Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-501

adenoid cystic carcinoma was first described by billroth in 1859 and called " cylindroma " due to its characteristic histologic appearance1. in 1953, adenoid cystic carcinoma is a malignant salivary gland tumour characterized by a deceptive histologic pattern, indolent, locally invasive growth with high propensity for perineural invasion, local recurrence and distant metastasis. these uncommon neoplasms account for fewer than 1% of all head and neck malignancies and fewer than 10% of all salivary neoplasms. they make up 15%-30% of submandibular gland tumours, 30% of minor salivary gland tumours, and 2%-15% of parotid gland tumors1. it is defined by the world health organization as " a basaloid tumour consisting of epithelial and myoepithelial cells in various morphological configurations, including tubular, cribriform and solid patterns. the present case report is unique as it shows presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth rather than the classical nodular swelling. a 56-year-old male patient presented with a chief complaint of an ulcer in the left floor of the mouth for one week. he gave a history of pain of respect on the left side of the jaw which was continuous, dull, throbbing, and radiating to the ear of the same side. the patient had under gone extraction for tooth #18 but the pain still persisted. thereafter, he noticed an ulcer on the left floor of the mouth which was initially small and increased to the present size. there was no history of bleeding or discharge, but he did have difficulty eating and speaking. intraoral examination of the soft tissues, the buccal mucosa, labial mucosa, tongue, and palate showed no abnormalities, but there was a solitary ulcer on the left floor of the mouth. examination of gingival status revealed his oral hygiene status to be poor, with severe stains and calculus deposits. on hard tissue examination, healing socket was present in respect to tooth #19. on local examination of the lesion, inspectory findings revealed a solitary ulcer presenting as a mucosal tear involving the mucosa and connective tissue extending mesially from left side of the lingual frenum and distally to an area corresponding to the extracted tooth #19 region. it was oval in shape, 32 cm at its widest point, and 3 cm deep. the margins were everted, the edges of the ulcer were sloping, and the floor was not evident. the colour was the same as that of the adjacent mucosa, but erythematous at the periphery of the ulcer. 1) on palpation of the site, the size and the extent of the ulcer were confirmed. the margins and the base of the ulcer were mildly indurated in a posterior aspect. based on the history given by the patient and the clinical features, a provisional diagnosis of carcinoma of the floor of the mouth t4an0m0, chronic generalized periodontitis, partially edentulous in respect to tooth #7, #5, #3, #13, #14, #15, #24, #19, #25, and #31 was made. lesions presenting as solitary ulcers on the floor of the mouth were considered in the differential diagnosis. traumatic ulcers are most common on the tongue, lips, mucobuccal fold, gingiva and palate. they present as solitary ulcers with raised reddish borders and white necrotic floors with associated history of trauma. on the floor of the mouth, they are usually due to calculus or sharp denture margins. major recurrent apthous ulcers are mostly solitary, deep, and painful, with smooth margins and a reddish halo and may persist for months with history of reoccurrences. habit associated lesions seen in quid chewers may also form ulcerations at the region of quid placement. odontogenic infections may be associated with an ulcer that may serve as a cloacal opening of a sinus draining a chronic alveolar abscess. other conditions such as acute necrotic ulcerative gingivostomatitis or gangrenous stomatitis usually present as necrotic sloughing ulcerative lesions diffusely involving the gingiva. solitary ulcers are also seen in nonodontogenic systemic diseases such as uncontrolled diabetes mellitus, blood dyscrasias (leukemia, sickle cell anemia), gastrointestinal and immunocompromised individuals and autoimmune conditions (pemphigus, pemphigoid, erythema multiforme, epidermolysis bullosa). the ulcers in such conditions are well demarcated, painful, and shallow with an erythematous halo and a grey necrotic floor, usually in the marginal and interdental gingiva. salivary gland disorders such as adenoid cystic carcinoma, mucoepidermoid carcinoma, mucous adenocarcinoma, warthin tumor and necrotising sialometaplasia are seen as solitary palatal ulcers. an orthopantomogram and a mandibular crossectional occlusal radiograph were taken and showed no abnormality in the region of interest.(fig. 2) a magnetic resonance image was taken, and the axial sections showed a t1-weighted image of a mass of medium intensity extending from the midline of the mandible to the premolar region on the left side.(fig. 3) an incisional biopsy was performed and the histopathologic report showed the presence of uniform basaloid cells arranged in the form of solid islands, along with a cribriform pattern at some places. based on the clinical features and the histopathologic report, a final diagnosis of adenoid cystic carcinoma t4an0m0 was made.(fig. adenoid cystic carcinoma is a malignant tumour with a deceptively benign histological appearance, characterized by indolent locally invasive growth with a high propensity for local recurrence and distant metastasis. according to the literature gender predilection is an inconsistent feature in the literature; however, it is slightly more common in women than in men4,5. although the palate is the most commonly involved intraoral site, other commonly involved areas are the major and minor salivary gland regions, the floor of the mouth, the tongue and the gingiva (in decreasing order). adenoid cystic carcinoma usually presents as a slowly growing, firm, unilobular mass in the glands. however, in our case it presented as a solitary ulcer on the floor of the mouth. the clinical course is characterized by an initial period of slow and indolent growth that is usually asymptomatic, although bone invasion or perineural spread can cause pain or hypoesthesia5. adenoid cystic carcinoma of the salivary glands is a malignant epithelial tumour with bidirectional differentiation towards luminal (ductal) and abluminal (myoepithelial and basal) cells. the tumour is composed of basaloid cells with small, angulated, and hyper chromatic nuclei and scant cytoplasm arranged into three prognostically significant patterns: cribriform, tubular, and solid. the combination of surgery and postoperative radiation therapy has improved locoregional control of the disease. despite this achievement, late local recurrence and distant metastasis rates remain high and may occur decades after initial diagnosis5. in its most frequently seen histological pattern, the majority of the cells are small and darkly stained with scant cytoplasm. the cells are arranged in nests or sheets that are fenestrated by round or oval spaces, creating the characteristic " cribriform " design. occasionally, the tumours have a predominantly solid cellular growth with a basaloid or anaplastic appearance that has few, if any, fenestrations. tubular structures with minimal stratification of the lining epithelium are often mixed with the classic cribriform and solid areas6. several authors have suggested that a solid histological pattern indicates a more serious prognosis than a cystic pattern. stewart7 first noted the increased aggression suggested by the solid variant, although he credits the initial observation to patey and thakray8. little information exists on cytogenetic abnormalities in salivary gland neoplasms, but in adenoid cystic carcinoma, anomalies in the terminal part of the 6q and 9p chromosomes have been reported. recent studies have demonstrated a high incidence of loss of heterozygosity at chromosome 6q23-359. the differential diagnosis of adenoid cystic carcinoma in cludes tumours that also exhibit tubular and cribriform structures, such as polymorphous low-grade adenocarcinoma, tumours with basaloid cellular morphology, such as basal cell adenoma, and basal cell adenocarcinoma and tumours with a dual population of ductal and myoepithelial cells, such as pleo morphic adenoma8. possible treatments of adenoid cystic carcinoma include four different modalities: surgical therapy, radiotherapy, chemotherapy and combined therapy. avery et al.11 recommend postoperative radiation since radiation often produces tumour regression and relieves symptoms. postoperative radiotherapy is also indicated when the tumour location is close to the base of the cranium with the presence of neck lymph node metastasis and perineural invasion, with a solid histological subtype, and for recurrent tumours11. adenoid cystic carcinoma shows a limited response to chemotherapy, and it is believed that this lack of a response is due to its slow growth rate. however, a study by alcedo et al.12 opened up a new possibility in the pharmacological treatment of this tumour by demonstrating its response to imatinib mesylate, a potent inhibitor of kit gene tyrosine kinase, which is an enzyme involved in the pathogenesis of the tumour. however, more studies are needed to confirm its effectiveness. distant metastasis can occur even decades after the primary tumour has been treated and after having achieved adequate locoregional control. furthermore in the setting of inoperable, incompletely resected or recurrent tumours, outcomes after conventional therapy are dismal and remain a therapeutic challenge. some authors have applied other forms of radiotherapy, particularly neutron irradiation, aiming to improve treatment results13. however, adenoid cystic carcinoma remains incurable because further improvements in local-regional control are not likely to impact survival due to the high number of distant failures. the present case differs from usual cases of adenoid cystic carcnioma with respect to site and presentation, making it a rare entity. thus, the aim of this article is to emphasise that though the literature states that adenoid cystic carcinoma ulcerates the superficial lesional mucosa, it can also present as an ulcerative lesion.

adenoid cystic carcinoma is a rare epithelial tumour, and comprises about 1% of all malignant tumours of the oral and maxillofacial region. it is a malignant tumour which may develop in the trachea, bronchus, lungs or mammary glands, in addition to the head and neck region. occurrences in the head and neck are mostly detected in the major salivary gland, oral cavity, pharynx and paranasal sinus where it presents as a slow growing firm nodular swelling. the aim of the article is to highlight the unique presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth.

PMC4217273

pubmed-502

the ability of mammals to respond to an inadequate o2 supply, commonly termed hypoxia, is crucial for their survival. although a proper response to changed o2 tensions triggers adaptation, a number of pathological conditions or failures in the o2 response are associated with various diseases such as anemia, myocardial infarction, thrombosis, atherosclerosis, or cancer. when exposed to hypoxia or even anoxic conditions, mammalian organisms initiate a variety of responses in different organs, aiming to increase the delivery of oxygen to the tissues. in addition to the switch from an aerobic to an anaerobic metabolism and the suppression of energy-using reactions, the carotid body chemoreceptor cells stimulate the brain stem center controlling the respiratory and cardiovascular systems to enhance ventilation, heart rate, and blood pressure (reviewed by prabhakar1). in addition, neuroepithelial cells in the lung contribute to adjusting pulmonary perfusion and gas exchange. moreover, organs and cells switch their gene expression profile: the kidneys produce erythropoietin, which increases red blood cell production in the bone marrow, and vascular cells produce vascular endothelial growth factor to promote angiogenesis and flow of enhanced blood volume (reviewed by semenza2). in addition to the expression of erythropoietin and vascular endothelial growth factor, the expression of more than 500 genes, products of which are involved in glycolysis, angiogenesis, erythropoiesis, cell death, and differentiation, is also changed on exposure to hypoxia (reviewed by wenger and stiehl3 and semenza4). in mammals, the hypoxia-dependent changes on the level of gene expression are mainly mediated by the -subunits of hypoxia-inducible transcription factors (hifs). hif -subunits are tightly regulated, and post-translational hydroxylations in response to hypoxia appear to be of major importance. in addition to hypoxia, hif -subunits were also found to respond to various growth and coagulation factors, hormones, cytokines, or stress factors already under normoxia. indeed, different kinases, among them glycogen synthase kinase 3 (gsk-3), have been identified to directly phosphorylate hif- proteins. this review discusses the regulation of hif- by gsk-3 and compares it with hydroxylase-dependent hif- protein regulation. in their active form, hifs are heterodimeric transcription factors consisting of an-and -subunit. the hif -subunit represents the stable nuclear subunit primarily represented by the ubiquitously found arnt (arylhydrocarbon receptor-nuclear translocator) protein; however, arnt2 or artn3, although to a lesser extent, also appear to be able to take part in the formation of hif dimers (reviewed by semenza5). so far, three -subunit proteins, hif-1, hif-2 (also known as epas,6 hlf,7 hrf,8 or mop29), and hif-3 have been identified. together, the different hif-and -subunits may give rise to the formation of several combinations of hif dimers.5,10 hif-1 and hif-2 are the best-studied hif- isoforms. although they share structural and functional similarities, it appears that differences in the cell-type expression pattern, the target genes, the embryonic deletion phenotypes, and the effects on tumorigenesis exist between hif-1 and hif-2.1114 the function of hif-3, from which several splice variants exist in humans,15,16 is largely unknown, although some human hif-3 variants and a mouse splice variant termed inhibitory pas protein (ipas) appear to act as negative regulators of the hypoxic response.1619 similar to the arnt proteins, the hif -proteins belong to the basic helix-loop-helix pas (per-arnt-sim) protein family. in particular, hif-1 and hif-2 show the highest degree of sequence identity in the basic helix- loop-helix (85%), pas-a (68%), and pas-b (73%) domains. both also contain two nuclear localization sequences responsible for translocation to the nucleus under hypoxia; they are localized in the n terminus (amino acids 1733 in hif-1 and amino acids 150 in hif-2) and in the c terminus (amino acids 718721 in hif-1 and amino acids 689870 in hif-2).20,21 with the exception of hif-3, which does not contain a c-terminal transactivation domain (c-tad),22,23 hif -subunits also contain n- and c-terminal transcriptional activation domains (n-tad and c-tad). a unique oxygen-dependent degradation domain (oddd, amino acids 401603 in hif-1 and amino acids 517682 in hif-2) overlaps n-tad. the residues between n-tad and c-tad represent an inhibitory domain (amino acids 604785 in hif-1 and amino acids hif -subunit activation under hypoxia is mainly the result of an increased protein stability and coactivator recruitment, although transcriptional and translational mechanisms also were shown to be involved in hif -subunit activation.22,2630 as a result, hif- proteins accumulate, translocate to the nucleus, and dimerize with hif- to form a functional transcription factor.31 thus, in the presence of oxygen (ie, normoxia), hif- proteins become degraded. this is primarily achieved by oxygen-dependent hydroxylations at the oddd.32 under normoxia, prolyl hydroxylase domain proteins (phds),33,34 in particular phd2, hydroxylate two crucial residues in the oddd of hif -subunits (p402 and p564 in hif-1 and p405 and p531 in hif-2).25,32,35 prolyl hydroxylation is required for binding the von hippel-lindau protein (vhl),36,37 which represents the substrate recognition subunit of an e3 ubiquitin protein ligase consisting of elongin c, elongin b, ring box 1, cullin 2, and an e2 ubiquitin-conjugating enzyme (figure 1). the prolyl hydroxylation and ubiquitination can be further promoted by the binding of phd2 to os938 and that of hif-1, vhl, and elongin c to ssat2, respectively.39,40 in addition to prolyl hydroxylation, a conserved asparagine residue (n803 in hif-1 and n852 in hif-2) in the c-tad is hydroxylated by the factor-inhibiting hif in an oxygen-dependent manner. this hydroxylation prevents interaction with the coactivator proteins cbp/p300.4144 thus, the major posttranslational modification appears to be the oxygen-dependent hydroxylation.36,37 in addition to hydroxylation, hif- transcriptional activity and protein stability appear also to be dynamically regulated by other posttranslational modifications such as acetylation, s-nitrosylation, sumoylation, and phosphorylation (for review, see dimova and kietzmann45). phosphorylation appears to be of special importance under normoxic conditions, mediating the response of hif- to various growth and coagulation factors, hormones, cytokines, or stress factors (reviewed by dimova et al46) under normoxia. indeed, a panel of protein kinases is reported to be involved in hif-1 phosphorylation, either directly (table 1) or indirectly.4752 although the individual action of certain kinases on hif-1 regulation was mainly studied in vitro (table 1), the in vivo mechanisms are likely much more complex. at least the extent to which the kinases can be involved in hif- phosphorylation may vary according to the signal, cell type, or tissue. given the different developmental and/or differentiation status of a cell or tissue, the expression of various growth factors, their receptors, and respective signaling components and thus, it seems not to be surprising that phosphorylation of hif- by different kinases or after modulation of signaling pathways may be a highly cell type-specific event. although direct proof is currently lacking, it is plausible that the phosphorylation pattern of hif- in a certain cell may be explained by different layers of regulations that affect kinases depending on the cellular context. in addition to being activated by a variety of extracellular signals, the pi3k/akt cascade appeared also to be regulated by hypoxia, thus integrating hypoxia signaling with extracellular signals affecting multiple cellular processes such as apoptosis, metabolism, cell proliferation, and cell growth (for review, see braccini et al53). the pi3k/akt pathway is considered to control hif-1 within the cell via regulation of hif-1 protein synthesis and stability. however, it appeared that hif- proteins are not directly phosphorylated by pkb/akt but, rather, by a pkb/akt target. the pkb/akt targets hdm2,54,55 mammalian target of rapamycin (mtor),56 and gsk-357 were shown to contribute to changes in hif- protein levels; however, only gsk-3 was shown to do this directly, ie, by phosphorylating hif- proteins. gsk-3 is a serine/threonine kinase that was first identified as a negative regulator of glycogen synthesis; inhibition is achieved through phosphorylation of glycogen synthase.58,59 since its initial discovery, gsk-3 has been found to be involved in numerous signaling pathways initiated by diverse stimuli and to contribute to the regulation of cell proliferation, stem cell renewal, apoptosis, and development, which are processes often associated with hypoxia. because of these multiple involvements, dysregulation of gsk-3 has been implicated in the pathogenesis of human diseases, including type 2 diabetes, bipolar disorders, inflammation, alzheimer s disease, and cancer (reviewed by frame and cohen,60 grimes and jope,61 and woodgett62). two isoforms, gsk-3 (51 kda) and gsk-3 (47 kda), have been identified in mammals. despite their homology in the catalytic domain (98%), they significantly differ in their n- and c-terminal parts63,64 and do not have entirely overlapping roles in metabolism (reviewed in force and woodgett65). moreover, gsk-3 (gsk-3) homozygous knockout mice showed an embryonic lethal phenotype around day 16 because of hepatic apoptosis or a cardiac pattern defect,66,67 whereas homozygous gsk-3 (gsk-3) knockout mice are viable and fertile.68,69 gsk-3 is a target of pkb/akt, which can phosphorylate both gsk-3 isoforms (serine 21 of gsk-3 and serine 9 of gsk-3), leading to an inhibition of gsk-3 activity.70 interestingly, these serine residues can also be phosphorylated by other kinases such as erk1/2,71 p70 ribosomal s6 kinase 1,72 camp (cyclic adenosine monophosphate)-dependent protein kinase a (pka),73 and protein kinase c (pkc).74 in contrast, an autophosphorylation event leading to phosphorylation of tyrosine 279 in gsk-3 and of tyrosine 216 in gsk-3 increases gsk-3 activity.75,76 neurons seem to possess a spliced gsk-3 variant called gsk-32 that contains a 13 amino acid residue insert within the kinase domain, leading to reduced kinase activity.77,78 although gsk-3 is mostly known in the insulin field as a regulator of glycogen synthesis, it has been shown that early hypoxia enhanced pi3k/akt activity and increased hif-1 protein levels.57 similarly, hypoxia was capable of inhibiting gsk-3 by phosphorylation in different cell types, such as pc-12 (rat pheochromocytoma cell line) cells,79 ht1080 (human fibrosarcoma cell line) cells,80 and hepg2 (human liver hepatocellular cell line) cells,57 as well as in vivo.81 although this effect was not observed in other cell types, including some breast cancer cell lines,82 pc-3 prostate cancer cells,83 and 3t3 cells,84 it was considered to have a cell type-specific component. however, the findings that gsk-3 inhibition57 and small interfering rna-mediated depletion induced hif-1, whereas gsk-3 overexpression reduced hif-1 protein levels,85 suggested that hif-1 is a direct target of gsk-3. indeed, the oddd86 and three sites, s-551, t-555, and s-589, located within the oddd overlapping the n-tad of hif-1 were found to be directly phosphorylated by gsk-3.85 another study reported five sites, t-498, s-502, s-505, t-506, and s-510, within the n-tad of hif-1 as gsk-3 phosphorylation sites.87 the disparity of the different phosphorylation sites is difficult to explain, but the different oxygen concentrations (8% o2 compared with 2% o2) used in these studies may contribute to the differences. it is possible that different oxygen levels may induce variable signaling pathways that have unequal effects on hif-1 and its ability to act as a substrate for gsk-3. another possibility could be the different cell types (hepg2 compared with sk-ov-3 [human ovarian cancer cells ]) that were used in the studies. despite the differences in the phosphorylation sites, both studies demonstrated that the regulation of hif-1 by gsk-3 is independent of o2, hydroxylation, and recruitment of the vhl-containing e3 ubiquitin ligase. experiments with vhl-deficient cells showed that gsk-3-dependent hif-1 degradation occurred independent of vhl, indicating that the phosphorylation of hif-1 by gsk-3 target hif-1 for proteasomal degradation in an oxygen-independent manner.85 this suggested involvement and recruitment of another so-far-unknown e3 ubiquitin ligase to gsk-3-phosphorylated hif-1. indeed, two groups demonstrated that the f-box and wd protein fbw7 (also known as hcdc4 in yeast, hsel10 in caenorhabditis elegans, or ago in drosophila) acted as the substrate-recognition component of a multisubunit e3 ubiquitin ligase, which was crucial for the proteasomal degradation of gsk-3 phosphorylated hif-1.85,87 in this e3 ligase, fbw7 interacts with skp1 (s-phase kinase-associated protein 1), cul1 (cullin 1), and rbx1, forming the so-called scf complex. similar to vhl, fbw7 is considered to serve as a tumor suppressor, and three fbw7 isoforms (fbw7, fbw7, and fbw7) are known to be produced by alternative splicing. they are found in the nucleoplasm, cytoplasm, and nucleolus, respectively.88 in addition to hif-1, fbw7 was shown to be involved in the degradation of various oncogenic proteins, including cyclin e,89 c-myc,90,91 c-jun,92,93 and notch.94 several studies have shown that loss of the fbw7 gene is associated with malignant transformation, especially in ovarian cells and t cells,95 in breast cancer cells,96 and later also in human colorectal cancers,97 which leads then to chromosomal instability and some types of malignancy. furthermore, investigation of more than 1,500 human tumors revealed that approximately 6% of those tumors showed mutations in the fbw7 coding region. specifically, cholangiocarcinomas (35%), t-cell acute lymphocytic leukemia (31%), and endometrial (9%), colon (9%), and stomach (6%) cancer98 had the highest mutation rates. strikingly, nearly half (43%) of these were missense mutations that resulted in amino acid substitutions within the wd40 domain (arg465 and arg479), which are shared by all three fbw7 isoforms, suggesting that all fbw isoforms might collectively contribute to the tumor-suppressor function.98 with respect to hif-1, all three fbw7 isoforms were able to induce hif-1 degradation, and the loss of the fbw7 wd domain abolishes gsk-3-initiated degradation, leading to higher hif-1 levels, which has been found to be associated with several tumors.99101 the finding that hif subunits can be targeted for degradation by two different e3 substrate recognition proteins indicates that the system is highly dynamic. the human genome encodes nearly 100 deubiquitylating enzymes that are predicted to be active and that oppose the function of around 600 e3 ligases.102,103 similar to e3s, deubiquitylating enzymes have a central role in cell cycle regulation and dna damage response and, depending on the context, can act either as a tumor promoter or suppressor (see references in love et al104). with respect to vhl, two different deubiqiutinating enzymes, vdu1 (usp33) and vdu2 (usp20), were suggested to oppose the vhl-e3 ubiquitin ligase.105,106 later, it was shown that vdu2 but not vdu1 can interact with hif-1.107 experiments with cycloheximide and hypoxia showed that the half-life of hif-1 was significantly increased upon overexpression of vdu2, whereas a catalytic inactive vdu2 c154a mutant had no effect. in addition, it was shown that only vdu2, not vdu1, deubiquitinated hif-1, resulting in the stabilization of hif-1 protein107 (figure 1). experiments with gsk-3- and fbw7-deficient cells revealed that gsk-3- and fbw7-dependent hif-1 degradation can be antagonized by ubiquitin-specific protease 28 (figure 1).99 these findings suggest that the gsk-3-dependent degradation of hif-1 is not limited by the presence of oxygen and is therefore independent of vhl. together, these results demonstrate that hif-1 protein stability is regulated in a dynamic manner involving different ubiquitin ligases and deubiquitinases. as such, the hydroxylation- and vhl-dependent ubiquitination and degradation of hif-1 under normoxia is opposed by the deubiquitinase vdu2. in contrast, the oxygen-independent but phosphorylation-dependent ubiquitination of hif-1 is counteracted by ubiquitin-specific protease 28-mediated deubiquitination. the latter process allows the integration of the hif system into the cellular response to various physiologic and pathophysiologic signals independent of the oxygen tension. the finding that gsk-3 is involved in the degradation of hif-1 indicated similarities with the destruction of -catenin in the canonical wnt signaling pathway. in this pathway, gsk-3 and -catenin are part of a destructive complex in which binding of gsk-3 and -catenin promotes phosphorylation of -catenin by gsk-3, which requires priming phosphorylation by casein kinase 1, -isoform. the phosphorylated -catenin is recognized by the f-box/wd protein -trcp and subsequently ubiquitylated and targeted for proteasomal degradation (for review, see cohen and frame108 and metcalfe and bienz109). when this phosphorylation event is blocked, -catenin accumulates and binds to the t-cell-specific transcription factor/lymphoid enhancer-binding factor 1 family of transcriptional activators to activate numerous target genes (reviewed by reya and clevers110) contributing to embryonic development and adult tissue homeostasis (reviewed by clevers111). similarly, gsk-3-mediated phosphorylation of hif-1 recruits fbw7, and thus targets hif-1 for ubiquitylation and proteasomal degradation.99 those very similar scenarios imply interference or interconnection of both the wnt/-catenin and hypoxia/hif-1 signaling on the level of gsk-3. actually, crosstalk between the hypoxia and/or hif-1 and wnt/-catenin pathway was reported and appears to be quite complex because of controversial and likely cell/tissue/differentiation-stage specific data.112117 indeed, it was reported that hypoxia and/or hif-1 can inhibit wnt/-catenin signaling. several mechanisms, such as binding of hif-1 to hard1 (human arrest-defective-1 protein) with subsequent interference with acetylation of -catenin,112 blocking processing and secretion of wnt proteins,113 down-regulating -catenin via p53-dependent activation of siah-1 (seven in absentia homolog 1),118 or direct interaction between hif-1 and -catenin119,120 were proposed to contribute to these effects. in contrast, hypoxia was also shown to activate wnt/-catenin signaling in undifferentiated cells and in vivo.115,117 in hypoxic embryonic stem cells, this occurred via hif-1-mediated expression of lymphoid enhancer-binding factor 1 and t-cell-specific transcription factor, followed subsequently by increased interaction of -catenin with lymphoid enhancer-binding factor 1/t-cell-specific transcription factor, and thus activating wnt/-catenin targets.115 in addition, hypoxia was able to activate -catenin via gsk-3 inactivation116,121 in different human cell lines such as ht-29 (human colorectal adenocarcinoma cell line) and hepg2; this activation contributed to an endothelial mesenchymal transition program, leading to significantly increased invasiveness,121 and in renal tubular cells, this process impaired wound healing.116 together, the reported findings indicate that complex interconnections between hypoxia and/or the hif-1 and wnt/-catenin pathway exist and that cell-, tissue-, and differentiation-specific aspects contribute to their functional consequences. hypoxia and hifs play important roles in many critical aspects of physiological and pathological processes. most solid cancers contain hypoxic areas, and clinical data demonstrate that overexpression of hif-1 is associated with an increased risk for patient mortality. in line, downregulation of hifs interferes with tumor growth, vascularization, invasion, and metastasis, as well as radiation and chemotherapy. activation of multiple oncogenic pathways including growth factor signaling coupled with enhanced kinase signaling is a common event in tumors, thus making it likely that kinases are involved in the modulation of hif- function. because regulation of hif- protein stability is critical for its activation, identification of kinases contributing to hif- stability may provide a link explaining normoxic hif- stabilization by extracellular stimuli. in light of this, dysregulation of gsk-3 is thought to underlie the pathogenesis of various diseases that are also associated with hypoxia and changed hif- levels, such as type 2 diabetes mellitus, alzheimer s disease, mood disorders, cardiovascular diseases, and cancer.122 thus, given that gsk-3 upstream regulation leads to inhibition of gsk-3 and hif-1 accumulation, this raises the question whether it is an option to target gsk-3 in those diseases and disregard the adverse effects. although research from the last decade has demonstrated that a number of kinase pathways contribute to hif-1 regulation, data for hif-2 or hif-3 are limited. taking into consideration the overlapping, but different, roles of the hif- proteins, more knowledge about the phosphorylation-dependent regulation of hif-2 and hif-3 is necessary to better understand both already-observed general and different effects.

hypoxia-inducible factors (hifs), consisting of-and -subunits, are critical regulators of the transcriptional response to hypoxia under both physiological and pathological conditions. to a large extent, the protein stability and the recruitment of coactivators to the c-terminal transactivation domain of the hif -subunits determine overall hif activity. the regulation of hif -subunit protein stability and coactivator recruitment is mainly achieved by oxygen-dependent posttranslational hydroxylation of conserved proline and asparagine residues, respectively. under hypoxia, the hydroxylation events are inhibited and hif -subunits stabilize, translocate to the nucleus, dimerize with the -subunits, and trigger a transcriptional response. however, under normal oxygen conditions, hif -subunits can be activated by various growth and coagulation factors, hormones, cytokines, or stress factors implicating the involvement of different kinase pathways in their regulation, thereby making hif--regulating kinases attractive therapeutic targets. from the kinases known to regulate hif -subunits, only a few phosphorylate hif- directly. here, we review the direct phosphorylation of hif- with an emphasis on the role of glycogen synthase kinase-3 and the consequences for hif-1 function.

