our center from their homes. after adequate resuscitation, all the 30 patients had emergency surgery of simple closure of their perforations, re-enforced with an omental patch and thorough peritoneal larvage. most of the 26 managed patients had a favorable outcome; were discharged home and followed-up at the clinic for 4-6 weeks but later lost to follow-up. pdu is still a major complication of chronic peptic ulcer disease seen quite often in the study center, as well as other centers of the world as a frequent cause of acute abdomen. although experience from some parts of nigeria showed that gastric outlet obstruction has overtaken pdu in incidence, it is still frequently seen in many centers in nigeria, as well as many centers in the developed world.[17] this study has also highlighted that the perforation affected mostly the younger age group (in their 3 -6 decade) [table 2], which is in keeping with studies in many centers in the developing world.[111] much has been written about non-operative management of pdu in the western world. since the early works of croft et al., there has been considerable interests in the non-operative management of pdus. in a randomized trial comparing surgical and non-surgical therapy, for pdu, they showed a mortality rate of 5% in each group and no difference in morbidity., have also shown that non-operative therapy could be effective in selected patients. they showed that as much as 81% of their patients were treated conservatively, but 43% later had surgery. some writers have claimed that virtually all patients with pdu, could be managed conservatively. however, conservative management has not been accepted by many workers; whereas, most surgeons have difficulty in understanding how a patient who has wide spread peritonitis with food debris widely distributed throughout the abdominal cavity can improve without operation. undoubtedly, there are patients with small leaks, from a perforation and with relatively mild peritoneal contamination who may be managed conservatively; these are in a minority. we did not consider this treatment option because of the delay in presentation, 2-7 days as well as the socio-economic implications of long hospitalization. all patients were operated as soon as they were resuscitated and optimized for surgery. in the pre h. pylori era, in the developed world, it has been shown that only 30% of patients with pdu treated with simple closure and thorough peritoneal larvage had good long-term result. in the present era, (h. pylori era), studies have shown, that operation may achieve long-term satisfactory results, only when h. pylori infections, present in 50-70% of patients with pdu is totally eliminated. however, all have agreed that it is sometimes difficult to determine the h. pylori status of patients having emergent operation for perforated d.u. in this study, none of the patients had an ugie done before presentation and surgery; and in all of them, their h. pylori status was not known: although, 20 (66.6%) of them were erratically treated at one time or the other for peptic ulcer disease symptoms. all patients had simple closure of their perforation with omental patch reinforcement, thorough peritoneal larvage and h. pylori eradication therapy was instituted. this is only palliative and is sufficient for the elderly patients in the developed world. patients who have suffered one perforation may suffer another one if anti-secretory drugs are not maintained; as it were, for life. this life-long treatment is obviously not within the reach of an average patient in the developing world. in this study, most workers, from the developing world have also shown that pdu, affects mostly the younger age group.[18] all have attested to the fact that this group are not likely to be anti eradication drug compliant for life. the costs of these drugs, re-infection by h. pylori organisms even after the eradication and dyspeptic symptoms after surgery,[18] shows that this palliative surgery (omental patch) is obviously not appropriate for a resource poor center, vis-a-vis for the developing world; that a shift towards the free use of definitive ulcer surgery should be the goal. dempsey summed it all, using the possible h. pylori infection eradication as an excuse not to do a definitive ulcer operation in any patient with perforated d-u is irrational. therefore the various surgical options that have been proposed by workers in the field include: omental patch closure+highly selective vagotomyomental patch closure+bilateral truncal vagotomy (btv)resectional surgery+truncal vagotomypyloroplasty+btv. dakubo et al., writing from a west african sub-region had shown statistically that age greater than 60 years, alcohol intake and resectional surgery are key factors in predicting post-operative morbidity and mortality. it stands therefore to reason that since the majority of the patients in the study center vis-a-vis developing world are below 60 years, they stand to benefit from a curative definitive ulcer surgery. pyloroplasty (inco-operating the perforation) and btv is quite safe and highly recommended because of its short operative time, simplicity and easily reproducible by all, even trainee surgeons. omental patch closure+highly selective vagotomy omental patch closure+bilateral truncal vagotomy (btv) resectional surgery+truncal vagotomy pyloroplasty+btv. pdu disease is still a frequent cause of acute abdomen in many centers of the developing world where it affects mostly the youths. the relative high costs of triple regime therapy for h. pylori eradication, fear of re-perforation and easy loss to follow-up, call for an urgent re-appraisal of the present method of surgical treatment. therefore, a more liberal role for wide spread definitive ulcer surgery is suggested for most of our young patients.

introduction: perforated duodenal ulcer (pdu) is still seen frequently in the study center inspite of the free use of effective medical curative therapy. we then set out to ascertain the pattern of presentation, peculiar risk factors in the study environment, re-evaluate our method of management, and to see if it is adequate for patients in a developing country. materials and methods: this is a retrospective study of patients admitted and managed for pdus, between january 2004 and december 2011 at the federal medical centre, idoekiti, southwest nigeria. the records of patients were retrieved and demographic data relating to age, sex, symptoms, duration, diagnosis, intra-operative findings, and management outcome were extracted. the results were analyzed. results:a total of 30 patients were admitted and operated during this period. twenty-eight of them were males and two were females. the mean age was 47 years and the male: female ratio was 14:1. the duration of symptoms before presentation ranged from 2 to 7 days. none of the patients had a prior diagnosis of their ulcers, by an upper gastro intestinal endoscopy before presentation; although most had dyspeptic symptoms, with inadequate or no medical treatment. the notable peculiar risk factor was the abuse of local herbal concoction for body pains by all the patients. seven patients smokes, 15 consumes alcohol, and only two take non-steroidal anti-inflammatory drugs for body pains. most of the managed patients; 26 were satisfactorily discharged home and later followed-up at the surgical out-patient department. four mortality was recorded during the period of study. conclusion:pdu is still a major complication of chronic peptic ulcer disease. simple omental patch and h. pylori eradication is no longer appropriate as a mode of treatment for the youths who are mostly affected in the center. we therefore, suggest a more wide spread use of definitive ulcer surgery for most of our patients with no pre-operative risk factors.

PMC3762035

pubmed-310

protease inhibitors have been purified from an array of leguminous and nonleguminous species encompassing torresea cearensis, erythrina caffra, dolichos lablab, crotalaria paulina, medicago scutellata [5, 6], canavalia gladiata, pisum sativum, dimorphandra mollis, swartzia pickellii, psophocarpus tetragonolobus, delonix regina, poecilanthe parviflora, adenanthera pavonina, cajanus cajan, dolichos biflorus, phaseolus acutifolius, arachis hypogaea, leucaena leucocephala, bauhinia bauhinioides, bauhinia variegata, bauhinia ungulata, vigna unguiculata, lens culinaris, glycine max, peltophorum dubium, pithecellobium dulce, glycine soja, and barley. protease inhibitors impair the activity of insect midgut proteases and thus adversely affect protein digestion and health in insects. they represent one of the multitude of entomotoxic proteins [30, 31]. in addition to insecticidal activity [3235], protease inhibitors demonstrate antiproliferative and antitumor activities [3645]. the objective of the present study was to isolate and characterize proteins with protease inhibitory activity from white cloud beans. an aqueous extract of the beans (250 g) was produced by blending in distilled water (3 ml/g) followed by centrifugation (14000 g for 25 minutes at 4c). the resulting supernatant was applied to a 5 20 cm column of deae-cellulose (sigma) in 10 mm tris-hcl buffer (ph 7.4). after elution of unadsorbed proteins (fraction d1), the column was eluted successively with 0.2 m nacl and 1 m nacl in the tris-hcl buffer. fraction d2 eluted with 0.2 m nacl was dialyzed to remove nacl and then subjected to affinity chromatography on a 5 15 cm of affi-gel blue gel (bio-rad) in 10 mm tris hcl buffer (ph 7.4). the unadsorbed fraction (b1) was dialyzed against 10 mm nh4oac buffer (ph 5) and then applied to a 2.5 20 cm column of sp-sepharose (ge healthcare). after elution of unadsorbed proteins (fraction s1), the column was eluted with a 0-1 m nacl concentration gradient in the nh4oac buffer. the first and second adsorbed fractions (sp2 and sp3) were then further purified by gel filtration on a superdex 75 hr 10/30 column (ge healthcare) in 0.2 m nh4hco3 buffer (ph 8.5) using an akta purifier (ge healthcare). the molecular mass of the isolated proteins was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) following the procedure of laemmli and favre. gel filtration on an fplc-superdex 75 column, previously calibrated with molecular mass marker proteins (ge healthcare), was employed to determine the molecular mass of the protein. the n-terminal sequence of the protein was analyzed by using a hewlett-packard hp g1000a edman degradation unit and an hp 1000 hplc system. the test sample (20 l) was added to 160 l of a 1% casein solution in 0.1 m tris-hcl buffer (ph 7.4). trypsin (20 l of a 0.5 mg/ml solution) was then added and the mixture was incubated at 37c for 15 minutes followed by addition of trichloroacetic acid (0.4 ml, 5%) that was added to bring the reaction to an end. after centrifugation the absorbance of the resulting supernatant, which indicates the amount of casein fragments produced by trypsin, was read at 280 nm. the% inhibition of trypsin activity is equal to the% decrease in absorbance of the supernatant. the isolated trypsin inhibitor (2.5 m) was treated with dithiothreitol (dtt) at the final concentration 2.5, 10 and 40 mm for 5, 20, and 80 minutes at 37c. soybean trypsin inhibitor from sigma (2.5 m) was similarly treated and used as a positive control. the reaction was terminated by adding iodoacetamide at twice the amount of thiol functions at each dtt concentration. residual trypsin inhibitor activity was measured at ph 7.4 as described above in assay for trypsin inhibitory activity. the highest iodoacetamide concentration used in the test was devoid of any effect on trypsin activity and the trypsin inhibitory activity of isolated trypsin inhibitor and soybean trypsin inhibitor. the cell lines l1210 (human leukemia) and mbl2 (murine lymphoma) were obtained from american type culture collection. the cell line was maintained in dulbecco modified eagles ' medium (dmem) supplemented with 10% fetal bovine serum (fbs), 100 mg/l streptomycin, and 100 iu/ml penicillin, at 37c in a humidified atmosphere of 5% co2. cells (1 10) in their exponential growth phase were seeded into each well of a 96-well culture plate (nunc, denmark) and incubated for 3 hours prior to addition of the trypsin inhibitor. incubation was performed for an additional 48 hours. radioactive precursor, 1 ci ([ h-methyl]-thymidine, from ge healthcare), was then introduced to each well and the incubation continued for 6 hours. the assay for hiv reverse transcriptase inhibitory activity was carried out in view of the report that trypsin inhibitors manifest this activity [50, 51]. it was conducted according to instructions supplied with the assay kit from boehringer mannheim (germany). the assay makes following use of the ability of reverse transcriptase to synthesize dna, commencing from the template/primer hybrid poly (a) oligo (dt) 15. the digoxigenin- and biotin-labeled nucleotides in an optimized ratio are incorporated into one of the same dna molecule, which is freshly synthesized by the reverse transcriptase (rt). the detection and quantification of synthesized dna as a parameter for rt activity are based on a sandwich elisa protocol. biotin-labeled dna binds to the surface of microtiter plate modules that have been precoated with strepatavidin. in the following step, an antibody to digoxigenin, conjugated to peroxidase, binds to the digoxigenin-labeled dna. in the last step the peroxidase enzyme affects the cleavage of the substrate, yielding a colored reaction product. the absorbance of the sample at 405 nm which is directly correlated to the level of rt activity can be measured using a microtiter plate (elisa) reader. a fixed amount (46 ng) of recombinant hiv-1 reverse transcriptase was used. the inhibitory activity of the trypsin inhibitor was calculated as percent inhibition compared to a control without the trypsin inhibitor. the plasmid that expressed his-tagged wild-type hiv-1 integrase, pt7-7-his (y | tx)-hiv-1-in, was a generous gift from professor s.a. a 1-liter culture of e. coli bl21 (de3) cells containing the expressing plasmid was grown at 37c until it reached od600 0.7-0.8. cells were induced by addition of 0.8 mm iptg (isopropyl--d-thiogalactopyranoside) and harvested, after 4 hours of incubation, by centrifugation at 6000 g for 10 minutes at 4c. cells were suspended at a concentration of 10 ml/g wet cell paste in 20 mm tris-hcl buffer (ph 8.0) containing 0.1 mm edta, 2 mm -mercaptoethanol, 0.5 m nacl, and 5 mm imidazole. after incubation at 4c for 1 hour, the lysate was sonicated and centrifuged at 40 000 g at 4c for 20 minutes. the pellet was homogenized in 50 ml buffer a (20 mm tris-hcl, ph 8.0, 2 m nacl, 2 mm -mercaptoethanol) which contained 5 mm imidazole. the suspension was rotated at 4c for 1 hour and cleared by centrifugation at 40 000 g at 4c for 20 minutes. the supernatant was applied to a 1 ml chelating sepharose (ge healthcare) column charged with 50 mm imidazole. the column was eluted with five column volumes of buffer a containing 5 mm imidazole, and the protein was eluted with three column volumes of buffer a containing 200 and 400 mm imidazole, respectively. protein containing fractions were pooled, and edta was added to a final concentration of 5 mm, followed by dialysis against buffer b (20 mm hepes, ph 7.5, 1 mm edta, 1 m nacl, 20% glycerol) containing 2 mm -mercaptoethanol and then against buffer b containing 1 mm dithiothreitol. a nonradioactive elisa-based hiv-1 integrase assay was carried out according to the dna-coated plate method. in this study, 1 g of smal-linearized pbluescript sk was coated onto each well in the presence of 2 m nacl as target dna. the donor dna was prepared by annealing vu5br (5-biotin-gtgtggaaaatctcta- gcagt-3) and vu5 (5-actgctagagattttccacac-3) in 10 mm tris-hc1, ph 8.0, 1 mm edta, and 0.1 m nacl at 80c, followed by 30 minutes at room temperature. integrase reaction was conducted in 20 mm hepes (ph 7.5) containing 10 mm mncl2, 30 mm nacl, 10 mm dithiothreitol, and 0.05% nonidet-p40 (sigma). after the reaction, biotinylated dna immobilized on the wells was incubated with streptavidin-conjugated alkaline phosphatase (boehringer-mannheim, mannheim, germany), followed by colorimetric detection with 1 mg/ml p-nitrophenyl phosphate in 10% diethanolamine buffer (ph 9.8) containing 0.5 mm mgcl2. the activity of sars coronavirus (cov) protease was reflected by a cleavage of designed substrate which is composed of two proteins linked by a cleavage site for sars cov protease. the reaction was carried out in a mixture containing 5 m sars cov protease, 5 m sample, and 20 m substrate and buffer [20 mm tris-hcl (ph 7.5), 20 mm nacl and 10 mm beta-mercaptoethanol] for 40 minutes at 37c. the reaction was then terminated by heating at 100c for 2 minutes. then the reaction mixture was analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page). if sars cov protease is inhibited by the test sample, there is only one band, which is the intact substrate, shown in sds-page. the assay for antifungal activity toward botrytis cinerea and fuserium oxysporum was executed in 100 mm 15 mm petri plates containing 10 ml of potato dextrose agar. after the mycelial colony had grown to a sufficiently large size, sterile blank paper disks (0.625 cm in diameter) were laid at a distance of 0.5 cm away from the edge of the mycelial colony. an aliquot (15 l) of the trypsin inhibitor was added to a disk. the plates were exposed at 23c for 72 hours until mycelial growth had enveloped the disks containing the control and had produced crescents of inhibition around disks containing samples with antifungal activity. anion exchange chromatography of the bean extract on deae-cellulose resolved it into three fractions, an unadsorbed fraction d1 together with two adsorbed fractions d2 and d3. after affinity chromatography of fraction d2 on affi-gel blue gel, the activity appeared in the unadsorbed fraction b1 (data not shown). ion exchange chromatography of fraction b1 on sp-sepharose resolved it into a small unadsorbed fraction sp1 and three large adsorbed fractions (sp2, sp3, and sp4) of about the same size (figure 1). final purification of sp2 on superdex 75 produced two fractions, sp2su1 and sp2su2 (figure 2(a)). gel filtration of sp3 on superdex 75 yielded two fractions sp3su1 and sp3su2 (figure 2(b)). fractions sp2su2 and sp3su2, both with a molecular mass of 16 kda as determined by gel filtration on superdex 75, were the only fractions with trypsin inhibitory activity. both sp2su2 and sp3su2 displayed a molecular mass of 16 kda in sds-page (figure 3) and gel filtration (figure 2). these two white cloud bean trypsin inhibitors inhibited trypsin with an ic50 of about 0.6 m (figure 4). dtt treatment curtailed the trypsin inhibiting activity in a dose- and time-dependent manner (table 3). the two trypsin inhibitors did not inhibit hiv-1 reverse transcriptase when tested at various concentrations up to 100 m (table 4). they lacked antifungal activity when tested up to 24 g/disk (100 m, 15 l) (data not shown). the ic50 values of the inhibitory effects of the trypsin inhibitors on l1210 cells were, respectively, 21.5 m and 28.8 m (table 4). however, there was no activity toward mbl2 cells when tested up to 100 m. the present study disclosed the production of two trypsin inhibitors with closely related n-terminal sequences chromatographic behavior and bioactivities by the white cloud bean variety of phaseolus vulgaris. the trypsin inhibitors demonstrate the same molecular mass; both are adsorbed on deae-cellulose and unadsorbed on affi-gel blue gel but can be separated by ion exchange chromatography on sp-sepharose. they have approximately the same trypsin inhibitory potency, and neither of them inhibits hiv-1 reverse transcriptase inhibitory activity, hiv-1 integrase inhibitory activity, sars coronavirus proteinase inhibitory activity, or fungal growth. both inhibitors exhibit an antiproliferative activity toward l1210 cells albeit with a small difference in potency, while there is little activity toward mbl2 cells. the difference in yields of the two trypsin inhibitors from the white cloud beans is only slight. the two trypsin inhibitors exhibit n-terminal sequence homology with those of other leguminous trypsin inhibitors such as inhibitors mungbean (vigna mungo), cowpea (vigna unguiculata), and lima bean (phaseolus lunatus). whereas leguminous antifungal proteins [48, 49], like nonleguminous antifungal proteins, are unadsorbed on deae-cellulose and adsorbed on affi-gel blue gel, white cloud bean trypsin inhibitors are adsorbed on deae-cellulose and unadsorbed on affi-gel blue gel. thus the purification procedure adopted in the present investigation can be conveniently used to separate trypsin inhibitors from antifungal proteins. the antiproliferative activity of white cloud bean trypsin inhibitors is consistent with similar observations on field bean trypsin inhibitor [39, 40, 42, 43, 54]. it is noteworthy that white cloud bean trypsin inhibitors do not exert a similar action on lymphoma mbl2 cells. in contrast to broad bean trypsin inhibitor [48, 56], those from white cloud bean do not inhibit hiv-1 reverse transcriptase. this is reminiscent of the finding that lentil and vigna mungo inhibitors have little or no hiv-1 reverse transcriptase inhibitory and antifungal activities [57, 58]. in summary, the isolation of two trypsin inhibitors with very similar biochemical and biological characteristics from white cloud beans was achieved in the present investigation. white cloud bean trypsin inhibitors demonstrate antiproliferative activity against tumor cells but do no inhibit mycelial growth or hiv-1 reverse transcriptase. previously isolated p. vulgaris trypsin inhibitors have not been so tested [6064]. they reportedly have a molecular mass of about 9 kda [63, 65] or 13 kda, smaller than the value of 16 kda obtained for white cloud bean trypsin inhibitors.

a purification protocol that comprised ion exchange chromatography on deae-cellulose, affinity chromatography on affi-gel blue gel, ion exchange chromatography on sp-sepharose, and gel filtration by fplc on superdex 75 was complied to isolate two trypsin inhibitors from phaseolus vulgaris cv white cloud bean. both trypsin inhibitors exhibited a molecular mass of 16 kda and reduced the activity of trypsin with an ic50 value of about 0.6 m. dithiothreitol attenuated the trypsin inhibitory activity, signifying that an intact disulfide bond is indispensable to the activity. [methyl-3h] thymidine incorporation by leukemia l1210 cells was inhibited with an ic50 value of 28.8 m and 21.5 m, respectively. they were lacking in activity toward lymphoma mbl2 cells and inhibitory effect on hiv-1 reverse transcriptase and fungal growth when tested up to 100 m.

PMC2896657

pubmed-311

although about two-thirds of patients with epilepsy (pwe) treated with antiepileptic drugs (aeds) reach seizure-freedom, about one-third remains drug-resistant to the current therapies.1 despite the introduction of new aeds with a better pharmacokinetic and safety profile compared to old generation aeds, today, one of the major causes of failure of antiepileptic treatment is poor adherence often due to occurrence of adverse drug reactions (adrs), leading up to 25% of patients to discontinue treatment before the achievement of effective doses and with a consequent increase of health care costs.2,3 during the last 25 years, many efforts have been directed to the development of new aeds with different mechanisms of action able to reduce brain hyperexcitability; recently considerable interest has been focused on synaptic vesicle protein 2a (sv2a) and its role as a target for aeds.4 the first drug of this new class approved for epilepsy is levetiracetam (lev), and from this lead compound, several racetam analogs have been synthesized.5 based on target-drug program, brivaracetam (brv) (2s)-2-[(4r)-2-oxo-4-propylpyrro-lidinyl]butanamide, an n-propyl analog of lev has been identified and has entered clinical trials for pwe;6 it is an sv2a ligand with high selectivity and a 1030-fold higher potency, depending on the experimental conditions, when compared to lev.7,8 the purpose of this review is to present updated data available on the pharmacology, efficacy, and tolerability of brv. we have conducted a systematic search in the pubmed and cochrane library databases up to august 14, 2015 summarizing all relevant data for efficacy, safety, and tolerability of brv in the treatment of partial-onset seizure. although the correlation between sv2a binding and anti-convulsant potency in animal models has been previously demonstrated, the role of sv2a in neurotransmission still remains unclear.9 in fact, even if it has been established that sv2a protein is involved in normal synaptic vesicle function, the exact mechanism of synaptic vesicle cycling regulation and neurotransmitter release remains unknown.5,9 several preclinical studies have demonstrated that brv is more potent and efficacious than lev in animal models of both focal and generalized epilepsy.10 in particular, in fully amygdala-kindled rats, brv induced a significant suppression in motor-seizure severity from a dose of 21.2 mg/kg, whereas lev caused a similar effect from a dose of 170 mg/kg. brv also significantly reduced the after-discharge duration at the highest dose tested (212.3 mg/kg), whereas lev was inactive on this parameter up to 1,700 mg/kg.10 moreover, brv protected significantly against both partial and generalized seizures in fully amygdala-kindled mice resistant to phenytoin (effective dose 50 [ed50]: 68.3 mg/kg, intraperitoneal [ip]).10 recently, it has been demonstrated that brv has a higher brain permeability than lev, with consequently more rapid onset of action after acute dosing in audiogenic mice; this fast onset of action might also have a potential clinical relevance for the treatment of status epilepticus or cluster seizures.11 another study confirmed the protective activity of brv against kindled seizures with focal seizure threshold and significantly severity significantly modified.12 furthermore, a recent study, using a rapid kindling model in p14, p21, p28, and p60 rats, has evaluated two doses of brv 10 and 100 mg/kg, demonstrating that brv 100 mg/kg significantly increased the after-discharge threshold at all ages, whereas brv 10 mg/kg increased after-discharge threshold in p60, p28, and p21 rats. brv also reduced the after-discharge duration, achieving statistical significance with 10 and 100 mg/kg at p60 and with 100 mg/kg, at p21. at p60, brv increases the number of stimulations required to reach stage 45 seizures in a dose-dependent manner. at p28 and p21, brv increased the number of stimulations required to develop stage 45 seizures in a dose-dependent manner, with almost complete elimination of stage 45 seizures.13 moreover, brv showed a marked synergism with diazepam to reduce seizure duration in self-sustained status epilepticus induced by stimulation of the perforant path.14 a recent study has evaluated the antiseizure and antimyoclonic activities of brv in comparison to lev in an animal model of posthypoxic myoclonus, showing higher efficacy of brv (0.3 mg/kg) than lev (3 mg/kg) against posthypoxic seizures.15 furthermore, recent experiments conducted in transgenic mice with alzheimer s disease supported an adjunctive and peculiar role of brv that not only revealed an efficacy against spike-wave discharges similar to ethosuximide, but it showed the ability to reverse memory impairment, thus extending the potential spectrum of action of this new aed.16 in addition to sv2a block, brv also exhibits inhibitory activity on neuronal voltage-gated sodium channels (vgsc) playing a role as a partial antagonist, as has been reported for other aeds.17,18 in particular, experimental studies on primary cortical cultures have demonstrated that brv is able to prolong the sodium channel time recovery from fast inactivation, and this effect could reduce the availability of sodium channel during high-frequency repetitive firing.17,19 even if this data has been refuted by another recent experimental study that has showed that this vgsc inhibition does not impair sustained repetitive firing in neurons of neuroblastoma cells,20 this is an important aspect, which deserves to be better clarified, since the lack of effect of brv to reduce neuronal excitability by blocking high repetitive firing in neurons might exclude that the modulation of vgsc contributes to antiseizure effects of brv. brv presents a favorable pharmacokinetic profile, linear and predictable, with low intersubject variability and almost 100% bioavailability.2123 the pharmacokinetic properties of brv have been studied in healthy adult volunteers, in the elderly, in patients with pwe, and in those with hepatic or renal impairment.2225 the pharmacokinetic differences in elderly subjects compared to healthy volunteers are not so important as to require any dose adjustment.25 absorption of brv is unaffected by the presence of food, including high fat meals; after oral administration, brv is rapidly absorbed by the gastrointestinal tract, and displays linear and dose-proportional profile over the dose range tested.22,26 its distribution volume is close to total body water (vz=0.5 l/kg), and it binds weakly to plasma proteins (17.5%). its terminal half-life is ~9 hours.21 saliva and plasma brv levels are highly correlated, brv crosses the mucosa by passive diffusion, therefore, the saliva concentration of brv is correlated with plasma concentration. it is possible to speculate that saliva might be a suitable sample for monitoring brv levels when blood sampling could be a limiting factor.23 brv is extensively metabolized through several metabolic pathways and is fully excreted by urine (only 8%11% remains unchanged). brv is eliminated primarily by metabolism, with the major metabolic pathway involving hydrolysis of the acetamide group resulting in formation of an acid metabolite (brv-ac; 34.2% of a radiolabeled dose in urine).21 a secondary pathway, mainly mediated by cytochrome p450 (cyp) 2c19,27 forms a hydroxy metabolite (brv-oh; 15.9% of dose in urine).21 a combination of these two pathways leads to the formation of a hydroxyacid metabolite (15.2% of dose in urine);21,28 only 8.6% of the dose is recovered as the unchanged compound in urine.21 all three metabolites of brv are pharmacologically inactive (unpublished results) in an open-label study conducted in patients with liver disease, the plasma half-life of brv was prolonged up to 17.4 hours in correlation with the severity of hepatic impairment; however, the exposure to brv is increased by 50%60% in patients with hepatic impairment, irrespective of severity classified by child pugh score.25,26 these data suggest that the maximum daily dose of brv might be reduced by one-third in patients with hepatic impairment.25 in severe renal impairment, the exposure to a single oral dose of 200 mg brv not requiring dialysis (creatinine clearance<15 ml/min), and renal clearance of three metabolites (acid, hydroxy, and hydroxyacid), was decreased 10-fold in patients with severe renal impairment.24 nevertheless, there are data showing a toxicological coverage for metabolites, without the evidence of any safety issues (ucb data file). based on these observations, a dose adjustment for brv should not be required at any stage of renal dysfunction. the efficacy of brv as add-on therapy in patients with uncontrolled partial seizures has been assessed in six randomized placebo-controlled clinical trials (table 1).29 in the first two studies, brv as adjunctive therapy in adult patients with partial epilepsy and poor control with 12 concomitant aeds, at different doses (5, 20, 50, and 50150 mg/d) has been evaluated.30,31 french et al30 reported a statistically significant reduction of seizure frequency achieved at the 50 mg/d dose, with high tolerability and infrequent adrs. in particular, the percentage reduction over placebo in focal seizure frequency/week was directly correlated to brv dose, respectively 9.8% at 5 mg/d, 14.9% at 20 mg/d, and 22.1% at 50 mg/d, with a median percent reduction from baseline in seizure frequency/week of 21.7% (placebo), 29.9% (brv5), 42.6% (brv20), and 53.1% (brv50); 50% responder rates were 16.7% (placebo), 32.0% (brv5), 44.2% (brv20), and 55.8% (brv50); seizure freedom rates during the 7-week treatment period were 1.9% (placebo), 8.0% (brv5), 7.7% (brv20), and 7.7% (brv50). on the other hand, higher doses of brv would not seem to be more effective, in fact, van paesschen et al31 did not find significant differences in seizure frequency reduction between brv 50 and 150 mg/d during the 7-week maintenance period. in particular, the median seizure frequency/week was 1.00, 1.96, and 1.86 in the group treated with brv 50 mg/d, brv 150 mg/d, and placebo, respectively.31 the reduction in baseline-adjusted seizure frequency/week over placebo during the maintenance period was 14.7% in the brv 50 mg/d group and was 13.6% in the brv 150 mg/d group; however, a significant difference over placebo was observed on several secondary efficacy outcomes (10 weeks combined up-titration and maintenance period).31 in fact, after the 10-week treatment period, the median seizure frequency/week was 1.10, 2.05, and 1.95 in the brv 50 mg/d, brv 150 mg/d, and placebo groups, respectively. in the maintenance period, 50% responder rates were 23.1% for placebo compared with 39.6% for brv50 and 33.3% for brv150. during the treatment period, 50% responder rates were 17.3% for placebo compared with 35.8% for brv50 and 30.8% for brv150. nine patients were seizure-free during the 10-week treatment period in the brv50 group (three in the brv150 group, only one in the placebo group). in the study by ryvlin et al,32 the efficacy and safety/tolerability of brv (at doses of 20, 50, and 100 mg/d) in patients with uncontrolled partial seizures with/without secondary generalization, despite treatment with one or two concomitant aeds, was investigated. the percent reduction over placebo in baseline-adjusted seizure frequency/week was 6.8%, 6.5%, and 11.7% in the brv 20, 50, and 100 mg/d groups, respectively. the percent reduction over placebo in baseline-adjusted seizure frequency/28 days was 9.2% and 20.5% in the brv 50 and 100 mg/d groups, respectively. median percent reductions from baseline were 30.0% for brv 20 mg/d, 26.8% for brv 50 mg/d, and 32.5% for brv 100 mg/d in comparison to 17.0% for placebo. responder rates (50%) were 27.3%, 27.3%, and 36.0% for brv 20, 50, and 100 mg/d, respectively, in comparison to 20.0% for placebo. based on these results, only brv 100 mg/d was able to significantly reduce seizure frequency/week over placebo. indeed, in their randomized placebo-controlled trial, adjunctive brv at a daily dose of 50 mg significantly decreased seizure frequency, while lower dosages (5 and 20 mg/d) did not achieve significant differences.33 in more detail, the percent reduction in partial-onset seizure frequency/week in comparison to placebo was 0.9% (p=0.885) for brv 5 mg/d, 4.1% (p=0.492) for brv 20 mg/d, and 12.8% (p=0.025) for brv 50 mg/d; in the brv 50 mg/d group, statistical significance was also observed for the 50% responder rate (brv 32.7% vs placebo 16.7%) and median percent reduction from baseline in focal seizure frequency/week (brv 30.5% vs placebo 17.8%). recently a randomized, multicenter, double-blind phase iii trial was conducted by klein et al34 to evaluate the efficacy and the safety profile of brv at fixed doses of 100200 mg/d in adult patients with refractory partial onset seizures. responder rate was 21.6% for placebo group, 38.9% for brv 100 mg/d, and 37.8% for brv 200 mg/d; the percent reduction of partial onset seizures in 28-day frequency was 22.8% for brv 100 mg and 23.2% for brv 200 mg. kwan et al35 conducted a double-blind, randomized, placebo-controlled trial investigating the safety and tolerability profile of adjunctive brv (at individualized tailored doses ranging from 20 to 150 mg/d) in patients with partial or generalized refractory epilepsies. the percent of reduction of focal seizure frequency/week in the brv group in comparison to placebo was 7.3%, while only in the generalized seizures group, the number of seizure days/week decreased from 1.42 at baseline to 0.63 during the treatment period in brv-treated patients (n=36), and from 1.47 at baseline to 1.26 during the treatment period in the placebo group (n=13).35 the median percent reduction in baseline-adjusted seizure frequency/week was 26.9% brv vs 18.9% placebo, and the 50% responder rate was 30.3% brv vs 16.7% placebo. the median percent reduction from baseline in generalized seizure days/week was 42.6% vs 20.7%, and the 50% responder rate was 44.4% vs 15.4% in brv-treated and placebo-treated patients, respectively. similar to lev, brv might become a useful aed for the treatment of myoclonic seizures occurring in the setting of idiopathic generalized epilepsies (eg, juvenile myoclonic epilepsy)36 or of progressive myoclonic epilepsies.37 two randomized, placebo-controlled trials evaluating efficacy and safety of adjunctive brv (5150 mg/d) in unverricht lundborg disease, the most common and less severe form of progressive myoclonic epilepsies,38 failed to show a significant improvement of myoclonus in these patients.39 however, sample size was small (106 patients randomized in the two trials), and the patients were allowed to receive lev.39 moreover, it is well known that myoclonus may present high inter- and intrapatients variability (with patients experiencing good days and bad days) in unverricht currently an open-label, multicenter, follow-up study to evaluate the long-term safety and efficacy of brv is ongoing (brite study-nct01339559). finally, to date, in all studies performed, brv was evaluated as an oral tablet formulation, and no data are available about intravenous infusion since the study nct02088957, aiming at a comparison of the efficacy and safety of intravenous brv vs phenytoin in adult subjects with nonconvulsive electrographic seizures, was terminated for low enrollment. the most commonly reported adverse effects with brv in adults were primarily related to the central nervous system and included somnolence, fatigue, and dizziness.22 these adverse effects were mild to moderate, and the tolerability profile is so excellent that it did not impair therapeutic compliance. in fact, the daily dose of brv (20150 mg) was well tolerated and associated with 6.1% of discontinuation rates due to adrs compared to 5.0% of the placebo group.35 furthermore, adrs induced by brv seem to be time-related, disappearing during the course of treatment. the entity of sedative effects of brv measured by psychometric tests is dose-related in healthy men and appeared clearly from 600 mg upwards as a decrease in attention, motor control, and alertness.22 moreover, the type and the severity of adrs are not influenced by food.22 as demonstrated in healthy males, a twice-daily dosing regimen could be a good clinical practice to reduce blood fluctuations and peak, which might influence the appearance of adverse events.22 no effects on cardiac function were reported even at very high daily dosages (up to 800 mg/d).40 no data about fertility and/or potential teratogenic effect of brv in humans are currently available; however, no adverse effects were detected up to the highest tested oral dose of 400 mg/kg/d on fertility, and no effects on pregnancy or fetal development at 600 mg/d were observed in animals.26 seizure aggravation or the appearance of new generalized seizures was rare: three studies reported this adverse event, occurring in similar proportions between placebo and treated group (4.3% vs 5.2%, p=0.67).32,33,35 in the above-reported five randomized clinical trials, 1,639 subjects were included in an intention-to-treat analysis (1,214 treated with brv and 425 with placebo).3035 no differences were observed in the proportion of subjects experiencing at least one adverse event (65.5% with brv vs 60.5% with placebo, p=0.10). most events were mild to moderate; actually, comprehensive withdrawal rate due to adverse events was quite low and similar in brv and placebo arms (5.4% with brv vs 4.2% with placebo, p=0.37). serious adverse events were quite rare and equally distributed (2.9% with brv vs 4.4% with placebo, p=0.16). adverse events that were observed in at least 5% of subjects in either group are listed in table 2. the proportion of patients reporting fatigue and somnolence was significantly higher in brv group compared to placebo (table 2). irritability was reported in three studies only, and it was present in a small proportion of subjects (3% receiving brv, 1% receiving placebo, p=0.36). because of its advantageous pharmacokinetic profile, brv treatment does not appear to influence plasma concentrations of other aeds such as carbamazepine, lamotrigine, lev, oxcarbazepine, topiramate, or valproic acid.41 however, carbamazepine plasma levels are slightly reduced by coadministration of brv (400 mg/d), while levels of carbamazepine-epoxide are increased in a dose-dependent manner.26,42 this increase of plasma concentration of carbamazepine-epoxide is the result of inhibition by brv of epoxide hydrolase that metabolizes carbamazepine-epoxide into carbamazepine-diol.42 high doses of brv (400 mg/d) cause a moderate decrease of ethinylestradiol and levonorgestrel plasma levels (components of oral contraceptives) but this posological range has no impact on ovulation. no effect on contraceptive disposition is reported at therapeutic doses of brv 100 mg/d.39 interestingly, there is a possible negative interaction between brv and lev, in fact, the concomitant use of both drugs may reduce brv efficacy; however, this evidence is not robust because the number of patients with concomitant lev was very small, other studies may be useful to assess this apparent pharmacodynamic interaction.33 brv is a novel aed whose efficacy in partial epilepsies has been studied and established in five randomized controlled trials;3035 furthermore, two recent meta-analyses have confirmed significant effects for brv in patients with refractory partial seizures.29,43 considering that brv shares part of its mechanism of action with lev and that its ability to inhibit vgsc (still debated) is in common with several other aeds, it will be very intriguing to see how this drug will behave in real-life clinical practice. accordingly, it could be hypothesized that brv might possess at least the same effectiveness as lev. based on this hypothesis, brv may be reasonably considered as a valuable add-on aed in patients with partial seizures, also considering its suggested good tolerability. however, specific studies are needed to confirm its efficacy in specific epileptic syndromes, for example, a decreased expression of sv2a in the hippocampus of patients with temporal lobe epilepsy with hippocampal sclerosis has been documented and might represent a pharmacoresistance mechanism in some cases; however, lev has been reported to be effective.44,45 in addition, because of its good safety and pharmacokinetic profile, brv might be ideal for use in monotherapy, as previously demonstrated for lev.46 finally, few studies have been performed, and more randomized double-blind studies are needed to confirm these considerations and to demonstrate if brv might really confirm its promises and become a new tool for epileptologists.

brivaracetam (brv), a high-affinity synaptic vesicle protein 2a ligand, reported to be 1030-fold more potent than levetiracetam (lev), is highly effective in a wide range of experimental models of focal and generalized seizures. brv and lev similarly bind to synaptic vesicle protein 2a, while differentiating for other pharmacological effects; in fact, brv does not inhibit high voltage ca2+channels and ampa receptors as lev. furthermore, brv apparently exhibits inhibitory activity on neuronal voltage-gated sodium channels playing a role as a partial antagonist. brv is currently waiting for approval both in the united states and the european union as adjunctive therapy for patients with partial seizures. in patients with photosensitive epilepsy, brv showed a dose-dependent effect in suppressing or attenuating the photoparoxysmal response. in well-controlled trials conducted to date, adjunctive brv demonstrated efficacy and good tolerability in patients with focal epilepsy. brv has a linear pharmacokinetic profile. brv is extensively metabolized and excreted by urine (only 8%11% unchanged). the metabolites of brv are inactive, and hydrolysis of the acetamide group is the mainly involved metabolic pathway; hepatic impairment probably requires dose adjustment. brv does not seem to influence other antiepileptic drug plasma levels. six clinical trials have so far been completed indicating that brv is effective in controlling seizures when used at doses between 50 and 200 mg/d. the drug is generally well-tolerated with only mild-to-moderate side effects; this is confirmed by the low discontinuation rate observed in these clinical studies. the most common side effects are related to central nervous system and include fatigue, dizziness, and somnolence; these apparently disappear during treatment. in this review, we analyzed brv, focusing on the current evidences from experimental animal models to clinical studies with particular interest on potential use in clinical practice. finally, pharmacological properties of brv are summarized with a description of its pharmacokinetics, safety, and potential/known drug drug interactions.

PMC4622453

pubmed-312

cleft lip and palate (clp) patients are going through an extensive treatment with orthodontic and surgical correction of the position of teeth and hard and soft tissues. the aim of the primary surgery is to close the clefts of the lip and the soft palate. the aim of the secondary surgery is to close the cleft of the alveolus by bone grafting. surgery of the clefts induces formation of scar tissue, which affects the soft tissue matrix that guides the development of the maxillary complex. the scar tissue as well as a reduced growth of the mid face often causes a maxillary retrognatism, that adversely affects the chewing function, the ability to speak, the facial aesthetics, social life as well as psychological and general wellbeing of the clp-patients. for that reason, between 25 to 60% of the clp-patients need a surgical treatment of the maxillary retrognatism. this surgical-orthodontic treatment is the last part of the rehabilitation of the clp-patient, which has the objective to create a good dental occlusion and function, more harmonic facial aesthetics and increase the quality of life. since the 1970 's the standard treatment of clp-patients with a maxillary hypoplasia has been a le fort i osteotomy with a bone graft. treating extensive sagittal discrepancies maxillary surgery has to be combined with mandibular set-back. maxillary surgery is difficult in clp-patients because of the scar tissue, a tendency to relapse, poor bone quality and quantity and a reduced blood supply in the affected area. these conditions are responsible for a typical relapse of 20-25%. to compensate for this an overcorrection is often made during the surgical procedure, which can lead to an unpredictable final result. polley and figueroa described the use of distraction osteogenesis (do) as an alternative treatment of maxillary hypoplasia using an external bone distraction device. the principle of this treatment was to induce formation of immature bone in the gap after a le fort i osteotomy by gradual tensile strength separating the two segments. studies of the treatment have shown a significantly reduced tendency of relapse, favourable changes of the soft tissue and changes of the velopharyngeal closure similar to that of conventional advancement. the duration of the course of treatment is up to 16 weeks longer when choosing do. in this period the appliance penetrates the buccal mucosa in the sulcus and the patient must take care of the daily activation and keep it clean. the aim of this retrospective pilot study was to examine and compare the cleft lip and palate patients ' satisfaction after treatment with either maxillary distraction or traditional advancement of the maxilla after a le fort i osteotomy. in the period 1996-2007 forty-two clp-patients with need for advancement of the maxilla were surgically treated at the department of oral and maxillofacial surgery, aarhus university hospital by either traditional advancement of the maxilla or distraction osteogenesis. until 2000 the standard regime of treatment was a traditional advancement of the maxillary complex after le fort i osteotomy. since 2000 maxillary distraction has provided an alternative in treatment of clp-patients requiring a maxillary advancement of 10 mm or more. consequently, the patients in this study consisted of two groups of clp-patients with the need for surgical-orthodontic correction of maxillary hypoplasia. a criterion for both groups was that the postsurgical orthodontics had to be finished if the patient was to be included in the study. conventional group (conv) included patients treated with traditional advancement of the maxilla after a le fort i osteotomy in the period 1996-2007. the group do included patients treated with maxillary distraction table 1. patients ' characteristics according to gender, type of cleft, type of surgery performed, type of distractors used and age at surgery unsegmented le fort i osteotomy and internal distraction. unsegmented le fort i osteotomy and external distraction. m=male; f=female; uclp=unilateral cleft lip and palate; bclp= bilateral cleft lip and palate; cl. fifteen patients met the inclusion criteria in the do group and ten patients in the conv group. the composition of the two groups according to gender, type of cleft, type of distraction, type of distractors used, age at surgery and type of surgery performed is presented in table 1. group do consisted of 10 males and 5 females with a mean age at the time of surgery of 17.5 (sd 2.3) years while group conv consisted of 5 males and 5 females with a mean age at the time of surgery of 17.8 (sd 2.6) years. a quantitative method, a questionnaire, existing literature was reviewed and a list of relevant subjects was made and operationalized in a questionnaire containing 13 questions about the patients ' perception of aesthetics and function. the patients were asked to answer by making a mark on a vas-scale scaled 0-100. the score 0 indicating the highest level of satisfaction with functional parameters or facial aesthetics and the score 100 indicating the lowest level of satisfaction. the end points of the scales were unequivocal and easy to understand, for example no pain/intolerable pain; very satisfied/very unsatisfied; no discomfort/worst imaginable discomfort. the accompanying letter contained information about the aim of the study and how to answer. the patients were asked to return the questionnaire by pre-paid mail after two weeks. the study was approved by the central denmark region committees on biomedical research ethics. all patients had presurgical orthodontic treatment and were treated surgically with a high le fort i osteotomy. in the conv group the treatment was a conventional combined orthodontic-surgical treatment with model surgery and splint fabrication for the maxillary position and completed with postsurgical orthodontics. the patients in the conv group had an average advancement of 6.98 mm (range 5-11 mm). patients from the do group had the distraction device placed in pre-planned position calculated from lateral cephalograms and adjusted on a three-dimensional print of the skull based on a computed tomography (ct) or a cone beam ct (cbct). the appliances used for distraction were synthes internal distractor (synthes, west chester, pa, usa), kls martin internal distractor (kls martin group, tuttlingen, germany) and rigid external device (red) kls martin (kls martin group, tuttlingen, germany) for the external distraction procedures (table 1). all the patients treated with distraction were registered for model surgery using the same procedure as for the conventional treated patients using face bow registration, wax bite and articulator mounting. the patients had surgical splints fabricated and in the cases of do the splint was used as a guide for using intermaxillary elastics after the active distraction. the maxilla was thereby manipulated into the final planned position. in five of the do patients the palatal defect caused an unstable intersegmental position. the use of the splint was refrained from and intermaxillary elastics were used to guide the segments into occlusion. during the surgical procedure the internal distraction devices were adapted to the maxilla in the planned position. the screw holes were marked and the devices were removed in order to complete the le fort i osteotomy. after ensuring mobility of the maxilla the devices were fixed to the maxilla and tested for interference free activation. the mean latency period after device placement was 4.9 days (range 4-7 days). during the active phase of distraction the appliances were activated on a daily basis either by the patient or an assistant, usually a family member. activation was done twice a day with a rate of 0.5 mm, corresponding to 1.0 mm daily. activation went on until the planned position of the maxilla was achieved and intermaxillary elastics were then used to adjust the final position. the mean periodof active distraction was 17.7 days (range 13-28 days) and the mean advancement of the maxilla was 12 mm (range 6-16 mm). after an average consolidation period of 77.3 days (range 35-213 days), the patients were readmitted and the devices removed in general anaesthesia. the treatment was a conventional combined orthodontic-surgical treatment with model surgery and splint fabrication for the maxillary position and completed with postsurgical orthodontics. unpaired t-tests were performed to analyse intergroup differences regarding duration of orthodontic treatment and vas-scores in spss 18.0 (ibm, usa). statistical significance was defined as p<0.05. the duration of the orthodontic treatment was in average 10 months longer in the do group than the conv group and this difference was significant (p<0.05). neither the age distribution nor the period of time between surgery and completion of the questionnaire differed significantly (p<0.05) table 2. distribution of the patients ' groups according to gender, age at surgery and period between surgery and completion of the questionnaire after the primary surgery with insertion of the distractors. after the surgical procedure. unpaired t-test, states p<0.05 between patients of do and conv groups. nineteen out of 25 patients returned the questionnaires and the total response ratio was 76%. results of the patients ' satisfaction on a continuous visual analog-scale (vas) on a vas-scale scaled 0-100 with the score 0 indicating the highest level of satisfaction with functional parameters or facial aesthetics and the score 100 indicating the lowest level of satisfaction. both groups felt a great deal of satisfaction with their appearance both according to themselves and the perceptions of relatives and other people's reaction in general. both groups were satisfied with their general well being and felt few restrictions or discomfort during social activities. according to functional parameters the groups were alike. both groups were minimally affected by pain and sensory disturbances and reported a great deal of satisfaction with speech and breathing. the discomfort during eating and drinking and sleep were low as well in both groups. the greatest difference occurred in the parameter satisfaction with the duration of the treatment course. the do group scored higher on the vas-scale according to less satisfaction with the duration than the conv group. statistical analyses revealed no significant differences (p>0.05) among the groups which may be explained by the numbers of patients included in the study. distraction osteogenesis has become a widely used treatment of maxillary hypoplasia in clp-patients because of the reports of better stability and the possibility for larger advancements. however, it is a more complicated treatment because of the period with active distraction, the obligate need for good cooperation and the long consolidation phase with the patient still wearing the appliance. the present study is a pilot study and evaluates retrospectively patients ' satisfaction in two groups of clp-patients treated for maxillary hypoplasia with either maxillary distraction or conventional le fort i advancement. the number of patients was limited and especially the conv group was small and the number of patients responding was lower than in the do group. the results indicated a high level of satisfaction with the facial aesthetic at the end of treatment in both the do and the conv group. the parameters pain and sensory disturbances did not differ a lot between the groups in this study. it could be hypothesized that more extensive osteotomies and preoperative advancements in conv could induced more sensory disturbances and pain compared with a gradual movement and distraction histogenesis of soft tissues when using do. the groups had comparable scores according to the functional parameters eating and drinking, sleep, speech and breathing. do was significantly less satisfied with the duration of the treatment than conv probably according to a longer duration of the orthodontic treatment. the influence of the period with the distractors mounted on the level of satisfaction was not measured but it can be hypothesized that this period is troublesome. further studies of this period between mounting and removal is needed as the prolonged total treatment time is a disadvantage and perhaps the most important difference when choosing do instead of conventional treatment. a greater understanding of the cellular processes during the period of distraction and the period of consolidation and possibility to accelerate the genesis and maturation of bone by the use of pharmacological agents could reduce the duration of these periods. by a reduction of the duration of these aforementioned periods the probable inconveniences could be reduced and possibly of a greater patients ' satisfaction and lesser discomfort could be achieved. another way to reduce the strain on the do patients would be the continuous development of the distractors, e.g. reduction in size, partly removable appliances, continuous activation etc.. patients ' satisfaction in association with distraction is a subject sparsely examined in the existing literature. no studies describes patients ' satisfaction during internal distraction while only a single retrospective survey with a quite small population has studied patients ' satisfaction during external distraction. concluded that most of the patients receiving red treatment had an increased satisfaction with facial aesthetics after the treatment than before the treatment in spite of a great deal of dissatisfaction with the facial aesthetics during the course of treatment. a long term study of patients ' perception of function and satisfaction showed that orthognathic surgery resulted in a subjective estimation of function, appearance, health, and interpersonal relationships that was higher than that among pretreatment and no-treatment control groups. a newly prospective study of patients receiving orthognathic surgery showed that perception of function and general satisfaction significantly increased after orthognathic surgery and that the parameters were positive correlated. this study also showed a general high level of satisfaction with appearance and functional parameters in clp-patients treated with either do or conventional treatment. the retrospective design of this survey and the two years between the operation and the completion of the questionnaire diminished the reliability of the patients ' answers. the use of a questionnaires cause problems with the internal validity, because the questionnaire is designed with a limited amount of topics, that might not all be the most valid according to every single patient but representing a selection bias. further use of this questionnaire necessitates a validation. instead a validated questionnaire, for instance the oral health impact profile or orthognathic quality of life questionnaire can be used in further studies. prospective surveys should be based on a validated questionnaire and include the period between mounting and removal of the distractors. a comparative study of patients ' satisfaction during three different courses of treatment, traditional advancement, external distraction and internal distraction, could probably lead to a greater understanding of this important subject. 1. cleft lip and palate patients experience a high level of satisfaction with functional parameters and aesthetics after surgical-orthodontic treatment of maxillary hypoplasia. patients treated with distraction osteogenesis were less satisfied with the duration of their treatment than the conventional group. no external funding, apart from the support of the authors ' institution, was available for this study.

abstractobjectivesto compare cleft lip and palate patients ' satisfaction with aesthetics and functional parameters after conventional advancement of the maxilla or by the use of distraction osteogenesis. material and methodscase series observational study. group of distraction osteogenesis (do) consisted of 15 patients treated with distraction osteogenesis while group conventional (conv) included 10 patients treated with traditional advancement of the maxilla. patients were asked to fill out a questionnaire about their subjective evaluation of satisfaction with facial aesthetics and functional parameters on a continuous visual analog-scale (vas) when the treatment was finished. resultsthe total response rate was 76%. preoperatively the two groups did not differ significantly according to group characteristics. at follow-up both groups were satisfied with aesthetics and functional parameters. the do group was less satisfied with the duration of the treatment than the conv group. there were no statistically significant differences among the groups regarding functional parameters or facial aesthetics. conclusionscleft lip and palate patients experienced a high level of satisfaction with functional parameters and aesthetics as a result of surgical maxillary advancement. the patients treated with distraction osteogenesis were less satisfied with the duration of the treatment. further studies are needed.

PMC3886103

pubmed-313

diabetic macular edema (dme) is a common complication of diabetic retinopathy (dr) and a leading cause of visual loss in this population [1, 2]. major components of dme are retinal microvascular dysfunction and blood-retinal barrier (brb) breakdown with consequent increase in vascular permeability that allows plasma compounds to leak into the retina [35]. there is evidence that upregulation of angiogenic and inflammatory factors, including vascular endothelial growth factor (vegf), and downregulation of antiangiogenic factors as well as redox shift contribute to the breakdown of the brb in dr [510]. oxidative stress and inflammation also play an important role in the pathogenesis of dr and dme. vegf causes conformational changes in the tight junctions of the retinal vascular endothelial cells and plays a major role in the increased vascular permeability and brb breakdown in diabetic eyes [5, 7, 11, 12]. vitreous vegf levels correlate significantly with the severity of dr, but dme can occur in nonproliferative dr (npdr) as well as proliferative dr (pdr). interventional studies on ranibizumab, a monoclonal antibody against vegf, have shown that intraocular injections of ranibizumab significantly reduce foveal thickness and improve visual acuity in patients with dme [14, 15]. however, the conclusions of the studies were not based on the comparison of the real intravitreal concentration of vegf with the foveal thickness in oct; they only asses the retinal thickness before and after therapy. in our earlier study, we found that also the intravitreal uric acid (ua) concentrations correlated significantly with degree of dr. we suspect that ua may play a role in the pathogenesis of dr and dme: studies of ua strongly suggest that its redox potential affects endothelial function and might contribute to the brb breakdown. the correlation of intravitreal ua with vegf in npdr and dme has not been studied yet. optical coherence tomography (oct) has enabled clinicians to noninvasively evaluate the effect of dr on retinal thickness in a standard clinical setting [18, 19]. however, there are very limited data on how oct parameters in dme correlate with vitreous levels of vegf and other biochemical parameters. the aim of our study was to analyse the vitreous and serum of diabetic patients with dme and severe npdr and compare them to nondiabetic controls. the analysis focused on vegf and ua as two possible pathogenetic factors in the development of dme. we compared blood and vitreous levels of vegf, ua, and protein between the two study groups and describe their correlation with the changes seen in oct. first group involved 16 subjects with type 2 diabetes mellitus (dm) with npdr and cystoid dme. in this group, the mean duration of dm was 18.6 8.3 years and 15 patients (93.75%) were treated with insulin and 1 patient (6.25%) was treated with peroral antidiabetics. a group of 13 nondiabetic subjects with idiopathic epiretinal membrane and diffuse retinal thickening served as control. dm duration was defined as the duration from the first diagnosis of dm to the time of vitreous sampling. all patients underwent a standard ophthalmologic examination including measurement of best corrected visual acuity, slit-lamp biomicroscopy, indirect ophthalmoscopy, and oct. the retinopathy was graded according to the early treatment diabetic retinopathy study research group and patients enrolled in the study had moderate to severe nonproliferative dr (npdr). the center involving dme was defined clinically and confirmed by retinal thickening in cross-sectional spectral domain (sd) oct scans. the indications for vitrectomy in this study were macular edema and preoperative best corrected visual acuity (bcva) more than 0.3 logmar (logarithm of the minimum angle of resolution) and in the diabetic group no or poor response to previous therapy with photocoagulation or intravitreal injection. exclusion criteria were as follows: (a) history of intraocular haemorrhage, (b) prior vitreoretinal surgery, (c) other ocular surgeries or laser coagulation less than 6 months prior to the operation, (d) history of ocular inflammation, (e) proliferative dr or other retinal conditions causing neovascularisation, (f) ophthalmic disorders associated with macular edema, and (g) treatment with intravitreal anti-vegf or steroid injections (e.g., triamcinolone, dexamethasone, bevacizumab, ranibizumab, and aflibercept) less than 6 months prior to the operation. at the time of the study, all patients were in a stable clinical condition without clinical or laboratory signs of acute inflammation. the research was approved by the local institutional ethics committee, faculty of medicine and dentistry, palacky university olomouc, czech republic. data and sample collection was independent of all treatment decisions. it did not affect a patient's access to treatment and fully complied with all ethical and legal requirements for noninterventional data collection in the czech republic. all patients gave written informed consent to the treatment, as well as data collection. the reported investigations were in accordance with the principles of the current version of the declaration of helsinki. oct examinations were performed one day before vitrectomy with spectral domain oct (cirrus hd-oct, carl zeiss meditec ag, jena, germany) using macular cube acquisition according to the manufacturer's protocol. the macular cube 512 128 scan consists of 128 raster scans with 512 a-scans, within a 6 6 mm macular area. the mean central retinal thickness (crt, i.e., central subfield thickness) from the internal limiting membrane to the retinal pigment epithelium at the fovea was defined as the mean retinal thickness in a 1 mm diameter circular zone concentred on the fovea. also cube volume (cv) and cube average thickness (cat) of the scanned area were calculated by cirrus hd-oct software and checked for accuracy. the cv is calculated from the 1 mm diameter zone and cat from the central 6 mm diameter zone concentred on the fovea. based on previous studies that evaluated morphological changes in dme [22, 23], the central scan through the fovea was assessed for the presence of intraretinal cysts and serous retinal detachment (srd) by an independent examiner. vitrectomy was performed to improve visual acuity and to decrease retinal thickness in the macula. each patient underwent standard three-port therapeutic pars plana vitrectomy using current surgical techniques (the alcon constellation vision system). before opening the infusion port at the start of the vitrectomy, undiluted vitreous samples were obtained and collected in sterile tubes (cca. 0.3 ml). overnight fasting blood samples were drawn from the antecubital vein at the time of vitrectomy and used for biochemical assay. the concentration of ua was estimated using enzymatic methods (uricase-peroxidase) with photometric detection (modular, roche, germany). hba1c was measured by high performance liquid chromatography and calibration was traced to the reference method of the international federation of clinical chemistry (variant ii, bio-rad; http://www.bio-rad.com/). the concentration of vegf was quantified by enzyme linked immunosorbent assay (elisa) using a commercial human vegf kit (r and d systems, minneapolis, mn, usa) according to the manufacturer's protocol. the limits of quantification for vegf were min=31.2 pg/ml and max=1000 pg/ml, respectively. we calculated the median with 1st and 3rd quartile (iqr, interquartile range). in 16 subjects, the intravitreal vegf and in 3 subjects the intravitreal ua concentration were under the detection limit; these subjects were included in the statistical analysis to avoid selection bias. hence, we used the nonparametric analysis for ordinal variables, and the concentrations under the detection limit were assigned the comparison between dme group and control group was done by mann-whitney u test and fisher's exact test. biochemical analysis of the vitreous showed significant differences between dm and control group in the concentration of vegf, ua, and total protein but not albumin as shown in table 2 and figures 13. in all nondiabetic control subjects, the concentration of vegf in vitreous was under the detection limit of 31.2 pg/ml. in the diabetic group, ua concentration in vitreous correlated significantly with vitreous vegf concentration (= 0.559, p=0.03). however, in dme vitreous vegf and ua did not correlate with the total vitreous protein. further, in the control group, no significant correlation between the biochemical analytes in vitreous was found. figure 4 shows the relationship between vitreous vegf and vitreous ua of dme and control group. median of serum concentration of ua in diabetic patients was significantly elevated compared with the control group (337.0 mol/l, iqr: 324.0407.0 mol/l in dm group versus 259.5 mol/l, iqr: 220.0334.8 mol/l in control group; p=0.025). also median concentration of vegf in serum of diabetic patients (414.3 pg/ml, iqr: 293.1512.0 pg/ml) was higher than in controls (332.7 pg/ml, iqr: 149.4551.8 pg/ml), but the difference was not significant. there was a significant correlation between ua concentrations in serum and vitreous (= 0.652, p=0.016) in the control group but not in dme. further, no significant correlation between concentrations of vegf in serum and vitreous was found in both groups. the median crt, cat, and cv did not differ significantly between both groups and are listed in table 3. significant difference was found in presence of srd between the groups as shown in table 3. in the diabetic group, there was a significant correlation between crt and cat (= 0.589, p=0.016). the crt of dm subjects also correlated significantly with the cv (= 0.581, p=0.018). however, the strongest correlation in the dm group was between cat and cv (= 0.999, p<0.001). the srd was found in the oct scans of 6 diabetic eyes, but its presence did not correlate with any of the other oct parameters. further, among all oct parameters, only cv correlated significantly with the concentration of vitreous vegf in the dm group (= 0.515, p=0.041). the crt, cat, cv, and srd show in dm and control subjects no significant correlation to vitreous concentrations of ua, albumin, or total protein. the correlation of logmar bcva with changes in oct parameters and vitreous content was also evaluated and we found it to be nonsignificant in both groups. there was also no correlation between oct parameters and serous concentrations of ua or vegf. the results demonstrate that biochemical analysis of the vitreous showed significant higher concentrations of vegf, ua, and total protein in dm and control group. moreover, in patients with dme intravitreal levels of ua correlate significantly with intravitreal levels of vegf. furthermore, we found that the cv measured with cirrus hd-oct correlate significantly with the concentration of vegf in the vitreous of patients with npdr and dme. in our earlier study, we showed that the levels of intravitreal ua correlated significantly with the degree of dr and recently also serum ua concentration has been found to be associated with increase in severity of dr. finding significant higher ua concentration in vitreous of dm compared to controls and a correlation between ua and vegf in the vitreous of npdr patients supports our assumption that ua too may be one contributing causal factor in the pathogenesis of dr. ua is a degradation product of metabolism and under normal conditions ua acts as an antioxidant. in diabetics, hyperglycaemia induces redox stress, which leads to consumption of the naturally occurring local antioxidants protecting capillary endothelium. this results in urate redox shuttle, meaning that ua paradoxically becomes prooxidant and contributes to endothelial dysfunction through oxidative-redox stress. johnson et al. showed that local ischemia results, via enzymatic activation, in increased ua production as well as oxidant formation. decreased total antioxidant status was shown to contribute to the progression of pdr via induction of vegf. on the other side, high ua concentration in the vitreous of diabetic patients the vegf-induced production of reactive oxygen species was attenuated by urate; however, it did not modify the vegf-induced changes in permeability of monolayers. this could explain the correlation of ua and vegf in the vitreous of diabetic group found in the present study. it has to be elucidated whether ua is originating from leakage of retinal vessels, which is increased in dr, or from local production. although total vitreous protein was significantly higher in the diabetic group compared to controls, its level did not correlate with both ua and vegf. furthermore, in the diabetic subjects we found no correlation between serum and vitreous level of ua. however, to be able to distinguish the origin of increased ua in the vitreous, further analyses, for example, with tagged ua, should be done. since there was a correlation between vitreous ua and vegf but no correlation between vitreous ua and oct parameters, we conclude that ua has a probable relation with diabetic microangiopathy and accordingly dr but not directly with the development of dme. recent studies have shown that vegf causes conformational changes in the tight junctions of retinal vascular endothelial cells and plays a major role in the elevated vascular permeability in diabetic eyes with dme. it is well known that the vitreous vegf levels correlate significantly with the severity of dr [1113, 28]. few authors have also found a significant correlation between retinal thickness at the fovea measured on oct and vegf concentrations in the vitreous [29, 30] and aqueous. the association of vitreous vegf levels and dme morphology was studied by sonoda et al. and these authors showed no significant differences in vegf concentrations in cystoid versus diffuse aspect of dme. in the present study, there was no significant correlation between vitreous vegf levels and crt of diabetic patients. however, the results show that in dme increase in cv correlated with increased concentration of vegf in the vitreous. the retinal thickness at the central fovea in funatsu et al. was calculated as average foveal thickness from 4 manual measurements per patient. used the average thickness of the central area with 1000 m in diameter calculated by humphrey oct. defined the central macular thickness as the average thickness of the central 500 m in diameter. the mean crt in dme is widely accepted as the new surrogate marker for evaluating treatment efficacy. this is also because the changes in the fovea are deciding for the visual acuity. in our study, the crt, cat, and cv in both dm and control group did not correlate with the logmar bcva. there are also studies evaluating the effect of the anti-vegf therapy using both the mean foveal thickness and cv. on the other hand, since dme usually affects the macular area and not only the foveal region, assessment of vegf concentration in clinical practice using the cv is comprehensible. like us, sonoda et al. showed that there was no significant correlation between intravitreal vegf levels and the amount of subretinal fluid in dme. other studies have reported that eyes with serous retinal detachment often have a poor prognosis after treatment [22, 36]. the strength of the study described here is that it determined the relationship between the levels of intravitreal biochemical parameters and retinal morphology at the same time. the limitation was the small sample size (29 eyes). this was caused by decreasing use of vitrectomy for dme and this curtailed collection of vitreous samples. although our vitrectomy for dme might be considered overtreatment, it was a comparatively effective method as it stabilized the intraocular condition of dme and the efficacy was maintained for a long period. in interpreting or generalizing our results, it should be remembered that the findings demonstrate association of vegf levels in the vitreous with the cube volume, but they do not prove cause and effect. further, the study was focused on vegf and ua; however, the pathogenesis of the dme is complex and still not fully understood. vitreous concentrations of uric acid and vegf were significantly higher in dm subjects than in controls. moreover, vitreous ua concentration correlated significantly with the vitreous vegf concentrations in patients with npdr and cystoid dme. increased vegf concentrations are known to be involved in the pathogenesis of dme. our results suggest that, apart from vegf, the role of ua in the pathogenesis and progression of dr should also be considered. comparing oct parameters to the vitreous levels of ua and vegf, we found that increased concentration of intravitreal vegf in patients with npdr and cystoid dme correlated with increase of cube volume calculated by cirrus hd-oct. since dme usually affects the macular area and not only the foveal region, the assessment of the vegf concentration in clinical practice using the cube volume is comprehensible. this oct parameter could be used to assess the efficacy of anti-vegf therapy.

purpose. we investigated two factors linked to diabetic macular edema (dme), vitreous and serum levels of vascular endothelial growth factor (vegf) and uric acid (ua) in patients with dme, and compared the results with changes in optical coherence tomography (oct) and visual acuity (va). methods. a prospective study of 29 eyes, 16 cystoid dme and nonproliferative diabetic retinopathy (dr) and 13 nondiabetic controls. biochemical analysis of vitreous and serum samples was performed and oct scans were graded according to central retinal thickness (crt), cube volume (cv), cube average thickness (cat), and serous retinal detachment (srd). results. in dme group, intravitreal concentrations of vegf (p<0.001), ua (p=0.038), and total protein (p<0.001) were significantly higher than in control group. in dme subjects, intravitreal ua correlated significantly with intravitreal vegf (= 0.559, p=0.03) but not with total vitreous protein and serum ua. increased intravitreal vegf in dme group correlated with increase in cv (= 0.515/p=0.041). none of the oct parameters correlated with the va. conclusions. the results suggest that the cv might be assessor of anti-vegf therapy efficacy. second, apart from vegf, the role of ua in the pathogenesis and progression of dr should be considered.

PMC4664812

pubmed-314

diabetes is the most frequent cause of end-stage renal disease in industrialised countries [1, 2]. clinically, diabetic nephropathy is characterized by the development of albuminuria and a subsequent decline in glomerular filtration rate. this severe complication significantly influences the risk of cardiovascular disease as well as mortality and quality of life [3, 4]. at present the most important identified risk factors are diabetes duration, arterial blood pressure, and glycaemic regulation. as evident from an increasing incidence of affected patients, however, there is still a great need for new strategies in the treatment and prevention of diabetic nephropathy. clear evidence indicates that the pathogenesis of diabetic nephropathy is multifactorial and triggered by a complex series of pathophysiological events. the inflammatory response in diabetes is highly complex involving proinflammatory cytokines and chemokines, for example, il1 the impact of complement activation on the diabetic kidney may well, in part, be mediated through induction of cytokine response and inflammation [911]. several studies have linked diabetic late-complications to the complement system of the innate immune system [12, 13]. the complement system plays a crucial role in recognition and clearance of infectious microbes and the system forms a link between innate and adaptive immunity. the activation of the complement system results in the release of multiple inflammatory signaling molecules. ultimately complement activation leads to the formation of pore-forming membrane attack complexes (macs) that are inserted in the cell membranes to mediate lyses of the cell through osmotic stress. however, in mammalian cells, it has been shown that sublytic amounts of mac can increase production of il-8 and monocyte chemoattractant protein 1 dependent on nfb nuclear translocation. furthermore, macs are shown to have a mitogenic effect and cause release of basic fibroblast growth factor and platelet-derived growth factor from endothelial cells leading to fibrosis in neighboring cells including glomerular mesangial cells [16, 17]. the latter effects of mac may explain the link between complement and diabetic kidney damage. three activations pathways exist: the classical, the alternative, and the lectin pathway. the present paper focuses on the lectin pathway, in which at least five soluble pattern-recognition molecules are characterized that may activate the complement system, that is, mannan-binding lectin (mbl), h-ficolin, l-ficolin, m-ficolin, and collectin-k1. the three ficolins utilize a fibrinogen-like domain that binds, for example, n-acetylglucosamine, n-acetylgalactosamine, and n-acetyl-neuraminic acid, whereas mbl and cl-k1 have a carbohydrate recognition domain and through this bind specifically to patterns of monosaccharides. a very recent publication reports a close association between ficolin and diabetic nephropathy in patients with type 1 diabetes. the observational design of the study, however, limits its ability to study a cause-effect relationship. when ficolins bind they all initiate activation of associated serine proteases (mbl associated serine proteases, masps), which subsequently cleave the complement factors, c2 and c4, leading to further complement activation [20, 21]. eventually, complement activation leads to the formation of macs causing cell lyses or induction of fibrosis. the balance between activation and inhibition of the complement cascade is tightly controlled by regulatory proteins in order to prevent damage of healthy host cells. in diabetes, inappropriate effects of the complement system may be present as glycation-induced dysfunction of the complement inhibitory mechanism and consequently overactivation of the system is indicated [2325]. it is speculated that diabetic patients are exposed to uncontrolled complement attack partly due to altered molecular patterns on the cell surfaces as a consequence of high blood glucose [24, 25]. most significantly, an association is seen between diabetic nephropathy and the lectin pathway [2628]. we have previously demonstrated direct cause-effect relationship between presence of mbl and worsening of kidney injury in a mouse model of diabetic nephropathy [29, 30]. we speculate that ficolins also exert detrimental effects in diabetes similar to mbl through activation of the lectin pathway as indicated in patients with type 1 diabetes. this study aimed to investigate the impact of ficolin b (the orthologue to human m-ficolin) on the development of diabetic nephropathy in a mouse model of type 1 diabetes. we used 11-week-old, female ficolin b knockout mice and age-matched, female c57bl/6j bomtac wild-type mice (taconic, ry, denmark). the knockout ficolin b model was backcrossed more than 10 generations to a c57bl/6j bomtac genetic background (own breeding). in each cage there were three to eight mice and they had free access to tap water and standard chow (altromin number 1324; lage, germany). the environment was stable with a 12-hour light-dark cycle, temperature at 21 1c, and humidity of 55 5%. the ficolin b knockout mice and the wild-type mice were randomized into a diabetic and nondiabetic group; thus four groups were made: (1) diabetic knockout mice (n=6), (2) nondiabetic knockout mice (n=7), (3) diabetic wild-type mice (n=11), and (4) nondiabetic wild-type mice (n=11). diabetes was induced by intraperitoneal injections of streptozotocin (stz) dissolved in a cold 10 mm citrate buffer (doses of 55 mg/kg body weight, sigma aldrich, st louis, mo, usa) on five consecutive days. the 18-week experiment was initiated when the mice were classified as diabetic (blood glucose>15 mm). animals with more than 15% sustained weight loss, signs of illness, or persistent ketonuria were excluded from the study. blood glucose was measured from tail vein by contour (bayer diabetes care, kgs. lyngby, denmark). with combur test d strip (roche diagnostics gmbh, mannheim, germany) two mice from each diabetic group were excluded because of insufficient increase in blood glucose levels. furthermore, two mice from the diabetic knockout group were excluded because of weight loss>15% of body weight. the excluded mice were not included in the number of animals per group indicated above. spot urine was collected in eppendorf tubes on five consecutive days prior to sacrifice of the animals. the blood samples were drawn from under the tongue at baseline and from the retroorbital venous plexus at study end and collected in potassium edta tubes (sarstedt, nmbrecht, germany). the animals were anesthetized by an intraperitoneal dose of ketamine at 0.5 mg/g body weight and xylazine at 0.2 mg/g body weight (ketaminol 4 vet and narcoxyl vet, resp., urinary albumin excretion was determined by mouse albumin elisa quantification kit (bethyl laboratories, inc., urine creatinine was measured by isocratic high-performance liquid chromatography (hplc) on a zorbax scx300 column (agilent, usa) using a slight modification of a method first reported by yuen et al.. in brief, 5 l urine was added to 100 l acetonitrile containing 0.5% acetic acid and vortexed for 15 seconds to extract the creatinine. after 15 min of 20c storage and centrifugation the supernatants were evaporated and then reconstituted with 25 l 5 mm sodium acetate, ph 4.1. duplicate samples (10 ul each) were fractionated on a 50 mm 2.1 mm zorbax scx300 column with an in-front scx guard column. isocratic hplc was performed at a flow rate of 1 ml/min, and uv absorbance was monitored at 225 nm. a standard curve was created by including a 2-fold dilution series of creatinine anhydrous (sigma aldrich). this study was designed with two independent factors; diabetes/nondiabetes and knockout/wild-type and thus analysed by two-way anova for normal distributed variable with equal variance. the main focus of interest was the interaction between the diabetic factor and the knockout factor; that is, does ficolin b modify the effects of diabetes on the effect parameters? if no interaction was found, the independent effects of diabetes and ficolin b on the kidney were estimated. for pairwise comparison, normal distributed data was tested with student's t-test, whereas otherwise the wilcoxon mann-whitney rank sum test was used. data are given as mean (95% confidence interval (ci)) unless else is stated. at baseline, the knockout mice on average weighed 20.0 g, which was slightly less than the wild type mice, 20.8 g (p=0.04). no difference was found between the two diabetic groups or between the two nondiabetic groups (table 1). after 18 weeks an expected difference in body weight was observed between the diabetic and the nondiabetic mice independently of knockout status (p<0.001). the nondiabetic mice weighed 3.2 g (ci: 2.0 g4.3 g) more than the diabetic mice. furthermore the diabetic knockout mice were significantly smaller than the diabetic wild type (p<0.05). as presented in table 1, blood glucose, estimated as area under the curve (auc), did not differ between the two diabetic groups (p=0.69) or between the two nondiabetic groups (p=0.13). the kidney weight was equally increased in diabetic wild-type mice, 24% (ci: 13%36%), and in the diabetic knockout mice, 29% (ci: 12%47%), compared to the respective control groups (figure 2(a)). no interaction between knockout and diabetes was found (p=0.60), indicating that wild-type and knockout mice develop the same degree of diabetes-induced renal hypertrophy. the considerable body weight difference between the two diabetic groups at study end indicated that the kidney weight was to be normalised to the body weight. ficolin b did not modify the diabetes-induced increase in kidney weight when testing for interaction (p=0.11). furthermore, no significant statistical difference was found in kidney weight per body weight between the diabetic wild-type, 1.95 mg/g, and the diabetic knockout, 2.89 mg/g (p=0.09). the albumin-to-creatinine ration (acr) was higher among the diabetic wild-type mice, 76 mg/g (ci: 50103 mg/g), compared to the nondiabetic wild-type mice, 44 mg/g (ci: 2563 mg/g), p=0.07. similarly, the acr of diabetic knockout mice was 96 mg/g (ci: 71122 mg/g) compared to the nondiabetic knockout group, 34 mg/g (ci: 2344 mg/g), p<0.001. as depicted in figure 3 no interaction was observed between diabetes and ficolin b knockout, p=0.21. in the present study we found no association between diabetes-induced kidney changes and the presence of ficolin b. we conclude that ficolin b is not responsible for, or a crucial contributory factor in, the pathophysiology of diabetic nephropathy. in our study, the kidney weight and to some extent the acr were altered by diabetes as expected. the diabetes-induced increase in kidney weight, measured by comparing the diabetic mice with the nondiabetic mice, was not statistically different between the wild-type and ficolin b knockout mice. the diabetes-induced increase in kidney weight was 24% in the wild-type mice and 29% in the ficolin b knockout mice. taking the lower body weight of the knockout mice into account, the difference in renal hypertrophy was still insignificant when comparing the wild-type mice and the ficolin b knockout mice. similarly, the diabetic change seen in acr was not altered in the absence of ficolin b. the experimental setup including four groups matched on age, body weight, and genetical background was a strength to the study, as the diabetes factor and the knockout factor were the only modulators of the outcome. most importantly both diabetic groups did reach and sustain blood glucose levels of above 15 mm. at study end, the body weight differed among groups, which impeded the analyses of the diabetic kidney damage, because the knockout mice appear to be more vulnerable to type 1 diabetes mellitus. our study provides important new information on the association between the lectin pathway and diabetic kidney damage. we are the first to investigate the role of ficolin b (which corresponds to ficolin m in human) in the inflammatory response of diabetic nephropathy. in mice with deficiency of mbl, the classical functional and physical renal changes normally seen in this experimental model of type 1 diabetes were modified [29, 30]. the fact that ficolin b does not appear to modulate diabetic effects on the kidney emphasizes the importance of mbl compared with ficolin b. both mbl and ficolin b activate the lectin pathway of the complement system, but only deficiency of mbl has been shown to protect against diabetic kidney damage. this indicates that the role of the lectin pathway in the development of diabetic nephropathy is complex and may depend on the specific carbohydrate-binding properties of mbl as previously described. the function of other complement factors in the first parts of the lectin pathway (e.g., ficolin a and masps) in the pathology of diabetic kidney disease remains unknown and must be explored in further studies. one study indicates that ficolin a and ficolin b exert a cooperatively defensive role in destroying streptococcus pneumoniae, suggesting a synergetic immunological effect. this emphasises the need for further investigations involving both mouse ficolins. in order to fully understand the involvement of the lectin pathway in the development of diabetic nephropathy, an additional parallel experiment with masps is of particular interest given that they represent the limiting downward step in the complement activation in conclusion, this study demonstrates that ficolin b does not modify the kidney weight and acr in a type 1 diabetes mouse model. this indicates that the role of the lectin pathway in the development of diabetic nephropathy is specific and that hyperglycaemia-induced glycations on renal cells may be more prone to bind mbl than ficolin b.

background. the innate immune system may have adverse effects in diabetes and cardiovascular disease. the complement system seems to play a key role through erroneous complement activation via hyperglycaemia-induced neoepitopes. recently mannan-binding lectin (mbl) was shown to worsen diabetic kidney changes. we hypothesize that mouse ficolin b exerts detrimental effects in the diabetic kidney as seen for mbl. methods. we induced diabetes with streptozotocin in female wild-type mice and ficolin b knockout mice and included two similar nondiabetic groups. renal hypertrophy and excretion of urinary albumin and creatinine were quantified to assess diabetic kidney damage. results. in the wild-type groups, the kidney weighed 24% more in the diabetic mice compared to the controls. the diabetes-induced increase in kidney weight was 29% in the ficolin b knockout mice, that is, equal to wild-type animals (two-way anova, p=0.60). in the wild-type mice the albumin-to-creatinine ratio (acr) was 32.5 mg/g higher in the diabetic mice compared to the controls. the difference was 62.5 mg/g in the ficolin b knockout mice, but this was not significantly different from the wild-type animals (two-way anova, p=0.21). conclusions. in conclusion, the diabetes-induced effects on kidney weight and acr were not modified by the presence or absence of ficolin b.

PMC4539181

pubmed-315

population aging is the process by which older individuals become a proportionally larger share of the total population. it was the most distinctive global demographic event that the world witnessed in the past century and is an important event for the twenty-first century too. it was initially experienced by the more developed countries and has recently become apparent in the developing countries. population aging will be faced globally by all countries in this century, although at varying levels of intensity and time. according to the world health organization (who), world's elderly population i.e., people 60 years of age and older is approximately 650 million at present and by 2050, it is forecast to reach 2 billion. in 2008, five out of the top ten causes of mortality worldwide, other than injuries, were non-communicable diseases (ncds) and expected to go up to seven out of ten by the year 2030. by then about 76% of the deaths in the world will be due to ncds. government and the who have already recognized the huge burden of preventable disease, disability, death and distress caused by the ncds. the present international health agenda guided by who focuses on four conditions (cardiovascular disease, diabetes, cancer and chronic respiratory disease) responsible for most of the premature mortality and four lifestyle risk factors (smoking, harmful alcohol use, lack of physical activity and high salt, high fat diets) leading to above conditions. medications play crucial role in geriatric health care as they treat chronic diseases, alleviate pain and improve quality of life. age-related changes in drug disposition and pharmacodynamic responses have significant clinical implications, and increased use of a number of medications in elderly raises the risk of medicine-related problems that may occur. as medication use and the incidence of adverse drug outcomes increase with advancing age, it is important to ensure quality use of medicines in older people towards attaining a higher goal of healthy and active aging. but, use of drugs by the elderly and their clinical outcomes especially adverse drug reactions (adrs) have not been prominent research topic and continues to be given low priority in national and international public health arena, at least in a developing country like india. however, we feel that this probably needs more attention in india because we have not completely dealt with the scourge of communicable diseases yet. in addition, 70% of all older people now live in low- or middle-income countries, including india where sustainable pharmacovigilance systems has not developed as yet. the relationship between increased use of drugs and elderly is well established. consequently, increased use of medications in elderly increases the risk of adrs. studies from around the world have shown a definite correlation between increasing age and adr rate, at least for some medical conditions. although very few such studies are available in indian settings, harugeri et al. in a hospital setting found that the prevalence of adr-related hospital admissions was 5.9%, while in another such study in india, it was observed to be 6.7%. for india, harugeri et al. predicted that 18000 bed days in a given time would be due to adrs in elderly and total cost of hospital stay due to adrs is estimated to be us $4350 (inr 200100), that is us $80.5 per patient (108.7% of per capita per year expenditure on health). there has been much debate on whether advancing age by itself is a cause of increased risk of adrs but merely a marker for comorbidity, altered pharmacokinetics, and polypharmacy. gurwitz and avorn concluded that patient-specific physiological and functional characteristics are probably more important than any chronological measure in predicting both adverse and beneficial outcomes associated with specific drug therapies, while studies around the world have clearly shown that the risks of adrs (including interactions) is related to the number of medicines taken and sometimes due to inappropriate use of medicines. (1991) observed an exponential rather than the linear relation between the risks of adr and the number of medicines taken in 9000 elderly italian patients receiving 10 medicines. review of several studies by steward rb et al. found that the patients aged above 65 years use an average of two to six prescribed medications, and 1-3.4 non-prescribed medications. out of all the factors that are most consistently associated with adverse drug reactions, polypharmacy is considered to be the most important. thus, studies have correlated the integral association between old age and increased rate of adrs arising out of confounding association between age and polypharmacy contributed by age-related changes in pharmacodynamics and pharmacokinetics at least for some medical conditions. the classical pharmacological classification of adrs by rawlins and thompson divides adr into two major subtypes: type a reactions, which are dose-dependent and predictable, and unpredictable type b (bizarre or idiosyncratic) reactions. majority of adrs (80%) causing admission or occurring in hospital setting are type a reactions. they are predictable and potentially avoidable in nature as they are related to accentuation of known pharmacological effects of the drug. drugs associated with type a reactions are generally with low therapeutic index and commonly used among elderly. the lists of medicines most likely to be used in the elderly include antibiotics, anticoagulants, digoxin, diuretics, hypoglycemic agents, antineoplastic agents and non-steroidal anti-inflammatory drugs (nsaids) and these are responsible for 60% of adrs leading to hospital admission and 70% of adrs occurring in hospital. type b adrs are usually uncommon, but rarely may sometimes cause serious toxicities. therefore, adrs in elderly are largely contributed by prescribing error e.g., large doses of drugs without taking into account, the effect of age and frailty on drug disposition, especially renal and hepatic clearance. the other contributing factor may be because of not considering the increased pharmacodynamic sensitivity of the elderly to several commonly used drugs, e.g., central nervous system and cardiovascular drugs. since only around 3000 subjects receive a medicine prior to marketing, it is not surprising that less frequent (particularly type b) adrs are often recognized only after marketing. the capacity of premarketing studies to recognize adrs is further reduced by the limited numbers of patients in the age group of 65 or older in trials and that even smaller numbers of the oldest old. in addition, long latency diseases like cancer are difficult to detect on account of the short duration of study. the latter has been defined in the literature in relative terms (for example, the administration of an excessive number of drugs) and in absolute terms, ranging from two to more than six simultaneous medications. in contrast to general population, the incidence of combination therapy is found to be greatest in the elderly. a drug combination may sometimes cause synergistic toxicity, which is greater than the sum of the risks of toxicity of either agent used alone. for example, the combination of corticosteroids and nsaids: the risks of development of nsaid-induced peptic ulcer in older patients may increases by 10% among elderly. however, concurrent use of corticosteroids and nsaids had shown a risk of peptic ulcer disease that was 15 times greater than that of non-users of either drug. similarly, the relative risk of hospitalization for hemorrhagic peptic ulcer disease in elderly patients (above 65 years) has been observed to be increased by manifolds on concurrent use of oral anticoagulants and nsaids, while the risks were lower when used alone. this suggests that there is certainly a need to recognize and consider the aspects of synergism of toxicity while prescribing medications in elderly. however, polypharmacy at times can effectively control certain disease condition e.g., hypertension and epilepsy. respecting the individual needs of every individual patient is the preferred approach of prescribing in elderly. some of the steps that may be helpful in minimizing adrs in elderly may be: maintaining accurate record of all medications in use: may include asking patients to bring all medications to clinic including the use of over-the-counter and complementary medicines.number of medications (prescribed and non-prescribed): monitoring to balance the need and avoid polypharmacy while minimizing under-use of vital drugs.individual doses: reducing the doses wherever appropriate and titrating them carefully from a low starting dose, if pharmacodynamic sensitivity is likely to be the problem.simple regimens of medication: choose the preparation suitable for the patient and minimize the dose whenever needed, but avoid advising the patient to break a single tablet into two or three equal pieces.ensuring safe management of medications by patients: involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur. minimize hoarding of previously used and expired drugs.therapeutic drug monitoring is encouraged, but should not replace clinical observation. considering an adr as a possible cause for any new problem.utilizing available strategies and inter-disciplinary collaboration to enhance the quality use of medicines. maintaining accurate record of all medications in use: may include asking patients to bring all medications to clinic including the use of over-the-counter and complementary medicines. number of medications (prescribed and non-prescribed): monitoring to balance the need and avoid polypharmacy while minimizing under-use of vital drugs. individual doses: reducing the doses wherever appropriate and titrating them carefully from a low starting dose, if pharmacodynamic sensitivity is likely to be the problem. simple regimens of medication: choose the preparation suitable for the patient and minimize the dose whenever needed, but avoid advising the patient to break a single tablet into two or three equal pieces. ensuring safe management of medications by patients: involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur. considering an adr as a possible cause for any new problem. utilizing available strategies and inter-disciplinary collaboration to enhance the quality use of medicines. drugs are double-edged weapons and increased use of drugs by elderly increases the risk of adverse drug reactions causing increased morbidity and mortality. in addition, economic consequences of adrs constitute a problem of considerable magnitude. developing countries have rapidly aging population and the governments are seeking guidance in promoting healthy and active aging. however, strategies to increase opportunities for identifying adrs and related problems have not been emphasized in current policy responses in india to meet the increase in elderly population and chronic conditions. in addition, there is definite paucity of good quality research and data on adrs in india. further, growing pharmacotherapy with increase in the number of diseases in the elderly will require more timely and accurate drug safety data. pharmacoepidemiological studies that encompass large numbers of elderly drug users are needed to obtain this information as increased knowledge of the frequency and cost of adverse drug reactions is important in enabling more rational therapeutic decisions by individual clinicians and more optimal social policy. given quantitative information on medication risks, clinicians will be able to change the use of the drug (prescribe for fewer patients, use safer alternatives when available, and use in lower doses for shorter duration) or can take measures to minimize side effects (prescribe prophylactic medications, increase monitoring for side effects, and intensify patient education). policy changes that can result from better data on drug toxicities include withdrawal of drug from the market, change in drug labeling, educational programs to physician and changes in academic curriculum of pharmacology. this will result in promoting and ensuring a good health of older people, which can be of great benefit to their families and communities. in the long run, more precise estimates of the true costs associated with adrs could stimulate development of prophylaxis and of alternative therapies.

medications probably are the single most important health care technology in preventing illness, disability, and death in the geriatric population. age-related changes in drug disposition and pharmacodynamic responses have significant clinical implications; increased use of a number of medications raises the risk that medicine-related problems may occur. the relationship between increased use of drugs including the prescription medication and elderly is well established. majority of adrs (80%) causing admission or occurring in hospital are type a reactions. although less common occurring in elderly, type b adrs may sometimes cause serious toxicity. studies have correlated the integral association between old age and increased rate of adverse drug reactions arising out of confounding association between age and polypharmacy contributed by age-related changes in pharmacodynamics and pharmacokinetics at least for some medical conditions. a drug combination may sometimes cause synergistic toxicity which is greater than the sum of the risks of toxicity of either agent used alone. but, strategies to increase opportunities for identifying adrs and related problems have not been emphasised in current international policy responses especially in india to the increase in elderly population and chronic conditions. careful epidemiological studies that encompass large numbers of elderly drug users are required to obtain this information as increased knowledge of the frequency and cost of adverse drug reactions is important in enabling both more rational therapeutic decisions by individual clinicians and more optimal social policy.

PMC3669588

pubmed-316

myelofibrosis (mf) belongs to the category of myeloproliferative neoplasms (mpns) and may present as a primary disorder (primary myelofibrosis [pmf ]) or evolve from polycythaemia vera (pv) or essential thrombocythaemia (et) to post-pv or post-et mf.1 it is characterised by the clonal proliferation of a pluripotent haematopoietic stem cell,2 in which the abnormal stem cell population releases several cytokines and growth factors into the bone marrow microenvironment, thus leading to an increase in bone marrow fibrosis, stromal changes, involvement of extramedullary organs such as the spleen and liver, and consequent clinical manifestations.3 myelofibrosis has an incidence of about 0.58 new cases per 100 000 person-years, but a higher prevalence of 6 per 100 000 person-years because of its chronic and disabling course.4 median age at diagnosis is 67 years, without any significant difference in distribution between the sexes. the diagnosis of mf is currently based on the world health organization 2016 criteria, which include the jak2v617f mutation that is detected in 50% to 60% of all cases.58 mutations in genes other than jak2 such as mpl mutations (frequency: 5%10%)9,10 and somatically acquired mutations in the calr gene (frequency: 15%20%)11,12 have also been described. however, about 10% of patients with mf do not develop any known mutation and are considered to have triple-negative mf.13 in addition to these 3 driver mutations, numerous other somatic mutations involving epigenetic processes (ezh2, tet2, asxl1, and dnmt3a), spliceosome machinery (srsf2, sf3b1, and u2af1), and disease evolution (eg, tp53, idh1/2, and ikzf) have been identified in mf.1416 some of these mutations, such as those in dntm3a17 or tet2,18 have not been shown to correlate with survival outcome. conversely, mutations in asxl1, srsf2, and ezh2 predicted short survival in a large cohort of patients. more specifically, a report by tefferi et al19 points to the calr/asxl1+profile as the most detrimental mutation profile in pmf. the symptoms mainly include those associated with splenomegaly (abdominal distension and pain, early satiety, splenic infarction, dyspnoea, and diarrhoea) and constitutional symptoms such as fatigue, cachexia, pruritus, bone pain, weight loss, and fever; these worsen patients role functioning and quality of life (qol). median survival ranges from approximately 3.5 to 5.5 years,20,21 and the most frequent cause of death in patients with mf is transformation to acute myeloid leukaemia (20%), but most patients die because of other disease-related events, such as progression without transformation, infections, and thrombo-haemorrhagic complications.20 prognosis is currently based on 3 different prognostic scoring systems, which mainly refer to age, constitutional symptoms, anaemia, white blood cell counts, and percentage of peripheral blood blasts: international prognostic scoring system (ipss), which is applicable at diagnosis20; dynamic international prognostic scoring system (dipss)22; and dipss-plus, which can be applied at any time during followup. the last incorporates 3 additional independent risk factors: red blood cell (rbc) transfusion requirement, platelet counts of<100 10/l, and an unfavourable karyotype (table 1).23 until recently, mf has remained orphan of curative treatments: the only treatment that has a clearly demonstrated impact on disease progression is allogeneic haematopoietic stem cell transplantation (allo-hsct), but treatment-related mortality is high and only a minority of patients are eligible for such intensive therapy.24 the previously used treatments were palliative and have only limited benefits in qol and symptom control. however, the discovery of jak2 mutations, which has established that dysregulation of the jak-stat signalling pathway is a major contributor to the pathogenesis of mpns, has also led to the development of small-molecule jak1/2 inhibitors, the first of which (ruxolitinib) has been approved for the treatment of mf in the united states and europe. in this article, we report on old and new therapeutic strategies that proved effective in early preclinical and clinical trials and subsequently in the daily clinical practice for patients with mf, particularly concerning the topics of anaemia, splenomegaly, iron overload (io), and allo-hsct. the management of anaemia can be one of the most challenging aspects of treating patients with mf (table 2). blood transfusion is the standard therapy for symptomatically anaemic patients, and the transfusion target should be assessed individually. corticosteroids (eg, prednisone 0.5 mg/kg/day) may be temporarily effective in treating anaemia and constitutional symptoms and are usually used in combination with other therapies.25 erythropoiesis-stimulating agents (esas) are worth trying in mf patients with moderate, nontransfusion-dependent anaemia and a low serum erythropoietin level (< 125 iu/l), although rapid spleen enlargement during treatment has occasionally been reported. response rates vary from 23% to 60% in different studies, with no clear evidence favouring darbepoetinalfa over conventional recombinant erythropoietins. furthermore, responses are usually short-lived (< 1 year), and as no prospective randomised study of the value of esas has yet been published, they are not indicated in anaemic subjects with established transfusion dependency.26 if there are no contraindications, androgen preparations or danazol (a semisynthetic attenuated androgen) can be used. they have been shown to stimulate erythropoiesis in patients with refractory anaemia, leading to increased haemoglobin (hb) levels, reticulocytosis, and a decreased need for rbc transfusions27; however, documentation of their efficacy as single agents is largely restricted to retrospective studies. one of these reported responses in 11 of 30 patients with mf, including 8 with a complete response,28 with a lack of transfusion dependence and higher pretreatment hb levels predicting response. in another retrospective study, responses were observed in 17 of 39 patients with mf taking danazol, including 8 (21%) with an increase in hb of 1.5 g/dl, hb levels of>10 g/dl, and transfusion independence for 8 weeks.29 however, there were no identifiable patients characteristics (such as transfusion dependency, baseline hb level, or cytogenetic results) that influenced outcome. these findings have been confirmed in a recent series of 50 patients with mf30; the slightly lower rate of anaemia response (30%) should be attributed to the use of more stringent response criteria.31 in terms of predicting response, the only pretreatment variable showing a trend for an association with response to danazol was transfusion dependency, with only 18.5% of the responders in this subgroup of patients against 43.5% in the subgroup not requiring transfusions. the main limitations of using danazol are toxicities, including fluid retention, increased libido, liver function test abnormalities, headache, and virilisation. all patients receiving danazol should therefore be monitored using monthly liver function tests during initial therapy and periodic liver ultrasound examinations to detect any hepatic malignancy. the antiangiogenic and immunomodulatory properties of thalidomide, lenalidomide, and pomalidomide make them potentially effective medical therapies for mf, with some responses in patients with anaemia, thrombocytopenia, and splenomegaly; potential modifications to the bone marrow microenvironment; and a possible reduction in bone marrow fibrosis. the combination of thalidomide and prednisone has been evaluated in 21 patients with mf, 62% of whom showed an anaemia response.32 however, the high incidence of neuropathy associated with thalidomide limits its usefulness. furthermore, because of the risk of thrombosis, prophylaxis with aspirin is recommended in all patients with a platelet count of>50 10/l. this combination is therefore not usually selected for the first-line management of anaemia. a phase ii clinical trial (nct00227591) assessed the therapeutic efficacy of lenalidomide combined with prednisone in 42 patients with mf. clinical improvements in anaemia and splenomegaly were observed in, respectively, 19% and 10% of the subjects. similar to thalidomide, lenalidomide was burdened by toxicity, including cytopenia (at least 1 grade 34 event in 88% of patients) and nonhaematologic toxicity (at least 1 grade 34 event in 45% of patients).33 a second study of lenalidomide plus prednisone in 40 patients with intermediate-risk or high-risk mf led to an overall response rate based on international working group criteria of 30% for anaemia and 42% for splenomegaly, with a median time to response of 12 weeks. however, grade 3 and 4 adverse events (aes) were reported, mainly cytopenia.34 a recently updated report of this study after a median follow-up of 9 years35 showed that treatment responses improved over time, with 14 patients (35%) responding overall. more specifically, 39% of the patients showed a response in terms of reduction in spleen size, and the overall anaemia response rate was 32%. however, there was no significant difference in baseline characteristics between the patients who responded and those who did not. an analysis combining the results of 3 phase ii trials indicated that lenalidomide-based therapy may be more effective than thalidomide-based therapy, and fewer patients treated with lenalidomide plus prednisone discontinued therapy due to toxicity than those receiving thalidomide-based therapy. in addition, there was no significant difference in the response to lenalidomide alone and lenalidomide plus prednisone; however, response duration was significantly longer in patients who received lenalidomide plus prednisone.36 pomalidomide, a more potent immunomodulatory drug, has been evaluated in a multicentre, double-blind, placebo-controlled phase iii study (nct01178281).37 however, the study failed to meet the primary endpoint as an equal proportion of patients with mf in the pomalidomide (n=152) and placebo arm (n=77) achieved an anaemia response (16% vs 16%, p=1). on the contrary, the platelet response was significantly better in patients who received pomalidomide (22% vs 0%). cytoreductive agents have been the treatment of choice for most mf patients with symptomatic splenomegaly (table 3). hydroxyurea (hu), an s-phase cell cycle specific nucleotide-depleting agent that inhibits ribonucleotide reductase,38 is one of the most widely used medical therapies for patients with appreciably symptomatic splenomegaly,39,40 although it induces only modest responses at higher doses (12 g daily) and mainly in subjects with nonmassive splenomegaly (< 15 cm).45 although hu is generally well tolerated, the modest improvement in symptoms is temporary, and exacerbated cytopenia frequently limits treatment. in patients who do not respond to hu, it has been shown that the oral alkylating agents, melphalan and busulfan, improve splenomegaly and other disease symptoms, but they may also exacerbate cytopenia and possibly increase the frequency of leukaemic transformation. furthermore, they are mainly used in older patients as they are relatively manageable insofar as frequent laboratory monitoring is not required, unlike in the case of hu or other cytoreductive agents.41,46 in cases of massive refractory splenomegaly, it has been found that monthly courses of intravenous cladribine (2-chlorodeoxyadenosine) lead to a response in up to 50% of patients, with severe but reversible cytopenia being the main toxicity.42 interferon-alfa (standard and pegylated versions) has proved to have only a minimal clinical effect in reducing splenomegaly, and therefore, its use is not generally recommended.43 hypomethylating agents, such as azacitidine and decitabine, have also been studied in mf, but currently play only a limited role in its treatment.47 more recently, thomas et al48 demonstrated that methotrexate (mtx) may act as an inhibitor of the jak-stat pathway and that this activity is likely to be specific and not related to a general effect on protein phosphorylation: the drug s in vitro activity was observed at a concentration equivalent to that used in patients taking low-dose mtx (525 mg/wk). what is important is that its efficacy in controlling haematologic parameters, systemic symptoms, and splenomegaly has been confirmed in vivo in 2 recent case reports.49 splenectomy is a palliative debulking measure used in patients with mpns. its indications are mainly symptomatic massive splenomegaly, symptomatic portal hypertension with oesophageal varices and/or bleeding, profound cachexia, transfusion-dependent anaemia, and/or severe hypercatabolic symptoms. removal of the spleen improves mechanical symptoms (ie, early satiety and pain) in most cases and is often followed by weight gain in cachectic patients, but it is usually not effective against other constitutional symptoms. improvements in anaemia and thrombocytopenia after splenectomy have been reported in, respectively, 50% and<30% of patients. progressive hepatomegaly sometimes follows splenectomy, probably due to the migration of haematopoiesis, and a markedly enlarged liver is a contraindication to splenectomy. current data concerning an increased rate of leukaemic transformation after spleen removal are still discordant.44,50 however, given the high complication rate and limited benefit of splenectomy, appropriate patient selection is crucial.51 splenic radiotherapy, on a fractioned basis, at a daily dose of 0.4 to 1 gy, with weekly evaluation of spleen size and haematologic values until therapeutic effect is achieved or haematologic toxicity develops, can be used to treat mpns with an adequate platelet count (> 50 10/l), as extramedullary haematopoiesis has proved to be considerably sensitive to external beam radiotherapy in patients with mf. however, it leads to only transient benefits and may exacerbate cytopenia, particularly thrombocytopenia.50 it also has to be remembered that radiation can also cause local fibrosis with splenic adhesions to surrounding tissues that make a subsequent splenectomy technically more complicated and increase the morbidity and mortality of the procedure. in general, traditional treatment options are limited and insufficient to address the morbidity and mortality associated with mf. however, as mentioned above, the discovery of mutations leading to constitutive activation of the jak-stat signalling pathway raises hope that mf may be cured by selective jak1/2 inhibitors, as happens in the case of chronic myeloid leukaemia treated with bcr-abl1 tyrosine kinase inhibitors. ruxolitinib (jakavi; novartis, basel, switzerland) was the first jak1/2 inhibitor to become commercially available for the treatment of mf.52 in preclinical jak2v617f-positive mpn mouse models, it induced a considerable downregulation of jak-dependent proinflammatory cytokines, reduced mouse splenomegaly, and showed antiproliferative and proapoptotic activities. it is the only jak inhibitor approved in the united states for the treatment of splenomegaly in subjects with intermediate/high-risk mf and in europe for the treatment of splenomegaly and/or constitutional symptoms in patients with intermediate-2/high-risk mf.53 these approvals were based on the results of 2 phase iii randomised studies: comfort-i (ruxolitinib vs placebo) and comfort-ii (ruxolitinib vs best available therapy [bat]).54,55 the primary endpoint of both studies was a>35% reduction in spleen volume after 24 (comfort-i) or 48 weeks of treatment (comfort-ii), which was reached by, respectively, 41.7% and 28.5% of the patients treated with ruxolitinib, as against, respectively, 0.7% and 0% of the patients receiving placebo or bat (p<.0001).54,55 overall, more than 90% of the patients enrolled in both studies experienced some reduction in spleen volume at some time during the follow-up, and the reduction remained stable in most of the patients after a median follow-up of 3 (comfort-i) and 5 years (comfort-ii).56,57 the therapeutic success of ruxolitinib is not limited to reducing spleen volume because, unlike the drugs previously used to treat mf, it is efficacious in relieving constitutional symptoms; reducing abdominal discomfort, appetite loss, itching, fatigue, and night sweats; and improving the qol of most treated patients. as the drug s activity is independent of jak2 mutational status and not specific for the neoplastic clone, the response rate is similar in patients with and without the jak2v617f mutation because of its anti-jak1mediated effect. the uk, open-label, phase ii robust study evaluated its safety and efficacy in patients with mf, including those at intermediate-1 risk. the treatment was successful in 50% of the population as a whole and 57% of the intermediate-1risk patients. reduction in spleen length and symptoms was observed in all of the risk groups, and improvements in the myelofibrosis symptom assessment form total symptom score were seen in 80% of intermediate-1, 72.7% of intermediate-2, and 72.2% of high-risk patients.58 similarly, the phase iiib expanded-access jak inhibitor ruxolitinib in myelofibrosis patients (jump) trial for patients with mf without access to ruxolitinib outside of a clinical study found that the drug s safety and efficacy profile in intermediate-1risk patients was consistent with that in the study population as a whole and with that previously reported in intermediate-2risk and high-risk patients.59 the toxicity of ruxolitinib treatment is mainly haematologic due to the drug s interference with an essential pathway for haematopoiesis, as demonstrated in the comfort studies; in both trials, thrombocytopenia was the dose-limiting toxicity, and anaemia was the most common haematologic ae. a number of studies have shown that ruxolitinib affects many cytokines and interferes with the immune process necessary for the pathogenesis of mpns, but it also affects the function of various immune cells and may therefore favour an increased incidence of opportunistic and nonopportunistic infections.60,61 for example, ruxolitinib impairs natural killer cell differentiation and function and inhibits dendritic cell activation and migration, and antigen-specific t-cell responses in a dose-dependent manner in vitro and in vivo. however, despite warnings about this increased risk,6264 a recent update of the jump study described a low incidence of infections: the all-grade infections observed in 1% of patients included nasopharyngitis (6.3%), urinary tract infection (6%), pneumonia (5.3%), bronchitis (4.2%), herpes zoster (3.6%), influenza (3%), upper respiratory tract infection (2.9%), cystitis (2.5%), gastroenteritis (1.8%), respiratory tract infection (1.8%), and oral herpes (1.6%). other infections included tuberculosis in 3 patients (0.3%) and legionella pneumonia in 1 patient (0.1%). no hepatitis b reactivation was reported, and only 6 patients (0.5%) discontinued treatment because of grade 3 pneumonia.59 the patients receiving ruxolitinib in the comfort-ii study experienced higher rates of viral and bacterial infection than those receiving conventional therapy, but most of the infections were grade 1 or 2 and did not lead to any dose reductions or the discontinuation of trial medication. furthermore, the rates of infection tended to decrease with longer exposure to the drug. however, as patients with mf are already predisposed to infections65 and the long-term risks of ruxolitinib treatment are still unknown, treated patients should be carefully monitored, and prophylaxis for herpes zoster or other infections should be considered on a case-by-case basis, depending on local risk. given its promising results, a further indication for ruxolitinib treatment is as a therapeutic bridge to allo-hsct. furthermore, an increasing number of reports appeared in the literature, describing the morphologic changes in the bone marrow occurring in ruxolitinib-treated patients, mostly focusing on modifications in bone marrow fibrosis degree.6670 by the beginning of 2014, a number of other jak2 inhibitors were being tested: fedratinib,71 pacritinib,72 ly2784544,73 and momelotinib.74 however, the clinical trials of fedratinib and pacritinib were soon discontinued because of safety problems: wernicke encephalopathy (fedratinib) and bleeding (pacritinib). momelotinib (formerly known as cyt387) is a small-molecule, adenosine triphosphate its kinase profiling indicates that it has good selectivity over other jak family kinases (jak3, tyk2) and excellent selectivity over other tyrosine and serine/threonine kinases.75 the preclinical data provide a rationale for the use of momelotinib in bcr-abl1negative mpns, and a multicentre phase i/ii trial involving 166 patients with intermediate/high-risk mf showed that the drug is well tolerated at oral doses of 150 or 300 mg once daily or 250 mg twice daily and led to improvements in splenomegaly, constitutional symptoms, and transfusion requirement.74 of particular interest are the transfusion independence responses, which were observed in more than half of the rbc transfusion dependent subjects with a maximum transfusion-free period exceeding 2 years. in addition, the percentage of all subjects requiring rbc transfusions substantially decreased over the treatment period. more precisely, the overall anaemia response rate was 54% in transfusion-dependent patients with a median time to a confirmed anaemia response of 12 weeks (range: 84293 days). as has been previously reported, treatment with momelotinib led to a rapid and sustained reduction in splenomegaly in approximately 31% of all cases, with a median time to response of 15 days, and the constitutional symptoms of most of the patients disappeared within 6 months. in terms of safety, about 20% of the patients experienced a first-dose effect (dizziness, flushing, and hypotension) that was self-limited. grade 3/4 haematologic and nonhaematologic aes were infrequent with the exception of thrombocytopenia, which occurred in approximately 17% of patients. grade 3/4 nonhaematologic laboratory aes included hyperlipasaemia (4%) and increased liver enzymes (grade 3 and 4 increase in aspartate aminotransferase in, respectively, 1% and<1% of the patients; a grade 3 increase in alanine aminotransferase in 2%). mainly, grade 1 treatment related sensory peripheral neuropathy was reported, but there were no treatment-related deaths. in brief, momelotinib seems to lead to a significant and lasting improvement in anaemia, splenomegaly, and constitutional symptoms at doses of 150 or 300 mg/day or 150 mg twice daily. the efficacy and aes of momelotinib will be further evaluated in 2 currently ongoing phase iii trials: a randomised bat-controlled study of mf patients with anaemia and thrombocytopenia previously treated with ruxolitinib and a randomised study comparing momelotinib and ruxolitinib in patients with mf (nct02101268-nct01969838). more recently, the efficacy and safety of 3 dose levels of a potent and selective oral jak1 inhibitor, incb039110, have been evaluated in an open-label phase ii study, resulting in clinically meaningful symptom relief, modest spleen volume reduction, and limited myelosuppression.76 in particular, only 1 patient discontinued for grade 3 thrombocytopenia, whereas nonhaematologic aes were largely of grade 1 or 2 and most commonly represented by fatigue. nearly 40% of patients with mf are anaemic at the time of diagnosis, including 25% who are already transfusion dependent,77,78 and more than 60% will develop clinically significant anaemia during the course of follow-up.49 the clinical impact of io and its potential relationship to the heightened inflammatory response of patients with mf warrant consideration not only because potential liver dysfunction, cardiac disease, and other complications of io probably contribute to patient morbidity and mortality but also because the growing evidence of impaired haematopoiesis attributable to bone marrow haemosiderosis suggests a viable therapeutic target.79,80 each unit of rbc contains 200 to 250 mg of iron, and as the reticuloendothelial system can clear approximately 10 to 15 g (corresponding to 50 rbc units), any excess is deposited in tissues and leads to organ damage.81 iron overload is a concern when treating patients with mf, which is why iron chelation therapy (ict) has been used to counteract its potentially negative effects. however, it has to be admitted that there is a lack of prospective, randomised, controlled trials of the use of ict in patients with mf. one small retrospective study of 10 patients with mf demonstrated an erythroid response in 40% of cases receiving oral ict with deferasirox (dfx), thus allowing these patients to reduce their transfusion requirement; it also revealed a trend towards better overall survival in the responding patients.82 other data coming from a number of reported case studies79,80,83,84 also indicate that ict improves anaemia and decreases transfusion dependence in patients with mf. finally, a recent retrospective, multicentre analysis of 28 patients with mf and io secondary to transfusion dependence found that 11 patients (42.3%) achieved a stable and consistent reduction in ferritin levels (< 1000 ng/ml), and 6 of 26 patients (23%) showed a persistent (> 3 months) increase in hb levels to>1.5 g/dl, with the disappearance of transfusion dependence in 4 cases. however, comparison of the baseline characteristics of the patients who achieved an erythroid response and those who did not achieve did not reveal any significant differences that could be considered predictive.85 deferoxamine (desferal) is a linear ligand that forms 1:1 complexes with iron that maintain a net charge, allow for membrane permeability, and provide access to intracellular iron stores86 that are then excreted primarily in urine.87,88 it is administered in the form of an intravenous or subcutaneous infusion, and because of its short plasma half-life, the efficacy of the treatment correlates with the duration of infusion, and it is only effective if administered at high doses between 5 and 7 times per week.89 when administered as a continuous 24-hour infusion for 6 to 7 days per week in patients with high-risk -thalassemia, it can reverse iron-induced cardiac dysfunction and increase long-term survival.90 however, treatment-related side effects include infusion site discomfort (nearly 100%, with the development of local erythema or induration in some cases),91 visual changes (0%10%), generally transient auditory neurotoxicity (20%25%),92,93 increased serum creatinine levels (22%), vomiting (16%), abdominal discomfort (14%), constipation (14%), arthralgia (14%), nausea (11%), rash (5%), and diarrhoea (5%).94 deferasirox is an oral iron chelator frequently used in clinical practice in the united states and europe that has a long half-life of 8 to 16 hours and can be administered once daily.89 it forms a 2:1 complex with iron,95 which is then excreted largely in the bile and faeces (much less in urine).96,97 unlike other iron chelators, it is thought that dfx also affects haematopoietic stem cell differentiation by means of a reactive oxygen species mediated mechanism, which may underlie the erythropoeitic response seen in some dfx-treated patients.95 the most frequently reported adverse effects are gastrointestinal toxicity (21%64%), diarrhoea (46%), abdominal pain (15%28%), nausea (24%), vomiting (21%), and constipation (10%).94,98101 patients have also been reported to experience renal dysfunction (10%64%, usually nonprogressive at the start of treatment and improving after a dose reduction), skin rash (4%39%), arthralgia (15%),94 and transaminitis (4%70%),81,98101 and there have been rarer reports of auditory neurotoxicity (1%6%) as a potential side effect.100,101 it is not entirely clear whether ict can reverse the ill effects of io, and there are no completed studies that provide prospective evidence of a beneficial impact in terms of the restoration of normal haematopoiesis or outcomes in patients with mf. consequently, treatment decisions concerning the use of ict in patients with mf continue to be extrapolated from the data of myelodysplastic syndromes. allogeneic haematopoietic stem cell transplantation is still the only intervention that has been shown to be a potential cure for mf or a means of prolonging the survival of these patients. data from the most recent studies suggest that the expected 3-year progression-free survival rate is in the range of 40% to 50%.102 the adoption of reduced intensity conditioning regimens has recently made allo-hsct applicable to a larger proportion of patients.103 however, decisions concerning allo-hsct are based on inductive reasoning and require a considerable professional experience. key questions include patient selection, donor selection, pre- and posttransplant management, conditioning regimen, and prevention and management of post-transplant relapses. international prognostic scoring systems (ie, ipss, dipss, and dipss-plus)20,22,23 are the most comprehensive means of risk stratification currently available to guide therapeutic decision making, although the influence of driver mutations and the acquisition of additional mutations during the natural course of the disease may further refine this process. all patients with mf aged<70 years with ipss, dipss, or dipss-plus intermediate-2risk or high-risk disease and a reasonable performance status, and without any significant competing comorbid conditions, should be considered potential candidates for allo-hsct. patients aged<65 years with intermediate-1risk disease should only be considered candidates if they present with refractory, transfusion-dependent anaemia or>2% of peripheral blood blasts, or adverse cytogenetics (as defined by the dipss-plus classification). finally, patients with low-risk disease should not undergo allo-hsct.104 individual transplant-specific prognostic factors should be considered in every candidate for allo-hsct to be able to make individualised decisions. in this context, the transplant-specific high-risk factors include a spleen extending more than 22 cm below the costal margin, having been transfused with more than 20 rbc units, having received a transplantation from an hla nonidentical donor, a poor performance status (an eastern cooperative oncology group status of>2), a high comorbidity index (a haematopoietic cell transplantation comorbidity index score of>3), and the presence of portal hypertension. completely matched rather than mismatched donors should be selected because, as reported in the european blood and marrow transplantation registry, the cumulative incidence of nonrelapsed mortality after 1 year is, respectively, 12% and 38% and is not different between hla-identical siblings and 10/10 matched unrelated donors (10% vs 13%).105 however, haploidentical related donors are an attractive alternative source of haematopoietic stem cells.106 it is important to note that peripheral blood is considered the most appropriate source of haematopoietic stem cells in the case of hla-matched sibling and unrelated donors. when splenectomy is performed before allo-hsct, it may facilitate disease eradication. some reports have also shown faster engraftment in splenectomised patients; however, the pretransplant use of splenectomy remains controversial as no study has yet prospectively evaluated the effect of protocol-based splenectomy before transplantation. in the case of older patients and/or those with comorbidities, a less intense conditioning regimen is more appropriate, whereas patients with advanced disease and a good performance status should undergo a more intensified regimen.104 finally, in patients relapsing with constitutional symptoms or splenomegaly, jak1/2 inhibitor treatment is recommended but remains experimental. to address this question, ruxolitinib is being administered to eligible patients with mf for 60 days before definitive allo-hsct in a prospective multicentre phase ii study conducted by the myeloproliferative disorders research consortium (nct01790295). traditional mf treatments are primarily palliative and have proved to be inadequate to address the considerable morbidity and mortality associated with this disabling disease. more specifically, concerning anaemia, there have been various therapeutic attempts, but rbc transfusions still remain the most frequently used approach, even though io represents an increasingly frequent clinical challenge. considering instead splenomegaly, besides hu, ruxolitinib, as well as other investigational jak1/2 inhibitors, offers new hope for these patients as they have been shown to lead not only to significant reduction in splenomegaly but also to the palliation of disease-related symptoms. however, allo-hsct is still the only intervention that has evidence indicating it is potentially curative. obviously, in such a context, participation into a clinical trial should be encouraged whenever possible, with the purpose of making new drugs available .

myelofibrosis (mf) is a bcr-abl1negative myeloproliferative neoplasm that is mainly characterised by reactive bone marrow fibrosis, extramedullary haematopoiesis, anaemia, hepatosplenomegaly, constitutional symptoms, leukaemic progression, and shortened survival. as such, this malignancy is still orphan of curative treatments; indeed, the only treatment that has a clearly demonstrated impact on disease progression is allogeneic haematopoietic stem cell transplantation, but only a minority of patients are eligible for such intensive therapy. however, more recently, the discovery of jak2 mutations has also led to the development of small-molecule jak1/2 inhibitors, the first of which, ruxolitinib, has been approved for the treatment of mf in the united states and europe. in this article, we report on old and new therapeutic strategies that proved effective in early preclinical and clinical trials, and subsequently in the daily clinical practice, for patients with mf, particularly concerning the topics of anaemia, splenomegaly, iron overload, and allogeneic stem cell transplantation.

PMC5428134

pubmed-317

transesophageal echocardiography (tee) is considered to be safe and relatively noninvasive diagnostic tool,1) however severe complications have been reported. the incidence of major tee-related complications range from 0.2% to 0.5% and mortality is reported to be<0.01%.2345) among these complications, problems related to insertion of tee probe take a large proportion, including perforation of hypopharynx and esophagus. for our knowledge, there have been reported only few cases of hypopharyngeal perforation, especially not been reported in asian population to date. we describe the clinical presentations and secondary complications associated with oropharyngeal injury with the case of a 74-year-old man who suffered a hypopharyngeal laceration after tee. a 74-year-old man was referred to our cardiovascular center for the evaluation and treatment of mitral regurgitation (mr). he had been complaining of aggravation of dyspnea (new york heart association functional class iv) for the preceding 3 weeks, and atrial fibrillation and severe mr were detected from other clinic. the patient had medical history of hypertension and chronic obstructive pulmonary disease for 15 years, and received endovascular aneurysm repair for abdominal aortic aneurysm 8 years ago. the patient was admitted to the intensive care unit because of uncompensated heart failure and careful control of pulmonary edema with chronic kidney disease. the patient presented tachypnea and orthopnea before the tee procedure, less than minimal dose of sedative agent was administrated to lessen patient's discomfort, 1 mg of lorazepam, 25 mg of fentanyl, intravenously. as we checked for the mental status, the insertion of tee probe was performed with the patient in left lateral decubitus position according to the following standardized technique: the probe was inserted through the midline and gently advanced to pass the first pharyngeal curvature corresponding to the base of the tongue. the probe was then extended, and the patient was asked to swallow, at which point the probe was further advanced to enter the esophageal inlet. when the probe has reached to the root of tongue, the patient suddenly changed his position form left decubitus to supine position and gave force to the neck, and resisted to probe insertion. the probe got lodged at right-side of hypopharyngeal area so that failed to advance. at second attempt, tee demonstrated severe eccentric mr with medial commissural prolapse due to chordae rupture (a3-p3 commissure) with left ventricular dilatation, mild tricuspid regurgitation (fig. the physical examination revealed tenderness and crepitus on right anterolateral area of neck (level iii) 3 hours later after tee. iatrogenic hypopharyngeal or esophageal injury was suspected, antibiotic treatment with piperacillin/tazobactam was initiated and the patient was not allowed to eat or drink. computed tomography (ct) scan revealed subcutaneous emphysema without involvement of mediastinum, but the level of injury was not detected (fig. fiberoptic nasolaryngoscopic examination identified edema of the right posterolateral wall of the hypopharynx and hypopharyngeal bruise but there was no evidence of rupture or perforation. laboratory analysis revealed an elevation of the white blood cell count (20.36 10/l) and c-reactive protein (crp; 28.54 mg/dl). we tried to find any evidence of esophageal injury because treatment strategy would be different if the esophagus was involved. an ent specialist and a gi specialist agreed with hypopharyngeal injury without esophageal damage after multiple tests. we concluded the lesion was limited to the hypopharynx because the presence of hematoma at the right side of hypopharynx, consistent with the direction and the depth of the probe passage. further, there was no evidence of esophageal injury on serial follow-up multimodality imaging studies. after 5 days from the injury, the subcutaneous emphysema disappeared and the patient remained afebrile with improvement of the leukocyte count and crp (fig. however painful neck mass around anterolateral area of neck was noticed (level iii). the follow-up ct without contrast showed a right parapharyngeal and retropharyngeal abscess secondary to hypopharyngeal injury (fig. yellowish fluid in the abscess was analyzed for cytology and revealed as acute inflammatory cells predominantly neutrophils. as the patient's systemic status was stable with decrease of the leukocyte count and crp, the antibiotics (piperacillin/tazobactam) was maintained for 14 days with the drainage of abscess because no organisms were identified from the abscess fluid culture and repeated blood cultures. on 7th day after tee, second swallowing study was performed and no leakage was demonstrated (fig. 4b), infectious parameters were continuously decreased, and follow-up fiberoptic nasolaryngoscopic examination demonstrated no evidence of perforation or rupture in hypopharyngeal cavity. after 14 days of antibiotic therapy, when the infection was controlled completely, the patient had successful mitral valve repair with tricuspid annuloplasty with st. the overall incidence of severe hypopharyngeal and esophageal complications from traditional tee is low.1)3)6) risk factors of hypopharyngeal and upper gastrointestinal complications have been reported in few studies. patient related risk factors include older age, short stature, presence of cervical spinal disease, chronic steroid use, presence of congestive heart failure.3)7)8) the presence of gastroesophageal pathology such as zenker's diverticulum, esophageal stricture or obstructing mass, fibrosis secondary to prior chest radiation could be potential risk factor. anatomical variation like massive cardiomegaly1)9) or tracheoesophageal fistula may be correlated to increase the risk. procedure related risk factors include inexperience of the cardiologist, and resistance to prove insertion with poor cooperation. to avoid direct injury to the hypopharynx and upper esophagus during a blind insertion of probe, appropriate conscious sedation and local anesthetic spray direct visualization of the passage of the probe with direct laryngoscope could be recommended to minimize blind injury of throat. if there are procedural difficulties such as multiple attempts at passage of the tee probe or resistance during insertion, the examination should be stopped. in addition, indirect injury is also result from increased continuous pressure on the probe positioned in the upper esophagus, therefore, the exam should be stopped if the resistance is continuing. finally, it is very important to prevent sudden position change of the patient during the probe insertion. it needs pre-procedural enough education, adequate sedation, careful insertion of tee probe, and an experienced assistant. in our case, we assumed that the patient's poor cooperation and insufficient sedation might cause the wrong direction of the tee probe and advancing force of tee probe into the throat had led the probe to get lodged into the right pyriform sinus. treatment of hypopharyngeal perforation depends on the cause, timing of diagnosis, and type of lesion.101112) in a study of hinojar et al.,10) 3 patients out of 7 patients were managed conservatively, whereas other 4 patients got surgical treatment. mostly in the former cases, the time duration to the diagnosis was less than 1-2 days and involvement of infection was limited to pharyngeal space. in current case, our patient complained pain in his throat and we detected subcutaneous emphysema within 3 hours after injury that may prevent aggravation of infection and lead good prognosis. it is important not only to understand possible complications of the procedure and to recognize the risk factors of pharyngeal and esophageal injury, but also to detect the complication as soon as possible if it occurred, to get better prognosis.

transesophageal echocardiography (tee) is considered relatively safe but semi-invasive. the hypopharyngeal and esophageal injury is infrequent complication of tee but could be serious, even life-threatening. we present a case of a 74-year-old man who experienced a deep neck infection secondary to hypopharyngeal injury following tee. the diagnosis was made because of the subcutaneous emphysema developed 3 hours after tee. in spite of antibiotics therapy with prolonged fasting, a right parapharyngeal and retropharyngeal abscess was developed 5 days later. with ultrasound-guided drainage of abscess and continuous antibiotic treatment, infection was controlled. the patent underwent mitral valve repair after 14 days of antibiotic therapy. the patient recovered uneventfully. for cardiologists performing tee, it is required to know complications and their risk factors to minimize hypopharyngeal and esophageal injury.

PMC4595706

pubmed-318

it has been reported that the prevalence and incidence of dementia in the united states have been either stable or even declining over the last 2 decades of the 1990s. this question is particularly relevant to the case of japan which is an economically advanced country like the us, but is believed to have a different level of vascular disease risk. studies conducted in the late 1980s and early 1990s reported that vascular dementia (vad) was more prevalent than alzheimer's disease (ad) in japan, compared with the us and other western countries where ad is more prevalent than vad. in studies among japanese americans conducted in the early 1990s [4, 5], the prevalence ratio of ad to vad was higher than that reported among japanese in japan and more closely resembled that found in the caucasian population. this suggests that there might have been environmental factors that changed the risks of developing subtypes of dementia after japanese immigrated to the us. on the other hand, more recent studies conducted in the late 1990s suggest that the cross-national differences found in the past may have been due to differences in the diagnostic methods used [6, 7]. standardization of diagnosis is one of the challenges of cross-national comparisons of dementia prevalence. there is an ongoing debate as to whether: (1) the higher proportion of vad found in the past studies in japan could be due to differences in diagnostic criteria used in japan and the us, (2) the similar ad/vad ratio with that of the us found in recent japanese studies could be due to decreased cerebrovascular disease incidence over the past decades in japan, or (3) there is no systematic time trend in ad/vad ratio in japan and the observed variation is due to regional differences within japan. despite a growing interest in the influence of vascular disease and its risk factors on alzheimer's disease (ad) [812], our aims in the current study are to: (1) summarize epidemiological studies of dementia in japan including relevant details of study protocols and diagnostic criteria, (2) compare age-specific prevalence of all-cause dementia among studies, and (3) assess the trends in ad versus vad over time. previous studies which concluded an increase in ad/vad over time in japan [1315] did not examine the diagnostic criteria used, nor did they examine age-specific ad/vad ratios. we selected dementia prevalence studies in japan that were designed to be representative of specific communities or prefectures with at least 500 study participants aged 65 and older, and whose age-specific prevalence (for either 5- or 10-year age intervals) for ad and vad was published between 1990 and 2009 in international journals, using medline with the search words japan, dementia, and prevalence. we used the former criterion (n 500) in order to have a large enough sample size to allow meaningful between-cohort comparisons of dementia prevalence. eight studies met these criteria: the hisayama study [16, 17] conducted at four time points, the okinawa study, the radiation effect research foundation adult health survey (rerf-ahs, a.k.a hiroshima study), the tajiri project, and the ama-cho study. brief descriptions of each study cohort follow (see also table 1 for further summary). hisayama is a rural community adjacent to the city of fukuoka, a major city of kyushu island. cross-sectional dementia prevalence was estimated 4 times, in 1985, 1992, 1998, and 2005 [16, 17]. random sampling was conducted to recruit study participants in the selected sites between 1991 and 1992. in 1958, the atomic bomb casualty commission began the adult health study (ahs) to survey the occurrence of illnesses and changes in physiological and biochemical function resulting from exposure to atomicbomb radiation. the original ahs cohort consisted of atomicbomb survivors and their controls, selected from residents in hiroshima and nagasaki. between 1992 and 1996, those aged 60 and older who were residents of hiroshima and members of the ahs were examined. the tajiri project is a community-based study started in 1988 for the prevention of stroke, dementia, and bed-confinement in tajiri, an agricultural area in northern japan. in 1998, all residents 65 years and older were targeted for the dementia prevalence study [6, 20]. this study was conducted in the municipality of ama-cho, a rural island town in the northwestern part of japan. all residents as of the prevalence day of march 1, 2008 were requested to participate in the dementia prevalence study. differences in overall dementia prevalence among 8 studies were examined using poisson regression models based on the number of dementia cases (weighted numbers of cases for okinawa studies) and the number of participants by 10 year age groups (except the youngest age group where 5-year ages were used: 6569, 7079, 8089, and 90 +) to provide large enough sample sizes in each group for meaningful statistical comparisons, yet controlling for changing age composition over time. the okinawa 1992 study sample was used as a reference group because it was the largest and was conducted at the mid-point of assessment years among the 8 studies. table 1 gives a brief description of each study and the criteria used to define dementia and dementia subtypes. all assessments, except in the tajiri study, were based on multistage assessments, during which all participants were screened in phase 1 (screening phase), and selected participants and controls from phase 1 received final diagnoses from physicians in phase 2 (clinical assessment phase). the dementia diagnostic criteria used in japanese studies were either dsm-iii, dsm-iii-r, or dsm-iv. the diagnostic criteria used to define subtypes of dementia varied among the studies in japan. the following criteria were used to define vad: hachinski ischemic scores, ninds-airen, dsm-iv, and the alzheimer's disease diagnostic and treatment centers (addtc) criteria. for ad, dsm-iii-r, dsm-iv, and nincds-adrda were used. the overall prevalence of dementia among those aged 65 and older ranged from 5.6% (hisayama 1992) to 11.3% (ama-cho 2008) (table 1). poisson regression models for dementia prevalence showed that compared with the okinawa 1992 study, hiroshima 1996 (p=0.0002), tajiri 1998 (p<0.0001), hisayama 2005 (p<0.0001), and ama-cho 2008 (p=0.007) had a higher prevalence of all-cause dementia, controlling for sex and age groups (table 2). there were no difference between the okinawa 1992 study and hisayama studies conducted in 1985, 1992, and 1998. no difference was found between men and women. as a post hoc analysis, we also ran poisson regression models using only the hisayama studies (4 time points). the results showed that compared with the all-cause dementia prevalence in 1985, that of 2005 was higher (coefficient: 0.32, 95% ci: 0.010.64, p=0.04) controlling for sex and age groups (not shown in table 1). ad/vad ratios among those aged 65 and older are listed in the last column of table 1. the okinawa (1992), hiroshima (1996), tajiri (1998), and ama-cho (2008) studies used the same criteria for diagnoses of ad (nincds-adrda) and the ad/vad ratio among those aged 65 and older was 1.85, 1.85, 3.33, and 4.12 for the above studies, respectively. the hisayama studies which conducted 4 cross-sectional studies using the same diagnostic criteria for subtypes of dementia also showed the increasing trend in the ratio of ad/vad, ranging from 0.52 in 1985 to 1.96 in 1998, and 1.92 in 2005. the tajiri project, which conducted an mri substudy to identify dementia etiologies, showed that the proportion of ad among total dementia cases differed largely depending on the criteria used: 62.5% (ad/vad=3.3) using ninds-airen criteria, and 40.6% (ad/vad=1.0) or 56.2% (ad/vad=2.3) depending on assessors using dsm-iv criteria. even though we selected studies with relatively large sample sizes (n 500), the number of cases was too small to conduct meaningful comparisons of age-specific ad/vad ratios for the age group 6570 (< 5 for each case). therefore, we list age-specific prevalence of dementia and ad/vad ratios for the age groups 7079, 8089, and 90 and older in table 3. the youngest age group examined here (age 7079) had a prevalence of vad that was consistently higher than that of ad in japan (i.e., ad/vad<1) except in more recent studies conducted in 2005 (hisayama) and 2008 (ama-cho). except for these two recent studies (hisayama 2005 and ama-cho 2008), eight major prevalence studies conducted in japan were reviewed in an attempt to identify trends in prevalence of all-cause dementia and subtypes of dementia, paying careful attention to diagnostic protocols. we found that compared with the okinawa 1992 study, studies conducted in later years (1994 (hiroshima), 1998 (tajiri), 2005 (hisayama), and 2008 (ama-cho)) had a higher prevalence of all-cause dementia, after controlling for age groups and sex. within 4 studies conducted in hisayama (1985, 1992, 1998, and 2005), we also found that the prevalence in 2005 was higher than that in 1985, after controlling for age groups and sex. thus, the dementia prevalence seems to be increasing in japan, in contrast to the us where decreasing or stable prevalence of all-cause dementia has been reported. two diseases that could have high impact on the prevalence of dementia at national levels are cerebrovascular disease and type 2 diabetes, as shown by their relatively high population attributable risk% (par%) of dementia in the united states [12, 28]. according to the national nutrition survey in japan, those with hemoglobin a1c values 6.0% (possible type 2 diabetes) were estimated to be 22.8%, 37.4%, and 40.9% among men aged 70 and older in year 1997, 2002 and 2007, respectively, and the comparative figures among women were 27.2%, 28.2%, and 34.6%. on the other hand, the decline in stroke incidence reached plateaus around the late 1990s after a continuous sharp decline beginning in 1960, thus further declines in dementia due to stroke would not be expected after the 1990s. however, it is possible that the prevalence of small vessel cerebrovascular disease with resultant microinfarcts that would not be accounted for in these vascular disease statistics could play a latent or underappreciated role in causing or contributing to dementia. the increase in type 2 diabetes, the metabolic syndrome and its associated vascular complications (risk factors for ad), with a plateau in declining trends in major stroke incidence, could have lead to an increase in dementia prevalence in recent years in japan. it is also possible that increasing public awareness of dementia in recent years is resulting in enhanced recognition of functional and cognitive declines that might previously have been dismissed as longer survival of those who suffered from stroke/tia due to advanced medical treatment could also increase the prevalence of dementia to some extent. unfortunately, autopsy confirmation in large proportions of the participants in these epidemiologic studies is not available, thus limiting conclusions as to more specific underlying etiologies. we found that okinawa had a lower overall prevalence of dementia compared with other cohorts except hisayama studies in 1985, 1992, and 1998. these two regions (okinawa and hisayama) have had lower incidence of cerebrovascular diseases in comparison with other regions studied here. for example, the rate of cerebrovascular mortality, as a proxy of cerebrovascular disease incidence, declined sharply between 1975 and 2000 by over 65% in all regions and declined further between 2000 and 2005 by over 10% in all regions (table 4), with the above two regions constantly having lower rates than other regions. historically, salt consumption has been high in the northern part of japan because vegetables and marine products are cured with salt to preserve them during the longer winter months and consumed with processed white rice. this dietary pattern is believed to be one of the reasons of the higher prevalence of hypertension and large vessel cerebrovascular disease in the northern prefectures in japan. the low dementia prevalence in okinawa and hisayama (except 2008), which is located in the southern part of japan, could not only be due to a lower rate of vad resulting from lower cerebrovascular disease incidence, but also due to lower ad prevalence resulting from reduced vascular injuries [8, 12, 33, 34]. vascular dementia (vad) was believed to be more prevalent than alzheimer's disease (ad) in japan in the 1980s, in contrast to the us or other western countries, but studies conducted in the late 1990s and after showed patterns that were more similar to the us [13, 15, 35]. westernization of the dementia prevalence pattern could be partly due to the declining stoke incidence observed during the 1980s as described above. however, it could also be due to changes in diagnostic criteria used in japan. for example, in the tajiri study, patients received a diagnosis of possible ad with cvd by means of the ninds-airen criteria, provided that the vascular effect on dementia was considered to be too ambiguous to diagnose as vad, which lead to relatively high proportion of ad out of all dementia cases (over 62%). the study also demonstrated the difficulty of obtaining consensus on the definition of vad, even for experienced neurologists using the same criteria; two neurologists blinded to each other's diagnosis did not agree when diagnosing vad versus ad under dsm-iv criteria: the proportion of vad out of total dementia cases ranged from 40.6% to 56.2%, depending on assessors. we expect that lack of imaging data may result in underdiagnosis of subcortical vascular brain injury (e.g., white matter hyperintensity, and silent brain infarcts, etc.) and thus lead to underestimation of vad. however, more recent studies including the tajiri, hisayama (1998; 2005), hiroshima and ama-cho studies used imaging data, and these tend to show higher ad/vad ratios (i.e., not higher vad prevalence) compared with earlier studies. therefore, it is likely that changes in diagnostic criteria at least partly explain the higher proportion of diagnosed ad in recent years. in all studies except more recent studies conducted after 2000, as age increased, the proportion of ad among the total dementia cases increased: the youngest age group examined (age 7079) had a prevalence of vad that was consistently higher than that of ad in japan (i.e., ad/vad<1). on the other hand, among the older age groups, in fact, among the oldest age group (age 90), ad/vad ratios in japan were not necessarily lower than the us figures even among studies conducted in the early 1990s, ranging from 2.5 (hisayama 1985) to 6.0 (hisayama 1992). in the aging, demographics, and memory study (adams) [36, 37], which is the first study in the us to calculate a nationally representative dementia prevalence, the age-specific ad/vad ratios were found to be 2.36, 4.43, and 4.79 for age group 7179, 8089, 90 and older, respectively, using dsm-iii-r and dsm-iv criteria for dementia and nincds-adrda criteria for ad, that is, the age-associated increase in ad prevalence seems to be more evident in japan than in the us. this could be partly due to the fact that the gender gap in life expectancy is larger in japan compared with us and the proportion of women increases more steeply as age increases in japan. for example, in 1990, the life expectancy at age 65 was 18.9 years for women and 15.1 years for men in the us, that is, a gender gap of 3.8 years, while the comparative figure in japan was 20.0 years and 16.2 years, with the gender gap of 4.8 years. similarly, in 2008, the life expectancy at age 65 was 19.8 years for women and 17.1 years for men in the us, with the gender gap of 2.7 years, while the comparative figure in japan was 23.6 years and 18.6 years, with the gender gap of 5.0 years. cerebrovascular disease is more common among men than women, and we expect a higher proportion of vad among men than women. a steeper age-associated increase in ad prevalence found in japan, therefore, could be due to a higher proportion of women among the older old age groups in japan. comparisons of age-specific ad/vad ratios between men and women could clarify this issue, but we were unable to do so due to the small sample size once we stratify prevalence by sex and age groups, especially among those aged 90 and older. however, at least among the younger two age groups (ages 7079; 8089), we see an increasing trend in the proportion of ad cases as age group goes up in both men and women (data not shown). these results also suggest that it is important to consider the age/sex structure of samples when we compare the ad/vad ratio among different cohorts although incidence of dementia and its subtype would give a more accurate picture regarding the trend, there is a paucity of dementia incidence studies in japan. to our knowledge, only three incidence studies have been reported thus far: (1) the hisayama cohort, following their 1985 cohort for 7 years; (2) the tajiri project, following a sub-sample of their 1998 cohort for up to 7 years; (3) the hiroshima study (radiation effects research foundation adult health study), following their 19921996 prevalence cohort until the year 2003. the incidence of all-cause dementia was 19.3 per 1000 person-years for men and 20.9 for women in the hisayama study, 33.9 for men and 44.0 for women in the tajiri study, and 12.0 for men and 16.6 for women in the hiroshima study. the hisayama and hisorhisma studies reported significant gender differences in subtypes of dementia incidence: hisayama reported that the incidence of vad increased with age and was consistently higher than that of ad for men, while the incidence of ad was higher than that of vad for women age 75 years or older. the incidence of ad markedly increased after the age of 80 in either sex, but overall, vad was more common in the hisayama study. the hiroshima study also reported that probable ad showed the most remarkable increase with age, and probable vad was significantly lower among women. overall, ad was more common in this study, possibly because the hiroshima study was conducted later than the hisayama study, after a further decline in stroke incidence had occurred. in all 3 incidence studies, nincds-adrda criteria were used for ad and ninds-airen for vad. in japan, ad incidence and prevalence tend to increase with age more than vad and older old women predominantly have ad rather than vad. therefore, when aggregated, the overall prevalence of ad may become higher as more women survive in the oldest old age group. as we mentioned earlier, it is important to consider the age/sex structure of samples when examining trends in the ad/vad ratio. in conclusion, our systematic review shows that (1) there is an increasing trend in overall dementia in japan. although we can not confirm definitively from the current study, the possible explanation of the increase could be a shift in health conditions among the elderly in japan including the increase in diabetes mellitus in more recent years despite the plateau in decline in stroke incidence during the late 1990s; (2) the similar ad/vad ratio found in recent studies in japan with that of the us could be due to a combination of at least 3 factors: (a) shifting diagnostic criteria (more in line with us consensus diagnosis), (b) possible shifting in health conditions among the elderly in japan (decline in stroke incidence, but increase in metabolic disease e.g., type 2 diabetes, hyperlipidemia, and atherosclerosis), (c) an increase in the proportion of the oldest old who had an historically higher prevalence of ad (as opposed to vad) in japan, and (d) regional variations (i.e., a north-to-south gradient in vad) possibly due to large difference in dietary patterns. the study limitations include relatively small sample sizes, especially for the oldest old group. the okinawa study took into account the potential dementia cases among those who were screened at phase 1 (screening phase), but did not participate in phase 2 (clinical assessment phase), using weights generated from phase 1. however, as with most other epidemiological studies of dementia, there was no way of precisely estimating the frequency of dementia among those who did not participate in the screening phase. four japanese prevalence studies [15, 4143] were not included in this study because the age-specific prevalence of ad and vad were not provided in the published articles. although it would be interesting to deconstruct the changes in all-cause-dementia prevalence and ad/vad ratios into the potential explanatory factors, different criteria used to define subtypes of dementia would not allow this type of quantitative assessment. one of the strengths of our study is that we could ascertain the detailed screening procedures and diagnostic criteria by contacting the investigators of the original studies. future studies could aid in monitoring changing prevalence patterns and their causes by including some of the following elements. first, as with hisayama studies, it would be ideal for studies to examine the prevalence of dementia and its subtypes repeatedly at the same locations using the same criteria. second, it would be helpful if future epidemiology studies would recruit more participants aged 90 and older (e.g., through aggressive age-stratified sampling protocols) to improve estimates of prevalence in this age group. third, more comprehensive diagnostic criteria should be used for inter-cohort comparisons: as suggested by viswanathan and colleagues, ad and vad exist in a continuum of disease. it might be more meaningful if we could apply, for example, more specific clinicopathological criteria for mixed dementia [4450] than those currently used. increased use of standardized neuroimaging such as the alzheimer's disease neuroimaging initiative (adni) might aid in the development of more specific and comparable criteria for the diagnosis of vad. finally, autopsy confirmation of the underlying potential causes of dementia in epidemiological studies would go a long way to help resolve these important uncertainties in the shifting patterns over time of the dementias.

there is a paucity of data regarding trends in dementia and its subtype prevalence in japan. our aims in the current paper are to: (1) summarize epidemiological studies of dementia in japan including relevant details of study protocol and diagnostic criteria, (2) compare the age-specific prevalence of all-cause dementia among studies, and (3) assess the trends in alzheimer's disease (ad) versus vascular dementia (vad) over time. we reviewed diagnostic criteria, all-cause dementia prevalence, and the ad/vad ratio from 8 large population studies of dementia in japan. compared with the okinawa 1992 study, studies conducted in 1994, 1998, 2005, and 2008 had a higher prevalence of all-cause dementia using poisson regression models, after controlling for age and sex. in contrast to the us and some european countries, all-cause dementia prevalence is increasing in japan. the prevalence of ad as opposed to vad seems to be increasing over time, but large variability in diagnostic criteria, possible regional variability, and differences in prevalence of subtypes of dementia between men and women make it difficult to draw a conclusion about this trend at the national level. further studies, for example, comparing the population attributable risk of vascular diseases to the prevalence and incidence of dementia could help to clarify the regional variations in etiological subtypes.

PMC3469105

pubmed-319

chronic low back pain (clbp) refers to chronic pain around the lumbar vertebra sustained for over three months without serious pathological characteristics, regardless of the existence of sciatalgia1. clbp causes pain and changes in the muscles, as well as decreases in contractile force and muscle activity. studies of therapeutic approaches to clbp pain reduction, muscular strength improvement, and spinal movement enhancement have investigated the effects of myofacial release, osteopathy, massage, lumbar stabilization exercises, and proprioceptive neuromuscular facilitation (pnf)5,6,7. among these therapeutic approaches, joint mobilization using pnf has a positive effect on pain, muscle strength, and range of motion (rom)8, 9. it is applied as a passive movement by therapists10, 11. in particular, kaltenborn-evjenth orthopedic manual therapy (keomt) is an effective treatment for improving rom and pain. keomt is a safe and well-established procedure that slowly utilizes the convex-concave rule (traction or gliding on the treatment side)10, 12. hindle et al. reported pnf is effective at improving rom and muscular strength13. kim et al. reported that lumbar stabilization therapy using pnf for clbp significantly improved the thicknesses of the external oblique and multifidus muscles, and the functional level8. in addition, pnf has been used to improve the muscular strength of athletes14. this case study was a single patient with clbp and a lumbar transitional vertebra who has six lumbar vertebrae (not five). a lumbar transitional vertebra is defined as a congenital malformation that appears as a deformation of the fifth lumbar (l5) or first sacrum (s1) vertebra15. vergauwen reported that lumbar transitional vertebrae patients more commonly experience disc protrusion, degeneration, and spinal stenosis than patients without lumbar transitional vertebrae16. therefore, the purpose of this study was to identify the effects of joint mobilization using keomt and pnf on a patient with clbp and a lumbar transitional vertebra. the subject was selected from among the patients of sarang hospital (yongin, south korea). the subject agreed to participate in the study after receiving explanations regarding the purpose and procedures of the experiment, and signed an informed consent statement before participation. the protocol for this study was approved by the local ethics committee of the namseoul university of cheonan. computer tomography (ct) showed six lumbar vertebrae, which is one more lumbar vertebra than a normal person (fig. the subject was aged 29, and had a weight of 67 kg, a height of 158 cm, and a bmi of 26.90. the initial symptom developed about two years earlier, and at the time of the study the subject was not receiving any medical or physical therapy. the major complaint of the subject was a numb feeling, especially in the hind part of the left leg. she also complained of a stinging pain during daily activities, such as lifting, lumbar twist, and flexion. the program consisted of a 40-min session, 3 days a week for 4 weeks (october 131, 2014), during which joint mobilization was performed using keomt and pnf techniques. joint mobilization using keomt lasted 20 min, and it included lumbar segmental traction and lumbar segmental mobilization (flexion, extension) in a side-lying position. it was performed by a therapist who had completed a keomt spine advance course. the pnf exercise included shoulder flexion, abduction, and external rotation in a supine position, and dynamic reversal of the antagonist was performed17, which indirectly exercised the abdominal muscle through irradiation of the shoulder muscle. it was performed by a therapist who had completed the pnf level i, ii courses. the subject was assessed for spinal motion, low back pain, and thickness of the multifidus. spinal motion was assessed using a spinal mouse (idiag, swiss), which measures the spinal curvature, flexion, and extension (thoracic and lumbar vertebrae). low back pain was assessed using a visual analogue scale (vas) and the oswestry disability index (odi). the vas assesses subjective pain through a which has a possible range of 0 to 10. the odi assesses low back pain, and has a possible range of 0 to 100%. it is composed of ten items, including pain severity, self-management, lifting, sitting, standing, sleeping, etc. the thickness of the multifidus was measured using ct (general electric, korea). the multifidus muscles of the fourth lumbar vertebra (l4)20 was scanned by a radiological thechnician at sarang hospital. the spinal curvature, flexion, and extension of thoracic and lumbar vertebrae were measured. in the thoracic vertebra, the rom of flexion increased from 14 to 20, and the rom of extension increased from 1 to 4. in the lumbar vertebra, the angle of spinal curvature increased from 12 to 20. the rom in flexion increased from 33 to 47, and the rom of extension increased from 2 to 7 (table 1table 1.change of thoracic and lumbar movementvariablecurvature ()flexion ()extension ()prepostprepostprepostthoracic2632142014lumbar1220334727). the subject mentioned she was less uncomfortable in daily life, e.g. during face washing, dishwashing, hair washing, etc. the odi percentage score decreased from 48.88 to 24.44 (table 2table 2.change of vas and odivariablevas (score)odi (%) prepostprepost7.5348.8824.44). the thickness of the multifidus was measured at the fourth lumbar vertebra (left and right). the left multifidus increased from 572.09 to 662.09 mm, and the right multifidus increased from 479.84 to 530.90 mm (table 3table 3.change of multifidus thicknessvariableprepostmultifidus (mm)l: 572.09l: 662.09r: 479.84r: 530.90l: left; r: right). 3.multifidus thickness on a ct (post) show the multifidus thickness on a ct. multifidus thickness on a ct (pre) multifidus thickness on a ct (post) this study was a case study of a single patient with clbp and a lumbar transitional vertebra. the purpose of this study was to identify the effects of joint mobilization using keomt and pnf techniques in a patient with clbp and a lumbar transitional vertebra. the spinal motion, pain, and thickness of the multifidus were evaluated and compared between pre- and post-assessment. florentino et al. reported that most nurses possess at least one musculoskeletal disorder, among which low back pain is the most frequent (60.9%)21. after the intervention, the angle of spinal curvature increased, and the roms of flexion and extension of the thoracic and lumbar vertebrae also increased, indication that joint mobilization using keomt and pnf had a positive effect on spinal motion. ko et al. reported that clbp patients in a thoracic joint mobilization group showed greater improvements in spinal motion and pain reduction than a william exercise group22. our present results were similar, suggesting that joint mobilization has a positive effect on spinal motion. after the intervention, the vas score decreased from 7.5 to 3, and the odi score decreased from 48.88% to 24.44%. orthopedic manual therapy has positive effects on the spinal function of clbp patients6, especially items of self-management, such as bathing, dressing, and sleeping. reported pain reduction after joint mobilization using keomt was performed for osteoarthritic elderly people23, and lpez et al. reported joint postero-anterior mobilization had an effect on the pain and rom of clbp patients9. lee reported a pnf group demonstrated greater pain reduction and increased muscle activity than a ball training group, and jung reported pnf reduced the pain of clbp patients24, 25.. therefore, the results of previous studies agree with those of the present study. the spinal muscle contracts prior to motion and controls the movement28. in particular, the multifidus muscle is important for lumbar stabilization. the superficial multifidus plays a role in spinal direction control, and after the intervention, the left multifidus increased from 572.09 to 662.09 mm, and the right multifidus was increased from 479.84 to 530.90 mm. kim et al. reported a pnf group showed greater increases in the thicknesses of the multifidus and external oblique muscles than a general physiotherapy group and a lumbar stabilization group8. in addition, a resistance exercise using pnf not only reinforced muscular strength causing maximal muscular contraction, but it also stabilized the body position30. these results indicate pnf has a positive effect on the thickness of the multifidus. according to our present results, joint mobilization using keomt and pnf had a positive effect on the spinal motion, pain, and thickness of the multifidus of a patient with clbp and a lumbar transitional vertebra. this study was a single subject case study, but it is meaningful in that it presented spinal motion, pain, and muscle activity in a patient with a lumbar transitional vertebra. a larger number of patients will need to be studied in the future.

[ purpose] the purpose of this case study was to identify the effects of joint mobilization using kaltenborn-evjenth orthopedic manual therapy (keomt) and proprioceptive neuromuscular facilitation (pnf) techniques on a patient with chronic low back pain (clbp) and a lumbar transitional vertebra. [methods] the intervention methods were joint mobilization using keomt and pnf techniques. the program consisted of 40-min sessions 3 days a week for 4 weeks. the spinal motion (thoracic and lumbar vertebrae), pain, and thickness of the multifidus were measured. [results] the angle of spinal curvature increased, and the range of motions (roms) flexion and extension increased in the thoracic and lumbar vertebrae. the pain score as measured on a visual analogue scale (vas) and the oswestry disability index (odi) score decreased. the thickness of the multifidus (l4) increased on the left and right sides. [conclusion] these results suggest that joint mobilization using keomt and pnf techniques had a positive effect on the spinal motion, pain, and thickness of the multifidus of a patient with chronic low back pain and a lumbar transitional vertebra.

PMC4483456

pubmed-320

patient acuity has been increasing, patient turnover is higher, and patients are frequently of advanced age with several comorbid disorders. limited resources and the pressure for higher efficiency can result in the suboptimal delivery of healthcare. during treatment within the healthcare system, a significant percentage of patients (316%) suffer from adverse events through system errors- with 1565% of adverse patient events being attributed to communication failure. patient care can involve several health care providers with several transfers between providers. in this transition, poor or incomplete relay of patient data may result in errors, near misses and adverse events. standardized and thorough communication of critical information is an essential component of patient safety ,. although individual us based handover guidelines, and handover tools have been developed, these practices are not widespread. a previous survey study observed that 31% of mds experienced daily clinical problems which they believed avoidable if provided with adequate hand-over processes. widespread us practice of verbal hand-over has been observed to be highly inefficient. the world health organization listed communication during patient care handovers as one of its high 5 patient safety initiatives. the joint commission international listed their 2nd national patient safety goal as to improve the effectiveness of communication among caregivers. there is a lack of studies on how anaesthesiologists hand over their patients, which is surprising given that anesthesiology is a specialty that has always aimed at placing patient safety as its top priority. the standards of postoperative care issued by the american society of anesthesiology does not state how handover should be performed nor what information it should include, leaving the handover process decision up to the individual clinician. studies analyzing anesthetic team handover in the recovery room observed that the majority of handovers were remarkably brief and insufficient-. in these studies, critical details such as the preoperative state of the patient, type of operation performed, amount and kinds of analgesics given and problems encountered during the case were either barely mentioned or underplayed. in some instances significant intraoperative events were completely disregarded. additionally, there were frequent distractions present at the time of the hand-over. there are no reported studies on handover practices performed by anesthesia providers when transition of care occurs intraoperatively. this preliminary pilot study was a qualitative rather than quantitative survey to highlight the scope of the current us intraoperative handover of patient information. this study had institutional approval (wayne state university irb). due to the anonymity of the suvey content, this study used an online questionnaire format with 8 survey questions created using a computerized online survey program (survey monkey, palo alto, ca, usa,). an e-mail with a link to the questionnaire was sent to anesthesia providers at all anesthesia residency programs nationwide (120 out the 132 us programs encompassing around 4500 residents and their attending academic mdas) and a smaller survey selection of crnas (10 institutions about 300 crnas in the metropolitan area of detroit, mi). all questionnaires were anonymous and were only sent to us anesthesia providers working in an academic hospital setting with an associated residency program in anesthesiology. the only demographics of surveyed anesthesia health care providers obtained were for medical training level (certified registered nurse anesthetist -crna, medical doctor of anesthesiology resident mdar, or medical doctor of anesthesiology mda). from all questionnaires received (n=216), 87 (40.3%) of respondents were mdas, 71 (32.9%) were mdar, and 58 were crnas (26.9%; table 1). the response rate to this survey was low with a response from approximately 5% of the resident population in us anesthesia programs and approximately 20% of the crnas surveyed in the metropolitan detroit area. of all respondents, 108 (49.1 %) stated that they did not have a handover protocol at the institution where they practiced (table 1). of the respondents who did have an institutional handover policy furrthermmore, 85.7% respondents reported not having a departmental standardized handover form (table 2). of all responders, 84.8% (173/204) had an experience where they had not received sufficient information during a patient handover. only 7.4% (15/203) of respondents had never experienced complications or mismanagement due to poor or incomplete handover. in comparison, 59.6% (121/203) reported rarely having complications, 30.5% (62/203) reported sometimes having complications and 2.5% (5/203) reported frequently having complications (table 3). respondents were asked to respond on the frequency in which they addressed the specific handover information such as allergies and medications, past medical history, intraoperative events (anesthesia related and surgery related), postoperative plans (extubation/icu, etc.), special concerns (code status, jehovah's witness, type and screen antibodies, airway information (ie. h/o difficult intubation) and significant diagnostic studies (e.g blood lab, ekg, chest x-ray, stress tests, pulmonary function tests, etc.). for this specific handover information, the majority of providers frequently or always relayed information regarding patient allergies (89.2%), past medical history (99%), anesthesia related intraoperative events (99%), surgery related intraoperative events (91.7%), airway information (97.5%) and significant diagnostic studies (84.2%; fig. 1). however, information about medications (31.4%), postoperative plan (19.1%), code status (75.4%), information about refusal of blood (21.1%) and type and screen antibodies (49%) were either sometimes, rarely or never included during handover. from the specific list of patient handover information factors, 80.5% (165/204) of responders stated that these factors would be sufficient for an effective, complete handover. on a scale from 15, key-(1= never, 2= rarely, 3= sometimes, 4= frequently, 5= always. mdar-medical doctor of anesthesiology resident, crna- certified registered nurse anesthetist, mda-medical doctor of anesthesiology. ponv: post-operative nauseaand vommitting; mh: malignant hyperthermia; iv: intravenous. this pilot study was a qualitative rather than quantitative survey to highlight the scope of the current problem of us intraoperative handover of patient information. poor transition of patient care from the operating room has a high potential for adverse patient outcomes. our study indicates that the current intraoperatvive handover processes among anesthesia providers do not have standard uniform practices, and there may be a high proportion of insufficient patient handover practices. these findings are surprising given that the anesthesiology specialty places patient safety as one of its top objectives and that all survey respondents practiced in an academic institution. major limitations of this study were the low response rate of 216 respondents and that due to annonymous nature of this survey the number of individual academic institutitions could not be determined. additionally, there is the possibility that there was a bias towards an increased proportion of responses from anesthesia providers who had prior poor handover experiences and were unsatisified with current practice. the lack of standardized handover process has resulted in substandard patient care in us healthcare setting ,., we hope that our study will stimulate a discussion of us handover practices in the anesthesia field. increased awareness in handover practices we believe that patient handover practices should be discussed and an optimal response would be the formation of an expert consortium with the aim to develop and implement standardized protocols.

abstractcurrently, no reported studies have evaluated intraoperative handover among anesthesia providers. studies on anesthetic handover in the us recovery room setting observed that handover processes are insufficient and, in many instances, significant intraoperative events are disregarded. an online survey tool was sent to anesthesia providers at us anesthesia residency programs nationwide (120 out of the 132 us programs encompassing around 4500 residents and their academic mdas) and a smaller survey selection of crnas (10 institutions about 300 crnas in the metropolitan area of detroit, mi, usa) to collect information on handover practices. the response rate to this survey (n=216) was comprised of approximately 5% (n=71) of the resident population in us anesthesia programs, 5% (n=87) of mdas, and 20% (n=58) of the crnas. out of all respondents (n=212), 49.1% had no hand-over protocol at their institution and 88% of respondents who did have institutional handover protocols believed them insufficient for effective patient handover. in addiiton, 84.8% of all responders reported situations where there was insufficient information received during a patient handover. only 7% of the respondents reported never experiencing complications or mismanagement due to poor or incomplete hand-overs. in contrast, 60% reported rarely having complications, 31% reported sometimes having complications, and 3% reported frequent complications. in conclusion, handover transition of patient care is a vulnerable and potentially life-threatening event in the operating room. our preliminary study suggests that current intraoperatvive handover practices among anesthesia providers are suboptimal and that national patient handover guidelines are required to improve patient safety.