PMC5045055

pubmed-503

the pars distalis of the pituitary is composed of both granular and agranular cell types, the former largely hormone-producing cells, the latter forming a reticular and canalicular network in and around the granulated cells. among the nongranulated cells are folliculo-stellate (fs) cells, which have numerous long cytoplasmic processes that insinuate among the endocrine cells. neighboring fs cells are joined by well-developed junctional complexes forming an interconnected network of channels extending throughout the anterior pituitary, but particularly, the pars distalis [2, 3]. fs cells resemble polarized epithelial cells, with their apical surfaces containing microvilli and lining the lumen of the follicular cavities [2, 3]. of relevance to the current study, there is evidence that fs cells play a role in the absorption of ions and water from the luminal spaces [46], which could involve the activity of an apical na/h exchanger. many aspects of metabolism, growth, stress, immunity, and reproduction are under the direct influence of granular cell secretions of the pars distalis; however, the contribution of fs cells to intrapituitary communication and the mode(s) by which this occurs are less well understood. fs cells play a regulatory role both by secretion of paracrine factors, including activin, follistatin, and vascular endothelial growth factor [7, 8], and by intercellular communication via ca signals transmitted through gap junctions, which has been suggested to contribute to synchronization of hormone secretion by endocrine cells [9, 10]. a potential additional means of intrapituitary communication that could play a role in coordination of both fs cell and endocrine cell activities is the network of channels formed by the fs cells. previous studies showed that genetic ablation of the na/h exchanger isoform 2 (nhe2, gene symbol, slc9a2), which is expressed at high levels in stomach, causes loss of gastric acid secretion, decreased viability of parietal cells, and severe metaplasia and hyperplasia of the gastric mucosa [12, 13]. histological abnormalities were not observed in the kidney or intestinal tract of nhe2-null (nhe2) mice; however, they exhibited defects in the absorption of na and hco3 in both the renal nephron and colonic crypts [14, 15], where nhe2 is also expressed, indicating that nhe2 can function as an absorptive na/h exchanger. in the current study, it was shown that pituitaries from mice lacking nhe2 exhibited significant histopathological changes, particularly in the pars distalis and pars intermedia, both of which are derivatives of the primitive gut ectoderm. there was a greater accumulation of cytoplasmic lipid in fs cells and parenchymal cells, an undulating and reduplicated basement membrane, and decreased thickness of the pars intermedia, with a reduction of projections into the pars nervosa. however, the most striking change was a dilated fs cell canalicular system with large cyst-like spaces throughout the pars distalis, which is consistent with the loss of an absorptive ion transport mechanism in the luminal membrane of fs cells. interestingly, the cystic fibrosis transmembrane conductance regulator (cftr), a cl channel that is defective in cystic fibrosis, is expressed in the pituitary gland and likely mediates the camp-stimulated anion currents detected in cultured fs cells [4, 5]. a recent study showed that treatment with forskolin, which stimulates cftr-mediated cl secretion, affects secretion of growth hormone from pituitary slices in culture and suggested that loss of cftr activity in the pituitary might be responsible, in part, for the reduced growth rates in both humans and pigs with cystic fibrosis. the current results support the view that fs cells play a major role in regulating the ionic composition and volume of the interstitial and follicular fluid and suggest that nhe2 serves as an absorptive na/h exchanger on the luminal surface of fs cells that counters fluid accumulation resulting from cftr-mediated secretion of anions. nhe2 and age- and gender-matched wild-type (wt) mice of the original 129/svj and black swiss background were used for these studies. all mice were housed in humidity and temperature controlled rooms, on a 12-hour light/dark cycle, with access to standard mouse chow and water ad libitum. mice varied in age from 17 days to over 1 year old at euthanasia, with approximately equal numbers of males and females. animals were separated into two age groups, age 1: 17 days to 2.5 months, age 2: 4 months1 yr, and 37 mice were used. the number (n) of mice in any given analysis or bar graph is given in the legend. animal protocols were approved by the university of cincinnati institutional animal care and use committee, and animal handlers were trained in an american association of assessment and accreditation of laboratory animal care facility. genotypes were determined by pcr analysis of dna isolated from tail biopsies using a set of 3 primers that simultaneously amplified wild-type and nhe2-null alleles. forward (5-catctctatcacaagttgcccacaatcgtg-3) and reverse (5-gtgactgcatcgttgagcagagactcg-3) primers from the 5 and 3 ends of exon 2 amplified a 450-base pair product from the wild-type allele. a reverse primer (5-gacaatagcaggcatgctgg-3) complementary to sequences within the neomycin resistance gene cassette, which was inserted into exon 2, and the forward primer described above amplified a 221-base pair product from the targeted allele. using total rna from colon and pooled pituitaries of 3-4 month-old mice and a 3.1 kb rat nhe2 cdna probe spanning nucleotides 4493561 (accession number l11236). in situ hybridization using s-labeled antisense (as) and sense (s) probes corresponding to codons 684813 and detected using autoradiographic emulsion. pituitaries were removed immediately after euthanasia and immersed in 2% paraformaldehyde/2.5% glutaraldehyde or 4% paraformaldehyde in phosphate-buffered saline (pbs) for at least 24 hrs. tissues were postfixed in 1% osmium tetroxide in either millonig's buffer or pbs for 2 hrs, dehydrated stepwise in increasing concentrations of ethanol, with two changes of propylene oxide and one change each of 1: 1 and 1: 3 propylene oxide: spurr (electron microscopy sciences, hatfield, pa). tissues were left overnight in fresh 100% resin and flat-embedded in cut-off beem capsules (electron microscopy sciences, hatfield, pa) the following day in fresh resin. sections, 1.5 m thick, were stained with toluidine blue for light microscopy. pituitaries were also preserved in 4% paraformaldehyde, dehydrated in ethanol and xylene, blocked in paraffin, and serially sectioned at 5 m. some of these slides were stained with hematoxylin and eosin (h&e) and others were prepared for in situ hybridization. pituitaries fixed for fine structural detail and opportunely oriented were thin-sectioned and stained with uranyl acetate and lead citrate for transmission electron microscopy. light microscopic morphology and morphometry were conducted on h&e stained sections as well as on plastic sections stained with toluidine blue. the vd (percentage) of cytoplasmic elements was calculated from the number of intersections of a 320 point grid lying over any element/(320 minus the points over nontissue elements) 100. the 320-point grid was printed directly onto digital light micrographs acquired from toluidine blue stained sections at a magnification of 100x. intersections of that grid lying over the following cytoplasmic and nuclear features were counted for pars distalis: (1) fs cell canalicular space, (2) obvious fs cell cytoplasm and nuclei (mainly where the cells were adjacent to canalicular lumens), (3) nuclei and cytoplasm of somatotrophs and mammotrophs (as a single group of cells containing large granules) and other endocrine cells (those with smaller granules), (4) lipid droplet inclusions, (5) blood vessels and vascular luminal contents (endothelium, red cells, and vascular space), and (6) negative areas (those which were not tissue content, such as grid bars, edges, folds, and tears). the number of cells per light micrograph was approximately 200; metaphase cells were counted and the percentage of cells in mitosis calculated. although it was not possible to absolutely identify the cell types in 1.5 m thick sections at the light microscopic level, morphological consistencies among cell types allowed for a reasonable separation of the large granule cells, granule cells with smaller granules, fs cells, and capillaries. fs cells are somewhat under-represented in light micrographs because the thinness is just at the limits of the light microscope. basement membrane redundancy was quantified by drawing a line perpendicular to the endothelial cell basal lamina up through the basement membranes to the closest fs cell basal lamina. measurements of the thickness of the pars intermedia were obtained similarly, using both paraffin and plastic sections at 10x magnification, drawing a line perpendicularly to the interface with pars nervosa up to the pars distalis, sometimes ending at the remnants of rathke's pouch. data were analyzed using sas 9.1 (sas institute, cary, nc) and sigmaplot 2000. means and standard errors of the means were determined by genotype, gender, and age using the general linear model for vd parameters. mean thickness of the pars intermedia, standard errors, and unpaired t-tests were obtained using sigmaplot. for data shown in bar graphs or tables, n is the number of animals. data points from wt mice were pooled since no significant differences were found in morphometry within age comparisons. images were obtained using a spot i camera and nikon inverted microscope or scanned from electron microscopy prints. images were contrast enhanced, and, when needed, the grey tones were evened, and the bandaid, dust, and scratches filters were conservatively applied with photoshop 7 (adobe.com), without altering the integrity of the histological data. previous studies of nhe2 mice revealed functional defects directly related to loss of ion transport activity in stomach, kidney, and colon [12, 15, 16]. although some disturbances in fertility of nhe2 mice were suggested, gross appearance, growth curves, and overall health of nhe2 mice were seemingly normal. however, in a routine histological survey of h&e-stained tissues, we observed cyst-like structures in the pars distalis of nhe2 pituitary glands (figure 1). these first became noticeable by 5 weeks of age and by 10 weeks were well developed. such cystic changes could be due to increased secretion of ions and fluid into canalicular spaces or to reduced absorption. to determine whether the cysts were a direct effect of the loss of nhe2, an absorptive na/h exchanger [15, 16], in pituitary rather than an indirect effect of pathology in other organs, the expression of nhe2 in the pituitary gland was analyzed by blot hybridization and in situ hybridization. northern blot analysis of pituitary and colon rna (figure 2) showed that nhe2 mrna is expressed in the pituitary, but at much lower levels than in colon, the tissue in which the highest levels of nhe2 are expressed. the relative levels of expression suggest that expression of nhe2 mrna might be restricted to a limited area of the pituitary or to a small subset of pituitary cells. in situ hybridization (figure 3) showed three distinct areas in coronal and transverse sections from both wt and nhe2 mice, comprising the more or less concentrically arranged view of these anatomical divisions, with pars distalis forming the outer layer and pars intermedia in a semicircular array around the centrally located pars nervosa (figure 3). in situ hybridization using the antisense probe demonstrated similar grain distribution patterns for both wt and nhe2 pituitaries, though the latter signal was greatly reduced in intensity. the antisense probe was complementary to the part of the mrna that encoded amino acids 684813 of the protein. this region is present in the mutant mrna, which contains a frame-shift mutation just beyond codon 172; it is expressed at low levels in some tissues, likely accounting for the reduced signals detected. hybridization with a control sense probe labeled the entire pituitary uniformly, and at very low levels, with no specific signal in any region (data not shown). with the antisense probe, grain deposition was the highest in the pars distalis, with lower levels in the pars intermedia. in pars distalis, the pattern of distribution of the grains was not clearly specific to either fs cells or to granule cells; however, this may be due to the interdigitation of fs cell cytoplasmic projections around the granule cells. cystic changes were not observed in pars intermedia or pars nervosa of nhe2 or wt mice. the pars intermedia of nhe2 mice showed significant thinning (figure 3, cf. 3(i) and 3(j)) compared to that of wt mice (nhe2: 96 8 m, n=6; wt: 146 8.4 m, n=5; p=.003). finger-like projections of the pars intermedia into the pars nervosa (black arrows in figures 3(e) and 3(g)) appeared to be reduced in nhe2 mice as well. these data show that pars intermedia is also affected, although the loss of nhe2 did not cause cystic changes as in pars distalis, at least in the time frame studied. fs cells and their junctional complexes formed the canaliculi. on tissue sections they occupied a very small percent of the pars distalis in wt mice, a volume density (vd) of less than 2%. canalicular lumens were generally collapsed in wt mouse pituitary but on occasion canaliculi contained small amounts of membrane-like debris. in contrast, in nhe2 mice there was a considerable increase in the combined vd of fs cells and canalicular space (figure 4) to a vd of more than 10% (nhe2 null: 12.05% 2.9; wt: 1.45% 0.35). the integrity of the canalicular lumens seemed not to be compromised, but it became apparent that with increasing age the combined vd of fs cells and follicular space (figure 4) increased in the pars distalis. analysis of pituitary sections from a single 56-day old achlorhydric mouse that lacked the gastric h, k-atpase subunit revealed no histopathology. the vd of large granule pituitary cells (somatotrophs+mammotrophs) was greater in nhe2 pituitaries (figure 4) compared to wt. however, no differences were detected in the actual morphology of the large granule cells. both vd of fs cells (figure 5) and dilation of canaliculi gradually increased in nhe2 mice compared to wt (figure 5). and while the vd of fs cell cytoplasm and nucleus increased to about 4% in the aged nhe2 mice (p=.04) it still represented only a small portion of the pars distalis as a whole. the increase in the vd of fs cells appeared to be fs cell hypertrophy rather than hyperplasia; this backed up the fact that there was no statistically significant increase in the number of mitotic cells in the nhe2 mice (nhe2: 0.022 0.17; wt: 0.003 0.02, p=.48). while the vd of folliculo-stellate cells increased in nhe2 mice, in several other respects, fs cell morphology and ultrastructure were similar to those of wt fs cells (figure 5). connections among fs cells surrounding the dilatations were seemingly occlusive, and there was no evidence for expansion or edema in the lateral (intercellular) spaces. junctional complexes were prominent and extensive and, like desmosomes, were most common just beneath the canalicular lumens. canalicular cystic dilatations were quite variable in size and were clearly demarcated by contiguous fs cells. nhe2 mice had fs cell canaliculi lined with unremarkable microvilli and an occasional primary cilium and sometimes contained membrane-like fragments and other cellular debris, and recognizable apoptotic bodies. there were occasional phagolysosmal structures within fs cells, particularly in the nhe2 mice. ultrastructure of the fs cell cytoplasm and nucleoplasm was not obviously changed in organization (figure 5), and intercellular interdigitations among fs cells, appearance of the rough endoplasmic reticulum, polyribosomes, mitochondria, golgi bodies, nuclei, and other organelles appeared to be unchanged from wt as well. an increase in small lipid droplets (figure 6) was found predominantly in fs cell cytoplasm, and also in other cell types, including granulated cells. the vd of lipid was about 3-fold greater in the aging nhe2 mice than in wt mice, but in both groups the vd of lipid increased as age increased. values for vd of lipid for each group were compared with the genotype-matched younger age group (resp.), but statistical significance was reached in the nhe2 animals only. lipid droplets were typically less than a few m in diameter and were found either as part of or adjacent to inclusions (phagolysosomes or autophagosomes) (figure 6(a)). microvilli on the apical membranes of fs cells of nhe2 mice (projecting into the canalicular space) were not noticeably different from wt (figure 7). they appeared similar to the flexible microvilli that were found in numerous other tissues, such as bile canaliculi in the liver and canalicular microvilli of parietal cells in the stomach (about 1 m in length). the actin filaments seen on cross-section were more or less evenly distributed within the microvillus, if not peripherally, and were definitely not bundled centrally as one typically sees in intestinal and renal brush border. the microvilli were not very densely packed along the fs cell apical membrane in either wt or nhe2 fs cells (figure 7) though, on occasion, areas of densely packed microvilli were found in the nhe2 fs cells displaying a phenotype not unlike that of parietal cell canaliculi. similar to the membrane-like debris occasionally found in canalicular lumens, membrane-like debris was sometimes found within the apical cytoplasm of fs cells of nhe2 mice (figure 7). basal membranes of fs cells adjacent to capillary endothelium abutted two basement membranes: one an fs cell product and the other produced by the capillary endothelium. in wt mice reduplicated and redundant basement membranes were common in the nhe2 mice, older animals showing greater changes. redundancies were sometimes focal, and on occasion as many as 8 redundancies were counted, with a mean number of basement membranes in the nhe2 samples significantly greater than in wt (wt: n=3, 1.7 0.19; nhe2: n=4, 2.2 0.14, p=.036). subjectively, areas of redundant and duplicated membrane appeared more likely to be attributable to the fs cells than to the capillary endothelium. an increase in other extracellular matrix proteins may have occurred as well, and occasionally collagen was seen. the vd of blood vessels in the pars distalis was not significantly different among the groups of old, young, null, or wt mice. there were many desmosomal-mitochondrial connections, which spanned adjacent fs cell membranes at the site of desmosomes (figure 9). these comprise mitochondria with a portion of outer lamella abutting the keratin filaments which radiate from the desmosome into the cytoplasm. such desmosomal-mitochondrial juxtapositions often were present on both sides of the desmosome (i.e., adjacent to desmosomes in adjacent cells), other times adjacent to the desmosome on one side only. since so many of these juxtapositions occurred, they are likely more paired than not, at least in wt mice, and section orientation has left one mitochondrion unseen (table 1). the order and incidence of junctional complexes, desmosomes, and desmosomal-mitochondrial associations in a tally made from electron micrographs revealed a significant reduction from wt in the number of desmosomes which were associated with 2 mitochondria (table 1). junctional complexes, intercellular spaces, membrane interdigitations, microvilli, and pinocytotic vesicles/caveolae are not different in nhe2 than in wt samples, as counted in this study. a count of caveolae per membrane profile per cell showed no significant difference between wt and nhe2 (wt: 0.69 0.16; nhe2: 0.23 0.10; p=.2). the most prominent histological finding consequent to gene-targeted ablation of the nhe2 na/h exchanger was the dilation of the canaliculi formed by fs cells in the pars distalis of the anterior pituitary. the cyst-like structures were lined by fs cells, with their luminal surfaces containing microvilli, and a morphology clearly indicating that they were derived from the network of interconnected follicular cavities. the cysts became apparent at about 5 weeks of age and were very prominent by 8 and 10 weeks. the absence of cysts in pituitary sections from an achlorhydric mouse lacking the gastric h, k-atpase subunit indicated that the cysts in the nhe2 pituitaries were a direct response to the loss of nhe2 in the pituitary rather than an indirect response to achlorhydria. given the known absorptive functions of nhe2 [14, 15], the expression of nhe2 mrna in pars distalis and at lesser levels in pars intermedia, both of which are reported to contain fs cells, and the previously demonstrated transcellular fluxes of ions and water across fs cells [4, 5], the data suggest that nhe2 serves as an important absorptive na/h exchanger on the luminal surface of fs cells of the anterior pituitary. nhe2 mrna expression, as indicated by northern blot analysis, was very low in the pituitary gland when compared with its expression in colon, the tissue with the highest expression in rats and mice [11, 12]. the apparent low level of expression may be due in part to the relatively low abundance of fs cells compared to endocrine cells, as indicated by measurements of fs cell vd; however, other factors might also be involved. under normal conditions, the luminal membrane of the follicles, where nhe2 is presumably expressed, is a small percentage of the total plasma membrane of fs cells. in addition, the gradual appearance and expansion of the canaliculi in nhe2-null pituitary glands suggest that the absorptive process is far less robust than in colonic crypts and kidney, where large quantities of ions and water are absorbed on a continuous basis. rather, the pituitary phenotype developing with the loss of nhe2 suggests that absorption mediated by low levels of nhe2 may counter relatively low levels of fluid accumulation in the follicular cavities. attempts to identify the membrane location of nhe2 protein in the pituitary gland using antibodies that have been used for immunolocalization in apical membranes of salivary acinar and duct cells were unsuccessful. thus, at the present time the membrane location of nhe2 can only be inferred from the histological phenotype and from its expression on apical membranes in epithelial tissues where it is expressed at much higher levels. earlier studies showed that fs cells in culture can function like typical epithelial cells involved in transepithelial ion and fluid transport. when grown as primary cultures, fs cells derived from the pars distalis and pars tuberalis and from the pars intermedia formed domes, indicating that they absorbed ions and water from the culture fluid. studies using cultured cells mounted in ussing chambers showed that application of -adrenergic agonists to the serosal surface led to currents consistent with cftr-mediated anion secretion, whereas application of amiloride to the mucosal surface, at concentrations known to inhibit the epithelial na channel, led to a reduction in transepithelial currents, with a further reduction in response following inhibition of the na, k-atpase with ouabain. these data indicated that fs cells contained an apical anion channel and apical transporters that were able to absorb na, with accompanying anions, from the luminal spaces. aquaporin 4 has also been shown to be expressed in fs cells, suggesting that it contributes to water transport associated with ion movements. the identities of specific ion transporters involved in transcellular ion fluxes in fs cells have not been determined; however, a recent study showed that cftr is expressed in the pituitary and the current data indicate that nhe2 plays a critical role in this process. nhe2 is one of two absorptive na/h exchangers in apical membranes of renal and intestinal epithelial cells [14, 15]. nhe3 mediates high levels of nacl absorption via coupling with either cl/formate exchange or cl/hco3 exchange [21, 22]. however, when operating alone, na/h exchange mediates na and hco3 absorption. nhe2 has an unusual ph sensitivity that would appear to make it suitable for a role in nahco3 absorption. its activity is very low at normal extracellular ph, but it exhibits 50% activity at ph 8.0, and its activity increases further as the extracellular ph increases. in the kidney, nhe2 plays a role in na and hco3 absorption and is particularly important under conditions of increased delivery of hco3 to the distal nephron. in colon, nhe2 is expressed primarily in the crypts, where the luminal ph is relatively alkaline in the presence of physiological concentrations of short-chain fatty acids, again consistent with a function in nahco3 absorption. as far as we are aware, the ph and hco3 content of follicular fluid is not known, but it is possible that the sensitivity of nhe2 to extracellular ph makes it more suitable for its role in the pituitary. cystic dilatations were not observed in the pars intermedia of nhe2 mice despite the presence of fs cells and nhe2 expression in this segment of wt pituitary glands. it is possible that secretory processes that expand the canaliculi, which may involve cftr-mediated anion secretion, are less active in this segment than in the pars distalis or that a compensatory absorptive mechanism prevents their expansion. for example, an ion transport mechanism that can compensate for the loss of nhe2 has been shown to be activated in colonic crypts of nhe2 mice. for example, de bold et al. reported the presence of two types of interconnected channels in the pars intermedia, which they noted was highly avascular and presumed that fluid and solutes in the channel systems can reach the general circulation. if this were the case, it could provide drainage, thus preventing cyst formation. it is difficult to draw clear parallels between the pituitary and stomach phenotypes of nhe2-null mice. nhe2 was originally proposed to function on the basolateral membrane of the parietal cell, operating in concert with the ae2 cl/hco3 exchanger to mediate na and cl uptake that is required for stimulated acid secretion. however, it is clear that the few mature nhe2 parietal cells were able to secrete high levels of acid and there is evidence that nhe4 is the basolateral na/h exchanger required for acid secretion. an alternative possibility is that nhe2 is expressed in canalicular membranes, where it could operate in concert with the slc26a6 cl/hco3 exchanger and other transporters to dehydrate secretory membranes during transitions to the resting state. such a function would be similar to the absorptive function proposed in fs cells and consistent with its apical expression in other epithelial tissues [14, 15, 19, 28]. the cystic dilations in the fs cell canaliculi in nhe2 mice did not readily conform to those of known human or animal pituitary disease, where most reported cystic changes were within pituitary neoplasms or were cysts containing mucins or colloid-type inclusions [29, 30]. metaplastic transformation of fs cells, described in human pituitary, was not found in the nhe2 mice. while neither colloid contents nor mucins were found with any regularity within the dilated canaliculi of nhe2 (or wt) pituitaries, membrane and nuclear debris were seen on occasion. they were greater in quantity in nhe2 pituitaries than in wt, and likely the residue from an occasional expulsion of previously phagocytosed apoptotic debris into the canalicular lumen. the amount of cellular debris, apoptotic bodies, or phagolysosomal vacuoles did not suggest excessive fs cell death in the nhe2 mice. this is in contrast to conspicuous parietal cell death which occurred in the stomach of nhe2 mice. fs cell microvilli most closely resembled the morphology of bile canaliculi in the liver, but nhe2 fs cells occasionally formed apical invaginations containing clusters of densely packed microvilli (figure 7(b)) resembling those of parietal cell canaliculi. it is unclear whether these rare instances of densely packed microvilli correspond to an absorptive state or to a secretory state, as is the case for parietal cells, but given the invagination of the canaliculus into the cell a secretory state seems more likely. ultrastructure was also affected on the basal side of fs cells and comprised duplicated and/or redundant basement membranes. fs cells produce their own basement membranes, of the continuous type, distinct from, and parallel to, basement membranes of the capillary bed. the ability of these cells to produce matrix proteins and basement membrane structures has been described using a transgenic mouse model. redundancies in basement membranes occurred primarily beneath fs cells and were short and fragmented. duplicated basement membranes have been described in bile duct and other tissues [3436] but were not reported in stomach or other affected tissues of the nhe2 mouse [12, 13]. it is possible that physical strain related to canalicular dilation could induce an increase in matrix proteins or that perturbations of cellular homeostasis related to the ion transport defect are involved. fs cells displayed numerous instances of close physical associations between mitochondria and the intracellular filaments of desmosomes. in wt mice, over half of the desmosomes exhibited associations with two mitochondria, one from each cell contributing to the desmosomal junction. nhe2 fs cells exhibited a significant decrease in the percentage of desmosomes associated with 2 mitochondria, from 52% in wt to 7% in mutant mice. desmosomes undergo frequent remodeling, so if mitochondria are involved in this process, it would suggest less remodeling in nhe2 fs cells. the frequent associations between mitochondria and desmosomes have led to speculations of their providing for energy requirements and calcium delivery, but the function is not known. these desmosome-mitochondria associations [3841] lend further credence to the dynamic nature of the apical membrane of fs cells. lipid droplet accumulation in the cytoplasm of cells is a well-recognized indicator of cell stress and pathology [4245]. therefore the significant increase in cytoplasmic lipid in fs and granule cells of the pars distalis of nhe2 mice may be an indication of cell stress resulting from the loss of nhe2. this observation and the increased vd of large granule cells indicate that these endocrine cells are negatively affected by the fs cell defect. the function of the canalicular network is unclear; however, there is compelling evidence that fs cells themselves form an extensive cell network in addition to the canalicular network and that intrapituitary communication occurs via ca signaling through gap junctions [9, 10, 4648]. this mechanism, which allows propagation of ca signals over long distances within the anterior pituitary, has been suggested to provide a means by which fs cells synchronize secretory activity of endocrine cells [9, 10]. it is clearly important, and perhaps predominant; however, it has also been noted that the anastomosing channels formed by fs cells might provide a means of synchronizing hormone secretion. one can speculate that the two networks operate separately, with fs cell ca signaling through gap junctions providing rapid coordination of endocrine activity and fs cell control of the canalicular fluid composition via ion secretion and absorption providing longer-term regulation. alternatively, anion secretion and ca signaling might act in concert if they were stimulated together or if one activity triggered the other. additional studies will be needed to identify all of the transporters involved in ion secretion and absorption by fs cells and to determine their relevance to human diseases involving transepithelial ion transport defects. in this regard, it has long been reported that pituitary function is impaired in cystic fibrosis, the most common genetic disease in humans, and recent work showed that cftr is expressed in pituitary and that the absence of its activity impairs hormone secretion (, and references therein). in conclusion, the loss of nhe2 produced anterior pituitary pathology, including a gross dilation of fs cell canaliculi, increase in the vd of fs cells, a significant accumulation of small lipid droplets in fs cell and granule cell cytoplasm, a reduction in desmosomal-mitochondrial complexes, reduplication of the fs cell basement membranes, an increase in the vd of somatotrophs and mammotrophs, and a thinning of the pars intermedia. the absence of apparent effects on growth and development suggests that dilation of the canaliculi resulting from the loss of nhe2 is a relatively benign defect. nevertheless, a fertility defect remains unexplained, and the increase in both vd and lipid droplets in large granule cells showed that endocrine cells are affected. the dilation of the canaliculi suggests that nhe2 is the major absorptive mechanism that counters the accumulation of canalicular fluid resulting from ion secretion by fs cells. thus, if ion secretion serves an important function in the pituitary, as suggested by studies on the pig cystic fibrosis model and human infants with cystic fibrosis, then one might expect that disease conditions or drugs that impair ion secretion or homeostatic regulation of the volume and ionic composition of the canalicular fluid would affect pituitary function and human health .

genetic ablation of the nhe2 na+/h+ exchanger causes gastric achlorhydria, absorptive defects in kidney and colon, and low fertility. here we show that nhe2 is expressed in the pituitary, with the highest mrna expression in pars distalis and lower expression in pars intermedia. in pars distalis of nhe2-null mice, prominent cyst-like dilatations of folliculo-stellate (fs) cell canaliculi developed with age, and there were increased fs cell area, accumulation of lipid in fs cell cytoplasm, redundancies in fs cell basement membrane, and other changes. the expansion of the canaliculi indicates that nhe2 is a major absorptive na+/h+ exchanger in the luminal membranes lining the extensive network of channels formed by fs cells, which may provide a means of intrapituitary communication. the results suggest that nhe2 contributes to homeostatic regulation of the volume and composition of the canalicular fluid and may counter the secretory activity of the cftr cl channel, which is known to be expressed in pituitary.

PMC3025390

pubmed-504

location of the study area- the administrative district of barcelos is located north of am. to the east, it borders the state of roraima; to the southeast and south, it borders the district of santa isabel do rio negro and, to the north, it borders venezuela (latitude 058'1 " south of the equator and longitude 6256 " west of greenwich). the city of barcelos, where this study was conducted, is located on the right bank of the negro river, 490 km from manaus, the capital of am (fig. 2). 2location of barcelos, state of amazonas, brazil, 2010, and number of blood samples collected by teams (a-f) and city district for screen tests. survey and samples- the new serological survey was conducted in the main settlement of barcelos and covered the entire resident population that was willing to participate in the survey after providing informed consent. for minors, the main settlement of the municipality was divided into six areas (a-f), which were to be covered by the municipality's health agents under supervision by two laboratory technicians at the municipal hospital. the teams were trained by the project coordinator (jr coura, a physician and infectologist) and were monitored throughout the survey by a postgraduate student (mhp marquez). each team was composed of two health agents; the two laboratory technicians each supervised three of the teams and all six teams were monitored by the postgraduate student. in total, 4,880 blood samples were collected on filter paper in accordance with the technique of souza and camargo (1966) for the screening test: 770 samples were collected by team a (so sebastio), 925 by team b (so lzaro), 1,000 by team c (so francisco), 728 by team d (nazar), 817 by team e (vila linhares) and 640 by team f (aparecida). all the blood samples on the filter paper were eluted in 250 l of phosphate-buffered saline (ph 7.2) and were tested using the iif test, as recommended by fife and muschel (1959) and souza and camargo (1966), as adapted by ostermayer et al. (2011) for the detection of anti- t. cruzi antibodies. the iif-chagas kit produced by biomanguinhos was used. in this kit, the antigens used are cultured epimastigote forms of t. cruzi in liver infusion tryptose medium. the tests were performed in the serology sector of the parasitic diseases laboratory of the oswaldo cruz institute, oswaldo cruz foundation, state of rio de janeiro (rj), brazil. the slides were prepared in accordance with the classical techniques for iif and were examined under an immunofluorescence microscope by at least two observers. the slide readings were considered to be negative (unreactive, absence of fluorescence), doubtful (weakly reactive, low intensity of fluorescence) or positive (strongly reactive, high intensity of fluorescence). confirmatory serological test- to perform confirmatory reactions, venous blood (5 ml) was collected by the laboratory technicians from 315 patients (60%) who presented positive (137 patients; 62%) or doubtful (178 patients; 59%) iif reactions to t. cruzi infection based on the serological screening of blood on the filter paper. after separation, the serum was frozen, packed on dry ice and sent from barcelos to our laboratory in rj. these serum samples were subjected to three serological reactions: iif (chagas kit, biomanguinhos) with a dilution of 1:40, with the positive samples tittered as much as 1:1,280, conventional elisa (dmed kit) and recombinant elisa (wiener lab. samples were considered to be seronegative if two or three of the tests were negative and seropositive if two or three of the tests were positive. serological screening test- the screening test performed on the blood placed on the filter paper using immunofluorescence, 221 (4.5%) of the 4,880 samples were considered to be positive (strongly reactive) and 302 (6.2%) were considered to be doubtful (weakly positive) (table ii). of the 4,880 samples examined, 2,741 (56.2%) were from females and 2,139 (43.8%) were from males. among the 221 samples that were considered to be positive, 104 (3.8%) were from females and 117 (5.5%) were from males. the numbers of blood samples collected on filter paper, along with the percentage of positivity for t. cruzi infection, varied according to the number of people living in the area and their degree of exposure to infection in rural areas, especially in relation to piassava harvesters and their families. this characteristic has already been presented in previous studies by our group (coura et al. 1995a, b, 2002a, b, 1999, albajar et al. 2010, coura&junqueira 2012, junqueira et al. 2013). table ii age groups (years) tested n positives n (%) doubtful n (%)<5 495 9 (1.8) 17 (3.4)5-962618 (1.9)30 (4.8)10-1462212 (2.9)30 (4.8)15-1952424 (4.6)35 (6.7)20-2987246 (5.3)56 (6.4)30-3957834 (5.9)41 (7.1)40-4941324 (5.8)39 (9.4)50-5929319 (6.5)18 (6.1)60-6922717 (7.5)17 (7.5)70-791389(6.5)10 (7.2)>79554 (7.3)2 (3.6)unknown 37 5 (13.5)7 (18.9) 4,880 221 (4.5) 302 (6.2) a: yanomami indians. a: yanomami indians. the prevalence of serological positivity in samples collected on filter paper gradually increased after the age of 15 years, precisely when adolescents (especially males) started to be involved in piassava harvesting and after the age of 20 years among women, when as wives would accompany their husbands to the piassava plantations (fig. the unknown age group (yanomami indians who do not know their age) is the most exposed to wild triatomines in the forest; therefore, they had the highest percentage of iif-positive results (13.5%), as shown in fig. 3percentage of positive immunefluorescence by age group in the screen tests in barcelos, state of amazonas, brazil, 2010. confirmatory serological test- among the 137 serum samples that were considered to be positive based on immunofluorescence testing, 37 (27%) were considered to be seronegative based on the confirmatory serological test, 67 (48.9%) were considered to be serodivergent, as only one of the three reactions was positive, and only 33 (24.1%) were confirmed as seropositive, with two or three positive reactions (table iii). of the 178 serum samples for which the immunofluorescence was considered doubtful, 89 (50%) were seronegative in all three confirmatory reactions, 79 (44.4%) were considered to be serodivergent, with only one positive reaction out of the three reactions, and only 10 (5.6%) were considered to be seropositive, with two or three positive reactions (table iii). in summary, of the 137 samples that were positive in the screening serological tests, only 33 (24.1%) were positive in the confirmatory tests, while only 10 (5.6%) of the 178 samples that were doubtful in the screening test were positive in the confirmatory test, as shown in table iii. the numbers of serum samples and the titres of igg confirmed by immunofluorescence as positive are shown in fig. 4. these data most likely reflect the low level of parasitaemia and the particular t. cruzi strain circulating in the area (tci), which likely provide low stimulation for antibody genesis. table iiiconfirmatory serological tests of 137 samples positives and 178 doubtful by indirect immunofluorescence (iif) in blood from filter paper evaluated by iif and elisa conventional and or recombinantserological evaluation positives iif from filter paper n (%) doubtful iif from filter paper n (%) seronegatives 37 (27) 89 (50)serodivergents 67 (48.9)79 (44.4)seropositives33 (24.1)10 (5.6) total 137 (100) 178 (100) fig. 4titres of igg of immunofluorescence in serum from confirmatory serological tests in barcelos, state of amazonas, brazil, 2011. the high prevalence found in the preliminary serological screening surveys that we conducted in 1991, 1993 and 1997 (coura et al. 1999) certainly occurred due to cross-reactions with a variety of diseases that are endemic in this area, including malaria, american cutaneous leishmaniasis, tuberculosis, leprosy and trypanosoma rangeli infection. additionally, the low titres of anti- t. cruzi antibodies demonstrated in the present study favoured occurrences of cross-reactions with other infections. the prevalence of t. cruzi infection in barcelos was observed to vary according to the intensity of exposure. in a group of 244 highly exposed individuals, we found that 11% were serologically positive (iif and tesa-blot). however, among the 46 individuals in this group who underwent xenodiagnosis and polymerase chain reaction (pcr) analysis, we only isolated t. cruzi in 19% of the individuals through xenodiagnosis and the pcr was only positive in these cases (coura et al. (1998a, b) demonstrated only two lineages of t. cruzi in the area (tci and z3). although no studies have provided evidence, we can suppose that these lineages of t. cruzi are poorly immunogenic for antibody generation. finally, we recommend that the serological diagnosis of t. cruzi infection in the amazon region should be made using at least two different techniques, e.g., immunofluorescence and elisa and confirmed by western blot analysis when possible.

the serology of human trypanosoma cruzi infection in the rio negro microregion is very complex because of the large numbers of false-positive cases that result from low antibody titres and cross-reactions with other infections. in the present study, we collected 4,880 blood samples on filter paper; of these, indirect immunofluorescence (iif) was strongly reactive in 221 (4.5%), which were considered to be positive (iif strongly reactive; high intensity of fluorescence) and weakly reactive in 302 (6.2%), which were considered to be doubtful (iif weakly reactive; low intensity of fluorescence). the confirmatory test on the serum using at least two of three techniques (iif, conventional elisa and recombinant elisa) on 137 samples that were positive in the screening test only confirmed 33 cases (24.1%). of the 178 samples that were considered doubtful in the screening test, only 10 (5.6%) were considered to be positive in the confirmatory test. finally, we recommend that the serological diagnosis of t. cruzi infection in the amazon region be made using at least two different techniques, for example immunofluorescence and elisa and confirmed by western blot analysis when possible.

PMC3970652

pubmed-505

tis education forms the common mind; just as the twig is bent, the tree s inclined, wrote alexander pope in 1734. this is likely one of the earliest poetic descriptions of a current topic of great interest to psychiatrists and research neuroscientists, namely the impact of early psychosocial factors on subsequent neuronal development and ultimate phenotypic presentation. michael meaney and colleagues at mcgill university have demonstrated, in an elegant series of experiments in rats, the effect of early maternal grooming of rat pups on stress resilience via hippocampal glucocorticoid receptor expression and activation of nerve growth factor inducible-a. offspring interactions can dramatically influence the child s behavior as they age.1 the focus of this study is to examine retrospectively the potential relationship between maternal personality characteristics, as measured by the minnesota multiphasic personality inventory (mmpi), and drug dependence in their sons. the hypothesis is that certain personality traits in mothers may help predict an at-risk population of their sons for the development of drug dependence. this preliminary work is intended to explore a potential translational aspect of the work of meaney and others. bucknall and robertson,2 have demonstrated the role of family in the etiology of drug abuse, with an even greater role in the maintenance of an individual s drug dependence. andersson and eisemann,3 confirmed that a parental rearing behavior perceived both as rejecting and overprotective represents a link between dysfunctional parenting and the development of maladaptive psychosocial behaviors, like drug addiction. drug addicts often come from families where there is frequently expressed ill will and hostility in the home. they have weaker family ties than do those who do not take drugs. in families in which there was contact with drugs, authority belonged to the mother to a greater degree than the father.4 handlarz et al5 studied drug addicts and their families and observed general characteristics common to all substance-dependent patients. among these were vulnerability of personality and ego weakness, absent father, narcissistic mother, disaggregation of the family, and pathological communication among family members. graeven and schaef 6 reported the relationship with the opposite sex parent had the strongest impact on both male and female heroin users. kaufamn7 studied the family structure of drug addicts and their families who were in residential treatment at the time of the study. the most common familial pattern seen was that of a mother enmeshed with her addicted son. the father reported feeling excluded by the dyad and reacted with disengagement, brutality, or increased consumption of alcohol. this paper examines the personality of mothers and its relationship to severity of addiction of their sons. it is a follow up to our previous work on childhood parenting styles of the substance-dependent patient.8 patients were diagnosed according to diagnostic statistical manual (dsm iv).9 the control group consisted of 35 mothers of non-drug-dependent subjects. mothers from both groups fulfilled the following inclusion criteria: age between 40 and 60.not suffering substance use disorders or any other psychiatric disorders.not suffering significant medical disorder. age between 40 and 60. not suffering substance use disorders or any other psychiatric disorders. all study subjects were informed they were participating in a volunteer study examining the relationship between a mother s personality and drug dependence in their children. all study participants provided informed consent to a psychiatrist (sa) member of the study team. both groups were administered the minnesota multiphasic personality inventory (mmpi),10 which is a self-reported inventory developed in 1937 by starke hanthaway and charnley mckinley. the items of each scale were selected for their ability to separate medical and psychiatric patients from normal control subjects. we applied the arabic version prepared by melika et al.10 substance-dependent patients were assessed with the addiction severity index (asi).11 the asi is a semi-structured interview designed to address 7 potential problem areas in substance use disorder patients: medical status, employment and support, drug use, alcohol use, legal status, family/social status, and psychiatric status. in 1 hour, a skilled interviewer can gather information on recent (past 30 days) and lifetime problems in all of the problem areas. the asi provided an overview of problems related to substance, rather than focusing on any single area. personality profiles of mothers of both groups were compared, and those of mothers of dependent patients were correlated to the 7 dimensions of the asi. differences between quantitative variables for the addicts group and the control group were assessed using student s t-test. the mmpi scales for mothers were classified into risk grades and differences between the study groups were assessed using pearson s chi-square test. the association between the different study scales for mother and their offspring was assessed using correlation analysis. the mean age of mothers of patients was 50, while that of the control was 44.8 years. they were age matched (p=0.07) there were significant differences between both groups on depression, hysteria, and paranoia scales of the mmpi. depression scores were higher than 70 (pathological) in 8% of study group compared to only 1% of control group. depression scores were in the normal range (45 to 50) in 5% of study group compared to 22% of the control group (p=0.003). scores on the hysteria scale were higher than 70 in 4% of study group compared to none of the control group. negative scores for hysteria were seen in 15% of the study group, compared to 40% of the control group (p=0.02). paranoia scale scores were positive in 4% of the study group, compared to 1% of controls (p=0.03). no paranoia was detected in 10% of the study group, compared to 40% of controls. no significant differences were reported on any of the other mmpi scales (table 1). significant positive correlations were observed among mothers of substance-dependent patients on scores of depression, hypochondrias, and psychopathic deviance (p=0.003, and p=0.01 respectively). a positive correlation was also detected between scores of hysteria, hypochondrias and psychopathic deviance (p=0.001 and p=0.004, respectively), and between paranoia and hypochondrias, depression, and psychopathic deviance (p=0.005, p=0.01, and p=0.01, respectively). pearson s correlation coefficient was calculated to measure the degree of association between mmpi scores and the asi. results showed significant positive correlation between scores of hysteria and psychopathic deviance and asi legal status impairment (p=0.023 and p=0.019, respectively). there was a significant negative correlation between social introversion and asi scores of drug/alcohol use, and family history (p=0.007 and p=0.003, respectively). significant positive correlations were observed between scores of social status impairment and those of psychiatric and legal status impairment (p= 0.005 and p=0.04, respectively). the role of parenting in the development of drug abuse is a widely discussed topic. this is best demonstrated by 2,590,000 google hits displayed when the role of parenting on drug abuse is searched. behavioral scientists appreciated the highly complex nature of parental interactions, particularly maternal, and have demonstrated the role of nurturing in early life to the development of pathophysiologic functioning in later years of the offspring. schweitzer and lawton12 and brook et al1 have independently reported mothers assessed as cold, indifferent, controlling, and intrusive were a major risk factor for the development of adolescent drug use. similarly, andersson and eisemann3 reported that parenting perceived as rejecting was linked to maladaptive psychosocial behaviors, including drug abuse. our previous study confirmed these findings8 and demonstrated that substance-abusing patients had lower maternal protection scores than non-drug-abusing controls. this analysis of maternal mmpi scores in addicted offspring demonstrated a statistically significant correlation in the depression, hysteria and paranoia subscales. these results have significant health, mental health, and public health and health policy implications. the cost of drug abuse and addiction to the patient, their family, and society is enormous. any primary interventions which might decrease pathologic drug use would be beneficial. these and other data strongly support the importance of early mother child assessment and intervention when clinically indicated. although the role of family varies somewhat based on cultural norms, the effect of early maternal nurturing on neuronal development and subsequent phenotypic expression is not affected by socio-cultural variations. it is far more effective to work with mothers than to treat drug addiction in their grown children. future research needs to focus on identifying cost-effective and clinically effective early intervention strategies through prospective, longitudinal trials. clinical translational research drawing on results from pre-clinical reports will also be valuable.

drug addicts often come from dysfunctional families. the prevailing view in the literature is that mothers of drug-dependent patients can be characterized by strong emotional bonds and overprotection. studies suggest that maternal rejection could be a major risk factor of developing drug addiction. this work is a continuation of our previous study of childhood parenting experiences of substance-dependent patients. the aims were to compare the personality profile of mothers of substance-dependent patients and that of mothers of matched control subjects; and to examine the relation between the personality of mothers of addicts, and severity of their offspring s addiction. the study group consisted of 20 mothers of substance-dependent patients and a control group of 35 mothers of non-dependent subjects; mothers of both groups were age matched. patients were diagnosed according to dsm iv criteria. personalities of mothers of both groups were assessed using the minnesota multiphasic personality inventory (mmpi). substance-dependent patients (sons) were administered the addiction severity index (asi). the mean scores of the mmpi scales were higher for mothers of dependent patients compared to mothers of non-dependent subjects. scores on the depression, hysteria and paranoia scales were significantly higher for mothers of patients (p=0.03, 0.02, and 0.03, respectively). there was a significant positive correlation between scores of hysteria, and psychopathic deviance and the asi (p=0.03 and 0.01, respectively). there were significant negative correlations between scores of social introversion and the asi drug/alcohol use status (p=0.007), and family history dimensions (p=0.003). mothers of substance-dependent patients showed disturbances in aspects of personalities that might be related to initiation of perpetuation of substance dependence.

PMC3004601

pubmed-506

cardiovascular disease, the leading cause of death in western countries, is a preeminent health problem worldwide. atherosclerosis, a chronic inflammatory-based disease (cibd), constitutes the single most important contributor for cardiovascular complications. mainly, atherosclerosis results from an immune response to oxidized low-density lipoproteins (ldls). induced by an atherogenic diet, monocytes are promoted to adhesion into the artherial endothelium and intimae (diapedesis). once in the intimae, monocytes differentiate into macrophages and then modified lipoproteins (such as oxidized ldls) are accumulated as cytoplasmatic droplets. some of these mediators are involved in proatherogenic processes, such as interleukin- (il-) 1, il-6, and tumor necrosis factor alpha (tnf-) that involve in the upregulation of the molecular adhesion on the endothelial cells. others have demonstrated to have antiatherogenic properties such as il-10 that involve in the attenuation of the monocyte differentiation into macrophages. the use of medicinal plants, or extracts from them, has been traditionally practiced worldwide in the prevention and treatment of several chronic diseases such as cardiovascular diseases, intestinal inflammatory diseases, inflammatory bowel disease, arthritis, diabetes, allergies, multiple sclerosis, parkinson's and alzheimer's diseases, and others. extracts from thyme have been used in traditional medicine for the treatment of several respiratory diseases like asthma and bronchitis and for the treatment of other pathologies thanks to several properties such as antiseptic, antispasmodic, antitussive antimicrobial, antifungal, antioxidative, and antiviral [7, 8]. thyme oils have also been described as a strong bactericide against gram-positive and gram-negative bacteria and also as a bronchospasmolytic [9, 10]. for example, it has been reported that thyme oil reduces no production in j774a.1 murine macrophages. major bioactive compounds of the extracts from thyme are carvacrol and thymol [12, 13]. thymol exhibits multiple biological activities including anti-inflammatory, immunomodulating, antioxidant, antibacterial, antifungal, and free radical scavenging properties. carvacrol also possesses antimicrobial, antifungal, and antioxidant activities [2022], as well as antimutagenic and anticarcinogenic effects. there have been demonstrated effects on the treatment of colitic mice with essential oils of thyme and oregano containing thymol and carvacrol as their principal bioactive compounds, decreasing levels of the proinflammatory cytokines il-1, il-6, and tnf-. however, mechanisms mediating these suppressive effects are unclear. borneol, another compound present in thyme, has been also described as an anti-inflammatory since its dietary supplementation significantly decreases the concentration of the proinflammatory cytokines il-1 and il-6 in mice. nowadays medicinal therapies for cibds involve treatment with nonsteroidal anti-inflammatory drugs, antibiotics, corticosteroids, and immunosuppressant, but the application of these drugs is limited due to their toxicity and side effects. therefore, there is an increasing interest in finding alternative treatments with fewer side effects. supercritical fluid extraction (sfe) is considered an attractive extraction method when compared to conventional techniques such as steam distillation or soxhlet extraction because it avoids solute contamination with solvent residues and the degradation of thermolabile compounds. in this sense, sfe with co2 is in increasing demand to produce high-quality essential oils from plant material with medicinal properties. during our on-going screening program, designed to identify natural compounds with anti-inflammatory potential, we have studied thyme oils from three different species (thymus vulgaris, thymus zygis, and thymus hyemalis). to determinate whether thyme oils could have immunomodulation properties and could mediate in inflammatory cytokines regulation, we study the effect of our extracts on ox-ldl-activated thp-1 macrophages, measuring the expression and release of several inflammatory mediators. co2 sfe oil fractions composition from three different species of thyme (thymus vulgaris, thymus zygis, and thymus hiemalys) were determined by gc-ms (see table 1). the cytotoxicity effect on thp-1 macrophages of s1 and s2 co2 supercritical fluid extracts from thyme leaves was evaluated before the bioactivity study. mtt assay was performed for periods of 24 of incubation (figure 2). after 24 hours of incubation neither extracts reduced significantly cell viability for concentrations from 5 to 25 g/ml. to activate the thp-1 macrophage, cu-oxidized ldls (ox-ldl) these ox-ldl-treated cells showed an increase in total protein secreted (data not shown). treatment of activated cells with thyme fractions results in an overall reduction of proinflammatory cytokines release, tnf, il-1, and il-6 (figures 3 and 4), in a dose-dependent manner. to test anti-inflammatory effects of oil extracts, one group was treated with a small amount of diclofenac (5 g/ml). extracts in general show a better anti-inflammatory effect than diclofenac at this small concentration, diminishing more the proinflammatory cytokines (tnf- and il-1) than diclofenac did and inducing anti-inflammatory release of il-10 that was not observed with diclofenac. after 24 hours of incubation, activated cells treated with any of the thyme fractions showed a very significant decrease in tnf- release when compared with nontreated cells. both fractions of thymus zygis and thymus vulgaris had similar effects on tnf- secretion. for fraction concentrations of 15 g/ml and higher, the reduction of tnf- was such that these cytokine levels were much lower than the nonactivated basal levels. for thymus hyemalis, tnf- secretion was lower than the nonactivated controls for fraction concentrations of 25 g/ml. despite the large reduction of tnf- secretion at 24 hours treatments, treatment with fractions of thymus zygis and thymus vulgaris for 48 hours showed a lesser reduction of tnf-. for these fractions, only concentrations of 25 g/ml induced a very significant reduction of tnf- levels, equal to nonactivated basal levels. at 48 hours, thymus hyemalis induced larger tnf- release inhibition, with all fractions concentration showing a decrease under the nonactivated basal levels. regarding il-1 release at 24 hours, treatment of activated cells with any of the thyme fractions induced a decrease of this cytokine secretion in a dose-dependent manner (figure 3(b)). both fractions of thymus zygis or thymus vulgaris induced similar reduction of il-1. 24-hour treatment with 15 g/ml of these fractions reduced il-1 secretion significantly to the nonactivated cells basal secretion. after 48-hour incubation with these thyme fractions, il-1 concentration in the medium was the same as the basal secretions of nonactivated cells. regarding thymus hyemalis, at 24-hour treatments, both fractions of this species induced similar cell responses. there is a decrease in il-1 secretion with the increase of fraction concentration, although this il-1 decrease is only significant till 25 g/ml incubations. after 48 hours, incubations with these two fractions reduced il-1 secretion to nonactivated basal levels in the same manner as thymus zygis and thymus vulgaris did. il-6 secretion was reduced significantly when activated cells were incubated with any of the fractions of either thymus zygis or thymus vulgaris at a concentration of 15 g/ml or higher. this reduction on il-6 secretion was dose dependent and was verified on both 24 and 48 hours of incubations. incubations with 25 g/ml of these extracts reduced il-6 secretion to nonactivated cells basal levels. 48-hour treatment with thymus hyemalis, induced the same decrease as thymus zygis and thymus vulgaris, whereas at 24 hours, there was no significant reduction of il-secretion at the concentrations used. 24-hour treatment with any of the fractions induced an increase on il-10 secretion in a dose-dependent manner; higher fraction concentration induced higher il-10 secretion. thymus zygis and thymus vulgaris increased significantly il-10 secretion of activated cells, with both fractions and at any of the concentrations used. as for thymus hyemalis, the increase in il-10 secretion was lower and only significant when the fractions were 15 g/ml or higher concentrations. 48-hour treatments with higher concentrations of the fractions induced an increase on il-10 secretion; the rest concentrations did not induce significant increases. in all experiments, thymus hyemalis had shown to be less effective than thymus vulgaris and thymus zygis, either in increasing or reducing cytokine release. a dose-dependent effect was observable in treatments with 24 and 48 hours of incubation. changes on production were dose dependentent and according to the thymol content of each species (table 1). relative quantification (rq) determinates the change in expression of a nucleic acid sequence relative to a control. endogenous control represented in this figures was 18s rrna; similar results were showed using gapdh (data not shown). similar to the observed cytokine release, gene expression of analyzed cytokines, but not il-10, increased in oxldl-activated cells compared with nonactivated cells in treatments during 24 hours. 48-hour treatments caused an increase only in tnf expression on oxldl-activated cells compared with nonactivated cells. tnf gene expression decreases only in cells treated with thymus zygis s1 at 24 hours of incubation; other treatments did not change expression of this gene with respect to oxldl-activated cells. similar to 24 hours of incubation, at 48 hours tnf- gene expression did not change with extract treatments; only thymus hyemalis s2 caused significant reduction of this cytokine gene expression. expression of il-1 decreased in cells treated with all thyme extracts with respect to activated cells at 24 hours of incubation. at 48 hours of incubation, all treatments, except thymus hyemalis s2, caused reduction in gene expression. for thymus zygis s2, thymus vulgaris s1, and s2 and thymus hyemalis s1, expression of il-1 was lower than the nonactivated controls cells. il-6 gene expression at 24-hour treatment with any of thyme extracts was reduced until level of nonactivated control cells which expression was decreased to half compared to activated cells. in contrast, at 48-hour treatment, expression was reduced using only thymus zygis s1 and s2 and thymus vulgaris s2 extracts with respect to activated cells. il-10 expression gene increased twice with all thyme extracts at 24 hours of treatment compared with oxldl-activated cells. at 48 hours, gene expression in cells treated with thymus zygis s1 and s2 and thymus vulgaris s1 extracts increased significantly, but thymus vulgaris s2 and thymus hyemalis did not change expression of il-10 compared to oxldl-activated cells. cytokines are considered to be key players in the inflammatory response involved in atherosclerosis and other chronic inflammatory-based diseases (cibds). among these, interleukin (il)-1, il-6, il-10, and tumor necrosis factor- (tnf-) are expressed in atherosclerotic lesions by endothelium cells, macrophages, and smooth muscle cells [29, 30]. some of them are involved in proatherogenic processes, such as upregulation of adhesion molecules on the endothelial cells, while others were proved to have an antiatherogenic role like attenuating the differentiation of monocytes in macrophages. the imbalanced expression of cytokines has been implicated in the progression of many diseases including cibds. cytokines exhibit both beneficial and pathologic effects on their target cells and are produced by many cell types. several natural compounds are known for their beneficial properties to some diseases or their derived complications and particularly concerning anti-inflammatory effects. in our experiments, were observed significant cellular responses elicited by the treatment of thp-1 cells with thyme fractions. the action of thyme fractions appears to involve the expression of the proinflammatory cytokine: tnf-, il-6, and il-1 and the anti-inflammatory cytokine il-10. the most interesting observation made during these studies was that treatment of oxldl-activated thp-1 cells with thyme oils had different effects on proinflammatory and anti-inflammatory expression: tnf-, il-6, and il-1 expressions were inhibited while il-10 expression was enhanced. proinflammatory cytokines levels decreased in a dose-dependent manner with any thyme fraction from thymus vulgaris, thymus zygis, or thymus hyemalis used (after 24 or 48 h of incubation). these results were in agreement with the ones regarding the expression of cytokines genes at 24 hours of incubation. other authors have previously reported an increment in cytokine secretion in activated macrophages treated with ox-ldl [3, 33]. similar results have been described for essential oils extracted from cinnamomum osmophloeum, a herb traditionally used in asia as food and as a medicine, which contains cinnamaldehyde. murine macrophages were treated with essential oils from this plant; anti-inflammatory effects by decreasing tnf-, il-6, and il-1 secretions were reported. main compounds present in supercritical thyme extract were thymol, 1,8 cineole, camphor, borneol, and carvacrol. anti-inflammatory effect of thymol has been reported on human neutrophiles incubated with 10 or 20 g/ml of this compound. mice edema has been reported to be reduced with a topical application of 100 g/cm of carvacrol. moreover, antioxidant properties of thymol and carvacrol have been demonstrated in several studies, suggesting their use as nutraceutical ingredients in the development of novel functional foods. derivatives of thymol and carvacrol have been described as antioxidant according to the dpph radical scavenging method [3537]. essential oils of thyme and their components carvacrol and thymol inhibited 3-nitrotyrosine formation, biomarker of the oxidative stress, supporting the nutraceutical value of thyme and the potential of thymol and carvacrol in preventing the formation of toxic products by the action of reactive nitrogen species. also, thymol and carvacrol prevent autoxidation of lipids. in the same way, the inhibitory activity of 1,8-cineol (eucalyptol) on cytokine production in cultured human lymphocytes and monocytes has been described: particularly, in monocytes, inhibition of tnf-, il-1, il-6, and il-8 was 99, 84, 76, and 65%, respectively, when monocytes were treated with 0.15 g/ml of 1,8-cineol. borneol, one of the major compounds present in essential oils from sage, has been described as anti-inflammatory since its dietary supplementation significantly decreases the concentration of the proinflammatory cytokines il-1 and il-6 in mice. results observed in this work suggest that supercritical thyme s1 and s2 fraction oils from thymus vulgaris, thymus zygis, and thymus hyemalis may act as effective inhibitors of oxldl-induced proinflammatory cytokines (tnf-, il-1, and il-6) secretion, and also as enhancers of the anti-inflammatory cytokine il-10 secretion, in macrophage thp-1 cells. in summary, co2 supercritical thyme extracts showed anti-inflammatory properties by (a) reducing the release of proinflammatory cytokines, and (b) increasing the anti-inflammatory secretion in activated macrophages. these results may suggest that essential oils from thyme extracts could be used as novel options for treatment of chronic diseases based on inflammatory processes. however, numerous and in-depth studies should be carried out for this purpose. dried and cryogenic grinded leaves from three varieties of thymes (thymus hyemalis, thymus zygis, and thymus vulgaris) were subjected to supercritical fluid extraction with co2. the supercritical extractions were carried out in a pilot-plant-scale supercritical fluid extractor (thar technology, pittsburgh, pa, usa, model sf2000) of 2 l capacity using pure supercritical co2 at a pressure of 300 bar and a temperature of 40c. extracts from the three thyme species were fractionated using a two-cascade depressurized system and samples were collected in each of the two (separators 1 and 2) separators. fractionation conditions were as follows: separator 1 was kept at constant pressure and temperature of 15 mpa and 40c, respectively, whereas separator 2 was maintained at a pressure of 2 mpa and a temperature of 40c. composition of the supercritical thyme extracts was carried out by a gc-2010 (shimadzu, japan), equipped with a split/splitless injector, electronic pressure control, aoc-20i autoinjector, gcms-qp2010 plus mass spectrometer detector, and a gcms solution software. the column used was a zb-5 (zebron) capillary column, 30 m 0.32 mm i.d, and 0.25 m phase thickness. helium, 99.996%, was used as a carrier gas at a flow of 1 ml/min. oven temperature programming was 60c isothermal for 4 min, increased to 64c at 1c/min, and then increased to 106c at 2.5c/min. oven temperature was then increased from 106c to 130c at 1c/min, then to 200c at 5c/min, and then to a final temperature of 250c/min at 8c/min which was kept constant for 10 min. sample injections (1 l) were performed in split mode (1: 20). injector temperature was of 250c and ms ion source and interface temperatures were 230 and 280c, respectively. the mass spectrometer was used in tic mode, and samples were scanned from 40 to 500 m/z units. compounds thymol, carvacrol, borneol, and linalool were identified by comparison with standard mass spectra obtained in the same conditions and compared with the mass spectra from library wiley 229. rests of the compounds were identified by comparison with the mass spectra from wiley 229 library and by their linear retention index. the chromatographic method was to be based on the previously described by jordn et al.. human thp-1 monocyte cell lines (american type culture collection, atcc) were maintained in suspension in rpmi 1640 culture medium (atcc) supplemented with 10% fbs (gibco), 100 u/ml penicillin (gibco), 100 mg/ml streptomycin (gibco), 0.05 mm -mercaptoethanol (sigma-aldrich), and 2 mm l-glutamine (gibco), at a density of 39 10 cells/ml at 37c in 5% air 95% co2. cells were pelleted via centrifugation and assessed for viability using the trypan-blue exclusion method. viable cells were plated at a density of 5 10 cells/ml in 24 wells plates (100 l and 1 ml, resp.) and incubated with phorbol 12-myristate, 13-acetate (pma) 100 ng/ml (sigma-aldrich) for 48 h in fbs-free medium. afterwards oil extracts toxicity was assessed using the mitochondrial-respiration-dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (mtt) reduction method. thp-1 cells were plated in 96-well plates, differentiated and incubated with different concentrations of extract for 24 and 48 hours at 37c in 5% co2. after treatment, the cells were washed with pbs and incubated with mtt 1 mg/ml in pbs for 2 hours at 37c in 5% co2. afterwards, formazan crystals produced from mtt by the mitochondrial hydrolase of the viable cells were solubilized in lysis buffer (10% sds in 50% dimetilformamida ph=7). the absorbance of each well was then read at 540 nm using a microplate reader (sunrise remote, tecan). the optical density of formazan formed in control cells (without treatment with extract) was taken as 100% viability. oil thyme extracts were dissolved in dimethyl sulfoxide (dmso; sigma-aldrich) to stock concentration of 10 mg/ml determined as the maximum doses not cytotoxic by the cell viability assays. after differentiation, the cells were washed with pbs and treated with or without cu oxidized ldls to activated or not activated them. then, cells were incubated with the corresponding thyme extract diluted in fbs-free medium, for 24 or 48 hours at 37c in 5% co2. afterwards, the supernatant was frozen and rna isolated. supernatants were centrifuged at 12,000 rpm to remove debris and then stored at 80c until cytokine analysis. il-10, il-1, il-6, and tnf- were quantified using elisa kits from bd biosciences, according to the manufacturer's instructions. 100 l of 1: 10 diluted medium was added to anticytokine antibody-coated polystyrene wells and incubated for 2 h. after washing, the plates were incubated with biotin-labeled secondary antibody for 1 hour. the plates were washed and incubated for 30 min in the dark with substrate solution. stop solution was added and the absorbance read at 450 nm with correction at 570 nm using a microplate reader (sunrise remote, tecan austria gmbh, grdig, austria). 5 10 cells were homogenized in 200 l of trizol reagent and, if necessary, stored at 80c. following homogenization, samples were left to rest at room temperature for 5 minutes. after 40 l of chloroform was added, the tubes were vigorously shaken for 15 seconds and let rest at room temperature for 5 minutes. tubes were then centrifuged at 12000 g, 4c for 15 minutes. the aqueous (upper and colorless) phase was transferred to a new tube. 100 l of isopropyl alcohol was added to the aqueous phase; the tube was then gently mixed and incubated at room temperature for 10 minutes. after incubation, samples were centrifuged at 12000 g, 4c for 10 minutes. the pellet was washed with 200 ml of 75% ethanol in depc-treated h2o and centrifuged at 7600, 4c for 5 min. total rna was then dissolved in 15 l of depc h2o, incubated at 55c for 10 minutes, and stored at 80c for future use. total rna isolated from thp-1 cells was quantification of il-1, il-6, il-10, tnf-, 18srna, and gapdh gene expression using real-time pcr. 10 ng/l total rna was used as template for cdna synthesis using the high-capacity archive kit from applied biosystems, according to the manufacturer's instructions. real-time pcr was performed using taqman probes (applied biosystems) following the manufacturer's recommendations in an ab7900 ht fast real-time pcr system (applied biosystems). the taqman probes used were hs99999029_m1 for il-1, hs00174131_m1 for il-6, hs999999035_m1 for il-10, hs00174128_m1 for tnf-, hs99999901_s1 for 18s rrna, and hs99999905_m1 for gapdh. gene expression quantification was determined using delta-delta ct method with correction for values of amplification efficiency and normalized to 18s rrna expression. for single variable comparisons, student's t-test was used. for multiple variable comparisons, data were analyzed by one-way analysis of variance (anova) followed by dunnett's multiple comparison test and bonferroni test when necessary using the graphpad prism statistical software (graphpad software inc.

properties of thyme extracts from three different species (thymus vulgaris, thymus zygis, and thymus hyemalis) were examined. two oil fractions from each species were obtained by co2 supercritical fluid extraction. main compounds presented in the supercritical extracts of the three thyme varieties were 1,8 cineole, thymol, camphor, borneol, and carvacrol. as a cellular model of inflammation/atherogenesis, we use human macrophages derived from thp-1 monocytes and activated by oxidized ldls. these cells were incubated with the thyme fraction oils, and the productions and gene expressions of the inflammatory mediators tnf-, il-1b, il-6, and il-10 were determined. thyme extracts significantly reduced production and gene expression of the proinflammatory mediators tnf-, il-1b, and il-6 and highly increased these parameters on the anti-inflammatory il-10 cytokine. changes on production and gene expressions were dose dependent and according to the thyme content of each species. taken together, these results may suggest that thyme extracts could have anti-inflammatory effects.

PMC3345235

pubmed-507

an early cross-sectional study of mild hypertension reported that the predominant hemodynamic feature was a high cardiac output and this observation has been confirmed consistently since. although not invariably so, the high cardiac output is accompanied by an increased heart rate and several studies have demonstrated that when oxygen consumption is measured, both cardiac output and this parameter are raised. in the mild early stages of essential hypertension the peripheral resistance is low although the crucial point is that it remains appropriately high for the corresponding cardiac output. a 20-year longitudinal study of the haemodynamics of essential hypertension, confirmed the finding of initially increased cardiac index heart rate oxygen consumption and blood pressure with normal peripheral resistance. however, over this period the high cardiac index and normal total peripheral resistance pattern changes to a low cardiac index high resistance pattern. again, the inappropriately high level of vascular resistance for the increase in cardiac output is a hallmark of early hypertension. such a haemodynamic profile could be ascribed to a high sympathetic nervous tone with the resulting increased drive to the heart, peripheral circulation and metabolic receptors, which would then promote enhanced oxygen consumption. other studies demonstrated that autonomic blockade of the heart in mild hypertensive patients restored cardiac output to normal and there was a combination of increased sympathetic tone and decreased parasympathetic activity in such individuals [4, 5]. this combination of increased sympathetic discharge coupled to a reduced parasympathetic activity suggests that the abnormality in essential hypertension is one of integrated function in the medulla oblongata. recent data have proposed that this might be a consequence of neurovascular compression on the left ventrolateral medulla. therefore it should follow that the resulting increased sympathetic activity would be distributed to all innervated organs and vascular beds producing uniform vasoconstriction and the predicted cardiac indices. there is evidence for this in the heart, kidney and skeletal muscle but it has not been confirmed in studies of the hepatomesenteric circulation. in other words, it is difficult to provide evidence for a ubiquitous abnormality of sympathetic function in all vascular beds although the overall integrated haemodynamic profile can be ascribed to increased sympathetic discharge. since the work of bright and johnson it has been recognized that the walls of medium-sized arteries are thickened in hypertension. however, it has to be conceded that their contribution to vascular resistance is small. the histopathological change appears to be hypertrophy, and indeed the heart and medium-sized blood vessels demonstrate this hypertrophic response to blood pressure. in addition, until the heart dilates it is of interest to note that the hypertrophic response takes place at the expense of the ventricular cavity: in other words there is inward encroachment on the chamber space. therefore in any form of sustained hypertension there is an alteration in the architecture of the circulation that inevitably occurs in consequence. at the level of the resistance artery where the internal diameter of the blood vessels is around 250 m or less, there is evidence of a reduced lumen diameter and increased media thickness: lumen diameter ratio. this was originally reported in necropsy specimens and subsequently confirmed in segments of artery mounted as isometric ring preparations on wires and in vessels perfused in vitro. detailed histological analyses more recently carried out have suggested that eutrophic inward remodelling occurs at this point in the circulation (fig. it is meant that there is a narrowing of the vascular lumen without having to invoke a growth response of the arterial wal1. a small amount of hypertrophy may be observed in some pathological states where hypertrophy may supervene and is an adverse prognostic sign. a cartoon representation of small arteries in transfer section. the number of smooth muscle cells in both arteries is the same as is their size indicating that there is no hypertrophy but the cells have re-orientated themselves and as a result produced an increased number of smooth cell layers and decreased the external and internal diameters of the vessel. the most compelling issue is whether structural changes in these small blood vessels occur before blood pressure rises or in consequence of the hypertension? the corollary of what has been described above, namely the existence of excessive sympathetic nervous activity in the early stages of the development of hypertension being the trigger for the majority of this disorder then it is tempting to regard the small artery as changing shape in consequence. in a study of small artery structural characteristics in first degree offspring of hypertensive patients, in whom one would predict an increasing propensity to developing hypertension, there was no evidence of any alteration despite mean blood pressures being higher. also, in another study in young genetically hypertension-prone spontaneously hypertensive rats (shr), where non-constricting ligatures were placed on the iliac artery and the animals allowed to mature until a point when the ligature compressed gradually on the vessel, the pressures in the hind limb were kept low and structural changes were not observed. however, most recently it has been reported that mice mutant for emilin 1, a cysteine-rich secreted glycoprotein expressed in the vascular tree, display hypertension, increased peripheral vascular resistance and reduced blood vessel size. emilin 1 inhibits tfg- signalling by binding specifically to protgf- precursor and prevents its maturation by furin convertases in the extracellular space. therefore in this model the other important issue to consider at this time is whether structural alterations amplify vasoconstrictor responses? korner and angus developed a theory with respect to the role of an increased wall: lumen ratio in the resistance vasculature, which maintains the elevated peripheral resistance in hypertension. this is based on calculating resistance from pressure and flow recordings and consequently calculating an arbitrary radius from the fourth route of 1/r (poiseuille s law). the calculations indicate a constant narrowing in vessel radius from maximal dilatation to maximal constriction in hypertension, which acts to amplify changes in resistance. a number of studies has consistently reported structural changes predicted and described above in small arteries with an internal diameter between 200 and 300 m from patients with essential hypertension and in various animal models with the disease. however, direct supporting evidence needs the measurement of the lumen diameter of blood vessels demonstrated to contribute to the control of resistance in a vascular bed but under extremely rigorous conditions. in this context particular emphasis this has been carried out using studies of functional and structural characteristics of small mesenteric arteries cannulated and pressurized in vitro. such arteries have spontaneous myogenic tone at physiological pressures, which is a major determinant of diameter in the resistance vasculature unlike the upstream mesenteric arteries frequently studied in hypertension research. distal mesenteric arteries were pressurized to 63% of the mean aortic pressure of each rat. it is the pressure recorded at this level of the mesenteric/intestinal vasculature in both rat strains indicating a location within the resistance vasculature. in the absence of tone, however, with spontaneous myogenic tone, lumen diameter became identical in the two strains, and importantly remains identical as tone was increased throughout the complete noradrenaline concentration response curve. such data do not support the hypothesis of an increased wall lumen ratio acting as an amplifier in hypertension. studies in isolated segments of small artery or in isolated intact vascular beds can provide clear insights into basic mechanisms, which can only be considered as hypothesis generating regarding the relevance of a particular mechanism. surprisingly few studies have actually been carried out to date in intact conscious animals and overall the results are not consistent with an amplifier hypothesis. in a recent study, blood pressure and total peripheral resistance responses to infusion of the agonist phenylephrine at two rates at the development phase of hypertension in shr aged 826 weeks was compared with aged matched wistar kyoto rats before and after ganglionic blockade. at 16 weeks of age more complete dose total peripheral resistance responses to phenylephrine were significantly less in shr versus wky rats at all ages in the study. the higher infusion rate increased mean arterial pressure by approximately 80 mmhg and nearly doubled the tpr. in contrast, blood pressure and tpr responses to methoxamine were enhanced in shr in low rates of infusion but did not differ at the higher rates. assuming that methoxamine is the most specific agonist, these results are suggestive for functional rather than structural changes being contributory to the hyper-responsiveness to modest receptor stimulation. from a pathophysiological perspective, changes in tpr in response to low/modest stimulation appear to be a relevant parameter of tpr reactivity. more marked stimulation leading to 5- or 6-fold increases in tpr may lead to increased responsiveness but these are unlikely to be relevant for the maintenance or development of most hypertension. in other words, in vivo studies do not actually support the hypothesis that structural changes amplify vasoconstrictor responses throughout the circulation. to understand how hypertension produces non-hypertrophic changes in small arteries, one must look at the physiological role of the resistance vasculature. at normal pressures, these vessels exhibit a level of contraction (myogenic tone), which is independent of neurohormonal influences and in functioning in this way the response enables arteries to constrict or dilate in response to changes in upstream pressure. this process known as the myogenic response is only observed in smaller resistance arteries, which mediate autoregulation of blood flow and stabilize capillary pressure. this ensures that target organs downstream are supplied with oxygenated blood at a constant flow and pressure. hypertrophy is observed in vessels which do not possess myogenic tone whereas in smaller resistance arteries, initial increase in pressure will bring about an increased myogenic constriction. if an individual has untreated hypertension then there will be prolonged myogenic constriction as the resistance vasculature endeavours to protect the target organs downstream from pressure-induced damage brought about by an increase in blood flow. the structural difference between large conduit and medium-sized arteries and downstream resistance vessels is apparent in many models of hypertension: for example, in a hypertensive model brought on by chronic nitric oxide synthase inhibition. in addition, the magnitude and duration of an increase in intraluminal pressure plays a role in determining the remodelling response. eutrophic inward remodelling is a process of structural adaptation observed in most forms of hypertension including the onset of hypertension and milder hypertensive states. however, a few animal models of hypertension, such as a model developing hypertension independent of the renin angiotensin system (bph-2 mice), demonstrate hypertrophy as the predominating structural change. inward eutrophic remodelling is a relatively fast functional adaptation observed after prolonged vasoconstriction and is thought to be an energetically favoured mechanism to preserve a lumen diameter for long periods. the process is also the preferred physiological mechanism by which wall stress can be normalized while maintaining vasomotor tone. studies of the well-characterized tgr (mren2) 27 rat which develops fulminant hypertension from 4 weeks of age have demonstrated that eutrophic inward remodelling occurs from 4 weeks and is dependent on the integrin av3, a multifunctional extracellular matrix receptor. the extracellular matrix of resistance arteries is subject to tensile force exerted by blood pressure, which is transferred through integrins across the cell membrane and linked by molecular complexes to the cytoskeleton. using peptides and specific antibodies, it has been shown that integrins v3 and 51 indirectly regulate the myogenic response by influencing the control of calcium flow through ion channels; 51 is responsible for the initial calcium influx required to establish vascular tone and v3 mediates force maintenance by calcium sensitization of contractile components. these integrins can form complexes, which regulate cytoskeletal dynamics and maintain a vascular myogenic force at a given pressure (fig. cytoskeletal proteins such as heat-shock protein 27 activated by rhoa kinases have been shown to regulate myogenic tone. it is now clear that rhoa signalling plays a central role in both calcium sensitization and regulation of actin dynamics in small artery remodelling. these figures show a percentage control diameter of isolated arterioles exposed to step increments and intraluminal pressure before and after abluminal treatment with a control antibody anti-rat major histocompatibility complex. anti-5-integrin function blocking antibody or an anti-1-integrin function-blocking antibody, or anti-3-integrin function-blocking antibody. in both cases one can see the amelioration of the myogenic response in consequence implicating these two integrins in the control of myogenic tone (data taken from). in contrast to molecular signalling mechanisms behind the vascular myogenic response relatively few data are available on the role of integrins and the underlying biochemical pathways of the next stage of vascular adaptation for hypertension. remodelling involves a migratory process following prolonged vasoconstriction whereby existing vascular smooth cells reposition themselves in the vascular wall and thereby produce a narrow lumen. a characteristic of migrating cells in vitro is the presence of lamealae podial and filopodial protrusions containing focal adhesion kinase which provide a substrate for other cytosolic proteins such as src and interact with actin-associated cytoplasmic components. recently it has been shown that the migration of vascular smooth muscle cells of arteries in vivo is more subtle and limited to elongation of tape in smooth muscle cells and an increase in cellular overlap. it is thought that cytoskeletal re-arrangements in subsequent force generation play a central role in these changes. integrin v3 is necessary for the pressure-induced inward remodelling process but the rest of the biochemical sensing mechanism is still uncertain. if the physiological response to a raised blood pressure in small arteries is eutrophic inward remodelling then the integrity of the circulation appears to be preserved until this breaks down. as indicated above in the tgr (mren27) rat there is evidence of the development of vascular wall hypertrophy in small arteries from week 6 onwards. this rat model of hypertension develops a severe form of the disorder and indeed dams are unable to breed if they do not receive antihypertensive medication. therefore against this background it would appear that the breakdown of autoregulation (at the myogenic tone) is associated with the vascular wall developing a growth response (hypertrophy) in an attempt to offset the increased wall stress. recent work on the small blood vessels of patients with type 2 (maturity onset) diabetes mellitus has demonstrated that there is vascular wall hypertrophy. these patients were selected as already having evidence of downstream target organ damage because they demonstrated microproteinuria and their myogenic tone was disordered. in other words, the onset of hypertrophy is a consequence of disruption of normal myogenic tone and the delivery of blood at a higher perfusion pressure causing cellular damage. in the kidney, this would inevitably lead to a loss of filtration capability and protein leak. in terms of cardiovascular risk, recent data from italy have demonstrated that there is an increased risk of development of cardiovascular events in patients whose small arteries demonstrate hypertrophy rather than eutrophic inward remodelling (figs 3 and 4). it has been demonstrated that the myogenic response of the middle cerebral artery from pre-stroke spontaneously hypertensive stroke-prone rat (shrsp) are impaired compared with the shr. this observation would explain the deranged cerebral autoregulation that has been observed in the shrsp before stroke occurs. also this is associated with a re-distribution of collagen throughout the blood vessel wall. other studies have demonstrated that the myogenic component of renal autoregulation is impaired in the fawn hooded rat (the tubuloglomerular feedback component of renin autoregulation is unchanged) compared with controls thereby causing glomerular hypertension and hyperfiltration, which explains why the kidneys are susceptible to the deleterious effects of moderate hypertension. furthermore, the brown norway rat is normotensive but has a greater than normal life expectancy. however, when hypertension is induced, these animals have a high incidence of cerebral haemorrhage and mortality compared with the long evans rat. also the brown norway rat is very sensitive to hypertension-induced renal injury and recently the myogenic component of renal autoregulation has been found to be abnormal in normotensive brown norway rats. therefore it seems reasonable to speculate that the cerebral vessels from the brown norway animals exhibit weaker myogenic responses compared with cerebral vessels from wistar rats, which would explain the susceptibility of the brown norway rat to hypertension-induced cerebral haemorrhage. inhibition of the renin angiotensin system markedly delays the development of cerebral haemorrhage and mortality in salt-loaded shrsp [25, 26]. in the fawn hooded rat early angiotensin-converting enzyme (ace) inhibition prevents renal damage and this protection is associated with a normalization of glomerular pressure. the protective effect of ace inhibition in the kidney has been presumed to be a consequence of an inhibition of angiotensin ii induced efferent arteriolar myogenic tone. of course it could be argued that the effects of blood pressure lowering would be important on stroke development and, in consequence, ace inhibition is working by its antihypertensive effects. however, dexamethasone or thyroxine increased blood pressure in the shrsp to a greater extent than salt loading but stroke does not occur. also, the anti-stroke effect of captopril on salt-loaded shrsp which occurs without an antihypertensive effect is unchanged when blood pressure is increased with dexamethasone. therefore it seems that the renin angiotensin system inhibition improves myogenic responses and survival in salt-loaded shrsp largely independent of changes in blood pressure although this remains to be confirmed. individuals with a medial lumen ration greater than the medium of 9.8% show a larger number of cardiovascular events compared with those with smaller wall thickening v (data from). a further analysis of the data from reference 17 indicating that those individuals with marked vascular hypertrophy rather than eutrophic inward remodelling have an increased number of cardiovascular events (data taken from). there is little evidence to suggest that hypertension is associated with abnormalities of contractile function. both in vitro and in vivo studies have suggested that contraction is normal although there is controversy about whether the structural alterations in the vascular wall lead to exaggerated constriction and vascular amplification (see above). this has been the subject of intense debate over a number of years although some work in intact animals really seems to suggest that vascular amplification seen in isolated vascular beds is not something which is observed when the whole of the circulation is integrated and examined. the problem with interpreting studies which have been published is that many other risk factors are often abnormal and accompany hypertension. for example, there is often associated dyslipidaemia and there is clear evidence that oxidized low-density lipoprotein (ldl) can reduce the bioavailability of nitric oxide and as a result of this there is evidence of abnormal endothelium dependent dilator function which has been reported in patients with high blood pressure and dyslipidaemia, patients with dyslipidaemia and coronary artery disease or the subcutaneous vasculature of patients with hypercholesterolaemia. in addition endothelial function is recognized to decline as individuals age and therefore it is obviously complex to dissect out whether endothelial function is abnormal as a result of hypertension per se or as a result of other demographic abnormalities and the cohorts being examined. the overall impression that one is left with is that it is the level of oxidized ldl that is important in the bloodstream of individuals with hypertension and that blood pressure per se is not responsible for endothelial dysfunction. with regard to improvement in endothelial function the use of statins has been demonstrated to restore endothelial integrity to near normal as soon as the cholesterol levels are improved. there is also evidence that the use of ace inhibitors or angiotensin receptor blockers can also ameliorate abnormal endothelial function. this is because hypercholesterolaemia is associated with an increased expression of a type 1 angiotensin receptor (atl) and that the binding of angiotensin ii to the atl receptor is associated with an increase in oxidative stress and a reduced bioavailability of nitric oxide. animal experiments have demonstrated that the use of angiotensin receptor blockers independent of their antihypertensive effect can be associated with an improvement in endothelial function and a reduction in plaque load throughout the vasculature. of course, longitudinal experiments in human beings are awaited but it is clear that endothelial function can be improved with the use of angiotensin receptor antagonists and ace inhibitors and recent studies have demonstrated in human beings that the combination of an angiotensin receptor blocker and a statin is an extremely powerful one for improving endothelial function. the molecular basis of the physiological remodelling response to hypertension is slowly being understood. the replacement of eutrophic inward remodelling by a pathological change such as hypertrophy appears to herald the development of an increased risk of circulatory disease. future research should look at why this occurs and whether effective antihypertensive medication can reverse this and improve outcome for individual patients. the obvious attraction is that the identification of the, at risk patient will mean that scarce healthcare resource can be targeted at such individuals with maximum benefit in terms of circulatory protection. the challenge ahead is to identify those that are going to develop hypertrophic remodelling against a background of sustained high blood pressure and more indirect measurements of structural changes in blood vessels are urgently required. the authors state that there is no conflict of interest with the view state in this paper.

abstractit has been known for some considerable time that sustained hypertension changes the circulatory architecture both in the heart and blood vessels. the histopathological alterations are of considerable interest because once they have developed they appear to carry an adverse prognostic risk. in the heart it is apparent that there is hypertrophy. this extends also to the large- and medium-sized blood vessels but at the level of the smaller arteries that contribute to vascular resistance, this is not the case: it is clear that the physiological response to higher pressures is a change in the positional conformation of the pre-existing tissue constituents and as a result of this the lumen is narrowed. this brief review looks at our knowledge in this area and attempts to clarify our understanding of how hypertension brings these about and what happens when these homeostatic mechanisms break down. from a therapeutic perspective it appears imperative to control blood pressure in an attempt to reverse or prevent such alterations to cardiovascular structure. our knowledge is fast expanding in this field and it is only to be anticipated that as detection methodology improves everyday practice will alter as we profile our patients in terms of structural alterations in the ventricle and blood vessels.

PMC3822738

pubmed-508

annexin a2 (a2) belongs to the annexin family of ca-regulated phospholipid binding proteins, which are expressed in plants, animals, and protists throughout the phylogenetic tree. a2 is a 36-kilodalton protein produced by endothelial cells, monocytes, macrophages, trophoblast cells, and some tumor cells and exists both free in the cytoplasm and in association with intracellular and plasma membrane surfaces [2, 3]. the human anxa2 gene consists of 13 exons distributed over 40 kb of genomic dna on chromosome 15 (15q21). among mammalian species for which a2 has been sequenced, identity is approximately 98% at the amino acid level. when a2 is membrane associated, the tightly packed, alpha-helical 33-kda core domain forms a disk whose convex face is associated with membrane phospholipid and whose concave face is oriented away from the membrane. membrane binding is mediated by at least two potential ca-binding annexin repeats, features common to all annexin family proteins. while the core domains of the annexin proteins are relatively well conserved, the hydrophilic amino-terminal tail or interaction domains are highly variable and essentially unique to each family member. protein s100a10, also known as p11, is a well-described binding partner of a2 [7, 8]. as a member of the s100 family of proteins, p11 contains ca-binding helix-loop-helix motifs and confers increased phospholipid binding affinity on a2. typical s100 proteins undergo a conformational change upon ca-binding that places helix iii (hiii) in a perpendicular orientation relative to helix iv(hiv), thus forming a cleft that can accept associated target proteins. this calcium activation rule, however, does not apply to p11, which has permanently assumed a calcium-on state, due to replacement of the bidentate e by s, and the monodentate d with c. the published crystal structure of p11 in complex with the n-terminal 13 amino acids of a2 suggests that the basic unit of p11 structure is a noncovalently linked homodimer, each component of which can bind the a2 tail peptide to form a heterotetramer. upon binding, the a2 tail peptide assumes an -helical conformation that presents key hydrophobic residues (v, i, l, and l) within a cleft formed by loop l2 and helix hiv of one monomer and helix hi of the other. the c-terminal region of p11, particularly its hydrophobic residues within the c-terminal extension (yfvvhm), such as y and f, contributes critical contact points for binding to a2. the primary fibrinolytic protease, plasmin, is formed upon cleavage of plasminogen at a single peptide bond at position r-v by either of two serine proteases, tissue plasminogen activator (tpa), produced by vascular endothelial cells, or urokinase (upa) [1113]. tpa-dependent plasminogen activation is dramatically accelerated in the presence of fibrin, and to a lesser extent by cell surface fibrinolytic receptors. upar is expressed by monocyte/macrophages, tumor cells, and activated endothelial cells [14, 15], while the (a2p11)2 complex is expressed on both resting and activated endothelial cells [16, 17]. in addition, an interesting array of plasminogen-binding receptors, including -enolase, tata-box protein interacting protein (tip49), histone h2b, m2 integrin, amphoterin, and plg-rkt, have been identified on many cell types. on cell surfaces, the (a2p11)2 complex serves as an assembly site for plasminogen and tpa [16, 17, 25, 26]. although it is clear that heterotetramer-mediated colocalization of activator and substrate accelerates plasmin generation, there are, interestingly, two main theories as to the exact site of interaction of plasminogen and tpa with components of the heterotetramer complex. while one group suggests p11 as the key ligand interaction site and annexin a2 as the molecule that anchors it to the plasma membrane, another proposes annexin a2, in complex with p11, as the ligand binding site. a third group has suggested that, in the context of the cell surface and its proteolytic milieu, both annexin a2 and p11 may have exposed lysine residues that are accessible to the lysine binding kringle domains of both tpa and plasminogen. translocation of a2 to the outer leaflet of the plasma membrane of the endothelial cell is a key regulatory step governing vascular fibrinolysis [16, 17]. although cell surface appearance of a2 has been linked to plasma membrane fusion of multivesicular bodies in nih 3t3 fibroblasts, and as a consequence of membrane disruption upon exocytosis of secretory granules in chromaffin cells, it is not clear whether similar mechanisms apply to the endothelial cell. endothelial cell translocation, which can occur within minutes, is initiated by several factors including heat stress, thrombin stimulation, and hypoxia [3032] and is known to require the presence of adequate p11 as well as src kinase phosphorylation at y. a2 was originally identified as a src kinase substrate, and translocation is driven by activation of pp60src. translocation of a2 to the cell surface is dependent upon the abundance of p11. in the endothelial cell, p11 is stabilized by a2, which, upon binding, masks a critical degron, or polyubiquitination site on p11. in the absence of sufficient a2, p11 is polyubiquitinated and targeted to the proteasome for degradation. in anxa2 mice, which demonstrate low to nondetectable p11 expression, treatment with bortezomib, a proteasome inhibitor, restored p11 expression, verifying its regulation via a proteasome-linked pathway in vivo. in nonendothelial cells, p11 may be stabilized by one or more of its other partner proteins, which include a number of transmembrane channels and membrane receptors, such as the tetrodotoxin-resistant sodium channel nav1.8, the two predomain k channel task-1, the acid-sensing ion channel asic1a, the transient receptor potential channels trp5 and trp6, and the 5ht-1b serotonin receptor. protein kinase c-(pkc-) mediated phosphorylation of s or s residues on a2 appears to represent an additional regulatory pathway. serine phosphorylation within the tail domain of a2 dissociates the heterotetramer complex, preventing further translocation to the cell surface by allowing polyubiquitination of p11 and its degradation in the proteasome [40, 41]. this event appears to be initiated by plasmin, which, once generated, signals activation of conventional pkc and thus limits its own generation. this mechanism appears to require cleavage of a2 by plasmin as well as activation of toll-like receptor 4. in this paper, we summarize evidence from both animal models and human studies on the in vivo functions of the annexin a2/s100a10 system. the concept of the annexinopathy was first proposed in 1999, and expanded in several subsequent reviews [4347]. here, we focus exclusively on the growing body of evidence that annexin a2 and its partner protein p11 contribute to human health and disease. the anxa2 mouse has been highly informative in investigating the role of the annexin a2 system in vascular homeostasis in vivo. although a2-deficient mice display normal development, fertility, and lifespan, fibrin accumulation is evident in both intravascular and extravascular locations within the lungs, spleen, small intestine, liver, and kidney (figure 1). microvascular endothelial cells isolated from anxa2 mice, moreover, lack the ability to support tpa-dependent plasmin generation in vitro, and arterial injury in vivo leads to an increased rate and severity of vascular occlusion in the anxa2 mouse. recently, fibrinolysis was also assessed in p11-null mice, which also displayed increased vascular fibrin, reduced clearance of thrombi, and impaired neovascularization of matrigel thrombi. interestingly, mice with diet-induced hyperhomocysteinemia share this phenotypic feature with the anxa2 mouse (figure 1). homocysteine (hc) is a thiol-containing amino acid that is generated during the conversion of methionine to cysteine. elevated levels of circulating hc have been associated with both thrombotic and atherosclerotic vascular disease, although therapies that lower plasma hc have not been shown to reduce the risk of recurrent cardiovascular disease. pretreatment, but not cotreatment, of endothelial cells with hc blocks their ability to bind tpa and inhibits endothelial cell-related, tpa-dependent plasminogen activation. incubation of purified a2 with hc, moreover, interferes with its ability to bind tpa. when wild type mice were subjected to diet-induced hyperhomocysteinemia, fibrin accumulated in multiple tissues (figure 1(d)), and extracted a2 failed to support tpa binding or tpa-dependent plasmin generation, revealing that hc-induced blockade of the cell surface a2 pathway can occur in vivo. the potential clinical utility of recombinant annexin a2 protein (ra2) in ischemic stroke has emerged from thrombosis models in rats. animals were treated with low-dose tpa with or without ra2 at 2 or 4 hours following the initiation of focal embolic stroke. those receiving both agents had a significantly lower infarct size and greater cerebral blood flow compared to animals treated with low-dose tpa alone. in similar experiments, in which animals underwent middle cerebral artery embolization with autologous clot, pretreatment with ra2 not only improved blood flow but also reduced infarct size compared to saline-treated controls. these findings are significant in view of reported neurotoxicity and cerebral hemorrhage associated with the use of tpa in the treatment of thrombotic stroke in humans [5759]. thus, ra2 or related agents may constitute a useful adjunct to tpa alone for the restoration of cerebral blow flow. a2 or its analogs might also prove efficacious in the treatment of peripheral arterial occlusion. when carotid artery thrombosis was induced by adventitial application of fecl3, administration of recombinant full length, but not truncated, a2 was associated with improved cerebral blood flow and reduced thrombus size in comparison with untreated control animals. this treatment had no effect on bleeding time, prothrombin time, or activated partial thromboplastin time, indicating that global clotting parameters remained intact. thus, a2 or its analogs may constitute a useful adjuvant to conventional thrombolytic treatment by reducing the effective dose of tpa, thereby limiting its potential toxicity. the fibrinolytic system appears to modulate the development of plaque-like vascular lesions in mouse models of atherosclerosis in a complex fashion. mice deficient in both plasminogen and apolipoprotein e (apoe), for example, display an enhanced tendency toward atherosclerosis compared to those lacking apoe alone, suggesting that plasminogen protects against lesion formation. on the other hand, when macrophages overexpressed upa in apoe mice, plaque development was accelerated through a plasminogen-dependent pathway. when apoe deficiency is combined with global deficiency of either upa or tpa, however, the predilection for early fatty streaks and advanced plaque development was similar to that seen in mice with isolated apoe deficiency. these data suggest that the fibrinolytic system acts at multiple levels in the regulation atherogenesis. in order to determine whether blocking plasmin(ogen) binding to a2 on the surface of macrophages is an effective strategy to reduce the development of atherosclerosis, apoe mice were crossed with anxa2 mice to generate double nulls (figure 2). following weaning, apoeanxa2 mice were placed on a western chow diet (30% fat) and sacrificed at 12 or 24 wks. aortas were removed and evaluated for lesion development by en face oil red o staining and morphometry of histologic sections taken through the aortic root at the base of the heart. there was no difference in en face lesion area or lesion size in apoeanxa2 mice as compared to apoeanxa2 mice. therefore, we conclude that the redundant nature of plasmin(ogen)-binding sites on macrophages renders targeting a single binding site ineffective in modulating lesion development in this model system. although embryonic vasculogenesis appears to be normal, anxa2 mice display diminished neovascularization in several in vivo assays, including matrigel implant, corneal pocket, and oxygen-induced retinopathy (oir) models. mice with diet-induced hyperhomocysteinemia also display impaired corneal neoangiogenesis, which can be corrected upon intravenous injection of recombinant annexin a2. microvascular endothelial cells from anxa2 mice, as well as hc-treated human endothelial cells, moreover, migrate less efficiently in growth factor-enriched matrigel. together, these data suggest that absence of a2, or its modification by hc, leads to impairment of angiogenesis-related endothelial cell function. interestingly, annexin a2 is upregulated in oir (figure 3). in this model, newborn mouse pups are transitioned to room air after 5 days in a 75% oxygen environment, whereupon relative hypoxia initiates a robust vascular proliferative response in the retina. the return to 21% oxygen also triggers a2 synthesis out of proportion to the increase in vascular endothelial cell abundance. a2 expression is also increased in the endothelial cell under true hypoxia through the direct action of hypoxia-inducible factor-1 (hif-1) with the a2 promoter. electrophoretic mobility shift experiments, chromatin immunoprecipitation studies, and luciferase promoter reporter assays all indicate binding of hif-1 and hif-1 to a hypoxia-responsive element within the promoter region of the human a2 gene, leading to its activation. although oir-associated retinal neovascularization is impaired in the anxa2 mouse, it can be reestablished upon treatment of anxa2 mice with a subretinal injection of an a2-encoding adenovirus, which restores a2 expression. in addition, neovascularization of the hyperoxia-treated anxa2 retina can be repaired upon treatment with the defibrinating agent ancrod, which depletes fibrinogen, thereby preventing fibrin formation. together, these findings provide a link between fibrin accumulation and diminished neoangiogenesis and imply that new therapeutic avenues for proliferative retinal vascular disorders, such as retinopathy of prematurity or diabetic retinopathy, could involve blockade of a2 in addition to inhibition of angiogenic growth factors. in the central nervous system, glioblastomas, malignant tumors derived from glial cells, are usually highly aggressive and refractory to treatment due to the early development of widespread infiltrative loci. glioma-generated proteases, such as plasminogen activators and matrix metalloproteinases, contribute substantially to glioma cell invasion [67, 68]. high concentrations of annexin a2, similarly, are associated with the pseudopodia of invasive glioma cells, and knockdown of a2 reduces their migratory capacity in vitro. in both mouse and rat in vivo models, stable knockdown of a2 expression in glioblastoma cells retarded overall tumor progression upon implantation of the cells into rodent brains; cellular invasion, proliferation, apoptosis, and angiogenesis interestingly, when a2 expression was stably reduced by transfection of rnai directed against a2 in rat gl261 glioma cells, tumor growth and invasiveness were reduced, even though p11 expression persisted; this result indicated that the contribution of a2 to tumor invasiveness was p11 independent (figure 4). these data suggest that a2-directed treatment could offer a new therapeutic modality for human glioblastoma. in a xenograft model in which highly invasive and metastatic breast cancer cells were implanted into nude mice, both tumor growth and vascular density the tumor cells employed in this experiment expressed abundant a2, strongly supported tpa binding and tpa-dependent plasmin generation and exhibited plasmin- and a2-dependent cellular matrix invasion [72, 73]. these studies suggest that a2 may contribute to aggressive breast cancer cellular invasion and tumor angiogenesis through production of localized protease activity. in a third in vivo model, growth of lewis lung and t241 sarcoma tumors implanted into p11-deficient mice impaired tumor growth was correlated with diminished macrophage density within the tumors, and clodronate-mediated depletion of macrophages in wild type mice led to a similar reduction in tumor size. this study recapitulates the finding that thioglycollate-induced macrophage invasion into the peritoneum, and macrophage invasion of subcutaneous matrigel plugs, were also impaired in the p11 knockout mouse. a related study reveals that soluble (a2p11)2 tetramer activates human and murine monocyte-derived macrophages, that this activation requires toll-like receptor 4 (tlr-4), and that the tetramer modulates cytokine production in the macrophage. thus, tumor infiltration by macrophages may in part be due to (a2p11)2 tetramer signaling. nevertheless, aseptic osteolysis, due to generation of wear debris particles (wdp), is an emerging problem that leads to failure of 1030% of all joint replacements. alkane polymers, 812 carbon atoms in length and derived from the breakdown of wdp, bind directly to toll-like receptors 1 and 2 and activate the downstream signaling pathway. in addition, endocytosed wdp can induce endosomal membrane damage and disruption in phagocytic cells, and this process is associated with dramatic recruitment of cytoplasmic annexin a2 to the endosomal membrane (figure 5). in the absence of a2, endosomal disruption leads to leakage of lysosomal cathepsins and h ions into the cytosol with subsequent activation of the nlrp inflammasome and an accelerated inflammatory response. a large body of work has focused on the role of p11 in neuropsychiatric function. p11 binds to both the serotonin 1b and serotonin 4 receptors, suggesting a role for p11 in regulation of mood. p11-deleted mice show depression-like behavior, characterized by increased immobility in the tail suspension test, increased thigmotaxis, and decreased responsiveness to a sucrose reward. in wild type mice, adenovirus-mediated deletion of p11 specifically within the nucleus accumbens (na) resulted in depressive behavior, indistinguishable from that seen in mice with global p11 deficiency; exogenous administration of p11 within the na of p11-deleted mice restored normal behavior. these data correlate with findings in human depression, in which p11 protein levels were reduced in the na. furthermore, reduced p11 mrna levels in peripheral blood mononuclear cells may serve as a potential biomarker for patients at high risk of suicide. these studies raise the possibility that some forms of human depression may be reversible by augmentation of p11 expression. indeed, commonly used anti-inflammatory drugs that attenuate the antidepressive effects of serotonin reuptake inhibitors may do so by inhibiting the effects of interferon, a known inducer of p11 [82, 83]. the tetrodotoxin-resistant sodium channel (nav1.8/sns), whose expression is restricted to sensory neurons, is the major pain perception receptor and is expressed in 85% of neurons emerging from the dorsal route ganglia. p11 binds to the amino terminus of the nav1.8 protein and promotes its translocation to the plasma membrane to produce functional channels. deletion of p11 specifically in primary nociceptor sensory neurons was achieved using nav1.8 promoter-directed cre recombinase and led to a loss of tetrodotoxin-resistant sodium current density, and severe compromise of noxious coding in sensory neurons from the dorsal root horn. thus, directed p11 targeting may prove useful in the treatment of refractory pain disorders. at diagnosis, acute promyelocytic leukemia (apl) is commonly associated with life-threatening hemorrhage. in apl, clonal expansion of immature promyelocytes harboring a balanced chromosomal translocation (t(15; 17)(q2224; q1221)) gives rise to the transcriptionally active promyelocytic leukemia-retinoic acid receptor (pml-rar) fusion protein. apl frequently responds to differentiation therapy with all-trans retinoic acid (atra), which triggers degradation of pml-rar. while disseminated intravascular coagulation promotes coagulopathy in apl, consumption of the plasmin inhibitor alpha2-antiplasmin and development of a hyperfibrinolytic state due to excessive plasmin generation high-level expression of annexin a2 occurs specifically in apl blast cells (figure 6). a2 was detected in blast cells recovered from 6 of 6 apl patients, all of whom had evidence of hyperfibrinolysis, as evidenced by elevated circulating fibrin degradation products and d-dimer and depletion of plasma fibrinogen. nb4 cells, which carry the t(15; 17) translocation and express the pml-rar fusion protein, displayed steady state a2 mrna levels that were approximately 10-fold higher than those found on leukemia cells that lacked the fusion protein. treatment of nb4 cells with the retinoic acid receptor ligand, all-trans retinoic acid (atra), attenuated a2 expression in a time frame associated with clinical resolution of bleeding. intracranial bleeding, an unusually frequent problem in apl, may be due to the relatively high level expression of the a2 system on cerebral microvascular endothelial cells compared to those of other vascular beds. elevated expression of p11 in nb4 cells was also recently demonstrated and shown to respond to treatment with atra. in a second clinical study, a cohort of 26 patients were studied prospectively and found to have enhanced fibrinolysis at diagnosis, despite normal tpa levels and increased pai-1. apl cells harvested from these subjects expressed 3-fold higher levels of a2, and their rate of tpa-dependent plasmin generation was similarly elevated over that seen in the presence of m1, m2, m4, or acute lymphoblastic leukemia cells. both elevated a2 expression in blast cells and hyperfibrinolytic hemorrhage corrected in 23 patients upon treatment with differentiation therapy, consisting of all-trans retinoic acid (atra) or atra plus arsenic trioxide. this study confirms the role of the a2 system in fibrinolytic bleeding in patients with apl. expression levels of annexin a2 have been examined in a variety of human malignancies. in some, such as renal cell [9092], gastric, prostate, pancreatic, breast carcinoma, and osteogenic sarcoma, increased expression levels appear to correlate with higher histologic grade and/or development of distant metastases. in human glioblastoma, a2 expression correlates with histologic grade and cns dissemination [49, 9799]. in human breast cancer, a2 appears to be associated with the surface of invasive, malignant cells, but not normal ductal or acinar epithelial cells, and expression correlated with neoangiogenic activity. proteomic profiling of colorectal cancer, moreover, revealed differentially increased expression of a2 in tumors that had progressed to lymph node metastases versus localized tumors. primary multiple myeloma cells harvested from a cohort of patients displayed 10-fold higher cell surface a2 expression than that observed on normal plasma cells; silencing of a2 in related cell lines suppressed expression of proangiogenic genes. a2 and a related a2-binding receptor has been reported to promote myeloma cell adhesion and growth in the bone marrow. on the other hand, a2 expression in oral squamous cell carcinoma or sinonasal adenocarcinoma these studies suggest that expression levels of a2 may have prognostic value in malignancy, but would need to be validated for each specific tumor. high levels of both p11 and a2 were found in 100% of anaplastic thyroid carcinomas, and correlated with their aggressive behavior. in a comprehensive study of s100 gene expression in over 300 primary breast cancers, both p11 (s100a10) and s100a11 were selectively upregulated in basal versus nonbasal breast cancer subtypes, but did not predict overall survival. among 62 cases of human esophageal squamous cell carcinoma, 11 of 12 s100 genes, including p11, were downregulated, based on reverse transcription-polymerase chain reaction assays. p11 transcripts have also been reported to be increased in both renal cell and gastric carcinomas [92, 108, 109]. further studies may define p11 expression as a viable biomarker or prognostic indicator in selected tumors. it is characterized by thrombosis and recurrent fetal loss in association with circulating antiphospholipid antibodies. the latter are distinct, often coexisting antibodies directed against either 2-glycoprotein i or other intravascular proteins, which may be found in complex with anionic membrane phospholipids. a2 has been identified as a prominent target of autoantibodies arising specifically in patients with aps with severe thrombosis and/or pregnancy morbidity [112, 113]. in vitro, patient-derived antiannexin a2 antibodies blocked endothelial surface tpa-dependent plasmin generation, and also activated cultured endothelial cells, inciting them to express elevated levels of the prothrombotic agent, tissue factor. other groups have noted that a2 can serve as a binding site for (2)-glycoprotein i in aps and can initiate a2-dependent endothelial cell activation. together, these data implicate a2 in the pathogenesis of aps-associated thrombosis through several possible mechanisms. cerebral venous thrombosis is a rare disorder of unknown etiology that mainly affects children and young adults. among a cohort of 40 consecutive patients studied 2 to 6 months following the index thrombotic event, 12.5% were found to have high titer anti-a2 antibodies compared to 2.1% in healthy subjects. thus, anti-a2 may define a new subset of individuals with immune-mediated thrombosis, play a role in the pathogenesis of this disorder, and/or offer novel therapeutic targets. both a2 and p11 are expressed on the brush border of the placental syncytiotrophoblast. in 60 patients with preeclampsia, a2 mrna and protein levels in placenta high titer anti-a2 antibodies, moreover, were detected more frequently in sera from subjects in the pre-eclamptic group and associated with increased placental vascular thrombosis. impaired local fibrinolytic function due to blunted a2 expression may contribute to the pathogenesis of pre-eclampsia and maternal and perinatal infant morbidity. sickle hemoglobinopathy arises from a point mutation within the 6th codon of the human -globin chain. polymerization of abnormal hemoglobin under deoxygenating conditions induces erythrocyte shape change and non deformability, which leads to vascular occlusion, impaired vasodilatation, distal ischemia, and endothelial cell activation with adhesion of leukocytes. in children a recent analysis of 108 single nucleotide polymorphisms in 39 candidate genes revealed that variations in the annexin a2 (anxa2) gene, among several others, were associated with increased risk of stroke. a second independent study linked anxa2 polymorphisms to increased risk for stroke in sickle cell disease, while additional anxa2 snps have been associated with avascular necrosis of bone (osteonecrosis) in sickle hemoglobinopathy. these data suggest that annexin a2 may represent a significant modifier gene that shapes the clinical expression and natural history of sickle cell disease.