PMC4197389

pubmed-321

neonatal bacterial meningitis continues to be the most common serious infection of the central nervous system (cns) in newborns with high morbidity and mortality despite the availability of effective bactericidal antibiotics over the last sixty years [1, 2]. this high morbidity and mortality are due to inadequate knowledge of the pathogenesis of this disease. e. coli is the most common gram-negative bacterium causing neonatal sepsis and meningitis. bacterial meningitis in newborns is due to hematogenous spread of the pathogen to the meninges. the most important issue in the pathogenesis of e. coli meningitis is how circulating pathogens cross the blood-brain barrier (bbb), which is mainly composed of brain microvascular endothelial cells (bmecs) [3, 4]. our previous studies showed that e. coli k1 invasion of human bmec was significantly greater with stationary-phase (sp) cultures than with exponential-phase cultures, suggesting that expression of e. coli k1 invasion-associated virulence genes is strongly regulated in a growth-phase-dependent manner. a nonsense mutation in the sp regulatory gene rpos was identified in e. coli k1 strains e44 and ihe3034. complementation with the wild type e. coli k12 rpos gene significantly enhanced ihe3034 invasion of bmec, but failed to improve the invasion activity of another e. coli k1 strain e44. these studies suggest that the growth-phase-dependent invasion of bmec by ihe3034 is affected by rpos and that e44 carries a loss-of-function mutation in the rpos gene. several virulence factors, including ibe (termed after invasion of brain endothelial cells) proteins [6, 7], ompa, yiijp, fimh, asla, and traj, have been identified in various strains of e. coli in the in vitro and in vivo models of the bbb as invasins. most of those invasion genes are present in the e. coli k-12 genome [4, 16]. however, the ibea gene encoding a 50 kda protein has been found to be unique to some pathogenic e. coli k1 strains (e.g., c5 and rs218), while laboratory strains of e. coli k-12 (e.g., dh5 and hb101), as well as noninvasive e. coli (e.g., e412), lack ibea. recently, vimentin has been identified as an ibea-binding protein on the surface of human bmec. using the ibea gene as a probe, we have identified a 20.3 kb genomic locus as a genetic island of meningitic e. coli containing ibea (gima). this locus is situated between yjid and yjie, adjacent to the fim operon, and absent in nonpathogenic e. coli k12 strains. the first three operons (ptnipkc, cgldtec, gcxkrci) may be involved in energy metabolism and the last operon (iberat) contributes to e. coli k1 invasion of bmec. our previous work showed that gima-mediated invasion of human endothelial cells is regulated by carbon source. this is consistent with the observations by others that carbon source modulates expression of virulence factors in several pathogenic bacteria. ibea and ibet contribute to e. coli k1 invasion and adhesion [18, 19]. our previous studies suggest that iber is a novel regulatory protein that is present in pathogenic e. coli k1. it belongs to the ntrc/nifa family of transcriptional activators, carrying a sigma 54-interaction domain and showing significant sequence homology to various regulatory proteins for glycerol metabolism operon in citrobacter freundii (p45512), acetoacetate metabolism in e. coli k12, sigma l-dependent transcription in b. subtilis (p54529), nif-specific regulation in herbaspirillum seropedicae, dhar transcription in e. coli k12, and globe signal transduction in clostridium beijerinckii [4, 20]. however, it is unknown how iber contributes to the pathogenesis of meningitic infection by modulating the virulence of the pathogen. as e44 carries a nonsense mutation in the rpos gene and exhibits strong invasion activity in the sp, there we speculated that iber is an rpos-like regulator in sp gene expression in e44. in order to dissect the regulation of sp gene expression in e44 that is associated with the pathogenesis of e. coli meningitis, a comparative proteomic analysis of an iber deletion mutant (br2) and its parent strain e44 our studies suggested that the iber gene was involved in regulating sp gene expression related to stress resistance and pathogenesis. the bacterial strain and plasmid vectors and their relevant characteristics are shown in table 1. the mutant strains used in this study were derived from e44, which is a rifampin-resistant strain derived from a neonatal meningitis isolate, e. coli k1 rs218 (o18: k1: h7) [4, 21]. sm10 (pir), dh5 (pir), and pcvd442 were used for making isogenic deletion mutants of iber and tnaa [6, 10, 11]. e. coli k12 strain mc4100 and its rpos insertion mutation tn10 mutant rh90 were used as positive and negative controls for rpos, respectively. plasmid pstyabb, which carries the gene for monooxygenase, was used for indole assay. e. coli strains were grown at 37c in luria broth (lb; 1% tryptone, 0.5% yeast extract, 0.5% nacl) or brain heart infusion (bhi, difco laboratories, detroit, mich, usa) broth and were stored at 70c in lb plus 20% glycerol. when it was necessary, the medium was supplemented with ampicillin (100 g/ml) and rifampin (100 g/ml) for the positive selection of plasmids or bacterial strains (table 1). all genetic manipulations were done by using standard methods, as described elsewhere. plasmid dna was extracted by using a plasmid mini kit (qiagen, calif, usa). dna fragments were purified and were extracted from agarose gel slices, using qiaquick gel extraction kit (qiagen). competent e. coli cells were made in 10% glycerol and were transformed by electroporation as described previously [6, 7]. to determine the role of the iber gene in the growth-phase-dependent e. coli k1 invasion of bmec, an isogenic deletion mutant of iber two pcr dna fragments, b (1.2 kb) and r (1.0 kb), flanking a 1.8-kb region to be deleted were produced from two pairs of primers (iber-s1/iber-b1 for b and iber-b2/iber-x2 for r, see table 2). the two fragments were ligated to make a 2.2 kb fragment (br) that carries an iber internal deletion. the br fragment was subcloned between sali and xbai sites on pcvd442, and the resulting recombinant plasmid was named pcbr2. the mutants named br2 were obtained by mating e44 with sm10 pir that carries pcbr2 as described previously. we used pcr and dna sequencing to confirm the internal deletion in the iber deletion mutant br2 and the desired chromosomal gene iber of the mutant with primers iber-s1 and iber-x2 (table 2). amplification was done by using the following cycle profile: 35 cycles at 94c for 1 minute, 58c for 1 minute, and 70c for 1.5 minutes. for the tnaa in-frame deletion briefly, 2 pcr dna fragments, ftn5 (1.0-kb) and ftn3 (1.4-kb), were made to flank a 1.3 kb region containing tnaa to be deleted, by using 2 primer pairs (tn-s1/tn-b1 for ftn5 and tn-b2/tn-x2 for ftn3, see table 2). then the two fragments were ligated to make a 2.4 kb fragment (ftn53) that carried a tnaa internal deletion. the ftn53 fragment was subcloned into pcvd442 between sali and xbai sites to get the suicide plasmid pctna2. to get the tnaa in-frame deletion mutant, tna44, conjugation and screening were carried out as described above. the tnaa gene deletion in the mutant tna44 was confirmed by pcr using the primers tn-s1 and tn-x2 (table 2). human bmecs were routinely cultured in rpmi 1640 medium (mediatech, herndon, va, usa) containing 10% heat inactivated fetal bovine serum, 10% nu-serum, 2 mm glutamine, 1 mm sodium pyruvate, essential amino acids, vitamins, penicillin g (50 g/ml), and streptomycin (100 g/ml) at 37c in 5% co2. the number of intracellular bacteria was determined on blood agar plates after the extracellular bacteria were killed by incubation of the monolayers with experimental medium containing gentamicin (100 g/ml) for 1 hour. results were expressed as percent invasion (100 (number of intracellular bacteria recovered)/(number of bacteria inoculated)). briefly, e. coli strain e44 and the iber deletion mutant br2 were cultured in bhi medium overnight without agitation. the bacterial cells were harvested at the stationary-phase (od=2.53.0) by centrifugation at 6000 g for 10 minutes. denaturing protein extraction (phenol extraction procedure) was performed according to saravanan and rose. the lyophilized pellets were dissolved in rehydration buffer (7 m urea, 2 m thiourea, 4% chaps, 0.2% ph 310 biolytes, 1% dtt; 1 mg dry pellets for 200 l buffer) and shaken on vortex for 1 hour at room temperature. the first and second dimensions of the page were performed at least in triplicate (to reduce the likelihood of differences based solely upon gel-to-gel variability) according to the standard protocols developed and defined by bio-rad. solubilized total e. coli protein samples (200 l each) were loaded on 11 cm immobilized ph gradient (ipg) strips (ph 47). rehydration/loading was done passively (no voltage) for 1 hour, followed immediately by 14 hours of active rehydration (50 v) at 20c. isoelectric focusing of the ipg strips was performed at 20c using a 50 a current limit per strip to prevent damage to the strip and the instrument. electrophoresis was carried out as follows: step 1, 250 v for 20 minutes; step 2, a rapid ramp to 8000 v; step 3, focusing at 8000 v for 55 000 vhr; step 4, hold at 400 v. due to latent ionic components in the sample the actual running voltage was only approximately 6500 v. after the first dimensional run was completed, the ipg strips were equilibrated in buffer i (6 m urea, 0.375 m tris-hcl ph 8.8, 2% sds, 20% glycerol, and 2%dtt) for 15 minutes and then in buffer ii (6 m urea, 0.375 m tris-hcl ph 8.8, 2% sds, 20% glycerol, and 2%dtt) for additional 15 minutes. the second dimension sds-page was performed with 15% resolving gels and 5% stacking gels (160 180 0.5 mm). the 2de gels were scanned at a 200 bpi resolution with typhoon scanner (amersham biosciences, nj, usa), and analyzed with imagemaster 2d platinum version 6.0 (ge healthcare bio-science, nj, usa). only those protein spots having differences in density of 1.5-fold or greater between the groups were chosen. moreover, all protein spots selected for analysis were shown to have significant difference in protein density (mean sem, p<.01) by software of spss 10.0. protein bands were excised from preparative coomassie blue-stained gels and washed several times with destaining solutions (25 mm nh4hco3 for 15 minutes and then with 50% acetonitrile containing 25 mm nh4hco3 for 15 minutes). gel pieces were then dehydrated with 100% acetonitrile, dried, and then incubated with a reducing solution (25 mm nh4hco3 containing 10 mm dithiothreitol) for 1 hour at 56c and subsequently with an alkylating solution (25 mm nh4hco3 containing 55 mm iodoacetamide) for 45 minutes at room temperature. after reduction and alkylation, gels were washed several times with the destaining solutions and finally with pure water for 15 minutes before being treated again with 100% acetonitrile. depending on the protein content, 2-3 l of 0.1 g/l modified trypsin (promega, wiss, usa, sequencing grade) in 25 mm nh4hco3 was added over the gel spots and incubated for 30 minutes. about 710 l of 25 mm nh4hco3 was then added to cover the gel spots and incubated at 37c overnight. the in-gel digestion products were extracted with formic acid/acetonitrile solutions followed by evaporation. samples were desalted using mziptip c18 pipette tips (millipore, mass, usa) before ms/ms analysis. the sample was resuspended in 10 l of 0.1% formic acid, injected via an autosampler (surveyor, thermofinnigan, calif, usa) and subjected to reverse phase liquid chromatography using thermofinnigan surveyor ms-pump in conjunction with a biobasic 18 100 0.18 mm reverse-phase capillary column (thermofinnigan, calif, usa). mass analysis was done using a thermofinnigan lcq deca xp plus ion trap mass spectrometer equipped with a nanospray ion source (thermofinnigan, calif, usa) employing a 4 cm metal emitter (proxeon, odense, denmark). spray voltage of the mass spectrometer was set to 2.9 kv and capillary temperature was set at 190c. the column equilibrated for 5 minutes at 1.5 l/min with 95% solution a and 5% solution b (a, 0.1% formic acid in water; b, 0.1% formic acid in acetonitrile) followed by a linear gradient was initiated 5 minutes after sample injection ramping to 65% solution a over 45 minutes. solution a was increased to 80% over the subsequent 5 minutes and held at 80% for 5 minutes, after which the column was reequilibrated back to 5% solution a (aqueous). a data-dependent acquisition mode was used where each of the top five ions for a given scan was subjected to ms/ms analysis. the protein identification was conducted with the ms/ms search software mascot 1.9 with confirmatory or complementary analyses using turbosequest as implemented in the bioworks 3.2. e. coli genome sequences at the national center for biotechnology information (ncbi) were used as the primary search databases and searches were complemented with the ncbi nonredundant protein database. for determination of indole production, we followed the method of indole conversion into indigo as described previously [12, 27], with minor modifications. all strains e44, br2, tna44, mg1655, and rh90 were transformed with the pstyabb plasmid, which constitutively expresses the styab protein converting indole to indigo. the bacteria were incubated in m9 medium containing 0.4% glucose and 100 g/ml ampicillin overnight with shaking. then the bacteria were collected by centrifugation and resuspended to od600=0.2 in bhi medium supplied with 100 g/ml ampicillin, and incubated at 37c without shaking. to determine the indigo formation at different time points, the samples were read at 600 nm to determine the indigo concentration by comparison to a standard curve. bacteria were grown in bhi broth at 37c overnight without shaking, and collected by centrifugation. the number of cells was measured on the basis of their od at 600 nm. bacteria were suspended and diluted to 10 cells/ml in pbs for the following assays. for heat shock, 100 l of bacteria was heated at 54c for 3 minutes. for alkali endurance, the bacterial suspension was mixed with equal volume of tris buffer (1 m, ph=10.0) and 8 volumes of water (final concentration, 100 mm, ph 10.0) and incubated at 37c for 30 minutes. for acid endurance, 1/10 volume of the bacterial suspension was mixed with lb containing acetic acid (final concentration, 90 mm, ph 2.8) and incubated at 37c for 20 minutes. for high osmolarity challenge, bacteria were mixed with an equal volume of 4.8 m nacl (final concentration, 2.4 m) and incubated at 37c for 1 hour. for oxidative stress, bacteria were harvested and resuspended in an equal volume of pbs containing 10 m h2o2 incubated at 37c for 30 minutes. after exposure to these stresses, bacteria were diluted in 0.9% saline and plated in duplicate on lb agar plates. the surviving rate with stress was calculated from the ratio of the bacterial number under stress condition to the bacteria number under nonstress condition. the surviving rate without stress was calculated from the bacteria number grown on plates. the gene iber in e. coli k1 e44 is predicted as the only regulatory protein present in the iberat operon in gima by bioinformatics approaches. to determine the role of iber gene in the growth-phase-dependent invasion of bmec by meningitic e. coli k1, an isogenic in-frame deletion mutant of iber was made by chromosomal gene replacement with the recombinant suicide plasmid pcbr2 carrying a 2.2 kb dna fragment with iber internal deletion (figure 1(a)). the 2.2 kb dna fragment was generated by ligation of two pcr amplicons (1.2 and 1.0 kbs) flanking the 1.8 kb iber coding region. the iber deletion mutant was obtained by mating e44 with sm10 pir carrying pcbr2. the mutant colony morphology on lb agar plates and growth rate in lb broth were the same as the parent strain e44. the deletion of iber was confirmed by colony pcr and dna sequencing (figure 1(b)). in order to examine the virulence phenotype of the iber deletion mutant, a comparative study of the invasiveness of e44 (parent strain), br2, and the complemented br2 was carried out. as shown in figure 1(c), the relative invasion rate of br2 was significantly reduced as compared to that of e44 and the plasmid pwks1030 carrying the iber gene was able to complement the noninvasive phenotype of br2, suggesting that the iber gene contributes to the e. coli e44 invasion process. to determine the role of iber in regulating sp gene expressionof meningitic e. coli k1, the wild type e. coli e44 and its iber deletion mutant br2 were cultured in bhi broth overnight. the total proteins of each strain were extracted from the cells as described in section 2. the experiment was performed three times with two sets of independently grown cultures. only spots showing the same pattern in three independent runs were retained and quantified using the software imagemaster 2d platinum version 6.0. figures 2(a) and 2(b) showed the protein patterns of e44 and br2, respectively. all the upregulated spots and downregulated spots satisfying the criteria as mentioned above were marked on both the 2d maps. they were excised and identified by lc-ms/ms (table 3). eight protein spots were found to be differentially expressed in br2 as compared to its parent strain e44. among them, 4 protein spots were significantly upregulated in br2 including elongation factor ef-tu (tufb, spot u1), glyceraldehyde-3-phosphate dehydrogenase a (gapa, spot u2), outer membrane protein 3a (ompa, spot u3), and alkyl hydroperoxide reductase (ahpc, spot u4), while 4 protein spots were of decreased abundance in br2, including dihydrolipoamide dehydrogenase (lpda, spot d1), tryptophanase (tnaa, spot d2), and two isoforms of outer membrane protein c (ompc, spot d3, and d4). figure 3(a) showed the enlargements of each changed protein marked with black arrows and spot numbers. the relative ratios of each downregulated protein and upregulated protein were shown in figures 3(b) and 3(c). we classified the proteins into two main categories on the basis of their roles in the sp growth of e. coli cells: (a) response to environmental modifications (including tnaa, tufb, ompc, ompa, and ahpc) and (b) central metabolism (including lpda and gapa). since iber was hypothesized as an sp-regulator contributing to the growth regulation and virulence of e44, its role in the invasion process and resistance to stress conditions should be further characterized. tnaa, a tryptophanase, degrades tryptophan, resulting in the formation of indole, which has been proposed to act as an extracellular signal in stationary phase cells of e. coli [28, 29]. production of indole, via the enzymatic activity of tnaa, is also induced during biofilm formation. tnaa, which was controlled by rpos in other e. coli strains, is one of the most important transcriptional regulators for the gene expressions in sp cells. tufb (ef-tu) is responsible for binding and transporting the appropriate codon-specified aminoacyl-trna to the aminoacyl (a) site of the ribosome [32, 33]. in addition to its function in translation elongation, elongation factor tu is implicated in protein folding and protection from stress like a chaperone molecule. ompc, as well as ompf, is a porin protein present on the outer membrane of e. coli, responding to the osmotic challenge. ompr, as a regulator, activates transcription of ompf and ompc, and changes the ratio of these two, so that the total level of porin proteins remains approximately constant [36, 37]. ompf, which produces slightly wider pores (1.2 nm) than does ompc, predominates at low osmotic strength, whereas ompc (1.1 nm) predominates at high osmotic strength. in e. coli, the expression of ompc it has been proposed that the smaller pores formed by ompc could reduce the diffusion of larger hydrophobic and negatively charged molecules when bacteria encounter high osmolarity conditions as in the host compartments. presumably, this protein is very important for the stress resistance of e. coli in the stationary phase. in this study, the downregulation of ompc resulting from the iber deletion might decrease resistance to high osmolarity. in addition, it had been reported that ompc is involved in invasion of epithelial cells by crohn's disease-associated e. coli strain lf82 and shigella flexneri [39, 40], suggesting that ompc might be involved in e44 invasion of the host tissue barriers. ompa is a major protein in the outer membrane of both pathogenic and nonpathogenic e. coli . as shown in our previous study, the ompa-deletion mutant of e44 was significantly more sensitive than that of its parent strain to sds, cholate, acidic environment, and high osmolarity. ompa is downregulated upon entry into sp by sigmae, which plays a central role in maintaining cell envelope integrity both under stress conditions and during normal growth [42, 43]. we demonstrated here that ompa was upregulated in the iber mutant br2 (figure 3), suggesting that ompa expression is suppressed upon entry into sp by iber in a manner similar to sigmae. alkyl hydroperoxidase (ahpc) functions as a primary scavenger of endogenous h2o2 at a low (10 m) concentration. all of ahpc, katg, and kate genes are known to participate in the antioxidant defense mechanism against h2o2-induced stress in e. coli. it has been reported that sp-inducible rpos regulates kate gene expression and oxyr regulates ahpc and katg genes [45, 46]. our previous study has demonstrated that e. coli k1 rs218 had a nonsense mutation in its rpos gene, resulting in a negligible kate activity, but no obvious difference in katg. in this study, the increase in ahpc expression indicated that the iber deletion led to an increased oxidative stress in sp compared with the wild type strain, suggesting that iber is involved in the resistance to oxidative stress upon entry into sp. lipoamide dehydrogenase (lpda), which is the same as dihydrolipoamide dehydrogenase (dldh), makes up the e3 component of pyruvate dehydrogenase complex, 2-oxo glutarate dehydrogenase, and branched-chain 2-oxo acid dehydrogenase complexes. dldh has been identified as virulence factors contributing to the pathogenesis of bacterial infections caused by mycobacterium tuberculosis and streptococcus pneumoniae because it enhances their survival within the host cells [47, 48]. as shown in figure 3, lpda was downregulated in the iber deletion mutant br2, suggesting that this enzyme might be involved in the virulence of meningitic e. coli k1 via enhancing the pathogen survival within the host. recently, gapa in e. coli has been identified as one of a few proteins, which harbors functionally important thiol groups against oxidative stress. as gapa is upregulated in br2 (figure 3), iber may be involved in the negative control of gapa in sp. in summary, all these proteins contribute to growth-related carbon source metabolism or stress resistance. they are associated with the sp regulation. among these proteins, tnaa is the most important one as it produces the signal molecule indole and is regulated by rpos. since e44 carries a loss-of-function mutation in its rpos gene, there should be alternative signaling pathway(s) to complement the functional deficiency of rpos in this pathogenic e. coli strain. our proteomic analyses showed that the tnaa expression was significantly affected by iber, which might be functionally equivalent to rpos. therefore, our focus for further studies was placed on how tnaa is regulated by iber. to test our hypothesis that iber is an rpos-like regulator, the tnaa in-frame deletion mutant tna44 was generated with the same gene replacement approach that was used for the iber deletion mutant. tna44 was obtained by mating e44 with sm10 pir carrying the recombinant suicide plasmid pctna2 which contains the truncated tnaa gene. although overall growth rates did not differ between the mutants (br2 and tna44) and their parent strain e44 (figure 4(a)), the invasive capability of tna44 (19%) and br2 (35%) was significantly reduced as compared to that of e44 (100%) (figures 4(c)-4(d)). these data suggest that tnaa is an important downstream regulator that is required foriber-modulated e. coli k1 invasion. as our proteomics analysis had shown that tnaa expression was induced by iber in sp and the tnaa and iber deletion resulted in a deficiency in indole production in sp-cultures (figure 4(b)), we further tested whether the tnaa product indole, as an sp extracellular signal molecule, played a role in the process of invasion. indole is converted to indigo (which is not further degraded in e. coli) by several monooxygenases, thus providing an easy method for its determination. a plasmid pstyabb, carrying the gene for styrene monooxygenase, was used to monitor the indole production through its conversion to indigo. the plasmid was transformed into e. coli strains e44, br2, and tna44, and the indole production was measured at different time points for these stains in bhi media (figure 4(b)). by contrast, the indole production was almost abolished in the tnaa deletion mutant and severely reduced in the iber deletion mutant (figure 4(b)). these results demonstrated that the indole production was controlled by iber through tnaa. to examine whether indole could compliment the noninvasive phenotype of tnaa and iber deletion mutants, indole was supplied in the bhi medium at 100 m to the tna44 and br2 sp cultures. the result showed that indole was able to significantly enhance the relative invasion rate of tna44 (19% to 69%) and br2 (35% to 65%) as compared to that of e44, suggesting that indole could partly compliment the noninvasive phenotype of tna44 (figure 4(c)) and br2 (figure 4(d)). lacour and landini have shown that the rpos gene in e. coli k12 strain mg1655 controls the production of indole, which acts as a signal molecule in sp cells, via regulation of tnaa, the indole-producing enzyme. as tnaa is regulated by iber in e44, it is most likely that iber is a novel regulator to complement the functional deficiency of rpos in e44. it has been reported that rpos is able to positively and negatively control expression of a large set of genes when bacteria enter into the sp [46, 50, 51]. during such transition, bacteria undergo physiological changes that allow their sp organisms to survive better in such insults as heat, high-osmotic environment, starvation, uv radiation, h2o2, and acid than their exponential counterpart [50, 52]. the loss of rpos resulted in the decrease of stress resistance and cell survival in the sp [5, 53]. although our study showed that the loss of iber did not affect the growth rate in bhi medium, the survival rates of the iber deletion mutant br2 in the sp significantly decreased as compared to that of the wild type strain e44 even without any stress treatment (figure 5(a)). our proteomics analysis also revealed that the most significant proteomic changes in the iber deletion mutant were related to bacterial response to environmental modifications. for example, ahpc, as a primary scavenger of endogenous h2o2, was upregulated in the iber deletion mutant, implying that the loss of iber resulted in the decreased survival rates of bacterial cells under an oxidative stress in the sp. ompc, as a porin protein, was downregulated in br2, perhaps resulting in the decreased resistance to osmolarity stress. these results suggested that iber plays a regulatory role in response to stress conditions in e44 that carries a nonsense mutation in rpos. to examine the function of iber in response to stress environments, we performed several survival assays under different stress conditions, including heat shock (54c for 3 minutes), alkali endurance (tris, ph=10 for 30 minutes), acid endurance (acetic acid, ph=2.8 for 20 minutes), high osmolarity challenge (2.5 m nacl for 1 hour), and oxidative stress (10 m h2o2 for 30 minutes). in all the survival experiments, the wild type strain e44 showed higher survival rates than the iber deletion mutant, indicating that the iber gene is required for all these stress resistances (figure 5(b)). especially in the heat shock assay, the loss of iber resulted in over 95% cells death, indicating that iber played a vital role in temperature sensitivity in this strain. in the other stress treatments, the iber deletion also significantly reduced the survival rates (more than 60% cell death) of br2 as compared to that of the wild type strain e44, suggesting that iber had a global regulatory role in the resistance to acid, alkali, high osmolarity and oxidative stress. in the survival assays for the e. coli control strain mg1655, the rpos deletion mutant rh90 also decreased the survival levels in these five stress conditions, showing the similar patterns like iber in response to stress environments (data not shown). combining the proteomics analysis and the stress survival studies, we conclude that iber is an rpos-like regulator to control gene expression of proteins that are critical for stress-resistance and cell survival in the sp in e44, which carries a loss-of-function mutation in the rpos gene. currently, most e. coli meningitis studies are done with sp cultures in which the pathogen invasion of human bmec is significantly greater than the log phase cultures. in most strains of e. coli, rpos plays a central role in regulating the sp regulatory genes for protecting cells against starvation and stress damage. rpos, the major sp regulator, has also been shown to regulate the expression of microbial virulence genes in various bacteria including e. coli k1 (o157: h7), salmonella typhimurium, shigella flexneri, yersinia enterocolitica, vibrio cholera, and borrelia burgdorfer, [5, 53, 54]. surprisingly, however, rpos was found to be inactive in meningitic strain e44. the current proteomic studies may provide an answer to the long-standing question regarding the sp gene regulation in e44. combining the proteomics analysis, virulence determination, and the stress survival studies of the iber mutant br2, we have demonstrated for the first time that iber serves as an rpos-like regulator to control gene expression that is critical for stress-resistance and cell survival in the sp of e44. iber is not a structural homologue of rpos as iber and rpos do not share any significant sequence homology. rpos (also known as,, or katf) is a global regulator in e. coli, which is the second principal subunit after the major factor. in e44, however, iber appears not to be a master regulator on the basis of its genomic prevalence and functional spectrum. the prevalence of the gimalocus carrying iber is highly dependent on the origin of the strain and on the subgroup it belongs to (a, b1, b2, and d) (4). in all the studies, where the presence of this locushas been analyzed, gima was found to be restricted to the b2 subgroup, a subgroup that includes strains with the highest virulence in mice and the highest level of virulence determinants (4). our proteomic studies showed that a limited number of genes were regulated by iber, suggesting that iber is a regulator with a narrow functional spectrum. in other e. coli strains, either pathogenic or probiotic strains, functional heterogeneity of rpos in stress tolerance was widely observed [5, 53, 55]. those studies have shown that some e. coli strains can maintain their stress tolerance capability or significantly modulate their stress resistance phenotype independent of their rpos genotypes. such adaptation processes compromising the rpos-dependent stress responses may have significant impact on bacterial survival in environments, as well as in the host's stomach and intestine [53, 55]. iber, a regulator in the gima regulon, may contribute to bacterial virulence adaptation process in e44 to complement the functional deficiency of rpos. another significant finding of our proteomic studies is that iber in meningitic strain e44 is able to upregulate tnaa, which is controlled by rpos in other e. coli strains. the virulence determination of the tnaa mutant showed that tnaa and its product indole were required for e44 invasion of human bmec. the generation of indole, via the tryptophanase activity of tnaa, was also observed during the formation of biofilm in e. coli and other bacteria [28, 56]. in addition to the initiation of indole-mediated signaling, tnaa (tryptophanase) is able to catabolize tryptophan, cysteine, and serine to pyruvate [29, 56]. the three proteins significantly upregulated by iber are tnaa, lpda, and ompc, all of which are directly or indirectly involved in pyruvate metabolism. ompc, an osmotically regulated porin, may facilitate nutrient uptake. on the other hand, the three operons (ptnipkc, cgldtec, and gcxkrci) in the gima regulon may also directly or indirectly contribute to pyruvate metabolism by converting dihydroxyacetone, glycerol, and glycerate to pyruvate. it has been shown that the capability to catabolize carbon source is an important parameter in the ability to persist and compete in stationary phase. this raises the possibility that signaling by indole, which is regulated by iber via tnaa, may play a critical role in the pathways that prepare the pathogens for a nutrient-poor environment (e.g., cns) when the carbon source becomes limited for energy production .

iber is a regulator present in meningitic escherichia coli strain e44 that carries a loss-of-function mutation in the stationary-phase (sp) regulatory gene rpos. in order to determine whether iber is an sp regulator in e44, two-dimensional gel electrophoresis and lc-ms were used to compare the proteomes of a noninvasive iber deletion mutant br2 and its parent strain e44 in the sp. four up-regulated (tufb, gapa, ompa, ahpc) and three down-regulated (lpda, tnaa, opmc) proteins in br2 were identified when compared to e44. all these proteins contribute to energy metabolism or stress resistance, which is related to sp regulation. one of the down-regulated proteins, tryptophanase (tnaa), which is regulated by rpos in other e. coli strains, is associated with sp regulation via production of a signal molecule indole. our studies demonstrated that tnaa was required for e44 invasion, and that indole was able to restore the noninvasive phenotype of the tnaa mutant. the production of indole was significantly reduced in br2, indicating that iber is required for the indole production via tnaa. survival studies under different stress conditions indicated that iber contributed to bacteria stress resistance in the sp. taken together, iber is a novel regulator contributing to the sp regulation.

PMC2655632

pubmed-322

dermatomyositis (dm) is an uncommon idiopathic inflammatory myopathy that primarily affects skeletal muscle and skin with well-characterized cutaneous findings. it has been well documented that dm carries an increased risk of malignancy and can present as a paraneoplastic syndrome to multiple types of underlying malignancies [3, 4]. however, 1530% of cases of dm are manifestations of paraneoplastic syndromes of an underlying malignancy. here, we present a case of concurrent dm and breast cancer to highlight a rare presentation, progression and regression of symptoms, as well as key components of diagnosis and treatment. the patient is a 47-year-old polish premenopausal female who presented with complaints of a non-tender palpable left breast mass for 4 months at an outside institution. she underwent a diagnostic mammogram and ultrasound that reported a 2-cm irregular, hypoechoic mass at 12 o'clock. there was a 2.2-cm enhancing mass in the left breast at 12:00 that was consistent with the patient's biopsy-proven malignancy (fig., she underwent a core needle biopsy, which revealed a poorly differentiated triple-negative invasive ductal carcinoma (fig. there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple. there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient's biopsy-proven malignancy. high power view of the left breast core biopsy (b). left breast ultrasound. there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple. the circled area revealed a 2-cm irregular mass with biopsy clip noted. left breast on mri. there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient's biopsy-proven malignancy. two weeks after the biopsy, she complained of new onset pruritic, erythematous rash on her anterior chest, face and back of the hands (fig. she was complaining of diffuse myalgias, worse during menstruation. owing to her worsening symptoms which included cuticular hypertrophy of the hands with associated erythema over the metacarpophalangeal and proximal interphalangeal joints bilaterally (fig. 5c), she was transferred to the bellevue hospital breast clinic and referred to the rheumatology clinic for management of her symptoms. initial laboratories revealed moderately elevated laboratory values (table 1). at this time, she was presumptively diagnosed with paraneoplastic dm secondary to invasive ductal carcinoma of the left breast and treated with 20 mg prednisone daily. her persistent and slowly progressing symptoms despite aggressive treatments prompted our decision to proceed with surgical intervention in hopes of preventing progression of her musculoskeletal manifestations. postoperatively, she experienced rapid improvement in both cutaneous and musculoskeletal manifestations with visible clearing of her rash and return of her strength. she was maintained on prednisone with excellent symptomatic control. on her 6-month visit, we noted resolution of most of her rash, periorbital edema as well as myalgias and muscle weakness (fig. table 1laboratory values prior to the surgery, 3 weeks postoperatively and 6 weeks postoperatively.preop3 weeks postop6 weeks postopwhite blood cell (10)9.312.67.8creatine kinase (u/l)2183302160aldolase (u/l)17.45.3myoglobin247ast (u/l)1177744alt (u/l)539130 figure 5:image of patient with facial rash and periorbital edema that initially developed during her workup (a). images of the worsening rash on her chest and hands that initially developed during her workup (b and c). image of patient with facial rash and periorbital edema that initially developed during her workup (a). images of the worsening rash on her chest and hands that initially developed during her workup (b and c). dm typically presents with progressive, symmetrical, proximal muscle weakness and characteristic skin lesions such as helitrope rash, gottron's papules, gottron's sign, the v-sign and shawl sign. additional cutaneous manifestations that have become more commonly recognized include vasculopathic changes (i.e. telangiectasias and livedo reticularis), cuticular overgrowth (mechanic's hands) and poikiloderma. initial presentation follows a bimodal distribution between ages 515 and 4564 and tends to progress over a 3- to 6-month period before the patient will seek medical attention. contrary to this typical presentation, the above patient experienced rapid progression of symptoms over a much shorter period and predominately reported skin manifestations with subsequent rapid development of muscular deterioration. the diagnosis and classification of dm commonly follows the criteria set forth by bohan and peter in 1975 (table 2) [1, 2]. initial evaluation for suspected dm should include such investigations as serum creatine kinase, aldolase, aspartate aminotransferase, alanine aminotransferase and/or lactate dehydrogenase. serum creatine kinase is the most sensitive muscle enzyme in the acute phase of the disease as it is released in the serum during muscle damage. serum inflammatory markers (e.g. erythrocyte sedimentation rate and c-reactive protein) may also be elevated during the active phase of the disease. table 2bohan and peter criteria for diagnosis of dermatomyositis.individual criteria symmetric proximal muscle weaknessmuscle biopsy evidence of myositisincrease in serum skeletal muscle enzymescharacteristic electromyographic patternstypical rash of dermatomyositisdiagnostic criteria definitive5 plus any three of 14probably5 plus any two of 14possible5 plus any one of 14 bohan and peter criteria for diagnosis of dermatomyositis. symmetric proximal muscle weakness muscle biopsy evidence of myositis increase in serum skeletal muscle enzymes characteristic electromyographic patterns typical rash of dermatomyositis definitive5 plus any three of 14 probably5 plus any two of 14 possible5 plus any one of 14 previous studies have shown that up to 30% of dm patients had underlying malignancies [6, 7]. malignancies in dm patients have been found to be highest in those over 45 years of age, commonly diagnosed within the first year of initial presentation, and most strongly associated with lung, ovarian, gastric, pancreatic and colorectal origin. malignancy can precede, occur concurrently or develop after the diagnosis of dm. in our patient, the symptoms of dm occurred 2 weeks following her diagnosis of breast cancer. the goals of therapy in patients with dm are to improve the patient's ability to carry out activities of daily living by increasing muscle strength and improving myalgias as well as treating the extramuscular manifestations (including rash and arthralgias). there has been report of variable influence of the treatment of the underlying malignancy on the clinical course of the dm [9, 10]. in our patient, the complete surgical excision of the underlying breast cancer resulted in dramatic improvement in both her cutaneous manifestations and her musculosckeletal symptoms. given the high frequency of malignancy in patients with a diagnosis of dm, any woman over the age of 45 with newly diagnosed dm should prompt a thorough physical examination, including a breast examination, as well as further workup for other malignancies (e.g. ovarian or colorectal cancer). early diagnosis of dm as a paraneoplastic syndrome allows for initiation of systemic therapy for symptom control and also treatment of the underlying malignancy itself, which may aid in control of the dm symptoms.

breast cancer is the most common cancer in women in the usa, with the lifetime incidence of 1 in 8 women. dermatomyositis (dm) is an uncommon idiopathic inflammatory myopathy that can manifest as a paraneoplastic syndrome of an underlying malignancy. here, we report a case of a patient who presented with breast cancer and dm symptoms. the patient's rash and muscle weakness progressed during the workup of her breast cancer, while she was already started on medical treatment of these symptoms with oral prednisone. her cutaneous and musculoskeletal improved dramatically following the treatment of her breast cancer. our case report describes the rapid progression and regression of her symptoms emphasizing the benefit of early diagnosis and treatment of dm as well as the underlying breast cancer.

PMC4495251

pubmed-323

the comingling of swine from numerous premises with varied management practices and their interaction with large numbers of exhibitors and visitors make agricultural fairs an ideal setting for the intra- and inter-species transmission of influenza a viruses (iavs) between swine and human populations. the frequency with which intra- and inter-species iav transmission occurs in these settings is likely due to a myriad of factors, including but not limited to, management practices, iav strain, and animal and/or human population immunity. swine is a host species in which reassortment of iav genomic segments may lead to emergent novel strains, since they are susceptible to infection from swine, human and avian influenza a viruses. for this reason, limiting the bidirectional zoonotic transmission of these viruses at agricultural fairs is important for public and animal health. the association between human and swine influenza was reported after respiratory disease similar to the human disease was noted in pigs during the 1918 human spanish flu pandemic. iav subsequently became established in the united states swine population with the relatedness of the swine and human viruses being established in 1931. for nearly 80 years, classical swine influenza h1n1 virus was the dominant endemic iav strain in the north america swine population. in 1998, triple reassortant h3n2 iavs containing polymerase basic 1 (pb1), hemagglutinin (ha) and neuraminidase (na) gene segments from human iav lineages, polymerase basic 2 (pb2) and polymerase acidic (pa) genes from avian lineages, and nucleoprotein (np), matrix (m) and non-structural (ns) gene segments from swine lineages, emerged in north american swine. subsequently, this lineage became established in us and canadian swine herds and has resulted in an increased rate of genetic and antigenic change among swine-origin iavs. reported cases of humans contracting iav infections directly or indirectly from pigs have been historically sporadic and these variant iavs showed limited capability for sustained human-to-human transmission. however, the emergence of the influenza a(h1n1)pdm09 virus, a strain containing gene segments from north american and european swine lineages, illustrated the pandemic potential of swine lineage iavs crossing the species barrier to humans. while a(h1n1)pdm09 rapidly spread worldwide and became endemic in the human population, sequencing of this virus has to date failed to elucidate any virulence or adaptation markers that would explain its human-to-human transmission efficiency, highlighting our inability to predict iavs with pandemic potential. while the origin of the a(h1n1)pdm09 virus remains unknown, the virus was introduced into the north american swine population in 2009 and has since reassorted with other swine-origin iavs. epidemiological data show that zoonotic transmission of iav from swine to humans has been documented at unprecedented levels in recent years. more than 320 human cases of infection with variant iavs were reported to the centers for disease control 20112012 and likely thousands more h3n2v cases went unreported during those years. these zoonotic iavs contained seven genes from contemporary north american swine lineage iav and one gene (m) derived from the h1n1pdm09 virus. the majority of the cases were epidemiologically linked to swine exposure occurring at agricultural fairs across several states. within ohio, 107 h3n2v cases documented during 2012 resulted in eleven hospitalizations and one fatality. we recovered iav from exhibition swine at 10 of 40 (25%) ohio fairs sampled during 2012. genomic analyses of h3n2 iav isolates recovered from pigs at one agricultural fair in the state during 2012 demonstrated>99% nucleotide similarity to h3n2v isolates recovered from concurrent human cases, providing molecular confirmation of zoonotic iav transmission. this record number of variant influenza a cases created the need for a one health ' effort to minimize intra- and bidirectional inter-species iav transmission at swine exhibitions. the reason to prevent iav infections among swine at fairs is clear; however, the paucity of scientific evidence makes it difficult for veterinary officials to make sound recommendations to protect public and animal health. in the present study, we investigate fair specific risk factors contributing to the emergence of influenza a virus in exhibition swine that could be altered to mitigate the risk of iav transmission in these settings. as part of an ongoing active iav surveillance project, swine nasal swabs and associated metadata about management practices were collected at 40 ohio fairs in 2012. sample size was selected to provide a 95% probability of detecting iav infection if greater than 15% of the pigs at each fair were infected. all pigs sampled in this study were from junior fair market swine shows occurring at agricultural fairs. for the outcome of interest, a fair was considered positive if viable iav was recovered from one or more pigs at the fair. data collection focused on fair level variables possibly contributing to the presence or absence of iav in the pigs at each exhibition. junior fair shows are limited to local exhibitors approximately nine years of age through 19 years of age participating in 4-h, ffa or another youth organization, whereas open-class shows are generally open to all participants regardless of age, affiliation or residence. classification of swine included market swine (pigs bred, raised and intended for food purposes) and breeding swine (gilts, sows and/or boars being raised for breeding purposes). terminal swine shows are those in which all participating livestock are consigned to harvest immediately following the exhibition and partial terminal shows usually require the champion animals to be harvested following the exhibition and other pigs may or may not go to harvest. to account for the variability of arrival and departure procedures among fairs enrolled in this study, the length of the swine exhibition was defined as the number of days between the required arrival deadline for the pigs and the day the pigs were sampled. study team members calculated the area per pig (ft/pig) from the recorded size of the pens and the number of pigs per pen. while on the fairgrounds, study team members also documented if there was an easily identifiable and operational hand-wash and/or hand-sanitizer station within close proximity to the swine barn(s). these sanitation stations were used by study team members to determine if they were functional. additional variables included the number of pigs at the fair, number of swine exhibitors, fair attendance (number of people) and vaccine requirements, all of which were reported to the study team by the fair organizers. fair officials also reported if there was a commingling event, such as a pre-fair animal identification or weighing session, during the weeks or months prior to the fair. exhibition directors also reported if there were other pigs besides the exhibition swine on the fairgrounds (i.e., petting zoo, pig races, educational displays). the commercial swine inventory was retrieved from united states department of agriculture's 2007 census of agriculture. the county human population was defined as the value reported in the 2010 us census report. weather data were collected from the national weather service's weather station nearest to each fairground. data were analyzed using stata version 11.1 (statacorp, college station, tx, usa). univariate analysis was performed to calculate unadjusted odd ratios to identify factors contributing to the presence of iav in pigs at fairs. exact logistic regression was used for multivariable modeling using a forward stepwise model building approach. influenza a virus was recovered from pigs at 10 of the 40 fairs included in the investigation. the presence or absence of iav infection among the pigs at the fairs could not be associated with county population, county swine inventory and number of people attending the fair (table 1). all iav-positive fairs and 27 of 30 (90%) negative fairs were mixed sex (barrows and gilts) market swine exhibitions. the average space per pig at the studied fairs was 12.8 ft/pig. properly functioning hand-wash and/or hand-sanitizer stations were available at 25 of 40 (62.5%) fairs. average daily mean temperature was almost 4 c higher for fairs with iav-positive pigs (table 1). pre-fair tag-in and/or weigh-in events were rather common with 23 out of 40 (57.5%) of the enrolled fairs holding one of these events. for every increase of 20 pigs at a fair, the odds ratio of iav infection in the pigs increased by 1.27 times (table 2). the results of the current study provide the first look at fair-level risk factors associated with iav infections in swine at agricultural fairs. while it is likely impossible to completely prevent iav transmission at swine exhibitions, these data can be used to develop and evaluate mitigation strategies to reduce the impact of intra- and inter-species iav infections at swine exhibitions. just like all other agriculture biosecurity programs, mitigation strategies which are practical, user-friendly, low cost and do not dramatically alter the fair experience for exhibitors and visitors are most likely to be considered, implemented and maintained. not surprisingly, larger pig shows appear to be more likely to have iav-infected pigs than smaller swine exhibitions (table 2). larger swine exhibitions tend to also have open-class and breeding swine shows in addition to junior market shows. while open-class shows were common among our studied fairs (16 of the 40), only 5 of the 40 (12.5%) fairs in this study had a breeding show; 4 of those 5 (80%) fairs had iav-infected pigs at the fair. the small number of fairs with breeding shows in this study makes analysis of this risk factor problematic; however, the finding is enough to warrant concern given that breeding swine are intended to leave the exhibition and enter a herd for progeny production. this fair-to-farm movement of pigs is a disease introduction risk for the receiving herd and a potential method to disseminate iav strains across a larger geographic area. previous research has shown that environmental stressors (heat, lack of space, noise) on pigs can affect the course of various diseases in commercial swine operations. the average space per pig at the studied fairs was well above 68 ft/finishing pig common throughout the swine industry. the results indicate that heat stress could be a contributing factor to iav infections in exhibition swine; however, caution must be used when interpreting this result because the vast majority of the fairs with iav-positive pigs occurred in a 4-week period during the middle of summer. this trend of mid-summer iav activity in ohio's exhibition swine was also observed in the previous three years and could be more related to animal and/or people movement between these fairs than the weather. environmental temperature failed to meet the selection criteria for inclusion in the final multivariable model. while the majority of fairs had hand hygiene stations, their presence at fairs was not linked to the occurrence of iav among pigs at the respective fairs. the large number of h3n2v infections linked to swine exposure at agricultural fairs during 2012 suggests that hand hygiene stations also had minimal impact on zoonotic transmission of iav in these settings. however, hand hygiene stations are critically important in protecting human health by controlling zoonotic diseases transmitted via direct contact at these venues. this would limit the time for iav to spread among susceptible pigs and decrease the time humans are exposed to iav-infected pigs. the length of the exhibitions in the current study was similar between iav-positive and -negative fairs. active recruitment of fairs with more diverse management practices is needed to study the impact of a shortened swine exhibition. no matter the length of the exhibition time, the disposition of the pigs following the show must be considered. the majority of fairs in this study (65%) had terminal junior market shows. the practice of having a terminal show was not associated with decreased odds of iav; however, sending all the pigs to harvest at the end of each fair is expected to help protect subsequent fairs by decreasing the potential for fair-to-fair spread of iav. mandated vaccinations were almost non-existent with only one fair in the current study requiring the pigs be vaccinated for erysipelothrix rhusiopathiae prior to the fair; no fairs required the pigs to receive iav vaccination before arrival. use of iav vaccine in exhibition swine to decrease the risk of iav infections in swine and humans has been one of the most debated topics following the h3n2v outbreak of 2012. there are currently several commercially available swine influenza vaccines in the united states, all of which are universally indicated to reduce clinical signs of disease in pigs but appear to have limited efficacy against 2012 h3n2v strains. although their impact on intra- and inter-species transmission dynamics remains unclear, it is expected that iav vaccines will impart at least partial immunity to circulating strains of iav, which should decrease viral shedding during a fair. an unintended consequence of iav vaccine use may be vaccine-associated enhanced respiratory disease, which has been reported in swine vaccinated with swine influenza virus vaccines that are mismatched to circulating strains. furthermore, decrease of clinical signs may hamper recognition and response to active iav infections in exhibition pigs. some of the major pitfalls of mandated iav vaccination lie with the practical application of vaccines in this setting. the logistics of vaccine distribution to swine exhibitors prior to the fair becomes difficult because most exhibition swine are raised by youth exhibitors in small, dispersed herds (< 10 pigs per herd). commercial vaccines are usually sold in 50 doses per bottle adding to the cost per vaccinated pig in these small herds. because youth exhibitors and their family members may not be proficient at administering vaccines, agriculture education advisors often volunteer to assist the youth with this task, a practice that is time-consuming and increases the risk of infectious agents being transmitted farm to farm. additionally, problematic is that most iav vaccines labeled for swine require a booster dose given 24 weeks later to provide optimal protection, which can be difficult for youth exhibitors and their family members to accomplish. tagging or weighing events are frequently used as a way for exhibitors to declare ownership of their pig(s) prior to the fair. these pre-fair events could provide an opportunity for mass vaccination of pigs prior to the fair, but the application of such events can facilitate disease spread between animals. even in properly vaccinated pigs, the immunity stimulated by current iav vaccines the strains used for commercial swine influenza vaccines are irregularly updated and the constant genetic and antigenic change occurring in contemporary swine-origin iavs makes viral antigens unpredictable and difficult vaccine targets. the reason for the increase in the number of reported h3n2v cases during 20112013 remains unclear, but the strain of iav is thought to be a major contributing factor. the swine-origin h3n2 iav isolates recovered from these human cases contains the matrix gene from the a(h1n1)pdm09 virus, a recently emerged genomic constellation that increases replication and transmission in cell culture and animal models. epidemiological data modeling indicate that children are most susceptible to h3n2v, likely due to lack of strain-specific immunity. additionally, current seasonal trivalent inactivated iav vaccine provides little to no protection against h3n2v strains. the limited ability for human-to-human transmission of h3n2v has minimized the impact of these recent zoonotic transmission events, but the outbreak has illustrated the importance of swine exhibitions in zoonotic iav transmission. it is nearly impossible to predict the iav strain that will infect the swine at fairs because iav reassortment events and novel strain generation frequently occur in modern swine populations. agricultural fairs provide a pathway for human exposure to these ever changing viruses; thus, blanket iav prevention, without regard for strain, is needed for swine at fairs to decrease zoonotic iav transmission and protect public health. while iav can infect pigs at any fair, the data presented here indicate that special attention should be paid to large pig shows where the likelihood of iav among the pigs is much higher. the results presented herein are based on one year of data from a limited geographic area of the united states. additional assessments of swine exhibitions in multiple states across several years are needed to provide more comprehensive evaluations of risk factors contributing to the problem. these data provide a critical first step toward developing effective iav mitigation strategies in swine populations that benefit fairs, exhibitors, visitors and the swine industry. this information will serve as a baseline for measuring the acceptance and effectiveness as mitigation strategies are developed and implemented.

influenza a virus infections occurring in exhibition swine populations at agricultural fairs during 2012 served as a source of h3n2 variant influenza a viruses transmitted to humans resulting in more than 300 documented cases. prior to the outbreak, this investigation was initiated to identify fair-level risk factors contributing to influenza a virus infections in pigs at agricultural fairs. as part of an ongoing active surveillance program, nasal swabs and associated fair-level metadata were collected from pigs at 40 junior fair market swine shows held in ohio during the 2012 fair season. analyses of the data show that the adjusted odds of having influenza a virus-infected pigs at a fair were 1.27 (95% confidential interval (ci): 1.041.66) higher for every 20 pig increase in the size of the swine show. additionally, four of the five fairs that hosted breeding swine shows in addition to their junior fair market swine shows had pigs test positive for influenza a virus. while the current study was limited to 40 fairs within one state, the findings provided insight for veterinary and public health officials developing mitigation strategies to decrease the intra- and inter-species transmission of influenza a virus at fairs.

PMC3913824

pubmed-324

the sense of coherence (soc), which was proposed by antonovsky is based on the salutogenic model of health. the soc is composed of three factors; (1) the stimuli derived from internal and external environments in the course of living are structured, predictable, and explicable (comprehensibility); (2) resources are available to meet the demands posed by these stimuli (manageability); and (3) such demands are challenges, worthy of investment and engagement (meaningfulness). antonovsky defined the soc as a personality dimension that is hypothesized to influence stress recognition style, facilitate stress management, and contribute to overall well-being. people with a strong soc have a high ability to cope with stress and maintain good physical and mental health. to the best of our knowledge, six studies have investigated the association between soc, job stress, and mental health. findings from these studies suggest that soc modified the effect of job stress on mental health. to the best of our knowledge, only four studies have investigated the relationship between the soc and depressive symptoms, one used the brief job stress questionnaire and the other three used general health questionnaire. these studies suggested that a weak soc was a strong predictor of mental distress, including depressive symptoms. nurses are exposed to high-stress work environments, including irregular work schedules, shift work, and interaction with patients and other hospital staff members. therefore, preventing mental distress, including depressive state, is an important issue for nurses. the aim of this study was to investigate the relationship between depressive state, job stress, and soc among nurses in japanese general hospital. in february 2013, supervisors distributed a questionnaire to all nurses (n=710) in a general hospital with 611 beds in an urban area in japan. nurse specialties included intensive care, pediatrics, surgery, oncology, and emergency medicine. an explanation of the nature of the survey accompanied the questionnaire, which was anonymous and voluntary. the study was approved by both the local direction board and the committee for the prevention of physical disease and mental illness among health care workers at the general hospital. the questionnaire collected data on age, hours of work (full-time or part-time), shift work, overtime hours per week, and job rank (manager, middle manager or staff nurse). we measured job stress using the japanese version of the effort-reward imbalance (eri) scale (23 items) translated by tsutsumi et al. the eri consists of three subscales; effort (6 items), reward (11 items) and over-commitment (6 items). the reward subscale is further divided into three subgroups: esteem, job security, and promotion. the eri model indicates that job stress is related to high effort with low reward. four eri ratios (eri, effort-esteem imbalance, effort-promotion imbalance, and effort-job security imbalance) were calculated based on the total scores according to tsutsumi et al. the soc scale consisted of 29 items assessing comprehensibility, manageability, and meaningfulness. scores for each item ranged from 1 to 7 points, and the total score was calculated as the soc score. we measured depressive state using the k6 short screening questionnaire that was developed in accordance with the world health organization translation guidelines. the k6 consists of six items on depression and anxiety, each of which is measured on a 5-point scale (0-4). higher scores indicate a more depressive state. the k6 was translated into japanese and showed good validity with the diagnostic and statistical manual of mental disorders, fourth edition, mood, and anxiety disorders in a community sample. we used pearson's correlation to investigate the relationship among age, work related-factors, job stress, soc, and depressive state. to examine factors with a significant effect on depressive state, stepwise multiple regression analyses were conducted with the k6 total score as the dependent variable and variables related to the depressive state as independent variables. completed questionnaires were returned by 420 out of 710 nurses (response rate, 59.2%). male nurses were excluded from the analysis because only 28 of the 42 (66.7%) male nurses responded. subjects with missing values for job stress, soc, or depressive state were also excluded (n=43). the final sample for analysis consisted of 348 female nurses (52.1%), including nurses who were managers and middle managers. overtime was reported in hours per week, which was voluntary but limited to 45 h/month. shift work categories included: no shift work, shift work with rotation to night shift, or characteristics of study subjects table 2 shows the pearson's correlation coefficients between age, overtime hours, eri ratios, soc, and the depressive state. depressive state moderately correlated with three eri ratios, over-commitment, and soc. pearson's coreration between work environments, eri ratios, over-commitment, soc and depressive state table 3 shows the influence of work-related factors, eri ratios, and soc on depressive state. soc, over-commitment, effort-esteem ratio, and age were significantly correlated with depressive state (= 0.46, p<0.001; =0.27, p<0.001; =0.16, p<0.001, =0.10, p<0.01, respectively). the coefficient of multiple determination (r) was 0.56 (f=106.56 p<0.001). we found that soc, over-commitment, effort-esteem ratio, and age were predictors of depressive state among female nurses in the general hospital. the soc was inversely associated with depressive state, which was similar to previous studies. the present findings contribute to the literature investigating the relationship between depressive state, job stress, and soc. strength of our study is that we investigated the independent contribution of three ratios of eri (effort-esteem, effort-job security, and effort-promotion), over-commitment, and soc to the depressive state. according to our previous study, the present findings suggest that a depressive state of nurses was associated with not only job stress but also both over-commitment and soc. age correlated positively with soc [table 2], which was also similar to a previous study by harri who suggested that soc tends to increase with age. previous studies suggested that an increasing soc of workers may reduce negative job stress responses and mental health problems. intervention support enhancing the soc could be effective in preventing nurses from experiencing a depressive state. first, the sample size was small and included nurses from only one general hospital. our findings provide insight into some factors associated with a depressive state among nurses in a general hospital. from a practical perspective, the influence of soc on a depressive state should be considered for health care professionals. intervention support such as group cognitive psychotherapy to strengthen comprehensibility, manageability, and meaningfulness may help nurses cope better with job stress and reduce their risk of depression.

background: people with a strong sense of coherence (soc) have a high ability to cope with stress and maintain good physical and mental health.aims:the aim of this study was to investigate the relationship between depressive state, job stress, and soc among nurses in a japanese general hospital. materials and methods: a self-reporting survey was conducted among 348 female nurses in a general hospital. job stress was measured using the japanese version of the effort-reward imbalance (eri) scale. depressive state was assessed by the k6 scale. soc was assessed with the soc scale, which includes 29 items. stepwise multiple regression analysis was conducted to examine factors that significantly affect depressive state. results:soc, over-commitment, effort-esteem ratio, and age were significantly correlated with the depressive state (= 0.46, p<0.001; =0.27, p<0.001; =0.16, p<0.001; =0.10, p<0.001, respectively). conclusions: soc may have a major influence on the depressive state among female nurses in a japanese general hospital. from a practical perspective, health care professionals should try to enhance the soc of nurses.

PMC4083521

pubmed-325

walking ability is impaired in patients with peripheral arterial disease (pad) due to decreased blood flow to the skeletal muscle tissue used during walking. it has been demonstrated that walking distance is associated with the degree of impairment in the affected leg as measured by the ankle-brachial index (abi) and the time to onset of claudication pain [16]. likewise, it has been shown that walking exercise in patients with pad prolongs the onset of claudication pain thus allowing the patient to walk longer but does not change the abi [79]. recently, several investigators have used near-infrared spectroscopy (nirs) to dynamically study the effect of walking on oxygen desaturation of the gastrocnemius muscle of the impaired leg during exercise [2, 1014]. investigators noted a marked decline in skeletal muscle tissue oxygenation (sto2) during walking exercise [2, 1014]. gardner et al. also identified that the rate of decline in calf muscle sto2 was significantly associated with initial claudication time and absolute claudication time in patients with pad. three of the above studies examined the changes in tissue oxygenation, using nirs, in patients with pad before and after an exercise training program [1214]. used a pretest-post-test design and reported greater exercise duration and lower mean exercise sto2 in 15 patients after a 3-month treadmill and calf exercise training program. studied 55 patients with pad who were given the option to participate in a structured or unstructured home exercise program for 34 2 weeks. at the end of the study, those patients in the structured exercise program had an increased oxyhemoglobin area under the curve when compared to baseline; similar changes were not identified in the unstructured exercise group. lastly, tew et al. studied calf-tissue oxygenation and treadmill walking response time after randomization to 12 weeks of arm-crank ergometry or a control group in 57 patients with intermittent claudication. investigators identified that walking distance and time to nadir sto2 increased in those assigned to arm-cranking and there were no changes in the control group. no studies however compared leg muscle responses after a traditional walking program compared to a walking-with-poles program of rehabilitation in patients with claudication. the purpose of this study was to determine if there were differences in calf muscle sto2 parameters before and after 12 weeks of a traditional walking program versus a walking-with-poles exercise program. we reasoned that by using the poles to offload the legs, patients would have less claudication pain and be able to walk longer distance thus achieving a greater training effect. we hypothesized that the calf muscle tissue deoxygenation would be less in both groups after 12 weeks of exercise training than at baseline and that the decrease would be greater in those patients assigned to the walking-with-poles group. these data represent a subanalysis of data from a larger clinical trial comparing traditional walking to walking with poles. patients with pad were screened and recruited to participate in a randomized clinical trial designed to compare the effects of a traditional walking training program versus walking-with-poles exercise training program. a total of 2296 patients were screened for eligibility, 146 enrolled in the study. patients were recruited using radio and newspaper advertising, posted fliers, and letters of invitation sent to patients at the university and va hospitals. for the purposes of this analysis, we included only those participants with an abi of 0.90 (n=91 patients). of those 91 patients, 3 did not have sto2 analyses on their baseline progressive treadmill test due to equipment malfunction and 3 had questionable data resulting in a final sample of 85 patients. of those 85 patients, 45 were assigned to the walking-with-poles group and 40 patients were assigned to the traditional walking group. the major study was a randomized clinical trial to examine the effects of a traditional walking program compared to walking with poles on walking endurance and perceived physical function in patients with pad. our primary outcome focused on changes the patients realized walking on the constant work rate treadmill test whereas this analysis used data from the progressive treadmill test. at two minutes on the constant work rate test, the speed and incline increased to 85% of the patient's workload on the progressive treadmill test resulting in a sudden decline in sto2. due to the gentle nature of the progressive treadmill protocol used, we were able to detect more subtle changes in sto2 and onset of claudication pain. patients were randomized using computer-generated permuted blocks and group assignment was managed by the study statistician. the training programs for both groups were identical except that one group exercised with poles and the other group did not. patients assigned to the walking-with-poles group received training on the use of the poles prior to beginning the exercise program. additionally, patients were coached on proper poling mechanics during the training period if needed. the training program incorporated interval training whereby exercise consisted mostly of low-to-moderate intensity training at the start of the program and progressed to moderate-to-high intensity. exercise intensity was determined by heart rate associated with a percentage of oxygen uptake obtained during the metabolic exercise treadmill tests. exercise duration and intensity was adjusted every three weeks. during the first weeks, patients walked for 30 minutes (20% light intensity, 60% moderate intensity, and 20% hard intensity). by weeks 1012, patients walked for 55 minutes (10% light intensity, 45% moderate intensity, and 45% hard intensity). light intensity was defined as 2544% peak vo2, moderate intensity was 4559% peak vo2, and hard intensity was 6084% vo2 peak. the program was designed so that patients walked on the treadmill two days/week and outdoors or in the hospital corridors one day/week. the exercise interval was adjusted based on the patient's pain tolerance. for example, some patients could only walk for one to two minutes at the higher intensities. in order for them to achieve 20% total time at the harder intensities, demographic information, height, weight, comorbid conditions, and medication history were obtained from the patient and reviewed in the patient medical record. the abi was measured in the more severely affected leg at baseline and 12 weeks after training. the location of the signal was recorded and used consistently throughout the study for that individual subject. after the patient rested comfortably in a supine position for 15 minutes, doppler ultrasound was used to measure the systolic pressure in the right and left arms and in the ankle of the most severely affected leg. the arm with the highest systolic pressure patients were tested using a gentle treadmill protocol that was developed for patients with pad [6, 16]. increases in percent grade occurred every 30 seconds, and, after the first 6 minutes, speed increased every 3 minutes. initial claudication time was defined as the time during the treadmill test when the subject experienced pain in the affected leg. the absolute walking time was defined as the time walked by the patient on the progressive treadmill test. peak oxygen uptake was measured using the medgraphics cpx/d system (medical graphics corp, st. the metabolic cart was calibrated using a 3 l syringe prior to each test and the analyzers were calibrated using references gasses and room air. patients breathed through a mouthpiece and their nose was clipped with a standard nose clip. oxygen uptake was averaged over 30 s and the highest value at peak exercise was recorded. skeletal muscle tissue oxygenation was measured prior to, during, and after exercise using the nirs spectrometer (inspectra 325, hutchinson technology, inc., a 25 mm probe attached to an optical cable was used to noninvasively measure the percentage of hemoglobin oxygen saturation of the tissue beneath the near-infrared light. the inspectra machine was calibrated prior to each test according to known high and low reference standards. the nirs probe was attached to the medial section of the gastrocnemius muscle of the patient's most severely affected leg. the probe was placed into a specially designed adhesive housing unit to reduce ambient light. the probe was then secured to the leg to avoid excessive motion and possible tripping. the sto2 values used in this analysis were the sto2 value recorded after 2 minutes of standing prior to exercise (sto2 rest), time walked when the patient reached the nadir sto2 value (time to nadir sto2 value), sto2 value at peak exercise (sto2 peak), and absolute and relative drop in sto2 (absolute drop in sto2=rest sto2 minimal sto2 value, relative drop in sto2=[rest sto2 nadir sto2 value]/rest sto2). ratings of perceived leg pain were obtained every minute using the borg ratio scale. the initial claudication time is the time that patients either notified the staff of the onset of pain or the time they first reported pain when asked every minute. the two groups were compared at baseline using the t-test for independent samples and mann whitney u test. regression analyses were used to compute the initial decline in slopes for sto2 values (sto2 value regressed over time). pearson r correlations were completed to examine relationships between the variables. paired t-tests independent t-tests were used to examine differences between groups. intent-to-treat analyses using the baseline value carried forward were completed for the comparisons between groups. the sample consisted of primarily older (age=69.4 9.2 years) men. over one-third of the patients were current smokers, half were diabetic, and the majority of patients received treatment for hypertension and dyslipidemia (table 1). patients were generally unfit with a peak oxygen uptake of 14.3 2.9 ml kg min. the walking-with-poles group was older than the traditional walking group. calf muscle oxygenation decreased from 56 17% prior to the treadmill test to 16 18% at peak exercise (71% relative decline from rest to peak exercise). patients walked 4.45 3.67 minutes before experiencing claudication pain and 4.39 3.99 minutes when the sto2 reached its nadir value. there was no difference between the time elapsed when the sto2 reached its nadir value and pain onset (p=.87). although all patients reported claudication pain, exercise was not limited by claudication pain for all patients. therefore, we examined the onset of claudication pain and time to nadir sto2 for those whose exercise was limited by claudication pain only (n=72). patients walked 3.35 2.57 minutes before experiencing claudication pain and 3.67 3.49 minutes when the sto2 reached its nadir value. there was no difference between the time elapsed when the sto2 reached its nadir value and pain onset (p=.40). after exercise, the time for the sto2 to return to half of its resting value was 1.3 1.3 min and 2.2 2.1 minutes to return to resting values. the initial claudication time and absolute walking time were not associated with the sto2 values at rest (table 2) but were moderately related to the time elapsed prior to reaching the nadir sto2 value (r=.42, p<.001; r=.58, p=.001, resp.). there was also a small to moderate relationship between onset of claudication pain and the exercise slope decline in sto2 (r=.28, p=.011). relationships were similar between initial claudication time and absolute walking time and the time elapsed prior to reaching the nadir sto2 values when the analysis was restricted to those whose exercise was limited by claudication (r=48, p .001 and r=.47, p<.001). data comparing groups after exercise training were analyzed using intent-to-treat analysis for all patients. the change in time elapsed prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks (r=.65, p<.001) and initial claudication time at 12 weeks (r=.33, p=.002). analysis of covariance was completed to compare the groups with age as the covariate since there was a difference in age at baseline (table 3). the change in the time elapsed prior to reaching nadir sto2 values (p=.002) and absolute walking time (p=.002) were greater in the traditional walking group when compared to the walking-with-poles group. there was, however, no difference in the change in initial claudication time between the two groups (p=.38). when the analyses were restricted to those who completed the exercise training only (n=71), the change in time elapsed prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks (r=.57, p<.001) and initial claudication time at 12 weeks (r=.32, p=.004). data from a sample patient are depicted in figure 1. recovery time was unchanged when baseline and 12-week values were compared (baseline=2.45 2.17 min, 12 wk=2.19 1.94 min, p=.81). after 12 weeks of exercise training, within-group changes in initial claudication time, absolute claudication time and time elapsed prior to reaching nadir sto2 values increased (table 4.) the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking-with-poles group (walking group=4.01 5.13 minutes, walking-with-poles group=.89 3.56 minutes, p=.009). similarly, absolute walking time increased more in the traditional walking group than in the walking-with-poles group (walking group=3.97 3.14 minutes, walking-with-poles group=2.24 2.41 minutes, p=.017). there was no difference between the two groups in initial claudication time (walking group=1.16 3.64 minutes, walking-with-poles group=.85 3.46 minutes, p=.69). since there was a significant difference in age between the two groups, age no differences in recovery time were noted between the traditional walking and walking-with-poles groups at the 12-week follow-up time period (traditional walking recovery time=1.26 1.43 min, walking with poles=1.41 1.76 min, p=.70). no significant differences were identified in peak oxygen consumption or abi within or between the two groups from baseline to 12 weeks using intent-to-treat analysis or restricting the analysis to those who completed the training only. there are three major findings of this study: (1) the time elapsed before reaching nadir sto2 values is associated with initial claudication time and absolute walking time, (2) there was no difference in the time associated with the nadir of sto2 and the onset of claudication pain, and (3) the time to nadir sto2 of the gastrocnemius muscle was greater after 12 weeks of exercise training in the traditional walking group when compared to the walking with poles group. as bauer notes, during higher work rates and apparent blood flow limitation, muscle oxygen desaturation becomes more rapid in pad subjects. thus, one would expect that oxygen desaturation would be associated with onset of claudication and walking duration. our findings reflect these assumptions and were similar to those reported by gardner et al., that is, shorter time to reach nadir sto2 values were associated with shorter initial claudication time and total walking duration. second, in gardner's study, relationships between initial claudication time (r=.339), absolute walking time (r=.68) and measured time to minimal exercise sto2 were similar to our relationships between initial claudication time (r=.42), absolute walking time (r=.58) and measured distance to nadir sto2. these findings suggest that our sample patients were similar to patients in other studies [2, 19]. exercise-associated decline in sto2 of the gastrocnemius muscle was less after 12 weeks of exercise training when compared to baseline. wang and colleagues recently demonstrated in 17 subjects with pad who completed a 24-week walking program that an increase in the number of capillaries in contact with type iix and iia calf muscle fibers was related to an improved pain-free walking time (r=.69 and r=.62, p<.05). investigators hypothesized that the ratio of capillaries to muscle fibers affects oxygen supply thus delaying the mismatch between supply and demand. both report greater exercise sto2 area under the curve postexercise training when compared to preexercise training. in our study, an increase in the time to nadir sto2 values was associated with delayed initial claudication time and improved absolute walking time. our findings provide further evidence that walking exercise improves tissue muscle oxygenation in patients with pad. likewise, our findings support the possibility that the onset of claudication and walking duration are linked by the decline in tissue oxygenation. the onset of claudication and the time elapsed prior to reaching the nadir sto2 values were nearly identical. thus, the patient's perception of pain is a good indicator of sto2 in the calf muscle. exercise-induced decline in gastrocnemius muscle sto2 was less in patients assigned to the traditional walking program than in patients assigned to the walking-with-poles exercise training program. we had originally hypothesized that a walking training program with poles for patients would be advantageous because the poles would offload the legs during periods of claudication allowing additional walking exercise. indeed, oakley et al. investigated the immediate effects of walking with nordic poles on 20 patients with pad and found that claudication distance increased from 77 m without the poles to 130 m with the poles (p<.0001) and the level of claudication pain also decreased (p=.0002). our group has also previously reported that patients had decreased calf pain when walking with poles. oakley et al. compared muscle histology of 36 patients randomly assigned to 12 weeks of treadmill training, strength training or control. after the 12 weeks, only the treadmill group had histological changes in the muscle. the increase in muscle ischemia with treadmill training was associated with a marked increase in muscle damage. hiatt suggests that skeletal muscle dysfunction and associated muscle metabolic state can be ameliorated with treadmill exercise training. tew et al. provides evidence that even when the exercising muscle is not the calf muscle, tissue oxygenation can improve. clearly, the patients assigned to the traditional walking group experienced a prolonged exercise time before experiencing claudication pain, prolonged their absolute walking time and increased the amount of time exercising until reaching nadir values. in the walking-with-poles group, there were no changes over time when an intent-to-treat approach was used. however, when the analysis was restricted to those who completed the training program only, there was a difference in absolute walking time and a trend toward increasing time to initial claudication pain onset as well as nadir sto2. the explanation for these findings may be that leg metabolic changes in the calf muscle occurred to a greater extent in those assigned to the walking-with-poles group or we may not have had enough statistical power to detect changes that were present. another explanation for this finding may be that the intensity of our training program was based on oxygen uptake associated with heart rate response to exercise. with the addition of the upper body to the exercise regime for patients assigned to the walking-with-poles group thus, the work accomplished by the leg muscles may have been less even though overall exercise intensity was consistent between the two groups of patients. both groups trained on the treadmill and outdoors. patients assigned to the walking with poles group were unable to use the handrails on the treadmill for balance; added anxiety may have increased the cardiovascular response thus keeping the overall work accomplished lower in some patients. first, although age was not a contributing factor to the differences between the groups, the walking-with-poles group was older than the traditional walking group. we can not exclude that the differences in exercise tolerance and willingness to push limits may differ between someone who is 67 years old (mean age for walking group) and someone who is 72 years old (mean age for walking-with-poles group). this five-year age difference may have influenced our outcomes in ways that we did not measure. next, the sample was primarily men and thus can not be generalized to women. additionally, in order to include only those with compressible vessels, we excluded 17 patients who were initially randomized to our study. lastly, although all of our patients experienced claudication pain, not all patients stopped exercise due to claudication pain. including patients that did not stop exercise due to claudication pain additional studies examining different walking intensities in patients with peripheral arterial disease should be tested. further, it may be that use of walking poles early in the rehabilitative effort may augment traditional walking training later by assisting patients to train longer early on. in summary, we conclude that there is a significant decline in sto2 in the gastrocnemius muscle during walking exercise in patients with peripheral arterial disease reflecting muscle tissue ischemia. contrary to our hypothesis, after 12 weeks of exercise training, absolute walking time and time to reach nadir muscle tissue oxygenation were prolonged in the patients assigned to the traditional walking program more than those assigned to a walking-with-poles exercise training program reflecting greater tissue perfusion and enhancement of arteriovenous oxygen extraction. the precise mechanism for these differences remains unknown but these findings may provide some insight to tissue adaptations to exercise stimulus and may therefore be useful to pad rehabilitation programs .

this randomized trial proposed to determine if there were differences in calf muscle sto2 parameters in patients before and after 12 weeks of a traditional walking or walking-with-poles exercise program. data were collected on 85 patients who were randomized to a traditional walking program (n=40) or walking-with-poles program (n=45) of exercise training. patients walked for 3 times weekly for 12 weeks. seventy-one patients completed both the baseline and the 12-week follow-up progressive treadmill tests (n=36 traditional walking and n=35 walking-with-poles). using the near-infrared spectroscopy measures, sto2 was measured prior to, during, and after exercise. at baseline, calf muscle oxygenation decreased from 56 17% prior to the treadmill test to 16 18% at peak exercise. the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking-with-poles group. likewise, absolute walking time increased more in the traditional walking group than in the walking-with-poles group. tissue oxygenation decline during treadmill testing was less for patients assigned to a 12-week traditional walking program when compared to those assigned to a 12-week walking-with-poles program. in conclusion, the 12-week traditional walking program was superior to walking-with-poles in improving tissue deoxygenation in patients with pad.

PMC3463188

pubmed-326

the transition-metal-catalyzed amination of aryl halides has become one of the most powerful methods to construct arylamines. the development of methods to couple aryl halides with amines has been studied extensively in the past decade. palladium-catalyzed reactions occur with a broad scope of both coupling partners, high functional group tolerance, and good selectivity for monoarylation of the amine nucleophile. both the palladium metal and the ligands used for this reaction are costly, and the ligand is difficult to recycle. for these types of reasons, much interest has been paid recently to develop reactions catalyzed by first-row metal complexes that are typically catalyzed by precious metals. for example, copper complexes have been studied extensively for the coupling of aryl iodides, and to a lesser extent aryl bromides, with nitrogen nucleophiles. yet, the scope of such coupling with electron-rich bromoarenes, ortho-substituted bromoarenes, unactivated aryl chlorides, and heteroaryl halides is limited. many of the first-row metals are more electropositive than those of the second row and form electron-rich low-valent species. indeed, nickel complexes have been shown to catalyze the amination of aryl chlorides and phenol derivatives (scheme 1). such nickel-catalyzed amination reactions could be more practical than palladium-catalyzed amination reactions on large scale because the metal is much less expensive, and much simpler ligands on the nickel center are needed for the catalyst to react with aryl chlorides. for example, hidai showed over 40 years ago that ni(pph3)4 adds phenyl chloride at room temperature to form (pph3)2ni(ph)(cl), whereas pd(pph3)4 does not react with aryl chlorides. however, the scope of the nickel-catalyzed amination of aryl halides has been limited to the coupling of secondary alkylamines and arylamines. primary alkylamines, one of the most significant classes of amines for such cross coupling, have been shown to couple only with activated aryl chlorides. in addition to the limitations on the scope of the coupling of aryl halides with amines, the mechanism of the coupling of aryl halides with amines catalyzed by nickel complexes has not been studied. many papers cite the potential of ni(i) intermediates, either as part of a one-electron redox event or as part of a mechanism involving ni(i) and ni(iii) intermediates. in contrast, the mechanism for the palladium-catalyzed amination of aryl electrophiles has been studied in detail, including the kinetic behavior of the catalytic reaction and stoichiometric reactions of isolated intermediates. such studies have not been conducted on nickel-catalyzed couplings to form c n bonds, but are particularly important if one is to determine how to create catalysts of nickel that are as long-lived as those of palladium and that react with similarly broad scope. here, we present the first nickel-catalyzed amination of unactivated aryl chlorides with primary aliphatic amines. the reaction occurs with aryl and heteroaryl chlorides and bromides catalyzed by a single-component binap-ligated nickel(0) precursor. kinetic studies have been conducted on the reaction, and studies on the relative rates of the reaction with various isolated nickel complexes have been conducted. these studies rule out a catalytic cycle occurring through a ni(i) halide intermediate and are consistent with a ni(0)/ni(ii) catalytic cycle for the amination of aryl chlorides and aryl bromides, which react with different ni(0) species. we initiated our studies of nickel-catalyzed amination of aryl chlorides with primary aliphatic amines by studying the reaction between 3-chloroanisole and octylamine. we investigated nickel complexes generated in situ from ni(cod)2 and various phosphine ligands as catalysts. these reactions were conducted with naobu as base in toluene at 50 c. reactions catalyzed by the combination of ni(cod)2 and monophosphines, such as pph3 and pcy3, afforded only trace amounts of the desired amine product (entries 14). similar results (< 5% conversion and<2% yield) were obtained for reactions catalyzed by the combination of ni(cod)2 (1 mol %) and dppe, dppp, or dppb (1 or 2 mol %) (entries 510). however, reactions catalyzed by the combination of ni(cod)2 and dppf or binap gave significant amounts of product (1667%, entries 1114). in particular, the reaction catalyzed by the single component catalyst (binap)ni(-nc-ph) afforded the product in 92% yield (entry 15). an explanation for the high activity of this catalyst will be revealed during the presentation of our mechanistic studies. conditions: 3-chloroanisole (0.400 mmol), octylamine (0.600 mmol), naobu (0.600 mmol), 24 h. conversion and yield were determined by gc analysis using dodecane as internal standard. [ni]=(binap)ni(-nc-ph). with an active catalyst in hand and reliable conditions identified for this ni-catalyzed amination, we studied the scope of aryl chlorides that undergo these amination reactions, and the results are summarized in table 2. in general, a range of electron-rich (2a2e), electron-neutral (2h), and electron-deficient (2i2l) aryl chlorides coupled with octylamine in high yields (7696%) under the developed conditions with 1 mol% of nickel complex 1. for very electron-rich aryl chlorides, 4 mol% of the catalyst was required to obtain modest to good yields (2f and 2 g). for these two reactions, aryl chlorides were not fully converted, and only trace amounts (< 5%) of biaryl compounds were detected by gc analysis. mono-ortho-substituted aryl chlorides reacted in high yields (2a, 2c2e, 2h, and 2j). however, di-ortho-substituted aryl chlorides, such as 2-chloro-1,3-dimethylbenzene, did not couple with octylamine under the developed conditions. conditions: arcl (0.400 mmol), octylamine (0.600 mmol), (binap)ni(-nc-ph) (4.0 mol, 1 mol%), naobu (0.600 mmol), toluene (1 ml); temperature, 50 c; reaction time, 24 h. (binap)ni(-nc-ph) (16.0 mol, 4 mol%). the scope of primary amines was studied by conducting the amination reactions of 3-chloroanisole catalyzed by 2 mol% complex 1. the results of this study are summarized in table 3. in general, a variety of primary aliphatic amines underwent this amination process in good to excellent isolated yields (7596%). conditions: 3-chloroanisole (0.400 mmol), primary amine (0.600 mmol), (binap)ni(-nc-ph) (8.0 mol, 2 mol%), naobu (0.600 mmol), toluene (1 ml); temperature, 50 c; reaction time, 24 h. (binap)ni(-nc-ph) (16.0 mol, 4 mol%). the steric bulk of the alkyl group of the primary amines significantly influenced the yields of these reactions. the reactions of an amine containing a primary alkyl group (2 m) afforded the product in higher yield than the reactions of amines containing a secondary alkyl group (2n and 2o), although the primary amines containing a secondary alkyl group still coupled with aryl chlorides in good yield. however, the amination of 3-chloroanisole with primary amines containing a tertiary alkyl group, for example, tert-butylamime and amylamine, gave only trace amounts of the desired products. amines containing aryl (2p), heteroaryl (2q and 2r), allyl (2s), and cyano (2 t) groups reacted in high yields (9096%). primary amines bearing 1,3-dioxolane (2u and 2v) and morpholine (2w) moieties also reacted in high yields (8388%). the reaction of n-isopropylethylenediamine, a substrate containing both a primary and a secondary amine, occurred selectively with the primary amine, leaving the secondary amine intact (2x). nitrogen-containing heterocycles containing amino substituents are of particular importance for pharmaceutical applications. however, the c n coupling reactions between nitrogen-containing heteroaryl electrophiles and primary amines are challenging, presumably because of the coordinating properties of both pyridines and primary amines. nickel catalysts have been reported for the amination of heteroaryl chlorides, but the amine nucleophiles are limited to secondary amines. cross-coupling reactions between nitrogen-containing heteroaryl chlorides and primary amines catalyzed by 2 mol% of complex 1 are summarized in table 4. the scope of heteroaryl chlorides that underwent this amination reaction encompassed a range of 2-pyridyl (3a3f), 3-pyridyl (3g3l), and 4-pyridyl (3m3p) chlorides containing electron-donating groups (me and ome) and electron-withdrawing groups (cn and cf3). in general, these reactions afforded the corresponding heteroaryl alkylamine in good to excellent isolated yields (5796%, average yield: 81%). this amination also occurred in high yields with 2-chloroquinoline (3q) and 2-chloropyrazine (3r). the scope of primary amines that underwent reactions with chloropyridines was similar to that of the reactions of 3- chloroanisole described in table 3. conditions: 3-chloroanisole (0.400 mmol), primary amine (0.600 mmol), (binap)ni(-nc-ph) (8.0 mol, 2 mol%), naobu (0.600 mmol), toluene (1 ml); temperature, 50 c; reaction time, 24 h. (binap)ni(-nc-ph) (16.0 mol, 4 mol%). compared to the well-established palladium-catalyzed amination of aryl bromides, the nickel-catalyzed amination of aryl bromides has been less studied, and conditions for coupling of aryl bromides with amines by nickel catalysts have not been identified. only two examples of nickel-catalyzed amination of aryl bromides have been published, and these two reactions occurred in poor yields (eqs 1 and 2). having identified conditions for the nickel-catalyzed amination of aryl chlorides, we tested these conditions for the coupling of aryl bromides with primary amines. the amination of aryl bromides catalyzed by benzonitrile complex 1 in toluene with naobu base occurred in good yields in some cases, but the scope of the reaction was limited. bromobenzene and 4-bromobenzotrifluoride reacted with octylamine in high gc-yields (98% and 94%, repectively) under conditions listed in table 2 with 3 mol% of complex 1 (eq 3). however, 3-bromoanisole coupled with 2-(1,3-dioxolan-2-yl)ethan-1-amine in only 55% gc-yield, whereas the reaction of the same amine with 3-chloroanisole afforded the desired product in 87% isolated yield (eq 4). this limited scope for the amination of aryl bromides may stem from the faster thermal decomposition of arylnickel(ii) bromide species to nickel(i)3 bromide, relative to the rate of decomposition of arylnickel(ii) chloride species. the catalyst precursor employed in this study is a single-component nickel(0) complex (binap)ni(-nc-ph) (1). previously, we reported the synthesis of this nickel complex by substitution of the 1,5-cyclooctadiene (cod) in ni(cod)2 by binap, and benzonitrile. to avoid using the thermally labile, air- and moisture-sensitive ni(cod)2, we developed a new synthesis (scheme 2) of this complex starting from the air-stable nickel precursor (dme)nicl2. reaction of (dme)nicl2 with 1 equiv of binap in thf at 50 c afforded (binap)nicl2, which was then reduced by zinc metal in the presence of cod. p nmr analysis of this reaction indicated a clean formation of (binap)ni(cod). the byproduct zncl2 was removed by washing the reaction mixture with degassed aqueous naoh. at this stage, the residue was suspended in toluene and then allowed to react with benzonitrile. arylnickel halide complexes are important intermediates in nickel-catalyzed cross-coupling reactions. in general, arylnickel halides ligated by monophosphines are synthesized by oxidative addition reactions of aryl halides to ni(pr3)x (r=alkyl or aryl), but arylnickel halides ligated by bisphosphines are prepared by ligand substitution reactions between monophosphine-ligated arylnickel halide complexes with bisphosphines. the direct oxidative addition of aryl halides to bisphosphine-ligated ni(0) has rarely been investigated, mainly due to the lack of bisphosphine-ligated ni(0) precursors that can react with aryl halides at ambient temperature. recently, we reported the synthesis of binap-ligated arylnickel halide complexes by reactions of aryl halides with (binap)ni(cod) in the presence of catalytic amounts of benzonitrile, and we identified (binap)ni(-nc-ph) as the active ni(0) species. in our communication on the nickel-catalyzed asymmetric -arylation of ketones, we reported the single reaction of electron-deficient 4-chlorobenzotrifluoride with this newly defined ni(0) precursor 1 and no isolation of the products. here we show the results of the reactions of complex 1 with electronically varied aryl chlorides. electron-neutral and electron-deficient aryl chlorides reacted smoothly with ni(0) complex 1 in thf at room temperature to afford the arylnickel(ii) chloride complexes 47 in 7689% isolated yields (eq 5). these complexes are stable in the solid state at ambient temperature for at least six months without noticeable decomposition. however, upon standing in thf solution at room temperature for about 48 h, they fully decomposed to [(binap)ni(-cl)]2 (8) with concomitant release of biaryls, as detected by gc-ms analysis. however, the reaction of electron-rich 4-chloroanisole with complex 1 in thf did not form the arylnickel chloride complex resulting from simple oxidative addition, as determined by p nmr spectroscopy. instead, p nmr signals corresponding to two mutually trans phosphine resonances (doublets at 24.2 and 14.4 ppm with jpp=352 hz) were observed. 56single-crystal x-ray diffraction of the isolated material (figure 1) showed that this product is complex 9 (eq 7). complex 9 contains a coordinated monophosphine ligand ph2p(c6h4-4-ome) and a six-membered nickelacyclic structure. nickelacyclic complex 9 contains a small dihedral angle between the two naphthyl groups of 63, and the nickel center consists of a distorted square planar geometry. complex 9 is formed by p c bond cleavage of the binap backbone after the initial formation of binap-ligated arylnickel chloride complex (binap)nicl(c6h4-4-ome). c bond cleavage of the binap backbone in a binap-ligated phenylpalladium bromide complex was reported by our group previously. all the ellipsoids are drawn at the 50% probability and all the hydrogen atoms are omitted for clarity. complex 9 was tested as a catalyst for the amination of 4-chloroanisole with octylamine under the conditions described in table 2. only trace (< 5% by gc analysis) amounts of the amination product were formed. thus, the formation of catalytically inactive complex 9 by the reaction of 4-chloroanisole and nickel precursor 1 explained the high catalyst loading required for the amination of electron-rich 4-chloroanisole. the oxidation state of the nickel intermediates in the amination of aryl halides with amines has been ambiguous, and pathways involving both ni(0)/ni(ii) and ni(i)/ni(iii) couples have been proposed for these reactions. with isolated, binap-ligated ni(0), ni(i) halide, and arni(ii) halide complexes in hand, we were able to assess precisely the competence of these complexes to be intermediates in the amination reactions. to do so, we conducted the reaction of the isolated (binap)nicl(c6h4-4-cf3) (7) with octylamine and naobu in the presence of 1 equiv of binap to trap a ni(0) product (a, scheme 3). this reaction afforded n-octyl-4-(trifluoromethyl)aniline in quantitative yield in less than 5 min at room temperature, as indicated by f nmr spectroscopic analysis. in addition, we conducted the amination reaction of 4-chlorobenzotrifluoride with octylamine in the presence of naobu catalyzed by 2 mol% of (binap)nicl(c6h4-4-cf3) at room temperature (b, scheme 3). full conversion of 4-chlorobenzotrifluoride was achieved in 2 h, and this reaction afforded n-octyl-4-(trifluoromethyl)aniline in 91% isolated yield. the same reaction catalyzed by 2 mol% of [(binap)ni--cl]2 did not afford any amination product (c, scheme 3). these results show clearly that the binap-ligated arylnickel(ii) chloride compound is kinetically and chemically competent to be an intermediate in the catalytic process and the binap-ligated nickel(i) halide is not. to identify the resting state of the catalyst in this nickel-catalyzed amination reaction, we monitored by p{h} nmr spectroscopy the reaction of 4-chlorobenzotrifluoride with octylamine in the presence of naobu catalyzed by 2 mol% of (binap)ni(-nc-ph) (1) at room temperature. during the first 50% conversion of 4-chlorobenzotrifluoride, however, during the second 50% conversion, a new species corresponding to a p{h} nmr resonance at 31.7 ppm gradually accumulated. this new species is (binap)2ni, as determined by independently preparing this complex by reduction of (dme)nicl2 with zn metal in the presence of 2 equiv of binap in thf and comparing the p nmr chemical shift. to test the catalytic activity of (binap)2ni for this amination process, we conducted the reaction of 4-chlorobenzotrifluoride with octylamine catalyzed by 5 mol% of (binap)2ni in the presence of naobu at room temperature. this reaction did not afford detectable amounts of the amination product (a, scheme 4). this result is consistent with the early report that (binap)2ni does not undergo oxidative addition with aryl chlorides or bromides at ambient temperatures. the same reaction catalyzed by 5 mol% (binap)2ni in the presence of a catalytic amount of phcn (30 mol %) afforded the amination product in 84% yield in 20 h (b, scheme 4). for comparison, we conducted the same reaction catalyzed by only 2 mol% (binap)ni(-nc-ph). this reaction afforded the amination product in almost quantitative yield in 2 h at room temperature (c, scheme 4). thus, (binap)ni(-nc-ph) is a more active catalyst than the combination of (binap)2ni and phcn. to assess the origin of the effect of benzonitrile on the rate of the catalytic reaction, we performed the reaction of (binap)2ni with benzonitrile and the reaction of (binap)ni(-nc-ph) with binap. the reaction of (binap)2ni with 10 equiv of benzonitrile did not form detectable amounts of (binap)ni(-nc-ph), as determined by p nmr spectroscopy (d, scheme 4). the reaction of (binap)ni(-nc-ph) with 1 equiv of binap afforded (binap)2ni quantitatively at ambient temperature (e, scheme 3). based on these stoichiometric reactions and the catalytic reactions in scheme 3, we conclude that the formation of (binap)2ni is reversible in the presence of benzonitrile, but the equilibrium lies largely on the side of (binap)2ni and free nitrile. the formation of bis(amine)-ligated palladium complexes was reported as one possible pathway for deactivation of the catalyst in the palladium-catalyzed amination of aryl halides. formation of analogous bis(amine) complexes of nickel was proposed to explain the much lower reactivity of primary aliphatic amines than that of cyclic secondary aliphatic amines and anilines in the nickel-catalyzed amination reaction. however, these bis(amine)-ligated nickel complexes have never been prepared or characterized. in the nickel-catalyzed amination of aryl chlorides with primary amines catalyzed by (binap)ni(-nc-ph), we observed the formation of (binap)2ni. the stoichiometry of this conversion indicates that there are nickel complexes lacking binap ligand in the reaction mixture. thus, we studied the ligand substitution reactions between primary aliphatic amines and binap-ligated ni(0) and binap-ligated ni(ii) complexes. the reaction of (binap)ni(-nc-ph) with 50 equiv of n-butylamine in toluene did not form any new nickel species, and free binap was not detected by p nmr spectroscopy (a, scheme 5). this result is consistent with the affinity of the electron-rich ni(0) center for softer, -accepting ligands. however, the reaction of (binap)nicl(c6h4-4-cn) with 50 equiv of n-butylamine afforded free binap and trans-(n-butylamine)2nicl(c6h4-4-cn) (10) (b, scheme 5). complex 10 was isolated in 76% yield. with the bis(amine)-ligated complex 10 in hand, we tested its potential to serve as an intermediate in the amination reaction. we conducted the reaction of 10 with 2 equiv of naobu in the presence or in the absence of 1 equiv of binap (c, scheme 5). this result indicates that the formation of bis(amine)-ligated nickel complexes is one possible pathway for decomposition of the nickel catalyst. after identifying the resting state of the nickel catalyst and possible paths for catalyst deactivation, we sought to identify the rate-limiting step for this nickel-catalyzed amination process. to do so, we measured the dependence of the initial rates of the amination reaction on the concentrations of each reagent under conditions in which the other reagents were present in large excess. we chose the reaction of 4-chlorobenzotrifluoride with octylamine in the presence of naobu for the kinetic studies because this reaction occurred at ambient temperature, and we were able to monitor the reaction conveniently by both p and f nmr spectroscopy. furthermore, no background nucleophilic aromatic substitution reaction was observed for this aryl chloride and octylamine in the presence of naobu. for the initial rates to be a valid method for kinetic analysis of this reaction, all reagents must be soluble in the reaction medium, and no induction period can be present. the single-component catalyst precursor 1 is only marginally soluble in the reaction medium. thus, we used (binap)nicl(c6h4-4-cf3) (7) as the source of nickel for our kinetic experiments because it dissolves in seconds once mixed with other reagents. benzonitrile was added to the reaction mixture to trap the binap-ligated ni(0) species to form (binap)ni(-nc-ph), which had been identified as the catalyst resting state. in the absence of benzonitrile, the irreversible formation of (binap)2ni occurs quickly. benzonitrile (10 equiv relative to complex 7) was added so that catalyst decomposition was not observed by p nmr spectroscopy over the time of the reaction. the kinetic behavior was assessed for the coupling of 4-chlorobenzotrifluoride with octylamine catalyzed by the combination of complex 7 in the presence of phcn and naobu at room temperature (eq 8). the initial rates were measured by f nmr spectroscopy using 4-ocf3-anisole as the internal standard. the rate of the amination reaction was determined by measuring the formation of n-octyl-4-(trifluoromethyl)aniline with respect to time. the plots of concentrations of n-octyl-4-(trifluoromethyl)aniline vs time at various concentrations of each reagent are shown in figures s1s5 in the supporting information. the plots of the initial rates of the reaction vs the concentrations of the catalyst, aryl chloride, and benzonitrile are shown in figure 2.8 the kinetic analysis showed that this nickel-catalyzed amination reaction of aryl chlorides is first order in the nickel catalyst, first order in aryl chloride, and inverse first order in phcn. the remaining reagents, naobu and amine, did not affect the initial rate of the reaction. these data indicate that oxidative addition of the aryl chloride to (binap)ni(0), formed by reversible dissociation of phcn from the catalyst resting state (binap)ni(-nc-ph), is the turnover-limiting step in the amination reaction. plots of initial rates vs concentration of catalyst, aryl chloride, and benzonitrile for the amination of 4-chlorobenzotrifluoride (0.101.0 m) with n-octylamine (0.30 m) catalyzed by (binap)nicl(c6h4-4-cf3) (0.00600.018 m) in the presence of benzonitrile (0.0900.180 m) and naobu (0.30 m) at room temperature. the mechanism of palladium-catalyzed cross-coupling reactions with aryl halides as electrophiles has been extensively studied. these studies reveal that the halide identity has a dramatic effect on the mechanism for the oxidative addition of aryl halides to pd(0) species. the additions of the less reactive aryl chlorides occurs through lower-coordinated pd(0) intermediate than the additions of more reactive aryl iodides. however, such mechanistic data has not been gained for the nickel-catalyzed amination of aryl halides. for the nickel-catalyzed enantioselective -arylation of ketones, we found that aryl chlorides react in much higher yields and with much higher enantioselectivities than aryl bromides, and we attributed this dramatic effect of halide on the reaction yield and enantioselectivity to the faster decomposition of the arylnickel(ii) bromide intermediate relative to the arylnickel(ii) chloride intermediate to their corresponding ni(i) halide complexes. because the ni(0) complex 1 ligated by binap and phcn catalyzes the amination of both aryl chlorides and aryl bromides, we can compare directly the kinetics and mechanism of the amination reactions of aryl chlorides and aryl bromides catalyzed by this nickel system. to do so, we conducted kinetic experiments on the amination of aryl bromides that were similar to those we conducted on the amination of aryl chlorides. we monitored by p nmr spectroscopy the reaction of 4-bromobenzotrifluoride with octylamine catalyzed by (binap)ni(-nc-ph) in the presence of naobu at room temperature. as was the case in the reactions of chloroarenes, (binap)ni(-nc-ph) was identified as the resting state of the catalyst in the reaction of 4-bromobenzotrifluoride with octylamine. kinetic studies were conducted on the reaction of 4-bromobenzotrifluoride with octylamine catalyzed by (binap)nibr(c6h4-4-cf3) (11) in the presence of added phcn (eq 8). the initial rates were measured for various concentrations of each reagent while keeping the other reagents in excess. the plots of concentrations of n-octyl-4-(trifluoromethyl)aniline vs time at various concentrations of each reagent are shown in figures s7s11. the plots of the initial rates of the reaction vs the concentrations of the catalyst, aryl chloride, and benzonitrile are shown in figure 3. plots of initial rates vs concentration of catalyst, aryl bromide, and benzonitrile for the amination of 4-bromobenzotrifluoride (0.100.80 m) with n-octylamine (0.30 m) catalyzed by (binap)nicl(c6h4-4-cf3) (0.00600.018 m) in the presence of benzonitrile (0.0900.180 m) and naobu (0.30 m) at room temperature. like the amination of 4-chlorobenzotrifluoride, the amination of 4-bromobenzotrifluoride with octylamine is first order in the nickel catalyst, first order in aryl halide, zero order in naobu, and zero order in amine. in contrast to the reaction of 4-chlorobenzotrifluoride, which is inverse first order in phcn, the amination of 4-bromobenzotrifluoride is zero order in phcn. this order in phcn, in combination with the first order in aryl bromide, indicates that the bromoarene reacts directly with (binap)ni(-nc-ph) during the turnover-limiting step of the amination of the bromoarene without dissociation of phcn. the different reactivities of aryl halides with binap-ligated nickel complexes of different coordination numbers parallels a trend in oxidative addition to pd(0) complexes noted in the introduction to this section. based on the stoichiometric reactions of the isolated binap-ligated arylnickel halides with primary amines in the presence of base and the conducted kinetic studies, we propose a catalytic cycle depicted in scheme 6 for the nickel-catalyzed amination of aryl chlorides and aryl bromides reported in this paper. the observed first order rate-dependence on the concentrations of both the catalyst and aryl halides indicates that the oxidative addition of aryl halides to binap-ligated ni(0) species to form (binap)niar(x) (x=cl or br) is the turnover-limiting step for both amination processes. this binap-ligated arylnickel(ii) halide complex subsequently reacts with primary amine and naobu to form an arylnickel amido complex, followed by reductive elimination of the n-alkyl aniline product in the presence of phcn to regenerate (binap)ni(-nc-ph), which was confirmed as the catalyst resting state. interestingly, different rate-dependences on the concentration of phcn were observed for this nickel-catalyzed amination of aryl chlorides and aryl bromides. the reaction of aryl chlorides is inverse first order in phcn, whereas the reaction of aryl bromides is zero order in phcn. these reaction orders indicate that aryl chlorides and aryl bromides react with different nickel(0) species. the aryl chlorides react after reversible dissociation of phcn from (binap)ni(-nc-ph) to form the lower-coordinate nickel(0) species (binap)ni(0) and ultimately the binap-ligated arylnickel(ii) chloride complex. however, the aryl bromides react directly with (binap)ni(-nc-ph) to form binap-ligated arylnickel(ii) bromide complex and the nitrile dissociates during or immediately after the oxidative addition process. one could imagine the zero-order dependence on added phcn could indicate that dissociation of this ligand is rate limiting, but the first-order dependence of the reaction on the aryl bromide is inconsistent with this proposal. in addition to the steps within the catalytic cycle that form the arylamine product, there are several pathways that generate catalytically inactive nickel species. first, the reaction of (binap)niar(cl) with amine rnh2 forms the catalytically inactive (rnh2)2niar(cl) and free binap. the released free binap in the reaction mixture traps the (binap)ni(0) fragment generated by dissociation of phcn from (binap)ni(-nc-ph) or reductive elimination of n-alkyl aniline from the binap-ligated arylnickel(ii) amido complex to form (binap)2ni. (binap)2ni does not undergo oxidative addition of the aryl halide and does not catalyze the amination reaction. second, thermal decomposition of (binap)niar(x) (ar=electron-neutral and electron-rich aryl groups) affords the catalytically inactive [(binap)ni(-x)]2 with concomitant formation of biaryl. c bond cleavage of the binap backbone is a potential pathway for the deactivation of the nickel catalyst. indeed, this complex was observed to accumulate (approximately 6.4 mm of the 16 mm concentration of initial catalyst) during the reaction of 4-chloroanisole with octylamine. to gain information on the relative rates of the amination of aryl chlorides and aryl bromides and the effect of temperature and concentration of phcn on the selectivity of the amination reaction for an aryl chloride versus an aryl bromide, we conducted a series of reactions with an aryl halide containing both chloride and bromide and a mixture of aryl halides in the presence of various amounts of phcn at room temperature or 50 c. the amination of 1-bromo-4-chlorobenzene with octylamine catalyzed by 3 mol% of (binap)ni(-nc-ph) at 50 c occurred selectively at the c br bond, and the product of the reaction at the c cl bond was not detected by gc-ms analysis. (a, scheme 7). however, side-by-side reactions of chlorobenzene and bromobenzene under the same conditions occurred in the same gc yield (98%) (b, scheme 7). the amination of equal amounts of 1-bromo-4-butylbenzene and 4-chlorotoluene with octylamine catalyzed by 3 mol% of (binap)ni(-nc-ph) was conducted at both room temperature and 50 c (c, scheme 7). at both temperatures, these reactions occurred in similar yields, but with different selectivity. at room temperature, 1-bromo-4-butylbenzene was converted selectively over 4-chlorotoluene, and a product ratio of 3:1 was obtained. however, at 50 c, 1-bromo-4-butylbenzene and 4-chlorotoluene converted equally. br bond in 1-bromo-4-chlorobenzene (a, scheme 7), the decreased selectivity for amination of the c br bond over the c cl bond in different haloarenes might stem from irreversible or nearly irreversible binding of the haloarene to ni(0) to form an arene -complex prior to cleavage of the carbon halogen bond. this preferential intramolecular oxidative addition has recently been observed for the ni-catalyzed kumada cross-coupling reactions that are part of chain-growth polymerizations. to evaluate the effect of phcn on the selectivity between the amination of an aryl chloride and an aryl bromide, we conducted the amination of equal amounts of 1-bromo-4-butylbenzene and 4-chlorotoluene with octylamine catalyzed by 3 mol% of (binap)ni(-nc-ph) in the presence of 0.9 equiv of phcn (relative to octylamine) (d, scheme 6). because our kinetic studies revealed different dependences of the reaction rate on phcn for this nickel-catalyzed amination (inverse first order and zero order on phcn for the reaction of aryl chloride and aryl bromide, respectively), we considered that an increased selectivity for the conversion of aryl bromide over aryl chloride would be observed for reactions conducted with higher concentrations of phcn than for reactions conducted with lower concentrations of phcn. consistent with this prediction, the selectivity was higher (30:1 for the reaction at room temperature and 9:1 for the reaction at 50 c) for the amination of 1-bromo-4-butylbenzene versus the amination of 4-chlorotoluene for reactions run with higher concentrations (from 0.004 to 0.18 m) of benzonitrile at both room temperature and 50 c for 24 h. these data show that the difference in ni(0) species that adds the different aryl halides can be used to beneficially affect selectivity. several first-row metal complexes catalyze cross coupling reactions, and many catalyze the coupling of certain classes of chloroarenes. however, no first row metal complex has been shown to catalyze the coupling of primary alkylamines with unactivated chloroarenes. copper complexes couple bromoarenes and iodoarenes with primary amines, but they do not catalyze the coupling of chloroarenes with primary amines. previously, the combination of ni(cod)2 and dppf was shown to couple an electron-poor chloroarene with a primary amine, but this catalyst did not couple unactivated chloroarenes with primary amines. a set of preliminary studies we conducted have shown that the complexes (dppf)ni(cod) or (dppf)2ni generated in situ by the reaction of ni(cod)2 and dppf do not add aryl chlorides at ambient temperature, and the reaction of chloroarenes with (dppf)ni(cod) or (dppf)2ni at elevated temperatures forms (dppf)ni(i)cl and biaryl. this formation of (dppf)2ni(0) and (dppf)ni(i)cl at the elevated temperatures required for oxidative addition of chloroarene to occur, likely prevented productive coupling reactions with unactivated chloroarenes. these observations further illustrate the importance of the nitrile-ligated precursor with the general formula l2ni(-nc-ph). nickel complexes of n-heterocyclic carbenes have been shown to couple aryl chlorides and sulfonates with secondary amines and with arylamines, but not primary alkylamines. mechanistic studies on the reactions of secondary amines catalyzed by the complexes of n-heterocyclic carbenes are too limited to determine the origin of their lack of reactivity with primary amines, but recent studies have shown that the arylnickel halide complexes containing hindered n-heterocyclic carbenes are not formed by the reaction of (imes)2ni(0) with chlorobenzene, bromobenzene, and iodobenzene. instead, ni(i) species are formed, and this formation of ni(i) complexes could either constitute the pathway for catalyst decomposition or a mechanism for reaction with this catalyst involving odd-electron nickel intermediates. we have shown that nickel complexes containing common aryl bisphosphine ligands can catalyze the coupling of aryl chlorides and bromides with primary amines. in particular, we have shown that the mixed ni(0) species (binap)ni(-nc-ph) containing one bisphosphine and one side-bound nitrile is a particularly active catalyst for the coupling of chloroarenes with primary amines and is more active than the related (binap)2ni catalyst. a range of electronically varied aryl halides and nitrogen-containing heteroaryl chlorides, including pyridine, quinoline, and isoquinoline derivatives, couple with a variety of aliphatic primary amines in high isolated yields. several aspects of the current system lead to the ability of this first-row metal system to catalyze this class of amination reaction. in general, we attribute the high yields for these amination reactions to the facile oxidative addition of aryl chlorides and heteroaryl chlorides to the (binap)ni(-nc-ph) precatalyst at ambient temperatures. detailed studies on the mechanism of the amination reaction the following conclusions about the mechanism of this coupling process have been drawn from these studies: (1) the oxidative addition of aryl chlorides to (binap)ni(-nc-ph), together with the stoichiometric reactions of (binap)niar(cl) with primary aliphatic amines in the presence of base, support a reaction pathway involving a ni(0)/ni(ii) couple in the catalytic cycle. (2) the oxidative addition of aryl chlorides and heteroaryl chlorides to the single-component nickel precursor (binap)ni(-nc-ph) at ambient temperatures prevents the formation of inactive ni species. (3) ni(i) intermediates, which have been observed in oxidative addition studies to phosphine-ligated ni(0) complexes, appear to result from decomposition of the ni(ii) product of oxidative addition as opposed to forming from one-electron pathways for oxidative addition to ni(0). (4) the reaction of (binap)ni(-nc-ph) with electron-rich aryl chlorides, such as 4-chloroanisole, leads to the p c bond cleavage of the backbone of binap and forms the nickel complex 9 containing two monophosphine ligands. the formation of the catalytically inactive complex 9 explains the high catalyst loading required for the amination of electron-rich aryl chlorides. (5) mechanistic and kinetic studies revealed that the turnover-limiting step of these nickel-catalyzed amination reactions of aryl chlorides is oxidative addition of the aryl chloride to (binap)ni(0), which is formed by dissociation of phcn from the catalyst resting state (binap)ni(-nc-ph). (6) mechanistic and kinetic studies imply that the turnover-limiting step of the reactions of aryl bromides is also oxidative addition, but that aryl bromides react with a different nickel species, of composition (binap)ni(-nc-ph) containing a bound nitrile. (7) the formation of catalytically inactive bis(amine)-ligated ni(ii) species (rnh2)2niar(cl), ni(i) species [(binap)ni(-cl)]2, and bis-binap-ligated ni(0) species (binap)2ni are the major pathways for catalyst inactivation. further studies to improve the lifetime of the ni-bisphosphine catalysts, to determine the mechanism by which the phosphine-ligated ni(i) species form as a means to prevent this detrimental path, and to determine if ni(i) complexes are generated during oxidative addition of haloarenes will be the subject of future work.

first-row metal complexes often undergo undesirable one-electron redox processes during two-electron steps of catalytic cycles. we report the amination of aryl chlorides and bromides with primary aliphatic amines catalyzed by a well-defined, single-component nickel precursor (binap)ni(2-nc-ph) (binap=2,2-bis(biphenylphosphino)-1,1-binaphthalene) that minimizes the formation of ni(i) species and (binap)2ni. the scope of the reaction encompasses electronically varied aryl chlorides and nitrogen-containing heteroaryl chlorides, including pyridine, quinoline, and isoquinoline derivatives. mechanistic studies support the catalytic cycle involving a ni(0)/ni(ii) couple for this nickel-catalyzed amination and are inconsistent with a ni(i) halide intermediate. monitoring the reaction mixture by 31p nmr spectroscopy identified (binap)ni(2-nc-ph) as the resting state of the catalyst in the amination of both aryl chlorides and bromides. kinetic studies showed that the amination of aryl chlorides and bromides is first order in both catalyst and aryl halide and zero order in base and amine. the reaction of a representative aryl chloride is inverse first order in phcn, but the reaction of a representative aryl bromide is zero order in phcn. this difference in the order of the reaction in phcn indicates that the aryl chloride reacts with (binap)ni(0), formed by dissociation phcn from (binap)ni(2-nc-ph), but the aryl bromide directly reacts with (binap)ni(2-nc-ph). the overall kinetic behavior is consistent with turnover-limiting oxidative addition of the aryl halide to ni(0). several pathways for catalyst decomposition were identified, such as the formation of the catalytically inactive bis(amine)-ligated arylnickel(ii) chloride, (binap)2ni(0), and the ni(i) species [(binap)ni(-cl)]2. by using a well-defined nickel complex as catalyst, the formation of (binap)2ni(0) is avoided and the formation of the ni(i) species [(binap)ni(-cl)]2 is minimized.

PMC3985683

pubmed-327

increasing cytosolic calcium ion (ca) concentration is essential for the contraction of smooth muscle cells. the increase results from the influx of ca through the plasma membrane and release of ca from intracellular stores, mainly the sarcoplasmic reticulum (sr) [14]. phenylephrine (pe) or angiotensin ii (ang ii) induces receptor-coupled g protein-induced phosphoinositide 3-kinase (pi3k) and phospholipase c (plc) activation, resulting in ca-dependent vasoconstriction in smooth muscle cells [510]. pi3k activity facilitates the production of 3-phosphorylated phosphoinositides such as phosphatidylinositol 3-phosphate (pi(3)p), phosphatidylinositol (3,4)-bisphosphate (pi(3,4)p2), and phosphatidylinositol (3,4,5)-triphosphate (pi(3,4,5)p3) [11, 12]. among these, pi(3,4,5)p3 stimulates the l-type ca channel (12), a voltage-dependent ca channel that plays an important role in the regulation of vascular tone [5, 12, 13]. activated plc is an effector in the stimulation of ca release from the endoplasmic reticulum (er) or the sr [1416]. plc hydrolyzes phosphatidylinositol 4,5-bisphosphate (pip2) into diacylglycerol (dag) and inositol (3, 4, 5)-triphosphate (ip3). the latter is released as a soluble structure into the cytosol, where it binds to ip3 receptors in the sr [15, 17]. this binding process increases the cytosolic ca concentration and smooth muscle constriction [15, 16]. the herb cinnamomi ramulus (cr) has traditionally been used in asia and europe to treat maladies involving blood circulation and inflammation. in one study, an aqueous extract of cr ameliorated sucrose-induced blood pressure elevation in spontaneously hypertensive rats. recently, we reported that cr ethanol extract (cre) reduces vascular contraction through the inhibition of voltage-dependent ca channels. the present study explored the suggestion that the vasodilatory effect of cre is related to ca-dependent mechanisms in rat aorta. all animals were provided with food and water ad libitum and allowed to adapt to the experimental conditions (temperature, 21 2c; humidity, 5060%) for 1 week. rabbit polyclonal antibodies against phosphorylated plc (pplc), -actin, and anti-rabbit secondary antibody were purchased from santa cruz biotechnology (santa cruz, calif, usa). pi3k/p85 antibody was purchased from cell signaling technology (beverly, mass, usa). pe, ang ii, verapamil, nifedipine, fpl64176, 2, 4, 6-trimethyl-n-(meta-3-trifluoromethyl-phenyl)-benzenesulfonamide (m-3m3fbs), u73122 and caffeine were purchased from sigma-aldrich (st. louis, mo, usa). cr (twigs of cinnamomum cassia blume) collected in china in november 2009 was purchased from humanherb (gyeongsan, korea). a voucher specimen (cre08) has been deposited in the college of oriental medicine, dongguk university. dried cr (100 g) was extracted with 500 ml of 70% ethanol by heating at 75c for 3 h. the extract was filtered through whatman filter paper (whatman international, maidstone, uk) to remove the insoluble materials. after filtration, the extracts were concentrated by rotary evaporation using a model vv2000 apparatus (heidolph, walpersdorfer, germany) at a temperature of 75c and then dried using a model fd8508s freeze dryer (ilshin, busan, korea). the ec50 value of 0.1 mg/ml cre was used in all experiments. in a previous research, cinnamaldehyde and coumarin also, cinnamaldehyde was known as major active compound of cr for vasodilation, antitumor, and antifungal activity. all procedures were performed according to protocols approved by the institutional animal care and use committee of dongguk university. briefly, rats were sacrificed and their thoracic aortas were immediately excised and immersed in ice-cold krebs solution (115.0 mm nacl, 4.7 mm kcl, 2.5 mm cacl2, 1.2 mm mgcl2, 25.0 mm nahco3, 1.2 mm kh2po4, and 10.0 mm dextrose). the aortas were cleaned of all adherent connective tissue and cut into 3 mm long ring segments. endothelium was removed from the internal surface of each segment by gentle rubbing with forceps. one triangle was anchored to a stationary support and the other was connected to a ft03 isometric force transducer (grass, quincy, mass, usa). each vessel ring was incubated in a water-jacketed organ bath (10 ml) that was maintained at 37c and aerated with a mixture of 95% o2 and 5% co2. each ring was stretched passively by imposing the optimal resting tension of approximately 2.0 g, which was maintained throughout the experiment. each endothelium-free aortic ring was allowed to equilibrate in the organ bath for at least 50 min before the experiment involving the contractile response to 5 m ang ii, 1 m pe, 10 m fpl64176, 5 g/ml m-3m3fbs, or 30 mm caffeine. endothelium-free rings were used because preliminary experiments (data not shown) established that cre relaxes vascular constriction in an endothelium-independent manner. the denudation of endothelium was assessed by treating the rings with 1 m acetylcholine. isometric tension was recorded using a powerlab/8sp computerized data acquisition system (adinstruments, castle hill, nsw, australia). the influence of cre on extracellular ca influx was studied in ca-free krebs solution. after equilibration of the ring in ca-free krebs solution containing 60 mm kcl, cumulative doses of cacl2 were added (0.3, 0.6, 1, 1.5, 2.5, 5, and 10 mm, in order) with preincubation of cre in organ bath. the cacl2 dose-dependent maximum constriction of the aortic ring with 60 mm kcl in ca-free krebs solution was expressed as 100%. to determine the influence of cre on ca influx through the l-type ca channel, aortic rings were pretreated with nifedipine or verapamil before pe contraction, and were preincubated with cre before contraction by fpl64176. to investigate the inhibitory effect of cre on intracellular ca release by pe in ca-free conditions, and by caffeine in normal krebs solution, the transient contraction of cre preincubated aortic rings was measured. to further investigate the relationship with the plc pathway, aortic rings were constricted with m-3m3fbs, and were preincubated with u73122 prior to contraction by pe. a previously described protocol was used for preparation of protein extract with some modifications. briefly, endothelium-free aortic rings were contracted with 1 m pe or 5 g/ml m-3m3fbs, and then treated with cre for 30 min. the aortic rings were quick frozen by immersion in acetone containing 10% trichloroacetic acid (tca) and 10 mm dithiothreitol (dtt) precooled to 80c. when used, recovered samples were homogenized in buffer containing 320 mm sucrose, 50 mm tris, 1 mm edta, 1% triton x-100, 1 mm dtt, and the following protease inhibitors: leupeptin (10 g/ml), trypsin (10 g/ml), aprotinin (2 g/ml), or phenylmethylsulphonyl fluoride (100 g/ml). the protein samples were electrophoresed and the resolved proteins were transferred to a nitrocellulose membrane. the membrane was incubated with primary antibodies and then treated with horseradish peroxidase-conjugated anti-rabbit igg as a secondary antibody. all bands were detected using an enhanced chemiluminescence system (amersham biosciences, buckinghamshire, uk). each set of experiments was done at least three times and results are presented as the mean sd. the statistical significance of differences between mean values was assessed with student's t-test or anova. ang ii increases the intracellular ca concentration in vascular smooth muscle cells through a sequence of events following activation of ang ii type 1 receptor and l-type calcium channels [6, 7]. pe- or ang ii-induced contraction was significantly dilated by 53.6 7.8% and 66.0 5.4%, respectively, as compared to maximal tension (figure 1), indicating that that cre-mediated vasodilation may be related to decreased intracellular ca concentration. to determine the influence of cre on ca influx, the change of contraction was measured by adding cacl2 in an accumulative manner (0.3, 0.6, 1, 1.5, 2.5, 5, and 10 mm, in order) before and after cre pretreatment in ca-free krebs solution containing 60 mm kcl. the vasoconstriction rate at the aforementioned cacl2 concentrations were 7.7 8.1%, 23 16%, 44 16.7%, 59 17%, 72 14%, 88.4 9.4%, and 100%, respectively, (the latter represents the maximum contraction value of the aortic ring, achieved at 10 mm cacl2). these contractions were significantly reduced by 1.9 2.2%, 5.8 4.1%, 8.3 6.3%, 11.4 4.4%, 22.3 1.9%, 24.8 6.2%, and 29.7 3.8% (same respective cacl2 concentrations) with cre-pretreatment (figure 2). to discern the effect of cre on the l-type calcium channel, the influence of the l-type calcium channel blocker nifedipine (100 m) or verapamil (1 m), and the l-type calcium channel activator fpl64176 (10 m) on vasorelaxation of cre against pe-induced contraction of aortic rings was measured. pretreatment of aortic rings with nifedipine or verapamil significantly inhibited the relaxant effect of cre (figure 3(a)). previous studies have shown that fpl64176 increases extracellular ca entry, thereby enhancing the cytosolic ca concentration [23, 24]. presently, fpl64176 induced contraction, which plateaued at 3.75 0.22 g in 30 min, was inhibited by 2.4 0.1 g with preincubation of cre (figure 3(b)). to assess whether cre is involved in ca release-mediated vasoconstriction from intracellular stores, the transient contraction by pe or caffeine was examined in cre preincubated aortic rings. preincubation reduced the magnitude of contraction by pe from 0.32 0.6 g to 0.1 0.6 g (figure 4(a)). the transient contraction induced by 30 mm caffeine was also reduced by cre pretreatment (figure 4(b)). to evaluate whether the relaxant effect of cre was involved in the plc pathway, the plc pathway inhibitor u73122 and activator m-3m3fbs were used. u73122 pretreatment significantly inhibited the relaxant effect of cre on pe-induced contraction from 56.9 2.7% to 8.5 1.3% (figure 5(a)). m-3m3fbs (5 g/ml)-induced contraction was relaxed significantly with cre treatment (figure 5(b)). pi3k is directly activated by g-protein for generation of pip3, which eventually stimulates l-type calcium channels in vascular myocytes [5, 12]., ip3 stimulates intracellular ca release from the sr for vasoconstriction [15, 17]. presently, pe and m-3m3fbs increased the expression levels of pi3k (4.5 0.38 and 2.0 0.32, resp.) and pplc (4.1 0.30 and 2.5 0.14, resp.), which were significantly decreased by cre. pe-induced pi3k expression was decreased by 2.8 0.70 at 50 g/ml and by 0.2 0.6 at 100 g/ml. pplc expression was also decreased by 2.0 0.30 at 50 g/ml and by 1.8 0.1 at 100 g/ml (figure 6(a)). m-3m3fbs-induced pi3k expression was downregulated by 0.6 0.1 at 50 g/ml and by 0.5 0.2 at 100 g/ml, and pplc expression was decreased by 1.4 0.1 at 50 g/ml and by 0.3 0.1 at 100 g/ml (figure 6(b)). its bark and twig are known as cinnamomi cortex (cc) and cinnamomi ramulus (cr), respectively. cc inhibits helicobacter pylori and ameliorates sucrose-induced blood pressure elevation in spontaneously hypertensive rats. furthermore, cre exerts an endothelium-independent vasodilatory response through inhibition of voltage-dependent ca channels. the present study investigated the vasodilatory effect of cre resulting from the inhibition of both ca influx and release in rat aorta. pe or ang ii stimulate plc isoforms to generate ip3 through the activation of g proteins, causing release of activator ca from sr [9, 10, 1416]. presently, cre markedly and similarly relaxed aortic rings that were precontracted with pe or angii. these results suggest that cre-mediated vasodilation may be involved in the regulation of ca mobilization. to assess this, firstly, whether cre actually inhibits extracellular ca influx or not, we measured the tension of aortic rings by accumulative addition of cacl2 in ca-free krebs solution containing 60 mm kcl. preincubation with cre significantly reduced rat aortic contraction by addition of cacl2,, indicating inhibition of ca influx. nifedipine (100 m) and verapamil (1 m) pretreatment inhibited the vasodilative effect of cre on pe-induced constricted aortic rings from 54.9 4.1% to 15.3 2.1% and 13.9 5.2%, respectively. in addition, preincubation with cre reduced the contraction of aortic ring by 10 m fpl64176. these results support the suggestion that the vasodilative effect of cre is related to the inhibition of l-type calcium channel in the cell membrane. the sr is the major source of ca release into the cytosol [1, 16, 17]. this ca release is induced by the ip3 second messenger, which is generated by plc activation. ca release from the sr is considered to be the initial mechanism in agonists such as pe- and ang ii-induced vasoconstriction [6, 17]. pe-induced transient constriction is dependent on ca release from the sr through the ip3 signal pathway in ca-free krebs solution; however, caffeine is dependent on ca-induced ca release from the sr [27, 28]. to demonstrate the effects of cre on ca release from the sr, transient contractions induced by pe in ca-free krebs solution and induced by caffeine in normal krebs solution were investigated. cre significantly reduced the magnitudes of transient contraction by pe and caffeine, suggesting cre inhibits ca release from the sr by blocking the ip3-induced ca release and ca-induced ca release mechanisms. pretreatment with the plc inhibitor u73122 significantly reduced the vasorelaxation of cre on pe-induced vasoconstriction, and cre relaxed m-3m3fbs-induced vasoconstriction. additionally, we analyzed the expression levels of the intracellular signaling regulator proteins pi3k and plc. pi3k generates various 3-phosphorylated phosphoinositides through activation by g-proteins, especially pi(3,4,5)p3 stimulates the l-type ca channel that plays an important role in the regulation of vascular tone [8, 11, 12]. on the other hand, plc formats the two potent second messengers ip3 and dag especially, ip3 induces the activation of ip3 receptor on the sr membrane, opening a calcium channel, resulting in the release of ca into the cytosol [14, 17]. presently, pe- or m-3m3fbs-induced phosphorylation of plc and upregulation of pi3k/p85 protein expression were inhibited by cre (figure 6). the collective data supports the idea that cre dilates vascular contraction through the inhibition of both ca influx via the l-type ca channel and ip3-induced ca release from the sr. in conclusion, the data supports the vasorelaxation of cre through the inhibition of ca influx and ca release. therefore, cre may be useful as a drug for the treatment and prevention of high blood pressure associated with ca-dependent contraction of smooth muscle.

contraction of vascular smooth muscle cells depends on the induction of cytosolic calcium ion (ca2 +) due to either ca2+influx through voltage-gated ca2+channels or to receptor-mediated ca2+release from the sarcoplasmic reticulum. the present study investigated the vasorelaxation effect of cinnamomi ramulus ethanol extract (cre) and the possible mechanisms in rat aorta. cre (0.1 mg/ml) relaxed vasoconstriction induced by phenylephrine (pe; 1 m) and angiotensin ii (5 m). preincubation with cre significantly reduced the rat aortic contraction by addition of cacl2 in ca2+-free krebs solution and fpl64176 (10 m). pretreatment with nifedipine (100 m) or verapamil (1 m) significantly reduced the cre-mediated vasorelaxation of pe-induced vascular contraction. in addition, cre also relaxed the vascular contraction caused by m-3m3fbs (5 g/ml), but u73122 (10 m) significantly inhibited the vasorelaxation of pe precontracted aortic rings. furthermore, cre significantly reduced the magnitude of pe- and caffeine (30 mm)-induced transient contraction. in vascular strips, cre downregulated the expression levels of phosphorylated plc and phosphoinositide 3-kinase elevated by pe or m-3m3fbs. these results suggest that cre relaxes vascular smooth muscle through the inhibition of both ca2+influx via l-type ca2+channel and inositol triphosphate-induced ca2+release from the sarcoplasmic reticulum.

PMC3137977

pubmed-328

cell migration requires the rearrangement of adhesions and cytoskeleton in response to extracellular stimuli to form a leading edge that allows directed locomotion. in most cell types, migration-related adhesive structures are composed of integrin heterodimers and intracellular associated proteins clustered in plaques termed focal complexes and their more mature variant, focal adhesions. in addition to these adhesive structures, dcs also assemble distinctive adhesions named podosomes that are characteristic of cells of the myeloid lineage including macrophages and osteoclasts [4, 5]. the molecular composition of podosomes is similar to that of focal complexes and focal adhesions. however, they have a unique organization with actin filaments bundled in discrete foci forming a conical core containing distinctive elements such as gelsolin, cortactin, the actin-nucleating factor arp 2/3 complex, and the scaffolding protein wasp surrounded by a ring of integrins and integrin-associated proteins [4, 5]. wasp is an essential component of podosomes, where it activates the arp2/3 complex inducing actin polymerization. wip has also been detected in the core of podosomes in endothelial cells expressing egfp-wip, and although there is evidence indicating that wip plays a major role in regulating the activity of wasp family proteins and the dynamics of actin filaments [8, 9], it remains unknown how wip participates in the assembly of podosomes. to study the role of wip in podosome formation, the distribution of f-actin and vinculin was examined in wild-type and wip dcs by confocal microscopy. as expected, podosomes were grouped in clusters in wild-type dcs (figures 1a and 1c). those few podosomes formed in wip dcs displayed an abnormal structure having less discrete actin cores and disorganized vinculin rings around f-actin (figure 1d). large focal contacts containing vinculin comprised the most striking adhesion structures in wip dcs (figures 1b and 1e), replacing podosomes as the major points of contact with the substratum. the critical involvement of wip in dc podosome formation is also supported by the presence of endogenous wip in the core of podosomes in wild-type cells (figure 1f). our data suggest that the key role of wip in podosome formation is in the organization of f-actin and the clustering of integrins and associated proteins. the absence of wip had a profound effect on the organization of f-actin within dcs. while the bulk of f-actin in wild-type dcs was associated with the core of podosomes (table 1, see figure s1a in the supplemental data available online), in wip dcs it distributed among various anomalous structures including actin cables (table 1, figure s1b), large fused actin aggregates, commonly with a circular shape (table 1, figure s1c), and extensive membrane ruffles (table 1, figure s1d). clustering of podosomal integrins and the integrin-associated proteins paxillin and talin was also affected. in wild-type dcs, 2-integrins formed rings around the f-actin cores of podosomes (figure s2a) as previously described. in contrast, wip dcs failed to cluster 2-integrins into rings, and instead they formed small integrin-containing focal contacts scattered through the basal surface and around the periphery of the cell (figure s2b) or large plaques associated with anomalous actin-rich aggregates (figure s2c). facs analysis showed that wild-type and wip dcs expressed equivalent levels of 1- and 2-integrins (figure s3), indicating that wip does not affect integrin expression. paxillin and talin, which normally array around the podosome core in wild-type dcs (figures s2d and s2 g), in wip dcs localized to focal adhesions (figures s2e and s2h) containing 1 integrins (data not shown) or formed amorphous clusters colocalizing with the anomalous actin aggregates (figures s2f and s2i). the shift of adhesion composition and structure from podosomes (short half-life in the range of 30 s to 5 min) to large focal contacts (long half life in the range of 30 to 60 min) in wip dcs had a negative impact on adhesion turnover (figure 1 g). as previously described, interference reflection microscopy (irm) analyses showed podosomes in wild-type dcs rapidly assembled and disassembled, giving a high turnover index (figure 1 g). in wip dcs, although multiple transient and unstable lamellar protrusions were developed at the cell periphery, the major adhesion sites in contact with the substratum were highly stable with a significantly lower turnover index compared to wild-type (figure 1 g). interestingly, we found a decrease in podosome turnover in wild-type dcs plated on fibronectin (fn) and icam-1, indicating that integrin ligands promote podosome stability (figure 1 g). this stability of adhesion on integrin ligands correlates with an increase in the percentage of wild-type dcs with well-defined podosomes and small focal contacts (figure 1a) and accumulation of podosomal f-actin, integrins, and associated proteins (data not shown). in contrast, no significant differences were detected in turnover index of adhesions between wip dcs plated on different substrata (figure 1 g). the presence of integrin ligands failed to induce major changes in the composition of adhesions of wip dcs (figure 1b) except for an increase in the size of the focal adhesions. taken together, our data indicate that wip plays a key role in regulating dc adhesion structure and dynamics on biologically relevant substrata, processes crucial for the migratory capacity of cells. stabilization of the leading edge in the direction of dc movement is provided by podosomes [13, 14]. migrating wild-type dcs clearly polarized, forming a patent leading edge, with the rear of the cell retracting at a similar rate, allowing net translocation of the cell body. in contrast, wip dcs failed to develop a major leading front and instead formed multiple simultaneous and unstable lateral lamellae and ruffles (figures 2a2e; movies s1 and s2). cortactin is an arp2/3 activator that plays a major role in the formation of podosomes [15, 16], establishment of cell polarization, and also generation of cellular cortical protrusions. it has been proposed that cortactin synergises with the wasp family of proteins to induce actin polymerization, and it is thought that the actin filament meshwork triggered by the n-wasp/cortactin pair may have a different organization from actin meshworks triggered by n-wasp or cortactin alone. importantly, wip has been shown to interact with cortactin and induce cortactin-mediated actin polymerization. our results show that in the absence of wip, cortactin is displaced from podosome cores where it normally colocalizes with f-actin (figure 2f) and is instead associated with random lamellar protrusions and ruffles over the cell periphery (figure 2 g). in addition, we found there was a higher proportion of cortactin associated with the cytoskeletal fraction (triton insoluble) in adherent wip dcs compared to wild-type dcs (figure 2h). taken together, these results show that in the absence of wip, association of cortactin with the cytoskeleton is deregulated and associated with the formation of random cortical protrusions and loss of dc polarity. this suggests that the wasp/wip complex may couple with cortactin to induce a type of meshwork of actin filaments and associated proteins that allow the clustering of 2-integrins during the assembly of podosomes and dc polarization. in the absence of wip, cortactin can not be recruited to form a complex with wasp, discrete actin foci in podosomes fail to form, and instead, cortactin codistributes with actin filaments at the cell margin, resulting in the random protrusions and reduced motility (data not shown) observed in wip dcs. we have previously shown that wasp dcs display equivalent anomalies in 2-integrin clustering and focal contact formation to that observed in wip dcs. also we find here that like wasp dcs, wip dcs fail to polarize and form and stabilize consistent leading edges. recently, it has been proposed that wip contributes to the stabilization of wasp expression and the regulation of wasp-mediated actin rearrangement [8, 22]. we find here that wip dcs express low levels of wasp at the protein level (figure 3a), as recently described for wip t-lymphocytes. levels of wip expression were not affected by the lack of wasp in wasp dcs (figure 3b). since mrna levels of wasp in wip dcs were comparable to those of wild-type dcs (figure 3c) the levels of expression of the wip binding partners cortactin, nck, and crkl was not affected in wip dcs (figure s4). it has been predicted that wip may prevent the exposure of wasp family proteins to proteases, because the 25-residue wasp binding motif from wip wraps around the wip binding domain of n-wasp. wasp, but not n-wasp, is a substrate for the protease calpain in platelets, and we have recently found that calpain also cleaves wasp in migrating dcs. our present results show that wip prevents wasp cleavage by calpain in dcs since inhibition of this protease in wip dcs resulted in major recovery of wasp expression (figures 3d and 3e). this suggests that wip may play a crucial role in regulating the accessibility of wasp for calpain cleavage, which takes place during dissolution of podosomes. a role for wip in the maintenance of wasp levels is also suggested by recent findings showing that in was patients, mutations that prevent wasp binding to wip result in diminished expression of wasp [24, 25]. we suggest that the low levels of wasp in these was patients may be the result of extensive calpain-mediated cleavage because of failure of wasp-wip interaction. surprisingly, the recovery of wasp levels in wip dcs by treatment with calpain inhibitors was not sufficient to induce podosome formation, and large focal contacts remained the major adhesion structures (figure 4a). in addition, forced expression of egfp-wasp in wip dcs treated with calpain inhibitors alone or in conjunction with proteasome inhibitors failed to restore podosome formation, and egfp-wasp remained diffusely distributed in the cytoplasm or associated with anomalous f-actin aggregates that could contain vinculin forming abnormal plaques colocalizing with f-actin (figure 4b, top and middle). this contrasts with the observed recovery of podosome formation and dynamics in wasp dcs (where wip levels are normal) after the expression of egfp-wasp (figure 4b, bottom) [11, 13]. we excluded the possibility that wip binding is essential for the intrinsic actin polymerizing activity of wasp because specific wasp mutants (wasp a134 t and wasp r138p) that interrupt wip binding [24, 27] showed an actin polymerizing activity equivalent to wild-type wasp (figure 4d). these results indicate that wip not only protects wasp from calpain cleavage but also facilitates the localization of wasp to sites of actin polymerization and the organization of integrins, vinculin, and other integrin-associated proteins in circular clusters. the mechanisms by which wip regulates wasp activity to allow podosome formation are yet to be fully elucidated. it is possible that wasp/wip interactions may directly facilitate the recruitment of wasp to cell-surface receptors. alternatively, wip may facilitate the bridging of wasp to these receptors by mediating the interaction with other adaptor proteins or may regulate the function of regulatory proteins such as kinases, known to affect wasp activity [30, 31]. our data show that wip by itself is not sufficient to promote podosome assembly because wasp dcs, which express normal levels of wip, also lack podosomes and assemble large focal contacts and disorganized actin clumps instead. it is tempting to speculate that the cellular responses (of dc) to external soluble ligands such as chemoattractants would recruit wasp/wip complexes coupled to integrin-associated proteins to trigger the assembly of podosomes at appropriate sites in the developing leading edge of the cell. these complexes would provide a cytoskeletal platform that regulates the accurate clustering and activation of 2-integrins, facilitating their function. taken together, our results suggest that wasp and wip work as a functional unit in a cellular context as has been previously proposed [8, 9] to regulate podosome formation and dynamics during the establishment of cell polarity as seen in the chemotactic response to extracellular stimuli. in summary, we have shown that in dcs wip is essential for podosome formation and cell polarity by preventing the extensive degradation of wasp by calpain and by facilitating the recruitment of wasp to discrete foci to form the core of podosomes. the tight coupling between wasp and wip is therefore a key contributor to normal podosome dynamics and likely of major importance to the cell trafficking behavior of dcs.

summarythe wiskott-aldrich syndrome protein (wasp) is an adaptor protein that is essential for podosome formation in hematopoietic cells [1]. given that 80% of identified wiskott-aldrich syndrome patients result from mutations in the binding site for wasp-interacting-protein (wip) [2], we examined the possible role of wip in the regulation of podosome architecture and cell motility in dendritic cells (dcs). our results show that wip is essential both for the formation of actin cores containing wasp and cortactin and for the organization of integrin and integrin-associated proteins in circular arrays, specific characteristics of podosome structure. we also found that wip is essential for the maintenance of the high turnover of adhesions and polarity in dcs. wip exerts these functions by regulating calpain-mediated cleavage of wasp and by facilitating the localization of wasp to sites of actin polymerization at podosomes. taken together, our results indicate that wip is critical for the regulation of both the stability and localization of wasp in migrating dcs and suggest that wasp and wip operate as a functional unit to control dc motility in response to changes in the extracellular environment.

PMC1885947

pubmed-329

alpha1-adrenergic receptors (1-ars) are a heterogeneous family of g-protein-coupled receptors that present in most human and animal tissues, and there are considerable variations in the expression levels of 1-ar subtypes in various tissues of different species [14]. 1-ars play important roles in regulating physiological and pathological responses mediated by catecholamines, particularly in the cardiovascular and urinary systems. in addition to mediating catecholamine-induced vasoconstriction, the 1-ars in vascular wall have been shown to promote proliferation and hypertrophy of arterial smooth muscle cells and adventitial fibroblasts [5, 6]. in the urinary system, the demonstration of 1-ar expression in human prostate, bladder muscle, and smooth muscles has led to the treatment of bladder outlet obstruction and ureteral stones, via blocking these receptors [7, 8]. of the three 1-ar subtypes (1a, 1b, and 1d), the 1d-ar has been the least studied due to difficulties in obtaining significant expression levels and poor coupling to membrane signals due to its intracellular localization [911]. however, recent experiments performed in 1d-ar knockout models suggest that this 1-ar subtype plays an important role in the overall regulation of blood pressure. additionally, armenia et al. reported that 1a- and 1d-ars are the major functional subtypes of renal 1-ars in both normal and streptozotocin-induced diabetic sprague-dawley rats. using in situ hybridization, kurooka et al. identified the gene expression of all three 1-ar subtypes in human kidney cortex they found that intense 1-ar mrna staining was apparent especially in the smooth muscle of arterial walls, whereas weak staining of each of the 1-ar mrnas was observed in the glomeruli and renal tubules. more recently, the presence and distribution of subtypes in human renal pelvis and calyces were evaluated, and 1d-ar was most dense in both followed by 1a and 1b. however, the expression and distribution patterns of 1d-ar in normal and diabetic rat kidneys remain unknown. in the present study, we examined mrna levels of three 1-ar subtypes in the kidney cortex of normal zucker lean (zl) and zucker diabetic (zd) rats by microarray and real-time pcr analyses. confocal immunofluorescence microscopy was performed to evaluate the distribution of 1d-ar in the kidney of zucker rats. furthermore, we investigated whether activation of peroxisome proliferator-activated receptor- (ppar) or ppar, known renoprotective intervention in animal models of type 2 diabetes, would affect renal expression of 1-ar subtypes. six-week-old male zucker lean (zl) and zucker diabetic fatty (zd) rats were purchased from charles river laboratories (wilmington, ma, usa). rats were housed in a temperature-controlled room with a 12: 12-hour light-dark cycle and free access to purina 5008 rat chow and water. blood glucose was monitored using the accu-chek glucometer by tail-vein blood sampling. in a previous study in which we characterized the time course of blood glucose in this model, we showed that blood glucose of the zd rats began to increase at week 8, reached a peak at week 12, and remained at this higher level thereafter. the rats were housed in the animal care facility at the morehouse school of medicine that is aaalac accredited. all animal protocols were approved by the institutional animal care and use committee and were in accordance with the requirements stated in the national institutes of health guide for the care and use laboratory animals. for fenofibrate treatment, 12-week-old zucker rats were divided into 3 experimental groups: vehicle- (0.5% carboxymethylcellulose ig) treated zl, vehicle-treated zd, or fenofibrate- (150 mg/kg/day ig) treated zd (f-zd) rats for 10 weeks. for rosiglitazone treatment, 12-week-old zd animals were treated with rosiglitazone (10 mg/kg/day in drinking water) or vehicles for 8 weeks. glomeruli were isolated from the kidney cortex of zl and zd rats at the age of 7, 12, and 2022 weeks, respectively, by a modified procedure as described previously. briefly, the rats were anesthetized and the kidneys were rapidly removed and placed in hanks ' balanced salt solution (hbss) at ph 7.4. the renal cortex was dissected and cut into small pieces with a surgical blade. glomeruli were isolated by passing the tissues successively through calibrated sieves (pore size: 200, 125, and 65 m) and rinsed with hbss. isolated glomeruli, collected on the 65 m sieve, were resuspended in hbss. total rna was prepared from isolated glomeruli or kidney cortex by using ultrapure trizol reagent according to the manufacturer's instructions (gibco-brl, grand island, ny). the quality of the rna samples was assessed using the agilent 2100 bioanalyzer (g2938a). seven hundred and fifty nanograms of total rna per sample were used for crna synthesis and amplification. cyanine-3-(cy3-) labeled crna was purified and hybridized to agilent whole rat genome 44k oligo microarray chips (p/n g2519f-14870, agilent technologies) according to the manufacturer's instructions. the processed microarrays were scanned with the agilent g2565ba dna microarray scanner (p/n g2505-a). the scanned images were analyzed with agilent feature software (version 9.5.1.1) using default parameters. the resulting text files were loaded into the agilent genespring gx software (version 7.3) for further analysis. significantly differentially expressed -adrenergic receptor genes among zl, zd, and f-zd groups were identified by a threshold of 2 fold change and p 0.05. reverse transcription was performed on equal amounts of total rna by using random hexanucleotide primers to produce a cdna library for each sample. real-time pcr reactions were run on an icycler iq real-time pcr detection system by using taqman universal pcr master mix (applied biosystems, p/n 4304437). 1a-, 1b-, and 1d-ar and -actin gene-specific taqman probe and primer sets were obtained from applied biosystems as assays-on-demand (aod) gene expression products. the aod identification numbers were rn00567876 for 1a-ar, rn01471343 for 1b-ar, rn00577931 for 1d-ar, and 4331182 for rat -actin each sample was run in triplicate, and the comparative threshold cycle (ct) method was used to quantify fold increase (2) compared with controls. for immunofluorescent staining, 5 m thick cryostat sections of oct-embedded kidney samples were used. to study the localization of 1d-ar in the rat kidney, the sections were incubated with a mixture of two antibodies overnight: rabbit anti-1d-ar antibody (1: 100, sigma-aldrich, st. louis, mo), mouse anti--smooth muscle actin (-sma, 1: 100, santa cruz biotechnology, dallas, tx), or goat anti-kidney injury molecule-1 (kim-1, 1: 100, r&d systems, minneapolis, mn). as a negative control, the sections were exposed to nonimmune igg (in replacement of primary antibodies) with the same secondary antibodies, and no specific staining occurred. comparisons among multiple groups were performed by one-way anova and newman-keuls post hoc test. we performed microarray analysis to assess gene expression levels of -adrenergic receptor subtypes in the kidney cortex of 22-week-old normal zl (blood glucose: 108 8 mg/dl) and diabetic zd (blood glucose: 425 35 mg/dl) rats. the expression profile of each experimental group was determined in three animals per group. table 1 shows gene expression levels of 1- and 2-adrenergic receptor subtypes detected in rat kidney tissue. the rank order of expression levels of the three 1-ar mrnas in normal rat kidney cortex was 1b>1d>1a. among these genes compared to normal zl controls, renal cortical 1d-ar gene was increased by 553% in 22-week-old zd rats (table 1). to verify the relative transcript levels of 1a-, 1b-, and 1d-ar subtypes derived from the microarray experiment, we performed quantitative real-time pcr (qpcr) assay. the relative expression levels of 1a-, 1b-, and 1d-ar mrnas normalized against -actin in rat kidney cortex are shown in figure 1. in consistency with the microarray results, qpcr analysis showed that renal cortical 1d mrna was increased by 16-fold in 22-week-old zd rats compared to zl controls. we have previously shown that ppar activation protects against kidney injury in zucker diabetic fatty rats [15, 17]. here, we further examined the effect of ppar activation on the expression level of 1-ar mrnas in the diabetic kidneys. gene microarray analysis revealed that ppar activation inhibits the upregulation of 1d gene in the diabetic kidneys. chronic administration of fenofibrate, a ppar agonist, resulted in a decrease in 1d-ar mrna by 64% compared to vehicle-treated zd animals (table 1). qpcr analysis confirmed a reduction of 1d-ar mrna in the kidney of f-zd rats (figure 1). in contrast, both microarray and qpcr analyses indicated that mrna expression of 1a- and 1b-ar subtypes was not affected by fenofibrate in the diabetic kidneys. additionally, the effect of ppar activation on gene expression of 1-ar subtypes was examined in the zd rats after rosiglitazone treatment. compared to vehicle-treated zd rats, renal cortical 1d-ar mrna was significantly lower when rosiglitazone was administered for 8 weeks (figure 2). similar to ppar activation, 1a- and 1b-ar mrna expression in the diabetic rats was not affected by rosiglitazone treatment. in a previous study, we showed that blood glucose levels were not different between normal zl and diabetic zd rats at the age of 7 weeks. blood glucose of the zd rats began to increase at week 8, reached a peak at week 12, and remained at this higher level thereafter. to analyze the temporal pattern of renal expression of 1d-ar receptors, renal cortical and glomerular 1d-ar mrna levels were compared in the zucker rats at the ages of 7, 12, and 2022 weeks. as shown in figure 3, zd rats at week 7 had slightly lower 1d-ar mrna level in the glomeruli compared to their zl littermates, whereas renal cortical 1d-ar mrnas were not different between the two groups. at the age of 12, both renal glomerular (2.4-fold) and cortical (1.7-fold) 1d-ar mrna levels were significantly higher in the zd animals, which were further increased by 3.4-fold and 12.9-fold, respectively, at the age of 2022 weeks. we performed immunofluorescence staining to correlate 1d-ar gene expression results with its protein level and distribution in the kidney of zucker animals. as expected, 1d-ar protein was clearly detected in the renal arteries and arterioles in both normal and diabetic animals (figure 4). the intense staining was primarily in the smooth muscle of renal arterial walls as evidenced by its colocalization with -sma. in normal zl rats, weak 1d-ar staining was also detected in the glomeruli, whereas there was no obvious staining in the renal tubules (figure 4). in consistency with the mrna expression results, immunofluorescence staining identified increased 1d-ar signal in the glomeruli of diabetic rats, which was partially colocalized with -sma (figure 4). intense tubulointerstitial staining of 1d-ar was apparent in the diabetic kidneys. as shown in figure 5, 1d-ar was expressed in both tubular epithelial cells and activated interstitial fibroblasts, which was positive for -sma staining. to further characterize 1d-ar expression in renal tubules of diabetic animals, we performed double staining for 1d-ar and kim-1, a sensitive tubular injury marker. dual labeling revealed a spatial relationship between kim-1 and 1d-ar in the diabetic kidneys. as shown in figure 6, virtually all dilated tubules expressing 1d-ar were also kim-1-positive, suggesting that 1d-ar was expressed in the injured dedifferentiated proximal tubules. in these tubules, 1d-ar expression was predominantly cytoplasmic, whereas kim-1 staining was prominent at the apical membrane. in this study, the expression and distribution of 1d-ar mrna and protein were determined by the gene microarray, qpcr, and confocal immunofluorescence analyses. although mrna expression of all three 1-ar subtypes (1b>1d>1a) was detected in rat kidney cortex, only 1d-ar gene was massively upregulated in the diabetic animals. moreover, diabetes-related increase in 1d-ar mrna was inhibited when the zd rats were treated with fenofibrate or rosiglitazone. immunostaining for 1d-ar confirmed that intense 1d-ar staining was apparent especially in the smooth muscle of arterial walls in both normal and diabetic kidneys. weak 1d-ar protein staining was detected in the glomeruli of normal zl controls, but there was no obvious staining in the normal tubular epithelium. in consistency with the gene expression results, 1d-ar protein was significantly increased in the glomeruli and proximal tubules of diabetic animals. the expression of 1-ar subtype mrnas has previously been studied in various animal and human organs, and the predominant subtype mrna expressed differs among species and organs. for example, kurooka et al. reported that 1a-ar gene was detected more than 1b-ar or 1d-ar in human kidney cortex. in contrast, karabacak et al. recently evaluated 1-ar subtype protein expression in human renal pelvis and calyx tissues and found that 1d-ar was most dense in both followed by 1a- and 1b-ar subtypes, respectively, where the rate of 1b-ar was significantly lower than the other two. in the rat kidney, it was reported that the 1b-ar is predominant when detected by a radioligand binding assay and rnase protection assay. in consistency with these findings, we confirmed the expression of all three 1-ar subtype mrnas (1b>1d>1a) in rat kidney cortex by microarray and qpcr analyses. of the three 1-ar subtypes, the 1d-ar has been the least studied due to difficulties in obtaining significant expression levels and poor coupling to membrane signals due to its intracellular localization [911]. however, recent experiments performed in 1d-ar knockout models suggest that this 1-ar subtype plays an important role in the overall regulation of blood pressure. moreover, armenia et al. reported that 1a- and 1d-ars are the major functional subtypes of renal 1-ars in both normal and streptozotocin-induced sprague-dawley rats. interestingly, among the three 1-ar subtypes detected in rat kidney cortex, we found that 1d-ar mrna was markedly increased by 16-fold in the diabetic kidneys. additionally, diabetes-associated upregulation of 1d-ar mrna expression was inhibited when the diabetic animals were treated with ppar agonists, known renoprotective interventions. therefore, previous evidences and present results strongly suggest that 1d-ar may play an important role in renal physiology and/or pathophysiology. diabetic nephropathy is characterized by a series of ultrastructural changes, including glomerular and tubular hypertrophy, mesangial expansion, glomerulosclerosis, and tubulointerstitial fibrosis. we have previously demonstrated a progressive loss of renal function in the diabetic animals as evidenced by an increase in urinary protein to creatinine ratio in the zd rats between the ages of 7 and 20 weeks. in the current study, we further observed a gradual increase in cortical and glomerular 1d-ar mrna expression during disease progression in the diabetic animals. we speculate that increased 1d-ar may play a role in the development of diabetic renal hypertrophy and fibrosis. in fact, a role for 1d-ar in vascular hypertrophy and remodeling has been suggested by a recent report that a decrease in the lumen area and an increase in the wall thickness of arteries in hypoxic pulmonary hypertension were strongly inhibited in 1d-ar knockout mice. in this study, we evaluated the expression and distribution of 1d-ar protein in the kidneys of zl and zd rats by immunofluorescence staining. as expected, intense 1d-ar staining was apparent especially in the smooth muscle of arterial walls in both normal and diabetic kidneys. compared to low expression level of 1d-ar protein in the glomeruli of normal zl controls, zd rats demonstrate a significant increase in 1d-ar signal. moreover, zd kidneys displayed strong tubulointerstitial 1d-ar signal within fibrotic areas. a colocalization of 1d-ar with -sma indicates that 1d-ar expressing interstitial cells are myofibroblasts. future work in the field could be necessary to establish the exact role of 1d-ar in activation and proliferation of renal interstitial fibroblasts. another interesting novelfinding in our set of data reported here is the 1d-ar expression in tubular epithelial cells of diabetic kidneys. although there was no obvious staining in the normal tubules, 1d-ar staining was apparent in the dilated tubules in the fibrotic areas. to further characterize 1d-ar expression in renal tubules of diabetic animals, the spatial relationship between tubular 1d-ar and kim-1, a tubular injury marker, the selective increased expression by dedifferentiated epithelial cells and activated interstitial fibroblasts supports the potential importance of 1d-ar in renal tubulointerstitial injury. moreover, recent studies on the pulmonary circulation suggest that catecholamines may participate in the excessive muscularization and fibrosis of the arteries through erk1/2 signaling pathway in hypoxic pulmonary hypertension [5, 2022]. therefore, further studies are warranted to evaluate the functional consequences of 1d-ar induction in diabetic kidney injury. in summary, the current study highlights mrna expression of the three 1-ar subtypes in rat kidney cortex. an increase in renal expression of 1d-ar mrna and protein was associated with glomerular and tubulointerstitial injury in diabetic nephropathy. chronic treatment with ppar agonists prevents the increase in 1d-ar mrna in the diabetic kidneys. these findings may provide new insights into the prevention and early management of diabetic kidney disease.

alpha1d-adrenergic receptor (1d-ar) plays important roles in regulating physiological and pathological responses mediated by catecholamines, particularly in the cardiovascular and urinary systems. the present study was designed to investigate the expression profile of 1d-ar in the diabetic kidneys and its modulation by activation of peroxisome proliferator-activated receptors (ppars). 12-week-old zucker lean (zl) and zucker diabetic fatty (zd) rats were treated with fenofibrate or rosiglitazone for 810 weeks. gene microarray, real-time pcr, and confocal immunofluorescence microscopy were performed to assess mrna and protein expression of 1d-ar in rat kidney tissue. using microarray, we found that 1d-ar gene was dramatically upregulated in 22-week-old zd rats compared to zl controls. quantitative pcr analysis verified a 16-fold increase in 1d-ar mrna in renal cortex from zd animals compared to normal controls. chronic treatment with fenofibrate or rosiglitazone reduced renal cortical 1d-ar gene. immunofluorescence staining confirmed that 1d-ar protein was induced in the glomeruli and tubules of diabetic rats. moreover, dual immunostaining for 1d-ar and kidney injury molecule-1 indicated that 1d-ar was expressed in dedifferentiated proximal tubules of diabetic zucker rats. taken together, our results show that 1d-ar expression is upregulated in the diabetic kidneys. ppar activation suppressed renal expression of 1d-ar in diabetic nephropathy.

PMC3977090

pubmed-330

allergic diseases are among the most common chronic diseases throughout the world and the prevalence of atopic diseases in childhood has significantly increased during the past several decades [2, 3]. although there is a general consensus on the importance of a genetic predisposition for atopic diseases, only changes in environmental factors can explain this increase [46]. there is a strong association between sensitisation and symptoms of allergic diseases although this association is not absolute. the allergy march refers to the natural history of sensitisation to allergens and symptoms of eczema, asthma, and rhinitis, which is characterized by a typical sequence of sensitisation and manifestations of symptoms that appear during a certain age period [7, 8]. food allergy and atopic eczema during the first years of life have been considered risk factors for subsequent asthma and rhinitis caused by indoor and outdoor inhalant allergens [5, 9, 10]. however, allergy-like symptoms in childhood like wheezing and eczema need not have an atopic background [11, 12]. wheezing episodes in young children are often transient and associated with viral respiratory infections [13, 14]. thus, better predictors of disease development and diagnostic markers for allergic disease are needed to give proper treatment and valuable advice, especially concerning environmental control to parents of young children. the present study was carried out in order to evaluate the diagnostic performance of phadiatop infant, an in vitro test designed to detect allergen-specific ige antibodies known to be relevant in the development of ige-sensitisation in early childhood. the study was conducted retrospectively in consecutively included children, below the age of five years and admitted to bkl voksentoppen, rikshospitalet, oslo, during a period of twelve months. the children were referred from paediatricians and other paediatric departments at hospitals in norway and thus selected for more severe allergic symptoms. frozen-serum samples from 122 children were analysed and clinical data documented in the patients ' records were compiled for the study. the study conformed to the principles of helsinki's declaration and was approved by the local ethics committee. skin prick test (spt) was performed according to standard procedure at the hospital. glycerinated allergen extract (soluprick alk-abello, denmark and a standard lancet with 1 mm tip and a shoulder (alk-abello, denmark) was used. histamine chloride 10 mg/ml was used as positive-control and as negative-control glycerol. the reaction was recorded as 3+when the reaction was equal to the histamine control, 2+when half the histamine control, and 4+when double the histamine control. the panel included egg white, cow's milk, cod fish, peanut, hazel nut, wheat, house dust mite, cat dander, birch, timothy, cladosporium, and latex. total and allergen-specific ige antibodies were determined in immunocap 100 (phadia ab, sweden) at the hospital laboratory when appropriate according to clinical findings. serum samples were sent to phadia ab, uppsala, sweden, for determination of specific ige antibodies using immunocap phadiatop, fx5 (a food mixture of milk, egg white, fish, peanut, wheat, and soy bean), and immunocap phadiatop infant using immunocap100 (phadia ab, uppsala, sweden). phadiatop infant is designed to detect allergen-specific ige antibodies to food and inhalant allergens, relevant in the development of ige-mediated disease in young children. the following allergens are included in the test: hen's egg, cow's milk, peanut, shrimp, cat epithelium and dander, dog dander, house dust mite, common silver birch, timothy, ragweed, and wall pellitory. the laboratory analyses were performed in a blinded manner and the results of phadiatop and fx5 were sent back to the investigating physician. atopy was defined as a constitutional disposition to produce ige antibodies to common allergens whether the patients had clinical symptoms or not, as judged by the investigator. the study was designed to make the diagnosis with best possible available tools (case history, spt, and allergen-specific ige results) to evaluate the clinical performance of phadiatop infant. a preliminary diagnosis whether a child was atopic or not was assessed by the investigating physician in retrospect, taking into account clinical history and diagnostic procedures, which includes available spt and allergen-specific ige results, noted in the patient records. in the final diagnosis of the atopic state, the laboratory results from phadiatop and fx5 were also taken into consideration in order to get comparable data of allergen-specific ige sensitisation on all children. this final diagnosis was used as the reference for calculation of the diagnostic performance of phadiatop infant. quantitative variables are described in appropriate measures of localisation and dispersion, quantitatively variables presented by counts and percentages. the diagnostic performance of phadiatop infant was evaluated by calculating sensitivity, specificity, negative and positive predictive values (npv, ppv), respectively, with 95% confidence intervals. the subgroups divided by age, <2 years and 2 years were compared with regard to the diagnostic performance of phadiatop infant using descriptive statistics. the demographic characteristics of the children classified according to the final diagnosis of atopy/nonatopy or inconclusive diagnosis are shown in table 1. thirty-eight (31%) subjects in the study population were girls and 84 (69%) were boys with a median age of 2.7 years. of the 122 children, 86 (70%) were atopic, 26 girls and 60 boys, which is a commonly found gender distribution among atopic children at that age. only 18% of the children presented with wheezing as a single symptom and the majority of these children were nonatopic, 55% below 2 years and 40% above this age, respectively. eczema as a single symptom was the most prevalent symptom among the children below two years of age (49%) and 63% were classified as atopic. in the older age group of children, eczema and/or wheezing in combination with other allergic symptoms dominated (41%) and other allergy-like symptoms such as rhinitis, rhinoconjunctivitis, anaphylaxis, and gastrointestinal symptoms were registered in 31 (26%) children, out of whom 22 (71%) were older than 2 years (data not shown). eighty-three of the children (68%) reported at least one first degree relative, with about the same proportion for the atopic as for the nonatopic children, 71% and 61%, respectively (data not shown). the diagnostic performance characteristics of phadiatop infant in this study population with a prevalence of 70% are presented in table 2. the sensitivity calculated for the whole group of children was 98% (95% ci: 92100%) and the specificity 89% (95% ci: 7497%). the ppv and npv values were 95% (95% ci: 8999%) and 94% (95% ci: 8099%), respectively. the diagnostic performance of the test was found to be similar when the children were separated in the two age groups, below or above two years, but due to small numbers of children in the separated age groups, the calculated values are not presented. symptoms of allergic disease in young children are generally unspecific and the diagnosis without objective tests could be an arbitrary process. the paediatric section of the european academy of allergy and clinical immunology has recently published a position paper with recommendations on allergy testing in children to improve the identification of allergy and quality of care. an earlier published study has shown that 76 out of 147 children could not be classified as having an ige-mediated disease or not, based on case history and physical examination alone. similar results were found in a recently published study, where measurements of ige-antibodies, added to case history and physical examinations, highly improved the discrimination between ige- and non-ige-mediated diseases in young children. the results from our study confirm these findings and suggest that phadiatop infant could be a useful tool for discrimination between atopy/non-atopy. a positive phadiatop infant test should however be followed by allergen-specific antibody testing to a selected panel to identify the offending allergen(s) [19, 20]. the test seems to be at least as useful among the youngest children, below two years, as among children at 24 years of age. the youngest child in the study was 6 months, which confirms findings from other publications that allergen-specific ige-antibodies can be detected early in life [17, 18, 21]. these findings support the value of testing children with allergy-like symptoms at an early age. family history has been considered an important risk factor for atopy and has been widely used for prediction of allergy and allergic diseases. the results from our study are in good agreement with the notion that allergy/atopy is extremely commonly found. on the other hand, the fact that 30% of the atopic children did not have a family history of allergy agrees with investigators claiming that a great portion of newly diagnosed allergics/atopics do not have a family history of allergy/atopy. thus it could be stated that family history is no longer practical in predicting allergic disease. this study population represents a selected cohort as voksentoppen is a hospital having referred patients with allergy-like symptoms and allergic diseases from general paediatricians in the whole country, often of a more severe character. however, other studies have shown that phadiatop infant could be applied in populations with a lower prevalence of atopy, still demonstrating good performance characteristics [17, 18, 21]. the clinical appearance of allergy in our study is in agreement with the concept of the allergy march and supports what has been reported earlier from other studies [7, 8]. thus, eczema was not common in the nonatopic group of children and only one of the 31 children with eczema was classified as nonatopic. the progression from eczema to other allergic problems eighty-six percent of the children with eczema and wheezing in combination with other symptoms were found in the older age group and as many as 82% were classified as atopic. the majority of children, all ages, presenting with wheezing were nonatopic (73%). many infants and children who wheeze have transient conditions associated with diminished airway function and do not have an increased risk of asthma later in life. however, children with persistent wheezing, starting during the first years of life, and with an atopic heredity, should be considered being at risk for asthma later during childhood [11, 22, 23]. therefore, an early diagnosis of ige sensitisation may be important for the choice of treatment to wheezing toddlers. children with allergic symptoms usually present at a general paediatrician who needs to discriminate which patients have to be sent to an allergist for further evaluation. rule-out tests with a high discriminating potential are suggested to have a gateway function to fulfil this differentiation and an important role to prevent the march of allergic children from the first to secondary level of care. the present study shows that phadiatop infant has a diagnostic performance with a high sensitivity and specificity. thus, the test could be recommended as a complement to the clinical information in the differential diagnosis on ige-mediated disease in young children with allergy-like symptoms. furthermore, the test could be useful in assisting primary care physicians in selecting atopic children at an early stage for further intervention or referral to an allergist. an early correct diagnosis will thus allow for better management and a possibility to delay or even prevent the onset of asthma in children with eczema and the avoidance of further deterioration of lung function in children with asthma [16, 25].

background and objective. allergy-like symptoms such as wheezing and eczema are common in young children and an early diagnosis is important to initiate correct management. the objective of this study was to evaluate the diagnostic performance of phadiatop infant, an in vitro test for determination of early sensitisation to food and inhalant allergens. patients and methods. the study was conducted, retrospectively, using frozen sera from 122 children (median age 2.7 years) admitted to the hospital with suspected allergic symptoms. the doctor's diagnosis atopic/nonatopic was based on routinely used procedures such as clinical evaluation, spt, total and allergen-specific ige antibodies. the performance of phadiatop infant was evaluated in a blinded manner against this diagnosis. results. eighty-four of the 86 children classified as atopic showed a positive phadiatop infant test. thirty-six were classified as nonatopic, 32 of who had a negative test. with a prevalence of atopy of 70% in this population, this gives a sensitivity of 98%, a specificity of 89%, and a positive and negative predictive value of 95% and 94%, respectively. conclusion. the results from the present study suggest that phadiatop infant could be recommended as a complement to the clinical information in the differential diagnosis on ige-mediated disease in young children with allergy-like symptoms.

PMC2778347

pubmed-331

a 67-year-old male presented to the emergency eye centre (eec) complaining of a painful right eye of 5-day duration. clinical examination revealed a visual acuity (va) of 6/9 with minimal conjunctival injection, anterior chamber (ac) cells 1+and posterior synechiae (ps). a diagnosis of anterior uveitis was made and the patient was commenced on topical prednisolone 1% and topical cyclopentolate 1%. the response to this treatment was good and the steroids were slowly tapered over 1 month; however, before cessation of treatment, the anterior segment inflammation worsened. the patient represented with va 6/36 and ac cells 3 +, extensive ps and a posterior vitritis. 2, the topical treatment was increased and an urgent referral was made to the uveitis service. at review, 4 weeks after presentation, the anterior and posterior segment inflammation remained and a white mass was noted in the peripheral nasal retina [fig. 1 upper plate], almost at the ora serrata. a diagnosis of presumed toxoplasma chorioretinitis was made and treatment with pyrimethamine and sulfadiazine followed by oral clindamycin was initiated. on further questioning, it was discovered that there was the possibility of a previous pulmonary tuberculosis (tb) infection. he had had no previous treatment for active tuberculosis. in view of concern over possible reactivation of tb with an increase in oral steroids, quantiferon and induced sputum sampling were also performed (all negative) and the dose of prednisolone was increased to 60 mg daily. blood cultures were also negative and there was no serological evidence of toxoplasma infection (toxoplasma latex<16). (upper plate) 10 mhz b-scan ultrasonography of subretinal mass (nasal peripheral retina-white arrow) (middle plate) hematoxylin and eosin stained section of the retinal biopsy showing brown fungal hyphae (black arrows) coursing through the abscess.(lower plate) masson fontana stain showing a positive melanin brown reaction. thin arrows showing fungal septae and thick arrows indicate dichotomous branching of hyphae the patient responded to oral steroids and clindamycin, with a reduction in intraocular inflammation and improved va of 6/18 after 2 weeks treatment. however, when the oral prednisolone was gradually reduced and the clindamycin stopped (after 5 weeks treatment), there was an increase in intraocular inflammation and va reduced to 3/60. a diagnostic pars plana vitrectomy was therefore performed with vitreous sampling, which revealed a chronic vitritis without infectious agent or neoplasia. no herpes family viruses or toxoplasma organisms were identified on polymerase chain reaction testing. in order to clinch the diagnosis, combined cataract surgery, retinal biopsy, and intraocular oil tamponade was performed. the nasal sub-retinal mass was biopsied using a 23-gauge (23 g) vitrector hand piece and samples sent to histopathology and microbiology. close inspection showed brown pigmented septate branching hyphae that stained strongly with masson fontana melanin stain and with a periodic acid schiff (pas) and silver stain [fig. the presence of a melanin containing, septate, branching, and mycelial fungus on histopathology was diagnostic of phaeohyphomycosis infection, on morphology alone. prolonged fungal culture of the biopsy was negative and 18s ribosomal subunit polymerase chain reaction (pcr) was also negative (most likely due to the presence of pcr inhibitors in the sample). the absence of a culture and pcr result did not permit precise speciation of the phaeohyphomycosis fungus. the patient remained under joint care and was treated with antifungal therapy for 6 months; however, no primary source of fungal infection was identified. following retinal biopsy the patient developed a retinal fold secondary to proliferative vitreoretinopathy (pvr), which extended from the biopsy site to the optic disc. vitrectomy, removal of silicone oil, epiretinal membrane peel, subretinal pvr removal and retinectomy were performed with laser retinopexy and intraocular gas tamponade. unfortunately, the patient required two further operations for rhegmatogenous retinal detachment. currently, the retina is flat with heavy silicone oil tamponade and the va is 2/60. further retinal biopsy taken during vitrectomy for retinal detachment revealed no fungal elements on microscopy and intravitreal amphotericin b was also injected perioperatively. phaeohyphomycosis is a collective term that describes infection caused by darkly pigmented mycelial fungi, a feature secondary to the presence of melanin within their cell walls. the most common phaeohyphomycosis genera pathogenic to humans include exophilia, phialophora, wangiella, bipolaris, exserohilum, cladophialophora. morphology by histopathology is sufficient to make a diagnosis of phaehyphomycosis, characterized by branching, septate hyphae with confirmation of melanin by tinctorial staining (masson fontana or an equivalent). whilst histopathology permits a clear diagnosis of phaeohyphomycosis, the precise species does require pcr and cultures. infection is presumed to be as a result of implantation following superficial trauma and exposure to contaminated soils or organic matter. systemic infections result either from direct invasion from a more superficial site, such as the paranasal sinuses or by means of haematogenous dissemination. the central nervous system is most frequently affected but other sites including lung, bone, and joint or peritoneum may also be involved., primary cerebral phaeohyphomycosis seems to ignore this rationale with more than half of cases being fully immunocompetent. melanin within the cell walls of dematiaceous fungi may provide the reasons for this disparity; it has been extensively investigated as a virulence factor. however, this is the first time a subretinal abscess caused by phaeohyphomycosis has been documented in the medical literature. the most plausible theory involves a haematogenous route (metastatic infection) transmission from a peripheral nidus to the subretinal space, which in turn initiated a posterior and anterior segment uveitis. patients with underlying lung disease appear to be at a increased risk of pulmonary phaeohyphomycosis. it is possible that, in this patient, the lung parenchyma may have been a source of infection, in the setting of chronic, low level immune suppression/modulation by the methotrexate therapy with reactivation of a previous self-limiting respiratory phaeomycotic infection, with subsequent dissemination. posterior segment pathology is usually diagnosed by characteristic clinical signs, extensive systemic investigations and non-invasive ocular investigations such as fluorescein angiography. however, it is not uncommon for vitreoretinal surgeons to aid in the diagnosis of a posterior uveitis of unknown aetiology by sampling vitreous, retina or choroidal tissue, leading to increased diagnostic accuracy and prompt treatment. reported 13 cases of retinochoroidal biopsy in unclear uveitis seven of the cases tissue biopsy helped direct specific treatment. intraocular lymphoma, recurrence of lymphoblastic leukaemia, chronic scleritis, toxoplasmosis, and metastasis were diagnoses confirmed as a result of the tissue biopsies performed. malignancy was also excluded in several cases, which allowed for a trial of medications such as oral steroids and anticytomegalovirus agents. in this case, it is difficult to postulate whether the final va and outcome have been improved by surgical intervention. it is clear that the patients intraocular inflammation was increasing rapidly and only high dose steroids subdued the response. without sub-retinal biopsy, the specific treatment of this patient's phaeohyphomycosis with antifungal medication would not have been possible and years of treatment for idiopathic uveitis may have ensued.

a 67-year-old former gold miner with rheumatoid arthritis, treated with steroids and methotrexate, presented to eye casualty with a painful right eye. examination revealed an anterior uveitis and despite an initial response to topical steroids, the intraocular inflammation worsened with anterior and posterior uveitis development. re-examination showed a white mass in the peripheral nasal retina initially suspected of being active toxoplasmosis infection and anti-toxoplasmosis treatment commenced. after improvement and tapering of this treatment, the intraocular inflammation reoccurred. cytopathological examination of a pars plana vitrectomy obtained vitreous sample that showed a non-diagnostic non-infectious chronic vitritis. the vitreoretinal surgeons elected to do a direct biopsy of the white subretinal mass in the peripheral nasal area. this revealed, quite unexpectedly, an abscess containing pigmented phaeohyphomycosis fungi. this case report documents the multidisciplinary approach that assisted in clinching a final diagnosis and the role of sub-retinal biopsy in this unprecedented scenario.