since its discovery as a src kinase substrate more than three decades ago, appreciation for the physiologic functions of annexin a2 and its associated proteins has increased dramatically. with its binding partner s100a10 (p11), a2 forms a cell surface complex that regulates generation of the primary fibrinolytic protease, plasmin, and is dynamically regulated in settings of hemostasis and thrombosis. in addition, the complex is transcriptionally upregulated in hypoxia and promotes pathologic neoangiogenesis in the tissues such as the retina. dysregulation of both a2 and p11 has been reported in examples of rodent and human cancer. intracellularly, a2 plays a critical role in endosomal repair in postarthroplastic osteolysis, and intracellular p11 regulates serotonin receptor activity in psychiatric mood disorders. in human studies, the a2 system contributes to the coagulopathy of acute promyelocytic leukemia, and is a target of high-titer autoantibodies in patients with antiphospholipid syndrome, cerebral thrombosis, and possibly preeclampsia. polymorphisms in the human anxa2 gene have been associated with stroke and avascular osteonecrosis of bone, two severe complications of sickle cell disease. together, these new findings suggest that manipulation of the annexin a2/s100a10 system may offer promising new avenues for treatment of a spectrum of human disorders.

PMC3496855

pubmed-509

pregnancy in patients with end-stage renal disease (esrd) is rare, and kidney disease before pregnancy is associated with poor fetal outcome. however, the outcome of pregnancy in dialysis patients has been much improved, and the overall rate of successful fetal outcome is reported to be 76% (1). this is mainly due to a multidisciplinary approach that incorporates intensive dialysis and aggressive management of anemia and hypertension. autosomal dominant polycystic kidney disease (adpkd) is the most common inherited renal disease, and approximately half of the patients progress to esrd by age of 60 (2). with regard to pregnancy, fertility is not affected by adpkd in patients with normal renal function (3, 4). however, as kidney cysts grow, hypertension and deterioration of kidney function develop, which adversely affect pregnancy. in addition, massively enlarged kidneys may occupy the abdominal and pelvic cavities, preventing the normal growth of placenta and fetus. we present a case of successful pregnancy in an adpkd patient on hemodialysis (hd). she started hd 3 times a week after 3 yr of her initial diagnosis. at the time of presentation, she was normotensive and had been prescribed aspirin (100 mg daily), multivitamins, calcium-based phosphate binders, and erythropoietin (1,000 units every hd session). her dry weight was 53.3 kg and interdialytic weight gain was 1.5-2.5 kg. she was confirmed to be 8 weeks pregnant by pelvic ultrasound and beta-hcg test. the physical examination revealed a blood pressure (bp) of 137/85 mm hg and a regular heart rate of 107 beats per minute. laboratory findings at presentation were as follows: hemoglobin (hb) of 10.4 g/dl; hematocrit (hct) 31.5%; blood urea nitrogen (bun) 56.9 mg/dl; serum creatinine (cr) 9.0 mg/dl; total protein 5.9 g/dl; serum albumin 3.7 g/dl; serum calcium 9.3 mg/dl; serum phosphorus 3.3 mg/dl; potassium 5.5 mm/l; and normal liver function. the computed tomography scan taken 2 yr ago showed bilaterally enlarged kidneys filled with numerous renal cysts along with only a few liver cysts (fig. she was managed by a multidisciplinary team approach to optimize the patient and fetal outcomes. firstly, the risk of pregnancy in a dialysis patient and the need for intensive dialysis were discussed with her family. secondly, our team evaluated the risk of stunted intrauterine fetal growth by her massively enlarged kidneys. we considered a unilateral nephrectomy at the second trimester to secure the intraabdominal space, but the risk was determined to outweigh the benefits in this case. finally, genetic counseling about the fetus's risk of inheriting adpkd and prenatal genetic diagnosis was provided but declined by the patient. at 10 weeks gestation, hd prescription was changed to 4-hr treatments 4-5 times a week, and a predialysis bun less than 50 mg/dl was targeted. throughout pregnancy, predialysis bun her bp was well controlled without any antihypertensive medication: systolic bp remained at 110-140 mmhg and diastolic was consistently at 60-80 mmhg. erythropoietin doses were adjusted to target a maternal hb between 10-11 g/dl. the median dose was 18,000 iu/week (range, 5,000-26,000 iu/week) during gestational weeks 12-36. in addition, 100 mg intravenous iron sucrose was administered every session during gestational weeks 19-22. the follow-up data of dry weight, predialysis bun and hb level are shown in fig. routine fetal karyotyping was performed at 16 gestational weeks, but mutation screening was not performed. at 34.5 weeks of gestation, the membrane ruptured during hd, and vaginal delivery was performed without any complications. she delivered a healthy female weighing 2,100 g. one week after delivery, the patient was hospitalized for 5 days because of postpartum cardiomyopathy. previous studies suggested pregnancy in women with adpkd and normal kidney function can result in a favorable outcome. (3) studied fertility and pregnancy complications between patients with polycystic kidneys (n=76) and a control group (no polycystic kidney) (n=61) of women at risk of adpkd. they found no significant distinction between the 2 groups with regard to fertility, spontaneous abortion, stillbirth, or urinary tract infection (3). another study showed that overall fetal complication rates were not significantly different between women with and without adpkd (4). on the contrary, affected women with preexisting renal failure and hypertension developed various complications and were associated with poor fetal outcome. other risk factors for fetal complications include maternal age>30 yr and development of preeclampsia (4). landesman and sherr (5) suggested a classification of pregnant women with adpkd based on severity of renal disease. the patient in this case would be classified into group c, which refers to patients in renal failure secondary to advanced pkd. (6) first described a successful pregnancy in a patient with group c disease, and other cases have also been reported (6-9). prophylactic hemodialysis was needed in 1 case (8), and in another case series, we found a pkd patient who underwent nocturnal hd, which is seldom performed in korea (10). with this background, we sought to determine the best way to secure fetal survival and a good maternal outcome. first, the management of ckd-related complications and the hd schedule were reviewed. pregnant women with a favorable outcome were found to have lower predialysis bun levels compared to those with adverse fetal outcomes (11). it is recommended to increase the hemodialysis frequency (usually 4-6 sessions/week) to maintain a predialysis bun below 50 mg/dl (12). this provides a less uremic environment for the fetus, allows better control of volume status and bp, and permits the mother a more liberal diet. it also reduces the risk of intradialytic hypotension, which may be associated with fetal distress and premature labor (12). increasing the dialysis dose prolongs gestation, resulting in higher birth weights and a better chance of fetal survival (13). hypertension is the most frequently reported maternal complication in hd patients, occurring in 42%-80% of women (14). both the rate of fetal survival and birth weights were lower in hypertensive pregnant patients compared to normotensive patients. maternal dry weight and interdialytic weight gain should be regularly evaluated and adjusted according to changes in fetal growth (12). a lower third trimester hematocrit was associated with risk of an adverse fetal outcome and low birth weight (11). erythropoietin dose needs to be increased by approximately 50% in order to maintain a target hemoglobin level of 10-11 g/dl (13). another important area of concern for adpkd patients is the mass effect of huge kidneys and/or a massive polycystic liver. this can cause chronic pain and compression of adjacent organs, resulting in indigestion, gastroesophageal reflux, malnutrition, and ascites (compression of ivc or portal vein). although adpkd does not affect fertility, pregnancy in patients with large kidneys at an advanced stage of renal failure has not been reported. the patient in this case had a measured kidney volume of about 6 l which is 30-fold larger than normal. fortunately, the patient's liver size was normal with only a few small cysts, and she had no symptoms related to a mass effect. moreover, abdominal muscles during pregnancy can adapt to increased space requirements by increasing the intra-abdominal volume under the influence of various hormones, such as relaxin. this case illustrates that even a very large kidney volume has no significant adverse effect on pregnancy. lastly, the risk of congenital anomalies and inheritance of mutant pkd genes should be evaluated. prenatal genetic diagnosis can be offered by obtaining fetal dna through chorionic villus sampling or amniocentesis. however, demand for prenatal diagnosis for elective abortion seems to be low, as in our case, and only 4% of women with adpkd would terminate a pregnancy if they knew the inheritance status (15). although pregnancy remains risky in adpkd patients with esrd undergoing long-term hemodialysis, outcomes can be improved by optimizing management through a multidisciplinary team of nephrologists, obstetricians, and neonatal care specialists. intensified dialysis, proper anemia management, and improved preconception counseling is needed in all women on dialysis because most of the pregnancies reported were unplanned.

recent advances in dialysis and a multidisciplinary approach to pregnant patients with advanced chronic kidney disease provide a better outcome. a 38-yr-old female with autosomal dominant polycystic kidney disease (adpkd) became pregnant. she was undergoing hemodialysis (hd) and her kidneys were massively enlarged, posing a risk of intrauterine fetal growth restriction. by means of intensive hd and optimal management of anemia, pregnancy was successfully maintained until vaginal delivery at 34.5 weeks of gestation. we discuss the special considerations involved in managing our patient with regard to the underlying adpkd and its influence on pregnancy.graphical abstract

PMC3924015

pubmed-510

despite expanded indications for conservative surgery of urothelial tumors (ut-formerly transitional cell carcinoma) of the upper urinary tract (uut), radical nephroureterectomy (nue) with complete removal of the distal ureter including the bladder cuff is the standard surgical technique used for most patients with ut of the uut. choosing the best procedure for this group of patients in everyday clinical practice is frequently a challenging task. while laparoscopic nephrectomy as a part of nue was first described in 1991 and it is to-date broadly accepted, the approach to the distal ureter and the timing of the ureterectomy are still disputed. several techniques have been developed to remove the distal intramural part of the ureter during laparoscopic nue and it is very difficult to choose the best procedure for a given patient in everyday clinical practice. there is a risk of residual tumor at the stapling site and titan clips may constitute a nidus for the formation of cystolithiasis [5, 6]. two groups [79] have described a technique for the division of the ureterovesical junction with a thermo sealing system (ligasure atlas). we considered this modification of clnue as an excellent method and we have previously performed this on 14 patients. however, we found a significant risk of incomplete resection of the intramural part of the ureter. exclusive laparoscopic sharp excision of the bladder cuff with intracorporeal suturing [1115] appears too difficult for us. thus, we have decided to start clnue with excision of the ureterovesical junction with collin's knife followed by clnue. the main problem with this procedure is the risk of occlusion of the ureter to prevent spillage of urine containing tumor cells during laparoscopic pluck nephroureterectomy. several methods have been described to date: (1) cauterization of the ureteric ostium only, (2) endoloop [16, 17], (3) hem-o-lok clip [1820], or (4) fibrin sealant. we chose to close the ureter with a lockable hem-o-lok clip, which was introduced through a 5 mm intravesical port in the suprapubic area rather than endoscopically [18, 19, 20]. we have labeled this technique as clnue-wilc (with intravesical lockable clip). in this study the study is prospective, but due to the absence of a standard technique for nue, the study was not randomized and comparative. from 1/2010 to 1/2012, 38 patients with suspected ut of uut were indicated for surgical treatment. four underwent conservative surgery (one ho: yag ablation, one ureteroscopic resection, one nephroscopic resection with resectoscope, and one open resection of the ureter) and 34 nue. thirteen underwent some type of open surgery (advanced cases with open nephrectomy or laparoscopic nephrectomy with open ureterectomy for tumor of the distal ureter) and 21 nue by clnue- ivlc (main inclusion criteria: not suitable for conservative treatment, no tumor of distal ureter, no advanced tumor by ct, no contraindications to laparoscopy, or no concomitant bladder tumor). the ureterovesical junction is excised transurethrally with collin's knife (the paravesical adipose tissue must be clearly visible). from the suprapubic region, the stump of the ureter is grasped with biopsy forceps and on the end of ureter, a hem-o-lok clip size ml is applied (the applicator is introducible through the 5 mm port). in broader ureters, the patient is rotated to the flank position and a standard laparoscopic nephrectomy via a transperitoneal approach is performed [10, 22]. the transperitoneal approach is more familiar to us than the retroperitoneoscopic one. one additional 5 mm port in the suprapubic region is introduced; the skin incision from the previous endoscopic phase is used. the ureter is dissected along and under the iliac vessels with a harmonic scalpel or ligasure advance or blunt tip 35 mm. this phase is delicate due to the relatively narrow operation space and the close relation of iliac vessels and the bowel. the ureter is completely separated and the hem-o-lok clip must be clearly visible to constitute proof of completion of the ureterectomy. a few points to emphasize include: four complications (clavien ii 2x, iiib and v) wound infection at the site of extraction (staphylococcus aureus), urine leakage from the pelvic drain for 6 days (bladder catheter was removed on the 8 postoperative day following cystoradiography that did not reveal leakage), one open prostatectomy on the 2 postoperative day because of an enlarged prostate (bph with hematuria), and one patient died of heart failure on the day of operation. in four cases (19.0%) application of the clip failed and clnue was concluded with a non-occluded ureter and the risk of dissemination of tumor cells in urine paravesically. in the first case the patient had a ureteral stent and the ureter was incrassate, which is why we did not want to apply 10 mm port to facilitate the introduction of the hem-o-lok clip size l. in another case, the stented ureter was also incrassate and we introduced a 10 mm port to the urinary bladder and applied a size l clip without difficulty. there was one incidence with the inability to grasp the ureter by endoscopic forceps. in two cases the laparoscopic nephrectomy was converted to the open surgery (flank incision and lumbolaparotomy) in one case this was due to extensive adhesions in the abdominal cavity (a history of open cholecystectomy with evacuation of subphrenic abscess), and in the other two cases it was due to advanced tumor growth with perirenal and periureteral adhesions. in three cases, laparoscopic nephrectomy was followed by open distal ureterectomy with the standard pluck method, because the laparoscopic approach was not feasible due to poor access of the laparoscopic instruments to the small pelvis. four patients with non-ut histology were judged to be ut by preoperative imaging. follow-up (mean 10, range: 0-22 months), including results of the control endoscopy, are known in all patients. one patient with uc of the renal pelvis pt2n0m0g2 had uc in the contralateral distal ureter and died after 11 months due to extensive metastatic disease, mainly to bone. abbreviations: ae adrenalectomy for adenoma, bcg history of intravesical instillation of bcg, bt urinary bladder tumor, eskd end-stage kidney disease, l left, m male, mo right, turb transurethral resection of bladder tumor, up-um ureter proximal-middle, uc notes: all cases were n0m0; time of whole procedure (endoscopy, rotation of patient, laparoscopy); non-uc histology: tumors were described by radiologists on ct/mri as a suspicious uc tumor. it should be noted that the aim of this work is not to comprehensively discuss the whole complex problem of nue. our experience prompted us to review this topic in two recent publications [10, 22] and now we will focus the discussion on complete laparoscopic nue with emphasis on the method of removing the distal part of the ureter including the bladder cuff. in our view, due to the disadvantages mentioned in the introduction, the method involving a stapler should be abandoned. the other options of distal ureterectomy as a part of clnue are as follows: (1) a thermosealing technique [7, 8, 9], (2) the sharp excision of the bladder cuff with intracorporeal suturing (a purely laparoscopic technique) [11, 12, 15] including modification with a bulldog clamp, (3) robotic, or (4) purse string technique. the steps of the endoscopic phase in lithotomy position. the ureterovesical junction is excised transurethrally with a collin's knife to the paravesical adipose tissue. the stump of the ureter is grasped with biopsy forceps and the end of the ureter is clipped with a hem-o-lok clip size ml (an applicator is introduced through the 5 mm port inserted as an epicystostomy). as pointed out previously, the thermosealing system technique has the risk of leaving the intramural part of the ureter intact. the laparoscopic ne with ensuing sharp excision of the ureterovesical junction and closing of the defect with suture is an ideal but challenging method. we consider the technique with any variant intracorporeal suturing technically more challenging and time consuming [10, 22]. the variant with the da vinci robotic system [24, 25] decreases the technical difficulty of intracorporeal suturing. the disadvantages of the da vinci system include: high cost, lack of tactile sensation, long set-up time, and unavailability of the robotic system in many hospitals. an exotic technique is the pneumovesicum approach in which three 5 mm ports are introduced to the bladder and insufflated with co2 pneumovesicum (10-12 mm hg). the distal ureter, bladder cuff, and intramural ureter are then completely dissected free using electrocautery. as soon as the distal ureter is dissected an endo-loop knot is used to ligate the ureter. we do not have experience with this technique and we feel this technique to be complicated. the ureter is excised through a laparoscopic single port introduced to the urinary bladder and the defect is closed with intravesical suture. six ports, on the left side, but five usually suffice. the same skin incision as for the epicystostomy is used for the suprapubic port. due to the factors mentioned above we prefer a variant of excision of the ureterovesical junction but with another method for sealing of the ureter. we have long-term experience with excision of ureterovesical junctions using collin's knife. previously we used it as a pluck technique combined with open and thereafter laparoscopic or retroperitoneoscopic nephroureterectomy, and, later on, we also used it as a part of antegrade mini-invasive nue. 's idea [18, 19] of endoscopically closing the excised ureter with lockable clip to be excellent, although the introduction of the hem-o-lok clip via endoscope appears to be difficult. pathak et al. performed their technique in 25 cases with a mean total operative time of 164 (range: 105-235) minutes. no pelvic complications in were reported and there were no perivesical tumor recurrences with mean follow-up of 26 (range: 11-44) months. we have decided to apply the hem-o-lok clip size ml via an intravesical 5 mm port introduced through the suprapubic area. regarding our first nine cases, we had found the exact same method described in the literature. suprapubic transvesical single-port technique for control of lower end of ureter during laparoscopic nephroureterectomy. the dissected nephroureterectomy specimen during the operation. the tumor can be seen in the upper calyx with hem-o-lok size ml at the end of the ureter (see detail). reportedly, occlusion of the ureter may be performed instead of clip with electro-coagulation only (it is probably less reliable) or with fibrin sealant injection. clnue- ivlc is a relatively simple, reproducible, and minimally invasive method with minimal risks of tumor spillage and seeding. the main disadvantage seems to be the risk of an unclosed defect of the urinary bladder, but based on our own experience, as reported in this paper and the available literature, we have not found any significant complications emerging from this. another disadvantage is failure in applying the hem-o-lok clip, in which the technique is concluded without closing the ureter, and is generally thought to carry a higher risk of extravesical tumor recurrence, but as described recently, this technique has comparable oncological results to the open distal ureterectomy [3, 6]. failures in clip application were experienced only in early cases and, with increasing experience, this problem was avoided. importantly, if needed, the endoscopic phase can be transformed to open nue or it can be combined primarily with open surgery. some may consider conversion to open distal ureterectomy/nephrectomy as a failure of the method. the method whereby closing of the ureter is performed allows the procedure (nue) to be completed safely in complicated cases (obesity, advanced cases, previous intraabdominal surgery etc.).

introductionwe present a cohort of patients with low-stage pelviureteric neoplastic disease who underwent complete laparoscopic nephroureterectomy (clnue) with intravesical lockable clip (ivlc). due to the absence of a standard technique of nue, the study was not randomized. materialsfrom 1/2010 to 1/2012, 21 patients were subjected to clnue-ivlc. the first step was transurethral excision of the ureterovesical junction with collin's knife deep into the paravesical adipose tissue. the ureter was grasped with biopsy forceps and the distal end of the ureter was occluded with lockable clip. the applicator was introduced through a 5 mm port inserted as an epicystostomy. the patients were rotated to flank position and clnue followed. the endoscopically introduced clip on the distal ureter is proof of completion of the total ureterectomy. resultsthe mean operation time was 161 (115-200) min. in four (19.0%), the application of the clip failed and clnue was completed with non-occluded ureter. in three cases, subsequent laparoscopic nephrectomy was converted to open surgery. in two cases, the distal ureterectomy was completed with pluck technique through a lower abdominal incision that was also used for extraction of the specimen. there were four complications (clavien ii 2x, iiib, v). follow-up was available for all mean 10.6 (range: 0-25) months. one died of disease generalization within 11 months. conclusionclnue-ivlc is fast and safe. if needed, the endoscopic phase can be switched to open nue. disadvantages include: the need to change the position of the patient, the risk of inability to apply the clip on the distal ureter, and the risk of an unclosed defect of the urinary bladder.

PMC3921777

pubmed-511

segmental copy-number variations (cnvs), involving the gain or loss of several hundreds of bases to several hundred kilobases (kb) of the genome, can be an important source of genetic variation among human populations of different ethnic groups as well as among individuals. molecular genetics analyses and cytogenetic analyses have provided significant information about these variations in the human genome, specifically as they relate to disease, such as cancer, and to congenital malformation (see [1, 2], and review in). following the development of methodologies and the introduction of new research platforms [49], information regarding the nature and pattern of cnvs from representative populations have accumulated. examinations of a relatively large number of individuals from various specific ethnic groups have recently been conducted using different array platforms, such as bac-arrays [1013], oligo-arrays [1416], and others. the results are not always consistent and it is likely that different human populations bear different cnvs. the numbers of japanese individuals examined to date are not so large compared to the studies for other ethnicities. polymorphic cnvs have received considerable attention since they might play an important role in the etiology of common diseases. therefore, more data regarding cnvs should be accumulated from japanese populations. in this report, we focus on cnvs which were observed at a high frequency (5.0% of the individuals) in the population residing in hiroshima and nagasaki, japan by acgh with bac-clones as targets. in the study, the population studies were conducted at two stages: stage (1): 80 unrelated japanese individuals were examined using bac-acgh with an array having 2,241 bac clones, and stage (2): 133 unrelated japanese individuals were examined using bac-acgh that contained 2,622 bac-clones. the majority of the clones used in stage (1) of this study were selected from the set of cytogenetically mapped p1-artificial chromosome (pac) clones and bacterial artificial chromosome (bac) clones reported by the bac resource consortium and obtained from either the children's hospital oakland research institute (oakland, ca, usa) or from invitrogen inc., co. (carlsbad, ca, usa). in stage (2), in addition to bac clones used in stage (1), an additional 381 bac clones were used, a majority of which were collaboratively obtained from dr. n. matsumoto of yokohama city university. the 2,241 clones of chromosomal fragments from chromosome 1 to chromosome 22 were used in stage (1) and 2,622 clones were used in stage (2), respectively. that is, the additional 381 bac clones were examined for only 133 unrelated individuals in stage (2). those clones are distributed every 1.2 mb across all of the human autosomes in stage (1), and 1.1 mb in stage (2), respectively. in addition to autosomal clones, four kinds of x-chromosomal clones were used as internal references. with respect to examination for stage (1), three sets of arrays were constructed and imprinted: slide no.1, consisted of 698 clones on chromosomes 1 to 4; slide no.2 consisted of 718 clones on chromosomes 5 to 10, plus two bac clones on chromosome 3, and six clones on chromosome 4; and slide no.3 consisted of 817 clones on chromosomes 11 to 22. for stage (2), all of the clones were printed onto one glass slid. the genomic dna samples used in this study were principally the same as those used in a previous study. the dna samples used for reference purposes were extracted from mononuclear cells of two physically and clinically normal volunteers (a 57-year-old japanese male and a 54-year-old japanese female). the dna used for testing and analyses of this population was extracted from lymphoblastoid cell lines obtained from the offspring of atomic-bomb survivors. high molecular weight genomic dna was isolated using conventional methods as described in detail elsewhere. lymphoblastoid cell lines were derived from a cryopreserved archive of approximately 1000 families consisting of father, mother, and offspring from hiroshima and nagasaki for whom permanent cell lines have been established by epstein-barr (eb) virus transformation of peripheral b-lymphocytes. the composition of the families has been reported elsewhere. three hundred five offspring were initially screened. since the offspring include some siblings, we selected one representative offspring to construct unrelated individuals to avoid double counting of polymorphic cnvs from families containing two or more siblings. we selected the offspring who first visited our institution for donating blood rather than other siblings. the 213 offspring selected as unrelated individuals included 124 offspring from hiroshima and 89 from nagasaki. cloned dnas for microarray targets were isolated from bacterial cultures using nucleobond bac 100 (nippon genetics, tokyo). with respect to stage (1), dna was digested by noti followed by phenol-chloroform-isoamyl alcohol (25:24:1) extraction and ethanol-precipitation. on the other hand, in stage (2), cloned dna was digested with msei followed by phenol-chloroform-isoamyl alcohol (25:24:1) extraction and ethanol precipitation. the fragmented dnas were amplified by ligation-mediated pcr carried out as described by snijders et al.. the target dnas (0.5 g/l) were dissolved in 50%-dimethylsuloxide and printed in triplicate onto the glass slides (matsunami glass co. ltd.) using the affymetrix 417 arrayer (affymetrix). the screenings of both stages were conducted following the procedures described previously. in brief, for labeling dna, test and reference genomic dna (1.25 g each) was cut by bamhi, and labeled by a random priming method with cyanine-5- and cyanine-3-labeled dutp (cy5- and cy3-dutp; perkinelmer life sciences, wellesley, ma, usa). the labeled probes were mixed and centrifuged with microcon column (millipore co., bedford, ma, usa) to purify the probes. subsequently, human coti dna (120 g; roche diagnostic gmbh, mannheim, germany) was added to the column, and recentrifuged. after the volume of the mixture became less than 20 l, it was transferred to microtubes with 100 l of hybridization solution (50% formamide, 10% dextran sulfate, 1% tween 20, 2 ssc, 10 mm tris-hcl [ph 7.4] and 800 g of yeast t-rna [invitrogen, carlsbad, ca, usa]). the hybridization mixture was then denatured at 70c for 10 minutes, and subsequently incubated at 37c for at least five hours to block repetitive sequences of the labeled probes. prehybridization was conducted in order to block repetitive sequence binding of target dna on the arrays, and to prevent nonspecific binding of probe dna to the targets. following the initial incubation (overnight at 37c), the prehybridization solution was removed, and fresh hybridization solution with cy-labeled dna (prepared as described above) was added. again, hybridization processes were carried out. all of the procedures were conducted using the genetac hybridization station (genomic solutions inc., ann arbor, mi, usa). fluorescent images of the hybridized arrays were obtained using a scanarray 5000 confocal laser scanner (perkinelmer life sciences). fairfax, va, usa) in stage (1) and gene pix (axon instruments, sunnyvale, ca) in stage (2), respectively, were used to quantify the fluorescence of each spot on the array images. fluorescent ratios of the total integrated cy3 and cy5 intensities for each target (triplicate spots for each target) were calculated, along with the mean ratios of the triplicate spots (if the raw ratio of one of the triplicate spots differed by more than 10% from the other two, the value was automatically excluded from the mean ratio calculation). normalized ratios were computed by dividing each raw ratio by the mean raw ratios of every autosomally mapped target (therefore, after normalization, the averaged ratio for all targets in one array was 1.0). the spots whose ratios were 2.58 standard deviations (sd) below the mean (1.0), or 2.58 sd above the mean, were marked cnv. to confirm the quality of each analysis, the ratio of x-linked clones was verified. dna in the plugs was cleaved by restriction enzymes (paci, or sse8387i). the resulting fragments were then separated by pulse field gel electrophoreses (pfge) on 1% pulse field certified agarose (biorad, hercules, ca, usa) with 0.5 tbe (tris-borate-ethylenediaminetetraacetic acid). using the chef-dr ii system (biorad), electrophoresis was carried out using 6 v/cm at 14c for 22 hrs. the angle of pulse was 120. the switch time was used: ramped from 0.3 seconds to 15 seconds. southern blot analyses were carried out using conventional, well-described procedures. in brief, after completion of pfge, the dna in the gel was cleaved by uv irradiation and blotted onto nitrocellulose filters (schleiche&schuell, dassel, germany). the filters were prehybridized with human coti dna (48 g/ml, roche diagnostic gmbh) and salmon testis dna (14 g/ml, sigma-aldrich) to decrease the background due to repetitive sequences. subsequently, the filters were hybridized with whole bac-dna as a probe. dna probes were labeled with [-32p] dctp (amersham biosciences, piscataway, nj, usa) and preannealed with human coti dna and salmon testis dna (10.5 g/ml). prehybridization and hybridization were performed overnight at 37c in a solution containing 50% formamide, 10% dextran sulfate, 1% tween 20, 2 ssc, and 10 mm tris-hcl (ph 7.4). after hybridization, the filters were washed at 65c with 1.0 ssc containing 0.1% sds (sodium dodecyl sulfate) and 0.5 ssc containing 0.1% sds. banding patterns were obtained by either exposure to x-ray film (fuji film, tokyo, japan) or through use of the molecular imager fx (biorad). the qpcr was performed using sybr premix ex taq (takara-bio) and the light cycler system (roche diagnostics), according to the manufacturers ' protocols. primers were designed with primer3 software (http://primer3.sourceforge.net), and the size of pcr products was confirmed by the pattern of restriction enzyme digested fragments using the labchip dna 500 kit on the 2100 bioanalyzer (agilent technologies, waldbronn, germany). two, 0.5, and 0.125 ng of genome dna from an individual with cnv were used and the quantification of each amplicon was carried out at 45 cycles of pcr. the results were analyzed with light cycler data analysis software using a second derivative maximum model. the main purpose of this paper is to report the accumulation of the data about highly polymorphic cnvs found in 5.0% of the individuals. (the number of cnvs was 11 or more in each bac-spot.) as shown in table 1, 680 polymorphic cnvs were observed on 16 bac-regions. as described before, the results of two bac (rp11-259n12 and rp11-121a8) were obtained from 133 unrelated individuals examined in stage (2). southern blot analyses followed by pfge were carried out for the highly polymorphic cnvs. as shown by the typical cases in figures 1 and 2, the patterns of these two bac clones (rp11-79f15 and rp11-88l18) are shown in figures 1 (rp11-79f15) and 2 (rp11-88l18) as the typical examples. since each individual contained a different number of core segmental duplication units, each individual showed bands having different motilities. the results of qpcr conducted for two bac clone regions are described in figure 3 (rp11-89b15) and figure 4 (rp11-79o18). for the former case, a part of a gene (meox2) was deleted. on the contrary, for the latter case, the copy number of a part of the gene (nsf) increased, but the copy number of the gene (wnt3) did not change. there are many segmental duplications which have already been summarized in a public data base, such as human genome segmental duplication database (tcag database; http://projects.tcag.ca/cgi-bin/variation/gbrowse), ucsc human genome browser (ucsc database; http:/genome.ucsc.edu/index.html), and ncbi map viewer (ncbi database; http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi). the cnv data obtained in our studies are summarized in table 1 in addition to the presence or absence of cnvs already reported in the databases. one bac clone, named rp11-115g22, was mapped on two chromosomes, 6 and 15 in tcag database, so it is likely that this clone is present on two discrete chromosomes. on the contrary, however, we accept the reports from the latter two databases and described that this clone was mapped on only chromosome no.15. with respect to segmental duplications, 10 out of 16 (about 63%) were present in the above databases (ucsc database, and ncbi database). it was noteworthy that the majority of bac clones containing our cnvs were known to overlap to at least one cnv reported in the database. however, that does not mean that our highly polymorphic cnvs are exactly the same as those reported in previous reports, since precise comparisons between our study and the other studies were not carried out. as mentioned before, there was very little information about the cnvs of 45 japanese individuals for which relatively large sizes of population have been systematically screened. we compared our data with the data of japanese including the hapmap project as reported by redon et al. ten out of 16 cnvs identified in our study were reported in the data reported by redon et al., although we should emphasize again that the cnvs identified in our bac region are not exactly the same as those reported by redon et al.. cnvs identified in our study with lower numbers tend to not be identified in redon's report. on the other hand, when our data are compared with redon's oligo-data from affymetrix 500ea array conducted for japanese, only two cnvs were overlapped to our cnvs. as redon et al. mentioned in their report, the reason appears to be that oligo arrays have some limitations for a complicated genome, such as segmental duplication areas. we summarized the genes and disease-related genes in omim which overlap to the bac-clone region with our cnvs (table 2). in addition to those two categories, mrnas have been also reported in the database, but they are too many to describe here. all bac-clone regions contained at least one mrna, although the functions of a majority of those mrnas are not known yet (data not shown). we examined 213 unrelated japanese using bac-acgh and found a total of 680 cnvs on 16 bac clones. a large fraction of the regions involved in the cnvs observed in our study (i.e., 625 out of 680 (92%), table 1) have been reported previously in other studies listed in the database. a majority (63%) of the cnvs had been found on the bac clones that overlapped with segmental duplication, suggesting the notion that segmental duplication might play a significant role in the creation of cnvs (table 1). in which they reported the sharing of cnvs among several populations, meaning those specific genomic imbalances either predated the dispersal of modern humans out of africa or arose independently in different populations. on the other hand, our cnvs, especially those showing high frequencies, were also identified by redon's work. on the contrary, our cnvs showing low frequency, such as less than about 10% of individuals, were not observed in their work (table 1). that result suggests that those cnvs might be identified if the number of individuals examined by redon et al. were increased to the level of our study (about 200 individuals). moreover, as described before, when our data compared with redon's oligo-data conducted for japanese, only two of their cnvs were overlapped to our cnvs. although the oligo-based method tends to detect smaller cnvs (about a few kilobases), this approach is less effective in tracking cnvs in genomic regions of complex structure, like segmental duplications, that are not sufficiently tagged by oligo targets. on the contrary, the bac platform can only identify larger cnvs (> 40 kb), but this method has some advantage for detecting cnvs present in the regions of segmental duplications. the cnvs in the human genome are often associated with developmental disorders and susceptibility to diseases. large duplications and deletions have been known to be present within the human genome based initially on cytogenetic observations in the course of etiological studies of congenital malformations (e.g., [1, 2]). the frequency of those duplications and deletions was presumed to be low and, for the most part, directly related to specific genetic disorders. a limited number of studies reported the presence of specific large duplications and deletions that were not apparently related to diseases (e.g.,). reported that cgh on a bac-dna-based microarray could reliably detect single-copy gene decreases or increases from normal diploidy. following this, other array platforms, such as cdna, and oligo-nucleotide, have been developed and many data from them have been reported. as we mentioned before, many cnvs were reported to be closely related to disease phenotypes, and recent studies based on advanced molecular technologies, such as genomewide association studies [2729] and next generation sequencing [30, 31], reported that many genes appear to play important roles in the etiology of common diseases. we report our highly polymorphic cnvs in bac clones, which were reported to contain genes, expected to be related to phenotypic heterogeneity of each individual, based on the tcag database. we focused on genes reported in the above database, although many mrna were listed in the database in addition to genes (table 2). bac clone (rp11-90a9) contains two genes: ankyrin repeat domain 34b (ankrd34b) and dihydrofolate reductase (dhfr). a phosphoprotein encoded by ankrd34b is induced during bone marrow commitment to dendritic cells which play an important role in vertebrate immunity. dhfr genes were reported to be related to various malignancies including lymphoproliferative disorders such as systemic non-hodgkin's lymphoma, primary central nervous system lymphoma (pcnsl), and childhood acute lymphoblastic leukemia. those two genes are fully overlapped to the bac clone (rp11-90a9). it is likely that the cnvs might affect the copy number of those genes. one bac clone (rp11-89b15) contains a gene mesenchyme homeobox 2 (meox2). the analyses by qpcr (figure 3) demonstrated that the copy number of gene (meox2) is deleted in the individual having cnvs detected by this bac clone. meox2 suppressed epithelial cell proliferation in cooperation with tgf-beta1, and mediated induction of the cell-cycle inhibitor gene p21. finally, the data from genome wide association study (gwas) reported that this is one of the candidate genes that might be associated with ischaemic stroke. another bac clone (rp11-115g22) was mapped on the chromosomes 15. (chrna7). that gene was used as a candidate target for examining interactions on the severity of adult attention deficit hyperactivity disorder (adhd). moreover, it was reported that the gene is one of the candidates for alzheimer's disease. the gene chrna7 is overlapped to the segmental duplication region of bac clone (rp11-115g22). many cnvs were listed in the databases mentioned as above, and those are overlapped to the gene. for those reasons, our cnv appears to be overlapped to the genes, and it might affect the copy number of gene chrna7. a bac clone (rp11-79o18) contains two genes which are n-ethylmaleimide-sensitive factor (nsf) and wingless-type mmtv integration site family, member 3 (wnt3). the qpcr results (figure 4) demonstrated that the copy number of a gene (nsf) increased but no change was observed in the gene (wnt3). that result suggested that the cnv might affect the nsf gene, but not the wnt3 gene. however, there may be an opportunity for the cnvs to become a surrogate marker of wnt3 for the future association study between the cnv and some disease phenotype. the nsf gene is one of the essential components of membrane fusion machinery which is an important homeostatic process in eukaryotic cells. a recent study showed that the nsf gene is a good candidate marker for association studies for genetic risk underlying parkinson's disease. the wnt3 gene's single nucleotide polymorphisms (snps) were used as candidate markers for association studies of hemorrhagic stroke, hypertension, and chronic kidney disease. upregulation of the wnt gene family, including wnt3, suggested involvement of the wnt's canonical and/or noncanonical signaling pathway in chronic lymphocytic leukemia. a bac clone (rp11-79f15) contains two genes: methyl-cpg binding domain protein 3-like 1 (mbd3l1) and cell surface associated mucin 16 (muc16). the protein is localized to discrete areas in the nucleus, and expression appears to be restricted to round spermatids, suggesting that the protein plays a role in the postmeiotic stages of male germ cell development. on the other hand, muc16 is a member of the mucin gene family and encodes cancer antigen 125 (ca125) which is a blood biomarker routinely used to monitor the progression of human epithelial ovarian cancer (eoc), although its potential role in eoc is poorly understood. maintenance of an intact mucosal barrier, one of whose components is a gene product of muc16, is critical to preventing damage and infection of wet-surfaced epithelia. as we demonstrated by southern blot analysis (figure 1), the polymorphism was caused by segmental duplications in the bac clone. the series of segmental duplications were on the 5-region of two genes (mbd3l1 and muc16). the cnvs do not affect the expression pattern of the genes, but these cnvs might be useful surrogate markers for future studies. glutamate receptor, ionotropic, (ampa 2). ampas are ligand-activated cation channels that mediate the fast component of excitatory postsynaptic currents in neurons of the central nervous system. since the size of the gene (ampa 2) is larger than that of the bac clone (rp11-231j7), it is likely that the cnvs affect the copy number of the gene. a bac clone (ctd-2100f13) contains two genes: rio kinase 3 (yeast) (riok3) and niemann-pick disease, type c1 (npc1). npc1 can have a function in the egress of certain membrane-impermeable lysosomal cargo. the membrane-bound npc1 and soluble npc2 play an important role for the release of cholesterol from lysosomes. as a result of that mechanism, the gene is associated with obesity [5658]. the bac clone (ctd-2100f13) is fully overlapped to both of the two genes (riok3 and npc1). the size of cnvs summarized in the databases shows that the reported cnvs were overlapped to both genes. we assumed that our cnvs may reflect the change of copy number of the genes themselves. since the genes mentioned are good candidate markers for enabling us to examine the etiology of common diseases and phenotypical heterogeneities among individuals, our highly polymorphic cnvs should be able to become good markers in future studies. we are currently planning to examine the same population using a high-density oligo-array platform to accumulate more cnv data for japanese. the reason, as mentioned before, is that the bac platform and oligo methods complement each other. the oligo platform is known to be more effective in detecting smaller cnvs (around a few kilobases), even though this approach is less effective in tracing cnvs in genomic regions of complex structure that are covered by the bac approach conducted in this study. we expect to construct a more definite japanese cnv database by the combination of bac- and oligo-platform arrays. we conducted population screening for 213 unrelated japanese, and observed 680 highly polymorphic cnvs. the majority of the polymorphic cnvs presented on bac clones that overlapped with regions of segmental duplication, and had been previously reported in other publications. moreover, it is expected that the cnvs might be good surrogate markers for detecting etiological genes, even if cnvs did not directly affect the genes themselves.

segmental copy-number variations (cnvs) may contribute to genetic variation in humans. reports of the existence and characteristics of cnvs in a large japanese cohort are quite limited. we report the data from a large japanese population. we conducted population screening for 213 unrelated japanese individuals using comparative genomic hybridization based on a bacterial artificial chromosome microarray (bac-acgh). we summarize the data by focusing on highly polymorphic cnvs in 5.0% of the individual, since they may be informative for demonstrating the relationships between genotypes and their phenotypes. we found a total of 680 cnvs at 16 different bac-regions in the genome. the majority of the polymorphic cnvs presented on bac-clones that overlapped with regions of segmental duplication, and the majority of the polymorphic cnvs observed in this population had been previously reported in other publications. some of the cnvs contained genes which might be related to phenotypic heterogeneity among individuals.

PMC3010704

pubmed-512

extracellular superoxide dismutase (sod3) is an enzyme known to catalyze dismutation of the highly reactive, superoxide anion into longer-lived and more stable hydrogen peroxide. the consequences of sod3 action in the cells reach beyond the antioxidative functions, as it has been shown to downregulate inflammation, stimulate cell proliferation during tissue injury recovery, and to counteract apoptosis [4, 5] by affecting cytokine production, cell signal transduction, and expression of survival-related genes. the anti-inflammatory properties of sod3 have been studied in models of pulmonary disease and peritonitis [2, 6]. previous work with collagen-induced arthritis (cia) suggests that both genetic transfer of the sod3 gene as well as a small molecular sod mimetic have the ability to ameliorate arthritis. the arthritis ameliorating effect of sod3 was later confirmed using sod3 knock-out mice. these results were explained on the basis that sod3 acts as an antioxidant and catalyses dismutation of superoxide into hydrogen peroxide, thus reducing inflammation-induced oxidative stress and restoring the oxidant balance in the arthritic joints [10, 11]. this explanation, however, is difficult to reconcile with the finding that animals naturally deficient in the induced oxidative burst in fact develop more severe arthritis [12, 13]. the most potent producer of superoxide, the substrate for sod3, is the well-characterized phagocytic nox2 complex. in inflamed tissues nox2 complex produces massive amounts of superoxide upon activation in a process called phagocyte oxidative burst. in addition to nox2, superoxide is produced from various other cellular sources, such as from the mitochondria during cellular respiration and by other members of the nox enzyme family. however, it should be noted that during inflammation these superoxide producers are not nearly as efficient superoxide producers as the nox2 complex. in the current work we studied the role of sod3 in collagen-induced arthritis (cia) to understand whether the therapeutic effect of sod3 on arthritis operates through attenuating the biological effects of the induced oxidative burst produced by the nox2 complex. to avoid artifacts introduced by chemical inhibitors of nox2 complex [1416] thus we used wild-type (ncf1) and ncf1 mutated (ncf1) mice on b10.q background. these strains differ at only one snp in the ncf1 gene, which makes the ncf1 strain unable to produce oxidative burst. the mutated mouse is more susceptible to induced arthritis due to hyperactivated t cells, and also increased susceptibility to thioglycollate peritonitis has been reported in the ncf1 knockout mouse. our results confirm the previously documented anti-inflammatory role of sod3 and additionally, for the first time, we show that it can downregulate both cia and peritonitis even in the absence of functional nox2 complex and phagocyte oxidative burst. the previously described ncf1 (protein also called p47phox) mouse, which carries a point mutation globally and completely abolishing nox2 complex derived ros production, has been backcrossed onto the b10.q background and shown to contain only the causative mutation using a 10 k snp typing chip. the mice were housed under specific pathogen-free conditions in climate-controlled environment and fed standard rodent chow and water ad libitum at turku university central animal facility. all experimental mice were sex- and age-matched, treatment groups were blinded, and experimental groups were mixed in cages in all experiments. the experiments were performed in accordance with the national and eu guidelines and the study was approved by the oulu section of the national animal experiment board (elinkoelautakunta, ella) with ethical approval numbers eslh-2008-02873, eslh-2008-07941, and esavi-0000497/041003/2011. replication deficient adenoviral e1-partially-e3-deleted adbglii vectors (developed from serotype ad5) expressing rabbit sod3 (ade-sod3) or bacterial -galactosidase lacz (ade-lacz) were used in both in vitro and in vivo experiments. collagen-induced arthritis (cia) was induced under isoflurane anesthesia by injecting 100 g rat type ii collagen (purified from chondrosarcoma) emulsified in complete freund's adjuvant intradermally at the base of the tail. arthritis was boosted day 19 with 50 g rat type ii collagen emulsified in incomplete freund's adjuvant intradermally at the base of the tail. disease development was evaluated macroscopically three times a week before the booster immunization and daily after the boost. one point was given for each swollen toe or joint and five points for a swollen ankle, each paw having the maximum of fifteen points. in the arthritis experiments ade-sod3, ade-lacz (vector control), and pbs (injection control) were injected locally in the left front paw in 25 l injection volume containing 2,5 10 pfu virus. injections were performed right after the booster immunization during the same anesthesia at day 19, before the onset of clinically apparent arthritis. briefly, mice were pretreated i.p. with 0.5 10 pfu ade-sod3, ade-lacz, or pbs three days before peritonitis induction with 5% proteose peptone (bd difco, sparks, md, usa) and 10 ng il-1 (r&d systems, minneapolis, mn, usa) in 1 ml pbs. after 18 hours peritoneal infiltrating cells were collected with 10 ml ice-cold rpmi cell culture medium. cells from the peritoneal lavage were counted and cytocentrifuged, slides were stained with reastain diff-quick (reagena, toivala, finland), and differential counting was performed under a standard light microscope. experiments were pooled and the total cell numbers are presented as percentual increase from the pbs injection control. all peritonitis results were normalized to adjust the vector control group (ade-lacz) mean to 100. cos-7 cells stably expressing all the essential components of the nox2 complex, namely, cybb (gp91phox), cyba (p22phox), ncf2 (p67phox), and ncf1 (p47phox) were provided by dr. cells were cultured in dulbecco's complete medium (gibco), 10% fetal calf serum, and penicillin-streptomycin (invitrogen, paisley uk). extracellular superoxide production was quantified two days after transduction (moi 4) with adenoviral constructs (ade-sod3 and ade-lacz) or medium control directly on the 96-well cell culture plate using an isoluminol-enhanced chemiluminescence method [22, 23]. briefly, the cells were washed with pbs, and 100 l of isoluminol buffer was added in each well. isoluminol buffer contained isoluminol (10 g/ml, sigma-aldrich) and horse radish peroxidase-type ii (4 u/ml, sigma-aldrich) dissolved in pbs with pma (200 ng/ml, dissolved in dmso, sigma-aldrich) and data collection was initiated immediately and followed at 37c as produced luminescence signal (tecan infinite m200, tecan, mnnedorf, switzerland) for 30 minutes. red blood cells were lysed from heparinized whole blood with hypotonic lysis buffer and leukocytes were surface stained with apc conjugated anti-gr-1 (rb6-8c5) and efluor 450 conjugated anti-cd11b (m1/70) antibodies (ebioscience). cells were suspended in high-glucose d-mem (gibco) with antibiotics without fcs and incubated for 10 min at 37c with 3 m dihydro-rhodamine 123 (dhr-123; molecular probes and invitrogen life technologies) followed by 20 min activation at 37c with 200 ng/ml pma (sigma-aldrich). the cells were washed into pbs and acquired on lsr ii flow cytometer equipped with facs diva software (bd biosciences). live cells were gated on the cell type, and geometric means of respective populations were analyzed with flowing software (cell imaging core, university of turku). isoflurane anesthetized animals with equal arthritis scores were injected intraperitoneally with 20 mg/kg l-012 probe (wako chemicals, germany) dissolved in pbs. the luminescent signal was detected with ivis 50 bioluminescent system (xenogen, usa) that consists of an anesthesia unit built in a light tight chamber equipped with a ccd camera. rna was isolated from the treated paws collected d25 according to the manufacturer's instructions with tri reagent (sigma-aldrich). the isolated rna was dnase treated with deoxyribonuclease i (fermentas) in the presence of ribolock rnase inhibitor (fermentas). the rna was used for reverse transcription reaction performed with revert-aid m-mulv (fermentas). the acquired cdna was subjected to q-pcr with ade-sod3 (fw: gtg tgc tcc tgc ctg ctc, rev: ctg ctc cac cgt gtc tga g) and -actin specific primers (fw: cta agg cca acc gtg aaa ag, rev: acc aga ggc ata cag gga ca), and the gene expression level was analyzed using sybr green pcr master mix (applied biosystems), icycler iq multicolor real-time pcr detection system (bio-rad), and the icycler (version 3.1) software. ade-sod signal was normalized against -actin expression levels and the results are reported as fold change from the ade-lacz group mean denoted as 1. statistical significance was analyzed by using two-tailed student's t-test or if more than two groups were analyzed one-way anova with lsd post hoc analysis was run using ibm spss statistics 19 software (spss inc.), p<0.05 is considered as statistically significant. adenoviral sod3 gene delivery reduced the superoxide predominant ros signal 37% compared to the ade-lacz control virus when investigated two days after transduction with ade-sod3 and ade-lacz viruses (figure 1). mice started to develop mild, clinically apparent arthritis at day 20 and made a full response, mean arthritis scores reaching 7 (out of the maximum of 15) in ade-laz treated and 3 points in ade-sod3-treated mice some days later. the mean disease score in the treated paws was lower in the ade-sod3-treated group when compared to the ade-lacz-injected control group, and the difference reached statistical significance at d26 (figure 2(a)). the treatment effect was only seen in the treated paw, while there were no differences between the treatment groups in sum scores of the three untreated paws (see supplementary figure 1(a) in supplementary material available online at doi: 10.1155/2012/730469) highlighting the local character of the used gene therapy vector expressing sod3. both virus vector treated groups showed elevated arthritis scores in the treated paws when compared to the pbs-injected control paws in the injection control group. this difference is illustrated in figure 2(b), where ade-lacz-treated paws are shown to have larger increase in arthritis score than the ade-sod3-treated paws. starting from d20 the ncf1 mice started to develop arthritis with significantly higher mean score than the wild-type mice. interestingly, the mutated mice without functional nox2 complex derived superoxide production also responded to ade-sod3 treatment. ade-sod3-treated paws of the ncf1 mice had significantly lower mean disease score than the ade-lacz-treated vector control paws at days 24 and 25 after arthritis induction. similarly to the wild-type mice, the difference in the mean arthritis score in nox2 complex deficient mice was observed when sod3 was highly expressed from the adenoviral vector (figure 3(a)). no differences were observed between the treatment groups in the sum scores of the untreated paws (supplementary figure 1(b)) again supporting the local character of the immunomodulatory effect of ade-sod3 treatment. similarly to the wild-type mice, ade-sod3 treatment in ncf1 paws induced significantly smaller difference between the virus-treated and pbs-injected paws than ade-lacz virus injection (significant d24 and d25 after immunization), again confirming the arthritis limiting effect of sod3 (figure 3(b)). the experiment was repeated and as the experiments were well reproduced, data from both experiments was combined for analysis. sod3 expression significantly reduced the number of peritoneal infiltrating cells in proteose peptone and il-1 induced peritonitis in wild type mice (figure 4(a)). the decrease in infiltrating leukocytes was mainly due to a lowered number of infiltrating macrophages (figure 4(b)), which well corresponds with the macrophage phase of peritonitis taking place three days after virus injection and 18 hours after peritonitis induction. both virus-treated groups had more infiltrating cells than the pbs-injected control mice. similarly as in the wild-type mice ade-sod3 was shown to reduce the number of infiltrating cells in the peritoneal cavity of ncf1 mice when compared to ade-lacz-treated mice. the difference was due to a significantly lowered number of infiltrating macrophages in the ade-sod3-treated mice (figures 5(a) and 5(b)). in the wild-type mouse both severely inflamed paws (right hind leg and right front paw) emitted strong ros-induced l-012 luminescence signal, while in spite of the severe inflammation, no luminescent signal was detected from the ncf1 mice (severe arthritis with arthritis score of 15 in both front paws and milder symptoms in the left hind leg) (figure 6(a)). monocytes (cd11b-pos, gr-1-lo, or gr-1-neg) and granulocytes (gr-1-hi, cd11b-pos) from ncf1 mice were unable to generate efficient ros production upon pma stimulation, while phagocytes from the wild-type animals responded to pma stimulation and induced significant increase in dhr-123 derived fluorescence signal detected by flow cytometry (figures 6(c) and 6(d)). quantitative rt-pcr revealed a a 5.5-fold (fc, fold change) expression of adenovirally produced sod3 mrna in the ade-sod3-treated joints collected at d25 when compared to the ade-lacz-treated vector control paws (figure 6(b)). sod3 is an enzyme that has been shown to give rise to therapeutic responses in damaged tissues such as reduced ischemia-reperfusion injury, arthritis, peritonitis, hind limb injury, and lung injury models. these tissue healing promoting and anti-inflammatory effects induced by sod3 are accompanied by reduced macrophage infiltration, inhibition of oxidative fragmentation of the extracellular matrix matrix, decreased apoptosis [4, 5], and enhanced cell proliferation. the beneficial effects of sod3 are mostly explained by its antioxidant properties and reduction of oxidative stress in the injured tissues. however, in this report we show that overexpression of sod3 downregulated inflammation even in the absence of phagocyte oxidative burst, thus highlighting the capacity of sod3 to affect cellular processes independently of nox2 complex ' superoxide production. the adenoviral gene expression system used in this work reaches its maximal expression around three days after the injection, after which the vector is eliminated by the immune system and the expression of the transgene slowly decreases to undetectable levels 14 days after the initial injection. we confirmed the presence of virally delivered sod3 mrna in the paws d25 and thus confirmed that the decrease in arthritis severity coincided with substantial adenovirus driven sod3 expression. similarly, pretreating the mice three days before induction of peritonitis allowed us to analyze the effect of sod3 during substantial sod3 expression in the peritoneal cavity. the percentual treatment effect in both inflammation models was comparable with the effect previously obtained with transgenic sod3 overexpression in pulmonary emphysema. similarly, the degree of sod3-induced macrophage infiltration inhibition in peritonitis was similar as reported previously. even though sod3 is an important local regulator of the acute inflammatory reaction, it is obvious that there are a number of other factors affecting inflammation severity in vivo. when the nox2 complex is not functional, there are still a number of other enzymes and enzyme complexes producing superoxide in the inflamed tissue. nox1 has been reported to worsen hyperoxia-induced acute lung injury in mice, and nox4 has been suggested to stimulate microglial il-6 expression and to hamper neurodegeneration after poststroke ischemia reperfusion injury. however, only nox2 is abundantly expressed on phagocytes and thus recruited to inflammatory foci. other nox family members are expressed on other cell types than phagocytes and their ros production is not upregulated during inflammation. in addition to the nox family enzymes, superoxide is also produced during mitochondrial respiration at levels corresponding to the general metabolic rate in the tissue. mitochondrial superoxide has also been linked to tlr2/4 signaling and is also suggested as a pathologic mechanism in tissue injury. all these superoxide generating processes, however, can not compensate for the massive production of ros by the nox2 complex during inflammation as the arthritic paws of ncf1 mice emitted no detectable luminescence signal when probed with l-012 dye (figure 6(a)). l-012 reacts with any radical to produce light and can not be used to distinguish between superoxide and hydrogen peroxide in vivo. as a tool to study the nox2 complex dependency of sod3, we used ncf1 mutated mice, in which a splice site point mutation abolishes the production of ncf1 protein leading to complete loss of nox2 complex derived oxidative burst. in line with previous reports, arthritis severity was significantly higher in ncf1 animals when compared to b10.q wild-type mice. mutated mice also developed arthritis quicker after the booster allowing us to work with a more homogenous and extremely well reproducible disease model. better arthritis synchronization in the mutated mouse model together with larger treatment groups resulted in less variability and increased statistical power in data analysis. in proteose the use of ncf1 mutant mice allowed us to avoid pit falls associated with the use of chemical nox2 complex inhibitors such as dpi and apocynin, which are not specific for the nox2 complex, do not provide full suppression of superoxide production and additionally profoundly affect various other cellular processes [1416]. in both arthritis and peritonitis, adenoviral gene expression vectors locally enhanced inflammation. the arthritis enhancing effect was restricted to the treated paw, as the virus-injected groups did not differ from the pbs-injected control group when their nontreated paws were analyzed. this is in line with previous reports where intra-articular injections of adenoviral gene expression vectors have been shown to induce increased paw swelling and elevated levels of inflammation mediators [33, 34]. intravenous injection route has not given rise to enhanced arthritis [3537], but has triggered liver inflammation; liver being the primary target of systemically administered adenoviral vectors. the immunogenicity of the adenoviral gene expression systems is well documented in the literature [3840]. sod3 polymorphisms are associated with copd, coronary artery disease, myocardial infarction as well as acute lung injury and related mortality. we report that sod3 limits inflammation in cia and peritonitis both in the presence and in the absence of phagocyte oxidative burst. the anti-inflammatory function of sod3 is not compromised by the lack of functionality of the nox2 complex as both ncf1 and ncf1 mice develop milder inflammation when treated with sod3. thus, we conclude that the anti-inflammatory effect of sod3 is not dependent on superoxide produced by the nox2 complex derived phagocyte oxidative burst and thus acts via other signaling pathways.

extracellular superoxide dismutase (sod3), an enzyme mediating dismutation of superoxide into hydrogen peroxide, has been shown to reduce inflammation by inhibiting macrophage migration into injured tissues. in inflamed tissues, superoxide is produced by the phagocytic nox2 complex, which consists of the catalytic subunit nox2 and several regulatory subunits (e.g., ncf1). to analyze whether sod3 can regulate inflammation in the absence of functional nox2 complex, we injected an adenoviral vector overexpressing sod3 directly into the arthritic paws of ncf1/ mice with collagen-induced arthritis. sod3 reduced arthritis severity in both oxidative burst-deficient ncf1/ mice and also in wild-type mice. the nox2 complex independent anti-inflammatory effect of sod3 was further characterized in peritonitis, and sod3 was found to reduce macrophage infiltration independently of nox2 complex functionality. we conclude that the sod3-mediated anti-inflammatory effect on arthritis and peritonitis operates independently of nox2 complex derived oxidative burst.

PMC3317049

pubmed-513

traumatic arterial occlusion following major or minor blunt trauma, especially in the absence of any other bony injury, is a rare phenomenon. motor-scooter handlebar syndrome is one such type of arterial occlusion affecting vascular structures following direct blow by a handlebar of a motorbike or bicycle to the groin. given their superficial course at this location, femoral vessels are the most common vascular structures affected. in all instances, injury to iliac vessels remains exceedingly rare, given its posterior position within the pelvis, representing only 0.4% of vascular injuries. in this case, we highlight a delayed presentation of external iliac artery occlusion secondary to motor-scooter handlebar syndrome, in a paediatric patient. pathophysiology and management of vascular injuries in the paediatric population vary significantly compared with the adult population. additional factors which need to be considered include: smaller vessel size or vessel spasm, higher risk of infection, tendency for re-stenosis and continuing growth. we review previous paediatric cases of this unusual vascular injury to highlight the pathology and most appropriate management option. a 15-year-old male presented to the emergency department following a direct blow from his bicycle handlebars to his groin. his abdominal examination was unremarkable, except for a small abrasion and visible mass in his right groin. after exclusion of other abdominal or chest injuries, he was discharged on the same day with a diagnosis of right groin haematoma and follow-up in 68 weeks. his symptoms included pain and paraesthesia in his right buttocks on mobilization>100 m. he was found to have absent peripheral pulses in his right leg, although it appeared well perfused with a normal capillary refill. an arterial doppler ultrasound showed a right external iliac artery thrombus occluding the proximal two-thirds of the vessel. a computed tomography scan of the abdomen and pelvis with intravenous contrast identified complete occlusion of the right external iliac artery 1 cm beyond its origin. however, the common femoral artery and profunda femoris remained patent via collaterals (fig. 1). he underwent a right external iliac thromboendarterectomy with patch repair using a saphenous vein graft. a suprainguinal incision was initially made in attempt to expose the proximal external iliac artery. due to its extent, retrieval of the entire thrombus was incomplete and a second groin incision near the junction of the common femoral with external iliac (at the inguinal ligament level) was required. the patient subsequently underwent a proximal and distal thrombectomy, and the arteriotomy was extended between the two incisions identifying an intimal stricture with significant fibrosis (fig. 2). an intimal flap was identified in the distal region and tacked down with a 7-0 prolene suture. the long saphenous vein was harvested and the defect closed with patch repair extending from proximal iliac to proximal femoral vessel. at the initial 2-week follow-up, the vessels remained patent and patient was progressing well. subsequently, regular biannual follow-up was planned to monitor for any longer-term complications. figure 2:occlusion of right external iliac artery 1 cm below its origin (white arrow). occlusion of right external iliac artery 1 cm below its origin (white arrow). motor-scooter handlebar syndrome is an uncommon form of arterial blunt injury following a direct blow by the handlebar of motorbikes or bicycles. only a handful of paediatric cases have been reported [1, 2, 47]. the common femoral vessel is the most commonly affected vascular structure. a common site for these injuries is at the inguinal ligament, where the femoral artery is superficial and courses anterior to the superior pubic ramus and femoral head. as such, it is prone to compression between the handlebar and posterior osseous structures. in addition, it is a relatively immobile structure, tethered by arterial branches, periadventitial connective tissue and the femoral sheath. they proposed that a circumferential tear of the intima leads to dissection and prolapse of the inner aortic layers, causing complete luminal occlusion., patients may remain asymptomatic until a period of growth spurt or they resume more rigorous physical activity. this can lead to delay in the diagnosis, and a high index of suspicion needs to be maintained to avoid ischaemic complications such as limb length discrepancy [8, 9]. in such instances, it is important to rule out any secondary occlusion of the femoral artery and vein that may predispose to the development of thrombosis within these vessels. duplex sonography should be carried out to assess flow velocities and waveform characteristics in these patients, and is especially suited to the paediatric population as they have reduced abdominal fat, and there is no radiation. identified ultrasound, in the right hands, to be highly sensitive (100%) and specific (97.5%) for the detection of arterial injuries when compared with surgical findings. open arterial thromboendarterectomy with graft or patch repair is the standard of care for such cases in trauma centres. previously documented cases include patch repair or bypass using saphenous vein, bovine pericardium and synthetic material [13, 5, 6]. one case was successfully treated with iv heparinzation alone. however, in most injuries, the presence of significant groin haematoma may limit anticoagulation, requiring more urgent operative re-vascularization. in our patient, delayed presentation and presence of significant collaterals meant definitive operative management could be planned as a semi-elective procedure. the role of endovascular intervention in this paediatric population has previously been documented mainly as a temporizing measure for revascularization [4, 5]. used a nitinol stent in the distal superficial femoral artery of a 13-year-old patient whose arterial and venous calibre at the time of injury were of inappropriate size for reconstruction. the main disadvantage of endovascular interventions in paediatric patients is the constantly enlarging calibre of the vessel with a fixed stent diameter. this can predispose to complications such as restenosis, stent fracture, stent dislocation and acute on chronic ischaemia. as a result, future vascular reconstruction may be compromised and in extreme cases, this may progress to significant ischaemia and even limb loss. we provide an unusual cause of external iliac occlusion secondary to bicycle handlebar injury to the groin. all patients presenting with groin injury from this mechanism should be carefully investigated with duplex sonography and monitored for risk of vascular injury. the presence of collaterals, particularly in the paediatric population, can lead to delay in diagnosis. literature seems to advocate open primary surgery for management of these injuries; however, endovascular and conservative medical management have also been used successfully. the latter two were contraindicated in our patient and open surgery was the most appropriate option. long-term follow-up, beyond the 12-month period, is needed, particularly in relation to known vascular complications including pseudoaneurysms, arteriovenous fistula formation and restenosis.

arterial occlusion following blunt trauma is an uncommon occurrence. we report an unusual case of delayed external iliac artery occlusion in a young male following blunt abdominal injury. he was successfully treated with thromboendarterectomy and saphenous vein patch repair. there have only been a handful of documented cases occurring in the paediatric population. all patients presenting with groin injury from this mechanism should be carefully investigated and monitored for risk of vascular injury.

PMC4345309

pubmed-514

nanotechnology deals with the production and stabilization of various types of nanoparticles (1). plants or natural resources have been found to be a good alternative method for nanoparticles synthesis, since this method does not use any toxic chemicals and does not require the use of high pressure, energy, and temperature. this green chemistry process has numerous benefits, including environmental friendliness, cost-effectiveness, and suitability for pharmaceutical and biomedical applications. at present, several groups of researchers concentrate on biomimetic approaches such as plant or plant leaf extracts, nuts, microorganisms and yeast to synthesize the metal nanoparticles called " green chemical or phytochemical " approach (2-5). antibacterial activity of the silver ion has been well established (6) and ag is currently used to control bacterial growth in a variety of applications, including dental work, catheters, and burn wounds (7,8). in fact, ag ions and ag-based compounds are highly toxic to microorganisms, showing strong biocidal effects on as many as 12 species of bacteria including e. coli (9). apart from these antimicrobial activities, ag-nps are also known to possess antifungal, anti-inflammatory, antiviral, anti-angiogenesis and antiplatelet properties (10, 11). the betel (piper betle) is the leaf belonging to the family piperaceae. the p. betle leaves possess antifungal, antiseptic, antihelmintic, antihypertensive etc., 2011 claim that ethanolic extract of p. betle leaves show antibacterial activity against some food borne pathogens (13). the aim of this study was to synthesize agnps using aqueous leaves extract of p. betle, characterized the agnps and evaluated the antibacterial activity of ag-extract nanoparticles against some gram positive and gram negative bacteria. collection of materials fresh young leaves of p. betle were collected from the local market of noakhali, bangladesh. silver nitrate (agno3), nabh4 and aniline were collected from the laboratory of department of pharmacy, noakhali science and technology university (nstu). preparation of p. betle leaf extract about 30 g of freshly, taxonomically authenticated healthy leaves of p. betle were collected in january 2014 from noakhali district of bangladesh. the leaves were washed thoroughly with double distilled water, cut into fine pieces and boiled with 150 ml double distilled water for 8-10 min. finally, extract of leaves was stored at refrigerator at 4 c till further use. biosynthesis of silver nanoparticles ag nanoparticles were made according to the recipe described in the literature (creighton, 1979; suh js et al.; briefly, a 100-ml aqueous solution of 1.0 x 10 m silver nitrate was mixed with a 300-ml aqueous solution of 2.0 x 10 m sodium borohydride. triply distilled water was used for solutions, and both solutions were chilled to ice temperature before mixing. by mixing both solutions, ag ions were reduced and clustered together to form monodispersed nanoparticles as a transparent solution in aqueous medium. the solution was stirred repeatedly whenever some dark color appeared for approximately an hour until it became stabilized. at this point this solution of ag nanoparticles was so stable that it did not change color for as long as several months without any stabilizing agent. because the particle concentration of the solution is only 3.3 nm, it was concentrated 10 times using a rotary vacuum evaporator. preparation of ag-extracts nanoparticles these above two solutions were mixed continuously for 30 min by magnetic stirrer and then stood for 2 h. after that uncoated ag-extract nanoparticles were prepared. coating of ag-extract nanoparticles with polyaniline coating on the extract-agnps were done according to the k. gopalakrishnan, 2012 (14). after that 68 ml (6 %) of h2o2 was added slowly at room temperature. the final product was filtered, washed with distilled water and then dried at room temperature. finally, samples were ready for further analysis (antimicrobial activity). the reaction mixture turned into dark brown color from its initial brownish-yellow color within 20 min of mixing. the reduction of pure silver ions was monitored by measuring uv-vis spectra of the reaction mixture. the absorption spectra of the samples were taken 240 to 540 nm using a uv vis spectrophotometer (hitachi, model u-2800 spectrophotometer). water was used as the blank. again, spectrum was recorded in ftir (ir prestige-21, shimadzu) in the range of 4000500 cm at a resolution of 4 cm. tem observations were carried out on an h-7100 electron microscope (hitachi, tokyo, japan). test microorganisms authentic pure cultures of staphylococcus aureus atcc 25923, salmonella typhi atcc 14028, escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were obtained from the department of microbiology, nstu, bangladesh. antimicrobial activity using kirby-bauer s disc diffusion method antibacterial activities of the ag-extract nanoparticles were determined according to kirby-bauer s disc diffusion method (2006) with slight modifications. the petri dishes were flooded with mueller hinton agar and after solidification of agar 0.1 ml of diluted inoculums were spread over mueller hinton agar in the dishes using sterile l spreader to achieve confluent growth of test organisms and allowed to dry for 10 min. the sterile readymade discs loaded with p. betle extract, agnps solution, uncoated agnps, coated ag-extract nps. the plates were then incubated at 37 c for 36 h. the plates were observed for the zone of inhibition. after incubation at 35 c for 18 h, the different levels of zone of inhibition were measured. characterization of the synthesized ag nanoparticles evaluation of ag-nps by visual assessment the formations of silver nanoparticles were confirmed through visual assessment. within 20 min of the reaction, color of the mixture turned into dark brown from its initial brownish yellow color. the appearance of dark brown color may be due to the reduction of agno3 (17). (a)agnps solution (b)aqueous extract of p. betle (c) ag-extract nps evaluation of ag-nps by uv spectrum uv vis spectrum of reaction mixture at different wavelengths ranging from 300 to 700 nm showed strong absorption peak with centering at approx. 400 nm (figure 2) indicated the formation of aqueous extract coated ag-nps. uv visible spectrum of agnps evaluation of ag-nps through ft-ir spectra the ft-ir spectra were used to identify the possible biomolecules (including functional group) responsible for the reduction of the agions and capping of the p. betle formed ag-nps. figure 3, showed the ftir spectra of p. betle aqueous extract and bio-synthesized ag-nps. ft-ir spectrum for curve (a) red color- p. betle aqueous extract; and curve (b) ag-extract nanoparticles the possible functional groups of leaf extract involved in coating nanoparticle are identified by ftir analysis. the intense absorption peaks at 3400 cm (curve-a, red color) and 3291.67 cm (curve-b, black color) correspond to n-h stretching of primary amine. the band observed at 3059.23 cm (curve-b) represents=c-h stretching. the weak band observed at 2917.46 cm and 2848.98 cm (both in curve-b) indicates the h-c-h asymmetric and symmetric stretching of alkanes. the band observed at 2340.72 cm and 2369.65 cm (both in curve-a), which are nearly the same band in curve-b, denotes the presence of hydrogen bonded oh stretching of carboxylic acids in leaf extract which may be a reducing/coating agent for silver nanoparticles. the band at 1617.38 cm (curve-a) and 1600.02 cm (curve-b) represents n-h bending vibration of primary amine. the peak occurs at 1496.83 cm (curve-b) for n-h bending vibration of sec. amine and at 1447.64 cm (curve-b) c-h bending vibration of alkane (ch3). the band observed at 1387.84 cm and 1379.16 cm (both in curve-b) represent n=o stretching of nitro groups of leaf extract coated on nanoparticles. the arising of functional groups in ftir spectrum indicates proper coating of leaf extract on silver nanoparticles. the bands at 1296.22, 1249.93, 1175.66, 1155.41 cm (curve-b), which are nearly the same in curve a, denotes c-h stretching vibration of ester. beside, c-o stretch occurs at 1072.47, 1026.17 (curve-b) where first is stronger and broader than the second. the band at 843.89, 829.43, 602.78, 668.36 cm shows c-h bending vibration of alkynes. the band at 751.31 cm and 691.51 cm represents the ortho substituted and mono substituted aromatic stretching respectively. the ft-ir results imply that the ag-nps were successfully synthesized and capped with bio-compounds present in the p. betle extract by using a green method. the tem image in figure 4 shows that ag-nps were well dispersed with a spherical structures and particle size ranging from 10 to 30 nm with some deviations. of the total particles, approximately 20% particles were of 10 nm, 50% were of 20 nm and remaining 30% particles tem image of bio functionalized agnps assessment of antibacterial activities antibacterial activity of p. betle formed ag-nps on s. aureus atcc 25923, e. coli atcc 25922, s. typhi atcc 14028, p. aeruginosa atcc 27853 values are the mean of three replicates sd (standard error). antibacterial activity of p. betle formed ag-nps on (a) s. aureus atcc 25923 (b) e. coli atcc 25922 (c) s. typhi atcc 14028 (d) p. aeruginosa atcc 27853 graphical representation of the antibacterial activity of p. betle formed ag-nps on s. aureus atcc 25923, e. coli atcc 25922, s. typhi atcc 14028, p. aeruginosa atcc 27853 the antibacterial activity of the aqueous extracts of p. betle leaves were analyzed against both gram-positive and gram-negative bacteria, which are presented in (figure 6, table 1). after analyzing the above results, it is clear that gram positive bacteria s. aureus is more susceptible than other experimental species of gram negative bacteria-e. coli, s. typhi, p. aeruginosa. maximum zone of inhibition 32.780.64 mm was found for s. aureus, whereas norfloxacin showed maximum 32.150.40 mm zone of inhibition for s. aureus. again, maximum zone of inhibition 29.550.45 mm was found for s. typhi, 27.120.38 mm for e. coli and 21.950.45 mm for p. aeruginosa. we have demonstrated a good method for developing a simple, safe, cost-effective, and ecofriendly preparation of agnps using aqueous extract of p. betle. the biosynthesized silver nanoparticles have spherical shapes and the particle size ranges from 10 to 30 nm approximately. the ftir spectra revealed the involvement of hydroxyl moieties and n-h bonding in the formation of ag-nps. they showed potential antibacterial activity against both gram-positive and gram negative bacteria. in our study we also found, gram positive bacteria are more susceptible on ag-extract nps rather than gram negative bacteria. application of these synthesized agnps based on our findings may lead to valuable discoveries in various fields, including medical devices and in the pharmaceutical and biomedical industries. the results obtained by this study can not be directly extrapolated to human; further studies should be undertaken to elucidate the exact mechanism of action by which agnps-extracts exert their antimicrobial effect which can be used in drug development program for safe health care services.

plants or natural resources have been found to be a good alternative method for nanoparticles synthesis. in this study, polyaniline coated silver nanoparticles (agnps) synthesized from piper betle leaves extract were investigated for their antibacterial activity. silver nanoparticles were prepared from the reduction of silver nitrate and nabh4 was used as reducing agent. silver nanoparticles and extracts were mixed thoroughly and then coated by polyaniline. prepared nanoparticles were characterized by visual inspection, ultraviolet-visible spectroscopy (uv), fourier transform infrared spectroscopy (ft-ir), transmission electron microscopy (tem) techniques. antibacterial activities of the synthesized silver nanoparticles were tested against staphylococcus aureus atcc 25923, salmonella typhi atcc 14028, escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853. uv vis spectrum of reaction mixture showed strong absorption peak with centering at 400 nm. the ft-ir results imply that ag-nps were successfully synthesized and capped with bio-compounds present in p. betle. tem image showed that ag-nps formed were well dispersed with a spherical structures and particle size ranging from 10 to 30 nm. the result revealed that ag-extract nps showed 32.780.64 mm zone of inhibition against s. aureus, whereas norfloxacin (positive control) showed maximum 32.150.40 mm zone of inhibition for s. aureus. again, maximum zone of inhibition 29.550.45 mm was found for s. typhi, 27.120.38 mm for e. coli and 21.950.45 mm for p. aeruginosa. the results obtained by this study ca nt be directly extrapolated to human; so further studies should be undertaken to established the strong antimicrobial activity of ag-extract nps for drug development program.