PMC3917400

pubmed-332

despite advancements in renal replacement therapy, acute kidney injury (aki) is a frequent complication with severe implications for the critically ill patient. published mortality rates for intensive care unit patients with aki range between 30 and 70%, and aki alone remains an independent risk factor for mortality even after adjustment for demographics and severity of illness [1, 2]. kidney ischemia-reperfusion injury (iri) occurs in various clinical settings including shock, sepsis, organ transplantation, and vascular surgery. it has become apparent that clinically much of the high patient mortality can be attributed to the onset of systemic inflammatory response syndrome (sirs) and progression to multiple organ failure (mof). since the 1950s pulmonary dysfunction was thought to result from increased permeability of congested pulmonary capillaries, and this was dubbed the uremic lung. even in the acute setting, however, kidney dysfunction directly contributes to the onset of remote organ injury. for example, increased kidney ischemia time during complex aortic surgery is associated not only with acute and chronic renal failure, but also with an increased incidence of remote organ injury and death [46]. clinical and translational laboratory studies have demonstrated the relevance of interactions between the injured kidney and distant organs, and complex mechanisms of crosstalk between injured kidneys and remote organs such as the lungs, liver, heart, gut, brain, and hematologic system have been identified. recent data highlights the importance of both the innate and adaptive immune response, activation of proinflammatory cascades, and an alteration of transcriptional events in remote organs during ischemic aki. the purpose of this paper is to review emerging concepts of organ crosstalk and recent experimental data regarding the activation and systemic expression of proinflammatory pathways during ischemic aki. for a complete list of abbreviations used in this paper, please see table 1 kidney iri remains a major cause of aki in both native and transplanted organs and lacks a specific treatment aside from renal replacement therapy. the local effects of kidney iri begin in the most vulnerable regions of the organ, after which a cascade of microvascular inflammation propagates. although 25% of cardiac output contributes to renal blood flow, only a fraction ultimately reaches the vasa recta of the renal medulla, with the majority reaching the renal cortex. therefore, even slight alterations in total renal blood flow may lead to anoxic injury in the medulla, resulting in tubular dysfunction, salt wasting, and glomerular vasoconstriction through tubuloglomerular feedback [8, 9]. kidney iri activates an inflammatory response which results in endothelial cell activation, leukocyte adhesion and entrapment, and compromised microvascular blood flow. inflammation in the postischemic kidney triggers the upregulation of leukocyte adhesion molecules, toll-like receptors, and downstream transcription factors, which all contribute to disruption of the integrity of the renal vascular endothelium. adhesion molecules such as integrins and selectins along with proinflammatory cytokines propagate cellular injury not only locally in the renal tubular epithelial cells but also travel to remote organs where genomic markers of injury are upregulated and phenotypic injury occurs. unfortunately, selective inhibition of cytokines and adhesion molecules such as tumor necrosis factor- (tnf-) and intercellular adhesion molecule (icam-1) have failed to demonstrate global attenuation of both local and remote organ injury during experimental models of ischemic aki [1316]. however, -melanocyte-stimulating hormone (-msh), a cytokine with broad antiinflammatory, anticytotoxic, and antiapoptotic properties, has demonstrated success in treating the inflammatory phenotype in rodents. in this model, treatment with -msh has attenuated both renal and pulmonary injury during ischemic aki [13, 17]. the largely unsuccessful effort to ameliorate mof with specific anti-inflammatory therapeutics highlights the complexity of the systemic response to kidney iri. from these early experimental studies, it is possible that the multiple inflammatory pathways activated in each organ system represent a unique response to ischemic aki. despite a paucity of data, several different pathophysiologic responses to ischemic aki in remote organs have been identified (figure 1). in the heart, increased expression of tnf and interleukin-1 (il-1) are associated with myocyte apoptosis. in the brain, increased expression of chemokines including keratinocyte chemoattractant (kc, a brain il-8 homologue) and granulocyte colony-stimulating factor (g-csf) are seen with increased vascular permeability. additional responses in the lungs, gut, and liver have been discovered, and these individual organ responses will be detailed later in this paper. we will now focus on cellular mediators, specifically those involved in the innate and adaptive immune system, which may connect local ischemic aki with distant organ injury. the innate immune system plays an important role in mediating the inflammatory response during ischemic aki. traditionally, innate immunity elicits an immediate, preprogrammed response to tissue injury that lacks immunologic memory. it is composed of plasma proteins (complement), cells (neutrophils, macrophages, and natural killer cells), and physical barriers. proposed initiators of the innate immune response during iri include the activation of toll-like receptors (tlrs) and the release of reactive oxygen species (nitric oxide and superoxide anion) and mitochondrial products. the complement system, particularly the alternative pathway, is activated, stimulating release of cytokines and subsequent activation of neutrophils, endothelium, and macrophages. tlrs are a family of transmembrane proteins which serve as major pattern recognition receptors, binding to a wide range of microbial products and endogenous ligands released as a consequence of injury. tlr-dependent signaling serves as a rapid response mechanism to local tissue damage and has been implicated in early activation of the innate immune response during kidney iri [11, 20]. renal tubular epithelial cells constitutively express tlr2 and tlr4, and iri results in selective upregulation of these tlrs. experimental studies of kidney iri have demonstrated attenuation of renal structural and functional injury in both tlr2/ and tlr4/mice, implicating tlr2 and tlr4 signaling in renal damage [21, 22]. tlr2 may also play a role in transplantation tolerance by decreasing the infiltration of t cells, dendritic cells, and macrophages. t cells may act during early iri despite lacking alloantigenic stimulation, which challenges the traditional function of t cells as exclusive mediators of the adaptive immune response. significant evidence exists to support the role of t cells in gut, heart, and lung ischemia-reperfusion injury [2428]. likewise, experimental data also points toward antigen-independent t-cell activation in ischemic aki through cytokines secreted by macrophages and dendritic cells, chemokines, oxygen free radicals and the complement system [7, 19, 29]. for example, mice deficient in cd4+and cd8+cells and athymic mice demonstrate protection from experimental ischemic aki; however, only adoptive transfer of t cells of the cd4+type restores this injury [30, 31]. not all t cells, however, perpetuate inflammatory damage during ischemic aki; some populations of t cells confer renal protection after iri, particularly the th2 phenotype of cd4+t cells and t regulatory cells. additional recent experimental data has characterized specific populations of t lymphocytes trafficking to remote organs that may facilitate organ crosstalk during ischemic aki. in a rodent model of kidney iri, a distinct influx of cd3+(t) cells with a predominant cd8+t cell subpopulation was identified 24 hours after experimental kidney iri. these pulmonary t cells acquired increased expression of activation markers suggesting that ischemic aki induced trafficking of activated t cells which contributed to pulmonary injury, specifically apoptosis. the specific role of subpopulations of t cells in the pathogenesis of ischemic aki remains a stimulating topic of current and future investigation, both in the innate and adaptive immune response to kidney iri. the adaptive immune system relies on the specificity of antigen receptors on both b and t cells that respond to millions of various antigenic molecular structures. once stimulated by an antigen, b cells (humoral immunity) produce specific antibodies, perform opsonization to facilitate phagocytosis, and activate the complement system. the t-cell receptor (tcr) responds to presented antigen peptides by activating macrophages to kill phagocytosed microbes, directly destroying infected cells and by releasing cytokines to promote further response (cell-mediated immunity). antigen-dependent t-cell activation has been demonstrated in experimental models of renal iri [34, 35]. for example, mice with a restricted tcr cell repertoire suffer less injury and promote a far diminished inflammatory response during renal iri. additionally, athymic mice that subsequently underwent adoptive transfer with these tcr-restricted t cells failed to restore injury as severely as seen with transfer of wild-type t-cells. t cells also play a role in long term renal modification, as an increased number of both activated and effector-memory t cells have been observed in postischemic kidneys as long as 6 weeks after iri. these t cells may in fact recognize antigens released during kidney iri and subsequently target the kidney in an autoimmune response, leading to long-term progression of renal dysfunction. this hypothesis was demonstrated in a murine adoptive transfer model in which nave mice received t cells from mice who were 6 weeks after kidney iri and subsequently developed albuminuria. little is known about the role of b cells in renal iri; however, b-cell-deficient mice demonstrated renal protection in the early phase of experimental iri. in summary, both the innate and adaptive immune responses play critical roles in the pathophysiology of ischemic aki. either following antigen stimulation or in the presence of proinflammatory chemokines and oxygen free radicals, t cells undergo early activation and serve as a bridge between adaptive and innate immunity. this specific host immune response to kidney iri facilitates distant organ crosstalk along with soluble proinflammatory mediators and will be further discussed in the following paragraphs. the combination of aki with acute lung injury (ali) remains a formidable challenge to clinicians caring for critically ill patients. in the setting of mof, aki and ali occur more frequently together than any other combination of organ systems, and predicted mortality approaches 80% [40, 41]. this exceedingly high mortality can not be attributed solely to volume overload; leukocyte trafficking, uremic toxins, and oxidative stress mechanisms all likely contribute to this devastating clinical syndrome. for the purposes of this paper, ali represents a pao2/fio2 ratio<300 combined with chest radiograph findings of acute bilateral infiltrates in the absence of elevated cardiac filling pressures, as defined by the america-european consensus conference on acute respiratory distress syndrome (ards). while the mechanisms for ischemic aki-induced ali remain incompletely understood, several studies point toward a self-propagating cycle with activation of proinflammatory and proapoptotic pathways (figure 2). aki leads to lung injury and inflammation, and in turn, ali and its attendant hypoxemia and hypercapnia worsened by mechanical ventilation with high positive end-expiratory pressure leads to diminishing renal hemodynamics and function. lung injury during ischemic aki features marked pulmonary vascular permeability, erythrocyte sludging in lung capillaries, interstitial edema, focal alveolar hemorrhage, and inflammatory cell infiltration [12, 43, 44]. mechanisms for decreased alveolar fluid clearance include downregulation of pulmonary epithelial salt and water transporters including enac, na, k-atpase, and aquaporins during ischemic aki [4345]. this specific response likely contributes to the increased microvascular permeability and clinical pulmonary edema frequently encountered in the setting of ischemic aki and mof. experimental studies have identified a distinct pulmonary functional response and genomic signature induced during ischemic aki which differs from that induced by uremia alone. a comprehensive genomic map and ontology analysis revealed many of these top differentially expressed genes participating in proinflammatory and proapoptotic pathways. genes with early and sustained activation at 6 and 36 hours after ischemic aki included neutrophilic granule protein (ngp), serum amyloid a3 (saa3), and interleukin 1-receptor type ii (il-1r2). further investigation by deng et al. has also identified an early pulmonary inflammatory response with rapid activation of transcription factors nf-b and ap-1 during ischemic aki. by 4 hours, leukocytes play a fundamental role in the development of ali, and several studies have documented lung leukocyte activation and trafficking during experimental aki with early and sustained neutrophil sequestration [46, 47]. additional experiments by klein et al. have demonstrated early expression of the neutrophil chemokine keratinocyte-derived chemokine (kc/cxcl1) and macrophage inflammatory protein (mip-2/cxcl-2) along with increased pulmonary myeloperoxidase activity and pulmonary microvascular permeability during ischemic aki. the authors also examined interleukin-6, a neutrophil-recruiting chemokine previously identified as a candidate gene by preferential expression in whole lung tissue during ischemic aki, and determined it was critical for influencing lymphocyte trafficking and pulmonary permeability. while neutrophils are key mediators in several extrapulmonary models of ali such as sepsis and mesenteric iri, their role in ischemic aki-induced ali remains to be elucidated. uremic neutrophils have even demonstrated a protective effect in the setting of ali. clearly, leukocyte trafficking and the innate immune response play a complex and important role in mediating the pulmonary inflammatory response and dysfunction during renal iri. though not traditionally associated with a proinflammatory response, pulmonary apoptosis plays a critical role in the genomic and phenotypic response to ischemic aki. apoptosis of pulmonary epithelial and endothelial cells along with delayed leukocyte apoptosis occurs during ali [5052]. pulmonary apoptosis disrupts tethering forces involved in cell-to-cell and cell-to-extracellular matrix interactions, leading to a loss of endothelial barrier function and increased vascular permeability. in a rodent model, our laboratory has characterized caspase-dependent pulmonary apoptosis which is abrogated by the administration of a broad-spectrum caspase inhibitor. not only did caspase inhibition attenuate the pulmonary functional injury, but the proapoptotic response to ischemic aki appears to be mediated via a tnf receptor-1 (tnf-r-1) dependent pathway. our research has also demonstrated t-cell-dependent pulmonary apoptosis during ischemic aki. along with identification of activated t cells trafficking to the lungs during ischemic aki, we have found that pulmonary apoptosis was subsequently attenuated in t-cell-deficient animals. further pursuit of the specific pathway for t cell and tnfr1-dependent pulmonary apoptosis remains an active focus of future investigation in our research laboratory. cardiovascular collapse is one of the most common causes of death in the setting of aki, yet the mechanisms involved are not entirely understood. kelly has demonstrated left ventricular dilation, increased left ventricular end diastolic and end systolic diameter, increased relaxation time, and decreased fractional shortening in an experimental model of ischemic aki. mechanisms of cardiac injury during ischemic aki include cardiac myocyte apoptosis and neutrophil infiltration, which have been attributed to increased cardiac and systemic tnf, il-1, and icam-1 expression [56, 57]. when kidney ischemic time is decreased, cardiac il-1 and icam expression, along with myocyte necrosis, decreased correspondingly. effects of ischemic aki on the central nervous system (cns) are evident clinically when mental status changes develop. of note, renal replacement therapy fails to fully correct this cns manifestation of renal failure. uremic toxins certainly contribute to many symptoms of encephalopathy; however, cellular and soluble inflammatory mediators have also been implicated. preclinical data identified an increase of kc, g-csf, and glial fibrillary acidic protein (gfap) in the cerebral cortex and hippocampus of the brain, which may serve to recruit neutrophils to sites of neuronal damage. this may result from either increased local neuronal production or an alteration of the blood-brain barrier; further research is required to delineate the source. a cell-mediated proinflammatory response has also been identified with activation of microglial cells (brain macrophages) during ischemic aki. ischemic aki is also implicated in oxidative stress, inflammation, apoptosis, and tissue damage in hepatocytes. hepatic stellate cells (hscs) regulate leukocyte trafficking and the secretion of chemokines such as il-8, and crosstalk between hscs likely occurs via a c-jun n-terminal kinase pathway. oxidative stress during ischemic aki causes hepatic malondialdehyde, an index of lipid peroxidation, to increase while total glutathione, an antioxidant, decreases. proinflammatory cytokine tnf expression and hepatic cellular apoptosis is also evident during ischemic aki. previous investigators and clinicians have labeled the gut as the motor of mof because of its ability to amplify the systemic sirs response in the setting of shock and gut hypoperfusion [6264]. these mechanisms include increased intestinal permeability, interactions between host and bacterial pathogens, and propagation of toxins to distant organs via the lymphatic system [63, 65] and could potentially play a role during ischemic aki. clinical studies have long demonstrated the increased secretion of potassium by the colon and rectum in response to aki, and recent literature linked channel-inducing factor, a potassium channel regulator found in both the kidney and colon, to ischemic aki [67, 68]. the role of the gut in response to organ crosstalk during ischemic aki remains a fascinating topic of future investigation. aki is a frequent complication amongst hospitalized patients, with grave implications in the setting of mof. ischemic aki initiates a cascade of proinflammatory pathways, and through the release of soluble mediators and activation of the host innate and adaptive immune systems, it facilitates organ crosstalk and remote organ injury. as our understanding of the postischemic kidney's role in mediating organ crosstalk continues to evolve, further laboratory investigation into the remote organ response to this devastating injury

acute kidney injury (aki) is a common complication during inpatient hospitalization, and clinical outcomes remain poor despite advancements in renal replacement therapy. aki in the setting of multiple organ failure (mof) remains a formidable challenge to clinicians and incurs an unacceptably high mortality rate. kidney ischemia-reperfusion injury (iri) incites a proinflammatory cascade and releases cellular and soluble mediators with systemic implications for remote organ injury. evidence from preclinical models cites mechanisms of organ crosstalk during ischemic aki including the expression of cellular adhesion molecules, lymphocyte trafficking, release of proinflammatory cytokines and chemokines, and modification of the host innate and adaptive immune response systems. in this paper, the influence of kidney iri on systemic inflammation and distant organ injury will be examined. recent experimental data and evolving concepts of organ crosstalk during ischemic aki will also be discussed in detail.

PMC3118535

pubmed-333

plasma cell leukemia (pcl) is a rare disease that represents approximately 4% of plasma cell malignant disorders.1 diagnosis of pcl is established based on kyle s criteria, which includes an absolute plasma cell number accounting for greater than 2000/l or 20% of white blood cell differentiation.2 pcl consists of two variants: primary pcl presents in patients with no previous history of multiple myeloma (mm), while secondary pcl consists of a leukemic transformation in previously recognized mm.3 primary pcl is an extremely resistant, rapidly progressive, fatal disease, with a median overall survival of 6.8 months.4 there is no standard therapeutic strategy because none of the treatment options have been prospectively evaluated. we describe herein a successful case of newly diagnosed primary pcl, treated with a regimen that included bortezomib, followed by auto stem cell transplantation (asct) and nonmyeloablative allogeneic stem cell transplantation (allo-sct). a 37-year-old man with suspected primary pcl was sent from a nearby hospital to our institution in february 2010. table 1 shows the laboratory data of the initial medical examination, and table 2 shows the data on admission to our hospital. the white blood cell count and its differentiation met kyle s criteria. the patient had acute heart failure. his chest x-ray revealed cardiomegaly (cardiothoracic ratio was 59%) with slight pulmonary congestion. amino-terminal pro-brain natriuretic peptide levels were elevated to 811.2 pg/ml. this acute heart failure was probably caused by cardiac amyloidosis, as cardiac ultrasound showed a granular sparkling pattern. these cells were negative for cyclin d1, cd3, cd5, cd10, cd20, cd56, cd79a, and chain, and positive for cd138 and chain. no immunoglobulin h/cyclin d1 (igh/bcl1) translocations were found in fluorescence in situ hybridization analysis. treatment with a pad regimen (bortezomib 1.3 mg/m [days 1, 4, 8, and 11], adriamycin 1.3 mg/m [days 1, 4, 8, and 11], and dexamethasone 40 mg/body [days 14, 811, and 1518 ]) was started. as soon as the treatment was started, leukemic plasma cell levels rapidly decreased (figure 1). no organ dysfunction was detected, except that serum creatinine levels temporarily increased to 1.21 mg/dl. on day 27 of the first pad cycle after three pad cycles, we were unable to assess his bone marrow, because it remained dry tap. serum /, a surrogate marker for the treatment effect of this case, became similar to normal levels. in addition, the granular sparkling pattern detected by cardiac ultrasound at the time of admission disappeared. the patient was then administered high-dose therapy (hdt)+asct. before hdt+asct, his p eripheral blood stem cells containing 10.9 10/kg cd34-positive cells were harvested with high-dose cyclophosphamide. he received hdt+asct with a conditioning regimen of high-dose melphalan (100 mg/m [days 3 and 2 ]) and bortezomib (1 mg/m [days 7, 4,+1, and+4]). at the end of hdt+asct sixty-seven days after hdt+asct, the patient received allogeneic bone marrow stem cell transplantation (allo-bmt) from his human leukocyte antigen-matched brother, containing 2.1 10/pt kg nuclear cells and 1.44 10/pt kg cd34-positive cells. the conditioning regimen consisted of fludarabine (30 mg/m [day 6 to day 2 ]) and total body irradiation (2 gy [day 1]). graft-versus-host disease (gvhd) prophylaxis included tacrolimus and short-term methotrexate. twelve months after allo-bmt, the patient s serum/level was maintained at normal levels. he remained in a state of remission, with only the complication of mild skin gvhd. there are no established therapeutic regimens for pcl. several regimens that include an alkylating agent are sufficient to improve the overall survival (os) of pcl patients. jimnez-zepeda and domnguez reported a median os of 6.8 months for pcl patients treated with a common chemotherapy regimen consisting of vincristine, adriamycin, and dexamethasone, versus 2 months for those who received melphalan and prednisolone.5 it has also been reported that a combination of intermediate doses of melphalan and dexamethasone obtained the highest level of response in pcl patients. however, the median os was only 60 days for the cohort that achieved a partial or complete response.6 by comparison, bortezomib regimens show promise as induction regimens for pcl. katodritou et al reported that a combination of bortezomib and dexamethasone prolonged os (median, 12 months).7 the efficacy of pad has been reported by chan et al.8 similar to the case presented by chan et al, our case, inducted with pad, showed a very impressive clinical course. as soon as pad was started, leukemic plasma cell levels rapidly decreased (figure 1). in addition, anemia and platelet depletion improved, and acute heart and kidney dysfunction rapidly recovered. after three pad cycles, serum/levels were normalized, without any adverse effects (figure 2). in the present case, the absolute values of the immunoglobulin/free light chains in the serum before and after therapy had to be very important although pad is effective for pcl, it remains to be determined whether long-term survival is improved, because of a lack of long-term follow-up. immunomodulatory drugs (imids), such as thalidomide and lenalidomide, are as promising as bortezomib.9, the reasons we did not choose imids were that lenalidomide was not approved in japan at the onset of the patient s pcl, and we decided to leave an opportunity to use thalidomide at his relapse. our case represented a potential curative strategy for pcl, with the safe introduction of allo-immunization with a n onmyeloablative regimen following pad and hdt+asct. for multiple mm, the most common malignant disease in plasma cells, asct is regarded as the standard therapy for newly diagnosed cases in patients younger than 65 years. however, few patients who undergo the procedure are free of disease for more than 10 years. on the other hand, allo-sct is a promising therapy. because of the graft-versus-myeloma effect, a lower relapse rate and longer remissions have been reported in patients receiving allo-sct.11 presumably, pcl may be the same as mm. however, the high risk of transplant-related mortality (30%60%) is a limitation of the use of allo-sct for mm. to overcome this limitation, maloney et al reported that combining a cytoreductive autograft with a nonmyeloablative allograft lowered transplant-related mortality by approximately 15%.12 meanwhile, ramasamy et al reported that alemtuzumab-based reduced intensity conditioning allogeneic transplantation.13 although progression-free survival of their patient cohort was comparable to previously published data of reduced intensity conditioning allogeneic transplantation in myeloma, there is no plateau on the survival curves, with a significant transplant-related mortality of 21%. although nonmyeloablative conditioning reduces transplant-related mortality, it is difficult for patients older than 65 years to use our strategy. for them we have a successful case of newly diagnosed primary pcl, treated with a regimen that included bortezomib and asct, followed by nonmyeloablative allo-sct. this strategy is promising for pcl, which, though an extremely resistant disease, may become curable.

plasma cell leukemia (pcl) is a rare disease that represents approximately 4% of plasma cell malignant disorders. pcl consists of two variants: primary pcl presents in patients with no previous history of multiple myeloma, while secondary pcl consists of a leukemic transformation in a previously recognized multiple myeloma. primary pcl is an extremely resistant, rapidly progressive, fatal disease, with a median overall survival of 6.8 months. there is no standard therapeutic strategy, because no treatment option has been prospectively evaluated. we describe a successful case of newly diagnosed primary pcl, treated with a regimen that included bortezomib, followed by auto stem cell transplantation and nonmyeloablative allogeneic stem cell transplantation. our patient has maintained remission status for over 12 months since undergoing the allogeneic stem cell transplantation. this strategy is promising for pcl, which, though an extremely resistant disease, may become curable.

PMC3658252

pubmed-334

sutureless clear corneal incisions are now arguably the most common incisions made to perform cataract surgery with phacoemulsification, replacing scleral tunnel and limbal incisions. there are significant differences in the effects of clear corneal and scleral or limbal incisions, related to anatomical and physiological differences in the respective structures where the incisions are made. the cornea is comprised of a regular lamellar structure of collagen fibrils that stretch from limbus to limbus, arranged in a lattice formation; this is what provides the primary structural support of the cornea and accounts for its transparency. vascular arcades are present, providing a potential source of fibroblasts. the differences in the healing effects of incisions at the limbus and the cornea have been previously discussed in the literature [24]. limbal incisions appear to heal more quickly and are more resistant to deformation pressure than those in the cornea. clear corneal incisions also appear to increase the likelihood of endophthalmitis, potentially for the reasons above. in short, there are no disadvantages to a limbal incision in terms of surgical safety. from a structural point of view it is known that incisions for cataract surgery will induce a flattening effect when made on (or near) the steep axis of the cornea. this effect is positively correlated with incision size (larger incisions generating more astigmatism, all other things being equal) and location (scleral or limbal incision inducing less astigmatism than clear corneal), though for small incisions the effect of location appears less critical [6, 7]. wound construction also appears to have an effect, with square incisions reported to affect astigmatism the least. data related to surgically induced astigmatism in the recent literature is primarily related to clear corneal incisions. the data reported here summarize the astigmatic changes produced with a small (2.2 mm) square posterior limbal incision. a retrospective patient chart review was conducted at one site (pe) for a study of toric and spherical iols. those eyes with preoperative and postoperative keratometry results eyes were excluded if they had irregular (nonorthogonal) corneal astigmatism or if they had previous corneal surgery. this obviated the need for a specific informed consent or irb approval for the data collection undertaken here. in addition, all patients sign an acknowledgement that their deidentified phi data may be used for research purposes when they are seen in the practice. comparative surgically induced astigmatism data were obtained from one of the authors (w. hill) from a website specifically designed to collect preoperative and postoperative keratometry data for the purposes of calculating surgically induced astigmatism. this site provides the necessary spreadsheet and instructions to surgeons for the calculation of sia. an option allows any surgeon who uses the spreadsheet to upload their data to the website for the purposes of aggregate analysis. again, no phi was collected so informed consent was not required for this data set. results from ph and the aggregate data from wh were tabulated in microsoft excel and analyzed using statistica statistical software. differences between groups were calculated with t-tests and analysis of variance (anova) tests, with significance at p<0.05. for the patients at one site (p. ernest) the data were corroborated with an automated keratometry reading and the automated keratometry feature of the iolmaster (carl zeiss meditec, jena, germany). the automated keratometry readings were repeated on all patients postoperatively, and the comparison to the preoperative automated keratometry was used to calculate sia. the surgical technique employed in the time period in which the retrospective data were collected was constant for all patients. all incisions were temporal, 2.2 mm square posterior limbal incisions, using a technique previously described in the literature. surgical technique was not described in the aggregate sia data collected off the web, but incision type (e.g., clear corneal, limbal) was generally indicated, and the size of the incision was noted. these variables were collected so that surgeons could submit different preoperative and postoperative data sets for different incision sizes and locations. the review of available clinical records from pe yielded a total of 38 eyes that both met the criteria for inclusion and had available postoperative keratometry data for analysis. surgically induced astigmatism was calculated as the vector difference between preoperative and postoperative anterior corneal astigmatism as measured with automated keratometry. the sia in this cohort averaged 0.25 d with a standard deviation of 0.14 d. a total of 1,712 eyes were available in the aggregate sia data from w. hill, from 51 different surgeons. the data were filtered to remove duplicates, include only incision sizes of 2.2 mm, and exclude those records where the incision type was not indicated. where there were not at least 20 surgeries in any incision category (size and location) for a surgeon, those data were also deleted. after this data-screening step, 246 surgeries from 5 surgeons remained for comparative analysis. average preoperative keratometry was not statistically significantly different between surgeons (p=0.41); means ranged from 43.8 d to 44.5 d. the magnitude of preoperative corneal cylinder was also not statistically significantly different between surgeons (p=0.13); means ranged from 0.79 d to 1.04 d. table 1 contains a summary of the surgically induced astigmatism by surgeon. looking at the aggregate clear corneal incision data versus the ernest posterior limbal data, there was a statistically significant difference in the surgically induced astigmatism by incision type (p<0.001). inside the clear corneal group as a post hoc test, the ernest data were compared to the surgeon with the lowest average sia from the clear corneal incision group (surgeon 5); there was a statistically significantly lower mean sia in the ernest cohort (p=0.001). note, too, that the standard deviation of the ernest cohort is less than half that of the cohorts of 4 of the 5 other surgeons, and 40% lower than surgeon 5 despite having less than half the sample size. surgeons 1 to 5 used 2.2 mm clear corneal incisions, while pe used a 2.2 mm square posterior limbal incision. there was a statistically significant difference in sia by surgeon (p<0.001). post hoc testing showed that the ernest data yielded a statistically significantly lower sia than the other surgeons ' data. the results suggest that the magnitude and the variability of surgically induced astigmatism with small incision surgery (2.2 mm) is significantly lower if a posterior limbal incision is used instead of a clear corneal incision. results for the clear corneal incisions used here as comparative data are consistent with those recently reported in the literature. wilczynski et al. reported sia values of 0.50 0.25 d with 1.7 mm and 1.8 mm surgical incisions. holland reported sia values of 0.6 0.4 d for 2.4 mm clear corneal incisions. masket reported that sia results were somewhat lower with his 2.2 mm clear corneal incisions (0.35 0.21 d) but it is worth noting that his incision was started with a groove at the temporal limbus. some of the variability of sia data from surgeons other than ernest is likely related to differences in technique between surgeons. in addition, intrasurgeon variability may be slightly higher if surgeons did not measure their postoperative keratometry 1 month or more after surgery, as there is some change in keratometry expected in that first month. the minimization of the magnitude (and variability) of surgically induced astigmatism is important for modern day cataract surgery, particularly with the use of toric and multifocal intraocular lenses residual astigmatism after surgery will reduce the likelihood of spectacle independence for distance vision for these patients. minimizing astigmatism for multifocal iols is equally important, as even small amounts of residual astigmatism can compromise the outcome with regard to uncorrected visual acuity at distance. surgeons interested in reducing the magnitude and variability of induced astigmatism at the time of cataract surgery may want to consider the use of a 2.2 mm square posterior limbal incision.

purpose. to compare the surgically induced astigmatism from clear corneal and square posterior limbal incisions at the time of cataract surgery. methods. surgically induced astigmatism was calculated for a set of eyes after cataract surgery using a temporal 2.2 mm square posterior limbal incision. results were compared to similar available data from surgeons using clear corneal incisions of similar size. results. preoperative corneal astigmatism averaged 1.0 d and was not significantly different between the incision types. surgically induced astigmatism with the 2.2 mm posterior limbal incision averaged 0.25 0.14 d, significantly lower in magnitude than the aggregate surgically induced astigmatism produced by the 2.2 mm clear corneal incision (0.68 0.49 d). conclusion. the 2.2 mm square posterior limbal incision induced significantly less, and significantly less variable, surgically induced astigmatism relative to a similar-sized clear corneal incision. this is likely to improve refractive outcomes, particularly important with regard to premium intraocular lenses.

PMC3216393

pubmed-335

the embryonic development of the cerebellum derives from the hindbrain from the fifth week, originating from the thickening of the dorsal alar plates. anatomically it is formed by a median portion, the vermis, connected to two large lateral masses, the cerebellar hemispheres. the cisterna magna is located in the posterior fossa and occupies the space between the underside of the cerebellum, the posterior side of the bulb and the roof of the fourth ventricle. it continues caudally with the spinal subarachnoid space and binds to the fourth ventricle through the opening median. at ultrasonography the cerebellar hemispheres are usually low to moderately echogenic, connected above by an echogenic cerebellar tentorium. the vermis is a highly echogenic structure, which can be recognized as an oval density in the midline of the axial and sagittal plans. the cerebellum and cisterna magna can be observed on ultrasound around 11 weeks, but the formation of the cerebellar vermis ends around 18 weeks. for this reason, we must be careful in early diagnosis of the posterior fossa anomalies before this period, due to the possibility of a pathological image simulation [3, 4]. the measurement of the transverse cerebellar diameter by two-dimensional ultrasonography (2dus) is a very reliable parameter in the evaluation and early detection of intrauterine growth restriction. on the other hand, an adequate evaluation of the posterior fossa abnormalities allows the diagnosis of the cisterna magna as the dandy-walker complex, megacisterna magna, and blake's cyst. the three-dimensional ultrasonography (3dus) appeared as an important tool in the evaluation of fetal central nervous system in the late 1990s, because of the development of high resolution endocavitary volumetric transducers. currently, with the development of new software like volume contrast imaging allows adequate evaluation of posterior fossa anomalies as well as the biometry of the cerebellar vermis [7, 8]. the three-dimensional extended imaging software (3d xi-medison, seoul, korea) is composed of three programs: multislice view, volume ct view, and oblique view. the multislice consists of multiple sequential and adjacent planes arranged in the set screen (sagittal, axial, and coronal). the reference plane, number of images arranged in the screen (1 1, 2 1, 3 2, 4 3, or 6 2), orientation and rotation of the image, the magnitude of the magnification, and depth and range between the planes (0.5 to 5.0 mm) can be adjusted according to the region of interest. a preliminary study evaluated the application of the multislice view in fetal central nervous system anomalies, showing potential benefits. up to date there are no studies evaluating the measures of the fetal cerebellum and cisterna magna by 3dus using the multislice view. the objective of this study is to compare the measurements of transverse cerebellar and anterior-posterior cisterna magna diameter obtained by 2d and 3dus using the software 3d xi in normal pregnant women between 18 and 24 weeks. a prospective cross-sectional study between march 2010 and february 2011, involving 69 normal pregnant women between 18 and 24 weeks was performed. this study was approved by the research ethics committee of the irmandade da santa casa de misericrdia de so paulo, brazil, and the patients who agreed to participate signed a term of consent. this study was carried out at the department of obstetrics and gynecology, faculty of medical sciences of santa casa of so paulo (fcmscsp). the patients were randomly selected, and all evaluation made by a single examiner (fsbb), with five years experience in obstetric ultrasound. the examinations were performed on a sonoace x8 (samsung-medison, seoul, korea) device equipped with multifrequency volumetric convex transducer (37 mhz). the criteria for inclusion were (1) unique pregnancy with live fetus and (2) gestational age evaluated by last menstrual period and confirmed by ultrasound performed until the 14th week (crown-rump length-crl: 484 mm). exclusion criteria were (1) pregnant women carrying fetuses with structural anomalies detected at the time of the examination and (2) pregnant women carrying chronic diseases that would interfere with fetal growth. initially, a realtime 2d evaluation was performed in order to evaluate the biometry, morphology, and quantification of amniotic fluid volume. for the 2d measurement of transverse cerebellar and anterior-posterior cisterna magna diameter, it was performed a modified transversal slice of the fetal head slightly angled, through the thalamus, cerebellar hemispheres, cisterna magna, cave of septum pellucidum, the occipital bone, and nuchal fold. an insonation angle of the occipital bone was chosen, taking care that it was focused on an angle of 30. it was performed a single measurement of transverse cerebellar and antero-posterior of the fetal cisterna magna diameter in each mother, and this image is saved in the memory of the device. the three-dimensional volume acquisition was performed on the same 2d plane in which was performed the measurements of the transverse cerebellar diameter and anterior-posterior cisterna magna, to encompass the entire fetal skull (roi-region of interest) (figure 1(a)). in order to standardize all 3d measurements, the following preset was used on the device: scanning3d static; display mode three-dimensional extended imaging (multislice view); scanning speed slow; angle scanning70; overall gain of the device50%. after the three-dimensional scanning, the image was displayed in the multiplanar mode (axial, sagittal, and coronal) (figure 1(b)). the volumes were saved in the device memory and then stored on compact discs (cds) and transferred to a personal computer. the analyses were performed offline in the same apparatus in a time period of 30 to 120 days after the volumetric capture. for measurements of the transverse cerebellar and anterior-posterior cisterna magna diameters the program multislice view on 3 2 (two rows and three columns) was chosen, with slice thickness of 0.5 mm (figure 1(c)). the buttons 3 and 4 of the device were maneuvered, for navigation between tomographic slices, until in one of them the image of the cerebellum disappeared in higher plan than that of the posterior fossa (figure 1(d)). from this point, the 1 1 (one row and one column) option was selected and the number of the image was recorded. with the presence of only one tomographic slice on the screen, the button 4 of the apparatus was rotated clockwise or counterclockwise, depending on the fetus position, leading the exposition of a lower plan, successively until the outline of the cerebellum began to appear. following, each plan of the cerebellum and the cisterna magna was measured, with a difference of 0.5 mm between them to the normal cerebellum outline disappeared and the bone of the skull base could be observed. on average, measurements of the transverse cerebellar diameter and the antero-posterior diameter of the cisterna magna were performed in 25 consecutive plans in each volume, being considered as the value of the measurement of the cerebellum and the cisterna magna by 3d xi method the highest value obtained. the average time for manipulation of the 3d volume measurement of the cerebellum and the cisterna magna was 180 seconds. the data were transferred to an excel 2007 (microsoft corp, redmond, wa, usa) spreadsheet and analyzed by the statistical package for social sciences (spss inc., chicago, il, usa) version 19.0 for windows. for the 2d and 3d measurements of the transverse cerebellar diameter and antero-posterior cisterna magna, mean, median, maximum, and minimum values were calculated. and for the 3d measurements percentiles 5, 10, 90, and 95 were also calculated in each gestational age evaluated. to evaluate the difference between the two techniques the wilcoxon test was used. to evaluate the correlation of 2d and 3d, measurements of the transverse cerebellar diameter and antero-posterior cisterna magna as well as measurements of biparietal diameter (bpd) and head circumference (hc) according to the gestational age, the spearman's correlation coefficient (r) was used. in cases of high correlation, polynomial regression models, with adjustments by the coefficient of determination (r) the first examiner (fsbb) held a second 2d and 3d measures in 8 cases randomly selected 7 days after the first. for interobserver reproducibility, a second examiner (lsvf), with the same experience in obstetric ultrasound performed a third measure of these same 8 cases, and the results were armored one of the other. for this purpose, to calculate the reproducibility intraclass correlation coefficient (icc) and it is considered poor correlation icc<0.40; satisfactory iccs between 0.40 and 0.75 and excellent icc 0.75. the bland-altman plots evaluate the average of measurements performed by one or two examiners plotted against the difference of their mean values with standard deviation 1.96 (limits of agreement). in all analysis we used a significance level (p)<0.05. the 69 patients initially selected met the criteria for inclusion and exclusion, being allocated in the final statistical analysis. the age of the pregnant women ranged from 17 to 41 years, with an average of 26.93 years (standard deviation 6.10 years). the number of pregnancies ranged from 1 to 6, with an average of 2.19 pregnancies (standard deviation of 1.32 pregnancies). the average transverse and anterior-posterior cerebellum and cisterna magna diameter by 3dus ranged from 9.23 3.16 mm (18.0629.34) and 6.62 1.41 mm (4.1910.45), respectively. the average transverse diameter and antero-posterior cerebellum and cisterna magna by 2dus ranged from 22.33 3.16 mm (18.1429.10) and 5.60 1.33 mm (3.189.32), respectively. it was observed that on average the measurements obtained by 3dus were significantly higher, 0.76 and 1.02 mm for the length of the cerebellum and cisterna magna, respectively (p<0.001) (tables 1 and 2). there was a high correlation between the measurement of transverse cerebellar diameter by 3dus with gestational age (r=0.940, p<0.001) as well as measures of dbp (r=0.927, p<0.001) and hc (r=0.938, p<0.001). the equation that best represented the correlation between the extent of the transverse cerebellar diameter and gestational age was of a second degree: dtc=7.231+1.851 ga 0.027 ga2 (r=0879). for the measurement of antero-posterior diameter of the cisterna magna, a low correlation between gestational age, bpd, and hc (r=0.462, p<0.001; r=0.430, p<0,001; r=0.517, p<0.001, resp.) (figure 2) was observed. the low correlation between the antero-posterior diameter of the cisterna magna and gestational age did not allow the construction of polynomial regression models. tables 3 and 4 show the percentiles 5, 10, 90, and 95 for measurements of the transverse and anterior-posterior cerebellum and cisterna magna diameter at each gestational age evaluated. an icc>0.66 for all intra- and interobserver measurements of the cerebellum and cisterna magna length by 3dus was observed, with the exception of the intraobserver measurement of the length of cisterna magna (icc=0.792, 0.668, 0.691, and 0.287, resp.). the mean differences as well the limits of agreement for intraobserver and interobserver reproducibility of the cerebellum and cisterna magna length by 3dus were 0.16 mm (limits of agreement, 0.79; 1.11), 0.13 mm (limits of agreement, 1.22; 0.95), 0.08 mm (limits of agreement, 0.67; 0.82), and 0.12 mm (limits of agreement, 0.69; 0.93), respectively (figures 3 and 4). the posterior fossa cystic malformations include abnormalities of the meninges (arachnoid cyst, megacisterna magna) and cerebellum (dandy-walker malformation and variants). the prenatal diagnosis of these malformations is of great importance for an adequate followup of pregnancy as well as the relatives counseling. the postnatal results are in general very bad in the dandy-walker malformation and variants, mainly as result of associated anomalies. the postnatal result of megacisterna magna is better, especially if isolated. in this study, we compared the measurements of the transverse and antero-posterior cerebellum and cisterna magna diameters by 2d and 3dus between 18 and 24 weeks. this interval was defined by the fact that the transverse cerebellar diameter showed the highest correlation with gestational age, its measurement in millimeters is similar to the gestational age in weeks. furthermore, the diagnosis of agenesis of the vermis, especially the partial can not be performed before 18 weeks. in relation to the antero-posterior diameter of the cisterna magna, in general, in this period the ultrasound of the second trimester for malformations evaluation will be performed, its normal measure being less than 10 mm. in this study we observed that the transverse cerebellar and anterior-posterior cisterna magna diameters by 2d and 3dus increased from 18 to 24 weeks, however, the cisterna magna measurements by 3dus showed low correlation with the gestational age. in a cross-sectional study carried out by vinkesteijn et al. with 360 normal pregnant women between 17 and 34 weeks, the average of fetal transverse cerebellar diameter by 2dus was 22.1 mm from 18 to 24 weeks, very similar to our results obtained using 2dus (22.33 mm). in another cross-sectional study carried out by koktener et al. with 194 normal pregnant women between 16 and 24 weeks, the mean antero-posterior diameter of the cisterna magna by 2dus was 4.83 mm, lower than that obtained in our study (5.60 mm). the test to prove that the antero-posterior diameter of the cisterna magna increased from 18 to 24 weeks is important because the fixed value of 10 mm for the indication of normality can not be real in more advanced gestational ages. we believe that this low correlation measurement of the cisterna magna by 3dus and gestational age is due to a greater difficulty in identifying the edges of the structure as it progresses toward the occipital bone. in general, the mean diameters of the transverse and anterior-posterior cerebellum and cisterna magna by 2dus were lower than those obtained by 3dus. in studies evaluating the volume of fetal cerebellum by 3dus, there was also an increase in this parameter with the gestational age, both by multiplanar and virtual organ computer-aided analysis (vocal) methods [1820]. there are no studies evaluating the volume of the fetal cisterna magna by 3dus throughout gestation. other studies using other softwares such as three-dimensional volume contrast imaging c-plane have shown a positive correlation between the biometrics of the vermis and gestational age [821]. we observed in this study a statistically significant difference in the measurement of transverse and anterior-posterior cerebellum and cisterna magna by 2d and 3dus using the 3d xi (multislice view) software. the program multislice view (samsung-medison, seoul, korea) allows the evaluation of multiple plans of sequential and adjacent images arranged on the screen, being the thickness of the slices determined by the operator. in this study, we evaluated an average of 25 plans with 0.5 mm thickness between them, from the plan of the transverse cerebellar diameter measure to a plan in which the usual outline was lost and the bone of the skull base could be observed. we used as the final value the greatest measure found, unlike the 2dus in which we used a single measure. we believe that the measures taken by 3dus should be more reliable because it corrects any small displacement of the sound beam transducer, which can compromise the 2d measure. however, the biggest inconvenience of this technique, which makes its application in clinical practice difficult, is the long time required to perform the measurements, an average 180 seconds. we noticed in this study an icc value>0.66 for all length measurements of the fetal cerebellum and cisterna magna through 3dus, except for the intraobserver measure of the cisterna magna (icc=0.287). such a result could assume a low reproducibility of the new method; however, by bland-altman plot it was observed that the intraobserver mean difference was similar to the cerebellum and cisterna magna (0.16 and 0.13 mm, resp.). we believe that the low value of icc is due to the small number of cases we evaluated, and as this is a laborious technique with average rating of 25 plans per volume, with a mean time of 180 seconds, it may have contributed to this low value of icc. however, the real applicability of the method can only be testified in further studies evaluating pathological cases of fetal central nervous system. we believe that the great importance of this study is the evaluation of borderline cases, such as an anterior-posterior diameter of the fetal cisterna magna of 9.0 mm and a transverse cerebellar diameter of 16 mm at 18 weeks of gestational age. in these cases the 3dus with the program multislice view can help in decision making between normal and pathological cases, modifying the prenatal, and counseling of the parents. in summary, this was the first study that compared the measurements of the transverse and antero-posterior fetal cerebellum and cisterna magna diameters by 2d- and 3dus using the 3d xi (multislice view) software. the measurements the length of the fetal cerebellum and cisterna magna by 3dus were significantly higher than those obtained by 2dus. the length measurement of the cisterna magna by 3dus showed low correlation with gestational age. measures the length of the cerebellum and cisterna magna by 3dus proved to be reproducible.

to compare the fetal cerebellum and cisterna magna length measurements by means of two- (2dus) and three-dimensional (3dus) ultrasonography using the three-dimensional extended imaging (3d xi), a cross-sectional study with 69 healthy pregnant women between 18 and 24 weeks was performed. for the measurements by 2dus, the axial planes were used and for the 3dus a sequence of adjacent axial slices (multislice view). to evaluate the difference between the two techniques, we used the wilcoxon test. to evaluate the correlation between the cerebellum and cisterna magna length measurements and the gestational age, we used the spearman correlation coefficient (r). for the calculation of reproducibility, we used the intraclass correlation coefficient (icc). the mean of the transverse and anterior-posterior diameter of cerebellum and cisterna magna by 3dus was 9.23 and 6.62 mm, respectively. it was observed that the average of the measurements obtained by 3dus was significantly higher, 0.76 and 1.02 mm for the length of the cerebellum and cisterna magna, respectively (p<0.001). there was a high correlation between the length measurement of the cerebellum 3d (r=0.940, p<0.001), but low correlation of cisterna magna 3d (r=0.462, p=0.080) with the gestational age. there was good intra- and interobserver reproducibility for the cerebellum and cisterna magna 3d with icc=0.792, 0.668, 0.691, and 0.287, respectively. the measurements of the fetal cerebellum and cisterna magna length by 3dus using the software 3d xi were significantly higher than those obtained by 2dus.

PMC3504390

pubmed-336

over the next several decades, the number of americans living to advanced ages will increase substantially. although many individuals will age in relatively good health, a growing number will encounter challenges associated with the burdens of chronic conditions and associated disabilities [13]. this is especially so for the large numbers of women who will continue to outlive their male counterparts and likely live those additional years with chronic illnesses requiring day-to-day management [4, 5]. further, with a dramatic increase of female baby boomers with obesity-related chronic conditions, accompanied by reduced fertility rates among this rapidly aging cohort, the additive or multiplicative effects of living with one or more chronic conditions are likely to result in a diminution of (1) individuals ' capacity to adequately care for themselves, (2) caregivers to serve as efficient resources, and (3) healthcare providers to give adequate attention and guidance to complex patients with multiple chronic conditions (mccs). in line with the millions of older women struggling to manage the symptoms associated with chronic disease, there is growing recognition about the importance of self-care behavior, which is supported by strong epidemiological documentation regarding the positive association of self-care and health outcomes [710]. however, this issue transcends women's exposure to and understanding of pertinent information and their development of self-care skills. older women with chronic conditions also need to assess their surrounding resources to develop the confidence and efficacy necessary to initiate and maintain self-care behavior [1113]. self-care behavior are intended to draw upon one's physical, social, and healthcare environments to compensate for, or delay, physical limitations and chronic conditions from progressing into more severe disabilities. further, self-care skills include (1) identifying strategies that enable older women to adopt and institute appropriate self-care behavior such as getting adequate exercise, eating healthy, or managing medications [15, 16]; (2) interacting with healthcare providers to obtain resources and referrals necessary to manage the progression of chronic conditions [10, 17, 18]; and (3) locating social and community resources to become more educated about their conditions and alleviate the stressors and frustration acting as barriers to self-care behavior [6, 19]. while a growing literature has identified general disparities related to self-care among women with chronic conditions based on their race/ethnicity [2022], socioeconomic status [2224], and residential rurality [22, 25], the extent to which self-care disparities exist based on these and other sociodemographics requires further investigation. similarly, the role of education an indicator of socioeconomic status, healthcare access, and health behavior engagement emphasizes its importance when assessing disparities issues [26, 27]. additional efforts are needed to examine the influence of sociodemographics on self-care skills and behavior among aging women, especially in the presence of perceptions about healthcare-related factors. healthcare provider-patient interactions can foster self-care behavior although such interactions can also have a less-recognized negative effect on disease self-management. women can feel frustrated and helpless when their physicians do not fully explain or clarify the causes of their disease or ways how to best manage their illness. some patients report not having enough time to address their concerns, or that their physicians simply would not listen to them. conversely, among patients with diabetes, those who have good communication with their physicians report feeling more involved in decision-making efforts to manage their condition more effectively. also, patients who report their physicians provided adequate information about their conditions were more likely to better self-manage their illnesses. healthcare professionals often encounter challenges to address their female patients ' mcc alongside existing barriers to self-care behavior in their home or community environments. regardless of the source or cause of these barriers, competing demands on the side of either the patient or provider have potential to create a recursive relationship resulting in disconnect, miscommunication, frustration, and fewer self-care practices. these occurrences may inevitably contribute to decreased health outcomes and rapid chronic disease progression, which highlights the importance of support mechanisms available to the patient. effective self-care support mechanisms and resources identified to promote self-care behavior include traditional in-person, familial, and community support systems (e.g., support groups and faith-based organizations) [6, 3135]; however, an emergence in technology-based support mechanisms has been shown to enable individuals with chronic conditions to access and utilize self-care information, despite traditional barriers [18, 3639]. further, the active seeking of self-care support and resources has been shown to enhance self-care behavior among individuals with chronic conditions [12, 38, 40]. the preferred and/or utilized support mechanisms differ by population subgroup and type of chronic condition. evidence shows that racial/ethnic minorities with chronic conditions report increased in-person support mechanisms compared to their non-hispanic white counterparts [41, 42]. conversely, those residing in rural areas have shown improvement in their self-care behavior through the use of internet-based support mechanisms, which may be critical to overcome traditional challenges associated with geographic isolation, less healthcare resources, and longer travel distances to healthcare services [25, 44]. the advancing study of self-care behavior has identified factors influencing the adoption and maintenance of self-care behavior for different populations and people of all ages, with more recent attention paid to lifestyle relative to disease self-care behavior [17, 45, 46]. to advance the translation of research to practice, this secondary data analysis assesses issues surrounding self-care barriers, healthcare-related frustrations, and perceived supports among middle-aged and older adults with one or more chronic conditions. in an effort to further understand the multilevel influences on perceived barriers to self-care, this study will examine the roles of healthcare frustrations and doctor-patient interactions alongside other simultaneously occurring contextual factors (see figure 1). more specifically, the purposes of this study were to (1) describe sociodemographic variables, health indicators, healthcare-related frustrations, and perceptions of physician support among middle-aged and older adult women with one or more chronic conditions and (2) identify these factors ' association with reporting the need to help learning how to take better care of their health among this female population. the national council on aging (ncoa), with support from atlantic philanthropies and the california healthcare foundation (chcf), commissioned the ncoa chronic care survey, which offers unique insight into the lives of americans with chronic health conditions. the ncoa chronic care survey is a nationally representative probability survey of 960 community-dwelling men and women aged 44 years and older with at least one chronic condition. lake research partners utilized telephone-based interviewing to collect data using random digit dialing (rdd) sampling techniques, which oversampled those aged 65 and older and hispanics/latinos. the dataset was weighted by age, race, and region to reflect the overall population of americans 44+with chronic condition(s). margin of error is greater when analyzing smaller subgroups within the sample. to be eligible for inclusion in the ncoa chronic care survey, participants had to report having at least one chronic condition at the time of the study. participants were screened for chronic condition(s) with the following question(s): have you ever been told by a doctor, nurse, or other health professional that you have (name of chronic condition)? chronic conditions included in the screening process included heart disease, cancer, stroke, diabetes, arthritis, asthma, hypertension or high blood pressure, emphysema, chronic bronchitis, depression, anxiety, and others. only participants who reported yes to at least one of these items of the 960 adults age 44 years and older in this sample, only women were included in study analyses (n=427; 44.5%). of these women, an additional 140 cases (32.8%) more specifically, cases were omitted for incomplete data on rurality (n=48), frustration with the healthcare system (n=25), perceived physician support (n=18), self-reported chronic conditions (n=17), marital status (n=8), using the internet for general support (n=7), race/ethnicity (n=6), education (n=4), perceived barriers to self-care (n=4), and activity limitations (n=3). the analytic sample for this study contained 287 community-dwelling women, aged 44 years and older who self-reported having at least one chronic condition. when comparing characteristics of women omitted from the study (n=140) with those in the analytic sample (n=287), a significantly larger proportion of the analytic sample was younger (= 4.98, p=0.026), non-hispanic white (= 4.60, p=0.032), and married (= 11.78, p=0.001). participants were asked to self-report their perceived barriers to self-care using an item intended to measure their need for help to learn how to take better care of their health. more specifically, participants were asked to rate their level of agreement to the following statement: i need help learning how to take better care of my health in a way that works for me and my life. responses were scored on a 5-point likert-type scale ranging from strongly disagree to strongly agree. based on the frequency distribution, participant responses were then dichotomized into two categories: disagree (scored 0) and agree (scored 1). participants were asked to report their frustrations with healthcare interactions using items intended to measure their feelings about repeatedly having to describe their conditions at each doctor visit, the self-care instructions they received from the healthcare provider, the time spent interacting with the healthcare provider, and having a friend or family member attend physician's visits with them. for example, participants were asked to rate their level of agreement to statements like how often do you feel tired of describing your same conditions and problems every time you go to a hospital or doctor's office? and how often do you wish you had a friend or family member who could go to the doctor with you? responses were scored using a 3-point likert-type scale with categories of never (scored 0), occasionally the healthcare-related frustration scale (ranging from 0 to 12) was created using these six items. all items loaded on one factor and the items were summed into a single-composite score (= 0.766). higher scores for the healthcare-related frustration scale indicate a higher level of frustration with healthcare interactions. based on the frequency distribution, the highest tertile (i.e., representing the highest frustration levels) served as the referent group. participants were asked to self-report the degree to which their physician engages them in treatment-related problem-solving/decision-making, refers them to other healthcare services and professionals, and asks if they understand their medications and associated regimens. for example, participants were asked to rate their level of agreement to statements like how often does your physician ask for your ideas about how you can take care of your health problems? and how often does your physician talk to other doctors and nurses who are taking care of you? responses were scored using a 5-point likert-type scale with categories of never (scored 1), rarely (scored 2), occasionally (scored 3), frequently (scored 4), and always (scored 5). the perceived physician support scale (ranging from 6 to 30) was created using these six items. all items loaded on one factor and the items were summed into a single-composite score (= 0.776). higher scores for the perceived physician support scale indicate a higher level of perceived physician support. based on the frequency distribution, this scale was converted into tertiles for the analytic purposes. the lowest tertile (i.e., representing the lowest perceived support levels) served as the referent group. participants were asked to self-report aspects of their current health status using items intended to measure activity limitations, the number of prescription medications taken regularly each day, and the number of physician visits in the previous 12 months. participants were asked are you limited in any way in any activities because of physical, mental, or emotional problems? responses were scored as no (scored 0) or yes (scored 1). participants were also asked in the past 12 months, how many times have you, yourself made a doctor visit? participants were asked to self-report their perceptions about their use of the internet for general support related to managing their health problems. participants were asked how much do you rely on the internet for ongoing help and support with your health problems? responses were scored on a 4-point likert-type scale with categories of not at all (scored 0), a little (scored 1), some (scored 2), and a lot based on the frequency distribution, participant responses were then dichotomized into two categories: no (scored 0; indicating that they do not rely on the internet at all) and yes (scored 1; indicating that they rely on the internet at least a little). participants were also asked how often do you feel you get the help and support you need to improve your health and manage your health problems? responses were scored using a 5-point likert-type scale with categories of never (scored 0), rarely (scored 1), occasionally (scored 2), frequently (scored 3), and always sociodemographic variables in this study included age (i.e., 4464 years, 65+years); race/ethnicity (i.e., non-hispanic white, non-white); education level (i.e., high school or less, some college or more); marital status (i.e., unmarried, married); and residential rurality (i.e., urban, suburban, and rural). frequencies were calculated for all major study variables, which were initially examined in relationship to participants ' age group (4464 years, 65+years) and whether they reported needing help learning how to take better care of their health (yes or no). pearson's tests were performed to assess the independence between the dependent variable and categorized independent variables. logistic regression was performed to examine how sociodemographics, health indicators, perceived support, and frustrations were associated with reporting the need to help learning how to take better care of their health (i.e., not needing help served as the referent group). sample characteristics of study participants are presented in table 1. of the 287 females participating in this study, over 65% of participants were between the ages of 44 and 64 years and 34.4% were aged 65 years and older. respondents were disproportionately non-hispanic white (88.5%), married (69.0%), and had an education level of some college or more (61.7%). fifty percent of the study population resided in suburban areas, 25.2% resided in urban areas, and 24.8% resided in rural areas. approximately 33% of participants reported being limited from activities because of physical, mental, or emotional problems. on average, participants reported taking 3.67 (3.83) medications daily and visiting a physician 3.07 (1.94) times in the previous 12 months. over 45% of participants reported relying on the internet for ongoing help and support to manage their health problems, and 67% of participants reported frequently or always getting the help and support they need to improve their health and manage their health problems. compared to women aged 65 years and older, a significantly larger proportion of participants aged 4464 years had some college education or more (= 7.14, p=0.008) and relied on the internet for ongoing support to manage their health problems (= 21.15, p<0.001). a significantly larger proportion of participants who reported needing help learning how to better care for their health problems were non-white (= 4.78, p=0.029) and had a high school education or less (= 4.23, p=0.040). healthcare-related frustration scale characteristics are presented in table 2. of those who reported healthcare-related frustrations, 16.4% reported frequently wishing their doctor had more time to spend talking to them; 16.0% reported frequently feeling tired of describing their same conditions and problems every time they go to a hospital or doctor's office; 8.7% reported frequently wishing they had a friend or family member who could go to the doctor with them; and 8.3% reported frequently being tired of feeling on their own when it comes to taking care of their health problems. fewer respondents (5.6%) reported frequently feeling their doctor does not realize what it is really like for them at home trying to take care of their health problems or (5.2%) frequently leaving the hospital or doctor's office feeling confused about what they should do. on average conversely, when comparing frustrations by whether the participant reported needing help learning how to better care for their health problems, those needing help reported significantly higher scores on the healthcare-related frustration scale (t=4.79, p<0.001) and higher frustration levels for five of the six individual scale items (t=25.94, p<0.001). perceived physician support scale characteristics are presented in table 3. of those who reported receiving physician support, 50.9% reported their physician always helped them get an appointment they needed; 46.5% reported their physician always asked if they understood their medications when their doctor prescribed them; 15.7% reported their physician always talked to other doctors and nurses who were taking care of them; and another 15.7% reported their physician always made plans to contact them after a visit to see how they were doing. fewer respondents (13.3%) reported their physician always told them about other people who could help them with their health problems or (13.2%) their physician always asked for their ideas about how they can take care of their health problems. on average, participants scored 18.70 (5.84) on the perceived physician support scale. conversely, when comparing support by whether the participant reported needing help learning how to better care for their health problems, a significantly smaller proportion of those needing help reported asked for their ideas about how they can take care of their health problems (= 10.48, p=0.033). table 4 displays the results of the logistic regression analysis explaining factors associated with participants reporting they need help learning how to better care for their health problems (i.e., not needing help served as the referent group). participants who were non-white were significantly more likely to report needing help learning how to better care for their health problems (compared to non-hispanic whites, or=2.26, p=0.049), whereas those with some college or more were significantly less likely to report needing help learning how to better care for their health problems (compared to those with high school or less education, or=0.55, p=0.044). compared to participants with the highest level (tertile) of healthcare-related frustrations, those with middle (or=0.17, p<0.001) and lowest (or=0.44, p=0.017) frustration levels were significantly less likely to report needing help learning how to better care for their health problems, respectively. compared to participants with the lowest level (tertile) of perceived physician support, those with the highest level of perceived support were significantly less likely to report needing help learning how to better care for their health problems (or=0.49, p=0.033). despite our concerns that the majority of older women would likely experience self-care problems [4850], our analyses revealed that only about one-third of the women in our sample reported needing help learning how to take better care of their chronic conditions. but consistent with health disparities in the epidemiology of chronic illnesses [22, 24], persistent health disparities related to self-care behavior were noted among minorities and those with less education. the rural healthcare disparity often reported in other studies [25, 5153] was not observed in this study, nor were unmarried women disadvantaged relative to their married counterparts. these findings suggest middle-aged and older women in this sample were comparable in terms of having a variety of social supports for learning how to take care of their health. additionally, despite the previous assumption that older women might be disadvantaged relative to younger baby-boomers, no significant differences in help needed based on age group were reported. similarly, our proxy measures for disease magnitude and severity (i.e., number of medications, physician visits, and limitations in activities) did not differentiate those needing help. however, the existence of an age-based digital divide was observed [5456], with older women less likely to use online/technology as a resource for chronic condition self-management. further investigation is needed to examine differences in the types of methods/strategies in which these older women engage when caring for their health conditions outside of the healthcare setting. this study helps elucidate the complex relationships among contextual factors, healthcare frustrations, and patient-provider interactions and support and points to potential opportunities for intervention. the lack of a significant relationship between age and healthcare-related frustrations or perceptions about physician support may be attributed to the fact that the sample was selected based on the presence of chronic conditions. however, the lack of a significant relationship is consistent with the fact that participation in community-based disease self-management programs is not limited to those of only older ages; rather, program enrollment is based on the participant's chronic disease status. this study reveals two strong modifiable correlates of women needing help learning how to care for their chronic conditions, even after controlling for sociodemographic and health status indicators in multivariate analyses: healthcare-related frustrations and perceived physician support. the majority of identified frustrations were significantly related to middle-aged and older women's perceptions of needing help learning how to care for their health, which is supported in other studies [8, 16, 58, 59]. the recent emphasis on patient-centered care and medical homes is designed to help reduce such frustrations and hence can be expected to help boost women's self-efficacy to care for their own health conditions. additionally, perceived physician support was another significant factor for knowing how to self-manage chronic conditions, especially in terms of patient activation as exemplified by wanting physicians to ask for your ideas about how you can take care of your health problems. this reinforces previous research about the importance of perceived physician support for motivating patients to engage in healthier lifestyles and recommended medical regimens [9, 31, 61, 62]. from the health professional point of view, fostering beliefs of patient support can be accomplished through continuing education units (ceus) or expanded emphasis during medical school training to develop strategies in which clinicians can engage and implement to be supportive, listen to their patients, and solicit their patients ' thoughts so they have an active role in their healthcare team [29, 63]. from the patient point of view, widely available evidence-based self-management programs include elements within their curricula to teach older women how they can more effectively communicate with their healthcare providers. considering perspectives from each side of the healthcare interaction is essential to improve self-management both within and outside of the healthcare setting, which has implications for reducing disease mismanagement, unnecessary healthcare utilization (e.g., emergency room use), and medical costs. this secondary dataset did not contain all variables necessary to fully contextualize barriers and challenges associated with chronic disease self-care behavior among this aging population. however, this national study contained many variables of interest to address the current research gaps in knowledge about associations of healthcare frustrations, physician support, and self-care needs to chronic disease management. substantial numbers of participants were lost due to incomplete data on particular scale items, resulting in an analytical sample that was systematically different from the full sample (e.g., younger, married, and more white) and potentially limited the generalizability of study findings. this is especially true in that the reduction of cases in the analytic sample reduced the potential proportion of older adults in the study from 42.1% to 33.4%, which may especially influence generalizability of findings to populations aged 65 years and older. study participants reported a variety of chronic conditions, but subanalyses based on disease type were not performed because the sample size was inadequate to make such comparisons. recognizing that needed self-care behavior may differ based on women's particular condition diagnoses, disease stage, and the number of comorbidities in which they are diagnosed, future studies should strive to compare about barriers to self-care, perceived physician support, and frustrations with the healthcare system by their chronic condition profile. further, because women's ability to cope with and adjust to their disease self-care may differ based on their available resources and socioeconomic status, future studies should examine such variables to determine their relationship with self-care disparities. another study limitation reducing the ability to widely generalize findings to the greater female community was the self-report and cross-sectional nature of these data. however, the sample was derived from random digit dialing and included items that deeply explore the challenges and frustrations with chronic condition self-management, which are not typically seen in other studies that investigate correlations between self-care behavior and other healthcare or physical health indicators. thus, this study contributes to a fuller understanding of the complex interrelationships that exist between self-care strategies, provider-patient interactions, and policies/programs in community contexts. the current study adds to the existing science base by examining barriers to self-care with a new lens, exploring healthcare-related frustrations and perceptions of physician support, and how these perceptions relate to various life domains, including diverse health status and sociodemographic contexts. identifying these common and unique challenges and correlates of these challenges, with a representative national population, advance our current knowledge about self-care issues among middle-aged and older women. learning more about healthcare-related frustrations of and self-management supports utilized by middle-aged and older women has the potential to help program deliverers, healthcare providers, and health agencies provide the services and resources that women with chronic conditions want and think are helpful. findings from this investigation has potential to inform and guide modifications in the implementation and dissemination of evidence-based programs for older women to better match individuals with programs that meet their needs.

previous research emphasizes the importance of reducing healthcare frustrations and enhancing physician supports to help patients engage in recommended healthcare regimens. however, less is known about how these factors are associated with aging women's knowledge about self-care behavior. this study examined the sociodemographics, health indicators, healthcare-related frustrations, and perceptions of physician support associated with middle-aged and older adult females ' self-reported need for help to learn how to take better care of their health. data were analyzed from 287 females with one or more chronic conditions who completed the national council on aging (ncoa) chronic care survey. a logistic regression model was developed. women who were non-white (or=2.26, p=0.049) were more likely to need help learning how to better manage their health. those who had some college education or more (or=0.55, p=0.044) and lower healthcare-related frustrations (or=0.44, p=0.017) and perceived to have more physician support (or=0.49, p=0.033) were less likely to need help learning how to better manage their health. findings can inform the planning, implementation, assessment, and dissemination of evidence-based self-management programs for middle-aged and older women within and outside of clinical settings.

PMC3809381

pubmed-337

patients with schizophrenia (scz) exhibit a wide variety of cognitive deficits, particularly with memory (barch and ceaser, 2012; ranganath et al., 2008). these deficits are predictive of overall functional outcome and clinical remission (bodnar et al., 2008; green, 2006; green et al., 2004; kahn and keefe, 2013), and it has recently been suggested that schizophrenia should be viewed primarily as a cognitive disorder (kahn and keefe, 2013). understanding the nature of the memory deficits is therefore a critical goal when moving towards improved clinical interventions in scz. when considering episodic memory, one area in which patients with scz have a substantial deficit is with source monitoring (identifying the context in which a stimulus was encountered; johnson et al., 1993). for successful source monitoring it is necessary to bind elements of a memory together into a memory trace, along with their context (spatial context, temporal context, etc.). patients demonstrate source monitoring deficits even when stimulus recognition is preserved (danion et al., 1999; this deficit in source monitoring is in many ways not surprising given that patients with scz also demonstrate difficulties with relational or associative memory (binding items together during memory encoding, and later recalling which stimuli were presented together), while object memory is not as severely impaired (achim et al. most typically, source monitoring problems in scz are considered in the context of attributing events from internal (self) to external sources. patients with predominant hallucinations and thought disorder have a greater tendency or bias to attribute internally generated events to an external source, while still being able to correctly identify externally generated stimuli (brunelin et al. this bias for scz to misattribute internal sources has been observed in the absence of recognition memory deficits or false positive responses (fisher et al., 2008). interestingly, in a repetitive magnetic stimulation trial of low frequency (1 hz, inhibitory) stimulation to the left temporal parietal junction over 5 consecutive days not only improved auditory hallucinations but also resulted in an improvement in source monitoring compared to sham stimulation (brunelin et al., 2006). the improvement in auditory hallucination was marginally correlated with the improvement in source monitoring, further suggesting the relationship between source monitoring and hallucinations. patients with schizophrenia have also been found to have a deficit in source memory (remembering the context in which experimental stimuli occurred; brebion et al., 2002; the deficit in source memory has been related to deficits in binding contextual cues together into a holistic memory representation (diaz-asper et al., 2008; waters et al., 2004), which is an essential component of source memory. source memory errors are present in scz even for short-term recognition (when source information is tested immediately, minimizing the need to recollect information stored in long-term memory), suggesting that source memory deficits in scz may be related to encoding errors rather than problems in recognition (achim et al., 2011). (2009) performed a list learning task in scz and found that patients who hallucinate had more intrusions (indicating a word was part of the memory set when it was not) than non-hallucinating patients. this finding was related to source misattribution (patients attributing an internally generated stimulus to an external source, the original memory set). overall, scz appears to have a noteworthy deficit in source memory which is likely intricately related to other memory and cognitive processes, such as contextual binding and episodic memory. within healthy controls, source memory involves a range of cortical regions known to be involved in episodic memory, including the medial temporal lobes, prefrontal cortex, and parietal cortex. increased hippocampal activity has been related to trials in which the source was correctly identified (davachi et al., 2003; ranganath et al., 2004), probably due to the role of the hippocampus in relational binding (davachi, 2006). one of the first fmri studies to examine source memory found greater left prefrontal activity for source memory and for old new recognition (nolde et al., 1998), with subsequent studies finding activity in the left lateral prefrontal cortex associated with source memory for a variety of stimuli types (mitchell and johnson, 2009). prefrontal lesions have been found to disrupt the self-initiation of processes which promote feature binding (stuss and benson, 1986), and left prefrontal damage is associated with deficits in source monitoring (duarte et al., 2005). prefrontal activity during source recognition may be more involved in the evaluation of source information (e.g. does this stimuli fit with source x) rather than retrieving source information per se (mitchell et al., activity in medial parietal areas (intraparietal sulcus and precuneus) has been suggested to be present regardless of the type of source information being assessed (uncapher et al., 2006), while activity in lateral parietal areas may be more dependent on how well the information has been encoded (wheeler and buckner, 2004) and/or to attentional processes (cabeza, 2008). examining declines in source memory with age has proven fruitful for examining structural and functional correlates of source memory, with evidence that age-related decline in source memory is related to decreased activity mainly in the prefrontal and medial temporal lobes (see mitchell and johnson, 2009, for review). (2006) examined source monitoring in scz using a level-of-processing framework. patients were presented words with either deep (semantic) or shallow (orthographic) encoding instructions. during recognition, when participants successfully identified a previously encountered stimuli they were asked under which encoding condition the word was encountered (the source memory aspect being recalling the context in which the word was encountered, in this case, which encoding condition). when contrasting correct vs. incorrect source, both patients and controls activated areas of prefrontal and parietal cortices. patients showed activity in the middle and superior temporal gyrus, thalamus, and parahippocampal gyrus, which was correlated with more severe positive and negative symptoms independent of memory performance. other neuroimaging studies of source monitoring in scz have focused on deficits related to attributing stimuli as self-generated or externally-generated (reality monitoring). deficits in reality monitoring appear to involve the medial prefrontal cortex (subramaniam et al., 2012; vinogradov et al., 2008; wang et al., 2011). following computerized training to improve source monitoring, activity was found to be increased in the medial prefrontal cortex (subramaniam et al., 2012). the purpose of this study was to examine the neural correlates of source memory in schizophrenia. while most previous studies of source memory (in both controls and schizophrenia) have used less ecologically valid task (e.g. identifying the color of the stimuli during encoding), we utilized a paradigm involving encounters (with a person and an object in a specific place) within a realistic 3d environment (burgess et al., 2001; king et al., 2005), which may better evaluate source memory networks used in everyday life. we examined participants with early schizophrenia (within the first 4.5 years of treatment, with 75% of patients within the first 2 years) thus minimizing potential confounds associated with prolonged illness such as cognitive decline, social isolation and long-term medication effects. during fmri scanning a source recognition memory task was employed, which was contrasted with an object memory task. by directly comparing source memory to object memory, we can identify regions in the cortex which are specific to source memory compared to object memory and determine if any deficits observed in schizophrenia are source-memory specific. we hypothesized that patients would show deficits in source memory relative to object memory and may show compensatory activation in source memory retrieval contrasts. furthermore, as deficits in source memory have been associated with auditory hallucinations (woodward et al., 2007) we expected to observe relationships between hallucinations and the neural activity of source memory retrieval. all participants with scz were treated at the douglas mental health university institute in montreal, canada, at the prevention and early intervention program for psychoses, a specialized service providing treatment to individuals aged 1435 years from a local catchment area. individuals with an iq>70 who had not taken antipsychotic medication for more than 1 month were consecutively admitted as in- or out-patients. patients were assessed with the scale for assessment of positive symptoms (saps) (andreasen, 1984) and the scale for assessment of negative symptoms (sans) (andreasen, 1983) at numerous time-points following clinic admission (baseline; at 1, 2, 3, 6, 9, and 12 months; and every 6 months thereafter). (2003) or visit http://www.douglas.qc.ca/pages/view?section_id=165 for more details. for the neuroimaging study, only individuals aged 1830 years with no previous history of neurological disease, head trauma causing loss of consciousness, or lifetime diagnosis of substance dependence twenty-five people with schizophrenia spectrum disorders were recruited, diagnosed according to the structured clinical interview for dsm-iv (first et al., 1997) and confirmed between two senior research psychiatrists (a.m. and r.j.). twenty-four healthy controls were recruited through advertisements in local newspapers and were included only if they had no current or previous history of any axis i disorders, neurological diseases, or head trauma causing loss of consciousness, and no first-degree family members with schizophrenia or related schizophrenia-spectrum disorders. all patients provided written informed consent, and the study was approved by the research ethics boards of the douglas hospital research centre and the montreal neurological institute. participants performed an encoding task (outside the mri) using a modified version of the virtual city developed by burgess and colleagues (burgess et al., 2001; king et al., 2005), created using 3ds max (3ds max, 2011) and unity software (unity, 2011). participants navigated through a 3d virtual city, following a path indicated by green arrows to the site of an encounter (an encoding trial, a character at a location). after approaching within five virtual meters of the character, the participant's view was frozen and the character stepped aside, and a life-sized object appeared on a small table displayed to the right. participants were instructed to pay careful attention to the object, character and location, and try to remember for a later memory test. after a 5 s study delay the person and object disappeared, and participants then followed the arrows to the next encounter. there were a total of 20 encounters, each with a unique person, location and object. a total of 80 recognition trials were administered, in which participants were shown an image consisting of a typical viewpoint encountered within the virtual city (in one of 20 places where encounters occurred), with a person in the center of the screen, and two objects, one on each side of the person. participants were then asked one of four possible recognition questions: (1) person (which object was paired with this person), (2) place (which object did you view in this location), (3) object (which object was viewed in the city; the other object was new), and (4) bright (which object is brighter in appearance). participants responded on an mri-compatible button box to indicate which item (left or right) was selected. for the person condition, the place was not associated with either object, while in the place condition the person was not associated with either object. the person and place conditions were designed to access source memory (in what context was an object encountered) while the object condition assesses object memory (old vs. new). including two source memory conditions allows us to better understand if the observed activity is modality specific. the bright condition was not considered in this analysis as we were specifically interested in source vs. object memory. images (with encoding question) were presented on the screen for 8000 ms, with a 20008000 ms isi (in 100 ms increments), with an average trial length of 13 s. stimuli were presented and results were recorded through e-prime 1.0 software. 1. a practice route was designed to allow participants to become familiar with the arrow key and mouse, and to practice following the arrows and encounter two characters with objects in independent locales. participants also practiced answering two of each of the four forced-choice recognition questions regarding the objects collected. echo-planar images were collected on a siemens 3 t tim trio mri (tr=2000 ms, te=30 ms, flip angle=90, 36 slices of 4 mm thick, 64 64 voxel plane with an fov of 256 mm 4 mm slices). each bold run was preceded by 4 volumes that were later discarded to allow a magnetic steady state. the anatomical scan was an mprage (tr=2300 ms, te=2.98 ms, fov 256, 1 1 1 mm voxels, flip angle=9) and lasted 5.21 min. data analysis was conducted using spm 8 (wellcome department of cognitive neurology, london, uk). data was motion corrected by realigning to the 3rd tr, normalized to the icbm template (and resampled at 2 2 2 mm voxel size) and smoothed with an 8 mm isotropic gaussian kernel. the general linear model was implemented by convolving a standard hemodynamic response function and its first temporal derivative and dispersion. events were defined based upon recognition question (person, place, object, or bright), with incorrect answers modeled as distinct event types and excluded from further analysis. accuracy data was not available for three controls and four scz patients due to technical problems during initial data collection. for these participants, contrasts were person vs. object and place vs. object (both performed bidirectionally) to identify voxels which are differentially activated by source or object memory. a second level analysis was performed separately for each group (controls or scz) using a one sample t-test. corrections for multiple comparisons were performed at the cluster level using an individual voxel threshold of p<0.001 (uncorrected). a monte-carlo simulation of 1000 iterations (slotnick et al., 2003) resulted in a cluster extent threshold of 49 resampled voxels. to test for differences between groups, an independent-samples t-test was performed, using the contrast value derived for each participant from the above contrasts. given that between-group differences often have smaller effect sizes, we used a slightly more liberal single-voxel threshold of p<0.005, but corrected to p<0.01 at the cluster level (resulting in an extent threshold of 97 voxels). a regression analysis in patients was performed to examine the relationship between source memory and clinical symptoms. as patients were stabilized and undergoing treatment at the time of scanning, few patients were actively experiencing positive symptoms as of the assessment closest to the date of scanning. as a result, the data did not possess sufficient variability for a regression analysis (the majority of cases had global scores of 0 or 1 on the saps at closest assessment). furthermore, positive symptoms are often highly responsive to treatment (malla et al., 2006; robinson et al., 1999). as such any patient displaying continued positive symptoms may represent treatment resistant patients or those with a more severe illness, rather than relate to the symptoms themselves per se. instead, we utilized scores from the assessment at the initial visit to the clinic, prior to treatment onset. the presence of specific symptoms at initial clinical assessment was considered as a proxy of how prone to those symptoms each patient may be. we propose that the pre-treatment ratings best represent the underlying neurobiology and clinical characteristics of individual patients, as they show their symptom characteristics in an untreated state of illness. while it is not possible to make several such assessments prior to treatment onset (which would best capture the potential symptom profile of each patient), such an approach may allow for a data exploration which separates patients who are prone to certain symptoms (such as hallucinations) from those who have experienced less or never experienced those symptoms while in an untreated state. as such, this can be conceptualized as a trait based approach to symptom evaluation. saps scores for global hallucinations and global thought disorder were entered into a whole-brain regression model with the person>object and place>object contrasts. the global delusion score was not included as most patients were highly delusional at baseline. in order to account for differences in time since initial diagnosis, the interval between baseline assessment and mri scan (in days) was entered as a covariate in the second-level regression analysis. cluster threshold for the regression was 49 voxels at p<0.001 uncorrected (voxel threshold). there were no significant differences in age or gender distribution between groups, though patients had a marginally significant lower parental ses and significantly fewer years of education. accuracy in the person, place and object conditions was assessed using independent samples t-test. schizophrenia patients had significantly lower accuracy in the person condition, t(40)=2.247, p=0.03, but not for place, t(40)=0.44, p=0.66, or object, t(40)=0.07, p=0.95. numerous cortical regions showed significant increases in neural activity for retrieval of source memory over retrieval of object memory, similar to the pattern observed in previous studies using a similar paradigm (burgess et al., 2001; king et al., 2005). activated regions in the source memory contrasts (person>object and place>object) included bilateral activity around the parietal occipital sulcus (including the precuneus and retrosplenial cortex) extending into the superior parietal cortex, left inferior frontal gyrus (vlpfc), fusiform gyrus bilaterally, and the occipital cortex. activity in the person>object contrast included the head of the caudate nucleus, the right inferior frontal (vlpfc), and the medial aspect of the superior frontal gyrus. object>place showed widespread activity in the medial frontal cortex and parietal cortices (supramarginal gyrus bilaterally) and smaller clusters in the frontal and occipital cortices. for the object>person contrast, activity was observed in the left and right angular gyrus. 2. when examining source vs. object retrieval contrasts in scz, a smaller number of significantly activated voxels were observed relative to the activity maps of controls. in the person>object contrast only smaller clusters in the head of the caudate and occipital cortex were significant. in place>object, mainly posterior activity was observed (e.g. parietal occipital sulcus and fusiform cortex). in both the object>person and object>place, scz showed a right inferior frontal (vlpfc) activity which was not observed in controls. 2. when comparing between groups, controls demonstrated regions of greater differences between conditions than scz for person>object condition (including bilaterally in the precuneus and superior parietal, and left and right inferior frontal in the vlpfc) and for place>object (bilaterally in the superior parietal, and the left precuneus). schizophrenia patients had greater differences between conditions than controls when considering place>object across a wide range of areas. the group comparison was run using contrast values, which can be positive (e.g. if place>object) or negative (e.g. if object>place). thus, while we observed greater activity in scz than control in the place>object contrast, it is not clear from the activation maps if such a difference is due to changes in activity in either object or place. in order to visualize the results for each condition, beta values were extracted for an roi of 11 voxels (9 in-plane voxels surrounding the selected voxel and one above and one below). rois were selected to represent a range of representative patterns of activity across the brain (e.g. regions in which controls showed differences from scz in both person>object and place>object, and regions in which scz showed greater activity in place>object). which controls had greater differences between conditions than scz, controls are showing increased activity to the source memory conditions (person and/or place) relative to object, while values in scz do not show any such differentiation. interestingly, in regions in which we observed greater differences between conditions (in this case, place>object) in scz than controls, we again observe little differences between source memory and object memory in scz. thus, it is not that patients with scz are showing greater activity in the place condition, but that they are failing to modulate brain activity in the same way as control participants. results of the regression analysis with positive symptoms are presented in table 6 and fig. we observed significant negative correlations with the global hallucination score from the saps (at first assessment) and place>object contrast, in the right midtemporal gyrus, left prefrontal cortex, and right cerebellum (in a region noted in at least one lesional case study to be associated with source memory deficits; tamagni et al., 2010). in order to examine the relationship between recognition memory performance and neural activity, spearman's correlations were run on global hallucination score, memory performance in the place and object conditions, and values from the three clusters. while hallucinations did not significantly correlate with performance in either condition (place, rho=.228, p=0.32; object, rho=0.28, p=0.22), there was a marginally significant correlation between performance in the object condition and value in the dlpfc cluster (rho=0.38, p=0.088). this study examined differences in the neural correlates of source memory in patients with schizophrenia and controls. we examined this issue using a virtual reality paradigm, which has improved ecological validity when assessing the source of a memory, as compared to other studies which have used less ecologically valid tasks. furthermore, we examined a group of patients, who were within the first 4.5 years of treatment avoiding potential issues associated with illness chronicity such as cognitive decline, prolonged exposure to medications (although medication exposure remains an issue), social isolation, and sedentary lifestyle (pelletier et al., 2005). while patients with scz demonstrated some activation in the source memory contrasts, the extent and magnitude of activity were substantially less than those in controls. even in regions in which the difference appeared to be in the directions of scz>controls, it seems to be the case that controls differentiate between source and object memory while patients do not. as discussed below, this finding may be true of other forms of memory, and may therefore be representative of the underlying deficit across a range of memory subtypes. more specifically, patients with scz may fail to activate cortical regions which facilitate elaborative memory processes. this is consistent with previous findings of relatively intact object memory in scz (achim et al. 2009), but deficits in source memory (johnson et al., 1993) and associative memory (achim and lepage, 2003). it may be that the vr environment minimizes these behavioral differences, in that the place condition may be easier than person as locations were more distinct from each other relative to the 3d rendered characters. alternatively, our recent-onset sample may have better preserved function than the more enduring schizophrenia samples often examined. however, this lack of behavioral difference has a positive aspect, in that it removes performance as a potentially major confound in the fmri analysis. had patients with schizophrenia demonstrated profound deficits in performance, it would beg the question if any observed neural activity differences were due to disease pathology or simply related to poor performance (and as such would be similar to poor performing healthy controls). we did observe a performance difference in the person condition, and interestingly very little significant activity in the schizophrenia group for person>object. however, some activations observed in the group analysis, particularly in the posterior regions, were present in both person>object and place>object, suggesting that these differences were not at all modality specific. negative correlations were observed between the difference in neural activity in place>object and global hallucinations, measured at intake baseline using the saps. this suggests that the propensity of an individual to experience hallucination may modulate differences between source and object memory in these areas. we did not observe significant correlations with global thought disorder, which is not surprising as hallucinations but not thought disorder are generally associated with source memory (woodward et al., 2007). while these regions did not directly overlap activity observed in the healthy control group, the left frontal cluster was proximal to significant activity in place>object in controls, while the middle-temporal cluster was proximal to significant voxels in the object>place clusters in controls, suggesting that these regions are at least similar to those observed in healthy controls. however, the lack of direct overlap and given the nature of the result (greater difference with more hallucinations), it is possible that these regions represent malfunctioning cortical regions which are more active in patients who have experienced hallucinations as part of their disorder. this over-activation within these regions when considering source information may play an important role in generating hallucinations, which are essentially the misattribution of internally generated stimuli to an external source. at least one study has found relationships between the left prefrontal cortex and the right temporal cortex while patients are actively experiencing hallucinations (hoffman et al., 2011), and a meta-analysis suggests that these regions among others are frequently active during hallucination (jardri et al., 2011). as such, the regions found to be significantly active in our regression are consistent with the existing literature on the neurobiology of hallucinations. while many studies examining hallucinations have utilized either general state based measurements (approximately how much the participant is hallucinating in general at the time) or direct analysis of overall activity during hallucinations, we have attempted to utilize a our sample of patients early in treatment makes such an approach possible with minimal confounding for chronicity (which we attempted to control for by including length of treatment as a covariate in the regression). our results overall suggest a relationship between mal-adaptive neural activity related to source memory retrieval and how prone participants are to hallucinatory symptoms, further verifying the relationship between source memory and hallucinations (woodward et al., 2007). however, some limitations must be considered as well. while we have attempted to use baseline scores as a trait measure of how prone an individual is to hallucinations, it is well known that clinical symptoms can vary across time. as such, the appropriate method for evaluating trait symptoms is to take repeated symptom measurements over time (mathalon and ford, 2012). it would be preferable to have several assessments of pre-treatment symptoms to have a complete picture of the symptom profile of a given patient, but this is not possible as it would require delaying treatment. as such we utilized the best available measure to assess pre-treatment symptom profile, which produced results which are consistent with the existing literature on those symptoms. however, it is important to remain considerate of the limitations of our measures when considering these results. source memory can be considered a form of associative/relational memory, as participants are binding elements together during encoding and storing these elements together as part of a larger whole. a deficit in source memory can be viewed as a failure to associate a memory item with its context. in the case of this study in particular, our source memory paradigm is not far removed from studies examining associative memory (achim et al., 2007; achim and lepage, 2005; murray and ranganath, 2007), which is known to be more impaired in scz than object memory (achim and lepage, 2003). some studies have suggested that patients with schizophrenia do not properly differentiate between associative and item memory (achim et al. 2012), in keeping with suggestions that source memory impairments are part of associative memory impairments (achim et al., 2011). our present study focused on source retrieval, and as such we can not definitively determine if the differences observed in our contrasts are driven by deficits in encoding (in that the information was not properly moved into memory) or retrieval (in that the memories may have been encoded but are not properly accessed), or a combination of both (which seems likely given the plurality of evidence for memory deficits in scz). (2011) found deficits in source memory even when using short term recall, minimizing the need for retrieval of information from long-term memory. this suggests that at least part of the source memory deficit in scz is related to problems with encoding. our finding of an overall pattern of lack of differentiation between conditions may be a fairly consistent finding in the cognitive neuroscience of memory in scz, regardless if one considers activity during encoding or retrieval/recognition. core regions required for task performance may be relativity intact in scz, while deficits in activity will be observed in that is to say, the deficits in memory (and possibly cognition in general) are related to a lack of engagement of extended cortical regions. these extended regions are not critically required for minimal task performance, but instead serve to enhance performance (such as regions involved in cognitive control processes). healthy controls will tend to utilize such areas automatically, while patients with schizophrenia will fail to do so. for example, patients with scz have been shown to have impairments in initiating elaborative encoding processes which may be beneficial during associative encoding (brebion et al. however, when patients are specifically instructed to utilize effective encoding strategies they show an improvement in memory performance, demonstrating that patients with scz can utilize such encoding strategies when specifically instructed but fail to do so spontaneously (brebion et al., 1997). this pattern of results is similar to that in patients with prefrontal cortical lesions (alexander et al., 2003). bonner-jackson et al. (2008) examined memory strategies in schizophrenia by contrasting intentional but unstructured encoding (simply instructing participant to memorize words) with an externally imposed deep encoding strategy (having participants perform an abstract/concrete judgement on words, deep semantic encoding which facilitates memory encoding; craik and lockhart, 1972). they observed group encoding interactions in several regions, including the left inferior frontal gyrus and precuneus, with the most common finding being a difference between controls and scz in the incidental, unstructured encoding condition. for example, in the left inferior frontal cortex, scz patients showed no activity for unstructured encoding, but substantial activity for deep encoding. that is to say, when scz patients were provided a structured encoding strategy they activated this region, but failed to do so spontaneously. likewise, controls showed significantly better memory performance than scz patients for the deep encoding condition. further support for the importance in strategic and/or cognitive control comes from findings of changes and/or normalization of activity in scz following cognitive training (hooker et al., 2012; penades et al., within both encoding and recognition studies in schizophrenia, the most prevalent finding is a decrease in the extent or magnitude of activity in scz patients relative to controls, although many studies also report findings in the direction of scz>controls (ragland et al., 2009). while it is likely that scz often shows compensatory networks or inefficient over-activation during cognitive tasks, it can be difficult to judge from many of the published studies on cognition in scz. many papers report differences in group activities without also reporting the parameter estimates which accompany those changes. if we had done so in this study (by only presenting the activation maps in fig. 3 and not the beta values) we may have concluded that scz showed greater activity in some regions for place vs. object and concluded that this was compensatory of maladaptive over-activation. however, when examining the beta values, we realize that this is not the case but instead these are regions where controls show greater activity for object over place (often in the form of a decrease in activity for place). this highlights the importance of carefully examining parameter estimates when performing between-group comparisons. it is possible that in at least some cases in the existing literature, the so-called compensatory activity may instead be a lack of activity relative to the control group, such as was the case in this study. such ambiguity and misinterpretation can be avoided if studies fully report parameter estimates for contrasts which differ between groups. we have reported the results of a study looking at source memory retrieval in scz using a virtual reality environment on a group of patients relatively early into treatment. while controls activated a large, extensive network for source relative to object retrieval, scz showed a marked reduction in activity. this reduction was borne out in the group comparison, and appears to be related to the fact that patients with scz are failing to activate these regions or differentiate between object and source retrieval. despite the large-scale group differences, patients were still able to perform the source retrieval tasks, suggesting that at least some of the core system involved in source retrieval is intact. instead, we propose that the observed differences are related to supporting regions which are not critical to task performance but instead facilitate source retrieval. that is, patients may generally fail to engage extended cortical networks which facilitate task performance and facilitate overall cognitive functioning .

source memory, the ability to identify the context in which a memory occurred, is impaired in schizophrenia and has been related to clinical symptoms such as hallucinations. the neurobiological underpinnings of this deficit are not well understood. twenty-five patients with recent onset schizophrenia (within the first 4.5 years of treatment) and twenty-four healthy controls completed a source memory task. participants navigated through a 3d virtual city, and had 20 encounters of an object with a person at a place. functional magnetic resonance imaging was performed during a subsequent forced-choice recognition test. two objects were presented and participants were asked to either identify which object was seen (new vs. old object recognition), or identify which of the two old objects was associated with either the person or the place being presented (source memory recognition). source memory was examined by contrasting person or place with object. both patients and controls demonstrated significant neural activity to source memory relative to object memory, though activity in controls was much more widespread. group differences were observed in several regions, including the medial parietal and cingulate cortex, lateral frontal lobes and right superior temporal gyrus. patients with schizophrenia did not differentiate between source and object memory in these regions. positive correlations with hallucination proneness were observed in the left frontal and right middle temporal cortices and cerebellum. patients with schizophrenia have a deficit in the neural circuits which facilitate source memory, which may underlie both the deficits in this domain and be related to auditory hallucinations.

PMC4297883

pubmed-338

many neurodegenerative disorders are characterized by their presence in neural tissue of aberrant protein aggregates (see table 1). in general, these aggregates arise after the modification of a native protein. that modification could result in a conformational change of the native protein that promotes the aberrant aggregation. the most studied model of this mechanism has been the prion protein where a change from an alpha helix to beta sheet structure facilitates the polymerization of a protein with a different conformation that appears to have a cytotoxic effect. in a similar way, conformational changes between a native protein and its aberrant protein counterpart with capacity for self-assembly have been studied in many neurodegenerative diseases. among the most common techniques used for these analyses are x-ray diffraction, nuclear magnetic resonance, circular dichroism, or fourier-transformed infrared spectroscopy. similarly, to the case of prion protein, in some disorders a change from alpha helix to beta sheet conformation has been suggested to cause protein aggregation (table 1), probably because in alpha helix, intramolecular hydrogen bonds could occur whereas intramolecular hydrogen bonds are facilitated in beta sheet conformation, facilitating protein aggregation. however, there is one case, the formation of aberrant aggregates of tau, where the aggregated protein contains also a high proportion of alpha helix structure. although, in some cases, like that of prion protein, the formation of aberrant aggregates of protein could result in a toxic effect in the affected neurons, in other cases, like huntingtin aggregates, the formation of the aberrant aggregates could be a survival response of the affected neurons. in other neurodegenerative diseases, it will be of interest to know if protein aggregation is synonymous of cell toxicity or not. protein conformation could also play a role in a possible toxic mechanism. in this way, a protein with a high proportion of alpha helix and hydrophobic regions could be inserted in cell membrane promoting toxic effects. additionally, the presence of aberrant polymers could affect the protein degradation cell machinery (the proteasome complex), decreasing its activity and promoting a toxic effect. recently, some good reviews have been published on protein aggregation and neurodegenerative disorders [6, 7]. in this review we will mainly focus on those aggregates assembled from tau protein, aggregates that could be present in the neurological disorders known as tauopathies (for a review see) (table 1). it has been described that large amounts of native or unmodified tau protein were enough to promote tau assembly into fibrillar polymers resembling those found in ad [912]. thus, obviously, an increase in tau concentration will favour the formation of tau polymers. recently, it has been reported that not all the brain areas have a similar amount of tau protein. thus, it suggests a different probability in the formation of tau polymers in different brain regions. the amount of tau will be the consequence of its synthesis and its degradation. changes in transcription have been indicated for other proteins related to neurodegenerative disorders, where a tata binding protein may play a role. tau degradation may take place through the proteasome complex [15, 16] and it has been suggested that such degradation could be regulated by posttranslational modifications occurring in tau molecule, like its phosphorylation. also, tau degradation by other proteases could be regulated by its level of phosphorylation. it should be also indicated that in some cases like parkinson's disease or lafora disease, mutations in the e3 ubiquitin ligases like parkin or malin will result in the appearance of aberrant protein aggregates. a conformational change, that could be followed by antibodies that react with tau molecule after that conformational change [2124] has been also suggested to be required for the transition tau monomer-tau polymer. also, it has been suggested that different posttranslational modifications like phosphorylation, glycation, or truncation, may play a role in the formation of tau polymers. due to the alternative splicing of its heterogenous (or nuclear) rna, different tau isoforms could be expressed and, therefore, different tau aggregates with different tau isoforms in different tauopathies could occur, but we will not discuss this point here. for further information see., it has been suggested that removal of the amino and/or carboxy terminal regions, leaving the tubulin binding region will facilitate tau polymerization [21, 22, 28]. some work has been done in vitro and in vivo [30, 31] about a possible role of tau phosphorylation on tau assembly, suggesting that in some conditions tau phosphorylation may increase the capacity of tau for its self-assembly. not only an increase in serine/threonine phosphorylation of tau could regulate its aggregation but also an increase in tau tyrosine phosphorylation may increase the formation of tau aggregates. this assembly process may involve the formation of oligomers, filaments, and aggregates of filaments (tangle-like structures). in the formation of these aggregates of filaments, glycation may play a role. the possible relation between phosphorylation and tau aggregation has been studied in transgenic mice expressing human tau bearing some mutations found in human fronto-temporal dementia linked to chromosome 17 (ftdp-17). in this mouse, tau phosphorylation mainly occurs by gsk3. when a specific inhibitor of this kinase, lithium, was given to the transgenic mice no tau phosphorylation was found, and in addition no aggregation of the protein was detected suggesting a correlation between tau phosphorylation and aggregation in this model. this result was supported by an additional experiment using another mouse also expressing human tau with a ftdp-17 mutation. alternatively, protein chaperones, acting on tau or in phosphotau, could modify the level of tau aggregation, examples could be the protein 14-3-3, musashi-1, or pin-1 [37, 38]. the chaperone associated ubiquitin ligase chip could be able to target phosphotau for proteasomal degradation [16, 18]. it has been described that tau binding to microtubules is regulated by the level of tau phosphorylation at some specific sites. it is known that hyperphosphorylated tau binds with less affinity to microtubules resulting in the decrease in the interaction with microtubules, in a decrease of microtubule stability, and probably in a microtubule dysfunction inside the cell that could result in a toxic effect. also, tau phosphorylation could result, as indicated above, in a decrease of its proteolysis. more recently, it has been indicated that expression of a tau mutant (p301l) could result in an increase of its phosphorylation, since once it is phosphorylated, that mutation can prevent the binding of those phosphatases involved in its dephosphorylation. this phosphotau could have a decreased capacity for microtubule binding and it could be toxic for the cell. additionally, it has been indicated that hyperphosphorylated tau can cause neurodegeneration, in the absence of large tau aggregates. on the other hand, only the overexpression of wild-type human tau in a mouse is sufficient to cause tau phosphorylation, aggregation, and neural toxicity. on the other hand, it has been suggested that tau phosphorylation may represent a protective function in ad. sometime ago, the development of tau pathology, related with dementia in ad, was clearly described by braak and braak by following the development of neurofibrillary lesions at different stages of the disease. also, the formation of neurofibrillary (tau aggregates) pathology within those neurons of hippocampus and cerebral cortex affected at different stages was found. these neurons could degenerate yielding extracellular ghost tangles (enft). in the hippocampus, an inverse relation has been found between the number of enft and the number of surviving neurons [4851]. it suggests that neurons that degenerate, have previously developed tau aggregates. on the other hand, it has been indicated that neurons bearing neurofibrillary lesions could survive for a long period of time, and, by comparing with other neurodegenerative disorders, like huntington disease, it can be suggested that tau aggregates could protect against neurodegeneration by sequestering toxic (phospho ?) monomeric tau that could be present in a high amount inside a cell in pathological conditions. also, it has been suggested, using a transgenic mouse model, that behavioural (memory) deficits could be unrelated to the formation of tau polymers, although, more recently, the discussion of those experiments suggested that hyperphosphorylated, aggregated tau intermediates could be the ones that cause neurodegeneration. in this way, the implication of different types of protein aggregates in neurodegeneration has been extensively discussed [19, 54]. a possibility about the existence of neurotoxic tau intermediate aggregates in human tauopathies is based in the fact that patients with ftdp-17 show an extensive neurodegeneration with a high level of tau phosphorylation but with a low number of tangles. in any case, even if the formation of tau aggregates has a protective function for the neurons, that function is not working well, as described by braak and braak, and afterwards by delacourte et al, indicating a correlation between progression of tau pathology and progression of the disease. this idea is supported by those experiments indicating that neural loss and neurofibrillary tangle number increase in parallel with the progression of the disease. similar results have been described in other neurological disorders like brain encelphalopathies, where the formation of aberrant polymers are related to the onset of neurodegeneration; whereas this is far from clear in other disorders like huntington disease. examples of neurological diseases where aberrant protein aggregates are found, and the suggested conformations in the aberrant aggregates are indicated.

protein aggregation takes place in many neurodegenerative disorders. however, there is a controversy about the possible toxicity of these protein aggregates. in this review, this controversy is discussed, focussing on the tau aggregation that takes place in those disorders known as tauopathies.

PMC1479889

pubmed-339

only those contraceptive methods are new in which synthetic steroid is used. regarding the current status of growth, the world population is doubled every 54 years; however, in poor countries, population is doubled in less than 20 years. to complete and preserve personal health during pregnancy, the optimal use of contraceptive methods is effective, and planning is necessary before pregnancy. the rate of pregnancy in women with a high potency for fertility who use no contraceptive method is 90% during one year. therefore, conscious and accurate decision making for pregnancy and precise care play an important role in decreasing the maternal mortality. induced abortion that can be the important complication followed by unwanted pregnancy play a significant role in the incidence of infection, fever, risk of the next premature delivery, low birth weight, and infertility [1, 4]. pregnancy is a temporary crisis that creates deep mental, physical, and behavioral changes in a woman. conscious and accurate decision making for pregnancy, continuation, and precise care play an important role in declining the maternal mortality. according to the studies by world health organization, close to one-third of the pregnancies in the third world countries considering the fact that induced abortion may create some significant complications such as infection, septic shock, fever, risk of the next premature delivery, low birth weight, and infertility, it can also cause some anatomic complications resulting from the surgery such as uterus, bladder, and intestinal rupture [1, 4]. planning for pregnancy can help the safety of childbirth, and unplanned pregnancies increase the maternal mortality. despite the attempts by the authors in health centers, some unwanted pregnancies occur that can danger the women. therefore, we decided to evaluate some factors related to unwanted pregnancy in women referred to health centers. it was a cross-sectional study on 400 randomly pregnant women, who were referred to several clinics and health center in ahwaz city during 2010. data was collected through interview and filling up a designed questionnaire containing demographic characteristics, fertility, and so forth. the mean age of women with unwanted pregnancy was 27.5 5.7 years, and in women with intended pregnancy was 24.6 4.5 years. the percentage of the older women (35 years) in unwanted pregnancy was 3 times of intended pregnancy which was statistically significant. most of pregnant women lived in urban area (70.1%), and the percentage of rural women who intended pregnancy was higher (35.6%). the educational level in the subjects was 36% in secondary school and 44% in high school. 37% of subjects with unwanted pregnancy were illiterate and primary school (table 1). the findings have shown that most of pregnant women were housewives (82%), and their husbands had self-employment (40%), and 7.1% of subjects with unwanted pregnancy had unemployed husband. half of the women with unwanted pregnancy had low economic status, while, in women with intended pregnancy, this rate was only 20%. according to the interviews, good relationship with regarding fertility characteristics, the findings showed that more than half of the women with unwanted pregnancy were in the third trimester 54%, (figure 1). 80% of unwanted pregnancy had more than two times pregnancies, but the percentage in intended pregnancy was 38%. this study showed that more than half of the pregnant women had used one of the contraceptive methods before the recent pregnancy, and 30% had used natural (interrupted) methods. the most percentage of women with unwanted pregnancy used unreliable methods like interrupted method (59.1%). the incidence of pregnancy followed by the consumption of contraceptive pills in women unwanted pregnancy was 16%. this study has shown that 26% of women who wish to become pregnant had more knowledge and performance about pregnancy health 26%, and the low levels of knowledge and performance were more observed in unwanted pregnancy. the incidence of unwanted pregnancy is different in the world, but it has the same undesired outcomes. our study has shown that prevalence of unwanted pregnancy was 26%, and similar conducted studies indicated that the incidence rate of unplanned pregnancy was 25%, 30%, 43%, and 52% [69]. in this study, relative decrease in the incidence of unwanted pregnancy in our country in comparison with the other countries may be due to the hopeful success of health centers. considering the point that intended pregnancy which results in a healthy childbirth from a healthy mother as an aim of midwifery science [10, 11], pregnancy must be occurred based on the accurate and conscious decision and according to the physical, mental, economic, social, and cultural status [2, 3]. alenova in a study after evaluating the activities of consultation clinics guiding women for that the prevention of pregnancy states that prevention of unwanted pregnancy is more necessary in aged women, and it becomes more vital with the increase of age. mohammadloo in his study declares that more than half of the unwanted pregnancies occur in women more than 30 years. one of the causes of not intending pregnancy is the age of more than 35 years that has been noted in other studies too [6, 8, 13, 14]. in the present study, low education has a close relationship with increased incidence of unwanted pregnancy, and, in a study by bennett et al. most of the women have the ability to become pregnant for at least three decades in their life, but most of men are potentially fertile all over their life. in our study, the rate of unwanted pregnancy was higher in individuals with more number of children. also, in similar studies, the increased prevalence of unwanted pregnancy is observed with an increase in the number of children, from 7.9% in childless women to 92.8% in women with 4 children or more. in our study, unwanted pregnancy was more observed in employee women, and some other studies have achieved this result too. low income, poverty, unemployed husband, and inappropriate job play significant role in the incidence of unplanned pregnancy [7, 1519]. a study in zimbabwe has shown that women with unemployed husbands were more exposed to the unwanted pregnancy. some studies in africa and new york indicated that unwanted pregnancy more occurred in poor, low income, and homeless women, which necessitates more concern about the poor women. other studies in thailand and usa have found that one of the related factors with unwanted pregnancy is the relationship with the spouse; also they showed that good relationship with the spouse in women with unwanted pregnancy was less than intended cases. a study from london has found that planned pregnancy was more observed in couple with more strengthened union in marriage. it seems that couples ' relationship is an important and positive factor which affects the increase of their cooperation in regarding the fertility health. it was indicated in this study that, in 20% of women with unwanted pregnancy, no contraceptive method was used, and more than half of them used unreliable methods of which failure was more observed in unwanted pregnancies. a study in egypt states that 47% of pregnant women with unplanned pregnancy do not use adequate prevention, and 28.8% encounter with the failure of their contraceptive method. in a study in china, it has been indicated that the failure of the contraceptive method has been the main cause of unwanted pregnancy. it seems that of the most important educational needs and the most effective attempts to prevent unwanted pregnancy are creating motivations in families, providing necessary facilities, and helping them in selection and accurate use of different methods by holding educational classes in health centers. therefore, introducing accurate information about the contraceptive methods acquires a profound understanding, and using this information is very important in planning for the pregnancy. considering the lack of safe methods, educational programs, introducing adequate contraceptive options, and consultation before pregnancy 76% of world population live in developing countries, 85% of births, 95% of neonatal mortality, and 99% of maternal mortality occur in these countries. so, regulating reproduction and adequate planning for pregnancy is significant in these countries. in conclusion, more attempts must be taken to decrease complication of pregnancies such as unwanted cases. in the recent years, it has been proved that, in addition, the population control and educational program for contraceptive methods are important and necessary in preventing unwanted pregnancy. because in iran abortion is illegal consider in the muslim religious, unwanted pregnant women can not do abortion except if physician has diagnosis that mother has complication to continue of her pregnancy or there is intrauterine growth retardation in the first trimester.

we aimed to find the prevalence and some factors relating with unwanted pregnancy. methods. it was a cross-sectional study on 400 randomly pregnant women, who were referring to different health centers in ahwaz city during 2010. data was conducted based on questionnaire, and all the analysis was performed using spss (version 17) statistical analysis software. results. the prevalence of unwanted pregnancy was 26%. the percentage of unwanted pregnancy in ages more than 35 years was approximately three times more than the intended pregnancy. there were significant relationship between unwanted pregnancy and some variables such as age, number of pregnancy, number of childbirth, education status, economic status, husband's occupation, and the relationship with the spouse and contraceptive methods (p<0.0001). conclusion. the prevalence of unwanted pregnancy was high. to prevent unwanted pregnancy using consultation services before planning to be pregnancy, it is necessary to identify the factors relating with unwanted pregnancy.

PMC3205614

pubmed-340

at the end of past millennium, flexible bronchoscopy was regarded as one of the most frequently performed procedures by the physicians of multiple disciplines to inspect the airway. in our institute, the fibreoptic bronchoscopies are performed by either the pulmonologists or the anaesthetist. at many places, fibreoptic bronchoscopies are still performed after topical anaesthesia only, without any sedation. this simplified approach is safe and results in decreased expenditures. in a retrospective study done by colt et al., intravenous sedation was reported in 50% of the procedures; however, this technique requires the use of adequate anaesthetic resources and is associated with a low but real morbidity and mortality. the intravenous sedation limits dynamic analysis of the airways such as vocal cords, presence of local or diffuse malacia or effects of voluntary cough. therefore, a risk benefit approach comparing the same procedure performed under sedation and under local anaesthesia alone is indicated. there are several techniques for anaesthetising the vocal cords and tracheobronchial tree, each with its own potential advantages and disadvantages. topical lignocaine applied by the spray as you go technique with direct instillation of 4% solutions is used by a few bronchoscopists, while the others use transcricoid route for local anaesthesia of the vocal cords and tracheobronchial mucosa. we have compared a transcricoid injection of local anaesthesia with the spray as you go technique without sedation in patients posted for elective fibreoptic bronchoscopies requiring only bronchoalveolar aspirate for diagnosis and not biopsies of any kind. it is a very safe technique which can be performed with or without conscious sedation. after obtaining institutional ethical committee approval, 60 patients in the age group 2070 years of either sex, undergoing elective fibreoptic bronchoscopies for diagnostic bronchoalveolar aspirate, were included in this study. the patients of the specified age group coming to the bronchoscopy suit, requiring only diagnostic bronchoalveolar lavage over a period of 6 months, were selected and alternatively divided into two groups of 30 each. group i patients were given a single transcricoid injection of lignocaine, while in group ii patients lignocaine was used as spray as the bronchoscopist entered inside, after the lignocaine sensitivity test was done in all the patients. if any contraindication for transcricoid injection was present, like any local pathology, then these patients were included in the other group. after taking an informed written consent and lignocaine sensitivity test was done, the patients were alternatively assigned to different groups. all the patients were given injection atropine 0.6 mg intramuscularly, 20 min prior to the procedure. nebulisation with 3 ml of 4% lignocaine was done in all the patients for 15 min before starting the procedure. the blood pressure, pulse and oxygen saturation (spo2) were recorded before the procedure in both the groups. the patency of the nostril was checked, and in the more patent nostril, 2 ml of 2% lignocaine gel was applied in all the patients. group i patients received transcricoid injection of 3 ml of 4% lignocaine solution given as a bolus through a 21-g hypodermic needle in the sitting position after confirming its position by aspirating air under aseptic conditions. in group ii patients, 2 ml of 4% lignocaine was instilled on to the vocal cords under direct vision after insertion of the bronchoscope. further boluses of lignocaine were instilled through the bronchoscope if local anaesthesia was thought to be inadequate in both the groups. the assistant as well as the bronchoscopist could not be blinded to the local anaesthetic techniques. a single endobronchial procedure was selected and the bronchoscopist was also not changed to allow a fair comparison of the two techniques studied. the pulse rate and systolic blood pressure were recorded before the procedure and 5 min after the bronchoscopy. the time from the nasal insertion of bronchoscope to reach the carina was recorded in both the groups. a bout of coughing was considered as a single episode of cough. the total dose of lignocaine used in both the groups was also noted. record of any complication like bleeding from the transcricoid site was made, as well as any other complication if detected was observed and noted. thirty min after the procedure, an assistant who was unaware of the patients group was asked to assess any discomfort to the patients, using a 10-cm visual analogue scale (vas). the vas score of 0 was considered as no discomfort, 1 as mild, 2 as moderate discomfort and 3 or more as severe discomfort. the data were analysed using chi-square test and the p values were calculated. group i was transcricoid group and group ii patients received spray as you go technique. the age of patients in group i (51.6614.08 years) was comparable with that in group ii patients (48.2613.32, p=ns). as shown in table 1, mean basal values of systolic blood pressure in both the groups were comparable before starting the procedure. in group ii, the systolic blood pressure increased significantly from the baseline when measured 5 min after the procedure (p<0.02). similarly, as shown in table 2, the pulse rate was comparable in both the groups before starting the procedure (p=ns), but it increased significantly in group ii when measured 5 min after the procedure. the total dose of lignocaine used in group ii (372.6624.90 mg) was significantly higher than that used in group i (3149.32 mg, p<0.001) as shown in figure 1. the number of coughs in group i (40.98) was significantly lesser than in group ii (4.91.24, p<0.05), as shown in figure 2. the mean time to reach the carina was significantly shorter in group i (57.3312.98 sec) compared to group ii (79.3322.35 sec, p<0.02). systolic blood pressure before and 5 min after the procedure pulse rate before and 5 min after the procedure dose of lignocaine used plotted against the no. of patients cough episodes plotted against the no. of patients as shown in table 3, the values of vas score were comparable after 30 min of the procedure in both the groups. there were no cases of haematoma or subcutaneous emphysema when the neck was examined after the procedure in the transcricoid group. lignocaine is the most commonly used local anaesthetic agent for fibreoptic bronchoscopy and has a wide margin of safety. it has been suggested that the total dose should be limited to 300400 mg as absorption of lignocaine from the respiratory mucosa is known to be rapid. the risk of more serious side effects increases when blood concentrations exceed 5 mg/l, with seizures and hallucinations occurring at concentrations of 812 mg/l and cardiorespiratory arrest at 2025 mg/l. the peak concentration is influenced by dose per unit weight administered and not by the factors considered likely to influence mucosal absorption from the bronchial tree, such as sputum production, airflow obstruction or cigarette smoking. a major proportion of the total dose of lignocaine is required to anaesthetise the nose, pharynx and larynx, with only a small proportion needed for the bronchial tree. although most clinical studies have reported non-toxic blood lignocaine concentration associated with bronchoscopy, several have reported concentration in the toxic range (> 5 mg/l). the control of coughing is of paramount importance for the quality of a bronchoscopy as this facilitates ease of viewing the bronchial tree and obtaining good biopsy samples. activation of the cough centre in the brain stem causes the respiratory muscles to induce cough, the bronchial smooth muscle to cause bronchoconstriction and subsequently the airway submucosal glands to secrete mucus. various local anaesthetic techniques can be used to anaesthetise the respiratory mucosa for fibreoptic bronchoscopy. it would be safe and not unpleasant for the patient and would at the same time provide acceptable conditions for the bronchoscopist. in our institute these patients are malnourished and have deranged liver function tests as well as the pulmonary function tests, hence doing fibreoptic bronchoscopy under local anaesthesia only without sedation is a routine. the present study was designed to compare the techniques of applying topical anaesthesia to the respiratory mucosa for elective diagnostic fibreoptic bronchoscopy. the bronchoscopist was not changed, to allow a fair comparison of the two techniques studied. although the current british thoracic society guidelines provide a consensus statement on the current evidence base without specific guidance on drugs or techniques and without defining methods of sedation, the guidelines recommend offering sedation to all, except where there are contraindications. if a centre has experience of performing unsedated diagnostic flexible bronchoscopy, it is reported that patient co-operation is not improved with sedation. performed a double-blinded, placebo-controlled trial in 100 patients in a centre that normally performs unsedated bronchoscopy, and could not demonstrate improved patient tolerance, comfort and co-operation with lorazepam. tried to identify the common fears of patients undergoing fibreoptic bronchoscopy and also determine whether any factors might contribute to reducing these fears. it was found that doctors were more likely to explain the indication for bronchoscopy than how it would be performed. they concluded that provision of detailed information about sensations that are likely to be experienced in bronchoscopy could be used to allay some of the common fears. improved preparation of patients with lower education, inferior health status and asthma may lead to decreased pain during fibreoptic bronchoscopy. although sedation is associated with major complications, sedative drugs are often given immediately before fibreoptic bronchoscopy in the belief that patient's comfort is improved. compared two such regimens with placebo and concluded that routine sedation has little part to play in patients undergoing a single diagnostic procedure. the present study compared two techniques of anaesthetising the respiratory mucosa for diagnostic bronchoscopy without sedation. the transcricoid method was more effective than the spray as you go technique. no complication was associated with transcricoid injection and minor bleeding associated with the technique did not interfere with the bronchoscopy. they recommended transcricoid technique as a safe method of inducing effective local anaesthesia that is well tolerated by the patient. in our study, we nebulised all the patients with 3 ml of 4% lignocaine for 15 min before the procedure. the systolic blood pressure and pulse rate were compared between the two groups before the procedure and 5 min after the procedure. the systolic blood pressure and the pulse rate were comparable in both the groups before the procedure, but the systolic blood pressure increased significantly in group ii after the procedure (p<0.02). similarly, the pulse rate also increased significantly after the procedure in group ii (p<0.001). the vas score was similar in both the groups, 30 min after the procedure (p=ns). the incidence of side effects was negligible in both the groups. the dose of lignocaine used in group ii (372.6624.90 mg) was significantly higher than that used in group i (3149.32 mg, p<0.001). the number of coughs in group i (40.98) was also significantly lower than in group ii (4.91.24, p<0.05). the time to reach the carina was also significantly lesser in group i (57.3312.98 sec) compared to group ii (79.3322.35 sec, p<0.02) as the transcricoid injection given probably brought about excellent relaxation of the vocal cords, making the introduction of the bronchoscope smooth. diagnostic fibreoptic bronchoscopy without sedation with transcricoid injection of lignocaine can be recommended as a safe method of anaesthetising the respiratory mucosa, which is well tolerated by the patients with negligible side effects and provides acceptable conditions for the bronchoscopist as compared to the spray as you go technique.

aim: the aim of the study was to compare transcricoid injection with spray as you go technique for diagnostic fibreoptic bronchoscopy, to perform the procedure without sedation and to record any complication or side effects. methods:sixty patients belonging to the age group 2070 years, undergoing diagnostic bronchoscopy over a period of 6 months, were randomly selected and divided into two groups alternatively to receive 3 ml of 4% lignocaine by a single transcricoid puncture (group i) or 2 ml of 4% lignocaine instilled through the bronchoscope on to the vocal cords and further 1 ml of 2% lignocaine into each main bronchus (group ii). additional dose of lignocaine as required was given in both the groups. all patients were given intramuscular atropine 0.6 mg, 20 min before the procedure. nebulisation with 3 ml of 4% lignocaine was given to all patients. the time from nasal insertion of the bronchoscope to reach the carina was recorded, and the total dose of lignocaine required in both the groups was calculated and compared. the cough episodes during the procedure, systolic blood pressure, and pulse rate were compared before the procedure and 5 min after the procedure in both the groups. a010 visual analogue scale (vas) was used to assess discomfort 30 min after the procedure. results:the time to reach carina was more in group ii (p<0.02), and cough episodes were also more in group ii (p<0.05) than in group i. the vitals before the procedure were comparable in both the groups, but 5 min after the procedure the vitals were more stable in group i than in group ii, and the total dose of lignocaine required in group ii was more than in group i (p<0.001). however, the vas score was comparable in both the groups. conclusion:transcricoid puncture for diagnostic bronchoscopies without sedation was associated with no complication and discomfort and required lesser dose of local anaesthetic with more stable vitals and good conditions for bronchoscopists.

PMC3237148

pubmed-341

cerebrovascular diseases (cvds) are associated with balance disturbances, dependency in performing daily living activities, and limited ambulation. as life expectancy increases spasticity is a speed-dependent resistance to the passive motion of muscles and tendons, developing secondary to enhanced stretch reflexes in patients with upper motor neuron lesions. spasticity is a major problem in rehabilitation programs, and it hampers patient progress and may trigger severe complications2, 3. quantitative assessment of spasticity is critical when gauging responses to medical treatment and physical therapy, and when making a prognosis. at present, rather limited clinical scoring systems of spasticity, and biomechanical and electrophysiological data, are used. electroneuromyographic evaluation of the spinal reflex organization allows detailed follow-up of physiological changes. this measure, and also the f reflex, assessed using various techniques, are employed to quantitate and explore spasticity4. transcutaneous electrical nerve stimulation (tens) is a rehabilitative form of physical therapy used to treat pain. various types of nerve fiber are stimulated at different frequencies, wavelengths, and amplitudes. tens delays the h reflex through the 1a fibers, which mediate presynaptic inhibition8. in the present study, we evaluated the utility of tens for patients with spasticity due to cvd, who were undergoing rehabilitation, was evaluated using clinical scoring systems and electrophysiological assessment. this study also aimed to explore whether tens affects spasticity electrophysiologically, and the extent of the effects on clinical features. patients hospitalized in ankara physical therapy and rehabilitation training and research hospital, who were participating in a rehabilitation program for hemiplegia with spasticity in the lower extremity, were recruited. patients who had received any treatment for spasticity, who lacked spasticity, who had a history of any systemic disease that might cause peripheral neuropathy, or symptoms of radiculopathy in the lower extremities, who had suffered strokes less than 30 days prior, who had a prior history of cerebrovascular disease, who had upper motor neuron damage on the non-hemiplegic side, who could not co-operate, or who were obese, were excluded. aphasic and geriatric patients were also excluded; because their co-operation was lacking. patients with spasticity of at least ashworth grade 1 in the lower extremities were included. the active motor power and spasticity of all patients reflex, and superficial and deep sensorial examinations were performed. the time taken to walk 10 m by patients who could walk was measured before and after tens. after a clinical evaluation, emg examinations were initially performed on healthy controls and, later, on the affected sides of patients. all electrophysiological work was performed in a calm, intermediately lit room with patients in the supine position. their feet extended from the examination bed, commencing at the ankle joints, each of which was in the 90 neutral position; the knee joint was at 180 of extension. all patients were asked to relax their muscles as much as possible during the electrophysiological study. the h reflexes and m responses of the gastrocnemius-soleus muscle were electrophysiologically recorded on both the healthy and hemiplegic sides. subsequently, a single 30 min session of tens was applied to the hemiplegic lower extremity. ten minutes later, the h reflexes and m responses were re-assessed and compared with the pre-tens data. a nihon kohden neuropack four-channel emg platform was used for measurements in the single-channel mode. the active electrode was placed on the gastrocnemius-soleus muscle, in a slightly medial position, 14 cm proximal to the junction of the achilles tendon and the heel. the reference electrode was placed at the junction of the tendon and the heel, and a velcro ground electrode was placed between the active electrode and the stimulator. the latter electrode was placed on the fossae popliteal, to stimulate the tibial nerve, and the cathode was placed across the active electrode. the stimulus intensity was increased in steps of 2 ma, commencing at zero, and the combined action potentials of the soleus muscle were recorded. the peak-to-peak amplitudes and latencies of the h and m responses were measured. the latencies were assessed at the point of separation of each response from the baseline. the sensitivity, low frequency filter, and high frequency filter were 2 mv/dv, 200 hz, and 3 khz, respectively. stimuli were created randomly, and delivered to the popliteal fossa with the posterior tibial nerve lying proximal to the cathode. a rectangular flow 1 ms in duration, delivered every 2 s, served as the stimulus. the sweep speed and sensitivity were 10 ms and 2 mv/dv, respectively. subsequently, the largest h wave was determined by varying the strength of the stimulus with the location of the stimulator unchanged. after all electrophysiological work was completed, and all wave amplitudes calculated, the h/m maximum amplitude ratio was calculated for each patient by dividing the maximal amplitude of the h reflex by that of the m responses from both the healthy and affected sides. in addition, to evaluate alpha motor neuron excitability and the extent of spasticity, the slopes of the rising sides of the h and m amplitude-stimulus severity slopes were calculated using excel and the h slope, m slope, and h slope/m slope values were obtained. tens was performed in the supine position with the feet hanging in a neutral manner. electrodes were placed bilaterally on the tibialis nerve, between the tendon of the muscle and the medial malleolus; thus the gastrocnemius muscle was included. the recording electrodes used in the electrophysiological study were not removed. a systems 200e tens platform was used. this equipment has two output channels the flow intensity in each channel can be adjusted independently. the frequency was 50 hz and the pulse width was 100 ms in normal stimulation. the current intensity was not allowed to exceed a mean of 50 ma and no contractions were noted. electrophysiological data were collected before and after tens, the same as for the patient group. controls were positioned the same as patients, and tens was applied for 30 min. electrophysiological data were gathered from only the right lower extremities of the controls and the pre- and post-tens values were compared. the, wilcoxon signed-rank, and kruskal-wallis tests, were used, as appropriate, to evaluate the experimental parameters. the patient group with hemiplegia secondary to cvd numbered 27 [12 females (44.4%) and 15 males (55.6%)]. a total of 24 healthy subjects [10 females (41.7%) and 14 males (58.3%)] served as controls. the mean ages of the patients and controls were 60.9312.8 and 49.886.85 years, respectively. the mean heights of the patients and controls were 160.858.99 and 165.38+8.56 cm, respectively. the mean age, but fourteen (51.9%) and 13 (48.l%) patients respectively had left- and right-side hemiplegia. thromboembolic and hemorrhagic stroke were the principal causes of hemiplegia in 21 (77.8%) and 6 (22.2%) patients, respectively. superficial sensory nerve examinations revealed hypoesthesia in 10 patients (37%), but 17 were normal (63%). the deep tendon reflexes (dtrs) on the hemiplegic sides were normal in the upper extremity of one patient (3.7%) but hyperactive in 26 (96.3%); the lower extremity on the affected side was hyperactive in all patients. on the healthy sides, the dtrs were normative in both the upper and lower extremities of 26 (96.3%) patients, and hyperactive in one (3.7%). no significant difference in the mean pre- and post-tens lower-extremity dtrs on the hemiplegic side was found (p>0.05). the values of the spasticity parameters before and after tens differed significantly in the patient group (table 1table 1.change in the spasticity between pre- and post-tensashworth 1ashworth 2ashworth 3pre-tens10 (37%)13 (48.2%)4 (14.8%)post-tens14 (51.9%)11 (40.7%)2 (7.4%) all p values<0.05). fourteen patients were able to walk, either with support or independently, but 13 were not. after tens, 11 patients exhibited increased walking speeds and 3 reduced speeds. when patient hemiplegic and healthy lower extremities were electrophysiologically compared, the mean maxima of the h reflex, the h/m ratio, the h slope, and h slope/m slope ratio, were significantly greater on the affected side. in addition, the mean m response amplitude was significantly different (greater on the healthy side). the differences in the h/m maximum and h slope/m slope ratios were particularly marked (table 2table 2.electrophysiological variables of the healthy and affected sides of the patientsvariablehealthy sideaffected sideh max amp (mv)1,669.851559.792,899.701,698.69h max lat (msec)31.212.1831.082.28 m max amp (mv)8,735.892,820.527,439.892,825.16 m max lat (msec)4.900.444.930.40h/m max amp (mv)0.190.160.420.22h slope0.010.0090.030.22 m slope0.030.0060.030.006h/m slope0.40.320.910.43). the h maximum amplitude values were higher on the spastic hemiplegic side than on the healthy side. the h/m ratio, h slope, and h slope/m slope ratio were higher on the affected side. however, the mean m amplitude was higher on the normal than on the hemiplegic side. the mean h reflex amplitude, the h/m amplitude ratio, the h maximum latency, the h slope, and the h/m slope ratio, differed significantly pre- and post-tens on the hemiplegic side. the post-tens electrophysiological changes in the control group were similar to those in the patient group. the h maximum amplitude, the h/m ratio, the m maximum amplitude, and the m slope ratio, decreased, whereas the h and m maximum latencies increased, with statistical significance. the duration of disease was positively associated with the mean h maximum amplitude, the h/m ratio, and the h/m slope ratio; however, no association was statistically significant. the h maximum latency was lowest in patients with disease durations greater than 100 days. higher mean h maximum amplitudes, h/m ratios, and h slopes evident as spasticity worsened. however, only the mean h slope differed significantly among the spasticity subgroups, with significant differences being found between subgroups i and iii, and ii and iii, in parallel with worsening of spasticity. tens significantly reduced spasticity scores and increased the walking speed. on the spastic side, tens significantly reduced the m amplitude and increased the h reflex amplitude, the h/m maximum amplitude ratio, the h slope, and the h slope/m slope ratio. also, the mean patient h reflex amplitude, the h/m ratio, the h slope, and the h slope/m slope ratio, decreased significantly, and the h reflex maximum latency increased, after tens. in controls, tens significantly decreased the h maximum amplitude, the h/m ratio, the m maximum amplitude, and the m slope ratio, and lengthened the h and m maximum latencies. the h maximum latency was the only variable affected by lesional duration. the mean h maximum amplitude, the h/m ratio, and the mean h slope increased as spasticity worsened on the ashworth scale. explored changes in the spasticity of patients with medulla spinalis injuries after tens, and found there were short-term reductions in spasticity9. robinson et al. applied 20 min electrical stimulation to the quadriceps muscles of patients with medulla spinalis injuries and reported a significant decrease in leg spasticity10. cho et al. found that a single session of high-frequency tens significantly improved the spasticity (for less than 1 day) of chronic stroke patients. similarly, tens reduced the spasticity of stroke patients, and repeat tens reduced the hyperactive tension reflexes of the plantar flexors, and the passive resistance to plantar flexor movement11. in a study that included acute stroke patients, tens applied to acupuncture points for 3 weeks decreased plantar flexor spasticity and increased dorsiflexion of the ankle joint. in chronic stroke patients, however, ankle joint dorsoflexion was strengthened by stimulation, and muscle co-contraction was decreased. in addition repeated skin stimulation was advocated, to increase the number of cortical fields represented12. in a study that included chronic stroke patients, addition of tens to a 20-session rehabilitation program decreased spasticity by 30% and markedly improved muscle strength13. park et al. showed that balance, walking, and the functional activity of chronic stroke patients improved after 30 tens sessions (each 30 min in duration), and a combination of exercise and tens increased the activation of pathways associated with proprioception and balance14. in the present study, a significant decrease in spasticity and an increase in walking speed were evident after acute hemiplegic the patients in a rehabilitation program received a single session of tens. fisher reported that the m amplitudes of patients with first-motor neuron diseases decreased, after tens, compared to the amplitudes of polyneuropathic patients15. angel and hoffman, who first showed that the h/m ratio was increased in spastic patients, reported mean ratios of 9.17 and 0.48 in the extremities of control and spastic groups, respectively. the excitability of alpha motor neurons increased when various physiopathological mechanisms were in play; therefore, the responses to stimuli carried by 1a afferent fibers increased16. garcia-mullin and mayer reported mean h/m ratios of 0.33 and 0.46 on the healthy and paretic sides, respectively, of spastic hemiplegic stroke patients in whom the disease duration was longer than 90 days17. bakhtiary showed that spasticity was reduced by electrical stimulation, but no significant change in the h reflex amplitude was evident. also, the h/m maximum ratio did not change, and this was attributed to muscle weakness caused by stimulation18. gaft et al. noted significant decreases in both spasticity and the h reflex amplitude after stimulation. in the present study, significant differences were found in the m response and h reflex amplitude between the healthy and affected sides of spastic the hemiplegic stroke patients. the mean maximum amplitudes of the h reflexes of the triceps surae were 1,669 and 2,899 mv on the healthy and paretic sides, respectively, and the difference was significant. the difference in the h/m ratio between the healthy and plegic sides was also significant19. huang et al. reported that the h/m maximum and h2/h1 ratios were not adequate for defining the extent of spasticity as assessed by the ashworth scale. the mean h/m maximum and h2/h1 values increased in stroke patients, compared to healthy controls, but the m maximum ratio did not significantly differ between the groups. the h2/h1 and m maximum ratios did not significantly correlate with other measures of spasticity. in contrast to other previous studies, huang et al. concluded that the mas value correlated with the h/m ratio20. in the present study, we noted a decrease in the m amplitude on the spastic side was observed, whereas the h reflex amplitude and the h/m maximum amplitude ratio, increased. higashi et al. found that the change in the h slope/m slope ratio was more significant on the spastic than the healthy side, and no significant difference in the h/m maxima of the two sides was evident. as the h slope/m slope graph is bell-shaped, such data are more compatible with the brunnstrom stage of hemiplegic patients than are other indicators. in conclusion, the h slope/ m slope ratio is primarily useful for objectively evaluating the extent of spasticity, and the excitability of the motor neuron pool of the spastic sides of hemiplegic patients21. measured the excitability of the motor neuron pool and compared the h/m ratios, the h maximum amplitude, and the h slope/m slope ratio, in spastic and normal individuals, and found there were marked differences between the two groups. they concluded, the h slope/m slope ratio was particularly useful for evaluating motor neuron pool excitability22. in the present study, steeper h slope and greater h slope/m slope ratio on the spastic (compared to healthy) side of hemiplegic patients prior to tens were observed. one study evaluating the electrophysiological components of the h reflex and f wave compared the pre- and post-tens h reflexes, and f wave latencies and amplitudes, and reported the reduction in spasticity was associated with electrophysiologically proven decreases in the h reflex amplitude, the f wave amplitude, and the h/m and f/m ratios23. in another study, tens was applied segmentally and heterosegmentally to the median nerve of the wrist, and to the common peroneal nerve (placebo). the h reflex latencies increased in 75% of the patients in the experimental groups, but the h amplitude did not change significantly. aydin et al. compared tens with baclofen, the commonest drug prescribed to treat spasticity in patients with medulla spinalis injuries. significant improvements in all parameters, except pain, were evident in the tens group, and they were associated with decreases in the h amplitude and h/m ratio, and the m response. the electrophysiological and clinical changes did not differ significantly between the tens and baclofen group25. tekeoglu et al. also reported that tens reduced spasticity in stroke patients, and improved their capacity to engage in activities of daily living, concluding that tens effectively improved motor function26. in the present study, a single session of tens resulted in significant clinical inhibition of spasticity; however, lower extremity strength did not improve. on the spastic side, tens significantly decreased the mean h reflex amplitude, the h/m ratio, the h slope, and the h slope/m slope ratio; and increased the h reflex maximum latency. this study had some limitation walking speed was not measured after several tens applications. in conclusion, tens for hemiplegic patients with spastic lower extremities due to cvd markedly improved clinical parameters and significantly changed electrophysiological variables. the results of this study suggest that tens is effective when used to manage spasticity.

to investigate whether transcutaneous electrical nerve stimulation (tens) mitigates the spasticity of hemiplegic stroke patients, as assessed by electrophysiological variables, and the effects, if any, on the clinical appearance of spasticity. [subjects and methods] twenty-seven subjects who had acute hemiplegia and 24 healthy people as the control group, were enrolled in this study. some of the acute cerebrovascular disease patients could walk. subjects who did not have spasticity, who were taking antispasticity medicine, or had a previous episode of cerebrovascular disease were excluded. the walking speed of the patients was recorded before and after tens. emg examinations were performed on the healthy controls and in the affected side of the patients. a 30-minute single session of tens was applied to lower extremity. at 10 minutes after tens, the emg examinations were repeated. [results] a statistically significant decrease in the spasticity variables, and increased walking speed were found post-tens. the lower m amplitude and higher h reflex amplitude, h/m maximum amplitude ratio, h slope, and h slope/m slope ratio on the spastic side were found to be statistically significant. [conclusion] tens application for hemiplegic patients with spastic lower extremities due to cerebrovascular disease resulted in marked improvement in clinical scales of spasticity and significant changes in the electrophysiological variables.

PMC4681915

pubmed-342

proteinase-activated receptors (pars) belong to a family of g-protein-coupled receptors with seven transmembrane domains activated via proteolytic cleavage by serine proteinases. a total of four pars have been identified and cloned. among them, par-1 [2, 3], par-3, and par-4 are targets for thrombin, trypsin, and cathepsin g, whereas par-2 is resistant to thrombin but can be activated by trypsin, mast cell tryptase [6, 7], neutrophil elastase, and insect-derived proteinase. pars are expressed by various cells involved in inflammatory and immunological responses, such as vascular endothelial cells, epithelial cells, mast cells, t cells, monocyte, eosinophils, and neutrophils [10, 11]. in these cells, activation of pars affects their main functions such as proliferation, degranulation, and release of inflammatory mediators [10, 11]. in our previous study, we have showed the expression of par-1, par-2, and par-3 on t cells, and thrombin-, trypsin-, and tryptase-induced interleukin (il-6) release from t cells. it has also been reported that cytoplasmic free calcium and phospholipase c and protein kinase c activation are increased in t-leukemic cell lines following stimulation with thrombin or the thrombin receptor agonist peptide. thrombin and thrombin receptor agonist also enhanced cd69 expression and il-2 productions by cross-linking t cell receptors in both jurkat t cells and peripheral blood lymphocytes. we, therefore, anticipated that thrombin, trypsin, and tryptase might induce tnf release from t cells through pars. tnf is a major proinflammatory cytokine that is thought to be important in the pathogenesis of asthma, food allergy, ocular allergy, and atopic dermatitis. it has been reported that the increased number of tnf expressing cells and levels of tnf is observed in the bronchoalveolar lavage (bal) and in the airways of asthmatics. inhaled tnf increases airway responsiveness to methacholine in asthmatic subjects associated with a sputum neutrophilia. since pars, tnf, and t cells all play roles in inflammation, we believe, there must be some linkages between them. the aim of the present study is to investigate roles of thrombin, tryptase, trypsin, elastase, and agonist peptides of pars in the secretion of tnf from purified human t cells and subtypes of t cells. human thrombin, trypsin (specific activity: 10,000 baee u/mg protein), soybean trypsin inhibitor (sbti), and bovine serum albumin (bsa, fraction v) were purchased from sigma (st louis, mo, usa). recombinant hirudin and human neutrophil elastase (specific activity: 20 meo-suc-ala-ala-pro-val-pna u/mg protein) were obtained from calbiochem (san diego, ca, usa). recombinant human lung tryptase (specific activity: 1,000 n cbz-l-lysine thiobenzyl ester u/mg protein) was from promega (madison, wi, usa). agonist peptides of pars, and their reverse forms, and par-2 antagonist peptide fsllry-nh2 were synthesized in cl bio-scientific inc. the sequences of the active and reverse peptides were par-1, sfllr-nh2 and rllfs-nh2, tfllrn-nh2 and nrllft-nh2; par-2, sligkv-nh2 and vkgils-nh2 as well as trans cinnamoyl (tc)-ligrlo-nh2 and tc-olrgil-nh2; par-3, tfrgap-nh2 and pagrft-nh2. rpmi 1640 and newborn calf serum (ncs) were obtained from gibco (carlsbad, ca, usa). pe-conjugated mouse anti-human cd3 monoclonal antibody, pe-conjugated goat-anti rabbit igg, and tnf opteia elisa kits were purchased from bd pharmingen (san jose, ca, usa). trizol reagent and sybr green i stain were purchased from invitrogen (carlsbad, ca, usa). cellular activation of signaling kits for extracellular signal-regulated kinase (erk), 2-(2-diamino)-3-methoxyphenyl-4h-1-benzopyran-4-one (pd98059), akt, pi3k, and p38 2-(4-morpholinyl)-8-phenyl-4h-1-benzopyran-4-one (ly294002) was purchased from cell signaling technology (beverly, ma, usa). exscript rt reagent kit and sybr premix ex taq (perfect real time) were obtained from takara (dalian, china). rabbit anti-human par-1 and rabbit anti-huamn par-2 polyclonal antibodies were purchased from santa cruz biotechnology (santa cruz, ca, usa). fitc-conjugated mouse anti-human cd4 monoclonal, pe-conjugated mouse anti-human cd8 monoclonal, percp-cy5.5-conjugated mouse anti-human tnf monoclonal, fitc-conjugated mouse anti-human ifn monoclonal, pe-conjugated mouse anti-human il-4 monoclonal, apc-conjugated mouse anti-human cd25 monoclonal, and apc-conjugated mouse anti-human il-17 monoclonal antibodies were purchased from ebioscience. all other reagents were of analytic grade and obtained from sigma (st louis, mo, usa). human t cells were isolated from peripheral blood mononuclear cells (pbmcs) by a macs system with t cell isolation kit i according to the manufacturer's protocol. in brief, pbmcs were isolated from fresh blood donated by healthy volunteers, 100 ml from each individual per visit. the informed consent from each volunteer and agreement with the ethical committee of the first affiliated hospital of nanjing medical university were obtained. after being separated from red blood cells by ficoll-paque density gradient, pbmcs were collected and incubated with microbead-linked anti-cd3 monoclonal antibody for 15 min at 8c. cd3+t cells were separated from other cells by passing through a magnetic cell separation system. for purity analysis, the cells were resuspended in pbs and incubated with pe-conjugated monoclonal antibody against human cd3 for 1 h. the purity of t cells was consistently more than 95% and cell viability was more than 98%. the purified cd3+t cells were then used for the further cell challenge tests. t cells were cultured in 24-well culture plates at a density of 5 10cells/well in rpmi 1640 medium containing 10% ncs at 37c for 2 h with 5% co2, respectively. the culture supernatants were then removed and cells were washed twice with fresh serum-free rpmi 1640 medium at 300 g for 10 min. for challenge experiments, cells were exposed to various doses of thrombin (0.013.0 g/ml, 1 u=0.5 g, 1 u/ml=5.6 nm, u=nih unit), trypsin (0.010.3 g/ml, 1 g/ml=42 nm), tryptase (0.252.0 g/ml, 1 g/ml=7.4 nm), and elastase (0.010.3 g/ml, 1 g/ml=34 nm, 1 u/ml=1700 nm) with or without their inhibitors; and to agonist peptides of par-1, par-2 and par-3 (all at 0.1100 m) and their reverse peptides, respectively, for 16 h before the culture, supernatants were harvested and stored at 40c till use. quantitative expression of tnf mrnas in t cells was determined by real-time pcr following the manufacture's protocol. briefly, after synthesizing cdna from the total rna by using exscripttm rt reagent kit, real-time pcr was performed by using sybr premix ex taq on the abi prism 7000 sequence detection system (perkin elmer applied systems, foster city, ca, usa). each reaction contains 12.5 l of 2 sybr green master mix, 1 l of 10 m of primers, 1 l of the cdna, to a total volume of 25 l. the thermal cycling conditions included an initial denaturation step at 50c for 2 min, 95c for 10 min; 40 cycles at 95c for 15 s, annealing temperatures at 60c for 30 s, and extension at 72c for 30 s. the sequences of pcr primers for tnf and -actin were 5-ccccagggacctctctctaatc-3 (forward) and 5-ggtttgctacaacatgggctaca-3 (reverse); 5-aggggccggactcgtcatact-3 (forward), and 5-ggcggcaacaccatgtaccct-3 (reverse), respectively. consequently, at the end of the pcr cycles, specificities of the amplification products were controlled by dissociation curve analysis. expression of mrna in each sample was finally determined after correction with -actin expression. the gene specific threshold cycle (ct) for each sample (ct) was corrected by subtracting the ct for the housekeeping gene -actin. untreated controls were chosen as the reference samples, and the ct for all experimental samples was subtracted by the ct for the control samples (ct). t cells were preincubated with 50 m of pd98059, 20 m of ly294002, or medium alone for 30 min before adding thrombin 3.0 g/ml, trypsin 0.3 g/ml, or medium alone for 30 min, 2 h, or 6 h. the cells were lysed in a buffer containing 20 mm of tris-hcl (ph 7.4), 137 mm of nacl, 10% glycerol, 1% triton x-100, 2 mm of edta, 25 mm of -glycerophosphate, 2 mm of sodium pyrophosphate, and 0.5 mm of dithiothreitol at 4c for 30 min. cell debris was removed by centrifugation of the lysate at 12,000 g for 10 min. the supernatants were mixed with equal volumes of 2x sodium dodecyl sulphate (sds) sample buffer and heated to 100c for 10 min. an equal volume of sample was fractionated by sds-page on a 10% acrylamide gel and transferred onto polyvinylidene difluoride (pvdf) membranes with a bio-rad transfer system, according to the manufacturer's instructions. after blocking nonspecific binding sites with 5% bsa in tbst (50 mm of tris, 0.15 m of nacl, 0.1% tween 20, ph 7.6) for 1 h, membranes were probed with phospho-erk1/2, phospho-akt, phospho-p38, or phospho-pi3k antibodies at 4c overnight, followed by incubation with hrp-conjugated secondary antibodies. immunoreactive bands were visualized by using enhanced chemiluminescence reagents according to the manufacturer's protocol. densitometry analysis of immunoblots was carried out using quantity one software (bio-rad, usa). the levels of tnf in culture supernatants were measured with opteia elisa kits according to the manufacturer's instructions. the plates were read on a plate reader (molecular devices, menlo park, ca) with the softmax data analysis program. the minimum detectable concentration of tnf was 2.2 pg/ml. to test the par1 and 2 expressions after treatment of trypsin and thrombin, isolated t cells were pelleted by centrifugation at 450 g for 10 min after cells were stimulated with thrombin 3.0 g/ml, trypsin 0.3 g/ml, or medium alone for 16 h. for par1 and par2 staining, cells were incubated with rabbit anti-human par1 or par2 antibodies at 37c for 1 h. after washing, cells were incubated with pe-conjugated goat anti-rabbit igg antibody 37c for 45 min. after washing, cells were analyzed on a fluorescence-activated cell sorting (facs) arial flow cytometer with celldevia software (bd biosciences, usa). to test the secretion of tnf from subtypes of t cells, isolated t cells were pelleted by centrifugation at 450 g for 10 min and then fixed and permeabilized by using a cell fixation/permeabilization kit (bd pharmingen). briefly, thoroughly resuspended cells were added in 100 l of bd cytofix/cytoperm solution and incubated for 20 min at 4c. cells were then incubated with fluorescence labeled anti-human cd4, cd8, cd25, tnf, ifn, il-4, and il-17 monoclonal antibodies or isotope control, respectively (at a final concentration of 4 g/ml) at 4c for 30 min. after washing, cells were analyzed on a fluorescence-activated cell sorting (facs) arial flow cytometer with celldevia software (bd biosciences, usa). the purity of t cells was consistently more than 95% (date was shown in supplementary material, figure s1). it has been shown that thrombin, trypsin, and tryptase can induce proinflammatory cytokine il-6 release from t cells, but little is known of serine proteinase-induced tnf release from t cells. here, we showed that thrombin at concentrations of 1.0 and 3.0 g/ml provoked tnf release from t cells following 16 h incubation period in a dose-dependent manner. approximately up to 2.5-fold increase in tnf release was observed when t cells were incubated with thrombin for 16 h. at 6 h following incubation, data (not shown) on both basal and induced tnf release from t cells were inconsistent. this is most likely due to the limitation of the assay sensitivity and relatively low secretion of tnf. par-1 agonist peptides, sfllr-nh2 at the concentration of 100 m and tfllrn-nh2 at the concentration of 5 m, induced a significant release of tnf at 16 h following incubation. however, rllfs-nh2, a reverse peptide of sfllr-nh2, and nrllft-nh2, a reverse peptide of tfllrn-nh2, had little effect on release of tnf from t cells (figure 1(a)). hirudin, a specific thrombin inhibitor, was able to inhibit thrombin-induced secretion of tnf. approximately up to 82.4% inhibition of thrombin-induced secretion of tnf was observed when 3.0 g/ml of thrombin and 10 u/ml of hirudin were added to t cells for 16 h. hirudin alone at the concentrations tested had little effect on tnf secretion from t cells. sch 79797, a par-1 antagonist at the concentration of 1 m, inhibited 89% thrombin-induced tnf release from t cells (figure 1(a)). similarly, trypsin at the concentration of 0.3 g/ml induced 2.3-fold increase in tnf release from t cells at 16 h (figure 1(b)). however, tryptase at the concentrations up to 2 g/ml and elastase at the concentrations up to 6 u/ml had little effect on tnf release from t cells (data not shown). inhibitors of trypsin, sbti at the concentrations of 10 and 30 g/ml, eliminated 0.3 g/ml trypsin-induced tnf release by a value up to 94.8 and 94.2%, respectively. sbti alone at the concentrations tested had little effect on tnf secretion from t cells. sch 79797, a par-1 antagonist at the concentration of 1 m, inhibited 96.8% trypsin-induced tnf release from t cells (figure 1(b)). sligkv, an agonist peptide of par-2 and tfrgap-nh2, an agonist peptide of par-3 at the concentrations up to 100 m, did not appear to have any effect on tnf release from t cells (data not shown). in order to confirm the findings above, we investigated the influence of the serine proteinases on the expression of tnf mrna in t cells. it was found that the expression of tnf mrna was upregulated when t cells were incubated with thrombin at 1 and 3 g/ml for 2 and 6 h. the maximum enhanced expression of tnf mrna was 4.2-fold over baseline control (figure 2(a)) after 6 h incubation. hirudin, a specific thrombin inhibitor at the concentration of 3 u/ml, completely abolished thrombin-induced upregulated expression of tnf mrna after 6 h incubation (figure 2(b)). trypsin at the concentration of 0.3 g/ml also induced increased expression of tnf mrna by a value up to approximately 4.0-fold in t cells (figure 2(a)), which was completely blocked by sbti (figure 2(b)). similarly, sch 79797 at the concentration of 1 m inhibited both thrombin- and trypsin-induced upregulated expression of tnf mrna in t cells by a value up to 72 and 72.5%, respectively (figure 2(b)). sfllr-nh2 at the concentration of 100 m and tfllrn-nh2 at the concentration of 5 m significantly increase the expression of tnf mrna at 2 and 6 h following incubation (figure 2(a)). but rllfs-nh2, a reverse peptide of sfllr-nh2, and nrllft-nh2, a reverse peptide of tfllrn-nh2, had little effect on expression of tnf mrna in t cells (data not shown). at the same time, neither thrombin nor trypsin showed obvious effect on the expression of par-1 and par-2 (data not shown). it is wellknown that there are numerous subtypes of t cells and each of them has distinctive functions. we, therefore, investigated subtypes of t cells by flow cytometer analysis in order to determine the subtypes that upregulate tnf in response to trypsin or thrombin. the results showed that trypsin and thrombin induced upregulated expression of tnf in cd4+t cells, but not cd8+t cells, following 16 h incubation period. among cd4+t cells, trypsin and thrombin enhanced tnf expression in il-4+or cd25+t cells, but not in ifn+ or il-17+t cells. sch 79797 was able to inhibit enhanced tnf expression induced by trypsin and thrombin (figures 3(a) and 3(b)). in order to examine signal transduction pathways of thrombin and trypsin, t cells were preincubated with pd98059, ly294002, or medium alone for 30 min before adding thrombin 3.0 g/ml, trypsin 0.3 g/ml, or medium alone for 16 h. following 16 h incubation period, pd98059 an inhibitor of mapk pathway, and ly294002, an inhibitor of pi3k, completely blocked thrombin- and trypsin-induced release of tnf (figure 4(a)). furthermore, pd98059 inhibited thrombin- and trypsin-induced upregulation of expression of tnf mrna by a value up to 91.2 and 98.6%, and ly294002 eliminated thrombin- and trypsin-induced expression of tnf mrna by 95.5 and 83.2% in t cells following 6 h incubation (figure 4(b)). 3 g/ml) induced enhanced phosphorylation of erk1/2 in t cells following 0.5, 2, and 6 h incubation periods. however, thrombin and trypsin did not significantly affect phosphorylation of p38 in t cells following 0.5, 2, and 6 h incubation periods (date was shown in supplementary material, figure s2). pd98059 was able to completely block thrombin- and trypsin-induced phosphorylation of erk1/2 when it was preincubated with t cells for 30 min. thrombin at a concentration of 3 g/ml and trypsin at a concentration of 0.3 g/ml induced significantly increased phosphorylation of akt in t cells following 0.5, 2, and 6 h incubation periods. however, thrombin and trypsin did not significantly affect phosphorylation of pi3k in t cells following 0.5, 2, and 6 h incubation periods (date was shown in supplementary material, figure s3). ly294002 was able to block thrombin- and trypsin-induced phosphorylation of akt when it was incubated with t cells for 30 min. we discovered in the present study that serine proteinases thrombin and trypsin, but not tryptase induced tnf release from human t cells. since tnf is a potent proinflammatory cytokine, our observation is likely to add some novel information for, understanding of actions of serine proteinases in causing inflammation. as little as 1.0 g/ml of thrombin was able to induce significant tnf release from t cells, suggesting this proteinase is a potent secretagogue of tnf. this concentration of thrombin should be easily achieved in blood, particularly when the processes of platelet aggregation and coagulation are initiated. inhibition of thrombin-induced tnf release by a specific inhibitor of thrombin and hirudin indicates that action of thrombin on t cells was dependent on the enzymatic activity of this serine proteinase. there are 3 receptors for thrombin on cells, including par-1, par-3, and par-4 [2, 3]. since par-1 agonist peptides sfllr-nh2, and tfllrn-nh2, but not par-3 agonist peptide tfrgap-nh2 were capable of stimulating tnf release, a par-1 antagonist sch 79797 almost completely abolished thrombin-induced tnf release from t cells, and purified human t cells do not express par-4; the action of thrombin on t cells is most likely through activation of par-1. our previous report which found thrombin-induced il-6 secretion from human peripheral blood t cells may support our current findings. while little information is available on induction of tnf release from t cells by trypsin, the ability of trypsin to stimulate il-6 secretion from t cells may support the anticipation that trypsin is capable of inducing cytokine release from t cells. as little as 0.3 g/ml of trypsin was able to provoke tnf secretion from t cells proved that it is a potent stimulus of tnf release. as for thrombin, inhibitor of trypsin sbti was able to inhibit trypsin-induced tnf release from t cells, indicating that an intact catalytic site is required for the serine proteinase to stimulate tnf release. since par-1 is one of three receptors of trypsin, par-1 agonist peptides sfllr-nh2 and tfllrn-nh2 are capable of stimulating tnf release from t cells, and sch 79797 almost completely abolished trypsin-induced tnf release from t cells, the action of trypsin on t cells is most likely through activation of par-1. since par-2 agonist peptide sligkv-nh2 and tryptase are not capable of stimulating tnf release from t cells, the action of trypsin on t cells is not likely through activation of par-2. trypsin- and thrombin-induced upregulated expression of tnf was observed in cd4 +, il-4+or cd25+t cells, indicating that il-4 +, and cd25+t cells are major sources of tnf. while little information on the relationship between cd25+t cells and tnf is available, a study which found that the percentage of cd4(+)cd25(+) t cells were significantly high, but the percentage of foxp3(+) cells were low in allergic rhinitis patients, and that il-4, il-5, and tnf levels in nasal lavage fluids were high indicates that the increased tnf release may be from cd4(+)cd25(+), nonregulatory t cells. we believe that the current study is the first work that demonstrates coexpression of cd25 and tnf in the subtype of cd4(+) t cells. similarly, we clearly found that il-4+t cells express enhanced tnf, though little information on co-expression of il-4 and tnf in t cells is available. this finding implicates that trypsin and thrombin may be involved in the inflammation through induction of tnf release from il-4+or cd25+t cells. it was demonstrated that nickel-specific cd4+t cell lines and th17 cells corelease il-17 and tnf, but trypsin- and thrombin-induced tnf release appears not from il-17+t cells as tnf expression in il-17+t cells was not upregulated by these two proteinases. mapk/erk pathway is the signaling pathway that is most likely involved in the thrombin- and trypsin-induced tnf release from highly purified t cells, as pd98059, an inhibitor of mapk/erk pathway, almost completely blocked thrombin- and trypsin-provoked phophorylation of erk and tnf release. while little information on signaling pathways associated with par-1 signaling in purified t cells is available, the previous reports that par-1 agonists activated mapk/erk and p38 mapk signaling pathways in dermal and cardiac fibroblasts may support our current observation that mapk/erk pathway is the signaling pathway that is most likely involved in the thrombin- and trypsin-induced tnf release. in addition, pi3k/akt signaling pathway seems also to be involved in thrombin and trypsin induced tnf secretion, as ly294002 an inhibitor of pi3k/akt signaling pathway partially diminished thrombin and trypsin induced tnf secretion and completely abolished thrombin and trypsin provoked phosphorylation of akt. this finding is in the same line with the report, which showed that thrombin stimulated enhance pi3k activity in hamster embryonic fibroblasts, but different from our previous report, which showed that thrombin did not enhanced pi3k activity in human dermal fibroblasts. the discrepancy between these studies may be due to the difference in cell origin and species. tnf is a member of a growing family of peptide mediators comprising at least 19 cytokines, including lymphotoxin-, fas ligand, and cd40 ligand. the family is now considered as central mediators of a broad range of biological activities in protective immune responses against a variety of infectious pathogens. on the other hand, tnf also exerts host-damaging effects in sepsis and autoimmune disease [30, 31]. these findings indicate that tnf is one of key mediators of inflammation; therefore, our current study is of importance in understanding tnf-related inflammation and the mechanism of proteinase-induced cytokine production in t cells. in conclusion, it is discovered in the present study that serine proteinases thrombin and trypsin are potent stimuli of tnf secretion from highly purified t cells. their actions on t cells depend on their enzymatic activities and are likely through activation of par-1. stimulation of tnf secretion from t cells by serine proteinases further proved that these proteinases are actively involved in the pathogenesis of inflammation and regulation of immune response in man.

serine proteinases have been recognized as playing an important role in inflammation via proteinase activated receptors (pars). however, little is known about the influence of serine proteinases and pars on tnf secretion from highly purified t cells. we challenged t cells from human peripheral blood with serine proteinases and agonist peptides of pars and measured the levels of tnf in culture supernatants by elisa. the results showed that thrombin and trypsin, but not tryptase, stimulated approximately up to 2.5-fold increase in tnf release from t cells following 16 h incubation. proteinase inhibitors and par-1 antagonist sch 79797 almost completely abolished thrombin- and trypsin-induced tnf release from t cells. agonist peptides of par-1, but not par-2 induced tnf release from t cells. moreover, trypsin- and thrombin-induced upregulated expression of tnf was observed in cd4 +, il-4 +, or cd25+t cells, but not in ifn+ or il-17+t cells. the signaling pathways mapk/erk and pi3k/akt are involved in the thrombin- and trypsin-induced tnf release from t cells. in conclusion, thrombin and trypsin can induce tnf release from il-4+and cd25+t cells through activation of par-1 and therefore contribute to regulation of immune response and inflammation of the body.