PMC5018287

pubmed-515

registration details of all 2,431 horses registered with the british palomino society were collected for the period 19832007 inclusive. of these animals, a further 207 animals were removed from the analysis as the true coat colour described for one or more parents was impossible to identify from the colour supplied. a further 39 animals (shaded in grey in table 1table 1.colour combinations which have produced a registered palomino in the society within the last 25 years) were removed from the analysis since parents with these combinations of details can not produce palomino offspring (e.g. chestnut chestnut). however animals where there was ambiguity regarding the exact colouration (e.g. grey which could be represented by one or more recognised coat colour), were kept in the analysis, provided they could be explained by one of the possible sources of palomino offspring listed in. details of the animal s name and the coat colour of both parents were collated. throughout the year the society hold shows varying from small county shows to a large annual national championship. many classes at local shows may only have one or two horses exhibited. to ensure that the results were comparing like with like, the data analysed focused entirely on the british palomino national championship show, where each class generally has more animals exhibited than would be the case in local shows. at this show there are two major categories (ridden and in-hand) with in-hand classes placing more emphasis on colouration of horses (80% of available marks). since the national championship has the greatest number of exhibitors and the emphasis on colour is greatest for in-hand classes, the investigation into show success was restricted to animals placed in the in-hand classes at the national championships in the following nine categories: under 148 cm stallion, mare, yearling, 2&3 year old; over 148 cm stallion, mare, yearling, 2& 3 year old and geldings 4 years and over. registration details for all animals placed (i.e. top four prizes) in any of these classes were consulted from the database. in the first instance, this analysis took no account of which prize an animal won and also took no account of how many times an animal won a prize (e.g. in consecutive years). it also meant that any animal which had been placed but did not fall into the group of 801 (e.g. one of the 1,630 animals where both parents could not be identified) were not included in the analysis of prize winners. the relative distribution of parental coat colours between all 801 animals registered and the 90 which had been placed at shows was calculated. analysis was performed to compare relative values of parental coat colour between those animals registered with the society, and those placed at the national show. those combinations for which the expected value was less than 5 were treated as a single group in analysis, meaning that five groups were used: chestnut cremello; chestnut dun; chestnut palomino; palomino palomino; and all others. due to certain factors having expected values which were low, this analysis was repeated using fisher s exact probability test. table 1 shows that the largest number of registered palominos in this work, where the coat colour of both parents could be identified, came from a chestnut cremello mating, which is the only parental cross which guarantees a palomino offspring. since 356 of the animals (i.e. 44%) in this study were this type of cross, these data are supportive of the hypothesis that a large proportion of palominos registered with the society were intentionally bred for their colouring. table 2table 2.colour combinations which have produced a prize-winning palomino at the society s show within the last 25 years shows that the largest number of the palominos placed at least once at the national championships also came from a chestnut cremello mating. hence of the 90 (following removal of 1 animal shaded in grey) animals placed during this time, 60 (i.e. 67%) resulted from the only mating type guaranteed to give palomino offspring. both tables show that a large number of animals either registered with the society or placed at the national championship are the result of a chestnut cremello mating. moreover, the percentage of horses resulting from a chestnut cremello mating is higher for animals placed at the show than it is for the list of animals registered. given this observation a calculation was performed to determine if the number of chestnut cremello animals which were placed at the national championship was significantly higher than the figure based on that expected from registration details. since the expected number of some parental combinations was low (i.e. less than 5) the only pair-wise combinations which could be used to derive an expected value were: chestnut cremello; chestnut dun; chestnut palomino; and palomino palomino. all other combinations where an animal had been registered with the society (e.g. bay palomino) were treated as a single expected value. this resulted in the two datasets being different (p=2.8 10) with proportionally more of the chestnut cremello matings being successfully exhibited relative to those registered. when the analysis was repeated using fisher s exact probability test to compensate for the fact that certain expected values were low, this also suggested that the differences between the populations was significantly different (p=4.5 10). it is also interesting to note from table 2 that every single animal which was placed at the show over the last 25 years whose parents coat colours could be identified had at least one parent which was a palomino, a chestnut or a cremello, and 77 of the 90 had both parents falling into one of these colourings. when the analysis was restricted to only those horses which won first prize in a particular class at the national championships, only 35 horses could be identified where the colouration of both parents had been recorded (table 3table 3.colour combinations which have produced a palomino which won first prize in its class at the society s show within the last 25 years). of these animals 22 (63%) the remaining animals were chestnut bay (4); palomino palomino (3); chestnut palomino (2) and 1 each of black palomino, chestnut dun, chestnut skewbald and cremello grey. thus the values for considering chestnut cremello animals winning first prize versus those for any of the four places, are relatively similar (67% versus 63%). the second category investigated was one which extended beyond the national championship, and looked at a points scheme, whereby horses are awarded a certain number of points every time that they are placed at any show at which points are available. here analysis was restricted to horses which finished in the top eight for their cumulative score for any particular year. this allowed only 22 horses to be studied where the colouration of both parents could be identified. of these horses, 13 (59%) were the product of a chestnut cremello mating with the remaining horses being palomino palomino (5); chestnut palomino (2); and cremello bay (2). however, interestingly of the 7 horses which won the annual points scheme (with one of the horses winning it in two consecutive years), only one horse (a chestnut palomino) was not the result of a chestnut cremello mating. this work is constrained by some potential limitations in terms of conclusions which may be drawn. for example, judging of animals always has a degree of human subjectivity associated with it. moreover, many animals which are registered with the society may never be exhibited. hence it is possible that some of the animals which could have been prize-winning stock were not given the opportunity to fulfil their potential. in addition, due to restricted information being provided to the society by owners at the time of registration, only around a third of horses registered with the society met the criteria regarding parental information needed for inclusion in these analyses. despite these possible limitations, one observation is very interesting, that the showing success achieved by the only possible parental combination which guarantees a palomino foal is disproportionally larger than that seen for registration of foals with the society. this is true for all definitions of success investigated: horses winning any prize at the national championship; horses winning first prize at the national championship; horses which finished in the top 8 of the annual points scheme; and horses which won the annual point scheme. the reasons for this are uncertain, as there are a range of shades which are acceptable for society membership and a range of parental combinations which can achieve a palomino offspring. this is true for both the initial inspection at the time of society registration, and also for horses being exhibited at shows. part of the reason for this is that the colour of the horse can vary (e.g. bleaching of hair colour following periods in the sun). however, it appears that the possible shade, or shades, of coat colour resulting from chestnut cremello matings are also those which are most likely to appeal to judges at shows. this in turn poses an additional question; has the society s ideal colour definition been influenced in favour of matings which are most likely (or even guaranteed) to produce a palomino foal ?

although various combinations of parental coat colours can produce a palomino foal, examination of records of the british palomino society suggest that many animals registered with the society resulted from matings which maximise the likelihood or even guarantee a palomino foal. when show records were examined, it was clear that the colouration preferred by judges corresponds to that of the only pair-wise parental combination guaranteeing a palomino foal.

PMC4013964

pubmed-516

vascular complications are the most frequent adverse outcomes associated with percutaneous coronary intervention (pci) via the femoral artery. they contribute to in-hospital morbidity, mortality, and costs; and furthermore, are associated with increased long-term risk of myocardial infarction and death. vascular complications include bleeding, pseudoaneurysm formation, hematoma, arterio-venous fistula, retroperitoneal bleeding, and other femoral arterial injuries requiring procedural or surgical intervention. abdominal wall hematoma is a rare condition that can give rise to an acute abdomen. in this report, we describe a case of a 73-year-old woman who developed an abdominal wall hematoma, which is a rare but serious complication of a pci via the femoral approach. a 73-year-old woman, with a past medical history of hypertension, diabetes mellitus for 40 years, and chronic kidney disease stage 5, because of diabetic nephropathy, presented to the emergency department with dyspnea (nyha iv). the patient had the following vital signs: blood pressure: 155/63 mmhg; pulse: 93 beats per minute; respiratory rate: 28 breaths per minute; and her body temperature was 36.0. on physical examination, the patient had no notable findings, other than bilateral expiratory rales and neck vein distention. an electrocardiogram was within normal limits. a chest x-ray revealed marked cardiomegaly and pulmonary edema. laboratory tests showed the following: white blood cell count: 10300/mm, hemoglobin: 8.3 g/dl, platelet count: 250000/mm, blood urea nitrogen: 63 mg/dl, creatinine: 4.4 mg/dl, brain natriuretic peptide: 483 pg/ml, creatine kinase isoenzyme mb: 2.0 ng/ml, and troponin-i: 0.10 ng/ml. the patient received emergency hemodialysis because of pulmonary edema refractory to medical therapy, including high-dose furosemide infusion. after stabilizing the patient s volume status by regular hemodialysis, she received coronary angiography for the evaluation of ischemic heart disease on the 19th day of admission. the patient took aspirin (300 mg) and clopidogrel (300 mg) loading dose 12 hours before the procedure. when the 0.025-inch straight guidewire (45 cm, terumo, tokyo, japan) for a 4 french sheath was advanced, some resistance was felt. we then checked the fluoroscopy and found that the guidewire was introduced into the circumflex iliac artery (fig. 1a). we promptly pulled the guidewire back from the circumflex iliac artery and advanced it into the abdominal aorta under fluoroscopic guidance. the external iliac artery and circumflex iliac arteries were intact, there were no changes in the patient s vital signs, and no abdominal symptoms were found, therefore, we continued the coronary angiography without incident. (a) hydrophilic guidewire is unintentionally introduced into the circumflex iliac artery (arrow). the circumflex iliac artery is intact and there is no evidence of perforation (arrow). coronary angiography revealed significant stenosis in the middle and distal segments of the right coronary artery and the middle segment of the left anterior descending artery. after 7000 iu of heparin was administered intravenously, we performed a pci at the middle and distal right coronary artery and the mid-left anterior descending artery with an activated clotting time (act) of more than 300 seconds, without any immediate complications. because the act remained prolonged fourteen hours after pci, the patient complained of a right abdominal pain, with mild swelling of her right abdomen. we started hydration with normal saline and performed a transfusion of 2 pints of packed red blood cell because of an abrupt drop of hemoglobin from 9.3 to 7.3 g/dl over 12 hours. the sheath site was clear with no evidence of bleeding, hence, we performed an abdominal computed tomography angiography to identify other causes of the bleeding, which revealed a right lateral abdominal wall hematoma about 5 cm in diameter (fig. the right circumflex iliac artery was located in the hematoma, but there was no evidence of active extravasation of contrast media. the patient s vital signs remained stable after hydration and transfusion, so we decided to closely observe her. however, the patient still complained of abdominal pain and ecchymotic patches appeared on her abdomen 3 days after the procedure (fig., the patient underwent intermittent hemodialysis with minimal use of heparin and had her hemoglobin checked daily. the patient was discharged uneventfully after 26 days of hospitalization (7 days after pci). she was discharged on aspirin (100 mg), clopidogrel (75 mg), rosuvastatin (10 mg), losartan (50 mg), and carvedilol (6.25 mg). transverse (a) and coronal (b) section show right-sided abdominal hematoma and circumflex iliac artery (arrows). abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after cardiac and peripheral angiographic procedures.1) predisposing factors include increased sheath size, repeat or multiple punctures of the artery, concomitant use of anticoagulants, advanced age, being female, and hypertension.2)3) there are two types of abdominal wall hematomas: spontaneous and iatrogenic. iatrogenic hematomas often occur when the circumflex iliac artery is perforated during the insertion of the guidewires, although this is a rare complication.4) these hematomas are distinguished from retroperitoneal hematomas, which occur when a physician unintentionally punctures the inferior epigastric artery or cannulates the femoral artery too superiorly. there have been cases of spontaneous abdominal wall hematomas in patients with some predisposing factors, although the incidence is very low.5)6) the common symptoms of abdominal wall hematoma are the sudden onset of abdominal pain and swelling, which usually occurs several hours after the procedure. because of its rarity, abdominal wall hematoma can be mistaken for several common acute abdominal conditions, such as appendicitis, sigmoid diverticulitis, perforated ulcers, ovarian cyst torsion, tumors, and incarcerated inguinal hernias.7) diagnosis can be made clinically by the appearance of an obvious swelling or bruising, or may include non-specific findings, such as anemia and fever. imaging studies help to confirm the diagnosis and exclude intra-abdominal hemorrhage.8) contrast-enhanced ct can detect and evaluate active bleeding from a rupture site. even in patients without contrast extravasation at the bleeding site as observed on a ct, angiography could be a useful imaging technique to identify an active bleeding point.9) conservative management, including bed rest and analgesics, is appropriate for most stable patients. however, when a patient has evidence of sustained bleeding, angiographic interventions or surgery should be considered.10) in order to prevent vascular complications, such as abdominal wall hematomas or pseudoaneurysms, puncturing the femoral artery under fluoroscopy guidance may be considered.11) after the artery has been successfully punctured, the guidewire must be smoothly advanced through the cannula. the cornerstone of safe sheath engagement is to stop when resistance is encountered during the insertion of the guidewire. difficulty in advancing the guidewire may occur when the wire enters a small branch vessel. after confirming the location of a wire by fluoroscopy, one can then retract the wire, spin it gently, and try advancing it again. in this situation, one must consider angiography to assess for the occurrence of complications, such as vessel perforation and dissection. when vascular complications are suspected, pci should be delayed with a discontinuation of antithrombotic agents, as well as close observation of the patient. because hydrophilic guidewires tend to unintentionally engage small vessels, replacing the straight hydrophilic guidewire with a j-tipped wire can be one strategy for preventing the perforation of small vessels. in general, it can not be overemphasized that it is important to closely observe patients who have undergone pci, especially with those with predisposing factors for bleeding, even without any evidence of immediate vascular complications. in the present case, there was an unusual development of an abdominal wall hematoma after a pci, in the absence of immediate vascular complications. thus, we suggest that the following may be causative factors of a delayed abdominal wall hematoma following a pci: injury to the circumflex artery during guidewire insertion and the subsequent prolonged act associated with the use of periprocedural heparin in patients with chronic kidney disease. this case reminds medical professionals of the importance of close observation and proper evaluation of complications after percutaneous coronary intervention, even if the rates of these complications are very low. fluoroscopy-guided femoral artery puncture and guidewire insertion may reduce the rate pci-related vascular complications. when vascular complications are suspected during the procedure, a staged pci should be considered to prevent periprocedural vascular complications and ensure a patient s safety. with more coronary angiographic procedures being performed, it is important for clinicians to consider the possibility of abdominal wall hematoma in this situation, especially when the patient has many predisposing factors.

abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after coronary angiographic procedures. in particular, an oblique muscle hematoma caused by an injury of the circumflex iliac artery is very rare, yet can be managed by conservative treatment including hydration and transfusion. however, when active bleeding continues, angiographic embolization or surgery might be needed. in this study, we report an uncommon case of injury to the circumflex iliac artery by an inappropriate introduction of the hydrophilic guidewire during the performance of a percutaneous coronary intervention.

PMC4891606

pubmed-517

for the invasive treatment of symptomatic aortic stenosis several attractive options became available beyond conventional cardiosurgical implantation of stented bioprostheses or mechanical valves. besides stentless prostheses, in particular transcatheter procedures are of growing importance. nevertheless the number of implanted stented bioprostheses in germany expanded or at least remained stable over the last years. thus, 9.704 bioprostheses were implanted in germany in 2010, according to 84% of all implanted prostheses in aortic position. implantation of bioprostheses was associated with a 30-day-mortality of 3,3 %, which is higher than for mechanical valves (1,5%) due to the fact that patients for bioprostheses are significantly older or suffer from more complex co-morbidities. the purpose of this review is to summarize the features of the currently available bioprostheses in the light of competing procedures. there has been a continuous development to improve the design of stented bioprostheses with respect to hemodynamic profile, biological durability and ease of implantation. various designs are available, allowing a valve selection according to individual patient factors or anatomical criteria including techniques for intra-annular and supra-annular positioning [3, 4]. it would have the same biological and hemodynamic properties as a normal valve and would not undergo degeneration. stented bioprostheses have proven to be effective even in small aortic roots regarding hemodynamic improvement, left ventricular mass reduction and improvement of the patient s quality of life. in vitro examinations showed pericardial valves to be slightly superior to porcine valves with regard to gradient and orifice area. associated with the scalloped designs of stented bioprostheses a tension-free implantation with avoidance of paravalvular leaks can be expected. implantation techniques evolved over the last decades which resulted in short cross-clamp times in normal findings. surgeons learned that meticulous care in decalcifying the aortic annulus and sizing helps to prevent paravalvular leaks. additionally, accurate sizing prevents a patients-prosthesis-mismatch which could result in poor postoperative clinical performance. avoiding the use of running suture for stented valve implantation the evolvement of low profile valves reduces the risk of coronary occlusion in patients with a small distance between annulus and coronary ostia. the currently available and established bioprostheses show rates of degeneration at 20 years around 15% in patients aged 65 or higher. the freedom from repeat aortic valve replacement reaches over 85% after 20 years in patients older than 60 years and 65% in all age groups. along with these convincing results of durability and freedom of re-implantation stented bioprostheses became also attractive for younger patients. if a repeated valve replacement is necessary due to functional deterioration the operative mortality is acceptable with 4 to 6% and is mainly due to active endocarditis and comorbidities. lately transcatheter aortic valve implantation (tavi) with valve-in-valve implantation into the degenerated xenograft showed to be an additional option in high risk patients with the need for redo valve replacement. stentless porcine valves were initially believed to have superior hemodynamic properties resulting in more effective reduction of left ventricular mass and better clinical performance according to nyha class. these findings could nt be yet approved by long-term follow up investigations [15, 16]. bearing this in mind calls the more demanding implantation technique of stentless prostheses in question. stented bioprostheses are still used more commonly than stentless ones because of their relative ease of implantation, their extensively documented long-term results, and the low risk associated with reoperation. another biological approach is the use of an autograft like the ross procedure, where the patient s pulmonic valve is transferred to the aortic position. these pulmonic autografts have excellent hemodynamic properties as well as low rates of thrombosis, degeneration, and endocarditis. the ross procedure is suitable for children and young adults because it is compatible with further growth of the aortic root. nevertheless since the pulmonary valve has to been replaced by a bioprosthesis it is a demanding two valve procedure with prolonged cross clamping times. aside from this, special means are necessary for pulmonary autograft stabilization to prevent its degeneration. there are only a few current randomized trials comparing the long-term results of biological and mechanical valves. a large-scale review revealed no difference in survival rates at 10 years and a slightly higher survival rate at 15 years for patients with mechanical prostheses. the reoperation rate for mechanical valves in the aortic position is less than 5% at 10 years and less than 10% at 15 years, while the corresponding figures for bioprostheses are 10% and 30%, respectively. hemorrhagic complications are significantly more common in patients with mechanical valves because of anticoagulation. chronic atrial fibrillation is no longer a contraindication to bioprostheses since permanent oral anticoagulation can be avoided if concomitant ablative surgery results in permanent conversion to sinus rhythm. end stage renal failure was also defined a contraindication to bioprostheses since a rapid degeneration was feared due to altered metabolism in these patients. it has been found that life expectancy is already curtailed to such an extent that bioprosthesis degeneration often does not occur in the remaining lifetime. the supposed advantage of the longer durability of a mechanical valve is also offset by the potential complications of oral anticoagulation, especially because anticoagulation is more difficult to manage in dialysis patients than in others. nevertheless aortic valve replacement using a tissue valve remains controversial for patients younger than 60 years since there are studies reporting reduced mid-term results. some younger patients are averse to oral anticoagulation and therefore prefer a biological valvular prosthesis. thus, younger patients opting for a bioprosthesis can enjoy a normal quality of life without anticoagulation for many years but may need to undergo a second valve replacement procedure with an acceptable degree of risk. implantation of conventional prostheses can be performed through a limited direct access like a hemi-sternotomy or a lateral access. reported large series show that aortic valve operations can be safely performed in experienced centers. substantial progress in valve technology led to the development of self-expanding valves. since a few years a number of bioprostheses are available for suture-less implantation which is usually combined with a limited surgical access.. future will show the benefits of this procedure characterized by short cross clamping times and whether it can coexist with tavi procedures. after its clinical inauguration by cribier in 2002 the transcatheter aortic valve implantation gained widespread use in high risk patients with aortic stenosis. in germany a massive increase of its application can be observed; in 2010 nearly every fourth aortic valve replacement was performed as a tavi procedure. the partner trial was a randomized trial comparing tavi with standard-of-care therapies in high risk patients. a 2-year follow-up of patients in the partner trial supports lately tavi as an alternative to surgery in high-risk patients. the two treatments were similar with respect to mortality, reduction in symptoms, and improved valve hemodynamics, but paravalvular regurgitation was more frequent after tavi and was associated with increased late mortality. there are a growing number of publications reporting promising short term results in high risk patients. nevertheless there is still a lack of evidence that tavi is superior to open valvular replacement as the gold standard regarding long-term results. current guidelines recommend the use of tavi restricted to patients with contraindications for open surgery or inacceptable perioperative risks. current studies reveal that bioprostheses of the most recent generation last longer than earlier types. because life expectancies in general have risen, more and more elderly patients are presenting for valve replacement and for these patients a bioprosthesis is usually chosen. in addition the cost effectiveness of stented bioprostheses appears unbeatable and the surgical ease of implantation allows for cross-clamp times between 30 and 60 minutes. overall, even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis. especially in the light of growing use of interventional valve replacement there is the urgent need for complete nationwide registry with adequate long term follow up, quality of life information and relevant subgroup analysis to define new standards in the treatment of patients with aortic stenosis.

introductionbiological stented prostheses are currently the main type of prosthetic valve used for aortic valve replacement. the ratio of bioprotheses to mechanical prostheses has switched in the last 15 years; the percentage of biological prostheses implanted has risen from 30% to 85 %. moreover the total number of implanted stented bioprostheses remained stable over the last years despite competing procedures like stentless prostheses or transcatheter aortic valve implantation. methodsa literature search of all published aortic valve replacement studies was performed from january 2000 through may 2012. resultsthe recommendations guiding the type of heart valve replacement have been revised in recent years. of particular interest are the new generation of biological prostheses with extended durability, a decrease in mortality of reoperation and an increase in life expectancy. comorbidities such as chronic renal insufficiency or chronic atrial fibrillation are no longer contraindications to bioprostheses. conclusionoverall, even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis.

PMC3484933

pubmed-518

while decreases in both breast cancer incidence and mortality have been apparent in recent years, the societal and economic impact of this malignancy continues to be enormous. positive associations between environmental and individual factors and increased risk of breast cancer development have been alleged for at least a century. several progresses were made in understanding the underlying mechanisms of cancer development and some drugs were recently approved for the preventive approach of this disease. thus, the current thinking is that prevention is a highly feasible approach to breast cancer control. despite several factors which increase the woman ' risk (gender, age, and family history) are not changeable, other modified risk factors such as alcohol intake, dietary fat, obesity in postmenopausal age, and hormonal stimulations have been identified and for these reasons interest in strategies to prevent breast cancer remains strong and intriguing. cancer chemoprevention is defined as the use of natural, synthetic, or biochemical agents to reverse, suppress or prevent carcinogenic process to neoplastic disease. the epithelial carcinogenesis is a multistep, multipath, and multiyear disease of progressive genetic and associated tissue damage (figure 2). in detail, the carcinogenetic process starts with unspecified accumulations of genetics events which lead to a progressive dysplastic cellular appearance with genotypic and phenotypic alterations, deregulated cell growth, and finally cancer. this process is similar in every epithelial cancer, and the ability to arrest one or the several of these steps may impede or delay the development of cancer. although the precise mechanism that causes breast cancer is not fully established itis recognized that hormones play a significant role in almost 70% of cases and current chemopreventive strategies have targeted hormonally responsive breast cancers. estrogen is well established as a promoter of cell division in the breast, where it causes proliferation of both normal and malignant cells. the two major classes of antiestrogenic drugs, the selective estrogen receptor modulators (serms) and the aromatase inhibitors (ais), have been recently used for their activity in breast cancer prevention. this class of drugs includes in particular tamoxifen (tam) and raloxifene, acting as both estrogen agonist and antagonists. tamoxifen citrate is the first generation of serms that competes with circulating estrogen for binding the estrogen receptor (er). like tamoxifen, also raloxifene, a second generation of serms, has both estrogen agonist and antagonist properties. tam has been in clinical use for breast cancer treatment for more than 30 years to reduce the risk of both recurrence and contralateral neoplasia, 42% and 47%, respectively. these data lead to choose tam as a potential chemopreventive agent, and several studies were conducted in last decades in this particular setting. the bcpt nsabp-1 was a placebo-controlled trial of tam in more than 13000 women at high risk of breast cancer. women were randomized to receive tamoxifen 20 mg/die or placebo for 5 years. this trial was closed early after the interim analysis showed a 49% reduction in incidence of invasive breast cancer in the treatment arm. moreover, the highest level of benefits was observed in patients with precancerous lesions as lcis (relative risk=0.44) and atypical ductal hyperplasia (relative risk=0.14). tamoxifen appeared able to reduce breast cancer incidence also in healthy brca2 carriers by 62% but not in brca1. the study showed also an increased risk of endometrial cancer and thrombotic events, and these conclusions suggested that despite its extraordinary preventive efficacy the utilization of tam in this particular setting should be extremely individualized. the results of this study were the first to show the benefit of tam in breast cancer prevention. in addition, 3 european tamoxifen prevention trials have been completed and have reported long-term follow-up data of the effect of this agent in bc incidence: the italian tamoxifen prevention study, the royal marsden hospital tamoxifen randomized chemoprevention trial, and the international breast cancer intervention study (ibis)-1. although they differ in many details in study design and other, these trials were similar enough to be evaluated together in an overview of their main outcomes. their combined data indicate an overall 30 to 40% reduction in breast cancer er-positive incidence following 5 years of tam versus placebo (figures 3 and 4), and these effects remains also after more than ten years of followup. the serious adverse events that occurred with tam were as anticipated from previous adjuvant trials, an increase of endometrial cancers and venous thromboembolic events (vtes). other expected tam-associated toxicities were observed as cataracts, hot flushes, and vaginal discharge. the data from the nsabp p-1 trial, which showed a reduction in both invasive and noninvasive breast cancers, led to the 1998 us food and drug administration (fda) approval of tam for reduction of breast cancer incidence in high-risk women. however, the adverse effects of this drug have hampered its uptake by women at increased risk. when tam's benefits are balanced against its major toxicities, younger women at very high risk and possibly hysterectomized postmenopausal women appear to be the best candidates for preventive tam. a simple and economic approach to retain tamoxifen efficacy while reducing the risks may be a dose reduction. in a study conducted by our group, standard dose of tamoxifen (20 mg/die) and two differ lower doses (10 mg/die and 10 mg on alternate days) were administered for 2 months in a cohort of more than 120 healthy women, and changes in serum biomarkers regulated by the er were evaluated. no evidence for a concentration-response relationship was observed for most of these biomarkers. the concept of dose reduction was further supported by the observation of tamoxifen as very high tissue distribution (560 times its blood concentrations) and a prolonged half-life. moreover, the low-dose concept has been confirmed in a preoperative trial in which 120 breast cancer women were treated with either 20, 5, or 1 mg/die of tam for 4 weeks before surgery. the effects of these different doses of tam on proliferation were analyzed using the ki67 expression as the main surrogate endpoint marker. interestingly, the change in ki67 expression induced by lower doses of tamoxifen was comparable to that achieved with the standard dose, implying that low-dose tam retains its antiproliferative activity. moreover, several blood biomarkers of tam estrogenicity associated with the risk of breast cancer, cardiovascular disease and bone fracture showed a dose-response relationship, and suggesting that this approach may be associated with reduced, positive and negative oestrogenic effects of tam. these fundamental data provide a strong rationale for the formal assessment of low-dose tam in preventive setting, and for these reasons we started two phase iii randomized placebo trials (actually ongoing in our institute) in order to assess the efficacy of 5 mg/die of tam in high-risk women as current hrt (hot study) and with breast intraepithelial neoplasia (ien). raloxifene, a second generation of serms has reduced the incidence of breast cancer in preclinical models and several clinical trials evaluated it for the prevention of osteoporosis and heart disease [2022]. raloxifene, which has a well-established and favourable effect on bone metabolism, was in fact initially approved (by fda) for the prevention and treatment of osteoporosis in postmenopausal women. in the multiple outcomes of raloxifene evaluation (more) trial, raloxifene (60 mg or 120 mg compared to placebo) shows a 30% reduction in the risk of vertebral fracture in postmenopausal women with osteoporosis. one of the secondary endpoints of the study was the incidence of breast cancer in this target of population, and in raloxifene-treated group the risk of invasive breast cancer was significantly reduced by 72% (rr=28; 95% ci 0.170.46) that becomes 62% after 4 years of followup in the continuing outcomes relevant to evista (core) trial. as was noted in the tamoxifen trials, the benefits appeared to be specific only to receptor-positive invasive breast cancer. an increasing risk in thromboembolic events included dvt (deep venous thrombosis) and pulmonary embolism as observed in a raloxifene study (rr=3.1; 95% ci 1.56.2), but unlike what occurs in tamoxifen there was no difference in the incidence of endometrial carcinoma compared with placebo arm [23, 24]. results of more and core trials led researchers to conduct a comparative, randomized phase iii study of raloxifene versus tamoxifen in more than 19000 postmenopausal women at increased risk for breast cancer. the study of tamoxifen and raloxifene (star) trial or nsabp-p2 compared 20 mg of tamoxifen daily to 60 mg of raloxifene daily for 5 years with the incidence of breast cancer as a primary endpoint. the secondary end points included noninvasive breast cancer, uterine malignancies, thromboembolic events, fractures, cataracts, quality of life, and death from any cause. interestingly, although no untreated control group was included, there was no difference in the incidence of the disease between the two groups (rr: 1.02; 95% ci: 0.8281.28). furthermore, while there was a difference between the two treatment groups for the rate of in situ(ductal and lobular) breast cancer, this was not shown to be statistically significant (rr: 1.40; 95% ci: 0.9892.00). conclusive results based on the risk reduction seen in the bcpt for tamoxifen show that both drugs reduced the risk of developing invasive breast cancer by about 50%. while tamoxifen reduced the incidence of lcis and dcis, raloxifene did not have an effect on these diagnoses. a mechanism to explain the difference in noninvasive breast cancer incidence is unknown, but long-term follow-up results for the star trial may result in additional information regarding this issue. regarding the side effects, more uterine malignancies occurred in the tamoxifen arm and no statistically significant differences were noted between the 2 groups relative to the incidence of any cardiovascular events. more recently, results from the raloxifene use for the heart (ruth) study affirmed the benefit of raloxifene with regard to reduced risk of breast cancer. this trial, designed to focus on heart disease, randomized more than 10,000 postmenopausal women with coronary health disease or multiple coronary health disease risk factors to receive either raloxifene 60 mg per day or placebo. data from the star trial and the other raloxifene/placebo trial resulted in the approval of raloxifene by the us food and drug administration for a reduction in the risk of invasive breast cancer in postmenopausal women with osteoporosis and reduction in the risk of invasive breast cancer in postmenopausal women at high risk of invasive breast cancer. no data are currently available on the use of raloxifene in patients with brca1 or brca2 mutations, nor was raloxifene approved for women with a previous invasive breast cancer or for the treatment of invasive breast cancer. however, the approval of raloxifene gives an important new option to postmenopausal women beyond that of tamoxifen, one that avoids an excess of endometrial cancers and reduces the risk of thromboembolic events. high circulatory estrogen levels, as well as high aromatase levels in breast tissue, have been known to increase breast cancer risk. thus, inhibition of aromatase would be expected to decrease estrogen production and ultimately estrogen-related breast carcinogenesis. in adjuvant setting, third generation of ais (anastrozole, letrozole, and exemestane) has been found to superior to tamoxifen and be able to reduce the incidence of contralateral breast cancers by 37 to 55% [2833]. these agents have resulted in improved disease-free survival and are associated with fewer life-threatening side effects than serms. thus, the third-generation aromatase inhibitors (ais) have been introduced into the treatment of breast cancer, and their greater efficacy compared to tamoxifen, along with a more favorable side-effect profile, makes them attractive agents for use in breast cancer prevention [35, 36]. the international breast cancer intervention (ibis)-ii prevention trial, direct consequence of atac trial, is actually ongoing and is comparing anastrazole (ana) to placebo in 6000 postmenopausal women at increased risk to breast cancer. a second complimentary study (ibis-ii) will look at the role of ana in affected postmenopausal women who underwent a locally excised (or mastectomy) hormone receptor-positive intraductal neoplasia with clear margins. in this second group, both arms address the ability of ana to reduce the incidence of first primary invasive breast cancers. another prevention trial with ais (map3) is actually underway with exemestane (exe). authors are comparing placebo or exe, or exe plus celecoxib for 5 years in more than 5000 high-risk postmenopausal women. in september 2004 the disclosure of an excess of adverse cardiovascular events in the cox-2 inhibitor arm has recommended authors to revised the study design. they modified it in two different arms (exemestane vs placebo) and a new simple size of 4.560. despite this, the map3 study was reopened to accrual in march 2005 with a revised sample size of 4,560 and two arms, exe 25 mg/d alone and placebo. the primary endpoint is the incidence of breast cancer specifically to determine if exe is able to reduce invasive breast cancer by 65% compared to placebo. these data obtained by adjuvant trial provide a rational for exploring ais in prevention setting. they are superior to tamoxifen, and we hypothesized that the major of er-positive breast cancer (but not for er negative) can be prevented by these drugs. moreover, they are also well tolerated than tamoxifen without uterine and thrombotic effects, but they do lead to bone mineral loss. these effects should be contrasted by the use of bisphosphonates. although a number of antiestrogenic agents are being extensively tested in clinical trials, all these agents affect the endocrine pathway and suppress only the development, of estrogen receptor (er)-positive breast cancer. they have no effect in reducing the risk of er-negative breast cancer, which accounts for 2030% of breast cancers and has a poor prognosis. thus, it is worth identifying new pathways, biomarkers, and agents that are effective in the treatment and prevention of these subtypes. with the accumulating knowledge in understanding the biology of cancer development several classes of a new generation of chemopreventive agents modulating the nonendocrine biochemical pathways have been developed and many of these are still currently under investigation. these agents include retinoids, epidermal growth factor receptor (egfr), tyrosine kinase inhibitors (tkis), cyclooxygenase-2 (cox-2) inhibitors, bisphosphonates, vitamin d receptor (vdr), statins, peroxisome proliferator- activated receptor (ppar), and others. a complete summary of involved agents, with their specific pathways, is shown in table 1 and a brief state of the art of the more compounds involved are analyzed below. retinoids are natural and synthetic derivative of vitamin a (retinol) that have profound effects on development, metabolism, differentiation, and cell growth. the retinoid, the most widely studied in chemoprevention clinical trials, is the synthetic amide of retinoic acid n-(4-hydroxyphenyl) retinamide (4-hpr), or fenretinide. fenretinide has been found to exert significant chemopreventive activity in various in vitro and in vivo studies [3942]. a phase iii clinical trial, using 4-hpr to reduce the incidence of secondary breast cancer in almost 3000 patients, was published in 1999 and showed no difference in contralateral and ipsilateral breast cancers; however, a posthoc analysis suggested a significant treatment interaction with menopausal status. in particular, it showed a 35% reduction in premenopausal women and an opposite trend in postmenopausal women. moreover, the 15-year follow-up of this trial substantially confirmed these results, and the risk reduction is of the order of 50% in women aged 40 years or younger and persists for 10 years after retinoid cessation. moreover, 4-hpr was observed to reduce secondary tumours in premenopausal women irrespective of the hormone receptor status of the primary cancer, suggesting that retinoids have a potential chemopreventive effect on er-negative and er-positive breast cancers. recently, also a new rxr-selective retinoid, commonly named as rexinoids, has been studied as cancer preventative agent. preclinical studies in fact have demonstrated that this compound is able to maintain the chemopreventive efficacy of the retinoids, also in er-negative setting, but with substantial minor toxicity [45, 46]. the egfr is one of a family of four closely related receptors (egfr or erbb-1, her-2/neu or erbb-2, her-3 or erbb-3, and her-4 or erbb-4) that uses tyrosine kinase activity and contributes to a large number of processes involved in tumour survival and growth, including cell proliferation and inhibition of apoptosis, angiogenesis, and metastasis, thus making it an attractive target for cancer prevention and treatment, because agents that are able to block the erbb-signaling pathways are promising in the treatment and prevention of breast cancer. in particular, the researchers focused their attention to egfr-her-1 and her-2 pathways, because the mechanism of resistance to antioestrogen therapy is usually associated with an increased expression of her-1 and her-2 receptors. inhibition of tyrosine kinase activity, with tkis, involved in the egfr signaling cascade could be the right pathway for the treatment and prevention of er-independent breast. one involves blockade of this activity with monoclonal antibodies (trastuzumab), whereas the second involves the tkis. amplification of the her2 gene and overexpression of it's related protein have been found in almost 30% of human breast cancer and it is generally correlated with poorer outcomes compared with tumors her2 negative [49, 50]. moreover, there is substantial evidence of an inverse correlation between her2 expression and hormone receptor. in an effort to improve the prognosis of these her2+cancers, research has focused therapies directly against this pathway and in particular included the monoclonal antibodies trastuzumab (herceptin). trastuzumab has largely showed its benefit in adjuvant therapy; in particular, it is able to increase the clinical benefit of first-line chemotherapy in metastatic her-2 breast cancer, and this benefit seems to be irrespective of the er status. the drug is generally well tolerated, but its possible cardiotoxicity and its route of administration (intravenously) make it difficult to propose it to healthy women as chemoprevention. apart from the monoclonal antibodies directed against the extracellular receptor domain of her-2, there is another way to contest erbb activity. as previously explained, the use of small molecules inhibit intracellular tyrosine kinase activity, named tkis. tkis have several advantages over monoclonal antibodies such as oral bioavailability, potentially less toxicity, and ability to inhibit truncated forms of egf receptors. lapatinib (tykerb) is a reversible small-molecule tki that targets both her-2 and egfr tyrosine kinase. it is able to interrupt signal transduction from both egfr and her-2 receptors, and because of its dual-receptor activity it has been evaluated in several phase ii and iii trials in various forms of breast cancer [5860]. moreover, in the prevention setting, it showed a significant delay in the er-negative mammary tumors development. this preventive action was seen in premalignant mammary lesions, and this suggests a drug efficacy also in initiation and progression of breast carcinogenesis. gefitinib (iressa), another egfr tyrosine kinase inhibitor that suppressed er-negative mammary tumor formation in mmtv-erbb2 transgenic mice. its mechanism of action is complex and involves cell cycle, angiogenesis, and growth factors [62, 63]. moreover, results of preclinical and clinical studies about breast cancer treatment remain controversial [64, 65], but in preventive setting, the ability of gefitinib to inhibit the proliferation at the early stages of breast cancer and also in the normal adjacent epithelium could be the rationale for using this compound in prevention trial. the inducible isoenzyme cox-2 is expressed in invasive and in situ breast cancers cells, and several epidemiological studies have shown the inverse relationship between nonsteroidal, anti-inflammatory drugs (nsaids) and cancer incidence [68, 69]. cox-2 is the main target of nsaids, and despite the mechanism by which it contributes to tumor formation is not fully understood, it is possible to hypothesize an involvement of a multidisciplinary process which involves proliferative stimulation, mutagen production, and apoptosis inhibition. the cox-1 and cox-2 pathway, which converts arachidonic acid to prostaglandin, is involved in the development and growth of several different neoplastic lesions, and it is frequently overexpressed not only in invasive breast cancer but also in adjacent intraductal neoplasia; therefore, it might be an early event in mammary tumorigenesis. a meta-analysis, published in 2001, demonstrated that nsaids were associated with a 20% reduction of breast cancer risk, and the same results were confirmed in a more recent publication [72, 73]. these data suggested the chemopreventive potential (including breast cancer) of anti-inflammatory drugs. celecoxib, a selective cox-2 inhibitor, reduced the incidence and multiplicity of dmba-induced mammary tumors in rat models by 68 and 86%, respectively. nimesulide, another selective cox-2 inhibitor, significantly reduced the incidence and multiplicity of phip and nmu-induced rat mammary tumors. similar effects were observed with aspirin, but the level of evidence for both of agents on breast cancer incidence is, at present, too small to justify their use solely as a preventive therapy and insufficient to make any recommendations. bisphosphonates, the drugs of choice for the treatment of osteoporosis, act on the mevalonate pathway and for this reason are currently of considerable interest in the treatment and prevention of breast cancer. their mechanism of action involved osteoclasts, and in particular, they are able to inhibit their activity. thus they have proven efficacy in control of breast cancer bone metastases and also in bone loss induced by other treatment as ais. moreover, interestingly recent two cohort studies showed a reduction of 30% in breast cancer incidence in bisphosphonates users [80, 81], irrespective of hormonal status. bisphosphonates are generally well tolerated, but randomised prevention trials with composite endpoints in women with osteopenia and increased risk of a new breast cancer are required to fully investigate the risk-benefit profile of these drugs. poly(adp-ribose) polymerases (parps) are a family of enzymes that play a key role in the repair of dna damage. in particular, the most important seems to be parp enzymes (parp-1 and parp-2) [83, 84]. a key role for parp-1 and parp-2 is maintaining genomic integrity, in particular, repair of single strand dna lesions and breaks using the base excision repair (ber) pathway. the inhibition of these enzymes leads to accumulation of dna single-strand breaks, which can lead to dna double-strand breaks at replication forks [85, 86]. normally, these breaks are repaired and a key component of this mechanism comprises the tumour-suppressor proteins brca1 and brca2. in brca mutated cells, this dna repair ability is lost and the aberrations drive to carcinogenesis. consequently, the requirement for a brca mutation to be present for a parp inhibitor to be effective constitutes a synthetic lethal strategy selectively affecting mutant tumour cells comprising brca1-brca2, which are 1000-fold more sensitive than others [8789]. recent preclinical studies have shown encouraging results, and at present parp inhibitors are usually studied in combination with other cytotoxic agents [90, 91]. the only published study with a parp inhibitor as a single-agent treatment is a phase i trial with olaparib in patient with brca-associated cancer, which showed a good efficacy to inhibit parp activity and that it has few side effects compared conventional chemotherapy. the efficacy of a particular risk group as the mutation carriers and the relative good tolerability make these agents well suited for cancer prevention. further investigations should be proposed in brca mutation carriers to assess the ability of this class of agents to prevent cancer, evaluate the safety profile, and reduce the incidence of breast cancer. there is increasing evidence that presence of hyperinsulinemia and insulin resistance increased breast cancer risk, worsen, the prognosised and partly explained the obesity-breast cancer risk association in postmenopausal women [9398]. several epidemiological and observational studies have confirmed the relationship between insulin levels and cancer induction [99, 100]. insulin may promote tumorigenesis via a direct effect on epithelial tissues, or indirectly by affecting other modulators, such as insulin-like growth factors, sex hormones, and adipokines [101, 102]. thus, there is a great interest in exploring the possibility that antidiabetic therapies, which lower insulin levels, could decrease breast cancer incidence or its related mortality. metformin, a biguanide derivative, is the most commonly used drug worldwide to treat type ii diabetes. epidemiological studies have shown a significant risk reduction in cancer incidence and mortality in diabetic patients on metformin, relative to other antidiabetic drugs, including positive results specifically in breast cancer [103105]. it may impact cancer through a direct (insulin-independent) activation of ampk-mtor pathway mechanism or indirect effect (insulin-dependent) reducing hepatic gluconeogenesis obtaining lower circulating insulin levels with inhibition of proliferation cells and protein synthesis over increase apoptosis (figure 5). several preclinical studies have confirmed these effects of metformin in vitro and in vivo and showed a significant reduction of both breast epithelial cell proliferation and protein synthesis [106, 107]. in particular, it is confirmed that metformin produces a significant repression of cell proliferation, and moreover, they also found that this effect was different in human breast cancer cell lines if related to either positive or negative ers. they in fact detected a complete cell growth repression in er-positive cell lines, although only a partial inhibition was detected in er-negative phenotypes. these data suggest that, although er-negative cells are not as sensitive as er-positive ones, both of them show a reduction in cell growth under metformin treatment. several important phase ii and iii studies are actually ongoing in the world in order to confirm and clarify these promising settings. many molecularly pathways and the correlated targeted drugs are actually in development for advanced cancer therapy, and they have potential activity and tolerability also in cancer chemoprevention setting. the identification of new potential molecular targets and the development of agents aimed at these targets within cancer have already had a significant impact on advanced cancer therapy and provide a wealth of opportunities for chemoprevention. there is substantial evidence that together with the epithelial cells alterations the microenvironment dysfunction is crucial for carcinogenesis, and this makes the microenvironment an interesting target for breast cancer chemoprevention. in particular, there are many excellent publications which consider microenvironment as a good target for cancer therapy, but the application of chemoprevention to control the tumour microenvironment during the early stages of carcinogenesis is not yet adequately analyzed. we will briefly explain a recent progress that indicates that the effects of chemopreventive agents on the microenvironment are an important aspect of their preventive action and that many classes of agents, which showed to have significant chemopreventive actions on epithelia, also have similar useful actions on the microenvironment. many molecular targets inside the microenvironment with the correlated drugs are summarized in the table 2. these transcription factors and their associated regulatory proteins are an ideal target of chemoprevention, and in particular three attractive pathways as the nuclear factor b (nfb), hypoxia-inducible factor 1 (hif-1), and pi3-mtor are analyzed in this section. nuclear factor-b pathway plays important roles in the control of cell proliferation, differentiation, apoptosis, inflammation, stress response, cell signaling transduction, and other physiological processes, but it is also critically involved in the processes of development and progression of cancers [110113]. oxidative stress is defined as an increase in intracellular reactive oxygen species (ros) such as h2o2, superoxide, and hydroxyl radical and. these findings suggest that oxidative stress activates nf-kappab activity in the cells [114, 115]. moreover, nfb is activated not only by the ros but also by various carcinogen and tumor promoters, and these are the reasons why nfb is overexpressed and activated in various cancers, especially in the poorly differentiated. experimental studies have shown that natural antioxidant compounds including isoflavones, indole-3-carbinol (i3c), 3,3-diindolylmethane (dim), curcumin, epigallocatechin-3-gallate (egcg), rosveratrol, curcumin and others seems to be able to inhibit the activity of nf-kappab and the growth of cancer cells and also to induce apoptosis, suggesting that nf-kappab could be a target for cancer prevention [117121]. similarly, hif-1a master regulator in the control of tissue homeostasis, crucial in adaptive responses to tissue oxygenation including energy status, glucose, and iron metabolism as well as growth factor signaling [122, 123]is a key target for the prevention and treatment of cancer. interest in the role of hif-1 in cancer has grown exponentially over the last two decades, as this factor activates the transcription of many genes that code for proteins involved in several pathways intimately related to cancer [124126]. hypoxia-inducible factor-1 (hif-1) plays a central role in the adaptation of tumor cells to hypoxia by activating the transcription of genes, which regulate several biological processes. for these reasons, hif-1 is considered a potential target for cancer therapy, and, recently, many efforts to develop new hif-1-targeting agents have been made [127130]. interestingly, they are recently identified by increased hif-1 expression (relative to adjacent normal tissue) in 13 tumor types, including lung, prostate, breast, and colon carcinoma. moreover, hif-1 was also overexpressed in preneoplastic and premalignant lesions, such as colonic adenoma, breast ductal carcinoma in situ, and prostate intraepithelial neoplasia. these data show that overexpression of hif-1 may occur very early in carcinogenesis, before histologic evidence of angiogenesis or invasion, and suggest that hif-1 might be a biomarker of carcinogenesis and a suitable target for cancer chemoprevention. because hif-1 seems to have an important function in carcinogenesis several, approved anticancer drugs (e.g., topotecan, imatinib mesylate, trastuzumab, ns398, celecoxib, and ibuprofen) inhibit hif-1 activity. moreover, also several natural products (e.g., resveratrol, genistein, apigenin, and berberin) have also been found to inhibit the activity of this transcription. in this setting it is important to say that: however, the use of hif-1 inhibitors in cancer chemoprevention might be associated with toxicity. an excessive inhibition of hif-1 may produce adverse effects, as hif-1 regulates many cellular processes under physiologic conditions [125, 132]. therefore, although hif-1 inhibitors may represent a useful source of chemopreventive agents, the potential toxicity associated with these agents should be considered carefully, especially when chemopreventive interventions are aimed at preventing cancer in healthy populations. the mammalian target of rapamycin (mtor) is a signaling kinase of the phosphatidylinositol 3-kinase/protein kinase b or pi3k pathway that mediates cell growth and metabolism and coordinates cell cycle progression in response to genetic, epigenetic, and environmental conditions. pathways involved in mtor signaling are dysregulated in precancerous human tissues, including breast cancer, and is associated with the development of resistance to endocrine therapy [133135] and to the anti-human epidermal growth factor receptor-2 (her2) monoclonal antibody trastuzumab [136, 137]. phase i trials have demonstrated that mtor inhibitors are fairly well tolerated with the most frequent drug-related toxic effects being acne-like maculopapular rash, mucositis, and stomatitis, all of which were reversible on discontinuation of treatment. rapamycin and its analogues, the rapalogues, decrease tumor growth in many xenograft models, including those with breast cancer cell lines [139, 140]. thus, preclinical data have confirmed the antitumor activity of rapamycin and the rapalogues and have suggested that patients with breast cancer may especially respond to mtor inhibitors. phase i-ii clinical trials have demonstrated that everolimus (rad-001), an mtor inhibitor with demonstrated preclinical activity against breast cancer cell lines, has been shown to reverse akt-induced resistance to hormonal therapy and trastuzumab. it has promising clinical activity in women with her2-positive, her2-negative, and estrogen receptor-positive breast cancer when combined with her2-targeted therapy, cytotoxic chemotherapy, and hormonal therapy, respectively. the involvement of mtor pathways in precancerous lesions makes the mtor signaling an intriguing target for chemopreventive intervention. thus, several recent preclinical studies explored also the possibility of a chemopreventive action through the mtor inhibition. in one of this, rapamycin showed chemopreventive activity against mammary gland tumors in transgenic mice, bearing activated erbb2 (her-2/neu) receptor either alone (neuyd) or with vegf expression, where it dramatically inhibited tumor formation in neuyd mice. these results seem to suggest the mtor inhibition as a possible chemopreventive strategy against metachronous tumors or recurrence in high-risk patients, whose primary tumors overexpressed erbb-2, or in patients showing dysregulation of the pi3k/akt/mtor signaling pathway. another recent preclinical study evaluated chemopreventive effects of rapamycin in a transgenic mouse model of human breast carcinogenesis, where it significantly inhibited growth of mammary intraepithelial neoplasia outgrowths, invasive tumor incidence, and tumor burden. finally, some natural products, such as epigallocatechin gallate (egcg), caffeine, curcumin, and resveratrol, have been found to inhibit mtor as well and are actually under investigations in this setting. in conclusion, the success of chemopreventive approach depends on a tumor-specific risk model for identifying high-risk subjects, increasing preclinical drug test over the development novel and more safety chemopreventative agents, and identifying new surrogate endpoint using molecular pathways and new targets of drugs activity. safety is a very important point to take into account, because several large randomized prevention trials in several cancers have shown that major adverse events can prevent widespread public acceptance of active chemoprevention agents. despite the success of action showed for example in endocrine intervention is a promising starting point in order to continue to evolve with the rapid integration of molecular approaches into research and clinical practice. it is urgent to find active agents in other fields as nonhormone-responsive lesions. the personalized approaches in advanced cancer therapy and the evolution of molecularly targeted will streamline chemoprevention research and facilitate the development of rational, effective, and safe preventive drugs, involving different pathways and with the ability to modify carcinogenesis in early phases.