PMC3876890

pubmed-343

relapsing chronic inflammation found in the gut of individuals affected by inflammatory bowel diseases (ibd) is a result of several overlapping factors, including dysregulation of the immune response to the enteric microbiota, genetic susceptibility, and environmental factors [1, 2]. reactive oxygen (ros) and nitrogen (rns) species generated by inflammatory cells during an immune response create oxidative stress and are considered as important factors contributing to the pathogenesis of ibd. lymphocytes, neutrophils, and macrophages activated during the gut inflammation produce high amounts of ros/rns destroying surrounding tissue. although oxidative stress is a major factor in the inflamed tissue leading towards necrosis, dna damage, and carcinogenesis, certain amounts of ros and other free radicals have an indispensable role in regulating different cell signalling pathways. in addition, some immune cells, namely, the macrophages and neutrophils, use ros to combat the microorganisms responsible for the infection. current therapies of ibd, including immunosuppressive drugs, antibiotics, and biological drugs, are efficient in controlling the course of the disease. however, for many affected individuals, conventional therapy becomes an inadequate choice for long-term treatment because of significant side effects and risk factors, such as increased cancer risk, development of tuberculosis, and heart failure [57]. in recent years, hyperbaric oxygen (hbo2) therapy has been introduced as a possible additional treatment for ibd patients, especially in the case of refractory disease when the standard therapy is ineffective. hbo2 involves exposure to 100% oxygen under pressure greater than 1 atmosphere of absolute pressure (atm). it is a well-established procedure frequently applied in the medical practice, especially effective in treating wounds of various aetiologies [811]. hbo2 increases blood and tissue oxygen saturation resulting also in enhanced production of ros and rns. previous studies have verified that the clinical efficacy of hbo2 derives from modulation of intracellular transduction cascades, leading to synthesis of growth factors which promote wound healing, neoangiogenesis, and ameliorates postischemic and postinflammatory injuries. additional investigations on the mechanism underlying hbo2-induced wound healing have revealed a central role of hypoxia inducible factor-1 alpha (hif-1) as transcriptional regulator of genes involved in angiogenesis, energy metabolism, and cell proliferation [9, 14, 15]. a further important function attributed to the hif-1 is modulation of the immune responses, including the helper t-cell differentiation towards regulatory (treg) versus th17 phenotype [16, 17] and its strong anti-inflammatory activity in the gastrointestinal mucosa and hypoxic epithelium as a result of the transactivation of specific genes encoding for barrier-protective elements such as mucins [1820]. hypoxia and ros/rns can induce stabilization of hif-1 leading to the activation of the hypoxia signal transduction pathway. increased oxidative stress in the gut mucosa has been verified in humans suffering from ulcerative colitis [22, 23], as well as in experimentally induced colitis in animals [24, 25]. a recent study revealed increased activity of antioxidative enzymes and reduced oxidative stress in the inflamed gut mucosa following hbo2 exposure; however, specific mechanisms inducing activation of antioxidative enzymes in the inflamed colonic tissue upon hbo2 remain unknown. since there is evidence that the intracellular redox status is in a close correlation with the inflammatory microenvironment, and it can also be changed by hbo2, the aim of this study was to investigate the effects of hbo2 on the mrna expression of hif-1, proinflammatory cytokines, and antioxidative enzymes in the gut and peripheral lymphoid organs of balb/c mice with dss-induced colitis. an additional aim was to assess the activity of antioxidative enzymes and whether hif-1 gene expression regulation during the gut inflammation and hbo2 treatment correlates with the changes in antioxidative and proinflammatory gene expression. our findings reveal that hbo2 treatment may effectively modulate the intestinal milieu in inflammatory conditions involving hif-1-mediated regulation of antioxidative gene expression. balb/c mice, obtained from charles river (calco, italy), were bred at the animal facility of the medical faculty osijek (croatia). mice were provided with standard rodent chow (mucedola, settimo milanese, italy) and water ad libitum. the experimental facility was maintained at 22 2c, 55 5% humidity, and 12-hour light/dark cycle. all procedures involving live animals were conducted in accordance with the european guidelines for the care and use of laboratory animals (directive 86/609/eec) and were approved by the local ethical committee (faculty of medicine, university of osijek) and croatian ministry of agriculture. for each experiment male mice at the age of 1012 weeks were randomized into 4 groups (n=4-5 mice/group/experiment): control mice (ctrl), control mice undergoing hbo2 (ctrl+hbo2), mice receiving dextran sodium sulphate (dss), and dss treated mice undergoing hbo2 (dss+hbo2). the average body weight of the mice at the time of inclusion into the study was 22.8 0.4 g. colitis was induced by 5% (w/v) of dss (mr 36.00050.000, mp biomedicals, illkrich, france) in drinking water ad libitum for 7 consecutive days [26, 27]. the hbo2 treatment was initiated at day 1 and was administered twice a day, 12 hours apart, until the end of experiment (the last session was applied in the morning of day 8; 15 sessions in total). during one hbo2 session, mice were exposed to 100% o2 for 60 minutes at 2.4 bars with addition of 15 minutes for gradual compression and decompression. mice were sacrificed by cervical dislocation on day 8, after the morning hbo2 session. disease activity index (dai) was assessed by daily measurement and scoring of animal body weight loss, stool consistency, and the presence of occult or gross blood per rectum. measurements were performed at the same time each day until the end of experiment (day 8). dai was determined as a sum of body weight loss score (0, none; 1, 15% loss; 2, 510%; 3, 1015%; 4,>15%), stool consistency score (0, normal; 2, loose stool; 4, diarrhea), and score of occult/gross bleeding (0, normal; 2, occult bleeding; 4, gross hematochezia). mice were sacrificed by cervical dislocation on day 8 following the last morning hbo2 treatment. colons, mesenteric lymph nodes (mln), and spleens were collected for further analysis. colonic tissue was removed immediately after the animals were sacrificed, washed in pbs, and fixed in 4% paraformaldehyde. after 72 hours fixed tissue was embedded in paraffin and cut into a series of 6 m thick sections. histological evaluation was preformed according to modified geboes score as follows: grade 0 (structural (architectural changes)): 0: no abnormality, 1: mild abnormality, 2: mild or moderate diffuse or multifocal abnormalities, 3: severe diffuse or multifocal abnormalities. 2: mild or moderate diffuse or multifocal abnormalities, 3: severe diffuse or multifocal abnormalities. grade 1 (chronic inflammatory infiltrate): 0: no increase, 1: mild but unequivocal increase, 2: moderate increase, 3: marked increase. 1: mild but unequivocal increase, 2: moderate increase, grade 2 (lamina propria leukocytes): 0: no increase, 1: mild but unequivocal increase, 2: moderate increase, 3: marked increase. 1: mild but unequivocal increase, 2: moderate increase, grade 3 (intraepithelial neutrophils): 0: none, 1:<5% crypts involved, 2:<50% crypts involved, 3:>50% crypts involved. 1:<5% crypts involved, 2:<50% crypts involved, 3:>50% crypts involved. grade 4 (crypt destruction): 0: none, 1: probable, local excess of neutrophils in part of crypt, 2: probable, marked attenuation. 1: probable, local excess of neutrophils in part of crypt, 2: probable, marked attenuation. grade 0 (structural (architectural changes)): 3: unequivocal crypt destruction. 3: unequivocal crypt destruction. grade 5 (erosion or ulceration): 0: no erosion, ulceration, or granulation tissue, 1: recovering epithelium+adjacent inflammation, 2: probable erosion focally stripped, 3: unequivocal erosion, 4: ulcer or granulation tissue.slides were analysed using light microscopy at magnifications 40x, 100x, 200x, and 400x and photographed at 200x (olympus bx50 microscope, olympus c-5050 digital camera, and quickphoto pro imaging software (promicra s.r.o., prague, czech republic)). 0: no erosion, ulceration, or granulation tissue, 1: recovering epithelium+adjacent inflammation, 2: probable erosion focally stripped, 3: unequivocal erosion, 4: ulcer or granulation tissue. after isolation, the colon was cleaned of intestinal content and freed of fat tissue, washed in dmem (sigma aldrich, steinheim, germany), cut into 5 cm long pieces, and, while shaken at 100 rpm, incubated at 37c for 20 minutes in dmem with 25 mm edta. the tissue was then thoroughly washed in pbs buffer for at least 5 times, cut into 2 mm long strips, and digested in dmem containing 5 u/ml dnase (roche, mannheim, germany) and collagenase ii (gibco, paisley, uk) at 37c for 20 min. following this, supernatant was removed, and the previous step was repeated until complete digestion of the tissue was achieved. the supernatant was then filtered through a 100 m sized filter; dmem+2% fbs (sigma aldrich, steinheim, germany) was added and centrifuged at 800 g for 10 min at room temperature. cells were resuspended in 5 ml of 40% percoll (ge healthcare, uppsala, uk), overlaid on 4 ml of 80% percoll, and centrifuged at 900 g/20 min/4c. lymphocytes were isolated from the mesenteric lymph nodes (mln) and spleen by teasing apart the organs between the frosted ends of two microscopic slides. the cells were incubated with a mixture of pe anti-cd4 (clone gk1.5, exbio antibodies), fitc anti-b220 (clone ra3-6b2, obtained from the american type culture collection and conjugated with fitc using standard procedures), and apc anti-cd3 antibodies (clone 145-2c11, exbio antibodies) and the other panel with percp anti-cd45 (clone 30-f11, bd biosciences), fitc anti-gr-1 (clone rb6-8c5, bd biosciences), and pe anti-f4/80 (clone bm8, stemcell technologies inc.) or pe anti-cd4 (clone mem-241, exbio antibodies) and percp anti-cd8 (clone mem-31, exbio antibodies) antibodies. dead cells were excluded based on 7-aminoactinomycin d (7-aad) (applichem, darmstadt, germany) staining. at least 20,000 live cells were collected by a bd facs canto ii cytometer (facs canto ii, becton dickinson, san jose, ca, usa) and analysed using the flowlogic software (inivai technologies, mentone, australia). to assess hydrogen peroxide (h2o2) and peroxynitrite (onoo) level, 10 lymphocytes isolated from mln and spleens were incubated for 30 min on+4c with 10 m dichlorofluorescein diacetate (dcf-da) (biomol, hamburg, germany), washed for 5 min at 400 g on+4c, and analysed with the facs canto ii. following this, cells were stimulated with 100 nm phorbol 12-myristate 13-acetate (pma, calbiochem, darmstadt, germany), incubated for 30 min, and analysed for the second time. at each measurement minimum of 10,000 target cells colon, mln, and spleen samples were isolated, snap frozen in liquid nitrogen, and stored at 80c till analysis. rna purity and concentration was assessed by nanophotometer p-class p330-30 (implen, munich, germany). in order to purify rna from all polysaccharides, including dss, an additional purification step using 8 m licl was performed, followed by the standard genomic dna purification step using deoxyribonuclease i kit (sigma aldrich, st louis, mo, usa). one microgram of rna was used for cdna synthesis by high capacity cdna kit with rnase inhibitor (applied biosystems, foster city, ca, usa). real-time pcr was performed on cfx96 system (bio rad, singapore) to assess relative expression of catalase (cat), glutathione peroxidase 1 (gpx1), superoxide dismutase 1 (sod1), hif-1, il-1, il-2, and il-6. except for the primers for il-6 gene published by jeong et al., all other primers were custom made using primer 3 software. messenger rna expression was determined using ssofast evagreen supermix (bio rad, singapore). tissue powder was additionally homogenized in 100 mm phosphate buffer solution (ph 7.0) containing 1 mm edta (1: 10, w/v) using ultra turrax t10 homogenizer (ika, staufen, germany) while kept on ice. tissue homogenates were sonicated for 30 seconds on ice in three 10 seconds intervals and then centrifuged at 20,000 g for 15 minutes at 4c. cat, gpx, and sod enzyme activities were determined using a lambda 25 uv-vis spectrophotometer equipped with uv winlab 6.0 software package (perkin elmer for the better, massachusetts, usa). catalase (ec 1.11.1.6) activity was estimated spectrophotometrically using h2o2 as a substrate. the reaction mixture consisted of 10 mm h2o2 in 50 mm phosphate buffer ph 7.0. changes in absorbance of the reaction mixture were measured at 240 nm during 2 minutes after the sample addition. one unit of activity corresponds to the loss of 1 mol of h2o2 per minute. cat activity was calculated using molar extinction coefficient (= 0.04 mm cm) and expressed as u mg protein. to assess glutathione peroxidase (ec 1.11.1.9) activity a modified method described by wendel using h2o2 as a substrate was employed. gpx activity was determined indirectly by measuring the rate of nadph oxidation to nadp+, accompanied by a decrease in absorbance at 340 nm. the assay mixture consisted of 50 mm phosphate buffer with 0.4 mm edta and 1 mm sodium azide (ph 7.0), 0.12 mm nadph, 3.2 units of gr, 1 mm glutathione, and 0.0007% (w/w) h2o2 in a total volume of 1.55 ml. one unit catalyses the oxidation by h2o2 of 1.0 mole of reduced glutathione to oxidized glutathione per minute at ph 7.0 and 25c. gpx activity was calculated using molar extinction coefficient for nadph (= 6.220 mm cm) and expressed as u mg protein. superoxide dismutase (ec 1.15.1.1.) activity was determined using cytochrome c (0.05 mm) as an inhibitory molecule in pbs buffer saline with 0.1 mm edta in system xanthine (1 mm)/xanthine oxidase (50 u) by flohe method. total soluble protein concentration in protein extracts was determined by bradford reagent (sigma aldrich, steinheim, germany) following manufacturer's protocol and using bovine serum albumin as a standard. were tested by one-way anova or kruskal-wallis test followed by the holm-sidak/tukey or dunn's post hoc multiple comparison procedure, respectively (sigma plot 11.0, sigmastat inc., the student t-test and mann-whitney u statistic were used to compare the differences between the two groups in the case of normally distributed variables and variables that violated assumption of normality, respectively. spearman's correlations were calculated where appropriate (sigma plot 11.0, sigmastat inc.). dai results were analysed by two-way anova and bonferroni post hoc test (graphpad prism 5.0, graphpad software, inc., la jolla, ca, usa). a p value of<0.05 was considered statistically significant for all procedures. all data are presented as mean values standard error of mean (s.e.m.). in order to determine the effects of hbo2 on the course of acute colitis, balb/c mice were exposed to 5% dss in the drinking water ad libitum and daily monitored for body weight, stool consistency, and occult/gross rectal bleeding to calculate dai. in this study the dss treatment induced substantial weight loss, rectal bleeding, loose stool, and colon shortening resulting in significantly higher dai compared to the control (ctrl) group, starting from day 3 until the end of the experiment (p<0.01; figure 1(a)). mice that received dss and underwent hbo2 treatment (dss+hbo2 group) also presented with significantly higher dai compared to the ctrl group; however, in this group of mice hbo2 treatment significantly reduced dai compared to the dss mice, starting from day 5 throughout day 8 (days 5 and 8 p<0.01; days 6 and 7 p<0.05; figure 1(a)). in addition, average colon length in the dss group of mice was significantly shorter (8.14 0.23 cm) compared to the ctrl group (13.88 0.45 cm; p<0.0001), while this effect was significantly ameliorated by hbo2 treatment in the dss+hbo2 group (11.34 0.38 cm) compared to the dss group (p=0.0001, figure 1(b)). dss induced colitis resulted in significant body mass loss compared to ctrl group, irrespective of hbo2 treatment (11.89 0.03% and 8.24 0.01% in the dss and dss+hbo2 group, resp.; ctrl and ctrl+hbo2 gained body mass during the experiment, 8.25 0.2% and 0.33 0.01%, respectively. histological assessment of the colon revealed severe inflammation and ulceration extending into the deep portions of the mucosa with loss of crypts and with increased number of lamina propria leukocytes in dss group of mice. we also found structural changes of mucosa in the colonic tissue of dss+hbo2 mice but with reduced infiltration of inflammatory cells and decreased crypt distortion. when compared to the dss+hbo2 group, the dss group had significantly higher total histological score as well as individual scores (see modified geboes score in section 2.3, figure 1(d), p<0.001), except for the intraepithelial neutrophil infiltration score (p=0.104). distribution of inflammatory cells among the peripheral lymphoid organs, including gr-1 leukocytes (monocytes and neutrophils), f4/80 leukocytes (monocytes), cd3 t lymphocytes, and b220 b lymphocytes (figure 2), was assessed at the end of the experiment. in the mln, frequencies of gr-1 cells did not differ among the experimental groups, while dss induced a significant increase in f4/80 and decrease in cd3 cell frequencies (p<0.05 and p=0.032, resp.; figure 2(b)). these findings in the dss group were accompanied by a b-cell increase which was not statistically significant. hbo2 alone had no effect on the cell frequencies in mln of control mice, whereas it substantially ameliorated these changes in mice with dss-induced colitis (dss+hbo2 group) but without reaching statistical significance. in the spleen, gr-1 cell frequencies were significantly decreased in the dss group compared to ctrl (p=0.006) and ctrl+hbo2 groups (p<0.001; figure 2(a)). hbo2 treatment reversed gr-1 cell frequencies to control values in the dss+hbo2 group (p=0.056; figure 2(a)). in addition, the dss mice showed reduced frequencies of b220 lymphocytes compared to the ctrl group (p=0.016), and hbo2 treatment abolished these effects in the dss+hbo2 group (p=0.034; figure 2(c)). in addition, our study revealed that dss-induced immune responses in the mln and the spleen were significantly dampened by hbo2 treatment. frequency of cd4 cells among the colon lamina propria lymphocytes of dss and dss+hbo2 groups was significantly increased compared to the ctrl group (p=0.015 and p=0.047, resp.), while the frequency of cd8 cells was significantly increased only in the dss group when compared to the ctrl group (p=0.011; figure 3). inflammatory conditions have been known to include the enhanced production of ros and other oxidative mediators that may affect transcriptional regulation via hif-1. to investigate the role of hif-1 in the regulation of the antioxidative response/capacity during dss-induced colitis and hbo2 treatment, hif-1, cat, gpx1, and sod1 mrna expressions were determined using quantitative pcr method. mrna expression was significantly changed by the hbo2 treatment and the inflammatory microenvironment in the gut mucosa. dss-induced colitis resulted in significant upregulation of hif-1 gene in colonic mucosa (p=0.008 for dss group compared to ctrl), and the hbo2 treatment further increased hif-1 mrna expression in the dss+hbo2 group (p=0.028 compared to ctrl; figure 3(a)). in addition, the activity of hif-1 protein was indirectly confirmed by measuring mrna expression of well-established hif-1 target genes, vegf and pgk1. both genes showed strong positive correlation to the hif-1 mrna (supplementary figure 1) (see supplementary material available online at http://dx.doi.org/10.1155/2016/7141430). there was also a tendency for upregulation of hif-1 gene in mln and spleens of the dss group and its downregulation via hbo2 in the dss+hbo2 group (figure 4(a)); however, these changes did not reach statistical significance. inflammation during dss-induced colitis and the hbo2 treatment also induced significant changes in mrna expression of target antioxidative genes. dss-treated mice presented with significant downregulation of the cat gene in the colon compared to the ctrl group (p=0.031), while there was a significant upregulation of cat gene in the spleen of the dss+hbo2 mice compared to the ctrl group (p=0.026; figure 4(b)). in the colon, gpx1 mrna expression was increased in the dss (p=0.034) and the dss+hbo2 (p=0.003) group compared to ctrl group. the upregulation was even greater in mice with dss-induced colitis that underwent the hbo2 treatment (dss+hbo2 group; figure 4(b)). sod1 mrna expression was significantly reduced in the colon of the dss+hbo2 group compared to ctrl (p=0.008) and ctrl+hbo2 (p=0.007) groups. similar changes in sod1 gene expression were also found in the mln of the dss+hbo2 group (p=0.025 compared to ctrl; figure 4(b)). to summarize, colitis resulted in gpx1 gene upregulation and cat gene downregulation, while hbo2 downregulated sod1 and further upregulated gpx1 in a tissue-specific manner. to examine the possible role of hif-1 in transcriptional control of antioxidative genes in the colon, the results revealed a strong negative correlation between hif-1 and sod1 (r=0.651, p=0.001) and a positive correlation of hif-1 to the gpx1 gene (r=0.750, p<0.001), while there was no significant correlation between the hif-1 and the cat gene in the colonic tissue (figure 4(c)). the early phase of inflammation is mediated by several proinflammatory mediators, which prompted us to assess how hbo2 treatment affects their production. we found that gut mucosa inflammation was accompanied with a significant increase in il-1 and il-6 gene expression. in the case of il-6 gene, this was significant for dss and dss+hbo2 groups compared to the ctrl+hbo2 group (p=0.024 and p=0.021, resp.; furthermore, il-6 gene was significantly upregulated in the mln of the dss group (p=0.001 compared to ctrl), and hbo2 reduced its expression almost to control values in the dss+hbo2 group (p=0.016 compared to dss; figure 5(a)). il-1 mrna expression in the colonic mucosa was significantly increased during inflammation in dss group compared to ctrl (p=0.014) and ctrl+hbo2 groups (p=0.041). il-1 mrna levels in the colon of the dss+hbo2 group did not significantly differ from the control groups, suggesting that hbo2 treatment blocked the increase of il-1 gene expression in the inflamed mucosa. il-2 gene was significantly upregulated in the mln of the dss group compared to the ctrl group (p=0.003), and hbo2 treatment resulted in its significant downregulation in the dss+hbo2 group (p=0.032). similarly, il-2 gene was significantly downregulated in the spleen of mice from the dss+hbo2 group compared to the ctrl group (p=0.025). in addition, there was a strong positive correlation between hif-1 and il-6 gene (r=0.749, p<0.001; figure 5(b)), while there was no correlation between hif-1 and il-1 or il-2 genes in the colonic tissue (figure 5(b)). in addition to their mrna expression, we also tested the enzymatic activity of antioxidative enzymes. we found that both the inflammation and the hbo2 treatment per se were able to change the activity of antioxidative enzymes in the colonic mucosa and the peripheral lymphoid organs (mln and spleen). in spleen hbo2 treatment per se induced significant increase of sod activity (p=0.040 compared to ctrl). mice with dss-induced colitis presented with significantly increased activity of sod (p=0.012 compared to ctrl) in the colon and reduced cat activity in mln and spleen (p=0.023 and p=0.032, resp.) compared to ctrl group. treatment did not change sod activity in the inflamed colonic mucosa, which was comparable to the levels found in dss and ctrl+hbo2 groups (significantly increased compared to ctrl, p=0.010). on the other hand, hbo2 treatment significantly increased cat (p=0.020) and gpx (p=0.001) activities in the spleens of the dss+hbo2. immune cells at the site of inflammation and in the peripheral lymphoid organs are an important source of ros. therefore we assessed the basal levels of intracellular h2o2 and onoo and their production upon pma-induced activation in the lymphocytes isolated from mln and spleens of the mice from all experimental groups (figure 6). basal h2o2 and onoo production in the mln was not significantly different among the groups, except for the lymphocytes from the dss+hbo2 group which presented with a significant increase of h2o2 and onoo levels compared to the ctrl group (p=0.033). pma stimulation resulted in increased intracellular h2o2 and onoo production, although statistically significant only for ctrl (p=0.031) and dss+hbo2 (p=0.012) groups. in the spleen, hbo2 increased lymphocyte h2o2 and onoo production in ctrl+hbo2 and dss+hbo2 groups (p=0.004 and p=0.007 compared to the ctrl; and p=0.005 and p=0.009 compared to the dss group). their production after pma-induced activation was decreased in all experimental groups except the ctrl group; however, this effect reached statistical significance only in the ctrl+hbo2 group (p=0.018 compared to unstimulated lymphocytes). in the present study, the experimental model of dss-induced colitis in balb/c mice was employed to explore the effects of hbo2 on the antioxidative enzymes, transcription factor hif-1, and proinflammatory cytokine genes during colonic inflammation and their role in modulating the course of the disease via hbo2 treatment. the most important findings are that (a) hbo2 significantly reduces symptoms and severity of dss-induced colitis, as evidenced by clinical appearance, contraction of the immune cell expansion and mobilization, and reversal of il-1, il-2, and il-6 gene expression; (b) hbo2 modulates the expression of antioxidative enzyme genes and enzyme activities during colitis; and (c) hbo2 enhances hif-1 mrna expression in the inflamed colonic tissue which is in a strong correlation with gpx1, sod1, and il-6 mrna expression. several previous studies in animals and humans demonstrated the positive effects of hbo2 treatment in influencing the severity of colitis and reducing gut mucosa inflammation [27, 34]; however, data on the precise underlying mechanisms are scarce. considerably more data on the beneficial anti-inflammatory effects of hbo2 are available for other conditions such as septic shock, ischemia/reperfusion injuries, and atherogenesis, where the previous studies reported reduced proinflammatory cytokine expression, suppressed development of th cells, shrinking of spleen and lymph nodes, decreased responses to antigens, and reduced frequencies of circulating leukocytes [3542]. although this is the first animal study investigating the effects of hbo2 performed on dss-induced colitis in balb/c mice and correlating it with the immune cell frequencies, our results are in line with previous findings on the changes associated with dss-induced acute immune response, as well as on the effects of hbo2 on the antioxidative enzyme activities determined in other animal models, such as tnbs and acetic acid induced colitis in rats [27, 43, 44]. during colitis mice presented with decreased t and b cell frequencies in the spleen and reduced t cell frequencies in the mln, suggesting that lymphocytes are recruited from the peripheral lymphoid organs and probably migrate to the inflamed colonic mucosa. one element of the beneficial effect of hbo2 may be linked to normalized t and b cells frequency in the mln and spleen of mice with dss-induced colitis after hyperbaric treatment (figures 1 and 2). by measuring cd4 and cd8 lymphocyte in colon we confirm our hypothesis of t-cell recruitment from the peripheral lymphoid organs and their migration to the inflamed colonic mucosa, as well as immunomodulatory effect of hbo2. in our model hbo2 did not affect cell frequencies in the peripheral lymphoid organs of control mice, in contrast to previous findings where hbo2 treatment per se was able to change lymphocyte subset populations in the spleen. for a long time macrophages and neutrophils have been considered as immune cells exclusively producing proinflammatory cytokines, chemokines, and large amounts of ros/rns contributing to aggravated inflammation. we have found decreased spleen gr-1 cell frequencies during colitis and their normalization upon hbo2 treatment (figure 2). in addition, we showed increased mln frequencies of f4/80 cells in dss group, while hbo2 treatment reversed their frequencies almost to control values. these findings indicate that hbo2 can modulate distribution of phagocytes by retaining neutrophils in the spleen and instigating macrophage migration towards the site of inflammation, in agreement with previous findings describing inhibited neutrophil infiltration into the gut of mice with dss-induced colitis. furthermore, hbo2 treatment alone did not change the expression of proinflammatory cytokines in the colon, mln, or spleen of the control mice; however, dss-induced colitis resulted in a significant il-1 and il-6 gene upregulation in the colonic tissue and il-2 gene upregulation in the mln (figure 5). consistent with previous studies, hbo2 treatment abolished these effects, further confirming its anti-inflammatory potential [4749]. several animal studies on the effects of hbo2 on the experimental colitis reported an increased antioxidative capacity and changes in antioxidative enzyme activity [24, 25]. it has been proposed that an optimal hbo2 treatment could generate ros which would function primarily as intermediates in the antioxidative signalling pathways leading to increased expression of antioxidative enzymes, reduced inflammation, and ameliorated colitis symptoms but would not further damage the colonic tissue [50, 51].. showed that 24 hours after a two-hour hbo2 treatment at 2 bars in rats oxidative stress is not elevated, as evidenced by assessing ferric reducing antioxidant power ability of plasma (frap) and thiobarbituric acid reactive substances (tbars) level. in addition, a recent study also suggests that ros produced by nadph oxidase complex are important mediators inducing anti-inflammatory response in autoimmune diseases. data on the cat mrna level during dss-induced colitis and upon hbo2 treatment were not available prior to this study. we found that cat mrna expression is tissue and treatment specific (figure 4). colitis resulted in a significant downregulation of cat mrna expression in the colonic mucosa, and the hbo2 treatment induced its upregulation in the spleen of dss+hbo2 group of mice. these results were largely in accordance with our finding on enzymatic catalase activity that was decreased in all measured tissues in the dss group and reversed to control values in the spleen of dss+hbo2 group (table 2), as well as with a previous study demonstrating decreased catalase activity in colonic tissue upon dss treatment. this is also in line with a study on skin transplanted balb/c mice where hbo2 treatment increased catalase, gpx, and sod activity in the spleen. furthermore, upregulation of protein and mrna catalase levels 14 days after hbo2 treatment, but not after 7 days, was also observed in the ulcer tissue of patients with diabetic foot, indicating a time-course for the effect of hbo2 to prevail. we found that gpx1 mrna level was upregulated in the colon of dss treated mice, irrespective of the hbo2 treatment, and there were no significant differences in the gpx1 mrna expression in mln and spleen. in contrast to our findings on mrna expression, colon gpx enzyme activity was slightly reduced in dss+hbo2 group compared to other groups, which is consistent with previous results obtained in acetic acid induced colitis in rats receiving combined hbo2 and ozone treatment. however, other reports indicate decreased gpx and sod activity in the inflamed distal colon mucosa and the plasma of rats with acetic acid induced colitis, and hbo2 normalized gpx but not sod activity in the colon. the observed discrepancies in the results may be related to the differences in experimental models used among the studies. in addition, in our study hbo2 treatment induced enhanced gpx and sod activity in the spleen of dss mice which is in contrast to reduced sod1 mrna expression and might be explained by additional sod2 and sod3 function in regulation of antioxidative capacity. although intracellular h2o2 and onoo levels were slightly increased during inflammation and hbo2 treatment in the mln and hbo2 per se increased its level in spleen, impaired lymphocyte function was not observed. intensive research on the beneficial wound healing effects of hbo2 revealed its capacity to induce neovascularization, reduce oedema, decrease leukocyte adhesion, stimulate fibroblast expansion, and inhibit bacterial growth [14, 57]. some of these processes are transcriptionally regulated by hif-1, namely, the vascular endothelial growth factor (vegf) expression, regulatory t lymphocyte differentiation, and preservation of epithelial thigh junction integrity. in addition, previous studies employing conditional deletion of epithelial hif-1 or pharmacologic activation of hif-1 in a murine model of colitis demonstrated a protective role for hif-1 in colitis. it has also been shown that hif-1 increases expression of barrier-protective genes (multidrug resistance gene-1, intestinal trefoil factor, cd73), decreases tnf mrna expression, and enhances antimicrobial activity by transcribing beta-defensin 1. in the present study we found increased expression of hif-1 gene in inflamed colonic tissue, and hif-1 gene expression was changed (upregulated) by the inflammation while hbo2 treatment showed a tendency to reverse this increase. these data suggest involvement of different mechanisms controlling hif-1 gene expression at the site of inflammation (colon) and the peripheral lymphoid organs (mln and spleen), responsible for the initiation of the immune response and the t/b-cell expansion and differentiation, respectively. we also demonstrated a strong positive correlation between hif-1 and gpx1 mrna levels in the colon (figure 4(b)). this is in line with in vitro studies where overexpressed hif-1 in colorectal cancer cells resulted in enhanced gpx1 expression through tgf-ri/smad2/erk1/2/hif-1 signalling cascade, suggesting transcriptional regulation of gpx1 by hif-1. in the present study we found strong negative correlation between hif-1 and sod1 mrna expression this is in accordance with a previous study showing that docosahexaenoic acid downregulates sod1 gene transcription through an hre-mediated mechanism (hre, hypoxia-response element), involving hif signalling in human cancer cells; thus our results indicate similar mechanism involved in sod1 control in the murine colon mucosa in vivo during colitis and hbo2. previous studies revealed that hif-1 mediated transcriptional regulation of different proinflammatory cytokines and growth factor genes are tissue and cell specific and include regulation trough alternative splicing, mrna stability, and interactions with other transcription factors like nf-b [6669]. in our study we found a strong correlation between hif-1 and il-6 mrna levels suggesting involvement of hif-1 in transcriptional regulation of il-6 gene during colonic inflammation and hbo2. in conclusion, our results confirmed that hbo2 exerts an anti-inflammatory effect on dss-induced colitis in mice, and this effect at least involves hif-1 and antioxidative genes expression regulation (as outlined in figure 7). however, further studies are necessary to identify the cells that may contribute to or are influenced by the effects upon hbo2 treatment.

reactive oxygen species (ros) and nitrogen species have an indispensable role in regulating cell signalling pathways, including transcriptional control via hypoxia inducible factor-1 (hif-1). hyperbaric oxygenation treatment (hbo2) increases tissue oxygen content and leads to enhanced ros production. in the present study dss-induced colitis has been employed in balb/c mice as an experimental model of gut mucosa inflammation to investigate the effects of hbo2 on hif-1, antioxidative enzyme, and proinflammatory cytokine genes during the colonic inflammation. here we report that hbo2 significantly reduces severity of dss-induced colitis, as evidenced by the clinical features, histological assessment, impaired immune cell expansion and mobilization, and reversal of il-1, il-2, and il-6 gene expression. gene expression and antioxidative enzyme activity were changed by the hbo2 and the inflammatory microenvironment in the gut mucosa. strong correlation of hif-1 mrna level to gpx1, sod1, and il-6 mrna expression suggests involvement of hif-1 in transcriptional regulation of these genes during colonic inflammation and hbo2. this is further confirmed by a strong correlation of hif-1 with known target genes vegf and pgk1. results demonstrate that hbo2 has an anti-inflammatory effect in dss-induced colitis in mice, and this effect is at least partly dependent on expression of hif-1 and antioxidative genes.

PMC5021505

pubmed-344

sexuality in women is a complex issue with physiological, psychological, and cultural components. determination of sexual partner involvement, intimate relationships, and past abusive relationships is crucial in female sexual dysfunction (fsd) (1, 2). sexual dysfunction is more prevalent among women compared to men (43% vs. 31%) (3-5). in 1960, masters and johnson studied and reported both on healthy sexual function and sexual dysfunction for the first time. they described four phases of the human sexual response cycle, as follows: excitement, plateau, orgasm, and resolution. nowadays, the accepted classification of fsd consists of disturbances in desire, including hypoactive sexual desire disorders (hsdd), sexual aversion disorders, sexual arousal disorders, orgasmic disorders, and sexual pain disorders, including dyspareunia and vaginismus (3, 6-9). fsd can further be classified as primary or secondary and persistent or situational (10). intimate sexual function is one of the best predictors of quality of life, and sexual dysfunction causes many problems for couples. some researchers have found that the frequency of sexual relationship and sexual satisfaction are positively associated with marital satisfaction (11, 12). among other factors, illicit drug dependency changes. moreover, opioids act on a variety of neurotransmitters in the brain, including endorphins. furthermore, morphine has been found to inhibit sexual behavior in a dose-dependent manner through a complex pharmacological domain (13, 14)., most studies on drug abuse and sexual performance have focused on addicted populations, and have usually considered men. although many studies have looked at the frequency of sexual dysfunction in women, limited research has focused on the impact of addiction on spouse sexual function. to the best of our knowledge, few studies have been conducted on the effect of males opium dependency on their wives sexuality. thus, the present cross-sectional study aimed to assess the prevalence of fsd among women with addicted partners. we hypothesized that substance dependency in males would affect their wives sexual function. this cross-sectional controlled study was conducted on 340 women of reproductive age (25-50 years old) selected through convenience sampling. the case group included 160 women whose husbands were opioid dependent. some of them were the wives of opioid-dependent males hospitalized in the addiction treatment units of teaching hospitals affiliated with the shiraz university of medical sciences, shiraz, iran. other women were encountered in centers where opioid-dependent males spouses were referred for group therapies. in contrast, the control group (n=160) included women whose spouses were not opioid dependent; they were selected from the general population referring to the clinics of the shiraz university of medical sciences. after giving informed consent, the participants were interviewed privately according to the dsm-iv-tr criteria by a senior female medical student who was one of the researchers and had been properly trained regarding the nature of the study. the interview focused on hsdd, sexual arousal disorder, orgasmic disorder, and sexual pain disorder. in addition, the subjects demographic information, such as age, level of education, marital status, and duration of marriage, was obtained using a self-constructed questionnaire designed by the authors. to include the women in the study the exclusion criteria of the study were a history of substance use disorders, gynecological disorders (gyn), and chronic medical disease that has been shown to affect sexual functioning (e.g. hypertension, diabetes mellitus, chronic kidney disease, cancer, spinal cord injury, lupus, fibromyalgia, chronic pain and chronic depression). it should be noted that the questionnaires were anonymous and participation in the study was voluntary. the chi-square test was used for categorical data, while the t-test was utilized for continuous data. the protocol for this study was approved by the ethics committee of the shiraz university of medical sciences, shiraz, iran. out of the 340 women who were selected, 5 in the case group and 15 in the control group were excluded due to missing data. the mean ages of the case and the control group were 36.35 and 33.2 years, respectively. in this study, statistical significance was defined as p<0.05. it should be noted that in terms of demographic characteristics, there was no significant difference between the case and the control group (p>0.05), so, we could use further statistical methods on the data. table 2 shows the frequency of sexual dysfunction in the two study groups. according to the results, approximately more than 50% of the participants had problems in at least one domain of sexual function. moreover, the main fsd observed in the case women was hsdd (75.46.9%) followed by sexual aversion disorder (73.46.2%), sexual arousal disorder (65 .40.9%), orgasmic disorder (59.37.1%), and sexual pain disorder (45.28.5%). furthermore, 75 out of the 155 women in the case group (46.9%) and 16 out of the 145 women in the control group (10%) had hsdd, and the difference between the two groups was statistically significant (p<0.05). in addition, 73 women in the case group (46.2%) and 20 in the control group (12.6%) had sexual aversion disorder, with a significant difference between the two groups (p<0.05). in this study, this disorder was a significant problem affecting a considerable number of women in both the case and control groups (table 2). this high prevalence may have resulted from various causes. although studies have shown that many factors, such as age and level of education, affect sexual function (15-17), the findings of the current study revealed no relationship between the demographic characteristics, that is, age, duration of marriage, and level of education, and sexual dysfunction. as can be seen in table 2, the frequency of hsdd and aversive sexual desire disorder was more common in the case group than the control group, and the difference was statistically significant (p<0.05). the high frequency of hsdd among the addicts spouses exhibited in this study was in line with the study performed by noori et al. however, noori et al. included no control groups in their study, and consequently, it was not possible to compare the characteristics of the subjects with those of women whose husbands were not addicted. the findings of the present study showed that the addicts spouses suffered from hsdd significantly more than the control group. another finding was the higher frequency of orgasmic disorder in the case group; however, this difference was not statistically significant. the higher rate of orgasmic disorder among the addicts spouses obtained in this research was in line with the study by noori et al. in contrast to our research, in one study conducted on 2626 women in iran in 2006, 31.5% of the subjects (759) suffered from sexual disorder, and the most prevalent disorder was orgasmic disorder, followed by desire disorder (19). in the dsm-iv-tr, sexual desire disorders are divided into two classes, as follows: 1) hsdd characterized by a deficiency or lack of sexual fantasies and desire for sexual activity and 2) sexual aversion disorder characterized by an aversion to and avoidance of genital contact with a sexual partner. no single cause of hsdd has been defined; however, physiological, psychological, and sociocultural factors that contribute to female sexual desire may all be important in its development (20, 21). master and johnson s linear model of sexual response does not always work for females. some factors, such as emotional intimacy and relationship satisfaction, may change this model. studies have shown that the motivating factors for female sexual desire are very complicated. sexual desire and the presence or absence of orgasm could result from multiple cultural and environmental factors, as well as from interpersonal and intrapersonal distresses, and are greatly affected by emotional intimacy (2). since addiction in the family could be the origin of many stressors and disputes, such stresses and interpersonal turmoil could have a decisive role in decreasing females sexual desire toward their addicted husbands. researchers have found that sexual response phases in women are a combination of mental and physical responses which overlap with one another (2, 3). in general, women have diverse reasons to initiate or agree to have sex with their partners. sexual motivation in females is far more complicated than just the presence or absence of sexual desire and is characterized by thinking or fantasizing about sex and longing to have sex. moreover, the decision to be sexual may originate from a conscious wish for emotional closeness or result from seduction or a suggestion from a partner. addicted couples often have conflicts over money and drugs; so that love gradually flies out of the window, and most often these couples relationships end at a sad, bitter point (11, 22, 23). hence, this kind of relationship is expected to have a negative impact on sexuality. of course, further studies are needed in order for better characterization and understanding of fsd epidemiology. one of the limitations of this study was the difficulty of gaining access to the case group sample and persuading them to cooperate with the researchers. in addition, when they agreed to take part in the study, the interviewer had to meet them out of their group. moreover, the subjects might have answered the questions conservatively due to the particular nature of the study subject, that is, sexual behavior, in iranian culture. another limitation of the study was a lack of control of other contributing factors, such as the economic status of the family and sexual disorders and duration of opioid dependency in addicted husbands, which are assumed to have an effect on their wives sexual dysfunctions .

backgroundopiate abuse in males has significant effects on their sexual functions. in contrast, sexuality in females is a multidimensional issue that can strongly be affected by several factors in their partners. however, only a limited number of studies have assessed the role of males opioid dependency in their female partners sexual function. objectivesthe present study aimed to evaluate the effect of males opioid dependency on their wives sexual function compared to the sexual function of the females whose husbands were not opioid dependent. patients and methodsthis study included 340 women who were selected through convenience sampling and divided into a control (females whose husbands were not opioid dependent) and a case group (women whose husbands were opioid dependent). the data were collected through an interview according to the dsm-iv-r criteria for female sexual dysfunctions by a senior female medical student who was one of the researchers. finally, the data were entered into the spss statistical software (v. 15) and analyzed using the t-test and chi-square test. resultsaccording to the results, the frequency of hypoactive sexual desire disorder and sexual aversion disorder in the control group was significantly higher than that of the case group (p<0.05). conclusionsthe results showed that having an addicted husband could strongly affect some sexual domains in women. it could change the pattern of desire and motivation for sexual contact in females and alter their attitude toward the sexual relationship, thereby causing disturbances in the females normal sexual function.

PMC4870547

pubmed-345

laparoscopic surgery has gained widespread acceptance in a variety of procedures, ranging from gastric fundoplication to cholecystectomy. although laparoscopic appendectomy (la) is more expensive than is open appendectomy (oa) due to the costs of the disposable equipment, and can be more technically challenging in children, the overall cost of the operation has been shown to be similar to that of open appendectomy. the real cost savings of la are due to the shorter postoperative length of hospital stay (los) and the infrequent postoperative complications. the ultimate reduction in postoperative hospital costs to make la most cost-effective would be to perform the procedure as same-day surgery or so-called fast-track surgery. because it has been our observation that many children can be discharged within 24 hours after a laparoscopic appendectomy, we reviewed our records to determine its feasibility. a retrospective chart review was performed on 79 children who underwent a laparoscopic operation for the suspected diagnosis of acute appendicitis over a 3-year period between july 1997 and july 2000. prior to the operation, if the diagnosis of acute appendicitis was unclear, the patients were evaluated with further laboratory and diagnostic testing, which included an abdominal computed tomography scan or ultrasound evaluation, or both of these, in select patients. laboratory information included white blood count and urinalysis, and depending on the circumstances, might also include a beta human chorionic gonadotropin and rapid streptococcal screen, as well as other tests as indicated. all patients underwent the operation while under general anesthesia, and all received a single dose of a broad-spectrum antibiotic preoperatively for wound infection prophylaxis. the standard laparoscopic operative technique was used, with either a 5-mm or 12-mm port introduced at the umbilicus after inducing pneumoperitoneum with carbon dioxide. a 0- or 30-degree laparoscopic telescope was then introduced through this port, and the abdominal and pelvic cavities were directly visualized with the laparoscope to inspect for other possible pathologies. next, two 5-mm ports were introduced under direct vision, one in the suprapubic region or the left lower quadrant and another in the right iliac fossa or in the right upper quadrant. the appendix was identified and grasped by its distal end to fully expose the entire organ and its attached structures. the appendiceal artery was isolated, ligated, and divided or cauterized. at that point, a staple line was fired across the base of the appendix by using an endoscopic stapler, or endoscopic loops were used to isolate the base of the appendix, and it was divided. if the appendix was particularly enlarged or friable, it was removed from the abdomen through the umbilical incision with the use of an endoscopic bag. all ports were removed under direct visualization, and the fascia was reapproximated to prevent future incisional hernia occurrences. if any evidence of localized or generalized peritonitis was visualized during the operation, patients were sent home on oral antibiotics, usually a 5-day course of amoxicillin plus clavulanate. if the appendix was perforated prior to removal, patients were placed on triple antibiotic coverage intravenously, which included ampicillin, gentamicin, and clindamycin for 5 days while in the hospital. if any evidence of abscess formation or peritoneal soilage was noted, the abdominal cavity was vigorously lavaged with normal saline. postoperative analgesia was obtained usually with ketorolac tromethamine and acetaminophen. to be discharged home, patients had to be tolerating oral liquids, be afebrile, and free of nausea and vomiting. seventy-nine children (44 boys and 35 girls) between 2 to 17 years of age (mean, 11 years) underwent la. in 4 (5%) children, all with perforated appendicitis, the la was converted to an open appendectomy, secondary to technical difficulties in completing the operation laparoscopically. at operation, 51 (64.5%) had acute appendicitis, 22 (27.8%) had perforated appendicitis, 4 (5%) had ruptured ovarian cysts, and 2 (2.5%) had no obvious pathology. total los for all 79 patients was a median of 58 hours, and median postoperative los was 35 hours. complications included wound infection, 2 (2.5%); abdominal abscess, 4 (5%); drug rash, 2; and epididymoorchitis, 1. all but one complication (drug rash, 1) occurred in the perforated group. in the 57 (72%) children without perforated appendicitis, the total los was a median of 42 hours, while median postoperative los was only 28 hours. thirty-two (56%) of the children without perforated appendicitis went home in 24 hours following la. no significant morbidity occurred in the nonperforated group (drug rash, 1; fever>24 hrs, 3); and no readmissions or reoperations were necessary on follow-up. although most appendectomies, especially in children, are not done laparoscopically, many studies have shown that laparoscopic appendectomy (la) is at least as good as open appendectomy (oa), with several benefits, including less postoperative pain and shorter lengths of stay (los). the disadvantages of la, which include increased operative time and increased cost of equipment, are easily offset by the decreased postoperative recovery time and the apparent decreased incidence of postoperative complications. additionally, it has been suggested that with increasing operative experience the operative time required for la will decrease significantly. lastly, it has been suggested that even if patients are not discharged from the hospital soon enough after la to make a significant difference between the cost of la versus oa, la has a much shorter recovery time and returns patients to a productive lifestyle sooner, thus justifying la. although most children are not working, the care-givers or parents can return to work sooner, when their child goes back to school. adult series have documented a decreased incidence of postoperative complications and a decreased incidence of wound infection after la., in our series, 2 patients had wound infection and 4 patients developed abscesses, which is a similar complication rate to that in other series. in all instances, these complications arose in the perforated group. although perforation was at first considered a contraindication for la, it has now been utilized successfully in the management of acute appendicitis as well as perforated appendicitis. it has been suggested that thorough lavage of the abdominal cavity after appendectomy can help to decrease the incidence of abscess formation, and this is a practice that we utilize and is facilitated by the use of laparoscopy. certainly, the laparoscopic approach facilitates the complete irrigation of the abdominal cavity and identification of all loculated collections. an additional benefit of laparoscopic surgery is that it leads to greater accuracy of diagnosis, especially in teenage female patients with suspected appendicitis. in cases such as obesity and mental retardation, the diagnosis of appendicitis laparoscopy can be used to delineate the source of abdominal pain when the diagnosis of appendicitis is suspected but not certain. in 4 of our patients with the presumed diagnosis of appendicitis, intraoperative visualization revealed normal appendices, and ruptured ovarian cysts were identified as the source of their pain. obviously, all four patients were female. others have also found an increased preponderance of unclear diagnoses in the female population. in our patients, the appendix was always removed at the time of operation, despite the fact that occasionally (in 4 patients) the gross appearance of the appendix was normal. in the past, it has been unclear whether it would be of any benefit to the patient to remove a healthy organ, but it has been argued that with advances in laparoscopy and its proven benefit, there is no justification for leaving a visually normal appendix in place. additionally, microscopic evidence of early appendicitis is occasionally seen. in our study, it was noted that 2 visually normal appendices were found to have microscopic evidence of appendicitis. outpatient surgery has been widely accepted in a variety of procedures, and many are done laparoscopically. the idea that an appendectomy can be done in the pediatric patient as outpatient surgery is not a new one. in 1993, ramesh and gallard suggested early discharge after open appendectomy, even within 24 hours. in another study, velhote et al also found that most children could be sent home within 24 hours after appendectomy. in that study, the appendectomy was performed through a standard gridiron incision of 2 cm or less. brosseuk and bathe suggested laparoscopic appendectomy as outpatient surgery in 1999, and they advocated early discharge in both perforated and simple appendicitis. the fact that all major complications in our study occurred in perforated cases would argue against these cases being performed as same-day surgery, although others have disputed this approach. in our treatment protocol, perforated appendicitis would not be placed on a fast-track surgery list because these patients usually receive inpatient intravenous antibiotic therapy for 72 hours. we suggest that laparoscopic appendectomy is a safe and effective treatment in the pediatric population, and that in cases of nonperforated appendicitis this may be performed as a fast-track or short-stay procedure. we believe that this not only is more convenient for patients and their families, but it also adds to the overall cost-effectiveness of laparoscopic appendectomy. our findings are based on a retrospective review of our charts over the past 3 years, and this is an obvious criticism of the study. in no instance was it prospectively decided that the child would be discharged within 24 hours. in fact, a small number of children met exclusion criteria due to delays in discharge not related to their medical condition. we made our best attempt to identify when the order was given for the child to be released rather than the actual time that the child left the hospital. however, the documentation was occasionally unclear, and these children were excluded if it could not be ascertained exactly when the order was given or when they left the hospital. we believe that in cases of simple appendicitis, there is no reason not to dismiss a child within 24 hours if the above-mentioned discharge criteria are met. we anticipate that in the future, a greater percentage of our pediatric patients will be discharged within 24 hours, and we feel that in cases of simple appendicitis, laparoscopic appendectomy can be done as fast-track or short-stay surgery. it may be safely performed as fast-track or same-day surgery, in select children without perforated appendicitis, with a postoperative stay of 24 hours in the majority of such patients.

background: laparoscopic surgery has reduced the length of hospital stay for common operations like cholecystectomy, gastric fundoplication, and appendectomy. we have noticed a reduction in length of hospital stay for children undergoing laparoscopic appendectomy. we, therefore, looked at our data to assess whether laparoscopic appendectomy in children could be performed as fast-track or same-day surgery (24-hour postoperative stay). methods: we performed a retrospective review of the records of all children who underwent laparoscopic appendectomy for suspected appendicitis during a 3-year period (7/97 to 7/00). results: laparoscopic appendectomy was performed in 79 children (44 boys and 35 girls), between 2 to 17 years of age (mean, 11 years). in 4 (5%) children with perforated appendicitis, the laparoscopic appendectomy was converted to an open appendectomy. at operation, 51 (64.5%) had acute appendicitis, 22 (27.8%) had perforated appendicitis, 4 (5%) had ruptured ovarian cysts, and 2 (2.5%) had no pathology. the median operative time was 54 minutes. total length of stay for all 79 patients was a median of 58 hours, and median postoperative los was 35 hours. complications included wound infection (2), abdominal abscess (4), drug rash (2), and epididymo-orchitis (1). in 57 (72%) children without perforated appendicitis, the total length of hospital stay was a median of 42 hours, while median postoperative length of stay was only 28 hours. thirty-two (56%) children went home in<24 hours following laparoscopic appendectomy. no significant morbidity was noted in the nonperforated group (drug rash,1; fever>24 hrs, 3); and no readmissions or reoperations were necessary on follow-up. conclusion:laparoscopic appendectomy is safe and effective for treating children with appendicitis. laparoscopic appendectomy may be safely performed as fast-track or same-day surgery, in select children without perforated appendicitis, with a postoperative stay of 24 hours.

PMC3015535

pubmed-346

international diabetic federation estimated that in india there are 66.8 million patients in 2013, with nearly 50% undiagnosed. diabetes was related to one million deaths and mortality was higher under age of 60 years. by 2030 there will more than 79 million diabetics, making it one of the major public health challenge to the country. observed retinopathy in 28.9%, nephropathy in 32.5%, neuropathy in 30.1%, cardio-atherosclerotic diseases in 19.2% and peripheral vascular diseases in 18.1% diabetic patients. the investigators of a1 cheive study observed high prevalence of macrovascular and microvascular complications among the indian diabetic patients. different studies conducted in countries like united states have observed the positive association of patient's knowledge regarding the disease and self care to the treatment compliance. hence, this study was planned to assess knowledge about diabetes and its correlation with pharmacological and non-pharmacological compliance, among the diabetics attending a rural health center from sangli district, maharashtra (india). this was a cross-sectional study conducted in a rural health center attached to a medical college from sangli district of maharashtra, india. the study population was adult type-2 diabetes patients on oral hypoglycemic drugs for at least 6 months attending the rural health centre. the patients attending for routine check up or drug re-prescription and consenting to participate were included in the study. minors, patients on insulin, hospitalized patients, patients who had undertook any sensitization program other than routine counseling by physician and those who can not read in the local language were excluded from the study. prevalence of knowledge regarding diabetes in the pilot study was 52.71%; considering level of significance as 5% and error 15%; study instrument was a pretested, prevalidated, self-administered questionnaire with good test-retest reliability (spearman correlation coefficient, r=0.81) and internal consistency (cronbach's, r=0.78). it was developed in marathi language with the help of subject experts and published literature and finalized after the pilot study. it consists of initial section with general information of patient like age, gender etc., the occupations reported by patients were classified as sedentary work, moderate work and heavy work. the second section consisted of questions regarding knowledge of patients about diabetes and its complications and the answers were scored. those scoring under 50%, 5075% and more than 75% were considered to be having poor, moderate and good knowledge, respectively. pharmacological compliance was self-reported, with participants reporting to have missed more than two doses in last 15 days were considered as non-compliant. due to lack of exact definition of compliance to the non-pharmacological management, a scale was developed with equal importance to diet modifications and physical exercises. the maximum possible score was 12 and the participants scoring above 9 (75%) were considered as compliant to non-pharmacological management. mean, standard deviation, percentage, chi-square and binary logistic regression were applied. data from the pilot study and incomplete questionnaires were not included in the final analysis. out of 329 questionnaires collected, 307 were complete and hence used in the final analysis. two hundred twenty-three (72.6%) participants were male while 84 (27.4%) were female [table 1]. the mean age of study participants was 55.6 years (range 3585 years and standard deviation 12.22 years). two hundred ninety-two (95.1%) participants were married. while considering the educational status, 106 (34.5%) had studied up to secondary school and 201 (65.5%) had attended college. among the participants: 208 (67.8%), 56 (18.2%) and 43 (14%) were sedentary, moderate and heavy workers, respectively. the mean morbidity with diabetes was 10.7 years (range: 1 to 44 years and; standard deviation: 10.02 years). age group and gender distribution of the participants the pharmacological compliance was reported by 234 (76.2%) participants. the mean score for the non-pharmacological compliance was 8.35 (standard deviation: 2.8). based on preset criteria of score, 156 (50.8%) participants were considered to compliant to the non-pharmacological management. the mean score for knowledge regarding diabetes was 14.82 (standard deviation: 3.5). only 29 (9.4%) participants had good knowledge, whereas 219 (71.3%) had moderate and 59 (19.2%) participants had poor knowledge. age was not associated with the knowledge (chi-square 5.47, p=0.49), however, higher percentage of older age group (75 yrs) participants had poor knowledge. gender was associated with knowledge (chi-square 10.78, p=0.005); higher percentage of male participants (81.6%) had moderate to good knowledge as compared to females (78.6%). marital status and occupation education was not associated with the knowledge (chi-square 2.23, p=0.33), however higher percentage of participants who had attended college had moderate to good knowledge. pharmacological compliance was associated with knowledge. among the participants with good compliance, 88.5% had moderate to good knowledge as compared to only 56.2% participants with poor compliance. the moderate to good knowledge was present in 87.8% participants with good compliance as compared to only 73.5% with poor compliance [table 2]. association between knowledge regarding diabetes with pharmacological compliance and non-pharmacological management compliance binary logistic regression was applied with knowledge regarding diabetes as dependent variable, while age, gender, education, occupation, pharmacological compliance and non-pharmacological management compliance as independent variables. the chance accuracy rate for the model is 83.6%, which was greater than calculated chance accuracy rate (67.3%). pharmacological and non-pharmacological management compliance were the highly significant predictors, while education and age were also significant predictors for knowledge regarding diabetes [table 3]. binary logistic regression model-association of age, gender, education occupation, pharmacological compliance and non-pharmacological management compliance with knowledge regarding to diabetes in the current study, we observed that the patients compliant with pharmacological and non-pharmacological management had good knowledge regarding diabetes. al-qazaz hkh et al., (2010), observed significant correlations between the knowledge about diabetes and adherence to the treatment in subjects from penang. when carried out a study at al-makhfia governmental diabetes primary healthcare clinic in nablus, palestine in 2012, observed that diabetic patients with high knowledge were less likely to be non-adherent. chaudhary et al., from multan (pakistan) in 2010, observed that male gender, higher education and older age (> 40 years) were associated with the knowledge regarding diabetes mellitus. however, age groups used by them were only two:<40 years and>40 years, while in the current study four age groups were considered with lowest being 3550 years. abdella and mohammad studied awareness of diabetic patients about their illness and associated complications in ethiopia (2012); majority of patients (67%) had good knowledge on actions to be taken on the occurrence of acute complications and reasons for developing acute complications. while we observed that less than 10% participants had good knowledge. however, there is difference in the questionnaire used in both the studies and most of the participants from abdella study had undergone sensitization unlike the current study subjects. (bangladesh) 2013, observed that 19% respondents had poor knowledge, while 68% had average and 13% had good knowledge. they also deduced that male gender and higher educated people are likely to have better knowledge regarding diabetes. conducted a study on adults in tamaka village, kolar (india) in 2009. observed that male gender, higher education and younger age of respondents was significantly associated with level of knowledge, while type of occupation is not associated with it. bansal et al. observed compliance to medication in 82.5% patients from rural area of ludhiana district, india. rao et al. observed that 83.6% patients from southern karnataka were on regular medication. santhanakrishnan et al. observed compliance to oral hypoglycemic agents in 76% subjects, dietary modifications in 81.4% and physical activity in 37% subjects from puducherry, india. while in the current study, pharmacological compliance was reported by 76.2% participants and compliance to the non-pharmacological management was reported by 50.8% participants. being a self-administered questionnaire reporting bias can not be totally eliminated; there may be over-estimation of compliance. confounders like economical state, availability of medications, counseling by health professionals, exposure to information through media, additional use of ayurvedic/homeopathic/other indigenous systems of medicines etc., may be present and are not considered in the current study. only self-reported compliance was considered without confirming.. however, many of the patients have poor knowledge regarding the disease, the situation is worse among the females. lower level of literacy and old age hinder the presence of knowledge regarding the diabetes. seminars, counseling sessions and workshop should be arranged periodically for diabetic patients to increase their awareness regarding diabetes disease in total per say.

introduction: diabetes is an important public health problem of india. studies have shown that increase in patients knowledge regarding the disease results in better compliance to treatment and decrease in complications. this study was planned to assess the knowledge about diabetes and its correlation with pharmacological and non-pharmacological compliance, among the diabetic patients attending rural health center from sangli district, maharashtra (india). materials and methods: the study was conducted during september to november 2014. the study subjects were all willing adult patients with type ii diabetes mellitus attending a selected rural hospital. the study tool was pretested and self-administered questionnaire. analysis was done using microsoft excel and spss-22. results:total study participants were 307 in number, with the mean age of 55.6 years. the mean morbidity with diabetes was 10.7 years. only 23.8% had good knowledge regarding diabetes, while 19.2% participants had poor knowledge. knowledge was significantly associated with the compliance to the pharmacological and non-pharmacological management. conclusion:although most of the patients were suffering with diabetes for many years there is lack of knowledge regarding the disease and self care. the compliance to the management of diabetes was better in patients with good knowledge. seminars, counseling sessions and workshop should be arranged periodically for diabetic patients to increase their awareness.

PMC4535111

pubmed-347

lactic acid was first found and described in sour milk by the swedish chemist karl wilhelm scheele (17421786) in 1780. the swedish chemist jns jakob berzelius (17791848) found lactic acid in fluid extracted from meat in 1808 [2, 3], and the german chemist justus von liebig (18031873), who established the world's first school of chemistry at giessen, proved that lactic acid was always present in muscular tissue of dead organisms. in 1859, emil heinrich du bois-reymond (18181896) published several articles on the influence of lactic acid on muscle contraction [59]. araki and zillessen found that if they interrupted oxygen supply to muscles in mammals and birds, lactic acid was formed and increased [1014]. this was the first demonstration of the relationship between tissue hypoxia and the formation of lactate. the occurrence of increased lactic acid in blood (hyperlactataemia) nowadays reflects severe illness, in which the increased blood lactate levels may result from both anaerobic and aerobic production or from a decreased clearance. it was the german physician chemist johann joseph scherer who first demonstrated the occurrence of lactic acid in human blood under pathological conditions after death in 1843 and 1851 [15, 17], and carl folwarczny in 1858 who first demonstrated lactic acid in blood of a living patient. in this article we wish to honour scherer's forgotten observations and describe the influence of his finding on further research on lactic acid at the end of the 19th century. born on 18 march 1814 in aschaffenburg, germany, scherer studied medicine, chemistry, geology and mineralogy at the university of wrzburg between 1833 and 1836. he obtained his phd in medicine and surgery in 1838 with a thesis entitled versuche ber die wirkung einiger gifte auf verscheidene thierclassen he practised medicine in wipfeld, but inspired by the chemist ernst von bibra (18061878) he completed his studies in chemistry at the university of munich between 18381840. in 1840 he was employed at the laboratory of justus liebig at giessen, and became professor at the medical faculty in 1842, professor of organic chemistry in 1847, and later professor of general, anorganic and pharmaceutical chemistry. his work especially concerned quantitative research on blood and urine in pathological conditions. in 1843 he published his book chemische und mikroskopische untersuchungen zur pathologie angestellt an den kliniken des julius-hospitales zu wrzburg (chemical and microscopic investigations of pathology carried out at the julius clinic at wrzburg) (fig. 1), in which he described 72 case reports, giving details on clinical course, diagnosis, and results obtained during autopsy and analysis of body fluids. in one chapter in his 1843 book entitled ' untersuchungen von krankhaften stoffen bei der i m winter 18421843 in wrzburg und der umgegend herrschenden puerperal-fieber-epidemie ' (investigations of pathological substances obtained during the epidemic of puerperal fever which occurred in the winter of 18421843 in and around wrzburg) scherer described the cases of seven young women who all died peripartum. one of the women, the 23-year-old primipara eva rumpel, gave birth to a healthy child on 9 january 1843. the same night she developed a painfully swollen abdomen and became ill, feverish, and sweaty, with rapid pulse and severe thirst. the next evening she deteriorated, became delirious, with anxious breathing, a tense abdomen, cold extremities and rapid pulse, finally losing consciousness. a.m., 36 h after the onset of the first symptoms, she died. during autopsy, severe purulent endometritis, vaginal pus, pulmonary oedema, and shock liver and shock spleen were found. the blood that was obtained directly from the heart was chemically analysed, in which lactic acid was found. most likely this unfortunate woman had died from a fulminant septic shock caused by group a haemolytic streptococci (streptococcus pyogenes). another patient, the 28-year-old, 7 months pregnant (second pregnancy) margaretha glck, was, after being icteric, nauseous, vomiting and complaining about epigastric pain for 8 days, admitted to the lying-in birth clinic on 6 february 1843. four days later she was transferred to the hospital with severe nosebleeds and generalised exanthema or purpura. in the evening she suffered from severe gastric bleeding and epistaxis, showing rapid pulse, cold extremities and dizziness. the next morning, she was transferred back to the birth clinic, where she gave birth to a premature child (30 weeks) and suffered from a severe post-partum fluxus. she was again transferred to the hospital with the following symptoms: cold clammy skin, tachycardia, severe lochia and persistent exanthema or purpura, but without signs of an acute abdomen. during the night of february 11 autopsy revealed a small intracerebral haematoma, normal lungs without pulmonary oedema, ascites and an anaemic, foul smelling uterus filled with purulent and decayed tissue and pus. blood was also obtained directly from the heart during autopsy and lactic acid was found. in this case we could think of a haemorrhagic shock and cerebral haemorrhage due to clotting disorders possibly resulting from either acute fatty liver of pregnancy/hellp syndrome, idiopathic thrombocytopenic purpura, thrombotic microangiopathy (ttp/hus) or dic. in the conclusions of his 1843 book, scherer attached high importance to the fact that he found lactic acid in cases of puerperal fever, which he had not found before in healthy persons. he held the opinion that lactic acid was formed in blood during bodily deterioration in severe diseases like puerperal fever. lactic acid was thus described for the first time in human blood and was demonstrated for the first time as a symptom of septic and haemorrhagic shock. in the same period a junior obstetrician in vienna, ignaz philipp semmelweis (18181865), discovered in 1847 that physicians carried infectious particles on their hands from the mortuary to the obstetrical clinic, causing puerperal fever and puerperal sepsis, and he introduced a successful method for its prevention. louis pasteur (18221894) found in 1879 that infection with streptococci was the most important cause of puerperal fever. scherer worked closely with the famous pathologist rudolf virchow (18211902) on several projects (fig. 2). in 1851 virchow performed an autopsy on a patient who had died from leukaemia and offered scherer blood from this patient for analysis. the results of this analysis were published the same year in the verhandlungen der physikalisch-medicinischen gesellschaft in wrzburg. virchow and scherer had previously studied the spleens of patients who died from leukaemia, and were curious if they could find the same results in the blood. scherer reached the conclusion that: the blood of this patient contains: ameisensure, essigsure und milchsure, die gleichfalls von mir schon frher als in der milzflssigkeit vorkommend bezeichnet wurden (formic acid, acetic acid, and lactic acid, as also found by me previously in fluids from the spleen). 2johann joseph scherer (left) and rudolf virchow (right) in 1849 johann joseph scherer (left) and rudolf virchow (right) in 1849 scherer's observations inspired others to conduct further research, primarily in patients with leukaemia [1922], but also in patients with other conditions and diseases and in animal experiments with dogs and rabbits. while scherer found lactic acid in blood obtained after death during autopsy, mosler and krner mention an observation made by carl folwarczny, published in the allgemeinen wiener medicinischen zeitung in 1858, where blood was withdrawn from a leukaemia patient during life, analysed according to scherer's method, and found positive for lactic acid. in addition, carl folwarczny described in 1863 in his ' handbuch der physiologischen chemie ' that lactic acid can be found in the blood of patients with leukaemia, septicaemia (pyaemia) and in conditions leading to septicaemia like puerperal fever, the latter probably after scherer's observations. in an extensive article, the berliner physician georg salomon, who had serious doubts that the occurrence of lactic acid in blood was mostly related to leukaemia, proved in 1878 that lactic acid was also present in the blood of patients who were suffering and died from other diseases. he studied blood obtained during autopsy from cadavers, but also blood from patients obtained by bloodletting or cupping, and in some cases he compared the blood before and after death. he was able to demonstrate lactic acid in the blood of patients suffering from leukaemia, (pernicious) anaemia, congestive heart failure, chronic obstructive pulmonary disease, pleuritis, pericarditis, pneumonia and several solid malignant tumours. gaglio is often erroneously mentioned as the first author to find lactic acid in blood [2729]. he was able to demonstrate lactic acid in fresh arterial blood withdrawn from dogs and rabbits after bloodletting. both gaglio and berlinerblau, however, neglected previous research, as indignantly described by salomon in 1888 [ich erlaube mir, den inhalt meiner arbeiten, die von gaglio nur ganz flchtig, von berlinerblau gar nicht berhrt sind, in krze zu reproduciren (i take the liberty of summarizing the contents of my work, which was mentioned only briefly by gaglio and not at all by berlinerblau)]. the japanese chemist trasaburo araki showed that the amount of lactic acid in exhausted muscle results from muscle activation. irisawa, inspired by the results obtained by salomon and gaglio, obtained fresh blood of 11 dying patients with serious conditions. in six cases he found hyperlactataemia, in four cases normal values. he speculated on the aetiology of hyperlactataemia, the most plausible cause being the severe hypoxia during the dying process. in an experiment in which he made a dog anaemic for several days, he found a rise in lactic acid levels during the time leading up to death. in cambridge (uk), walter morley fletcher (18731933) and frederick gowland hopkins (18611947) worked together on the metabolic changes occurring in muscular contractions and rigor mortis under anaerobic conditions, and found that lactate was the product of carbohydrate metabolism. their classic 1907 paper demonstrated rigorously that muscle contraction is accompanied by the anaerobic formation of lactic acid, which is removed aerobically, at a rate depending on the level of exposure to oxygen. poul astrup and john severingshaus mentioned scherer's 1851 article as first demonstration of lactic acid in blood, but overlooked the 1843 cases and folwarczny's work. in conclusion, scherer's 1843 case reports should be cited as the first description of lactic acid in human blood and also as the first demonstration of lactic acid as a pathological finding in septic and haemorrhagic shock. folwarczny, in 1858, was the first to demonstrate lactic acid in blood in a living patient.

lactic acid was first found and described in sour milk by karl wilhelm scheele (17421786) in 1780. the german physician chemist johann joseph scherer (18411869) demonstrated the occurrence of lactic acid in human blood under pathological conditions in 1843 and 1851. in this article we honour the forgotten observations by scherer and describe the influence of scherer's finding on further research on lactic acid at the end of the 19th century. we conclude that scherer's 1843 case reports should be cited as the first description of lactic acid in human blood after death and also as the first demonstration of lactic acid as a pathological finding in septic and haemorrhagic shock. carl folwarczny was, in 1858, the first to demonstrate lactic acid in blood in a living patient.

PMC2040486

pubmed-348

panax ginseng (ginseng) has been used traditionally in eastern asia over thousands of years. it has been used orally to treat various diseases including hypertension, diabetes mellitus, liver and kidney dysfunction, mental disorders, and postmenopausal disorders. in addition, topical applications have also been used to heal wounds and reduce skin inflammation. in the past few decades, it has been proved that ginseng extracts actually show a wide range of effects against human diseases. their potential therapeutic effects have been mainly attributed to its immunomodulatory, neuroprotective, antioxidative, antitumor, and hepatoprotective activities. ginseng contains a number of active ingredients including ginsenosides, polysaccharides, phytosterols, peptides, polyacetylenes, fatty acids, and polyacetylenic alcohols, which have different effects on carbohydrate and lipid metabolism, cognition, angiogenesis, and the neuroendocrine, immune, cardiovascular, and central nervous systems. among the active constituents of ginseng, ginsenosides are known to be the major biologically active components of ginseng and the most widely studied. several studies have shown that ginsenosides play important roles in the pharmacological effects of ginseng.. however, ginseng contains other constituents, including ginsenoyne, phenolic compounds, polyacetylenes, sesquiterpenes, methoxypyrazine, alkylpyrazine derivatives, sesquiterpene alcohols, panasinsanols, and -carboline. white ginseng is peeled, dried, ginseng root and red ginseng is produced by steaming fresh ginseng root at 98100c for 23 h, and then drying until the moisture content is<15%. red and white ginseng have both been shown to have immunomodulatory, anti-inflammatory, antioxidant, and antiatopic activities. moreover, red ginseng has been reported to have more potent pharmacological activities than white ginseng in some respects [2022]. the differences in biological activities between red and white ginseng are caused by the chemical changes of ginsenosides after the steaming process. steaming partially converts the original ginsenosides to deglycoslated derivatives. as a result, the species and amounts of ginsenosides are quite different based on the processing method used. chu et al showed that a total of 53 and 43 compounds were tentatively identified in white ginseng and red ginseng samples, respectively. the featured compounds are mainly malonyl ginsenosides in white ginseng, and decarboxyl products of mal-ginsenosides and the dehydrated compounds from polar ginsenosides were characteristic in red ginseng. it is interesting that ginsenosides show a wide variety of biological activities, although the absorption rates from orally administered intact ginsenosides are very low. in the human intestinal tract, thus, the pharmacological actions of these ginsenosides have been closely related to their biotransformation by human intestinal bacteria. in this context several studies showed that the transformation of ginsenosides into deglycosylated ginsenosides is needed to increase ginseng's effectiveness in vivo. abnormal changes in skin color induce significant cosmetic problems with a negative effect on quality of life. there are two groups of pigmentary disorders: disorders of the quantitative and qualitative distribution of normal pigment and the abnormal presence of exogenous or endogenous pigments in the skin. hyperpigmentation-related diseases include melasma, lentigines, nevus, ephelis, freckles, postinflammatory hyperpigmentation, and age spots. postinflammatory hyperpigmentation appears in many skin conditions, including acne, eczema, and contact dermatitis. skin color is determined by various factors including melanin content, oxygenation state of hemoglobin in capillary vessels, carotenoid content, water content, and organization of collagen fibers in the dermis. among these factors, melanin is the major determinant of skin color. in this context, melanogenesis is a biochemical pathway responsible for melanin synthesis that is controlled by complex regulatory mechanisms. melanogenesis occurs in melanocytes confined in separate cytoplasmic organelles called melanosomes, which contain key enzymes of melanogenesis. differences in skin color are related to the size, number, shape, and distribution of melanosomes, whereas melanocyte density typically remains relatively constant. although tyrosinase is the key regulatory enzyme of melanogenesis, tyrosinase-related protein (trp)-1, dopachrome tautomerase (dct/trp2), and melanosomal matrix proteins (pmel17, mart-1) carry out important roles in regulating melanogenesis. the genes of tyrosinase, trp-1, and dct contain common transcription starting sites, the microphthalmia-associated transcription factor (mitf) binding sites. the intracellular signal transduction pathways of protein kinase c, cyclic amp (camp), and nitrogen oxide are involved in the regulation of melanogenesis. various endogenous and exogenous factors, such as estrogen and ultraviolet (uv) radiation, affect melanogenesis via signal transduction pathways. these endogenous/exogenous factors exert their actions directly on melanocytes or indirectly via surrounding skin cells. melanocytes, keratinocytes, dermal fibroblasts, and other skin cells communicate with each other by factors that are secreted and cell cell contacts. it has been shown that the interactions between keratinocytes and melanocytes are critical in the regulation of melanogenesis. in addition, dermal factors have been found to be involved in the regulation of melanogenesis. at the same time, stimulated melanocytes secret a number of signal molecules targeting not only keratinocytes but also skin immune cells. soluble factors released by melanocytes include proinflammatory cytokines and chemokines such as interleukin (il)-1/1, il-6, il-8 il-10, tumor necrosis factor (tnf)-, transforming growth factor (tgf)-, catecholamines, eicosanoids, serotonin, -melanocyte stimulating factor (-msh), and nitric oxide (no). a variety of hypopigmenting agents including hydroquinone, arbutin, tretinoin, kojic acid, azelaic acid, vitamin c, n-acetylglucosamine, niacinamide, linoleic acid, ellagic acid, methimazole, dioic acid, soy extract, licorice extract, rucinol, and glycolic acid have been used alone or in combination to treat abnormal hyperpigmentation. these agents can interfere with the pigmentation process at several different steps of skin pigmentation. however, the treatment of hyperpigmented conditions still remains challenging and the results are often discouraging. thus there is a need for novel skin-whitening agents that are highly effective and tolerable. in this article, we review recent reports investigating the skin-whitening effect of ginseng and its components and the underlying mechanisms of action, and then discuss their potential as candidates for novel skin-whitening agents. p. ginseng is one of the most widely used medicinal plants in traditional oriental medicine. over thousands of years, it has been used to improve the overall condition of skin, as well as to treat a wide variety of diseases. however, genuine scientific approaches to clarify the efficacy of ginseng in skin have only been made in recent years. several reports have shown that ginseng extract, powder, or some other constituents could inhibit melanogenesis in vitro and in vivo. table 1 summarizes the direct effects of ginseng and its components on skin color and key enzymes involved in melanogenesis. song et al reported that red ginseng powder improved melasma in a human clinical trial. they orally administered korean red ginseng powder for 24 weeks to female patients with melasma. after 24 weeks, the melasma area and severity index score decreased and melasma quality of life scale showed improvement in 91% of patients. in addition, 74% of the patients showed some improvement on the patient- and investigator-rated global improvement scales. most of reports investigating the antimelanogenic effect of ginseng were conducted in vitro used purified tyrosinase or melanocyte cell lines. in melan-a cells treated with ethanol extract of ginseng seeds, melanin content and in addition to the crude extract or powder, several studies tested the effects of specific constituents of ginseng. the phenol compounds inhibited tyrosinase activity while ginsenoside prevents uvb-induced intracellular increase of reactive oxygen species [4648]. in some reports, ginsenosides alone exerted antimelanogenic effects. aglycone of ginsenoside rh4 inhibited melanin synthesis in b16 melanoma cells, possibly by involvement of protein kinase a pathway. it significantly reduced melanin content and tyrosinase activity in -msh and forskolin-stimulated b16 melanoma cells. it reduced the camp level and camp response-element binding protein level in b16 melanoma cells, and this might be responsible for the downregulation of mitf and tyrosinase. in addition, ginsenoside rb1 inhibited melanogenesis through the inhibition of tyrosinase activity in -msh-stimulated b16 cells in a dose-dependent manner. the crude methanol extract of the fresh leaves of p. ginseng showed inhibitory activity on mushroom tyrosinase, and p-coumaric acid was characterized as the principal tyrosinase inhibitor in the extract. p-coumaric acid inhibited melanogenesis in b16f10 melanoma cells stimulated by -msh, and was suggested to interfere with melanogenesis by its structural similarity with tyrosine. interestingly, p-coumaric acid showed weaker inhibition against mushroom tyrosinase but more strongly inhibited human or murine tyrosinase in comparison with kojic acid and arbutin. enzyme kinetics analysis indicate that p-coumaric acid is a mixed type (for tyrosine) or competitive inhibitor (for dopa) of human tyrosinase. in addition, p-coumaric acid potently inhibits melanogenesis in human epidermal melanocytes exposed to uvb. cinnamic acid, one of the major components of cinnamomum cassia blume, is found in the root and seed of p. ginseng. cinnamic acid significantly reduced melanin production, tyrosinase activity, and tyrosinase expression in the melan-a cells. in addition, cinnamic acid showed depigmenting activity on the uvb-tanned skin of brown guinea pigs. it is already known that the pharmacological actions of these ginsenosides have been closely related to their biotransformation by human intestinal bacteria. although the contents of total ginsenosides in red ginseng and fermented red ginseng using lactobacillus brevis were not significantly different, the ginsenoside metabolite content was higher in fermented red ginseng compared to red ginseng. the tyrosinase inhibitory activity of fermented red ginseng extract was more potent compared with red ginseng extract in a test using mushroom tyrosinase. as reviewed above, crude extract or some components of ginseng and its components showed antimelanogenic activities by direct inhibition on key enzymes of melanogenesis, such as tyrosinase. moreover, ginseng and its components could exert antimelanogenic activity via action on the several factors related in melanocyte physiology. among a large number of soluble factors produced from melanocytes, keratinocytes, fibroblasts, and immune cells in skin, adrenocorticotropic hormone (acth), -msh, endothelin-1, prostaglandin e2, prostaglandin f2, no, and histamine are well-known stimulators of melanogenesis [37,5963]. il-1/1 and granulocyte-macrophage colony-stimulating factor (gm-csf) stimulate melanogenesis, while il-6, tgf-1, and tnf- downregulate melanin production. gm-csf has been reported to be involved in regulating the proliferation and differentiation of epidermal melanocytes. treatment of melan-a cells with conditioned media from uv-irradiated sp-1 keratinocytes increased melanocyte proliferation, and the proliferative effect of the conditioned media was blocked by anti-gm-csf antibody treatment. when uv-irradiated sp-1 keratinocytes were treated with red ginseng extract or saponin of red ginseng, the increased melanocyte proliferation by the conditioned media was blocked. in that report, red ginseng extract or saponin of red ginseng treatment decreased the expression of gm-csf induced by uv-b irradiation in sp-1 keratinocytes. as mentioned above, inflammatory cytokines such as il-1 and tnf- take part in the regulation of melanogenesis. ginseng extracts and ginsenosides have been reported to have anti-inflammatory activities in several different studies. ginsenosides inhibit different inducer-activated signaling protein kinases and transcription factor nuclear factor (nf)-b, and then decrease the production of proinflammatory cytokines and mediators of inflammation. korean red ginseng extracts decreased tnf- and il-8 production in lipopolysaccharide (lps)-stimulated hacat keratinocytes and show radical scavenging and antioxidant activity in human dermal fibroblasts. these findings suggest that ginseng extracts and ginsenosides might affect melanogenesis through their anti-inflammatory activities. the effect of ginseng on no production is still questionable. sun ginseng, a new processed ginseng prepared by steaming at high temperature, reduced uv-b-induced cell damage and decreased no production by inhibition of inducible no synthase mrna synthesis in hacat keratinocytes and human dermal fibroblasts. red ginseng marc oil inhibited inducible no synthase and cyclooxygenase-2 via nf-b and p38 pathways in lps-stimulated raw264.7 cells. in addition, ginsenjilinol, a protopanaxatriol-type saponin obtained from the roots of p. ginseng, shows inhibitory activity on no production in lps-stimulated raw264.7 cells. by contrast, there are some controversial reports that ginseng extract enhanced no production or no signaling. hong et al reported that ginseng extract administration stimulated nongenomic endothelial no synthase activation and enhanced no production in spontaneously hypertensive rats. in another report, water extract of korean red ginseng exerted vasoprotective effects through augmentation of no production by inhibiting arginase. therefore, the effect of ginseng on melanogenesis via no signaling remains to be clarified by further study. considerable numbers of immune cells including langerhans cells, macrophages, mast cells, and t cells are working actively in skin tissue. because the immunostimulatory activities of many ginsenosides are known, it is not surprising that ginsenosides could enhance the reactivity of skin immune cells. in a recent paper, a cream containing 0.1% ginsenoside f1 (a metabolite of ginsenoside rg1) showed a significant whitening effect on artificially tanned human skin. however, ginsenoside f1 did not directly inhibit mrna expression of tyrosinase or dct in normal human epidermal melanocytes. instead, ginsenoside f1 enhanced production of il-13 from human epidermal t cells, and il-13 significantly reduced the mrna expression and protein amount of both tyrosinase and dct resulting in visible brightening of normal human epidermal melanocyte pellets. these results suggest that ginsenosides might be able to regulate melanogenesis via their effect on skin immune cells. recently, several reports have shown that extract, powder, or some constituents of ginseng could inhibit melanogenesis in vivo or in vitro. the underlying mechanisms of the antimelanogenic effect of ginseng or its components included the direct inhibition of key enzymes of melanogenesis (tyrosinase and dct), inhibition of transcription factors (mitf, nf-b) or signaling pathways (protein kinase a pathway and protein kinase c pathway) involved in melanogenesis, decreasing the production of inducers of melanogenesis (camp, gm-csf), and enhancing production of antimelanogenic factor (il-13). fig. although issues surrounding the antimelanogenic activity of ginseng still remain controversial, especially in its effect on the production of proinflammatory cytokines and no, these recent findings suggest that ginseng and its constituents might be potential candidates for novel skin-whitening agents.

abnormal changes in skin color induce significant cosmetic problems and affect quality of life. there are two groups of abnormal change in skin color; hyperpigmentation and hypopigmentation. hyperpigmentation, darkening skin color by excessive pigmentation, is a major concern for asian people with yellow brown skin. a variety of hypopigmenting agents have been used, but treating the hyperpigmented condition is still challenging and the results are often discouraging. panax ginseng has been used traditionally in eastern asia to treat various diseases, due to its immunomodulatory, neuroprotective, antioxidative, and antitumor activities. recently, several reports have shown that extract, powder, or some constituents of ginseng could inhibit melanogenesis in vivo or in vitro. the underlying mechanisms of antimelanogenic properties in ginseng or its components include the direct inhibition of key enzymes of melanogenesis, inhibition of transcription factors or signaling pathways involved in melanogenesis, decreasing production of inducers of melanogenesis, and enhancing production of antimelanogenic factor. although there still remain some controversial issues surrounding the antimelanogenic activity of ginseng, especially in its effect on production of proinflammatory cytokines and nitric oxide, these recent findings suggest that ginseng and its constituents might be potential candidates for novel skin whitening agents.

PMC4268563

pubmed-349

chronic kidney disease (ckd) is associated with a number of comorbidities and prognosis is poor, because many patients experience progression to end-stage renal disease. also, in the majority of patients disease progression may be altered due to more or less suitable immunosuppressive protocol treatments and therapeutic approaches. the mechanisms of injury underlying progression are blurred, but traditional opinion pointed to an association between decline in renal function with the degree of proteinuria and histological findings of glomerulosclerosis and interstitial fibrosis [2, 3]. kidney injury molecule-1 (kim-1) is a new specific biomarker of proximal tubule injury that can be measured both in urine and kidney tissue samples. it is an apoptotic-cell phagocytosis and scavenger receptor that is most highly upregulated in proximal tubular epithelium in acute and chronic kidney injury. also, much attention has been paid to its possible pathophysiological role in modulation of tubular damage and repair [57]. besides a close relationship between tissue kim-1 expression and urinary kim-1 concentration, our previous six-month prospective pilot study showed that kim-1 expression in tissue correlated better with tin features and renal function in different chronic kidney diseases than with urinary kim-1 concentration. therefore, that investigation was the basis of this long-term retrospective study, where only kim-1 tissue expression as a predictor of long-term kidney function was examined. the aim of this retrospective investigation was to evaluate (1) possible associations between tissue kim-1 expression and tubulointerstitial (tin) inflammation, atrophy, and fibrosis in different chronic kidney diseases and (2) possible associations between tissue kim-1 expression and some demographic and laboratory parameters as well as kidney function and proteinuria at the time of biopsy and 6, 12, 24, and 36 months later. the retrospective study included 60 patients (27 men) of mean age 34.42 12.15 years (range 1859 years), who were hospitalized in the clinical center of serbia for kidney biopsy from 2006 to 2009. indications for kidney biopsy were nephrotic syndrome, pathologic proteinuria without nephrotic syndrome, and abnormal urinary sediment (erythrocyturia and leukocyturia) in several samples. pathohistological analysis revealed minimal change glomerulonephritis (mcgn) in two patients, non-iga gn in nine, iga gn in six, membranous and membranoproliferative gn in seven patients each, focal glomerulosclerosis in eleven, lupus nephritis in ten, and crescentic gn in eight patients. after diagnosis, the participants were treated according to established protocols for each type of gn with immunological and nonimmunological therapy (nonsalt diets, statins, angiotensin-converting-enzyme-ace inhibitors, and angiotensin receptor type 1 blockers atb). the institutional review committee approved our study protocol therebys following local biomedical research regulations (irb no. a complete blood count; serum urea and creatinine, albumin; lipid status, and urine sediment were determined in blood and urine samples collected 1 day before kidney biopsy as well proteinuria/day. only samples with a sterile urine culture were processed. urine sediments with more than 3 rbc/hpf or 5 wbc/hpf were defined as clinically significant erythrocyturia or leukocyturia. estimated glomerular filtration rate (egfr) was calculated with a shortened version of the modification of diet in renal disease (mdrd; patients 18 years). alteration in tin were assessed after routine hematoxylin-eosin staining by a qualified nephropathologist who was not familiar with the preset histopathologic or clinical diagnosis, nor the identity of patients. inflammation activity was then scored numerically (0: no inflammation, 1: slightly marked inflammation, 2: moderate inflammation, and 3: strong inflammation) as well as atrophy and fibrosis advancement (0: no atrophy and no fibrosis, 1: slightly marked atrophy and fibrosis, 2: moderate atrophy and fibrosis, 3: very pronounced atrophy and fibrosis). after deparaffinization tissue samples were rehydrated and stained immunohistochemically for kim-1 using the tissue kim-1/tim-1 kit (r&d systems inc., minneapolis, mn, usa) with contrasting hematoxylin and eosin staining. a tubule was considered to be kim-1 positive if it contained at least one kim-1 positive cell regardless of whether the kim-1 expression was cytoplasmic or apical. kim-1 staining was scored semiquantitatively by estimating the percentage of cortical tubules expressing kim-1 per field (the complete biopsy area was scored, with a minimum of five fields; in controls 30 fields were scored). unaffected parts of kidneys from patients with renal cell carcinoma were used as the negative control. the 6-, 12-, 24-, and 36-month followup for all patients included measurement of serum creatinine concentration, egfr, and proteinuria. data are presented as mean 1 standard deviation (sd) and the range of values. the one-sample kolmogorov-smirnov test was used to check for normal distribution of the variables. relationships between variables were estimated using pearson's rank and spearmen's correlation tests as appropriate. independent predictors of renal function 6, 12, 24, and 36 months after the kidney biopsy were identified by stepwise multivariant regression analysis. table 2 presents the demographic, clinical, and laboratory data for the patients at the time of kidney biopsy. tissue kim-1 expression was significantly induced in all kidney biopsies except in one patient with mcgn. tissue kim-1 had a typically apical localization, but it could also be found in the cytoplasm with no apparent affinity for the apical membrane of tubulocytes. kim-1 positive tubules were located mainly in the tin regions affected by inflammation or fibrosis but were not observed in regions with end-stage fibrosis. kim-1 univariate analysis showed significant positive associations between tissue kim-1 expression and age (r=0.313; p=0.015), tin inflammation (r=0.4563; p=0.004), tin fibrosis (r=0.317; p=0.021), and hemoglobin (r=0.440; p=0.001) as well as negative associations with albumin concentration (r=0.376; p=0.011) and egfr (r=0.572; p<0.001) at the time of biopsy and 6 (r=0.442; p=0.002), 24 (r=0.398; p=0.012), and 36 (r=0.412; p=0.015) months later. tissue kim-1 expression correlated significantly only with proteinuria/day 6 months after biopsy (r=0.394; p=0.026) but not with proteinuria at the time of biopsy and 12, 24, and 36 months later. table 3 gives the correlation coefficients between egfr at the time of biopsy and 6, 12, 24, and 36 months later and the examined variables. multivariant stepwise regression analysis showed that the best predictor of kidney function at the time of biopsy (egfr 0) was tin inflammation (p<0.001), as well as of egfr12 (p=0.015), egfr 24 (p=0.039), and egfr 36 (p=0.012). however tissue kim-1 expression was the best predictor of egfr 6 (p=0.016) along with tin inflammation (p=0.016) (table 4). figure 2 presents the linear correlation between tin inflammation (p<0.001), tissue kim-1 expression (p<0.001), and egfr 6. in our previous 6-month prospective study, we found higher urine kim-1 concentrations in twenty chronic renal patients than in control subjects and a significant positive correlation between urine kim-1 level and kim-1 expression in tissue. although, urine kim-1 content reflected tissue kim-1 expression, tissue kim-1 correlated better with tin inflammation and fibrosis as well as with kidney function at the time of biopsy and 3 and 6 months later. therefore, we retrospectively examined sixty patients with different kidney diseases in order to evaluate the importance of tissue kim-1 expression in predicting kidney function in the ensuing 36 months after kidney biopsy. in the present study tissue in addition, kim-1 positive tubules were located in parts of the cortex that were imbued with inflammatory infiltrate and/or fibrotic changes but not in completely atrophic areas. it is well known that the expression of kim-1 in tubules is associated with inflammation and tin damage. double-labeling studies have shown simultaneous expression of kim-1 and markers of prefibrotic changes, repair, and chemotaxis [10, 11]. the study of van timmeren et al. also demonstrated a connection between kim-1 expression in tissue, interstitial fibrosis, and macrophage accumulation.. first showed that tubular epithelial cells expressing kim-1 on their surface could act as phagocytes for apoptotic and necrotic renal epithelial cells. kim-1 is expressed predominantly in renal tubules, which, judging by the simultaneous expression of markers of dedifferentiation, are currently under the influence of agents that cause injury, but is absent from completely atrophic tubules. controversy remains about the function of kim-1: is it actively regulating the inflammatory process? or is its expression just a response to damage, attempted recovery, and/or repair ?. the present study revealed a significant negative correlation between tissue kim-1 expression and all estimated gfr at the time of kidney biopsy and 6, 24, and 36 months later. however multivariate analysis pointed to tin inflammation, but neither tin fibrosis nor proteinuria, as the best predictor of kidney function at biopsy and 6, 12, 24, and 36 months afterwards. however, along with tin inflammation, tissue kim-1 expression was the best predictor of kidney function 6 months after biopsy. interstitial infiltration of inflammatory cells can be seen in a variety of immune and nonimmune kidney diseases and is thought to play a significant role in tin damage and fibrosis. upon exposure to high protein concentrations, renal tubule cells produce a host of chemokines, vasoactive mediators, and adhesion molecules, which may contribute to interstitial fibrosis. protocol immunosuppressive therapy and treatment with ace inhibitors and at blockers for chronic renal patients with different chronic immune and nonimmune-mediated kidney disorders proven by biopsy have the strongest effects during the first 6 months of therapy. the severity of pretreatment tin damage predicts a dulled response to renoprotective intervention, with a worse long-term renal outcome. therefore, we can speculate that patients with less interstitial inflammation at the time of kidney biopsy will have a more favorable response to treatment and better kidney function afterwards. also, the finding that kim-1 was the strongest predictor of kidney function 6 months after biopsy along with tin inflammation may support the hypothesis about its potential role in the development of interstitial fibrosis and an unsatisfactory treatment response. association between higher urinary kim-1 levels and poorer kidney function was found in some human studies in native [10, 14] and transplanted kidneys but data on human tissue kim-1 expression are scarce. zhang et al. found that kim-1 expression in transplant biopsies is a sensitive measure of cell injury. in addition, they showed that more intense kim-1 staining predicts a better graft outcome over the ensuing 18 months and speculated that its level of expression may be an indicator of graft function recovery. it is well known that proteinuria is an ominous biomarker of progressive kidney disease and our study revealed that only proteinuria 6 months after kidney biopsy correlated negatively with kidney function 24 and 36 months after the biopsies and positively with kim-1 expression in tissue. earlier investigations [10, 14, 17] have yielded conflicting data regarding the relationship between urinary kim-1 level or tissue kim-1 expression and proteinuria. one explanation may be that proteinuria is not always accompanied by tin damage and a progressive decline in renal function [18, 19]. data regarding the selectivity of proteinuria were not available for the purposes of this study. the present study exposed a strong association between kim-1 tissue staining and tin inflammation and fibrosis but not with tin atrophy. although multivariate analysis pointed to tin inflammation, as the best predictor of kidney function at biopsy and 6, 12, 24, and 36 months later, tissue kim-1 expression is one of the best predictor of kidney function 6 months after biopsy, the time when treatment effects are the strongest. therefore, we can speculate that kim-1 has a potential role in the development of interstitial fibrosis and poor treatment responses. the major limitation of this investigation is the relatively small number of patients examined but it could be the basis for a larger prospective follow-up study for evaluation of urinary kim-1 concentration and tissue kim-1 expression in patients with various chronic and acute renal diseases.

objectives. retrospective study was designed to examine the importance of tissue kidney injury molecule-1 (kim-1) expression in predicting kidney function in sixty patients (27 males) aged 34.15 12.23 years with different kidney diseases over three years after kidney biopsy. materials and methods. tissue kim-1 expression was determined immunohistochemically and kim-1 staining was scored semiquantitatively, as well as tubulointerstitialis (tin), inflammation, atrophy, and fibrosis. kidney function (mdrd formula) and proteinuria/day were evaluated at the time of biopsy (gfr0) and 6, 12, 24, and 36 months later. results. significantly positive correlations between tissue kim-1 expression and age (r=0.313), tin inflammation (r=0.456), fibrosis (r=0.317), and proteinuria at 6 months (r=0.394) as well as negative correlations with gfr0 (r=0.572), gfr6 (r=0.442), gfr24 (r=0.398), and gfr36 (r=0.412) were found. meanwhile, tin inflammation was the best predictor of all measured kidney functions during three years, while tissue kim-1 expression (p=0.016) was a predictor only at 6 months after biopsy. conclusion. tissue kim-1 expression significantly predicts kidney function solely at 6 months after biopsy, when the effects of immune and nonimmune treatments are the strongest.

PMC3824354

pubmed-350

these range from various slow-growing benign tumors and low-grade malignancies to fast growing high-grade malignancies. angiofibromas are one such group of tumors arising in this region, which present as swellings. of these, nasal angiofibromas (nas) are the most common and nas occurring in the region other than the nose are called as extranasopharyngeal angiofibromas (ena). a 54-year-old male reported to our department with history of swelling over the right side of face since 5 years. the patient reported insidious onset of swelling with a gradual progress to the present size. he also reported mild, intermittent, and dull pain in the region of swelling. clinical examination confirmed a solitary, oval, well-defined swelling measuring approximately 7 5 cm in the preauricular region [figure 1]. it extended superioinferiorly from the level of outer canthus of the eye to inferior border of mandible and anterioposteriorly extended from 2 cm in front of anterior border of ramus to the mastoid notch [figure 1]. on palpation, the swelling was firm, non-tender, free from skin, and mobile over the underlying structures. ultrasonography revealed a large lobulated solid mass of 6 4 cm in the right parotid region with multiple vessels with low velocity flow and without any areas of calcification or cystic changes. findings were suggestive of a low-grade vascular tumor. computed tomography scan with contrast medium revealed a large well-circumscribed, solitary isodense lesion measuring 6.36 4.39 cm [figure 2]. it was observed to be extending anteriorly over the superficial lobe of the parotid gland, with anterior displacement of parotid gland. fnac revealed numerous vascular channels with occasional singly scattered and single cluster of plump spindle cells. ct- scan transverse section classical superficial parotidectomy was performed under general anesthesia using a modified appiani incision. tumor mass was dissected anteriorly and excised along with the superficial lobe of parotid gland [figure 3]. facial nerve was located using the anterograde method and all the branches of facial nerve were preserved. follow up, facial nerve function was intact and no sign of reoccurrence was observed. histopathological sections revealed connective tissue with numerous vascular spaces of variable sizes ranging from small capillary-like vessels to partly lined vessels. around the endothelial cells, cells were plump or stellate-shaped with mild inflammatory cell response and composed predominantly of plasma cells and a few lymphoid follicles [figure 4]. photomicrograph shows numerous endothelial lined blood capillaries with collagen fibres interspersed with fibroblasts and fibrocytes (h&e stain, 40). (b) photomicrograph shows endothelial lined blood vessels with connective tissue wall in the background of collagen fibres interspersed with fibroblasts and fibrocytes (h&e stain, 400) photomicrograph of the sections showing the blood vessels positive for cd 34 (ihc stain, 100) various soft tissue tumors, both benign and malignant, present as swelling in the parotid region. clinical examination confirmed a smooth-surfaced, solitary, oval, firm, well-defined swelling measuring approximately 7 5 cm in the preauricular region. based on the clinical findings of location, consistency and borders a differential diagnosis of pleomorphic adenoma, solitary fibrous tumor (sft), low-grade fibrosarcoma, and lipoma was made. as the most common tumors found in the region are parotid tumors, a provisional diagnosis of mixed parotid tumor was made. however, fnac and contrast-enhanced ct scan were in favor of a tumor with vascular component, shifting the differential diagnosis towards tumors with a vascular component presenting as slow-growing, circumscribed firm swellings. histopathological examination of the excised lesion revealed features suggestive of angiofibroma and had to be differentiated from lesions with similar features. the differential diagnosis included low-grade vascular lesions, spindle cell neoplasms, comprising of a large range of benign and low-grade malignant soft tissue lesions, including cellular angiofibroma, sft, low-grade fibromyxoid sarcoma (lgfms), low-grade myxofibrosarcoma, myxoid liposarcoma, giant cell angiofibroma (gca), angiomyolipoma, and angiomyofibroblastoma. cellular angiofibroma, usually occurs in the pelviperineal region, which would be an unusual location for the tumors reported herein; however, cases have been reported to have occurred in the buccal mucosa, raising a diagnostic possibility. cellular angiofibroma shows more rounded, non-branching vessels, often of medium size with thicker walls. the tumors are generally more uniformly cellular, composed of lesional cells with short, stubby nuclei resembling those of spindle cell lipoma. sfts occur in a variety of locations in the head and neck region; myxoid examples may be particularly difficult to identify and should be considered in the differential diagnosis. microscopically, besides the so-called patternless architecture, there is pronounced regional variation in cellularity, prominent thick collagen bundles and characteristic branching ectatic staghorn vessels, which are not accompanied by the abundant smaller-sized vessels present in angiofibroma of soft tissue. in addition, the tumor cells in sft express strong and diffuse cd34 in most cases. this entity lacks the innumerable, evenly distributed, arborizing thin-walled vessels characteristic of angiofibroma. lgfms is a distinctive fibroblastic malignant neoplasm characterized by a peculiar tendency to give rise to very late metastases. histologically, it shows alternating collagenous and myxoid areas with a usually swirling or whorled growth pattern, a frequently lobular appearance, and deceptively bland spindle cell morphology. the lesions tend to be more hypocellular, with a fibrous component that has uniform collagen deposition rather than the fibrillary or coarsely banded collagen fibers in angiofibroma of soft tissue. although lgfms may contain arcades of thin-walled vessels, vascularity is usually not prominent. usually occurring in subcutaneous tissues of the extremities, it shows distinctive histologic features including a lobulated growth pattern with infiltrative margins and fusiform, round, or stellate tumor cells with frequently slightly eosinophilic cytoplasm and hyperchromatic atypical or pleomorphic nuclei. obvious features of malignancy are usually present, characteristic elongated curvilinear vessels with perivascular hypercellularity, these features bear little or no resemblance to the rich vascular network of angiofibroma. myxoid liposarcoma contains a prominent plexiform network of thin-walled capillaries (which has been referred to as a chicken wire or however, it also shows scattered univacuolar and multivacuolar lipoblasts throughout, as well as stromal mucin pools not seen in angiofibroma. gca has been reported as a benign mesenchymal tumor with 2 cases originating in the buccal mucosa. although benign, the lesion has potential for local reoccurrence, especially after incomplete resection. histopathologically, it has similar presentation to that of sft, with presence of multinucleated giant cells not seen in angiofibroma. angiomyolipoma differs from angiofibromas because of the presence of prominent muscular arteries while angiomyofibroblastoma differs because of the presence of fibrovascular component with a loose myxoid fibroelement. enas have interstitial stromal tissue predominance with less vascular elements such as that of long-standing na. other distinctive histologic features are angiofibroma of soft tissue, consisting of a vaguely lobular, variably cellular proliferation of bland, uniform spindle cells set in an abundant, variably myxoid or collagenous extracellular matrix with numerous small, and thin-walled, branching blood vessels. the complexity of the vascular pattern, often also including larger vessels of varying size and shape, is the most noticeable feature. immunohistochemical analyses may show that stromal cells have strong cytoplasmic reactivity for vimentin and are generally immunonegative for smooth muscle actin and desmin. histopathology coupled with immunohistochemistry usually confirms the diagnosis in favor of angiofibroma. in our case, the tissue specimen showed features consistent with the diagnosis of ena. in 1980, de vincentiis and pinelli reviewed a series of 704 cases of angiofibroma and found that 13 cases manifested outside the nasopharynx, thus suggesting that extra nasopharyngeal localization of this tumor is a possible although rare occurrence. a review article by windfuhr and remmert in 2004 summarized 65 patients with enas. the most common site reported for enas is the maxillary sinus followed by the ethmoid, nasal cavity, and nasal septum. enas are also reported to originate from the ethmoid sinus, nasal cavity, nasal septum, larynx, sphenoid sinus, cheek, conjunctiva, oropharynx, retromolar area, middle turbinate, inferior turbinate, and tonsil. other rare sites for enas occurrence have also been described-external nose, hard palate, external ear, lacrimal sac, carotid bifurcation, oesophagus, trachea, facial nerve, middle cranial fossa, and infratemporal fossa. the most common age of incidence was the second decade (46%) in comparison to 80% of patients with nas. enas have a higher mean age, i.e, 22 years compared to nas, which have a mean age of 18 years. this lesion has been described as different from that of the classical nasopharyngeal variety in being more common in females, older individuals with an early presentation, and being capsulated with poor vascularity and infrequent recurrence. unlike nas, enas present non-specific and numerous symptoms. imaging modalities such as ct scan, mri, ct angiography, and ultrasonography are required for optimal preoperative evaluation of nas and enas. imaging of nas with a contrast agent leads to diffuse and usually homogenous involvement in ct and mri scans with strong contrast enhancement. in contrast, enas enhances moderate amount of contrast or none due to its weak vascular involvement. surgical excision is the prime modality of treatment for enas; radiotherapy maybe applied for non-resectable lesions. occurrence of enas, although rare in the maxillofacial region, should be considered in differential diagnosis of swellings in this region.

angiofibromas are rare, benign, locally invasive vascular tumors, which represent 0.05-0.5% of all head and neck tumors. most frequent site of occurrence is the posterior nasopharynx, called as nasopharyngeal angiofibromas (na), when these arise outside the nasopharyngeal region they are termed as extranasopharyngeal angiofibromas (ena). only 65 cases of ena have been reported, and the most common site has been reported to be maxilla followed by ethmoids. other unusual sites of occurrence reported so far in literature are nasal cavity, nasal septum, larynx, sphenoid sinus, pterygomaxillary fissure, infratemporal fossa, cheek, oropharynx, retromolar area, middle turbinate, inferior turbinate, and tonsil. ena arising from the superficial lobe of parotid gland has not been reported in the literature so far and this case is the first to be reported.

PMC4196304

pubmed-351

atherosclerotic renal artery hypertension is reported in almost 7% of adults older than 65 years1) and is associated with cardiovascular events, and may double risk of mortality2). in the 1990s, radiological angioplasty began to replace surgical revascularization. galaria et al. showed that percutaneous and open renal revascularization had equivalent long-term functional outcomes3). over time, the less-invasive procedure became more accessible. most cases of atherosclerotic renovascular disease (arvd) are located in the ostium, and are extensions of calcified aortic plaques4). stent placement might also provide additional force to increase the rates of technical success5) and to reduce the rate of restenosis at 6 months after the initial procedure6). intervention with stents has become a standard procedure; in patients with stenosis of the renal artery, placement of a stent is likely to be the initial form of treatment. however, there is limited evidence to support revascularization over medical therapy for patients with atherosclerotic renal artery stenosis7, 8). retrospective studies previously reported that renal artery lesions might progress to severe stenosis and ultimately to renal artery occlusion9). michael et al. performed a prospective study that reported that the progression of renal artery disease was a frequent occurrence with an annual rate of progression of renal artery lesions reported to be 7%10). however, at the time of these studies, statins were being used in fewer patients. a retrospective study of the effects of statins on the progression of arvd has shown that the use of statins reduces the risk of progression and the development of arvd11). another prospective population-based study reported that the progression to significant arvd was observed in only 4.0% during 8 years of follow-up (annualized rate, 0.5% per year), and no case of arvd progressed to occlusion12). essential hypertension and clinically silent renal artery stenosis often coexist, and essential hypertension also coexists with renovascular hypertension13). renal injury distal to an atherosclerotic renovascular obstruction is due to multiple intrinsic factors producing parenchymal tissue injury (fig. non-traditional mediators of arvd such as inflammatory pathways, reactive oxygen species production, ischemia/reperfusion damage and modulation of matrix turnover have been proposed as causes of the renal failure related to arvd15). this complexity of the pathophysiology might explain why the severity of the stenosis is not correlated with renal dysfunction. clinical data support dissociation of improved renal artery patency from clinical outcome in patients with atherosclerotic renal artery stenosis; this may illustrate the effects of irreversible injury on the post stenotic kidney. a prospective clinical study reported by wright et al. showed absence of a correlation between renal artery anatomy and baseline renal function or functional outcome, and a good correlation between renal functional outcome and proteinuria; these findings suggest that renal parenchymal damage is a major determinant of renal dysfunction and outcome rather than the severity of the renal artery stenosis in arvd16). reported that the mean arterial pressure did not decrease by 10 mmhg or more after revascularization and renal function declined in most patients with arvd that had high resistance-index values before revascularization17). chrysochou et al. showed a correlation between baseline proteinuria and decline in estimated glomerular filtration rate (gfr) with time after revascularization18). therefore, post stenotic renal injury can lead to renal parenchymal injury reflected by high intrarenal resistance and/or the presence of proteinuria. proteinuria and other factors involved in intrarenal resistance are predictors of a poor outcome after renal revascularization in arvd. when patients with chronic kidney disease undergo renal angioplasty with/without stent placement, the response with regard to renal function can be negative as well as positive. positive responses include improvement of renal function, and stabilization or attenuation of declining renal function, as expected. possible causes of these adverse outcomes include contrast induced nephropathy, atheroembolism, and restenosis or stent thrombosis19). the administration of contrast might increase the risk of acute renal dysfunction, especially in patients that have preexisting renal impairment. an ex vivo study reported that each manipulation of atheroma specimens, from simply advancing the guidewire through the atherosclerotic lesion to positioning and deploying the wallstent, releases thousands of fragments, and that these atherosclerotic fragments are of sufficient size to create vascular occlusion and initiate significant renal parenchymal damage20). the nature of this disorder suggests that a systemic approach is necessary to provide cardiovascular protection. previously, statin therapy was discussed as a method of altering the natural history of arvd11). angiotensin-converting enzyme inhibitors and angiotensin receptor blockers effectively reduce blood pressure in patients with renovascular disease. in addition, a population-based cohort study of over 3,500 patients with arvd in canada found that angiotensin inhibitors could cause acute renal toxicity in a small subset of vulnerable patients; however, they still improved the cardiovascular and renal outcomes in patients with arvd, but at the expense of acute renal toxicity21). recently three randomized controlled trials have been performed: the stent placement and blood pressure and lipid-lowering for the prevention of progression of renal dysfunction caused by atherosclerotic ostial stenosis of the renal artery (star) trial, the angioplasty and stenting for renal artery lesions (astral) trial, and the cardiovascular outcomes in renal artherosclerotic lesions (coral) trial (table 1). two large randomized trials of intervention vs. medical therapy showed negative results for the intervention. the star trial was a european multicenter trial that enrolled 140 patients with ostial renal artery stenosis greater than 50%, blood pressure controlled to less than 140/90 mmhg, and creatinine clearance 15 to 80 ml/min7). all patients received angiotensin blocking agents and a statin, regardless of their lipid levels. after a 2-year interventional period, no difference was observed in the decline of renal function, the degree of blood pressure control, and the rates of cardiovascular morbidity and death. investigators in the astral trial enrolled 806 patients with at least one stenotic renal artery considered suitable for balloon angioplasty, stenting, or both in their international, multicenter trial8). the mean estimated gfr was 40 ml/min, and most of the patients were on statin and angiotensin blocking therapy. at a mean follow-up of 33.6 months, no difference was noted between the treatment groups in the decline of renal function or blood pressure control, and the renal function worsened slightly in both groups. most of the enrolled patients in the two clinical trials had relatively asymptomatic atherosclerotic renal artery stenosis. therefore, the practice of indiscriminately performing revascularization, without strong evidence, is no longer acceptable. the coral trial is an ongoing multicenter randomized controlled trial in the united states22). it is still enrolling patients that have drug-resistant hypertension or a gfr<60 ml/min. it is using a standardized medical protocol to control blood pressure, and embolic protection devices during procedures are encouraged. thus far, intervention has not been recommended if renal function has remained stable over the past 6 to 12 months and if hypertension can be controlled medically. according to a clinical classification of atherosclerotic renal artery stenosis with guidelines for vascular intervention of surveillance published in 2008 by the atherosclerotic peripheral vascular symposium23), additional recommendations favoring medical therapy were as follows: very advanced age and/or limited life expectancy, extensive co-morbidities that make revascularization too risky, high risk for or previous experience with atheroembolic disease, and other concomitant renal parenchymal diseases that cause progressive renal dysfunction (e.g., interstitial nephritis, diabetic nephropathy)23). they also recommended factors favoring medical therapy and intervention as follows: progressive decline in gfr during treatment of systemic hypertension, failure to achieve adequate blood pressure control with optimal medical therapy (medical failure), rapid or recurrent decline in the gfr in association with a reduction in systemic pressure, decline in the gfr during therapy with angiotensin-converting enzyme inhibitors or angiotensin receptor blockers, and recurrent congestive heart failure in a patient in whom the adequacy of left ventricular function does not provide an explanation23). the best evidence supporting intervention is for bilateral stenosis with " flash " pulmonary edema, but the evidence is from retrospective studies24-26). the aim of treatment for arvd should include the prevention of cardiovascular and/or renal events. treatment of patients with arvd should include consideration of the following factors: age, co-morbidity, blood pressure, renal function, and kidney size. the results of two recent studies suggest that patients with arvd and stable renal function can be controlled medically. intervention should be considered only in patients with arvd and rapidly progressive cardiac or renal dysfunction. the results of the coral and the post hoc analysis of astral might provide additional evidence for revascularization.

atherosclerotic renovascular hypertension is a form of secondary hypertension due to renal artery stenosis. after the introduction of medical therapy such as with statins and angiotensin blocking agents, it has been considered a very slowly progressive disease. in the 1990s, surgical methods were compared to radiological intervention and showed no additional benefits. recent clinical data also demonstrate that in cases of relatively stable atherosclerotic renovascular disease, medical therapy is as effective as other interventions with regard to patient outcomes. in this paper the recent clinical outcomes are reviewed.

PMC3043761

pubmed-352

tuberculosis (tb) caused by mycobacterium tuberculosis (m. tb) continues to be a significant global health problem, affecting millions of people worldwide [1, 2]. it is a prevalent infectious disease in china, with 250,000 deaths from tb annually and 6 million active tb patients at present. the global incidence of tb is raising due to coinfection with the human immunodeficiency virus (hiv) and the emergence of multidrug-resistant (mdr) m. tb strains [5, 6]. according to the report of world health organization (who), m. tb will cause 1 billion new cases and about 35 million deaths worldwide by 2020. therefore, effective treatment and control strategies are urgently needed to counteract the global threat of tb. the current vaccine against tb, m. bovis bacilli-calmette-gurin (bcg), is a live attenuated vaccine which has been widely used throughout the world for many decades. bcg protects children efficiently against miliary and meningeal tb, but protective efficiency against pulmonary tb in adults has been found to vary highly from 0% to 80%. much effort has been devoted to improving bcg efficacy by genetic engineering technology because of its strong immunostimulatory properties and proven safety for human use [9, 10]. recombinant bcg (rbcg) expressing different immunodominant antigens of m. tb, such as secreted antigens (ag85b, ag85c, esat-6, etc.) or latency associated antigens (-crystallin, rv2659c, rv3407 and rv1733c, etc.), have been tested as candidate vaccines against tb and are demonstrated to have an enhanced ability to induce th1 immune response and protection against m. tb challenge in animal models [11, 12]. also, it is definitely no doubt that doses of antigens could subtly influence the magnitude of host immune response as well as protection efficacy, no matter antigen is administered in the form of rbcg, protein, dna, or rna. we have previously reported the construction of a m. tb fura gene operator/promoter (pfura)-based differential expression system, from which it is feasible to express target antigens of interest in a modular fashion. m. tb chimeric antigen ag856a2, which is coded by a recombinant ag85a gene with 2 copies of esat-6 gene inserted at the acc i site of ag85a (see figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2014/196124), shows improved immunogenicity in mice when it is inoculated intramuscularly as a dna vaccine. for the current study, we selected two rbcg strains overexpressing the same chimeric antigen ag856a2 at the maximum difference: rbcg186 and rbcg486 overexpressing the fusion protein under control of the wild-type or the optimized double-mutated fura promoters, respectively. we tested their efficacy as vaccines in c57bl/6 mice, comparing immune response and protection against m. tb challenge. the results showed that mice vaccinated with rbcg186 or rbcg486 generally induced higher antigen-specific effector and memory immune responses, as well as protective efficacies compared to mice vaccinated with the parent bcg strain. however, the two rbcg strains between themselves, which expressed the chimeric antigen ag856a2 at different levels, induced different antigen-specific ifn- production and comparable number of m. tb-specific cd4 t cells expressing il-2. and the protective efficacies imposed by the two rbcg strains displayed no significant differences although higher protection was observed in rbcg486 vaccinated mice than that in rbcg186 vaccinated mice. female specific pathogen-free (spf) c57bl/6 mice aged 68 wks were purchased from shanghai slac laboratory animal co., ltd. (shanghai, china) and kept under spf conditions with food and water ad libitum until challenge. infected mice were maintained in a biosafety level 3 (bsl-3) biocontainment animal facility. all animal experiment protocols were approved by chinese science academy committee on care and use of laboratory animals and were performed according to the guidelines of the laboratory animal ethical board of shanghai public health clinical center. bcg and its derivative recombinant strains were grown in liquid middlebrook 7h9 broth (bd difco, usa) supplemented with 10% oleic acid-albumin-dextrose-catalase enrichment (oadc, bd difco, usa), 0.2% glycerol, and 0.05% tween 80. cultures in the exponential phase were frozen and stored at 80c. when required, kanamycin was added at a final concentration of 50 or 20 g/ml for e. coli or mycobacteria, respectively. two rbcg strains overexpressing m. tb chimeric immunodominant antigen ag856a2 at different levels were constructed as previously described. briefly, the ag856a2 coding gene, which is a recombinant ag85a gene with 2 copies of esat-6 gene inserted in its acc i site, was amplified from the plasmid template of dna vaccine hg856a and then cloned into mycobacterial differential expression vectors pmfa11 and pmfa41 under control of the prototypical and double-mutated (mutations: initial codon change from gtg to aug and 6 bp substitution at upstream at-rich region) fura promoter, respectively. the resulting constructs were electroporated into bcg-danish competent cells and selected on middlebrook 7h11 agar with kanamycin. the rbcg transformants were grown to midexponential phase in complete middlebrook 7h9 broth and then verified the recombinant protein expression by routine western-blotting assay. mice were vaccinated subcutaneously (s.c.) with 2 10 colony-forming units (cfu) of bcg or rbcgs in 100 l saline. eight weeks after vaccination, groups of 6 mice were either sacrificed for assessment of antigen-specific t cell responses in splenocytes or exposed to an aerosol of virulent m. tb h37rv strain to deposit an inhaled dose of 100200 cfu per lung by an inhalation exposure system (glas-col, usa). ifn- elispot assay kit (bd biosciences, usa) was used as described by the manufacturer. plates were coated with anti-ifn- mab overnight at 4c and then blocked with rpmi 1640 medium containing 10% fetal bovine serum (fbs) for 1 h at room temperature. splenocytes (2.5 10 cells/well) from immunized mice were isolated, plated, and cultured with 10 g/ml ppd (statens serum institute, denmark) or 2 g/ml recombinant ag85a, 6 g/ml recombinant esat-6 to provide stimulation at 37c, 5% co2 for 20 h. after washing the plates with pbs-t20 (1 pbs, ph 7.4, 0.05% tween 20), biotinylated anti-ifn- was added for 2 h at room temperature. streptavidin-hrp was added for 45 min, and the color was developed with 3-amino-9-ethylcarbazole (aec) substrate (bd biosciences). an immunospot analyzer (cellular technology, usa) was used to count the spots. splenocytes (2 10 cells/well) isolated at 8 weeks after immunization were plated in 96-well plates and stimulated with 10 g/ml ppd for 14 h in the presence of 1 g/ml anti-cd28 (bd biosciences) and subsequently incubated for an additional 5 h at 37c following the addition of 0.5 l/ml monensin/golgistop (bd biosciences). following overnight incubation at 4c, the cells were washed in facs buffer (pbs containing 0.1% sodium azide and 1% fbs) and subsequently stained for 30 min at 4c for surface markers with mabs as indicated using anti-cd3-pacific blue, anti-cd8-fitc, and anti-cd44-v500 (all from bd biosciences). cells were then washed in facs buffer, fixed, permeabilized using the cytofix/cytoperm kit (bd biosciences) according to the manufacturer's instructions and stained intracellularly for 30 min at 4c using anti-ifn--apc-cy7, anti-tnf--percp-cy5.5, and anti-il-2-apc mabs (all from bd biosciences). cells were subsequently washed, resuspended in facs buffer, and then analyzed by multiparameter flow cytometry using a bd facsaria flow cytometer (bd biosciences). for each sample, at least 300,000 events were collected and responses were analyzed using flowjo software (tree star, usa). five weeks after infection, mice were sacrificed and the mycobacterial burden was determined by plating homogenates of lung, excluding right postcaval lobe, and entire spleen onto middlebrook 7h11 agar plates supplemented with 10% oadc enrichment and a 4-antibiotic mixture (40 u/ml polymycin b, 4 g/ml amphotericin, 50 g/ml carbenicillin, 2 g/ml trimethoprim) that prevents growth of contaminating microorganisms. plates were incubated at 37c for 3 weeks in semisealed plastic bags and then cfu were counted and expressed as log10 cfu per organ. then, the embedded lung lobes were sectioned in thickness of 5 m, stained with haematoxylin and eosin (h&e) and photographed using a olympus ckx41 microscope (olympus, japan) fitted with an olympus dp20 camera connected to a computer. the image pro plus program (media cybernetics, usa) was utilized to objectively assess the level of inflammation present in each image. the mean percent of area inflamed was quantified averaging from three to five lung sections of each of the different groups of mice. the antibodies were rabbit polyclonal anti-mouse tnf- (abcam, uk), rabbit polyclonal ifn- antibodies (invitrogen, usa), and rabbit polyclonal anti-mouse inos antibody (cayman chemical, usa). all sections were examined by light microscopy, and the expression of tnf-, ifn-, or inos was semiquantified by intensity of positive signal using image pro plus software. immune responses, protective efficacies, and histopathological staining were tested by one-way anova followed by tukey's multiple comparison tests of the means. we have previously developed a novel mycobacterial differential expression system (pmfa series) based on the m. tb fura gene operator/promoter (pfura) or its derivatives. ag856a2 was cloned into two of these plasmids, pmfa11 and pmfa41, which drives low and high gene expression under the control of the wild-type and modified fura promoters, respectively. by transformation of bcg, we obtained two strains, rbcg186 and rbcg486, which drove correspondingly low and high expression of chimeric immunodominant antigen ag856a2 (figure 1, upper panel). quantification of the band intensities of western-blot indicated that rbcg486 roughly expressed>3-fold of ag856a2 than rbcg186 did (figure 1, lower panel). eight weeks after vaccination, elispot assay of splenocytes showed that more cells in the rbcg486-vaccinated mice expressed ag85a-specific ifn- compared to those of rbcg186- and bcg-vaccinated mice (figure 2, left panel). also, significantly elevated numbers of splenocytes expressed esat-6-specific ifn- in both rbcg186- and rbcg486-vaccinated mice compared to that of bcg-vaccinated mice (figure 2, middle panel). additionally, esat-6-specific ifn- was induced at much higher level in rbcg486-vaccinated mice compared to rbcg186 group (figure 2, middle panel). a similar pattern of ppd-specific ifn- responses as ag85a-specific response was also observed but the difference was not statistically significant, regarding to the comparisons of rbcg486-vaccinated mice and other immunized groups (figure 2, right panel). we used flow cytometry to measure the capacity of m. tb-specific cd4 t cells from spleens of vaccinated mice producing cytokines ifn-, tnf-, and il-2 at single cell level after stimulation in vitro with ppd. the cytokine-producing cd3cd4 cells were classified into seven subpopulations based on their production of ifn-, tnf-, and il-2 in any combination (figure 3(a)). significantly increased frequencies of ppd-specific il-2 cd4 t cells were identified in rbcg-vaccinated mice, whereas increased frequencies of ifn- cells were identified in bcg-vaccinated mice even though statistically insignificant (figure 3(a)). the pie chart of this data clarified the dominance of il-2 cd4 t cells in rbcg-vaccinated mice, while ifn- cd4 t cells dominated the responses of bcg-vaccinated mice (figure 3(b)). rbcg and bcg-vaccination did not differ in their ability to induce m. tb-specific cd4 t cells producing other combinations of cytokines (p>0.05). in accordance, we also observed higher integrated mean fluorescence intensities (imfi =% frequency mfi) of il-2 in il-2-producing cd4 t cells, even though it is statistically insignificant (figure 3(c)). in general, rbcg induced higher antigen-specific cytokine responses as compared to bcg (figures 2 and 3), and rbcg486 induced higher antigen-specific ifn- response (figure 2) and comparable frequency of m. tb-specific cd4 t cells expressing il-2 (figure 3). then, we further compared the protective efficacies of rbcg486, rbcg186, and bcg against m. tb-challenge. as shown in figure 4(a), 5 weeks after challenge all vaccinated mice had a significantly reduced bacillary load in lungs, when compared to the saline-treated mice. vaccination with bcg and rbcg186 resulted in a comparable reduction in bacillary load (figure 4). however, even though rbcg486 vaccination induced a significantly greater protection when compared to the bcg-vaccinated mice, it showed no difference of protection when compared to the rbcg186-vaccinated mice (figure 4(a)). the bacillary loads in spleens shared the similar pattern as those in lungs, with rbcg486-vaccinated mice having far fewer bacilli when compared to the saline-treated or bcg-vaccinated mice and having comparable bacilli compared to the rbcg186-vaccinated mice (figure 4(b)). five weeks after challenge, m. tb infection caused severe pathology changes in saline-treated mice, with about 24.3% of the tissue showing extensive multifocal granulomatous infiltration, characterized by numerous foamy macrophages surrounded by inflammatory cells (figure 5). however, all the vaccinated groups of mice had significantly reduced pulmonary granulomatous consolidation compared to the unvaccinated mice (i.e., 13.42% consolidation in bcg-vaccinated group, 7.24% in rbcg186-vaccinated group, and 4.87% in rbcg486-vaccinated group). the rbcg-vaccinated mice showed the mildest pathology, and all of the mice in these two groups had mainly well-preserved alveolar spaces with only a few scattered areas of diffused infiltration (figure 5). immunohistochemical staining of the lung tissues showed the presence of tnf-, ifn-, and inos in all groups of infected mice and staining was strongest in the granulomatous lesions compared to that in the nongranulomatous areas. five weeks after infection, a very high level of tnf- was observed in the lungs of saline-treated mice (figure 6(a)); tnf- staining was extensive in necrotic areas within the advanced coalescent granulomas. vaccination with bcg resulted in the reduced amounts of tnf- expression, even though statistically insignificant. in contrast, rbcg-vaccinated mice, especially rbcg486-vaccinated mice, showed only a little weak staining for tnf- and this was restricted primarily to the granuloma core (figure 6(a)). similar patterns of ifn- and inos staining were also observed except that there was relatively much weaker staining in the lungs of (r)bcg-vaccinated mice compared to the saline-treated mice (figures 6(b) and 6(c)). similar pattern of tnf-, ifn-, and inos staining was also observed in the infected spleens of vaccinated mice, with the highest staining in saline-treated mice, moderate staining in bcg-vaccinated mice, and the lowest staining in rbcg-vaccinated mice (figure s2). during the past decades, great efforts have been focused on modifications of the current bcg vaccine to develop new anti-tb vaccine candidates. some modified rbcg strains, such as rbcg30 and rbcgurec::hly, have been demonstrated to yield improved protection against m. tb infection in experimental animal model compared to the existing bcg vaccine and have entered into clinical trial. nevertheless, it is promising to keep on optimization of bcg protective immune if two points are being issued. one is the fact that the best immunodominant antigen for tb should be precisely defined. another is that the expression levels of such antigens should be optimal enough to elicit effective immune responses. here, we constructed two rbcg strains overexpressing immunodominant chimeric antigen ag856a2 at varying levels depending upon the strengths of the different fura promoters and then compared the cellular immune response and protection in mice induced by these two rbcg strains. one way to improve bcg efficacy is to overexpress mycobacterial immunodominant antigens to induce optimal host immune responses in the life cycle of bcg within host [12, 19]. this kind of strategy reflects that the doses of antigens are one of pivotal factors influencing the protective efficacies of vaccines. demonstrated that protective efficiency of tb subunit vaccines is highly dependent on the antigen dose. they vaccinated mice with different doses of fusion protein ag85b-tb10.4 which were emulsified in adjuvant ic31, and the higher immune response and protective efficacy were only observed when the antigen was administered in proper doses, and decreasing or increasing of the antigen dose would dramatically dwarf the protection efficacies of the antigens. in our study, the cognate antigen ag856a2 in rbcg186 and rbcg486 was expressed under the control of promoters pfura and pfurama (figure s1). these two promoters, by their nature, were verified to have varied promoter activities, with pfura the lower one and pfurama the higher one, and were consequently used to develop the rbcg strains overexpressing chimeric antigen ag856a2 at different levels, with lower expression in rbcg186 and higher expression in rbcg486 (figure 1). and different ag856a2 antigen loading in rbcgs resulted in differential host immune responses, with the higher antigen-specific effector immune response in the rbcg486-vaccinated mice as validated through in vitro ifn- elispot assay (figure 2). however, we did not observe the significant differences in the qualities of m. tb-specific cd4 t cells coexpressing ifn-, tnf-, and il-2 (figure 3), nor the protection efficacies and lung inflammations, between the two groups of rbcgs-vaccinated mice (figures 4 and 5). interestingly, subtly higher percent of polyfunctional cd4 t cells (ifn-il-2tnf-) was observed in bcg-vaccinated mice compared to other groups of mice (figure 3(a)); however, the protective efficacy elicited by bcg vaccination is not that effective as rbcgs (figure 4). this contradictory result could be explained with the fact that the lower imfi values of ifn-, il-2, and tnf- in bcg-vaccinated mice were observed (see the case of il-2 in figure 3(c) as representative). mfi provides one measure of the quality of the immune response since the cells that are more actively producing cytokine stain more brightly, thus the lower imfi values of cytokines reflected poor quality although mildly higher frequency of polyfunctional cd4 t cells was seen in bcg-vaccinated mice, and this further emphasizes that not only the magnitude but also the quality of vaccine-induced t cells responses are critical to guide development of effective immunization strategies. in addition, higher il-2 secretion, both in the levels of percentage and imfi, were seen in the rbcg486-vaccinated mice than that of bcg group; this data support our recent findings that il-2 production in the spleens of vaccinated mice after vaccination can predict vaccine efficacy (kang h, et al. immunology, 2014; in press). the same explanation might also be used to account for the fact that although the saline-treated mice showed high numbers of cells producing tnf-, the imfi is relative low (data not shown). the quality of t cell response has significant effect on the establishment of protective memory. as with the phenotypic heterogeneous nature of t cells thus, in addition to monitoring exclusively the ifn- response after vaccination, researchers have been focusing on the coexpression of more cytokines at single cell level through flow cytometry technique [24, 25]. the rbcg186 or rbcg486, at least at the time we tested, induced much higher frequencies of il-2 cd4 t cells responding to ppd stimulation in splenocytes compared to the saline-treated or bcg-vaccinated mice after vaccination, which was further confirmed by higher il-2 production when cytokine concentration was measured as imfi value (figure 3). although il-2 has little direct effector function, it has the ability to expand effector functions of other t cells. in the linear model of differentiation for cd4 th1 cells, il-2 cd4 t cells belong to memory cells and have the potential to differentiate into ifn--producing cells after recalling by the relevant antigens. thus, rbcg186 and rbcg486, because of the incorporation of chimeric antigen ag856a2, enhance the memory capacity of host to m. tb pathogen. however, we did not detect any differences of cd4 t cells between rbcg186-vaccinated and rbcg486-vaccinated mice. this may attribute to the short vaccination time window we chose, or the real differences lies in other functions of t cells which is beyond the scope of the t cell functions currently tested and may need to be further exploited in the future. those relevant th1 cytokines (e.g., tnf- and ifn-), in a larger extent, function through activation of macrophages. tnf- and ifn- synergistically inhibit the growth of m. tb in macrophages through stimulating the production of reactive nitrogen intermediates (rnis) [27, 28]. as for rnis, inos is the vital enzyme involved for the production of rnis [29, 30]. tnf-, ifn-, and inos give proper containment of m. tb in the early stage. at later stage of infection when inhibition or killing of m. tb is well established, their levels of expression will go down to a reasonable value; otherwise immune-pathological response would happen. rbcgs, especially rbcg486, induced enhanced protection against m. tb infection in this study (figure 4). consistent with the protective efficacy, the inflammation responses in the infected lungs alleviated greatly in rbcgs-vaccinated mice after infection (figure 5). when measuring the expression levels of inflammatory molecules, the rbcgs-vaccinated mice also displayed reduced levels of expression which were in accordance with the remissive granulomatous inflammation (figures 5 and 6).

one approach for improving bcg efficacy is to utilize bcg as vehicle to develop recombinant bcg (rbcg) strains overexpressing mycobacterium tuberculosis (m. tb) antigens. also expression level of a candidate antigen should impact the final t cell responses conferred by rbcg. in this study, based on our previously constructed differential expression system, we developed two rbcg strains overexpressing m. tb chimeric antigen ag856a2 (coding a recombinant ag85a with 2 copies of esat-6 inserted at acc i site of ag85a) at differential levels under the control of the subtly modified fura promoters. these two rbcg strains were used to vaccinate c57bl/6 mice and exploit dose of incorporated antigen in rbcg to optimize immune response and protective efficiency against m. tb challenge in mouse model. the results showed that rbcg strains overexpressing ag856a2 at differential levels induced different antigen-specific ifn- production and comparable number of m. tb-specific cd4 t cells expressing il-2. m. tb challenge experiment showed that rbcg strains afforded enhanced but comparable immune protection characterized by reduced bacillary load, lung pathology, and inflammation. these results suggested that the dose of antigens incorporated in rbcg can impact t cell immune responses but imposed no significantly differential protective efficacies.

PMC4134796

pubmed-353

after initial establishment and derivation of human embryonic stem cells (hesc; thomson et al., 1998; reubinoff et al., 2000) first the infection free status of the donors has to be addressed, in europe couples are tested before any fertility treatment is offered, but the cells themselves have to be tested, too (hovatta, 2011). second, optimized good manufacturing practice (gmp) compliant systems must be implemented for derivation, scaling-up, banking of cells, and their corresponding quality assurance controls (unger et al., 2008; ausubel et al., 2011). the culture systems currently encounter the problem of suboptimal quality of xeno-free culture constituents. thus strategies are needed to overcome this difficulty (sidhu et al., 2008). steps have been taken; initially, hesc were grown on irradiated mouse feeders, later human fore-skin fibroblast were used (hovatta et al., 2003), now we can use gmp compliant coating substrates specially designed for hesc growth (rodin et al., steps were also taken for the generation defined xeno-free gmp compliant medium for derivation and for expansion (ludwig et al., 2006; the potential of somatic cell reprogramming via expression of specific transcription factors and thus the generation of hesc induced pluripotent stem cells (hipsc; takahashi and yamanaka, 2006; takahashi et al., 2007) has the advantage that they could be generated from the recipient patients own cells. there is no deep understanding of the effects that the reprogramming events have; for instance on extracellular signaling (okita et al., 2011), and the way that this could lead to immune reaction. hence fast reactivity is already present in healthy individuals for controlling any rapidly amplifying cells (dhodapkar et al., 2010). un-silenced expression of the reprogramming factor oct-4 might then cause undesired immunoreactivity on the transplanted cells. immunoreactivity toward graft-derived hipsc of the same genetic background was also shown in animal models (zhao et al., 2011). for successful reprogramming of somatic cells, many epigenetic changes must occur in an adequate manner. dna methylation changes during reprogramming must occur in important developmental and oncogenic regions, which increases the oncogenic risk of the reprogrammed cells (doi et al. there is an additional risk for abnormalities and high tumorigenic potential, especially if c-myc is used as one of the transcription factors (okita et al., 2007). also, genetic and epigenetic stability and large-scale genomic rearrangements after reprogramming and subsequent culture (kim et al., 2010; gore et al., 2011; hussein et al., 2011; lister et al., 2011) it is also important to address the safety of long-term culture, as shown recently; the occurrence of chromosomal rearrangements in long-term culture of 125 hesc and 11 hipsc (amps et al., 2011). there is a consensus that undifferentiated pluripotent stem cells (psc) will not be used directly in any clinical transplantations procedure, but instead their psc derived differentiated cells recently, results using hesc derived dopaminergic neurons have shown correct phenotype differentiation and grafting potential given by no tumor formation, maintenance of the grafted cells, and functional recovery in parkinsonian animal models in mice, rats, and monkeys (kriks et al., 2011). the protocols designed for this cell replacement assay were optimal regarding the phenotype, quantity of the cells, functionality, and immunological properties. integration of transplanted cells was achieved when single cells were transplanted, the use of proper biodegradable scaffolds must also be considered. in addition to this initial report regarding the neural lineage, differentiation protocols for other cell types are needed. even if transplantation in animal models is successful, it is important to generate safety strategies before clinical trials to appropriately remove undifferentiated psc from their psc derived therapeutic cells. strategies such as inserting suicide gene (drobyski et al., 2003; uchibori et al., 2009) might have controversial outcomes under clinical trials given their safety (yi et al. alternatively, strategies such as removal of undifferentiated cells using antibodies might be safer (tang et al., 2011). as discussed earlier, an optimal engraftment and cell replacement strategy should account for a minimal immune reaction in the recipient. this immune reaction occurs because the immune system of the recipient recognizes the grafted cells as foreign material or mismatched cellular components and thus generates a cascade of events that ultimately results in destruction and rejection of the grafted cells. this destruction can also compromise the recipient s immune status (petersen et al., 1975). immunoreactivity toward the graft is mainly caused by t cell response toward unmatched major histocompatibility complex (mhc); in humans called human leukocyte antigen (hla). if the profile is unmatched, it will result in rejection (lechler et al., 2005). this rejection can occur via direct allorecognition of the donor antigen presenting cells (apc) or via indirect recognition of apoptotic cells ingested by the recipients apc, in both cases apcs presenting unmatched mhcs (walsh et al., 2004). several groups have studied mhc profiles of hesc and their differentiated cells (swijnenburg et al., 2008; pearl et al., 2011). findings are that undifferentiated cells express mhc i antigens, though at low levels compared with somatic cells; but they do not express mhc ii molecules (drukker et al., 2002, 2006; li et al., 2004). during in vitro differentiation toward germ lineages, embryoid body (eb) formation, or teratoma formation mhc i expression increases dramatically (drukker and benvenisty, 2004). also culture methods of hesc can change antigen expression levels (rajala et al., 2010). careful selection of culture conditions, both for the undifferentiated hesc and for their differentiated derivatives is needed. human embryonic stem cells adopts the expression of non-human cell surface markers if exposed to such substances during culture (martin et al., 2005; hisamatsu-sakamoto et al., 2008) hence, optimal culture conditions must be xeno-free from the initial derivation and onward. these culture conditions must be carefully analyzed and scientific consensus must be achieved in order to raise current methodologies. challenges with the immunoreactivity of the transplantable cells could be addressed by rigorous immunosuppressive treatments. unfortunately, this is not desired, since there is a clear correlation between the length and intensity of exposure to immunosuppressive therapy and post-transplant risk of malignancy and tumor aggressiveness (gutierrez-dalmau and campistol, 2007). an interesting solution is costimulatory blockage of t cell response (grinnemo et al., 2006, 2008; swijnenburg et al., 2008; pearl et al., 2011. this immunosuppression strategy will generate tolerance to the grafted cells and thus increase graft survival; initial pharmaceutical agents have been developed and pending clinical applications to the fda are to give in the near future more information. in this mini-review we highlighted the most important areas to be considered under a cell replacement therapy. the possibility of using hipsc derived therapeutic cells in cell replacement therapies requires still long-term studies in non-human animal models addressing the questions of immunogenicity, epigenetic and genetic stability of these cells, and the optimized differentiation of the cells. the importance of profiling immunogenic markers as part of the stem-ness characterization and profiling of cells allocated in stem cell banks must be consider. such information has to be well protected so that it will not be lost in any given situation. adequate culture conditions, supporting correct immunogenicity of the cells under a transplantation assay is also required. next, the management of immunosuppression schemes must aim to a minimal time influencing the immunological status of the recipient. from all the information obtained, these profiles can then be used in combination with methodologies focused at monitoring the status of the transplanted cells. in a given scenario that undesired cells persist in the transplant, adequate counteracting actions have immediately to be taken. such possibilities have to be tested and the removal of undesired effects confirmed before starting cell transplantations. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) are an attractive cell source for regenerative medicine. these cells can be expanded to vast numbers and can be differentiated to many desired pluripotent stem cells (psc) derived therapeutic cells. cell replacement bears promises, but also challenges. the introduction of exogenous cells in a recipient must address several different topics; its safety, the exclusion of tumor formation, the immunological response and possible rejection, the cells cleanliness and their biological quality, and quantity representing the functionality of the psc derived therapeutic cells. tumor formation requires the removal of any psc remaining after differentiation. immunological rejection can be addressed with immunomodulation of the cells and the recipient. cleanliness can be optimized using good manufacturing practice quality systems. at last, the functionality of the cells must be tested in in vitro and in animal models. after addressing these challenges, precise strategies are developed to monitor the status of the cells at different times and in case of undesired results, corresponding counteracting strategies must exist before any clinical attempt.

PMC3277061

pubmed-354

the prevalence of diabetes has explosively increased worldwide, leading to an increase in the number of patients who suffer from diabetic vascular complications such as diabetic nephropathy (dn). dn is not only the leading cause of end-stage kidney disease but also a significant risk factor for cardiovascular disease. although the treatment for dn is important to improve patients ' prognosis, the current treatment remains suboptimal and therefore novel approaches for dn are urgently needed. dipeptidyl peptidase-4 inhibitors (dpp4i) have been recently introduced in clinic as a new oral hypoglycemic agent. dpp4 is a serine exopeptidase and processes the substrates that have either n-terminal proline or alanine including glucagon-like peptide-1 (glp-1) and glucose-dependent insulinotropic polypeptide (gip) known as incretin hormones. these incretin hormones are secreted from the small intestine after foods intake and induce the release of insulin from the pancreatic beta cells in the islets of langerhans. in addition to the reduction in the blood glucose level, it has been reported that dpp4i possesses properties and can protect the cardiovascular system, kidney, liver, and bone from injuries. since it has been reported that receptors for incretins were not expressed within glomerulus, protective effects of dpp4i for kidney might depend on another substrate for dpp4. for instance, stromal cell-derived factor-1 (sdf-1), one of the substrates for dpp4, can be stabilized by dpp4i. because sdf-1 is the most important protein for the recruitment and homing of bone marrow-derived regenerative stem cells, increased levels of sdf-1 through dpp4 inhibition has reportedly increased the intragraft number of progenitor cells that had contributed to the recovery from ischemia-reperfusion lung injury throughout the mammalian system. it has also been reported that dpp4i decreased the levels of urinary albumin excretion in diabetic patients [9, 10]; however, the mechanism behind how dpp4i ameliorates kidney injuries is not yet clear. pituitary adenylate cyclase-activating polypeptide (pacap) is one of the substrates of dpp4. pacap belongs to the glucagon superfamily of peptides and was originally purified from sheep hypothalamus in 1989. pacap is able to potentiate cyclic adenosine monophosphate (camp) production in pituitary cells and has a diverse array of biological functions, particularly neuroprotective and general cytoprotective roles, such as anti-apoptosis and anti-inflammation. although the highest concentrations are observed in the nervous system, a wide variety of tissues, such as heart, pancreas, liver, and kidney, produce pacap; secreted pacap also has protective effects on the different types of tissues and cells through the three different receptors: pac1, vpac1, and vpac2. pacap was found to exist in two forms: 38-amino-acid, a major form, and 27-amino-acid, a short one, truncated at c-terminal and to a much lesser extent in blood stream, respectively. recently, it has been reported that dpp4 degraded pacap (127) and (138) to form pacap (327) and (338). it has been reported that pacap has protective effects in the kidney against various insults, including ischemia/reperfusion injury, drug-induced nephrotoxicity, and myeloma light chain-induced nephropathy. pacap treatment in streptozotocin-induced diabetic animals decreased cytokine expression and prevented kidney injuries. these results indicated that pacap has protective roles in the kidney; however, it is unknown which cell types pacap affects and how it decreases cytokine expression. therefore, in this study, we investigated the effects of pacap on kidney cells and the mechanisms of how pacap decreases the expression of inflammatory cytokines. lipopolysaccharide (lps) and u-73122 (phospholipase c (plc) inhibitor) were obtained from sigma aldrich and h89 (protein kinase a (pka) inhibitor) was obtained from cell signaling. cultured mouse podocytes, transformed by ectopic expression of cyclin-dependent kinase 4, were kindly provided by dr. podocytes were maintained in roswell park memorial institute (rpmi) 1640 medium containing 10% fetal bovine serum (fbs, sigma aldrich, usa), penicillin (100 u/ml), and streptomycin (100 u/ml, sigma aldrich, usa). all procedures were performed in accordance with the guidelines of the research center for animal life science of chiba university of medical science. six- to nine-week-old male c57bl/6j mice were purchased from clea japan (japan) and housed in cages and maintained on a 12 h light/12 h dark cycle. the glomeruli were isolated by dynabeads (invitrogen, norway) perfusion technique as previously described. the kidney tissues were dissected from the mouse, fixed in oct compound, and stored at 80c until use. several 6 m thick frozen sections were prepared and fixed with ice-cold methanol, air-dried for 30 min at room temperature, and then blocked with blocking buffer containing 2% bovine serum albumin (bsa) and 0.05% tween-20 in pbs. after washing with tween in pbs (pbst; 0.1% tween-20 in pbs), the slides were coincubated with vpac1 antibody (1: 50 dilution, santa cruz: sc-30019), podocalyxin (1: 200 dilution, r&d systems: mab1556), and toll-like receptor 4 (1: 50 dilution, santa cruz: sc-10741). the slides were imaged by the axio observer d1 (zeiss) or with a confocal laser scanning microscope (leica lsm5 pascal). the podocytes were cultured in lab-tek ii chamber slides (nalge nunc international), deprived of serum for 24 h, and stimulated with 100 ng/ml lps for 1 h. then the podocytes were fixed in ice-cold methanol for 10 min, rinsed with pbs, and incubated in a blocking buffer containing 0.5% bsa and 0.25% tween-20 in pbs for 1 h at room temperature. the slides were then incubated with an anti-nuclear factor-kappa b (nf-b) antibody (1: 50, santa cruz: sc-372) overnight at 4c, washed several times with pbs, and then incubated with 1: 1000 dilution of fluorescent-conjugated secondary antibody (alexa fluor 488 goat anti-rabbit igg, invitrogen) for 1 h at room temperature. the slides were then washed with pbst, nuclear-stained with hoechst 33342, and mounted with a fluorescence mounting medium. for the evaluation of immunostaining for nf-b, the cells that had accumulated nf-b in their nuclei were counted at 10 randomly selected areas. the total rna was extracted using the purelink rna mini kit (ambion: 12183-018a) according to the manufacturer's protocols. two micrograms of total rna were reverse-transcribed with the superscript iii reverse transcriptase kit (invitrogen: 18080). the complementary dna product was then subjected to pcr using the system with different pairs of oligonucleotide primers that were shown in supplemental table 1, available online at http://dx.doi.org/10.1155/2015/727152. the cycling conditions were as follows: a denaturation step at 94c for 30 s followed by 30 cycles, annealing at 55c for both pac1 and -actin and 58c for vpac1 for 30 s, and elongation at 72c for 30 s with the final extension at 72c for 7 min. the pcr products were separated by gel electrophoresis on a 2% agarose gel with ethidium bromide; the signals were quantified using a chemidoc mp imagelab pcsystem (bio-rad). quantitative pcr was performed in the 7500 fast real-time pcr system (applied biosystems) using the fast sybr green master mix (applied biosystems: 4385612). pcr conditions were set for incubation at 95c for 20 s followed by 40 cycles of 3 s at 95c and 30 s at 60c. podocytes were lysed in a sds sample buffer containing 0.5 m tris-hcl, 10% sds, glycerol, bromophenol blue, and 3% 2-mercaptoethanol. they were boiled at 95c for 10 min, and then the protein was fractionated on 10%15% polyacrylamide gels (e-pagel, atto corporation, japan). the protein was transferred to pvdf membranes (immobilon-p transfer membrane); the membranes were blocked for 1 h at room temperature to block the nonspecific binding of the protein and incubated for 18 h at 4c with primary antibodies. the primary antibodies that were used were as follows: anti-vpac1 antibody (1: 200 dilution, santa cruz: sc-30019), anti-phospho-p44/42 mapk (extracellular signal-regulated kinase (erk1/2)) antibody (1: 1000 dilution, cell-signaling: number 9106), and anti-p44/42 mapk (erk1/2) antibody (1: 1000 dilution, cell-signaling: number 9102). the blots were then washed and incubated with second antibodies, peroxidase-conjugated anti-rabbit immunoglobulins (1: 2500 dilution, ge healthcare), or goat anti-mouse igg-hrp (1: 2500 dilution, santa cruz: sc-2055) for 1 h at room temperature. after washing for several times, the antibody binding sites were visualized using an ecl western blotting detection system (ge healthcare: rpn2106). the blots were quantified using a chemidoc mp imagelab pcsystem (bio-rad). podocytes were plated in 96-well dishes at 50% confluency and transfected with 10 ng per well camp response element- (cre-) lux construct that contained consecutive camp response element by lipofectamine ltx and plus reagents (invitrogen). at six hours after transfection, cells were deprived of serum for 48 h. and then, the cells were stimulated with pacap for 1 h. the luciferase activities in the cell lysate were measured in a 1420 arvo sx multilabel counter (wallac, inc., gaithersburg, md) using the dual luciferase reporter assay system (promega, madison, wi). to correct for potential variation in transfection efficiency, prl-tk vector (promega) was cotransfected in all experiments. statistical analyses were done using sas 9.3 and/or microsoft office excel by student's unpaired t-test. pacap works as a ligand and binds with specific receptors in order to transduce intracellular signals. therefore, we first examined in which cell types pacap transduces intracellular signal within the glomeruli. reverse transcriptase pcr revealed that mrna for vpac1 but not pac1 was detected in glomeruli as shown in figure 1(a). immunohistochemistry revealed that vpac1 was primarily expressed in podocalyxin-positive cells (figures 1(b) and 1(c)). complete absence of signal was observed when primary antibodies were omitted (data not shown). rt-pcr (figure 1(a)) and western blotting (figure 1(d)) also confirmed that the vpac1 mrna and protein were expressed not only in isolated glomeruli but also in cultured podocytes. because vpac1, a pacap receptor, was expressed on podocytes, we next examined whether pacap acted on podocytes. it has been reported that pacap binds with vpac1, which is coupled with gs protein and induces rapid camp production, which ultimately activates the pka pathway. ten nm pacap significantly increased the cellular contents of camp in a time dependent manner (supplemental figure 1). increased levels of camp in the presence of pacap was associated with increased levels of camp responsive element promoter activities (figure 2(a)) and phosphorylated camp response element binding protein (creb) (figure 2(b)). these results indicated that pacap primarily sent signals to glomerular podocytes, especially activating the camp/pka pathway in the podocytes. it has been reported that pacap also played an anti-inflammatory role in peripheral and central tissues. toll-like receptors (tlrs) are the principal mediators of innate immunity and are reportedly activated by bacterial endotoxins. the tlr4 proteins were localized to podocytes and endothelial cells by immunohistochemistry as shown in figure 3. as shown in figure 4, lps, a ligand of tlr4, significantly increased the expression of il-6 and mcp-1. in the presence of pacap, the increased expressions of il-6 and mcp-1 were significantly attenuated. the expression of tlr2, tlr4, and myeloid differentiation primary response gene 88 (myd88), a tlr adaptor protein, but not that of il-1 receptor associated kinase-1 (irak1), a down steam signaling molecule of myd88, was decreased in the presence of pacap. it has been reported that pacap activates not only adenylate cyclase (ac), which eventually activates the pka signaling pathway, but also plc, which leads to an increase in intracellular calcium signaling. then, we examined the effect of h89, an inhibitor of the pka signaling pathway, and of u-73122, a known plc inhibitor, on the increased levels of mcp-1. mcp-1 expression was reversed by h-89 but not by u-73122 as shown in figure 5. these results indicated that pacap suppressed the expression of mcp-1 through the camp/pka-dependent signaling pathway. it has been reported that lps can activate tlr4 and subsequently the myd88 transfers signals by activating nf-b and mitogen-activated protein kinase, which eventually results in the expression of proinflammatory cytokines. therefore, we examined the effects of pacap on the nf-b transnuclear localization and phosphorylation of erk. figures 6 and 7 showed that, in the presence of lps, nf-b transnuclear localization and phosphorylation of erk were significantly increased and pacap significantly ameliorated both. in the present study, we reported that vpac1, a pacap receptor, was exclusively expressed in glomerular podocytes. pacap, a substrate for dpp4, activated the camp/pka signaling pathway in cultured podocytes and inhibited the expression of inflammatory cytokines, which were induced by lps/tlr4 signaling. pacap was first identified 25 years ago and has become one of the most studied neuropeptides [11, 12]. pacap is expressed not only throughout the nervous system but also in peripheral tissues, such as the gastrointestinal tract, the endocrine tissues, and the urinary tract. in addition to widespread expression of pacap, it reportedly has a variety of biological functions that are primarily neuroprotective and general cytoprotective roles through the specific receptors, such as pac1, vpac1, and vpac2. for instance, pacap has protected the kidney from ischemia-induced kidney injuries, myeloma injuries, cisplatin-induced renal failure, cyclosporine a-induced nephrotoxicity, and dn. these renoprotective actions appeared to depend on the anti-inflammatory actions on circulating cells, glomerular cells, and tubular cells. the kidney is injured by a wide variety of insults leading to chronic kidney diseases (ckd). among ckd reported that pacap-treated streptozotocin-induced diabetic mice had fewer histological changes, such as pas-positive areas within the glomeruli, tubular damage, and arteriolar hyalinosis compared with the controls. pacap treatment also decreased the expression of a number of cytokines that were upregulated in diabetic conditions. however, the specific cell types that are affected by pacap directly have not been reported. jean cr reported that vpac1, but not pac1 and vpac2, was expressed in human glomeruli. in agreement with this previous report, we found that vpac1 was expressed within the glomerulus and localized its expression to podocytes. recent studies of podocyte-expressed genes have considerably enhanced our knowledge of the molecular mechanisms of glomerular filtration. a number of podocyte-expressed genes, such as nephrotic syndrome type-1 (nphs-1), nephrotic syndrome type-2 (nphs-2); actin-related proteins such as -actinin 4, inverted formin 2, and cd2-associated protein (cd2ap); and cytoplasmic signaling molecules, such as phospholipase c, epsilon-1 (plce1) and transient receptor potential cation channel, subfamily c, member 6 (trpc6), were all involved in maintaining the cytoskeletal dynamics. therefore, among the glomerular cells, the podocytes are becoming the most highlighted cell type in the field of glomerular research of most glomerular diseases. thus, it is intriguing that pacap may give signals to podocytes. because it has been reported that pacap has anti-inflammatory effects in a wide variety of disease models, we focused on the anti-inflammatory effects of pacap on cultured podocytes. among the inflammatory signals, tlr, a sensor in the innate immune system, has been highlighted in the development of dn. it has been reported that tlr2 and tlr4 have been expressed in podocytes and activated in diabetic conditions. activated tlrs have been reported to induce proinflammatory cytokines in podocytes and a disorganized podocyte cytoskeletal structure which eventually led to proteinuria. therefore, our finding about the inhibition of podocytes ' tlr-related signaling in the presence pacap is significant in terms of treating dn. indeed, it has been recently reported that the treatment of pacap effectively counteracted diabetes induced podocyte injury in vivo. tlr is a conserved family of pattern recognition receptors, which is triggered by microbial pathogens, fatty acids, uric acids, oxidative stress, and high glucose. when tlr is activated, it recruits different adaptor molecules, such as myd88 and irak-1. activated myd88-dependent or myd88-independent pathway engages the activation of erk and nf-b signaling, which results in inflammatory cytokines. because pacap attenuated both activation of erk and nf-b in our case it has reported that administration of pacap attenuated the expression of tlrs and its adaptor protein in kidney. in agreement with these previous reports, lps-induced inflammation related genes, such as mcp-1 and il-6, and tlr signals related genes, such as tlr2, tlr4, and myd88 but not irak-1 were suppressed by pacap in this study. it has been reported that lps-induced expression of tlr2 has been suppressed by ciprofloxacin through the production of prostaglandin (pg) e2 but not through pka in monocyte/macrophages. because pge2 was reportedly induced in the presence of pacap, ns398, an inhibitor of pge2, was tested and was not able to reverse the effects of pacap, which attenuated the tlr4 expression (data not shown). thus, the precise mechanisms of how pacap inhibits the expression of tlrs and myd88 need to be further analyzed. dpp4i has been introduced in clinic and has become one of the most promising options to treat diabetic patients owing to their effectiveness in glucose lowering and low risk of hypoglycemia and weight gain. dpp4i stabilizes its substrates and incretins (glp-1 and gip), which are the main substrates for lowering blood glucose. beyond the hypoglycemic action, it has been reported that dpp4i has numerous potential benefits in diabetic vascular complications, including dn. the possible renoprotective effects of dpp4i include the reduction of oxidative stress and anti-inflammation and the improvement of endothelial dysfunctions through incretin-dependent and -independent pathways. since it has been reported that glp-1 receptor was not detected in glomerulus and we were also able to detect neither glp-1 receptor nor gip receptor both in glomerulus and cultured podocyte (supplemental figure 2: expression of glp-1 receptor and gip receptor were evaluated by rt-pcr), incretin independent pathway might have roles in protecting against dn. pacap is n-terminally truncated by dpp4, and it has been reported that dpp4-degraded pacap loses its insulinotropic effects. because the n-terminal of pacap is a high-affinity site for vpac1 binding, dpp4-degraded pacap may reduce the signals through vpac1. we also confirmed that the treatment of linagliptin, dpp4i, inhibited the degradation of pacap which secreted from cultured cells (supplemental figure 3: linagliptin protect pacap from degradation). in this study, we demonstrated that pacap had anti-inflammatory effects on podocytes, leading to an assumption that dpp4i protects kidney from injuries through the stabilization of pacap. nevertheless, we have not confirmed that pacap has protective roles in vivo. because the half-life of pacap injected into mice and humans is between 2 and 10 min due to enzymatic degradation, truncated pacap is required to be produced in order to get pacap more stable in vivo without losing receptor activating effects. in conclusion, we have shown that pacap has anti-inflammatory effects on glomerular podocytes. because treatment options for dn are still limited, pacap may be a good candidate for prevention/attenuation of dn. however, more study is definitely needed to prove this possibility.

diabetic nephropathy (dn) is a leading cause of end-stage kidney disease; however, there are few treatment options. inflammation plays a crucial role in the initiation and/or progression of dn. pituitary adenylate cyclase-activating polypeptide (pacap) is a neuropeptide, which was originally isolated from the ovine hypothalamus and reportedly has diverse biological functions. it has been reported that pacap has renoprotective effects in different models of kidney pathology. however, the specific cell types within the kidney that are protected by pacap have not yet been reported. in this study, we localized vpac1, one of the pacap receptors, to glomerular podocytes, which also reportedly has crucial roles not only in glomerular physiology but also in pathology. pacap was effective in the downregulation of proinflammatory cytokines, such as monocyte chemoattractant protein-1 (mcp-1) and interleukin-6, which had been induced by the activation of toll-like receptor (tlr) with lipopolysaccharide. pacap also had downregulated the expression of mcp-1 through the protein kinase a signaling pathway; this led to the attenuation of the activation of extracellular signal-regulated kinase and nuclear factor-kappa b signaling. our results suggested that pacap could be a possible treatment option for dn through the use of anti-inflammation effects on glomerular podocytes.

PMC4363873

pubmed-355

to the surprise and deep disappointment of all involved in the treatment of lung cancer, several large trials did not demonstrate any benefit of tyrosine kinase inhibitors (tkis) as an addition to chemotherapy [13]. basic and clinical research then focused on mutations of the gene for epidermal growth factor receptor (egfr) as a predictive factor for response to monotherapy with tkis and to development of new compounds with broader and/or irreversible inhibition. the biological basis for the negative experience with combined treatment gefitinib and erlotinib met all three standard criteria for inclusion in a combination with chemotherapy: activity as monotherapy, different mechanism of action, and different toxicity. why, then, did the combination not work? as explained in a recent editorial, we believe that the cells of tumors sensitive to tkis are pushed into the g-0 phase of the cell cycle and therefore become resistant to cytotoxic drugs. if antagonism between the two classes of drugs is really the biological basis for the aforementioned negative experience, then an optimal combination of tkis and chemotherapy should be in an intermittent, rather than a continuous schedule. this brief report presents a single-institution experience on intermittent chemotherapy and tki in a small series of patients with advanced adenocarcinoma of the lung. our hypothesis was that intermittent treatment would lead to superior time to progression, when compared to experience with chemotherapy alone. if confirmed, such a result would be a solid basis for a randomised clinical trial. patients eligible for the trial were chemonave with microscopically confirmed adenocarcinoma of the lung, had stage iii b (wet) or iv according to uicc-tnm classification (6th edition), had smoking history of less than 10 packs in years, had an ecog performance status 0 or 1, and had adequate parameters of hematological, liver, and renal function to receive cisplatin-based chemotherapy. in the absence of neurological symptoms, patients with brain metastases were eligible and were treated with brain irradiation only in case of intracranial progression. all patients had their diagnosis confirmed by biopsy or cytology. at the time when the trial was initiated, testing for egfr mutations was not available. within three weeks prior to treatment, the precise extent of the disease was determined by chest x-ray and ct scanning of the chest, upper abdomen, and brain. since 2008, pet-ct scanning has been available and included in the initial diagnostics and in followup. the treatment started with four cycles of intermittent chemotherapy and erlotinib according to the following schedule: day 1: gemcitabine 1250 mg/m in 30-minute infusion, day 2: cisplatin 75 mg/m, with appropriate hydration and antiemetics, day 4: gemcitabine 1250 mg/m in 30-minute infusion, days 515: erlotinib 150 mg daily p.o. the number of cycles depended on tolerance to cisplatin-based chemotherapy and was determined individually. immediately after the last cycle, patients continued with erlotinib 150 mg/m daily continuously until progression or unacceptable toxicity. definition of complete response (cr), partial response (pr), stable disease (sd), and progression followed the recist criteria. the first evaluation of response was done during the third cycle of intermittent therapy, with confirmation of response during the fifth cycle. control radiological examinations were repeated every 2 months for chest x-ray, every 4 months for ct, and at 6 and 12 months for pet-ct (only patients who had this examination during their initial diagnostics). in october 2010, all biopsy samples were reviewed, and specimens with more than 10% of tumour tissue were analyzed. genomic dna was extracted from formalin-fixed, paraffin-embedded tissue sections using qiaamp dna ffpe tissue kit (qiagen, hilden, germany) according to the manufacturer's instructions. quantification of extracted dna was done on qubit fluorometer (invitrogen, carlsbad, usa). to detect egfr gene-activating mutations, we used therascreen egfr29 mutation kit (dxs diagnostics, qiagen, manchester, uk). all realtime pcr reactions were performed in a 25 l final volume on abi 7500 instrument (applied biosystems, carlsbad, usa). after standard chemotherapy for metastatic nonsmall cell carcinoma, the expected ttp is 5 months. the size of this single-arm nonrandomised trial of intermittent therapy was based on the assumption of 9 months as the median time to progression (ttp). to obtain such a result with a confidence interval of 612 months, we planned to recruit 40 patients. the investigators strictly followed recommendations of the helsinki declaration (1964, with later amendments) and of the european council convention on protection of human rights in bio-medicine, as accepted in oviedo in 1997. the protocol was approved by the institutional review board (institute of oncology, ljubljana) and by the national committee for medical ethics, ministry of health, republic of slovenia. one patient was later found to have metastatic carcinoma of the pancreas rather than primary lung cancer and was excluded from all further analyses. with 12 patients each, twelve patients were never-smokers, and most were in good general condition (ps 0-1 for 21 patients). with the exception of a single patient with wet bone metastases were the most common site of metastatic disease, followed by pleura/pericardium, contralateral lung metastases, and liver. two or more sites of metastatic disease were documented in 4 and 12 patients, respectively (table 1). three patients had only cytological diagnosis, and an additional 3 had biopsy samples too small to allow for analysis of egfr mutations in tumor cells. of the 18 adequate samples, 8 were positive for egfr gene-activating mutations. the actual number of cycles of intermittent therapy was from 1 to 6 cycles (median: 4 cycles). due to early progression, 7 patients were still on maintenance treatment with erlotinib, and an additional patient stopped treatment with erlotinib after 12 months in pet-ct confirmed complete remission (figures 1 and 2). for the remaining patients, median total duration of treatment was 10 months. during the initial phase, side effects of maintenance with erlotinib were skin toxicity (grade 3: 1 pt; grade 2: 11 pts) and diarrhea (grade 2 in 1 pt). all patients are evaluable for response, and no patient has been lost to followup. for the whole group of 24 patients, complete remission (cr) was seen in 5 pts; partial remission (pr) in 9 pts (response rate 58%), minimal response or stable disease (sd) in 8 pts, and progression in 2 pts. a clear and statistically significant (p<.05) correlation was seen between the presence of activating egfr mutations and response. among the 8 patients who were positive for egfr gene-activating mutations, 4 complete and no cr and only 2 pr were seen among the 10 patients negative for mutations (table 2). for the whole group, median time to progression (ttp) was 13.4 months, and median overall survival (os) was 23 months. median ttp and os for this group was 21.5 months and 24.2 months, respectively. for patients without egfr mutations, ttp was 5 months, and os was 7 months (table 2 and figures 3 and 4). this clinical trial was launched at a time when routine testing for egfr gene-activating mutations was not yet available. selection of patients for a combination of chemotherapy and erlotinib was made on the basis of classical histopathology (adenocarcinoma) and smoking status. since testing for egfr gene mutations is now available, it is clear that patients with activating mutations are those who really benefit from tkis. in addition, standard first-line treatment for patients with activating egfr mutations is now monotherapy with a tki [6, 7]. since continuing a trial with the same selection criteria and without considering the status of egfr gene activating mutations was not justified, the research group made a decision to close the trial and analyse the experience. in order to get a longer interval for intermittent erlotinib, gemcitabine was given on days 1 and 4 of the cycle. when compared to the standard day 1 and day 8 schedule, this minor modification in timing of cytotoxic drugs did not have any adverse effect on the tolerance to treatment. clearly, other platin-based schedules which apply chemotherapy on a 3-weekly basis (such as pemetrexed-cisplatin or paclitaxel-carboplatin) can offer an even longer interval for tkis and might be considered for future trials of intermittent treatment. two other groups recently reported promising experience with intermittent chemotherapy and tkis. in a trial from the usa, two schedules of intermittent treatment were tested. in combination with pemetrexed (500 mg/m on day 1), erlotinib was given either as a pulse application in a high dose (range: 800 to 1400 mg) given on days 2, 9 and 16, or in lower doses (150250 mg daily) on days 2 to 16. while tolerance to this treatment was good, the small number and heterogeneity of patients recruited into this trial do not allow for any clear conclusion regarding the effectiveness of intermittent treatment. of more importance this study from asia compared gemcitabine and either cisplatin or carboplatin to a schedule with addition of intermittent application of erlotinib (150 mg on days 14 to 28 of the cycle) and reported significantly superior ttp with the intermittent schedule. their experience is most valuable but may not be of direct relevance for the rest of the world, due to the well-known differences in sensitivity of lung cancer to tkis between asian and caucasian patients. despite its small size, our trial can offer valuable experience for further research on optimisation of treatment with combinations of chemotherapy and tkis. looking at the whole series of patients, we can conclude that intermittent chemotherapy and erlotinib is a treatment of very low toxicity. it is also clear that the efficacy of treatment is closely related to the presence or absence of egfr gene-activating mutations. the most important finding is the excellent response rate with a substantial proportion of complete responses and prolonged ttp and os for patients positive for egfr gene-activating mutations. for many years, the maximal expectation of a patient with metastatic nonsmall cell lung cancer was a partial remission of relatively short duration in the range of 5 to 9 months. with intermittent treatment, while the number of patients in our trial is small and any definitive conclusion would be premature, we nevertheless believe that further research of intermittent therapy for patients positive for egfr gene-activating mutations is warranted. a randomised trial comparing first-line tki as monotherapy to the intermittent schedule should clarify the real value of this new approach.

background. intermittent application of chemotherapy and tyrosine kinase inhibitors may avoid antagonism between the two classes of drugs. this hypothesis was tested in a phase ii clinical trial. patients and methods. eligible patients were nonsmokers or light smokers, chemo-nave, with metastatic adenocarcinoma of the lung. treatment: 4 to 6 cycles of gemcitabine 1250 mg/m2 on days 1 and 4, cisplatin 75 mg/m2 on day 2, and erlotnib 150 mg daily on days 515, followed by erlotinib as maintenance. results. 24 patients entered the trial. four pts had grade 3 toxicity. complete remission (cr) and partial remission (pr) were seen in 5 pts and 9 pts, respectively (response rate 58%). median time to progression (ttp) was 13.4 months and median overall survival (os) was 23 months. when compared to patients with negative or unknown status of egfr mutations, 8 patients with egfr gene activating mutations had significantly superior experience: 4 cr and 4 pr, with median ttp 21.5 months and os 24.2 months (p<.05). conclusions. intermittent schedule with gemcitabine, cisplatin and erlotinib has mild toxicity. for patients who are positive for egfr gene activating mutations, this treatment offers excellent response rate, time to progression and survival .

PMC3085288

pubmed-356

using metagenomic deep sequencing, we analyzed fecal samples from 180 infants and children ages 7 days96 months (mean 18.7 months) in tunisia who had unexplained diarrhea that tested negative for rotavirus, norovirus, astrovirus, sapovirus, adenovirus types 40 and 41, and aichi virus by reverse transcription pcr (7). the fecal supernatants were filtered through a 0.45-m filter (millipore, darmstadt, germany) to remove bacterium-sized particles, and the filtrates were digested with a mixture of dnases (turbo dnase from ambion, carlsbad, ca, usa; baseline-zero from epicenter, madison, wi, usa; and benzonase from novagen, san diego, ca, usa) and rnase (fermentas, pittsburgh, pa, usa) to digest unprotected nucleic acids. enriched viral nucleic acids (rna and dna) were then extracted and amplified by using scriptseq v2 rna-seq library preparation kit (epicenter) and analyzed in pools of 10 specimens in 2 illumina miseq run of 250-bp end reads, yielding 20,693,619 unique sequences. we compared the illumina sequences with the genbank nonredundant protein databases using blastx (http://blast.ncbi.nlm.nih.gov/blast.cgi). using a blastx e-score cutoff of 10, we identified, in decreasing frequency, sequences related to the mammalian viruses: sapovirus (120,177 reads), anelloviridae (14,841 reads), parechovirus (10,557 reads), norovirus (4,551 reads), enterovirus (3,857 reads), circoviridae (2,127 reads), group a rotavirus (839 reads), adeno-associated virus (812 reads), picobirnavirus (274 reads), bufavirus (168 reads), wu polyomavirus (136 reads), bocavirus (62 reads), adenovirus (58 reads), papillomavirus (22 reads), cosavirus (20 reads), group c rotavirus (17 reads), human astrovirus 1 (14 reads), salivirus (4 reads), and aichi virus (2 reads). one pool showed a single read encoding a parvovirus-like protein segment with high levels of genetic similarity (blastx e-score of 5 10) to the nonstructural protein (ns) 1 of rat parvovirus (genbank accession no. was then identified by using pcr and underwent further deep sequencing as above, generating 11 more parovirus sequences. no other eukaryotic viral sequences were identified from 260,000 unique sequence reads from this patient. the near complete parvovirus genome was then acquired by filling genome gaps by pcr and amplifying 5 and 3 extremities using race (rapid amplification of cdna ends, life technologies). we named this virus tusavirus 1 for tunisian stool-associated parvovirus. a nearly complete 4,424-bp genome (tusavirus 1, genbank accession no. kj495710) was successfully acquired with partial 5 untranslated region (243 bp), complete ns1 open reading frame (625 aa), complete viral protein (vp) 1 open reading frame (715 aa), and a partial 3 untranslated region (68 bp). tusavirus has a potential upstream start codon mss in a weaker kozak consensus sequence than maq (figure, panel a), which we selected as the start codon. the walker loop gpattgks [gxxxxgk(t/s)], which is an atp- or gtp-binding motif, was found in the ns1. potential splicing signals to express vp1 were identified on the basis of alignments to other protoparvoviruses and classic rna splicing motifs (figure, panel a). the phospholipase a2 (pla2) motif was identified in vp1 n-termini with expected calcium-binding site and catalytic residues. the methionine codon of vp2 was located upstream of glycine-rich sequence (gggaraggvg). an unusual serine-rich sequence (sssdsgpsss) was also seen near vp1 n-termini. the alignment of the pla2 regions of representatives of 5 protoparvovirus species show the calcium-binding region and catalytic residues in tusavirus. pairwise sliding window of percentage nucleotide similarity of tusavirus aligns with the genetically closest kilham rat parvovirus. b) phylogenetic trees generated with nonstructural protein (ns) 1 and vp1 of tusavirus and of the 5 international committee on taxonomy of viruses designated species in the protoparvovirus genus. fpv, feline parvovirus; mev, mink enteritis virus; cpv, canine parvovirus; rapv, raccoon parvovirus; rpv1, rat parvovirus 1; mvmp, minute virus of mice, prototype; hapv, hamster parvovirus; ppv-kr, porcine parvovirus kresse; simian bupv, simian bufavirus; bupv1, bufavirus 1; bupv2, bufavirus 2; amdv, aleutian mink disease virus; gfav, gray fox amdovirus; b19v-lali, human parvovirus b19-lali. bootstrap values (based on 100 replicates) for each node are given if>70%. protein sequence alignments were made by using clustalx version 2.0.3 (http://www.clustal.org) with the default settings; a phylogenetic tree with 100 bootstrap resamples of the alignment datasets was generated by using the neighbor-joining method based on the jones-taylor-thornton matrix-based model in mega5 (http://www.megasoftware.net). phylogenetic analysis showed that tusavirus 1 was distinct from known members of the protoparvovirus genus (figure, panel b). vp1 and vp2 shared identities of 39% and 37%, respectively, to those of kilham rat parvovirus. according to the international committee on taxonomy of viruses, the members of the same parvovirus genus should share>30% and members of the same species>85% aa identity in ns1. the protoparvovirus genus currently comprises species infecting carnivores, rodents, pigs, and humans (1). tusavirus 1 is proposed as prototype for primate protoparvovirus 2 species that would join bufaviruses as human viruses in this genus. we used a nested pcr targeting ns1 to determine the prevalence of this virus in the 180 tunisia diarrhea samples. primers tusa-f1 (5-gaagaagctggaaactgtggtca-3) and tusa-r1 (5-ctcgtctttctcccaggcatct-3) were used for the first round of pcr, and primers tusa-f2 (5-attgctccaacaccagtcatca-3) and tusa-r2 (5-tctggtctggtccaatcttcttc-3) for the second round of pcr. the pcr conditions were: 95c for 5 min, 35 cycles 95c for 30 s, 52c or 51c (for the first or second round, respectively) for 30 s, and 72c for 1 min, a final extension at 72c for 10 min. no samples except the one initially detected by deep sequencing were pcr positive, yielding a low prevalence of 0.56% (1/180) in this tunisian population. we detected fecal shedding of a previously uncharacterized parvovirus in a child with unexplained diarrhea. the 18-month-old girl showed twice daily liquid and greenish feces over 3 days but no fever (37.4c), vomiting, or dehydration. to identify other viral infections in this patient, no other mammalian virus was detected, suggesting a possible role for tusavirus 1 in this patient s gastrointestinal illness, although the lack of testing for pathogenic bacteria and parasites does not enable us to exclude these alternative explanations. control pcr studies of unexplained diarrhea and serologic tests, are needed to define the prevalence and disease association of this new parvovirus species in different age groups and populations.

a divergent parvovirus genome was the only eukaryotic viral sequence detected in feces of a tunisian child with unexplained diarrhea. tusavirus 1 shared 44% and 39% identity with the nonstructural protein 1 and viral protein 1, respectively, of the closest genome, kilham rat parvovirus, indicating presence of a new human viral species in the protoparvovirus genus.

PMC4214302

pubmed-357

corneal epithelium is able to alter its thickness to mask subepithelial stromal irregularities and maintain a smooth anterior surface of the eye. laser refractive surgery such as lasik alters the anterior corneal contour and leads to remodeling of corneal epithelium. we estimated the extent of the epithelial remodeling after lasik with a mathematical model in a previous study. however, in that study, we did not have the capability to measure the corneal epithelial thickness to validate the model directly. instead, we constructed the model constants based on regression in manifest refraction after lasik. direct measurement of epithelial thickness change may help to better understand corneal epithelial remodeling after lasik and improve lasik ablation patterns with less regression and surgery-induced aberrations. previous studies used confocal microscopy to measure epithelial thickness, but the number of points measured was limited and the measurement was time consuming. very high-frequency digital ultrasound was also used to map corneal epithelium and stromal thickness [4, 5]. however, because ultrasound can not pass through air, this technique required immersing the cornea in a fluid bath. though both confocal microscopy and very high-frequency digital ultrasound are feasible in measuring corneal epithelial thickness, they are not often used in routine lasik because they required touching the cornea. optical coherence tomography (oct) is a noncontact imaging technique based on principles of low-coherence interferometry. the current generation of oct is based on fourier-domain technique [6, 7]. in a recent article, we demonstrated that a commercial fourier-domain oct could automatically map the corneal epithelial thickness with good repeatability. in this study, we use this algorithm to map corneal epithelial thickness for eyes before and after myopic lasik surgeries. the changes in epithelial thickness were used to validate the smoothing model we mentioned above. this prospective observational study was conducted at doheny eye institute, los angeles, ca. the lasik subjects enrolled in this study had no history of eye surgery and were comprehensively examined to exclude any eye diseases including dry eye. soft contact lenses wearers were asked to stop wearing contact lenses at least two weeks prior to lasik. the treatment of study subjects was in accordance with the tenets of the declaration of helsinki. the laser settings were based on manifest and cycloplegic refractions calculated at the corneal plane. the lasik flap was created with a 60 khz femtosecond laser (intralase, abbott medical optics, santa ana, ca). the femtosecond flap thickness was programmed to 110 m with a diameter of 9.0 mm and a 70-degree angled side cut. the stromal ablations were performed with visx star s4 ir customvue excimer laser (abbott medical optics, santa ana, ca). the optical zone was set to 6.5 mm in diameter centered on the pupil center with blend/transition zones up to 8.0 mm. to measure epithelial thickness before and after lasik, a commercial fourier-domain oct system (rtvue, optovue inc., fremont, ca) with a speed of 26,000 axial scans per second was used. a pachymetry+cpwr scan pattern (6 mm scan diameter, 8 radials, 1024 axial-scans each, repeated 5 times) centered at the pupil center was used to map the cornea. the subjects were asked to look straight ahead and fixate on the internal fixation target of the oct system. the oct scan pattern was repeated 2 times on each eye during the same visit. the algorithm was described in a previous article and was available in the commercial rtvue software. the average epithelial thickness over the central 1 mm diameter, 1~2 mm, 2~3 mm, 3~4 mm, 4~5 mm, and 5~6 mm annular zones, was used in the analysis. correlation of lasik-induced change in epithelial thickness with the amount of spherical equivalent of lasik correction was investigated. a smoothing constant based on our epithelial smoothing model, the change in epithelial thickness could be calculated by applying a first-order, 2-dimensional butterworth low-pass filter to the ablation profile. the cutoff frequency of the butterworth filter was the reciprocal of the smoothing constant. if we simulated the ablation profile for 1 d special myopic lasik using munnerlyn algorithm and assumed the optical zone diameter to be 6.5 mm, the smoothing contact could be estimated. the smoothing constant has a unit of length and can be thought of as the radius over which epithelial smoothing occurs. ablation simulations were performed using matlab software version 5.3 (the mathworks, inc., paired t-test was used to compare the difference of preoperative and postoperative epithelial thickness. generalized estimating equation was used to account for the intereye correlation in the variance of t-test. statistical analysis was performed using the microsoft excel and sas 9.1 (sas institute inc., cary, nc, usa). nineteen eyes (10 right eyes, 9 left eyes) from 11 myopic lasik patients (6 women, 5 men) were analyzed in the study. the spherical equivalent of lasik correction ranged from 1.69 d to 6.75 d (mean: 4.39 1.63 d). corneal epithelium was thicker on the inferior side compared to that on the superior side both before (figure 1(a)) and after lasik (figure 1(b)). the average central epithelial thickness was measured to be 52.6 4.1 m (40.9~60.6 m) before lasik and 56.2 4.3 m (50.0~65.5 m) 3 months after lasik (p=0.013, figure 2). the average epithelial thickness at 5~6 mm annular zone was 51.6 6.6 m (39.6~67.4 m) before lasik and 54.8 4.3 m (49.8~68.0 m) 3 months after lasik (p=0.024, figure 2). the epithelial thickening reached maximum at about 4 mm diameter and tapered off toward the peripheral (figure 3). the change in average central epithelial thickness was significantly correlated with lasik spherical equivalent setting (figure 4). the slope of 1.15 indicated that, for every diopter of myopic lasik correction, the central epithelial thickness increased by 1.15 m, which corresponded to a smoothing constant of about 0.46 mm. based on this smoothing constant pattern; that is, the maximum epithelial thickening occurred at an annular area around the center (figure 5). previous studies have demonstrated that it is feasible to use oct to measure the thickness of different layers of the cornea, such as the epithelium, stroma, and lasik flap using time-domain oct. however, the axial resolution of the earlier oct systems was low and the manual computer-caliper measurement was time consuming. in this study, we used newer fourier-domain oct which has faster scan rate and higher axial resolution with automated measurement of epithelial thickness. the finding agreed with previous oct studies [8, 12] as well as results with very high-frequency digital ultrasound. the asymmetry might be caused by the movement of upper eyelids during blinking [4, 13]. similar inferior/superior asymmetry in the thickness of corneal epithelium was also found after lasik (figure 1(b)). the average central epithelial thickening was about 3.6 m at the 3-month followup for a mean spherical equivalent correction of 4.39 d. this finding is in agreement with previous studies that demonstrated the correlation between central epithelial thickening and the amount of myopia correction [5, 1419]. using confocal microscopy, spadea et al. demonstrated that epithelial thickness increased within the first week after lasik, with a maximum increase of approximately 6.5 m by the third month for a mean spherical equivalent correction of 10.48 d. using very high-frequency digital ultrasound, reinstein et al. found that there was a central approximately 5 mm zone of epithelial thickening of up to 7.5 m 1 year after lasik for a mean spherical equivalent correction of 3.34 d. in a recent study where a similar oct system was used, kanellopoulos and asimellis found that increases in central (0~2 mm diameter), midperipheral (5 mm diameter), and overall mean epithelial thickness appeared to be in almost a linear correlation with the amount of targeted myopic correction (1.39 m/d for midperipheral region). the authors hypothesized that epithelial hyperplasia might be caused by a thinned cornea which was biomechanically unstable. this hypothesis was also supported by a study of epithelial thickness changes after collagen cross-linking (cxl). however, the epithelial thickness changes could actually be explained by the simultaneous topography-guided ablation to reduce the cone. in other words, the epithelial thickness changes could be a response to focal curvature changes in addition to corneal biomechanical properties. the average central epithelial thickening was significantly correlated with lasik spherical equivalent setting. for every diopter of the 1.15 m per diopter epithelial thickening was matched to a smoothing constant of 0.46 mm. this value was larger than our previous estimate (0.32 mm) probably because of the mix of spherical astigmatism subjects in this dataset. our results showed more epithelial thickening centrally (1 mm diameter zone) than that paracentrally (5-6 mm annular zone). this does not agree with a previous study with very high-frequency digital ultrasound where epithelial thinning was observed between the 5.6 mm and 8 mm diameters except superiorly. we speculated that the discrepancy may be caused by larger optical zone (6.5 mm) and use of transition zone (up to 8.0 mm diameter) in our study compared to the 6 mm optical zone used in the previous study. in figure 2, if we could measure epithelial thickness beyond 6 mm diameter and the plot could be extrapolated, epithelial thinning would have been observed at the periphery. however, because we did not have access to the proprietary ablation profiles of the laser companies nor had our current oct system the ability to measure a larger area, we could not provide a more concrete explanation for the disagreement. on the other hand, both clinical data (figure 3) and simulation (figure 5) showed that the maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter, not at the center. the difference was more obvious on the average epithelial change map from the clinical data than the simulation. we speculated the reason being that the actual lasik ablation pattern might precompensate for the laser-induced spherical aberration, which meant that the actual ablation at the paracentral area would be deeper than munnerlyn's algorithm used in the simulation which did not account for spherical aberrations. in addition, after the compensatory remodeling of corneal epithelium to surface curvature changes, the area with increased epithelial thickening was most likely to be annular because of the ring shape of spherical aberration. one limitation of this study was that it only included epithelial thickness measurements 3 months after lasik. however, central epithelial thickening has been reported 1 year up to 7 years after excimer laser ablation, all of which found no statistically significant change in central epithelial thickness after 3 months. therefore, it may be reasonable to assume that the epithelial thickness is stable 3 months after lasik. it also should be pointed out that, besides focal corneal curvature, changes in corneal biomechanical properties, such as dry eye and cross-linking [23, 24], may result in corneal remodeling as well. therefore, it is important to take multiple factors into consideration if they are mixed. in summary, fourier-domain oct was demonstrated to be a valuable tool for noncontact measurements of corneal epithelial thicknesses change caused by lasik. the maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter. however, wider scans are needed to measure epithelial thickness change toward the edge of the ablation zone.

purpose. to quantify corneal epithelial thickness changes after myopic lasik by oct. methods. epithelial thickness before and after myopic lasik were measured by a fourier-domain oct system. average central (within 1 mm diameter) and paracentral epithelial thickness (5~6 mm diameter) before and after lasik were compared. correlation between central epithelial thickness change and laser spherical equivalent setting was evaluated. an epithelial smoothing constant was estimated based on a mathematical model published previously. results. nineteen eyes from 11 subjects were included in the study. eyes had myopic lasik ranging from 1.69 d to 6.75 d spherical equivalent. the average central epithelial thickness was 52.6 4.1 m before lasik and 56.2 4.3 m 3 months after lasik (p=0.002). the average paracentral epithelial thickness was 51.6 6.6 m before lasik and 54.8 4.3 m 3 months after lasik (p=0.007). the change in average central epithelial thickness was correlated with laser spherical equivalent (r2=0.40, p=0.028). the epithelial smoothing constant was estimated to be 0.46 mm. conclusions. corneal epithelial thickens centrally and paracentrally after myopic lasik. the extent of epithelial remodeling correlated with the amount of lasik correction and could be predicted by a mathematical model.

PMC4427820

pubmed-358

this is particularly the case of the health of people living in contaminated site(s) (cs) which is affected by the legacy of past industrialization and current industrial activities, often in absence of environmental remediation. european community legislation addresses the concept of cs only in the context of the thematic strategy for soil protection and the soil framework directive proposed by the european commission (ec) in 2006; for details on the legal framework and definitions at eu level refer to who 2013. according to 2007 estimates, soil contamination requiring clean up is present in approximately 250,000 sites in the european environment agency (eea) member countries. although main polluting sources may vary across europe, industrial production and commercial activities, oil industry and waste disposal and treatment are reported to be the major ones. national reports indicate that heavy metals and mineral oils are the main soil contaminants, while mineral oils and chlorinated hydrocarbons are the most frequent pollutants found in groundwater. a general definition, following the public health perspective, is areas hosting or having hosted human activities which have produced or might produce environmental contamination of soil, surface or groundwater, air, and food chain, resulting or being able to result in human health impacts. given this definition, an area affected by a single chemical contamination of a single environmental matrix (e.g., the soil contamination caused by a given pesticide) and a large area with soil, water, air, and food chain contamination by multiple chemicals (e.g., the contamination caused by long-term emissions of a petrochemical complex) can be both considered contaminated sites. there are several approaches and methods for assessing the health impact of national priority contaminated sites (npcs). on the one hand, one can apply risk assessment techniques, where available data on the degree of contamination (typically measures of concentration of specific hazardous chemical agents) are used to quantitatively estimate the risk of occurrence of health endpoints causally associated with the agents; on the other hand, epidemiological approaches applicable to npcss involve the inclusive collection of available health information of resident population, and various agents and exposures. in these assessments, a first descriptive level is based on epidemiological tools that do not require an ad hoc collection of data and aims at describing the health profile of populations documenting ascertained or suspected associations with local environmental risks and the potentiality to provide efficient answers. more detailed analyses can be carried out, at a higher level of definition, by collecting specific data on health outcomes and/or on exposure. sentieri project (epidemiological study of residents in italian contaminated sites) [6, 7] is an example of first level descriptive approach adopting an ecological study design, looking at the aggregate population level rather than at individual level. sentieri project is a national project developed to evaluate the health profile of populations residing in the italian sites of national interest for environmental remediation-national priority contaminated sites (npcs). these sites were labelled as sites of national interest because of their substantial contamination, documented in qualitative and/or quantitative terms, and the consequent potential impact on the health of residents. the methods proposed under the approach exemplified by sentieri can be generalized and applied to other npcss. this paper's objective is to present the rationale and methods underlying sentieri project and to describe data and resources required to apply a similar approach in other countries. when studying how the environment can adversely affect human health, it is usually very difficult to identify clear cause-effect relationships because they are characterized by multicausality with different strengths of association. in addition, these relationships are influenced by individual factors (e.g., genetic, diet, life-style, occupation, and socioeconomic status) that can also have a role on both exposure level and disease development. it describes the health profile of residents in contaminated sites through small area analysis by applying the multistep procedure described in the following sections. a selection of epidemiologic terms are defined in glossary to facilitate the reading of the paper. as a first step, npcss to be studied should be chosen, and the criteria adopted to define npcs/npcss are clearly indicated. the npcs selection will depend on the aims of the study to be undertaken, on the availability of the npccs-related information, and on any other consideration researchers would make and consider appropriate. in many instances, npcss to be studied are chosen by third parties, such as an environmental authority, by public concern, and media pressure. it is advisable that the criteria used throughout this phase are clearly stated. in most instances npcss are characterized by the presence of numerous and different environmental sources of contamination possibly leading to human exposures. all the available npcs data should be collected and described in a standardized, homogeneous way. geographical characteristics, extension of the contaminated area, and demographic information about residents potentially affected should be listed. detailed description of contamination characteristics should be included as well as the presence of industries and all other human activities that have contributed to the environmental deterioration of the npcs. researchers will specify the sources used for this task: scientific reports, acts, and so on. populations at risk can be identified as people living in the neighborhood of npcss sources or living in areas defined as contaminated. typically, the distance from the areas affected by contamination is used, but also dispersion modelling results are used. in the latter case, the definition of the areas most affected by contamination, and the consequent identification of at-risk populations, depends on the accuracy of the model. there are several models used to evaluate the areas affected by contaminants; their implementation and improvement depend on the available information on several parameters. for example, in the case of emissions into the air from oil refineries, the parameters to be considered should be characteristics of emission sources: for example, height, flow rate, composition of emissions, exit temperature, local orography, and meteorological conditions. areas characterised by contamination processes different from direct industrial emissions require other parameters. in the case of landfills many early disposal sites did not have liners to trap rainwater that percolate through the landfill, and some newer landfills have liners that leak. the percolating water leaches toxic chemicals (e.g., from batteries, electronic equipment, and discarded household chemicals) that can contaminate soil and groundwater in ways that make it difficult to adequately identify the population at risk. furthermore, in defining contaminated areas in case of complex industrial contamination, it should be considered that populations can experience several routes of exposure, mainly through inhalation of pollutants emitted into the atmosphere, and through ingestion when contaminants are accumulated in soil, water, and food chain. for the reference population the same data of the area units under study are needed: cases and populations stratified by gender and age categories. the reference population should be selected considering two different needs: (1) it should be comparable to the studied populations for factors that can affect the health profile with the exception of the contamination at study the differences in the health profile between the compared populations should be ideally due only to the differences in environmental exposures, namely, to the contamination; (2) it should be sufficiently numerous to obtain stable reference rates also for rare diseases. these two needs have opposite requirements, as the first one is usually negatively correlated with the dimension of the population, while the second one is positively correlated with the dimension of the population. usually one or two populations among the following are selected as reference population: national, and regional, local (i.e., a population composed of populations residing in the neighbourhood of the contaminated area). the aims of the study will imply a sound outcomes selection to include the ones for which environmental exposure/s (see environmental data) is suspected or ascertained to play an etiologic role. the possible health impact from environmental exposures is measured in terms of mortality, morbidity, incidence of neoplastic diseases, and so forth. general considerations about the quality of available information and data as well as intrinsic limitations of the selected outcome measures should be described and discussed. health indicator characteristics should be carefully examined and multiple aspects considered taking into account the inherent uncertainty. sources of national or local routinely collected data, spatial and temporal coverage, and quality aspects are all of extreme importance for the validity of study results and their usefulness in terms of general knowledge and public health relevance. an appropriate length of the period under study will make research results and conclusions more informative for diseases with long latency times; precision of the epidemiological parameters will also improve with a longer study period. the specific value of small-area analysis is that it permits the examination of data for population which tend to be more homogeneous in character and in their environmental circumstances than the larger and more widely spread populations. the smallest territorial unit that can be used in small area studies depends on data availability that may vary in different countries. for example, in italy small area studies can be carried out at the census tract (average of 200 residents) and municipality levels. in 2001 about 70% of the italian municipalities included less than 5,000 residents; this compares with great britain, where small area studies can be carried out at the following levels: enumeration districts400 residents, electoral wards5,100 inhabitants, and postcode sectors6,600 people. in geographical studies of environment and health, confounding from social and economic factors may occur. to control such confounding effect, standardisation techniques have been extensively used since the mid-1990s. to account for possible confounding from socioeconomic factors in sentieri project, deprivation can be defined as a state of observable and demonstrable disadvantage relative to the local community or the wider society or nation to which an individual, family, or groups belong. deprivation indices are area-based measures of material and social disadvantageous circumstances, that is, indicators of relative deprivation at population level. a detailed discussion on the use and critical aspects of the application of di in small area studies of environment and health can be found in an open access systematic review. when performing epidemiologic studies, there is a risk for researchers to become data-driven. this can be the case when commenting results for causes showing an increase, possibly on the basis of statistical significance. as an example, sentieri dealt with the complexity of the relation between area contamination and health effects. for each npcs studied the project focused on those causes identified a priori from the epidemiological evidence of their association with selected environmental exposures. it is suggested that researchers use environmental contaminants information considering the available level of details. in sentieri possible relevant exposures were abstracted from legislative decrees, that is, administrative sources defining npcss boundaries and coded on a productive sectors basis (i.e., petrochemicals and/or refineries, harbours areas, etc.). while for some npcss information on specific chemical contaminants was available, for others only productive plants were listed. this is to point out that researchers should be able to adapt this approach to their specific situation. when studying factors that determine changes in the occurrence of a given health condition or its predictive factors, it should always be kept in mind that most diseases have a multiple etiology. therefore also exposures different from those specifically present in npcss should be considered, as well as every known cause or risk factor, such as smoking habits, alcohol consumption or other sources independent from those at study, that is, socioeconomic factors and occupational exposures, and air pollution due to combustion of fuels for transport activities and domestic heating. the latter aspects are particularly relevant when studying complex industrial settings close or overlapping to urban highly populated areas. once the environmental exposures of interest identified, researchers should examine the updated scientific literature to evaluate the associated health effects. this apparently easy task is in fact quite demanding, because by browsing the literature different kinds of publications are collected: handbooks, original articles, letters to scientific journals, multicentric studies, editorials, reviews, meta-analyses, and so on. therefore, the first decision to be taken is about the relevance to give to the collected material and how to use it to define the strength of the association between the specific health outcome and the environmental exposure/s that characterize/s the npcss. sources expressing the epidemiological community consensus, evaluating scientific evidence by means of standardized criteria, and weighting the study design and the occurrence of biased results were considered most important (i.e., iarc monographs, who publications, european environment agency reports, handbooks of environmental, and occupational medicine). they were followed in the hierarchy by quantitative meta-analyses. consistency among sources was a criterion used to classify the strength of the causal association. this process was performed considering not only the environmental exposures, but also those risk factors previously mentioned (smoking habits, alcohol consumption, air pollution, socioeconomic aspects, and occupational exposures). literature sources were presented in the final report in a tabular form to let the reader follow the entire process of evaluation for each cause combined with different exposures. on the basis of explicit criteria the strength of the causal association for each cause-exposure combination was classified (matrix of a priori evidence evaluation). expertise in environmental and occupational epidemiology, statistics, and public health clinical medicine, toxicology, and analytical chemistry are needed to tackle this complex environmental issue. all data about contamination sources and characterization of contamination should be collected and examined to identify the contamination diffusion and finally define the areas and populations possibly affected by contaminants. sentieri project studied populations residing in the sites of national interest for environmental remediation (national priority contaminated sites npcss). in sentieri the production activities and sources of contamination listed in the decrees defining the sites ' boundaries were used as a proxy for environmental residential exposures; they are coded as chemical industries, petrochemicals and refineries, steel plants, power plants, mines and/or quarries, harbour areas, and asbestos or other mineral fibres, landfills, and incinerators. for each npcs contamination data the study population comprised residents in 44 npcss; each one included one or more municipalities, a total of 5.5 million inhabitants in the 44 npcss, about 10% of the italian population at the time of 2001 census. in sentieri project the italian 2001 standard population was used as a reference to calculate crude and standardized rates. each outcome and cause analysed should be characterized to define its specific contribution in evaluating the possible health impact of contamination. for this aim, mortality, morbidity (e.g., hospital discharge records), cancer incidence, and congenital malformations prevalence could be of major interest. as described in the previous section, for each outcome a matrix of a priori evaluation each outcome can be considered usable for the sentieri approach if its validity is previously verified, and appropriate epidemiological parameters can be estimated. briefly, sentieri studied mortality in 44 npcss using data at municipality level (19952002), calculating indicators such as crude and standardized rates (italian 2001 standard population as reference) and standardized mortality ratio (smr), using regional comparison rates, both crude (smr) and adjusted for an ad hoc deprivation index (smr i d). to control for confounding from social and economic factors an ad hoc deprivation index was built and applied to the smr estimates in sentieri project (sentieri di). the deprivation index was constructed using the 2001 national census variables representing the following socioeconomic domains: education, unemployment, dwelling ownership, and overcrowding. the epidemiological evidence was examined on the basis of explicit criteria to build a matrix of the a priori epidemiological evaluation of the strength of the causal association for each combination of selected outcome and environmental exposure. for details concerning the a priori evaluation firstly a multidisciplinary group of researchers (see the previous section) draws up the list of causes to be submitted to the evidence evaluation. secondly, the epidemiologists classify the strength of the causal association of each outcome/exposure combination. firstly a multidisciplinary group of researchers (see the previous section) draws up the list of causes to be submitted to the evidence evaluation. secondly, the epidemiologists classify the strength of the causal association of each outcome/exposure combination. to complete this phase in sentieri project, the epidemiologists developed a procedure to examine the epidemiological literature published from 1998 to 2009 on the health risk of populations living in npcss. the epidemiologists examined each cause of death/exposure combination (mortality was the first outcome to be analyzed) in terms of strength of causal inference. environmental exposures the former were fixed on the basis of the possible sources of contamination in npcss listed in the decrees that defined each site boundaries (e.g., chemical industry, steel plants); the other exposures were the environmental, lifestyle and occupational most important known etiological factors: air pollution, active and passive smoking, alcohol intake, occupational exposures, and socioeconomic status. the procedure finally led to classify the evidence of the causal association into three categories: sufficient to infer the presence of a causal association, limited to infer the presence of a causal association, and inadequate to infer the presence or the absence of a causal association. the criteria adopted for the classification are reported in table 1. at the end of the second phase, a matrix of epidemiological a priori evidence about the strength of each outcome-cause/environmental exposure or outcome-cause/other exposure causal association was prepared (example in table 2). specific causes with a certain level of strength of causal association with the environmental exposures present in each npcs were reported and discussed in detail in sentieri. in order to have a general description of the residents ' health profile, main broad groups of causes of death the assessment and appropriate consideration of previous studies performed on the same npcs, if any, ameliorate the level of knowledge, reducing scientific uncertainties about the heath impact of contamination and facilitating the process of identification and implementation of remediation interventions. when more than one npcs are studied, a homogeneous way of presenting and discussing results can make the study results clearer and more readable. it included a summary description of population and contamination data: specific sections dedicated to (a) results by gender (general health profile and specific, a priori selected causes); (b) previous studies carried out in the investigated area; and (c) a conclusive paragraph with suggestions for further scientific and/or remediation priorities as well as recommendations for public health interventions. in single sites examples of recommendations aimed at a better description and clarification of the observed health effects include the investigation of the respiratory diseases prevalence in children, the conduction of occupational and residential cohort studies, and health surveillance activities as well as exposure assessment and biological monitoring investigations. an example is the one of sassuolo-scandiano npcs presented in a following paragraph. the presence of asbestos or asbestiform fibres was the motivation for including six npcss in the national environmental remediation programme. in five of these sites increases in malignant pleural neoplasm mortality were observed; in four of them the excess was in both genders. in four out of six other sites where in addition to asbestos other sources of environmental pollution most causes of death analyzed in sentieri have multifactorial etiology; furthermore in most npcss multiple sources of different pollutants are present, sometimes concurrently with air pollution from urban areas: in these cases, drawing conclusions on the association between environmental exposures and specific health outcomes might be a hard task. notwithstanding these difficulties, in a number of cases the attribution could be possible on the basis of the increases observed in both genders and in different age classes, and the exclusion of a major role of occupational exposures was thus allowed (in italy most of the workforce in industrial setting is still represented by males). for example, a role of emissions from refineries and petrochemical plants was hypothesized for the observed increases in mortality from lung cancer and respiratory diseases in two npcss; a role of emissions from metal industries was suggested to explain increased mortality from respiratory diseases in two other sites. in six npcss an etiological role of air pollution in the raise of congenital anomalies and perinatal disorders was suggested, and a causal role of heavy metals, pah's, and halogenated compounds was suspected for mortality from renal failure in six sites. according to the 2001 census, the npcs sassuolo-scandiano includes 6 municipalities with a 102,811 overall population. the perimetration decree of this npcs lists the presence of pottery manufacturing plants, an environmental exposure that sentieri qualifies as c (plants producing chemicals and/or chemical products). sentieri results among the main causes of death show in this npcs some excesses for all causes and circulatory and respiratory systems diseases in men. some excesses are also observed for digestive system diseases in women (table 3). for the causes of death with an a priori sufficient or limited evidence of causal association with the environmental exposure in this npcs, an excess for respiratory diseases and asthma was observed in men (table 4), and for congenital anomalies (malformations) in all age classes, both genders (table 5). previous studies in this npcs showed that lead, a metal used in the pottery production, polluted subsoil, surface, and ground waters. notwithstanding a decrease in occupational exposure between the beginning of the seventies and half of the nineties, in 1995, the lead levels remained high. at the beginning of the eighties, lead exposure levels in children were high; during the second half of the nineties a sharp decrease was observed, and blood concentrations were lower than the 10 g/100 ml limit. according to sentieri, the evidence of the causal association between occupation and respiratory system diseases and asthma was classified as sufficient. since silicosis was not separately analyzed in sentieri and its risk is known to increase in pottery production, as observed in the cohort study of workers compensated for silicosis in italy, it was probably conducive to the observed respiratory diseases excess in this npcs. the occupational exposure to lead in pottery production might have contributed to the mortality excess due to parkinson's disease and hypertension. a hypertension excess was pointed out for both genders (men: smr=192 (90% c.i. data acquisition for the appraisal of the present lead environmental pollution and occupational exposure is suggested. the mortality for causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure showed, for the period 19952002, 3,508 excess deaths for all causes, corresponding to 439 deaths/year; the number of excess deaths was 1,321 for respiratory diseases, 898 for lung cancer, and 588 for pleural neoplasms. when considering excess mortality with no restriction to causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure, the number of excess deaths for all causes was 9,969 (smr 102.5, about 1,200 excess deaths/year); the excess was 4,309 for all neoplasms (about 538 excess deaths/year), 1 887 for circulatory system diseases, and 600 for respiratory system diseases. the ecological approach used in sentieri does not allow to draw firm conclusions on the causal relationships between residential exposure and health status in residents in a contaminated site; furthermore, the causal inference might be complicated for causes with multifactorial etiology in areas with multiple sources of different pollutants and concurrent presence of air pollution from urban areas. notwithstanding these difficulties, in a number of instances, the a priori evaluation of the epidemiological evidence as carried out in sentieri reinforced the findings and strengthened the case of an etiological role to some environmental exposures. this has varying degrees of persuasiveness for example, an increased lung cancer and respiratory disease risk was observed in sites hosting refineries and petrochemical plants, suggesting the need for further studies; the ascertained exposure-disease association between pleural neoplasm mortality and asbestos was confirmed in sites with documented presence of asbestos and asbestos-like fibres. another aspect which could increase the persuasiveness of environmental-related health effects is the identification of raised health risks in children living in contaminated sites. in the 44 combined npcss, among children 0-1 year old, mortality from all causes and from perinatal conditions was, respectively, 4% (3,328 cases) and 5% higher (1,903 cases) than the italian reference population, and the overall mortality was significantly increased in one or more age groups (0-1, 014, and 019 years) among children living in 11 (25%) npcss. the value of an ecological study like sentieri should be measured, as recently suggested, against the baseline level of knowledge; in this context sentieri contribution can be considered high given the absence of systematic and standardized epidemiological investigations of the health impact of residents in npcss. exposure ascertainment is a key phase in ecological environmental investigations; the exposures affecting the study population should ideally be described in detail, while in practice a number of limitations affect this crucial aspect in most studies. in some investigations the exposure/s is a time-bound event in a limited geographical area, leading to a point source emission of a limited number of contaminants whose nature has been identified and whose toxicological properties can be partially known. events such as the explosion of seveso in 1976 and bhopal in 1984 belong to this category. more frequently the environment has been progressively and perhaps surreptitiously contaminated by a heterogeneous mixture of pollutants originating from industry (often a variety of industrial activities) or waste treatment/disposal activities. in this case several environmental matrices are contaminated over a period of years, leading to multiple sources of exposure to a variety of exogenous agents, possibly changing qualitatively or quantitatively overtime. for example, in sentieri project the sources of environmental exposures were abstracted from the legislative decrees defining sites ' boundaries, and chemical industry, petrochemicals and refineries plants, steel plants, power plants, mines and/or quarries, harbour areas, asbestos or other mineral fibres, landfills, and incinerators subsequently coded. such data are insufficient to give a full picture of space and time distribution and variability of the exposures. in addition, for most npcss no information is available on sources of exposure that can have a health impact, such as concurrent air pollution from road traffic and exposures in the occupational setting. another limitation in exposure ascertainment lies in the implicit assumption that all residents in the area under investigation experience the same exposures, while exposure variability is likely to be substantial, due to many factors (e.g., concentration of contaminants and their diffusion to soil and water, distance of residence from polluting sources). the possible consequences of such nondifferential exposure misclassification are complex, and direction of the resulting bias is not predictable. an additional limitation in exposure ascertainment derives from the territorial size and the population dimension of the areas at study for which vital statistics are available. whatever the administrative boundaries are, they hardly correspond to the distribution of environmental pollutants, so that the misclassification of exposure (and loss of statistical power) is common. as far as outcome measures. however, the analysis of hospital discharge records, ad hoc registry data of specific pathologies (e.g., cancer, congenital malformations) can give a better picture of the health profile of residents in npcss. each vital statistics is able to provide information only about the events that is designed to record, and databases need to be validated for use in epidemiological studies. in the majority of countries death rates from all causes are unlikely to be biased because reporting the event of death is exhaustive. therefore the overall mortality, which is an important indicator of conditions of life, can be analyzed with confidence. in italy mortality data are available for the whole country, and validity of cause of death certification has been documented for specific diseases [1922]. in most european countries hospital discharge records (hdrs) are indicators of hospital activity, and their main use is for administrative purposes: validity when employed in ecologic studies some italian reports [24, 25] comment on some critical aspects of this novel utilization of hdrs. the analysis of cancer incidence and congenital malformations data in environmental epidemiology investigations can be considered, subject to validity evaluation. in italy in the context of contaminated sites congenital anomalies have been used in a descriptive study and the investigation of cancer incidence has been planned. mortality statistics and hospital discharge statistics have been using the succeeding versions of the international classification of diseases (icd) that guarantees homogeneity and comparability of results obtained in different places. however, particularly for cancer, the resolution power of the icd is far lower than that of classifications based on pathological diagnosis such as the succeeding versions of the international classification of diseases for oncology (icd o). some associations between environmental agents and cancer are limited to specific pathological variants of the disease (e.g., wood dust and adenocarcinoma of the nose and nasal sinuses); for populations served by cancer registries where the histological type of cancer is systematically recorded this problem is solved. in environmental health studies factors as socioeconomic status, occupational exposures, and individual lifestyles can have an etiologic role on the health effects under study thus possibly confounding the exposure-disease relationships. socioeconomic status is a determinant of health and disease. since the mid-1990s ecologic studies of environment and health in uk adjusted for deprivation using census data; for a review refer to pasetto 2010. to account for deprivation in sentieri project mortality data were analyzed both crude and adjusted based on an ad hoc deprivation index (sentieri di). occupational exposures are potential confounders in ecological studies of environment and health; individual based studies may be needed to disentangle environmental and occupational risk. the present paper referred as a common thread to sentieri project, in its main components of mortality study and a priori evaluation of the epidemiological evidence. its major strengths are the standardization of the mortality analysis and npcss classification in terms of environmental exposure which allow the study of all npcss in one country; the a priori evidence evaluation to comment and interpret study results is a key characterizing element of the project. additional assets are that the mortality analysis can be updated and other vital statistics data can be analysed; also the a priori evidence evaluation can be brought up to date following the established criteria and procedures. the sentieri approach allows the description of the health status of populations living in the italian npcss. furthermore, it is suitable for an overall analysis of data from different npcss and comparative analysis of data from npcss with the same contamination sources. the sentieri approach is, in its essence, a tool to describe the health profile of residents in npcss to document ascertained or suspected associations with local environmental risks; it does not require an ad hoc data collection. the approach can also be of value for health surveillance activities in npcss (possibly analysing different outcomes); in addition it can contribute to etiological evaluation of cause-effect associations if additional data from biomonitoring investigations, risk assessment studies, and individual-based epidemiological studies are available. the links between environmental exposures and health effects depend on the environmental pollutants and diseases being considered but are also influenced by factors such as genetic constitution, age, nutrition and lifestyles, occupation, and socioeconomic factors such as poverty and level of education. identifying these relationships is therefore challenging; however, the effort is often worthwhile as it may help to redefine priorities and unlock resources. other strengths of the sentieri approach are that the a priori evidence evaluation and mortality analysis can be updated; other health outcomes in addition to mortality can be analyzed, for example, cancer incidence, morbidity, and adverse reproductive effects; also the a priori evaluation can be carried out for environmental exposures different from the ones in sentieri project. notwithstanding the remarkably laborious activities required to set up a national project such as sentieri, major benefits in terms of quality and quantity of findings, and a favourable cost/gain balance can be expected inasmuch as this becomes a permanent system of epidemiological observation on health of residents in npcss.

sentieri project (epidemiological study of residents in italian contaminated sites) studied mortality in the sites of national interest for environmental remediation (national priority contaminated sites npcss). sentieri described mortality of residents in npcsss, and it specifically focused on causes of death for which environmental exposure is suspected or ascertained to play an etiologic role. the epidemiological evidence of the causal association was classified a priori into one of these three categories: sufficient (s), limited (l), and inadequate (i). mortality in the period 19952002 was studied for 63 single or grouped causes at the municipal level by computing: crude rate, standardized rate, standardized mortality ratios (smr), and smr adjusted for an ad hoc deprivation index. regional populations were used as references for smr calculations and 90% ci accompanied smr values. the deprivation index was constructed using 2001 national census variables for the following socioeconomic domains: education, unemployment, dwelling ownership, and overcrowding. sentieri results will allow the priorities setting in remediation intervention so as to prevent adverse health effects from environmental exposure. this paper's objective is to present the rationale, methods, advantages, and limitations underlying sentieri project and to describe data and resources required to apply a similar approach in other countries.

PMC3703355

pubmed-359

colorectal cancer (crc) is one of the most common human malignancies in western countries. colorectal adenomas have high malignancy potential when they are large in diameter and/or present with severe dysplasia and/or a villous component. colonoscopic polypectomy has been documented to significantly reduce the incidence of colorectal cancer [3, 4]. therefore, the identification of factors associated with the development of colorectal adenoma represents a major goal in colorectal cancer prevention. they could indeed allow the selection of individuals at risk of crc who may benefit from a screening by colonoscopy. the adenoma-carcinoma sequence suggests that colorectal adenomas and adenocarcinomas share common environmental and genetic risk factors. an increased risk of colorectal tumors has been found in relatives of patients with large adenomas [5, 6]. a case-control study had suggested that family history of colorectal cancer influenced only the growth of adenomas or their malignant transformation. however, relatively few epidemiologic studies explored genetic risk factors in colorectal adenomas. we investigated, through a case-control study, the relation between polymorphisms within a series of candidate genes involved in colorectal tumorigenesis and putatively in the formation and the development of colorectal adenomas such carcinogen metabolism enzymes, methylation enzymes, dna repair genes, oncogenes and tumor suppressor genes. the genetics of adenomas (geade) study is a case-control and family study of patients with high-risk adenomas (10 mm). the data were obtained from 18 participating gastroenterology units of general hospitals in france. from september 1995 to march 2000, 306 consecutive patients with newly diagnosed colorectal large adenoma (la) were enrolled in the study. patients with personal cancer history, familial adenomatous polyposis, established hereditary nonpolyposis colorectal cancer or inflammatory bowel disease were excluded. to distinguish genetic factors involved in the occurrence of adenomas or in their growth, 307 cases with small adenomas (with a diameter smaller than 0.5 cm) (sa) and 572 polyp-free controls (with normal colonoscopy) (pf) reason for referral, family history of crc, completeness of colonoscopy were registered for all patients and controls. two pf per la cases were selected as controls within over 2000 pf for matching on age, gender, and geographic area. blood specimens were obtained at time of colonoscopy and those patients who presented with a polyp were included only when histological examination revealed the adenomatous nature of the lesion. as polyps were totally removed during colonoscopy, their natural evolution could not be scored. after longitudinally section, half of the tumor material was fixed for histologic analysis and half was frozen for molecular characterization. twenty individuals had to be excluded because of insufficient tumor material: 11 patients with la, 5 with sa, and 4 pf. the final groups contained 295 patients with la, 302 with sa, and 568 pf as controls. all patients and controls signed an informed consent after approval of the study by an ethic committee for biomedical research (le kremlin-bictre) and the database was declared to the national committee commission nationale de linformatique et des liberts (cnil). genes have been selected for their role in colorectal tumorigenesis and for the presence of frequent neutral polymorphisms. the polymorphisms of mmp1, mmp3, and mmp7 gene promoters, that are responsible for the degradation of extracellular matrix components, had been previously studied and were not considered in the present analysis. three genes, ts, ugt1a1, and mdr1, are implicated in folates, bilirubin metabolism, and transport of xenobiotic respectively. all these pathways are suspected to play a role in cancer occurrence or in the transformation of benign lesions, folates by interfering with dna synthesis and repair, bilirubin by its known antioxydant properties, and transport of xenobiotic by its detoxication function. case-control reports exemplified the relevance of these three genes in addition to hras1. three additional pathways have been secondary studied including the wnt pathway (apc, ctnnb1, axin2), the p53 pathway (tp53, bax), the tgfb pathway (tgfbr2), the main mmr and ber genes (msh2, mlh1, myh), and card15 as part of the family with lrr domains. all these genes have been strongly assessed for their major role in oncogenesis, cycle cell control, apoptosis regulation, cell adhesion and migration, proliferation, dna repair as their main functions. the vntr of hras1 was studied by conventional electrophoresis after pcr amplification on 1.2% agarose gels at 2 volts/cm for 1518 hours. hardy-weinberg proportions were tested for each polymorphism. linkage disequilibrium (ld) between pairwise loci genotype-specific odds ratio (or) and 95% confidence intervals (cis) were computed using unconditional logistic regression adjusted on matching factors; wald test was used to assess the global effect of each polymorphism. the homozygous genotype for the more frequent allele among controls was set as the reference class. the association was further examined using the combination test, that allows the analysis of all possible combinations of snps within a given gene or tightly linked genes to test their association with the disease. for each snps combination, the method computes a statistic test contrasting the genotypic (or haplotypic) distribution between cases and controls. because all these tests are correlated (many of them are nested in each other and the snps are likely to be in ld), a permutation procedure has been implemented which displays a significance level adequately adjusted for multiple testing. first, we used the famhap12 software to apply this method by performing haplotypic tests. then the combintest (jannot, personal communication) was used to perform genotypic tests. the method was extended to the test of combined polymorphisms on different genes that may act interactively. to avoid multiple tests biases, we chose a three-step strategy that minimizes the number of comparisons. first, we considered two-by-two combinations of polymorphisms chosen on their plausibility to interact with each other, for instance, apc and myh both responsible, when mutated, for adenomatous polyposis. finally, as a combination of polymorphisms may have an effect even if the genes are not suspected to interact with each other and are not involved in the same pathway, all possible combinations were considered if the first two steps did not reveal any significant association. when several combinations of polymorphisms were significant within a given test, it was possible to test nested combinations using chi-square calculation to determine whether a given polymorphism adds a significant contribution to the association found. the average age was very similar in patients (62 years for la and 61 years for sa) and in pf controls (61 years). the sex ratio (male/female) was quite similar in la (1.7) and in pf controls (1.5), slightly lower in sa (1.2) because of the absence of matching. table 1 describes the characteristics of the polymorphisms studied and the allele frequencies in controls. the distribution of genotypes in controls was consistent with hardy-weinberg proportions for all polymorphisms except for tp53.3 (p=.0013 without correction for multiple testing). a similar departure from h-w proportions (p=.010) was found in the hapmap european population (http://www.ncbi.nlm.nih.gov/projects/snp/) for this polymorphism. all polymorphisms within a same gene were moderately or not found in ld except myh; myh.1 and myh.2 are in quasicomplete disequilibrium (d=1 and r=0.99). analysis of single polymorphisms for the different comparisons, la versus pf, la versus sa, and sa versus pf did not reveal any association for most of the genes studied. the p-values found to be less than .05 were obtained for apc.1, mdr1.2, and axin2.9. the results of the haplotypic and genotypic combination tests performed for each gene or gene combination are shown in table 4. when considering each gene separately, only apc displayed a significant difference between small and large adenomas (p=.014 in haplotypic analysis and p=.07 in genotypic analysis). as apc.1 alone and the combination apc.1-apc.2 appeared both significant, we tested whether apc.2 provided a significant contribution to the association, which was not the case (= 2.12, 1df) showing that the association was solely due to the apc.1 (p.glu1317gln) polymorphism. the combination apc-myh appeared also significant with a global p-value of .045. however, the only significant combination was apc.1-apc.2 already found, showing that myh does not provide any additional contribution to the association between apc and adenomas. no difference was found for the other two comparisons, that is, sa versus pf and la versus pf. finally, the analysis of all possible combinations did not provide any significant result. we investigated the role of candidate gene polymorphisms in a case-control study of patients with large adenomatous polyps (n=295), compared to patients with small adenomatous polyps (n=302) and polyp-free controls (n=568). the 38 polymorphisms studied belonged to 14 genes possibly involved in increasing of colorectal cancer risk. the reason for comparing these different groups of patients was that different genes might be involved in the different steps of carcinogenesis. using this case-control study, we had shown that mmp polymorphism was most probably involved in the occurrence, but not in the growth of polyps. using the combination test, we had shown that the effect was due to a specific combination of mmp1-mmp3 polymorphisms which was not found using logistic regression. indeed, a major property of this test is that it allows the detection of polymorphisms with low marginal effects. multiple testing may be a limitation of studies in which several polymorphisms in several genes are tested. the combination test allows a correction for multiple tests on tightly linked markers, which other methods of correction such as bonferroni, benjamini-hochberg, or fdr (false discovery rate) do not. in the present study, we could show that the positive results obtained for axin2 and mdr1 when analyzing single polymorphisms were false positives as these results were not confirmed when using the combination test. for independent markers, there was no need for correcting for multiple testing as our results were essentially negative. our study did not give evidence for an effect of any of the gene polymorphisms studied except the p.glu1317gly variant of the apc gene. some studies reported an effect of this variant in patients with multiple adenomas or colorectal cancer [1517], and some others found an effect in adenomas but not in cancer [18, 19]. more recently, hahnloser et al. reported an effect of this variant in a group of patients with a small number of adenomas (1 to 3 lifetime adenomas) and in a group of crc cases. none of these studies considered the size of adenomas and could differentiate adenomas at high-risk from those at low-risk of cancer. our results favour the hypothesis that the p.glu1317gly variant would influence the growth and not the occurrence of adenomas, and would have thus indirectly an influence on colorectal cancer risk. nevertheless, although the three groups are paired on gender and geographic origin, it is not stated if other known risk factors would influence adenoma growth. it is thus important to plan a specific multivariate analysis when building a replication sample. regarding the ts polymorphisms chen et al. found a significant effect of the 3r allele of ts.2, particularly of the 3r/3r genotype (or=3.3). in our study, the or associated with 3r/3r genotype was 1.43 (ci 0.942.16) for la versus pf and 1.10 (ci 0.681.78) for la versus sa. on the other hand, ulrich et al. found no marginal effect with any of these two polymorphisms but found a significant interaction of ts.2 with folate intake. similarly, the most recent studies [23, 24] found no marginal effect of either polymorphism but a slight interaction with folate or vitamin b6 intake. the groups ' sizes in our study were of the same order of magnitude as in the study of chen et al., but the three other studies which did not show any marginal effect included larger groups (more than 500 individuals in each group). given the size of our population, we could a priori detect an or of 1.7 with a power of at least 80%. it is highly probable that the ts gene, which produces a key enzyme in folate metabolism, has an effect only in interaction with dietary exposures, which would explain why this effect was not found in our study. moreover a new snp has been recently identified in the second repeat of the 3r allele leading to split the allele 3r in 3rc and 3rg alleles as a tri-allelic polymorphism. this variant could explain these discrepant results since patients with 3rc/3rc genotype have a transcriptional activity of ts comparable to those with 2r/2r genotype. in our study, the problem of multiple testing was adequately controlled for each test performed by the permutation procedure implemented in the combination test. in the last analysis step, the tremendous number of comparisons resulted in a drastic correction of each p-value, which considerably lowered the testing power. thus, our negative results certainly do not definitively demonstrate the absence of specific combination influencing colorectal tumorigenesis, but more probably that, if it exists, this (of these) effect(s) is (are) low and could be found through the initial (and further) genome-wide association studies of colorectal cancer testing much larger numbers of patients and controls [26, 27] .

predisposition to sporadic colorectal tumours is influenced by genes with minor phenotypic effects. a case-control study was set up on 295 patients treated for a large adenoma matched with polyp-free individuals on gender, age, and geographic origin in a 1: 2 proportion. a second group of 302 patients treated for a small adenoma was also characterized to distinguish effects on adenoma occurrence and growth. we focussed the study on 38 single nucleotide polymorphisms (snps) encompassing 14 genes involved in colorectal carcinogenesis. effect of snps was tested using unconditional logistic regression. comparisons were made for haplotypes within a given gene and for biologically relevant genes combinations using the combination test. the apc p.glu1317gly variant appeared to influence the adenoma growth (p=.04, exact test) but not its occurrence. this result needs to be replicated and genome-wide association studies may be necessary to fully identify low-penetrance alleles involved in early stages of colorectal tumorigenesis .

PMC2771154

pubmed-360

today, implant therapy is regarded as an extremely reliable approach to replace missing teeth. the introduction of osseointegrated implants in dentistry represented a turning point in dental clinical practice.1 as a general principle in implant surgery implant surfaces should be surrounded by alveolar bone.2 following loss of teeth, natural process of bone resorption occurs.3 sometimes due to prosthetic or anatomical limitations of alveolar ridge, it is not possible to insert implants in bone appropriately.2 and also, while preparing implant sites in narrow ridges, dehiscence or fenestration defects may occur frequently that threaten the survival of implants.4 successful implant treatment depends on sufficient bone volume at the implant surface.5 insufficient amount of supporting bone, will limit the effectiveness of osseointegrated dental implants3 and will have an adverse effect on dental implant prognosis.6 several clinical studies have shown that to ensure long term success of implants, at least one millimetre thickness of bone in buccal surface and lingual surface of implant is essential. if the implant surface is not completely covered with bone, it will result in gingival recession, unpleasant appearance, problems in keeping good oral hygiene and ultimately increases the risk of infection around the implant.7 implants can be placed in alveolar ridges with defects including dehiscence, intraalveolar defects, and fenestration.8 several methods are presented to reconstruct the destroyed alveolar bone which include osteoconduction, osteoinduction and guided bone regeneration (gbr).6 many surgical techniques are introduced to enhance alveolar bone volume for placing implants that include various grafting techniques, bone-building using emineral method, and expanding the bone and guided tissue regeneration (gtr).5 among these techniques, gbr is widely used. gbr procedures performed in dental implants enable clinicians to increase the width and height of defected alveolar ridges or to treat fenestrations and dehiscence around implants. many researchers have reported predictable results in the simultaneous use of gbr technique when placing implants.7 in most cases of gbr, membranes are supported by protective materials consisting allografts, synthetic materials and xenografts.6 using autograft in augmentation has always been considered as a gold standard, but limited access to autogenous sources, particularly in the areas inside the mouth, prolongation of surgical procedures and bacterial contamination complication have always been considered as the limiting factors in autogenous transplantation. in addition, general surgical risks such as infection, bleeding, pain and swelling, damage to inferior alveolar nerve and the adjacent teeth should also be noted. therefore, using biomaterials on its own or in combination with autogenous bone is very common.9 dfdba can be named as one of the allograft materials which has osteoinductive potential, because this substance contains some major bone morphogenetic proteins (bmps) of donor tissue matrix. against this view, many recent reports have shown that augmentation with dfdba is not os-teoinductive, because it does not contain the necessary bmps to induce bone formation. in the united states, emineralised bone matrix (dbm) is considered a transplantable tissue and therefore, is regulated primarily by the american association of tissue banks.10 treatment of dehiscence and fenestration lesions with gbr technique and placing of implants simultaneously have predictable results.11 recent clinical studies have proven that the use of bone substitute materials together with placing implants led to successful coverage of pre-exposed implant surfaces.12 this prospective clinical trial animal study was conducted in professor torabinejad dental research centre isfahan university of medical sciences, isfahan, iran. samples dissection was carried out in the department of materials science and engineering, sharif university of technology, tehran, iran. studied population included three healthy adult iranian dogs that were chosen by convenient method. inclusion criteria included healthy 2 to 4 years old dogs that held all the teeth. at the beginning of the study, after examination to confirm their health and having the required criteria; seven step vaccination was carried out and the dogs were quarantined for 15 days. all the mandibular premolars teeth were extracted and then, the area was left to heal for three months. after healing period, the area assessed by periapical radiography in order to ensure full recovery, after preparing two sits on one side of each mandible and three sites on the other side which were more appropriate in terms of size and bone quality to place the implants, dehiscence bone defects, were prepared with dimensions of 5 mm apicocronaly, 4 mm mesiodistaly and 3 mm buccolingual in buccal plate using high-speed handpiece and diamond fissure bur and abundant irrigation. 10 mm periodontal probes were used to measure dimensions of the artificial dehiscence defects; all measurements were performed by a specialist investigator. euroteknika implants with 10 mm in length, 4.1 mm in diameter and sla surface (natea system) inserted into the prepared sites. implant stability quotient (isq) of each implant was recorded using ostell device (ostell integration diagnostics, svedalen, sweden) which was higher than 56% in all cases, indicating good initial stability of all implants placed. after that in two lesions, that was chosen in random, dfdba cenobone, hamanand saz baft, iran and in two other lesions dfdba dembone, pacific coast tissue bank, u.s were placed and the fifth lesion was left empty; finally, they all were covered by collagen membranes (bicon, usa). both dfdba brands were powder in sahape in 0.5 and 1 grams vials the size of the particles were almost similar and of the existing type to treat small lesions. dfdba particles were placed in the lesions and were gently pressed against the implant; the lesion were with particles filled up in a way that all the screws were covered and the primary bone contour was maintained. then, the grafted material and surrounded bone were covered completely by collagen membrane. moreover, the gingival flaps were replaced without stretching to submerge the implant and were stitched by polyglycolic acid sutures (vicryl) using simple and interrupted loop sutures. then, final status of implants were determined by periapical radiography. during the first week after surgery, animals were examined several times a day to control the health and complications after the operation and also to ensure the sutures are not opened. the animals mouth was washed twice a day using 0.2 chlorhexidine mouthwashes during the first week and thereafter, once a week. after four months of osseointegration period, dogs were anesthetized and periapical radiographs were taken to observe implants situation within the bone. then, crestal incision was done and the implants were exposed and the value of isq was recorded. samples were taken and immediately transferred to formaldehyde 10% and kept for 24 hours to be prepared for optical microscope study. samples were sectioned by with the ground section method using microtome (accutom-50 cutting machine, copenhagen, denmark). sectioned samples were obtained buccolingualy and parallel to the axis of implants in 100 micron thickness. sectioned samples prepared with trichro massons staining studied by optical microscope (olympus, japon). using histomorphometric method, the percentage of bone implant contact (bic) was cal-culated and type of bone (lamellar, woven) was determined at 40 times magnification and recorded by an experienced pathologist using optical microscope. in this method, the area of 2 mm around the implants is evaluated. spss 11.5 software was used to analyse data, using one-way anova and pearson correlation and regression tests. average bic in cenobone group (iranian dfdba), dembone group (american dfdba) and control group were 77.36% 9.96 (max 89.1% and min 63.4%), 78.91% 11.99 (max 91% and min 56.3%) and 71.56% 5.61 (max 75.8% and min 65.2%), respectively. therewas no significant difference in bic amounts among the three groups (p=0.607). there was not significant difference in the bic amounts among the three groups defects (p=0.388). comparison of average bic of lamellar bone, woven bone, cenobone and dembone groups defects and control group is presented in figure 1. comparison of average bic of lamellar bone, woven bone, cenobone and dembone groups defects and control group (lamellar bone p=0.298 and woven bone p=0.380). furthermore, there was not meaningful difference in rate of lamellar bone (p=0.298) and woven bone (p=0.380) formation in defects among the three groups. the total sample average isq was 70.83% 6.30 (max 82.5% and min 61.5%). average isq in cenobone group, dembone group and control group were 70.29% 7.74 (max 82.25% and min 61.5%), 72.25% 6.81 (max 82.5% and min 65.25%) and 69.08% 2.67 (max 72% and min 66.75%), respectively. there was no significant difference in isq amounts among the three groups (p=0.781). there was a positive relationship between total sample bic and isq (p=0.004, r=0.692). histological view under light microscope showes contact of lamellar new bone with implant in cenobone group magnification x40 massons's trichrom staning. histologic view under light microscope showes contact of lamellar new bone with implant in dembone group (magnification x40 massons's trichromstaning). results of the current study indicated that adding dfdba (dembone and cenobone) to membrane, on its own did not significantly increase the obtained bic and isq amounts. caplanis and colleagues placed, implants in the alveolar defects which treated with membrane on its own and membrane plus dfdba in dogs, the average bic was about 70%13 which is consistent to our study. and also, the bic obtained in this study is consistent with the findings of von arx and colleagues study14 that placed implants in areas grafted with dfdba and other hybrid materials in dogs and gained a high percentage of bic (59% to 75%). in this study, adding dfdba to the collagen membrane did not lead to strengthen induction of bone formation, and these findings were consistent with the results of other studies that showed adding dfdba to the membrane on its own did not significantly increase the clinical results obtained with the gbr procedure.151920 there were significant differences between the products of bone banks in terms of induction of bone formation. some studies found the use of dfdba to have a positive impact to increase bone growth while others considered it not to be beneficial. schwartz and colleagues have shown that there is a wide variety of dfdba products on the market which have different inductive capabilities.21 these differences may be related to the origin and methods of preparation of dfdba and if the preparation methods were the same in different bone banks, this would be due to individual donors ages and sexs, disease and injury, medical treatment or genetic differences. also, the variations of time between death and the bone extraction, may result in significant loss of the bone inductive ability. there are many differences in size and the surface shape of dfdba particles that may affect their inductive ability. bone cells distinguish different surface shapes and roughness and this will lead to differences in phenotypic diversity.22 in de vicente and colleagues study, the implants which the bone defects around them were filled with dfdba showed similar bic to the implants which their defects had just covered with collagen membranes.23 therefore, adding dfdba did not have any advantages over membrane on its own, which was in line with other studies.15161920242526 in stentz and colleague's study,26 using dfdba together with membrane in bone defects around implants improved the healing of the bone density. since they had used radiographic method, the obtained information could not determine the value of bic, which is a better evaluating index for outcome of implant treatment and for these reason, they could not show the dfdba efficiency to increase bic. becker and colleagues27 did not find the use of dfdba beneficial for periodontal regeneration and bone regeneration around implants, while abolfazli and colleagues found the use of dfdba (cenobone) beneficial to repair periodontal lesions in two or three walls alveolar bone defects and reported its effect on bone-formation being the same as aotogenous bone graft. in some studies dfdba was enriched with rhbmp-2 and growth factors and produced better results.2230 the current study results indicated that the relationship between indices of bic and isq was positive and significant. these findings are compatible with huang and colleagues study31 as well as nkenke and colleagues study32 which also found the significant and positive relationship between bic and isq amounts in implants placed in human cadaver bone. results of this study are coincident with the findings of other researchers in efficiency of using the resonance frequency analysis method to determine the implants stability3133 and showed the resonance frequency analysis is a suitable and reliable method to determine implant stability. adding dfdba (dembone and cenobone), either the american or iranian type, to membrane on its own did not significantly increase the obtained bic and isq with the gbr procedure. the resonance frequency analysis is still a suitable and reliable method to determine implant stability.

background: decalcified freeze-dried bone allograft (dfdba) may have the potential to enhance bone formation around dental implants. our aim in this study was the evaluation and comparison of two types of dfdba in treatment of dehiscence defects around euroteknika implants in dogs. methods:in this prospective clinical trial animal study, all mandibular premolars of three iranian dogs were extracted. after 3 months of healing, fifteen sla type euroteknika dental implants (natea) with 4.1 mm diameter and 10 mm length were placed in osteotomy sites with dehiscence defects of 5 mm length, 4 mm width, and 3 mm depth. guided bone regeneration (gbr) procedures were performed using cenobone and collagen membrane for six implants, the other six implants received dembone and collagen membrane and the final three implants received only collagen membrane. all implants were submerged. after 4 months of healing, implants were uncovered and stability (implant stability quotient) of all implants was measured. then, block biopsies of each implant site were taken and processed for ground sectioning and histomorphometric analysis. the data was analyzed by anova and pearson tests. p value less than 0.05 was considered to be significant. results:all implants osseointegrated after 4 months. the mean values of bone to implant contact for histomorphometric measurements of cenobone, denobone, and control groups were 77.36 9.96%, 78.91 11.9% and 71.56 5.61% respectively, with no significant differences among the various treatment groups. the correlation of implant stability quotient and histomorphometric techniques was 0.692. conclusion:in treating of dehiscence defects with gbr technique in this study, adding dfdba did not significantly enhance the percentages of bone-to-implant contact measurements; and implant stability quotient resonance frequency analysis appeared to be a precise technique.

PMC3177388

pubmed-361

the goal to achieve ideal pediatric drug therapy is a worldwide challenge for regulatory bodies and clinicians. children are treated with medicines not tested for safety and efficacy and are frequently supported by the low quality of evidence. in the absence of standard prescribing information, clinicians prescribe drugs in an off-label manner. off-label use means use of medicine which is outside the terms of product license with respect to dose, route of administration, indication, or age. off-label medicine use among children represents an important health issue as the effects and health risks may be unexpected. various national and international studies have been published about the amount of and problems associated with off-label medicines in children. the magnitude of off-label prescribing is accounted to be between 18% and 60% in infants but it may be up to 90% in neonates [39]. most of these studies have been conducted outside india and may not be applicable as hospitalization and prescribing patterns differ based on culture, healthcare infrastructure, and health policies. only one previous study has been conducted in india which reported 50.62% of off-label prescribing based on british national formulary. currently there is no study conducted in india based on national formulary of india (nfi). hence, the objective of the research study was to quantify off-label use based on nfi, various predictors and discusses some strategies to monitor it. the prospective observational study was carried out at a tertiary care hospital in ahmedabad (india) for the period of six months. all the pediatric patients in ages between 0 and 12 years receiving at least one medication and admitted in pediatric ward were included in the study. the pediatric ward was of 60 bed size and attended by 10 academic pediatricians and 28 postgraduate students. patients were not considered if they were in age of more than 12 years, not taking any prescription medication and undergoing surgery. demographics, clinical characteristics, and medication usage were obtained from the medical records using predefined paper case record forms. the data collection was carried out by one of the researchers (mms) who discussed each of the medicines with attending pediatrician and clinical pharmacologist (dr). drugs were entered into the database using the world health organization anatomical therapeutic chemical (who-atc) classification system. we utilized national formulary of india (nfi, 4th edition, 2011) which is an official publication of indian pharmacopoeia commission, ministry of health and family welfare, government of india. categories for off-label use were allocated for each medicine according to the reason(s) why their use was deemed off-label when compared to the terms of the product labeling for that medicine in nfi. we followed a published algorithm and used these dimensions to determine whether there is strong scientific evidence for frequently prescribed off-label medicines (table 4). variables such as age, number of medications, number of diagnoses, and length of hospital stay were regarded as continuous and expressed as mean with standard deviation (sd). the odds ratio (or) with 95% confidence interval (ci) was used to determine the predictors for off-label prescribing. the data were analyzed using statistical package for the social sciences (spss inc., this study was reported according to the strengthening the reporting of observational studies in epidemiology (strobe) guidelines. the study included a total of 320 patients admitted in pediatric general ward of the public teaching hospital over a period of six months. the mean age was 2.73 years (range=0.1 to 12 years and standard deviation: 3.09). the most common age group was 0 to 1 years representing 43% of total sample size. on average each patient had 1.2 number of diagnosis and 48 patients (mean=2.5) had more than one diagnosis during hospitalization. the majority of patients suffered from respiratory diseases (33%), central nervous system diseases (16.5%), and gastrointestinal disease (11%). a total of 1645 medications were prescribed to the study cohort during hospitalization, with a total hospital stay of 1743 days. this constituted the mean number of five (sd=2) medications prescribed per patient and 5.48 (sd=3.62) days of hospital stay. the number of medications and hospital stay ranged from one to 13 and one to 33 days, respectively. the majority of patients received antibiotics, cough, and cold preparations, antipyretics, inhaled corticosteroids, bronchodilators, and antiepileptic drugs. medications were mostly administered by oral route (40%) and intravenous route (35%) followed by inhalation route (25%). of the 320 patients included in the study, 310 (97%) patients received at least one off-label medication. a total of 1645 medications were administered during the hospitalization; 1152 (70%) medicines were prescribed in off-label manner when its usage was validated with national formulary of india, 2011, for five different off-label categories. patients received on average (sd) 3.66 (2.13) off-label medicines within a range of one to 10. the most common cause of off-label prescribing 893 (63%) was due to higher dose use (category 1) than stated for particular pediatric patients. off-label medicines use for age (category 2) and indication (category 3) was found to be 282 (19.8%) and 145 (10.2%), respectively. those medicines which had no pediatric information (category 5) were 76 (5.3%). use of ipratropium, salbutamol, and dextromethorphan was common for different dose and age limits. lorazepam (seizures) and ondansetron (nausea and vomiting) were frequently used for off-label indication. the study also attempted to distribute the receipt of off-label medicines in different age groups as shown in table 2. the extent off-label prescribing was highest (76%) in age group of more than 1 to 2 years, followed by age group of more than 1 to 12 months which accounted for 69% of off-label use. off-label use in dose (category 1) was consistent among the patients in age of 0 to 6 years. the use of medicines in patients for restricted age limits (category 2) was highest in 112-month age group. indication (category 3) and absence of pediatric information (category 5) were most prominent in 612-year patients. highest proportion of off-label medicines were prescribed in anti-infectives for systemic use 389 (73%) and respiratory system 378 (82%) as shown in table 3. the amount of off-label prescribing in nervous system and alimentary tract and metabolism system was 220 (53%) and 85 (86%), respectively. majority of off-label medicines prescribed were ceftriaxone, amikacin, amoxicillin, and vancomycin in antibiotics class and inhaled corticosteroids, ipratropium, salbutamol, chlorpheniramine, phenylephrine corresponding to respiratory system. blood and blood forming agents 16 (89%), hormonal preparation 32 (80%), and cardiovascular medicines 24 (71%) had substantial high amount of off-label use. adrenaline, nifedipine, prednisolone, and dexamethasone were also used in off-label manner. antiparasitic products 8 (16%) had minimum off-label use. antibiotics (75%) and inhaled corticosteroids (79%) were mostly prescribed in higher doses (category 1) than recommended. in respiratory system, many medicines (39.5%) were prescribed below age limits (category 2) as indicated in the formulary. medicines used for unapproved indication (category 3) largely confined to alimentary tract and metabolism system and blood and blood forming agents. medicines which had no pediatric information were predominantly in antihypertensive drug class. on multivariate regression analysis as shown in table 5, we found that pediatric patients in age of 0 to 2 years (or 1.68, 95% ci, 1.262.24,) were more likely to receive off-label medicines than any other age group. female patients (or 1.41, 95% ci, 1.131.77) received substantially high amount of off-label medicines compared to male. hospital stay of six to 10 days (or 1.91, 95% ci, 1.332.75) also carried higher risk of off-label prescription. using the data of the pediatric ward of a tertiary care hospital, we found that 70% of medicines were prescribed in off-label manner. the magnitude off-label prescribing is substantial higher than reported in the recent studies [1416]. cuzzolin et al. performed a literature review of published studies on off-label and unlicensed drug use in children. seven studies involved neonatal intensive care units (nicus), fifteen studies included pediatric wards, and twelve studies were conducted in community setting. cuzzolin et al. found off-label prescribing in pediatric ward ranging between 18 and 60%. various reasons for different rates of off-label use are off-label classification methods, sample sizes, pediatrician's prescribing habits, in-house treatment protocols, and diseases characteristics most importantly pediatric drug regulation. patients in ages between 0 and 2 years are most likely to receive off-label medicines and had highest representation in study sample. previous studies also established that age group of 0 to 2 years is the highest recipient of off-label prescriptions [16, 17]. this is mainly due to absence of specific dosing guidelines and route administration in 0-to-2-year age group in nfi. of the medicines prescribed during the period, it was observed that antibiotics, respiratory medicines, and nervous system medicines were frequently prescribed in off-label manner. several studies had shown high rate of off-label prescribing in respiratory, antibiotics, analgesics, and antiepileptics. about 82% of medicines in respiratory system were off-label which is more than what is reported in studies in us (n=312 million, 70%) and portugal (n=500, 77%). if asthma therapies are considered, inhaled corticosteroids are frequently prescribed (30.7% of all prescriptions). the mainstay therapy for asthma is inhaled corticosteroids (ics), but guidelines often do not give specific recommendations for upper doses limits specially in children. various combinations of antihistaminics, decongestants, and/or analgesics were prescribed to patients in off-label doses for common cold. still, the off-label use of paracetamol is substantial, mainly due to off-label classification for dose or age. although paracetamol is normally considered safe in pediatrics care, a previous cochrane review pointed out that there is limited evidence regarding the efficacy and safety for paracetamol in the treatment of fever in children. lorazepam and ondansetron were widely prescribed for off-label indication but are supported by well conducted clinical studies [27, 28]. better medicines for children to improve monitoring medicine safety in the pediatrics and highlighted its concern on off-label medicines. the strict drug approval procedure is the way to ensure quality data on quality, safety, and efficacy for different pediatric age groups. despite many regulatory amendments and policies, we still have apathetic outlook to pediatric clinical trials. the pharmaceutical companies should be convinced to have appropriate pediatric information in the label and they are not being permitted to market drugs likely to be used in children without suitable pediatric labeling. indian drug regulatory authorities should also develop pediatric specific drug development regulation so that the tendency to market medicines without pediatric specific data is discouraged. this might ensure pediatric labeling for new medicines yet to be introduced in the market; but it is unlikely that drug companies will carry out trials to confirm pediatric use for drugs already marketed and used in children, although in an off-label manner. alternatively, the situation can be improved when prescribers report their pediatric experiences with different off-label medicines in form research articles or discussion at scientific platforms. when medicines are used as off-label, each patient is unique and risk-benefit pertaining to him should be assessed by high quality evidence. the doctor needs to be updated with latest evidence which could be accomplished by using several useful drug compendia like drugdex, clinical pharmacology, and so forth. only such focused and coordinated actions would make sure that children's right to safe, cost-effective, and quality medicines would be realized. based on national formulary of india, our data suggest that magnitude of off-label prescribing in pediatric inpatients is considerable higher than reported in some of the countries. dose discrepancy and use in restricted age limits were identified as main contributor to off-label prescribing. there is need for strict drug regulation for pediatric population to ensure safety and effectiveness of pharmacotherapy. further studies are needed to examine why there are inadequate dosing guidelines and generation of more clinical data especially in respiratory medicines. understanding various risk factors and spectrum of off-label medicine use can assist developing prevention strategies.

background. in the absence of standard pediatric prescribing information, clinicians often use medicines in an off-label way. many studies have been published across the globe reporting different rates of off-label use. there is currently no study based on indian drug formulary. methods. the prospective observational study included pediatric patients in ages between 0 and 12 years admitted in a tertiary care hospital. off-label use was assessed using the national formulary of india (nfi). predictors of off-label use were determined by logistic regression. results. of the 1645 medications prescribed, 1152 (70%) were off-label based on 14 possible off-label categories. off-label medicines were mainly due to dose difference and use in restricted age limits as indicated in nfi. respiratory medicines (82%), anti-infectives (73%), and nervous system medicines (53%) had higher off-label use. important predictors of off-label prescribing were pediatric patients in age of 0 to 2 years (or 1.68, 95% ci; p<0.001) and hospital stay of six to 10 days (or 1.91, 95% ci; p<0.001). conclusion. off-label prescribing is common among pediatric patients. there is need to generate more quality data on the safety and efficacy of off-label medicines to rationalize pediatric pharmacotherapy.

PMC4262749

pubmed-362

the role of the thyroid gland in pregnancy and the impact of thyroid disorders on the course of pregnancy and development of the offspring have drawn a considerable interest in the recent years, both in the medical and in the general society. about 2 and 4% a growing body of evidence suggests that subclinical hypothyroidism may be associated with in vitro fertilization failure, subfertility, infertility, spontaneous abortion, placental abruption, gestational hypertension, preeclampsia, preterm delivery, postpartum thyroid dysfunction, depression (including postpartum depression), conversion to overt hypothyroidism, and impaired cognitive and psychomotor child development. american thyroid association in its recently published guidelines have stated against universal screening of pregnant women for hypothyroidism. it seems that prevalence of hypothyroidism is more in asian countries compared to the west. in a recent study by dhanwal et al. looking at these data the purpose of the study was to know whether routine screening would prove to be beneficial in our country. the study was an out-patient department (opd) based prospective cohort, observational study in which 305 women were randomly selected and screened on opd basis by thyroid-stimulating hormone (tsh) levels (cutoff level 0.10-2.50 miu/ml) as per recent guidelines. these women were followed till term and subsequent delivery to study the effect on maternal and perinatal outcome. known cases of other medical disorders and women who did not give consent for tsh estimation were excluded from the study. 0.10mu/l, the reference values for tsh were 0.1-2.5miu/l, 0.2-3.0 miu/l and 0.3-3.0 miu/l in the first, second, and third trimesters of pregnancy respectively, considering the recent literature. the statistical difference between variables in the study following are the observations made: the mean age of women was 24.46 years (sd=2.00). the mean gestational age at time of screening 9.09 weeks. (sd=4.09) 38.68% of women were of gestational age less than 9 weeks and 61.31% were with gestational age 913 weeks. cut off of 9 weeks was taken to identify those who presented early in first trimester, 55.08% women were nullipara, 31.14% were primipara, 11.47% were para 2, 2.2% women were para 3 and more. it was seen that 4.9% women were already having symptoms of thyroid diseases (main symptoms seen were weakness, lethargy, loss of appetite, weight gain), 4.2% had history of previous thyroid diseases (which is either hypo or hyperthyroidism), 0.65% women had history of other autoimmune diseases (apla syndrome) 4.9% women had history of previous caesarean section, 1.6% women had family history of thyroid diseases, 0.3% had history of irradiation, 1.6% had history of medication (thyroxine for hypothyroidism). on this screening. however, the incidence of hypothyroidism in high risk population was 20.58% and in normal population was 6.7% which shows a significant association of thyroid disorders with high risk factors (p<0.001). in the euthyroid women 7.2% had an adverse perinatal outcome, 92.7% had normal outcomes. this shows statistically significant association abnormal tsh values with adverse pregnancy outcomes (p<0.001). considering the route of delivery, 88.85% women had normal delivery, out of them 0.36% were hyperthyroid, 5.5% were hypothyroid rest were euthyroid. in abnormal perinatal outcomes 6.2% women had lower segment caesarean section (lscs) out of them 73.68% were euthyroid and 26.31% were hypothyroid. the main indications for lscs in these cases were fetal distress, maternal cephalopelvic disproportion (cpd), contracted pelvis, and failed induction. 1.9% had preterm labour, out of them 50% were euthyroid, 50% were hypothyroid. in all, there was only one preterm fresh still birth in a euthyroid woman. out of 2.2% spontaneous abortions 28.5% were in euthyroid group while 71.4% were in hypothyroid group. this study shows significant association between abnormal tsh values and adverse perinatal outcomes (p<0.001). this prospective screening of thyroid function in a cohort of unselected pregnant women shows that high-risk women (with a personal or family history of thyroid disorders or a personal history of other autoimmune diseases) have more significant (p<0.001) increased risk of hypothyroidism (subclinical or overt) during early pregnancy. however, testing only the high-risk pregnant women, as the consensus guidelines recommend, would miss about one- of women with hypothyroidism. therefore with the growing evidence for an association between maternal subclinical hypothyroidism and adverse pregnancy outcomes but lack of intervention trials showing beneficial effect of thyroxine (t4) in preventing these adverse outcomes, the controversy between targeted high-risk case finding and universal screening continues. the consensus guidelines recommend the use of t4 in pregnant women with subclinical hypothyroidism, justified on the basis of potential benefit to risk ratio. our study shows that, without universal screening, a significant number of such pregnant women with thyroid dysfunction will not be picked up. free thyroxine (ft4) increases with suppression of tsh in response to placental human chorionic gonadotrophin during the first trimester, whereas ft4 tends to decrease in late gestation. this is likely to be the cause for the high prevalence of suppressed tsh in this cohort. furthermore increased serum thyroid-binding globulin and decreased albumin during pregnancy result in assay-dependent variations in ft4 levels. these observations have led to the call for using trimester and assay-specific reference ranges for thyroid function tests in pregnancy. if the trimester specific reference range is used, 9.8% pregnant women in this cohort will be considered to have hypothyroidism. whereas there will be less of a controversy to use the trimester-specific reference range in titrating the dose of t4 in pregnant women on t4 replacement, further studies are needed to determine the threshold level of tsh at which initiation of t4 replacement should be considered. clinical studies have confirmed that the increased requirement for t4 (or exogenous lt4) occurs as early as 4-6 weeks of pregnancy. such requirements gradually increase through 16-20 weeks of pregnancy, and thereafter plateau until time of delivery. these data provide the basis for recommending adjustments to thyroid hormone in affected women once pregnant and for the timing of follow-up intervals for tsh in treated patients. the levothyroxine (lt4) adjustment, when necessary, should be made as soon as possible after pregnancy is confirmed to reduce the probability of hypothyroidism. a prospective, randomized study has recently provided evidence in support of one dose adjustment strategy for women receiving lt4 who are newly pregnant. for women who are euthyroid while receiving once-daily dosing of lt4 (regardless of amount), a recommendation to increase by two additional tablets weekly (nine tablets per week instead of seven tablets per week; 29% increase) can effectively prevent maternal hypothyroidism during the first trimester and mimic gestational physiology. this augmented dose should occur immediately after a missed menstrual cycle or suspected pregnancy occurs. a separate option is to increase the dosage of daily lt4 by approximately 25-30%. there is also an uncertainty regarding the most appropriate initial screening test for thyroid dysfunction in pregnancy. the consensus guidelines recommend using tsh as the initial test, whereas others have stressed the importance of testing ft4 by highlighting the fact that ft4 (and ft3) is responsible for thyroid hormone action and that maternal hypothyroxinemia (normal tsh but low ft4) is associated with neuropsychological deficit in the offspring. in our study, the cause of maternal hypothyroxemia is not fully understood, but iodine deficiency is thought to be a major factor although urinary iodine was not analyzed in the present cohort, a previous study in this same population has shown that 7 and 40% pregnant women have urinary iodine excretion of less than 50 g/l (suggestive of dietary iodine deficiency) and 50-100 nearly one-quarter of hypothyroid women on t4 replacement in this study had raised tsh at their first antenatal visit. given the fact that the fetus relies entirely on maternal thyroid hormones for its development until about 13 week of gestation, it is critical to ensure adequate t4 replacement in pregnant women during the first trimester. hypothyroid pregnant women on t4 require an increased dose from as early as the fifth week of gestation to maintain optimum t4 replacement. some recommend a 30% increase in the t4 dose as soon as the pregnancy is confirmed, with further dose adjustments based on tsh measurements. in addition, through education of all hypothyroid women in the reproductive age, every attempt should be made to ensure an adequate t4 replacement before a planned pregnancy. so screening of thyroid disorders should be done in early pregnancy. it will help to diagnose the cases at the earliest and to carry out timely intervention to prevent adverse perinatal outcomes. but still there is a controversy regarding universal thyroid function screening or high-risk screening in early pregnancy. but if we screen only high risk population we would miss 4.6% cases which could have been diagnosed and treated earlier. so this study emphasizes high risk screening in early pregnancy but also supports that universal screening should be a part of our screening protocols so that all thyroid disorders are screened and treated at the earliest. so in our country we must follow indian thyroid society guidelines which clearly recommend that all pregnant women should be screened at 1 antenatal visit by measuring tsh levels, and highlight that ideally screening should be carried out during prepregnancy evaluation or as soon as pregnancy is confirmed.

objective: to determine the importance of screening for thyriod disorders in the first trimester of pregnancy. materials and methods: the study was conducted on 305 patients which were were randomly selected and screened on opd basis by tsh levels (cut off level 0.10-2.50 miu/ml). results: in the 305 women screened mean age was 24.46 years, mean gestational age was 9.09 weeks, 89.83% were euthyroid, 9.8%were hypothyroid, 0.32% were hyperthyroid. incidence of hypothyroidism in high risk population was 20.58% and in normal population was 6.7%. there was significant association of thyroid disorders with high risk factors (p<0.001). in hypothyroid women 46% had adverse perinatal outcomes and 53.33% had normal outcomes. this shows statistically significant association abnormal tsh values with adverse pregnancy outcomes (p<0.001). in abnormal perinatal outcomes 6.2% women had caesarean section out of them 73.68% were euthyroid, 26.31% were hypothyroid 1.9% had preterm labour, out of them 50% were euthyroid, 50% were hypothyroid. out of 2.2% spontaneous abortions 28.5% were in euthyroid group while 71.4% were in hypothyroid group. there was 1 term stillbirth in hypothyroid group. this study showed significant association between abnormal thyroid stimulating hormone (tsh) values and adverse perinatal outcomes (p<0.001). conclusion: there is significant correlation between risk factors and hypothyroidism. so high risk screening is mandatory in early pregnancy. but if we screen only high risk population we would miss 4.6% cases which could have been diagnosed and treated earlier. therefore it is important to screen all pregnant women in the first trimester, it should be made mandatory.

PMC4171902

pubmed-363

the incidences were getting higher and higher. increased intramyocellular lipid accumulation plays a very important role in obesity and diabetes, as well as their complications [2, 3]. this attracted great interest in the effect of accumulated lipid intermediates on insulin resistance [4, 5]. lipotoxicity was regarded as the link of high levels of lipids with impaired insulin signaling [6, 7]. this sparked the interest in how excessive lipid affects -oxidation and mitochondrial biogenesis, which may have a great impact on glucose utilization and insulin resistance [710]. carnitine palmitoyl transferase 1 (cpt1) is an important rate-limiting enzyme of mitochondrial -oxidation, by controlling the mitochondrial uptake of long-chain acyl-coas. its muscle isoform, cpt1b, is the predominant isoform rich in the heart and skeletal muscles. it was suggested that inhibiting cpt1 activity by specific cpt1 inhibitors alleviates insulin resistance in diet-induced obese mice. however, there is no study investigating if specific cpt1b deficiency in skeletal muscles had significant impact on lipids and insulin sensitivity. therefore, in this study, by establishing a mouse model, we directly explored this issue. with specific knockout of carnitine palmitoyl transferase-1b (cpt1b) in skeletal muscles of mice, cpt1b m/ mouse model was established as per previously described [12, 16, 17] by using male c57/bl6 mice (12 weeks old; 2025 g) with cre-lox technology [17, 18]. mice were genotyped by standard pcr of tail dna with pcr master mix (applied biosystems inc.). twenty mice from each group (cpt1band cpt1b m/) were kept on a 12 h/12 h light/dark cycle, in temperature-steady rooms, and had ad libitum access to water and chow diet. all experimental procedures were conducted according to the care and use guide of laboratory animals and were approved by the iaec of the huzhou central hospital. general and metabolic profiles were measured at 12, 18, 24, and 30 weeks of age, including the following: body weight, lipids in serum, food intake, body mass, and fat mass, as per related protocols [19, 20]. skeletal muscle mrna and protein were extracted and purified with standard protocols as per our previous protocols [7, 21]. rt-pcr was performed for mrna quantization per standard protocols with the reagents from abi system inc. quantitative real-time rt-pcr analyses were carried out by using step one real-time pcr system (applied biosystems inc.). cycles were 50c for 2 min, a 2 min 95c denaturing step, followed by 50 cycles of 95c denaturation, incubated at 60c for 2 min, and denatured at 95c for 1 sec for the final step. the sequences of the primers are as follows: for cpt1b: forward: gac cat agaggc act tct cagcat gg, reverse: gcagca gcttca ggg tttgt; -actin: forward: gtc ctc tcc caa gtc cac ac, reverse: ggg aga cca aaa gcc ttc at; pakt forward: taa tac gac tca cta tag ggc caa ggagatcatgc, reverse: gatttaggtgacactatagctccaagctatcgtcc; glut4 forward: accgtggtccttigctgtgtt, reverse: acc cca atg ttg tac cca aac t. as described previously [16, 22, 23], a modified mitochondrial cpt1 assay was performed to measure cpt1 activity. briefly, quantified mitochondria (100 g protein) from skeletal muscles were incubated with reaction buffer (117 mm tris-hcl, 0.28 mm reduced glutathione, 4.4 mm atp, 4.4 mm mgcl2, 16.7 mm kcl, 2.2 mm kcn, 40 mg/l rotenone, 0.1% bsa, and 50 mm palmitoylcoa) at 37c for 5 min. initiate the reaction by adding 2 mm [c]-carnitine (0.1 ci) and queued it 10 min later with 50 l 1.2 mm ice cold hcl. [c]-palmitoyl carnitine was extracted with water saturated butanol and measured via liquid scintillation counting. as previously described [24, 25], fao was examined with radiolabeled palmitate fao assay. skeletal muscle tissues were homogenized, and mitochondria were isolated and quantified (100 g proteins). palmitate oxidation assay was performed with reaction buffer (75.5 mm sucrose, 12.5 mm k2hpo4, 100 mm kcl, 1.75 mm mgcl2-6h2o, 1.75 mm l-carnitine, 0.125 mm l(-) malic acid, 1.75 mm dtt, 0.07 mm nad+, 2 mm atp, 10 mm tris-hcl, and 0.07 mm coenzyme a). the reaction started when 200m [c]-palmitate-15% bsa (1: 6) complex (0.04 ci/reaction mixture) was added and stopped by 3.5 m perchloric acid after incubation at 37c for 30 min. co2-trapping medium (naoh, 0.1 m) for c radioactivity was measured by liquid scintillation to calculate palmitate oxidation rate. after incubation, co2 and c-asps were measured (ls 6500; beckman coulter). calculations were then performed accordingly. as previously reported [2628], tags, dags, and ceramides were tested with kc-esi-ms and gas chromatography (applied biosystems inc.). after the solution was evaporated dry and reconstituted, the samples were analyzed with mass spectrometry (ms). the analysis was performed in positive ion mode electrospray ion (esi-ms) source and precursor ion scans m/z 264 and 282 (ceramides). ceramides were quantified by taking the ratios of the integrated intensity for each subspecies to the intensity of c17:0. as described [2931], an intraperitoneal glucose tolerance test (igtt) and insulin tolerance test (itt) were performed on nonanaesthetized mice after 8 hours ' fasting. blood glucose was measured with lancet glucometer (johnson and johnson). for igtt, 20% glucose (2.0 blood samples were collected from tail vein at 30, 60, 90, and 120 min for glucose levels. for itt, glucose blood levels were sampled at 5, 10, 15, 20, 25, and 30 min following intraperitoneal injection of human insulin (0.75 u 4.5 nmol/kg; novolin r, novo nordisk). as described previously [32, 33], skeletal muscles were homogenized in ice-cold buffer (250 mm sucrose, 10 mm tris-hcl, 2 mm edta, and 1 mm atp (ph 7.4)). for glucose oxidation, fresh skeletal muscle tissues were homogenized in ice-cold buffer (5 mm kcl, 2 mm tris-hcl, 0.5 mm tris base, 0.25 mm mgcl2-6h2o, 0.05 mm edta, and 0.05 mm atp (ph 7.4)), 400 l homogenate was used and the reaction started when 200 m [c]-glucose (0.1 ci/reaction mixture) was added. co2-trapping medium (naoh, 0.1 m) for c radioactivity was measured by liquid scintillation to calculate glucose oxidation and quantified by weight of the skeletal muscle tissue homogenate. student's t-test was used to evaluate the statistical significance of differences between knockout and controls. as shown in figure 1(a), the mrna expression of cpt1b decreased specifically in skeletal muscles (rt-pcr) but not in the heart muscle in cpt1b m/ mice. cpt1 activity is barely detectable (dtnb assay at 412 nm) in mitochondria (figure 1(b)) for the knockout mice, even up to 10 minutes. compared to the mice in cpt1b group, those mice in cpt1b m/ group had similar daily food intake. however, as shown in table 1, their body weights were lower, starting about 12 weeks of age, along with lower fat mass (p<0.05, resp.). their lipids levels were higher (p<0.05), but their glucose and insulin levels were similar. as shown in figure 2(a), fao was decreased in isolated mitochondria (radiolabeled palmitate) in skeletal muscles of cpt1b m/ mice. this was accompanied by elevation of ceramides, tags, and dags (figures 2(b) and 2(c)). interestingly, for the ceramides, c16, c18, and c18:1 had significant increases for cpt1b m/, but not for c24 or c24:1. both dags and tags are dramatically elevated in cpt1b m/ mice. as shown in figure 3(a), cpt1b m/ mice maintain insulin sensitivity (insulin tolerance test). compared with wild type, glucose tolerance test of cpt1b m/ mice had improved significantly (as shown in figure 3(b)). pyruvate oxidation went up (figure 3(c)) and so did insulin-stimulated pakt and glut4 (figure 4). the relationship of fatty acid oxidation, lipids accumulation, and insulin sensitivity in skeletal muscles has been quite interesting. imbalanced fatty acid uptake and fatty acid oxidation (fao) have been linked to insulin resistance in muscles, which in turn worsens and complicates obesity and diabetes, as well as their complications [7, 34, 35]. our study demonstrated that in mice with conditional knockout cpt1b in skeletal muscles, mitochondrial fatty acid oxidation was depressed dramatically. this was accompanied by increased accumulation of lipids in skeletal muscles, such as dags, tags, and ceramides. regardless of these changes, insulin tolerance test, glucose tolerance test, and pyruvate oxidation all proved better insulin sensitivity for the knockout mice. this is partially consistent with the recent results in high-fat diet-induced obese mice, when given cpt1 inhibitor oxfenicine, as far as the major findings are concerned. another study done with different cpt1 inhibitor, etomoxir, suggested that lipids intermediates increased. 70% of total insulin-induced glucose disposal occurs in skeletal muscles, this may indicate that increased fatty acid intermediates in skeletal muscles could damage insulin sensitivity. our study showed that regardless of the characteristics of lipids accumulation, the mice are still insulin sensitive. first, due to the knockout of cpt1b in skeletal muscles, the major fuel sources were in deficit. this may suggest that signaling pathways related to energy were impaired or injured such as ampk or mtor. second, abnormal mitochondrial biogenesis and mitochondrial dysfunction may contribute to insulin resistance and diabetes [39, 40]. we explored from these aspects the enzymes involved in mitochondrial activity such as -had and citrate synthase, genes related to transcriptions such as nrf (nuclear respiratory factor), and the major nuclear receptor activator pgc1. thirdly, considering the correlation of adaptation of peroxisomal and amino acid to mitochondria, we further explored these changes. we will report these results in our next paper and further discuss the mechanism involved. in summary, it suggested that with specific knockout of cpt1b in skeletal muscles, although there were lipids accumulations in skeletal muscles, the insulin sensitivity still remains.

objective. by specific knockout of carnitine palmitoyl transferase 1b (cpt1b) in skeletal muscles, we explored the effect of cpt1b deficiency on lipids and insulin sensitivity. methods. mice with specific knockout of cpt1b in skeletal muscles (cpt1b m/) were used for the experiment group, with littermate c57bl/6 as controls (cpt1b). general and metabolic profiles were measured and compared between groups. mrna expression and cpt1 activity were measured in skeletal muscle tissues and compared between groups. mitochondrial fatty acid oxidation (fao), triglycerides (tags), diglycerides (dags), and ceramides were examined in skeletal muscles in two groups. phosphorylated akt (pakt) and glucose transporter 4 (glut4) were determined with real-time polymerase chain reaction (rt-pcr). insulin tolerance test, glucose tolerance test, and pyruvate oxidation were performed in both groups. results. cpt1b m/ model was successfully established, with impaired muscle cpt1 activity. compared with cpt1b mice, cpt1b m/ mice had similar food intake but lower body weight or fat mass and higher lipids but similar glucose or insulin levels. their mitochondrial fao of skeletal muscles was impaired. there were lipids accumulations (tags, dags, and ceramides) in skeletal muscle. however, pakt and glut4, insulin sensitivity, glucose tolerance, and pyruvate oxidation were preserved. conclusion. skeletal muscle-specific cpt1 deficiency elevates lipotoxic intermediates but preserves insulin sensitivity.

PMC3844227

pubmed-364

5-fluorouracil (5-fu) is a widely used chemotherapeutic drug and cardiac complications are not rare. however myocardial infarction, tako-tsubo-like syndrome and cardiogenic shock are also described. a 50-year-old man (weight 70 kg, height 180 cm) was admitted to a primary care hospital following an episode of syncope. he reported acute orthopnea and an attack of sweating at night accompanied by nausea and vomiting before loss of consciousness for 1 min. in the emergency room, patient developed asystole and was immediately and successfully resuscitated for 2 min. afterwards, he was fully oriented without any neurological dysfunction. consequently, he was transferred to our heart center for further diagnostic work-up and therapy. importantly, patient had no previous history of cardiovascular disease or risk factors, but was diagnosed with colorectal cancer (ct3 n1 m0) and underwent recent neoadjuvant chemotherapy with 5-fu (9500 mg by continuous infusion over a period of 120 h) until 1 day before his acute presentation. his physical examination revealed hypotensive blood pressures (89/58 mmhg) and heart rate at rest of 95 bpm. the electrocardiogram documented sinus rhythm at 95 bpm with non-significant st-elevation in leads ii, iii, avf. high-sensitive troponin t (60 ng/l; upper reference value 14 ng/l) and creatine kinase-mb fraction (0.74 mol/l*s; upper reference value 0.41 mol/l*s) were slightly elevated. creatinine kinase showed a normal value of 0.93 mol/l*s (upper reference value 3.17 mol/l*s). initial transthoracic echocardiography (tte) showed a normal sized left ventricle (left-ventricular end-diastolic diameter: 48 mm, left-ventricular end-diastolic volume: 103 ml) with global hypokinesia and severely decreased left-ventricular systolic function [left-ventricular ejection fraction: 16%; [figure 1a and b]. transthoracic echocardiography on day 1 (a) apical four-chamber view during diastole, (b) apical four-chamber view during systole (there is global hypokinesia with severely impaired thickening of the left ventricular wall in systole) one day after admission, patient had persistent hypotension with increasing lactate levels as a sign of peripheral malperfusion. on repeat echocardiographic examination, left-ventricular systolic function was found to have further decreased with a left-ventricular ejection fraction of<10%. due to the progressive cardiogenic shock, we decided to treat this condition by the use of an extracorporeal membrane oxygenation (ecmo) support by percutaneous implantation. on ecmo support, hemodynamic stabilization was evident and medical heart failure treatment including angiotensin-converting enzyme-inhibitor, diuretics and spironolactone was commenced. after 4 days with ecmo therapy, left-ventricular ejection fraction improved to 45% and lactate levels were in normal ranges (< 2 therefore, ecmo-flow was reduced slowly up to 1.5 l/min. due to the stable lactate levels (< 2 the following course was uncomplicated with normalization of blood pressures and no signs of heart failure. eight days after admission, he was transferred to the normal ward. left-ventricular ejection fraction was now recovered to a normal value of 60% [figure 2a and b]. for confirmation and further differential diagnosis cardiac, magnetic resonance imaging (mri) the mri showed a normal sized left ventricle (left ventricular end-diastolic volume: 149 ml; normal value 102-235 ml) with normal ejection fraction of 57% and without any specific wall motion abnormality. furthermore, t1-weighted imaging showed pronounced early contrast enhancement, indicating some degree of myocardial hyperemia. patient was discharged from hospital in a stable cardiac condition without symptoms of heart failure 11 days after admission. transthoracic echocardiography on day 10 (a) apical four-chamber view during diastole, (b) apical four-chamber view during systole. this report describes a patient with no history of cardiovascular disease who experienced acute left-ventricular failure after administration of 5-fu. cardiac complications ranging from angina pectoris to cardiogenic shock after chemotherapy with 5-fu are not rare. coronary vasospasm, endothelial damage with consequent thrombus formation, increased myocardial oxygen demand, block of myocardial cell metabolism and tako-tsubo-like syndrome with supraphysiologic levels of plasma catecholamines are discussed as potential pathogenetic mechanisms. our patient did not report any angina and obstructive coronary lesions were excluded by angiography. echocardiography did not reveal an apical ballooning as common in tako-tsubo-like syndrome. the cardiac mri of our patient strengthens the concept of an additional temporary myocardial inflammation. increased global myocardial edema and evidence of myocardial hyperemia are compatible with a regressive inflammation. unfortunately, the mri could not be performed in the acute setting with severely decreased left-ventricular function due to ecmo-therapy and therefore, the extent of myocardial edema and hyperemia might be underestimated. treatment of cardiogenic shock is still a therapeutic challenge, especially if coronary artery disease was excluded. usually, sympathomimetics are used as first line therapeutics, but several disadvantages in their use have to be taken into account. sympathomimetics induced vasoconstriction can lead to perfusion mismatch or even deficit within the microcirculation and metabolic acidosis due to an increased oxygen demand can be observed regularly. in addition, some studies give evidence that use of sympathomimetics is directly linked to enhanced systemic inflammatory response due to an increased interleukin-6 expression. in our case with unclear pathogenesis of cardiogenic shock, we decided to use a mechanical hemodynamic support (intraaortic balloon counterpulsation or ecmo) to avoid above mentioned disadvantages with the use of sympathomimetics, especially with the knowledge about inflammation as a possible cause of 5-fu induced left-ventricular dysfunction. recently, intraaortic balloon counterpulsation was shown not to reduce 30-day mortality in patients with cardiogenic shock complicating myocardial infarction. in our case with progressive cardiogenic shock, therefore, we decided to use ecmo-the most potent form of acute cardiorespiratory support, which enables complete relief of cardiac workload and prevents high-dose usage of sympathomimetics. cardiogenic shock should be taken into consideration as a possible complication secondary to chemotherapy with 5-fu, even in patients without a history of cardiovascular disease. to the best of our knowledge, this is the first report of an ecmo support in this kind of chemotherapeutic induced cardiogenic shock. ecmo support enabled complete relief of cardiac workload and together with medical therapy for heart failure, complete recovery of cardiac function was possible.

a 50-year-old man with no previous history of cardiovascular disease or risk factors was admitted for syncope and orthopnea. importantly, he underwent recent chemotherapy with 5-fluorouracil (5-fu) until 1 day before his acute presentation. in the emergency room, patient developed asystole and was successfully resuscitated for 2 min. at coronary angiography, no signs of coronary artery disease were detectable, but transthoracic echocardiography showed a severely decreased left-ventricular systolic function. due to the progressive cardiogenic shock, an extracorporeal membrane oxygenation (ecmo) support was used as bridge-to-recovery and to avoid the use of sympathomimetics with their known disadvantages. on ecmo support, hemodynamic stabilization was evident and medical heart failure treatment was commenced. left-ventricular function recovered to normal values within a short period of time. cardiac complications after chemotherapy with 5-fu are not rare and should be taken into consideration even in acute heart failure with cardiogenic shock. ecmo as the most potent form of acute cardiorespiratory support enables complete relief of cardiac workload and therefore recovery of cardiac function.

PMC4062987

pubmed-365

hand, foot, and mouth disease (hfmd) is a common, acute, and mostly self-limiting enteroviral infection that presents with fever and vesicular lesions on the hands, feet, mouth, and frequently buttocks as characteristic features1,2,3,4). although patients with hfmd recover without any sequelae within about 1 week, severe complications occur in a few cases, some of which are life threatening. severe complications accompanying hfmd include encephalitis, pulmonary edema/hemorrhage, cardiopulmonary collapse, and myocarditis1,2). enterovirus 71 can often lead to a more severe clinical course accompanied by neurologic and cardiopulmonary complications and may rapidly lead to death1,2,3). enterovirus 71-induced hfmd developed in korea in 2000 but it was not an epidemic and fatal until 20081,4,5). in the spring of 2009, a large nationwide outbreak of hfmd caused by enterovirus 71 occurred in korea, and a few cases with encephalitis were fatal1,4,6). a multicenter study in korea performed by the enterovirus complication working group revealed that encephalitis with cardiopulmonary complications of hfmd occurred in 2.4% of patients, including 2 patients (1.2%) who expired1). pulmonary hemorrhage in enterovirus 71-infected hfmd patients has been reported in taiwan, china, and malaysia2,7,8,9). however, to our knowledge, no cases of hfmd with sudden-onset massive pulmonary hemorrhage have been reported in korea. here, we report a fatal case of enterovirus 71-induced hfmd that progressed rapidly with massive pulmonary hemorrhage and convulsion. a 12-month-old, previously healthy boy with hfmd was referred to inje university ilsan paik hospital because of 3 episodes febrile convulsions. he was born at full term weighing 3.87 kg through normal vaginal delivery by a vietnamese mother. he was admitted to a primary hospital with high fever (up to 39), throat vesicles, and vesicular rashes on his hands and feet for 2 days. on the second hospital day, he had 3 generalized tonic-clonic and atonic convulsions with vertical eyeball deviation within 5 minutes of each other. his chest radiography was normal. within 5 hours after admission, he vomited 3 times after meals. besides a body temperature of 38.3, his other vital signs were stable and he remained conscious. desaturation to 76% percutaneous blood oxygen saturation (spo2) and tachycardia to 176 beats/min accompanied by perioral cyanosis occurred suddenly 6 hours after admission. his respiration rate was 34 breaths/min, and auscultation disclosed rales on the whole lung field. an endotracheal tube was inserted immediately, and a large amount of blood from a pulmonary hemorrhage came out through it. comparison of laboratory test results between his initial and pulmonary hemorrhagic status revealed that his hemoglobin decreased from 9.6 to 8.3 mg/dl and his white blood cell count increased from 13,090 to 17,450 cells/l. erythrocyte sedimentation rate was slightly increased from 15 to 32 mm/hr, but c-reactive protein level decreased from 1.06 to 0.2 mg/dl. prothrombin time (pt) and pt international normalized ratio were slightly prolonged (16.5 and 1.39 seconds, respectively). meanwhile, d-dimer (2,375.91 ng/ml) and fibrin degradation product (5-20 g/ml) were elevated. eight hours after admission, his blood pressure decreased to 82/41 mmhg and heart rate increased to 220 beats/min. his body temperature ranged from 38.8 to 40.2. the patient was diagnosed as fatal hfmd with massive pulmonary hemorrhage. intravenous immunoglobulin (ivig, 1 g/kg/dose), dexamethasone (0.3 mg/kg/day in divided doses every 6 hours), and cefotaxime (150 mg/kg/day in divided doses every 6 hours) were administered immediately. in addition, leukocyte-depleted red blood cells and fresh frozen plasma were transfused, and intravenous vitamin k and endotracheal epinephrine were administered. lumbar puncture was scheduled but was ultimately not performed because of the patient's unstable vital signs. the patient expired 15 hours after admission, and it was within 3 days of fever onset and within 9 hours after intubation. we reported it to the korea centers for disease control and prevention (kcdc), sending his urine, serum, nasopharyngeal swab, and endotracheal aspirate. enterovirus genome detection was attempted by realtime reverse transcription-polymerase chain reaction (rt-pcr) using a taqman system (applied biosystems, foster city, ca, usa). for genotyping, seminested rt-pcr was used to amplify part of the viral protein 1 (vp1) gene of enteroviruses according to the kcdc protocol, and sequencing analysis for the vp1 amplicon was performed by an automatic sequencer and the dnastar software package (dnastar inc., madison, wi, usa). the kcdc isolated enterovirus 71 with subgenotype c4a from the patient's serum and nasopharyngeal swab. bocavirus was also isolated from his nasopharyngeal swab by real-time rt-pcr at our hospital. to our knowledge, this is the first reported case of hfmd with sudden-onset massive pulmonary hemorrhage in korea. pulmonary edema/hemorrhage is the mysterious hallmark symptom of enteroviral hfmd and can kill a child within 1 day2). an epidemic study conducted in taiwan from 1998 to 2005 reported that pulmonary edema/hemorrhage occurred in 43% of patients with severe culture-proven enteroviral hfmd/herpangina2). this discrepancy maybe due to different enterovirus virulence or subgenotypes, or differences in susceptibility with respect to ethnicity. pulmonary edema/hemorrhage is characterized by respiratory distress, tachypnea, tachycardia, hemoptysis, and rapidly progressing diffuse infiltration or congestion on a chest film2). a study on the outbreak in taiwan in 1998 reported that enterovirus 71-infected hfmd patients with pulmonary edema had suddenonset tachypnea, tachycardia, and cyanosis within 1-3 days after disease onset, and pulmonary edema led to a rapid death within 12 hours after intubation10). the present patient exhibited a change in consciousness, respiratory distress, tachypnea, tachycardia, hemoptysis, rapidly progressing infiltration on a chest film, hypoxemia, and hypotension. this patient ultimately expired within 3 days of fever onset and within 9 hours after intubation. in this report, we had applied pulse oxymetry from the beginning, so we could find his desaturation immediately after pulmonary hemorrhage. we suggest saturation monitoring for hfmd patients with central nervous system (cns) involvements for early detection. it may be caused by increased pulmonary vascular permeability as a result of either brainstem encephalitis or a systemic inflammatory response caused by excessive cytokine release2,6). cns involvement of enterovirus 71-induced hfmd may also trigger a sympathetic storm, resulting in vasoconstriction with high systemic vascular resistance, passive pulmonary volume loading, and pulmonary edema/hemorrhage8). the present patient had several episodes of convulsions, lethargy, and loss of consciousness. therefore, we suspected encephalitis, although we were unable to perform a cerebrospinal fluid study because of his unstable vital signs. his suspected encephalitis may be a possible cause of the pulmonary hemorrhage. however, pulmonary edema/hemorrhage without cns involvement occurred in 11% of patients with severe culture-proven enteroviral hfmd/herpangina in an epidemic study in taiwan from 1998 to 20052). another possible explanation for the pathogenesis is coinfection with a second virus2), as bocavirus coinfection was detected in the patient. however, the presence of both viruses would not result in increased mortality due to hfmd, according to a previous study2). a multicenter study performed by the enterovirus complication working group investigating enterovirus 71-induced hfmd in korea in 2009 reported that an hfmd rash pattern, fever longer than 4 days, peak body temperature>39, vomiting, headache, neurologic signs, leukocytosis, serum glucose>100 mg/dl, and isolated enterovirus 71 may be indicative of poor prognosis during hfmd epidemic periods1,10). in addition, young age at disease onset and a history of lethargy are associated with an increased risk of severe hfmd11). the present patient was young and presented with hfmd rashes and vesicles, fever up to 39, vomiting, lethargy, and convulsions as neurologic signs as well as leukocytosis, high serum glucose level, and isolated enterovirus 71 as poor prognostic factors. hfmd patients are very frequently approximately 1 year of age, and deaths were reported to occur at around 1 year of age in other studies12,13,14,15). in the 2009 outbreak, 2 patients around 1 year of age expired, and the present patient was a 12-month-old baby. the gold standard for the diagnosis of enteroviral infection is viral culture and isolation in 2 or more specimens of cerebrospinal fluid, blood, nasopharyngeal swab or secretion, vesicular fluid, or stool to increased diagnostic sensitivity1,4,6,11). in the present report, enterovirus 71 was isolated from both the patient's serum and nasopharyngeal swab. in the 2009 korean outbreak, the subgenotype of enterovirus 71 was c4a, which was prevalent in china in 2008. in the present case, the subgenotype of enterovirus 71 was also c4a. the administration of high-dose ivig is recommended for severe hfmd as optional treatment, because ivig therapy was effective in many reports4,5,6,7,11). ivig neutralizes the virus and has nonspecific antiinflammatory properties11); this would significantly reduce mortality by attenuating sympathetic activity and cytokine production5). furthermore, fluid restriction, inotropic agents, and early intubation with positive-pressure mechanical ventilation are recommended for severe hfmd with pulmonary edema or hemorrhage8). pulmonary hemorrhage in enterovirus 71-infected hfmd is very rare; the present case is likely the first to have occurred in korea. the present case of fatal hfmd was rapidly aggravated and the patient expired within 3 days from fever onset. therefore, all physicians should pay special attention to infants and young children with hfmd, particularly in enterovirus 71 epidemic areas such as korea, to enable early detection and management of severe hfmd. above all, keeping the infected child at home until full recovery and controlling the preschool with infected child are very important for reducing infection6). in addition, the development of antiviral agents and vaccines is necessary especially for the control of severe hfmd with complication.

hand, foot, and mouth disease (hfmd) is an acute, mostly self-limiting infection. patients usually recover without any sequelae. however, a few cases are life threatening, especially those caused by enterovirus 71 (ev71). a 12-month-old boy was admitted to a primary hospital with high fever and vesicular lesions of the mouth, hands, and feet. after 3 days, he experienced 3 seizure episodes and was referred to our hospital. on admission, he was conscious and his chest radiograph was normal. however, 6 hours later, he suddenly lost consciousness and had developed a massive pulmonary hemorrhage that continued until his death. he experienced several more intermittent seizures, and diffuse infiltration of both lung fields was observed on chest radiography. intravenous immunoglobulin, dexamethasone, cefotaxime, leukocyte-depleted red blood cells, fresh frozen plasma, inotropics, vitamin k, and endotracheal epinephrine were administered. the patient died 9 hours after intubation, within 3 days from fever onset. ev71 subgenotype c4a was isolated retrospectively from serum and nasopharyngeal swab by real-time reverse transcription-polymerase chain reaction. here, we report a fatal case of ev71-associated hfmd with sudden-onset massive pulmonary hemorrhage and suspected encephalitis.

PMC4388973

pubmed-366

since the increase in adiposity is related to general poor health factors such as an increase in type ii diabetes and increased incidence of coronary heart disease, exercise to reduce adiposity is recommended for the ageing population. a further consequence of the ageing process is that elderly individuals have an impaired ability to oxidise fatty acids, particularly after a meal. since most individuals eat a meal prior to exercise in order to provide some form of sustenance, what should the meal contain if the exercise priority is to burn fat? generally, a high-fat, low-cho meal increases fat oxidation during subsequent exercise [46], whereas the ingestion of cho before exercise depresses the rate of fat oxidation due to hyperinsulinemia in the postprandial period. altering the type of cho consumed has been shown to have an effect on the magnitude of hyperinsulinemia and depression of fat oxidation [8, 9] postprandial increases in glucose and insulin concentration promote cho oxidation, resulting in decreased fatty acid oxidation. wu et al. found that the amount of fat oxidised was significantly higher during exercise commencing 3 h after consuming a low glycemic index (lgi) meal compared with a high glycemic index (hgi) meal. they also demonstrated that the hgi meal resulted in a greater glycemic and insulinemic response during the postprandial period compared with lgi meal. this is supported by stevenson et al. who investigated the metabolic responses to hgi and lgi mixed meals after 60-minute exercise at 70% vo2max and found that significant differences in hyperglycemia and hyperinsulinemia can be achieved repeatedly by changing the glycemic index (gi) of the cho in a mixed meal. they observed that the amount of fat oxidised during the postprandial period following lunch was significantly higher in the lgi than the hgi trial. thus, at least for several hours postprandial, both at rest and during exercise, fat utilisation is depressed after hgi compared with lgi meals. the effects of different meals (high fat, hgi, and lgi) on fat and cho metabolism at rest and during exercise in young subjects have been extensively studied, although this is not the case for elderly individuals. as mentioned previously, it is an important health benefit for the elderly to engage in some form of aerobic exercise for improvements in the cardiovascular system and to reduce body fat. therefore, the present study was designed to investigate the effects of four different types of meals (normal, high-fat, hgi, and lgi) on fat and cho metabolism during exercise in elderly male subjects. eight healthy males (mean sd, age 63.3 5.2 years, height 168 0.05 cm, body mass 78.1 14.0 kg, body fat 21 5.3%, and vo2 max 36.9 10.4 mlkgmin) gave informed written consent to participate in the study after gaining approval from the human ethics committee of liverpool john moores university. blood pressure (dinamap pro series, ge medical systems, florida) was determined prior to performing any exercise as a screening for hypertension. participants reported to the laboratory on five separate occasions. in the first session they were familiarised with the laboratory environment and physiological testing equipment. height, body mass, and percent of body fat using dxa were also determined during this session. after familiarisation, vo2 max was determined on a cycle ergometer as described previously. after initial physiological measurements, participants reported to the physiology laboratory on four separate occasions, each of which was allocated for the performance of a 30-minutes exercise on a cycle ergometer at 60% vo2 max after having a high fat (hf), high carbohydrate hgi (hgi), high carbohydrate low lgi (lgi), and normal (n) meal. the rationale for 30-minutes exercise reflects a typical aerobic bout of exercise undertaken by such persons in a gym session and is recommended for health purposes. the four meals were given to subjects in a counterbalanced design and sessions were separated by at least 3 days. to avoid circadian variation, experiments were always performed at the same time of day (08:00 am) after an overnight fast. participants completed a 2-day food diary on the day before their first test and were asked to repeat this diet before all subsequent trials. in addition, subjects were requested to refrain from drinking alcohol, nor to engage in any kind of strenuous exercise 24 hours before trials. participants reported to the physiology laboratory after an overnight fast and remained seated for 20 minutes. after this rest period, blood pressure was checked and a blood sample (10 ml) was taken. they then consumed one of the meals which were provided in a random, counterbalanced order within 2030 minutes. at 3 h 20 min after the meal, subjects started the exercise protocol that included a 30-minutes cycling at 60% vo2 max. two more venous blood samples were taken, immediately before exercise (3 hours after the meal), and immediately after exercise in each session. oxygen consumption (vo2), carbon dioxide output (vco2), and respiratory exchange ratio (rer) were measured breath by breath throughout the exercise. participants were provided with one of the four following isoenergetic test meals: (1) and (2) hgi and lgi: 65% carbohydrate, 20% fat, and 15% protein, (3) hf: 65% fat, 20% carbohydrate and 15% protein, or (4) n: 50% carbohydrate, 35% fat, and 15% protein. the glycaemic index values for hgi and lgi were 74.32 and 29.26, respectively. before the meal, immediately before exercise and immediately after exercise venous blood samples were drawn in a seated position in each session. two microhaematocrit tubes (l. i. p. shipley, england) and two -haemoglobin microcuvettes (hemocue ab, ngleholm, sweden) were filled with whole blood for determination of haematocrit and haemoglobin, respectively. plasma was obtained by collecting the blood sample into tubes that had been pretreated with an anti-coagulant (lithium heparin). these samples were mixed and immediately centrifuged at 4c for 15 minutes at 1900 g. after centrifugation, plasma was separated and stored at 70c for the subsequent analysis of glucose, glycerol, nonesterified fatty acids (nefas), and b-hydroxybutyrate (3-ohb). the blood was stored at room temperature for 30 minutes before centrifuged at 20c for 15 minutes at 2000 g. serum was stored at 70c for subsequent analysis of insulin. nefa, glucose, glycerol, and 3-ohb were analysed using appropriate kits on ilab 300 analyser (il instrumentation laboratories, warrington, uk). insulin was assayed by elisa (drg instruments gmbh, germany) using a fully automated system (triturus, grifols, cambridge, uk). insulin resistance (homa2-ir) and -cell function (homa2% b) in fasting state were determined using a homeostasis model assessment (homa-ir) and were calculated from fasting insulin and fasting glucose. all statistical analyses were performed using the software statistical package spss version 12 (chicago, usa). one-way anova was employed to evaluate differences in the resting mean values of all the variables measured over the four testing occasions. in addition, fat and cho oxidations values during exercise for four trials were compared using one-way anova. a two-way anova (4 3) with repeated measures across meals (4 levels) and conditions (3 levels) was employed to examine the differences in mean values for blood parameters. when anova indicated the presence of a significant difference, post hoc comparisons using the bonferroni method were applied to determine pairwise differences. no significant main effect of the meals was observed for rates of fat oxidation (f3,21=1.8; p=.177), although fat oxidation was demonstrably, but nonsignificantly, higher after hf (0.26 0.04 g/min) than n (0.21 0.04 g/min), hgi (0.22 0.03 g/min), and lgi (0.19 0.03 g/min). the rates of carbohydrate oxidation during exercise were 1.79 0.28, 1.58 0.22, and 1.68 0.22, 1.77 0.21 g/min for n, hf, hgi, and lgi, respectively. statistical analysis revealed no significant effect of meal on the rate of carbohydrate oxidation during exercise. statistical analysis showed a significant main effect of the meal on nefa concentration (f3,21=39.2; p=.001). pairwise comparisons revealed a significant difference between nefa responses to n and hf (p=.02) as well as between hgi and lgi meals (p=.003). pre-exercise nefa concentration increased significantly following hf (from 0.39 0.08 to 0.61 0.08 mmol/l) and decreased significantly after eating hgi (from 0.44 0.09 to 0.13 0.02 mmol/l) and lgi (from 0.55 0.08 to 0.27 0.07 however, nefa concentration increased significantly in response to exercise only after hgi (from 0.12 0.02 to 0.36 0.09 mmol/l) and lgi (from 0.27 0.06 to 0.64 0.18 figure 1 highlights data from nefa. a significant effect of meal was found for glycerol concentration (f3,21=9.7; p=.001). pairwise comparisons revealed a significant difference between hf and hgi (p=.01). resting glycerol values were increased significantly after all meals except for hgi (figure 2). moreover, glycerol concentration increased significantly during exercise after all types of meals (figure 2). the statistical analysis revealed a significant effect of the meal on 3-ohb (f3,21=3.6; p=.03). however, pairwise comparisons did not show any significant difference among the four meals. resting 3-ohb concentration a significant effect of meals on glucose concentration was found (f3,21=39.2; p=.001). postprandial glucose concentration increased following all meals, though the changes were not statistically significant (figure 4). however, glucose concentration decreased significantly (p<.05) from 5.36 0.25 to 4.65 0.08 mmol/l during 30 minutes of exercise after hf and lgi, respectively. although anova did not show a main significant effect of either meal or time on insulin concentration, the pre-exercise insulin concentration (18.9 1.7 u/ml) in hgi trial was significantly (p<.05) higher than resting values (15.2 1.1 u/ml). in addition, insulin concentration decreased significantly during exercise after n, hf and hgi (figure 5). the mean (se) resting value of homa2-ir (insulin resistance) for all subjects was 0.76 0.06 and that for homa2- (-cell function) was 78.5 69. these resting values are indicators of normal insulin resistance and -cell function in our elderly subjects. the present study is the first study designed to investigate the effects of pre-exercise mixed meals on fat and carbohydrate metabolism during exercise in elderly individuals, and its principle finding was that in spite of some changes in fat metabolites, the composition of the meal did not result in differences in cho and fat oxidation. these results are in contrast to the data reported by previous studies in young subjects that observed a rise in fat oxidation after hf due to increases in fatty acid (fa) availability and mobilization [4, 6, 15, 16]. moreover, a depression in the rate of fat oxidation following cho ingestion, attributed to hyperinsulinaemia, has also been observed in the postprandial period [79]. availability and utilisation of plasma fa decreases after a cho meal partly because the cho-induced rise in insulin inhibits the mobilisation and availability of circulating fa, which reduces fat oxidation possibly by inhibiting the rate of long-chain fatty acids entry into the mitochondria for -oxidation [17, 18]. despite cho-induced hyperinsulinemia and suppression of fa after cho ingestion, our results show that the cho oxidation was resistant to alteration during exercise in elderly males. several mechanisms, including impaired insulin-stimulated glucose uptake, may have contributed to these results. having said that, it should be noted that the homa scores indicate normal insulin resistance and -cell function for these elderly participants. the increased release of fas in older individuals, in excess of the energy needs and/or oxidative capacity of respiring tissues, increases the amount of non-oxidised fas. excess non-oxidised fas with age may have several adverse metabolic effects including increased glucose production and impaired insulin-stimulated glucose uptake. fas exert their effects through inhibition of pdh with subsequent increased intracellular concentration of glucose-6-phosphate and inhibition of hexokinase, which decreases glucose uptake. another factor that may contribute to impaired glucose uptake with ageing is inhibition of glucose transport either due to less availability of the glut-4 transporters or, to the signalling processes for glut-4 vesicle translocation to the plasma membrane. these considerations need further exploration. although after the hf meal, nefa, and glycerol concentrations were higher than for the other meals, the fat oxidation rates during exercise were not different. evaluation of skeletal muscle samples has revealed that maximal mitochondrial oxidative enzyme activity is lower in older than in young subjects because of both decreased mitochondrial volume density and mitochondrial function. lower activity of enzymes such as ampk, camp, and protein kinase c in elderly individuals results in activation of acc (acetyl-coa carboxylase). activation of acc leads to an increase in concentration of malonyl-coa which has an inhibitory effect on cpt-i, thereby inhibiting the entry of long chain fatty acids into mitochondria and resulting in lower fa oxidation. lack of changes in fat oxidation after hf was found in spite of increased lipolysis. it has been demonstrated that relative to the energy needs of the body, fa release is not impaired in the elderly. in fact, fas are released in excess of energy needs in older individuals when compared to younger controls. thus, when considered relative to the energy demands of the body or the metabolically active tissue mass, ageing is not associated with impaired fa release which supports our findings for lipolysis. a higher rate of fat oxidation during submaximal exercise after ingesting lgi foods has been reported in young healthy males when compared to hgi [9, 11]. in terms of the effect of gi, the results of the present study were somewhat unexpected since the calculated amount of fat oxidation during 30 minutes of cycling commencing 3 hour after consuming hgi and lgi meals was not significantly different. one possible explanation for this discrepancy might be the impaired glucose uptake associated with ageing as previously discussed. in the present study, postprandial nefa concentration was increased after hf, which is in agreement with previous studies on young participants [6, 9]. the increase in plasma nefa concentration which occurred might be a result of tag hydrolysis by endothelial lipoprotein lipase (lpl). both hgi and lgi resulted in suppression of nefa concentrations 3 hours after the meal consumption. however, nefa concentrations at the end of 30-minutes cycling in both hgi and lgi trials were raised to pre-meal levels. higher post-exercise nefa is typical response to exercise-induced decrease in insulin and increase in catecholamines. the lack of a significant increase in glycerol after hgi might be due to the enhanced secretion of insulin following the hgi meal which would activate the enzyme lpl in adipose tissue. the insulin activation of lpl serves to increase tag uptake and storage after a single meal which eventually results in lower glycerol concentration. studies in young subjects during low and moderate intensity exercise have demonstrated that increased blood glucose availability suppresses fat utilisation by inhibition of both fat mobilisation and fat oxidation within muscle [7, 18]. postprandial glycerol concentration was significantly higher after hf than hgi and lgi in elderly subjects which reflects the lack of insulin response to hf in comparison to the other meals. these findings are in agreement with those of whitley et al. and murphy et al. who reported increases in glycerol after hf in young participants. the present study demonstrated that in elderly individuals feeding isoenergetic meals containing different proportions of carbohydrate and fat alters the metabolic variables at rest and during subsequent exercise. energy regulation during 30 min of cycling in elderly individuals following isoenergetic meals is associated with a relative increase in fat oxidation and a decrease in carbohydrate oxidation following hf and a corresponding increase in cho oxidation and a decrease following high carbohydrate (low fat) meals. therefore, based on these finding, it could be concluded that fat and carbohydrate metabolism in elderly individuals in response to different meals at rest and during subsequent exercise are to some extent different from those of young individuals and further studies are warranted to investigate the mechanism/s responsible especially in relation to insulin action and sensitivity. what we can state is that, on balance, eating any type of meal 3 hours prior to a 30-minutes bout of exercise is unlikely to significantly impact on so-called fat burning in healthy elderly males .

the present study was designed to investigate the effects of four different meals on fat and cho metabolism during subsequent exercise in elderly males. eight healthy males (age: 63.3 5.2 years) reported to the physiology laboratory on four separate occasions, each of which was allocated for the performance of a 30-minute exercise on a cycle ergometer at 60% vo2max after having normal (n), high fat (hf), high carbohydrate high glycaemic index (hgi) and high carbohydrate low glycaemic index (lgi) meals. fat oxidation during exercise after the meals (hf=0.26 0.04 g/min; n=0.21 0.04 g/min; hgi=0.22 0.03 g/min; lgi=0.19 0.03 g/min) was not significant (p>.05), and neither were the rates of carbohydrate oxidation (n=1.79 0.28, hf=1.58 0.22, hgi=1.68 0.22, and lgi=1.77 0.21 g/m). nefa concentration increased after hf (p<.05) but decreased after hgi and lgi (p<.05). glucose concentration decreased as a result of exercise after hf, and lgi (p<.05) whereas insulin concentration decreased significantly during exercise after n, hf, and hgi (p<.05). it can be concluded that, in elderly males, feeding isoenergetic meals containing different proportions of carbohydrate and fat do not significantly alter oxidation of fat and cho during exercise in spite of changes in some circulating metabolites .

PMC3136113

pubmed-367

optical buffers are recognized as essential components in wavelength routers, in which the packets of data can be stored for resolving packet contention problems and also delay the outgoing packets.1,2 in practice, the optical router patents have been proposed and recorded,35 which can be useful for various applications. recently, the promising techniques of microscopic volume trapping and transportation within the add/drop multiplexer have been reported in both theory6 and experiment,7 respectively, in which the transporter is known as an optical tweezer. here, the optical tweezer generation technique has become a powerful tool for the manipulation of micrometer-sized particles. to date moreover, the use of dynamic tweezers is now also understood in practical works.810 schulz et al11 have shown that the transfer of trapped atoms between two optical potentials can be performed. in principle, optical tweezers use forces exerted by intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters, in which the other combination of force is induced by the interaction between photons, which is caused by photon scattering effects. in application, the field intensity can be adjusted and tuned, in which the desired gradient field and scattering force can form the suitable trapping force. hence, the appropriate force can be configured for the transmitter/receiver, which can perform the long distance microscopic transportation. in this paper, dynamic optical tweezers/vortices are generated using a dark soliton, bright soliton, and gaussian pulse propagating within an add/drop optical multiplexer incorporating two nanoring resonators (panda ring resonator). the dynamic behaviors of solitons and gaussian pulses are well described by tasakorn et al.12 by using the proposed system, the transceiver can be integrated and performed by using a single device. here, the use of the transceiver to form the transportation of microscopic volumes of matter, especially13 for molecule transportation in liquid core waveguide,14,15 drug delivery, and dna transportation, in which the buffer is needed before reaching the required destination. in operation, the trapping forces are exerted by the intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters, in which the optical forces are customarily defined by the relationship:16 (1)f=qnmpc here q is a dimensionless efficiency, nm is the refractive index of the suspending medium, c is the speed of light, and p is the incident laser power, measured at the specimen. q represents the fraction of power utilized to exert force. for plane wave incidences on a perfectly absorbing particle because biological specimens are usually contained in aqueous media, the dependence of f on nm can rarely be exploited to achieve higher trapping forces. increasing the laser power is possible, but only over a limited range due to the possibility of optical damage. it depends upon the numerical aperture (na), laser wavelength, light polarization state, laser mode structure, relative index of refraction, and the geometry of the particle. furthermore, in the rayleigh regime, trapping forces decompose naturally into two components. since, in this limit, the electromagnetic field is uniform across the dielectric, particles can be treated as induced point dipoles. the scattering force is given by:16 (2)fscatt=nmsc, (3)=83(kr)4r2(m21m2+2)2 here is the scattering cross section of a rayleigh sphere with radius r. s is the time averaged poynting vector, n is the index of refraction of the particle, m=n/nm is the relative index, and k=2nm/ is the wave number of the light. the scattering force is proportional to the energy flux and points along the direction of the propagation of the incident light. the gradient field (fgrad) is the lorentz force acting on the dipole induced by the light field. it is given by:16 (4)fgrad=2e2,where (5)=nm2r3(m21m2+2)is the polarizability of the particle. the gradient force is proportional and parallel to the gradient in energy density (for m>1). the stable trapping requires that the gradient force is in the direction, which is against the direction of incident light (dark soliton valley). it is greater than the scattering force. by increasing the na, when the focal spot size is decreased, the gradient strength is increased,16,17 which happens within a tiny system, for instance, a nanoscale device such as the nanoring resonator. in our proposal, the trapping force is formed by using a dark soliton, in which the valley of the dark soliton is generated and controlled within the panda ring resonator by the control port signals. in this paper, we used the same theory of optical trapping and ring resonator, in which the simulation results and applications are differed from the previous work.18 from figure 1, the output field (et1) at the through port is given by:19 (6)et1=aei1bei2el2jknl2 [cet1(el2jknl2)2+dei2(el2jknl2)31f(e2ljknl2)2]where a (11)(12),b (11)(12)1(12)e0l, c 1(11)(12)2e0e0l, d (11)(12)1(11)2(12)e0e0l2, andf (11)(12)(11)(12)e0e0l. (11)(12)1(12)e0l, 1(11)(12)2e0e0l, (11)(12)1(11)2(12)e0e0l2, and (11)(12)(11)(12)e0e0l. here, et and ed represent the optical fields of the through port and drop ports, respectively. =kneff is the propagation constant, neff is the effective refractive index of the waveguide, and the circumference of the ring is l=2r, where r is the radius of the ring. 1 and 2 are the coupling coefficients of the add/drop filters, kn=2/ is the wave propagation number for in a vacuum, and the waveguide (ring resonator) loss is =0.5 dbmm. the fractional coupler intensity loss is =0.1. in the case of the add/drop device, the nonlinear refractive index does not affect the system, therefore, it is neglected. the electric fields e0 and e0l are the field circulated within the nanoring at the right and left side of add/drop optical filter. the power output (pt1) at through port is written as: (7)pt1=|et1|2. the output field (et2)at drop port is expressed as:19 (8)et2=(12)(12)ei2 [(11)(12)12e0ei1el2jknl2+xe0e0lle2i(el2jknl2)21ye0e0l(e2ljknl2)2],where x (12)(11)(11)2(12),y= (11)(12)(11)(12) (12)(11)(11)2(12), (11)(12)(11)(12) the power output (pt2) at drop port is: (9)pt2=|et2|2. in operation, the optical tweezers can be trapped, transported, and stored within the panda ring resonator and wavelength router, which can be used to form the microscopic volume (molecule) transportation and drug delivery via the waveguide,18 in which the manipulation of trapped microscopic volumes within the optical tweezers has been reported. molecular buffers are devices that can be used to store or delay atoms/molecules for a period of time (see figure 2), where light intensity and velocity can also be controlled, which was described by rosenberry et al20 and lignie and woerdman,21 available for medical application. molecular buffers are a new device, which are operated in the same way as gas buffers.22 the polarizability of the particle is calculated by using equation (5), in this case, we assume that the sphere particle is polystyrene (n=1.5894) and the liquid medium is water (n=1.33), and the optical power which is required to trap particles of a certain size/polarizibility is 9.1w, which is the slope as shown in figure 3a. in simulation, the bright soliton with center wavelength at 1.50 m, peak power 2w, pulse 35fs is input into the system via the input port, and the coupling coefficients are given as 0=0.5, 1=0.35, 2=0.1, and 3=0.35, respectively. the ring radii are radd=10 and 30 m, rr=50 and 100 nm, and rl=50 and 100 nm, respectively. to date, the evidence of a practical device with a radius of 30 nm has been reported by piyatamrong et al.19 aeff are 0.50, 0.25, and 0.25 m. in this case, the dynamic tweezers (gradient fields) can be in the form of bright solitons, gaussian pulses, and dark solitons, which can be used to trap the required microscopic volume. there are four different center wavelengths of tweezers generated; the dynamical movements are seen in figure 4, where (a) |e1|, (b) |e2|, (c) |e3|, (d) |e4|, (e) through port, and (f) drop port signals, where in this case all microscopic volumes are received by the drop port. in practice, the fabrication parameters which can be easily controlled are the ring resonator radii instead of the coupling constants. the important aspect of the result is that the tunable tweezers can be obtained by tuning (controlling) the add (control) port input signal, in which the required amount of microscopic volume (atom/photon/molecule) can be obtained and seen at the drop/through ports, otherwise they propagate within a panda ring before collapsing/decaying into the waveguide. more results of the optical tweezers generated within the panda ring are shown in figure 5, where in this case, the bright soliton is used as the control port signal to obtain the tunable results. the output optical tweezers of the through and drop ports with different coupling constants are as shown in figure 5a, while the different wavelength results are as shown in figure 5b, which can be performed by the selected targets. in application, the trapped microscopic volumes (molecules) can move into the wavelength router via the through port, while the retrieved microscopic volumes are received via the drop port (connecting target). the advantage of the proposed system is that the transmitter and receiver can be fabricated on-chip and alternatively operated by a single device. the magnitude of the optical trapping force is the pico newton, which depends upon the relative refractive index of particle, which was given by kumar et al.23 the particle radius was given by hu et al,24 fischer and srensen,25 and nieminen et al,26 which is located in the cavity. we have proposed a new system that can be used to trap (delay) and transport molecules into an optical waveguide by using optical tweezers, which can be used for drug storage and as a delivery system. by utilizing the reasonable dark soliton input power, the dynamic tweezers can be controlled and stored (delayed) within the system before reaching the final destination. tweezer amplification is also available by using the nanoring resonators, in which the signals can be modulated via the control port as shown in figures 4b and 5a. in conclusion, we have shown that the use of a transceiver for long distance microscopic volume by using the proposed system, in which the drug delivery or molecular communication can be performed via the wavelength router to the required (connecting) targets. however, the problems of large microscopic volume and neutral matter may cause a problem, in which the pursuit of new guide pipes and media,27 for instance, nano tubes and specific gases, will be the issue of investigation.

a novel design of molecular buffer for molecule storage and delivery using a panda ring resonator is proposed. the optical vortices can be generated and controlled to form the trapping tools in the same way as the optical tweezers. in theory, the trapping force is formed by the combination between the gradient field and scattering photons, which is reviewed. by using the intense optical vortices generated within the panda ring resonator, the required molecules can be trapped and moved (transported) dynamically within the wavelength router or network, ie, a molecular buffer. this can be performed within the wavelength router before reaching the required destination. the advantage of the proposed system is that a transmitter and receiver can be formed within the same system, which is available for molecule storage and transportation.

PMC3107716

pubmed-368

a number of drugs are currently available to treat malaria; however, treatment is becoming complicated by drug resistance, toxicity, and high cost. recently, drug resistance against the new effective drug, artemisinin, is also emerging [4, 5], and we need new effective drugs to treat malaria. therefore, the development of other classes of effective antimalarials, especially compounds that act against novel biochemical targets, is required. to develop such compounds, it is very important to characterize the structural and biochemical features of new drug targets. among potential new targets for antimalarial chemotherapy proteases are druggable targets, and at present protease inhibitors are now licensed as well as in clinical development to treat different diseases for example osteoporosis, diabetes, cancer, hypertension, and infectious diseases [69]. recent advances, including the sequencing of plasmodium genomes (http://www.plasmodb.org/) and development of new tools for manipulating plasmodium genes, have improved our understanding of the cysteine proteases of parasites. therefore, given the importance of the cysteine proteases, this paper will focus on structural-functional relationship of falcipains, major cysteine proteases of p. falciparum. in cases of malaria, the parasite relies on human hemoglobin hydrolysis to supply amino acids for protein synthesis and to maintain osmotic stability [11, 12]. cysteine proteases are involved in hemoglobin hydrolysis and have been validated as promising drug targets [13, 14]. in a recent report, ch'ng et al., using cysteine protease inhibitors, demonstrate that clan ca cysteine proteases of p. falciparum are also involved in chloroquine-mediated programmed cell death. the best characterized plasmodium cysteine proteases are the falcipains, papain family (clan ca) enzymes (figure 1). among the four p. falciparum cysteine proteases, falcipain-2 and falcipain-3 appear to be the principal food vacuolar hemoglobinases [1618]. when the falcipain-2 gene is disrupted, undegraded hemoglobin accumulates in the food vacuole, confirming that this enzyme participates in haemoglobin hydrolysis. however, disruption of falcipain-3 could not be achieved, but the gene was readily replaced with a tagged functional copy, indicating that falcipain-3 is essential for erythrocytic parasites. falcipain-2 and falcipain-3 share 67% sequence identity and contribute more or less equally to the digestion of hemoglobin in the food vacuole. comparing with other papain family proteases, specifically, this paper will survey available information on structure and function of different domains of falcipain-2 and falcipain-3 and their interaction with inhibitors. falcipains are major cysteine protease, named due to the function of a catalytic cysteine, which mediates protein hydrolysis via nucleophilic attack on the carbonyl carbon of a susceptible peptide bond. falcipains have two main domains, the prodomain and the mature domain. the prodomain is further divided into different small domains. at the n-terminus of the prodomain, the first 35 amino acids are cytosolic, followed by a 20 amino acid transmembrane domain and a 188 amino acid lumenal domain. the inhibitory domain is present in the c-terminal part of the prodomain (figure 2). cysteine proteases of the parasite hydrolyze hemoglobin in the acidic food vacuole [20, 21]. recently, it has been demonstrated that prodomain has unique motifs which are responsible for targeting the falcipains. using transfection technology and constructing different chimeras with portions of the n-terminal part of prodomain fused to green fluorescent protein, it has been shown that the prodomains of falcipain-2 and falcipain-3 were sufficient to target green fluorescent protein to the food vacuole. once enzymes are in the er, using the signal from transmembrane domain, the proteins appear to traffic to the plasma membrane. at the plasma membrane falcipain-2 and falcipain-3 appear to be endocytosed in a process requiring the presence of both cytoplasmic and luminal prodomain trafficking motifs, followed by vesicular transport to the food vacuole. in summary, serial truncation and deletion studies showed that both a 20-amino acid stretch of the lumenal portion and a 10-amino acid stretch of the cytoplasmic portion of the enzymes were essential for food vacuolar trafficking (figure 3). like many other proteases, falcipains are synthesized as a zymogen, and the prodomain inhibits the activity of the mature enzyme. to investigate how the prodomain regulates the activity of falcipain-2, pandey et al. expressed constructs encoding different portions of the prodomain and tested their ability to inhibit recombinant mature falcipain-2. it has been found that a c-terminal segment (leu asp) of the prodomain, including two motifs (erfnin and gnfd) that are also conserved in cathepsin l subfamily proteases, mediates prodomain inhibitory activity. earlier work with other cathepsin l subfamily proteases suggests key roles for conserved hydrophobic amino acids (phenylalanine and tryptophan) as well as the erfnin and gnfd motifs in maintaining prodomain structure. later, pandey et al. explored the roles of conserved motifs in maintaining prodomain structure by circular dichroism analysis. secondary structure was seen in a fragment with potent inhibitory activity (leu asp), but not in two larger constructs that lacked any sequence downstream of the erfnin and gnfd motifs or in a peptide spanning the erfnin and gnfd motifs. these results indicate that, together with erfnin and gnfd motifs, an upstream region including two conserved phe*residues is required for proper folding or maintenance of secondary structure of the prodomain (figure 2). the 3d structures of the mature domain of falcipain-2 and falcipain-3 have been solved [25, 26], and the profalcipain-2 model suggests that conserved residues provide stability to the inhibitory domain (figure 4(a)). modeling, based on the solved structure of procathepsin b and procathepsin l [27, 28], shows that the charged pair arg and glu of the prodomain appear to form a salt bridge (figure 4(b)). further, glu from the gnfd motif may form a separate salt bridge with lys in the mature domain. phe may participate in nonpolar interactions and possibly pi stacking interactions, with two tryptophan residues in the mature domain, trp and trp. the model also suggests that the prodomain of falcipain-2 binds the mature domain in a manner similar to that of procathepsin k and l, inhibiting catalytic activity by blocking substrate access to the active site (figure 4(a)). they encode short n-terminal extensions of the mature domain, which is unique among described papain family proteases [13, 14]. looking at the family of c1a cysteine protease sequences on the merops database (http://merops.sanger.ac.uk/) have identified more than 40 members with an n-terminus extension of 12 amino acids at this location. notably, 18 of these sequences were those of falcipains and homologues from other plasmodial species to better characterize the determinants of folding for falcipain-2, pandey and sijwali et al. expressed multiple prodomain and mature constructs of the enzyme in e. coli and assessed their abilities to refold by checking their activity [23, 29] this folding study showed that refolding of the mature domain could be achieved when the mature domain was covalently joined with the n-terminus extension (figure 5). only 12 amino acids of the n-terminus extension (refolding domain) are necessary for refolding. deletion of 12 amino acids from n-terminus segment of the mature domain yielded a construct incapable of correct folding, but inclusion of this segment in trans allowed folding to active falcipain-2. correct folding also occurred when the catalytic domain was refolded with a separate prodomain-folding domain construct but not with an isolated folding domain peptide [23, 29] (figure 5). these results indicated that the prodomain mediates the interaction between the mature and folding domain when they were not covalently bound. however, it was not clear from these studies, whether the amino-terminal extension is required only for folding or whether it also plays an essential role in mediating enzyme activity. to determine whether the folding domain was required for activity, pandey et al after refolding and purification of the mature domain by anion exchange chromatography, the purified refolded mature domain still showed activity. together, these results suggest that the refolding domain is only required for refolding, and once refolding is accomplished, the refolding domain is not required for activity. the n-terminus extensions of different falcipain subfamily enzymes have limited (2045%) sequence identity but are functionally conserved. chimeras of the falcipain-2 catalytic domain with the refolding domain of six other plasmodial proteases folded normally and had similar kinetic parameters to those of recombinant falcipain-2. these results showed that refolding domain can be swapped between the plasmodial proteases that harbor the same function. the above-mentioned experiment also indicates that all plasmodial cysteine proteases including falcipain-3 also use n-terminus extension as a refolding domain. structural analysis further reveals that the folding domain, in fact, has a short but significant element of secondary structure. glutamate of the mature domain forms a buried hydrogen bond with tyrosine and a salt bridge with arginine of the refolding domain. this suggests that the small folding domain, though shorter than the standard papain family prodomain, still plays a very important role in folding by stabilizing the mature domain by a hydrogen bond and a salt bridge. this is analogous to a similar interaction in falcipain-2, where tryosine of the refolding domain of falcipain-3 provides hydrogen bonding anchor to glutamate of the mature domain of falcipain-3. these results indicate that the folding domains of falcipain-2 and falcipain-3 stabilize the mature domain in a similar fashion. falcipain-2 and 3 efficiently hydrolyze human hemoglobin in the acidic food vacuole of parasite [17, 18]. it has recently been suggested that hemoglobin hydrolysis is not a highly ordered process but rather proceeds with rapid cleavage by falcipains at multiple sites. falcipain subfamily proteases contain an unusual motif near the c-terminus, which is present between the highly conserved active site histidine and asparagine residues (figure 2). a motif of identical size (14 aa) is found in all studied proteases of this subfamily of falcipain, although sequence identity is modest. in case of falcipain-2 and falcipain-3, motifs smaller motifs are present in the sequences encoding p. falciparum serine repeat antigens (10 aa) and dipeptidyl peptidase i (8 aa), and larger (20 aa) motifs are present in two other putative p. falciparum dipeptidyl peptidase genes [14, 33]. to evaluate the function of the unusual c-terminal motif in falcipains, a mutant enzyme was made by deleting that motif lacking 10 amino acids from falcipain-2, and the biochemical properties of wild and mutant enzymes were compared. native page, biacore, and gel filtration studies indicated that the motif mediates specific interactions with hemoglobin. in fact, falcipain-2 has relatively higher affinity for methemoglobin (kd is 0.8 m) than hemoglobin (kda is 3.3 m). it had been demonstrated that several factors contribute to the formation of methemoglobin during malarial infection, including acidic ph of plasmodial food vacuole, oxidative damage in rbc [35, 36], which causes an increase in methemoglobin content to up to 2042% in the plasmodial food vacuole. thus, the higher affinity of falcipain-2 for methemoglobin looks like an adaptation to the specific conditions in the infected rbc. the enzyme without this motif showed negligible activity against hemoglobin or globin. further, a peptide encoding the motif blocked hemoglobin hydrolysis but not the hydrolysis of casein, indicating that the motif specifically interacts with hemoglobin. thus, this study suggests that the motif mediates the most biologically relevant activity of falcipain, the hydrolysis of hemoglobin during trophozoite stage. falcipains may also have other functions in erythrocytic malaria parasites, and it would be interesting to explore the role of the motif in hydrolysis of other proteins of potential biological relevance. in the case of other members of the falcipain subfamily, it is likely that the encoded motifs share the same functions as the falcipain motif, because a number of members of this subfamily have been also shown to be hemoglobinases. the sequence conservation among the motifs of falcipain subfamily proteases is not high, but, as in the case of the n-terminal extension that mediates protein folding, the presence of these unusual motifs in all related proteases probably indicates a conserved function. for genes encoding more distantly related enzymes, including falcipain-1, dipeptidyl peptidases, and serine repeat antigens, c-terminal motifs vary greatly in sequence and size, and specific functions of predicted motifs are undefined. data indicates that falcipain-2 captures hemoglobin via its c-terminal motif before subsequently cleaving the substrate at multiple sites. further, the structure of falcipain indicates a protruding configuration for the motif, surrounded by a predominant negative charge, and it may be that charged residues are crucial for interaction with hemoglobin. it is proposed that hemoglobin, which has many charged surface residues, first binds at the motif through charge-charge interaction and brings hemoglobin closer to the active site before hydrolysis. the function of the motif in mediating catalysis despite its separation from the active site somewhat resembles that of the hemopexin domain of matrix metalloproteases. the hemopexin domain is required for both the efficient cleavage of collagen and the formation of complexes with both inhibitors and proteases to mediate biological activities. thus, as is the case for the falcipain-2 motif, the hemopexin domain serves to facilitate biologically relevant protein-substrate and protein-inhibitor interactions. however, the hemopexin domain is approximately 20 times larger than the falcipain motif and, unlike the motif, is separated from the catalytic domain by a hinge region. therefore, it appears that falcipains and matrix metalloproteases use similar means of biological control, but the specific mechanisms by which the proteases mediate interactions with substrates and inhibitors are different. another papain family protease, cathepsin k, forms a pentameric complex with chondroitin sulfate to facilitate hydrolysis of collagen. having analogy to falcipain-2-hemoglobin interaction, structural requirements for complex formation between cathepsin k and chondroitin sulfate it is interesting to raise a question, why do falcipains contain a unique motif that mediates the hydrolysis of hemoglobin? this mechanism might not have evolved simply to facilitate hemoglobin hydrolysis, because other papain family enzymes without c-terminus motifs still can hydrolyze hemoglobin. it looks like that the utilization of a specific motif at this region to mediate enzyme-substrate interaction is an unusual but conserved feature of plasmodial cysteine proteases. it may be possible that an evolutionary bottleneck occurred in ancestral plasmodial cysteine proteases, and those enzymes might not be that efficient in hemoglobin hydrolysis. in addition, plasmodial cysteine proteases might have evolved with introduction of specific motif for efficient hemoglobin hydrolysis. the interaction of a major hemoglobinase, falcipain-2, with most biologically relevant substrate, hemoglobin, could be an interesting starting point for the development of an effective drug. the structure of falcipain-2 hemoglobin binding domain will guide the design of inhibitors that should interfere with hemoglobin binding. there are two major classes of cysteine protease inhibitor, small inhibitors like leupeptin, vinyl sulfones, e64, and another class known as macromolecular inhibitor. these endogenous cysteine protease inhibitors have been described in a number of eukaryotic systems. here, we will discuss three major cysteine protease inhibitors, cystatin, chagasin, and falstatin. excluding the two unique motifs discussed earlier, the rest of the falcipains are structurally similar to homologous proteases in the papain family. cystatin was used as a falcipain inhibitor with the expectation that protein-protein interaction over large surfaces would enhance crystal quality and thus facilitate structural determination. cystatins inhibit a wide range of papain family cysteine proteases with high affinity making them ideal candidates for cocrystallization with falcipain. falcipain and chicken egg white cystatin formed 1: 1 complex (figure 6(a)). the inhibitory constants (ki) of cystatin for falcipain-2 and falcipain-3 are 6.5 nm and 100 nm, respectively. it is interesting that cystatin is a more potent inhibitor of falcipain-2 than falcipain-3, which suggests that cystatin regulates both the falcipains with different rates. the falcipain-cystatin complex shares many features with two known cysteine protease-cystatin structures: cathepsin h-stefin a and papain-stefin b (the stefins are a subclass within the cystatin superfamily [41, 42]). these cystatins bind to target proteases in similar orientations, resulting in extensive interactions with the target proteases (figure 6(b)). cystatin largely interacts with falcipain-2 at prime sites where substrate-binding pockets are relatively shallow and less defined, but falcipains also have binding specificity at nonprimed sites. although, the binding preference is not as pronounced as that found at the s2 pocket (figure 6(b)). cystatin is only able to access the solvent exposed periphery of the nonprime site of falcipain-2 and majority of its binding occurs at the prime end of the active site. unlike most other cathepsin l-like cysteine proteases, crystal structures indicate that this preference may be due to ile in falcipains, because it creates a small protrusion in the otherwise flat base of the s2 pocket, which restricts aromatic side-chain binding (figure 6(b)). the falcipain cystatin complex can be exploited to design potent inhibitors of the malaria parasite. a recent study indicates that a peptide based on cystatin binding residues blocked the activity of falcipain-2 and led to accumulation of undegraded hemoglobin in the food vacuole. chagasin is a cysteine protease inhibitor that was first identified in trypanosoma cruzi as the physiological regulator of cruzain, the major cysteine protease [45, 46]. cruzain is also a papain-like (clan ca) cysteine protease that is expressed in all stages of t. cruzi life cycle. it is a key virulence factor of t. cruzi, the infectious agent responsible for the leading cause of heart disease in latin america, called the chagas disease. chagasin is associated with cruzain during its trafficking to specific compartments of the parasite cell, and accumulated evidence suggests that the primary role of chagasin is in posttranslational regulation of protease activity. 1 binding with falcipain-2 (figure 7). the protease-binding loops (bc, de, and fg) in chagasin form a well-aligned wedge that fills the active site groove of falcipain-2 to obstruct substrate binding (figure 7). the bc loop is one of the three signature motifs that contribute to the inhibition of the cysteine protease. this is confirmed by a synthetic peptide corresponding to the bc loop of the chagasin like protein from e. histolytica, which specifically blocked the activity of cysteine proteases. it is noteworthy that thr 31 in the bc loop of chagasin binds to the catalytic cys at the falcipain-2 active site by water-mediated hydrogen bonds (figure 7). it is likely that the highly conserved thr serves as a key functional residue among chagasin-like inhibitors. another interesting feature of the falcipain-2-chagasin interaction is the highly mobile de loop like in e64, a strong irreversible inhibitor of cysteine protease, which occupies the nonprime site. in summary, the bc loop, mobile de loop, and the rpw/f motif in the fg loop are the key elements for binding with falcipain-2. disturbance of the equilibrium between cysteine proteases and natural inhibitors is a key event in the pathogenesis of cancer, rheumatoid arthritis, osteoporosis, and emphysema. in case of malaria, falciparum parasites express falstatin, a potent inhibitor of falcipains and many other cysteine proteases. the stage-specificity of falstatin expression and the effects of anti-falstatin antibodies on parasite development suggest that this inhibitor facilitates a process that also requires proteolytic activity, the invasion of erythrocytes by p. falciparum merozoites. falstatin is a competitive and reversible inhibitor of falcipains, as demonstrated by increasing calculated km values but similar vmax values with increasing concentrations of falstatin. to evaluate the mechanism of inhibition of cysteine proteases by falstatin, pandey et al. tested the ability of active site-inhibited falcipain-2 to compete with active falcipain-2 for binding with falstatin. in contrast to results with the prodomain, the inhibitory effect of falstatin was not affected by the presence of active site inhibited falcipain-2. thus, the binding of falstatin to falcipain-2 appears to be via interaction with the enzyme active site. leupeptin, e-64, and vinyl sulfones are major cysteine protease inhibitors that bind to the active site [26, 48]. the active sites of both enzymes are located in a cleft between the structurally distinct domain of the papain-like fold. the structures of falcipain-2 and falcipain-3 have been determined in complex with these small inhibitors. e-64, and leupeptin interact with residues in the s1, s2, and s3 subsites of falcipain-2 and falcipain-3, corresponding to the p1, and p2, and p3 position of the inhibitors (figure 8). the conserved catalytic residues of falcipain-2 and falcipain-3 (gln, cys, his, asn, resp.) inhibitors display binding modes with their partner enzymes similar to those found in other papain family enzymes. the inhibitors bind to the main chain of falcipain-2 and falcipain-3 by glycine (gly in falcipain-2 and gly in falcipain-3) residue that is highly conserved in the s3 subsite of clan ca cysteine proteases (figure 9). in cocrystallization, these residues form hydrogen bonds with the o and n atoms of the inhibitor backbone. in the case of the falcipain-2 complex with e-64, enzyme active sites gln, ser, cys, asn, and his are involved in the formation of additional hydrogen bonds with e-64. in the falcipain-3-leupeptin complex, gln, cys, and asn also act as hydrogen bonding partners to the inhibitor. the enzyme-inhibitor complex stabilize by a series of possible hydrophobic interaction using nonpolar region of gly, tyr, gly, leu, ser, leu, asn, and ala in falcipain-2, and tyro, gly, tyr, ile, and ser in case of falcipain-3. the active site cysteine of falcipain-2 forms a covalent, irreversible hemithioketal with the e-64 epoxy carbon (figure 9). the active site cysteine of falcipain-3 forms a covalent, reversible hemithioacetal with the asymmetric carbonyl carbon of leupeptin (figure 10). the interaction pattern of e-64 and leupeptin with all papain family enzymes is conserved. the carboxyl group of e-64 and carbonyl group of leupeptin occupy the oxyanion hole formed by the conserved catalytic residues. falcipain-2 and falcipain-3 have a clear preference for substrates/inhibitors that contains a leucine at p2 position, and both leupeptin and e64 contain a leu at p2. surprisingly, falcipain-3 has been shown to be much less efficient at hydrolyzing peptide substrates and more difficult to inhibit with small peptidyl-based inhibitors compared with falcipain-2 [16, 51]. the structure that forms the active site is highly conserved between falcipain-2 and falcipain-3, and there is no notable movement in the peptide backbone or loop region. however, superimposition of falcipain-2 and falcipain-3 structures highlights two important substitutions in the s2 subsite. this position of the s2 subsite is known to be a key determiner of the specificity (figures 9 and 10). in comparison to asp in falcipain-2, the additional side chain carbon in glu of falcipain-3, this increased the size as well as flexibility at this position. in case of falcipain-3leupeptin complex, the larger and more flexible residue (glu) at the bottom of s2 subsite and bulkier residue (try) create a narrow wall of the s2 subsite, as compared to the falcipain e-64 complex (figure 10). the overall structures of falcipain-3leupeptin and falcipain-2e-64 complexes show a similar mode of binding and inhibition compared with macromolecule inhibitors like chagasin and cystatin. like e64 and leupeptin, vinyl sulphones (mu-leu-hph-vsph) have been shown to be effective inhibitors of a number of papain-family-like cysteine proteases. mu-leu-hph-vsph is a potent irreversible inhibitor of falcipain-2 and falcipain-3. the cocrystallization of falcipain-3 with mu-leu-hph-vsph indicates that inhibitor binds the respective s1 and s3 subsites to form an irreversible, covalent bond with the sulfur of the active site cysteine thiol in enzyme (figure 11). given the hydrophobic nature of the p1 and p2 substituents in mu-leu-hph-vsph, the active site of falcipain-3 is lined with a number of residues that are able to make nonpolar contacts with their respective inhibitor (figure 11). as seen in the crystal structures of falcipain-3 with the above inhibitor, the residue at the bottom of the s2 subsite (glu) points out of the pocket to avoid a potentially unfavorable interaction with the bulky phe residue at the p2 position of inhibitor. cysteine proteases of the malaria parasite may be targeted for inhibition by vinyl sulphones. indeed, vinyl sulphones-based cysteine protease inhibitors are already being used in preclinical trials for the chagas disease. the understanding of the cysteine proteases of malaria parasites has increased markedly in recent years. since cysteine proteases that play an important role in the parasite life cycle by degrading erythrocyte proteins, most notably hemoglobin, are attractive targets for antimalarial chemotherapy. falcipain-2 and falcipain-3 are the best characterized cysteine proteases of malaria parasite, the structure and function of different domains and their interaction with small and macromolecular inhibitors are studied. the structure-function study of falcipains and interaction with inhibitors will provide detail insights to develop rational design of inhibitor against falcipains. structure-guided approaches should have great role in the design of potent and highly selective inhibitor. efforts to optimize current inhibitors based on the structure-function of falcipains are currently underway.

evidence indicates that cysteine proteases play essential role in malaria parasites; therefore an obvious area of investigation is the inhibition of these enzymes to treat malaria. studies with cysteine protease inhibitors and manipulating cysteine proteases genes have suggested a role for cysteine proteases in hemoglobin hydrolysis. the best characterized plasmodium cysteine proteases are falcipains, which are papain family enzymes. falcipain-2 and falcipain-3 are major hemoglobinases of p. falciparum. structural and functional analysis of falcipains showed that they have unique domains including a refolding domain and a hemoglobin binding domain. overall, the complexes of falcipain-2 and falcipain-3 with small and macromolecular inhibitors provide structural insight to facilitate the design or modification of effective drug treatment against malaria. drug development targeting falcipains should be aided by a strong foundation of biochemical and structural studies.

PMC3317066

pubmed-369

alzheimer's disease (ad) is the most common cause of dementia in the aging population. this disease develops over time and leads to significant cognitive deficits affecting memory, insight, judgment, abstraction, and language functions. ad affects more than 5 million people in the united states and this number is projected to rise to 35 million by 2050 [2, 3]. this estimate underscores both the scope of this health care issue for the society as a whole and the need for the development of therapeutic options for these patients. the diagnosis of this neurodegenerative disease relies on the presence of senile plaques and neurofibrillary tangles in affected brain areas at autopsy. these ad hallmark lesions are the results of the pathological deposition of proteins normally present throughout the brain. senile plaques are composed of extracellular deposits of beta-amyloid (a) derived by proteolytic cleavage from the amyloid precursor protein (app) [410]. neurofibrillary tangles, on the other hand, are intracellular bundles of self-assembled tau proteins [1138]. the formation of both senile plaques and neurofibrillary tangles is associated with progressive and irreversible degeneration of neuronal processes and the loss of synaptic connections [3950]. initially, multiple studies focused on defining the characteristics of ad and on the analysis of the composition of senile plaques and neurofibrillary tangles. more recently, data have been obtained on the molecular mechanisms that link the formation of these lesions and underlie neurodegeneration and cell death in ad and related disorders. calpains are ca-dependent proteases in which activity is dysregulated in ad and other neurodegenerative diseases [5154]. a growing body of evidence suggests that the abnormal activation of calpains might modulate not only the formation of senile plaques and neurofibrillary tangles but also the development of synaptic pathology in ad. these data reviewed below position calpains at the crossroads of the mechanisms involved in the formation of the main pathological alterations associated with ad. furthermore, these findings underscore the importance of calpains as potential targets to block the activation of the signaling cascades leading to degeneration in ad. in turn, this information could be applied to the design of therapeutic options and prevention strategies for this devastating disease. in this review, we first summarized data on the properties of calpains and the mechanisms underlying their activation. then, we reviewed findings on the dysregulation of calpain in the context of ad and its deleterious consequences for the morphology and function of affected brain areas. calpains constitute a family of ca-dependent cysteine proteases involved in multiple and very diverse cell functions including cell development, proliferation, and differentiation, cell motility, growth cone motility and guidance, apoptosis, learning, and memory, among others [51, 52]. originally, two members of this family were identified: calpain 1 (-calpain) and calpain 2 (m-calpain), also known as conventional or classical calpains. more recently, the other 14 members of the calpain family have been identified in mammals [51, 55]. in contrast to classical calpains that are ubiquitously distributed, the expression of some of these unconventional or nonclassical calpains is tissue specific. for example, calpain 3a and calpain 8 are mainly present in skeletal and smooth muscle cells, respectively. calpain 11, on the other hand, is highly expressed in testes, while calpain 13 is concentrated in the lung and skin. others, like calpains 5, 7, 9, and 10 have more widespread distributions. none of these new members of the calpain family are highly expressed in the central nervous system (cns). both calpain 1 and calpain 2 are heterodimers composed of a large catalytic subunit (~80 kda) and a small regulatory subunit (~30 kda). based on this sequence, the catalytic subunit has been divided into four distinct domains (reviewed in). domain 1 corresponds to the n-terminal region of this subunit and undergoes autolysis upon ca binding. domain 2 contains a catalytic unit formed by cys, his, and asn residues. domain 4 has partial homology with calmodulin and contains several ef-hand calcium-binding motifs. the regulatory subunit can be divided into two domains, a calmodulin-like domain and a glycine-rich domain. while both proteases are present in neurons and glial cells, their relative abundance differs. calpain 1 is more abundant in neurons, and calpain 2 is prominent in glial cells. analysis of the subcellular localization of these enzymes demonstrated that calpain 1 is concentrated in the cell bodies and is also detected in the processes extended by central neurons, although at lower levels. calpain 1 immunoreactivity has been also detected in postsynaptic densities as well as in dendritic spines. astrocytic processes are also enriched in calpain 2 [62, 63]. calpains cleave proteins generating large fragments. initially, it was thought that these proteases ' cleavage sites have a leu or a val residue in the p2 position. more recently, it has been shown that the cleavage site specificity is determined by conformation rather than amino acid sequence [6568]. the specificities of the substrates for both calpains are very similar but not identical. in vitro studies calpain substrates include cytoskeletal proteins (cadherin, catenin, desmin, dystrophin, gelsolin, filamin, fodrin, microtubule-associated proteins map 1 and map 2, neurofilament proteins, spectrin, tau, talin, troponin, tubulin, vimentin, and vinculin), signal transduction proteins (calcium/calmodulin-dependent protein kinase, epidermal growth factor (egf) kinase, pp60, protein kinase c, calcineurin, and caspases 3, 7, 8, 9, 12, and 14), synaptic proteins (dynamin 1, postsynaptic density (psd) 95, n-methyl-d-aspartic acid (nmda) glutamate receptors, and metabotropic glutamate receptor glur1), and transcription factors (p53), among others [51, 53]. calpain activation is tightly regulated to prevent massive proteolytic activity in the cell. the binding of ca to either calpain results in conformational changes that initiate their proteolytic activity. while calpain 1 is activated in the presence of micromolar concentrations of ca, calpain 2 requires millimolar concentrations. the ca requirement for either calpain is significantly higher than the concentration of this ion in living cells. this fact has prompted a series of studies on potential mechanisms that could lead to a decrease in the ca requirement for the activation of these proteases in living cells. in vitro studies have shown that the interaction of calpains with a series of activator molecules lowers the concentration of ca required to initiate the activation of these proteases. among them, phospholipids (i.e., phosphatidylinositol) are the most studied. however, the phospholipid to calpain molar ratio required for lowering the ca requirement for either calpain activation is not likely to be achieved in the cellular context [6971]. nevertheless, it can not be ruled out that higher concentrations of ca are achieved in limited cellular areas where ca is not easily detectable by available methods. in turn, these local micromolar or millimolar ca concentrations could trigger calpain activation in distinct subcellular domains. in addition to ca, calpastatin has a key role in the regulation of calpain. calpastatin, a heat-stable protein ranging from ~70 to ~140 kda of apparent molecular weight depending on the cell type, is considered a specific endogenous inhibitor of calpains. immunocytochemical analysis showed calpastatin immunoreactivity throughout the dendritic tree in pyramidal neurons and purkinje cells. therefore, the ratio calpain/calpastatin plays a key role in the regulation of calpain activity [7880]. the inhibitory effect of calpastatin requires ca-dependent high-affinity binding to three sites of calpain. the kinases responsible for the phosphorylation of some of these sites have already been identified. thus, two of those sites seem to be phosphorylated by protein kinase c (pkc), two by protein kinase a (pka), two by calmodulin kinase ii, one site by casein kinase i, and another by protein kinase g. although the role of the phosphorylation of each site in calpain activation has not been completely elucidated, data suggest that phosphorylation mediated by mitogen-activated kinases (erk/map kinases) activates these proteases. on the other hand, phosphorylation by pka may decrease their activity [82, 83]. as briefly reviewed above, calpain activation is a tightly regulated process to prevent deleterious consequences of massive proteolytic activity. these regulatory mechanisms seem to decline with aging resulting in an increased calpain activity [8487]. thus, several studies have reported significantly increased activation of calpains in ad brains [8894]. the hyperactivation of calpain in the context of ad is the result of several factors including enhanced intracellular ca concentration and decreased calpastatin levels. experiments performed using an ad culture model system showed that oligomeric a induced a significant (5-fold) and instantaneous rise in ca in hippocampal neurons [9597]. these studies also addressed the source of the ca influx leading to calpain activation in the context of ad taking advantage of specific blockers of ca release from the endoplasmic reticulum, the major source of intracellular ca, and bapta, a chelator of extracellular ca. the data obtained showed that a induces calpain activation by enhancing extracellular ca influx [9597]. the mechanisms underlying the regulation of the enhanced ca influx and calpain activation in ad have also been studied. both nmda receptors and voltage-gated calcium channels (vgcc) have been implicated in such regulation in central neurons [99101]. specific nmda receptor inhibitors, mk801, and the fda approved nmda receptor antagonist memantine significantly attenuated the initial a-induced increase of ca and blocked a-induced calpain activation in cultured hippocampal neurons [9597]. in contrast, nimodipine, an l-type vsccs blocker, did not decrease the a-induced activation of calpain [9597]. these data suggest that nmda receptors play an important role in mediating the sustained ca influx and enhanced calpain activity induced by aggregated a. furthermore, these studies suggested that factors that affect nmda receptor-mediated ca influx could modulate calpain activation and its deleterious effects in central neurons. recently, it has been shown that cholesterol regulates calpain activity in the context of ad. a population-based study demonstrated that not only high cholesterol levels but also moderately elevated cholesterol levels in midlife represent a significant risk factor for ad [106, 107]. interestingly, cholesterol has been implicated in the susceptibility of cells to ca influx [108111]. thus, elevated membrane cholesterol actually increased the susceptibility of cells to a-induced elevation in ca influx leading to cell death via a calpain-dependent mechanism [111, 112]. by regulating the nmda receptor content and changing their localization in membrane microdomains at the synaptic sites, cholesterol modulates the ability of a to induce ca influx, leading to calpain activation in hippocampal neurons [111, 112]. calpastatin also seems to play an important role in the regulation of calpain activation in ad. thus, it has been shown that calpastatin is markedly depleted in the cortex of ad brains at late stages of the disease as compared to age-matched controls. focal areas of calpastatin depletion have been also detected along dystrophic neurites at early stages of ad. on the other hand, no changes in calpastatin levels were detected in neurons less susceptible to neurodegeneration in ad like purkinje cells. this decrease in calpastatin levels is the result of the proteolytic activity of caspases and calpain. in turn, the decrease in the ratio calpastatin to calpain causes calpain hyperactivation perpetuating this cellular deleterious effect [79, 113115]. these findings have been complemented with immunocytochemical studies on the distribution of calpain in ad. these studies have shown intense calpain immunoreactivity in dystrophic neurites associated with neurofibrillary tangles, neuritic plaques, and neuropil threads in the hippocampal region and entorhinal cortex of subjects suffering from ad and other tauopathies [116118]. based on this information, it was hypothesized that the enhanced calpain activity observed in ad brains plays an important role in the formation of senile plaques, neurofibrillary tangles, and synaptic dysfunction in the context of ad (figure 1). these peptides are the result of the sequential proteolytic cleavage of app by two proteases. first, -secretase (-site app-cleaving enzyme (bace 1)) cuts app at the n-terminus of the a domain leaving a 99-amino-acid-long c-terminal fragment. then, the -secretase complex (presenilin 1, presenilin 2, nicastrin, aph1, and pen2) cuts the c-terminus to generate a peptides of 38 to 43 amino acids in length [5, 119121]. of these peptides, therefore, increased levels of bace 1 could lead to enhanced production of a, its aggregation, and consequently the activation of signaling pathways associated with the neurodegenerative process. thus, a 2-fold increase in bace1 levels has been detected in ad brains [127129]. recently, it has been shown that the calpain/calpastatin system can modulate the pathological deposition of a. calpain activation increases the levels of bace1 in a transgenic mouse model of ad. in addition, the bidirectional regulation of the activation of the calpain/calpastatin system and a metabolism has been established. using transgenic mice overexpressing app, these authors showed that calpastatin deficiency enhanced calpain activation, a production, and increased mortality. in turn, the increased levels of a lead to enhanced ca influx and increased calpain activation. senile plaques are often surrounded by dystrophic neurons that contain tau aggregates known as neurofibrillary tangles. many studies have focused on the composition and the mechanisms underlying the formation of tau aggregates. those studies have identified two types of tau filaments in the neurofibrillary tangles: straight and paired helical filaments. tau hyperphosphorylation has been attributed to the increased activity of several kinases, including cyclin-dependent kinase 5 (cdk5), glycogen synthase kinase (gsk), and the mitogen-activated protein kinase (mapk) in hippocampal neurons [138, 143145]. thus, it has been shown that calpain cleaves the inhibitory domain of gsk3 generating two fragments of 40 and 30 kda. the latter has a longer half life than p35 and therefore it is a more potent activator of cdk5. experiments using calpeptin, a cell permeable calpain inhibitor, blocked both erk 1 and erk 2 activation. conditions that blocked the activation of these kinases induced a decreased in tau phosphorylation and resulted in enhanced neuronal survival in the presence of a. besides tau phosphorylation, calpain activation might play a role in tau-mediated neurodegeneration by inducing tau cleavage. in vitro studies have shown that both fetal and adult tau isoforms are rapidly proteolyzed by calpains [151153]. on the other hand, tau present in paired-helical filaments is considerably more resistant to proteolysis by these proteases [153156]. these findings suggest that phosphorylation might regulate the susceptibility of tau to calpain-mediated cleavage. tau obtained from cultured neurons incubated in the presence of this phosphatase inhibitor was more resistant to calpain cleavage than tau extracted from nontreated control neurons. nevertheless, the effect of phosphorylation on calpain-mediated tau cleavage seems to be complex. this effect might depend on the site phosphorylated and/or the extent of phosphorylation under pathological conditions since highly phosphorylated fetal isoforms are readily cleaved by calpain. calpain-mediated tau cleavage seems to play an important role under neurodegenerative conditions [157164]. it has been shown that calpain activation results in the generation of several n-terminal tau fragments. one of such tau fragments, of ~20 kda of apparent molecular weight, has been detected in mitochondria present in synaptosomal fractions obtained from ad brains. the levels of this tau fragment are partially reduced when cultured neurons are treated with a calpain inhibitor. it has been shown that tau fragments containing the 2644 tau amino acids affect mitochondria oxidative phosphorylation acting at the level of the adenine nucleotides translocator contributing to synapse dysfunction. a smaller tau fragment generated by calpain cleavage has been detected in mature hippocampal neurons treated with aggregated a oligomers [160, 161]. a-induced tau cleavage mediated by calpain 1 leads to the generation of a neurotoxic 17 kda tau fragment (tau 45230) in cultured hippocampal neurons [160, 161]. this fragment has also been detected in the neocortex of ad brains as well as in brain areas affected by other tauopathies. furthermore, when expressed in neuronal and nonneuronal cell types or in an in vivo drosophila model system, the 17 kda tau fragment produced cell death in the absence of a oligomers [160, 161, 163]. these data provided strong evidence for an important role of calpain 1 and the generation of the 17 kda tau fragment in the progression of a-mediated neurodegeneration. it is worth noting that calpain 2 activation cleaves tau generating a smaller tau fragment that lacks neurotoxic effects in central neurons. in addition to the presence of senile plaques and neurofibrillary tangles, ad brains are characterized by a decrease in synaptic contacts. this synaptic loss seems to be the best morphological correlate of the functional deficits observed in the mid to late stages of ad [39, 40]. although no significant decline in synapse number has been detected in the earliest stages of the disease, a stage of synaptic dysfunction seems to precede frank synapse loss [41, 46, 165]. by cleaving proteins in the presynaptic terminals and/or the postsynaptic elements changes in proteins involved in synaptic vesicle biogenesis and/or recycling at synaptic terminals are responsible, at least in part, for the synaptic dysfunction detected in ad. recently, data obtained using culture and animal models of ad showed that a induced a significant reduction in dynamin 1 levels that preceded synapse loss. dynamin 1 pinches off synaptic vesicles, freeing them from the membrane and allowing them to reenter the synaptic vesicle pool to be refilled for future release [167, 168]. decreased levels of this protein lead to the depletion of synaptic vesicles and the accumulations of invaginated pits at presynaptic membranes adjacent to the synaptic clefts [9597, 169, 170]. the a-induced decrease in dynamin 1 is a result, at least partially, of calpain-mediated proteolysis [9597, 171]. thus, it has been shown that calpain activation results in the breakdown of several proteins leading to changes in the ultrastructure of the postsynaptic density (psd). these changes in the psd are accompanied by the rapid cleavage of psd-95 and the nmda receptor subunits nr1 and nr2a and 2b [172175]. calpain has been shown to truncate also mglur1 exacerbating nmda-mediated neurotoxicity [176178]. an additional mechanism by which calpain activation can result in synaptic dysfunction involved the cleavage of pka leading to a decrease in both the regulatory and the catalytic subunits of this kinase. the decrease in pka activity attenuates creb activation impairing memory [179, 180]. taken together, the data reviewed above strongly suggest that calpains play an important role in the neurodegeneration mechanisms underlying ad in the aging population. based on these data, it has been tempting to speculate that calpain inhibition could be a useful tool to prevent neurodegeneration in this disease. to obtain further insights into the beneficial effects of blocking calpain activation, several studies have been conducted using experimental approaches to either suppress the expression of these proteases or prevent their abnormal activation. early studies using gene deletion of the calpain regulatory subunit by homologous recombinant techniques showed that the depletion of these proteases is embryonic lethal. the data obtained showed that indeed the suppression of calpain 1 expression by means of these specific probes prevented oxidative stress-induced cell injury in human hepatic cancer cell lines. other studies have assessed the effects of calpain inhibitors on cell death in culture model systems of ad. leupeptin and e64 calpain inhibitors had protective effects in those cultures [160, 183186]. the idea that calpain could be a potential therapeutic target in neurodegenerative diseases has been reinforced by studies performed in vitro and in culture using the calpain inhibitor mdl 28170. those studies suggested a protective effect of calpain inhibitors against excitotoxicity [178, 187, 188]. unfortunately, the potential use of known calpain inhibitors as therapeutic tools in ad is limited due to their low cellular penetration, poor selectivity, and kinetics. recently, this benzoylalanine-derived ketoamide is capable of inhibiting calpain in nanomolar concentrations and has improved oral bioavailability, water solubility, and metabolic stability. this calpain inhibitor is highly effective in preventing calpain-mediated cleavage of dynamin 1 and tau in cultured hippocampal neurons. this inhibitor is effective not only when added prior to the a treatment but also when added simultaneously with a and even when added after a has triggered the neurodegeneration process. the calpain inhibitor a-705253 also prevents a oligomer-induced neurodegeneration of the nucleus basalis magnocellularis. these experiments raised the possibility that more potent calpain inhibitors could have beneficial effects even at late stages of ad. moreover, initial studies using calpain inhibitors in mouse and rat models of ad showed an encouraging recovery of cognitive function in these animals when they were treated with calpain inhibitors at an early age [186, 190]. together, these data underscore the potential importance of calpain inhibitors as promising therapeutic tools in ad and related neurodegenerative diseases. in summary, the data briefly reviewed above provide strong support for the role of calpains in ad. they also highlight the tantalizing possibility that these proteases could serve as targets for the development of therapeutic interventions for this disease, one of the main challenges for decades to come in ad research.

alzheimer's disease (ad) is characterized by the presence of senile plaques and neurofibrillary tangles in the neocortex and hippocampus of ad patients. in addition, a marked decrease in synaptic contacts has been detected in these affected brain areas. due to its prevalence in the aging population, this disease has been the focus of numerous studies. the data obtained from those studies suggest that the mechanisms leading to the formation of the hallmark lesions of ad might be linked. one of such mechanisms seems to be the dysregulation of calcium homeostasis that results in the abnormal activation of calpains. calpains are a family of ca2+-dependent cysteine proteases that play a key role in multiple cell functions including cell development, differentiation and proliferation, axonal guidance, growth cone motility, and cell death, among others. in this paper, we briefly reviewed data on the structure of these proteases and their regulation under normal conditions. we also summarized data underscoring the participation of calpains in the neurodegenerative mechanisms associated with ad.