in 1976, sporn has defined chemoprevention as the use of pharmacologic or natural agents that inhibit the development of invasive breast cancer either by blocking the dna damage that initiates carcinogenesis, or by arresting or reversing the progression of premalignant cells in which such damage has already occurred. although the precise mechanism or mechanisms that promote a breast cancer are not completely established, the success of several recent clinical trials in preventive settings in selected high-risk populations suggests that chemoprevention is a rational and an appealing strategy. breast cancer chemoprevention has focused heavily on endocrine intervention using selective estrogen receptor modulators (serms) and aromatase inhibitors (ais). achieving much success in this particular setting and new approaches as low-dose administration are actually under investigations in several topics. unfortunately, these drugs are active in prevention of endocrine responsive lesions only and have no effect in reducing the risk of estrogen-negative breast cancer. thus, recently new pathways, biomarkers, and agents likely are to be effective in this subgroup of cancers and were put under investigation. moreover, the identification of new potential molecular targets and the development of agents aimed at these targets within cancer have already had a significant impact on advanced cancer therapy and provide a wealth of opportunities for chemoprevention. this paper will highlight current clinical research in both er-positive and er-negative breast cancer chemoprevention, explaining the biologic effect of the various agents on carcinogenesis and precancerous lesions, and finally presenting an excursus on the state-of-the-art about new molecular targets under investigations in breast cancer settings.

PMC3407675

pubmed-519

although patients who undergo dialysis suffer from a complex illness, there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself. nevertheless, randomized trials examining the impact of increased clearance of traditional uraemic solutes have yielded disappointing results. the haemodialysis study (hemo) failed to show any significant reduction in mortality with an increased dialysis dose. in contrast, in a post hoc analysis, the level of 2-microglobulin (representative of middle molecules) was found to be predictive of the relative mortality risk. furthermore, the results from a recent prospective, randomized and controlled study comparing online haemofiltration (hf) and haemodialysis (hd) have shown a significant difference in mortality in favour of hf, in spite of a very low kt/v in the convective procedure (1.07 0.06 with hf vs 1.42 0.06 with hd). this further confirms a series of observational studies that had already demonstrated that, in terms of patient survival, techniques capable of increasing middle-molecule clearance, such as haemodiafiltration (hdf), hold an advantage over the conventional hd. in recent years, scientists have been increasingly convinced that a large number of high-molecular-weight toxins increase their plasma concentration during uraemia and are responsible for a number of dialysis co-morbidities, such as an immune system imbalance, itching and so on. hence, the interest of clinicians, followed by that of industry, in a new class of dialysis membranes aimed at enhancing the transport capabilities (clearance) of middle, large and even protein-bound molecules by using all the available membrane separation phenomena: diffusion, convection and adsorption, by designing and developing both high-performance protein-leaking dialyser, we mean the dialyser capable of removing large molecules on the basis of convection enhancement (super-flux) or adsorption capabilities. the main aim of a dialysis filter is to better reproduce the physiological process of glomerular ultrafiltration. dialysis membrane clearance, however, is based on concentration differences rather than the convective separation of solutes and low-molecular-weight proteins from large serum proteins and blood elements. in an attempt to replicate glomerular ultrafiltration and the removal of middle molecules in high-flux dialysers, a significant increase in porosity has been obtained in order to remove large-molecular-weight solutes. hand in hand with the increase in porosity and the efficiency of mass transfer, there is a concomitant increase in the membrane ultrafiltration coefficient. the optimization of these properties has produced dialysers that allow for rapid solute fluxes and clearance profiles akin to those achieved across human glomeruli. the other significant feature of high-flux membranes, particularly the synthetic membranes, is that they tend to be more biocompatible. the properties of a dialyser, on the physical or biocompatible level, are related to its microstructural and macrostructural characteristics. microstructural aspects refer to the characteristics acting on the molecular scale (i.e. the chemical modification of the side chains, thickness of the hollow fibre wall, membrane porosity). macrostructural properties refer to the properties acting on a length scale greater than molecular dimensions (i.e. surface area, packing density, boundary layers adjacent to the membrane solution interfaces, shape and configuration of the hollow fibres, spacing and sterilization techniques). the so-called high-flux membranes are prepared with hydrophobic base materials, including polyacrylonitrile, polysulphone, polyaryethersulphone, polyamide and polymethylmethacrylate with various hydrophilic components. nevertheless, there are some examples of cellulose-based high-flux membranes, such as cellulose triacetate. in view of the large hydraulic permeability of synthetic membranes, the bidirectional water flux across the dialysis membranes is maximized (figure 1). under conditions of diffusive hd, at the proximal end of the dialyser, the sum of hydrostatic osmotic and oncotic pressure results in a large water movement from the blood to the dialysate. at the distal end of the hollow fibres, hence, the large volume of water leaving the blood and crossing into the dialysate at the proximal side is offset by the water backfiltration from the dialysate to the blood on the distal side. however, a larger and more important amount of small- and middle-molecule removal can be obtained in hdf. in hdf, with the further use of dialysate, a relatively free ultrafiltration is allowed, and there is a large volume of ultrafiltrate with no significant backfiltration from the dialysate. the amount of ultrafiltrate that offsets the fluid loss that the patient has to shed must be replaced by the direct intravenous substitution fluid infusion. in hf, all the water movements are from the blood to the dialysate compartment, and solute clearance is by convection alone. moreover, the removal with large-pore (i.e. high-flux) membranes is related to diffusion, convection and, in some cases, as discussed in the following, adsorption. this mechanism adds capacity to remove components with a pathophysiological potential, such as 2-microglobulin, cytokines and protein-bound uraemic toxins (pbut). diagram of the internal backfiltration (a) and backdiffusion (b) phenomenon in a high-flux dialyser. a schematic description of the pressure plays that leads to the onset of the backfiltration phenomenon. at the filter blood inlet, there is a water movement from the blood to the dialysate, due to the interplay of the hydrostatic, osmotic and oncotic pressures, as well as the dialysate pressure. at the outlet, the equilibria are inverted: the dialysate pressure and oncotic pressure grow, while the blood hydrostatic pressure is reduced. the latter is reflected in the lower activated serum complement levels, a lower intradialytic reduction in white cell counts, a lower oxygen radical production, and a reduction in the release of interleukin-1 and tumour necrosis factor in the course of dialysis. on the other hand, this reduced cytokine production along with decreased bioincompatibility has been used to account for the fewer dialysis-related symptoms, in particular less intradialytic hypotension observed with high-flux techniques. preliminary studies with high-flux dialysers have shown varying results upon the haemoglobin response, the increased 2-microglobulin clearance, and a reduction in advanced glycation end products, peroxidation products and homocysteine levels. however, only a few of these studies are randomized, none of them is blind and the comparison is often made with older-generation low-flux membranes. moreover, there are no clear and unequivocal data showing that improved biocompatibility and excellent larger-molecule clearance translate into improved patient symptoms and better survival. the same can be said of techniques such as hf or hdf based on the use of high fluxes attainable with high-flux dialysers. on the latter issues, however, a whole strand of literature is coming out in favour of the convective techniques, which is not only based on observational studies, as in the past, but on randomized controlled trials. the recent membrane permeability outcome (mpo), a study in which 647 incident dialysis patients were randomly allocated to high-flux or low-flux dialysis membranes, demonstrated that the improved 2-microglobulin clearance led to an improved survival in those with albumin<4 g/dl, with a 37% reduction in the mortality risk with the high-flux membrane. the european acetate-free biofiltration (afb) study has shown better survival in patients with mild hypertension treated for 4 years by means of an acetate-free biofiltration as compared with conventional dialysis. even the online hf performed by a high-flux dialyser does not only appear to have a superior cardiovascular stability but also a better survival as compared with hd. recently, the idea that the removal of a distinct class of uraemic toxins, such as 2-microglobulin, factor d, leptin and adrenomedullin, while minimizing albumin loss, could improve treatment outcome in end-stage renal disease (esrd) patients has led to the development of a series of dialysers known by the name of super-flux. super-flux dialysers have been designed to maximize convective transport by increasing the pressure drop along the membrane fibres. the same toxic substances directly bind with protein (pbut), originating from high-weight complexes (50200 kda) potentially involved in important uraemia co-morbidities such as itching and altered immune response [1821]. removing pbut from the blood by means of diffusion and convection (containing the albumin loss) is virtually impracticable; however, pbut can be removed by using the adsorptive properties of particular biomaterials. a number of adsorption techniques are well known in the world of blood purification: with selectivity or without selectivity, working with plasma or whole blood, consisting of fibres or solid spheres. in this context, only dialysers made with a synthetic membrane having adsorption capabilities should be taken into account. synthetic membranes, such as polysulphone, are usually asymmetric (figure 2left); this means that, on a membrane thickness of 30 microns, just a 1-micron layer is responsible for the separation process, while 29 microns have structural functions alone. synthetic membranes such as polysulphone are usually asymmetrics, which means that, on a membrane thickness of 30 microns, a layer of 1 micron only is responsible for the separation process, while 29 microns have structural functions only. pmma, conversely, is a symmetric membrane, in which the whole thickness is involved in the separation process allowing middle-molecule adsorption. another class of synthetic membranes, i.e. polymethylmethacrylate (pmma), is characterized by a symmetric structure (figure 2right). in this case, the pores are larger, longer and winding, designed to trap different substances. moreover, in some cases, an ionic treatment of the inner surface may enhance this adsorption mechanism. pmma adsorption capabilities have been demonstrated both in vivo and in vitro. among others, campistol and co-workers have shown that pmma bk removes 2-microglobulin by adsorption, while high-flux polysulphone does so by filtration, using radiolabelled 2-microglobulin and scintigraphic analysis (figure 3). kawanishi measured interleukin (il)-6 removal from different membrane mini-modules isolating convection and adsorption contributions. scintigraphic image (from campistol et al.) of the dialyser (pmma vs polysulphone) after the end of the dialysis session, using 131i-labelled 2-microglobulin. super-flux dialysers based on enhanced convection or adsorption, at least on the theoretical plane, could be widely used in clinical situations in which, apart from toxins of small molecular size, large quantities of mediators and toxic products are also produced, with a negative biological effect at a middle high molecular weight, or which are rapidly bound to the proteins. these filters make it possible to treat septic patients with acute renal failure and simultaneously provide the control of uraemia and fluid status as along with cytokine removal. in the field of haematological diseases, particularly in myeloma, early yet encouraging results have already been obtained in the light chain removal. hd with super-flux dialysers has been shown to be more effective than high-flux dialysis in reducing plasma homocysteine. however, an important side effect of super-flux dialysers, or at least some of them, might be plasma protein loss, and not only that of albumin but also coagulation factors, growth factors and hormones. hence, before opening the door to these new filters, it will be necessary to develop strategies in use to achieve a good clearance of waste and harmful products, while minimizing the risk of a huge loss of substances, such as proteins, useful for our organism's biochemical homeostasis.

although patients undergoing dialysis have a complex illness, there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself. this paper focuses on the transport phenomena that occur within a dialyser. an attempt is made to clarify how transport phenomena are related to the performance of a dialysis session and how they depend on the membrane characteristics. our study offers some discussion points on the complex issue of defining what the best parameters could be in comparing the efficiency of different membranes. the new high-flux dialysers have improved larger-molecule clearance and biocompatibility. membrane performance is a very hard process to evaluate, and different membranes can only be compared by establishing adequate points of comparison. at the same time, the points of comparison themselves may change depending on the type of co-morbidities of the specific patient who is considered for membrane selection. this editorial (together with all the papers presented in this issue) seeks to focus on the membrane's own merits in improving the dialysis therapy.

PMC4813820

pubmed-520

primary retroperitoneal germ cell tumors account for approximately 30% of extragonadal germ cell tumors (egcts) and for about 10% of all primary malignant retroperitoneal tumors. many studies have demonstrated an association between diffuse bilateral testicular microlithiasis (tm) and gonadal germ cell tumors and egcts [2, 3]. nevertheless, it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer, a history of cryptorchidism or testicular atrophy. we report the cases of a 33- and a 39-year-old man presenting with a retroperitoneal extragonadal tumor and bilateral tm without a focal testicular mass. a 39-year-old man with a 6-month history of lumbar pain came to our hospital to perform an mri examination in order to rule out a lumbosacral hernia. the mri images showed no slipped disks, but we unfortunately detected a voluminous retroperitoneal solid mass. therefore, we decided to perform a total body ct to better characterize the mass and its relationship to adjacent structures. ct images showed a large heterogeneous retroperitoneal mass with curvilinear calcifications and a marked inhomogeneous enhancement after intravenous contrast medium injection due to the presence of necrotic-colliquative areas. this lesion displaced the left renal vein cranially, the abdominal aorta anteriorly and towards the right, and infiltrated the inferior vena cava, the left renal vein, and the left psoas muscle (fig. 1). the patient's -fetoprotein, lactate dehydrogenase, and beta subunit of human chorionic gonadotropin levels were 2.680 iu/l (normal, 90180 iu/l), 279 ng/ml (normal, 07.5 ng/ml), and 4 miu/ml (normal,<5 miu/ml). we performed a scrotal ultrasonography (us) to rule out that this mass was a retroperitoneal metastasis of a primary testicular tumor: us showed bilateral classic tm (defined as more than 5 calcifications scattered throughout the testicle), without a focal lesion (fig. 2). comparing the current ultrasound images with previous us testicular images (the patient underwent a scrotal us when he was 25 years old because of a testicular trauma) the patient underwent a ct-guided biopsy and at histology, an immature teratoma was diagnosed. a 33-year-old man came to our emergency department complaining of abdominal pain, vomiting, weight loss and mild jaundice. the patient's serum -fetoprotein, lactate dehydrogenase, and beta subunit of human chorionic gonadotropin levels were 2.470 iu/l (normal, 90180 iu/l), 232 ng/ml (normal, 07.5 ng/ml) and 3 miu/ml (normal,<5 miu/ml). besides, the serum markers of cholestasis were high: conjugated bilirubin was 2 mg/100 ml (normal,<0.2 mg/100 ml), -glutamyl transpeptidase 70 iu/l (normal, 130 iu/l) and alkaline phosphates 300 iu/l (normal,<170 iu/l). ct and mri examinations showed a giant retroperitoneal mass made up by multiple necrotic-colliquative fluid areas with a multilocular aspect, which dislocated the inferior vena cava anteriorly and with possible infiltrating signs; it also compressed the portal vein and the common bile duct with moderate dilatation of the intrahepatic ducts (fig. 3). the patient was sent to do an us to rule out the presence of a primary testicular tumor, which revealed bilateral tm without a focal hypoechoic lesion; the microcalcification pattern was quite similar to that of a past ultrasound exam that was performed when the patient was 22 years old because of a suspected varicocele. the patient underwent a ct-guided biopsy and at histology, a yolk sac tumor was diagnosed. an egct is by definition a germ cell neoplasm, displaying one of the histologic types associated with gonadal origin, but located outside the gonads. the most widely accepted theory suggests that egcts arise from primordial germ cells misplaced during their migration to the gonads. it remains uncertain, however, whether such tumors develop primarily at extragonadal sites or represent metastases of a primary testicular tumor. regarding the latter case, egct may have developed from burned out testicular tumors or they may just be metastatic lesions from primary testicular tumors that were not detected at the time of the diagnosis. a burned out gonadal primary tumor is a regressed tumor which is seen as an echogenic scar or a hypoechoic tissue on testicular ultrasound and which clinically presents with metastasis. histologically, egcts comprise seminomas (3040%) and nonseminomatous tumors (6070%) in men and dysgerminomas and nondysgerminomas in women. nonseminomatous germ cell tumors (nsgcts) include teratoma, embryonal carcinoma, endodermal sinus tumor (yolk sac tumor), choriocarcinoma, and tumors with mixed histology. -fetoprotein is produced by endodermal sinus tumors, either alone or in association with other types of germ cell tumors. these are useful serum markers in the diagnosis, prognosis, and follow-up of patients with germ cell tumors. the majority of the egcts occur in men, except benign mature teratoma, which occurs with equal frequency in men and women. egcts are usually seen in children or young adults, and typically arise in midline locations. in adults, the most common sites of primary egcts are, in descending order, the mediastinum, the retroperitoneum and the cranium. in children, primary retroperitoneal germ cell tumors account for about 10% of all primary malignant retroperitoneal tumors and about 3040% of egcts. egcts are often seen in or near the midline, especially between the t6 and s2 vertebrae. patients may present with metastases: brain, liver, lungs and bones are the common sites of metastases. seminoma is rare in the retroperitoneum and is seen as a large, lobulated, well-defined homogeneous solid mass with fibrous septa and ring-like or speckled calcifications. nsgcts are depicted as heterogeneous tumors with areas of hemorrhage, necrosis, and heterogeneous enhancement. flow voids as well as invasion of adjacent structures that are due to hypervascularity may be seen. primary testicular malignancy and egcts are often associated with tm [2, 8]. this is an uncommon pathologic condition that is detected by scrotal us and is defined as the presence within the substance of the testis of 5 or more speckled bright foci, 12 mm in diameter, with little or no acoustic shadowing; the microcalcifications usually affect both testes, but may be unilateral and can be focal or diffuse [3, 4]. j. richenberg and n. brejt affirm that ultrasound surveillance is unlikely to benefit patients with tm in the absence of other risk factors; on the contrary, in the presence of additional risk factors (previous testicular cancer, a history of maldescent or testicular atrophy), patients are likely to be under clinical and ultrasound surveillance. nevertheless, it is still controversial whether performing sonographic surveillance is better than regular testicular self-examination in adult patients with classic tm and the absence of any known testicular tumor. in this setting, on the basis of our direct experience, we highlight the importance of annual ultrasonographic surveillance of the testis and retroperitoneal space in patients with occasionally detected tm. besides, taking into account the increased risk of metachronous testicular malignancy in patients with previous egct [6, 9], we recommend yearly testicular ultrasound follow-up after surgical removal of retroperitoneal gonadic tumor.

many studies have demonstrated an association between diffuse bilateral testicular microlithiasis (tm) and gonadal and extragonadal germ cell tumors. nevertheless, it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer, a history of cryptorchidism or testicular atrophy. we report the cases of a 33- and a 39-year-old man presenting with a retroperitoneal extragonadal tumor. the first patient underwent an mri examination in order to rule out a lumbosacral hernia: mri images showed no slipped disks but a voluminous retroperitoneal solid mass. the histological analysis revealed an immature teratoma. the second patient came to the emergency department complaining of abdominal pain, vomiting, weight loss and mild jaundice: ultrasound examination showed a large, ill-defined heterogeneous abdominal mass, confirmed by ct and mri examination. the histology diagnosed a yolk sac tumor. in both patients, the testicular sonography was performed to rule out a focal lesion, but it displayed bilateral tm without a focal testicular mass. based on our direct experience, we highlight the importance of annual ultrasonographic surveillance of the testis and the retroperitoneal space in patients with occasionally detected tm.

PMC3843917

pubmed-521

the cellular thiol-disulfide redox environment is defined by protein thiols (psh) and disulfides (psox) as well as low molecular weight thiols and disulfides. in mammalian cells, by far the most abundant low molecular weight sulfhydryl molecule is glutathione (gsh). together with its disulfide (gssg), this pair is often referred to as the cellular thiol-disulfide redox buffer. in the cytosol of eukaryotic cells, glutathione is highly reducing with a ratio of gsh to gssg of at least 3,000 [1, 2], and consequently the majority of protein cysteines are found as psh. the high concentrations of psh and gsh in this compartment are important in the cellular defense against thiol oxidants, during thiol-disulfide stress, formation of mixed disulfides between protein and glutathione (pssg) serves as a mechanism for protecting psh and gsh from irreversible oxidation. in contrast to cytosolic proteins, secretory proteins often contain disulfide bonds, and the glutathione redox pool in the secretory compartments of the cell is found to be considerably more oxidizing than the cytosolic pool. disulfide bond formation is an essential step for the correct folding of many secretory proteins, and in eukaryotic cells their folding and assembly takes place in the endoplasmic reticulum (er). in this compartment, molecular chaperones and enzymes for disulfide bond formation and glycosylation support protein folding. the maintenance of a proper er redox environment is crucial for the folding of secretory proteins. if the redox environment becomes too reducing, the formation of disulfide bonds is hampered. if too oxidizing, folding intermediates with nonnative disulfide bonds can accumulate. a number of oxidoreductases, which may have different functions and/or substrate or tissue specificities in the assistance of folding secretory proteins, the best characterized oxidoreductase is protein disulfide isomerase (pdi), which introduces, reduces, and reorganizes disulfide bonds in a broad variety of substrate proteins. the oxidative pathway remains unresolved, but pdi may be reoxidized by a number of enzymes including pdi peroxidases, gpx7 and gpx8, peroxiredoxin 4, and the flavoprotein ero1 (endoplasmic reticulum oxidoreductin 1), for review see [10, 11]. professional secretory cells are specialized in producing secretory proteins and are characterized by their abundant er. one example is the terminally differentiated b cell, also referred to as plasma cell, which secretes enormous amounts of antibodies, that is, immunoglobulins (ig). while resting b cells do not secrete antibody, they do express a membrane-bound ig on their cell surface as a subunit of the b cell receptor, which upon binding of antigen activates a signaling cascade that can lead to differentiation into antibody-secreting plasma cells. the differentiation is accompanied by many morphological changes to accommodate production of large amounts of secreted antibody. this includes a general increase in cell volume with a preferential expansion of the er. in addition, the differentiation is accompanied by dramatic changes in the proteome of the cell [13, 14]; as expected, the er proteins are significantly up-regulated. igm is typically secreted as disulfide-linked pentamers or hexamers of a subassembly consisting of two identical heavy chains () and two light chains (). the pentameric holoprotein in addition contains a j-chain, which the hexamer does not. as each subassembly contains 16 disulfide bonds and the j-chain contributes 4 disulfide bonds, ros production is increased during b cell differentiation and counterbalanced by a strong antioxidant response. we set out to investigate how this enormous load on the secretory machinery affects the global thiol-disulfide environment of the b cell. we have applied a previously developed method for quantitative determination of the absolute levels of psh, psox, and pssg on all cellular proteins (including membrane proteins) in cultured mammalian cells, and combined these data with quantifications of gsh and gssg in the same cells. in this way, we have obtained a picture of the global changes in cellular thiol-disulfide redox status during differentiation of the resting b cell into an antibody-secreting plasma cell. quantitative studies of the cellular redox status involve a variety of technical challenges due to the reactive nature of the sh group. great care must be taken to avoid artificial air oxidation and to eliminate cross-reactivity between the thiol and disulfide specific reagents, which can otherwise lead to deceptive conclusions. by applying a previously developed technology that carefully considers these technical pitfalls, we can quantitatively determine the cellular levels of total sulfhydryl equivalents in low molecular mass thiols and in protein. the key features of the experimental approach are illustrated in figure 1. to avoid perturbation of the cellular thiol-disulfide status during cell lysis and sample preparation, cells were acidified by the addition of tca to a final concentration of 10%, resulting in immediate protein denaturation and precipitation. this combination of rapid trapping and deprotonation simultaneously unfolds redox enzymes, some of which have low thiol pka and are fairly acid-stable, and quenches generic thiols by protonation. to fully exploit the strength of our approach, we did not facs-sort cells before analysis, nor did we homogenize and fractionate cells. the tca pellets were solubilized by sonicating in appropriate buffers with high concentrations of sds or urea to quantify the different sulfhydryl species in all cellular proteins including membrane proteins. psh and psox levels were determined with a highly sensitive hplc assay based on the thiol quantification agent 4-dps. the total value of protein cysteines (total ps) was calculated by the addition of psh and psox and to verify the method, this value was also determined experimentally. for experiments performed on resting b cells, there is an excellent agreement between the experimentally determined value and the calculated sum of the experimentally determined psh and psox (data not shown). finally, pssg levels were selectively quantified by the use of the thiol derivatization agent sbd-f. the sbd-gs derivative is highly fluorescent and can be quantified specifically due to its unique retention time in an hplc chromatogram. in addition to protein sulfhydryls, the total protein content of each sample was determined and used as a common denominator to compare the individual samples. this is a crucial step as it eliminates any bias from a possible uneven division of the tca pellet into fractions. furthermore, the requirement for a common denominator in this study is particularly important, as it also eliminates any bias due to morphological differences between cell samples. the total protein content was quantified using a method based on complete hydrolysis in hcl followed by quantification of released amino acids with ninhydrin. this constitutes a highly reproducible and sensitive method and, with a proper standard, it yields numbers that can be calibrated to amino acids in protein. furthermore, the ninhydrin assay is independent of protein solubility and hence includes both soluble and membrane proteins. thus, all the following data will be shown as sulfhydryl per amino acid (sh/aa). as a model for b cell differentiation, we used a previously established system based on the murine b cell lymphoma 1.29 which can be induced by lipopolysaccharide (lps) to secrete igm [13, 19]. to obtain a well-defined reference point for the differentiation of b cells into plasma cells, we quantified the thiol-disulfide status in uninduced b cells to obtain a reference point for differentiation into plasma cells. cells were seeded to a density of 0.2 10 cells/ml, and samples for redox quantification were taken each day during the next four days. although cell density increased considerably during this period, the protein redox state remained constant throughout the experiment (figures 2(a) and 2(b)). in addition, levels of pssg, gssg, and gsh remained constant (data not shown), and we concluded that the global thiol-disulfide status is independent of cell density. accordingly, the mean value of data obtained for each of the redox species during the four days was calculated, and the relative distributions of the different protein and glutathione sulfhydryl equivalents are given in table 1. from these data, we concluded that the vast majority of cellular sulfhydryl equivalents exists in the reduced thiol form with only 5% and 9% of the ps and gs equivalents engaged in disulfide bond formation, respectively. together, these data describe the total thiol-disulfide environment of resting b cells, and we used them as reference point for studying the differentiation into antibody-secreting plasma cells. in the remaining part of this study interestingly, the distribution of thiol and disulfide equivalents in resting b cells is very similar to that of hek (human embryonic kidney) cells, where 6% of the ps equivalents were found as psox and 8.5% of the gs equivalents were found as gssg. in addition, our observation that cellular pssg levels are extremely low is supported by results in hek and hela cells. it should be mentioned that although cells are grown in the presence of -mercaptoethanol, which was detected in the tca supernatant and also in very small amounts in the tca pellet, it did not interfere with the glutathione or pssg measurements because fluorescent -mercaptoethanol derivatives were separated efficiently from gs derivatives by hplc (data not shown). resting 1.29 cells were treated with lps to induce differentiation into antibody-secreting plasma cells. samples were prepared for global thiol quantification after 1, 2, 3, and 4 days of lps treatment. from the sh/aa of total ps equivalents (figure 3(a)), we find that the frequency of cysteine residues in proteins is fairly constant (~2%) throughout the differentiation. this is in excellent agreement with the experimentally determined values for other mammalian cell lines as well as calculated values for eukaryotes in general hansen [3, 20]. the sh/aa for total ps was expected to be largely unaffected during differentiation as the igm monomer has a cysteine frequency of 2.5% (igm has 1,540 amino acids, of which 38 are cysteines). although the absolute value of total ps equivalents remained unchanged throughout the experiment, the distribution of protein thiols and disulfides was influenced by the lps-induced cell differentiation. the percentage of protein thiols engaged in disulfide bond formation remained largely unaffected for two days after lps induction, but at day three the psox values had doubled, and a total increase by a factor of 3.3 was found at day four (figure 3(b)). likewise, after a lag time of two days, on day three pssg had increased by a factor of 2.2, but in contrast to psox, the pssg value did not increase further on day four (figure 3(c)). interestingly, the ratio of pssg to psox remained essentially unchanged throughout the experiment (figure 3(d)). quantification of soluble glutathione equivalents revealed that the absolute concentrations of gssg remained largely unaffected (figure 4(a)), but the fraction of oxidized gs equivalents (gs in gssg) relative to total gs equivalents (total gs) increased from 8.8% to 14.5% (figure 4(b)). this was caused by a gradual decrease in gsh (figure 4(a)) resulting in an overall decrease of 56% in (total gs) at day 4 compared to day 0. the gs equivalents were not recovered as pssg, which throughout the study remained a minute fraction of total gs equivalents (figure 4(c)). to rule out that the decrease in intracellular gs was caused by an increase in dying cells, the level of apoptotic and necrotic cells was measured using flow cytometry and staining with the cell-impermeable dye propidium iodide (pi). although the fraction of viable (pi-negative) cells decreased during the differentiation by a factor of 1.5 (supplementary material figure 1 available online at http://dx.doi.org/10.1155/2013/898563), it could not account for our observed decrease in intracellular glutathione (see supplementary material text). as the decrease in intracellular gs was not explained by an increase in cell death, we measured whether gs equivalents were secreted by the cells. no glutathione was detectable in a blank medium sample (data not shown); media from uninduced cells, however, contained measurable amounts of glutathione, and the values increased significantly on day three and four after induction (figure 4(d)). it should be noted that these numbers are only rough estimates and that the values are most likely underestimated due to extracellular gs degradation catalyzed by -glutamyl transferase. from the data shown in figures 4(a) and 4(d), the increase in extracellular gs/aa equivalents at day 4 relative to day 0 was calculated to (0.23 0.1) 10 while the decrease in intracellular gs/aa was calculated to (0.46 0.05) 10. as the two numbers are in the same size range, it is possible that the differentiating cells secrete glutathione (details are given in supplementary material text). the transformation of resting b cells into antibody-secreting plasma cells involves an extensive expansion of the er and both er resident proteins and proteins involved in redox balance are up-regulated linearly during differentiation. how cells cope with this sudden increase in secretory activity has been the subject of numerous studies [22, 23]. this study, for the first time, provides a quantitative overview of the cellular thiol-disulfide status during differentiation of resting b cells into antibody-secreting plasma cells. we applied a previously developed method to quantify soluble gsh and gssg as well as protein thiols and disulfides in cells. importantly, the method includes both soluble and membrane proteins, which precludes bias due to morphological changes during b cell differentiation. we find that the differentiation process affects the global protein thiol-disulfide status with an increase factor of 3.3 in the fraction of oxidized protein thiols at day 4 of differentiation, compared to day 0. the effects on the glutathione redox status are less significant with an increase factor of 1.6 in the fraction of oxidized gs equivalents. the changes in glutathione redox state were caused by a general depletion of gs equivalents from differentiating b cells. the differentiation of b cells into plasma cells has been studied in great detail at the proteomic level [13, 14]., the cell prepares by ensuring that metabolic capacity and secretory machinery can cope with the mass production of antibody molecules. we did not find any change in protein thiol-disulfide status until the third day of activation, when the fraction of psox increased by a factor of 2.2. the kinetics for the change in protein redox state were identical to the kinetics for igm production. our results suggest that a general expansion of the er does not affect protein redox status until an extensive production of cargo proteins is initiated. the increase of igm production at day three is possibly preempted by a process known as proactive unfolded protein response (proactive upr). the upr is a stress signaling process that is initiated when unfolded polypeptides accumulate in the er. this process leads to an up-regulation of er chaperones and folding enzymes which prevents er stress. while unfolded protein stress (or er stress) is not involved in the initial expansion of the er in professional secretory cells [13, 14], it is essential for b cell differentiation [26, 27]. upr-induced oxidases such as ero1 may facilitate the change in protein redox state on the third day of differentiation to initiate disulfide-dependent igm polymerization and its subsequent secretion. initially gssg was thought to provide oxidizing equivalents for disulfide bond formation, but after identification of the ero1 proteins this hypothesis was discarded. instead, gsh now is considered to be involved in the isomerization of nonnative disulfide bonds [2830] to consume excess oxidizing equivalents produced by the ero1 proteins and to activate ero1 by reducing its regulatory disulfides. consequently, the abundance of gssg in the er is altogether assumed to be at least partially caused by ero1 activity. the mechanisms by which the er maintains its gsh/gssg redox balance are unknown. excess gssg could be reduced by an er resident glutathione reductase, it could be transported to the cytosol for reduction or it could be secreted from the cells. during b cell differentiation ero1 is up-regulated by factors of 3.0 and 2.4 at day 3 and 4, respectively, and consequently we expected gssg levels to increase. surprisingly, gssg levels remained constant throughout differentiation, but the overall cellular glutathione redox status did become more oxidizing gradually (figure 4(a)). this was the result of a depletion of total gs equivalents at the expense of gsh (figure 4(b)). there are three possible explanations for the decrease in total intracellular gs, (1) differentiation of b cells leads to secretion of gs equivalents, (2) gsh is irreversibly oxidized to sulfinic or sulfonic acids, which is not detected by the quantification method, and (3) gs equivalents are released by the fraction of pi positive cells. we found an increase in extracellular gs on days 3 and 4 of the differentiation that was of about the same magnitude as the intracellular decrease (figure 4(d)). this result supports model (1) and suggests that gsh converted to gssg by the up-regulation of ero1 proteins and is exported to the media. this export could serve as a mechanism for relieving cells from any oxidative load caused by up-regulation of ero1 proteins. we can, however, not make any certain conclusions regarding the cause of intracellular gs depletion, as the levels of extracellular gs could in principle be explained by the fraction of pi-positive cells releasing their intracellular gs content to the media (see supplementary material text). due to the extremely reducing glutathione redox potential of the cytosol, the vast majority of pssg is expected to be found in the oxidizing compartments of the cell. in a study of liver microsomes, 50% of the gs equivalents were found as pssg, suggesting that a major fraction of the glutathione in the er is associated with protein. however, this fraction was subsequently estimated to be significantly lower (i.e., less than 2% pssg) based on whole-cell quantification with the assumption that no pssg is found in the cytosol. under the same assumption; that is, that all pssg equivalents are found in the er and that the concentrations of gs equivalents are the same in all cellular compartments, we can estimate that the maximal fraction of pssg is relative to total gs equivalents in the er, in fully differentiated b cells. the er volume is reported to constitute at least 10% of total cell volume in antibody-secreting b cells and, accordingly, maximally 7% (0.7%/10%) of the gs equivalents in er are found as pssg. thus, even in highly active secretory cells, pssg only constitutes a minor fraction of total gs equivalents of the er. these results support the notion that the er glutathione redox environment is more reducing than previously assumed. it is generally assumed that the level of gssg is critical for the amounts of pssg formed. interestingly, we found that the ratio of pssg to psox was independent of differentiation (figure 3(d)), suggesting that the oxidizing compartments of the cell maintain a constant level of pssg, and consequently, that the er glutathione redox status is tightly regulated throughout differentiation. this may be explained by the activation of oxidative stress during the early stage of b cell differentiation and followed by a strong antioxidant response [16, 36]. maintenance of a proper er glutathione redox environment can be a crucial factor in securing the correct folding of igm. in this study, we have for the first time characterized the changes in thiol-disulfide state during differentiation of b cells. in general, the differentiation does not cause massive thiol-disulfide stress to the cells. the steady state levels of pssg are maintained at very low levels, even in fully differentiated cells, and the overall protein redox state is not affected until late in differentiation, when large-scale igm production has started and the er stress response has been activated. 1.29 cells were maintained in suspension as described in and after 2 days, cell culture medium was replaced by fresh medium. for differentiation, cells were cultured in the presence of 20 g/ml lps (sigma). three independent cultures were induced with lps and samples were taken after 1, 2, 3, or 4 days of differentiation. as a control, samples from 3 independent cultures grown without lps were collected as well. each day after lps activation, samples were collected for flow cytometric analysis. cells were stained with pi (sigma) and flow cytometry data were obtained with facscalibur (bd biosciences) and analyzed using cellquest software (bd biosciences). cells were harvested by centrifugation followed by a wash step with 10 ml dulbecco's 1x pbs (paa laboratories) to eliminate traces of protein from the media. cells were resuspended in 1 ml ice-cold 10% (w/v) tca and incubated on ice for 30 minutes followed by centrifugation. the supernatant, used for quantification of gsh and gssg, was immediately frozen in n2 and kept at 80c until later use. the tca pellet, used for protein thiol quantification, was washed in 10% tca by four cycles of sonication and centrifugation. before the final centrifugation step, the suspension was divided in four to quantify psh, psox, pssg, and total ps. the psh, pssg, and total ps samples were immediately frozen in n2 and kept at 80c until later use. the psox sample was directly solubilized and alkylated by sonicating the pellet in 500 l of 5% sds, 1 mm edta, 20 mm nem (sigma) in 0.5 m tris-cl ph 8.3. the alkylation was allowed to proceed for at least 20 min before the sample was transferred to 80c. thiol and disulfide species in tca supernatant and tca pellet fractions were quantified as described in. briefly, psh samples were solubilized in 5% sds, 1 mm edta in 0.4 m sodium citrate, ph 4.5 and protein thiols were quantified by the addition of 4-dps (sigma) to a final concentration of 0.5 mm followed by hplc analysis. for quantification of psox, samples alkylated with nem were reduced by the addition of bh (sigma) to a final concentration of 3.3% (w/v). prior to quantification with 4-dps, bh was destroyed by the addition of hcl, as described in. total ps was quantified by solubilizing the pellet in 5% sds, 1 mm edta, and 0.5 m tris-cl ph 8.3, reducing all thiols with bh, followed by thiol quantification with 4-dps. the pssg sample was solubilized in 6 m urea, 8 mm edta, and 200 mm bicine ph 9.2. disulfides were reduced with 2.1 mm thp (calbiochem) and thiols were derivatized by the addition of 6.4 mm sbd-f (fluka) for 1 hour at 60c. to compare samples, total protein content was determined by using a ninhydrin based assay. an hplc assay based on thiol derivatization with n-(1-pyrenyl)maleimides (fluka) was used to quantify gssg and total gs (gsh+gssg) from the supernatant as described in. for quantification of secreted glutathione, proteins in media from harvested cells were precipitated by the addition of tca to 10% (v/w) and incubated on ice for 30 minutes followed by centrifugation.