PMC4393001

pubmed-370

descriptive investigation of a cluster of 5 sfts cases following exposure to an index patient who died from the disease was performed. a 77-year-old male farmer who died from sfts five other cases in the cluster included a 32-year-old male intensive care unit (icu) physician (case 1), a 48-year-old male icu consultation physician (case 2), a 42-year-old younger son of the index patient (case 3), and a 45-year-old older son of the index patient (case 4), as well as a 43-year-old male mortuary beautician (case 5). the investigation included a review of circumstances and medical records, specimen collection, virus isolation, real-time polymerase chain reaction for viral rna detection, and sequencing and serological tests (capture enzyme-linked immunosorbent assay [elisa] for immunoglobin [ig] m antibody, antigen sandwich elisa for igg antibody, and microneutralization tests [mnt]). as for risk assessment of transmission factors, all contactors of the index patient during the period from the beginning (25 september 2010) to the end (8 october 2010) were classified through 3 types of contacts, including blood, droplet, and possible airborne contacts. the investigation was reviewed and approved by the ethics committee of china center for disease control and prevention (cdc), which uses international guidelines to ensure confidentiality, anonymity, and informed consent. the index patient was from an sfts-endemic region and first had onset of illness on 25 september 2010; was admitted to a local hospital on 28 september with a high fever of 39.5c and vomiting; and the infection was identified through initial laboratory testing of thrombocytopenia, leukocytopenia, and elevated aspartate aminotransferase level. the patient was diagnosed as a suspected sfts case, and transferred to the intensive care unit the next day, where he received ribavirin, dexamethasone, omeprazole, and cryoprecipitation for therapy. on 2 october 2010, his condition deteriorated with hypersomnia, shortness of breath, and mouth mucosal bleeding. on 3 october, he appeared confused and showed dyspnea, then was intubated and mechanical ventilated. on 4 october, the patient was in shock and comatose, developed disseminated intravascular coagulation and multiple organ dysfunction syndrome, and died the next day. an important observation was that the index patient had unique hemorrhagic symptoms, including bleeding from mouth mucosa, gastrointestinal lumen, and lungs, which was rare in previously identified sfts patients. the patient s fever remained high (39c40c) until death, although lowered somewhat by giving dexamethasone. clinical laboratory values (table 1) showed unusually high level of tissue enzymes, blood urea nitrogen, and creatinine, which might indicate impaired liver, heart, and kidney functions. consistent with the largely reduced platelet count, the index patient had a significantly elongated activated partial thromboplastin time, which represented a largely impaired coagulation function. immediately after death, the corpse was transferred to the patient s home in a local village for a funeral ceremony, then transferred to a crematorium 3 days later. laboratory analysis of a cluster of severe fever with thrombocytopenia syndrome patients in china alt, alanine aminotransferase; ast, aspartate aminotransferase; ldh, lactate dehydrogenase; aptt, activated partial thromboplastin time., negative; +, weak positive;++ +, strong positive. viral rna copies were calculated according to standard reaction curves, which were established using serially diluted in vitro rna transcripts as standard samples. virus load was determined based on an average conversion coefficient between virus copies and virus titer presented as 50% tissue culture infective dose (tcid50/ml). serum samples collected in the acute phase were subjected to immunoglobin (ig) m detection with igm antibody capture enzyme-linked immunosorbent assay (elisa), with horseradish peroxidase conjugated recombinant severe fever with thrombocytopenia syndrome bunyavirus (sftsv) nucleoprotein as the detection agent. serum samples collected in the convalescent phase were subjected to igg detection with sandwich elisa by using recombinant sftsv nucleoprotein as the detection agent. values for igm antibodies, igg antibodies, and mnt are the reciprocals of the serum dilution. risk factors were assessed using logistic regression analysis; p<.05 was considered to be statistically different. epidemiologic investigations began with interviews with 5 secondary sfts patients and 58 other individuals who had exposure to the index patient from onset of the illness until cremation. we found that all 5 secondary cases had possible blood contact through skin or mucosa. case 1, the local icu doctor, performed the intubation for the index patient, resuscitating the patient before his death. case 2, the consultant doctor, traveled from a nonendemic area to the local hospital for a medical consult with the patient, and the patient s blood dropped on his hand when he was helping an icu nurse draw blood without wearing gloves. case 3, the younger son of the index patient, was a long-distance truck driver not living in the same village, and directly touched the blood flowing from the deceased patient s mouth and nose when he cried on the corpse. case 4, the older son of the index patient, was also a long-distance truck driver, and took care of the dead body and was wiping off the blood from the face of the corpse. case 5, a local mortuary beautician, did the make-up for the corpse with gloves and mask, but took them off twice during the procedure. the above 5 cases all developed the disease 715 days after exposure, with only 3 of them having contact with blood after death. in comparison with the index patient, all 5 secondary cases had minor clinical features (table 1), without obvious hemorrhagic manifestations, so they did not receive dexamethasone therapy. except for the major risk factor of blood contact, droplet contact (n=4), which included 3 medical staff who were involved in the intubation and the index patient s daughter who cared for him before death, in addition, the risk factor of possible airborne transmission (being in the icu room or funeral room without mask protection) was also assessed among all 63 exposed individuals. of them, the medical doctors and nurses (n=16) were with protection; and the others were without (n=47), including icu patients who were staying in the same room (n=8), family members (n=3), and visitors to the funeral room where the corpse was kept (n=35). the multivariate analysis (logistic regression analysis) showed that blood contact was the most likely mode of transmission (p<.001; table 1). it is noticeable that the serum collected from the index patient on the day he died contained a relatively high amount of sftsv, which reached about 3.55 10 viral rna copies/ml (calculated as 9.67 10 50% tissue culture infective dose [tcid50]/ml). this number was about 100 000-fold higher than viral copies detected in the serum samples of the 5 secondary patients, which ranged from 10 to 10 copies/ml (table 1). all 5 patients had virus-specific igm antibodies in the acute phase, and elevated virus-specific immunoglobin g (igg) antibodies in the convalescent phase. the index patient, however, had minimal or undetectable levels of virus specific igm antibodies on day 11 after onset of fever (table 1). compared with the entire genomic sequence of the virus strain isolated from the index patient, cases 2 and 3 were nearly 100% identical, and provided genetic evidence for the epidemic findings on the possible transmission of sftsv from the index patient to secondary patients. here, we reported the person-to-person transmission of sftsv with a cluster of 6 sfts patients that occurred in shandong province of eastern china. investigation studies revealed that all 5 secondary infected patients had possible contact with the index patient s blood. of them, only case 1 (icu doctor) had evidence of droplet contact contamination (during intubation) but not blood contact, but we included him also as a blood contactor because he performed intubation without protective face shield and goggles, therefore he had an extremely high risk of blood contact through unprotected skin and mucosa. the risk assessment revealed that blood contact was the major risk factor for the human-to-human transmission of sftsv. additionally, 3 secondary patients who only had contact with the index patient after death were still infected, which indicated that sftsv-infected blood may remain infectious for a long time, even after patient death. it is notable that the level of virus copies in the index patient s serum was extremely high, but with no detectable igm or igg antibodies, which suggested that his immune responses to limit the replication of sftsv were severely impaired. the patient had no immune system disease, thus the minimal immune responses might be due to the early and sustained application of glucocorticoid, which has a side effect of repressing immune functions; clinical physicians should take note of this finding. clinically, sfts is easily confused with hemorrhagic fever with renal syndrome caused by hantavirus and human anaplasmosis. the hantavirus-specific igm antibodies were not detected in the sfts patients serum samples (data not show). due to the limitation of our study, we were not able to detect rickettsia infection, which was previously reported in outbreaks of nosocomial infections. however, the methods we used for diagnosis of sfts patients were well validated, and the human-to-human transmission of sftsv we described in this study could not simply be classified as being nosocomial transmission; specially, 3 of the 5 secondary cases that occurred in the household. additionally, the lessons of person-to-person transmission of sftsv we learned from this study highlighted the necessity of establishing standard precautions for avoiding direct contact and blood-based transmission. this work was supported by the china mega-project for infectious diseases (2008zx10004-001, 2009zx10004) from the ministry of science and technology and ministry of health of the people s republic of china. conflicts that the editors consider relevant to the content of the manuscript have been disclosed .

severe fever with thrombocytopenia syndrome bunyavirus is a newly discovered bunyavirus with high pathogenicity to human. the transmission model has been largely uncharacterized. investigation on a cluster of severe fever with thrombocytopenia syndrome cases provided evidence of person-to-person transmission through blood contact to the index patient with high serum virus load.

PMC3245727

pubmed-371

therefore, the mother's knowledge about child care influences the nature and quality of care that is given to the child. several studies have revealed that the mothers level of education has a positive impact on her knowledge and how she deals with child health care issues.[213] our experience in pediatric practice has revealed significant gaps pertaining to child health issues in the mothers knowledge. there seems to have been very little improvement in the knowledge of mothers on common child health matters over the years inspite of the many years of girls education in the country. this descriptive cross-sectional survey aimed to answer the following questions: (1) what is the level of mothers knowledge of certain aspects of child health matters? (2) what are the main sources of health information and which ones are the most useful? (3) is there a correlation between mothers level of knowledge and the number of years spent in formal education? (4) in the mother's view, does the current formal education of girls in schools/colleges have a significant impact on mothers knowledge of child health matters. it was reviewed and refined by two other colleagues who have a lot of experience in pediatrics. the first part comprised information about mothers nationality, age, work, level of education and the number of children she has in addition to sources of health information and the role of formal school education in child health matters. the second part contained 40 statements about different aspects of child health issues including nutrition, immunization, development, accident prevention, certain neonatal and infants problems or behaviors and some common childhood illnesses. mothers who attended with their children at the pediatric outpatient clinic of king khalid university hospital in riyadh during the months of july and august, in 2007, were invited to participate in the study. those who agreed were interviewed by a trained non-medical research assistant using the items and statements of the questionnaire as a basis for the structured interview. it was indicated clearly to the mothers that participation was voluntary and their non- contribution would have no adverse effect on the quality of care given to their child in the hospital. they scored one point for each knowledge question answered correctly and zero for wrong and do not know answers. the first 20 questionnaires completed were used as a pilot test to evaluate the clarity of language and level of information in the questionnaire. data was entered in ms excel and analyzed using spss pc 11.5 version statistical software. descriptive statistics, mean and standard deviation and proportion were used to quantify the study and outcome variables. demographic data regarding nationality, age, work, education, and number of children are represented in table 1. as the main source of health information, 295 (80%) cited family members (grandmothers, mothers, sisters, relatives etc.), 30 (8.2%) cited schools, 68 (17.2%) cited tv and radio, 60 (16%) cited journals and magazines, 52 (14.2%) cited friends, colleagues and other members of society, 101 (27.1%) cited books and only 25 (7.1%) cited health care professionals. demographic data of the mothers two hundred twenty-five (60.6%) of the mothers believe that formal girls education in schools and colleges does not provide sufficient child health education. on the question of where to obtain useful information of child health, 287 (77.6%) of the mothers supported the increase in instruction on child health in the curriculum in schools, 284 (77%) supported specific courses on child health targeting girls and women, 321 (86.8%) supported the use of the mass media, and 311 (84.1%) supported programs run by health care professionals. the mean knowledge score of the total sample was 25 (out of 40), the minimum score obtained was 14 and the maximum was 36. we found no statistically significant correlation between the total score on mothers knowledge or any of the items on the knowledge questionnaire and mothers level of education. table 2 indicates total knowledge score in relation to mothers education, age and number of children. the results of mothers responses to individual items on the knowledge questionnaire are indicated in table 3. association between the scores of mother's knowledge and mother's age, educational status and number of children mother's response to the knowledge questionnaire incorrect knowledge on certain specific items of the questionnaire included 131 (35.1%) who believed that on most occasions, fever in children was a symptom of serious disease, 313 (83.9%) believed that the best method to treat a child with a fever was to bathe him/her with cold water or wipe with cold or iced cloth. questions on diseases covered by the national vaccination program revealed that 285 (76.4%) believed that mumps was not targeted, 245 (65.7%) believed that tetanus was not targeted, 203 (54.4%) believed that whooping cough (pertussis) was not targeted and 241(64.6%) believed that diphtheria was not targeted by the national vaccination program. three-hundred and five (81.8%) of the mothers believed that the best course of action for parents of a child who was due for a scheduled vaccination but has a fever, cough and runny nose (symptoms of upper respiratory infection) was to defer the vaccination until he was completely symptom free. on the question of conditions which were regarded as serious and warranted urgent attention by a doctor, 176 (47.2%) did not see the need for the newborn baby who was sleeping all the time and was not interested in feeding to be seen by a doctor. another 82 (22%) disagreed with seeking medical help for a child who cries continuously, does not sleep and who has pain with every movement. three-hundred and one (80.7%) of mothers believed that the appearance of jaundice on the first day of the life of a newborn was physiological (natural) and so nothing other than more frequent feeding and exposure to sunlight was required. it is noteworthy that more than 30% of the mothers believed that a newborn baby who passes stools after each feed, or a newborn who is otherwise healthy but has repetitive movements of the chin, or one who strains and becomes red in the face during defecation, or a breast fed baby who passes stools only once every 5 days, may have a serious illness and needed urgent medical attention. on feeding practices, 200 (53.6%) of the mothers believed that there was no harm in giving a child a bottle of milk at bedtime in bed or whenever he cried during sleep; 90 (24.1%) did not agree that the most acceptable time to start solid food for children was at 6 months of age, 225 (60.3%) agreed with force-feeding when children refused to eat. results on the items on safety practices revealed that only 84 (22.5%) of the mothers believed that it was harmless to let babies sleep by their mothers in the same bed. one-hundred and ninety (50.9%) thought that it was not harmful to let babies sleep on their tummy in bed (prone sleep position). two hundred two (59.5%) believed that putting a baby who crawls in a walker protected him from household accidents. two-hundred and five (55%) believed that the best place for a baby/an infant to sit or be carried in a car was the mother's lap. our results revealed that the mean score of the sample which was just above the cut-off score, was an indication of a satisfactory knowledge level. if it had been fixed at 20, the knowledge of more than 90% would have been satisfactory, on the other hand, if it had been raised to 30 the knowledge of only 12% would have been satisfactory. a closer look at some items revealed significant and sometimes serious gaps in the mothers knowledge. similar gaps have been reported from different societies.[71521] our results indicated that a majority of mothers believed that the best method to treat a child with a fever was to bathe him with cold water or rub him with ice cold cloth. this was worse than that reported by al eissa et al where 50% of the parents would use cold water and 7% ice water for the treatment of fever. impicciatore et al reported that 9% of the mothers used iced packing to reduce fever. knowledge of the diseases covered by the national vaccination program revealed that a high proportion of mothers were not fully informed about certain diseases targeted by the program. impicciatore et al reported that only 26% of italian mothers were able to state the vaccinations which were compulsory. our results revealed no statistically significant correlation between mother s knowledge score and their level of education, age or number of children. this is similar to the results of jan et al (jeddah, ksa, 2000) who found no correlation between parents level of education and safety practices, but contrary to the finding of moawed et al (riyadh, ksa, 2000) who found a statistically significant correlation between mothers knowledge and their practices during infants diarrheal episodes and mothers age, education and birth order. it is also not in accord with shawky et al (jeddah, ksa, 2001) who reported on the effect of maternal education on the rate of childhood handicap and found that the risk of having a handicapped child declined sharply with the increase in the level of maternal education. one possible explanation of this difference in the results could be the use of different research methodology (sample selection, data gathering and others). it is worrying to find that the majority of mothers believed that jaundice on the first day of life of a newborn was physiological (natural) and required no more than frequent feeding and exposure to sun light. also disturbing is the fact that nearly half did not realize that a newborn baby who slept all the time and was not interested in feeding could be seriously sick and needed to be seen urgently by a doctor; another quarter did not realize that a child who cried continuously, who did not sleep and was in pain with every movement was sick enough to require urgent medical attention. dongre et al from rural india reported that 23% of mothers were not aware of any danger signs in a newborn such as, poor sucking, low birth weight, lethargy/ unconsciousness, rapid/difficult breathing. these were indicated as danger signs by 34.4%, 25.8%, 25.5%, 10.3% mothers respectively, while hypothermia and convulsions were referred to as danger signs by 10.3% and 8.6% mothers respectively. the majority of mothers cited family members as their main source of health information, which is higher than what was reported by al eissa et al, where some 35% of the parents mentioned friends and relatives as their main source of information. only few mothers cited health care professionals as their main source of health information. in the report by impecciatore et al from italy, only 42% of the mothers said that the pediatricians had spontaneously spoken to them about vaccination during consultation with a child. al eissa et al reported that only a group of 37% of parents cited medical personnel as their source of information. these findings reflect a lack of active educational intervention by professionals. it is encouraging to find that more than three-fourths of the mothers believed that it was harmful to let babies sleep with them in the same bed. this is contrary to the finding of jan et al on which 75% of the mothers reported sleeping next to their infants in the same bed, though it is difficult to discern whether mothers were compelled to do so by social circumstances or they believed it was safer for their infant. around two-thirds believed that schools did not provide sufficient information on child health and more than two-thirds supported the increase of education of child health in the curriculum of schools. according to kolbe, behaviors and attitudes about health that began during childhood were responsible for most of the deaths, illnesses and disability. comprehensive health education programs in schools represent one effective way of providing students with the knowledge and skills to prevent health-impairing behavior. several previous studies stressed that health education in school curricula was not adequate, and that the knowledge of high school girls and university students on health matters was deficient.[2730] furthermore, studies have shown that school teachers were not trained to give health education in schools. their college curriculum did not equip them for such a role and so the teachers refrained from teaching health subjects. according to summerfield and others hundreds of studies have evaluated health education and concluded that it was effective, but its effectiveness depended upon factors such as teacher training, comprehensiveness of the health program, time available for instruction, family involvement and community support.[253234] the responsibility for health education was not to be left solely to schools. in addition to all other sectors of the community, health care personnel and other health care institutions should play a major role in health education. milaat et al, agble et al and kari et al, reported successful involvement of health care personnel and medical students in targeted health education classes for school children and university students. such efforts may prove more effective than formal general health education classes taught by uninterested, unenthusiastic, untrained school teachers. every visit to a health care professional or every health care facility or institution by patients/parents should be an opportunity for the delivery of a short course in health education. possible limitations of the study are that the sample of mothers selected may not have been representative of the community; mothers who volunteered to participate in the survey may prove to be different from the non-participants. whether the respondents were serious in completing the questionnaire and whether research assistant had influenced the responses of the mothers to the questionnaires is not known. it also revealed that health education in schools was deficient and it also exposed the limited involvement of health care personnel and institutions in health care education. there is a need for health education programs that target high school girls, university students, mothers and other caregivers (e.g. fathers). these should be delivered by trained personnel in classes, courses, and special sessions. in addition, health care facilities should be reformed to make health education an essential and compulsory part of health care delivery. involvement in these educational activities should be a mandatory requirement for the issue of a license to practice.

background: child care is mostly the responsibility of mothers. several studies have revealed that the mothers education has a positive impact on their knowledge and practice in child health matters. objectives:the study was undertaken to assess the level of mothers knowledge on certain aspects of child health care and whether there is any correlation between their level of knowledge and the number of years of formal education they have had. materials and methods: a two-part questionnaire was distributed. the first part comprised information about mother's nationality, age, work, level of education and number of children, in addition to sources of health information and the role of school education in child health matters. the second part contained 40 statements about different aspects of child health matters. a structured interview with the mothers who attended with their children at the pediatric outpatient clinic of king khalid university hospital in riyadh during july and august 2007, was conducted by a trained non-medical research assistant using the items and statements of the questionnaire as a base. a knowledge score was calculated from the number of correct answers. the maximum score was 40. an arbitrary cut-off score of 25 was considered satisfactory. results:three-hundred-seventy-three questionnaires were completed. the mean score of the total sample was 25 (out of 40) and the minimum score obtained was 14, and the maximum 36. fifty-eight percent scored 25 or more. scrutiny of individual items on the questionnaire revealed significant and serious gaps in mother's knowledge. no statistically significant correlation was evident between mothers knowledge of child health related matters and level of education, age, or number of children. conclusion: mothers knowledge of child health related matters is deficient. at present, knowledge on child health matters taught in schools in the kingdom is inadequate. health care institutions play a limited role in health education. there should be proper effective practical means of disseminating information on child health matters among mothers in our community.

PMC3195075

pubmed-372

neurotransmitters (nts) are signaling molecules, which play pivotal roles in neuronal communications in the central nervous system [1, 2]. it is reported that changes in nts quantitation in several brain regions involve the development of many psychiatric diseases and neurodegenerative diseases [3, 4]. generally, neurotransmitters are classified into two categories based on their chemical styles: (i) the small molecules (dopamine (da), serotonin (5-ht), norepinephrine (ne), epinephrine (ep), glutamate (glu), -aminobutyric acid (gaba), histamine, and endocannabinoids and (ii) the neuropeptides (enkephalin, endorphin, and substance p). the quantitation of various nts as a small molecule in the brain, especially the aromatic monoamines, should be measured by using high-pressure liquid chromatography (hplc) separation coupled with amperometric electrochemical detection (ecd). this method has been applied in nts analysis over the last three decades [68]. however, it is still rather difficult to determine different types of nts simultaneously in one sample owing to the limited capability of accommodating changes in the mobile phase composition. another difficulty of incorporating this method is that the analytes can only be identified by a stable retention time matching. nevertheless, tandem mass spectrometry (ms/ms) can provide high specificity due to additional structure information and high sensitivity. therefore, it has been commonly used for the quantification of nts in the brain by coupling with both gas chromatography (gc) and liquid chromatography (lc) [5, 11, 12]. owing to various efficiencies and time consumption of derivatization, a simplified sample preparation using liquid chromatography coupled with electrospray tandem mass spectrometry (esi-ms/ms) is widely employed to quantify the nts and their metabolites in the brains without derivatization [5, 9, 13]. the use of isotope labeled internal standards is vital to the enhanced method performance because the isotope ratio measurements provide a measure of quality control for each analyte by compensating for changes in analyte, retention time, recovery, degradation, and changes in detector responses caused by coeluting contaminants. in this study, we developed a sensitive, simple, and simultaneous method to quantify the six major nts such as da, 5-ht, ne, ep, glu, and gaba in mouse brains [14, 15]. in addition, a tetrahydrobiopterin (bh4), a vital cofactor for the biosynthesis of the da, 5-ht, and ne, was also measured in the same sample. to establish a novel method for the direct measurement of biologically active levels of bh4, da, 5-ht, ne, ep, glu, and gaba in the brain samples, the present study was performed using a high efficiency hilic column for bh4 and da, a luna 3 c18 (3.0 mm 150 mm, i.d., 3 m) column for 5-ht, ne, ep, glu, and gaba with reversed-phase hplc separation and an esi-ms/ms, which could minimize the sample interferences. at the same time, the multiple reactions monitoring (mrm) scan mode was sensitive enough to identify and quantify the bh4 and nts in this new method. the (6r)-5,6,7,8-tetrahydrobiopterin dihydrochloride, dopamine hydrochloride, serotonin hydrochloride, ()-norepinephrine, ()-epinephrine, d-glutamic acid, and -aminobutyric acid were purchased from sigma-aldrich corporation (st. louis, mo, usa). internal standards (is) with isotope labeling were 2-(3,4-dihydorxyphenyl) ethyl-1,1,2,2-d4-amine hcl (dopamine-d4, 98% at% d); serotonin-, ,,-d4 creatinine sulfate complex (serotonin-d4, 98% at% d); ()-norepinephrine-2,5,6,,,-d6 hcl (norepinepherine-d6, 98% at% d); ()-epinephrine-d3 (n-methyl-d3) (epinephrine-d3, 98% at% d); l-glutamic-2,3,3,4,4-d5 acid (glutamate-d5, 98% at% d); 4-aminobutyric-2,2,3,3,4,4-d6 acid (-aminobutyric acid-d6, 98% at% d). epsilon-acetamidocaproic acid (aaca) was donated by kuhnil pharmaceuticals (seoul, korea). water was purified with a milli-q water purification system (millipore, bedford, ma, usa). full-scan positive mass spectra of bh4 and the is (aaca) reveal the protonated molecules, [m+h], of m/z 242.1 and 174, respectively. the mass-to-charge ratios of fragments of bh4 after fragmentation were 166, 107, and 149 and fragments of is were 114, 156, and 79. the most abundant ion in the product ion spectra was 114 for is (figure 1(a)) and 166 for bh4 (figure 1(b)). in parallel, full-scan positive mass spectra of bh2 and the biopterin showed the protonated molecules, [m+h], of m/z 240.0 and 238.0, respectively. the mass-to-charge ratios of fragments were 196.0, 164.9, and 168.0 in bh2 and of 177.9, 193.9, and 192.0 in biopterin. the most abundant ion in the product ion spectra was 196.0 for bh2 (figure 1(c)) and 177.9 for biopterin (figure 1(d)). full-scan positive mass spectra of da and the is (dopamine-d4) showed that m/z of protonated molecules [m+h] are 154.1 and 158.1, respectively. the mass-to-charge ratios of fragments of da after fragmentation were 137.0, 90.9, and 64.9 and of da-d4 141.0, 95.0, and 67.9. the most abundant ion in the product ion spectra was 137.0 for da (figure 2(a)) and 141.0 for is (figure 2(b)). but da mrm had 154.1 to 90.9 due to matrix effects, which increased the mass-to-charge ratio level. full-scan positive mass spectra of 5-ht and the iss (serotonin-d4) showed that the mass-to-charge ratios of protonated molecules [m+h] were 177.0 and 181.0, respectively. after fragmentation, fragments of 5-ht seen were m/z 160.0, 114.9, and 132.0 and fragments of 5-ht-d4 m/z were 164.0, 118.0, and 136.0. the most abundant ion in the product ion spectra was at 160.0 for 5-ht (figure 2(c)) and at 164.0 for is (figure 2(d)). full-scan positive mass spectra of ne and the is (norepinephrine-d6) showed that the mass-to-charge ratios of protonated molecules [m+h] were 170.1 and 176.1, respectively. after fragmentation, fragments of ne were m/z 152.0, 107.0, and 76.9 and fragments of ne-d6 m/z were 158.0, 111.0, and 112.0. the most abundant ion in the product ion spectra was at 152.0 for ne (figure 2(e)) and at 158.0 for is (figure 2(f)). but m/z 170.1 to 107.0 and 176.1 to 111.0 was selected for ne and is (ne-d6) mrm due to matrix effects, which increased the mass-to-charge ratio level. full-scan positive mass spectra of ep and the is (epinephrine-d3) showed that the mass-to-charge ratios of protonated molecules [m+h] were 184.1 and 187.1, respectively. the m/z of fragments of ep after fragmentation were 166.0, 76.9, and 107.0 and of ep-d3 169.0, 76.9, and 107.0, respectively. the most abundant ion in the product ion spectra was at 166.0 for ep (figure 3(a)) and at 169.0 for is (figure 3(b)). full-scan positive mass spectra of glu and the is (glutamate-d5) showed that the mass-to-charge ratios of protonated molecules [m+h] were 148.0 and 153.0, respectively. the mass-to-charge ratios of fragments of glu after fragmentation were 129.0, 83.9, and 55.9 and of glu-d5 were 135.0, 84.8, and 88.0, respectively. the most abundant ion in the product ion spectra was at 129.0 for glutamate (figure 3(c)) and at 135.0 for is (figure 3(d)). but m/z 148.0 to 84.0 and m/z 153.0 to 88.0 for glutamate and is (glutamate-d5) mrm were selected due to matrix effects, which increased the mass-to-charge ratio level. full-scan positive mass spectra of gaba and the is (gaba-d6) showed the protonated molecules, [m+h], of m/z 104.0 and 110.1, respectively. the mass-to-charge ratios of fragments of gaba after fragmentation were 87.0, 44.9, and 85.0 and of gaba-d6 were 93.0, 49.0, and 91.9, respectively. the most abundant ion in the product ion spectra was at 87.0 for gaba (figure 3(e)) and at 93.0 for is (figure 3(f)). individual stock solution of each nt and isotope-labeled standard was prepared by accurate weighing of each compound (1 mg/ml methanol as the stock solution). the solution of bh4, da, 5-ht, ne, ep, glu, and gaba was prepared as a stock (1 mg/ml of each) with pure acetonitrile and then diluted with acetonitrile (50%) for each experiment. standard solutions of bh4, da, 5-ht, ne, ep, glu, and gaba for calibration curves were prepared by spiking the blank solution prepared to the appropriate amounts, but added volumes were less than 10% of total dw volume. the final yielding concentrations for the standard curve were 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, and 10000 ng/g for bh4 and dopamine. in parallel, the final concentrations for the standard curve were 20, 50, 100, 200, 500, 1000, 2000, 5000, and 10000 ng/g for 5-ht, ne, and ep. likewise, the final concentrations for the standard curve were 0.2, 0.5, 1, 2, 5, 10, 20, 50, 100, and 200 g/g for glu and gaba. the tolerance for reliable detection was 10 ng/g for bh4 and dopamine, 20 ng/g for 5-ht, ne and ep, and 0.2 g/g for glu and gaba. the linear ranges and correlation coefficient of the calibration curve were summarized in table 1. icr mice (male, body weight 2030 g, n=24), (daehanbiolink inc., chungju, south korea), were used. the mice were kept under a controlled condition (ambient temperature of 20 to 25c, 12-h light/dark cycle). nih's guidelines for animal research were followed for all animal procedures and were approved by institutional animal care and use committee (iacuc; dku-12-018) which adheres to the guidelines issued by the institution of laboratory of animal resources (ilar). the specific brain regions of mouse were quickly dissected on an ice bath and, subsequently, isolated brain tissues were homogenized with acetonitrile (1 mg/10 l) according to the internal standard (aaca: 100 ng/ml; dopamine-d4, serotonin-d4, norepinephrine-d6, epinephrine-d3, glutamate-d5, and gaba-d6: 1 g/ml). after a thorough homogenization, the bh4 and nts (da, 5-ht, ne, ep, glu, and gaba) from brain tissues were extracted by sonication for 60s. the homogenates of brain tissue were centrifuged at 12,000 rpm for 10 min at 4c. supernatants were carefully transferred to 96-well plates and then injected onto the lc-ms/ms system by an autosampler for subsequent analysis. for determination of bh4 and nts in mouse brain tissues, d-water was used as blank matrix. the liquid chromatographic system used was the accela system (thermo fisher scientific inc., waltham, ma, usa), equipped with a nanospace si-2 3133 solvent delivery module as an autosampler (shiseido inc., japan) and connected to discovery max (thermo fisher scientific, inc.) quadrupole tandem mass spectrometer coupled with electrospray ionization (esi-ms/ms). system control and data analysis were performed using the xcalibur software (thermo fisher scientific, inc.). chromatographic separation was achieved using hydrophilic interaction chromatography (hilic) sepax polar-imidazole (2.1 mm 100 mm, i.d., 3 m particle size) hplc column (sepax technologies, delaware, usa) to assay bh4 and dopamine, and luna 3 c18 (3.0 mm 150 mm, i.d., 3 m particle size) to assay serotonin, norepinepherine, epinephrine, glautamte, and gaba with a phenomenex c18 guard column (4 mm 2 mm, phenomenex). a nanospace si-2 3004 column oven (shiseido, japan) was used online. to assay bh4 and dopamine, the mobile phase consisted of 10 mm ammonium formate (ph 3) in an acetonitrile/water (75: 25, v/v) mixture. the flow rate was 300 l/min and the injection volume was 5 l. to assay 5-ht, ne, ep, glu, and gaba, the mobile phase consisted of an acetonitrile/water (20: 80, v/v) mixture. the flow rate was run at 350 l/min and the injection volume was 5 l. the electrospray ionization (esi) mass spectrometer was operated in the positive ion mode. the optimal condition was as follows: the esi needle spray voltage was 4000 v, the sheath gas pressure 35 unit, the auxiliary gas pressure 20 unit, the capillary temperature 206c, the collision gas (ar) pressure 1.5 mtorr, the skimmer offset 5 v, and the chrome filter peak width 10 s. scanning was performed in profile mode with the sim width 0.700 fwhm, scan time 0.200 s, and scan width 0.5 da. it was successful to qualify bh4 using hydrophilic interaction chromatography (hilic) sepax polar-imidazole (2.1 mm 100 mm, i.d., 3 m particle size) hplc column (sepax technologies, delaware, usa). moreover, the peaks had a symmetric shape, and we confirmed the lc-ms/ms chromatogram of bh4, aaca, da, and da-d4 (figure 4). following the same strategy, we analyzed successfully for 5-ht, ne, ep, glu, and gaba by using luna 3u c18 (3.0 mm 150 mm, i.d., 3 m particle size). the whole validation experiments followed the guideline of fda (us) [guidance for industry; handling and retention of ba and be testing samples], may 2004. linear regression of the ratio of peak area of bh4 or nts to that of is was done with weighting of 1/x (least-squares linear regression analysis, where x is the concentration of the analyte). precision and accuracy were evaluated by three different concentrations of qc solutions: interday precision was evaluated for 5 replicates per a single concentration. the value of accuracy was expressed as the mean of 25 replicates of determined concentration from 5 different analytical tests to the qc concentration (table 2). all the values, tables, and figures given in the text are expressed as mean sd. statistical differences between means were evaluated with two-tailed student's t-test. for simple sample preparation, protein precipitation was attempted using acetonitrile. to prevent sample degradation and oxidation, an ascorbic acid with 0.01% (w/v) the peaks of bh4, dopamine, and is were best when acetonitrile was used for protein precipitation and as an organic solvent of the mobile phase when using the hilic column (polar-imidazole, 2.0 mm 150 mm; i.d., 3 m) (figure 4). because bh4 and dopamine are easily dissolved in water, they are difficult to match the reverse column (c18) in chromatography analysis the other nts (5-ht, ne, ep, glu, and gaba) were matched with a c18 column (luna 3 c18 (3.0 mm 150 mm, i.d., 3 m particle size)) (figure 5), but the hilic column could not separate peak of nts clearly. the optimized electrospray ionization condition should be sensitive enough to detect bh4, da, is, bh2, and biopterin in positive ion detection mode. the most abundant protonated ion peaks ([ m+h ]) in the q1 mass spectra of bh4, da, is, bh2, and biopterin were at 242.1, 154.1, 174.0, 240.0, and 238.0, respectively (figures 1 and 2). the product ions in q3 mass spectra and proposed fragmentation patterns were bh4, which becomes at 2-amino-7,8-dihydropteridin-4(1h)-one of m/z 166.0 by losing propane-1,2-diol. da becomes butane-1,2-diol of m/z 90.9 by losing (e)-3-methylpent-3-en-1-amine; is, (e)-n-ethylidenepentan-1-amine of m/z 114.0 by losing both carboxyl and hydroxyl groups; bh2, 2-amino-7,8-dihydro-6-(hydroxymethyl)pteridin-4(1h)-one) of m/z 196.0 by losing propan-2-ol; biopterin, 2-amino-6-(hydroxymethyl)pteridin-4(1h)-one) of m/z 196.0 by losing propan-2-ol. also, to confirm separation between bh4 and other biopterins in biological samples, experiments were previously conducted to quantify biopterin, bh2, and bh4 in a mixed matrix. the optimized electrospray ionization condition should be sensitive enough to detect bh4, da, 5-ht, ne, ep, glu, gaba, and iss with positive ion detection mode. the most abundant protonated ion peaks ([ m+h ]) in the q1 mass spectra of bh4, da, 5-ht, ne, ep, glu, gaba, and iss are listed in table 3. the product ions and collision energy in q3 mass spectra of bh4, da, 5-ht, ne, ep, glu, gaba, and iss were listed in table 3. previously, our lab reported bh4 and dopamine levels in rat brain region. to extend this method to mouse brain regions, we applied it the bh4 and nts in the mouse brain. the peak areas of the spiked standard were constructed by subtracting the corresponding areas derived from the matrix. meanwhile, calibration using internal standardization with deuterated analogues was performed. in biological specimen analysis, the isotope-labeled analogues of the targeted analyte are often recommended. due to their similar physicochemical properties, compared to deuterated analogues, the variability during sample preparation and ionization efficiency in the transfer of analytes from liquid to gas could be compensated for, and they could be differentiated ideally by their distinct mass-to-charge (m/z) ratios. all analytes were subjected to hplc-ms/ms analysis, and their distinct mass-to-charge (m/z) ratios were determined. there are representative lc-ms/ms chromatograms of bh4, da, and iss (aaca and dopamine-d6) in the dw matrix (figure 4). also, there are 5-ht, ne, ep, glu, gaba, and iss lc-ms/ms chromatograms in the dw matrix (figure 5). we tested the newly developed method using olfactory bulb (ob), frontal cortex (fc), hippocampus (hp), striatum (st), hypothalamus (ht), pituitary gland (pt), midbrain (mb), cerebellum (cb), and brainstem (bs) from the mice and subsequently confirmed that the quantity of bh4 and nts (table 4). eight different concentrations from 10 to 2000 ng/g of bh4, from 10 to 5000 ng/g of da, from 20 to 10000 ng/g of 5-ht, ne, and ep, and from 0.2 to 200 g/g of glu, gaba is plotted against is for the standard curves. the correlation coefficients (r), lod, and loq of the standard curve are shown in table 1. the lc-ms/ms methodology was used to measure the levels of bh4 and nts in nine brain regions including ob, fc, hp, st, ht, pt, mb, cb, and bs from mice. the newly-developed lc-ms/ms method was used to analyze the quantity of bh4 and nts in mice brain regions (table 4). the endogenous levels of bh4, da, 5-ht, ne, ep, glu, and gaba were successfully detected and measured in mice brain regions. the present study was undertaken in order to describe a sensitive and specific lc-ms/ms method for simultaneous detection of bh4, da, 5-ht, ne, ep, glu, and gaba from mouse brain tissue. the principal advantages of using lc-ms/ms method include a simple purification procedure and a simple chromatographic condition using the mrm scan mode. the use of a hilic column overcame the limitations of separating hydrophilic materials. therefore, hilic column could separate bh4 and da from matrix effect with an appropriate retention time. the other nts (5-ht, ne, ep, glu, and gaba) were matched well with a luna 3 c18 column. so, the current developed method should be very useful for brain tissue works of research, regarding the analysis of the alternation of the levels of bh4, da, 5-ht, ne, ep, glu, and gaba. this new method can enable measurement of bh4 and nts rapidly and accurately in brain tissues. previously, bh4 levels have been indirectly calculated by measuring the concentrations of biopterin in biological samples. however the limitation of this indirect method is that it is unable to measure the exact bh4 levels owing to rapid oxidation and degradation. to avoid the problem, we tested several experimental conditions and found that a low temperature is a critical factor to prevent decomposition of bh4 in the brain tissues extract. but the addition of antioxidant (dte) and/or acid (hcl) to the samples does not affect dramatically the stability of bh4. keeping the treated extracts at 4c is necessary and enough to maintain bh4 stable for 4 hours, which is long enough to finish the analysis of the targets in samples. by using hilic column, bh4 and da were separated into single peaks. under other methods, many unknown materials in the biological matrix interfered with the analysis of bh4 and da in the biological samples. but the use of a hilic column could overcome the limitation to separating hydrophilic materials. so, hilic column could separate successfully the bh4 and da from matrix effect with an appropriate retention time (figure 4). in addition, it could increase the sensitivity, selectivity, and accuracy of bh4 and da in brain samples using mrm scan mode. using luna 3 c18 column, 3 m particle size), 5-ht, ne, ep, glu, and gaba were separated into single peaks. also, the luna 3 c18 column could separate nts from matrix effect with an appropriate retention time, and the usage of mrm scan mode could increase the sensitivity, selectivity, and accuracy of nts detection in brain samples (figure 5). the levels of bh4 and nts were measured in several brain sections by using the newly-developed experimental method (table 4). the bh4 is an essential cofactor for the aromatic acid hydroxylases, which are essential in the formation of nts (da, 5-ht, and ne), as well as for nitric oxide synthase (nos), a vital enzyme for normal vascular and cardiac nitric oxide. therefore, it is necessary to reliably measure the biological concentration of bh4 for the evaluation of various diseases and for screening potential therapeutic candidates in neurological diseases. these results showed that the bh4 level was at its highest in olfactory bulb, followed by cerebellum, frontal cortex, striatum, midbrain, pituitary gland, hypothalamus, brainstem, and hippocampus in a decreasing order. however, the da level was at its highest in striatum, followed by hypothalamus, midbrain, pituitary gland, and olfactory bulb in a decreasing order. interestingly, there were no detectable da in hippocampus, frontal cortex, cerebellum, and brainstem. however, the lower limit of quantification in our method is 10 ng/g in samples. therefore, even though there are some da transmissions in these regions, the amount of da in hippocampus, brain cortex, and brainstem could be below 10 ng/g. these data indicate that the level of bh4 could be distinctly correlated with the level of da in the mouse brain tissue. the 5-ht levels were at their highest in midbrain and brainstem, followed by hypothalamus, striatum, hippocampus, frontal cortex, occipital lobe, and cerebellum in a decreasing order. the ne level was at its highest in hypothalamus and pituitary gland, followed by brainstem, midbrain, olfactory blub, cerebellum, striatum, and frontal cortex in a decreasing order. the ep level was at its highest in hippocampus, followed by hypothalamus, brainstem, midbrain, olfactory blub, frontal cortex, and pituitary gland in a decreasing order. however, there was no detectable ep in cerebellum; the levels of ne and ep have similar order in mouse brain sections. the glu level was at its highest in hippocampus, followed by frontal cortex, striatum, hypothalamus, cerebellum, midbrain, brainstem, olfactory blub, and pituitary gland in a decreasing order. the gaba level was at its highest in hypothalamus, olfactory bulb, and hippocampus, followed by midbrain, frontal cortex, striatum, cerebellum, striatum, and brainstem in a decreasing order. interestingly, the levels of glu and gaba were detected as microgram based units, but others were detected as nanogram based units. these results suggested that the neurotransmitters in mouse brain were differentially released to do their function in brain sections. however, a simple and rapid liquid chromatography tandem mass spectrometry (lc-ms/ms) method has been developed for the determination of bh4, da, 5-ht, ne, ep, glu, and gaba in mouse brain; the quantitative determination of endogenous neurotransmitters in brain regions by chromatographic coupled mass spectrometry presented here still has a limitation because of the typical lack of analyte-free matrix. there is no analyte-free sample of the authentic matrix; therefore, we have to use a surrogate matrix containing the authentic analyte. a simple and rapid liquid chromatography tandem mass spectrometry (lc-ms/ms) method has been developed for the determination of bh4, da, 5-ht, ne, ep, glu, and gaba in mouse brain using epsilon-acetamidocaproic acid (aaca) and isotopically labeled neurotransmitters as an internal standard. although it is clear that further studies are necessary to understand the physiological meaning of the different levels of bh4 and nts, this new method could be applied for tracking the changes of the endogenous bh4 and nts which are affected significantly by various stimuli or in neurodegenerative diseases [10, 23].

a simple and rapid liquid chromatography tandem mass spectrometry method has been developed for the determination of bh4, da, 5-ht, ne, ep, glu, and gaba in mouse brain using epsilon-acetamidocaproic acid and isotopically labeled neurotransmitters as internal standards. proteins in the samples were precipitated by adding acetonitrile, and then the supernatants were separated by a sepax polar-imidazole (2.1 mm 100 mm, i.d., 3 m) column by adding a mixture of 10 mm ammonium formate in acetonitrile/water (75: 25, v/v, 300 l/min) for bh4 and da. to assay 5-ht, ne, ep, glu, and gaba; a luna 3 c18 (3.0 mm 150 mm, i.d., 3 m) column was used by adding a mixture of 1% formic acid in acetonitrile/water (20: 80, v/v, 350 l/min). the total chromatographic run time was 5.5 min. the method was validated for the analysis of samples. the calibration curve was linear between 10 and 2000 ng/g for bh4 (r2=0.995), 10 and 5000 ng/g for da (r2=0.997), 20 and 10000 ng/g for 5-ht (r2=0.994), ne (r2=0.993), and ep (r2=0.993), and 0.2 and 200 g/g for glu (r2=0.996) and gaba (r2=0.999) in the mouse brain tissues. as stated above, lc-ms/ms results were obtained and established to be a useful tool for the quantitative analysis of bh4, da, 5-ht, ne, ep, glu, and gaba in the experimental rodent brain.

PMC4166658

pubmed-373

it plays several important physiological and pathological roles in not only reproductive system but also other systems. estrogen disorder results in various diseases, such as endometrial diseases, skeletal diseases, and reproductive system tumors. increasing attention has been paid to revealing of the functions of estrogen in physiological and pathological conditions. estrogen receptors (er) and, the two well established nuclear estrogen receptors, have different physiological functions depending upon their various distributions. lots of evidences show that estrogen induces the proliferation of cancer cells in breast, uterus, and ovarian cancer through er. on the contrary, activation of er can reverse this effect. notably, a novel transmembrane estrogen receptor, known as g-couple estrogen receptor (gper), was found. er are involved in the initiation, migration, and progression of estrogen-related multiorgan cancers, such as breast cancer, ovarian cancer, prostate cancer, testicular cancer, liver cancer, and lung cancer as well. although increasing studied are focused on the roles of gper-1 in different types of cancers, the functions of gper-1 in cancers remain unclear yet. characteristics and functions of reproductive system cancer will be summarized and discussed in the present review. g-protein-coupled estrogen receptor-1 (gper-1), a seven-transmembrane-domain receptor localized in cell surface, was first identified in 1996. gper-1 is detected broadly in numerous human tissues, such as breast, prostate, ovary, placenta, subcutaneous adipose, visceral adipose, arteries, vessels, heart, liver, lung and intestine tissues. gper-1 is a member of gpcr superfamily, which is structurally unrelated to the classical er and er. there are four transcriptional variants encoding 375 amino acids composing seven transmembrane proteins. but gper-1 binding domain exists inside the plasma membranes and the endoplasmic reticulum [58]. estradiol, the major type of estrogen, binds to gper-1 with a high affinity to gper-1 while the other two isoforms, estrone and estriol, have very low binding affinities [5, 9]. furthermore, numbers of environmental estrogen bind to gper-1 and activate the downstream signaling pathways, such as bisphenol a, genistein, and nonylphenol. gper-1-specific compound 1 (g-1) is a specific agonist of gper-1, which has no function of er and er and was identified using virtual and biomolecular screening in 2006. g-1 has been widely used as a target tool to evaluate the function of gper-1 in different cells and disease models. gper-1 mediates both genomic and nongenomic response with its ligands. to date, gper-1 signaling pathways have not been fully elucidated yet. the binding ligands of gper-1, such as estrogen, g-1, tamoxifen, and ici182,780, cross the plasma membrane and bind to the gper-1 on endoplasmic reticulum where they activate its and subunits and subsequently activate both src and adenylyl cyclase (ac) leading to the intracellular camp production. the phosphorylation of src induces matrix metalloproteinase (mmp) production, which cleaves pro-heparan-bound epidermal growth factor (pro-hb-egf) releasing free hb-egf. hb-egf binds to the egfr leading to activation of multiple molecules such as ras, pi3k, akt, and erk1/2. the downstream signal of pi3k and akt results in several nuclear receptors activation which is closely related the proliferation and migration of cancer cell. gper-1 also binds to the g-couple protein subunit and activates the phospholipase c (plc), ac, and camp. activated plc results in inositol triphosphate (ip3) production, which further binds to its receptor and leads to intracellular calcium mobilization. breast cancer is generally classified into estrogen receptor positive (er+) and er negative (er). in clinical practices, the endocrine treatments such as tamoxifen and aromatase are recommended in the er positive breast cancers, while there is no benefit in the er negative cancers. gper-1 is widely expressed in both of these breast cancer types and the primary breast cancers. recent clinical study results showed that the expression of gper-1 might correlate with clinical and pathological poor outcome biomarkers. other results also showed that the expression of gper-1 was inversely correlated with the er expression. coexpression of gper-1 and er was found in almost 24% patients with inflammatory breast cancer, while 19% only express er and 46% only express gper-1. the gper-1 mrna levels were significant higher in er positive breast cancer cells compared to er negative cancer cells, and the expression of gper-1 depends on er mrna level. interestingly, gper-1 preformed a different proliferation manner in er positive mcf-7 breast cancer cell line. g-1 enhanced migration of mcf-7 breast cancer cells by activating erk1/2 and egfr signaling pathway, which is tremendously attenuated by g15. the other evidences also approved that gper-1 is an initiator of tamoxifen resistance in breast cancers [1921]. the promotion roles of gper-1 in cancer cells proliferation and migration may be correlated with the autolysis of calpain 1, cleavage of cyclin e, or the expression of target gene. there are also some studies which found that gper-1 inhibits the growth of er positive mcf-7 cells, which is probably through g-couple and subunits activating without camp signal activation [2124]. however, combination treatment with g-1 and her2 antibody trastuzumab exerted an additive growth inhibitory effect on breast cancer cells. thus, gper-1 inhibits er positive breast cancers proliferation which is a potential target for er positive breast cancers and drug-resistant breast cancer. deficiency of er in breast cancer is correlated with poor response to endocrine therapy. in er negative breast cancers, gper-1 stimulates the erk1/2 through the egfr/mapk signal cascade, inducing target gene like c-fos expression, which is involved in the progressing of breast malignancies [2729]. estrogen and antiestrogens can also promote the production of the early growth response-1 (egr-1), connective tissue growth factor (ctgf), and insulin-like growth factor 1 (igf-1) through the gper-1 [28, 30, 31]. grp30 activation stimulated breast cancer cells migration through ctgh, cxc receptor (cxcr1), and notch pathways. furthermore, gper-1 agonist g-1 promoted inflammation in breast cancers. gper-1 was reported to affect the deformation of breast glandular structure inducing the malignant transformation of breast tissue. gper-1 can also induce expression of cancer-associated fibroblasts (cafs) in tumor microenvironment [34, 35]. on the contrary, a recent study showed that activation of gper-1 by g-1 resulted in g2/m-phase arrest and induction of mitochondrial-related apoptosis. the other studies also proved that g-1 treatment suppressed the growth of skbr3 cancer cells and increased the survival rate by inducing the erk1/2 signal activation [36, 37]. 1520% of breast cancers are included in triple negative breast cancers (tnbc), characterized by lack of er, progesterone receptor (pr), and egfr2 (her-2). a higher rate of recurrence and aggressive biological features were found in younger females [38, 39]. gper-1 expression was found in majority of tnbcs patients. in the gper knockdown mice model, the proliferation of tnbcs, these findings suggest that gper plays a key role in putative mechanism for tnbcs and gper might be a therapeutic target for tnbcs. snps of gper-1, histone acetylation, and transcription factor recruitment were significantly associated with tumor size and histological grading [42, 43]. gper rna as well as gper-1 protein presents in both primary and malignant ovarian tumor tissues. the expression of gper-1 was significantly increased in ovarian carcinomas compared to pericarcinomatous tissues impendent with the expression of egfr, er, and er. estrogen and g-1 induce ovarian cancer cell growth responses via egfr-mapk signaling pathways. furthermore, gper-1 promoted the migration and invasion of ovarian cancer cells ovcar5 which is characterized by negative er and positive gper by increasing the expression mmp-9 [48, 49]. atrazine, one of the most common pesticide contaminants, promoted ovarian cancer cells proliferation via induction of erk and expression of estrogen target gene through gper-1 pathway. but other studies results showed that g-1 suppressed proliferation and induced apoptosis of human ovarian cancer cells probably through inhibition of cell cycle progression in g2/m-phase in ovarian carcinomas [51, 52]. gper-1 has been shown to be involved in a variety of hormone-dependent cancers. it is well understood that estrogens play a critical role in pathological germ cell proliferation in testicular germ cell tumors. gper-1 seems to be involved in modulating the growth of estrogen dependent testicular cancer cells. estrogen induces the high expression of gper-1 correlated with low levels of er in human testicular carcinoma in situ and seminomas [53, 54]. bisphenol a, a common environmental estrogen, can also promote the proliferation of testicular seminomas cells through gper-1. the above findings suggested that gper-1 may be a potential therapeutic target [56, 57]. estrogen has an efficacy for advanced prostate cancer (pc) via the mediation of the classical estrogen receptors. the effects of er on pc growth and metastases have different mechanisms in different cellular microenvironments. the expression of gper-1 is higher in the preneoplastic lesions and normal areas of benign prostate than the basal epithelial cells. g-1, the selectively activating gper-1, inhibited the growth of multiple pc cells in vitro and in vivo through erk1/2 and c-jun/c-fos signaling pathways, which indicates that the g-1 may be a new option for pc through targeting gper-1. g-1 inhibited castration-resistant phase but had no effect on androgen-sensitive tumors. the antitumor effect of g-1 on cr tumors was related to necrosis (approximately 65%) accompanied with neutrophils infiltration. g-1 can also upregulate neutrophil-related chemokines and inflammation-mediated cytokines in the cr tumors. in one word there are other studies which proved that gper-1 induced proliferation, differentiation, and drug resistance of lung cancers [63, 64], thyroid cancers, bladder cancers, and oral squamous carcinomas. more studies to reveal the functions and mechanisms of gper-1 in the other system cancers are warranted. majority of the study results addressed that activation of gper-1 by estrogen and g-1 results in the downstream signals and target genes activation, which promotes the proliferation, migration, and invasion of cancer cells. and this effect is in nonclassical er expression dependent manner in most cancers except for ovarian cancers. it is interesting that several other studies showed that g-1, the special agonist of gper-1, promoted the expression of gper-1 and inhibited the proliferation of er negative breast cancer cells, ovarian cancer cells, and prostate cancer cells. the opposite effects of gper-1 in cancer cells may be associated with the epigenetic of gper-1, such as the snps and histone acetylation. the different cell types, tumor microenvironment, and hormonal level may also affect the functions of gper-1. controversies still exist on the gper-1 localization and related signaling pathways, in particular the potential action as proapoptotic mediator. since the function and mechanisms of gper-1 are still unclear, more researches and clinical studies are strongly warranted to clarify the different function and mechanisms in different cancer types and conditions.

the g-protein-coupled estrogen receptor-1 (gper-1), also known as gpr30, is a novel estrogen receptor mediating estrogen receptor signaling in multiple cell types. the progress of estrogen-related cancer is promoted by gper-1 activation through mitogen-activated protein kinases (mapk), phosphoinositide 3-kinase (pi3k), and phospholipase c (plc) signaling pathways. however, this promoting effect of gper-1 is nonclassic estrogen receptor (er) dependent manner. in addition, clinical evidences revealed that gper-1 is associated with estrogen resistance in estrogen-related cancer patients. these give a hint that gper-1 may be a novel therapeutic target for the estrogen-related cancers. however, preclinical studies also found that gper-1 activation of its special agonist g-1 inhibits cancer cell proliferation. this review aims to summarize the characteristics and complex functions of gper-1 in cancers.

PMC4903118

pubmed-374

neoadjuvant chemotherapy actually takes an important place in treatment of operable breast cancer in the hope of improving conservative surgery rate of female patients. neoadjuvant chemotherapy includes today on target therapies involving the research on expression of specific molecules by tumoral cells. in routine practice, estrogen receptors (er), progesterone receptors (pr), and human epidermal growth factor receptor 2 (her2) are the common used biomarkers. new pharmaceutical molecules, other than er/pr or her2, are now already evaluated in clinical research as new biomarkers and new target for neoadjuvant therapy. fine-needle aspiration cytology (fnac) of the breast is wellknown as a safe, effective, economical, and accurate technique for diagnosing palpable breast lesion [24]. this last decade, fnac technique is improved by the development of new cytological methods allowing standardization of fixation and assuring constant results with ancillary tests such as immunocytochemistry and in situ molecular biology. also, one of the advantages of fnac is the management of small tissue fragments permitting a repetitive evaluation of the chronological evolution in expression of tumoral biomarkers. previously, the role of fnac has been challenged by results obtained with cnb that seems more robust than fnac. in general, nevertheless, cnb carries disadvantage in terms of a long tissue processing time and patient discomfort such as pain (1.7% to 3.7%), hematoma (0.72%), and very rarely pneumothorax [6, 7]. fnac includes more advantages than cnb such as minimal invasiveness and minimal discomfort (more painless) that could be interesting for aged or frailty patients with comorbidities. in palpable lesions, fnac could perform repetitively and is a serious candidate for the chronological followup of neoadjuvant chemotherapy response. an important quality of fnac is its ability to give rapid diagnostic information equivalent to that of frozen sections. in our experience, the result of rapid fnac prior to cnb improves the quality of cnb and gives an immediate diagnosis decreasing anxiety of patient. other indications of fnac are staging of multiple tumors or suspicious zones and apparition of a new suspicious lesion during neoadjuvant chemotherapy. finally, fnac could be an excellent alternative when radiographic screening of breast is not available. table 1 compares the main advantages and disadvantages of fnac versus cnb. other clinical fnac indications. palpable breast lesion.rapid diagnosis to decrease anxiety of patient. patient with morbidity (senile, cardiac, diabetic etc.).clinical staging: multiple lesions, suspicious lymph node, and so on. apparition of new lesion in patient treated for breast cancer.evaluation of biomarkers.evaluation of biomarker changes following time or metastasis. when cnb technique is not available. evaluation of biomarker changes following time or metastasis. when cnb technique is not available. it is well known that the combination of clinical evaluation, mammography, and fnac, called triple diagnosis, gives a precise diagnosis [10, 11]. yu et al. recently demonstrated in meta-analysis of 46 studies that fnac had a sensitivity of 92.7% and a specificity of 94.8% except the unsatisfactory samples. the roc curve showed an excellent area under the curve of 0.986, presenting a high level of accuracy. on the other hand, if the fnac result was negative, the probability of breast cancer is approximately 8%. these authors concluded that fnac was an accurate material for evaluation on breast malignancy if rigorous criteria are used. also, they said that fnac may provide a favourable screening method and permit an improvement of treatment planning. therefore, when fnac is unsatisfactory, cnb is required to minimize the probability of a missed malignant diagnosis. in a study of fnac and immediate diagnosis performed in 408 palpable breast lesions, liew et al. in 2010 reached the same conclusions: 98.1% sensitivity, 89.5% specificity, and 95.8% accuracy. in 508 cnb followed by jackman et al., the rate of false negative for all lesions was 4.4%, for microcalcifications alone 1.2%, and for tumoral mass 0.8%. these results of cnb are quasi-identical to those obtained with the satisfactory fnac. most of false negative fnac results of sampling error or discordance between clinical and histological observations [6, 14]. in a comparison between cnb and repeat fnac after an indeterminate diagnosis with fnac, kooistra et al. suggested that cnb should be performed after an indeterminate fnac to obtain a reliable preoperative diagnosis. other authors concluded that, although the fnac is easier to perform, this technique was not efficient for small and nonpalpable lesions or diagnosis of microcalcifications as those for in situ carcinoma. these comments are likely true because some preneoplastic lesions are associated with slight cell atypia. however, bilous emphasized that cnb shows also problems with similar lesions such as atypical proliferative lesions (atypical ductal hyperplasia, in situ lobular neoplasia, etc.), cellular fibroepithelial lesions, papillary tumors, mucinous carcinoma, radial scar, spindle cell lesions. moreover, fnac interpretation requires serious experience of the cytopathologist and they think that this is one of the main reasons that overall cnb is to be preferred. a recent japanese study of 5693 fnac and 7 different laboratories illustrated a great variability between the institutions suggesting likely difference between education of cytologists and the lack of clinical or radiological information (triple diagnosis). these last years a new cytological technique, called liquid-based cytology (lbc), has been developed and approved by the food and drug administration. briefly, lbc standardises the cell fixation, concentrates epithelial cells, and discards blood cells and/or cell debris that obscure the smear. the efficiency of lbc in the breast cytology has been demonstrated by numerous publications. the main advantage of lbc is surely to adjunct ancillary tests such as immunocytochemistry, flow cytometry, or molecular biology [1820]. compared the er and pr statuses from fnac (immunocytochemistry) and cnb (immunohistochemistry), both performed on surgical breast tumors. they found that both methods give similar results with a concordance between the 2 tests of 98% for er (with kappa correlation score=0.93) and 96% for pr (kappa=0.91).. demonstrated similar data in a comparative study between primary breast tumours and their metastasis. interestingly, the concordance between these both localisations was 81% for er, 65% for pr, and 71% for her2, suggesting a possibility of biological difference between primary tumors and their metastasis. other publications showed a long-time storage at 20c and 80c at least 6 months without significant loss of immunoreactivity of pr and ep from breast fnac. the cell block cytology is an attractive cytological method for ancillary techniques or long-time cell conservations and consists in putting cells of fnac directly in formol fixative fluid identically at a classical histology (figures 1 and 2: er, her2 and fish on cell block cytology). briefly, after centrifugation to concentrate cells, the pellet was embedded in a synthetic polymer gel that is then processed in paraffin block that could be cut at 4 m, as classical biopsy slides. with this technique, ferguson et al. found a concordance rate of 95% for er, 90% for pr, and 88% for her2. similar results were observed by shabaik et al. with high specificity (100% for both) and lower sensibility (85% and 80% resp. for er and pr). finally, in fnac, false negative er or pr immunostaining exists but false positive tests are very unlikely. false negative immunohistochemical results are also observed in cnb: in a retrospective study, seferina et al. calculated a rate of false negative of 26.5% and a rate of false positive of 63.8% for both er and pr. for her2, they showed 5.4% for false negative rate and 50% for false positive rate. nevertheless, in our experience, this discordance is often associated with the manipulation of cnb before the fixation (crush artefacts) or with a defect of fixation as desiccation. fortunately the concordance with molecular biology by hybridisation in situ using fish, cish, and sish is very good and can help when her2 is uncertain [6, 25, 27]. the fish is accurate for lbc cytology [22, 25, 28, 29]. the extraction of mrna or dna is also feasible from lbc and fnac, allowing all gene expression analyses [2932]. in our experience, the clinical staging and preoperative lymph node status are important for the evaluation of eligible patient to neoadjuvant therapy. in the axillary lymph node fnac, chang et al. fnac in lymph node is a cost effective and safe method, false positive is virtually non-existent, and false negative can occur when lymph node is partially involved such as by micrometastase, or isolated tumor cells. in our experience, we improve axillary lymph node fnac/lbc by immunocytochemistry using cytokeratin antibody. thus, axillary fnac plays a role in staging of advanced cases for systemic and neoadjuvant therapy and in evaluating candidates for sentinel lymph node surgical procedure or axillary lymph node dissection. despite the fact that cnb has been progressively replaced by fnac in the investigation of nonpalpable lesions or microcalcifications without a clinical or radiological mass lesion, fnac has yet a role in palpable lesions in the triple diagnosis association and performed by experienced cytologists. in these conditions, fnac is a safe, effective, economical, and accurate technique for breast cancer evaluation. recently, cytological methods using lbc technology, associated or not with the cellblock cytological technique, improve immunocytological and molecular tests with the same efficiency as classical histology. if the limits of its indications are well known, fnac still plays a role in the modern oncological practice.

despite the fact that cnb has been progressively replaced by fnac in the investigation of nonpalpable lesions or microcalcifications without a clinical or radiological mass lesion, fnac has yet a role in palpable lesions provided it is associated with the triple diagnosis and experienced cytologist. in these conditions, fnac is a safe, effective, economical, and accurate technique for breast cancer evaluation. numerous literature reviews and meta-analyses illustrated the advantages and disadvantages of both methods cnb and fnac. the difference does not seem significant when noninformative and unsatisfactory fnac was excluded. recently, cytological methods using liquid-based cytology (lbc) technology improve immunocytological and molecular tests with the same efficiency as classical immunohistochemistry. the indications of fnac were, for palpable lesions, relative contraindication of cnb (elderly or frailty), staging of multiple nodules in conjunction or not with cnb, staging of lymph node status, newly appearing lesion in patient under neoadjuvant treatment, decreasing of anxiety with a rapid diagnosis, evaluation of biomarkers and new biomarkers, and chronological evaluation of biomarker following the neoadjuvant therapy response.

PMC3725715

pubmed-375

understanding how and why vector-borne diseases like malaria remain a persistent problem despite being tools for diagnosis and treatment is essential for developing effective control measures for sub-saharan africa. temperature is one of the key climatic variables that determine the range of malaria transmission and hence global warming is likely to result in an increase in malaria prone areas especially where temperatures have generally been lower than the optimal range of 2527c for mosquito development. furthermore degradation of the environment and social and economic pressures due to population growth may boost the expansion of malaria prone areas. population migrations, drug and pesticide resistance, and deterioration of health service delivery systems will also influence the level of malaria transmission. the epidemiology of malaria is very complex, involving factors pertaining to the malaria parasites, the insect vectors, the human hosts, and the environment. an understanding of the link between malaria transmission, climatic variables, and other human related factors is therefore necessary for developing appropriate measures that will significantly reduce transmission and perhaps eliminate malaria in endemic areas. in most cases these human related risk factors the level of risk to human populations living in malaria endemic areas varies markedly across continents and also within countries and different areas within the same countries. several studies have shown that malaria vector distribution, transmission rates, and incidence can vary widely over short distances, between neighbouring villages and even within a single settlement, as a result of small area variations in risk factors [5, 6]. identification and understanding of this variation are important in the detection of high risk groups and for selective targeting of intervention. many studies have attempted to identify household and individual level factors associated with malaria. some of the factors studied include access to health facilities, type of housing that people live in, proximity of human settlements to vector breeding sites [1012], vector abundance, socioeconomic status, gender, occupation, residential mobility, travel, presence of domestic animals near homesteads, and use of preventive methods such as bed nets. information on how these factors interact to expose communities and individuals to malaria infections needs to be investigated systematically in each geographical setting, in conjunction with climate related factors. documented information about individual and household risk factors associated with malaria transmission is lacking in botswana. in order to address this paucity of information we assessed household and individual risk factors that may be contributing to malaria transmission in tubu village community in the okavango subdistrict in northern botswana. the study was conducted in the context of a larger project, botswana ecohealth project (bep), which is investigating the impacts of hydroclimate change on population health. apart from contributing towards the objectives of bep, the results of this study are relevant to an initiative by the ministry of health in botswana to eliminate malaria by year 2016. the study was conducted in tubu village on the banks of the thaoge river, one of the distributaries of the okavango delta. tubu village is located in the okavango subdistrict at an altitude of about 950 m above sea level and between latitude 1935s and longitude 2227e. according to the national central statistics office report of 2011 the area is subjected to annual flooding but the extent of flooding varies from year to year. the community practices flood recession farming locally known as molapo farming. they plough their fields along the banks of the river as the flood recedes and in some instances they plant crops taking advantage of a raised water table caused by flooding. community development and everyday governance issues pertaining to law and order in the area are conducted at a central place (locally known as the kgotla) within the village. tubu has a village development committee (vdc) established as a local government structure to guide development planning and implementation in the village. the village also has a primary school, a resident social worker, and a health post staffed with a nurse, nurse aid, and a health education assistant. gumare hospital, located 10 km east of the village, offers an array of general health services to the local community. the hospital also serves as the district health centre for critically ill patients referred from all district health posts including tubu. malaria cases in the okavango subdistrict have been fluctuating since 2005 with unconfirmed cases ranging between 4,686 in 2005 and 10,993 in 2006 and confirmed cases ranging between five (in 2012) and 791 (in 2006) (ministry of health annual report, 2012). the maximum number of deaths between 2005 and 2012 was 16, recorded in 2006. data from clinic records for the period of 2005 to 2010 indicated that 2009 had the highest with 131 unconfirmed cases and 2005 the lowest with 50 cases. however during the same period information on rapid diagnostic tests (rdts) was inconsistent and available only for years 2006, 2008, and 2010 with 9, 4, and 5 cases, respectively. pretesting of the questionnaire involved trained field research assistants with higher secondary education qualifications and field supervisors with degree qualifications who eventually administered the final questionnaire. the questionnaire had four thematic sections; first part focused on sociodemographic characteristics such as gender, age, marital status, education level, farming practice, household income, ethnicity, respondent's relationship to household head, employment status, and occupation and the second part included aspects on how the community or individuals got exposed to mosquito bites due to late night activities, location of homesteads in relation to animal shelters and mosquito breeding sites, visits made to other areas outside tubu village in the last 8 months, and history of malaria episodes in the last 8 months. a short period of 8 months was chosen so as to minimise on-recall bias as the time frame included the previous malaria transmission season which fell between the months of october 2011 and june 2012. the third part of the questionnaire focused on malaria prevention methods being practiced and health delivery services for the study area. the last part involved general observations made at each homestead during the interview with regard to house structure and use, type of eaves, and vegetation cover surrounding the homesteads. to ensure accuracy and good quality data, pretesting of questionnaires was carried out two weeks prior to the actual data collection exercise in etsha 1, a village with similar environmental and sociodemographic patterns to tubu village. following the pretest survey the questionnaire was revised, on the basis of responses given, for improvement of clarity and addition of essential questions that had been omitted in the original questionnaire. vague questions in the original questionnaire were either omitted from the final questionnaire or improved. the pretest exercise was also used to standardize the manner in which the interviewers would conduct the interviews and to ensure that they had a common understanding of each question. from the household listing compiled for the bep project the target sample size, as determined by raosoft inc. however, due to the fact that tubu is a relatively small village a census survey was done consisting of individuals representing all the 71 households. the questionnaire was administered at the household level to any person who is 18 years and above with preference being given to the heads of the household if they were present. only one person per household was interviewed. during the interviews the respondents answered some of the questions pertaining to children and other members of the same household such as visits outside study area and possession and use of nets. numbers 1 to 4 were assigned to individuals from the community who had come to attend the pras for the major bep project. all individuals assigned a similar number were grouped together to participate in the malaria risk survey. pra technique, using the closed scoring/ranking approach, was used to cross-check on some of the responses from the questionnaire interviews. the maximum number of individuals at any one given time during the pra discussions was 16, thus providing a total ranking capacity (n) of 160. the respondents were asked whether they had suffered from malaria within the past 8 months (the period between october 2011 and june 2012), which included the traditional peak malaria transmission season in botswana. mosquito sampling was conducted in houses, in pit traps, and in larval breeding sites located within the study area. adult mosquitoes were sampled from pyrethrum space spray knockdowns in 6 selected huts used as bedrooms and from 4 pit traps. the physiological conditions of the adult mosquitoes collected from indoors and pit traps were scored as non-blood-fed, blood-fed, half gravid, and full gravid. all adult mosquito specimens, from both adult and larval sampling, were identified to species level by the polymerase chain reaction (pcr) technique. a geographic positioning system instrument (gps) was used to determine straight line distances of study homesteads from the nearest mosquito breeding habitats. permission to carry out the study was obtained from the ministry of health, republic of botswana (permit number: ppme 13/18/1 vol. meetings with the community leadership and other interested community members were held to introduce the study, clearly explaining its objectives. on the day of the interview verbal consent respect for privacy was maintained during adult mosquito sampling in selected rooms used as bedrooms. participants were informed that they could refuse to participate in the study and not be prejudiced. respondents were assured that all the information captured on the data sheets would be treated with confidentiality and that no answers would be linked to individuals in the final analysis and presentation of findings. descriptive statistics were carried out to determine relative frequencies of all the survey variables. some of the variables had provisions for multiple responses. appropriate graphs and tables were generated to show differences in the relative frequencies of various variables. levels of association between various variables were determined by the pearson test and fisher's exact test in situations where the expected frequencies were less than five. where appropriate, p values and confidence intervals (ci) for odds ratios (or) are shown. the level of association between various factors and history of malaria was calculated based on the respondents ' views. the maximum number of people residing in a single homestead was 20 and the minimum was one. a total of 483 individuals resided in all the 71 study homesteads, thus giving an average household size of seven people. about two-thirds of the respondents had some years of schooling (table 1). the majority of households earned an income of less than us$63 per month (figure 1). only 7% of the respondents earned more than us$250 per month. eighty-one point seven percent (58) of the respondents resided within 1 km from the nearest health facility. eighteen-point three percent (13) resided 1 km to 2 km from the clinic. all the 71 respondents indicated that it took them less than an hour to get service at the clinic from the time they joined the queue. at the time of the study (june 2012) 53.5% (38) of the respondents said that they had suffered from malaria within the past 8 months whilst 46.5% (33) did not remember ever suffering from malaria in their entire life. forty-seven point nine percent (34) mentioned that at least one member of their family had suffered from malaria within the past 8 months. among family members who had suffered from malaria, 73.5% (25) were above five years old and 26.5% were below the age of five years. there was an association between household income and history of a malaria episode (table 2). almost all of those who had experienced a malaria attack were in the lowest bracket for household monthly income. in the whole village only two house roof types were observed. these were either of grass or iron sheet. a general observation noted that houses in the village were either grass thatched, built of reeds, pole, and mud or home-made bricks (referred to as traditional hut/house) or built of bricks and roofed with iron sheets (referred to as modern hut/house). among those structures used as bedrooms by the respondents, 52.1% (37) were traditional and 47.9% (34) were modern houses/huts. in traditional houses/huts large eave openings were observed in 89.2% (33) and the rest (10.8% (4)) had small eave openings. in modern houses 2.9% (1) had large eave openings and the rest (97.1% (33)) had virtually no eave openings. there was an association between history of malaria episode and use of traditional huts/houses as bedrooms (table 3). majority of individuals who experienced a malaria attack used traditional houses/huts as bedrooms. low vegetation cover surrounding homesteads was observed at 81.7% (58) of the homesteads. moderate vegetation cover was observed at 14.1% (10) of the homesteads whilst only 4.2% (3) of the homesteads were surrounded by dense vegetation cover. individual contact with mosquito bites was categorized into always, sometimes, often, and rarely. out of 98.6% (70) who experienced mosquito bites, 54.9% (39) mentioned that they seven percent (5) and 8.5% (6) often and rarely got bitten by mosquitoes, respectively. no association was found between house eave size and getting bitten by mosquitoes and between house eave size and frequency of bites (table 2). out of the 70 individuals who experienced mosquito bites 84.5% (60) indicated that they received the bites in the evening. the rest got mosquito bites during daytime (1.4% (1)), after dawn (1.4% (1)), or throughout the day (1.4% (1)). no association was found between house eave size and time of mosquito bites (table 2). about 93% (66) of respondents reported that they opened doors in the morning whilst 7% (5) during the day. ninety-seven point two percent (69) reported that they closed doors in the evening whilst only 1.4% (1) indicated that they closed doors after dawn and 1.4% (1) before dusk. eighty-eight point seven percent (63) mentioned that they were involved in late outdoor activities that included social gatherings (28.2% (20)), relaxing outdoors (74.6% (53)), preparing meals (50.7% (36)), and doing other things (8.5% (6)). a strong relationship was established between late outdoor activities and history of malaria episode (table 3). most of the outdoor activities were said to be done between 2000 hrs and 2200 hrs by 63.4% (45) of the respondents. a borderline association between the period spent outdoors and history of malaria episodes was established (table 2). ninety-three percent (93% (66) (of the respondents mentioned that they prepared meals outdoors using firewood. only 2.8% (2) said they used gas for cooking and the remainder (4.2% (3)) used both gas and firewood. eighty-five point nine percent (61) of the respondents mentioned that they were fulltime farmers. among them 60.7% (37) had field structures erected on the farm and these were in the form of mud houses (28.2% (20)), brick houses (2.8% (2)), or other form of materials (21.1% (15)) such as the grass-made temporary shelters locally known as the mathibelo. there was no evidence of association between history of malaria episode and being a full time farmer (table 2). seventy-six point one percent (54) of the respondents indicated that they had other residential homesteads elsewhere outside tubu village. seventy-three point two percent (52) had other homesteads in gumare village, 1.4% (1) in the cattle post areas, and another 1.4% (1) in shakawe village, about 150 km from tubu village. it is defined as an area designated solely for keeping domestic animals, mainly cattle, goats, and a few donkeys and horses. cattle posts are usually located away from defined residential areas. majority (69.1% (49)) of respondents fifty-nine point two percent (42) of respondents mentioned that they had travelled outside tubu village in the last 8 months. ninety-five point two percent (40) of them had travelled to malaria endemic areas in the north of the village whilst 4.8% (2) had travelled to non-malaria-endemic areas. there was a significant association between travel outside tubu village and history of malaria disease (table 3). twenty-six point eight percent (19) of respondents mentioned that 8 months prior to the date of the interview they had received visitors who stayed overnight. they reported that 94.7% (18) of the visitors were coming from malaria endemic areas. ninety-four point four percent (67) of the respondents indicated that they owned mosquito nets (insecticide treated or untreated mosquito nets). more than half of the respondents who possessed mosquito nets had not experienced any malaria attack indicating an association between previous malaria episode and possession of mosquito nets (table 3). number of nets per household were reported to range from zero (2.8% (2)) to more than six (5.6% (4)), with 39.4% (28) possessing one or two nets, 33.8% (24) possessing three or four nets, and 18.3% (13) possessing five or six nets. however, there was no association between history of malaria attack and the number of mosquito nets owned by a household (table 2). insecticide treated mosquito nets (itns) were possessed by 78.9% (56) of the responses whilst 50.7% (36) also possessed untreated mosquito nets. it was not unusual to find some households with a mixture of insecticide treated and untreated mosquito nets at the same time. two point eight percent (2) of the respondents were not sure of the status (treated or not treated) of their mosquito nets indicating poor knowledge on mosquito nets. ninety-one point five percent (65) of the respondents indicated that they always used mosquito nets. only 1.4% (1) mentioned that they used mosquito nets more often whilst 5.6% (4) sometimes used them and 1.4% (1) never used mosquito nets. usage of mosquito nets, among those who always used them, was reported to be relatively high (46.2% (30)) during summer and very low (3.1% (2)) in winter. most of the respondents were aware of government's efforts to control malaria through indoor residual spraying (irs) (97.2% (69)) and distribution of itns [97.2% (69)]. only 2.8% (2) of the respondents were not aware of what the government did to control malaria in tubu village. twenty nine respondents got their mosquito nets from the town council (figure 2). other respondents acquired their mosquito nets from the shops (14), both shops and town council (14), both clinic and council (5), clinic (4), and both clinic and shops (3). other personal malaria prevention methods reported as commonly practiced by the community included taking antimalarial drugs (1.4% (1)), clearing of surrounding vegetation (12.7% (9)), avoiding stagnant water (12.7% (9)), wearing long sleeved clothes (2.8% (2)), and use of aerosols (2.8% (2)) and repellents [8.5% (6)]. a total of 13 individuals (4 males and 9 females) participated in the pra discussions. during the discussions this shortage resulted in some household members using emptied maize meal bags to construct mosquito nets. however these self-made nets had disadvantages in that they did not kill mosquitoes since they were not treated with an insecticide. furthermore they were deemed uncomfortable as they tended to retain heat and could not fit well around modern beds. in winter (june-july), most households did not use the nets so often since mosquitoes were not a major problem during that time. the group was satisfied with the spraying exercise but expressed concern regarding coverage of areas inaccessible to the spraying teams due to flooding and also the fact that some households refused to have their homes sprayed claiming that the insecticide caused allergic reactions. mosquitoes were obtained from larval breeding (22) and adult sampling (64). using the pcr species identification technique all the 86 specimens in addition other nonvector mosquitoes, namely, two an, demeilloni and one an. apart from anopheles species, more than 200 culicine mosquitoes were also caught resting either indoors or outdoors and breeding in the sites where the vector mosquitoes were found. forty-eight point four percent (31/64) of the anopheles arabiensis mosquitoes caught resting indoors in selected huts were blood-fed and at different stages of their gonotrophic cycle. mosquitoes were also observed resting outdoors in animal burrow pits located within the village and close to breeding sites. these included vegetated areas at periphery of water bodies, animal hoof prints, open sunlit puddles created by receding floods, and man-made temporary puddles within farming fields. six homesteads were located within 100 m from mosquito breeding habitats, 17 were between 100 m and 500 m, 38 were between 500 m and 1000 m, and 10 were between 1000 m and 3000 m (figure 3). previous malaria episode was significantly associated with distance from water bodies (table 2). majority of our study population earned income far less than the botswana national poverty datum line pegged at us$81.94 (bwp611.30) by the ministry of finance and development planning as of 22 april 2013. this is consistent with the country statistics that show that about 44.8% of rural people (30.6% in towns) in botswana are classified as poor. such communities have been found to be at greater risk of malaria disease because they are poorer and face higher transmission rates than their urban counterparts. malaria parasiteamia was associated with a reduced household socioeconomic status in a rural area in tanzania. social and economic factors aggravate the contribution of climate related factors in influencing the malaria burden. for many social and economic reasons the community in tubu village according to the world health organisation such sedentary communities living in malaria prone areas and who can not afford to move out of flood-affected areas due to low economic status have an increased chance of acquiring infection. this is particularly true for children, pregnant women, and older people, who form the high risk groups. other important factors that contributed to individual exposure to mosquito bites were the limited use of personal protection methods such as taking antimalaria tablets and use of aerosols and repellents. cost of these prevention tools may have been the limiting factor especially in a community regarded as leaving below the national poverty datum line. similar observations were made in nouma, burkina faso, where the use of aerosols was not a popular method perhaps because of the costs associated with such measures. minimum use of these simple measures not only affect individual exposure to mosquito bites but is also an indicator of very low socioeconomic status, which in itself has been proposed as an important factor associated with malaria. residential house status or structure has some implications in malaria transmission as poorly constructed houses expose individuals to mosquitoes that may find the dwelling more comfortable as a resting place. traditional huts/houses with large eave gaps present in tubu village played a role in allowing free movement in and out of the huts/houses and providing suitable shelter for mosquitoes that eventually attacked the bedroom occupants. previous studies have shown that traditional grass thatched houses with open eaves and lacking ceilings provided more favourable resting places for mosquitoes and put the occupants at risk of contracting malaria than houses with closed eaves, iron corrugated/asbestos covered roofs, and having ceilings. nevertheless, in poorly constructed houses where cooking and sleeping take place in the same room, smoke could repel mosquitoes through the eaves at the time that cooking is taking place [9, 25]. however the community in tubu village did not benefit from the protective effects of smoke since most of the respondents prepared their meals outdoors. our findings indicated that the community was equally exposed to mosquito bites anytime of the night regardless of the size of eaves. therefore closing doors early in the evening did not provide any protection since mosquitoes could still freely enter the dwellings through the eaves as was evident from the anopheles and culicinemosquitoes caught resting indoors. arabiensis mosquitoes in the village verified that the community was at risk of being bitten by an infected vector mosquito. the fact that some study participants spent time in other homesteads away from tubu village did not make any difference since the structure of the dwellings there was the same and most of the alternative homesteads were in the same geographical area with similar climatic and environmental characteristics. most of the respondents who reported history of malaria attack also reported that they spent much of their night time outdoors during the peak biting period and therefore could have picked the infection during that period when they are not yet sleeping under a mosquito net. arabiensis could also expose individuals in the community who may not necessarily be involved in late outdoor activities. arabiensis has been shown to have early biting activities, which peak between 1900 hrs and 2000 hrs, with over 70% of biting activity occurring before 2200 hrs. the documented peak biting period coincided very well with the time that most of the individuals in tubu village would be involved in late outdoor activities since the vector mosquito is also known to bite humans both outdoors and indoors. arabiensis is an opportunistic species that feeds preferentially on humans in many parts of africa but can be diverted to domestic animals as their density increases. in tubu village the presence and number of livestock near or within 3000 m from the homesteads could have some influence on the degree of malaria transmission at community and household levels. it is most likely that the risk of getting mosquito bites could have been reduced due to zooprophylaxis especially in situations where the species predominantly displays zoophagic foraging tendencies. however, the benefit of keeping livestock close to human dwellings has been refuted by many authors from studies conducted in the gambia and the ethiopian highlands. it is clear that the association between the presence of livestock as a risk factor and malaria transmission is a complex issue that needs further investigations in botswana, where the ratio of cattle to humans is very high. more than half of the respondents had travelled outside tubu village in the last 8 months, to other more intense malaria endemic areas. although active screening for malaria parasites was not done among the respondents, the responses to questions crafted to determine malaria risk implications of travel outside the study area indicated that travel to more intense malaria transmission areas exposed individuals to malaria. reported visitors from malaria endemic areas could also have played an important role in importing malaria parasites to the village. in a study conducted in urban kisumu, kenya, children who reported spending at least one night per month in a rural area endemic to malaria were found to be at risk of contracting infections, indicating that exposure during rural travel was an important element of risk. the risks of acquiring malaria through travel were also observed in an urban area situated in the largest port of the pacific coast in columbia. insecticide treated nets (itns) have become quite significant as the most practical method of mosquito control by protecting at-risk individuals from mosquito bites and hence malaria infections. in this study participation of different organisations such as the council, clinic (ministry of health), and shops in supplying mosquito nets and the promotion done by the government could have resulted in overwhelming possession and use of mosquito nets by the community. similar findings were reported in nouma, burkina faso, and also in an urban area of burkina faso where it was attributed to regional promotion. reported mosquito net use in tubu village was very high regardless of whether it is treated or not. the use of untreated mosquito nets has also been found to have some protective measures against mosquito bites [19, 33]. in burkina faso mosquito net use was relatively more frequent in summer than winter, thereby conferring protection from mosquito bites during the peak malaria transmission period [22, 32]. for an average family size of 6.8, with some homesteads possessing as many as 6 nets, it is most likely that each individual in the community had the opportunity to use a mosquito net. however, actual mosquito net use was not investigated and overreporting by the respondents was possible since ownership does not necessarily translate to actual use. innovativeness by the community in mosquito net making using waste maize-meal sacks has also been reported by the doane college which implemented the doane nets project in kenya whereby recycled plastic bags were converted into mosquito nets. since the quality of material used to make maize-bag mosquito nets was of major concern there is need for the ministry of health to promote the initiative and provide the community with the proper netting material for making more comfortable mosquito nets., it shows that the community was aware of the protection given by nets and willing to contribute towards this initiative, thereby rendering the nets intervention more sustainable and not just waiting for handouts. irs, in addition to itns, is a mainstay of all national malaria control programmes in southern africa. irs is based on the assumption that mosquitoes feed and rest indoors, thereby coming in contact with the sprayed surfaces. mosquito survey conducted in tubu village showed that almost half of the vector mosquitoes caught resting indoors were blood-fed, an indication that the community was at risk of potentially infective mosquito bites. therefore, more should be done in terms of indoor residual spraying, to deter mosquitoes from seeking indoor shelter. in addition the ministry of health should devise strategies to cover those high risk areas for malaria transmission that are considered inaccessible due to flooding. although blood-meal analysis was not done, there is a high likelihood that some of the malaria vector mosquitoes might have fed from human beings, thus making the community vulnerable to potentially infective mosquitoes. this facilitated prompt treatment of malaria and other diseases. from similar observations made in ghana it was suggested that in such situations a higher health education standard could have an additional effect in reducing malaria disease. most of the homesteads were surrounded by low vegetation cover not ideal as resting places for mosquitoes. in general, the area does not support thick vegetation and probably this resulted in daytime resting mosquitoes taking shelter in animal burrow pits. incidentally, during the pra discussions, the community lamented increased activities of pests such as squirrels and porcupine which create burrow pits that have become convenient resting places for mosquitoes. the location of homesteads relative to mosquito breeding habitats was one of the major risk factors for malaria transmission. arabiensis infested water bodies, a distance considered to be within the general flight range of most mosquito species. such closeness of homesteads from breeding sites, in addition to the presence of animal burrow pits within the village, made the human population vulnerable to mosquito bites. year-round sampling through the major bep project established that larval breeding in tubu village took place throughout the year in a variety of habitats created interchangeably by either rainfall or floods (bep fifth report, 2012), thus exposing the community to year-round mosquito bites. the presence of culicine mosquitoes breeding in the same habitats exacerbated the problem of mosquito biting, though the species were of no medical importance in botswana. abundance of larvae and larval habitats and proximity of humans to larval habitats have been found to correlate very well with vector mosquito biting rates. close proximity of homesteads to vector mosquito breeding sites increased the risk of malaria in many countries including uganda and ethiopia. the ministry of health changed its policy on malaria case management and recording in botswana. as from october 2010 to date all suspected malaria cases are not handled at any clinic, tubu included, but promptly referred to gumare district hospital. all recordings are done at central/district hospital. retrieving information from the district attendance register of patients originating from tubu village was not possible because cases were pooled together onto one district register, with other patients presenting with other diseases. furthermore the outcome on malaria patients referred to gumare district hospital is never conveyed back to the clinic of origin. as a result of these anomalies, there is a possibility of both over- or underreporting of malaria episodes by the respondents. however a previous study among the same community/individuals showed that the community was well aware of the disease (95.6%) in terms of signs and symptoms (88.7%) and prevention measures (98.6%) and 100% of the respondents who had suspected a malaria attack sought medical treatment at the clinic. because of the small sample and population sizes of the study area, the results can only be extrapolated to other villages with similar demographic, ecological, and environmental characteristics and can not be generalized to all malaria prone villages in botswana. similar case studies in different malaria prone settings in botswana should be undertaken for comparative purposes. in conclusion, socioeconomic status, exposure to mosquito bites through individual nocturnal outdoor activities, and mobility of the community were identified as high risk factors for malaria transmission in tubu village. limited use of malaria protective measures such as insecticide treated nets, house structure (traditional or modern), and close location of homesteads in relation to breeding sites exposed individuals to mosquito bites. however the number of mosquito nets possessed in each household and the farming status were not considered as risk factors for malaria. hut/house eaves used as bedrooms by the respondents did not have any influence on the level, time, and frequency of mosquito bites. the overwhelming use of mosquito nets treated, untreated, or home-made proved to be a viable tool for malaria control in the village. satisfactory service provided at and the close proximity of the health facility were added advantages to the community. furthermore the community benefited from the low vegetation cover surrounding their homesteads, which did not provide enough shelter for even nuisance mosquitoes. it is recommended that the ministry of health should develop a health education package encompassing some of the risk factors identified in this study and other indicated similar studies to be conducted in different settings. from our findings the most important issues to be addressed through the health education package include behavioural changes during nocturnal outdoor activities, ways of protecting oneself during visits to other malaria endemic areas, advice on the ideal location of homesteads in relation to mosquito sources, and promoting the use of insecticide treated eave curtains. ways of promoting household based control methods, based on these specific risk factors, should be devised. the ministry of health should support community initiatives in mosquito net making, in addition to strengthening irs activities in inaccessible flood prone areas of the delta. future research should comprehensively look at the role of other potential risk factors, such as zooprophylaxis and firewood smoke, in malaria transmission and on the possibility of incorporating the benefits derived, if any, into community based malaria control initiatives.

this study investigated potential risk factors associated with malaria transmission in tubu village, okavango subdistrict, a malaria endemic area in northern botswana. data was derived from a census questionnaire survey, participatory rural appraisal workshop, field observations, and mosquito surveys. history of malaria episodes was associated with several factors: household income (p<0.05), late outdoor activities (or=7.016; ci=1.78627.559), time spent outdoors (p=0.051), travel outside study area (or=2.70; ci=1.0047.260), nonpossession of insecticide treated nets (or=0.892; ci=0.7970.998), hut/house structure (or=11.781; ci=3.86835.885), and homestead location from water bodies (p<0.05). no associations were established between history of malaria episodes and the following factors: being a farmer (p>0.05) and number of nets possessed (p>0.05). eave size was not associated with mosquito bites (p>0.05), frequency of mosquito bites (p>0.05), and time of mosquito bites (p>0.05). possession of nets was very high (94.7%). close proximity of a health facility and low vegetation cover were added advantages. some of the identified risk factors are important for developing effective control and elimination strategies involving the community, with limited resources.

PMC3976786

pubmed-376

the prevalence of pancreatic cystic neoplasms (pcns) is around 2.5%.1,2 pancreatic cysts are increasingly discovered probably because of the ubiquitous presence of multi-detector computed tomography (ct) scans and their increased use to evaluate patients with abdominal complaints. endoscopic ultrasound (eus) plays a pivotal role in the evaluation of patients with pancreatic cysts but eus and cross-sectional imaging alone have proven to be inaccurate in identifying the exact nature of the cysts. there is inadequate information on the natural history of pancreatic cysts but our knowledge base can not be expanded without being able to determine the exact nature of the cyst noninvasively. toward this end, eus with fine needle aspiration (fna) along with cyst fluid analysis has been advocated to improve the utility of eus in the diagnosis of pancreatic cysts. size>3 cm and/or the presence of mural nodules appear to be the best indicators of malignant change in patients with the side branch form of intraductal papillary mucinous neoplasm (sb-ipmn) and mucinous cystic neoplasms (mcn).3 eus with cyst fluid aspiration and/or fna can play a role in differentiating pcns. this paper will review the role of eus-fna in the evaluation of pcns. if the cysts are incidental (the patient has no symptoms referable to the pancreas), the great majority are determined to be neoplastic.4 in one study, the majority of incidentally detected pancreatic cysts (58%) were mucinous and therefore had some malignant potential.4 these data suggest that all incidentally found pancreatic cysts should undergo further evaluation. serous cyst adenomas consist of multiple " micro cysts " with thin septae coursing through the lesion. however, 20% have a dominant macrocystic or even solid component which can result in confusion with mucinous cysts.5,6 mcns are almost exclusively located in the tail of the pancreas and are either unilocular or have only a small number of discrete compartments. rarely they will have peripheral (eggshell) calcification which is highly predictive of cancer.7 mcn almost never communicate with the pancreatic ductal system. the cystic component of the side branch form of ipmn is essentially a dilated side branch(s) and by definition, is part of the pancreatic duct. magnetic resonance imaging (mri) is superior in imaging sb-ipmn by virtue of its ability to visualize the pancreatic ductal system. secretin stimulated mri/magnetic resonance cholangiopancreatography can be used to highlight the ductal anatomy8 and is commonly used in pancreatic centers but its superiority to non-secretin studies in the evaluation of ipmn has not been proven. identification of sb-ipmn with eus can be made by visualizing a dilated side branch(s) with connection to the main pancreatic duct. depending on the plane of imaging, they may appear as a chain of lakes-separate cysts that become confluent when scanning back and forth across the cyst. the primary problem with imaging alone in the evaluation of pancreatic cysts is that there are no clearly differentiating features that allow a high degree of diagnostic accuracy. studies have shown that imaging alone is inaccurate in differentiating each of the types of cystic neoplasms.9 in a recent study from the group at the academic medical center in amsterdam, the accuracy in identifying the nature of a pancreatic cyst using eus imaging alone was only 23% to 46% amongst a group of expert endosonographers.10 this study used 4 criteria to differentiate cysts: 1) septations, 2) mural nodules, 3) a solid component, and 4) communication with the pancreatic duct. as a result of these discouraging reports, eus-guided cyst aspiration and analysis along with cytology have been used to improve diagnostic accuracy; especially the differentiation between macrocystic serous cyst adenoma, sb-ipmn and mcn. difficulties in establishing an accurate diagnosis with imaging alone have prompted investigators to pursue adjunctive measures. the idea of using analysis of cyst aspirates to diagnose pcn dates back to 1991.11 the massachusetts general hospital surgical group is credited with advancing the clinical application of this concept12 and brugge13 then applied eus-fna techniques to obtain cyst fluid noninvasively. 1 to 2 ml of fluid is needed to perform carcinoembryonic antigen (cea) analysis. as a result, the cyst should be 1 to 2 cm in size to obtain sufficient fluid for cea analysis. recently, it has been possible to perform cea on as little as 500 l of fluid (redpath integrated pathology, pittsburgh, pa, usa). because the fluid may be quite viscous, a 19 or 22 gauge needle is preferred. intravenous antibiotics are recommended during the procedure with oral antibiotics given for 3 to 5 days afterwards. it is recommended that the fluid be sent for cea, amylase and/or lipase, and cytology. the rationale for analyzing for amylase or lipase is to aid in determining if there is ductal communication. the cooperative pancreatic cyst study group then reported that cyst fluid analysis for cea was the best test to differentiate a mucinous from a nonmucinous cyst.14 however, the sensitivity and specificity for cea is 73% and 84%, respectively, and 25% of mucinous cysts will have a cea level less than 192 ng/ml.14 it may be possible to improve the analysis of cyst fluid by combining cea and molecular analysis (dna quantity, k-ras mutations and allelic imbalance mutations). sawhney et al.15 reported a 100% sensitivity of discrimination between mucinous and nonmucinous cysts using a combination of cea and molecular analysis. it has also been reported that combining an extracellular mucin stain with cea analysis can provide an accurate discrimination between mucinous and nonmucinous cyst.16 problems with eus-guided cyst aspiration were delineated in a paper by de jong.17 one hundred forty-three consecutive patients with indeterminate pancreatic cysts underwent eus-guided cyst aspiration and the fluid was sent for cea, ca19-9, amylase and cytology. only 90% could be punctured (cyst in inaccessible location or too small). of the remaining 128 patients, only 31% had adequate cellularity for analysis and there was sufficient fluid for cea in only 68 (49%). fluid specimens from pancreatic cysts seldom yield cells because few viable cells are shed from the lining. the lining epithelium can be patchy which also contributes to the difficulty in obtaining adequate samples. the lining of serous cyst adenomas is a glycogen-rich cuboidal epithelium whereas mucinous cysts have a mucin containing columnar epithelium (mcn is differentiated from ipmn by having ovariantype stroma). a cytology brush within a 19 gauge needle has been developed in an attempt to improve cytologic yield during eus-guided cyst aspiration (echobrush; cook endoscopy, winston-salem, nc, usa). the needle is passed into the cyst and then the brush is advanced against the inner wall of the cyst. the 1st report of using the cytology brush for pancreatic cyst cytology came from al-haddad et al.18 they studied 10 patients with pancreatic cysts and compared the cellular yield for standard fna compared to brush cytology of the cyst wall. in 7 of 10 patients, the cellular yield and detection of diagnostic cells was superior for the echobrush. sendino et al.19 reported results in 30 patients with pancreatic cysts evaluated with the echobrush (cook endoscopy). in 8/30 patients (27%) however, the brush cytology provided a specific diagnosis in 20/22 (91%) patients in which the technique succeeded. the brush technique was superior to fluid aspiration (73% vs. 36%; p=0.08). three patients experienced complications (10%): 1 self limited pancreatitis, 1 self limited bleed, and 1 retroperitoneal bleed resulting in patient death at 30 days. a recent report presents better results in obtaining cytology by performing cyst wall puncture (cwp).20 the technique reported was to advance a 22 gauge needle into the cyst and aspirate all the fluid contents. then, without withdrawing the needle, the needle tip is moved back and forth across the residual hypoechoic cyst wall. if the cyst wall was not visualized, the needle was moved 2 to 3 mm from the needle tip location where the aspiration was completed. using this technique, the authors reported obtaining material adequate for cytologic assessment in 81% of cysts (60/66). thirty percent of cysts with cea<192 ng/ml were proven to be mucinous by cytology. in 67% of cases where the cyst fluid volume was insufficient for cea analysis, cytology demonstrated mucinous epithelium the complication rate was 1.45% (1 episode of pancreatitis which was graded as mild and self-limited). an alternative or adjunct to cyst wall cytology might be to directly examine the cyst wall. there have been recent reports of using a small confocal microscopy probe (mauna kea technologies, paris, france). the cellvizio system is a probe based confocal microscopy system and a very small probe has been developed which can be passed down a 19 gauge needle. like any other optical biopsy system, konda et al.21 reported use of this technology on 18 patients; 12 of whom had pancreatic cysts. imaging succeeded in 17/18 patients and in 10/17, the images were considered to be high quality. future studies will need to address safety issues and determine if a specific diagnosis can be made easily and safely. there have also been reports using the optical catheter used in the spyglass system (boston scientific, natick, ma, usa) to directly visualize the cyst lining. direct visualization of both cysts revealed smooth lining and biopsies revealed a mucinous cystadenoma in both cases. there were no immediate complications in either case but one developed severe pancreatitis 1 month after the procedure. identification of masses or nodules emanating from the cyst wall can indicate the presence of cancer or high grade dysplasia.3 however, it is important to make a differentiation between a mural nodule and an aggregate of mucin. this distinction was studied by zhong et al.23 who reviewed pathology, eus and ct examinations from 57 patients who had undergone surgical resection of mucinous cysts. cancer or high grade dysplasia was found in 23% of cysts with mural nodules verses 3% without nodules (p=0.02). mucin balls accounted for 65% of the intracystic lesions detected by eus and were characterized by being round, having smooth edges and being anechoic in the center with an echogenic rim. eus had sensitivity of 75% for the detection of mural nodules compared to 24% for ct. aspiration of cyst contents is indicated if identification of the cyst can not be made with imaging alone. however, if there is an associated mass or mural nodule, then the mass itself should be targeted for cytologic examination. while mucinous cysts are the most common indication, cystic degeneration of neuroendocrine tumors and adenocarcinoma as well as solid pseudopapillary neoplasm and acinar-cell cystadenocarcinoma represent cystic neoplasms of the pancreas that present with a solid component. in these cases any of the 3 gauges of needles (25, 22, or 19) could be used. in the instance of a mass multiple punctures into a cyst is the main risk factor for infection. in the case of a mural nodule, it is best if the cyst fluid can be removed 1st leaving a solid mass to target. our practice is to combine fluid aspiration (performed 1st) and then the needle is re-directed to the mass. we prefer to have the 1st pass stained and interpreted before considering a 2nd pass to minimize the number of passes needed to establish the diagnosis and decrease the rate of complications. there has been concern in performing eus-fna of a cyst in the body or tail of the pancreas if malignant transformation is suspected. our japanese colleagues have been most vocal in expressing concerns about the potential of needle tract seeding of cancer cells.24,25 a resectable cystic mass in the body of the pancreas should be considered for surgical resection without fna in most circumstances. pancreatic cysts are being increasingly recognized and when detected incidentally, they are likely neoplastic and should undergo further evaluation which should include eus. the cyst fluid should be sent for cea, amylase and cytology. in the future, safe techniques should be developed to improve the cytologic yield because it appears that the exact nature of the lining in mucinous cysts is predictive of their malignant potential.26,27

incidental pancreatic cysts are being increasingly recognized recently with incremented concern about health and frequent health check-up. endoscopic ultrasound (eus) has emerged as the principal modality for imaging pancreas for various pancreatic diseases including pancreatic cyst. but imaging alone can not accurately identify the exact nature of the pancreatic cyst. eus-guided fine needle aspiration is a useful adjunctive procedure to differentiate pancreatic cystic lesions. cystic fluid analysis with cytologic evaluation is important to diagnose etiology of pancreatic cystic lesions, helping the clinician to more accurately assess the presence or potential for malignancy.

PMC3401615

pubmed-377

since the framingham heart study first reported risk factors for atherosclerotic cardiovascular disease, numerous efforts have aimed at improving risk assessment in the asymptomatic population. over time, these efforts have resulted in the introduction of framingham risk score (frs) and other biomarkers including the use of noninvasive imaging modalities such as coronary calcium scoring with ct scan and carotid imt and plaque measurement. while these methods have shown prognostic values independent of risk factors, mainstream medicine is still relying on the frs, which tends to be inaccurate for individualized risk assessment and fails to assess the current status of vascular health. moreover, frs and risk factor-based scoring systems are neither designed nor used to monitor response to therapeutic interventions. a comprehensive cardiovascular risk assessment requires measurement of risk factors as well as structural and functional markers of the arterial system. for the widespread acceptance and clinical adoption of a new test, it must be (1) incrementally predictive over risk factors, (2) responsive to therapy, (3) operator-independent and reproducible, (4) low-cost and widely accessible in primary care settings, and (5) posing no significant side effects. in recent years, endothelial function measurement has emerged as a reasonable candidate that could fit the above criteria. barometer of cardiovascular risk, and endothelial dysfunction is the gateway to atherosclerotic cardiovascular diseases [3, 4]. over the past 20 years, a number of noninvasive methods of assessing peripheral endothelial function have been introduced, including ultrasound imaging of brachial flow-mediated dilatation (fmd), fingertip arterial tonometry, fingertip photoplethysmography, and laser doppler flowmetry [512]. a new technique named digital thermal monitoring (dtm) has been developed to evaluate endothelial function by measuring vascular reactivity during a 5-minute arm-cuff reactive hyperemia test. dtm is the newest addition to the field and monitors fingertip temperature changes to measure vascular reactivity. dtm is a noninvasive, automated, and operator-independent test that can be performed both at physicians ' offices and in patients ' homes. we and other researchers have previously reported the relationships between dtm and cvd risk factors, coronary calcium score, myocardial perfusion defects, and coronary angiographic findings [1320]. therefore, the present study was conducted on a large registry of 6,084 patients from 18 different clinics to better characterize dtm index of vascular reactivity (vri) in relation to patients ' phenotypes. the methodology for measuring endothelial function and vascular reactivity using dtm has been previously described [2125]. all dtm tests were performed using a vendys 6000 portable system (endothelix, houston, tx), a pc-based system that fully automates the cuff reactive hyperemia protocol. the general test setup and a sample vendys test report blood pressure cuffs were placed on both of the subject's upper arms, and vendys skin temperature sensors were affixed to both of the subject's index fingers. the software-driven dtm test began with an automated measurement of blood pressure and heart rate obtained from the left arm cuff. following a 5-minute period of patient and temperature stabilization, a 5-minute cuff occlusion (cuff inflated to 30 mmhg above systolic bp) of the right arm fingertip temperature in the right hand decreased because of the absence of warm circulating blood. when the cuff was released after the 5-minute occlusion, hyperemic blood flow to the forearm and hand was restored, and this resulted in a temperature rebound in the fingertip that is directly related to the subject's hyperemic blood flow response, endothelial function, and vascular reactivity [21, 22]. using the recorded fingertip temperatures, the ambient temperature of the testing room, the observed slope of temperature decline, and a multivariate bioheat formula, the vendys software calculated and plotted a zero reactivity curve (zrc). the zrc served as an internal control and showed the expected temperature rebound curve, if zero vascular reactivity was present and the other variables remained the same. in other words, the zrc is the expected temperature curve, if no vasodilatation and subsequent reactive hyperemia had occurred. vascular reactivity index (vri) was determined by taking the maximum difference between the observed temperature rebound curve and the zrc during the reactive hyperemia period. vri ranged from 0.0 to 3.5 and was classified as being indicative of poor (0.0 to<1.0), intermediate (1.0 to<2.0), or good (2.0) vascular reactivity. the vendys dtm test registry includes age, sex, blood pressure, heart rate, vri, and fingertip temperature measurements recorded during dtm tests. this study includes a total of 6,084 patients from 18 clinics that volunteered to submit their data to the registry. the number of each type of medical practice is as follows: cardiology=9, general/family practice=4, antiaging=3, and internal medicine=2. vri scores in men and women were compared using unpaired student's t-test. comparisons of categorical data (e.g., proportion of subjects with good vri in men versus women) were performed using fisher's exact test. pairwise correlations were examined using pearson's correlation coefficient, and correlations between vri and multiple patient characteristics (i.e., age, sex, blood pressure, and heart rate) were evaluated using multiple linear regression analysis. p value<0.05 was considered significant. when performing statistical comparisons, tests with missing data cold finger flag was defined as the condition in which the right finger temperature at start of cuff occlusion (time 300 s) is 27c. temperatures<27c often resulted in technically poor results. sympathetic response flag was defined as the condition in which left finger temperature continuously declines (> 0.5c temperature drop over a 5-minute time period) after right arm-cuff occlusion. when evaluating vri, tests that exhibited cold finger flag in addition to monitoring temperature at the index finger of the right arm, we studied temperature changes at the index finger of the left (nonoccluded) arm and observed interesting signals that are currently under further investigations and not included in the results below. overall, the study population had the typical age and sex distribution seen in internal medicine and cardiology clinics., 54% men, 46% women, systolic blood pressure (sbp) 138 20 mmhg, diastolic blood pressure (dbp) 77 12 mmhg, and heart rate (hr) 70 13 bpm. the vri distribution with cumulative percentages overall, the vri values exhibited the appearance of a normal distribution, with the exception of a small clustering of vri values at or above zero. thirteen percent of vri tests were categorized as poor vascular reactivity (vri<1.0), 70% as intermediate (1.0 vri<2.0), and 17% as good (vri 2.0). vri was slightly higher in women than in men (1.56 0.58 versus 1.50 0.49; p=0.0001). the distribution of poor, intermediate, and good vri in men and women is shown in figure 2(b). the percentage of good vri was higher in women than in men (21% versus 13%; p<0.0001). in contrast, men were slightly less likely to have poor vri than women (12% versus 14%; p=0.03). vri was mildly and inversely correlated with age (r=0.21, p<0.01) as illustrated in figure 3. as shown in figure 4(a), poor vri (< 1.0) was most frequent in the oldest age group (> 70 yrs., 18%) compared with middle age (5070 yrs., 10%) and younger (< 50 yrs., 6% however, the distribution of poor, intermediate, and good vri values in this elderly age group (figure 4(b)) was similar to that of the overall study population (13% poor, 70% intermediate, and 17% good). vri was not significantly correlated with sbp, dbp, pulse pressure (pp), or heart rate. a trend was seen of higher vri scores in subjects with higher diastolic blood pressure (r=0.10; p=ns). however, none of the blood pressure variables were significantly correlated with vri. multiple regression models were built using vri as the dependent variable and age, sex, sbp, dbp, and hr as independent variables. as shown in table 2, age, sex, and diastolic blood pressure were significant but weak predictors of vri. this is the largest report to date on any fingertip-based measurement of vascular reactivity and endothelial function [7, 26]. our analyses showed that vri values derived from dtm followed a near-normal distribution and the reasonable distribution conformed to previously established cutoff values for categorizing vri scores as indicative of poor (0.0 to<1.0), intermediate (1.0 to<2.0), or good (2.0) vascular reactivity. vri was weakly and inversely correlated with age. however, as shown in figure 4(a), the frequency of poor vri was three times higher in>70 y versus<50 y. this finding was in line with the findings of framingham heart study reported by hamburg et al.. nonetheless, as reported by schnabel et al. in a community based study of 5,000 individuals, classical risk factors only accounted for 15.4% of fmd and 13.9% of pat variability. this clearly indicates that endothelial function provides a new angle into the status of vascular risk. the distribution of weak association between vri and age is in sharp contrast to other vascular tests, including coronary artery calcium, carotid intimal-media thickness, and arterial stiffness, that are strongly and positively associated with age and, therefore, require age specific cutoffs. although the highest prevalence of poor vri was found in patients older than 70 y, the distribution of vri values in this elderly population (figure 4(b)) clearly shows a sizable number of good and intermediate scores. these findings support the clinical utility of dtm as a test that can differentiate good vascular function from poor vascular function, regardless of patient's age. this is consistent with the sex differences of endothelial function measured by flow-mediated dilation in healthy adults. however, the magnitude of the sex difference for vri is not felt to be large enough to warrant establishing sex-specific cutoff values for good, intermediate, and poor vascular reactivity. we also observed a trend of higher vri values with higher diastolic bp but no association with systolic bp or pulse pressure. it is possible that the subjects with high bp would have been on multiple antihypertensive medications that could have increased their vri scores. the results of multivariable analyses showed that sbp and dbp were found to have minimal correlations with age. because blood pressure is known to correlate strongly with age in untreated population, bp-lowering medications may have played a significant role in modifying (leveling) the relationships in our study population. because our data set was limited by the unknown status of bp medication many investigators of peripheral vascular endothelial function refer to fmd as the method of choice and consider it to be a reference standard, but it has several physiological and technical issues, including operator-dependency, which may result in excessively high inter- and intraobserver variability, effect of the baseline diameter, low flow-mediated constriction, and reduced arterial wall compliance [3234]. the correlation between fmd and finger-based measurements has been less than strong [7, 26, 3538]. the weak or inconsistent correlations between fmd and the finger-based measurements have been explained by the notion that fmd mainly reflects macrovascular reactivity, whereas the finger-based measurements mostly reflect microvascular reactivity. currently, there is no evidence regarding superiority of macrovascular over microvascular reactivity. more studies are needed to evaluate the predictive value of each for risk assessment and monitoring response to therapies. previous studies showed a significant relationship between poor vri and high framingham risk score as well as high coronary calcium score [14, 18, 19]. moreover, one study found that individuals with both poor vri and high framingham risk score had the highest coronary calcium scores. although more work is needed to develop clear clinical guidelines to incorporate such physiologic measurements into patient care, there is no doubt that these physiologic data offer a new window to an individualized assessment. the fact is that risk factors are population-based factors and do not speak for individual's susceptibility to the risk factors, nor can they evaluate the current status or activity level of the disease. on the other hand, structural markers such as coronary calcium and carotid imt-plaque are good indicators of susceptibility to risk factors and show the effects of past exposure, but they do not show the current status or the activity level of the disease. in fact, calcification will not go away with treatments, making it not suitable for monitoring progression and regression. measurement of endothelial function and vascular reactivity provides an instant status of the vascular physiology. therefore, for a comprehensive assessment of vascular health, one must pay attention to risk factors, structural markers, and functional markers of the disease. although almost all cvd patients receive medications and other therapeutic interventions, not all respond to the treatments or respond similarly. identifying who responds well and who responds poorly is a major challenge and currently classified as residual risk. budoff et al. reported that vri was significantly higher in patients who received statins and aged garlic extract, compared with those who received statin alone, and that patients who showed a significant improvement in vri had less progression of coronary calcium. showed an independent and significant predictive value for endothelial function measurement in patients at high risk for cardiovascular events. similarly, rubinshtein et al. showed that poor fingertip-based vascular reactivity measurement with pat significantly predicted poor outcomes. together, these data clearly point to the clinical utility of endothelial function in primary and secondary prevention. a detailed comparison of fmd, pat, dtm, and other noninvasive cvd risk assessment methods is shown in table 3. the primary limitation was that the vendys registry data do not include information about patients ' clinical conditions or medication use. we also did not know when the dtm tests were performed in relation to each individual's medical history and use of medications that might have affected vascular reactivity. strengths of our study include a large sample size and a mixed population of males and females, geographically dispersed and from various outpatient clinics. the present study using the largest database of finger-based assessment of endothelial function shows that digital thermal monitoring of vascular reactivity provides meaningful and reproducible physiological variables. it also suggests independent roles for vri as new indices of vascular reactivity and endothelial function. it is essentially a combination of a blood pressure and a thermometer empowered by intelligent software that can be used both at clinics and at home. however, further studies are needed to incorporate these functional measurements into clinical practice guidelines for primary and secondary prevention.

background. endothelial function is viewed as a barometer of cardiovascular health and plays a central role in vascular reactivity. several studies showed digital thermal monitoring (dtm) as a simple noninvasive method to measure vascular reactivity that is correlated with atherosclerosis risk factors and coronary artery disease. objectives. to further evaluate the relations between patient characteristics and dtm indices in a large patient registry. methods. dtm measures were correlated with age, sex, heart rate, and systolic and diastolic blood pressure in 6084 patients from 18 clinics. results. dtm vascular reactivity index (vri) was normally distributed and inversely correlated with age (r=0.21, p<0.0001). thirteen percent of vri tests were categorized as poor vascular reactivity (vri<1.0), 70 percent as intermediate (1.0 vri<2.0), and 17 percent as good (vri 2.0). poor vri (< 1.0) was noted in 6% of<50 y, 10% of 5070 y, and 18% of 70 y. in multiple linear regression analyses, age, sex, and diastolic blood pressure were significant but weak predictors of vri. conclusions. as the largest database of finger-based vascular reactivity measurement, this report adds to prior findings that vri is a meaningful physiological marker and reflects a high level of residual risk found in patients currently under care.

PMC5088311

pubmed-378

a sandwich or laminate technique is one of the methods proposed for composite resin restorations, which was introduced for the first time by mclean, et al. in 1985. the basic idea behind this technique is to use two different restorative materials for a single restorative procedure so that the maximum physico-mechanical and esthetic properties of these two materials can be exploited simultaneously. generally, the first component is a layer of conventional or resin-modified glass-ionomer cement which has drawn attention due to its capacity to form an inherent bond with tooth structures and the resultant better seal and decrease in microleakage (particularly in dentinal walls); it can also release fluoride and decrease the odds of carious lesions. the second component is a layer of composite materials (including composite resin, compomer, and ormocer), which is used to compensate for the limitations and disadvantages of glass-ionomer cements, including weak mechanical properties and inappropriate esthetic appearance. it has been reported that the combination of these two materials have different property results in the clinical success of restorations. the success of the laminate technique depends on the strength of the bond between the glass-ionomer and the resin composite materials in addition to the strength of the bond between the glass-ionomer cement and dentin. however, there is a relatively weak bond strength between conventional glass-ionomers and composite resin materials, mainly because of the lack of a chemical bond between these two materials and the low cohesive strength of glass-ionomer.[35] several studies have evaluated different surface preparation techniques for glass-ionomers, such as the use of different bonding systems and surface etching procedures in order to increase the bond strength between these two materials in the laminate technique. etching the surface with phosphoric acid has yielded different results. in a study carried out by sheth, et al. etching the surface of glass-ionomer had no effect on bond strength increase; however, an increase in bond strength after acid etching has been reported in another study. it has also been reported that premature etching of glass-ionomer cement (before its initial setting reaction) and failure to use an adhesive resin between the glass-ionomer cement and composite resin increases the odds of restoration failure. in another study, it was demonstrated that the use of a self-etch adhesive system on half-set glass-ionomer cement (before its initial setting) increases the bond strength between the glass-ionomer cement and composite resin more than that observed with the use of total-etch systems (its application after the initial setting of the cement). it has also been reported that the use of a glass-ionomer-based adhesive system applied after the cement's initial setting improves the bond strength between the glass-ionomer cement and composite resin compared to that with the use of total-etch adhesive systems under similar conditions. a new group of composite resin materials, giomers, have been introduced in less than a decade, which consist of reacted glass-ionomer fillers in a resin matrix; they are used in cavities in a manner similar to composite resins with the application of an adhesive system. in addition to appropriate esthetic results, easy polishing, fluoride recharging potential and strength, these materials release fluoride which may enhance their antibacterial effects. however, no studies to date have evaluated the bond strength between glass-ionomers and giomers; therefore, the aim of the present study was to evaluate the effect of three surface preparation methods on the shear bond strength of giomer to different surface treated conventional glass-ionomer. sixty cylindrical specimens were used in the present in vitro study. in order to prepare the samples, a plastic mold (with an inner diameter of 6 mm and a height of 4 mm) was placed on a glass slab. then conventional glass-ionomer (gc fuji ii, gc corporation, tokyo, japan) was packed into the plastic mold after mixing according to the manufacturer's instructions. another glass slide was used on the other side of the mold to make the free surface of the conventional glass-ionomer smooth. then the samples were randomly divided into three groups of 20. according to the manufacturer, the initial setting of gc fuji ii conventional glass-ionomer lasts in 5 minutes and a half, and the net setting time is 2 minutes and a half. three groups were compared; a total-etch adhesive resin or a self-etch giomer-based adhesive resin on set glass-ionomer; or the self-etch giomer-based adhesive resin on the unset glass-ionomer (before completion of the initial setting). in group 1 the surfaces of the specimens were etched with 37% phosphoric acid (3 m espe dental products, st. paul, mn, usa) for 15 seconds after 5 minutes and 30 seconds from the mixing procedure; the initial setting reaction was confirmed with the use of a sharp dental explorer. it should be pointed out that a complete setting of conventional glass-ionomer takes 24-72 hours. after surface etching, a single bond total-etch adhesive system (3 m espe dental products, st. paul, mn, usa) was applied according to the manufacturer's instructions and light cured [table 1]. a second transparent mold, with a diameter of 3 mm and a height of 2 mm, was placed on the conventional glass-ionomer specimen and a giomer restorative, beautifil ii a3-shade (shofu dental corporation, osaka, japan), was packed into the transparent mold and cured using a halogen light-curing unit (astralis 7; ivoclar vivadent, fl-9494 schaan, liechtenstein). the light-directing probe had a diameter of 8 mm and directed a light ray at an intensity of 700 mw/cm perpendicular to the surface, barely touching the surface, for 40 seconds. a light intensity of 700 mw/cm was confirmed using a radiometer before the start of each experimental session. after transparent mold removal, the specimens were cured for another 20 seconds from each direction. then the samples were kept in humidity chamber at 37c for 1 hour before being immersed in distilled water at 37c for the next 23 hours. in the next stage, a 500-cycle thermocycling procedure was carried out at 5c/55c 5c with a dwell time of 30 seconds and a transfer time of 10 seconds. chemical composition and application mode of adhesives used in group 2, the procedures were similar to those in group 1 except that fl-bond ii (shofu dental corporation, osaka, japan) self-etch adhesive resin was used on set glass-ionomer surface according to the manufacturer's instructions and light cured [table 1], without acid etching. in group 3, all the procedures were similar to those in group 2 except that fl-bond ii adhesive was applied according to the manufacturer's instructions right after the initial setting and before hardening of glass-ionomer (2 minutes and a half after the initiation of mixing, which is equal to the cement's net setting time). it should be pointed out that during that time the surface hardness of the cement was sufficient to place the second mold without damaging the cement. in order to measure the shear bond strength, the samples were mounted in cold-cured acrylic resin from the glass-ionomer side and the shear bond strength values of the samples were measured in newton using a universal testing machine (h5k-s model, hounsfield test equipment, surrey, uk) at a crosshead speed of 1 mm/min using a 0.5 mm-wide chisel. then the shear bond strength values were calculated in mpa by dividing the force (in newton) by the surface area (mm) of the samples. data were analyzed by one-way analysis of variance (anova) and pairwise comparisons were made by a tukey test using spss/ win.15. the failure modes were determined under a stereomicroscope (smz1500, nikon, tokyo, japan) at 20. the failure modes were classified as follows: adhesive failure: failure at giomer glass ionomer cement interface. in addition, to evaluate the interface between the conventional glass-ionomer and giomer in the groups under study, two additional specimens were prepared in each group and subsequent to longitudinal sectioning, they were evaluated under an scanning electron microscope [sem] (tescan, vega ii xmu, brno, czech republic) [figure 1]. scanning electron micrographs of conventional glass-ionomer and giomer interface in the study groups (mag 500). arrows indicate margins of adhesive resin between glass-ionomer and giomer. in the three scanning electron micrographs, the materials which are placed on the right and left sides of the adhesive resin indicate glass-ionomer and giomer, respectively shear bond strengths in mpa (means and standard deviations) for the study groups are represented in table 2. there were statistically significant differences in shear bond strength values between the study groups (p<0.0005). pairwise comparisons by a tukey test revealed that there were statistically significant differences in shear bond strengths between group 2 and the two other groups (p<0.0005), whereas the bond strength difference between groups 1 and 3 was not statistically significant (p=0.609). means and standard deviations (sd) of the shear bond strengths (mpa) measured in study groups moreover, all the cohesive failures were within glass-ionomer cement and there were no cohesive failures inside the giomer. failure modes of the study groups sem photomicrographs of the glass-ionomer and giomer interface in the study groups are represented in figure 1. in the sem photomicrograph in group 1 [figure 1a] the hybrid zone (the area of adhesive resin penetration into glass-ionomer) is almost homogeneous but has irregular borders on the glass-ionomer cement side. in the sem photomicrograph in group 2 [figure 1b] the hybrid zone is regular and homogenous and in the sem photomicrograph in group 3 [figure 1c] the hybrid zone is irregular and non-homogenous. moreover, the use of self-etch adhesive resin (fl-bond ii) in groups 2 and 3 resulted in the thicker hybrid zone than total-etch adhesive resin (single bond) in group 1. an appropriate bond between glass-ionomer and the superficial resin materials is very important for the success of the sandwich technique. in the present study shear bond strength of conventional glass-ionomer to giomer was evaluated using three different surface preparations for glass-ionomer (use of self-etch adhesive on glass-ionomer with or without complete initial setting reaction and use of total-etch adhesive on glass-ionomer after completion of the initial setting reaction). in designing the present study, the use of total-etch adhesive on glass-ionomer without the completion of the initial setting reaction was not considered, because in total-etch adhesives, rinsing after etching and contamination with moisture before completion of the initial setting reaction of glass-ionomer influences the surface integrity of the cement. the results of the present study showed that shear bond strength of glass-ionomer to giomer depends on surface preparation. in this context, in the group in which glass-ionomer was set and self-etch adhesive was used, the highest shear bond strength was recorded compared to two other groups, which is consistent with the results of a study carried out by gopikrishna, et al. on glass-ionomer-based adhesives; in the case of complete setting reaction the bond strength was higher than that in incomplete setting reaction. contrary to the results of the present study, knight, et al. reported no statistically significant differences in the bond strength before and after initial setting of glass-ionomer in the co-cure technique, where conventional glass-ionomer, resin-modified glass-ionomer (rmgi), and composite resin were placed in consecutive layers before light-curing procedure. the differences in the results of that study and the present study might be attributed to different etching times in the two studies. the etching time was 15 seconds in the present study, while in the study done by knight, et al. it appears that longer etching time paves the way for greater destruction of glass-ionomer surface by the acid and decreases the bond strength. in addition, a different technique was used in the above-mentioned study, i.e., a layer of rmgi was used over conventional glass-ionomer before placement of composite resin and the curing process was carried out for rmgi and composite resin simultaneously. it is well-known that the ph of glass ionomer cements is strongly acidic upon mixing, and it will increase with time, with the most rapid increase during the first 5-10 minutes of setting, regardless of the composition of the glass ionomer material. in comparison of groups 2 and 3, it appears that the acidic ph of unset glass-ionomer prevented complete polymerization of the giomer-based self-etch adhesive and therefore decrease the bond strength. in addition, this acidic ph might have an adverse effect on the polymerization of giomer itself. in a study carried out by mohamed-tahir, et al. another study has shown that surface hardness of composite resin placed on polyalkenoate glass (set for 4 minutes) significantly decreased. moreover, sem observation of the interface in group 3 revealed an inhomogeneous structure and occasionally breakdown of the glass-ionomer surface, which may have affected the bond strength. polyacrylic acid prevents polymerization of composite resin and results in composite resin softening; apparently this effect was intensified in incompletely set glass-ionomer. in comparison of groups 1 and 2, it appears that etching the glass-ionomer surface immediately after the initial setting in group 1 in the total-etch system resulted in the destruction of cement surface, crack formation and decrease in bond strength. this speculation was confirmed by the sem micrographs of the interface. the irregular interface in group 1 may be an indication of damage and weakening of the glass ionomer surface rather than improved micromechanical interlocking, when compared to group 2 which was treated by a comparatively mild acid, i.e., the self-etching primer. several studies have demonstrated a decrease in bond strength of glass-ionomer to composite resin as a result of etching the glass-ionomer surface. it has been reported that etching during the initial setting reaction of glass-ionomer leads to dissolution of weak calcium-polyacrylate rings, with the resultant deterioration of its physical properties. in the total-etch procedure however, another reason for a higher bond strength in the self-etch group compared to the total-etch group is the fact that the acidic monomers in the self-etch primer can chemically bond to the calcium in glass-ionomer and increase bond strength. in addition, a more appropriate compatibility of giomer with the giomer-based self-etch adhesive might be another reason for a higher bond strength in group 2; it has been suggested that the use of adhesives compatible with resin-based restorative materials can decrease deleterious chemical interferences. moreover in the self-etch adhesive group, resin penetration occurs simultaneous with the etching process and it is probable that the discrepancy between these two processes is eliminated or minimized. another factor that needs to be taken into account is the difference in composition and mechanical properties of the two adhesives; fl-bond ii is a two-step self-etching adhesive with filler particles while single bond is a mixture of hydrophilic monomers and solvents that contains no fillers. it has been suggested that the two-step self-etching adhesives that incorporate a hydrophobic resin as a separate bonding agent may have enhance mechanical properties compared to simplified adhesives. moreover, apart from the composition of resin matrix, addition of filler particles enhances the mechanical strength of the bonding layer and contributes to bond strength. in the present study, no differences were observed in bond strength between groups 1 and 3, and bond strength in both groups was significantly less than that in group 2. regarding failure mode in the present study, the majority of failures were of the cohesive type in glass-ionomer, which is consistent with previous studies. this phenomenon might be attributed to lower mechanical properties of glass ionomer cements when compared to resin-based materials and the presence of numerous air inclusion bodies inside glass-ionomer, which act as stress concentration points and probably increase the odds of cohesive failure. a disadvantage of sandwich technique is the absence of a chemical bond between conventional glass-ionomer and superficial resin materials; therefore, researchers have focused on the establishment of a chemical bond between them. considering the results of the present study, use of giomer-based self-etch systems not only decreases the time needed for the clinical application but also can result in the establishment of a chemical bond between giomer and conventional glass-ionomer. taking into account the limitation of this in vitro study, etching the surface of set glass-ionomer with a total-etch system or placement of self-etch adhesive on the surface of glass-ionomer with incomplete initial setting compromised bonding of giomer to glass-ionomer.

background: an appropriate bond between glass-ionomer and the superficial resin materials is very important for the success of sandwich technique. the aim of the present in vitro study was to evaluate the effect of three surface treatments of conventional glass-ionomer on its shear bond strength to giomer. materials and methods: sixty cylindrical specimens of a conventional glass-ionomer (gc fuji ii) were prepared and randomly divided into three groups (n=20). the specimens in groups 1 and 2 were treated with total-etch adhesive resin (single bond) along with acid etching, and self-etch adhesive resin (fl-bond ii) on the set glass-ionomer, respectively. specimens in group 3 were treated with self-etch adhesive resin (fl-bond ii) before initial setting of the glass-ionomer was complete. then a giomer restorative (beautifil ii) was added to the specimens. subsequent to thermocycling, the specimens were subjected to shear bond strength test. failure modes were evaluated under a stereomicroscope. data were analyzed by one-way analysis of variance and a post hoc tukey test at a significance level of p<0.05. results:there were statistically significant differences in bond strengths between the groups (p<0.0005). differences in bond strengths between group 2 and other groups were significant (p<0.0005) while the differences between groups 1 and 3 were not significant. failures were predominantly of the cohesive type in all the groups. conclusion:based on the results of this study, the use of self-etch adhesive resin (fl-bond ii) on the set glass-ionomer yielded the highest bond strength in the glass-ionomer/giomer sandwich technique.

PMC3612216

pubmed-379

planning, evaluating, and budget allocation for prevention programs are contingent upon estimating the size of their target groups. population size estimation of the target groups in some context, such as hiv/aids, always entail numerous challenges in countries where such diseases are concentrated in specific sub-populations with stigmatized behaviors&characteristics (e.g.: injecting drug users) (15). traditional sampling methods that are used to estimate the size of these high risk populations, including multiplier, capture-recapture, etc., are very complicated, if not impossible, since locating people with high risk behaviors is difficult, and approaching them directly can greatly reduce response reliability (510). estimating social network size of a representative sample, through a general population survey, and asking participants questions about specific high-risk behaviors among their acquaintances (1113) is one of the best means of gathering information on the sizes of such populations, also called hidden or hard-to-count populations due to the fact that it is not possible to calculate their sizes through regular, direct methods (14) one such method that has held the interest of researchers for the past decade is network scale-up (nsu) (6). in this method, the average social network size of the respondents (shown by c) is used as a prerequisite for estimating the size of a high risk population in the society (shown by e) based on the mean number of persons with high risk behavior known by respondents (shown by m) (15). in the past two decades, several studies in different countries including the united states, ukraine, brazil, moldova, rwanda, japan, china, and thailand have used this method to determine social network sizes as a pre-requisite for estimating high risk population sizes. this difference points to the need for local studies to determine this value and its determinants (1421). in iran, the estimated social network size on a national scale is between 308 and 380. however, tehran, as a megacity and the capital of iran, has unique demographic, cultural, and social features, special inter-individual relationship patterns, and different subpopulation proportions. in addition, due to the migration of different ethnic groups to this city, various ethnic networks have been formed (22). therefore to observe these different characteristics and the technical considerations which are recommended in the nsu method, the present study was designed to examine the social network size of the tehran province residents and the demographic factors affecting it in order to prepare the grounds for estimating the size of hidden populations. the social network size was estimated using an indirect approach, that is, respondents were asked how many persons they knew in a certain sub-population within the society, and estimations were made based on the respondents answers. the term knowing a person has a specific definition in this study, and involves a certain time span and space (23, 24); therefore by saying a knows b, it is understood that a knows b by name and face; a can visit, call or email b whenever he/she wants, and vice versa. moreover, a has contacted b by phone, email or in person at least once within the past 2 years, and b is a resident of tehran province (2527). for the total sample size 1029, we selected 829 persons from tehran and 200 from robat karim, the capital of robat karim county in tehran provincein 2012. the city of tehran was divided into 5 geographical zones: north, south, east, west, and center and the sample size were divided proportional to the population size of these five zones. sampling was done in crowded areas, such as streets and parks; individuals were selected through convenience sampling, and questions were asked in the form of street interviews. all participants were 18 or older, and had been residents of tehran province for the past five years. upon entering the survey, participants were briefed on the study objectives, and their informed consent was obtained. in order to determine the social network size, participants were asked questions regarding the number of people in their personal networks using the indirect method, that is, they were asked how many people they each knew in specific subpopulations. after coordination with the ministry of health and the statistical center of iran, twenty-three known populations with clear and available provincial level statistics were selected to be used in this study. in order to improve estimation accuracy, and in view of the findings of similar studies (20, 28), several considerations were taken into account in preparing the final list of the known populations to be used in the present study; for instance, the size of all selected populations was between 0.1% and 4% of the total population of tehran province. moreover, we excluded populations that could potentially induce a transmission error in the estimations for which there was no practical correction method. popularity of names in the past three decades was observed in assigning names, and more popular names were used at an almost even distribution. out of the twenty-three initial subpopulations, thirteen were eventually used in the study: first graders, high school graduates, university applicants, university students, married people, divorced people, those who had had normal vaginal deliveries (nvd), those who had had cesarean sections (c/s), primary school staff, people with the first names hamed, abulfazl, sara and marjan. in this study, social network size was estimated using the maximum likelihood estimation (mle) method and the equation below: c^i=j mijj ej.t where c^i is the social network size of the respondent i, mij is the number of people that i knows in the known population j, ej is the real size of the known population j, the statistical information for which is available through previous censuses or surveys, and t is the total size of the general population in the survey area (11, 13). to compute the 95% confidence intervals of the social network size, standard error c was calculated through the formula below: (29) se ci=tcijej this simple model will only work if the following strong assumptions exist (11, 24): all respondents have equal opportunity to know each member of the subpopulations under study.all respondents are fully informed about their own social network.all respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly. all respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly. violation of each of these assumptions brings about errors in the results achieved through the network scale-up method. one thing that can violate assumption a is the barrier effect, which pertains to barriers causing some respondents to know the subpopulations in the study with stronger or weaker possibility. transmission error, on the other hand, can violate assumption b, and that is when all people in a given person s network are similarly likely not to be aware of him/her belonging in a subpopulation. estimation effect is another factor that can violate assumption c, and it is due to a lack of precise knowledge of certain details about the people in a high risk social network. in order to control various effects and errors that can bias estimations, the following methods were employed to investigate the sources for these potential errors: 1) back estimation of each of the known populations to determine the best groups for estimating the ultimate social network size, and 2) variable stratification of the study samples, carrying out all analyses independently in each subgroup, and comparing results with that for the total sample. moreover, acquaintances who were among the respondents social network but were not residents of tehran province were eliminated from all estimations. in order to perform the first correction, a preliminary calculation of the social network size was done, the size of each known population was assumed unknown (e), and then the size of each subpopulation was estimated through the formula below: at this point, the estimate/real ratio (e/r ratio) for each population was calculated by dividing the estimated population sizes by the real sizes throughout the province. the next step was to eliminate the first known population in which this ratio was not between 0.5 and 2. after removing the population in which this ratio was the farthest away from the above-mentioned range of 0.5 and 2, the whole process was repeated one more time. the procedure was repeated for each of the populations, starting with the farthest outlier, until none of the calculated ratios was outside of this range. the final social network size was computed from the average social network size calculated for people in this stage (ci) (14, 24, 30). in the end, the effect of various demographic and background factors on the social network size of the residents of tehran province was analyzed using a linear regression model. a total of 1029 people were interviewed in this study; 46.7% participants were male. the majority (42.3%) was in the 18 25 year age group; the last educational degree of most participants was high school graduate or bachelor s degree, and they were mostly university students (table 1). demographics of study participants using the thirteen known populations, the social network size was estimated at 200.4 (ci95%: 188.3, 212.5), which was used for the back estimation of the known populations in this study. the pearson correlation coefficient between the real and estimated sizes of these known populations was 0.44 (p value=0.12). the e/r ratio was approximately 1 in all but three of the subpopulations; exceptions were first graders, and nvd, c/s where e/r ratios were 0.40, 0.43, and 0.3 respectively, and therefore the social network size of tehran province was estimated by eliminating the subpopulations c/s, first graders and nvds in that order. table 2 represents the estimated social network size after excluding each of the above subpopulations, as well as the e/r ratio for populations whose sizes have been calculated based on the estimated network sizes that continue to be out of the desired range. having eliminated c/s, primary school and nvd groups, the estimated cs were 220.8, 243.4 and 259.1 respectively. in addition, the correlation between the real and estimated sizes of remaining groupwas improved significantly in every steps (r= 0.32 based on groups, 0.51, 0.72 and 0.82 by dropping c/s, primary school and nvd groups respectively). estimate/real (e/r) ratio&estimate-real correlation changes after stepwise excluding the known populations with out of range e/r ratio table 3 demonstrates results of applying the back estimation method to subpopulations with estimated sizes within the acceptable range that were used in the final network size estimations. back estimations and e/r ratios of all populations are presented in table 4. known populations, source of data, back estimation of their population sizes, and the e/r ratio e/r ratio in separate estimations of social network size for men and women (before and after excluding the three out of range e/r ratio known groups) figure 1 represents the scatter plot of the real against estimated sizes of the thirteen known populations, and the same measures after excluding the three abovementioned subpopulations. the final network size estimated by using the remaining ten subpopulations was 259.1 (ci95%: 242.2, 276). real estimate scatter plot of known population sizes (before and after excluding the three out of range e/r ratio known groups) in the univariate analysis, social network size was significantly associated with gender (p=0.01), age (p<0.001), and occupation (p<0.001). men had larger networks comparing to women (291.8 versus 230.4), and c in younger people was larger than that in older ones (328.5 versus 201.1). multivariate analysis showed that variables of gender and age impacted social network size (table 5). age was also proved to have a significant impact on the respondents knowing the studied subpopulations (p<0.001). comparison of social network size in different sub groups based on different background variables the possibility of knowing a person who had graduated from high school, participated in the university entrance exam, or been admitted into university in the past year was higher in the younger age group (56.6%, 63.4% and 39.3% respectively) (table 6). based on the findings of this study and by using the mle method, the social network size of the residents of tehran province was estimated at 259.1 which were calculated using 10 known populations with an e/r ratio between 0.5 and 2. age and gender were determinants of peoples network sizes. estimated network sizes were different in male and female respondents, and appropriate known populations used for c estimation in these two groups were not equal. our experience showed that all subpopulations with known size were not appropriate to be used in the estimation of c. we dropped three sub-populations to improve the internal validity of our size estimations, which also used in other comparable studies (11, 14, 20, 22). by eliminating these 3 subpopulations, the social network size the national study was primarily biased in a similar manner as well (22). therefore, estimation of c based on the size of some known subpopulations is a stepwise technique and has to be applied with some considerations; otherwise the estimated c might have big bias. the estimated sizes for known subpopulations c/s, nvd, and first graders were less than half the real sizes, and for the subpopulation of people with the first name marjan the estimated size was more than twice the actual size. after all three subpopulations were eventually eliminated, the correlation coefficient was more than double (0.82 as opposed to 0.32), and became statistically significant. moreover, the estimations for the subpopulation marjan a persian female first name- fit within the acceptable range, and was closer to 1. this indicated that the social network size estimated by using the ten remaining known populations would yield a more reliable estimate of hidden subpopulations too. similar studies confirm likewise that elimination of populations with estimations outside of the range 0.5 1.5increases the correlation coefficient between back estimations and real sizes. conducted a research in ukraine to estimate the number of idu s fsw s and msm. of the 22 known populations used in this study, 13 fell within the acceptable e/r ratio range, and were used in the final network scale-up calculations. the estimated sizes of known populations had a high correlation coefficient with the real sizes using the back estimation technique (r=0.912), and this number reached 0.94 after nine of the known populations were eliminated (14). in another study conducted on 1554 individuals in the u.s. after elimination of two populations with a discrepancy between their real and estimated sizes, the correlation rose to 0.94 (11). in the present study, the average e/r ratio using thirteen known populations was calculated to be 1.17. removing each of the outliers brought this ratio closer to 1, and after eliminating the 3 sub-populations mentioned earlier, the e/r ratio reached 1.09. this figure indicated an average overestimation of about 9% in the calculations. in the ukrainian study, the e/r ratio was 1.65, which denotes an overestimation of 65% in population size estimations (14). overestimation seems to be one of the common limitations of the network scale-up method with small subpopulations (11, 30). in the present study, this problem occurred with the subpopulation of people with the first name marjan, which was the smallest subpopulation with only 0.12% of the total population of tehran province. since nicknames are common in iran, this overestimation may be because the respondents network includes people called marjan who are registered in the census with a different name; this can be true with several names. after eliminating the c/s subpopulation, the e/r ratio for the subpopulation marjan fell within the acceptable range (e/r=2), and after the two subpopulations nvd and first graders were removed, this ratio decreased even further (e/r=1.7). another common calculation error in the network scale-up method is underestimation of the size of large subpopulations (11, 30). the largest subpopulations used in this study were c/s, first graders, married people, and university applicants. the first two were underestimated as expected, while the other two had more accurate estimations, probably on account of a more satisfactory transmission and the respondents being more informed on these properties due to the significance that iranians attribute to marriage and university education. study on se-roprevalence in the united states, it is difficult for respondents to estimate the number of acquaintances they have in large subpopulations (11). in addition to the estimation error in the c/s subpopulation, another explanation for this group having the lowest e/r ratio (0.34) and an e/r ratio lower than 0.5 for the nvd group is transmission error. the similar natures of these two subpopulations as well as their connection to gender suggested that respondents gender impacts their awareness of nvd or c/s occurring within their social networks. in order to assess the validity of this theory, network size estimations and back estimations for populations were performed based on the respondents gender. based on our findings, the e/r ratios for known populations were different in male and female res pondents (table 4). the e/r ratios were out of range for the subpopulations c/s, nvd, and first graders when estimated through the networks of male respondents, but this limitation did not exist in case of female respondents. the difference seems to be understandable considering the nature of these subpopulations and the iranian culture: an iranian male respondent would be less likely to be aware of childbirth conditions or first graders in his social network compared to a female respondent in a similar situation. in the ukrainian study, similar circumstances were encountered when estimating the number of militiamen, since there was a higher likelihood for male respondents to know someone in this subpopulation on account of their cultural status and social relations compared to women (77% vs. 68%). therefore, using the militiamen subpopulation to estimate the social network size leads to different results in male and female respondents (14). barrier effect is another significant factor that can compromise the estimation of population sizes in the network scale-up method. one common barrier, which could be a concern in the present study, is the respondents age. those in the 18 25 year group were more likely than others to know someone in the subpopulations high school graduates, university applicants, and university students, considering how these categories are age-related. based on the results shown in table6 however, barrier effect did not affect the results of this study. this is probably because the 18-25 year old group is relatively larger in the general population, and our 18-25 year old group was proportionately larger too. in the ukrainian study, the two subpopulations polish and moldavian were removed due to the risk of barrier effect and consequent estimation errors. in the final stage of the present study, the remaining ten subpopulations were used to estimate the social network size at 259.1, and this was used as the base for estimating the known population sizes with the most suitable e/r ratio and the highest correlation with their true sizes. this number was smaller compared to similar study in the country, carried out by shokoohi et al. in kerman province in 2010 (c=303). their study was performed on 500 men between 18 and 45 years of age, and the data were collected through interviews. the difference between the social network sizes of the two provinces of tehran and kerman seems to be due to the lifestyle specific to metropolitan areas and capital cities that somehow limits social relationships; one other reason may be that the kerman study was restricted to male samples, who are expected to have more social contacts and consequently larger networks than females in a city like kerman (27). two estimates were computed by entering 23 known groups in the study using regression-based (c=308) and ratio-based (c=380) methods. according to their results, the ratio-based method, which is also used in the present study, is the recommended approach because of higher internal validity and prediction validity (22). the ratio of the population size to the total tehran population was beyond the range of 0.1% to 4.0% for 10 of the 23 known groups in the national study; differences in population compositions and their effect on results can partly explain the different estimates in these two studies. moreover, unique social, cultural, political, and economic processes in tehran have created a different pattern of social interactions that restricts inter-individual relationships and limits the social network size. social science studies also confirm that in recent years, the nature of urban development in megaci-ties such as tehran has entailed loosening in social ties. this is due to concentration of population in metropolitan areas and absence of alternative social practices (31). in the ukrainian study, the social network size was estimated at 202 using a network scale-up approach and the mle method, which was also employed by the present study (27). in a 2012 study conducted in japan by ezoe et al. with the purpose of estimating the msm population, the network size was estimated to be 363.5 regardless of gender, with 174 being male. out of the initial ten known populations used in this study, only three were eventually used to estimate the social network size in the pilot stage: male fire fighter, policemen, and military personnel. of the seven eliminated populations, five were removed on account of estimation error, that is, their estimated sizes were not consistent with their real sizes, and two were removed due to transmission error (20). the social network size was estimated at approximately 291 in the united states, as shown in the 2001 study by mccarty et al., using four separate national sets of samples. the study used the network scale-up method on 29 known populations, three of which were similar to the subpopulations in the present study and those were: first names, people who gave birth within the last year, and victims of car accidents (24). the social network size estimated by killworth et al. was 286, which is larger than the present study, and this may be due to the numerous cultural and social differences between iran and the united states (11). although in the kerman study, there was no significant relationship between the social network size and any of the demographic factors (age, education, marital status, and occupation) (27); the results of the present study showed that men comparing to women and younger people comparing older ones had a significantly larger social network, which seems understandable on account of cultural and social considerations. in the national study and the chinese study, the social network sizes of men and younger people was larger compared to those of women and other age groups, and this is due to men and young people having wider social circles (21, 22). married people had smaller social networks compared to single people in the two studies mentioned above; this difference was found to exist in the present study as well, although the difference between these two groups was statistically not significant in tehran province (248.8 versus 270.1). in this study, there were limitations associated with the network scale-up method. firstly, it is unrealistic to expect accurate and flawless estimations, because although there is a precise and specific definition for the term knowing a person, data collected on social networks is self-reported. in minimize this limitation, the present study attempted to use known populations that were easily recognizable by all respondents, and had clear and uniform definitions for all members of the society. furthermore, the time span for the questions was the past year so that respondents could remember the details with fewer errors. another issue, which is quite unavoidable, is lack of definite boundaries separating many subpopulations in the respondents points of view. researchers are limited to subpopulations for which official statistics exist, and these subpopulations have been assigned specific definitions that are not necessarily consistent with those of various members of the society. we intended to select a representative sample of general population in order to minimize different types of selection and information biases. although it was not a fully random sample of whole community and there are some methodological considerations, based on the existing experiences in iran and the result of a methodological study that was performed for comparing three popular sampling method in this type of studies (street-based, telephone-based and home-based interviews) in this regard, it seems street-based sampling from deferent geographical zones would be a feasible sampling scheme which was used in the national study as well. based on the above explanation, it seems that the social network size of tehran s residents is different not only with similar studies in other countries but also with the results of national survey in iran, which might be mainly because of the special social and cultural pattern of communications among different communities. we also showed that the c varies considerably in males and females, in young and old people. therefore, local estimations for c in different sub-populations are needed to improve the accuracy of nsu estimations. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or fal sification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.

abstractbackgroundnetwork scale-up is an indirect method for estimating the size of hidden, hard-to-count or high risk populations. social network size estimation is the first step in this method. the present study was conducted with the purpose of estimating the social network size of the tehran province residents and its determinants. methodsmaximum likelihood estimation was applied to estimate people s network sizes by using populations of known sizes and the scale-up method. respondents were selected from tehran province through convenience sampling in 2012. out of thirteen selected subpopulations with known size, ten had minimum accuracy which used in our analysis. resultsof the 1029 respondents in this study, 46.7% were male. the social network size of tehran province residents was estimated to be 259.1 (ci95%: 242.2, 276) based on the ten known populations remained in this study. this size was 291.8 in men and 230.4 in women. younger people (1825 years old) had larger network sizes compared to the other age groups (p<0.001). conclusionour estimation for social network size of tehran inhabitants was smaller than that previously estimated size for the whole country (c=380). in addition, we found that the social network of subpopulations was different. this difference means that we need local estimations for sub-populations to improve the accuracy of population size estimation using network scale up method.

PMC4411904

pubmed-380

the pathogenesis of gmd in pd patients is related to factors such as weight gain and insulin resistance evoked by peritoneal glucose load [13]. the periodical evaluation of pd patients for gmd is of clinical relevance and should be an element of the surveillance protocol. the gold standard method used for the diagnosis of gmd defined by the world health organization (who) in 1998 uses the level of 2-h post-challenge plasma glucose (2-hpg) in the oral glucose tolerance test (75-g ogtt). criteria for the diagnosis are the following: fasting plasma glucose (fpg) 100 mg/dl (5.6 mmol/l) to 125 mg/dl (6.9 mmol/l) (impaired fasting glucose, ifg); 2-h pg in the 75-g ogtt 140 mg/dl (7.8 mmol/l) to 199 mg/dl (11.0 mmol/l) (impaired glucose tolerance, igt); 2-h pg in the 75-g ogtt or random 200 mg/dl (11.1 mmol/l) (dm). the utility of the recently recommended use of hba1c in terms of diabetes diagnosis (diagnostic threshold of 6.5 %) still remains to be validated. the population at a particular risk of glucose metabolism disorders includes renal transplant recipients, pregnant women, and patients treated with peritoneal dialysis. for each of these groups, there is a lack of clear guidelines for the detection and diagnosis of gmd. therefore, alternative methods for detecting all glucose metabolism disorders (ifg, igt, and dm) in the population of high risk of hyperglycemia have been investigated. the issue of glucose metabolism disorders (gmd) in pd patients has regained interest in recent years. this increase in clinical relevance was caused by new evidence that even mild hyperglycemia in the dialysis period can be harmful in the long term, being associated with worse survival and elevated risk of post-transplant diabetes mellitus [68]. treatment with peritoneal dialysis is inherently associated with an additional load of glucose adsorbed from dialysis fluid. the effect of glucose deriving from the peritoneal cavity on the incidence of glucose intolerance still evokes some ambiguity, and published data are equivocal [13, 911]. the recent data suggest that high glucose exposure from dialysis solution may be a risk factor for vascular calcification in non-diabetic pd patients. there seem to be some analogies between the occurrence of de novo gmd in patients treated with pd and gestational diabetes (gdm), in which a combination of increased maternal adiposity and naturally occurring human placental hormones produces insulin resistance [13, 14]. in both cases, gestational diabetes mellitus is defined as any degree of glucose intolerance with onset or first recognition during pregnancy. the mechanisms that lead to chronic insulin resistance in gdm are varied as they are in the general population. up to 2012 gdm was diagnosed by a two-step approach using a sequential model of universal screening with a 1-h 50-g glucose challenge test (50-g gct) followed by a diagnostic 75-g oral glucose tolerance test (75-g ogtt) for women with a positive screening test [threshold value 140 mg/dl (7.8 mmol/l)]. the gdm was recognized in 75-g ogtt when the plasma glucose value was 140 mg/dl. ada recommendations for 2011 adopted new, stricter criteria for the diagnosis of gestational diabetes and confirmed them for 2012. according to the current recommendations for all pregnant women between 24 and 28 weeks of pregnancy, gestational diabetes is diagnosed if the fasting plasma glucose is at least 92 mg/dl (5.1 mmol/l), after 1 h 180 mg/dl (10.0 mmol/l), and after 2 h 153 mg/dl (8.5 mmol/l). these criteria were based on the results of the hapo study and recommendations of the research group of the international association of the diabetes and pregnancy study groups (iadpsg). there is also a critical discussion concerning the methods and criteria for the new ada 2012 diagnosis of gestational diabetes [2023]. currently, there are no clear recommendations for diagnosis and classification of glucose disturbances occurring de novo in a population of patients on pd. in our opinion, the who gold standard is not appropriate for pd patients because gmd differ from those in the general population, and other screening strategies should be explored. considering the mentioned similarities, we aimed to examine the utility of the oral glucose tolerance screening test (50-g gct) for pd patients, which is used in a two-step approach to evaluate gestational diabetes. the first step the 50-g gct is performed at any time of the day (the fasting state is not required), using 50 g of glucose, and the plasma glucose was measured at 1 h after administration. in the current study, we aimed to evaluate the applicability of the 50-g gct for the detection of gmd in non-diabetic continuous ambulatory pd patients with normal fasting glucose levels. the study was performed in 20 prevalent patients without history of diabetes before pd treatment onset who had been on a pd program at our institution as their first dialysis modality. the median age of patients was 44.19 years [interquartile range (iqr) 34.1556.25], 9 being males and 11 being females, all caucasian with cause of end-stage renal disease (esrd) being glomerular disease in 12 patients (60%), hypertensive nephropathy in four patients (20%), interstitial nephropathy in three patients (15%), and polycystic kidney disease in one patient (5%). the median duration of pd treatment before inclusion in the study was 15.34 months (iqr 10.821.34). patients were assessed at the study onset (on the day of the 50-g gct) and at the end of pd treatment (13 patients) or at end of the observation period (december 2012) for continuing the pd program (seven patients). at the study onset, all patients underwent 50-g gct with a glucose dose of 50 g. the test is performed at any time of the day (the fasting state is not required), using 50 g of glucose, and the glucose is measured at 1 h after the administration. interpretation of our 50-g gct results was as follows: glucose<140 mg/dl normal value; 140199 mg/dl impaired glucose tolerance (igt), 200 mg/dl diabetes. in case of a fasting glucose value 100125 mg/dl, and normal value in 50-g gct impaired fasting glucose (ifg) was diagnosed. the 50-g gct was performed in patients with an empty abdomen after the night dwell draining. during the night, all patients used 1.36% glucose containing dialysis solution. the glucose was measured at 1 h after administration; the fasting state was not required. in addition, the following parameters of glucose metabolism were measured: c-peptide, fasting insulin serum concentration, and the glycated hemoglobin level (hba1c). the concentrations of c-peptide and insulin were evaluated in serum samples, and hba1c in whole blood using a chemiluminescent microparticle immunoassay (cmia) on the architect system (abbott, usa). based on fasting insulin and glucose values, insulin resistance (ir) was determined according to the homeostasis model assessment insulin resistance (homa-ir). they encompassed blood pressure (bp), serum albumin, lipid profiles, hb, crp, liver tests, mean daily peritoneal glucose load, ultrafiltration volume, residual diuresis, weekly dialytic creatinine clearance (ccr), weekly dialytic kt/v, and other laboratory parameters (uric acid, pth, tsh, fe, tsat, and electrolytes). systolic and diastolic bp, residual gfr, weekly dialytic ccr, and kt/v were measured by standard methods. the estimated peritoneal glucose load was calculated by the product of the volume and the glucose concentration of each exchange. the glucose load did not differ between the patients and was similar in all study patients during the follow-up. the patients were prospectively followed for a median time of 25.8 months (iqr 18.9933.57), and 50-g gct was repeated at the end of the observation period. the statistical analysis was performed with r for windows, version 2.15.1, and medcalc for windows, version 12.3.1.0. clinical characteristics at the study onset are shown in table 1. table 1clinical characteristics at the study onsetvariable n medianiqr (interquartile range)fasting glucose level (mg/dl)2091.583.596glucose level1 h after gct (mg/dl)20165137.5195hba1c (%) 205.55.45.7c-peptide (ng/ml)207.245.1210.95fasting insulin serum concentration (u/ml)2010.347.7916.05homa-ir202.131.573.53systolic bp (mmhg)20135120155.5diastolic bp (mmhg)2087.58090serum albumin (g/dl)203.83.653.95total cholesterol (mg/dl)20196179231hdl cholesterol (mg/dl)20433852ldl cholesterol (mg/dl)20128.5105.5143triglycerides (mg/dl)20164.5130226.5hb (g/dl)2010.610.111.85crp (mg/l)202.091.116.69aspat (iu/l)2017.51421alat (iu/l)20171225uric acid (mg/dl)206.35.557.3pth20817490.51,221.5tsh202.191.054.11fe207451.588tsat (%) 2025.41933.9ca (mmol/l)2098.259.2p (mg/dl)206.44.857.25mean daily peritoneal glucose load (g/24 h)20120120120ultrafiltration volume (ml/24 h)201,3007251,500residual diuresis (ml/24 h)201,1505001,500weekly dialytic ccr200.690.620.75weekly dialytic kt/v202.192.112.7bmi total (kg/m)2025.1423.8327.63 clinical characteristics at the study onset 50-g gct revealed gmd in 15 investigated patients (75%). the most frequent abnormality was igt (plasma glucose between 140 and 199 mg/dl), which occurred in 11 patients (55%). however, despite normal fasting glucose, in four patients (20%), the glucose concentrations at 1 h after oral load were above 200 mg/dl, suggesting a preliminary diabetes diagnosis. the other glucose metabolism indicators exhibited little clinical utility for the detection of abnormal glucose tolerance in pd patients. the median percentage of hba1c was in the normal range (5.5%), exceeding the upper limit only in two patients (10%). median value of homa-ir was 2.13, being above 2.6 (the cutoff for ir) only in seven patients (35%). c-peptide concentrations were significantly higher than in non-diabetic healthy individuals (p=0.03). a significant correlation was found between homa-ir and c-peptide measurements (p=0.001, 0.677). homa-ir and c-peptide determinations did not correlate with other investigated parameters, i.e., serum albumin, crp, lipid profile, glucose load in the dialysis fluid, dialysis dose, ultrafiltration, and residual diuresis. patients with gmd were recommended a low-carbohydrate diet, lifestyle modification to promote weight loss, and increased physical activity. the adherence was checked at a monthly interval during patients visit to the pd clinic. four patients, in whom diabetes was recognized after the first 50-g gct, additionally received short-acting sulphonylurea compounds (glipizide) for a few months (35), and then, a diet satisfactorily corrected the glucose value. the patients were prospectively observed, and after a median time of 25.8 months, the glucose metabolism evaluation was repeated. during the second 50-g gct, igt persisted in eight patients (40%), and of particular note, ifg (100125 mg/dl) occurred in four patients (20 %) despite 50-g gct being in the normal range. all patients who exhibited the highest abnormalities suggesting diabetes in the first gct when retested at the end of the observation achieved a normal range. glucose metabolism disorders at study onset and at the end of observation are shown in table 2. table 2glucose metabolism disorders at study onset and at the end of observationgct 50 ggmdstudy onsetend of observationifg0 pts4 ptsfasting glucose level (mg/dl) median/iqr124/112153glucose level1 h after gct (mg/dl) median/iqr176/152189igt11 pts8 ptsfasting glucose level (mg/dl) median/iqr93/839587/78.2590.25glucose level1 h after gct (mg/dl) median/iqr167/149184150/146167dm4 pts0 ptsfasting glucose level (mg/dl) median/iqr93/83.399.8glucose level1 h after gct (mg/dl) median/iq207/204236 glucose metabolism disorders at study onset and at the end of observation the occurrence of gmd in 75% of the study subjects representing a small single-center cohort of prevalent pd patients gives a good illustration of the epidemiological dimension of the problem. after the first oral glucose load of 50 g, igt was revealed in 11 subjects (55%), and a glucose rise suggesting diabetes appeared in four patients (20%). the 50-g gct was performed in prevalent continuous ambulatory peritoneal dialysis (capd) patients, who had been on dialysis for a median time of 15.34 months. surprisingly, the literature on gmd in the pd population is very scanty. in two works published in the 1980s, lindholm et al. [25, 26] based on their own modification of ogtt (using 1 g glucose per kg body weight) carried out in 15 patients concluded that pd treatment up to 1 year does not deteriorate glucose metabolism.. published results of ogtt diminished from standard 7550 g glucose load accomplished in six patients being on pd for at least 6 months. the test was applied exclusively to detect insulin resistance, and the data on increased glycemic and insulinemic responses were presented. more informative and extensive investigation was done by cheng et al. in 35 nondiabetic patients treated by pd for more than 1 year. they challenged patients by standard 75 ogtt and found igt in 31 %. in a larger-scale epidemiological study, insulin resistance was significantly more frequent in pd patients than in hemodialysis and pre-dialysis subjects (47 vs. 21 and 26 %, respectively). in a study by tatar et al., insulin resistance was an independent risk factor for arterial stiffness in nondiabetic pd patients older than 50 years. in our present single-center study, we found homa-ir values indicating insulin resistance (> 2.6) in seven patients (35%). the c-peptide levels were significantly higher in the pd group than in healthy individuals and correlated closely with homa-ir. it should be mentioned that the elevated c-peptide concentrations in pd patients are mainly a consequence of the fact that 70% of this peptide is eliminated by the kidney route. however, the strong correlation with homa-ir can be treated as a sign of preserved excretory pancreatic cells capacity. commenting on the results of our study, it is worth emphasizing that the study group encompasses low-risk, middle-aged, non-obese subjects, with normal fasting glucose, normal hba1c, and slightly elevated cholesterol level. the only more pronounced abnormality which is associated with glucose intolerance in epidemiological investigation was hypertriglyceridemia. discovery of gmd in 75% of patients with such clinical characteristics highlights the clinical significance of this issue. we are conscious that 50-g gct was not validated in the pd population, but it seems to be well suited for a person on pd treatment due to its simplicity and convenience. a plasma glucose value 140 mg/dl, we gave up on performing the second step 75-g ogtt, because the aim of our study was not to recognize diabetes by who criteria, but reveal a group with special risk of hyperglycemia. we treated our test as a screening, not diagnostic method, also taking into account the cost benefit relationship. the 50-g gct allows quick verification of glucose disturbances in patients with an additional daily dose of glucose in the dialysis fluids. in contradistinction to standard 75-g ogtt, it does not require patients to keep coming to the pd clinic at different appointment hours without eating. it obviously does not provide a definitive diagnosis. in the next project following these preliminary data however, we believe that abnormalities revealed by 50-g gct are already of clinical value alerting the patient and physician. it provides a stimulus for preventive measures, which as shown by our experience can be effective, i.e., the normalization of the test in four patients with the worst results at the onset. the other positive aspect of the current study is supplying evidence that gmd are not inexorably progressive under pd treatment. the maintenance of normal glucose metabolism in pd patients is in the context of obtained results a feasible goal. its achievement could bring benefits in terms of longer patient survival and lower risk of post-transplant diabetes development. the oral glucose challenge screening gct test appears to be a sensitive instrument for the detection of glucose metabolism disorders in pd patients with normal fasting glucose.

background the aim was to evaluate the clinical utility of the oral glucose tolerance screening test (50-g gct glucose challenge test) for the detection of glucose metabolism disorders (gmd) in peritoneal dialysis (pd) patients with normal fasting glucose levels. methods the 50-g gct was performed in 20 prevalent patients without history of diabetes before pd treatment onset, who had been on dialysis for a median time of 15.34 months. in addition, other indicators of glucose metabolism were measured: c-peptide, fasting insulin serum concentration, and the glycated hemoglobin level (hba1c). the patients were prospectively followed for a median time of 25.8 months. results50-g gct revealed gmd in 15 studied patients (75 %) impaired glucose tolerance in 11 patients (55 %) and diabetes mellitus in four patients (20%). hba1c and insulin resistance, estimated by homeostasis model assessment, were elevated in two (10 %) and seven (35 %) patients, respectively. in patients with gmd, dietetic and pharmacologic interventions were performed. when the 50-g gct was repeated at the end of the observation period, 12 (60 %) patients reported gmd, with no case of diabetes. conclusion50-g gct appears to be a simple and practical tool for the detection of gmd in pd patients with normal fasting glucose. timely therapeutic intervention can effectively inhibit the progression of glucose intolerance during pd treatment.

PMC4375300

pubmed-381

proteomics has emerged as a valuable tool for the identification of biomarkers associated with human disease including those resulting from very subtle changes in normal cell functions and signaling pathways. proteomic technology has advanced to a state where thousands of proteins can be identified within complex samples, yet disease-based studies using fresh or frozen tissues are limited by a lack of available specimens for longitudinal clinical investigations. in contrast, there are millions of archival formalin-fixed, paraffin-embedded (ffpe) tissues for which the clinical course of disease and response to therapy has been established. ffpe tissue studies are affected greatly by sample collection, tissue processing, and archival time. though these factors are difficult to control in archival samples, improvements in techniques such as mtraq have made relative quantitation of disease biomarkers in ffpe tissue possible. improving protein extraction and detection of less abundant protein biomarkers is also of critical importance in proteomic analysis. protein modifications by formaldehyde treatment and histological processing significantly limit the use ffpe tissues for proteomic analyses. this has prevented proteomic studies of the clinical course of diseases, such as prostate and breast cancer, that evolve slowly or where the time between treatment and recurrence is long. coupling proteomic investigations with the retrospective pathology information available from archival ffpe tissues would produce a wealth of practical information on human diseases. some are practical for slide-mounted ffpe tissue, such as quantitative fluorescence imaging analysis (qfia), which is reproducible and sensitive for specific standardized proteins, or maldi-imaging mass spectrometry (ms). other encouraging mass spectrometry (ms)-based proteomic studies of ffpe tissues have appeared in the recent literature; however, these investigations have typically been restricted to minute tissue specimens, such as those obtained by laser capture microdissection. further, some studies report high rates of false-positive protein identification and are limited to the analysis of tryptic digests of ffpe tissues by liquid chromatography ms (lc ms). our laboratory has been studying the reactions of formaldehyde with proteins and ways to reverse these reactions. using proteins in aqueous solution, we demonstrated that the majority of protein formaldehyde adducts and cross-links were consistently reversed with mild heating following the removal of excess formaldehyde by dialysis. we then developed a tissue surrogate, which consists of one or more proteins that form a gel-like plug when treated with formaldehyde at protein concentrations exceeding 75 mg/ml. these tissue surrogates have sufficient physical integrity to be processed using normal histological methods. a variety of extraction buffers and heating protocols were examined for their ability to recover proteins from tissue surrogates. protein recovery was generally modest, and studies with multiprotein tissue surrogates revealed extraction bias, meaning that the composition of the solubilized proteins did not match that of the corresponding tissue surrogate. subsequent studies showed that the ethanol dehydration step of histology caused most formaldehyde-treated proteins to adopt conformations enriched in -sheets, leading to the formation of protein aggregates where the -sheets form a dense network of intermolecular formaldehyde cross-links. we proposed that the difficulty of rehydrating these stabilized protein aggregates was the primary impediment to recovering proteins from ffpe tissue. pressure promotes water penetration into the inner core of proteins, causing denaturation, whereas heat alone causes protein unfolding followed by aggregation. consequently, we hypothesized that the combined effects of heat and elevated pressure would facilitate the rehydration of the highly cross-linked protein aggregates in ffpe tissues. the increased exposure to water should greatly improve protein solubilization while simultaneously promoting the reversal of protein formaldehyde adducts and cross-links. initial physical studies on tissue surrogates supported this hypothesis and suggested that the effect of pressure was to reduce the size of protein aggregates through increased water penetration, rather than to increase the rate of reversal of protein formaldehyde adducts and cross-links directly. encouraged by these results, we extracted ffpe mouse liver tissues with heat augmented by elevated hydrostatic pressure, with the goal of reducing extraction bias, improving the recovery of intact proteins, and obtaining tryptic digests that more closely resemble those from matched fresh-frozen tissue. tissue tek oct compound was purchased from sakura, usa, amicon ultra 3k centrifugal filters were purchased from millipore, and 37% formaldehyde and pierce detergent removal columns were obtained from thermo fisher. precast nupage bis-tris 412% gels, 2-(n-morpholino)ethanesulfonic acid sds running buffer, and the silverquest staining kit were purchased from life technologies. tissue extracts were heated under a pressure of 40,000 psi (276 mpa) using both home-built and commercial instruments. the home-built instrument consisted of a 2-ml capacity ms-1 stainless steel reaction vessel coupled to a manually operated high pressure piston screw pump available from high pressure equipment company (erie, pa). the temperature of the pressure vessel was regulated by a eurotherm 2132 temperature controller (leesburg, va) connected to an aluminum heating collar surrounding the reaction vessel. the tissue extract (2 ml) was added directly to the reaction vessel using a syringe. the construction and operation of this pressure system has been described in detail previously. the commercial instrument was a model nep 2320 barocycler (pressure biosciences) modified by the manufacturer to hold isobaric pressure and to provide temperature control up to 95 c. the tissue extract (2 ml) was added to a ft500 sample tube, which was capped and placed in the pressure vessel of the barocycler. the liver from a female balb/c mouse was obtained under the secondary use provision from the department of laboratory animal medicine of the armed forces institute of pathology (usa). half of the liver was immediately frozen in tissue-tek oct compound, divided into several equal-sized pieces, and stored at 80 c. the other half was fixed for 48 h at 4 c in 10% formalin. the fixed liver tissue was washed for 30 min with distilled water and dehydrated through a graded series of alcohols (70, 85, and 100% by volume) and two changes of xylene, 30 min each. recovery experiments, 10 m sections of ffpe mouse liver were cleared of paraffin by incubating the sections through two changes of xylene for 10 min each. the sections were rehydrated through a series of graded alcohols for 10 min each2 changes each of 100% ethanol, 85% ethanol, and 70% ethanol and then incubated in distilled water for a minimum of 30 min, as described previously. matched fresh-frozen and ffpe liver tissue sections were analyzed after 30 days, and again after 1 year, of storage. the ability of elevated hydrostatic pressure combined with heat to improve the recovery of proteins from ffpe mouse liver tissue was evaluated using two heat-based ffpe proteomic protocols recently reported in the literature. for each protocol, the experimental procedure was followed exactly as published, but with the heating step divided into two arms, or variations. in the first arm, the ffpe tissue extract was heated at the temperature and for the length of time reported in the original method. in the second experimental arm, the temperature and length of time was identical, but the experiment was performed under a pressure of 40,000 psi. the two experimental arms were then analyzed using identical gel electrophoresis and lc/ms conditions. the protein content of the tissue extracts was determined using a bca protein assay kit (pierce). following deparaffinization and rehydration, the tissue was cut into small pieces and suspended in 36 ml of 50 mm tris-hcl, ph 7, 2% sds (extraction buffer 1, eb1) as described by shi et al. the tissue suspension was homogenized with three 5-s cycles of sonication on ice using a probe-tip sonicator, and the resulting homogenate was split into two equal fractions. one fraction (protocol-1a) was incubated at 100 c for 30 min followed by 80 c for 2 h at atmospheric pressure (14.7 psi) in a sand bath. the second fraction (protocol-1p) was incubated at 100 c for 30 min followed by 80 c for 2 h at 40,000 psi using our hand-built pressure instrument. a 750 m section (approximate thickness) of matched fresh-frozen liver was cut with a razor blade and homogenized in 22.5 ml of eb1 by sonication as described above. proteins were extracted using two methods: incubation of the homogenate in an ice bath for 2.5 h (protocol-1fi) or incubation at 100 c for 30 min followed by 80 c for 2 h at atmospheric pressure using a sand bath (protocol-1fh). following deparaffinization and rehydration, the tissue was cut into small pieces and suspended in 36 ml of 100 mm tris-hcl, ph 8, 100 mm dtt, 4% sds (extraction buffer 2, eb2) as described by ostasiewicz et al. and homogenized with three 5-s cycles of sonication on ice using a probe-tip sonicator. one fraction (protocol-2a) was incubated at 95 c for 1 h at atmospheric pressure in a sand bath. the second fraction (protocol-2p) was incubated at 95 c for 1 h at 40,000 psi using the barocycler instrument. a 750 m section of matched fresh-frozen liver was cut with a razor blade and homogenized in 22.5 ml of eb2 by sonication as described above. proteins were extracted by incubating the homogenate at 95 c for 3 min at atmospheric pressure using a sand bath (protocol-2fh). all ffpe and matched fresh-frozen mouse liver tissue extracts (40 g each) were separated by sds-page on precast nupage bis-tris 412% gels using 2-(n-morpholino)ethanesulfonic acid the gels were stained using the silverquest silver staining kit and documented using an epson v500 photoscanner and annotated in adobe photoshop, version 7.1. each gel lane was then divided into 10 bands and placed into microcentrifuge tubes. in-gel tryptic digestion was carried out as previously described. separation of the digested peptides was performed using nanocolumns prepared in-house (75 m i.d. packed with jupiter c18 particles, 5 m, 300) connected to an agilent 1100 nanoflow lc system, which was used to deliver binary gradient solvents a (0.1% formic acid (fa) in water) and b (0.1% fa in acetonitrile). reversed-phase chromatography was performed by solubilizing the lyophilized tryptic peptides in 10 l of 0.1% trifluoroacetic acid and injecting 7 l of sample per analysis. after sample injection, a 20-min wash with 98% mobile phase a was used to remove any remaining salts from the sample. peptide elution was accomplished using a linear gradient of 2% solvent b to 42% solvent b over 45 min at a constant flow rate of 250 nl/min. the nanoflow reversed-phase lc column was coupled online to a linear ion trap mass spectrometer (ltq, thermoelectron) using the manufacturer s nanoelectrospray source with an applied electrospray potential of 1.75 kv and a capillary transfer tube temperature of 185 c. the ltq-ms was operated in a data-dependent mode where each full ms scan was followed by seven tandem ms scans in which the seven most abundant peptide molecular ions detected were dynamically selected for ms/ms analysis using a normalized cid energy of 35%. a dynamic exclusion of 60-s was applied to reduce redundant selection of peptides. the ms/ms spectra were analyzed using sequest (thermoelectron) against a combined uniprot nonredundant mouse proteome database containing 36,799 protein sequences. only peptides with conventional tryptic termini (allowing for up to two internal missed cleavages) possessing delta-correlation scores (cn)>0.08 and charge state-dependent cross-correlation (xcorr) criteria as follows were considered as legitimate identifications:>1.9 for+1 charged peptides,>2.2 for +2 charged peptides, and>3.1 for+3 charged peptides. a reverse-database search, performed using the respective databases, resulted in a calculated false-positive rate of<2% for all samples analyzed. ffpe and matched fresh-frozen mouse liver tissue stored for 30 days were extracted using protocol-1. the fresh liver tissue was completely solubilized in the extraction buffer (eb1) using extraction either on ice (protocol-1fi) or at elevated temperature (protocol-1fh). the quantity of protein solubilized in the buffer was designated as 100% protein recovery in table 1. ffpe mouse liver tissue extracted at atmospheric pressure (protocol-1a) resulted in a protein recovery of only 17%, and a large plug of remaining tissue was observed in the extraction vial. in contrast, when the extraction was performed at 40,000 psi (protocol-1p), the solubilized protein increased to 77% and only a small amount of tissue residue remained in the vial. ffpe and matching fresh-frozen liver tissue stored for 1 year were extracted using protocol-2. the fresh liver tissue was completely solubilized in the extraction buffer (eb2) when extracted at elevated temperature (protocol-2fh). the quantity of protein solubilized in the buffer was designated as 100% protein recovery in table 1. the advantage of using elevated pressure was again evident, as 79% of the ffpe liver protein was solubilized at elevated hydrostatic pressure (protocol-2p) while only 18% was recovered at ambient pressure (protocol-2a). ffpe mouse liver was homogenized in extraction buffer and heated with or without elevated pressure. fresh-frozen tissue was extracted either at atmospheric pressure using the indicated extraction condition or on ice for 2.5 h. protocol used for protein extraction (see materials and methods). tissue was heated at 100 c for 30 min; then the temperature was lowered to 80 c for 2 h. the amount of protein extracted from fresh frozen tissue was set to 100%. previous studies using ffpe tissue surrogates containing several proteins indicated that failure to completely solubilize the tissue surrogate led to extraction bias, such that the composition of the solubilized protein solution differed significantly from that of the original surrogate. the extraction bias became less significant as the percentage of total protein solubilized from the tissue surrogate increased. thus, the 4-fold improvement in protein solubilization realized when the extraction was performed at elevated pressure is likely to lead to a protein extract that more accurately represents the composition of the original ffpe tissue. further, the increased amount of recovered protein allows a greater number of analytical techniques to be performed. while most published proteomic studies of ffpe tissue analyze only a few thousand cells from microdissected tissue, the use of elevated pressure has the advantage of improving protein extraction from whole tissue sections. this ability is particularly useful in instances where tissue microdissection is not practical or when a more global proteomic analysis is desired. unbiased protein extraction and standardized protocols are particularly important with techniques such as reverse phase protein arrays (rppas), where the protein components of cell signaling pathways are quantified to direct clinical treatment of cancer. the 30-day-old ffpe mouse liver extracted at 40,000 psi (protocol-1p) exhibited a number of well resolved high and low molecular weight protein bands by sds-page, corresponding to 87% of those seen in the matched fresh-frozen tissue extracted on ice (figure 1, lanes 2 and 1, respectively). the ffpe samples extracted at ambient pressure (protocol-1a) contained relatively few well-resolved protein bands equivalent to 25% of those seen in frozen mouse liver (figure 1, lane 3). similar results were seen with 1-year-old ffpe mouse liver extracted at 40,000 psi (protocol-2p) with well resolved high and low molecular weight protein bands corresponding to 74% of those seen in the matched fresh-frozen tissue (not shown). when the extraction was performed ambient pressure (protocol-2a) this value 1d sds-page of fresh-frozen and ffpe mouse liver extracts: lane 1, fresh-frozen tissue (protocol-1fi); lane m, molecular weight marker; lane 2, ffpe tissue extracted with heat at 40,000 psi (protocol-1p); lane 3, ffpe tissue extracted with heat alone (protocol-1a). as top-down ms sequencing technology improves, the ability to extract and analyze intact proteins from ffpe tissue will become more important. top-down sequencing facilitates the measurement of combinations of modifications, such as phosphorylation and glycosylation, and the direct quantitation of specific protein isoforms and splice variants. few of these measurements are directly obtainable using bottom-up proteomic approaches in which proteins are digested into peptides. the ability to extract intact proteins from the seemingly inexhaustible source of ffpe tissues will increase the diagnostic and prognostic efficacy of proteomic-based biomarker discovery by allowing biomarker validation using orthogonal methods such as western blotting, immunohistochemistry, immunoassays, and structural and interaction proteomics. in this context, the>3-fold increase in the recovery of intact proteins from ffpe tissue achieved by using elevated pressure represents a significant breakthrough. ffpe and matched fresh-frozen liver tissue stored for 30 days were extracted using protocol-1. ffpe tissue was extracted at ambient pressure (protocol-1a) or 40,000 psi (protocol-1p), while the matched fresh-frozen liver tissue was extracted using protocol-1fi and protocol-1fh. the solubilized proteins were separated by 1d-page, and each gel lane was excised, digested with trypsin, desalted, and analyzed by lc-ms/ms. the total unique peptide and protein identifications for each tissue type and extraction condition are shown in table 1. ffpe tissue extracted with heat alone resulted in the identification of 5565 unique peptides and 3449 unique proteins. the addition of elevated hydrostatic pressure significantly improved both the number of unique peptides (9621) and proteins (5192) identified. the number of proteins identified from the high pressure-extracted sample was comparable to the number of unique proteins identified from fresh-frozen tissue, which ranged from 4932 for tissue extracted on ice to 4451 for frozen tissue extracted with heat (table 1). the ms results for the 30-day-old ffpe mouse liver extracted under elevated pressure (protocol-1p) and the matched fresh-frozen tissue extracted on ice (protocol-1fi) were searched using gominer, a gene ontology program. the percentages of nuclear, membrane, intracellular, and extracellular proteins identified in fresh-frozen and ffpe liver were virtually identical (figure 2a), as were the results for classification by biological function (figure 2b). gene ontology analysis of proteins identified by lc-ms/ms. proteins identified using fresh-frozen mouse liver (protocol-1fi) or ffpe liver extracted with heat and elevated pressure (protocol-1p) were categorized by subcellular localization (a) or biological process (b), using gominer gene ontology software. to address the effect of long-term storage of the ffpe specimens, the mouse liver samples were investigated after an additional 11 months of storage (1-year-old sample). ffpe tissue was extracted at ambient pressure (protocol-2a) or 40,000 psi (protocol-2p), while the matched fresh-frozen liver tissue was extracted at high temperature (protocol-2fh). the solubilized proteins were separated by 1d-page, and each gel lane was excised, digested with trypsin, desalted, and analyzed by lc-ms/ms. from the 1-d gel, we were able to identify 3492 nonredundant proteins in the 1-year-old ffpe liver extracted under elevated pressure, which was comparable to the 3415 nonredundant proteins identified in the matched fresh-frozen mouse liver extracted at high temperature. in contrast, only 107 unique proteins were identified in the ffpe tissue extracted at ambient pressure. figure 3 shows venn diagrams of the unique and common (overlapping) proteins identified in mouse liver tissue extracts prepared by different methods. figure 3a compares 30-day-old fresh-frozen liver tissue extracted on ice (protocol-1fi) versus 100 c for 30 min followed by 80 c for 2 h (protocol-1fh). figure 3b compares 30-day-old ffpe liver tissue extracted under pressure (protocol-1p) figure 3c compares 1-year-old ffpe liver tissue extracted under pressure (protocol-2p) versus matched fresh-frozen liver extracted at elevated temperature (protocol-2fh). notably, the common proteins, expressed as a percentage of either the ffpe or matched fresh-frozen mouse liver tissue, were 50% for all three tissue pairs. venn diagrams showing the number of unique and common proteins identified using lc ms/ms analysis: panel a, fresh-frozen tissue extracted on ice (protocol-1fi) or with heat (protocol-1fh); panel b, fresh-frozen tissue extracted with heat (protocol-1fh) and ffpe mouse liver extracted with elevated pressure (protocol-1p); panel c, fresh-frozen tissue extracted with heat (protocol-2fh) and ffpe mouse liver extracted with elevated pressure (protocol-2p). figure 4a is a pie chart showing the number of unique proteins identified by two or more fully tryptic peptides for 30-day-old ffpe mouse liver extracted under pressure (protocol-1p). the results reveal that 49% of the proteins were identified by two peptides, 51% were identified by three or more peptides, and 21% of the proteins were identified by five or more peptides. figure 4b shows similar results for 1-year-old ffpe mouse liver extracted under pressure (protocol-2p), with 57% of the proteins identified by two peptides, 41% by three or more peptides, and 15% identified by five or more peptides. these results are similar to those for the matched fresh-frozen mouse liver tissue (not shown). the complete list of peptides identified in the fresh-frozen and high-pressure-recovered ffpe tissue, with their corresponding xcorr values, can be found online (supporting information table 1). total number of unique proteins identified using lc-ms/ms by two or more unique, fully tryptic peptides in ffpe mouse tissue extracted with heat and elevated pressure (40,000 psi): a, 30-day-old ffpe mouse liver (protocol-1p); b, 1-year-old ffpe mouse liver (protocol-2p). virtually all protocols reported in the literature for the extraction of proteins from ffpe tissue use a variation of the heat-induced antigen retrieval technique developed by shi and taylor for the recovery of antigenicity in immunohistochemical studies. this method involves exposing ffpe tissue sections to a buffer solution containing a detergent and/or protein denaturant and elevated temperatures of 90120 c for a period of 1030 min. optimal antigen recovery varies with the host ffpe tissue, with each type requiring different buffers, ph values, buffer additives, and incubation temperatures. although the ffpe proteomic literature is still quite limited, it is not unreasonable to propose that the same situation applies to the proteomic analysis of ffpe tissues. elevated hydrostatic pressure is not a technique unto itself but rather an adjuvant method that can be applied to existing or future ffpe protein extraction protocols. while it remains to be shown that this method is useful with every tissue fixation and protein extraction protocol, elevated pressure acts through purely physical means and should be compatible with ffpe protein extraction buffers of any ph and containing any detergent, protein denaturant, or other additive. this should allow its integration into a wide range of protein extraction protocols for ms-based proteomics with little to no alteration to downstream sample preparation and analysis. this was demonstrated in this report by the successful application of elevated pressure to two very different published ffpe protein extraction protocols. an increase in pressure to 40,000 psi, to augment heat treatment, improved protein extraction efficiency from ffpe mouse liver tissue by approximately 4-fold and increased the number of unique proteins identified by up to 30-fold over the published methods used at ambient pressure. further, the tryptic digests of these pressure-extracted tissues resulted in protein profiles that more closely resembled those from matched fresh-frozen tissue when analyzed by lc/ms than did those extracted with heat alone, while maintaining a false-identification rate of<2%. the ability of elevated pressure to significantly improve the recovery of intact proteins from ffpe tissues over the use of heat alone has great potential for broad application to top-down proteomic studies for the identification of disease biomarkers.

formaldehyde-fixed, paraffin-embedded (ffpe) tissue repositories represent a valuable resource for the retrospective study of disease progression and response to therapy. however, the proteomic analysis of ffpe tissues has been hampered by formaldehyde-induced protein modifications, which reduce protein extraction efficiency and may lead to protein misidentification. here, we demonstrate the use of heat augmented with high hydrostatic pressure (40,000 psi) as a novel method for the recovery of intact proteins from ffpe mouse liver. when ffpe mouse liver was extracted using heat and elevated pressure, there was a 4-fold increase in protein extraction efficiency, a 3-fold increase in the extraction of intact proteins, and up to a 30-fold increase in the number of nonredundant proteins identified by mass spectrometry, compared to matched tissue extracted with heat alone. more importantly, the number of nonredundant proteins identified in the ffpe tissue was nearly identical to that of matched fresh-frozen tissue.

PMC3320745

pubmed-382

type 2 diabetes mellitus (t2 dm) is considered a major epidemic of this century. it is estimated that its prevalence will increase worldwide from 371 million people in 2013 to 552 million people in 2030. t2 dm is associated with accelerated progression of atherosclerosis, the major cause of vascular complications leading to increased morbidity and mortality. chronic, low-grade inflammation has been demonstrated to be involved in the pathogenesis of atherosclerosis in subjects at high risk to develop cardiovascular disease [37]. among immune cells infiltrating atherosclerotic lesions, polymorphonuclear neutrophil leukocytes with their products were reported to have an important role in the development and progression of atherosclerosis [811]. marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophil leukocytes from subjects with carotid atherosclerosis are active producers of different inflammatory mediators including the vascular endothelial growth factor (vegf). several environmental and genetic factors (i.e., hypoxia, hyperglycemia, oxidative stress, ischemia, and gene polymorphisms of vegf) influence plasma vegf levels [1216]. among several polymorphisms of the vegf gene, the rs2010963 (634c/g polymorphism of the vegf gene) and few others were reported to affect serum vegf levels [1315]. moreover, rs2010963 was demonstrated to be associated with several disorders, such as diabetic retinopathy, diabetic nephropathy, myocardial infarction, and impaired prognosis in patients with chronic heart failure [1315, 17]. despite these findings, however, data about vegf polymorphisms and their possible association with carotid atherosclerosis in patients with diabetes mellitus are limited [1820]. additionally, cimt is highly heritable and associated with stroke and myocardial infarction, making it a promising quantitative intermediate phenotype for genetic studies of vascular disease. the present study was thus designed to investigate the association between polymorphisms of the vegf gene (rs2010963) and the kdr gene (rs2071559) and markers of carotid atherosclerosis (such as carotid intima-media thickness (cimt), the number of affected segments of carotid arteries, and the sum of plaques thickness) in patients with t2 dm. the study protocol was approved by the slovene medical ethics committee in september 2010 (protocol number 128/09/2010). after an informed consent for the participation in the study this cross-sectional study included 595 subjects with t2 dm and 200 subjects without t2 dm (control group). they were selected among patients admitted to the diabetes outpatient clinics of the general hospitals murska sobota and slovenj gradec, slovenia. subjects in the control group were not allowed to have t2 dm, and they were the staff of the general hospital murska sobota. subjects with t2 dm and control subjects were excluded if they had homozygous familial hypercholesterolaemia or a previous cardiovascular event such as myocardial infarction or a cerebral stroke. all ultrasound examinations were performed by two experienced doctors blinded to the participants ' diabetes status. the cimt, defined as the distance from the leading edge of the lumen-intima interface to the leading edge of the media-adventitia interface, was measured, as described previously. plaques were defined as a focal intima-media thickening and divided into 5 types according to their echogenic/echolucent characteristics, as previously described. the interobserver reliability for carotid plaque characterization the genomic dna was extracted from 100 l of whole blood using a flexigene dna isolation kit, in accordance with the recommended protocol (qiagene gmbh, hilden, germany). for vegf rs2010963 polymorphism competitive allele specific pcr (kasp) was conducted on an abi step-one system (applied biosystems, foster city, ca). the reaction mixture (5 l) contained 2.5 l 2x kaspar reaction mix (v3), 0.07 l assay mix, 1.43 l of distilled water dnase/rnase-free (gibco, invitrogen life technologies), and 10 ng of extracted genomic dna (1 l). thermal cycling employed the following conditions: hot-start enzyme activation (15 min at 94c), denaturation (20 sec at 94c) followed by 10 cycles of touchdown over 6557c for 60 sec (dropping 0.8c per cycle), and final 26 cycles (20 sec at 94c and 60 sec at annealing temperature 57c). for rs2071559 (kdr) everything was the same with the exception of thermal conditions. hot-start enzyme activation (15 min at 94c) and denaturation (20 sec at 94c) were followed by 15 cycles of touchdown over 5565c for 60 sec (dropping 0.8c per cycle) and final 26 cycles (20 sec at 93c and 60 sec at annealing temperature 58c). in addition, the fasting serum vegf levels were analyzed in 70 subjects with t2 dm and in 33 subjects with t2 dm. for the determination of the fasting serum vegf concentration (isoform vegf 165), a solid phase sandwich elisa using two kinds of high specific antibodies (hvegf assay kit, ibl co., ltd. the respective cv (%) were between 3 and 5.5 for interassay measurements and between 2.6 and 5.3 for intra-assay measurements. continuous clinical data were compared using unpaired student's t-test or analysis of variance (anova). a statistical analysis was performed using the spss program for windows version 21 (spss inc., patients with t2 dm were older, had a greater waist circumference, and had higher fasting glucose and hba1c levels compared to controls, whereas there were no differences in bmi and systolic and diastolic blood pressure between patients with t2 dm and control subjects (table 1). patients with t2 dm had lower total, hdl, and ldl cholesterol levels and a higher triglyceride level compared to controls (table 1). plasma levels of inflammatory markers (i.e., hs-crp and fibrinogen) were higher in patients with t2 dm compared to controls (table 1). additionally, there was higher percentage of men, statin therapy, and antihypertensive therapy and lower percentage of smokers in t2 dm group compared to control group (table 1). the genotype distributions in both patients with t2 dm and controls were in hardy-weinberg equilibrium for both vegf gene polymorphisms [rs2010963: t2 dm (genotype frequencies: cc genotype 8.7%, cg genotype 47.1%, and gg genotype 44.2%; =3.48; p=0.06) and controls (genotype frequencies: cc genotype 9%, cg genotype 48%, and gg genotype 43%; =1.46; p=0.22)]. the genotype distributions in both patients with t2 dm and controls were in hardy-weinberg equilibrium for the kdr gene polymorphism [rs2071559: t2 dm (genotype frequencies: cc genotype 22.0%, ct genotype 51.9%, and tt genotype 26.1%; =0.97; p=0.33) and controls (genotype frequencies: cc genotype 30.0%, ct genotype 48.0%, and tt genotype 22.0%; =0.63; p=0.23)]. no statistically significant differences in the vegf rs2010963 and kdr rs2071559 genotype distribution frequencies were observed between t2 dm patients and controls. the observed minor allele frequency (maf) distributions were mostly in agreement with the 1000 genomes project data in the european population. the c allele frequency of the vegf rs2010963 showed no significant difference (p=0.79) between patients with t2 dm and controls (32.3% versus 33%). however, the c allele frequency of the kdr rs2071559 polymorphism was significantly lower (p=0.04) in t2 dm subjects as compared to the controls (49% versus 54%). higher vegf serum levels were demonstrated in subjects with t2 dm with the cc genotype (rs2010963) compared to those with other (cg+gg) genotypes (table 2). moreover, higher vegf serum levels were found in subjects with the cc genotype (rs2071559) compared to those with other (ct+tt) genotypes (table 2). the comparison of atherosclerosis parameters was performed with regard to different genotypes of the vegf polymorphism (rs2010963) upon enrolment. in our study, we did not demonstrate any association between the rs2010963 and either cimt, the sum of plaque thickness, the number of involved segments, hscrp or the presence of carotid plaques, or the presence of unstable carotid plaques (tables 3 and 4). we did, however, demonstrate an association between the rs2071559 and either cimt or the sum of plaque thickness in subjects with t2 dm (table 3). in our study, we demonstrated an association between the rs2071559 of kdr and cimt in subjects with t2 dm, whereas we did not demonstrate an association between tested polymorphism of vegf (rs2010963) and cimt. variations in the vegf gene were reported to be weakly associated with cimt. none of the single genotyped polymorphisms (2578a>c rs699947, 634c>g rs2010963, and+936c>t rs3025039) were significantly associated with overall imt in the study reported by kangas-kontio and coworkers. the haplotype ccc, however, was associated with higher overall cimt in women and the haplotype cct with higher cimt in the internal carotid artery in men. additionally, we also demonstrated an association between the rs2071559 of kdr and the sum of plaque thickness in subjects with t2 dm, whereas no association between tested polymorphism of vegf (rs2010963) and markers of carotid atherosclerosis was demonstrated. the rs2010963 polymorphism of the vegf gene was not demonstrated to exert a significant influence on the risk of subclinical atherosclerosis manifested by the presence of endothelial dysfunction by brachial artery reactivity and increased cimt in a series of patients with rheumatoid arthritis. contrary, the importance of vegf and its receptor (vegfr1) was reported by russell and coworkers. in unstable plaques (cap rupture/thinning) increased vegf and receptor (vegfr1) staining as well as increased microvessel density was demonstrated in comparison with stable carotid plaques. additionally, marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophils (pmn) from subjects with carotid atherosclerosis are active producers of vegf, il-8, and elastase. moreover, an evidence is provided that these pmn have an increased ability to produce vegf (at mrna levels) in comparison to cells from healthy subjects. additionally, increased vegf mrna occurs in both intraplaque and circulating pmn, at rest as well as after stimulation, suggesting that such functional changes are systemic and not limited to cells infiltrating the vascular wall. in contrast to these findings, we did not demonstrate an effect of vegf/kdr polymorphisms on the presence of either plaques or unstable plaques, since no difference in genotype distribution was present. in our study, the effect of either rs2071559 of kdr or rs2010963 on vegf serum levels was demonstrated. these findings are in accordance with our previous studies in which subjects with recent mi history (up to 9 months after mi) were enrolled [13, 16, 25]. moreover, increased plasma vegf levels demonstrated in the stable phase after mi correlated with inflammation cytokines (il-8 and il-6), but not with atherosclerotic burden. in contrast to the minor effect of the rs2071559 of kdr and the absence of the rs2010963 of the vegf, an association of either rs2071559 or rs2010963 with mi has recently been reported in caucasians with t2 dm [13, 16, 24]. our present findings and previous reports are additional evidence that markers of carotid atherosclerosis and atherothrombotic events (i.e., mi) are most probably not regulated via similar genetical/biological mechanisms. to conclude, in our study we demonstrated a minor effect of the rs2071559 of kdr on markers of carotid atherosclerosis (cimt, sum of plaque thickness) in subjects with t2 dm, whereas we failed to demonstrate an effect of tested polymorphism of the vegf gene (rs2010963) on markers of carotid atherosclerosis

background. the current study was designed to reveal possible associations between the polymorphisms of the vascular endothelial growth factor (vegf) gene (rs2010963) and its receptor, kinase insert domain-containing receptor (kdr) gene polymorphism (rs2071559), and markers of carotid atherosclerosis in patients with type 2 diabetes mellitus (t2 dm). patients and methods. 595 t2 dm subjects and 200 control subjects were enrolled. the carotid intima-media thickness (cimt) and plaque characteristics (presence and structure) were assessed ultrasonographically. biochemical analyses were performed using standard biochemical methods. genotyping of vegf/kdr polymorphisms (rs2010963, rs2071559) was performed using kaspar assays. results. genotype distributions and allele frequencies of the vegf/kdr polymorphisms (rs2010963, rs2071559) were not statistically significantly different between diabetic patients and controls. in our study, we demonstrated an association between the rs2071559 of kdr and either cimt or the sum of plaque thickness in subjects with t2 dm. we did not, however, demonstrate any association between the tested polymorphism of vegf (rs2010963) and either cimt, the sum of plaque thickness, the number of involved segments, hscrp, the presence of carotid plaques, or the presence of unstable carotid plaques. conclusions. in the present study, we demonstrated minor effect of the rs2071559 of kdr on markers of carotid atherosclerosis in subjects with t2 dm.

PMC4736196

pubmed-383

ulcerative colitis (uc) is characterized by chronic and relapsing inflammation of the intestines, resulting in diarrhea, abdominal pain, and a variety of other symptoms (1), and impacts negatively on the quality of life. huangqing-tang decoction, described by zhang zhongjing (150 to 219 a.d., in chinese eastern han dynasty), has been used for the treatment of uc disease for thousands of years. radix scutellariae and radix paeoniae alba are the key ingredient herbs present in this decoction, the combination of radix scutellariae and radix paeoniae alba (3:2 g/g) renders its features, such as the heat-clearing, antiinflammatory, antidiarrheic and antinociceptive effects. apparently, it is essential to study the synergistic interaction of radix scutellariae and radix paeoniae alba for elucidating the substantial foundation of huangqing-tang. radix scutellariae has been widely used in traditional chinese medicine (tcm) for the treatment of inflammation, fever, hepatitis, allergic diseases and hypertension, and is comprised of the flavonoids, baicalin (bg), wogonoside (wg), baicalein (b) and wogonin (w) as the active ingredients (figure 1) (24). to date, the pharmacokinetic (pk) profiles of bg and wg in plasma, brain and eyes of rats and rabbits have been reported (511). it is generally assumed that baicalin is poorly absorbed from the gastrointestinal tract in its native form and must be hydrolyzed by microflora enzymes (bacterial-glucuronidase) in gut to its aglycone-baicalein, then reconverted back to baicalin. similar to baicalin, wogonoside is also firstly metabolized by microflora enzymes and reconverted, and is subsequently excreted mainly in conjugated form following administration of radix scutellariae extract in rat and human. baicalin and wogonoside demonstrated bimodal phenomenon in the plasma profile (12, 13). after oral administration of baicalein, levels of baicalein were negligible, whereas the glucuronides/sulfates conjugates of baicalein were predominant in the plasma (14, 15). various case reports on herb drug interactions or herb herb interactions in-vivo have been published in recent years, in addition to some reports on the influence of disease condition on the pharmacokinetic characteristics of drug (1619).. a better understanding of the pharmacokinetics of herbal interactions and herbs in diseased rats would be helpful in formulating rational dosage regimens (20). however, to the best of our knowledge, there are no published studies reporting the pharmacokinetics of bg, wg, b, and w after oral administration of pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts to normal rats, let alone to uc rats. the syndrome of the trinitro-benzene-sulfonic acid)tnbs(-induced colonitis model is similar to the spontaneous uc. this animal model has been used extensively in studies of colonitis and its complications, including the altered drug pharmacokinetics under the colonitis conditions (2126). the aim of this study is to explore the pharmacokinetic differences of the four flavonoids after oral administration of pure baicalin, radix scutellariae extract and scutellariae-paeoniae couple extract to rats and to compare the pharmacokinetic parameters of uc rats with those of normal rats. materials and chemicals radix scutellariae, radix paeoniae alba were purchased from bozhou medicine company (anhui, china) and authenticated by prof. feng li from the college of pharmacy, university of traditional chinese medicine (liaoning, china). the voucher specimens (no.20081205, 20081211) have been deposited in liaoning university of tcm. zhenqiu zhang (dept. of chemistry in our institute, liaoning university of tcm). baicalin and wogonin were purchased from the national institute for the control of pharmaceutical and biological products (beijing, china). the solvents used for chromatographic analysis were hplc grade and were purchased from fisher company inc. deionized water was prepared in a mill-q academic water purification system (millipore, bedford, ma, usa). all the other reagents were of analytical grade and provided by kermel chemical co. (tianjin, china). apparatus and chromatographic conditions the concentrations of the four flavonoids in plasma were assayed using reverse-phase high performance liquid chromatography (agilent 1100 series) equipped with a variable wave length uv detector and pump (agilent model g1314a vwd). separation was accomplished on a eclipsel xdb-c18 column (250 mm 4.6 mm, 5 m particle size). the mobile phase was composed of acetonitrile (a): 0.1% phosphoric acid water (b) (0 10 min, 16: 84; 10 15 min, 22: 78; 15 25 min, 25: 75; 25 30 min, 34: 64; 30 50 min, 42: 58, v/v) at a flow rate of 1.0 ml/min with gradient elution. preparation of radix scutellariae and scutellariae-paeoniae couple extracts radix scutellariae and radix paeoniae alba were mixed in the ratio of 1.5: 1 g/g and the total weight was 200 g. the mixture was decocted twice by refluxing with 70% ethanol (1: 10 and then 1: 8 w/v) for 1 h, and the solution obtained was concentrated to give an extract of 60.5 g. radix scutellariae (200 g) was treated as above to provide an extract of 43.3 g. the dried powder was stored at 4 c before use. for estimation of the administered dose, the concentrations of baicalin, wogonoside, baicalein and wogonin in the extracts and pure baicalin the extract powder (0.10 g) was ultrasound with 100 ml 60% methanol for 30 min. the contents of bg, b, wg and w were determined to be 17.3, 7.6, 2.4 and 1.7% in scutellariae-paeoniae couple extract and 43.6, 19.1, 6.2 and 4.5% in radix scutellariae extract, respectively. male sprague dawley rats, weighing 250-280 g, were obtained from the experimental animal department of dalian university (dalian, china). animal welfare and experimental procedures were strictly in accordance with the guide for the care and use of laboratory animals (us national research council, 1996) and the related ethics regulations of liaoning university of tcm. rats were housed in an air-conditioned animal quarter at a temperature of 22 2 c and a relative humidity of 50 2%. the animals were acclimatized to the facilities for five days, and then fasted with free access to water for 24 h prior to each experiment. colitis was induced in rats according to the model and method described by morris et al. briefly, rats were lightly anesthetized with 10% chloral hydrate solution, and then a medical-grade polyurethane cannula for enteral feeding (external diameter 2 mm) was inserted into the anus and the tip was advanced to 8 cm proximal to the anal verge. shanghai, china.) dissolved in 100% ethanol was instilled into the colon through the cannula (at a dose 80 mg/kg). following the instillation of the hapten, the rats were maintained in a head-down position for an additional 30 sec to prevent leakage of the intra colonic instillation. successful replication of the model of uc was characterized by reduction in activities, apathy and occult blood in stool. biosample collection the uc rats were divided into three subgroups randomly, the pure baicalin, radix scutellariae extract and scutellariae-paeoniae couple extract subgroup. each group was respectively administrated an oral dose of 200 mg/kg baicalin (in the form of pure compound or co-administrated mixture, 0.21 g/kg pure baicalin, 0.46 g/kg radix scutellariae extract and 1.16 g/kg scutellariae-paeoniae couple extract), all of the compounds were suspended in water and homogenized using ultrasonic technology just prior to dosing. blood samples (0.5 ml) were collected into a heparinized tube via the oculi chorioideae vein before drug administration and at 0.083, 0.25, 0.5, 0.75, 1.0, 2.0, 4.0, 8.0, 12.0 and 24.0 h after drug administration, and were centrifuged at 4000 rpm for 10 min for the separation of plasma from the red blood cells. the supernatant was decanted carefully and was stored at 40 c until analysis. biosample preparation an aliquot of 15 l arctigenin (32.0 m in methanol) and 10 l hcl solution (0.1 mm) were added into 100 l plasma, and then spiked with methanol 75 l and acetonitrile 100 l by vortex mixing for 5 min. an aliquot of 50 l of the supernatant was injected into the hplc system. known amounts of baicalin, baicalein wogonoside, wogonin and is were added into 100 l of blank plasma to prepare the following series of standards. the calibration curves showed good linearity in the range of 0.12331.6 m for baicalin, 0.28873.6 m for wogonoside, 0.1338.50 m for baicalein, 0.0627.9 m for wogonin. the extraction recoveries and matrix effects at three quality control (qc) concentrations were assayed in sets of six replicates. the cvs of the recoveries were less than 20% at low concentration, and less than 15% at medium and high concentrations. accuracy and precision of the method were investigated by intra-day and inter-day data via comparing the mean of five replicates of each qc sample. the stabilities of baicalin, wogonoside, baicalein and wogonin were determined by analyzing qc samples at three concentrations exposed to encounter during sample storage. the corresponding relative errors were less than 6% for samples at three concentrations for each reference standard, respectively. results of the stability test showed that under the experimental conditions the samples were stable throughout the testing process. the plasma concentration vs. time data of baicalin and wogonoside were analyzed by non-compartmental model using the nonlinear least squares regression program winnonlin (scientific consulting inc., shanghai, china) were used to calculate the pharmacokinetic parameters, such as the area under curve (auc), the maximum plasma concentration (cmax) and the corresponding time (tmax), the half-life of absorption (t1/2), etc. statistical analysis of pharmacokinetic parameter estimates was performed using a two-tailed nonparametric t-test. chemical structures of arctigenin (a), baicalin (b), baicalein (c), wogonoside (d) and wogonin (e). the selectivity of the method was evaluated by analyzing blank plasma samples prior to administration. the chromatograms were free of interfering peaks at the retention times of is (34.5 min) and baicalin (20.6 min), wogonoside (25.9 min), baicalein (31.9 min) and wogonin (40.8 min). figure 2 showed the representative chromatograms of blank plasma sample (a), blank plasma sample spiked with baicalin, wogonoside, baicalein, wogonin and is (b), blank plasma sample spiked with is (c), plasma sample (1.5 h) after oral administration of scutellariae-paeoniae couple extract (d). under the established chromatographic condition, no interfering peaks were observed at the elution times of baicalin, wogonoside, baicalein, wogonin and the internal standard. chromatograms of blank plasma sample (a), plasma sample spiked with baicalin, wogonoside, baicalein, wogonin and is (b), plasma sample spiked with is (c), plasma samples 1.5 h after oral administration of scutellariae-paeoniae couple extracts (d). pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts to rats. the mean plasma concentration-time profiles and standard deviation in normal rats and uc rats following the administration of pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts are depicted in figure 3 (a) and 3 (b). pharmacokinetic parameters resulting from non-compartmental analysis are listed in tables 1 and 2. the plasma concentration time profile of baicalin (bg) and wogonoside (wg) after oral administration of pure baicalin (0.21 g/kg), radix scutellariae extract (0.46 g/kg) and scutellariae-paeoniae couple extract (1.16 g/kg) to normal (a) and ulcerative colitis (uc) (b) rats pharmacokinetic differences of baicalin after oral administration of pure baicalin (0.21 g/kg), radix scutellariae extract (0.46 g/kg) and scutellariae-paeoniae couple extract (1.16 g/kg of baicalin) to normal and uc rats mean sd, n=10;*p<0.05 vs. normal-rats pharmacokinetic differences of wogonoside after oral administration of pure baicalin (0.21 g/kg), radix scutellariae extract (0.46 g/kg) and scutellariae-paeoniae couple (1.16 g/kg) to normal and uc rats mean s.d., n=10;*p<0.05 vs. normal-rats following oral administration of pure baicalin (purity>95.5%) to rats, wogonoside was detected in all rats plasma in addition to baicalin, the plasma concentration was almost equal to that of baicalin. the same result was observed after oral administration of radix scutellariae extract (200 mg/kg of baicalin, 28 mg/kg wogonoside) or scutellariae-paeoniae couple extract (200 mg/kg of baicalin, 27 mg/kg of wogonoside) to rats. the present result suggested that baicalin might convert to wogonoside in the rat body. zhenyu zhu et al. (4) reported that they found a peak (named m) with a retention time of about 5 min at m/z 461 was similar to wogonoside (m/z 461) after oral administration of xiaochaihu tang and radix scutellariae extract to rats, which was possibly a methylated product of baicalin. methylation generally existed during the drug metabolism in-vivo, and due to the multiple hydroxyl groups on the baicalin benzene ring, the combination of a methyl group with a hydroxyl group was easy. so, we tentatively concluded that absorbed baicalin could be methylated to wogonoside in-vivo. following oral administration of radix scutellariae or scutellariae-paeoniae couple extracts to rats, baicalein and wogonin with very high concentrations were presented in rat tissues (28), however, in the present study, it was below the detection limit in all plasma samples collected for all rats. these results appeared to be consistent with previous reports (14, 15, 29, 30). as described in previous studies, baicalin firstly must be hydrolyzed to baicalein by -glucuronidase in-vivo, which was produced by both intestinal bacteria and intestinal epithelial cells (3134). thus, baicalin can first enter the intestinal wall as baicalein and is then reconverted to baicalin within the intestinal mucosa and thereby is absorbed into the blood. therefore, baicalin in plasma may be derived from both baicalin and baicalein in radix scutellariae or scutellariae-paeoniae. the doses of baicalin and baicalein in the extracts were summed to produce the sum dose of baicalin and baicalin which was used to calculate dose-normalized cmax and auc0-t. based on the similar chemical structure between wogonoside and baicalin, it is proposed that the transformation between wogonoside and wogonin are similar to that between baicalin and baicalein in the intestinal wall, the sum dose of wogonoside and wogonin was calculated in the same way. consequently, we could only detect baicalin and wogonoside, not baicalein and wogonin in plasma. as shown in figure 3 and table 1-2, the absorption speed of baicalin and wogonoside in the normal pure baicalin group was quicker than those in the normal radix scutellariae and scutellariae-paeoniae couple groups, tmax for baicalin were: (0.087 0.02) h, (0.27 0.03) h and (0.28 0.03) h; tmax for wogonoside were (0.11 0.02) h, (0.22 0.09) h, (0.21 0.08) h, respectively. but tmax of baicalin and wogonoside were little different among the three groups of uc rats. the pharmacokinetic profiles differences of baicalin and wogonoside were reflected in auc(0t) and cmax. following oral adminstration scutellariae-paeoniae couple extract to rats, cmax and auc(0t) of baicalin and wogonoside were higher than the other two forms (p 0.05). compared to the radix scutellariae groups, cmax and auc(0t) of baicalin and wogonoside in the pure baicalin groups were significantly lower (p 0.05). these chemical components might produce certain pharmacological effects and have impact on the pharmacokinetic profiles of baicalin and wogonoside. under the guidance of the theory of tcm, radix paeoniae alba, used as messenger herb and hematinic herb, could guide the bioactive ingredients of radix scutellariae to the proper tissues and exert a harmonizing effect, including the increase of absorption and bioavailability. radix paeoniae alba also could increase the absorption of baicalin and wogonoside through increasing the function of spleen and improving the patients digestive system vitality and immune system. thus, compared to pure baicalin and radix scutellariae extract, the cmax and auc(0t) of baicalin and wogonoside increased remarkably (p<0.05) when radix scutellariae was mix-decocted with radix paeoniae alba, in contrast, the absorption of pure baicalin was the least. the present study demonstrated that herb extract could enhance the bioavailability of baicalin and wogonoside in rat plasma, a significant drug-drug interaction may occur and improve the absorption of baicalin and wogonoside when radix paeoniae alba is administered in combination with radix scutellariae (35). either in uc or in normal rats, baicalin and wogonoside demonstrated bimodal phenomenon in rat plasma after oral administration of pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts (figure 3). the first absorption peaks occurred at about 0.15-0.27 h and the second was at about 8 12 h. the concentrations of the second peak (cmax) and the values of auc(0t) dose were lower than which of the first peak. the ability of rapid absorption of baicalin and wogonoside may result in the rapid appearance of the first peak. baicalin and wogonoside had double-site absorption kinetics, and baicalin and wogonoside undergo enteric circulation and enterohepatic circulation in rats after oral dosing, which may be responsible for the second peak. but they were always detected and kept their concentration at a certain range in plasma. free drug might bind with plasma protein when it reaches a certain concentration (19). wang et al. (36) reported that the binding rate of free baicalin with plasma protein could reach 80%. it was not able to maintain a high concentration for a long time because the baicalin would enter into the plasma and then bind with plasma protein. when the concentration of free baicalin decreased to a certain concentration, the bound baicalin would dissociate. comparative pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts between uc and normal rats from figure 4 and table 1-2, it was noteworthy that uc rats showed better absorption than normal rats, regardless of oral administration of pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts. the absorption speeds of baicalin and wogonoside were very rapid, tmax were approximately 0.13 h. tmax showed no statistically significant difference among the three groups of uc rats. cmax and auc(0t) of baicalin and wogonoside in uc rats were greatly higher than those in normal rats (p<0.05). after oral administration of pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts to rats, auc(0t) of baicalin were: (41.46 0.62), (59.12 6.42) and (104.87 0.86) (g/ml)h in uc groups vs (17.77 0.66), (28.04 4.06) and (49.01 4.61) (g/ml)h in normal groups; auc(0t) of wogonoside were: (40.86 5.31), (57.95 1.91) and (101.31 3.05) (g/ml)h in the uc groups vs (14.67 1.93), (22.89 3.17) and (40.35 4.96) g/ml/h in the normal groups, respectively. plasma concentration-time profiles of baicalin (bg) (a) and wogonoside (wg) (b) after oral administration of scutellariae-paeoniae couple extract (1.16 g/kg) to ulcerative colitis (uc) and normal rats the significantly higher cmax and auc(0t) of baicalin and wogonoside in uc rats indicated that ulcerative colitis had an influence on the pharmacokinetic characteristics of baicalin and wogonoside in pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts. several factors were likely to be involved in the alteration of the pharmacokinetic behavior of baicalin and wogonoside under the colitis condition, including -glucuronidase, udp-glucuronosyltransferase, mrp2, intestinal or hepatic metabolic enzymes and bile flow rate, etc. trinitrobenzene sulfonic acid (tnbs)-induced uc condition might alter the formation of glucuronide, glutathione, and sulfate conjugates which played an important role in the metabolism of compounds in rats (40-43). these factors may result in a higher exposure of baicalin and wogonoside after oral doses. as known that intestinal flora plays an important role in the absorption and reabsorption of baicalin and wogonoside, we hypothesized that intestinal bacteria in uc rats would be very rich which lead to increased -glucuronidase activity. thus, profound intestinal -glucuronidase activity due to the ulcerative colitis condition may have enabled the rapid conversion of baicalin and wogonoside to baicalein and wogonin which have the propensity to be absorbed more completely leading to higher baicalin and wogonoside exposure after oral administration relative to normal rats. the findings of this study demonstrated that the pharmacokinetic behaviors of baicalin and wogonoside were remarkably altered in uc rats. scutellariae-paeoniae couple extract may exert more effectiveness than pure baicalin or radix scutellariae extract. it proves the rationality of using scutellariae-paeoniae couple for the treatment of ulcerative colonitis disease. in summary, the results of the present study highlighted that drug drug interactions, herb drug interactions and herb herb interactions always existed and affected the pharmacokinetic behavior of herbal ingredients. statistically significant differences (p<0.05) in pharmacokinetic parameters of baicalin and wogonoside including cmax and auc(0t) were obtained among the rats orally administered pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts. the huge number of active ingredients in tcm made them suitable for multi-target actions. baicalin and wogonoside had a better absorption effect, which would improve the therapeutic efficacy. we need to take caution when extrapolating pk and exposure data from healthy animals to diseased animals in designing pharmacological studies.

the aim of this study was to investigate the pharmacokinetic profiles of baicalin, wogonoside, baicalein and wogonin after oral administration of pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts were administered and the pharmacokinetics profiles were compared between normal and ulcerative colitis rats. the plasma concentrations of the four flavonoids were determined by using a simple and rapid high-performance liquid chromatography method. all the rats were divided randomly into two groups (ulcerative colitis and normal groups). each group contained three subgroups: pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts subgroup. each group received oral administration of pure baicalin, radix scutellariae and scutellariae-paeoniae couple extracts at the same dose of 200 mg/kg baicalin. the results showed that wogonoside, possibily as a methylated product of baicalin, was found in plasma after oral administration of pure baicalin or formulas to rats. baicalin and wogonoside demonstrated bimodal phenomenon. baicalin and wogonoside in scutellariae-paeoniae couple extract had shown better absorption than which in pure baicalin and radix scutellariae extract. whether oral administration of pure baicalin, radix scutellariae or scutellariae-paeoniae couple extracts, ulcerative colitis rats showed better absorption than normal rats. for example auc(0t) of baicalin were: (41.46 0.62), (59.12 6.42) and (104.87 0.86) (g/ml)h in uc groups vs (17.77 0.66), (28.04 4.06) and (49.01 4.61) (g/ml)h in normal groups, respectively. the pharmacokinetics properties of the four flavonoids differed between ulcerative colitis and normal rats, including auc(0t) and cmax (p<0.05).

PMC3813259

pubmed-384

weekly creatinine clearance (wccr) and kt/v are well-known parameters reflecting dialysis dose and adequacy, and are applied to adjustment of the dialysis menu in each patient who undergoes peritoneal dialysis (pd). however, the limitations of these parameters in predicting survival and morbidity have been reported. moreover, the collection of urine and peritoneal effluent is cumbersome work not only for patients, but also for medical staff. estimated ccr (eccr) was proposed as an alternative marker for measured total ccr (tccr), because it is less expensive and time-consuming. but it was also reported that eccr calculated by the cockcroft-gault formula substantially overestimated the effect of age on creatinine excretion in pd patients. estimated glomerular filtration rate (egfr) is an alternative marker for measured gfr (mgfr), and it might be a possible indicator for prognosis in the general population without known cardiovascular disease, diabetes or kidney disease and in ckd patients included in the modification of diet in renal disease (mdrd) study. moreover, these prognostic features of egfr might be partially independent of mgfr. we reported that egfr was well correlated with tccr in pd patients by cross-sectional analysis. similar correlation of egfr with ccr was reported by khosla, et al., although the analyzed patients were restricted to the population with a difference between two measurements of ccr of less than 25%. to clarify the actual utility of egfr in peritoneal dialysis practice, we retrospectively collected the data from 21 pd patients at ja toride medical center for the period of one year. patients who underwent pd at ja toride medical center for one year or longer were enrolled in the study after their informed consent was obtained. pd patients with a treatment period of less than a year, and patients who underwent combined pd and hemodialysis (hd) therapy were excluded. to measure renal ccr, urine was collected for 24 hours (from the second voiding of the day before visiting the hospital to the first voiding on the day of visiting the hospital). pd effluent was also collected for 24 hours on the day before visiting the hospital to measure peritoneal ccr. the sum of the peritoneal and renal ccr was defined as the measured tccr. the serum, urine, and effluent cr were measured by the established enzyme method. the formula proposed by the japanese society of nephrology was applied for calculation of egfr as follows: egfr (ml/min/1.73 m)=194 serum cr age (0.739 in females) protein catabolic rate (pcr) was calculated by the formula proposed by teehan as follows: pcr (g/day)=6.25 (urinary urea excretion+peritoneal urea excretion+1.39+0.15+ 0.031 body weight in kg). pcr was normalized (divided) by the measured body weight (bw) and described as npcr (g/kg/day). according to the guidelines of the japanese ministry of health, labour, and welfare, informed consent of the patients the study protocol was approved by the ethics committee of ja toride medical center. the data are shown as means sd, unless otherwise specified. to observe the correlation of two sets of data, the pearson s correlation coefficients were calculated using excel 2007 (microsoft, redmond, wa, u.s.a.). as table 1table 1characteristics of the studied patientsmen/women16/5age (years)66.6 12.6 (4695)capd/apd13/8cause of ckddm7cgn7ns4others3treatment period of pd in months45.1 32.4 (14118)samples in the data analysis1145.4 1.5 (27) per patient shows, 21 patients met the inclusion criteria and were included in this study. the patients comprised 15 men and 6 women with an average age of 66.6 12.6 years (4695 years old), and their average pd period was 45.1 32.4 months (14118 months). their causes of ckd were diabetes mellitus (dm) in seven patients, chronic glomerulonephritis (cgn) in seven patients, nephrosclerosis (ns) in four patients, and others in three patients. continuous ambulatory pd (capd) was undertaken in 13 patients, and the other eight patients received automated pd (apd). during the period of one year from november 2010 to october 2011, 114 data sets of egfr and tccr from the 21 patients were suitable for data analysis. according to the analysis, egfr and tccr were correlated (r.=0.435 in figure 1figure 1egfr and tccr. the open circles in the plotted data were obtained from one patient who denied the habitual intake of creatine supplements, such as creatine monophosphate, but poorly complied with the diet therapy.). however, their correlation was less than that of a previous cross-sectional study (r.=0.836). unexpectedly lower egfr levels were observed in one patient (shown as open circles in figure 1). repeated counseling of the patient revealed that his diet fluctuated. as figure 2figure 2tccr-egfr difference and npcr (a) and total cr excretion and npcr (b) in one patient who showed fluctuating diet intake. more detailed data from the patient, exhibited as open circles in figure 1 are shown. variations in the difference between egfr and tccr were correlated with both total cr excretion and npcr. shows, tccr-egfr difference and total cr excretion were actually correlated with npcr in this patient. similar correlations were observed for the difference between egfr and tccr with total cr excretion (r.=0.821 in figure 3figure 3tccr-egfr difference and total cr excretion. differences between egfr and tccr were well correlated with total cr excretion in total samples.) and npcr (r.=0.636 in figure 4figure 4tccr-egfr and npcr. differences between egfr and tccr were correlated with npcr in total samples.) in all the data. total cr excretion and npcr were also correlated with each other (r.=0.516 in figure 5figure 5total cr excretion and npcr. total cr excretion and npcr were also correlated with each other in total samples.). the open circles in the plotted data were obtained from one patient who denied the habitual intake of creatine supplements, such as creatine monophosphate, but poorly complied with the diet therapy. tccr-egfr difference and npcr (a) and total cr excretion and npcr (b) in one patient who showed fluctuating diet intake. more detailed data from the patient, exhibited as open circles in figure 1 are shown. variations in the difference between egfr and tccr were correlated with both total cr excretion and npcr. tccr-egfr difference and total cr excretion. differences between egfr and tccr were well correlated with total cr excretion in total samples. total cr excretion and npcr were also correlated with each other in total samples. this retrospective study with the data collected for a year from 21 pd patients showed that the correlation of egfr with tccr was less than that of a previous cross-sectional study. the difference between tccr and egfr was mostly dependent on total cr excretion, as reported in pre-dialysis patients, but this has never been reported in pd patients. moreover, total cr excretion fluctuated according to the npcr. consequently, protein intake estimated by npcr may affect the difference between tccr and egfr. because creatinine is homogeneously distributed in the body water, serum creatinine level is determined by the balance of several factors, such as oral intake, generation in the muscle, intrinsic degradation (metabolic clearance) and clearance by peritoneal dialysis and the kidney (figure 6figure 6considerable factors determining serum cr levels. meats (per 100 g) generally contain 400460 mg of creatine and creatinine (see discussion for details).). the amount of creatinine obtained by oral intake is mainly dependent on the amount of meat, which generally contains 400450 mg of creatinine and creatine per 100 g, or more precisely, 1 mg of creatinine and 23 mg of creatine per 1 g of meat protein. actually, total cr excretion was well correlated with npcr in this study (figure 5). meanwhile, the cr generation rate in the muscle is relatively stable, because it is thought to be related to the muscle mass and activity. mainly affects the variance in urinary creatinine excretion, especially in the case of preserved residual renal function, which has a wider ranging capacity for compensation. consequently, the serum cr concentration and its calculation product, egfr, are supposed to be more stable parameters than ccr by diminishing the preserved capacity in small solutes clearance of the kidney. the increased difference between tccr and egfr in the higher pcr population could be explained by a similar reason, because pcr was positively correlated with total cr excretion. hence, serum cr and its calculation product, egfr, may be superior to ccr because they are less dependent on diet, unlike ccr. (per 100 g) generally contain 400460 mg of creatine and creatinine (see discussion for details). recently, it has been reported that egfr had a prognostic value for ckd-related complications, kidney failure, cardiovascular risk factors and mortality. it is possible that egfr has a similar independency and distinct feature as a predictive indicator even in pd patients. hence, the obtained value can fluctuate as a result of several factors, such as patient condition, diet and drugs, which means that mgfr should not always be considered a representative value or gold standard of renal function, or rather the preserved capacity of the kidney to maintain the serum level of creatinine within a certain range under conditions of fluctuating intake may be a more reasonable index for actual kidney function. although the peritoneal clearance of small solutes represented by creatinine should be taken into consideration in pd patients, egfr derived from serum creatinine, age and gender may diminish the compensatory fluctuation of small solute clearance in the kidney, and provide a more stable level in each pd patient. this feature may be valuable in routine clinical practice, and it is worth investigating the significance of egfr as a possible prognostic factor in pd patients, as reported in pre-dialysis patients ,. this study has some limitations. because the study design was a retrospective analysis at a single center, the patient characteristics were divergent with respect to pd modalities, exposure periods, residual renal function and adherence to diet therapy. in addition, the study population was small, and equal amounts of data were not collected for each patient. therefore, differences between individual patients and the entire study population could not be distinguished from the obtained data. however, fluctuating cr excretion was certainly observed not only in data from individual patient but in all collected data, as shown in figures 2, 3, 4, 5. this study revealed the practical profile of egfr, distinct from tccr, as a more stable marker for small solutes clearance by dialysis and the kidney. a more extended and longitudinal study will be needed to verify the actual value of egfr in pd practice.

objective: the usefulness of estimated glomerular filtration rate may not be restricted to pre-dialysis patients, since we reported that estimated glomerular filtration rate was well correlated with measured total creatinine clearance in peritoneal dialysis patients. to clarify the clinical usefulness of estimated glomerular filtration rate as a parameter for peritoneal dialysis adequacy, we retrospectively surveyed estimated glomerular filtration rate and total creatinine clearance in peritoneal dialysis patients treated at ja toride medical center. patients and methods: a total of 114 data sets of estimated glomerular filtration rate and total creatinine clearance from 21 pd patients treated at ja toride medical center were collected from november 2010 to october 2011. the patients consisted of 15 men and six women with an average age of 66.6 12.6 years (4695 years old). the average number of samples was 5.4 1.5 (2 to 7) per patient. results: the collected data showed less correlation of estimated glomerular filtration rate and total creatinine clearance (r.=0.435) than that of a previous cross-sectional study (r.=0.836). as reported in pre-dialysis patients, the differences between estimated glomerular filtration rate and total creatinine clearance were correlated with total creatinine excretion in urine and pd effluent (r.=0.821). the differences were also correlated with normalized protein catabolic rate, which was one of the main determinant factors for total creatinine excretion (r.=0.636). a similar tendency was apparently observed in one patient with poor compliance to diet therapy and fluctuating dietary intake. from the analysis of these data, serum creatinine seemed to fluctuate less possibly due to compensatory capacity of the residual renal function in small solute clearance. conclusions: consequently, estimated glomerular filtration rate was turned out to be a more stable parameter than total creatinine clearance, which might be a desirable feature in long-term follow-up of peritoneal dialysis patients.

PMC4309341

pubmed-385

mesenchymal stem cells (mscs), also referred to as multipotent mesenchymal stromal cells, have been a focus of recent research, partially because they are an extraordinary model for investigating the biological mechanisms that allow a cellular population to generate diverse cell types and because they are a potential tool in cellular therapies for several clinical applications. mscs can differentiate into mesenchymal lineages and secrete cytokines and growth factors with paracrine effects that favor the regeneration of damaged tissues [1, 2]. several studies have demonstrated that mscs possess an immunoregulatory function in vitro and in vivo and that this property suggests clinical applications in the regulation of immunocompetent cell responses [2, 3]. this review addresses current knowledge of the biological aspects involved in msc immunoregulatory capacity and the clinical focus of these characteristics that allows these cells to be used in the treatment of several diseases with an immune component involved. this review culminates with a clinical description of the diseases treated with mscs as a component of cell therapy procedures. mscs are adult stem cells that are initially isolated from bone marrow (bm) and can generate stromal bm components, such as adipocytes, reticular cells, and osteoblasts, whereas in conjunction with additional cellular components, mscs maintain hematopoiesis. mscs proliferate in vitro as adherent, colony-forming cells with a high capacity for self-renewal and proliferation [4, 5]. because there is no definite marker of mscs, the international society for cellular therapy has established minimum criteria that these in vitro cell populations must fulfill and certain characteristics to be considered mscs. the cells must be positive for cd105, cd73, and cd90, express low levels of mhc-i, and be negative for mhc-ii, cd11b, cd14, cd34, cd45, and cd31. additionally, these cells must be capable of differentiation into osteoblasts, adipocytes, and chondroblasts in vitro [5, 6]. mscs have been isolated from multiple tissues: skeletal muscle, adipose tissue (at), synovial membranes, dental pulp, periodontal ligaments, cervical tissue, menstrual blood, wharton's jelly (wj), umbilical cord (uc), umbilical cord blood (ucb), amniotic fluid, placenta (pl), and fetal tissues such as blood, liver, and bm [710]. in most cases, isolated mscs are heterogeneous in proliferation and differentiation, although all express the characteristic msc marker profile. mscs cultivated in vitro possess three biological properties that qualify them for use in cellular therapy: (a) broad potential of differentiation, (b) secretion of trophic factors that favor tissue remodeling, and (c) immunoregulatory properties. furthermore, mscs differentiate into different mesodermal lineages (adipocytes, chondrocytes, osteocytes, fibroblasts, and myocytes). because of this potential for differentiation, mscs were initially used in the treatment of imperfect osteogenesis and myocardial damage. the benefits observed in these initial cell therapy protocols were thought to be the result of osteogenic and myogenic differentiation. the current understanding is that, in addition to diverse mesodermal differentiation capacity, msc benefits arise primarily from the secretion of trophic factors and immunoregulatory capacity [13]. mscs profoundly affect immune response through their interactions with the cellular components of the innate (natural killer cells (nk)) and adaptive (dendritic cells (dcs), b lymphocytes, and t lymphocytes) immune system. msc immunoregulation can occur through cellular contact and/or the secretion of diverse factors [1317]. because of these properties, mscs can prevent the inappropriate activation of t lymphocytes and generate a tolerogenic environment during wound repair or stop an immune response during healing, thus contributing to the maintenance of immune homeostasis [2, 3]. below, we describe the immunoregulatory effects of mscs on specific immune cells with special emphasis on the effect of mscs on t lymphocytes because of their role as effector cells in many diseases with an immune component. the phases in which t cells are vulnerable to msc immunoregulation, recognizing from a biological perspective that there are no obvious limits between phases, are described below. t lymphocytes express and secrete molecules characteristic of this phase, such as cd25, cd69, cd38, cytotoxic t lymphocyte antigen-4 (ctla-4), and human leukocyte antigen-dr (hla-dr) and in addition the cytokines interferon- (ifn), tumor necrosis factor (tnf), and il-2, among others. currently, there are contradictory results regarding the effect of mscs on t lymphocyte activation. some studies have observed that bm-mscs prevent the expression of the early activation markers cd25 and cd69 in t cells stimulated with phytohemagglutinin (pha) [19, 20], whereas other studies describe no effect by bm-mscs on the expression of these molecules [16, 21]. such contradictory results may be because of differences in the population of t lymphocytes studied. with this understanding, the activation of peripheral blood mononuclear cells (pbmc) with pha in the presence of bm-mscs results in lower numbers of cd4 and cd8 that express cd25, cd38, and cd69. employing the identical model, contradictory results report that the activation of pbmc with antibodies in the presence of bm-mscs does not modify the expression of cd25 or cd69 in cd4 and cd8 populations. similarly, no change was reported in the expression of cd25, cd69, or ctla-4 in studies of populations enriched with cd4 and cd8 lymphocytes activated by alloantigens. however, a recent study using populations enriched with cd3 t lymphocytes activated with anti-cd2/cd3/cd28 in the presence of bm-mscs showed an increase in the expression of cd69 in cd4 and cd8 t lymphocyte populations. the effects of mscs on the secretion of cytokines by activated t lymphocytes are also described by contradictory results. some studies have demonstrated that the presence of mscs diminishes [14, 21] or increases [23, 24] significantly the secretion of ifn by activated t lymphocytes. nonetheless, it has been described that the effects of mscs on ifn secretion depend on the source of the lymphocyte population studied. in this study, the authors demonstrated that the activation of cd3 t lymphocytes with anti-cd3/cd28 in the presence of mscs from adipose tissue resulted in an increase in ifn, which was an effect that was not observed when pbmc were activated with the identical stimulus. our laboratory recently demonstrated that the activation of cd3 t cells with antibodies in the presence of bm-mscs, ucb-mscs, and pl-mscs also resulted in an increase in ifn in cocultures. this observed effect might be related to the generation of ifn-producing t regulatory cells (tregs). the effect of mscs on the proliferation of t lymphocytes is independent of the activation method. the first studies to analyze the effects of bm-mscs on the proliferation of t lymphocytes used irradiated mscs that were cocultivated with alloantigen-stimulated pbmc. these studies reported that mscs inhibited t-cell proliferation in a dose-dependent fashion [13, 16, 17, 19]. however, in addition to inhibiting alloantigen-induced proliferation, mscs can inhibit proliferation induced by polyclonal activators such as pha [14, 26] or anti-cd3/cd28 [21, 23, 24]. the immunosuppressive effects of mscs have been analyzed using total populations of pbmc and populations enriched in cd3, cd4, or cd8 lymphocytes. every case has demonstrated the capacity of mscs to diminish proliferation [13, 16, 17, 19, 21, 23, 24]. immunoregulation has been shown to be independent of the induction of apoptosis [16, 27] and is performed through mechanisms dependent and independent of cellular contact. among the secreted factors identified are transforming growth factor beta 1 (tgf1), hepatocyte growth factor (hgf), indoleamine-2,3-dioxygenase (ido), prostaglandin e2 (pge2), il-10, and hla-g5 [13, 17, 28], whereas programmed death-ligand 1 (pd-l1) and hla-g1 are involved in contact-dependent mechanisms (figure 1) [2830]. whether direct contact between mscs and t lymphocytes is necessary for the inhibition of t-cell proliferation remains controversial. some authors have suggested that mscs act via an immunosuppressive mechanism independent of cell-to-cell contact [31, 32], whereas others have indicated that contact is required for efficient immunoregulation [24, 2830, 33, 34]. however, the mechanism of msc immunoregulation appears to depend on cellular populations, mode of activation, and the presence or absence of cell-to-cell contact [23, 32]. (3) differentiation and effector function. upon activation by the presence of pathogens or signs of damage, helper t cells cd4 (th0) differentiate into one of the following subtypes, depending on the t-cell microenvironment: th1, th2, th17, or tregs. each population is characterized by the secretion of a set of cytokines whose function is essential to eliminate pathogens within the organism, resolve inflammation, and maintain immune homeostasis. several studies have suggested that mscs modulate the differentiation, function, and balance of these subpopulations and foster the development of an anti-inflammatory immune response (figure 1) [14, 28, 35, 36]. the activation of nave t cells (cd45ra) in favorable conditions for the induction of th1 or th2 and in the presence of mscs results in the inhibition of ifn secretion by th1 cells and the increase of il-4 secretion by th2 cells. furthermore, mscs inhibit the production of proinflammatory cytokines il-17, il-22, ifn, and tnf and the differentiation of nave cd4 lymphocytes to th17. additionally, mscs promote the secretion of il-10 and the expression of the foxp3 transcription factor, thus suggesting differentiation toward tregs (figure 1). similarly, in a murine model, the presence of mscs in the th1 and th17 differentiation processes favors differentiation to cd4cd25foxp3 tregs. this effect was not observed when mscs were added to cultures of mature th1 or th17 populations. these results indicate that mscs affect the differentiation and function of inflammatory t lymphocyte populations in their capacity to produce proinflammatory cytokines and also in the induction of a tregs phenotype. several studies have described the role of mscs in the induction of distinct tregs populations [14, 28, 3740]. in an initial study analyzing the participation of bm-mscs in the differentiation of tregs populations, maccario et al. observed that the presence of allogeneic and autologous mscs, with respect to the responder t lymphocyte population in mixed lymphocyte culture (cml), induced a significant increase in the cd4cd25 t lymphocyte population. however, only allogeneic mscs favored an increase in cd4cd25ctla-4 populations. in the same year, a different study observed that pbmc activation by il-2 in the presence of mscs increased the proportion of cd4cd25 t lymphocytes. subsequently, prevosto et al. showed that pbmc in coculture with bm-mscs generated a population of cells that could inhibit t lymphocyte proliferation induced by alloantigens or polyclonal activators (anti-cd3 or pha), and this effect required cell-to-cell contact. the authors observed that the increase in foxp3 mrna expression occurred only in the tregs populations derived from cd4 lymphocytes. mscs can induce and maintain the function and phenotype of tregs derived from cd3, cd3cd45ro, or cd3cd45ra t lymphocyte populations. beginning with a cd3 population, the authors also demonstrated that the presence of bm-mscs maintained foxp3 expression in tregs. furthermore, mscs can induce regulatory t type 1- (tr1-) like cells characterized by ifn and il-10 secretion. through an in vivo transplant-induced arteriosclerosis model (obstructed arteries), jui et al. demonstrated that the local administration of bm-mscs could prevent this pathology through a local increase in ifn and il-10. in a subsequent in vitro study, the identical laboratory demonstrated that bm-mscs favored the generation of tr1 lymphocytes with an il-10ifncd4 phenotype mediated by pge2 and ido (figure 1). msc participation in t lymphocyte subpopulation equilibrium has also been observed in human in vivo studies. patients who have received mscs for the treatment of gvhd show subsequent increases of cd4cd25foxp3 and tr1 populations and decreases of th17. similarly, the administration of mscs to patients with systemic lupus erythematous induced an increase in cd4cd25foxp3 tregs in the peripheral blood. increases in this tregs population have also been observed in kidney transplant patients, which were transplanted with autologous mscs. these cells are derived from bm-cd34 cells in vivo and from monocytes stimulated with il-4 and granulocyte macrophage colony-stimulating factor (gm-csf) in vitro. the primary function of dcs is to process and present antigens to virgin and memory t cells, although they also interact with other immune components such as b lymphocytes and nk cells. the individual dcs must mature to initiate an appropriate immune response, and during the maturation process, dcs increase the membrane expression of mhc-ii and t-cell costimulatory molecules cd80 and cd86. mscs can significantly reduce monocyte differentiation into dcs, affecting the upregulation of cd1a, cd40, cd80, cd86, and hla-dr (figure 2) [15, 37, 4648]. this reduction is performed through the secretion of factors [15, 46] and is a reversible process because these monocytes then differentiate normally at the removal of mscs. when immature dcs (idcs) derived from monocytes-msc cocultures were activated with lipopolysaccharide (lps) to induce their final differentiation, they expressed lower levels of the maturation marker cd83 and costimulatory molecules cd80 and cd86. however, spaggiari et al. showed that mscs do not affect direct lps-induced maturation of dcs in cocultures, because there was no change in cd80, cd83, and cd86 expression. these results suggest that mscs exert a strong inhibitory effect on the differentiation process from monocytes to idcs but not on the lps-induced maturation of idcs to mature dcs (mdcs). in addition, mdcs cocultured with mscs show a diminished expression of hla-dr, cd1a, cd80, and cd86, thus suggesting that mscs may push mdcs toward an immature state with a reduced stimulatory capacity (figure 2). additionally, mscs affect the secretion of several cytokines that are key to dcs maturation. aggarwal and pittenger observed that mscs inhibit the secretion of tnf by dcs activated by lps. the inhibition of tnf secretion by dcs inhibits their maturation, migration to the lymph nodes, and their capacity to stimulate alloreactive t lymphocytes, because of the alteration in the expression of several receptors that are necessary to capture and process antigens. mscs also inhibit the dcs secretion of il-12 [15, 47, 48]. the insufficient production of il-12 is associated with the induction of t cell anergy and tolerance [15, 26, 47]. human bm-mscs that act through notch can induce the differentiation of cd34 hematopoietic progenitors into a population of regulatory dcs with specific properties: (1) the expression of high levels of il-10 mrna and low expression of il-2 mrna; (2) the capacity to inhibit alloreactive t-cell proliferation and function; and (3) the capacity to induce tregs differentiation characterized by expression of foxp3 and tgf1 mrna (figure 2). nk cells are important in innate immunity and participate in the body's defenses against infections and cancer. nk cells perform their effector function through the secretion of cytokines, such as ifn, tnf, and gm-csf, and possess cytotoxic activity both spontaneous and antibody-dependent. nk function is regulated by the equilibrium of signals transmitted by activator and inhibitor receptors that interact with specific hla molecules on target cells. thus, hla-class i negative or hla-class i-mismatched cells represent potential targets of nk cells [27, 50]. mscs affect the phenotype, proliferation, cytotoxic potential, and cytokine secretion of nk cells (figure 2). when activated by il-2, nk cells secrete ifn, but when activated in the presence of mscs, ifn secretion significantly decreases. furthermore, nk cells activated by il-2 and alloantigens in the presence of mscs show diminished proliferation and lytic activity [16, 51]. il-15 is another cytokine that promotes the proliferation, survival, and effector function of nk cells, but through factor secretion, mscs can inhibit il-15 induced proliferation. however, mscs and nk cell contact are necessary to inhibit nk cytotoxicity in tumor cell lineages. few studies have analyzed the effects of mscs on b lymphocytes; however, mscs diminish b-cell proliferation by cell cycle arrest in the g0/g1 phase and not by inducing apoptosis. a recent study demonstrated that effect of msc on b lymphocytes proliferation with cpg is not direct and requires presence of cd3 t cells. mscs can also affect b-cell differentiation because igm, igg, and iga production are diminished [5356]. furthermore, mscs modify the chemotactic properties of b lymphocytes, because expression changes in their chemokine receptors including cxcr4, cxcr5, and ccr7 were induced by mscs. the first molecules described in the msc-mediated immunoregulation of alloantigen-activated t lymphocytes were tgf1 and hgf. both cytokines can independently diminish alloantigen-activated t lymphocyte proliferation, although proliferation can be partially reestablished through blocking with antibodies [20, 31]. tgf1 is involved in the msc-mediated generation of cd4cd25foxp3 tregs (figure 1) and in the decreased proliferation of nk cells. these results suggest that tgf1 and hgf, in addition to other mechanisms, participate in the suppression of msc-mediated proliferation in mixed lymphocyte culture (mlc). ido is an enzyme that catalyzes the conversion of the amino acid tryptophan to kynurenine. the inhibition of t lymphocyte proliferation is because of the exhaustion of tryptophan or the build-up of kynurenine. thus, the addition of exogenous tryptophan has been shown to reestablish alloantigen-activated t-cell proliferation in the presence of mscs. similarly, the addition of kynurenine to mlc inhibits proliferation without mscs, however such inhibition is lower when compared with that observed in cultures in the presence of mscs. the use of competitive inhibitors of ido reduces msc immunosuppressive effects on alloantigen-activated cd4 t lymphocytes. notably, the reestablished proliferation does not reach the levels observed in mlc without mscs, thus suggesting the presence and participation of additional mechanisms. the exhaustion of tryptophan by ido participates in the inhibition of th17 differentiation; however, this mechanism and the build-up of kynurenine are involved in the ido generation of foxp3 tregs. furthermore, ido is involved in the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs and also in the inhibition of maturation and functional activity of dcs (figure 2). pge2 is a lipid mediator derived from the conversion of arachidonic acid to prostaglandin through cox1 and cox2 enzyme action. these enzymes, with pge2, are constitutively expressed by mscs, although their expression increases in an inflammatory environment [14, 17]. pge2 has been shown to diminish proliferation, stimulate the secretion of il-4 and il-10, and promote cd4cd25foxp3 and il-10ifncd4 tregs differentiation (figure 1) [25, 59]. several studies have shown that pge2 is a msc effector molecule; synthesis can be blocked with indomethacin or ns-398, and activated t-cell proliferation increases, but not similar to levels observed of t-cell proliferation in absence of mscs [14, 17, 32, 60]. pge2 is involved in the decrease of differentiation of monocytes into dcs and the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs (figure 2). it has been reported that il-10 is expressed by human and murine mscs and that tlr3 ligand increases the il-10 secretion by human mscs. however, other authors have showed that murine [16, 63] and human mscs do not express il-10. despite these conflicting results, some studies have reported a high concentration of il-10 in the supernatant from cocultures of fetal or adult mscs and immune cells and their participation in the immunosuppression by mscs in such cocultures have been well demonstrated. in that regard, some authors have showed that cell-to-cell contact between bm-mscs and t cells appears vital in the concentration increase of il-10 in the supernatant [24, 38, 64]. participation of il-10 in bm-msc-mediated immunoregulation and in tregs generation has been demonstrated through the use of antibodies [17, 20]. il-10 downregulates th1 cytokine expression and can stimulate the expression and secretion of hla-g5, which is another important molecule in mcs-mediated immunoregulation. a recent study reported an increase in immunosuppressive capacity of cd4cd25 tregs cocultured with bm-mscs, which is due to a high expression of pd-1 on tregs stimulated by il-10 present in the coculture supernatant (figure 1). furthermore, il-10 is also involved in the decrease of maturation and function of dcs, inhibiting the ability of dcs to produce il-12 (figure 2). hla-g molecules are nonclassic hla molecules characterized by a limited allelic polymorphism and a tissue-specific expression pattern. there are membrane-bound isoforms (hla-g1, g2, g3, and g4) and soluble isoforms (hla-g5, g6, and g7). bm-mscs express the membrane-bound isoform hla-g1 and the soluble isoform hla-g5 [28, 30]; expression of both molecules is promoted by il-10. similarly, hla-g5 stimulates the secretion of il-10 in a positive feedback loop. the simultaneous use of antibodies against both molecules nearly reestablishes proliferation of alloantigen-activated pbmc in the presence of mscs [28, 67]. direct contact between mscs and t cells is required to establish the positive feedback loop and subsequent generation of an immunosuppressive environment, which is further exacerbated by the generation of the cd4cd25foxp3 tregs induced by both molecules (figure 1). galectins participate in the regulation of cellular homeostasis in both adaptive and innate immunity as immunostimulators or immunosuppressors. the silencing of galectin-1 expression using sirna or antibodies reestablishes proliferation of pbmc activated by mitogens or alloantigen, thus indicating that galectin-1 participates in msc immunoregulation. similarly, mscs express galectin-3, a molecule known to regulate t-cell proliferation, adhesion, and migration. the inhibition of galectin-3 expression in mscs with sirna reduces immunosuppressive capacity on alloantigen-activated t lymphocytes. the authors observed that mscs express higher levels of galectin-9 in an inflammatory environment, and through the use of antibodies, the authors described the participation of galectin-9 in the msc-mediated proliferation reduction of stimulated t and b lymphocytes [73, 74]. the following membrane molecules participate in msc-mediated immunoregulation: the pd-1/pd-l1 pathway, hla-g1, jagged-1, and adhesion molecules, such as intercellular adhesion molecule 1 (icma-i) and vascular cell adhesion molecule 1 (vcam-i) (figure 1). pd-l1 (b7-h1/cd274) and its receptor (pd-1/cd279) are components of a t lymphocyte costimulatory pathway that releases inhibitory and regulatory signals upon activation. the pd-1/pd-l1 pathway is activated in the event of a persistent antigenic stimulus, as occurs with self-antigens, chronic viral infection, or tumors. the activation of this pathway prevents autoimmunity and directly contributes to the immunosuppressive microenvironment observed in tumors through t-lymphocyte regulation. in murine models and human msc from pl, uc, and bm [34, 65, 77], it has been observed that ifn induce an increase of pd-l1 expression and has been demonstrated the participation of pd-l1 in msc-mediated immunosuppression of t cell proliferation through the use of monoclonal antibodies [29, 75, 76]. future studies will be necessary to determine the participation of pd-l1 expressed on mscs in the expression of foxp-3 in t cells. interestingly, an increase in the expression of pd-l1 receptor (pd-1) has been observed in activated cd4cd25 tregs cocultured with bm-mscs, which is associated with a high immunosuppressive capacity. the same increase in pd-1 was observed in cd4cd25 t cells, but in contrast with tregs, it is associated with apoptosis [65, 77]. demonstrated that the reduced proliferation in anti-cd3/cd28-activated t lymphocytes in the presence of mscs derived from bm or fetal liver was primarily driven by cell-to-cell contact and that mscs expressed higher levels of hla-g1 in coculture. furthermore, the use of antibodies specific to this molecule nearly reestablished t lymphocyte proliferation and reduced concentration of il-10 in cocultures, which shows the relevance of cell-to-cell contact. similar studies have reported the importance of cell-to-cell contact between mscs and t cells in such mechanisms [24, 38, 64]. it appears that cell-to-cell contact in cocultures promotes expansion of cd4 t cells which produce il-10 and increase the expression of cd210 (il-10 receptor, subunit a) on cd4 t cells but not on cd8 t cells and mscs. these results suggest that through cell-to-cell contact between mscs and t cells a population of t cells whose secreted products contribute to the immunoregulatory environment generated by mscs is formed (figure 1). the participation of the adhesion molecules icam-i and vcam-i has been demonstrated using antibodies against both adhesion molecules, which are expressed by mscs during t-cell immunoregulation. when icam-i and vcam-i were blocked in a mouse model, anti-cd3-activated splenocyte proliferation was partially reestablished. additionally, the expression of icam-i and vcam-i increased when mscs were exposed to ifn. these results suggest that mscs increase the capacity to recruit inflammatory t-lymphocyte populations and modulate its own function toward a regulatory phenotype as was demonstrated in the th17 population. furthermore, adhesion molecules could be involved in t-cells immunoregulation through induction of ctla-4 expression on t cells, which has been previously demonstrated [79, 80]. our laboratory recently demonstrated that cell-to-cell contact between activated cd3 lymphocytes and mscs from bm or ucb increased the expression of ctla-4 (figure 1). through different mechanisms it has been demonstrated that interaction between ctla-4 with cd80/b7-1 and cd86/b7-2 expressed in dc induces ido upregulation by dc. it is likely that a similar mechanism is present in cd4ctla-4 t cells generated in cocultures with msc [24, 37, 38]. this idea is supported by several evidences; activated t cells express cd80 and cd86, in particular the presence of msc induces increased expression of cd86 on cd4 t cells, and it has been shown that the interaction of these molecules with ctla-4 induced ido expression in cd4 t cells. the cell-to-cell contact between mscs and cd3 t cells is important in the immunosuppresion of b cells by mscs. this evidence suggest that inhibition of b-cell proliferation observed in cocultures with msc is dependent of soluble factors produced during cell-to-cell contact between t cells and mscs. another molecule involved in the inhibition of t lymphocyte proliferation is jagged-1, a notch ligand. because jagged-1 is expressed in mscs suggests that notch signaling is involved in msc immunosuppressive functions. showed that when jagged-1 was blocked by antibodies, the mscs inhibitory effects were decreased on a population of alloantigen-activated cd4 lymphocytes. many studies suggest that mscs and immune cells have established two-way regulatory mechanisms; thus, the activation of msc immunoregulatory properties requires the presence of derived proinflammatory cytokines from immune cells. similarly, as a result of this activation, factors secreted by mscs also regulate immune response. broad evidence demonstrates that this activation requires the presence of proinflammatory cytokines derived from t lymphocytes, macrophages, and nk cells, thus indicating that there are bidirectional regulatory mechanisms between mscs and immune cells. cytokines, such as ifn, are necessary in this process, either alone or in combination with tnf, il-1, il-1, or il-17 [14, 17, 85] (figure 2). the importance of an inflammatory environment for msc immunosuppressive capacity has been shown both in vitro and in vivo. the initial experiments indicated that when exposed to ifn, mscs induce the expression of ido [13, 17] and pd-l1 and increase the secretion of pge2 [14, 60]. similarly, the conditioned medium of msc- and il-15-activated nk cell cocultures can inhibit nk-cell proliferation, which indicates that this coculture activates msc immunoregulatory properties. other studies have shown that nk cells can produce ifn when they interact with mscs (autologous or allogeneic), and msc exposure to ifn increases the expression of hla-i in mscs, which reduces the secretion of cytokines and cytotoxic activity of nk cells (figure 2). this evidence suggests that bidirectional regulatory mechanisms drive the interaction between mscs and nk cells. mscs express nk receptor ligands, such as pvr, nectin-2 (nam-1 ligands), and ulpbs and mica (nkg2d ligands). because of these receptor-ligand profiles, it is likely that the interaction of nk cells and mscs (autologous or allogeneic) results in ifn production by nk cells, whereas this exposure of mscs to ifn increases hla-1 expression in mscs and other immunoregulatory molecules, thereby reducing the secretion of cytokines and nk cytotoxic activity. in addition to the abovementioned cytokines, a recent study reported that il-17 together with ifn and tnf increased inhibition of t-cell proliferation mediated by mscs, apparently through a synergic effect of the three cytokines, leading to a high expression of inducible nitric oxide synthase (inos). recently suggested that mscs are not fully immunoprivileged because of their capacity to activate cells of the immune system (nk cells, macrophages, etc.) and may even be rejected by such immune cells. thus, resting mscs are immunogenic and able to promote the secretion of inflammatory cytokines, which in turn induce msc to express and secret distinct immunoregulatory molecules, allowing them to evade the immune response. in this regard, it has been demonstrated that nave mscs or primed previously with inf plus tnf are able to decrease t-cells proliferation. however, nave mscs induce the secretion of inf and il-2 by activated t cells at two days of coculture and this is a cellular event prior to inhibition of proliferation. the authors suggested that unprimed msc transiently induce proinflammatory cytokines secretion, which promote the increase of their immunoregulatory capacity. in vivo studies in mouse models suggest that mscs are effective in the treatment, but not prevention of gvhd. the highest survival rates were obtained when mscs were administered when serum ifn concentrations peaked. the injection of mscs preactivated with high concentrations of ifn was effective in gvhd prevention and resulted in 100% survival. however, the injection of mscs with low concentrations of ifn did not increase survival. the administration of mscs to patients with steroid refractory gvhd significantly improved patient outcomes [89, 90]. however, when mscs were administered simultaneously with hematopoietic stem cells (hsc), there was no change in grade ii/iv gvhd incidence and a high incidence of relapse. toll-like receptors (tlrs) are expressed by many immune cells, and their principal function is to detect pathogens. the activation of tlrs is essential to initiate an innate immune response and supports the adaptive immune response. ten tlr types have been identified in humans and each recognize specific molecular patterns associated with bacterial, viral, or fungal pathogens. the signaling pathway common to all tlrs is the activation of nf-, which controls the expression of several inflammatory cytokines and the expression of maturation markers. mscs express tlr-2, 3, 4, 5, 6, 7, and 9, which are all functional (except tlr-9) because its activation results in receptor internalization and the activation of the nf-, mapk, and akt pathways [62, 84, 94]. an in vitro population enriched with alloantigen-activated cd4 lymphocytes cultured in the presence of poly(i: c) or lps-treated mscs, activated tlr-3 and tlr-4 in the mscs, thus inhibiting their immunosuppressive capacity. contradictory results by opitz et al. showed an augmentation in immunosuppressive capacity after tlr-3 and tlr-4 activation in mscs, which continued to inhibit t-cell proliferation, even in low msc: t cells ratio in cocultures. these contradictory results can be explained with additional evidence from tomchuck et al. who observed that tlr-3 activation in mscs supports the activation of the anti-inflammatory cytokines il-10 and il-12, whereas tlr-4 activation supports the secretion of proinflammatory cytokines. these results were corroborated by waterman et al. who reported that tlr-3 supported msc immunosuppressive effects, whereas tlr-4 supported proinflammatory effects. these authors proposed that mscs could be polarized to one of two phenotypes: proinflammatory or anti-inflammatory. each msc population may possess unique characteristics and differ in their secretion of cytokines, differentiation capacity, extracellular matrix deposits, tgf1-signaling pathways, and expression of jagged, ido, and pge2. a recent study demonstrated the secretion of proinflammatory cytokines by mscs upon activation of tlr-3 or tlr-4. similarly, most literature describing the molecules that participate in immunoregulatory mechanisms are specific to bm-mscs [8, 13, 14, 16, 17, 20, 28, 31, 32, 38]. few studies have used other sources such as pl [24, 76, 9799], ucb [24, 60, 98], uc [34, 98, 100102], at [8, 99, 101103], and wj [8, 98, 99, 101, 104] (table 1). immune cell studies that have used mscs derived from pl, at, ucb, wj, placental villi, amnion, and chorion have focused principally on t lymphocytes, one of the most studied cell types in msc immunoregulation [8, 24, 76, 97, 101103, 105111] (table 2). the search for alternative sources is particularly important not only because obtaining bm is expensive and invasive, but also because of reports that msc differentiation capacity diminishes as the individual ages [112, 113]. some reports have compared the immunoregulatory properties of mscs from different sources to determine which is the most viable for bm replacement. in this regard, our research group has demonstrated that mscs from bm and ucb, have identical immunoregulatory capacity. however we have shown, in the same way as other groups, that in contrast to bm-mscs, pl-derived mscs have a lower capacity [24, 107]. in fact, results relating to pl are contradictory between groups [76, 97, 99, 108]. in this regard, results of a preclinical study for treatment of 9 patients with grades iii-iv acute gvhd with pl-mscs showed complete and partial recovery in two and four patients, respectively. the inconsistency of the results observed in clinical application of pl-mscs could be related to the inconsistent results obtained in vitro by various groups. a different study comparing uc-, ucb-, pl-, and wj-derived mscs observed differences in the capacity to express hla-g or tgf1 after activation with ifn. there were no differences observed in ido secretion. screening for immunosuppressive factors in wj- and bm-mscs activated with ifn or tnf has indicated differences in the postactivation secretion of ido, hgf, and pge2, which may influence immunoregulatory properties. it is important to pursue comparative studies to determine whether mscs from alternative sources operate with the identical immunoregulatory mechanisms as bm-mscs, which are used in cellular therapy. these studies will be vital in determining alternative sources of mscs for their potential implementation at the clinical level. the use of stem cells to replace cells and tissues damaged by congenital or degenerative disease or trauma is called stem cell therapy. in such procedures, we previously outlined that mscs have three biological properties that make them potential candidates for this use: high differentiation potential, trophic factor secretion, and immunoregulatory capacity. mscs are potentially applicable to many diseases, such as gvhd, autoimmune diseases and bone, cartilage, and cardiovascular diseases. the beneficial effects of mscs administration regarding several of the aforementioned diseases have been analyzed in animal models and phases i, ii, and iii clinical studies have been initiated [115, 116]. in the following sections, we focus on the use of mscs in the treatment of immune-associated diseases with special emphasis on the treatment of gvhd. because of their immunoregulatory properties, bm-mscs have been applied principally in hsc transplants because mscs are capable of treating and preventing gvhd [89, 117119]. after hsc transplant, gvhd presents when donor t lymphocytes recognize patient hla molecules (alloantigen) as nonself and mount an immune response (allogeneic immune response). gvhd can be acute or chronic depending on the time of onset and intensity of tissue damage. acute gvhd (agvhd) appears within the first 100 days of the transplant, whereas chronic gvhd (cgvhd) has a later onset. although the exact pathophysiology is unknown, three phases are believed to describe agvhd onset: (1) the activation of host antigen presenting cells (apcs) by the transplant conditioning regimen (radiotherapy and/or chemotherapy); (2) the activation of t lymphocytes, which proliferate and differentiate in response to histoincompatible antigens presented by apcs; and (3) a cellular effector and inflammatory phase. the final phase is a combined effect of different sectors of the immune system (cytotoxic t lymphocytes and nk cells) and inflammatory cytokines (ifn, tnf, il-1, etc.), which together promote inflammation and tissue damage in various organs and can cause death. the first clinical trial evaluating the safety and effectiveness of mscs in the treatment of gvhd was performed by frassoni et al. who observed that the coinfusion of hsc and nonirradiated mscs from the identical donor reduced the incidence and severity of gvdh in recipients of an allograft from an hla-identical sibling. subsequently, le blanc et al. reported the case of a 9-year-old boy with steroid refractory agvhd grade iv who was treated with haploidentical mscs from his mother. approximately 70 days after treatment, the child had renewed symptoms of diarrhea and high levels of bilirubin. the administration of a second dose of mscs significantly improved the patient's condition, and he remained stable throughout the following 100 days. after this case, the identical group reported another study with the administration of mscs to 8 steroids refractory gvhd grades iii-iv patients. no toxic effects were observed, and survival was significantly improved compared to the control. in a multicenter phase ii study of 55 steroid a response was observed in 39 patients treated with mscs, of which 30 recovered completely and 9 partially recovered. survival was significantly improved in patients experiencing full recovery, and the mortality rate was significantly lower than that generally associated with the transplant. the authors suggest that the effect of the mscs was independent of the donor because mscs of hla-identical, haploidentical, and incompatible siblings had similar results. von bonin et al. treated 13 patients with steroid-refractory agvhd with different doses of mscs (15 applications) from unrelated donors that had been expanded in medium with platelet lysate. only 5 patients responded to treatment and only 4 were alive after 257 days of treatment. similarly, mller et al. reported the treatment of 5 children with acute or cgvhd. mscs doses were increased in accordance with cell availability from 0.4 10 to 3.0 10/kg. in addition, it has been suggested that the cotransplant of hsc and bm-mscs may prevent gvhd, but there is a high rate of relapse. however, a clinical trial with 37 children treated with multiple doses of bm-mscs for steroid-refractory grades iii-iv agvhd reported complete response in 24 children and partial response in 8 children. the contradictory results may be because of differences in the method of msc expansion, the number of cells administered, number of doses given, diagnosis of the recipient (chronic or agvhd), stage of gvhd development, and administration of mscs, among others. in attempts to eliminate some these variables, clinical studies have been performed with a universal bm-msc preparation, such as prochymal, which has rendered positive results in the treatment of gvhd. additionally, the effects of using alternative sources of mscs, such as fetal membranes or uc, have been studied. reported that, in steroid-refractory gvhd patients after msc infusion, a high frequency of cd4cd25cd127foxp3 and tr1 populations was detected. a decrease of th17 cells and no changes in the number of nk or b cells were observed. furthermore, the authors suggest an induction and maintenance of tregs, because high levels of il-2 were detected. in another similar study an increment of cd8cd28 and cd5cd19 populations and decrease of cd8cd28 and cd5cd19 b cells after bm-msc infusion in the responsive group the first two populations of t and b cells are related with the maintaining of peripheral tolerance or the induction of differentiation of tregs. similar results were obtained recently in 23 refractory cgvhd patients treated with mscs in which it was detected an increment in the population of cd19cd5il-10 b cells and a high plasma concentration of il-10. it is important to mention that it has been suggested that changes in the immune microenviroment in patients may promote the risk of infections. in this regard, a retrospective cohort study showed that treatment of gvhd with msc is a risk factor for pneumonia related death. furthermore, remberger and ringdn reported treatment with msc increment incidence of invasive fungal infections. finally, randomized phase iii trials are necessary to determine the effectiveness of mscs in gvhd. msc immunosuppressive capacity may be useful in the treatment of autoimmune diseases. in these pathologies, self-antigens are not tolerated, and the body mounts an immune response against its own tissues and organs. the resulting damage can be systemic (systemic lupus erythematosus) or targeted to a specific organ or tissue, such as the pancreas (type i diabetes), central nervous system (multiple sclerosis), or joints (rheumatoid arthritis) [131133]. animal models have demonstrated that msc treatment is effective in some of these conditions, several of which have also been clinical trials, as described below [132, 133]. systemic lupus erythematosus (sle) is a chronic autoimmune disease that affects connective tissue. clinical studies using allogeneic bm-mscs and uc-mscs [135, 136] to treat this disease have described positive outcomes and no severe side effect. in a multicenter study, 40 sle patients were intravenously transplanted with uc-mscs and total or partial clinical response was observed in 60% of patients. the beneficial effect of uc-msc administration is not permanent, because 29.2% of patients relapsed. although these results are interesting, it is important to mention that in the future a controlled and randomized study will be necessary to conclusively demonstrate the effectiveness of ucb-msc administration for sle treatment. although the mechanism through which msc improves patient condition is unknown, li et al. reported increase of cd4cd25foxp3 tregs in peripheral blood of refractory sle patients transplanted with uc-mscs, even after one month of treatment. additionally, a significant decrease of th17 cells since the first week and up to twelve months after transplant was observed. also, wang et al. detected an increase in ido activity after administration of uc-mscs in sle patients, evidenced by kynurenine concentrations. these results suggest participation of immunoregulatory mechanism regarding beneficial effects of msc administration in such patients. on the other hand, some reports have shown that bm-msc administration in murine model of sle do not decrease the levels of autoantibodies or the mortality rates. furthermore, using the same animal model, you d et al. reported that administration of allogeneic bm-mscs to prevent or treat sle enhances autoantibody production and even exacerbates the disease in both experimental conditions. also, a study carried out in two patients showed that administration of autologous bm-mscs increased peripheral blood cd4cd25foxp3 tregs cells, but no improvement was observed in patients. today, there are no clinical trials in progress to assess efficacy of msc transplantation in the treatment of lupus erythematosus [http://www.clinicaltrials.gov/]. type i diabetes is a chronic metabolic disease characterized by an autoimmune reaction against insulin-producing pancreatic cells. in vitro studies using cocktail of growth factors or genetic manipulation have shown that bm-mscs can differentiate into insulin-producing cells. however, such transdifferentiation capacity of bm-mscs into endocrine pancreas cells in animal models has yielded contradictory results and still remains elusive. nevertheless, in animal models have been demonstrated that mscs can revert type i diabetes, enhances insulin secretion and sustain normoglycemia. it has been proposed that such beneficial effects are mainly due to trophic factors and immunoregulators secreted by mscs and not to their differentiation capacity. in a clinical trial, the administration of insulin-producing cells derived of mscs from adipose tissue in 11 patients reduced insulin requirements over the first 2 to 4 months after intraportal infusion. in another trail, wj-mscs were administrated to 15 patients and a decrease in insulin requirements and blood glucose levels was observed even after 24 months of follow-up. however, it is thought that msc immunoregulatory capacity prevents the destruction of the -pancreatic cells rather than their differentiation capacity to regenerate cells. in that regard, intravenous administration of bm-mscs in a murine model of type 1 diabetes reversed hyperglycemia and improved pancreatic regeneration, which is associated with an increase of cd4cd25foxp3 tregs cells in spleen and pancreatic lymph nodes. similar results were obtained by intraperitoneal administration of mscs from at-mscs in mouse models, during early development of induced type i diabetes. increased secretion of insulin and decreased glucose levels in peripheral blood were observed but also inflammatory infiltrate in pancreatic islets. furthermore, a low frequency of cd4ifn and cd4tnf t-cells was observed in pancreatic lymph nodes (plns), and in contrast, a high frequency of cd4cd25foxp3 tregs, a decrease of ifn concentration and increase in tgf1 were observed in pancreatic tissue. additionally, cotransplantation with bm-mscs improves engraftment of pancreatic islets in humanized diabetic mouse model. normoglycemia was maintained during 4 weeks after transplant which show that mscs promote functionality of transplanted islets. the authors observed low infiltration by cd3 t cells in the transplanted tissue and increase of cd4cd25foxp3 tregs in peripheral blood. future clinical trials will be required to determine if such immunological mechanisms also occur in humans. currently, phases i, ii, and iii clinical trials are evaluating the efficacy of autologous bm-mscs [clinicaltrials.gov identifier: nct02057211, nct01068951, nct01157403] and uc-mscs in the treatment of type i diabetes [clinicaltrials.gov identifier: nct01374854]. two autoimmune diseases affect the central nervous system (cns): multiple sclerosis (ms) and amyotrophic lateral sclerosis (als). ms is a chronic inflammatory disease characterized by the loss of myelin and axon damage. several studies have demonstrated in murine models that msc has positive effects for prevention and treatment of both pathologies, but it is not known what mechanisms are involved in such process. although in vitro studies show that, in the appropriate culture medium, mscs differentiate into cell types with neuronal and glial characteristics, contribution of such mechanisms for in vivo tissue regeneration is controversial. in contrast, in vitro and in vivo studies have suggested that immunoregulation and trophic factor secretion are the main mechanisms used by mscs to improve the symptoms of ms and als [1, 147]. studies in a murine model with experimental autoimmune encephalomyelitis (eae) as a model for multiple sclerosis have demonstrated that the intravenous administration of bm-mscs improved the symptoms of the disease by decreasing central nervous system inflammation and demyelination. other studies have reported that, in eae mice that had received mscs, less infiltration by cd3 t cells and macrophages in csn was observed after pathological analysis. also, it has been detected low levels of il-17 and tnf in serum. observed that intravenous or intrathecal administration of bm-msc promotes generation of cd4foxp3 in cns and also an increase of il-17 mrna. furthermore, after administration of huc-mscs in a murine eae model, the improvement of disease activity is accompanied by an increase of cd4cd25foxp3 tregs and decrease of th17 in spleen, while in the spinal cord increased il-4 and il-10 and decreased il-1 and il-6 levels were observed. taken together, these results suggest that immunoregulation by mscs has a neuroprotector effect that reduces demyelization and axonal loss and therefore results in the improvement of eae symptoms. it is important to mention that in a recent study it was reported that bm-mscs transplanted in a murine eae model, cd8 t cell infiltrate was increased in cns, which exacerbated eae. the difference between these results could be due to disease mechanisms that underlie various models of eae. similarly, allogeneic mscs administration in murine models of experimental als showed an improvement in survival and motor function, in the spinal cord from msc-treated mice. intrathecal infusion of bm-mscs in a murine model of als delayed disease progression and prolonged survival. activated microglia secrete inflammatory molecules including tnf and nitric oxide that play an important role in als and administration of hmscs decrease microglial activation (cd11b cells) and concentration of tnf in the spinal cord. based on the positive results obtained in murine models, clinical trials have been carried out to determine safety and efficacy of mscs for the treatment of these pathologies. a clinical trial in which 34 ms and als patients received intrathecal or intravenous autologous mscs reported that msc administration was safe and had an immediate immunosuppressive effect that diminished inflammation. a study by mazzini et al. studied the direct application of autologous mscs to the spinal cord in als patients and reported that msc administration generated no adverse side effects and was safe; however there was no significant improvement in patients. currently, no study has shown an improvement in patient's condition by msc treatment; therefore, further clinical trials must be performed. several of such studies, analyzing the efficacy and safety of autologous or allogeneic mscs for the treatment of ms and als, are in progress [http://www.clinicaltrials.gov/]. rheumatoid arthritis (ra) is a chronic, systemic inflammatory disorder that primarily affects joints and results in bone and cartilage destruction. collagen-induced arthritis (cia) initiated in susceptible strains of mice by immunization with native type ii collagen serves as a model of human rheumatoid arthritis. several authors have used this animal model to analyze msc efficacy to improve the symptoms of this disease; however evidence remains equivocal as conflicting results have been reported. results in this animal model suggest that inflammatory microenvironment present in ra could reverse the immunosuppressive capacity of mscs. observed that msc administration does not improve the course of disease and in vitro experiments showed that tnf was responsible of reverse biological function of mscs. additionally, it has been reported that the intravenous administration of mscs has no effect on the progression of the disease or make ra worse. similar results were reported by papadopoulou et al. who observed immunoregulatory capacity of mscs in vitro, but in vivo, they lost this capacity when they are administrated in the inflammatory ra environment. in a recent study similar immunosuppressive capacity by synovium-derived mesenchymal stem cells (s-msc) from ar both mscs are capable of decrease proliferation of pbmc activated with pha or alloantigens from healthy donors and also of autologous synovial t cells activated with pha. however, when cocultures are added with exogenous il-17 and/or tnf, s-mscs from ar patients or healthy donors, they lost their immunoregulatory capacity. in addition, it has been reported that infusion of allogeneic-related hla matched or partially matched mscs does not affect ra development, while mhc mismatched mscs exacerbate the disease activity. in contrast to these results, other studies have shown that administration of syngeneic, allogeneic, or xenogeneic mscs improves ra in mice models. thus, gonzlez et al. showed that intraperitoneal administration of human at-mscs in mice with cia reduced the incidence and severity of disease. improvement of ra is accompanied by a decrease both in inflammation and proinflammatory cytokine secretion (il-1, il-12, il-17, tnf, ifn, etc.) and reduction in th1 and th17 numbers. in addition, in a ra murine model induced by antigens, intra-articular infusion of bm-mscs prevented cartilage damage reduced the inflammation and also decreased serum concentration of tnf. a few studies have been done to determine safety and efficacy of mscs administration to humans for the treatment of ra. a study carried out in four patients with refractory ra and treated with allogeneic mscs from bm (1 patient) or uc (3 patient) administered intravenously showed no adverse effects; however clinical remissions were not detected. in contrast, a clinical assay with 172 patients with active ra showed that uc-msc administration is safe and that the improvement in patients is accompanied by an increase of cd4cd25foxp3 tregs in peripheral blood and a decrease of tnf secretion. two phases i and ii clinical trials are currently performed to evaluate the efficacy of uc-mscs [clinicaltrials.gov identifier: nct01547091 and nct01985464]. bm-derived mscs have an immunoregulatory capacity because they can regulate the function of multiple immune system components. to fulfill this role, mscs must be activated by proinflammatory cytokines such as ifn. mscs can inhibit dcs maturation and thus prevent the activation of t lymphocytes and even more and decrease the proliferation and cytotoxic activity of nk cells. as a result of these characteristics, mscs are a promising alternative treatment for immune-related diseases. currently, mscs have been used in the treatment of autoimmune diseases, including gvhd, and have rendered positive results. despite this encouraging debut in clinical application, it is necessary to perform more clinical trials that extend the current knowledge of the biology of msc immunoregulatory activity to optimize and control the patient's immune response for maximum benefits. these studies will be relevant to clinical decisions in the treatment of gvhd, autoimmune diseases, and other illnesses with an immune component, such as cancer, in which mscs play an important role in the tumor microenvironment that favors growth as our group has previously demonstrated.

mesenchymal stem cells (mscs) are multipotent cells capable of differentiation into mesenchymal lineages and that can be isolated from various tissues and easily cultivated in vitro. currently, mscs are of considerable interest because of the biological characteristics that confer high potential applicability in the clinical treatment of many diseases. specifically, because of their high immunoregulatory capacity, mscs are used as tools in cellular therapies for clinical protocols involving immune system alterations. in this review, we discuss the current knowledge about the capacity of mscs for the immunoregulation of immunocompetent cells and emphasize the effects of mscs on t cells, principal effectors of the immune response, and the immunosuppressive effects mediated by the secretion of soluble factors and membrane molecules. we also describe the mechanisms of msc immunoregulatory modulation and the participation of mscs as immune response regulators in several autoimmune diseases, and we emphasize the clinical application in graft versus host disease (gvhd).

PMC4417567

pubmed-386

preeclampsia is a disorder affecting 5 to 10% of pregnancies and is clinically characterized by new-onset hypertension and proteinuria. despite significant progress in our understanding of preeclampsia, there is a need for a reliable diagnostic biomarker for use in clinical practice. in the search for a biologically plausible biomarker, there have been attempts to reconcile clinical findings with pathologic changes in renal biopsies of preeclampsia. for example, renal pathology of preeclampsia in the kidney is classically described as endotheliosis, or swelling of endothelial cells in the glomerulus. the podocyte, a specialized visceral epithelial cell that lines and forms the slit diaphragm of the glomerular basement membrane, has traditionally been thought to be unaffected. however, more recent microscopic studies demonstrate that podocytes are structurally changed and harbor protein resorption droplets. furthermore, there is evidence that selected podocyte-specific proteins such as nephrin, synaptopodin, and glepp-1 are downregulated in preeclampsia, while vegf and flt-1 are increased [2, 3]. studied the use of podocytes in the urine (podocyturia) as diagnostic markers and found podocyturia to be highly sensitive and specific for preeclampsia. we sought to study the use of podocyturia to diagnose preeclampsia and differentiate it from other conditions that may have a similar presentation in a high risk pregnancy population. furthermore, podocyturia was found frequently in other high risk pregnancy states such as chronic hypertension and gestational diabetes. we recruited two groups of patients all 18 years of age: uncomplicated pregnant subjects (control group) and women at risk for pregnancy complications (high-risk group) as described below from the obstetric inpatient service at jacobi medical center, bronx, ny, usa. random urine samples inclusion criteria for high-risk group were diagnosis of preeclampsia, chronic hypertension (htn), gestational htn, type i and type ii diabetes mellitus (dm), gestational dm, mixed connective tissue disease, and pregnancies with fetal chromosomal abnormalities. exclusion criteria were patients under the age of 18 and absence of the above-mentioned diagnosis. inclusion criteria for the control group were uncomplicated pregnancies and deliveries and absence of the above-mentioned high risk pregnancy states. exclusion criteria for the control group were<18 years of age, preexisting high risk pregnancy states or complicated deliveries. diagnosis of preeclampsia fulfilled the criteria of new onset of htn with blood pressure of 140/90 mmhg after 20 weeks of gestation and proteinuria of>300 mg of protein in a 24-hour urine specimen or 1+protein on a urinalysis sample without evidence of another cause, such as urinary tract infection or inflammation. chronic htn was defined as preexisting htn or blood pressure of 140/90 mmhg before 20 weeks of gestation. gestational dm was defined as any degree of glucose intolerance with onset of first recognition during pregnancy. this study was approved by the internal review board of albert einstein college of medicine. urinary protein was quantified either from a 24-hour urine sample collection or extrapolated from a random urine dipstick. for example, when only a dipstick urine protein was available, the value was extrapolated to a 24-hour value based on the following: negative protein corresponds to less than 150 mg/24 hours, trace protein corresponds to 150 mg/24 hours, 1+corresponds to about 200500 mg/24 hours, 2+to 0.51.5 g/24 hours, and 3+to 25 g/24 hours. twenty ml of freshly voided urine was centrifuged at 700 g for 5 min. the sediment pellet was carefully recovered by aspirating the supernatant, washed twice with pbs and resuspended in 1 ml of pbs. aliquots of 100 l of the resuspended sediment were centrifuged onto slides using the shandon cytospin 4 cytocentrifuge (thermo electron corporation, asheville, nc), air-dried and fixed with 1: 1 acetone/methanol for 10 minutes. the slides were immersed with pbs/1% h2o2 for 15 minutes and washed with deionized water. subsequently, antigen retrieval was achieved by steam-heating in a solution of citrate buffer, ph 6.0, for 15 minutes and blocked with 10% horse serum in pbs and 2% bsa. slides were incubated overnight with monoclonal mouse antihuman synaptopodin antibody at 1: 1 dilution (gift of dr. peter mundel, massachusetts general hospital, boston, ma) followed by horse anti-mouse igg at 1: 1000 dilution (dako inc. sections were then incubated in avidin-biotin complex at 1: 25 dilution (vector labs, burlingame, ca) and developed using diaminobenzidine (dab) as chromogen. difference in clinical variables between more than two groups was determined by kruskal-wallis method, differences between two groups were determined by mann whitney method. analyses were performed with stata version 8.2 and graphpad prism version 5.02 for windows software, and results were considered statistically significant if p<0.05. for test characteristics of podocyturia, sensitivity, specificity, positive predictive value, and negative predictive value were calculated for each high risk diagnosis. the diagnoses at time of urine collection were as follows: preeclampsia (n=28), eclampsia (n=1), chronic hypertension (n=3), gestational hypertension (n=6), type i dm (n=1), type ii dm (n=1), gestational dm (n=4), connective tissue disorder (n=1), marginal previa (n=1), chromosomal anomaly (n=1), and uncomplicated pregnancy (n=9). the clinical characteristics of all subjects are described in table 1. podocyturia (figures 1(a) and 1(b)) was present in 11 out of 29 (38%) patients with preeclampsia/eclampsia, 3 out of 9 (33%) with chronic and gestational htn, and 3 out of 6 (50%) with gestational dm and type i/ii dm (table 2). among patients categorized as, 2 (marginal previa and chromosomal anomaly) out of 3 patients exhibited podocyturia (66%). in contrast, 0 out of 9 patients (0%) with uncomplicated pregnancies demonstrated podocyturia. based on these findings, we calculated the sensitivity and specificity of podocyturia for preeclampsia to be 38% and 70%, as compared to women of htn of any type, in whom it was 33% and 66%, respectively (table 3). the sensitivity and specificity for dm of any type were 50% and 68%, respectively. the positive predictive value was 57% for preeclampsia, as compared with 15% for both htn of any type and dm of any type. the negative predictive value, however, was poor for preeclampsia at 51%, as compared with 83% and 91% for htn of any type and dm of any type, respectively. podocyturia is well described in many glomerular diseases such as type i dm, iga nephropathy, lupus nephritis, and membranous nephropathy [5, 6]. though endothelial injury is thought to be the main lesion in preeclampsia, more recently, derangements of the podocyte with downregulation of selected podocyte-specific proteins in renal biopsies and presence of nephrin and podocalyxin (podocyte specific proteins) in the urine have been described [2, 7]. in this study, we sought to describe the presence of podocyturia in preeclampsia and other high risk pregnancy states using the podocyte marker synaptopodin for identification. though the exact reason for this discrepancy is unclear, immunofluorescent staining of podocyte-specific proteins, in general, does not appear to be an accurate tool to identify podocytes, as these podocytes may be parietal in origin and may also be apoptotic. thus, the utility of urinary podocytes to detect ongoing glomerular damage in women with preeclampsia as previously suggested is unclear. furthermore, our study showed presence of podocyturia in other high-risk pregnancy states such as dm (gestational or type this finding is not unexpected since podocyturia and urinary podocyte mrna have been described in nonpregnant diabetic patients and in nonpregnant hypertensive patients respectively. interestingly, the number of urinary podocytes has also shown a statistically significant correlation with blood pressure but not proteinuria in preeclampsia. though podocyturia might help shed light on the pathophysiology of preeclampsia, we feel that its clinical utility is limited. both cytospin methods (as was performed in this study) and cultivation of podocytes in culture are fraught with difficulties and are not cost-effective. it may not be easy to eliminate podocyte cell debris when counting podocytes from cytospin specimen of fresh sediment. growing urinary podocytes in cell culture, on the other hand, are frequently limited by bacterial or fungal contamination as the urine may not have been collected under sterile conditions. furthermore, these cells may proliferate, undergo apoptosis, or not attach to the culture dish, thereby falsely representing the true podocyte count. interobserver bias poses yet another obstacle as it requires a highly trained cytologist to correctly identify these cells. since clinical guidelines are available to diagnose preeclampsia, some have questioned whether the addition of a urinary marker is necessary. we feel that the utility of this marker becomes important when the diagnosis of preeclampsia is in question and when the clinical scenario is complicated by the presence of preexisting htn, dm, or other glomerular diseases such as lupus nephritis. in those cases, thus, a specific marker that is discovered through our understanding of the pathophysiology of preeclampsia remains crucial. our goal was to confirm the previously shown high sensitivity and specificity of podocyturia in preeclampsia. though a larger sample size would be ideal, we feel that of our total sample size of 56 with 29 patients diagnosed with preeclampsia/eclampsia, and 18 patients with other high-risk diagnoses, is an adequate sample size to demonstrate that podocyturia lacks sensitivity and specificity to be a diagnostic marker of preeclampsia. we discovered that podocyte loss is present not only in preeclampsia but in other high risk pregnancy states. in addition, podocyturia was not found in a majority of patients diagnosed with preeclampsia. however, our findings raise an important note of caution of relying on the limited findings in the literature regarding the predictive value of podocyturia in preeclampsia and encourage larger studies. given our current knowledge of the complex pathophysiology of the disease such as the significant role of vascular endothelial growth factor (vegf) signaling in maintaining a healthy endothelium and cross talk between the podocyte and vascular endothelial cell, it is unlikely that any single test or cell type will be able to predict preeclampsia.

urinary podocyte (podocyturia) has been studied as a diagnostic marker for preeclampsia. we sought to validate its use in preeclampsia and in differentiating it from other high risk pregnancy states. we studied an obstetric population at high risk to develop preeclampsia (study group) and uncomplicated pregnancies (control group) by analyzing their urine sediment for podocytes within 24 hours of delivery. podocytes were identified by immunohistochemistry using the podocyte-specific protein synaptopodin. of the 56 patients who were enrolled, 29 patients were diagnosed with preeclampsia, 9 patients had hypertensive conditions such as chronic and gestational hypertension, 6 patients had type i/ii and gestational diabetes mellitus, 3 patients were classified as others, and 9 patients exhibited uncomplicated pregnancies. podocyturia was identified in 11 out of 29 (38%) of patients with preeclampsia/eclampsia, 3 out of 9 (33%) with gestational and chronic hypertension, and 3 out of 6 (50%) with type i/ii and gestational diabetes mellitus. none of the 9 patients (0%) with uncomplicated pregnancies demonstrated podocyturia. the sensitivity and specificity of podocyturia for preeclampsia were found to be 38% and 70%. our study showed that podocyturia does not appear to be a sensitive nor a specific marker to diagnose preeclampsia.

PMC3432873

pubmed-387

illness is a challenge to our physical, psychological and spiritual wellbeing that has repercussions on our identity and our social context. in a pathogenetic approach, diagnostic tests are used to look for the underlying disease and treatments are aimed at removing it. a person is considered cured when the disease is no longer detectable and agreed parameters have normalised. however daily clinical practice is characterised by people who suffer from chronic illness where there is often a discrepancy between their biochemical results and the way they feel. good or even normal parameters do not necessarily correlate with a good perceived state of health, and vice versa. health is therefore a concept that goes beyond the absence of disease to include physical, mental and social wellbeing. salutogenesis, developed by antonovsky in the 1970s, looks at what generates health by exploring the reasons why some people stay healthy in the face of hazardous influences whilst others, faced with the same hardship fall ill. antonovsky s research shows how adverse events and stress can become the opportunity to generate health if certain personal characteristics are present. resilience to difficult situations depends on a person s sense of coherence (soc), a global orientation towards life that is based on self-reliance in the face of challenges, self-confidence in one s ability to deal with demanding events and the trust that difficult events hold meaning for one s life [2, 3]. there is a growing body of research on all age groups [46], different socioeconomic backgrounds and across cultures that shows how a strong soc is related to better health, healthier ageing [812] and is a protective factor against alcohol addiction despite similar rates of recreational consumption in teenagers. conversely, a weak soc is related to poorer health and lower mood [4, 5]. although soc develops naturally in the first 30 years of life it is not a static orientation. it can be strengthened through personal activity and care [4, 14]. a dynamic, personally driven element that can change through activity and care it is not the absence of hardship or disease that determines health but our ability to deal with them positively and assign meaning to them. health is not a steady state, effortlessly maintained once it has been achieved, but an active process of continuous adjustment, a subtle equilibrium between our physiological, psychological and spiritual integrity and the outer or inner influences that can strengthen or undermine this. the concept of health as a state of complete well-being advocated by the declaration of alma ata, becomes health as the ability to adjust and self-manage in the face of physical, emotional or personal challenges. a salutogenetic healthcare system needs to be oriented in such a way that illness is considered an adverse event that can become the foundation for better future health. methods need to be adopted that allow the ill person to be treated in all their characteristics and in context. each medical intervention should aim to strengthen soc and a person s physiological, psychological and spiritual resilience. the increasing prevalence of chronic diseases, the very different but constant environmental challenges faced by people in the developing and developed world alike, provide us with constant salutogenetic opportunities. person-centred medicine (pcm) takes into account the physical, psychological and spiritual aspects of a person in health and illness in order to individualise health promotion practices, diagnosis and treatment. it broadens the technological advances of biomedicine with the epistemological approach, the relationship-based care and the salutogenetic treatments of non-conventional medicine. complementary and alternative medicine (cam) and traditional medicine (tm) are grouped together as cam/tm or non-conventional medicine (ncm). the term includes a variety of different medical systems and healthcare methods whose roots lie in different philosophical backgrounds and cultural origins. although very different from one another, they all share a holistic view of the human being as a physical, psychological and spiritual entity. they value the complexity of natural phenomena and study the relationship between the human being and nature in health and illness. their treatment systems are based on knowledge, skills and practices that restore health and encourage the self-healing abilities of the human being. they advocate respect for the dignity of every person and promote responsibility for keeping healthy at individual and community levels. this holistic, person-centred, salutogenetic approach is the reason for the growing interest in all forms of ncm by patients and healthcare workers alike. salutogenetic healthcare practices are personalised using the principles and methods of person-centred medicine. in salutogenetic healthcare the caregiver-person relationship each professional role needs to be developed to provide salutogenetic care from as early as undergraduate training. in order to have a person-centred approach, technological proficiency, solid grounding in evidence-based medicine (ebm) and knowledge of international protocols need to be complemented by knowledge of the epistemological systems and practical tools of ncm. doctors and other healthcare workers are then encouraged to the use their clinical judgment as the final decision-making tool. clinical judgment is central to the role of the doctor and their professionalism and can be strengthened and developed to become an accurate decision-making tool. this complements the application of ebm and protocols, which are based on large numbers and therefore not always applicable to particular cases. following protocols ensures a basic standard of care that has lead to improvements in safety on a large scale. however following them automatically can lead to repetitive, monotonous practice which in turn can lead to errors as well as frustration and dissatisfaction both on the part of the healthcare worker, who feels like a generic cog in a smooth machine, and the patient who does not feel personally addressed. on the contrary, assessing and treating each person in their physical, psychological and spiritual uniqueness, encourages active personal involvement on the part of the both healthcare worker and the patient. the use of sound clinical judgment allows personalisation of guidelines and protocols to each case. moreover, learning and teaching about salutogenetic practices may mean that healthcare workers adopt healthier lifestyles for themselves. greater work satisfaction and active involvement strengthen a healthcare worker s resilience and soc, ultimately improving their health as well as that of their patients. with this person-centred method, any treatment is chosen as the result of an informed choice that takes all aspects of the person into consideration. for any therapeutic process to become a salutogenetic experience, physical as well as psychological, social and personal factors need to be addressed at the appropriate time with attentive care to the physical emotional and spiritual needs of the person. the patient needs to be able to rely on the doctor or the team who take responsibility for their treatment and recovery. during rehabilitation or at other times during the process there may be a chance to bring the experience to greater consciousness, to explore the reasons that led to the event and the things that could be changed in order to prevent similar episodes from happening again. all this works towards developing an awareness that overcoming this difficult experience was meaningful because it allowed the development of new life skills, new coping strategies, and new confidence in one s own healing abilities. this change needs to be sustained over time with appropriate follow-up as habits are difficult to change and may slip if they are not followed closely and encouraged over time. in order to evaluate the success of medical interventions broadened with a salutogenetic approach, parameters need to be developed and integrated into the current evaluation systems. they need to have a suitable epistemological basis, a methodological approach that considers the value of small numbers, individual cases and clinical judgement. salutogenetic parameters such as the quality of life of patients and caregivers, sustainable change, treatment satisfaction, job satisfaction and prevention of burn-out need to be assessed as well as cost-effectiveness and technological excellence. health education is both a therapeutic intervention and the key form of disease prevention in salutogenetic healthcare. it should take place at population levels, in primary care, in hospitals, as part of any rehabilitation process, in schools and families. environmental obstacles that prevent people from adopting healthy lifestyles should be removed as far as possible. the ottawa charter advocates the implementation of eight conditions that should underlie any change in health. these are peace, shelter, education, food, income, a stable eco-system, sustainable resources, social justice, and equity. at the same time, individuals need to be encouraged to actively increase control over their health in order to improve it. to reach a state of complete physical, mental and social well-being, an individual or group must be able to identify and to realize aspirations, to satisfy needs, and to change or cope with the environment. encouraging locally sourced, high quality foods, encouraging biodiversity and fair-trade, has positive effects on the sustainability of primary resources and the stability of the eco-system as well as people s health. in order to be adopted by individuals in their lifestyles, there should be variations between the diet of a child and that of an elderly person, of an office worker compared to that of a builder, the diet of someone who suffers from inflammatory illnesses compared to that of someone who suffers from cancer, the diet of the same person when they are well or ill. if diet were a better used resource in healthcare and people were taught its principles and practical applications, this may decrease the need to use medication in some cases. altered sleeping patterns, eating rhythms and patterns of physical activity are both a measure and a cause of pathology and health. variable shift workers have a higher degree of stress, of alcohol misuse and increased use of neuroleptic drugs compared to their colleagues with regular working patterns. many others have altered eating rhythms as they skip meals, or constantly pick at food during the day. it is important for people to become aware of their own biorhythms, which alter with age, gender, state of health, personal and constitutional characteristics. with the help of education, improved environmental conditions and appropriate care during illness, people can adjust or at least compensate for altered biorhythms and therefore actively improve their health. chronic stress can strengthen or weaken a person depending on how strong or weak their resilience and soc are. chronic stress has been shown to be greater risk factor for developing ischaemic heart disease than hypertension or hypercholesterolaemia. emotions can have adverse effects on the incidence of complication and prognosis during an acute event. apart from reducing known risk factors and encouraging positive emotions, we can strengthen emotional resilience and soc through artistic activity in the form of painting, music, dance, drama, creative writing. a study carried out in sweden showed how music therapy improved quality of life and soc in a group of elderly people. through artistic activities people learn new skills and their achievements have a positive effect on their self-esteem. this can be applied to overcome future challenges or unknown life-situations with strengthened soc. the initial steps towards a salutogenetic healthcare reform, are to broaden undergraduate training and to develop pilot projects in the fields of health promotion and salutogenetic rehabilitation. the person and the caregiver-person relationship needs to be placed at the centre of the therapeutic process through the principles of person-centred medicine both in education and in practice. caregivers need to be given the tools to consider the person in all their aspects and characteristics through the adoption of the epistemological basis of ncm that broadens the technological advances of biomedicine. medical interventions should not only be aimed at removing the disease but also at improving health by strengthening a person s soc and their resilience at physical, psychological and spiritual levels. reasons for illness can be explored during rehabilitation. through health promotion programmes, during rehabilitation, in education, people are taught how to take better care of themselves by adopting individually tailored, healthier lifestyles better suited to their own physiological, emotional and personal needs. active involvement needs to be encouraged both on the part of the to patient and healthcare giver, the use of clinical judgment needs to be taught. methods for the scientific investigation of effects on small numbers or single cases need to be included in the evaluation of a person-centred, salutogenetic healthcare system alongside ebm.

the purpose of this review is to discuss how a salutogenetic approach that takes into consideration the human being as physical, psychological and spiritual entity may provide some answers to the difficulties faced by healthcare systems. the choice of medical intervention needs to take into account the technological advances of biomedicine but tailor them to the physical, psychological and spiritual needs of the patient in the context of their biography. such person-centred medicine aims to strengthen antonovsky s concepts of resilience and sense of coherence with each therapeutic intervention so that overcoming illness becomes the foundation for better future health. appropriate evaluation parameters need to be developed and included in order to evaluate the success of interventions in a person-centred, salutogenetic system.

PMC3405411

pubmed-388

macroautophagy (abbreviated as autophagy) is a genetically regulated and evolutionarily conserved pathway for the degradation of subcellular components [15]. this process involves the de novo formation of cytoplasmic double membrane-bound vacuoles termed autophagosomes, which sequester cytosolic cargo for delivery to the lysosomes [5, 6]. autophagic cargoes may include various subcellular targets typified by ubiquitin-modified or long-lived proteins and major cytosolic organelles (e.g., mitochondria and peroxisomes) [79]. however, a number of other potential substrates have been identified, including lipids, nucleic acids, reticulocytes, and invading pathogens (e.g., intracellular bacteria, viruses, etc.) [7, 10]. the autophagic pathway proceeds through several defined steps: (i) the initiation phase involving the formation of an isolation membrane or phagophore, (ii) the elongation of the phagophore, (iii) the maturation of an autophagosome with assimilation of a cytosolic cargo, (iv) the fusion of the mature autophagosome to the lysosome, and finally (v) the degradation phase where the contents are digested by lysosomal proteases (e.g., cathepsins) and other hydrolytic enzymes [15] (figure 1). autophagy has been recognized as an essential function for cell homeostasis and adaptation to environmental stress conditions including nutritional starvation, energy depletion, endoplasmic reticulum stress, oxidative stress, and hypoxia [1114]. furthermore, autophagy plays a vital role in innate and adaptive immune mechanisms, including resistance to pathogen infections [10, 15, 16]. the role of autophagy in diseases is an emerging area of investigation, with recent studies indicating that autophagy may exert multifunctional roles in specific diseases, with the potential for both adaptive and maladaptive outcomes. furthermore, deficiency or absence in autophagic function may also contribute to the pathogenesis of human diseases [2, 12, 1719]. the occurrence of autophagy in response to environmental stress, most notably starvation, is generally regarded as a cell survival mechanism [2022]. due to the often coincident appearance of morphological and biochemical markers of autophagy in cells that are dying, the relationship between autophagy and cell death has been both extensively studied and speculated upon [2326]. autophagic cell death to describe a form of caspase-independent necrosis-like cell death associated with accumulation of autophagosomes in cells. this classification is now controversial, and the casual relationship between autophagy and cell death remains unproven [25, 26]. nevertheless, many studies have pointed to intimate relationships between autophagy and cellular death programs, which are not yet fully understood. recent studies have also examined potential cross-talk between the signaling pathways that regulate autophagy and those that regulate distinct forms of regulated cell death such as apoptosis. the major types of cell death which have been studied most extensively in the context of autophagy research include apoptosis, necrosis, necroptosis, and pyroptosis, as briefly summarized here. apoptosis denotes a regulated form of cell death that requires the coordinated action of proteases and nucleases within an intact plasma membrane. morphological characteristics of apoptosis include dna fragmentation, plasma membrane blebbing, cell shrinkage, and cellular decomposition into membrane-bound apoptotic bodies which are removed by phagocytosis [3033]. the cardinal biochemical features of apoptosis include mitochondrial dysfunction, respiratory chain inhibition, loss of inner mitochondrial membrane potential (m), increased mitochondrial membrane permeability, and externalization of phosphatidylserine [3033]. apoptosis has a crucial function in the maintenance of tissue homeostasis under physiological conditions and also serves as a component of developmental programs and furthermore may also contribute to disease pathogenesis. (mitochondria-dependent) apoptotic pathway represents a major mechanism by which exposure to harmful extracellular stimuli triggers apoptosis. this pathway is dependent on a proteolytic activation cascade for both regulation and execution (i.e., caspases) and subject to regulation by bcl-2 family proteins. the extrinsic apoptotic pathway, which shares common downstream features with the intrinsic pathway, is defined by its dependence on receptor-ligand (e.g., fas-fas ligand) interactions for initiation. necrosis is a type of cell death that results from acute, accidental, or nonphysiological injury [3033]. this type of cell death is associated with cell lysis as the consequence of membrane damage and subsequent leakage of cell constituents into the extracellular space, which may lead to local inflammation and damage to the surrounding tissue. in certain cases, cell swelling or oncosis may precede necrosis. necrosis and apoptosis differ in morphological features, though the two processes are not necessarily mutually exclusive. both apoptosis and necrosis can occur in response to treatment with many injurious stimuli, usually in a dose-dependent fashion. many agents that cause apoptosis at low to moderate doses may ultimately cause necrosis at relatively higher doses. a number of endogenous events can determine the balance between apoptotic and necrotic death. cellular energy charge (i.e., atp levels) whereas atp is required for certain steps of caspase activation, rapid decline of cellular atp levels typically leads to necrotic cell death. the existence of necrotic cell death pathways regulated by an intrinsic death program distinct from that of apoptosis has also been proposed. necroptosis, that resembles necrosis has been described [34, 35]. in this form of regulated necrosis, the ligand binding of death receptors such as the tumor necrosis factor receptor 1 (tnfr1) can promote the formation of a macromolecular complex (necrosome), involving the receptor-interacting protein (rip) kinase-1 and kinase-3 that initiate necrosis [36, 37]. increasing evidence affirms the relevance of this mode of cell death in the pathogenesis of various diseases [3842]. pyroptosis represents a form of cell death that is triggered by proinflammatory signals and which is associated with inflammation [32, 43, 44]. this type of cell death occurs primarily in inflammatory cells such as macrophages and may be triggered by bacterial or pathogen infections. caspase-1 is responsible for the maturation of proinflammatory cytokines such as il-1 and il-18 through inflammasome-dependent pathways cell death occurs as a result of membranous pore formation and cytoplasmic swelling and leakage of cytosolic contents. similar to apoptotic cells, pyroptotic cells may also display dna fragmentation and nuclear condensation. the molecular machinery of autophagic regulation is the subject of recent reviews [45, 46]. subsequent to their identification in yeast, a number of critical autophagy-related genes (atg) have been identified whose gene products regulate distinct steps in the induction or progression of autophagy [45, 46]. in brief, the autophagy pathway responds to regulation by nutrient status, including nutrient deficiency (starvation) and loss of energy charge. starvation induces autophagy through the inhibition of mammalian target of rapamycin (mtor), which resides in a multiprotein complex, mtorc1. in response to stimulation by nutrients or growth factors, mtorc1 negatively regulates a macromolecular substrate complex that includes ulk1, atg13, atg101, and fip200 (rb1cc1), which results in autophagy suppression [4854]. energy depletion, which stimulates autophagy, inhibits mtorc1, in part through activation of the amp-dependent protein kinase (ampk), leading to the activation of ulk1, an important initiating step in autophagy [47, 55, 56]. autophagy is also coregulated by a multiprotein complex consisting of beclin 1 (homologue of yeast atg6), which associates with class iii phosphatidylinositol-3-kinase (vps34) and a number of additional stimulatory or inhibitory coregulatory proteins (e.g., atg14l, uvrag, ambra1, and rubicon). in response to proautophagic stimuli, the increased production of phosphatidylinositol-3-phosphate (pi3p) by this complex regulates autophagosome formation [57, 58]. the beclin 1 complex is subject to negative regulation by the pi3 k/akt pathway as well by binding interactions with antiapoptotic bcl-2 family proteins. following phagophore formation, the elongation of the autophagosome membrane requires the action of two ubiquitin-like conjugation systems: the atg5-atg12 conjugation system and the microtubule-associated protein-1 light chain 3 (lc3, atg8) conjugation system [61, 62]. atg4b converts the proform of lc3b to its cytosolic free form (lc3-i). in mammals, the conversion of lc3-i (and other atg8 homologues) to its phosphatidylethanolamine-conjugated and autophagosome-membrane associated form (i.e., lc3-ii) is an initiating step in autophagy [6366]. once thought to be relatively nonspecific, it is now believed that autophagy is a highly selective process in which distinct cellular mechanisms are employed to identify and target cargo to autophagosomes. such selective autophagy pathways have been identified for the turnover of mitochondria (mitophagy) and other organelles and the turnover of denatured protein (aggrephagy). during starvation (e.g., deprivation of glucose or growth factors or depletion of cellular energy charge) autophagy prolongs cell survival through the degradation and recycling of cellular macromolecules. mice deficient in the autophagy protein atg5 are susceptible to the lethal effects of starvation. inhibition of autophagy by beclin 1 or atg5 knockdown, or by chemical inhibitors such as 3-methyladenine, can promote apoptosis and caspase-3 activation in starved hela cells. these studies have suggested a role for autophagy as a means for prolonging cell survival during starvation. autophagy performs a cardinal homeostatic function in the removal of damaged or dysfunctional mitochondria, in a selective process referred to as mitophagy. the increased turnover of mitochondria by mitophagy may occur as a result of chemical or physical stress (e.g., hypoxia). nix localizes in the outer mitochondrial membrane and directly interacts with mammalian atg8 homologs through its lir motif. damaged or dysfunctional mitochondria are recruited to the autophagosome for removal by mitophagy through a process regulated by the phosphatase and tensin homolog deleted in chromosome 10 (pten)-induced putative kinase 1 (pink1) and parkinson protein-2 (parkin) [9, 69, 70]. mutations in the corresponding pink1 and park2 genes are associated with recessive familial forms of parkinson's disease. in mice, pink1 and park2 deletions loss of mitochondrial membrane potential and the increased production of mitochondrial reactive oxygen species (ros) may provide initiating signals for mitophagy. pink1, a transmembrane protein, is stabilized on damaged or depolarized mitochondria. following the decline of mitochondrial membrane potential, which can be caused by chemical stress, pink1 recruits cytosolic parkin, an e3 ubiquitin protein ligase, to the mitochondria [69, 70, 73]. parkin ubiquitinates mitochondrial outer membrane proteins including porin, mitofusin, and miro [74, 75]. ubiquitinated mitochondria are subsequently recognized and targeted to autophagosomes by the autophagic cargo adaptor protein p62 [9, 69, 70]. autophagy can maintain cellular protein homeostasis (proteostasis) by providing a mechanism for the removal of ubiquitinated protein aggregates, in a selective process termed aggrephagy. recent studies suggest that autophagy may provide an alternative pathway to proteolysis in addition to the ubiquitin proteasome system [7678]. aggrephagy requires the selective autophagy cargo adaptor p62/sqstm1 (p62) which can interact with ubiquitinated proteins through a ubiquitin-associated (uba) domain. furthermore, p62 can interact with lc3 through its lir (lc3-interacting region) motif and thereby facilitate the targeting of ubiquitinated proteins to autophagosomes. the selective autophagy adaptor, nbr1 (neighbor of brca1 gene 1), promotes the formation of ubiquitin-positive protein aggregates, facilitating their sequestration and removal by aggrephagy. this process involves the 400 kda, pi3p-binding autophagy-linked fyve domain protein (alfy), a p62-interacting protein. in addition to mitophagy, other forms of organelle-specific or substrate-specific autophagy have been identified and collectively may contribute to the maintenance of cellular integrity under stress. these include the selective autophagic degradation of peroxisomes, ribosomes, and endoplasmic reticulum fragments. in addition to protein, autophagic processes have been implicated in the degradation of diverse cellular biomolecules, including lipids and rna. furthermore, autophagy can degrade exogenously derived substrates, most notably bacteria, virus particles, and other parasites, in a selective process termed xenophagy [10, 15, 16]. although recent studies begin to unravel the role of mitochondrial selective autophagy in cell death pathways, the role of diverse selective autophagy pathways in the modulation of cell death programs remains largely uncharted territory. despite a widely accepted role for autophagy in cellular survival, autophagy has also been associated with the regulation of various cell death pathways, most notably apoptosis. thus, autophagy may represent a failed adaptive mechanism that may have prevented death under milder conditions. hypothetically, excess activation of autophagy may contribute to apoptotic cell death through unchecked degradative processes. cells undergoing autophagy display an increase in autophagic vesicles (i.e., autophagosomes and autophagolysosomes). the distinctions between autophagy and apoptosis remain incompletely delineated, as the two processes are not always mutually exclusive and may occur simultaneously in the same cell type. recent studies suggest that factors well known to regulate apoptosis pathways also have the potential to exert regulatory activity on factors that regulate autophagy and vice-versa (figure 2). how these regulatory events, termed cross-talk, are integrated into a mechanism for the determination of cell fate yet remains incompletely understood. antiapoptotic bcl-2 family proteins, which downregulate apoptosis (i.e., bcl-2) by antagonizing the activity of proapoptotic proteins, can downregulate autophagy. binding of these bcl-2 family proteins to beclin 1 inhibits autophagy by preventing the association of beclin 1 with the class iii pi3k complex [57, 60]. bnip3 is a bh3-only protein that can trigger apoptosis by sequestering antiapoptotic bcl-2 family proteins and promoting bax/bad dependent mitochondrial release of proapoptotic mediators. these interactions suggest that autophagy and apoptosis may be coordinately regulated by bcl-2 family proteins. experimental evidence also suggests that, once activated, apoptosis effector molecules may suppress autophagy; for example, beclin 1 may be cleaved and inactivated by caspases during activation of apoptosis. further studies suggest that certain atg proteins may play dual roles in autophagy/apoptosis regulation; for example, the autophagic protein atg5 may affect extrinsic apoptosis pathways through interactions with the fas-associated death domain (fadd) protein. atg5 which regulates autophagy can be subject to calpain-dependent cleavage to generate a proapoptotic truncation product (tatg5). this cleavage product promotes apoptosis by binding to and inhibiting antiapoptotic proteins such as bcl-xl. recent studies also implicate atg12, the binding partner for atg5 required for autophagosomal elongation, as an effector of the intrinsic apoptosis pathway. atg12 may bind to and inactivate antiapoptotic bcl2 family proteins (e.g., bcl-2 and mcl-1), through an interaction involving a bh2 motif, and thereby act as a proapoptotic regulator. recent advances have identified other regulatory targets for caspase regulation among autophagy related molecules; for example, atg4d, a member of the atg4 family of atg8 processing enzymes, has been identified as a substrate for proapoptotic caspase-3. the autophagic protein atg3 has recently been identified as a caspase-8 substrate, which is cleaved during tnf-induced apoptosis. the antiapoptotic protein cellular flice-like inhibitory protein (c-flip) can act as a negative regulator of autophagy. the c-flip, an endogenous inhibitor of caspase-8 processing and the extrinsic apoptotic pathway, acts to prevent the binding of atg3 to lc3, which impairs lc3 processing. on the basis of what is known about the molecular cross-talk between autophagy and apoptosis it currently remains unclear whether autophagy and apoptosis are coregulated or mutually exclusive processes. antiapoptotic (e.g., bcl-2) as well as proapoptotic (e.g., caspase-3) molecules can downregulate autophagy by interacting with beclin 1. furthermore, other caspase-dependent events have been implicated in anti-autophagy or proautophagy events. for example caspase processing of atg4d is proautophagy, whereas caspase processing of beclin 1 is antiautophagy. the definitive cellular mechanisms that control the decision to embark on each one or both of these pathways in response to specific stimuli remain unclear. analysis of any single isolated regulatory component (using sirna knockdown for example) for its potential to cross-regulate autophagy and/or apoptosis will be unlikely to answer these questions. thus, an integrative approach is needed to understand how the entire molecular machinery of apoptosis and autophagy are coordinated to influence cell fate decisions. the p53 tumor suppressor protein is a well studied regulator of cell cycle progression and apoptosis. p53 modulates the expression of bcl-2 family proteins (e.g., bax, bid) and other apoptosis-related gene targets (e.g., apaf1). the nuclear form of p53 targets the expression of dram (damage regulated autophagic modulator), which can stimulate both autophagy and apoptosis. alternatively, p53 can induce autophagy through the upregulation of ampk, which downregulates the mtor pathway. recent studies have shown that genetic or pharmacological inhibition of p53 can also activate autophagy and have led to the identification of the cytoplasmic form of p53 as an inhibitor of autophagy. chemical stimuli known to induce autophagy can promote the proteasomal degradation of p53. cellular stimulation with interferon- (ifn-) induces the deacetylation of p53, leading to suppressed bmf expression, reduced complex formation between beclin 1 and bcl2, and enhanced autophagy. taken together these studies suggest a complex role of p53 in the regulation of autophagy, with opposing roles for the cytosolic and nuclear forms of p53 [98, 99]. several recent studies, supported by genetic manipulation of the autophagy program, have revealed that in select toxicological models, autophagy may be associated with the promotion of apoptosis. in our recent studies we have found that epithelial cells subjected to cigarette smoke extract (cse) exposure die by activation of the extrinsic apoptosis pathway [100, 101]. cse-induced cell death involved activation of the fas-dependent death-inducing signaling complex (disc) and downstream activation of caspases (-8,-9,-3). epithelial cells subjected to cse exposure concurrently responded with increased autophagosome formation and increased processing of lc3b-i to lc3b-ii in epithelial cells [100, 101]. knockdown of autophagy proteins beclin 1 or lc3b inhibited apoptosis in response to cse exposure in vitro, suggesting that increased autophagy occurred in association with epithelial cell death [100, 101]. further studies revealed that lc3b may act as a regulatory factor in extrinsic apoptosis in this model. lc3b was found to engage a complex with fas, the key component of the disc, in a fashion dependent on the lipid raft protein caveolin-1. cse exposure caused the rapid dissociation of lc3b from fas, in association with the activation of apoptosis signaling. in conclusion, these results using genetic knockdown experiments have implicated a proapoptotic role for lc3b, in a specialized model of cse-induced toxicity, though the relative role of autophagic activity in promoting cell death in this model remains unclear [100, 101]. it should be noted that cse-induced autophagy may differ from starvation-induced autophagy in that it occurs in the presence of a complex mixture of foreign matter, which may potentially alter the functionality of the autophagy response. thus, the concept of toxic autophagy may involve altered function, which may be dependent not only on whether its activation is physiological or excessive, but also on the nature of foreign substrates (e.g., complex xenobiotics such as tar or virus particles) and their interactions with autophagosomes. further examples of coincident autophagy and apoptosis include p53-dependent autophagy through upregulation of dram, which is coincidental with upregulation of apoptosis. deletion of atg5 was also shown to protect cells from prodeath environmental stimuli; however, the authors attributed this resistance to compensatory activation of chaperone-dependent autophagy, rather than inhibition of macroautophagy per se. these studies raise an important issue in that genetic knockdown of one specific autophagy-related factor can not establish whether autophagy was protective or not in any context, as downregulation of the target may potentially affect signaling pathways that are independent of autophagy, or alternatively, promote compensatory mechanisms, such as alternate forms of autophagy. the terms autophagic cell death or type ii programmed cell death have been previously used to refer to cell death distinct from apoptosis that occurs in association with increases in autophagosome formation and independently of caspases. many studies that have implicated autophagy as a cell death effector have been performed on apoptosis-compromised or caspase-deficient cells; for example, cells treated with z-vad-fmk, a general inhibitor of caspases, or with caspase-8 and calpain inhibitors, die essentially by a nonapoptotic pathway characterized by dramatic accumulations of autophagic vacuoles [104107]. genetic knockdown experiments (e.g., beclin 1) suggest that autophagy contributes to cytotoxicity in these models; however, contrasting studies, also using knockdown of autophagy proteins, have also suggested that autophagy can also protect in the context of nonapoptotic cell death induced by caspase inhibition. in baxbak mouse embryonic fibroblasts (mefs), which can not activate intrinsic apoptosis, treatment with chemotherapeutic agents results in nonapoptotic necrosis-like cell death accompanied by excessive autophagosome formation. currently it remains unclear whether the process of autophagy acts as an effector or bystander of caspase-independent necrosis-like cell death, though autophagic proteins likely play an accessory role [25, 26]. experiments in tumor cells have suggested the possibility of cross-talk between autophagy and necrosis in cells. autophagy provides a protective function to limit tumor necrosis and inflammation in response to metabolic stress. while autophagy acts to buffer metabolic stress, the combined impairment of apoptosis and autophagy promotes necrotic cell death in vitro and in vivo. although it remains to be determined what triggers necrosis in tumor cells, it is likely that insufficient atp production to maintain plasma-membrane integrity results in metabolic catastrophe and cell lysis [110, 112]. autophagy integrates a metabolic feedback system to allow sufficient atp generation to maintain cell viability. enhanced autophagy by spermidine, a natural polyamine, inhibits loss of membrane integrity and release of chromatin protein high mobility group b1 (hmgb1), a biomarker of necrosis. however, recent consensus agrees that specific genes can regulate necrosis, which is termed necroptosis. the kinases receptor-interacting protein 1 (rip1) and rip3 are key signaling molecules in necroptosis. published studies have suggested that the treatment with zvad, a caspase inhibitor with broad specificity, induced autophagy and the death of l929 cells; and this death process required rip1, suggesting that autophagy is involved in necroptosis. in several models, autophagy has been shown to regulate necroptosis [116, 117]. in endothelial cells, inhibition of autophagy rescues palmitic acid-induced necroptosis. on the other hand, a recent study has demonstrated that necrostatin-1 (nec-1), a specific necroptosis inhibitor, suppressed not only necrosis but also autophagy. these observations suggest that autophagy may be induced by necroptosis, raising the possibility that cellular stress during cell death may lead to the induction of autophagy. it is tempting to speculate that so-called autophagic cell death may involve elements of necroptosis, though further research will be needed to clarify this relationship, as well as the signaling pathways linking autophagy to necroptosis. recent observations have revealed a relationship between autophagic proteins and inflammasome-associated proinflammatory cytokine maturation in macrophages [122124]. inflammasomes are cytosolic multiprotein complexes that constitute a novel inflammatory signaling mechanism and which govern the maturation and secretion of distinct proinflammatory cytokines, such as il-1, il-18, and il-33. cytosolic receptors of the nod-like receptor (nlr) family (i.e., nlrp3, nlrp1) interact with accessory proteins to form inflammasome complexes. nlrp3 interacts with an adaptor protein [apoptosis-associated speck like protein containing card (asc)], which recruits and activates the procaspase-1 by proteolytic cleavage. proinflammatory cytokine secretion (il-1 and il-18) was enhanced in atg16l1 or atg7 deleted macrophages in response to lps. in contrast, atg16l1 or atg7 deficiency did not affect tnf and ifn- production or nf-b pathway activation in macrophages stimulated with lps. furthermore, atg16l1 deleted mice displayed increased susceptibility to a murine model of colitis, which could be ameliorated by anti-il-18 therapy. increased activation of il-1 and il-18 has also been observed in macrophages and monocytes isolated from mice genetically deficient in beclin 1 and lc3b. cytokine activation in response to lps and atp in wild-type macrophages, as well as the amplification observed in lc3b or beclin 1 deficient macrophages, required the nlrp3 inflammasome pathway [123, 124]. the mechanism by which autophagy deficiency enhanced nlrp3 inflammasome pathway activation involved mitochondrial dysfunction, including the enhanced production of mitochondrial ros and increased mitochondrial membrane permeability transition [122, 123]. the pathway to caspase-1 dependent il-18 secretion in macrophages was inhibited by mitochondrial targeting antioxidants. these experiments suggest that autophagic proteins dampen inflammasome pathway activation by stabilizing mitochondria and/or maintaining mitochondrial quality control through autophagy. in contrast to negative regulation of autophagy by the inflammasome, a recent study demonstrates that autophagy induction by starvation enhances caspase-1 activation and secretion of il-1 and il-18. it is possible that a distinct type of autophagy induction might differentially regulate the inflammasome pathway. taken together these studies suggest an important role for autophagic proteins in the dampening of proinflammatory responses, which warrants further investigation in models of inflammatory disease. in addition to confirmed negative regulatory roles of autophagy in inflammasome activation, it has been shown that stimulation of inflammasome pathways can promote autophagosome formation through activation of the gtpase ralb. furthermore, p62-dependent selective autophagy processes may regulate the turnover and degradation of ubiquitinated inflammasome complexes. further studies suggest that stimulation of plasminogen activator inhibitor-2 by toll like receptor activation suppresses nlrp3-dependent cytokines activation by promoting the autophagic degradation of nlrp3. an important and unanswered question is related to whether inflammasome activation and the generation of inflammasome-associated cytokines exert downstream consequences on autophagic processing. pyroptosis is triggered in inflammatory cells in response to excessive inflammation by caspase-1-dependent processes, leading to release of proinflammatory cytokines (e.g., il-1, il-18, and il-33) from dying cells. recent studies suggest that macrophages activate autophagy in parallel with inflammasome activation, as a means to delay the onset of pyroptosis. chemical inhibition of autophagy using 3-methyladenine or inhibition of the atg4 protease resulted in increased incidence of pyroptotic cell death in activated macrophages. the impact of autophagy modulation on the regulation of pyroptosis, and the relevance of these interactions in in vivo models of inflammatory disease and sepsis, warrants further exploration. autophagy is generally defined as a cellular program that ensures survival under conditions of stress. the ability of autophagy to clear damaged or denatured subcellular constituents such as aggregated protein (i.e., aggrephagy) as well as to maintain mitochondrial homeostasis (i.e., mitophagy) appears to play important roles in the cytoprotective and homeostatic functions of autophagy. despite the homeostatic roles, autophagy is now recognized to play complex and incompletely understood roles in cell death programs (figure 3). furthermore, there is considerable cross-talk between the molecular regulation of autophagy and other regulated forms of cell death [2326]. the role of autophagy in diseases is an emerging area of investigation, with recent studies indicating that autophagy may exert multifunctional roles in specific diseases, with the potential for both adaptive and harmful outcomes. furthermore, deficiency or absence in autophagic function may play a pathogenic role in select human diseases [2, 1719]. additional studies are needed to define the dynamic equilibrium between autophagy, apoptosis, regulated necrosis, and other modes of cell death in the context of human disease pathogenesis. furthermore, additional studies are needed to determine the relevance of autophagic regulation of pyroptosis in inflammatory diseases. an increased understanding of these relationships would be essential in the development of therapeutics targeting the autophagy pathway for the treatment of disease.

autophagy represents a homeostatic cellular mechanism for the turnover of organelles and proteins, through a lysosome-dependent degradation pathway. during starvation, autophagy facilitates cell survival through the recycling of metabolic precursors. additionally, autophagy can modulate other vital processes such as programmed cell death (e.g., apoptosis), inflammation, and adaptive immune mechanisms and thereby influence disease pathogenesis. selective pathways can target distinct cargoes (e.g., mitochondria and proteins) for autophagic degradation. at present, the causal relationship between autophagy and various forms of regulated or nonregulated cell death remains unclear. autophagy can occur in association with necrosis-like cell death triggered by caspase inhibition. autophagy and apoptosis have been shown to be coincident or antagonistic, depending on experimental context, and share cross-talk between signal transduction elements. autophagy may modulate the outcome of other regulated forms of cell death such as necroptosis. recent advances suggest that autophagy can dampen inflammatory responses, including inflammasome-dependent caspase-1 activation and maturation of proinflammatory cytokines. autophagy may also act as regulator of caspase-1 dependent cell death (pyroptosis). strategies aimed at modulating autophagy may lead to therapeutic interventions for diseases in which apoptosis or other forms of regulated cell death may play a cardinal role.

PMC3932252

pubmed-389

koreich in 1981 first reported the case of a 22 year old man diagnosed as hodgkin lymphoma (hl) who developed hypothermia and hypotension during the course of his admission, which resolved only after initiation of chemotherapy. systemic symptoms are present in a third of patients at presentation and among them fever is the most common followed by night sweats and weight loss. on review of literature, we found 18 case reports with similar finding of hypotension and hypothermia associated with hl. most of the patients in these case reports developed hypotension and hypothermia after initiation of chemotherapy. only 3 out of these 18 patients were found to have hypotension at the time of presentation prior to diagnosis. we report the case of a patient who presented with hypotension and hypothermia and was diagnosed initially with septic shock. he was found to have ill-defined liver lesions on the computed tomography (ct) scan which were new on comparison with a recent ct abdomen done for evaluation of nephrolithiasis. the pathophysiology of development of hypotension and hypothermia in patients during chemotherapy or prior to diagnosis remains unexplained. a complex interaction between cytokines, tumor and blood vessels has been proposed as the genesis of such a presentation. a 61 year old man presented to emergency room with history of flank pain on right side, dysuria, urgency and frequency with occasional hematuria for 3 days associated with fever, chills and rigors. 3 weeks before this presentation he was admitted for renal colic and was found to have a new staghorn calculus in the kidney which was managed conservatively with 7 days of oral antibiotics. review of systems noted a history of 40 pounds weight loss over 3 months, drenching night sweats and occasional low grade fevers for last 3 months. past medical history was significant for multiple episodes of renal colic secondary to nephrolithiasis treated with lithotripsy several years ago. social history was significant for 30 pack year history of smoking, occasional alcohol consumption and no substance abuse or high risk behavior. was noted to be hypotensive with a blood pressure (bp) of 78/49 mmhg and mean arterial pressure (map) of 59 mmhg. the hypotension was new compared with recent admission 3 weeks prior, where the bp readings were consistently above a map of 80. the hypotension did not correct with bolus of 3 liters of 0.9% normal saline (ns) and in view of his history of dysuria and intermittent hematuria and recent diagnosis of staghorn calculus he was diagnosed with urinary tract infection (uti) leading to urosepsis and septic shock. he was admitted to medical intensive care unit (micu) where he was started on pressor support with norepinephrine and broad spectrum antibiotic coverage with vancomycin and piperacillin-tazobactam. vitals recorded at presentation were temperature of 97.3f, bp of 78/49 mmhg, map of 59 mmhg, heart rate 80/min, respiratory rate 18/min, spo2 of 98-99% on room air. general exam was significant for an averaged sized man in mild distress with mild pallor, no icterus, cyanosis or edema. labs were significant for hemoglobin (hb) of 9.2 g/dl, mean corpuscular volume (mcv) of 77.6 fl and leukocyte count (wbc) of 5.1 k/l with differential of 77% neutrophils. liver enzymes showed alkaline phosphatase of 212 u/l, alanine transaminase (alt) 80 u/l, aspartate tranaminase (ast) 96 u/l, total protein 3.6 g/dl and albumin 1.5 g/dl. urine dipstick was positive for blood (1 +), proteins (30) and glucose (50) and urine microscopy showed 109 rbc and 12 wbc. two sets of blood culture and urine culture were done prior to starting antibiotics which showed no growth after 5 days of incubation. ct scan abdomen done at presentation showed numerous ill defined lesions in the liver which were new from the ct scan done 3 weeks before for evaluation of renal colic (figure 1). the study redemonstrated the staghorn calculus with no evidence of obstruction, no radiographic evidence of pyelonephritis or renal abscess. patient received 2 days of pressor support with norepinephrine drip, following which his blood pressure improved to a map over 70 mmhg, however he continued to have intermittent episodes of hypotension which were managed with frequent boluses of 1000 to 500 ml of 0.9% ns. interestingly, on day 5 of admission, patient developed increased shortness of breath and became hypoxic. trans-thoracic echocardiogram done at bedside showed normal ejection fraction and normal inferior vena cava. patient was diagnosed with fluid overload secondary to frequent fluid boluses and was given one dose of 20 mg i.v. lasix which led to resolution of shortness of breath. during this entire stay, he continued to have intermittent episodes of hypotension with mean arterial pressure dropping to low 60 s. colonoscopy and esophago-gastro-duo-denoscopy (egd) done as part of malignancy workup, showed 2 polyps which were diagnosed as tubular adenoma and thick gastric folds with chronic gastritis on histopathology respectively. a liver biopsy was planned after improvement in his overall condition however on day 9 of the hospitalization patient declined the procedure and requested a break from the hospital. liver biopsy was deferred for a later date and patient was discharged in a stable condition. during this admission 4 blood cultures and 3 urine cultures did not show any growth after 5 days of incubation. he was discharged with oral levofloxacin to complete a course of 14 days of antibiotics for complicated uti. three days after being discharged from hospital, patient returned to emergency room with similar complaints of acute onset weakness and fatigue and a single episode of fever for which he received a single dose of ibuprofen at home. vitals at presentation showed rectal temperature of 94.1f, bp of 84/49 mmhg, mean arterial pressure of 60 mmhg, breathing at rate of 18/min, heart rate 59/min and saturating 97% on room air. patient was readmitted to micu with a provisional diagnosis of urosepsis and was given vancomycin and piperacillin-tazobactam. blood culture and urine culture done at this time again showed no growth which could support the diagnosis of sepsis. biopsy of the liver lesions showed extensive lymphocytic and histiocytic infiltrates with abnormally large cells and positive stains for cd15 and cd30. bone marrow biopsy also showed areas of residual trilineage hematopoesis with 40% cellularity alongwith several para-trabecular infiltrates composed of large atypical cells including reed-sternberg (rs) cells, in a mixed inflammatory background consisting of small lymphocytes, histiocytes, eosinophils and plasma cells (figure 2). the immuno-histochemical stains were positive for cd15 and cd30 and negative for cd45, cd3 and cd20. a 100 cell count showed granulocytes (56%), monocytes (1%), eosinophils (6%), erythroid precursors (34%), lymphocytes (2%) and plasma cells (1%). the presence of the characteristic rs cell in a mixed inflammatory background pointed towards a diagnosis of hl. the diagnosis was further confirmed by positive immune-histo-chemical (ihc) stain for cd15 and cd30 along-with negative ihc stain for cd45, cd3 and cd20. since no pan-t antigens were missing, the possibility of a t-cell lymphoma was very low. a ct chest for staging did not show any hilar lymphadenopathy. soon after the diagnosis patient was started on chemotherapy with doxorubicin, dacarbazine, vinblastine. bleomycin was initially withheld due to unknown pulmonary function in view of patient been active smoker and was added later after pulmonary function test turned out to be normal. after completion of the 1 cycle of chemotherapy the blood pressure started improving to a map of more than 80 mmhg (figure 3). at 6 month follow up the patient continues to be free of any episode of hypotension or hypothermia. reported the first patient with hl who developed hypothermia and hypotension during the course of admission, prior to initiation of chemotherapy. since then 18 more cases have been reported with hypothermia as presenting feature and in 8 out of 18 patients, hypotension has also been recorded (table 2). fifteen out of 18 patients reported in literature had developed these symptoms after initiation of chemotherapy with only 3 patients presenting with hypotension prior to diagnosis. interestingly, most of the patients described with hypothermia and hypotension have been reported to have liver metastases. to date, the mechanism behind hypotension and hypothermia as isolated manifestations of hl remains unexplained. in our patient though the presentation of the patient was highly suggestive of urosepsis, numerous blood and urine cultures did not grow any microbe which could have explained the cause of sepsis. moreover treatment with vancomycin and piperacillintazobactam did not lead to improvement in the condition of the patient, essentially ruling out infectious cause and sepsis as the primary cause of hypotension. an increased random and morning cortisol level and tsh/free t4 level ruled out adrenal insufficiency and thyroid involvement respectively. a normal transthoracic echocardiogram demonstrated a normal cardiac anatomy and clinically there were no signs of heart failure. though orthostatic maneuver was not done in our patient because of his general condition, the absence of correction of hypotension with volume repletion and fluid boluses makes hypovolemia less likely. blood pressure control is governed by a complex interaction between cardiac, renal, endocrine and nervous systems. hypotension in cancer patients has long being believed to be secondary to cytokine release from increased macrophage function. the cytokines implicated in causing hypotension are interleukin (il)-1 and il-2, tumor necrosis factor- (tnf-) and interferon- (if-). although the exact mechanism of tnf- causing hypotension is not clear, it is well known that administration of tnf- leads to production of nitric oxide (no) which is a potent vasodilator and could lead to hypotension. in addition to this, cytokines also cause endothelial damage, a mechanism which is very well defined in patients with sepsis and septic shock. in patients with sepsis infection another important association implicated in this patient is the effect of psycho-neuroendocrine hormones in mediation of no, like melatonin, which has been shown to have counter-regulatory effect on action of free radicals, especially no. we postulate from the above, that the probable cause of hypotension in this patient could be release of cytokines from the tumor especially from liver metastasis, which is an extremely vascular organ. autonomic dysfunction is a know paraneoplastic syndrome associated with hl which raises the possibility of direct infiltration of hypothalamus or pineal gland by the tumor leading to alteration in neuroendocrine hormones. the loss of inhibition of counter-regulatory effects of these hormones on cytokine regulation could result in macrophage activation and no production resulting in hypotension. our patient never took any salicylates for his fever which rules this out as a possible cause. moreover, not all patients reported were taking nsaids before presentation, making this explanation less likely. in conclusion although, further studies are needed in support of this association, we can conclude from this case that the condition responds dramatically to aggressive chemotherapy.

hypotension is an extremely rare manifestation of hodgkin lymphoma. we report the case of a patient who presented with new onset hypotension and was diagnosed with urosepsis and septic shock requiring pressor support for maintaining his blood pressure. computed tomography (ct) scan of abdomen showed liver lesions, which were new on comparison with a ct abdomen done 3 weeks back. biopsy of the liver lesions and subsequently a bone marrow biopsy showed large atypical reed-sternberg cells, positive for cd15 and cd 30 and negative for cd45, cd3 and cd20 on immuno-histochemical staining, hence establishing the diagnosis of hodgkin lymphoma. the mechanism involved in hodgkin lymphoma causing hypotension remains anecdotal, but since it is mostly seen in patients with advanced hodgkin lymphoma, it is hypothetically related to a complex interaction between cytokines and mediators of vasodilatation. here we review relevant literature pertaining to presentation and pathogenesis of this elusive and rare association.

PMC4194386

pubmed-390

most conclusive evidences indicate that periodontal disease (pd) is not a conventional bacterial infection but is an inflammatory disease initiated by immune response against a group of microorganisms in susceptible hosts. the consequent uncontrolled inflammation causes destruction of attachment structures, being the most significant reason of tooth loss in adults from different populations. in affected tissues cytokines and chemokines lead to the migration of leukocytes to the periodontal tissues where these cells play an important role in pathogen destruction by releasing mediators in a local inflammatory response [4, 5]. therefore, these and other mediators have been detected at elevated levels in the gingival crevicular fluid, saliva, and blood, thus being considered acceptable biomarkers for some aspects of pd [3, 6, 7]. particularly, proinflammatory cytokines such as interleukin-1 beta (il-1) and tumor necrosis factor-alpha (tnf-) have been associated with pd progression and decline after periodontal treatment. these cytokines are released by macrophages after bacterial infection or tissue injury and, in high concentration, stimulate the production and release of other inflammatory mediators. similarly, il-17 is a proinflammatory cytokine produced by activated th17 cells that induce a distinct profile of effector cytokines which may exacerbate inflammation and tissue damage. in fact, th17 cells were found in human pd as well as il-17 expression in the alveolar bone of these subjects, suggesting a causal link between inflammation and bone destruction. thus, while proinflammatory cytokines are potent inducers of bone resorption and inhibitors of bone formation, immunoregulatory mediators inhibit such proinflammatory signals and suppress the activation of metalloproteinases (mmps) that mediate tissue destruction in pd. these enzymes are classified according to their catalytic domains or substrate specificity and several studies have associated mmps regulation with pd progression, once the control of synthesis and degradation of extracellular matrix defines levels of periodontal attachment. moreover, since mmps production is potentiated in inflammatory conditions and these enzymes are related to pd susceptibility, the determination of the levels of inflammatory mediators in gingiva or biologic fluids became good indicators of the patient's periodontal disease status and activity [18, 19]. however, although how the inflammation develops in the gingival tissue of pd patients is largely described, little is known about the progression of this response to the alveolar bone underneath gingiva and how pd affects cytokine and mmps expression in this tissue around the extensive periodontal pocket. accordingly, the present study focused on the detection of the ongoing inflammatory changes in the bone and neighboring tissues directly affected by the destructive disease in pd patients. seventeen (17) subjects with no periodontal or systemic diseases (controls) and 18 patients with advanced periodontal disease (pd) from the periodontal clinic of uberaba university at uberaba, minas gerais, brazil, were selected for periodontal evaluation and sample collection. the subjects were submitted to anamnesis, clinical and periodontal exams, as proposed by the periodontal american association. all the clinical profile such as probing deep and clinical attachment was recorded for subjects classification into pd patients or controls (table 1). informed consents approved by the local ethics committee on human research (protocol number 1230) were obtained from all the volunteers and the study was performed according to the declaration of helsinki, 1964. bone biopsies were extracted from patients with advanced pd in which alveoloplasty was necessary before gingival suture, in cases of extraction of teeth with previous extensive periodontal damage. therefore, the samples were obtained after maxillary or mandibular alveolar ridge regularization, with removal of minimal bone spicule from areas adjacent to the large bone resorption regions of the previously extracted teeth. biopsies from control group were obtained during extraction of third molars that required osteotomy (n=17). all samples used for gene expression analysis were first collected in rpmi medium supplemented with 10% of bovine fetal serum for transportation followed by washing in cold saline solution and storage into liquid nitrogen. samples destined for histopathology study were washed in cold saline solution and fixed in pbs-formaldehyde 10%. tartrate-resistant acid phosphatase (trap) activity was detected using a leukocyte-specific acid phosphatase kit (sigma aldrich, st. briefly, samples were decalcified and embedded in paraffin and serial sections of 5 m were placed in glass slides. the sections were stained with trap solution for 1 hour at 37c and counterstained with mayer's hematoxylin. cells stained dark red to purple with more than three nuclei on the bone surfaces were considered trap and were counted per mm of tissue. quantitative polymerase chain reaction analysis (rt-pcr) of tnf-, ifn-, il-10, il-4, and the metalloproteinases mmps 1, 2, 3, and 9 mrna expression was performed in the bone tissue samples. primer sequences were designed using the software oligoperfect designer (invitrogen, carlsbad, ca, usa). rna was extracted according to the manufacturer's guidelines of rna sv total rna isolation system kit (promega, madison, wi, usa) and the cdna confection was performed with oligodt (promega), dntps, reverse transcriptase enzyme m-mlv rt, and m-mlv buffer (promega) in a pcr thermocycler ptc-100 (mj research, waltham, ma, usa). the sequences of cdna products were amplified in real-time pcr machine geneamp 7000 (applied biosystems, foster city, ca, usa) using the reagent faststart universal sybr green master (rox) (roche, madison, wi, usa) and specific forward/reverse primers at 0.1 g/l. the default pcr condition was 2 minutes at 50c, 10 minutes at 95c and fifty cycles of 15 seconds at 95c, 30 seconds at 58c, and 30 seconds at 72c. sequence detection software version 1.3 (applied biosystems) was used to analyze data after amplification. results were obtained as cycle threshold (ct) values, which were normalized using the expression of the constitutive gene -actin, following the equation 2, according to the applied user's bulletin #2, p/n 4303859 (applied biosystems). biopsies were fixed with pbs-formaldehyde of 10% for 48 h and decalcified in pbs-edta of 0.5 m, during 30 days. sections (5 m) were stained with hematoxylin and eosin (he) and analyzed by light microscopy. all images were captured with the digital video camera evolution mp 5 (media cybernetics, rockville, md, usa) mounted on a light microscopy eclipse 50i (nikon, melville, ny, usa) using the software image-pro plus (media cybernetics). morphometric analysis of fibrosis was performed using the imagej software (national institutes of health, bethesda, md). fibrous connective tissues were stained with picrosirius red and the images were captured at 400 (24 fields/sample) that measured 3705.82 m. a grid with 100 points, each one representing 37.06 m, divided each field. for each sample, 2400 points were analyzed totalizing 90192 m. to calculate the percentage of collagen area, points coincident with stained area were counted. points were checked by the formula of hally, as described before. for immunohistochemistry, deparaffinized sections were treated with 3% hydrogen peroxide in methanol for 10 min and incubated for 30 min at 90c for antigen recovery. the blocking of the sections was performed using 2% bovine serum albumin incubated for 30 min at room temperature. afterwards, they were individually incubated with anti-cytokine monoclonal antibodies specific for tgf- (1: 100) (r&d, hopewell, nj, usa) and il-17 (1: 20) (r&d). all antibodies were diluted in 2% bsa prior to use and incubated with the samples for 2 hours at 37c. a secondary step was performed using biotinylated anti-mouse ig, anti-rabbit ig, and anti-goat ig from link system 002488 (dako, carpinteria, ca, usa) for 30 min at 37c. after being washed, the sections were incubated with streptavidin-peroxidase conjugated (dako) for 30 min. the number of positive cells for each cytokine was counted in 20 fields at a magnification of 400, in a predetermined area of 0.091575 mm. graph pad instat and prism statistical programs were used for analysis (graphpad, san diego, ca, usa). in case of normal distribution, the independent t-test was used while the nonparametric mann-whitney test was used in non-gaussian sample distribution. first, we performed a clinical periodontal examination and an analysis of the status of the volunteers enrolled in the study to better classify the individuals into pd or control group and to verify if these findings could be related to the next evaluations. data showed that both groups were balanced for gender and were different for age distribution, since chronic periodontitis was more prevalent in older individuals. regarding tobacco use, 4 patients from pd group were smokers, a habit known to be directly related to pd progression. the probing depth was not different between control and pd group (p>0.05) since there was extensive clinical attachment loss with gingival recession in pd patients, thus accounting to their classification into the advanced pd group (table 1). next, to verify if the periodontal and especially the bone tissue adjacent to the areas of extensive bone resorption in advanced pd presented any sign of inflammation, we performed histopathological evaluation of the he stained biopsies. results showed that control subjects presented a normal aspect of bone tissue with osteocytes and osteoblasts at the edge of bone matrix with no signs of alteration (figure 1(a)). in contrast, samples from pd group presented a focally distributed and mild inflammatory process composed predominantly by mononuclear cells with the presence of lymphocytes and plasma cells, besides a few neutrophils. the bone tissue did not present any significant alteration (figure 1(b)). then, since osteoclast-mediated bone resorption may be driven by local inflammation, we next aimed to verify if it could be an indicative of ongoing bone damage. in fact, we found increased numbers of trap-positive cells in samples from pd group when compared to controls (figure 1(c)), indicating that the inflammatory process was able to trigger osteoclast differentiation in periodontitis patients. previous studies from our group showed that advanced pd is characterized by elevated levels of tgf- and il-17 mrna, which may be related to disease progression [13, 21]. then, in the present study, immunohistochemical analysis revealed that both groups produced tgf- and il-17 cytokines (at protein level) in the periodontium biopsies. pd subjects presented a slight augment in the density of tgf- positive cells (figure 1(d)) and a significant increase was observed in the number of il-17 positive cells in comparison to the control group (figure 1(e)). furthermore, since the collagen matrix in the bone and connective tissue of the periodontium are one of main targets in periodontitis destruction, we determined the collagen percentage in the biopsies stained by picrosirius red. surprisingly, although pd subjects presented microscopic inflammation and osteoclast accumulation suggestive of tissue damage, a higher collagen deposition was found in this group, as observed in figure 1(f). once bone resorption is a result of the balance between anti- and proinflammatory mediators that may activate tissue destructive enzymes, we assessed the expression of cytokines and metalloproteinases (mmps) in the bone tissue of pd and control samples. the real-time pcr assays revealed that the levels of ifn-, il-10, and il-4 mrna were not altered in the samples of subjects relative to controls (figures 2(b)2(d)). however, there was a strikingly elevated expression of tnf- mrna in subjects with pd compared to control group (figure 2(a)). importantly, this increase in the inflammatory cytokine tnf- was accompanied by augmented expression of mmp-2 mrna (figure 3(b)) and there was a tendency towards elevated expression of mmp-1 and mmp-9 in pd patients (figures 3(a) and 3(d)). mmp-3 was not different between the studied groups (figure 3(c), p>0.05). furthermore, a positive and significant correlation was observed between tnf- and mmp-2 mrna expression when all the subjects of the study were evaluated together (figure 4, p=0.0036; rs=0.6190). altogether, these data suggested that the local immune alterations that culminate in tooth loss are not restricted to gingiva. the periodontal or bone tissue next to the extensive areas of resorption presents relevant inflammatory findings indicative of periodontitis destruction and progression in susceptible individuals. the data presented in this study obtained from examination of sites close to areas with extensive periodontal damage showed that, as expected, inflammation in advanced pd is not restricted to gingiva. otherwise, tissues like alveolar bone that is clinically undergoing a resorption process present relevant findings that could be considered inflammatory biomarkers for disease development in susceptible patients. although predictable, this is the first study that showed the immune response related to periodontitis evolution directly in the damaged bone and neighboring area. interestingly, our patients with advanced pd presented a number of features characteristics of local inflammation and some of them were smokers, a habit known to be classically involved in pd progression. in spite of this, it did not seem to interfere in the disease spreading to bone tissue, since the inflammation markers analyzed were not differentially expressed by these individuals. as a next approach, we examined whether pd could result in histological changes in the bone resorbing areas close to the large periodontal pocket. also, this mild inflammation associated with trap cells could be an indicative of microbial presence and an active process of tissue damage, though not at the same extent yet as that observed in the large periodontal pocket, that led to the tooth loss. corroborating our data, previous studies showed that pathogenic microorganisms might colonize different sites and then spread local inflammation in case of uncontrolled pathogen burden [22, 23]. the integrity of bone tissue depends on the balance between bone formation by osteoblasts and bone resorption by osteoclasts [24, 25]. in this scenario, several proinflammatory cytokines were identified as key molecules contributing to the destruction of periodontal tissue, including il-1, tnf-, ifn-, and il-6 besides rankl [26, 27]. thus, in view of our results, it is possible that the higher tnf- mrna found in our patients may have acted as an important osteoclastogenic factor by inducing the local osteoclast differentiation that could culminate in bone resorption. we also revealed that the number of il-17 cells was higher in pd regions than in control healthy tissues. such cells could be cd4, cd8,, neutrophils, natural killer cells, or others [2832]. a previous study demonstrated that patients with chronic periodontitis have th17 cells as well as il-17 expression in inflamed periodontal tissue, indicating the possible involvement of this cytokine in periodontal disease. indeed, th17 cells could exacerbate inflammatory periodontal disease by inducing metalloproteases or inflammatory mediators by gingival fibroblasts. in this context, our results suggested the involvement of th17 cells in the inflammatory events triggered in the periodontal disease affected areas. besides, il-17 could be capable of inducing rankl, the main stimulatory factor for the differentiation and activation of osteoclasts in bone inflammatory diseases like rheumatoid arthritis and pd [34, 35]. then, the higher number of osteoclasts in the areas evaluated could also be related to the presence of il-17 cells. the inflammatory process in pd leads to the degradation of extracellular matrix, mainly collagen, by mmps overproduction that may be induced by cytokines released from resident and inflammatory cells [36, 37]. however, during the healing process that follows inflammation, collagen is also newly produced for extracellular matrix remodeling. therefore, the increased collagen deposition observed in our patients could result from a repair response to the initial inflammation triggered nearby the extensive bone resorption areas. in fact, the number of tgf- cells was slightly higher in pd group compared to controls. nevertheless, this cytokine could play a dual role in pd, by controlling inflammation or inducing the differentiation of th17 response [13, 21]. most strikingly, as discussed before, levels of tnf- were significantly augmented in bone tissue from pd group. as tnf- is important for osteoclastogenesis, it is possible that this factor initiates osteoclast differentiation in subclinical inflammatory process. also, tnf- is produced in response to periodontopathogens, inducing the microbicidal activity of phagocytic cells, and, in the absence of the subunit p55 of tnf- receptor, mice infected with aggregatibacter actinomycetemcomitans presented less bone resorption and inflammatory response, besides increased number of bacteria. therefore, the higher levels of tnf- in our pd group could indicate the presence of pathogens in periodontal environment, besides accounting for the higher number of osteoclasts in these patients [40, 41]. during active periodontitis, degradation of gingival connective tissues, mainly collagen, is due to the expression of mmps in situ by inflammatory and resident cells such as fibroblasts and epithelial or endothelial cells [33, 37]. however, the evaluation of mmps directly in the bone resorbing areas adjacent to the large periodontal pocket, as well as their role in the disease outcome, is unclear. our subjects with pd presented a mild inflammatory infiltration of cells and the expression of mmp-2 mrna was almost five times higher in samples from this group. this local infiltrate could be able to produce mmp-2, based on previous results indicating that tnf- stimulates the secretion of active mmp-2 [42, 43], thus resulting in degradation of collagen types i, ii, and iii. mmp-2 expression in biopsies of subjects with pd could suggest a possible biological alteration in the turnover of connective tissue and a consequent active ongoing process of bone resorption. also, the degradation of collagen by mmp-2 could produce peptides important for recruitment of mononuclear and polymorphonuclear cells that could later amplify the inflammatory process. in our study, although we did not evaluate mmp-2 activity in situ, we might hypothesize that the production of tnf- could upregulate membrane type metalloproteinase-1 (mt1-mmp), which is able to activate the latent form of mmp-2, thus breaking collagen in pd sites. such phenomenon could be confirmed by higher percentage of collagen areas, indicating a remodeling process that follows collagen degradation. indeed, repeated exposure to low or moderate lps concentration induced augmented cardiac fibrosis along with elevated mmps expression (including mmp-2) in mice heart, thus indicating that a subclinical inflammatory response may be able to trigger tissue collagen response and alter mmps balance. tissues neighboring large periodontal pockets present inflammatory markers such as il-17, tnf-, mmp-2, and osteoclasts accumulation, which could be predictors of local bone resorption and disease spreading. these results support the importance of a more detailed evaluation of these regions other than gingiva, since the local immune response may represent sentinel factors relevant for disease outcome.

chronic periodontitis is a multifactorial inflammatory disease that affects supporting structures of the teeth. although the gingival response is largely described, little is known about the immune changes in the alveolar bone and neighboring tissues that could indicate periodontal disease (pd) activity. then, in this study we identified the ongoing inflammatory changes and novel biomarkers for periodontitis in the tissues directly affected by the destructive disease in pd patients. samples were collected by osteotomy in 17 control subjects during extraction of third molars and 18 patients with advanced pd, in which alveoloplasty was necessary after extraction of teeth with previous extensive periodontal damage. patients presented mononuclear cells infiltration in the connective tissue next to the bone and higher fibrosis area, along with increased accumulation of il-17+and trap+ cells. the levels of tnf- and mmp-2 mrna were also elevated compared to controls and a positive and significant correlation was observed between tnf- and mmp-2 mrna expression, considering all samples evaluated. in conclusion, nongingival tissues neighboring large periodontal pockets present inflammatory markers that could predict ongoing bone resorption and disease spreading. therefore, we suggested that the detailed evaluation of these regions could be of great importance to the assessment of disease progression.

PMC4439505

pubmed-391

modafinil, a novel wake-promoting drug has gained immense popularity among psychiatrists in recent times. now a days, its use is not limited to treat narcolepsy and other sleep wake disorders, but also in chronic fatigue syndrome, treatment resistant depression, attention deficit hyperactivity disorder and cocaine dependency.1) reportedly it has a much lower abuse potential but some have also suggested it to be having a definite potential for dependence.2) here we report a rare case of modafinil dependence who presented with hypersexuality behavior. till date, only one such similar case have been reported.3) a 35 years male patient was diagnosed with bipolar affective disorder (international classification of diseases [icd]-10 criteria), since last 7 years with four episodes of depression (characterized by low mood, decreased energy, anxiety throughout the day, depressive cognitions, decreased sleep and appetite along with occasional wish to die) and two episodes of mania (characterized by cheerful mood, increased activity levels, decreased sleep to only 3 hours/day, increased appetite, grandiose ideas, over-talkativeness and increased expenditure) along with benzodiazepine dependence (currently abstinent). he presented to our centre seeking treatment for excessive sexual desire and to limit excessive use of modafinil. he was on lithium (600 mg/day), carbamazepine (800 mg/day), venlafaxine (150 mg/day), and lamotrigine (200 mg/day) during this period. exploration of the history revealed that, he was started on modafinil 200 mg/day (100 mg at morning and afternoon) by a private practitioner four years earlier to improve his fluctuating sadness of mood and early morning lethargy. he would feel active, fresh, and would be able to work better after taking modafinil. over the next 3 years (2010 to 2012) he started to use modafinil whenever he used to feel low and escalated the dose to 400600 mg/day. whenever he would not take, he had strong craving for the same, felt low, lethargic, tired, aches and pains in body, decreased confidence and concentration at work. in mid of 2014, inspite of good compliance to above medications, without any apparent stressors, he again started to have persistent sadness, lack of energy and easy fatigability. because of this, he increased dose of modafinil to 400 mg/day on his own in early morning. after taking modafinil so, over the next few weeks, he increased the dose to 8001,000 mg/day in divided doses. though there was no improvement in his mood, there was change in his sexual behavior. on seeing any women nearby, he started to have spontaneous erection and feel excited. his frequency of masturbation increased to 1012 times/day, but he would not feel satisfied unlike his premorbid self. in addition to these symptoms, he started interacting with commercial sex workers (csws) on phone, would get aroused by mere talking with them. he would be preoccupied with sexual fantasies and would not be able to concentrate at his work. he tried meditation, increased his frequency of religious activities to get rid of his sexual urges but in vain. despite being happily married for last 16 years with adequate sexual adjustment he would have increased desire for intercourse with females other than his wife which would further instigate guilt in his mind. his sleep was disturbed with restlessness and anxiety at night and he would feel fatigue throughout the day despite taking high doses of modafinil. his mood remained sad for most part of the day, would not enjoy the day to day activities like before and continued to harbor depressive cognitions. there was no associated history of cheerfulness, grandiosity, hyperactivity, overplanning, increased appetite and decreased need for sleep during this time. throughout this period there was neither any change in his compliance with medications nor any change in dosage of other medications. and he had been on venlafaxine 150 mg/day since last 2 years under the cover of three mood stabilizers, i.e., lithium, carbamazepine, and lamotrigine with adequate dosages and normal therapeutic lithium level of 0.76 mmol/l. none of previous mood episodes (both depression and mania) had any symptoms suggestive of hypersexual behavior. his sexual behavior during the intake of high doses of modafinil was also not in keeping with his premorbid sexual desire and sexual activity. detailed evaluation of history did not suggest presence of any head injury in the recent past and presence of any associated impulsivity, obsessive compulsive behavior, substance abuse, hyperorality, cognitive decline, sleep attacks, use of aphrodisiacs and use of any other medications which could increase the sexual desire. with the above available information, a diagnosis of bipolar affective disorder with current episode mild depression (as per icd-10 criteria) along with an additional diagnosis of modafinil dependence and modafinil induced hypersexuality. physical examination, routine hematological and biochemistry investigations and electrocardiogram were within normal limits. at 8001,000 mg/day of modafinil, he had side effects as assessed by uku scale in areas of psychic (score 9), autonomic (score 3), other (score 9) and global assessment of interference (score 3). he was also rated on hypersexual behavior inventory-19 (hbi-19)4) where he scored 48. management included a gradual and slow reduction in dosage of modafinil at the rate of 100 mg every 2 days under the cover of benzodiazepines (clonazepam 2 mg/day) to manage withdrawal symptoms. mood charting was done to assess development of any mood symptoms. over 3 weeks period, all the above mentioned symptoms decreased significantly (uku total score 0; hbi-19 total score 19) and he was discharged after being counseled with structured relapse prevention programme on lithium (600 mg/day), lamotrigine (200 mg/day) and venlafaxine (150 mg/day). in literature, we could find only two case reports on modafinil dependence at higher doses.2,5) as seen in the index case, modafinil seems to have some abuse potential. our case escalated the dose of modafinil so as to overcome fatigue, increase energy and improve concentration. later on, to overcome the fear of relapsing into depression he increased to a supratherapeutic dosage of 1,000 mg/day and started having symptoms which fulfilled the criteria of hypersexuality disorder (as per kafka s criteria).6) these symptoms were temporally correlated with increment in dose of modafinil and subsided on decreasing the dose of the same in a controlled environment. hence, as neither any other drug used in the index case could be linked with such kind of behavior nor was there any switch to mania/hypomania/mixed episode which could explain such change in behavior, we concluded that the symptoms of hypersexual behavior was induced by modafinil. hypersexual behavior during a hypomanic/manic or mixed episode has characteristics of sexual disinhibition, severely compromised self-control, lack of guilt and shame feelings and is generally without any insight. in contrast, index case had guilt associated with his increased sexual desire which is very well reported in individuals with hypersexual behaviour.7,8) modafinil has been found to act by binding on dopamine receptors and affects dopamine uptake by dopamine transporters in the neurons. modafinil dependence can be explained by its dopamine uptake blockade leading to increase in dopamine concentration in the brain areas linked with reward pathways.9) on the other hand, a hyperdopaminergic state have been implicated in hypersexuality. upsurge of dopamine in the mesolimbic pathway due to use of supratherapeutic dosage of modafinil might explain for the development of hypersexuality in the index case. overdose of modafinil can cause insomnia, agitation, tachycardia, rise in blood pressure etc., but in case of dependence it is more likely to cause physical withdrawal symptoms like lethargy, tremors of hands, anxiety and erratic sleep hours5) or only severe psychological withdrawal symptoms.10) modafinil has been listed under schedule iv drug in united states for regulation of its sale. however, in india, it is available over the counter and being regularly prescribed by many psychiatrists. inspite of reportedly low abuse potential, we report a case of modafinil dependence and modafinil induced hypersexuality so as to increase awareness regarding this rare side effect of modafinil and for the need of regulation on its sale.

apart from sleep wake disorders, nowadays, modafinil is being prescribed for several psychiatric disorders including depression. despite being reported as to be having very low abuse potential, cases of modafinil dependence had come to the limelight. in this case report, we describe a 35 year old man with bipolar affective disorder while in remission who developed modafinil dependence and later on, had hypersexuality when he increased the dose of modafinil from 400 to 1,000 mg/day. existing literature suggests that modafinil when taken above prescribed doses can cause many side effects ranging from nausea, vomiting to psychotic exacerbation and mania. however, hypersexuality as a side effect of modafinil overuse is not commonly seen. the exact pathophysiological mechanism of modafinil induced hypersexuality is not clear. clinicians should be aware of possibility of modafinil leading to dependence and this rare significant side effect of modafinil.

PMC5083941

pubmed-392

childhood constipation is a common complaint accounting for 3% of visits to pediatricians and 10-25% of visits to pediatric gastroenterologist[13]. commonly there is no underlying organic cause and the constipation is indentified as functional or idiopathic[4, 5]. functional constipation is identified by rome iii criteria in children over 4 years old and adolescents having two months of at least 2 or more of the following conditions: 2 defecations in the toilet per week, 1 episode of fecal incontinence per week, history of retentive posturing or excessive volitional stool retention, history of painful or hard bowel movements, presence of a large fecal mass in the rectum, history of large diameter stools that may obstruct the toilet. children usually are treated with a combination of toilet training, running a bowel diary, and oral laxatives such as paraffin oil. in many patients there are many articles on the efficacy of probiotics in organic and functional gastrointestinal disorders. probiotics are live microbial food ingredients which are reported to be effective in the treatment of many forms of gastrointestinal disorders[812]. prebiotic is a selectively fermented ingredient that changes the composition and/or activity of the intestinal microflora and has shown beneficial effects in host's health., we aimed to determine the therapeutic effect of synbiotics (combination of probiotics containing strains of l. casei, l. rhamnosus, s. thermophilus, b. breve, l. acidophilus, b. infantis, and fructooligo-saccharide as prebiotic) on childhood constipation. the study was performed at children's medical center in tehran, iran, from january to december 2009. children with constipation were referred to the pediatric gastroenterology clinic for evaluation and treatment of constipation. one-hundred two children aged 412 years with chronic functional constipation enrolled in this study, were divided into 3 groups by simple randomization method. exclusion criteria were organic causes for constipation such as hirschsprung's disease, spina bifida occulta, hypothyroidism, cystic fibrosis, neurologic abnormalities and intestinal pseudo-obstruction. these patients were excluded from the study by history and physical examination and rome iii criteria of childhood constipation. the research protocol was approved by the medical ethics committee of tehran university of medical sciences. label of drugs was replaced by a new label indicating drug a or b. contents of sachets or bottles were not known to the physicians or nurses involved in the study. group a received 1.5 ml/kg/day oral liquid paraffin plus placebo, group b received 1 sachet synbiotic per day (restore 1x10 cfu/1 sachet, protexin co, uk). synbiotic combination consisted of probiotic strains containing l. casei, l. rhamnosus, s. thermophilus, b. breve, l. acidophilus, b. infantis, fructooligosaccharide as prebiotic, and placebo. group c received 1.5 ml/kg/day oral liquid paraffin and 1 sachet synbiotic per day. all patients in the 3 groups received drugs in bottles and sachets with similar shape, taste and color. frequency of bms, stool consistency, number of fecal incontinence, episodes of abdominal pain, painful defecation per week and side effects were determined in each patient before and after treatment. success treatment was defined as 3 bms per week, 2 incontinence per month and no abdominal pain. study design: from seven days prior to study and during the treatment period all children were requested to record frequency of bms, number of fecal incontinence episodes, stool consistency, abdominal pain, painful defecation and effects such as vomiting, diarrhea and oil seepage in a bowel diary. before starting treatment, all children were examined and patients with fecal impaction received rectal enema (paraffin oil 1530ml/year) once daily for three days in order to accomplish rectal disimpaction. toilet training consisted of sitting on the toilet 3 times per day for 5 minutes after each meal. patients were not allowed to use any other kind of medication for constipation during the study period. clinical efficacy was recorded, patients were seen at the end of 4 weeks, and their charts were reviewed. outcome measures: primary outcome measures were frequency of bms per week, stool consistency, fecal incontinence episodes per week, presence of abdominal pain, and painful defecation; secondary outcomes were success treatment and incidence of adverse effects such as vomiting, diarrhea and seepage. stool consistency was rated by the patients as hard, normal or watery. statistical analysis: data of baseline information were analyzed with the spss (ver. continuous variables were expressed as mean (sd), and categorical data were shown as frequency and percent. number of bms and fecal incontinence episodes in baseline information were analyzed by kruskal-wallis test. change of frequency of bms and fecal incontinence episodes were analyzed by non-parametric paired wilcoxon test. for assessment changes of stool consistency and abdominal pain between baseline and after treatment, the mcnemar test was used. totally, 102 children (aged 412 years) with chronic functional constipation enrolled in this study and were divided into 3 groups. five patients were lost to follow-up and remaining 97 patients consisted of 47.4% males and 52.6% females with a mean age of 6.32.1 years. as shown in table 1, no significant differences were found with respect to demographic data and recorded baseline characteristics between the three treatment groups. characteristics of the patients and the main outcomes are summarized in table 1 and 2. as shown in table 2, the frequency of bms per week increased in all groups, the highest rise occurring in group c (p=0.03). improvement in stool consistency and decrease in number of fecal incontinence episodes happened in all groups (p=0.2, p=0.3 respectively) without any statistically significant difference. also, abdominal pain and painful defecation per week decreased (p=0.6, p=0.9 respectively) similarly and there was no statistically significant difference between groups. no side effects were reported in group b but in group a 18 patients and in group c 21 patients had seepage (p<0.001). treatment success in group a was 24/29 (82.8%), in group b 22/31 (71.0%) and in group c 28/37 (75.7%) without statistically significant difference between them (p=0.6). new investigations have shown that gut bacterial colonization has an important role in health and disease. there are several hypotheses about the effectiveness of this microbial flora in treatment of constipation. according to some investigations gut microbial flora in chronic constipation is different from that in healthy persons[17, 18]. short chain fatty acids produced by probiotics reduce colon ph and by this mechanism enhance colon motility and finally transit time will decrease. there are a few rcts about probiotics in the treatment of constipation in children. in rcts study by banaszkiewicz and szajewska it was concluded that l. rhamnosus gg was not an effective adjunct to lactulose in treating constipation in children. bu et al evaluated the effect of l. casei rhamnosus lcr35 compared to magnesium oxide(mg0).comparisons of the frequency of defecation, consistency of stool and the use of lactulose or enema during the period of treatment were made among the groups. the patients who received mgo or probiotics had a higher defecation frequency, percentage of treatment success (defined as 3 spontaneous defecations per week with no episodes of fecal soiling) and less hard stool. there is no statistically significant difference in efficacy between mgo and lcr35, but less abdominal pain occurred when using lcr35. in a study by coccorullo et al the beneficial effects of l. reuteri (dsm 17938) in infants with functional chronic constipation was evaluated. administration of l. reuteri had a positive effect on bowel frequency, even when there was no improvement in stool consistency and episodes of inconsolable crying episodes. for example, in children with constipation defined according to the rome iii criteria, administration of bifidobacteria (b. bifidum, b. infantis, b. longum) and lactobacilli (l. casei, l. plantarum, l. rhamnosus) to 20 children aged 416 years resulted in an increased frequency of bowel movements, a decreased number of fecal incontinence episodes, and reduced abdominal pain, although there was no change in stool consistency. it seems that our study is the first rct study which investigates the synbiotics effects in childhood constipation. according to our study, mixtures of different strains of probiotics and their specialized prebiotics are more effective than each of them alone and this combination augments their efficacy in all parameters of study, but in previous researches improvement had been seen only in some of symptoms and signs. also adjunctive therapy of synbiotic and liquid paraffin could be more effective to improve bms than any of them alone. according to this rct, synbiotic have got beneficial effects on symptoms of childhood constipation similar to liquid paraffin without any side effects and synbiotic is an effective adjunct to liquid paraffin to improve bms.

objectiveconstipation is a common problem in children. there is some clinical evidence for the role of probiotics and prebiotics in the treatment of constipated children. this is the first study on the therapeutic effect of synbiotics (combination of probiotics and prebiotic) in treatment of childhood constipation. methodsin a double-blind randomized placebo controlled study 102 children aged 412 years with functional constipation were assessed according to rome iii criteria for 4 weeks. they were divided into 3 groups: group a, received 1.5 ml/kg/day oral liquid paraffin plus placebo, group b, 1 sachet synbiotic per day plus placebo and group c, 1.5 ml/kg/day oral liquid paraffin plus 1 sachet synbiotic per day. frequency of bowel movements (bms), stool consistency, number of fecal incontinence episodes, abdominal pain, painful defecation per week, success of treatment and side effects were determined in each group before and after treatment. findingsthe frequency of bms per week increased in all groups (p<0.001), but it differed between groups and was higher in group c (p=0.03). stool consistency increased and number of fecal incontinence episodes, abdominal pain and painful defecation per week decreased in all groups similarly and there was statistically no difference between them. no side effects were reported in group b; the main side effect in group a and c was seepage of oil (p<0.001). treatment success was similar in all groups without any significant difference between them (p=0.6). conclusionthis study showed that synbiotics have positive effects on symptoms of childhood constipation without any side effects.

PMC3446081

pubmed-393

their contribution has gone beyond academic research the team of researchers in the national institute of mental health and neurosciences (nimhans), bengaluru, karnataka, india, has developed indigenous ect devices that have stood the test of time in terms of their use in clinical practice as well as in their contribution to research. it delivered bidirectional stimuli, and facilities for measuring various parameters of electrical dose had been incorporated in the device. with the demonstration of cognitive superiority and comparable efficacy of brief-pulse ect, the national workshop on ect (1988) recommended the development of state-of-the-art ect devices with brief-pulse waveform to be available indigenously. a committee including the member of the bengaluru chapter of the national institution for quality and reliability, a psychiatrist (bng), and a biomedical engineer (vsc) took up the task of developing a brief-pulse ect device indigenously. after several laboratory tests, the machine was finally found suitable for safe use in 1992. the focus on the simplest of the models was the ease of use by psychiatrists. this was possible by a simple microcontroller unit that transmits a brief-pulse (1.5 ms as width) of bipolar nature (at a frequency of 125 pulses/s) and constant current (800 ma). ten steps of stimulus dose was made available by adjusting the total duration of stimulus from 0.2 s to 3.6 s and keeping current, pulse width, and pulse frequency constant. the first two stimulus steps were 30 mc and 60 mc; the next eight steps were in multiples of 60 mc up to 540 mc. the stimulus was delivered by pressing the switch provided on the hand-held electrode. the duration of stimulus was preprogrammed based on the total charge chosen and would be shorter if the switch was released earlier. the same switch also started a seconds counter to help time the observed motor seizures. the treating physician should keep the switch pressed to let that seconds counter on; release of switch at the termination of seizure stops the counter and indicates the duration (in seconds) of the motor seizure. release of the switch earlier than 20 s (failing to see the convulsion of duration longer than 20 s) automatically would increase the stimulus dose setting to next level for re-stimulation if the doctor chooses to do so. features such as internal trigger to disconnect the electroencephalograph (eeg) electrodes from external amplifiers during stimulus helped using standby eeg/electrocardiograph (ecg) monitoring free of artifacts. this allowed changing the settings of other electrical parameters such as pulse width and frequency if required while keeping the default setting same as the earlier microcontroller-programmed steps. however, it gave liberty to set either 10 steps of increment as in the basic model or 20 steps increase of 15 mc as 15, 30, 45, 60, up to 540 mc. automatic upgradation of the stimulus dose, if the observed seizure was<20 s, was preserved. by 1994, the computer monitor would display the eeg in two, four, or eight channels along with ecg. after eeg recording is terminated, a 10-s calibration signal of 100 v was recorded. there was also option of choosing different eeg settings, including number of channels, and display size (zoom). this refined eeg and computerized model is in use in nimhans since 1993. in 19981999, the option of automatic setting of threshold stimulus dose in mc, by feeding data on age, sex, and inion-nasion distance (ind), was developed. the research related to measurement of impedance and stimulus threshold of ect in nimhans contributed to it. around the same time, feature to store ect seizure and ecg for offline analysis was made available. with popularity of bifrontal ect (bfect), special concave stimulus electrodes were added. most recent development includes facility of administering ultra-brief-pulse (< 0.5 ms) ect that is expected to cause lesser cognitive dysfunction. the latest integrated ect machine, with four-channel eeg/ecg, has intelligent features to independently operate without interfacing with a computer system. eeg/ecg is displayed on 5.7 " color graphic lcd screen, and it also has sd card memory and printer interface. a separate portable eeg amplifier independent of ect can remain attached to the patient and the signals can be seen on any hand-held device that has bluetooth. all ect machines at nimhans are periodically calibrated for pulse width, frequency, amplitude, and stimulus duration stages. the frequency and duration, this device has been used to administer ect to about 700800 patients annually. with each patient receiving about 67 ects on an average through his/her course, the precision and flexibility of electrical parameters provided by this ect machine have fostered quality research on ect at nimhans. we have selected for review those studies from nimhans which have utilized specific features of this device. stimulus relative to seizure threshold is more critical than the absolute stimulus. a few techniques of threshold estimation included the half-age method and dose titration method but have limitations. the former was dependent on the model of the device while the latter might expose the patient to inadequate stimuli. the study at nimhans in this regard on 100 consecutive patients receiving bilateral ect (blect) revealed that age was the most important predictor of threshold stimulus accounting for 23% variance in multivariate analysis. the other significant but less robust factors were ind and severity of illness that accounted for 5% and 4% of variance in threshold, respectively. the psychotropic medications and head circumference were not noted to influence the threshold. a formula as mentioned below for determining stimulus threshold was devised using forward stepwise linear regression model based on age alone and was prospectively tested at the 1 and 6 ect sessions. t1=1.67 (age)+48.7 t6=1.8 (age)+71.9 t1=threshold at 1 session, t6=threshold at 6 session. the computerized version of stimulus setting allows use of this regression equation with ease. with the computerized version, ect sessions of each patient a similar effort was made to find the seizure threshold for unilateral ect (ulect). here, age was the only significant predictor of seizure threshold (15% of variance). a formula based on regression analysis was developed which is as follows: threshold (mc)=exp (age [0.015412]+3.667387), where unit of age is years. then, in an independent sample (n=30) of patients receiving ulect, the threshold was estimated (but not administered) using the above formula. the value obtained was rounded off to the nearest higher level on the ect device. this estimated threshold was then compared with the actual threshold stimulus which was determined by using the titration method. the results showed that 22 (73%) patients would have developed adequate seizure with the first stimulus estimated by the formula method, but it overestimated threshold stimulus by 3060 mc in majority of them. moreover, it underestimated the threshold in 8 (27%) patients. hence, the formula method may not be suitable for threshold estimation in ulect. however, if the ect administrator wishes to use it, he or she should do so with the stimulus set at one or two levels lower than the formula-estimated threshold estimation, and further titration may be done as needed. although stimulus at 26 times the threshold intensity is associated with greater clinical efficacy in ulect, the guidelines were less clear about this in blect. from 2006, there was change in practice in nimahns and unless otherwise requested from the referring psychiatrist, all blects are administered at 1.5 times the threshold stimulus charge. before 2006, the threshold stimulus was administered for blect. hence, a retrospective data analysis was done to see whether new practice has better outcome. the data of 100 consecutive inpatients who received blect at threshold level before the change in practice implemented were compared with that of 101 who received blect at 1.5 times threshold level after the change implemented. the outcome measures were the number of ects administered and the number of inpatient days after the start of ect. however, the change to suprathreshold blect conferred advantage in the treatment of mania: those receiving suprathreshold ect achieved clinical improvement with, on an average, 2 ects less and their inpatient days reduced by 10 days. ect guidelines mandate the need for seizure monitoring during ect. initially, feasibility, reliability, and validity of eeg seizure measurement were studied at nimhans using a separate paper eeg machine. subsequently, a paperless eeg amplifier, which was attached to a computer monitor displaying the eeg, was designed at nimhans. display of both eeg and the digital counter showing time duration was triggered by the ect stimulus switch (currently, eeg monitoring is available in a display in the ect machine obviating the need for a computer attached to the ect machine). this paperless eeg was validated against a paper eeg measurement which showed high correlation in terms of seizure duration (intraclass correlation, r=0.99, p<0.001). in later studies using this paperless eeg machine, unequivocal absence of epileptiform transients for five or more seconds on both channels the use of this paperless eeg simplified eeg monitoring by reducing mechanical problems associated with paper eeg and simplified the storing process. (1998) monitored 158 consecutive patients referred for ect on their first ect for both motor and eeg seizures. around 40% of patients with prolonged eeg seizures had a seizure duration>180 s, necessitating termination. motor seizure of 90 s failed to predict prolonged eeg seizures (120 s or more) in 60% of occasions. a sizable minority (8%) failed to obtain adequate motor seizure on the cuffed forearm although their eeg seizures were considered adequate by the study criteria (25 s). a similar study was conducted by mayur et al. with 232 consecutive patients posted for either blect (54%) or ulect (46%). in this study, 16% had prolonged eeg seizures, 39% of which was missed by motor monitoring, and 7% of adequate eeg seizures were classified as inadequate by motor seizure monitoring. around 1% of sessions with ulect and 11% with blect were considered inadequate by motor seizure monitoring despite adequate eeg seizures. motor seizure correlated well with eeg seizure when the latter was adequate but not when prolonged. these findings were again replicated in a further larger study with 485 consecutive patients receiving either blect or ulect. in the later study, two patients classified as having inadequate motor seizures (< 15 s) had prolonged eeg seizures (> 120 s). patients with prolonged seizures were younger, had lower seizure threshold, were more likely to receive a diagnosis of mania, and were treated with lithium. the above studies emphasize the need for eeg monitoring during ect to prevent unnecessary re-stimulation when motor seizures monitoring incorrectly label the treatment as inadequate and also to detect and abort the prolonged seizures, which appears to be common in indian setting. a study was conducted on 287 consecutive consenting patients receiving either blect or ulect to explore the factors influencing ratio of motor and eeg seizure duration (me ratio). patients were classified into low (0.8; n=146) and high (> 0.8, n=141) me-ratio groups. significantly, more patients in the low me-ratio group received blect, had prolonged eeg seizure, and were on concurrent lithium compared with the high me-ratio group. this study underscores the importance for eeg monitoring at least inpatients receiving lithium and blect. recent international guidelines have recognized the limitations of seizure duration as a marker of adequacy of treatment and emphasize the pattern of eeg seizure. a study was conducted to compare the old definition of seizure adequacy (based on seizure duration) with the new definition (a seizure with polyspikes and a 3-hz activity) in 102 computerized eeg recordings. this suggested that seizures meeting newer criteria almost invariably last for at least 25 s; in the indian context, the change in the criteria would make little change in the day-to-day practice of ect. numerous ictal eeg markers have been elucidated to predict treatment response of ect including postictal suppression, postictal coherence and amplitude, amount of slowing and time to onset of slowing, global eeg power, largest lyapunov exponent, and strength symmetry index (ssi). ssi was computed from the early- and mid-seizure eeg epochs using the fractal dimension (fd). the seizures of ulect were characterized by significantly smaller ssi in both phases, despite having seizure duration comparable to blect. it was suggested that ssi may be a potential measure of seizure adequacy. in another study, ssi was computed in 40 patients receiving either high-dose or low-dose bitemporal ect (btect). ssi of the early seizure was higher in the high dose than in the low dose ect group. another method of analyzing eeg is to measure the components of the eeg such as its frequencies across several nonoverlapping frequency bands: delta, theta, alpha, and beta through fast fourier transform. the delta band of eeg is said to be relevant to the therapeutic properties of ect. eeg of 25 patients receiving either blect or ulect was subjected fast fourier transform, and the spectral power of the delta (14 hz) band was computed. blect resulted in symmetrical seizure spectral power; ulect seizures had significantly lower spectral power in the delta band on the unstimulated side. fd was computed for early-, mid-, and post-seizure phases of the first ect. fd is a geometrical method of analysis of eeg, which was calculated based on the principles described by katz. it is a measure of complexity of the eeg wave in the terms of amplitude and frequency. smaller postseizure fd after the 1 ect was associated with remission status at 2 weeks. smaller postictal fd was considered a marker for postictal suppression suggesting that postictal suppression may be a marker for early antidepressant response for ect. a similar study was conducted in 51 right-handed, drug-free patients with major depressive disorder receiving right ulects at 2.5 times their seizure threshold. spectral power (db) for 26 hz band and fd of postseizure eeg were estimated. smaller fd and spectral power (i.e. greater postseizure eeg suppression) were seen in early responders compared to the late responders. ictal eeg fd was calculated from 26 eeg records of patients receiving either bfect or btect for schizophrenia. maximum fd at the 2 or 3 ect had an inverse correlation with psychosis severity after 6 ects as well as with the number of ects provided. hence, maximum fd during the early part of the ect course in schizophrenia patients is predictive of greater benefit in short-term psychopathology. in another analysis of data from the sample, it was seen that maximum fd does not change over six ects despite decline in seizure duration over ect. thus, eeg morphology of blect induced seizures show little variation over the course of treatment which is in keeping with other studies. bispectral index (bis) measures the level of hypnosis (sedation) during anesthesia. bis values of awaked individuals with schizophrenia were studied through a course of bitemporal brief-pulse ect. it was recorded using a bis monitor (a-2000, aspect medical systems inc., newton, massachusetts, usa), with sensor applied to the forehead on the right side. it was found that after six ects, 60% of patients had their resting bis values in the anesthetized/sedated range even when they are awake. thus, bis may not provide accurate estimation of the depth of anesthesia during ect after the initial ect sessions. bfect is found to be as efficacious as btect for depression but associated with fewer cognitive adverse effects. however, its efficacy in other indications had not been well studied and hence, it was planned in nimhans. assessing bfect in acute mania in double-blind randomized controlled trial showed faster decline in ymrs scores and earlier attainment of response compared to btect without differences in adverse effects. a double-blind, randomized controlled trial demonstrated the superior clinical as well as cognitive effects of bfect over btect in-patients with schizophrenia. seizure duration significantly reduced only with bfect and not with btect over the course of ect. this provided the indirect support to possible better anticonvulsant mechanism of action of bfect in schizophrenia. these studies used electrodes with inner concave surface specifically for bfect and later, we have been using these electrodes in clinical practice for bfect in nimhans. the effect of electrical stimulus parameters of ect on prolactin response was studied. stimulus dose, frequency of ect, and seizure variables such as seizure duration, seizure strength, pattern, and symmetry did not predict chance in prolactin level. similarly, none of the clinical variables including baseline severity of illness, presence of psychotic symptoms, drug-naive status, and degree of clinical improvement predicted the prolactin response. the prolactin response however, was significantly more in female participants which may be due to their lower seizure threshold and inherent biological predisposition. a study comparing low- and high-stimulus doses in a double-blind, randomized controlled design revealed that eeg seizure was of comparable duration in the two stimulus groups. another study with a cross-over design looking into the effect of different stimulus frequency found that lower pulse frequency (50 pps) stimulus had lower seizure threshold and produced fewer subconvulsive stimulations compared with high-frequency stimulus (200 pps) without altering seizure durations or the cardiovascular responses. the low-frequency stimulus produced similar clinical benefits as that of high frequency in subsequent study. thus, lowering down the frequency of pulses may be a viable option when seizure threshold is high due to various reasons. the lower stimulus frequency leads to longer stimulus train duration and hence, had lower rate (mc/s) of stimulus dissipation. the cardiovascular system (cvs) effects of ect were also studied with the features of automated cardiac monitor and ambulatory ecg system in eeg machine. to study the effect of atropine on cvs response to ect, 30 patients were randomly allocated before the third ect to receive atropine or no premedication and found that atropine contributed to 32% of the variance in rate pressure product (rpp) with lower values in those who did not receive atropine. however this study hence indicated that avoiding atropine as premedication can control rpp and thus can improve cardiac stability during ect without affecting other aspects. in a large sample of 124 patients, it was found that postictal rpp was significantly higher after blect than ulect even after eliminating the effect of possible confounding variables such as subconvulsions and concurrent medications. the difference of 10% postictal rpp increments between the right ulect and blect groups found in this study is of clinical relevance in elderly or patients at risk of cardiac complications. the postictal rpp may be considered as a peripheral marker of the degree of seizure generalization. in addition, if the hypothesis of seizure generalization to hypothalamus as a prerequisite for clinical efficacy is given consideration, then lower rpp of threshold ulect compared to blect can explain lower clinical efficacy of ulect and may reflect the less than optimal hypothalamic stimulation. the correlation of rpp with clinical efficacy was further supported by the lower postictal rpp with unilateral threshold ect compared to that with unilateral suprathreshold ect. however, atropine could mask the differential cardiovascular responses of the effective and ineffective seizures. in another study, the effect of anesthetic modification of motor seizure on rpp was also explored. 1 mg/kg dose of succinylcholine improved the number of patients with successful modification compared to 0.5 mg/kg but did not influence ictal or postictal rpp. it thus ruled out the significant cvs alteration due to depolarizing effect of succinylcholine and 1 mg/kg dose may be used routinely without fear of exaggerated cvs response. it confirmed the above findings that rpp response correlates with the cerebral seizure instead of motor component of seizure. ictal rpp did not differ between groups with or without adequate motor seizure if eeg seizure was adequate. however, the group with inadequate eeg seizure had the least ictal rpp. hemodynamic response with btect and bfect were examined at five-time points starting from before anesthesia induction to 2 min after the seizure. the maximum values of systolic blood pressure, heart rate, and rpp were similar in both groups, suggesting that cardiovascular load is similar in bfect and btect. it also indicates that differential frontal lobe stimulation rather than seizure generalization may be playing a role in better efficacy of bfect over btect in schizophrenia. lithium given concurrently with ect can have serious interactions with various aspects of the procedure. at the same time, not combining ect and lithium in certain patients may have adverse clinical consequences. in the absence of systematically collected data on adverse effects of lithium co-prescribed with ect, patients on lithium (n=27) and those not on lithium (n=28) were compared while they received ect. the sympathetic cardiovascular response was lower in those who were on lithium and the time to post-ect recovery directly correlated with serum lithium level. safety of lithium during ect was satisfactory particularly when serum lithium was at a lower therapeutic range in young patients without significant cardiovascular risk factors. to conclude, the indigenously developed brief-pulse ect-eeg device has been used to treat thousands of patients in the past two decades. summary of the findings of research conducted utilizing the specific features of the indigenously developed brief-pulse ect device*many more issues related to ect need exploration in future; these include altering amplitude of electrical stimulus, ultra-brief ect in indications other than depression, novel techniques of different electrode's sizes, and placements to reduce the cognitive adverse effects without compromising the clinical efficacy. the last author, mr. ltd., bengaluru, karnataka, india, which manufactures the brief-pulse ect device mentioned in this review article. candade is the director of the company, niviqure meditech pvt. ltd., bengaluru, karnataka, india, which manufactures the brief-pulse ect device mentioned in this review article.

in 1993, a device to administer brief-pulse electroconvulsive therapy was indigenously developed through collaboration between the national institution for quality and reliability and the national institute of mental health and neurosciences (nimhans), bengaluru, karnataka, india. the additional feature of computerized recording of the electroencephalograph and electrocardiograph for both online and offline use had substantial clinical and research implications. over the past two decades, this device has been used extensively in different academic and nonacademic settings. a considerable body of research with clinical and heuristic interest has also emanated using this device. in this paper, we present the development of this device and follow it up with a review of research conducted at nimhans that validate the features and potentials of this device.

PMC4776578

pubmed-394

the many genetic studies performed in recent years showed that genes such as interleukin 23 receptor (il23r) and il12b and tumor necrosis factor alpha (tnf) are closely associated with psoriasis and related diseases such as rheumatoid arthritis, psoriatic arthritis, and crohn's disease. human leukocyte antigen c (hla-c)0602 is the allele most closely associated with this disease. the age at onset of psoriasis follows a bimodal distribution: type i psoriasis appears before the age of 40 years (early-onset), with a peak at 1622 years; type ii psoriasis appears after the age of 40 years (late-onset), with a peak at 5760 years. type i psoriasis has been associated with several single-nucleotide polymorphisms (snps) in genes associated with the immune response (table 1). for example, hla-c0602 is more strongly associated with type i psoriasis than with type ii psoriasis. although several association studies have already been performed in psoriasis in both populations (type i or type ii psoriasis patients), knowledge of age at onset remains limited and controversial (table 1). therefore, we performed a candidate gene study, where we evaluated genetic susceptibility to type i or type ii psoriasis in patients with moderate-to-severe chronic plaque psoriasis. this approach may help us to identify snps previously associated with psoriasis or other autoimmune diseases that are specific to type i or type ii psoriasis. furthermore, our genetic study could improve our understanding of psoriasis and of its etiology and pathogenesis. we recruited 198 caucasian patients with moderate-to-severe plaque type psoriasis (psoriasis area and severity index>10) who attended the department of dermatology in four university hospitals in madrid between 16/10/2007 and 17/12/2012. five samples did not fulfill the quality criteria of the human genotyping unit-cegen (cegen, spanish national cancer research centre, madrid, spain), and 2 samples had insufficient volume. we also included 197 healthy volunteers (controls) recruited between 10/01/2011 and 14/12/2012 from the clinical pharmacology service (hospital universitario de la princesa, madrid, spain). all the volunteers were caucasian and had no personal or family history of psoriasis (at least 2 generations). the protocol fulfilled spanish law on biomedical research and was approved by the ethics committee for clinical investigation of hospital universitario de la princesa. all controls and patients gave their written informed consent to donate a sample for investigation. we preselected 320 snps based on an extensive review of 449 articles describing the association between polymorphisms and psoriasis and response to biological drugs and psoriasis and related inflammatory diseases (rheumatoid arthritis, psoriatic arthritis, and crohn's disease). we finally selected 192 snps based on minor allele frequency (0.05) and on the results of studies performed in caucasians and psoriatic patients. information on the 173 snps analyzed can be found in supplementary table s1, which is published in. dna was obtained from samples using an automatic dna extractor (magna pure system, roche applied science, usa) and its concentration was quantified in nanodrop nd-1000 spectrophotometer (wilmington, usa). the extracted dna was stored at 80c in the clinical pharmacology service until use. a total of 196 samples from patients (2 samples of 198 cases had insufficient volume) and 197 samples from controls were sent to the human genotyping unit-cegen to genotype 192 snps. the analysis was performed using the illumina veracode genotyping platform. if fluorescence was low or the genotype clusters were undifferentiated, the snps were removed. in addition, if the call rate was less than 95% of the average of the 192 snps analyzed, the samples were removed. since cegen quality criteria were not met in 19 snps and 5 patients, we finally analyzed 173 snps in 191 patients and 197 controls. the statistical analysis was performed to compare the following stratified populations: patients with type i psoriasis (n=155) or type ii psoriasis (n=36) versus controls (n=197) and patients with type i psoriasis versus cases with type ii psoriasis. hardy-weinberg equilibrium was tested for all the snps analyzed using the snpstats program. snps that were not in hardy-weinberg equilibrium in controls were removed from the subsequent analysis. we constructed various logistic regression models depending on the main types of inheritance (codominant, dominant, recessive, and additive). in the additive model, the presence of 2 mutant alleles confers double the risk of 1 mutant allele. the results were adjusted for rs12191877 (snp that is strongly associated with the hla-c0602 allele and is highly prevalent in our population) [3, 35]. subsequently, snps with p<0.1 in the univariate analysis (adjusted for rs12191877) were included in a multivariate logistic regression model to adjust for relevant confounding factors (spss 15.0). the results of the univariate analysis were adjusted for rs12191877, except when we compared patients with type i psoriasis and patients with type ii psoriasis (the influence of rs12191877 was not very relevant). we expressed the results as the odds ratio (or), 95% confidence interval, and p value. the study population included 155 patients with moderate-to-severe chronic plaque type i psoriasis (92 men and 63 women), 36 patients with type ii psoriasis (19 men and 17 women), and 197 controls (98 men and 99 women). the mean age was 46.01 13.11 years in patients with type i psoriasis (45.72 11.69 in men and 46.43 15.04 in women), 67.72 11.85 years in patients with type ii psoriasis (65.95 11.18 in men and 69.71 12.59 in women), and 24.51 4.29 years in the controls (25.07 4.94 in men and 23.95 3.46 in women). the mean age at onset of psoriasis was 23.31 8.52 in patients with type i psoriasis and 52.58 10.45 in patients with type ii psoriasis. a total of 192 snps were analyzed (see supplementary table s1 published in). one snp was monomorphic (rs165161 in the junb gene) and was excluded from the statistical analysis. all the minor allele frequencies were in hardy-weinberg equilibrium except 9 snps in the controls and 12 snps in the patients (see supplementary table s1 published in). the 9 snps which were not in hardy-weinberg equilibrium in controls were removed from the statistical analysis. our findings showed an association between type i psoriasis and 10 snps (n=155 versus n=197 controls): rs1634517 (ccl4l), rs1975974 (c17orf51), rs12720356 (tyk2), rs1800925 (il13), and rs6908425 (cdkal1) decreased the risk of psoriasis 2.94-fold, 2.08-fold, 10-fold, 100-fold, and 2.44-fold, respectively; and rs2282276 (clmn), rs10782001 (fbxl19), rs3792876 (slc22a4), rs12191877 (hla-c), and rs13437088 (hla-b/mica) increased the risk of psoriasis 3.90-fold, 2.10-fold, 3.75-fold, 30.54-fold, and 2.52-fold, respectively (table 2). however, comparison of 36 patients with type ii psoriasis and 197 controls revealed no significant association (results not shown). four snps were associated with significant decreases in the risk of type i psoriasis (n=155) compared with type ii psoriasis (n=36), namely, rs191190 (tnfr1; 126.08-fold), rs361525 (tnf-; 190.76-fold), and rs10499194 and rs6920220 (tnfaip3; 155.02-fold and 19.14-fold, resp.). we also found 5 snps that were associated with a significant increase in the risk of type i psoriasis, namely, rs1801274 (fcgr2a; 5.26-fold), rs763361 (cd226; 33.3-fold), rs12459358 (psors6; 11.11-fold), rs12191877 (hla-c; 12.5-fold), and rs1576 (cchcr1; 166.66-fold) (table 3). about 75% of patients with chronic plaque psoriasis have type i psoriasis before age 40, whereas a lower number of patients develop psoriasis at around 5060 years. our results are consistent with these findings, since 79.06% of our patients developed psoriasis before the age of 40. when we compared patients with type i psoriasis and controls, we found 10 significant snps in clmn, fbxl19, ccl4l, c17orf51, tyk2, il13, slc22a4, cdkal1, hla-c, and hla-b/mica. the hla-c0602 allele is a risk factor for psoriasis and has been associated with both type i [69] and type ii psoriasis. in one study, 85.3% of patients with type i psoriasis had this allele, whereas only 14.7% of patients with type ii psoriasis were carriers. other authors found an association between rs10484554 (hla-c) and type i psoriasis compared with type ii psoriasis (or=3.24 in type i). the hla-c gene was associated with type i psoriasis (p=2.97e 18 for rs1265181, p=2.58e 15 for rs12191877, p=1.84e 15 for rs4406273, and p=1.10e 07 for rs2395029), but not with type ii psoriasis after application of the bonferroni correction. in addition, our results showed significant differences in rs12191877 (hla-c) in patients with type i psoriasis (p=2.50e 19). however, we did not find this association in patients with type ii psoriasis, probably owing to the small sample size in this group (n=36). found an association between rs1295685 in the il13 gene and type i psoriasis (p=2.47e 03). our results showed an association between another snp in il13 (rs1800925) and type i psoriasis (p=0.034). in addition, munir et al. did not obtain significant results when they compared controls with type ii psoriasis or type i psoriasis with type ii psoriasis. both snps in il13 have been associated with predisposition to psoriasis [36, 37]. our comparison of patients with type i psoriasis and controls is the first to obtain significant results for a series of snps in type i psoriasis, although the snps have already been associated with the risk of psoriasis. rs10782001 in fbxl19, rs1975974 in c17orf51, rs12720356 in tyk2 [3, 39], rs3792876 in slc22a4, rs6908425 in cdkal1, and rs13437088 in hla-b/mica have previously been associated with psoriasis, but not with type i psoriasis. furthermore, snps in clmn (rs2282276) and ccl4l (rs1634517) have not been associated with psoriasis or age at onset. we found no significant differences between patients with type ii psoriasis and controls owing to the small sample size (n=36). comparison between patients with type i psoriasis and patients with type ii psoriasis revealed significant associations for the following genes: fcgr2a, tnfr1, cd226, psors6, tnfaip3, hla-c, tnf-, and cchcr1. polymorphisms in cchcr1 (386 and 404, cchcr1ww allele) have been associated with type i psoriasis [9, 31]. we found significant differences between rs1576 in cchcr1 and age at onset. in a study comparing controls (54.8%) and patients with psoriasis type ii (66.0%), allen et al analyzed rs763361 in cd226 in patients with early-onset psoriasis and patients with late-onset psoriasis, although they found no associations. rs12459358 in psors6 has been associated with type i psoriasis (g risk allele, or=1.47 and p=0.005). in contrast, our data showed an association between the t allele and type i psoriasis (or=11.11; p=0.026). rs361525 (238) in the tnf gene has been associated with susceptibility to psoriasis, and the a allele was more frequent in male patients with type i psoriasis (p=2e 07) [15, 22]. we found significant results in rs361525 (tnf-) when we compared patients with type i psoriasis and patients with type ii psoriasis, although we found no gender differences. other authors confirmed our association with type i psoriasis in caucasian [20, 23] and mongolian patients. baran et al. found no significant differences between rs1800629 in the 308 promoter (tnf) and type i or type ii psoriasis. likewise, rs12191877 in hla-c has been associated with increased risk of psoriasis. compared patients with type i psoriasis and patients with type ii psoriasis and obtained significant results for rs1265181, rs4406273, and rs12191877 in hla-c. we replicated these results in rs12191877 (t allele risk; p=0.045). rs191190 in tnfr1 and rs10499194 in tnfaip3 have been associated with psoriasis, but not with age of onset. moreover, rs1801274 in fcgr2a and rs6920220 in tnfaip3 have not been studied in patients with psoriasis according to age of onset. given the small sample size in the group with type ii psoriasis in our study, our results should be interpreted with caution. our results highlight the role of the immune system in psoriasis and enhance our understanding of pathogenic mechanisms. second, the sample size was limited by the number of study patients treated in the dermatology department, thus making it difficult to detect snps with a low probability of causing psoriasis. third, since the snps were selected based on a literature review, several major snps may not yet have been investigated. in conclusion, our study confirmed an association between rs12191877 (hla-c) and type i psoriasis and between type i and type ii psoriasis patients. ours is the first study to show an association between clmn, fbxl19, ccl4l, c17orf51, tyk2, il13, slc22a4, cdkal1, and hla-b/mica and type i psoriasis. in addition, psors6 and tnf have been described as more prevalent genes in type i psoriasis and we showed a significant association when we compared type i psoriasis and type ii psoriasis. ours is the first study to identify an association between fcgr2a, tnfr1, cd226, tnfaip3, and cchcr1 and age at onset of psoriasis.

psoriasis is a chronic skin disease in which genetics play a major role. although many genome-wide association studies have been performed in psoriasis, knowledge of the age at onset remains limited. therefore, we analyzed 173 single-nucleotide polymorphisms in genes associated with psoriasis and other autoimmune diseases in patients with moderate-to-severe plaque psoriasis type i (early-onset,<40 years) or type ii (late-onset, 40 years) and healthy controls. moreover, we performed a comparison between patients with type i psoriasis and patients with type ii psoriasis. our comparison of a stratified population with type i psoriasis (n=155) and healthy controls (n=197) is the first to reveal a relationship between the clmn, fbxl19, ccl4l, c17orf51, tyk2, il13, slc22a4, cdkal1, and hla-b/mica genes. when we compared type i psoriasis with type ii psoriasis (n=36), we found a significant association between age at onset and the genes psors6, tnf-, fcgr2a, tnfr1, cd226, hla-c, tnfaip3, and cchcr1. moreover, we replicated the association between rs12191877 (hla-c) and type i psoriasis and between type i and type ii psoriasis. our findings highlight the role of genetics in age of onset of psoriasis.

PMC4647058

pubmed-395

a case showing sustained structural and functional responses 2 years after a single treatment with iluvien (0.2 g/day fluocinolone acetonide, fac) despite suboptimal responses to ranibizumab. a 68-year-old female patient with diabetic macular oedema (dme) from type 2 diabetes mellitus was first diagnosed in october 2010 and had a baseline visual acuity (va) of 46 early treatment diabetic retinopathy study (etdrs) letters in the left eye. the patient was treated with 11 intravitreal injections of ranibizumab (5 in combination with a small-interfering rna agent), and by march 2014, va and cft were largely unchanged (55 etdrs letters and 774 microns). the patient was treated with iluvien as she had a pseudophakic lens and a clearly suboptimal response to the prior therapy with ranibizumab. an implant releasing fac at a dosage of 0.2 g/day was administered in march 2014, and the optical coherence tomography indicated that the macula was dry after 7 days (cft was below 300 microns). va improved by 5 letters within 7 days and by 15 letters within 14 days, and this was maintained after 24 months. throughout the duration of this study, the intraocular pressure was 22 mm hg, and no glaucoma medication was administered. in real-life uk practice, this dme patient showed a suboptimal response to multiple intravitreal injections of ranibizumab. when subsequently treated with a single injection of iluvien, there were large and rapid improvements in va and cft that were maintained for the following 2 years. worldwide diabetic macular edema (dme) is reported to have a prevalence of 6.8% and results in vision loss. dme management can be difficult, with only around 15% of the patients achieving significant vision recovery with laser, the current standard of care. a number of pharmacotherapies are now licensed for the treatment of dme in europe, including anti-vascular endothelial growth factor agents and corticosteroid therapies, which are used to target vascular endothelial growth pathways and inflammatory pathways, respectively. in diabetes, leukocytes release free radicals and enzymes that cause direct damage to endothelial cells, increasing blood retinal barrier leakage. they also release cytokines, including vascular endothelial growth factor, tumor necrosis factor-, and interleukin-6, which act through various signaling pathways to increase vascular permeability. the release of cytokines with a corticosteroid such as dexamethasone, triamcinolone or fluocinolone has been shown to reduce dme and rehabilitate vision in several pivotal clinical studies. iluvien contains the corticosteroid fluocinolone acetonide (fac) and uses microdosingtm technology to release fac at a daily rate of 0.2 g for up to 3 years. this differs significantly from both the dexamethasone delivery system and that of triamcinolone, which are reported to have a duration of action of only up to 3 and 4 months, respectively. the effectiveness of iluvien was demonstrated in the fame trials (nct00344968) in which patients with dme who had previously shown an insufficient response to laser were treated with either a 0.2 g/day (iluvien) or 0.5 g/day fac implant and were compared against a sham-control treated population. both fame trials independently met their primary endpoint and showed that significantly more patients with chronic dme treated with the 0.2 g/day fac implant experienced a 15-letter improvement in visual acuity (va) at month 24 than sham-control patients (pooled data; 34.4 vs. 13.4%; p<0.001) and that this benefit was sustained to month 36. functional improvements were accompanied by rapid and sustained improvements in central foveal thickness (cft). in europe, iluvien is indicated for the treatment of vision impairment associated with chronic diabetic macular oedema considered insufficiently responsive to available therapies. since then miss clare bailey presented the real world outcomes from a uk audit of patients treated with iluvien at the annual meeting of the royal college of ophthalmologists in birmingham, uk, between june 24 and 26, 2016. this unpublished interim analysis showed that the majority of treated eyes (69.4% of 290 eyes) maintained or improved va. to date, however, relatively limited data with a longer-term follow-up of the functional and structural responses following treatment with iluvien have been reported. the case described herein provides data for both va and cft over a 24-month follow-up period. a 68-year-old caucasian female with type 2 diabetes mellitus had diffuse dme diagnosed in her left eye in october 2010. the treatment history is summarised in table 1 and was previously reported when only 6 months of follow-up were available. at diagnosis, va was 46 early treatment diabetic retinopathy study (etdrs) letters, converted from snellen va using the equation 85+50 x log (snellen fraction), cft was 712 microns, and intraocular pressure (iop) was 22 mm hg. the patient had phacoemulsification plus intraocular lens insertion in the left eye in february 2012. intravitreal triamcinolone acetonide was also administered to treat the persistent dme postoperatively. at the first postoperative visit, va was 70 etdrs letters, cft was 278 microns, and iop was 20 mm hg. over the next 5 months, va (50 etdrs letters) and cft (805 microns) progressively worsened, and the patient was admitted into the matisse trial in september 2012 to test the effects of ranibizumab plus a small-interfering rna agent. between october 2012 and march 2014, the patient received 5 injections of ranibizumab plus the small-interfering rna agent and then subsequently listed for 2 further courses of 3 intravitreal injections of ranibizumab. by the end of this stage of treatment, by 1 month after the final injection of ranibizumab, the dme had recurred, va was 55 etdrs letters, cft was 774 microns, and iop was 17 mm hg. the patient's dme was now chronic (over 18 months of duration), relapsing, and her crt had fluctuated wildly through the different treatment phases, which is believed to have a deleterious effect on the function of the retina and, more specifically, on the visual function due to the presence of submacular fluid. it was at this stage that the patient was treated with iluvien according to nice ta301 (please see http://www.nice.org.uk/guidance/ta301/chapter/1-guidance). figure 1 shows the response of va and cft after a single iluvien implant without any further treatment to this eye over the next 2 years. within 7 days, va had increased to 61 etdrs letters and cft had decreased to 267 microns. within 2 weeks, va had improved further to 70 etdrs letters, which is the legal requirement to hold a driving license in the uk. these early improvements were then largely maintained throughout the next 24 months without further intervention, as shown in figure 1. figure 2 shows optical coherence tomography scans before and after iluvien implantation, illustrating the structural improvement that occurred alongside the functional improvement in vision. over the course of the 2-year period, iop remained below 21 mm hg, and no iop-lowering medication was required. this is the first case that the authors are aware of, which shows that a single injection of the 0.2 g/day fac implant leads to rapid improvements (within 7 days) in va and cft that are maintained over 2 years of follow-up. this was despite 11 previous injections of ranibizumab, which failed to control the dme prior to treatment with iluvien. the functional and structural responses presented herein are consistent with those reported in the fame trials, with rapid and marked responses observed early and being sustained in the long term. this patient will continue to be monitored to see if the responses reported in controlled clinical trials are replicated with a single injection in real-life uk practice over a 36-month period. this article does not contain any new studies with human or animal subjects performed by any of the authors. f. quhill has attended advisory boards and speaker engagements and has been remunerated for these by alimera sciences.

importancea case showing sustained structural and functional responses 2 years after a single treatment with iluvien (0.2 g/day fluocinolone acetonide, fac) despite suboptimal responses to ranibizumab.observationsa 68-year-old female patient with diabetic macular oedema (dme) from type 2 diabetes mellitus was first diagnosed in october 2010 and had a baseline visual acuity (va) of 46 early treatment diabetic retinopathy study (etdrs) letters in the left eye. central foveal thickness (cft) was 712 microns. the patient was treated with 11 intravitreal injections of ranibizumab (5 in combination with a small-interfering rna agent), and by march 2014, va and cft were largely unchanged (55 etdrs letters and 774 microns). the patient was treated with iluvien as she had a pseudophakic lens and a clearly suboptimal response to the prior therapy with ranibizumab. an implant releasing fac at a dosage of 0.2 g/day was administered in march 2014, and the optical coherence tomography indicated that the macula was dry after 7 days (cft was below 300 microns). this was sustained at 6, 12, and 24 months after the treatment. va improved by 5 letters within 7 days and by 15 letters within 14 days, and this was maintained after 24 months. throughout the duration of this study, the intraocular pressure was 22 mm hg, and no glaucoma medication was administered. conclusions and relevancein real-life uk practice, this dme patient showed a suboptimal response to multiple intravitreal injections of ranibizumab. when subsequently treated with a single injection of iluvien, there were large and rapid improvements in va and cft that were maintained for the following 2 years.

PMC5260609

pubmed-396

it is well known that they provide structural and metabolic support for neuronal networks, but a growing body of evidence indicates that they also play an active role in modulating neuronal activity. astrocytes make close contact with perisynaptic regions, forming a functional structure called the " tripartite synapse, " together with presynaptic and postsynaptic nerve terminals. indeed, one astrocyte in the hippocampus makes contact with tens of thousands of synapses. it is well established that astrocytes clear away excessive neurotransmitters and ions released from synaptic clefts through uptake via specific transporters and channels. for example, astrocytes remove excess extracellular glutamate using sodium-dependent glutamate transporters, such as the glutamate aspartate transporter and glutamate type 1 transporter. excessive glutamate is cytotoxic to neurons, causing an influx of calcium that far exceeds physiological levels and triggering the activation of enzymes and signaling proteins that are detrimental to neurons. evidence from a number of studies indicates that astrocytes release signaling molecules, the so-called " gliotransmitters, " such as glutamate, gaba, d-serine, and atp, into the extracellular milieu in response to extracellular stimuli (fig. gliotransmitter release often results from the activation of g protein-coupled receptors (gpcrs) that trigger downstream signaling cascades in astrocytes, including phospholipase c, adenylate cyclase, inositol 1,4,5-trisphosphate (ip3), and cause an intracellular calcium increase. gliotransmitters facilitate or inhibit the excitability and synaptic transmission of neighboring neurons, and the outcome of their release is dependent on the site of action and types of activated receptors. through the use of volume-sensitive organic anion channels, gap junction hemichannels, p2x7, bestrophin-1, and reverse-orientation plasma membrane glutamate transporters, diverse mechanisms for gliotransmitter release have been identified in astrocytes, including calcium-dependent exocytotic vesicular release as well as non-exocytotic mechanisms. although accumulating evidence suggests a coupling between various intracellular changes in astrocytes, such as intracellular calcium increase and gliotransmitter release, there is also evidence against this view; thus, the mechanisms underlying astrocyte-neuronal communication are still debated. in this review, we present recent studies that have using optogenetic and chemogenetic approaches to explore the function of astrocytes and gliotransmitters. optogenetics is a novel biological technique based on a variety of light-sensitive proteins called opsins, which include microbial ion channels and ion pumps as well as engineered gpcrs (fig. 1). following absorption of a specific wavelength of light, an opsin undergoes a conformational change that triggers diverse cellular changes in opsin-expressing cells. some of the opsins induce the translocation of ions, and others activate intracellular signaling cascades, such as g protein-mediated signaling. since most of these opsins do not exist in experimental-model organisms, and photostimulation itself has a negligible effect on cells and tissues, optogenetics has instead been used as a powerful experimental tool to manipulate specific populations of cells both in vitro and in vivo by means of a combinatorial approach of cell type-specific promoters and additional genetic tricks. this technique has also enabled the manipulation of cellular activity with millisecond-scale temporal precision. the time-resolved stimulation has made possible the revelation of causal relationships between manipulated cellular activity and functional outcomes, particularly in the study of neuronal circuits mediating specific behaviors. opsins have been modified to generate mutants and chimeric proteins with diverse features, including their intracellular effects, optimal wavelengths of light for activation, and temporal dynamics in activation and inactivation; thus, they offer great flexibility in designing experiments and conducting more refined manipulations. channelrhodopsin-2 (chr2), originally identified in green algae, is a cation channel that becomes permeable to positively charged ions such as proton and sodium when it is stimulated with blue light. when it is expressed in neurons, photostimulation elicits an influx of cations, which causes depolarization and the firing of action potentials in the stimulated cells. an influx of protons though chr2 can also acidify the cytosolic compartment of photostimulated cells. in the study of neurons, the frequency and duration of neuronal spiking can be easily controlled using variants of chr2, such as chr2(h134r), chr2(c128s), cheta, and step function opsin (sfo). for example, cheta can drive ultrafast spiking up to 200 hz, and sfo can elicit prolonged, bi-stable, sub-threshold depolarization of membranes. some light-gated cation channels, such as calcium-translocating channelrhodopsin (catch) and liglur, are more permeable to calcium than chr2, and therefore they have been preferentially used in studies exploring the role of intracellular calcium. liglur is a mutated ionotropic glutamate receptor 6 containing its ligand attached to an optically switchable tether called maleimide-azobenzene-glutamate. halorhodopsin is an opsin identified from archaea which, when stimulated with yellow light, pumps chloride ions into cells. when halorhodopsin is expressed in neurons, photostimulation promotes an influx of chloride ions that results in hyperpolarization and the inhibition of the firing of action potentials in the stimulated cells. archaerhodopsins, such as arch and archt, are light-driven outward proton pumps that inhibit the firing of action potentials during photostimulation when they are expressed in neurons; the efflux of protons can also cause alkalization of the cytosol. finally, optoxrs, such as opto1ar and opto2ar, are chimeric gpcrs in which the intracellular loops of rhodopsin are replaced with those of other gpcrs, such as adrenergic receptors and dopamine receptors. photostimulation can initiate diverse intracellular signaling cascades in target cells, depending on the type of g protein replacing the intracellular loops of rhodopsin. thus, these opsins enable the acute activation of different gpcr signaling pathways in cultured cells and animals. chemogenetics is based on engineered proteins, such as gpcrs and ligand-gated ion channels, that are no longer responsive or only very weakly responsive to their endogenous ligands but strongly respond to synthetic chemical ligands that are otherwise biologically inert. for example, hm3dq, one of the designer receptors exclusively activated by designer drugs (dreadds), is generated by multiple cycles of randomized mutagenesis of the human m3 muscarinic receptor, which is linked to the gq protein. it is neither sensitive to the endogenous muscarinic acetylcholine receptor ligand acetylcholine nor is it constitutively active, but it is strongly activated in response to a synthetic ligand, clozapine-n-oxide (cno), with nanomolar potency. in response to cno, hm3dq can induce an enhancement of neuronal excitability that can lead to burst-like firing. thus, it is one of the most frequently used chemogenetic tools to activate neurons. another dreadd molecule, hm4di, is a mutant of the gi-coupled human m4 muscarinic receptor that responds to cno. upon an application of the chemical agonist, hm4di activates the g subunit of the gi protein, which then stimulates g protein inwardly rectifying potassium channels (girk), causing an efflux of potassium and a resulting robust hyperpolarization when it is expressed in neurons. thus, hm4di has been used to silence spontaneous and depolarization-evoked neuronal firing. this goal is often attained by injecting a virus (e.g., adeno-associated virus (aav) or lentivirus) that encodes an effector into a target region in the brain or other tissue. alternatively, the effector can be expressed as a transgene in a genetically engineered mouse line. by using cell type-specific promoters, such as the astrocyte-specific glial fibrillary acid protein (gfap) promoter, the effector's expression can be restricted to a specific population (or more than one population) of cells. an intersectional strategy based on a combination of specific promoters and genetic tools, such as cre- and flippase-mediated recombination, can further restrict the effector expression to specific subpopulations. in addition, other genetic tricks, such as the use of tetracycline-dependent transcriptional regulation, have been used to achieve temporal control as well as amplification of effector expression. optogenetics can deliver photostimulation directly to target cells and manipulate cellular activity acutely and reversibly. in contrast, chemogenetics is ideal for a prolonged manipulation of cellular activity in the range of minutes to days, depending on the route of ligand delivery and the pharmacokinetic properties of the synthetic ligand(s) used. optogenetics is excellent in generating spiking patterns that mimic the endogenous firing responses of neurons by using a pulse generator that produces lights with different frequencies and pulse durations. in addition, photostimulation can be delivered to different subcellular locations such as the soma and nerve terminals, a useful feature for studying neuronal circuits in the brain. on the other hand, chemogenetics is less invasive in experimental animals and hampers animal behaviors only marginally, if at all, because it requires neither the installation of a fiber-optic cable within the brain nor a connection of the cable to a light source, such as a laser or a light-emitting diode (led). furthermore, some synthetic ligands for chemogenetics, such as cno, can be delivered via the animal's water and/or food as well as by systemic injection, permitting the delivery of the ligand with minimal disturbance of the animals, particularly in the case of chronic manipulation. optogenetic and chemogenetic techniques have been most frequently used to investigate neuronal circuits, but they also have been used to study non-neuronal cells in the brain and peripheral tissues. in the following section, we will summarize the approaches and findings of recent studies that have employed these techniques to reveal the function of astrocytes (table 1 and 2). studies using primary astrocytes and immortal astrocyte cell lines have shown that optogenetic stimulation can elicit an elevation of intracellular calcium and subsequent release of gliotransmitters that can activate adjacent astrocytes as well as neurons. have reported that photostimulation of chr2-expressing primary astrocytes using a led can elicit an intracellular calcium increase and electrophysiological responses not only in the stimulated cells but also in co-cultured astrocytes and neurons that do not express chr2. the calcium response in chr2-negative cells is suppressed by the application of antagonists of n-methyl-d-aspartate (nmda) and -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) receptors in the bath solution, suggesting that the response in chr2-negative cells is mediated by glutamate released from chr2-expressing astrocytes. similar results have been obtained in another study, in which the coupling has been demonstrated between an intracellular calcium increase in astrocytes and glutamate release. have performed fluorescent calcium imaging in primary cultures of mouse cortical astrocytes and shown that photostimulation of astrocytes expressing liglur can elicit calcium transients not only in stimulated liglur-expressing cells but also in neighboring astrocytes that do not express the opsin. the calcium response in liglur-negative astrocytes is affected by antagonists of glutamate receptors, but not by a gap junction blocker or an antagonist of extracellular atp signaling, suggesting the involvement of glutamate in the communication between astrocytes. further experiments have shown that the calcium transients in liglur-negative astrocytes are inhibited by an anion channel blocker but are unaffected by an inhibitor of v-atpase, which blocks exocytosis, suggesting that liglur-evoked glutamate release is mediated by anion channels. in an attempt to investigate whether intracellular ionic alteration in astrocytes triggers gliotransmitter release, ono and coworkers have co-cultured an astrocytic cell line and a neuronal cell line; in response to photostimulation, the chr2-expressing astrocytes exhibited diverse cellular changes, including an increase in intracellular sodium and calcium, intracellular acidification, glutamate release, and inhibition of proliferation. a short period of photostimulation (for minutes) elicited calcium transients in the co-cultured chr2-negative neurons, whereas a long period of stimulation for several days resulted in apoptotic responses in the neurons. thus, this study has demonstrated that activation of astrocytes releases glutamate which, in turn, provokes an intracellular calcium increase and cytotoxic cell death. to mimic gpcr-mediated signaling events occurring in astrocytes in response to extracellular neurotransmitters and neuromodulators, figueiredo et al. have expressed gpcr-based opsins, such as opto1ar and opto2ar, in astrocytes to activate gq- and gs-mediated signaling cascades, respectively. photostimulation elicited an intracellular calcium increase in astrocytes expressing either opsin, which was blocked by apyrase, an enzyme hydrolyzing extracellular atp, as well as by pharmacological blockers for the corresponding intracellular signaling cascade, such as inhibitors of phospholipase c and adenylate cyclase; these data indicate that a large portion of the calcium rise that was evoked by the activation of either opsin was a result of the autocrine action of extracellular atp. this study has demonstrated that gpcr-based opsins can be effectively used in the study of astrocytic gpcr-mediated signaling. tetracycline-dependent expression, using the so-called tet-off system, has been employed in several studies to generate transgenic mouse models expressing an opsin. in the tet-off system, the tetracycline-controlled transcriptional activator (tta) binds to a tta-responsive promoter sequence (teto) to induce the expression of a downstream gene. when bound to the tetracycline derivative doxycycline, tta undergoes a conformational change that prevents tta from binding to teto, inhibiting the transcription of a target gene. thus, this system enables a reversible control of gene expression produced by treatment with doxycycline. tanaka and coworkers have generated a mouse line by knocking in a transgene cassette encoding teto-driven chr2(c128s) downstream of a housekeeping gene, -actin, to obtain a high level expression. the knockin mice have been crossed to tta driver lines in which tta is driven by cell type-specific promoters, the mlc1, plp, and iba-1 promoters, to induce chr2(c128s) expression in astrocytes, oligodendrocytes, and microglia, respectively. the double-transgenic mice containing mlc1-driven tta and teto-driven chr2(c128s) have been used to reveal the role of bergman glia (bg), a specialized subtype of astrocytes in the cerebellum, in modulating the activity of purkinje neurons. first, photostimulation of acute brain slices prepared from the transgenic mice was found to elicit current responses from chr2-expressing bg, suggesting that chr2 is expressed in glial cells to a level sufficient for electrophysiological responses. second, photostimulation of the cerebellum using a fiber-optic cable installed above the skull, to avoid the generation of injury-induced reactive gliosis, was found to be sufficient to evoke an induction of a surrogate marker for cellular activation, c-fos, in chr2-expressing bg. third, photostimulation of chr2-expressing bg in acute cerebellar slices was shown to be sufficient to trigger glutamate release and firing of nearby purkinje cells (pcs), resulting in long-term plasticity between parallel fibers and pcs. finally, in vivo photostimulation of glia cells using fiber-optic cable inserted into the cerebellar flocculus was found to cause pupil dilation as well as perturbation of smooth eye pursuit of visual stimuli in head-fixed mice. have recently demonstrated using the same mouse line that neuronal damage in the mouse model of ischemia can be exacerbated by optogenetically induced acidosis and attenuated by alkalization of the cytosolic compartment of astrocytes. under ischemic conditions, such as deprivation of oxygen and glucose, cerebellar bg exhibited intracellular acidosis and glutamate release, followed by an inward excitatory current in the surrounding pcs. the response in pcs was inhibited by a cocktail of glutamate receptor and transporter blockers, suggesting the involvement of glutamate in the interaction between bg and pcs. acidosis induced in bg by optogenetic stimulation of chr2(c128s) was sufficient to evoke an inward excitatory current in the adjacent pcs. the response in pcs was inhibited by a non-competitive ampa and kainate receptor antagonist, confirming the involvement of glutamate in the signaling between bg and pc. in contrast, an efflux of proton from bg produced by optogenetic stimulation of a light-gated outward proton pump, archt, led to a reduction in the inward currents in the pcs elicited by the deprivation of oxygen and glucose. furthermore, in vivo photostimulation of archt-expressing bg caused a substantial reduction in cerebellar infarction following a local thrombosis-caused ischemic stroke, whereas control mice without archt activation exhibited severe neuronal death under the same conditions. taken together, the results of this study have demonstrated that ischemic injury causes glial acidosis, which, in turn, releases glutamate into the extracellular space and causes ischemic neuronal death. have demonstrated that in vivo optogenetic stimulation of cortical astrocytes elicits a rapid, robust, and widespread increase in cerebral blood flow (cbf). the increased cbf was abolished by an application of the inward rectifier potassium channel blocker, bacl2, on the exposed cortex, indicating the importance of potassium signaling in astrocytic modulation of cbf. in contrast, the study found that neither astrocytic intracellular calcium signaling nor glutamate release was involved in the increase in cbf. a number of studies have employed virally mediated expression of opsins to manipulate astrocytes, despite the possibility of inducing reactive gliosis as a result of viral infection. for example, an aav encoding gfap promoter-driven chr2 has been used to reveal a causal relationship between the activity of astrocytes and visual processing in the primary visual cortex (v1). although a previous study had shown that astrocytes in the visual cortex respond to visual sensory stimuli, their roles had not been clearly determined because of the difficulty in selectively manipulating astrocytes among the heterogeneous populations of cells in the region. perea et al. reported that in vivo optogenetic stimulation of astrocytes in the v1 enhanced the spontaneous firing of a population of inhibitory neurons expressing parvalbumin, and this firing was suppressed by treatment with an antagonist of type 1a metabotropic glutamate receptors, suggesting the involvement of glutamate in astrocyte-mediated visual processing. in contrast, optical stimulation of astrocytes had mixed effects in terms of activation and inhibition on excitatory neurons and another population of inhibitory neurons expressing somatostatin. finally, in vivo optogenetic stimulation of astrocytes in the v1 strongly affected the responses of neuronal populations to visual stimuli. optogenetic manipulations have revealed the involvement of other signaling molecules released by astrocytes, such as extracellular atp and l-lactate, in modulating the activity of neurons in the brainstem. have reported that astrocytes in the ventral surface of the medulla oblongata (vs) are exquisitely ph-sensitive. in response to a decrease in ph in anesthetized rats, astrocytes residing near the vs exhibited an intracellular calcium increase. furthermore, a decrease in ph in brainstem slices elicited a sustained atp release in the vs region, as well as extracellular atp-dependent calcium responses in vs astrocytes. to mimic ph-elicited calcium excitation in astrocytes, an aav encoding enhanced gfap promoter-driven chr2(h134r) was injected into the brainstem. in organotypic brainstem slices, photostimulation elicited not only calcium transients in chr2-expressing astrocytes but also long-lasting depolarization in adjacent chemo-sensitive neurons in the retrotrapezoid nucleus (rtn). rtn neurons have been found to play an important role in monitoring glucose concentrations, ph, and partial pressure of co2. either apyrase or an antagonist of extracellular atp receptor blocked the response of the rtn neurons, suggesting that extracellular atp mediates the interaction between astrocytes and adjacent neurons. finally, in vivo unilateral optogenetic stimulation of astrocytes in anesthetized, vagotomized, and artificially ventilated rats elicited a robust respiratory activity from hypocapnic apnea and an increase in phrenic nerve amplitude, which was suppressed by an antagonist of the extracellular atp receptor; these results indicate that astrocytes are critical components of the central respiratory and chemosensory functions, and extracellular atp is a key molecule in the signaling between astrocytes and neighboring neurons in the rtn. the same group of researchers has investigated the astrocytic modulation of norepinephrine (ne) release in the locus coeruleus (lc) using an aav encoding gfap promoter-driven chr2(h134r). evidence existed to suggest that l-lactate is involved in the process, but the exact mechanism was unclear. photostimulation of chr2-expressing astrocytes in organotypic cultured brain slices elicited delayed depolarization and increased firing rates in norepinephrine (ne)-ergic neurons. pharmacological interventions that reduce the level of l-lactate suppressed light-induced depolarization of neergic neurons, suggesting that astrocytes activate neergic neurons via l-lactate. indeed, the application of l-lactate to brain slices provoked similar electrophysiological responses in neergic neurons and caused ne release from the activated neurons. finally, optogenetic activation of astrocytes using either opto2ar or chr2(h134r) was sufficient to trigger ne release. thus, this study clearly demonstrated that activated astrocytes in the lc release l-lactate, which then triggers ne release from neergic neurons. a similar viral approach was used by gradinaru et al. to examine whether local astrocytes contribute to the therapeutic effect of deep-brain stimulation (dbs) delivered to the subthalamic nucleus (stn) to relieve tremor in parkinson's disease. to deliver photostimulation and measure neuronal activity from a parkinsonian rodent model, optrode recordings were performed in anesthetized rats, in which 6-hydroxydopamine (6-ohda) had been unilaterally injected into the right medial forebrain bundle to cause a loss of nigral dopaminergic cells. 6-ohda-treated animals displayed rotations ipsilateral to the lesion as a result of specific deficits in contralateral limb function, which became more obvious when amphetamine was administered to the subjects to increase locomotion. this study revealed that photostimulation of chr2-expressing astrocytes in the stn can reversibly inhibit firing of stn neurons in 6-ohda-treated animals; this treatment, however, failed to cause any changes in pathological motor behavior in parkinsonian rats, suggesting that astrocytes are unlikely to be critical players in the dbs-elicited effects. optogenetic manipulation has been used in two recent studies to examine the role of astrocytes in sleep. have reported that optogenetic activation of the posterior hypothalamus using chr2(h134r) promotes both rapid and non-rapid eye movement sleep. on the other hand, yamashita et al. have reported that in vivo optogenetic stimulation of chr2-expressing astrocytes in the anterior cingulate cortex results in a significant increase in wakefulness as well as disturbance of non-rapid eye movement sleep. in a very recent study reported by poskanzer and yuste, the role of neocortical astrocytes in the control of cortical circuit functions was examined using in vivo two-photon calcium imaging based on the genetic calcium indicator gcamp6s, together with electrophysiological recording from cortical neurons. to examine the causal relationship between the calcium signaling in astrocytes and neuronal activity in the v1, an aav encoding cre-dependent arch was injected into the v1 of transgenic mice expressing gfap promoter-driven cre, which resulted in astrocyte-specific expression of the opsin. when expressed in neurons, arch hyperpolarizes membrane potentials and inhibits neuronal firing by pumping protons out of neurons in response to yellow-light photostimulation. surprisingly, photostimulation of arch in the astrocytes triggered calcium transients that were specifically localized to the processes of astrocytes and largely undetected in the soma. in contrast, neighboring arch-negative cells failed to exhibit a calcium response during photostimulation. a previous study has reported that arch-mediated stimulation of cerebellar bg increases the intracellular ph as the result of an efflux of protons out of cells under oxygen-glucose-deprived conditions. in contrast, poskanzer and yuste found no significant changes in ph in stimulated astrocytes as well as in surrounding cells in the v1. it is not clear whether this discrepancy is a byproduct of cell-type specificity. finally, local field potential recordings have revealed that in vivo optogenetic stimulation of astrocytes in the v1 results in calcium transients, followed by a brief increase in extracellular glutamate and a shift in neuronal firing patterns in v1 from a desynchronized state to the synchronized slow oscillation-dominated state. among diverse chemogenetic effectors, dreadds, such as hm3dq, have been used most frequently in studies focusing on astrocytes. as in optogenetic approaches, astrocyte-specific expression of chemogenetic proteins has been achieved by using viral and transgenic delivery in combination with astrocyte-specific promoters such as the gfap and mlc1 promoters. to manipulate gq-coupled receptor signaling in astrocytes, fiacco et al. generated a bi-transgenic mouse line encoding gfap promoter-driven tta and teto promoter-driven mas-related g protein-coupled receptor a1 (mrgpra1) to express gpcr selectively in astrocytes. mrgpra1 can be activated by rf amides, such as a peptide phe-leu-arg-phe amide (flrf). since endogenous mrgpra1 is specifically expressed in dorsal root ganglion neurons but not in the brain, this protein is a useful molecular tool for manipulating neurons and glia in the brain when it is exogenously expressed in these cells. an infusion of flrf into acute hippocampal slices prepared from the transgenic mice elicited a robust calcium increase in widespread astrocytes, suggesting that mrgpra1 is able to activate the gq-coupled intracellular signaling pathway. it is particularly interesting that such a widespread calcium rise in astrocytes failed to affect neuronal activity in the same slices. this finding is at odds with other studies, questioning the hypothesis that an astrocytic calcium increase causes the release of gliotransmitters which, in turn, activate nearby neurons. in a follow-up study using margpra1 mice together with mice lacking inositol 1,4,5-trisphosphate receptor 2 (ip3 r2), the astrocyte-specific ip3 receptor isoform, the same group of researchers further confirmed that activation of gq protein-coupled signaling affects neither spontaneous excitatory postsynaptic currents nor the induction and maintenance of long-term potentiation in ca1 hippocampal neurons. in another study performed by the same group of researchers, bonder and mccarthy reported that hm3dq can be selectively expressed in astrocytes by injecting aav incorporating cre-dependent hm3dq into the visual cortex of transgenic mice encoding gfap promoter-driven cre, and they have used this system to investigate whether the astrocytic calcium elevation triggers vasodilation and a change in local blood flow in the cortex. activation of hm3dq with cno was sufficient to increase the intracellular calcium level in astrocytes but not to alter the basal blood flow in the visual cortex. the study also reported the absence of a temporal correlation between the astrocytic calcium increase and the change in cortical blood flow following either visual stimulation or a startle-evoking air puff. furthermore, genetic deletion of ip3 r2 did not affect neurovascular coupling, suggesting that gq signaling and ip3-dependent calcium elevation in astrocytes do not mediate vasodilation in the visual cortex. the gfap-driven mrgpra1 mouse line was used in a more recent study of cao and coworkers to investigate the role of astrocytic atp release in depression-like behaviors. application of the mrgpra1 agonist flrf elicited not only a robust increase in intracellular calcium in mrgpra1-expressing primary astrocytes but also a 2.5-fold increase in the atp concentration in the culture medium. furthermore, mrgpra1 mice infused with flrf into the cerebral ventricle exhibited a substantial reduction in depression-like behavior elicited in the murine paradigm of chronic social-defeat stress. together with other results reported in the study, these findings suggest that endogenous atp released from astrocytes can induce antidepressant-like behavior. whether intracellular calcium increases in astrocytes can affect the activity of neighboring neurons was untested in the study. for instance, sweger et al. developed a mouse line expressing an engineered k-opioid receptor (ro1) in gfap-expressing astrocytes by crossing transgenic mice encoding gfap promoter-driven tta mice with another line encoding teto promoter-driven ro1 on the background of a genetic deletion of the endogenous k-opioid receptor (kor). ro1 is a gi-coupled gpcr that is insensitive to endogenous ligands of kor, such as dynorphin, but highly sensitive to a synthetic ligand of the k-opioid receptor, spiradoline. ro1-expressing transgenic mice developed hydrocephalus and accumulation of cerebrospinal fluid in the ventricular system, even in the absence of a synthetic ligand, suggesting that ro1 is constitutively active in this mouse model; unfortunately, this constitutive activity negates one of main features of chemogenetics, its temporal controllability, and limits the use of this model. the same group of researchers has described another transgenic mouse line expressing gfap promoter-driven hm3dq. systemic treatment of these mice with cno elicited a number of physiological changes that are controlled by the autonomic nervous system, including cardiovascular function, saliva formation, and homeostasis of body temperature. furthermore, hm3dq-expressing mice receiving cno exhibited substantial changes in activity-related behaviors and motor coordination. thus, these findings indicate the critical role of astrocytes in a broad range of basic physiological functions. interestingly, the physiological and behavioral changes were unaffected by genetic deletion of ip3 r2, suggesting that astrocytic ip3-mediated calcium increase is dispensable for hm3dq-elicited responses. the gfap promoter-driven hm3dq mice have been used to study glial cells outside of the brain. examined the potential role of the enteric glia, which are astrocyte-like peripheral glial cells surrounding enteric neurons in the gut. an application of cno to the ileal and colonic myenteric plexus prepared from transgenic mice not only elicited and intracellular calcium increase in astrocytes but also triggered contraction of the ileum and colon to a degree similar to that elicited by direct stimulation of smooth muscle or electrical stimulation of enteric neurons. the contraction was abolished by the application of tetradotoxin, indicating the involvement of neuronal activation in the process. these findings have demonstrated that astrocytes in the gut play a critical role in the contractions of intestinal smooth muscle. the mechanism by which activation of gq-coupled receptor in astrocytes leads to activation of enteric neurons remains unknown. have reported two new transgenic mouse lines expressing hm3dq, depending on cre and flippase-mediated recombination. when crossed to cre or flp driver lines, the new mouse lines permit the selective expression of hm3dq in a population of cells that express either cre or flippase. in addition, the intersectional strategy involving both cre- and flippas-edependent recombination further restricts hm3dq expression in a specific subpopulation. this group reported that a systemic application of cno to mice expressing hm3dq in gfap-expressing cells elicits hypothermia, confirming the efficacy of the new mouse line by reproducing the previous finding. finally, the chemogenetic approach has also been applied to reveal the function of gs-coupled signaling in longterm memory in normal animals and the alzheimer animal model. for example, double-transgenic mice encoding gfap promoter-driven tta and teto-driven rs1 have been generated to acutely modulate gs-coupled receptor activity. rs1 is the human gs-coupled 5-ht4b serotonin receptor with a point mutation that renders this receptor insensitive to serotonin but highly sensitive to a synthetic ligand, gr-125487. activation of gs signaling by systemic delivery of gr-125487 impairs the performance of transgenic mice in the morris water maze as well as a novel object-recognition task. orr et al. found that rs1 is constitutively active in this mouse model, driving the gs signaling pathway even in the absence of the synthetic ligand. thus far, only a small number of studies focusing on glia have used a virally mediated method to achieve the expression of chemogenetic proteins. for example, an aav encoding gfap promoter-driven hm3dq or hm4di has been stereotactically injected into the arcuate nucleus of the mouse brain to investigate the potential role of medial basal hypothalamic astrocytes in regulating food intake. in the feeding assay, hm3dq-expressing mice receiving cno exhibited a significant reduction in both baseline feeding and ghrelin-elicited hyperphagia, whereas hm4di-expressing mice receiving cno showed substantially enhanced and prolonged ghrelin-evoked feeding. in contrast, following the cno treatment, leptin-induced anorexia was facilitated in hm3dq-expressing mice but suppressed in hm4di-expressing mice. thus, this study employing two different chemogenetic actuators that recruit different downstream signaling molecules clearly demonstrated that astrocytes in the arcuate nucleus exert bi-directional regulation of food consumption. an aav virus expressing gfap promoter-driven hm3dq was injected into the rat nucleus accumbens core (nacore) in two recent studies in order to investigate the contribution of glial cells and extracellular glutamate to substance abuse and motivation. reported that an application of cno elicited an elevation of the intracellular calcium level in hm3dq-expressing primary astrocytes and a decrease in motivation for self-administration of ethanol after 3 weeks of abstinence. showed that intracranial or systemic administration of cno triggered an increase in extracellular glutamate in the nacore. furthermore, hm3dq-expressing rats receiving intraperitoneal cno exhibited a significant reduction in the cueinduced reinstatement of cocaine seeking. neurons have always been a main focus of brain research, and non-neuronal cells that make up the majority of brain cells, such as glial cells, have not received much attention until recently. studies of glia have revealed that they do not merely provide food and support to neurons; rather, they play an important role in brain function. in order to understand astrocytic function, it is critical to be able to control their intracellular activity in a native context. since glia are intermingled with neurons in the brain and they express receptors and ion channels that are also expressed in neurons, it is difficult to perform such manipulation selectively in glial cells, while leaving neighboring neurons unaffected. optogenetics and chemogenetics are novel manipulation techniques based on genetically encoded effector molecules, such as specific ion channels and gpcrs, that respond to exogenously delivered light stimuli or synthetic ligands, but are unresponsive to endogenous molecules. in combination with cell type-specific promoters and other genetic tools, expression of effector molecules can be restricted to specific cell types. thus, the features of spatial and temporal control make it possible to perform a time-resolved functional manipulation in a specific population of cells. optogenetics and chemogenetics have been used most extensively in the study of neuronal circuits and behavior, but they have also been employed in a number of studies focusing on glial cells, mainly astrocytes. such studies have demonstrated that astrocytes play a critical role not only in a variety of basic physiological responses, including visual processing, norepinephrine release, breathing, cerebral blood flow, feeding, memory, and sleep, but also in pathological conditions, including drug addition, depression, and ischemia. those studies have further revealed the importance of gliotransmitters, such as extracellular glutamate, atp, and l-lactate, that modulate excitability and synaptic transmission in neighboring neurons. however, it is still debatable whether astrocytic release of gliotransmitters is a calcium-dependent process. in addition, the exact molecular mechanisms governing gliotransmitter release from astrocytes remains to be revealed. a combinatorial approach of advanced functional manipulation techniques such as optogenetics and chemogenetics, together with pharmacological and molecular genetic methods, can further our understanding of glial function in health and disease, including neurodevelopment, neurodegenerative disorders, and neuroinflammatory conditions.

the brain consists of heterogeneous populations of neuronal and non-neuronal cells. the revelation of their connections and interactions is fundamental to understanding normal brain functions as well as abnormal changes in pathological conditions. optogenetics and chemogenetics have been developed to allow functional manipulations both in vitro and in vivo to examine causal relationships between cellular changes and functional outcomes. these techniques are based on genetically encoded effector molecules that respond exclusively to exogenous stimuli, such as a certain wavelength of light or a synthetic ligand. activation of effector molecules provokes diverse intracellular changes, such as an influx or efflux of ions, depolarization or hyperpolarization of membranes, and activation of intracellular signaling cascades. optogenetics and chemogenetics have been applied mainly to the study of neuronal circuits, but their use in studying non-neuronal cells has been gradually increasing. here we introduce recent studies that have employed optogenetics and chemogenetics to reveal the function of astrocytes and gliotransmitters.

PMC5081467

pubmed-397

the online version of this article (doi:10.1007/s10953-014-0276-y) contains supplementary material, which is available to authorized users. in recent years, the deep desulfurization of diesel fuel has become the most studied process with different techniques (extraction, liquid liquid separation, oxidative desulfurization, adsorption). the emission of sulfur from petrol and diesel oils, which is linked to acid rain, plays a crucial role in pollution problems of large conglomerates. thus, the usa and european countries have issued regulations regarding sulfur content in fuels [1, 2]. due to this situation, the european union approved a new directive stating that the content of total sulfur in european gasoline and diesel fuels from 2010 onwards must be at a maximum concentration level of 10 ppm. ionic liquids (ils) have the ability to extract aromatic sulfur-containing compounds at ambient conditions. additionally, ils are immiscible with the fuel, are non-volatile and can be regenerated and recycled by solvent washing. oxidative desulfurization in future years probably will bring better results than simple liquid liquid separation, however, first the best ils must be chosen. at present, the hydrodesulfurization (hds) processes is the established method used in some industrial technologies to remove organic sulfur from fuels. however, to achieve low sulfur targets with current hds technology, higher temperatures, higher pressures, larger reactor volumes, and more active catalysts are needed. the hds process does not purify fuels of polycyclic organic sulfides such as thiophene, benzothiophene, methyldibenzothiophenes, 4,6-dibenzothiophenethiols, thioethers, and disulfides. extraction desulfurization, which has begun to be popular, especially with ils, has the potential for being an alternative and future complementary technology for deep desulfurization [410]. in order to solve this problem, extractive liquid liquid equilibrium (lle) desulfurization with ils has been proposed [7, 1018]. the 1-alkylpiperidinium-based, or pyrrolidinium-based ils with different anions, or 1-alkylcyanopyridinium-based ils, have been recently studied in our laboratory in ternary lle {il+thiophene, or benzothiophene+heptane) with high selectivities. attractive extraction parameters were presented as well for 1-ethyl-3-methylimidazolium bis{(trifluoromethyl)sulfonyl}imide, [emim][ntf2] (, and references cited therein), 1-ethyl-3-methylimidazolium acetate, [emim][oac], 1-ethyl-3-methylimidazolium thiocyanate, [emim][scn], and 1,3-dimethylimidazolium methylphosphonate [dmim][mp]. this work is a continuation of our systematic studies on the physicochemical properties and the extraction abilities of piperidinium-based ils (and references cited therein). proposed by us are new interaction parameters for the group contribution method modified unifac for the piperidnium-based ils, predicted attractive infinite dilution selectivity, and capacity of piperidinium-based ils (alkane chain, n=36) in the thiophene/heptane separation problem at t=328.15 k. to our best knowledge, the phosphonium-based il (tributyl-methylphosphonium methylsulfate, [p1,4,4,4][ch3so4 ]) was measured in ternary lle for the separation of thiophene from cyclohexane at t=298.15 k with very low selectivities in a range of 1.5 to 5.4. better results were obtained with deep eutectic solvents, des, containing phosphonium-based ils with ethylene glycol. des is composed of methyltripentylphosphonium bromide, [p1,5,5,5][br], and ethylene glycol (as a hydrogen bond donor) showed selectivities of about s=60100 for ternary lle at t=318 k for benzene/hexane separation. poorer results were estimated with des composed of tetrabutylphosphonium bromide, [p4,4,4,4][br], and ethylene glycol for the separation of toluene/heptane. usually, the results of separation processes for aliphatic/aromatic hydrocarbons provide good information for the separation of aliphatic/aromatic sulfur compounds. we can expect similar or even better results for the chosen il. on the other side, there are very good results obtained with methylphosphonate and diethylphosphate anions of ils in ternary lle (il+thiophene+heptane) mixtures. in this work we report experimental ternary lle data for one additional piperidinium-based il, {1-pentyl-1-methylpiperidinium bis{(trifluoromethyl)sylfonyl}imide [c5mpip][ntf2], for comparison with measured earlier 1-propyl, or 1-butyl-, or 1-hexyl-1-methylpiperidinium bis{(trifluoromethyl)sylfonyl}imide. moreover, tributylethylphosphonium diethylphosphate, [p2,4,4,4][dep] was chosen to check the influence of the anion. the [dep] anion in [emim][dep] shows interesting results for thiophene extraction from hexane at t=298.15 k. the solvents heptane, thiophene, and benzothiophene used in this work are model compounds for fuel and sulfur organic hydrocarbons, respectively. the ternary systems {il (1)+thiophene, or benzothiophene (2)+heptane (3)} were investigated at t=308.15 k and p=101.33 kpa. the experimental tie-lines for four ternary mixtures the solute distribution ratio and the extractive selectivity were determined from the experimental data, and are compared to the literature data. the ils studied, [c1c5pip][ntf2] and [p2,4,4,4][dep], were purchased from iolitec. the names, abbreviations, structures, measured densities and mass fraction of ils are listed in table 1. the names, cas numbers, sources, mass fraction purities, purification method, water content, and measured and literature densities of all chemicals used are shown in table 1s in the supplementary material information. the samples of ils were dried for 24 h at 300 k under reduced pressure to remove volatile impurities and trace amounts of water. thiophene and benzothiophene were stored over freshly activated molecular sieves of type 4 (union carbide). the densities for all substances were measured at t=298.15 and 101.33 kpa. the method and uncertainties have been described previously . table 1list of investigated ionic liquids: structure, name, abbreviation of name, molar mass (m) and densitycationanionname, abbreviationm/(gmol)exp. density /gcm (298.15 k; 101.33 kpa) 1-pentyl-1-methylpiperidinium bis{(trifluoromethyl) sulfonyl}imide [c1c5pip][ntf2]450.461.35016 tributylethylphosphonium diethylphosphate, [p2,4,4,4][dep]384.471.0089 list of investigated ionic liquids: structure, name, abbreviation of name, molar mass (m) and density the water content was analyzed by the karl-fischer titration (method titroline kf). the sample of il, or solvent, was dissolved in methanol and titrated in steps of 0.0025 cm. the error in the water content is 10 10 in mass fraction for the 3 cm of injected il. the water content in solvents used was less than 350 10 in mass fraction. to obtain the experimental lle tie-lines, mixtures with compositions inside the immiscible region of the systems the vessel was tightly closed to avoid losses by evaporation or pickup of moisture from the atmosphere. the jackets were connected to a thermostatic water bath (lauda alpha) to maintain a constant temperature of t=308.15 k (0.05). the mixtures were stirred for 6 h to reach thermodynamic equilibrium and after a minimum of 12 h were analyzed. after the phase separation, samples of about (0.10.3) 10 cm were taken from both phases using glass syringes with coupled stainless steel needles. a sample of the phase was placed in an ampoule with a capacity of 2 10 cm. next, acetone (1.0 cm) was added to the samples to avoid phase splitting and to maintain a homogeneous mixture. because of the low vapor pressure, the ils used in this work can not be analyzed by gc. thus, only thiophene or benzothiophene and heptane were analyzed; the mass fraction of the third component, the il, was determined by subtracting the mole fractions of the two other components from unity. the compositions were analyzed by gas chromatography (perkinelmer clarus 580 gc equipped with auto sampler and fid and tcd detectors). the capillary column of the chromatograph was protected with a pre-column to avoid the non-volatile ionic liquid reaching the column in the case of a leak from the glass wool in the liner. the totalchrom workstation software was used to obtain the chromatographic areas for the thiophene, or benzothiophene, heptane and the internal standard propan-1-ol. details of the operational conditions of the apparatus are reported in table 2s in the supplementary material. the estimated uncertainty in the determination of mole fraction compositions is 0.003 for compositions of the hydrocarbon-rich phase and 0.005 for compositions of the il-rich phase. the equilibrium compositions of the experimental tie-line ends in ternary systems of four mixtures {il (1)+thiophene or benzothiophene (2)+heptane (3) }, at t=308.15 k and p=101.33 kpa are reported in table 2. experimental solubilities for [c1c5pip][ntf2] and [p2,4,4,4][dep] in heptane at t=308.15 k are totally different from each other. in the binary {il (1)+heptane (3)} system complete liquid miscibility (solubility of heptane in the il) is up to mole fraction of heptane \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{\text{il}} $$ \end{document}x3il=0.089 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{\text{il}} $$ \end{document}x3il=0.456 for [c1c5pip][ntf2] and [p2,4,4,4][dep], respectively. the solubility of heptane is much larger in [p2,4,4,4][dep] than that in [c1c5pip][ntf2]. the piperidinium-based il shows much lower solubility of heptane in the il. in comparison with piperidinium-based il measured by us earlier, heptane shows higher solubility in [c1c5pip][ntf2] than in [c1c3pip][ntf2] (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{\text{il}} $$ \end{document}x3il=0.051, at t=308.15 k). this effect is due to an increase in the van der waals interactions between the hydrocarbon chain of the cation and heptane. table 2compositions of experimental tie lines, solute distribution ratios,, and selectivity, s, for ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1)+thiophene or benzothiophene (2)+heptane (3)} at t=308.15 k, p=101.33 kpahydrocarbon-rich phaseil-rich phase s \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{1}^{\text{i}} $$ \end{document}x1i \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{\text{i}} $$ \end{document}x2i \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{1}^{\text{ii}} $$ \end{document}x1ii \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{\text{ii}} $$ \end{document}x2ii [c1c5pip][ntf2]+thiophene+heptane 0.0000.0000.9110.000 0.0000.0570.7700.1422.4926.7 0.0000.1110.6630.2502.2523.0 0.0000.1910.5640.3521.8417.7 0.0000.2300.5230.3921.7015.4 0.0000.3530.4240.4901.3910.4 0.0000.4470.3760.5421.218.2 0.0000.5300.3370.5821.106.4 0.0000.6960.2810.6500.934.1 0.0000.8000.2410.7020.883.1 0.0000.8910.2130.7500.842.5 0.0001.0000.1860.8140.81[c1c5pip][ntf2]+benzothiophene+heptane 0.0000.0000.9110.000 0.0000.0250.8030.1094.3648.3 0.0000.0520.7050.2104.0445.0 0.0000.0920.5890.3263.5437.9 0.0000.1610.4440.4722.9329.3 0.0000.2430.3830.5312.1919.2 0.0000.3460.2990.6111.7712.8 0.0000.4600.2360.6741.478.8 0.0000.5530.2080.6961.265.9 0.0000.7660.1440.7580.992.4 0.0000.8530.0960.8190.961.7 0.0000.9150.0600.8730.951.2[p2,4,4,4][dep]+thiophene+heptane 0.0020.0000.5440.000 0.0020.0160.5150.0432.696.0 0.0040.0430.4430.1042.425.1 0.0050.0790.3760.1702.154.3 0.0080.1120.3230.2141.913.6 0.0090.1480.2740.2571.743.1 0.0080.1720.2440.2801.632.8 0.0100.1990.2010.3011.512.4 0.0130.2120.1870.3091.462.2 0.0130.2390.1600.3261.362.0[p2,4,4,4][dep]+benzothiophene+heptane 0.0020.0000.5480.000 0.0060.0150.4950.0624.139.1 0.0070.0440.4180.1633.708.4 0.0090.0680.3690.2243.297.5 0.0060.0920.3270.2773.016.9 0.0110.1200.2870.3232.696.0 0.0060.1670.2180.3802.284.7 0.0140.2410.1710.4221.753.2 0.0140.2710.1470.4351.612.7 0.0150.3110.1150.4531.462.3standard uncertainties are: u(x)<0.003, u(t)=0.05 k compositions of experimental tie lines, solute distribution ratios,, and selectivity, s, for ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1)+thiophene or benzothiophene (2)+heptane (3)} at t=308.15 k, p=101.33 kpa standard uncertainties are: u(x)<0.003, u(t)=0.05 k the solubility of thiophene at t=308.15 k is equal to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{\text{il}} $$ \end{document}x2il=0.814 for [c1c5pip][ntf2] (x2il=0.797 for [c1c3pip][ntf2] at t=298.15 k, the influence of temperature is minimal; the largest solubility of thiophene in the piperidinium-based il was observed for c1c6pip][ntf2]). complete miscibility with thiophene was observed for [p2,4,4,4][dep]. in the binary system with benzothiophene, the solubility of benzothiophene in [c1c5pip][ntf2] at t=308.15 k is equal to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{\text{il}} $$ \end{document}x2il=0.873 (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{\text{il}} $$ \end{document}x2il=0.945 for [c1c3pip][ntf2] at t=308.15 k. immiscibility is observed in the {thiophene, or benzothiophene (2)+heptane (3)} binary mixture, as was reported previously. the determined experimental tie-lines for the ternary lle systems are plotted in figs. 1, 2, 3, 4 for thiophene and benzothiophene, respectively. figures 1, 2, 3, 4 show that the two-phase region is much larger for [c1c5pip][ntf2] than that for [p2,4,4,4][dep]. fig. 1plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3)} at t=308.15 kfig. 2plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3)} at t=308.15 kfig. 3plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3)} at t=308.15 kfig. 4plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3)} at t=308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3)} at t=308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3)} at t=308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3)} at t=308.15 k plot of the experimental (filled circle, gray solid lines) results versus values calculated with the nrtl equation (square, black dotted lines) for the composition tie lines of the ternary system {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3)} at t=308.15 k the results obtained in this work show that the more suitable il for the separation of thiophene, or benzothiophene from heptane, is [c1c5pip][ntf2] because of its much larger selectivity (s) and the comparable solute distribution ratio (). these parameters are defined as follows:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \beta=\frac{{x_ {2}^{\text{ii} }}} {{ x_ {2}^{\text{i} }}} $$ \end{document}=x2iix2i2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ s=\frac{{x_ {2}^{\text{ii}} \cdot x_ {3}^{\text{i} }}} {{ x_ {2}^{\text{i}} \cdot x_ {3}^{\text{ii} }}} $$ \end{document}s=x2iix3ix2ix3iiwhere x is the mole fraction; superscripts i and ii refer to the heptane-rich phase and the il-rich phase, respectively. the values of and s are listed in table 2 for thiophene and benzothiophene. figures 5 and 6 present measured values of and s for ils for thiophene and benzothiophene. fig. 5plot of the selectivity (s) as a function of the mole fraction of solute in the hydrocarbon-rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3) }, filled square {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3) }, open circle {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3) }, and open square {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3) }, at t=308.15 kfig. 6plot of the solute distribution ratio () as a function of the mole fraction of solute in the hydrocarbon-rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3)} filled square {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3)} open circle {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3) }, and open square {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3) }, at t=308.15 k plot of the selectivity (s) as a function of the mole fraction of solute in the hydrocarbon-rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3) }, filled square {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3) }, open circle {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3) }, and open square {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3) }, at t=308.15 k plot of the solute distribution ratio () as a function of the mole fraction of solute in the hydrocarbon-rich phase for the ternary systems: closed circle {[c1c5pip][ntf2] (1)+thiophene (2)+heptane (3)} filled square {[c1c5pip][ntf2] (1)+benzothiophene (2)+heptane (3)} open circle {[p2,4,4,4][dep] (1)+thiophene (2)+heptane (3) }, and open square {[p2,4,4,4][dep] (1)+benzothiophene (2)+heptane (3) }, at t=308.15 k the values presented in table 2 show that the distribution ratio coefficient are in the range of 0.812.41, 0.954.36, 1.362.69 and 1.464.13 for [c1c5pip][ntf2]/thiophene, [c1c5pip][ntf2]/benzothiophene, [p2,4,4,4][dep]/thiophene and [p2,4,4,4][dep]/benzothiophene, respectively. the selectivities of the separation in the system thiophene or benzothiophene/heptane is quite high for [c1c5pip][ntf2] and very low for [p2,4,4,4][dep]. the values listed in table 2 for the best tie-lines are: 26.7, 48.3, 6.0 and 9.1 for [c1c5pip][ntf2]/thiophene, [c1c5pip][ntf2]/benzothiophene, [p2,4,4,4][dep]/thiophene and [p2,4,4,4][dep]/benzothiophene, respectively. in this work the effect of the alkane chain length on the cation of the piperidinium-based il was examined for comparison with previously measured data for [c1c3pip][ntf2]/thiophene, [c1c4pip][ntf2]/thiophene, and [c1c6pip][ntf2]/thiophene at t=298.15 k, and of [c1c3pip][ntf2]/benzothiophene at t=308.15 k (the influence of temperature is not large). the characteristic extraction parameters obtained in this work are compared to the few previously described in the open literature in table 3. unfortunately, the selectivity for [c1c5pip][ntf2] obtained in this work is slightly worse than that for [c1c3pip][ntf2] measured by us earlier. the values of selectivity presented for 1-alkylcyanopyridinium-based ils at t=308.15 k measured in our earlier work are also larger than those for piperidinium-based ils (see table 3). table 3comparison of solute distribution ratio () and selectivity (s) for sulfur compounds extractionillle system t/k max s max ref.[c1c5pip][ntf2]il+thiophene+heptane3082.4926.7this work[c1c5pip][ntf2]il+benzothiophene+heptane3084.3648.3this work[c1c3pip][ntf2]il+thiophene+heptane2982.5060.3[c1c3pip][ntf2]il+benzothiophene+heptane3085.3693.0[coc2mpip][ntf2] il+thiophene+heptane2982.6462.9[coc2mpip][fap] il+thiophene+heptane2984.0056.8[bcnpy][ntf2] il+thiophene+heptane3081.9362.2[bcnpy][ntf2] il+benzothiophene+heptane3083.50117.1[p2,4,4,4][dep]il+thiophene+heptane3082.696.0this work[p2,4,4,4][dep]il+benzothiophene+heptane3084.139.1this work[emim][dep] il+thiophene+hexane2982.8848.8[p1,4,4,4][ch3so4]il+thiophene+cyclohexane2981.385.38[dmim][mp] il+thiophene+heptane2980.421,756 1-(2-methoxyethyl)-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide 1-(2-methoxyethyl)-1-methylpiperidinium trifluorotris(perfluoroethyl)phosphate 1-butyl-4-cyanopyridinium bis{(trifluoromethyl)sulfonyl}imide 1-ethyl-3-methylimidazolium diethylphosphate 1,3-dimethylimidazolium methylphosphonate comparison of solute distribution ratio () and selectivity (s) for sulfur compounds extraction 1-(2-methoxyethyl)-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide 1-(2-methoxyethyl)-1-methylpiperidinium trifluorotris(perfluoroethyl)phosphate 1-butyl-4-cyanopyridinium bis{(trifluoromethyl)sulfonyl}imide 1-ethyl-3-methylimidazolium diethylphosphate 1,3-dimethylimidazolium methylphosphonate the selectivities for [c1c3pip][ntf2] are comparable to those for 4-(2-methoxyethyl)-4-methylpiperidinium trifluorotris(perfluoroethyl)phosphate [coc2mpip][fap] ils at t=298.15 k, or to 4-(2-methoxyethyl)-4-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide [coc2mpip][ntf2]. the extraction results for [p2,4,4,4][dep] are very low and similar to [p1,4,4,4][ch3so4]. it can be definitely concluded that phosphonium-based cations are not suitable for these separation processes. however, for the diethylphosphate anion [dep] and imidazolium-based cation [emim], the results are comparable to those obtained in this work with [c1c5pip][ntf2] but with a lower value (see table 3). it can be also seen from figs. 5 and 6 that and s decrease as the solute mole fraction (thiophene, or benzothiophene) in the heptane phase increases, for all systems, when going through the tie-line end compositions. the ternary lle data measured in this study were correlated (the tie-line correlation) using the well known non-random liquid equation, nrtl. the equations and algorithms used for the calculation of the compositions in both phases follow the method described by walas. the objective function f(p) was used to minimize the difference between the experimental and calculated compositions:3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ f(p)=\sum\limits_{i=1}^{n} {\left [{ x_{2}^{{{\text{i,}}exp}}-x_ {2}^{\text{i, calc}} \left ({ pt} \right)} \right]^{2}+\left [{ x_{3}^{{{\text{i,}}exp}}-x_{3}^{\text{i, calc}} \left ({ pt} \right)} \right]}^{2}+\left [{ x_{2}^{{{\text{ii,}}exp}}-x_ {2}^{\text{ii, calc}} \left ({ pt} \right)} \right]^{2}+\left [{ x_{3}^{{{\text{ii,}}exp}}-x_ {3}^{\text{ii, calc}} \left ({ pt} \right)} \right]^{2} $$ \end{document}f(p)=i=1nx2i, exp-x2i, calcpt2+x3i, exp-x3i, calcpt2+x2ii, exp-x2ii, calcpt2+x3ii, exp-x3ii, calcpt2where p is the set of parameters vector, n is the number of experimental points, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{{{\text{i}},exp}} $$ \end{document}x2i, exp, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{{{\text{i}},exp}} $$ \end{document}x3i, exp and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_ {2i}^{{{\text{i}},{\text{calc} }}} \left ({ pt} \right) $$ \end{document}x2ii, calcpt, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{\text{i, calc}} \left ({ pt} \right) $$ \end{document}x3i, calcpt are the experimental and calculated mole fractions of one phase, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{2}^{{{\text{ii}},exp}} $$ \end{document}x2ii, exp, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_{3}^{{{\text{ii,}}exp}} $$ \end{document}x3ii, exp\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_ {2}^{\text{ii, calc}} \left ({ pt} \right) $$ \end{document}x2ii, calcpt, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ x_ {3}^{\text{ii, calc}} \left ({ pt} \right) $$ \end{document}x3ii, calcpt are the experimental and calculated mole fractions of the second phase. the binary parameters of each constituent were regressed by minimizing the sum of the squares of the differences between the experimental and calculated mole fractions of each component of both liquid phases for each ternary system. the value of the non-randomness parameter, ij, was optimized in order to obtain the best model fit. the correlated parameters are given in table 4 along with the root mean square deviations (rmsd). the rmsd values, which are a measure of the precision of the correlation, were calculated according the equation:4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\text{rmsd}}=\left ({ \sum\limits_{i} {\sum\limits_{l} {\sum\limits_{m} {\left [{ x_{ilm}^{exp}-x_{ilm}^{\text{calc} }} \right]^{2} /6k} }}} \right)^{1/2} $$ \end{document}rmsd=ilmxilmexp-xilmcalc2/6k1/2where x is the mole fraction and the subscripts i, l, and m designate the component, phase, and tie-line, respectively. the experimental and calculated lle data agreed relatively well. table 4binary interaction parameters, parameter ij and root mean square deviation (x) for the nrtl equation for the ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1)+thiophene or benzothiophene (2)+heptane (3)} at t=308.15 k, p=101.33 kpa ij g 12/(jmol)g 21/(jmol) ij rmsd x [c1c5pip][ntf2]+thiophene+heptane 128261.1123225.940.20.007 132536.4315361.68 23460.97475.45[c1c5pip][ntf2]+benzothiophene+heptane 125698.7312608.560.20.007 135142.9534672.57 232498.842232.66[p2,4,4,4][dep]+thiophene+heptane 125566.067459.650.20.003 132785.5519670.14 233351.226008.81[p2,4,4,4][dep]+benzothiophene+heptane 129265.5911427.530.20.004 132823.0616531.68 231048.012808.72 binary interaction parameters, parameter ij and root mean square deviation (x) for the nrtl equation for the ternary systems {[c1c5pip][ntf2] or [p2,4,4,4][dep] (1)+thiophene or benzothiophene (2)+heptane (3)} at t=308.15 k, p=101.33 kpa liquid phase equilibrium data were measured in this study for the extraction of thiophene or benzothiophene from heptane using two ils. four ternary systems {il+thiophene or benzothiophene+heptane} were analytically determined using gc for the composition analysis at temperature t=308.15 k at ambient pressure. it has been demonstrated that the 1-pentyl-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide il is much more effective than the phosphonium-based il for extraction of thiophene or benzothiophene from alkanes. sulfur compounds can be extracted easily by piperidinium-based ils, leading to low sulfur content in fuels. our earlier experimental results revealed that the solubility of sulfur compounds in the il increases as the alkyl chain length increases. the capacity of extraction, described in terms of the selectivity and the solute distribution ratio coefficients, was calculated for all ternary systems and compared to the published data used in similar extraction problems. based on the values obtained, [c1c5pip][ntf2] was found to be useful for the extraction of sulfur compounds from alkanes; however, it is not as good as [c1c3pip][ntf2] measured previously. the selectivity and the solute distribution ratio decrease as the mole fraction of thiophene or benzothiophene in the heptane-rich phase increases. the best selectivity (s) is observed for very low mole fractions of s-compounds in the hydrocarbon-rich phase \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ (x_{2}^{\text{hc}} \,=\,0.0 5) $$ \end{document}(x2hc=0.05) (see fig. 5), which may be compared with the results of the hds method for the removal of the s-compounds. the experimental data in this work the non-randomness parameter was also determined through the reduction of the experimental data. the model exhibited an excellent fit to the data with the average rmsd values between 0.003 and 0.007.

in this work, the desulfurization ability of alkyl-piperidinium-based and phosphonium-based ionic liquids (ils) for (thiophene or benzothiophene+heptane) mixtures are studied. with this aim, ternary liquid liquid phase equilibrium data (lle) have been obtained for mixtures of {il (1)+thiophene, or benzothiophene (2)+heptane (3)} at t=308.15 k and p=101.33 kpa. for this study 1-pentyl-1-methylpiperidinium bis{(trifluoromethyl)sulfonyl}imide, [c1c5pip][ntf2], and tributylethylphosphonium diethylphosphate, [p2,4,4,4][dep], were used. the suitability of these ils as solvents for extractive desulfurization has been evaluated in terms of the solute distribution ratio and selectivity. immiscibility was observed in the binary liquid systems of (thiophene, or benzothiophene+heptane) with both ils. one of the studied ils, [c1c5pip][ntf2], shows high distribution ratios and high selectivities for extraction of sulfur compounds. the data obtained have been correlated with the non-random two liquid nrtl model. the experimental tie-lines and the phase compositions in mole fractions in the ternary systems were calculated with an average root mean square deviation of 0.0052.electronic supplementary materialthe online version of this article (doi:10.1007/s10953-014-0276-y) contains supplementary material, which is available to authorized users.

PMC4412552

pubmed-398

higher carriage rates are seen in diabetics, intravenous drug users (ivdu), hiv and dialysis patients. all patients with s. aureus bacteremia should undergo transthoracic echocardiography (tte), since s. aureus bacteremia is associated with heart valve involvement in 25% of the cases. nevertheless, tee has been shown to be superior to tte for the diagnosis of infective endocarditis (ie), identifying small vegetations and abscesses. all infective foci must be identified and removed as soon as possible; however, foci are not always obvious and long-term antimicrobial therapy might be necessary. nafcillin is a well-established agent for serious systemic non methicillin-resistant s. aureus (mrsa) infections and has been reported as superior over vancomycin. we present a very interesting case of a rapidly progressive methicillin-sensitive staphylococcus aureus infection, for which empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination despite adequate mic, taking longer than usual to respond to adequate treatment. a 64-year-old male patient with a past medical history of hypertension, hiatal hernia and osteoarthritis presented to the emergency department with a chief complaint of acute worsening of his chronic lower back pain for two weeks and progressive weakness in lower extremities. he used to ambulate with a cane and later used a walker for several days, but recently he felt non-ambulant. cardiac examination showed a regular rate and rhythm with normal s1 and s2 and no murmurs. on further review of systems he reported having chronic bilateral knee pain related with osteoarthritis and a congenital deformation of his right knee. he was a smoker of 40 pack-years, occasional user of alcohol and marijuana, but denied ever using intravenous drugs and toxicology was positive only for oxycodone, which he used for chronic lumbar pain for several years. laboratory exams displayed a leukocytosis of 25,500 with 89% neutrophils, no bands, sedimentation rate of 44, lactic acid 1.6, anion gap 18. thoracic and lumbar spine computed tomography (ct) scan showed multilevel central canal and bilateral neural foraminal compromise, but did not show evidence of abscess. partially visualized lungs showed a cavitary lesion in the superior segment of the left lower lobe, measuring 1.4 cm with circumferential thick wall, suggestive of septic emboli versus tuberculosis, and left inferior renal pole abnormalities suggestive of multiple infarctions. the patient was started empirically on vancomycin 15 mg/kg iv q 12h, while waiting for sensitivities. the tte performed after bacteremia diagnosis showed an ejection fraction of 65% with normal valves and no vegetations. on day two of hospitalization the clinical picture worsened as the patient suddenly developed an altered mental status and nuchal rigidity. lumbar puncture confirmed meningitis with a cerebrospinal fluid leukocytosis of 1157 (neutrophil 95%) and culture positive for s. aureus. testing for hiv, herpes simplex virus (hsv) and tuberculin skin test (ppd) were all negative. spine magnetic resonance imaging (mri) showed osteomyelitis at t12-l1 and previously seen (in ct scan) renal infarcts. the patient continued to be febrile despite pathogen susceptible to vancomycin with mic<2 mg/ml, trough previous to 4 dose 11, repeated trough 18.4, repeat blood cultures at 48 and 96 hours remained negative. six days later he had clinical deterioration with tachypnea, hypoxia, new systolic 2/6 murmur, louder over cardiac apex area, and bilateral respiratory crackles. at this point, the patient was switched to nafcillin 2 g iv q 4h when blood culture results confirmed methicillin susceptibility on day 3 of admission. head mri showed multiple infarcts in a non-vascular pattern secondary to septic embolisms (figure 1). the tee showed severe mitral and tricuspid regurgitations, with 1.5 cm mobile vegetation on the posterior leaflet of the mitral valve. the patient was transferred to the intensive care unit due to the complicated picture of mssa bacteremia, ie, osteomyelitis, meningitis, ischemic stroke, renal and pulmonary infarcts secondary to septic emboli. there were indications for emergent mitral valve replacement, however given his recent finding of embolic stroke; this was not feasible due to high mortality risk. follow up tte showed worsening mitral and tricuspid valve involvement, therefore mitral and tricuspid valve replacements were performed, four weeks from ie diagnosis. he completed 8 weeks of nafcillin (given his vertebral involvement and unknown source). after 2 months of hospitalization, patient was discharged home with a dual-chamber pacemaker due to persistent 3rd degree atrio-ventricular block, post surgery. staphylococcus aureus is one of the leading agents of infection among adult patients. when s. aureus invades deep structures it often metastasize hematogenously to other areas and organs with significant morbidity. infection caused by community acquired mssa strains are characterized by severe clinical course with increased incidence of endocarditis and organ failure. two important questions should be asked to the patient with the intention to identify focal source and consider additional necessary diagnostic test. ivdu related infection can manifest as an initially insidious presentation that later complicates to be an aggressive metastatic disease. we presented a unique case since our patient was not an ivdu nor an initial focus of infection was identified. additionally, the progression from negative to positive echocardiogram findings of valvular vegetations highlights the high virulence of this community-acquired pathogen, since severe valvular regurgitation or insufficiency should be equally observed on both types of echocardiograms. altered mental status in such patients a mri is crucial to confirm the diagnosis with the visualization of a non-vascular pattern. mssa meningitis is a serious infection, which can occurs in patients without risk factors or immunosuppression. like meningitis, stroke secondary ca-mssa is rarely seen, regardless of the severity of infection. high level of clinical suspicion is needed in such patients, as back pain could be the only reliable predictor of an added spine infection. when treating for gram-positive cocci bacteremia, empirical antibiotic therapy should provide coverage against staphylococci, usually with vancomycin to cover mrsa. nafcillin/oxacillin remains the antibiotic of choice for treating infections caused by mssa once culture and sensitivity results confirm it, because nafcillin is superior to vancomycin in preventing persistent or relapsing mssa bacteremia. in the case of endocarditis, studies have demonstrated that vancomycin (versus nafcillin) is significantly associated with relapse given its slow bactericidal activity. for our case, the reasons why empirical treatment with vancomycin and initial treatment with nafcillin, did not stop further dissemination remained unknown. nevertheless, continued treatment with nafcillin eventually did resolve the infection. we have to consider that, even though the mic remains the only satisfactory in vitro measurement of the intrinsic activity of antimicrobials, the test has always been open for criticism since it is performed with the use of artificial media and fixed concentrations, under conditions that may be very different from those in the actual site of infection. there is evidence that support the concept of the principal determinant of efficacy of beta lactams to be the time for which the drug levels exceed the mic at the site of infection, not just and mic<2 mg/ml by itself. also, bacterial strains have been detected to have a mbc (minimum bactericidal concentration) many times higher than the mic, (known as phenotypic tolerance), isolated in vitro gram-positive bacteria causing slower clinical response. the inoculum effect may be clinically relevant since the number of bacteria at the site of infection may much higher that the traditionally used for susceptibility testing. although the benefit of such concentration is questionable since our patient s infection was multifocal. our laboratory was not able to analyze serum nafcillin concentrations; hence, samples would have to send to a referral laboratory. a community acquired pathogen, even when part of the normal flora could be virulent enough to cause end organ damage from head to toe. the use of head mri as a pre evaluation tool for ie-related urgent valve surgery is imperative, to investigate whether such preoperative findings affect postoperative outcomes. the presence of characteristic cranial mri lesions may prompt early diagnosis of infective source and lead to the adequate management. beyond the mic, the time the drug level exceeds the mic, the phenotypic tolerance and the inoculum effects may be reasons why empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination, but, eventually, clearing the infection.

methicillin-sensitive staphylococcus aureus (mssa) meningitis is a rare disease when not related to neurosurgery: there are only few reported cases in the literature to date. we describe a case that highlights not only meningeal but also diffuse and rapidly progressive systemic involvement with multi-organ failure. a 64-year-old male presented to our hospital with a chief complaint of acute worsening of his usual chronic lower back pain, progressive weakness in lower extremities and subjective fevers at home. hospital course demonstrated mssa bacteremia, of questionable source, that resulted in endocarditis affecting right and left heart in a patient with no history of intravenous drug use. the case was complicated by septic emboli to systemic circulation involving the kidneys, vertebral spine, lungs and brain with consequent meningitis and stroke, even when treated empirically with vancomycin and then switched to nafcillin as indicated. even though mssa infections are well known, there are very few case reports describing such an acute-simultaneous-manifestation of multi-end-organ failure, including meningitis and stroke. our case, also presented with an uncommon manifestation of persistent infection dissemination despite adequate antibiotic treatment.

PMC4508536

pubmed-399

falls are one of the leading injury-related accidents involving older adults whose muscular strength, proprioceptive sense, and bodily coordination are compromised with aging1. the elderly lack obstacle negotiation capacity and are prone to trip over commonly encountered environmental barriers such as door sills, pavement blocks, and safety bumps2. in a local community, 33% of elderly people were reported to experience falls, of which 42.4% suffered falls3. individuals with a history of falls have fears of repeated falls, depression, and anxiety, all of which lead to decreased physical activities4. these negative experiences result in reduced physical capacity in terms of muscular strength, bodily flexibility, and coordination, rendering the affected elderly even more susceptible to falls in a vicious cycle5. notably, elderly women are more at risk of secondary injury such as severe fractures after falling than elderly men because of their low bone density after menopause6. interventions for fall prevention include exercise, education, environmental improvements, and medication7,8,9, of which exercise has been used in fall prevention programs in many ways, as it takes less time and money to implement and programs are easy to set up. carter et al.10 reported in a bibliographical study on exercise intervention that exercise improved leg strength 44.4% and balance ability 37.5% in older adults and that as weakness of muscle strength in the trunk was more important than that in the lower extremities, strengthening of lumbar function can improve functional stability, leading to increased balance ability, gait ability, and prevention of falling11, 12. core stabilization exercise (cse) can improve balance control ability by reinforcing intersegmental muscles in the multifidus, transversus abdominis, and rotators13 and physicopsychological functions in a harmonious way by stimulating proprioception powerfully when it is accompanied by swiss ball exercises, improving balance sense, and maintenance ability14. previous studies on falling in elderly adults involving cse have been limited to balance ability or gait ability15, 16, and there have been only a few studies on obstacles as an environmental factor or psychological factors. therefore, this study evaluated changes in the physicopsychological functions of elderly women with a fear of falling in negotiating obstacles such as a doorstep (5.2 cm) of a bathroom, where falling occurs frequently, through a performance-oriented mobility assessment (poma) in order to understand whether cse is valid as an efficient exercise to prevent and control falling in consideration of the physicopsychological functions of elderly women. the subjects of the study were 20 elderly women above the age of 65 who were able to walk independently, did not have experience participating in regular balance training more than twice a week within the past 6 months, had a score higher than 24 on the mini-mental status examination-korea (mmse-k), had no limits on exercise performance due to visual or musculoskeletal disorders and no previous experience of falling, and scored lower than 19 on the tinetti poma17. the purpose and methods of this study were explained to all the participants, who read and signed an informed consent from that revealed all the details of the study protocol, which were approved by the ethics committee of kangwon national university (no. the subjects selected were divided into an experimental group and a control group by drawing lots, and the average age, height, and weight in the experimental group were 73.203.46 years, 152.154.29 cm, and 57.787.95 kg, while those in the control group were 71.003.50 years, 149.836.45 cm, and 53.8011.04 kg. there were no significant differences among the groups with regard to age, height, or weight (p>0.05). the core stabilization exercise program proposed by jeffrey18 and hesari et al.19 was applied to the experimental group and cse was composed of three steps. level 1 consisted of abdominal hollowing in a supine position, abdominal hollowing in a prone position, abdominal hollowing in a quadruped position, abdominal hollowing in a supine position while curling the feet, abdominal hollowing in a prone position while curling the feet, and modified side bridging. level 2 consisted of bridging with abdominal hollowing, pelvic bridging, the dying bug with abdominal hollowing, and abdominal hollowing while seated on a swiss ball. level 3 consisted of pelvic bridging with a swiss ball, bird dog exercise, twists on a swiss ball, and bird dog exercises on a swiss ball. the experimental group performed a core stabilization program consisting of three levels for 30 min, three times per week on alternate days, for 6 weeks. this program consisted of three levels, and the subjects began at exercise level 1 and proceeded to the next level according to the protocol for the day. level 1 included static holds in a stable environment, level 2 included dynamic movements in a stable environment, and level 3 included dynamic movements in an unstable environment, such as on a swiss ball, and resisted dynamic movements in an unstable environment. before the program and 6 weeks after the program, the tinetti poma, crossing velocity (cv), maximum vertical heel clearance (mvhc) and knee flexion angle, which are related to physical functions, were measured, and with respect to psychological functions, depression and fear of falling were measured. the tinetti poma is an instrument used to decide the degree of fear of falling and balance and mobility in elderly adults consisting of items scored on a 3-point scale. the maximum score is 28, with 16 points for balance and 12 points for gait. if a subject scores below 19, fear of falling is high, and scores of 19 to 24 indicate an intermediate degree for fear of falling; scores of 25 to 28 indicate no fear of falling. for the crossing velocity (cv), the horizontal distance from the point at which the leading limb leaves the ground to the point at which the heel returns to the ground again is divided by the time taken20. for the maximum vertical heel clearance (mvhc), the vertical distance from the height of the obstacle before obstacle negotiation to the ball of the leading limb was measured21. the obstacle was 60 cm long, 10 cm wide, and 5.2 cm high. the subjects began their gait 5 m from the obstacle and continued on 3 m after obstacle negotiation. cv and mvhc were measured with the use of dartfish software (dartfish, fribourg, switzerland)23, and the results were output in a data table. to analyze depression, the ces-d (center for epidemiological studies-depression scale) was used. it is scored on a 4-point scale (03), and includes a total of 20 questions. the higher the score, the higher the depression24. for fear of falling, the fofq (fear of falling questionnaire) was used. it is scored on a 4-point scale (14) and includes a total of 11 questions. the higher the score, the higher the fear of falling25. for statistical analysis of the results, spss 18.0 was used. to explain the differences in measurement variables according to the measurement period between exercise groups, a 2-way anova with repeated measure was used, and the level of statistical significance was =0.05. repeated measure anova to analyze changes in the poma, cv, mvhc, kf, depression, and fof according to the measurement periods showed that there was a statistically significant difference in the interaction between time and the groups and that the changes in poma, cv, mvhc, kf, depression, and fof according to time differed (p<0.001) (table 1table 1.changes in physical and psychological function variablesgroupbeforeafterpoma (score)eg (n=10)17.601.3419.301.57**cg (n=10)17.801.4017.601.43cv (m/sec)eg (n=10)1.560.211.600.21*cg (n=10)1.560.101.550.09mvhc (cm)eg (n=10)7.421.387.021.33*cg (n=10)7.361.627.311.74kf (angle)eg (n=10)111.003.16108.604.06*cg (n=10)110.803.77110.303.16depression (score)eg (n=10)27.103.6724.503.34**cg (n=10)26.002.5825.203.00fear of falling (score)eg (n=10)22.501.4319.801.69*cg (n=10)22.603.2721.903.54meansd. eg, experimental group; cg, control group; poma, performance-oriented mobility assessment; cv, crossing velocity; mvhc, maximum vertical heel clearance; kf, knee flexion. eg, experimental group; cg, control group; poma, performance-oriented mobility assessment; cv, crossing velocity; mvhc, maximum vertical heel clearance; kf, knee flexion.*p<0.05;** p<0.01 older adults have low balance and stability due to physiological and functional decreases that occur with ageing26, and to compensate for balance and stability in gait, cadence and stride length decrease27. in the case of obstacle negotiation, when the leading foot encounters obstacles, the center of the body moves forward and fear of falling increases28. in this case, the mvhc, joint angle, and cv are important measures to assess the ability of elderly adults to safely cross obstacles during gait5, 29, 30. although falling is not always accompanied by physical injury, fear of falling again can be used to predict falling in elderly adults5. fear of falling leads to a decrease in activity and low self-esteem for independent behavior4 and has direct negative effects that result in decreased balance and gait disorder31, 32. cse is training to improve the stability of the trunk by inducing a correcting reaction and an equilibrium reaction through balance training of the flexors and extensors, and as it has been judged to have an effect on physicopsychological functions in obstacle negotiation, a clinical study was conducted. the results of the present study showed that the tinetti poma, cv, mvhc, and knee flexion angle were significantly improved. esculier et al.33 provided lumbar stability training through a wii fit program for parkinson s patients for 6 weeks and administered the tinetti poma. chou et al.20 reported that the cv was slow for elderly adults with lower balance ability. weerdesteyn et al.21 provided balance, gait, and coordination training for elderly adults and reported that foot clearance decreased, which matched with the results of the present study. park and lee22 reported that the maximum knee flexion angle of normal adults with lumbar stability was significantly lower in comparison with that of elderly adults with lumbar instability, which partially matched with the results of the present study. the study by lee et al.34, who reported that a falling prevention program decreased the gds (geriatric depression scale) significantly, was in agreement with the study by duque et al.35, who reported that fear of falling by elderly adults who experienced falling significantly decreased as a result of balance training using a virtual reality system. such results indicate that stability of the trunk was secured, as cse decreased the sway area of the center of mass. through harmonious exercise of the limbs based on physical stability, the subjects could negotiate obstacles precisely and easily, had higher self-esteem and had less fear of falling and depression. it is suggested that the 6-week cse decreased excessive obstacle gait with physical instability in elderly women and improved their physicopsychological functions involving obstacle gait.

[ purpose] the aim of the present study was to investigate the effects of core stability exercise (cse) on the physical and psychological functions of elderly women while negotiating general obstacles. [subjects and methods] after allocating 10 elderly women each to the core stability training group and the control group, we carried out performance-oriented mobility assessment (poma) and measured crossing velocity (cv), maximum vertical heel clearance (mvhc), and knee flexion angle for assessing physical performances. we evaluated depression and fear of falling for assessing psychological functions. [results] relative to the control group, the core stability training group showed statistically significant overall changes after the training session: an increase in poma scores, faster cv, lower mvhc, and a decrease in knee flexion angle. furthermore, depression and fear of falling decreased significantly. [conclusion] cse can have a positive effect on the improvement of physical and psychological performances of older women who are vulnerable to falls as they negotiate everyday obstacles.

PMC4242935

pubmed-400

a stroke is defined by the who as rapidly developing clinical signs of a focal (or global) disturbance of cerebral function, with symptoms lasting 24 h or longer or leading to death, with no apparent cause other than of vascular origin. taking into consideration the cause, the mechanism and the character of morphological lesions, there are two types of stroke: ischemic and haemorrhagic [2, 3]. eighty percent of strokes are of ischemic origin [2, 4], and their most common cause is thrombosis of the atherosclerotic internal carotid artery (ica) and/or cerebral arteries (ca)20 %. a stroke, including an ischemic one, is of particular interest to the forensic pathologist aiming on establishing the cause of death and its mechanism, rather than for giving an opinion in cases of suspected medical malpractice. neck and/or head trauma may very rarely constitute a cause of thrombosis of the ica and ca without any pre-existing pathology [58]. it most commonly results from direct, penetrating or non-penetrating (blunt) neck trauma in the region of large cervical vessels; less frequently it is attributed to indirect head trauma. in such cases the autopsy result and available clinical information has to allow the forensic pathologist to prove the existence of neck and/or head trauma and establish its causal connection with ica thrombosis and exclude other, known, non-traumatic causes of the latter. we present two cases of ica thrombosis with concomitant middle cerebral artery (mca) thrombosis secondary to the thrombus present in the ica lumen, in which the postmortem examination, the medical records regarding hospitalization and records of investigation indicated trauma as the cause of thrombosis. a 57-year old male carpenter sustained an injury in an occupational accident in the carpenter s warehouse. he was struck very hard in the face, in the region of his left cheek by an irregular-shaped wood fragment which looked like a big splinter (measuring about 26 cm in length, and with the greatest cross-sectional dimensions of 3.5 1.5 cm) that broke off from the board being processed on the carpenter s machine (fig. 1). first aid was provided in the emergency department in the local hospital, where the presence of a large, wooden fragment that thrust deep into the left cheek and penetrated through the parapharyngeal space into the neck was diagnosed. on admission he was then transferred to the otolaryngological ward, where a physical examination, including an evaluation of his neurological status revealed: maintained consciousness, narrow and symmetric pupils, circulatory and respiratory sufficiency and bp of 180/80 mmhg. the ct examination revealed the presence of a foreign body penetrating the left maxillary sinus with a comminuted fracture of the anterior and inferior wall below the external surface of the base of the skull, and a left occipital condyle fracture with concomitant breaking and impression into the posterior cranial fossa and soft tissues of the neck. no cerebral lesions, including traumatic, or features of raised intracranial pressure were observed (fig. 2). the ct angiography allowed the diagnosis of an occlusion of the ica by a thrombus localised at the level of the bifurcation of the common carotid artery (cca) and at the level of c1, adjacent to the foreign body. the laboratory findings were as follows: d-dimer 20921.25 g/l (n<500); pt and aptt within normal limits. once the diagnostic procedures were finished, a surgical intervention was performed on the day of admission. the preparation of the internal jugular vein revealed the medial translocation and compression of the carotid vessels. the foreign body was removed. post-interventional ct revealed the thrombotic occlusion of the left ica and mca and a hypodense area supplied by the mca and the concomitant left hemisphere oedema of the brain. the patient died on the 6th post-operative day exhibiting symptoms of intracranial hypertension and a brain oedema. fig. 2case 1: localisation of the foreign body (ct) case 1: wooden splinter removed during the surgical procedure case 1: localisation of the foreign body (ct) the findings of the medico-legal autopsy were as follows: a thrombus occluding the left ica and the proximal segment of the left mca, a large infarction area in the temporal lobe and adjacent parts of the frontal and occipital lobes of the left hemisphere of the brain, a large brain oedema with features of subfalcine herniation and transtentorian herniation, a comminuted fracture of the left maxilla and an occipital bone fracture in the region of the occipital condyle with the fragment impression. the histopathological examination revealed the occlusion of the left ica by the thrombus (h+e (fig. 3), masson, gomori, verhoeff and ptah), focal intimal haemorrhages and features of a mechanical injury the rupture of the artery wall in the form of an irregular fissure in the tunica media (fig. 4). the samples of the macroscopically changed left cerebral hemisphere revealed ischemic necrosis with polymorphonuclear leukocytes reaction, oedema and hyperaemia, while secondary, focal, non-reactive perivascular haemorrhages were found in the brainstem. other organs showed no significant histopathological lesions, apart from morphological indices of circulatory disturbances. fig. 3case 1: the internal carotid artery wall with the adjacent thrombus (h+e)fig. 4case 1: damaged tunica media, damaged and dissected intima, as well as fragments of the thrombus within the internal carotid artery (a h+e and b verhoeff) case 1: the internal carotid artery wall with the adjacent thrombus (h+e) case 1: damaged tunica media, damaged and dissected intima, as well as fragments of the thrombus within the internal carotid artery (a h+e and b verhoeff) a 32-year old female patient was brought to the hospital after being battered what resulted in police intervention. on admission the patient was conscious, complaining about a left upper extremity contracture that started 2 weeks prior to admission. she was generally healthy, with no chronic diseases, taking no medication, apart from being a smoker. for the previous month she had been repeatedly battered by her partner (about twice a week) with a fist and open hand to the face, neck and back, as well as pulled by the hair. the last battery that took place 1 day prior to admission resulted in a short-term loss of consciousness. on admission the following body injuries were described in her medical record: resorbing bruises on the face, including a wound of the lower lip mucosa, and the upper extremities ,. on admission the patient was sleepy with left-sided hemiparesis with symptoms concerning mainly the upper extremity, blood pressure was 110/80 mmhg, a fundus examination revealed no pathological lesions. d-dimer 1 200 ng/ml (n<500), aptt slightly shortened 25.69 s (n: 2836), aptt ratio and pt within normal limits. ct revealed the presence of a hypodense area in the right hemisphere region supplied by the mca, whereas mri scan confirmed the presence of an ischemic brain damage. thrombotic occlusion of the ica and mca was visible in mri (fig. 5) and angioct (fig., the patient died on the 12th day after admission presenting symptoms of raised intracranial pressure with a concomitant brainstem injury secondary to a brain oedema. fig. 5case 2: occlusion of the right internal carotid and middle cerebral artery marked with an arrow (mri)fig. 6case 2: occlusion of the right internal carotid artery marked with an arrow (angioct) case 2: occlusion of the right internal carotid and middle cerebral artery marked with an arrow (mri) case 2: occlusion of the right internal carotid artery marked with an arrow (angioct) the findings of the medico-legal autopsy were as follows: a thrombus occluding the right ica and the mca, thrombosis of the internal jugular veins, as well as the superior sagittal sinus and transverse sinus, an extensive infarction area in the right hemisphere region supplied by the mca; a brain oedema with features of right-sided subfalcine herniation and transtentorian herniation, carotid and basal ca with no atherosclerotic lesions. a histopathological examination revealed an occlusion of the right ica by the thrombus (h+e, masson, gomori, verhoeff and ptah)a muscular type artery with normal wall structure, the lumen filled with thrombus fragments, mechanical injury of the arterial wall rupture of the intima and tunica media (fig. 7). internal jugular veins normal wall structure, occluded by thrombi. there were dominating circulatory disturbances in the brain in the form of very significant capillary-venous hyperaemia resulting from an impaired cerebral venous return secondary to jugular vein and dural sinuses thrombosis. fig. 7case 2: damaged tunica media and intima of the internal carotid artery with intact adventitia (a h+e and b verhoeff) case 2: damaged tunica media and intima of the internal carotid artery with intact adventitia (a h+e and b verhoeff) observed in both cases, focal ischemic brain injury was secondary to the thrombosis of the ica and mca. cerebral vascular lesions may be causally associated with the sustained head and/or neck trauma with concomitant ica thrombosis and ischemic brain damage [5, 713]. they can, however, accompany head and/or neck trauma, yet be independent of trauma and have other morbid origins [2, 4]. in both cases we considered the most common, known, possible non-traumatic causes for ica thrombosis, including atherosclerosis, which is the most common cause for ica and ca thrombosis. the endothelium and the connective tissue cap injury expose the blood coagulation activating factors, which induce thrombus formation. the endothelium injury itself with exposure of the basal membrane may predispose to thrombus formation as well. the presence of stable atherosclerotic plaque may be complicated by arterial thrombosis, and this refers to cerebral vessels as well. however, vessel stenosis has to be significant, i.e. the blood flow transforms from being laminar into post-stenotic turbulent [1417] both the in vivo neuroradiologic diagnostic imaging modalities, including ct angiography, and the postmortem examination with a histopathological assessment did not reveal the atherosclerosis of ica or mca in any of the discussed cases. other factors favouring carotid arteries thrombosis include: hypertension, diabetes, hypercholesterolaemia, obesity and smoking [2, 4, 18]. such factors accelerate the course of atherosclerosis, of which a common complication is thrombosis. the analysis of both patients medical records, including the laboratory findings obtained during hospitalisation allowed diabetes and lipid metabolism disorders to be ruled out. the woman did not manifest features of hypertension, whereas unstable aterial pressure values, i.e. labile hypertension, was observed in the male patient. no lesions in the small-sized cerebral vessels that could have been responsible for the ischemic stroke were found during the postmortem examination, including the neuropathologic examination, within the ischemic, as well as in the non-ischemic areas. no arteritis, amyloid angiopathy, vascular malformations nor lesions observed in the course of hypertensive encephalopathy were found. the presence of a thrombus inside the ica and/or ca, and secondary focal ischemic brain damage may result from embolism [2, 4, 18, 19]. the most common source of such embolic material are thrombi localised in the left side of the heart (auricle of the left atrium in patients with atrial fibrillation), parietal thrombi in the left ventricle whose formation is associated with myocardial infarction or more frequently aneurysm of the heart in the area of an extensive post-infarction scar or left ventricle dilatation, e.g. in the course of dilated cardiomyopathy or endocarditis, especially of bacterial origin the embolism in the ica and ca may then develop in patients with atrial septal defect and deep vein thrombosis. the postmortem examination did not, however, reveal any of these conditions in the discussed patients. a significantly less common cause of stroke are haematological disorders, which are responsible for about 1% of all strokes and occur slightly more frequently in young subjects. the laboratory findings performed during hospitalisation and autopsies allowed haematological disorders to be ruled out as factors predisposing to thrombosis. the elevation of d-dimer level was the sole abnormal parameter observed on the coagulation profile and was associated with present ica and mca thrombosis in both cases. oral contraceptives (oc) should be considered as a possible cause for thrombosis in the female patient. oc are described in neurology as one of the ethological factors of ica and ca thrombosis. in the presented case the anamnesis collected on the patient s admission to the hospital indicated that she did not take any medication, most probably including oc. however, should she have taken oc, they did not significantly influence the development of ica thrombosis. arterial thrombosis in such cases is very rare in women below 35 years of age [21, 22]. the annual incidence of ischemic stroke in women in this age group is 13 cases/100 000 women. the following risk factors are considered to increase the risk of developing thrombosis in subjects using oc: hypertension, diabetes, hyperlipidemia and smoking [2025]. oc predispose more strongly to the development of venous, rather then arterial thrombosis, which results from the haemodynamic properties of blood flow in these two types of vessels. other risk factors for venous thrombosis are slowed blood flow and thrombophilia, whereas vessel wall injury (endothelium), including the atherosclerotic plaque are characteristic risk factors for arterial thrombosis. despite doubts concerning her taking oc, the patient s age (32 years old) and lack of other, above-mentioned risk factors and also atherosclerosis allow oc to be ruled out as a possible cause of ica and mca thrombosis. the above-mentioned exclusions and the circumstances preceding the disease established in the course of the investigation indicate the traumatic background of the ica thrombosis in both cases. the ct and ct angiography performed in the first patient revealed the presence of a foreign body adjacent to the left ica on the level of c1, whereas medial translocation and compression of carotid vessels caused by the foreign body were found during the surgical procedure. the histopathological examination revealed features of mechanical arterial injury, namely the rupture of the tunica media with focal haemorrhages into the intima and tunica media. the above-mentioned conditions indicate direct trauma as the cause of thrombosis. apart from the arterial occlusion by the thrombus found in the histopathological sections obtained from the second patient, the mechanical injury to the arterial wall in the form of the intima and tunica media rupture were also noted. such findings and the information obtained during investigation indicate indirect trauma as the cause of arterial thrombosis. post-traumatic ica thrombosis may result from a penetrating (e.g. knife, bullet or other foreign body splinter, as in case 1) or non-penetrating (blunt) trauma. there are two types of the latter, namely direct ones concerning the neck in the region of the carotid artery, and indirect concerning distant regions, e.g. head. penetrating neck trauma caused by the above-mentioned tools, leads to arterial wall injury in the form of contusion or vessel wall dissection with the formation of intramural haematoma, outer arterial layer damage (adventitia) and the formation of pseudoaneurysm or segmental vessel spasm. suppurative inflammation may also develop in the periarterial space, should the patient survive long enough after the trauma. the above-mentioned primary vessel wall injuries, associated with an injury limited to at least endothelium and intima, predispose to the development of thrombosis with subsequent vessel occlusion and ischemic stroke. the ica segment localised a few centimetres over the cca bifurcation is the vessel segment most commonly injured in the course of non-penetrating (blunt) ica traumas, both direct and indirect. they result in the rupture of the intima and/or tunica media, with the possible formation of intramural haematoma, i.e. a condition called dissecting aneurysm. the thrombotic occlusion of the vessel lumen occurs a few hours or even days or weeks after the trauma [5, 27, 28]. six to ten percent of patients manifest such symptoms within the first hour after trauma, another 50% after 10 h and in 5773% of cases the asymptomatic period lasts more than 24 h. only 1735% of such patients develop ischemic symptoms after such a period. the above-mentioned facts indicate that in some cases of traumatic ica thrombosis there is a variably long asymptomatic period between the trauma and the manifestation of neurological symptoms of ischemic brain damage. some authors compare it to intervallum lucidum occurring in patients with epi- and/or subdural haematoma. it results from thrombus propagation within the damaged vessel and may hamper the process of establishing the causal connection between the trauma and the ica thrombosis, especially, as according to some authors, the process itself may last up to several years [8, 9, 27], which in our opinion is hardly probable. according to unterharnscheidt traumatic ica thrombosis may result from: (1) direct neck trauma (e.g. boxers); (2) direct head trauma (including insignificant) with force transfer to the neck region; (3) oral cavity trauma; (4) fractures of the neuro- and splanchnocranium bones; (5) whiplash injuries; (6) strangling or other manual procedures in the carotid artery region (e.g. massage) and (7) compression by seatbelt in the course of road traffic accidents. non-penetrating ica injuries result from blunt head and/or neck trauma. a head trauma with a violent and powerful head rotation and hyperextension of the cervical spine results in some topographic alterations, including the ica course. it may lead to ica compression by the transverse processes of c3 or c1c2 vertebral bodies and predisposes to thrombosis due to the secondary rupture of intima and tunica media by an intact adventitia. ica thrombosis may result from neck trauma, as well. by certain head positions, in which the artery is covered only with skin and fascia, it would be pressed against the c1 and c2 or transverse processes of c3c5 with secondary damage to intima, and even tunica media. in both of the discussed cases the thrombosis could have been caused by a segmental artery spasm on the injury site, which is impossible to establish during a postmortem examination. in 1974 crissey and bernstein identified four basic mechanisms of ica injuries, and thus four types of damage. type i damage results from a direct blow to the neck and most commonly concerns older patients, frequently having advanced ica atherosclerosis. a similar mechanism occurs by a sudden powerful hyperflexion of the cervical spine with a compression of the ica between the mandible and spine. type ii ica damage is caused by the hyperextension of the cervical spine with a head and neck rotation in the opposite direction. such a mechanism results in injury to the ica segment that is overstretched over the lateral masses of the first two cervical vertebrae. the discussed mechanisms of ica injuries, apart from a direct blow to its region, are most commonly observed in motorcyclists participating in road traffic accidents. type iii ica damage is most commonly observed in children and accompanies the intraoral trauma caused by a foreign body e.g. by falling on a hand-held or more frequently mouth-held object, e.g. pencil. the establishment of the causal connection between neck and/or head trauma and ica thrombosis and its cerebral consequences requires the exclusion of non-traumatic factors in the first line disease-associated, being the most common cause of thrombosis. this is very important as such trauma is most frequently a result of a criminal offence and brings the perpetrator to criminal and civil liability. the establishment of a causal connection may be problematic or even impossible in victims who apart from traumatic injuries suffer from diseases or factors predisposing to thrombosis.

the following manuscript presents two cases of ischemic stroke secondary to traumatic internal carotid artery thrombosis with concomitant middle cerebral artery thrombosis occurring very rarely in the medico-legal practice. penetrating neck trauma due to an occupational accident and multiple head and neck trauma secondary to battery were described. the autopsy and histopathological examination as well as the analysis of available medical records, including radiological examinations, and records of investigation indicated the sustained trauma to be the cause of the thrombosis.

PMC4143597