plasma cells produce and secrete massive amounts of disulfide-containing antibodies. to accommodate this load on the secretory machinery, the differentiation of resting b cells into antibody-secreting plasma cells is accompanied by a preferential expansion of the secretory compartments of the cells and by an up-regulation of enzymes involved in redox regulation and protein folding. we have quantified the absolute levels of protein thiols, protein disulfides, and glutathionylated proteins in whole cells. the results show that while the global thiol-disulfide state is affected to some extent by the differentiation, steady-state levels of glutathionylated protein thiols are less than 0.3% of the total protein cysteines, even in fully differentiated cells, and the overall protein redox state is not affected until late in differentiation, when large-scale igm production is ongoing. a general expansion of the er does not affect global protein redox status until an extensive production of cargo proteins has started.

PMC3800581

pubmed-522

cutaneous horn (synonyms; cornu cutaneum: cornu humanum) is a conical, hyperkeratotic protrusion that often resembles an animal horn. the term cutaneous horn is a morphologic designation referring to unusually cohesive keratinized material and not a true pathologic diagnosis. the earliest documented case of cutaneous horn, or cornu cutaneum, was that of an elderly welsh woman in london who was displayed commercially as an anomaly of nature in 1588. there were several other accounts of cutaneous horns in the sixteenth and seventeenth centuries, including those described by danish anatomist thomas bartholin in 1670. illustrations from that time portray these growths as grotesque, and numerous natural and supernatural theories arose regarding their etiology. for centuries cutaneous horns have been a subject of curiosities and controversies. in the late eighteenth century, the london surgeons everard home and his brother-in-law john hunter are generally credited with the characterization of cutaneous horns as a medical disorder. though cutaneous horn has been described at various sites, horn over the penis is very rare and represents the most unusual site. the first case report of a penile horn was published as early as 1854. since then there has been sporadic reporting of cases by dermatologists, surgeons and urologists mainly for curiosity and various conditions which may present as a penile horn. cutaneous horn occurs mainly in individuals who are above 50 years of age and penile horns are no exception to this rule. they are common in males after 50 years and probably coincide with the age group of occurrence of penile cancer. to this date lowe and mc cullogh reported that penile horn may be benign in 4256% of cases, premalignant in 2237% or frankly malignant in 2022%. cutaneous horn is a morphologic designation for a protuberant mass of keratin produced by unusual cohesiveness of keratinized material. it is rather intriguing to note that why only few patients develop penile horn when compared with other patients with similar disease. the roles of chronic irritation, phimosis, surgical trauma and radiotherapy that have been implicated in penile horn formation have also been found to predispose to carcinoma penis. the emphasis is on the long-standing phimosis with chronic, prolonged preputial inflammation; however, it has also been seen in circumcised men. adult circumcision has been found to precede horn formation by a period ranging from 2 weeks to a year. the analysis of the cases reported so far do not reveal any common factor that predisposes to the development of horn over the underlying pathology. the occurrence of horn in different disorders ranging from benign viral disease to malignant carcinoma further augments the view that the keratinous growth probably represents a reactionary event, which does not depend on the underlying pathology. pseudoepitheliomatous, keratotic and micaceous balanitis is another rare disease, which has been found to be associated with penile horn. it was, originally described by jacob and civatte who considered it to be benign. similarly, verrucous carcinoma is another tumor which has been found to be associated with penile horn. this tumor is a highly keratinizing tumor, and this probably predisposes for penile horn formation. the progression of cutaneous horn to malignancy though has been reported probably represents the manifestation of underlying tumor. causes of penile horn the role of human papillomavirus (hpv) in penile carcinoma is well studied. the hpv 16 and 18 are implicated as the causative agents. in penile horns that arise from malignancies such as verrucous carcinoma, penile horns present as elongated, keratinous, white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis [figures 1 and 2]. traumatic breakage of the horn is rare and can occur due to the projectile nature of the growth. hard keratotic mass arising from glans penis the patients seek treatment for the disfigurement and difficulty posed during intercourse. in general horns arising from malignant lesions tend to be harder on their bases due to the inflammatory process. their surface is rough, irregular, laminated or fissured, the ends pointed, blunt or clubbed. the color varies; it is usually grayish-yellow, but may be even blackish. commonly they are small in size, a fraction of an inch or an inch or thereabouts in length, but exceptionally attain considerable proportions. the base, which rests directly on the skin, may be broad, flattened, or concave, with the underlying and adjacent tissues normal or the papill hypertrophied; and in some cases there is more or less inflammation, which may be followed by suppuration. they are, as a rule, painless but become painful when knocked or irritated. the histopathology of the cause is diagnostic in most cases. from the histopathological point of view cutaneous horn can be classified as benign, premalignant and malignant based on the origin. it consists of closely agglutinated epidermic cells, forming small columns or rods. in the columns they have their starting-point in the rete mucosum, either from that lying above the papilla or that lining the follicles and glands. keratinous mass overlying the epidermis (40) part two is the underlying pathology beneath the keratotic mass. though histopathology is diagnostic certain other investigations are required particularly in patients with underlying malignancy. approximately one-third of penile cutaneous horns are associated with an underlying malignancy, and so magnetic resonance imaging is helpful when there is uncertainty regarding the depth of infiltration or proximal extension. as kaposi noted more than a century ago, cutaneous horns can be removed by simple detachment and cauterization of the papillary base. stage one is establishing the diagnosis and next stage is a definitive treatment based on the histopathology. penile horn can hide either benign or malignant lesions. therefore, what is really important is not the cutaneous horn itself, but the subjacent disease. hence, it is justifiable to perform a local surgical excision for the histopathological diagnosis of its base. a wide local surgical excision is performed on the lesion in case of suspected malignancy to obtain the histopathological diagnosis. though various methods including electrosurgical excision, laser and cryosurgery, have been described as effective laser therapy with carbon dioxide or neodymium: yttrium aluminum garnet laser leaves lesser scarring with more cosmetic results. they are not preferred as they alter the histopathology of the lesion. in case of a benign lesion, excision of the horn would suffice. in case of verrucous carcinoma, wide local surgical excision should be followed up regularly. if the biopsy reveals squamous cell carcinoma, the treatment of choice is partial or complete penectomy with urethral diversion and perineal urethrostomy. the penile horn continues to fascinate the dermatologists and surgeons alike because of the morphological appearance and presentation. the penile horn is only a morphological entity and the true pathology masked by it.

cutaneous horn refers to unusually cohesive keratinized material and not a true pathologic diagnosis. though cutaneous horn has been described at various sites, horn over the penis is very rare and represents the most unusual site. the role of chronic irritation, phimosis, surgical trauma and radiotherapy have been implicated in penile horn formation. penile horns present as elongated, keratinous, white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis. histopathology of the keratotic mass reveals nothing but keratin. the underlying mass may vary from verruca vulgaris to squamous cell carcinoma. the treatment is based on the pathology.

PMC4555894

pubmed-523

whenever lesions in the ascending aorta and aortic arch have from direct aortic cannulation, arterial cannulation via the femoral artery has been used for a long time. however, because retrograde aortic dissection and nonperfusion into the true lumen are possible, the technique of selective antegrade perfusion under deep hypothermia using the axillary artery has become a standard perfusion method. axillary artery cannulation, however, has some drawbacks, including technical problems. limitations of deep hypothermia have also been reported. the benefits of using selective perfusion under moderate hypothermia for brain protection have been reported in recent years. reported that cannulation via the brachial artery, instead of the axillary artery, could be useful for a good operative field, a short operation time, and brain protection. methods for protecting the brain during surgeries of the ascending aorta and the aortic arch have been developing, but remain controversial. antegrade perfusion via the axillary artery shows better results than retrograde perfusion via the femoral artery; nevertheless, both of them have benefits and drawbacks. we tried to use antegrade and retrograde perfusion at the same time, with the aim of avoiding the fatal problems of either method alone. also we expected the brachial artery approach to be easier than that of the axillary artery. we report our clinical experiences using the ascending aorta and aortic arch replacement with perfusion via the brachial and femoral arteries under moderate hypothermia. forty-six consecutive patients underwent replacements of the ascending aorta and aortic arch between july 2005 and may 2010. we reviewed 36 patients who had been operated using a perfusion method via the right brachial and femoral artery under moderate hypothermia. ten patients were excluded because deep hypothermia or two cerebral perfusions including the left common carotid artery were used. we analyzed the preoperative diagnoses, operations, cardiopulmonary bypass time, selective antegrade cerebral perfusion time under circulatory arrest, lowest core temperature, operation mortality rate, and neurologic deficits by retrospectively reviewing the medical records. we defined the postoperative neurologic states showing delirium, irritability, or confusion during the postoperative days with normal brain computed tomography or mri findings as minor neurologic dysfunction, and the states among the above with definite lesions in brain ct or mri, or motor dysfunctions, as major neurologic dysfunction. we positioned the patients in supine position with the right arm abducted, and made incisions in the right axillary and inguinal area to expose the right brachial and the femoral artery at the same time in the manner by tasdemir et al.. after performing a median sternotomy and exposing the aorta and heart, we administered heparin and inserted cannulae into the right brachial and femoral artery. we directly inserted a 12-fr cannula (fem-flex ii, edwards lifesciences, usa) into the brachial artery, or an anastomosed 8-mm graft (intergard, intervascular, usa) to the brachial artery in an end-to-side manner when it was small. we directly inserted an 18-fr cannula (fem-flex ii, edwards lifesciences, usa) into the femoral artery. by reviewing the preoperative ct, we decided to use the femoral artery, which was connected to the true lumen. we connected the cardiopulmonary bypass circuit to the two cannulae using a y-shaped tube. venous cannulae were inserted into the ivc and svc. with the cardiopulmonary bypass running and the rectal temperature lowered to 24, we stopped femoral artery perfusion and maintained 40% of total perfusion via the right brachial artery. after blocking the aortic arch vessels with vascular clamps, we performed aortotomy and directly infused cardioplegic solution into the coronary artery ora. without clamping, we anastomosed the distal aorta, which was open, to a prosthetic bypass graft in an end-to-end manner. we anastomosed the aortic arch vessels, including the innominate artery, to the side of the prosthetic graft in the shape of an island simultaneously or to the prosthetic graft with 4 branches (intergard, maquet gmbh&co., germany) in an end-to-end manner, according to the range of the lesions. after finishing the anastomoses of the aortic arch, we anastomosed a 10-mm sized prosthetic graft to the side of the prosthetic graft in an end-to-side manner and used it as an arterial perfusion line. we then clamped the proximal side and started perfusion antegradely. while raising body temperature, we performed proximal anastomosis of the aorta. we verified that cerebral oxygen saturation (cerebral oximeter, invos monitor rs 232, somanetics, usa) was constantly maintained at a certain standard during the entire operation, including during cerebral perfusion. the mean age of the patients was 61.9 years (29 to 79 years), and 19 were male and 17 were female. the preoperative diagnoses were acute type a aortic dissection in 31 (86%) patients, and aortic aneurysm without dissection in 5 (14%) patients. there were 3 patients who were in preoperative shock with a creatinine level elevated to over 2.5, showing renal dysfunction (table 1). we performed ascending aorta replacement in 9 cases (25%), ascending aorta and hemiarch replacement in 13 cases (36%), ascending aorta and total arch replacement in 13 cases (36%), and total aortic arch replacement in 1 case (3%). operations which were performed simultaneously were a coronary bypass graft in 3 cases, aortic valve replacement in 2 cases, and aortic root reimplantation in 1 case. mean cardiopulmonary bypass time was 209.485.1 minutes, and selective antegrade cerebral perfusion time under the circulatory arrest was 36.124.2 minutes. five patients died within the first 30 days after operation (mortality rate, 13.8%). the causes of death were diffuse hypoxic brain damage in 1, acute myocardial infarction in 1, mediastinitis in l, bleeding in 1, and low cardiac output in l. there were 2 (5.5%) cases of minor neurologic dysfunction defined as delirium, irritability, or confusion during the postoperative days without brain ct and mri abnormalities. there were 6 (16.6%) cases of major neurologic dysfuction, with patients showing motor dysfunction or definite brain lesions in brain ct or mri. diffuse hypoxic brain damage occurred in 1 patient, left brain infarction in 3 patients, and right brain infarction in 2 patients. of the 6 patients who had major neurologic dysfunctions, 3 patients had preoperative unconsciousness or brain infarction. other complications were one case of reoperation due to bleeding, one case of mediastinitis and one case of vocal cord palsy. there were no complications related to the cannulation of the right brachial artery in the axillary area. in 3 cases, perfusion techniques for protecting the brain during surgeries of the ascending aorta and aortic arch have been controversial for a long time, but are constantly being developed. the complementary addition of retrograde cerebral perfusion has produced better operation results. though this technique continues to be used widely, has shown through animal experiments that retrograde cerebral perfusion can not supply complete perfusion to brain tissues. for this reason, surgeries using antegrade perfusion techniques started to be reported, demonstrating good operative results. recently, selective antegrade cerebral perfusion using the axillary artery became a standard perfusion technique for performing ascending aorta and aortic arch operations [1,13-15]. a wide review of the literature shows that axillary artery cannulation has produced better results in the protection of the brain than the femoral artery cannulation. however, gulbins et al. pointed out that there is a lack of evidence for the axillary artery to be recommended as a standard cannulation site. direct cannulation into the femoral artery in acute type a aortic dissection can cause retrograde dissection or malperfusion to the true lumen. dissection of the innominate artery may also occur during axillary artery cannulation, as imanaka et al. we therefore tried to perform antegrade and retrograde perfusion simultaneously, in order to provide against the fatal shortcomings of each approach. applying deep hypothermia requires ample time to raise and lower the temperature and may cause some side effects. wilde reported that deep hypothermia could keep coagulation down, and change the components of blood. cooper et al. reported that deep hypothermia could suppress the function of vascular endothelial cells and be involved in cell death, consequently bringing about multiple organ dysfunction. to avoid the drawbacks of deep hypothermia, some trials used selective cerebral perfusion under moderate hypothermia, resulting in excellent brain protection. we performed surgeries while lowering the core temperature to around 24, but we did not block cerebral perfusion during the entire time of operation. this allowed us to perform operations without the concern of brain damage, and required little time for raising and lowering the core temperature and for cardiopulmonary bypass. there were 3 cases of renal dysfunction, which we believe to be related to preoperative renal dysfunction due to shock, and to be independent of the temperature during operation. reported that using the brachial artery instead of the axillary artery for arterial cannulation could provide a good operative field, save operation time, and show good brain protection. it took 10 to 15 minutes to cannulate the artery directly and 25 to 30 minutes to connect a prosthetic graft to the brachial artery when it was very small. according to our experiences, the cannulation of the brachial artery was easier and supplied a cleaner operative field than that of the axillary artery. the incidence of major cerebral dysfunctions was a bit higher (6 cases, 16.6%). this resulted from our inclusion of 3 cases in which the state of preoperative unconsciousness or brain infarction could have been identified. there was diffuse hypoxic brain damage in 1 case, left brain infarction in 3 cases, and right brain infarction in 2 cases, so we supposed that only right cerebral perfusion might not be the cause of brain damage. the mortality rate (13.8%) was also higher than in previous studies, resulting from a higher rate of acute aortic dissection in our study group. even though methods of brain protection for ascending aorta and aortic arch operations are continuously progressing, there is still much debate about which sites are good to cannulate for arterial access, and to what degree it would be effective and safe to lower temperatures.. noted that additional methods for brain protection are needed, since cerebral perfusion through the right axillary artery can not supply enough perfusion to the left brain hemisphere in some people, pointing out that the development of circle of willis could be incomplete embriologically. kazui et al. suggested the " kazui technique ", in which antegrade cerebral perfusion is performed with catheters inserted into the three aortic arch branches during aortic arch replacement. olsson and thelin suggested bilateral cerebral perfusion via the right axillary artery and the left common carotid artery by inserting a supplementary catheter into the left common carotid artery during circulatory arrest. the authors have also inserted supplementary catheters into the left common carotid artery and the left subclavian artery recently, and will be reporting the results. using the right brachial and the femoral arteries as routes for arterial access under moderate hypothermia showed satisfactory results when there were lesions which made direct cannulation into the ascending aorta difficult during ascending aorta and aortic arch replacements. further studies are needed for to improve bilateral cerebral perfusion for more complete brain protection.

backgroundselective antegrade perfusion via axillary artery cannulation along with circulatory arrest under deep hypothermia has became a recent trend for performing surgery on the ascending aorta and aortic arch and when direct aortic cannulation is not feasible. the authors of this study tried using moderate hypothermia with right brachial and femoral artery perfusion to complement the pitfalls of single axillary artery cannulation and deep hypothermia. materials and methodsa retrospective analysis was performed on 36 patients who received ascending aorta or aortic arch replacement between july 2005 and may 2010. the adverse outcomes included operative mortality, permanent neurologic dysfunction and temporary neurologic dysfunction. resultsof these 36 patients, 32 (88%) were treated as emergencies. the mean age of the patients was 61.9 years (ranging from 29 to 79 years) and there were 19 males and 17 females. the principal diagnoses for the operation were acute type a aortic dissection (31, 86%) and aneurysmal disease without aortic dissection (5, 14%). the performed operations were ascending aorta replacement (9, 25%), ascending aorta and hemiarch replacement (13, 36%), ascending aorta and total arch replacement (13, 36%) and total arch replacement only (1, 3%). the mean cardiopulmonary bypass time was 209.485.1 minutes, and the circulatory arrest with selective antegrade perfusion time was 36.124.2 minutes. the lowest core temperature was 242.1. there were five deaths within 30 post-op days (mortality: 13.8%). two patients (5.5%) had minor neurologic dysfunction and six patients, including three patients who had preoperative cerebral infarction or unconsciousness, had major neurologic dysfunction (16.6%). conclusionwhen direct aortic cannulation is not feasible for ascending aorta and aortic arch replacement, the right brachial and femoral artery can be used as arterial perfusion routes with the patient under moderate hypothermia. this technique resulted in acceptable outcomes.

PMC3249305

pubmed-524

despite significant advances in our understanding of paediatric pain and the publication of pain management guidelines by several leading paediatric bodies in recent years, multiple studies and reviews show that pain in children continues to be poorly managed. as maclean et al. (2007) note, there remains a gap between what we know to be effective, easily implemented pain management strategies, and what is actually practiced. given these findings are based on their review of pain management practices in a paediatric teaching hospital in a high income country, it is perhaps not surprising this gap is larger in low income countries where resources, in their broadest sense, are more constrained. some barriers to managing a child's pain are common to a wide variety of health care settings, such as lack of provider training in the recognition, assessment and management of pain, and attitudes and beliefs regarding pain and its management. other barriers likely play a significant role mainly in low income countries where resources in terms of manpower, equipment, and medications, are in chronic short supply and must be balanced across the competing needs of patients presenting to providers practicing in these settings. despite these issues, given the current state of knowledge in this area, and the wide variety of options now available for managing paediatric pain, many of these barriers can be overcome through adaptation of published guidelines to address the unique needs and barriers of specific health care settings. this paper describes the development of a paediatric analgesia and sedation protocol, tailored to the specific setting of the medical research council (mrc) paediatric ward in the gambia, west africa. although a combined paediatric and adult protocol was ultimately developed, only the paediatric portion is reported here. for clarity of presentation, the protocol development process will be described in 3 steps. however, it is important to note, that an iterative process was employed beginning with a recognized need to improve pain management expressed by local clinical staff, and with feedback from local providers sought and incorporated throughout the development process. as noted above, protocol development began with an expressed desire for a pain management protocol tailored to the mrc paediatric ward, to facilitate efforts by clinical staff toward improving pain management. as a first step, key local informants including the senior clinician of the hospital, the matron, and another senior nurse, were interviewed to gain a comprehensive understanding of the hospitals resources, current practices and staff level of training, medication availability, and cost implications. two important considerations emerged from this consultation process, which were shortage of airway support capabilities and limited staff training in pain assessment and monitoring. to further assess the airway capabilities on the ward, sufficient airway equipment was located to organize two complete airway kits, which included oral airways, bag-valve-masks, intubation medications and equipment. discussions with physician and nursing staff, revealed both had little training or experience in pain management. for this reason it was felt that a more directive and structured protocol, with a strong educational component to accompany roll out of the protocol was needed. the second step in development of the protocol began with a review of published paediatric analgesia and sedation guidelines, the evidence base for their development where possible, and consultation with experts in paediatric sedation and analgesia. as most published guidelines were developed in and for high income health care settings, during the review process and again in consultation with key local informants a list of issues relevant to paediatric pain management on the mrc ward was identified. concerns were identified with respect to several unique attributes of the gambian population, specifically the relative high prevalence of hemoglobinopathies [3, 4] and under-nutrition particularly in the first 2 years of life. it was notable that despite the importance of cultural in perceptions and beliefs with respect to pain, no cultural issues were identified as important to pain management efforts in this setting. hemoglobinopathies, like sickle cell anemia and glucose-6-phosphatase deficiency (g6pd), are relatively common in the gambia [3, 4] and present challenges for managing pain. many established guidelines and experts recommend against sedation in sickle disease patients, and sickle trait patients with low oxygen saturations, unless anaesthesia is in attendance. given anaesthesia support is not available at the mrc, these were included as absolute contraindications to sedation in the mrc protocol. of additional concern is the potential for local anaesthetic induced methemoglobinemia. for a variety of reasons, including effectiveness, hemodynamic safety requiring no special monitoring, and availability of inexpensive preparations, local anaesthetics are ideal for management of brief painful procedures. while a variety of local anaesthetics have been reported to induce methemoglobinemia, reported cases have occurred mainly in very young infants or where excessive quantities of topical anaesthetic are used. although an uncommon complication and relatively easily managed in the general population with methylene blue, treatment of methemoglobinemia is significantly more complicated in individuals with g6pd deficiency where methylene blue can cause acute hemolysis and more intensive care, including exchange transfusions, may be required. given the high incidence of g6pd in the gambian population, cost and time required for testing, and potential for this serious complication whose treatment is beyond the resource capacity of the setting, use of topical anaesthetics was strictly limited to children at least 6 months of age and within recommended dosing guidelines. guidelines and experts generally recommend 3 months of age corrected for prematurity; however, given the prevalence of under-nutrition and difficulties in accurately assessing both age of gestation and date of birth in this setting, the age restriction was broadened to ensure minimum safety guidelines were observed. based on the findings of the first two stages of protocol development outlined above, a draft protocol was created and circulated to key local informants and an expert in paediatric pain management for feedback and amendment. perhaps not surprising considering the iterative nature of the development process, with the exception noted below, no major changes were suggested. at this stage the draft appeared as a numbered list of process steps with considerations at each step outlined within the section. for example, within the analgesia section, all available options were listed with their indications, contraindications, and dosages. while this format was modelled after other published protocols, and meant to emphasize options and provider choice, feedback from key local informants suggested that a more limited and algorithmic approach, presented as a flow chart would facilitate adoption of the protocol, particularly early on in the course of the campaign to improve pain management. based on this feedback the protocol was reworked into a flow chart (see figure 1), with the original protocol with small amendments included as a detailed reference or guide. the amended draft was again circulated to key local informants and the pain management expert, with no further revisions suggested. as a final step in the development of the protocol, the protocol was presented to the physician group at academic rounds, and at a staff meeting to the nursing and health attendant staff, with minor changes to the protocol incorporated as a result of feedback from these sessions. in addition to the final product, that is, the paediatric pain management protocol tailored to the mrc ward, other benefits were gained through the process of development. as a result of the equipment survey, two airway kits were created and placed together with other basic resuscitation equipment into a strategic location within the unit for ready access. equally important is early evidence that through the educational and feedback sessions, further interest in improving patient care was fostered among clinical staff. as one physician reported i encountered a case today where i would normally not have considered pain management, but after the session the other day, i decided i better do something. as clemmer and spuhler (1998) have argued, the purpose of creating protocols is greater than reducing practice variation, it also creates new paradigms and changes the culture in which health care is delivered, with the protocol itself designed to be transient, and the development process and the changes it produces, more important than the product itself. however, to ensure successful implementation of the protocol and ongoing improvements in paediatric pain management, further steps are needed. ongoing education of clinical staff, particularly early in the implementation process and as new staff are hired, is essential to ensure safe and appropriate pain management procedures. intermittent reassessment and revision based on experiences in using the protocol is needed to allow for adaptation as the needs of the patients served and the resources and options available change. despite some progress in recent years, pain continues to be undertreated globally, particularly in children, and particularly in low income countries. published guidelines based on best available evidence, can and should be adapted to allow for optimal pain management given the resources and capabilities of a given health care setting. it is hoped that the development process and protocol described here will not only help to improve care on the mrc ward, but serve as an example to others working toward improving pain management in similar health care settings.

despite recent advances in our understanding of paediatric pain and its management, pain continues to be undertreated globally, particularly in children and in low income countries. this article describes the development of a paediatric analgesia and sedation protocol, tailored to the specific setting of the medical research council (mrc) paediatric ward in the gambia, west africa. an iterative process was used throughout development, with inputs from the medical literature, local providers, and pain experts, incorporated to ensure a safe, effective, and locally appropriate protocol. we demonstrate that evidence-based published guidelines, can and should be adapted to allow for optimal pain management given the resources and capabilities of specific health care settings. it is hoped that the process and protocol described here, will not only help to improve care on the mrc ward, but serve as an example to others working toward improving pain management in similar health care settings.

PMC2905953

pubmed-525

h. pylori infection is reported to include pathologic changes of the stomach, including edema and congestive surface epithelium. a characteristic event in gastritis is the infiltration of the subepithelial gastric lamina propria by phagocytes, mainly neutrophils and macrophages, that produce large amounts of reactive oxygen species (ros). ros activate the oxidant-sensitive transcription factor nf-b, which induces expression of the inflammatory genes, oncogenes, and cell-cycle regulators. h. pylori-induced gastric mucosal injury and inflammation are mediated by proinflammatory cytokines such as interleukin (il)-8 and il-1 as well as inflammatory enzymes, including inducible nitric oxide synthase (inos). transcription of these inflammatory mediators is regulated by the oxidant-sensitive transcription factor nf-b [610]. nf-b is an inducible transcription factor composed of p50/p65 (heterodimer) or p50 (homodimer). nf-b is retained in the cytoplasm by binding to the inhibitory protein ib. extracellular stimuli trigger rapid degradation of ib by proteasomes, allowing nf-b to translocate into the nucleus and bind to the dna sites of target genes, including il-8, il-1, and inos.. h. pylori-elicited neutrophils produce ros, which subsequently injure gastric mucosal cells. ros cause peroxidation of membrane lipids, thus increasing the level of lipid peroxide (lpo) in the damaged tissues. we previously demonstrated that lpo production increases in parallel with il-8 production in h. pylori-infected cells. myeloperoxidase (mpo) is more abundantly expressed in neutrophils than other cells and thus, is used as a biomarker for neutrophil infiltration. in neutrophils ,. therefore, high levels of lpo and increased mpo activity could reflect oxidative damage and inflammatory responses of cells. korean red ginseng, which is the steamed root of a 6-year-old korean ginseng (panax ginseng meyer), is used in asian countries as a traditional medicine for the treatment of various diseases, including inflammatory disorders [1618]. an in vitro study showed that korean red ginseng inhibited adhesion of h. pylori to gastric epithelial cells. korean red ginseng extract (rge) inhibits h. pylori-induced oxidative damage in gastric epithelial cells. previously we showed hepatoprotective effects of korean red ginseng in rats and mouse liver, which may be contributed by its antioxidant activity. therefore, the antioxidant or anti-inflammatory effects of rge, containing ginsenosides, may protect gastric mucosa from inflammation caused by h. pylori infection. in the present study, we investigated whether rge protects against h. pylori-induced gastric inflammation in mongolian gerbils. animal models for h. pylori infection have been developed to replicate many features of human gastric inflammation and carcinogenesis in order to test potential therapeutic agents for the prevention and treatment of h. pylori-associated gastric disease. the mongolian gerbil model is the best animal model for this purpose because h. pylori infection induces chronic gastritis, gastric ulcers, and intestinal metaplasia in these animals. mongolian gerbils develop gastric neoplasia and gastric cancer after chronic infection by h. pylori strain 7.13, as used in the present study. after the infection of gerbils with h. pylori, we determined: the changes in lpo level, which is an index of oxidative membrane damage; the activity of mpo, a biomarker of neutrophil infiltration; the induction of inflammatory mediator keratinocyte chemoattractant factor (kc), an il-8 homolog in rodents; il-1; inos; and the phosphorylation of ib, which reflects the activation of nf-b. in addition, viable h. pylori colonization in the stomach, changes in food intake and body weight, stomach weight/total body weight, and histological analysis of gastric mucosa were compared between animals that received rge and those that did not. five-wk-old male specific-pathogen-free mongolian gerbils (mgs/sea) with an average weight of approximately 40 g were purchased from charles river laboratories (wilmington, ma, usa). gerbils were housed in polypropylene cages on hard wood chip bedding in groups of five/cage. the animals were maintained in a temperature-controlled room (22 2c) with a 12-h light protocols were reviewed and approved by the institutional animal care and use committee of the yonsei university medical center (seoul, korea; permit no. all animals were maintained in the specific pathogen-free facility at yonsei university medical center. bacteria were grown on horse blood agar plates containing 4% columbia agar base (oxoid, basingstoke, hampshire, uk), 5% defibrinated horse blood (hemostat labs, dixon, ca, usa), 0.2% -cyclodextrin, 10 g/ml vancomycin, 5 g/ml cefsulodin, 2.5 u/ml polymyxin b, 5 g/ml trimethoprim, and 8 g/ml amphotericin b at 37c under microaerophilic conditions. a microaerobic atmosphere was generated using a campygen sachet (oxoid) in a gas pack jar. for liquid culture, h. pylori was grown in brucella broth (difco&bbl diagnostics, franklin lakes, nj, usa) containing 10% fbs (gibco-brl, grand island, ny, usa). 10 bacteria were collected and resuspended in 500 l of brucella broth for the infection of each animal. a standardized water extract of korean red ginseng was prepared and supplied by the korea ginseng corporation (daejeon, korea) as described previously. the content of crude saponin in rge is approximately 7%, and it is composed of the following ginsenosides: 8.27 mg/g of rb1, 3.22 mg/g of rb2, 3.90 mg/g of rc, 1.09 mg/g of rd, 2.58 mg/g of re, 1.61 mg/g of rf, 2.01 mg/g of rg1, 1.35 mg/g for (20s)-rg2, 1.04 one wk after inoculation with h. pylori, mongolian gerbils were fed control ain76a diet (research diets, inc, new brunswick, nj, usa) or a diet containing rge (200 mg rge/each gerbil) for 6 wk. as a negative control, mongolian gerbils that were not inoculated with h. pylori were fed the control diet ain76a. gerbils that were inoculated with h. pylori were fed the control diet ain76a and considered as a positive h. pylori control. this level of rge supplementation (200 mg rge/gerbil) was adapted from previous studies showing the protective effect of rge against oxidative stress-mediated epithelial damage. body weight and food intake were measured every wk during the experimental period. at the end of experimental period, gastric mucosal tissues were examined histologically and h. pylori colonization was confirmed. for biochemical analyses, gastric mucosal samples were homogenized in 10 mm tris buffer (ph 7.4). the homogenates were used for determining lpo level, mpo activity, and protein levels of kc, inos, phospho-specific ib and ib. for mrna level of kc, il-1, and inos, total rna was isolated from a gastric mucosal sample by the guanidine thiocyanate extraction method. rge supplementation had no effect on any of these parameters in animals not infected with h. pylori, determined in our preliminary study. the number of viable h. pylori in the animal stomach was determined as previously described. after the animals were fasted for 24 h, they were euthanized, and their stomachs excised. the stomach was dissected along the greater curvature and washed with 0.01 m phosphate-buffered saline (pbs, ph 7.4) and then divided longitudinally into two halves. one half of each stomach was homogenized in 10 ml of pbs using a polytron. the plates were incubated at 37c under microaerobic conditions for 5 d. the colonies were counted and the number of viable h. pylori was expressed as colony forming units/g of tissue. the other half of each stomach was fixed in 10% neutral buffered formalin and embedded in paraffin. paraffin sections were cut into 4-m slices and stained with hematoxylin and eosin for morphological observation. morphological features of the gastric antrum and body were graded using the following four-point scale: grade 0 (normal), grade 1 (mild), grade 2 (moderate), and grade 3 (severe). four aspects of gastric lesions were recorded according to the updated sydney system: polymorphonuclear leukocytes (pmns) infiltration; chronic inflammation, such as mononuclear cell infiltration and lymphoid nodule formation; intestinal metaplasia and hyperplasia; and formation of heterotopic proliferative glands. lpo levels were measured by colorimetric assay as thiobarbituric acid reactive substances and the results were expressed as pg/mg protein. one unit of mpo activity was defined as the activity required to degrade 1 mol of peroxide/min at 25c. mrna expression of inos and kc was assessed using real-time reverse transcription-polymerase chain reaction (rt-pcr) analysis. total rna isolated from mucosal homogenate was reverse transcribed into cdna and used for pcr with mongolian gerbil-specific primers for kc, il-1, inos, and -actin. sequences of kc primers were cacccgctcgcttcttc (forward primer) and atgctcttggggtgaatcc (reverse primer). for inos, the forward primer was gcatgaccttggtgtttgggtgcc and the reverse primer was gcagcctgtgtgaacctggtgaagc. for -actin, real-time rt-pcr reactions were prepared using taqman reagents (applied biosystems, foster city, ca, usa) for inos, kc, and -actin. a dna engine (ptc-200) and its system interface software (mj research, waltham, ma, usa) were used to run samples and analyze data. the -actin gene was amplified in the same reaction and served as the reference gene. kc and inos mrna levels were reported relative to those of animals not inoculated with h. pylori that were fed the control diet. kc and inos mrna values for the negative control group were set equal to 1. the level of kc in gastric mucosal tissues was measured using an enzyme-linked immunosorbent assay and a mouse kc assay kit (ibl, gunma, japan). total cell extracts were prepared from gastric mucosa and separated by sds-polyacrylamide gel electrophoresis under reducing conditions. after blocking using 5% nonfat dry milk, the membranes were incubated with anti-inos (santa cruz biotechnology, santa cruz, ca, usa), anti-phospho-ib, anti-ib (cell signaling technology, inc., beverly, ma, usa), and anti-actin antibodies (santa cruz biotechnology). the immunoreactive proteins were visualized using anti-mouse secondary antibody conjugated to horseradish peroxidase, followed by enhanced chemiluminescence (amersham). cary, nc, usa). statistical differences between groups were determined using one-way analysis of variance and newman keuls test. all values were expressed as the mean standard deviation for 10 gerbils in each group. in order to examine gross changes of h. pylori-infected mongolian gerbils consuming rge dietary supplements, food intake and body weight change were determined every wk during the experimental period. the weight gain and food intake were similar in all three groups (data not shown). this finding was supported by previous studies showing that h. pylori infection did not affect either body weight or food intake in mongolian gerbils. to determine whether rge inhibits h. pylori colonization in gastric mucosa, the number of viable h. pylori in the stomachs of gerbils infected with h. pylori were determined after 6 wk of dietary supplementation with rge (fig. in addition, stomach wet weights were compared between groups at the end of the experiment (fig. animals infected with h. pylori had significantly more h. pylori colonization and greater stomach weight than noninfected animals. rge supplementation had no effect on the number of viable h. pylori in the stomach. h. pylori-induced increases in the stomach weight tended to be smaller in the rge-treatment group than in the control-diet group, but this difference was not significant. rge had no antibacterial effect and did not reduce pathologic changes of the stomach, such as edema, in animals infected with h. pylori. in h. pylori-infected animals, moderate to severe gastritis was accompanied by pmn infiltration, mainly neutrophil infiltration, and by lymphoid follicle formation in the mucosa and submucosa. the hyperplasia and mucous-gland metaplasia of epithelial cells in infected animals were obvious (fig. 2a, middle panel) in comparison with the normal gastric mucosal regions of noninfected animals (fig. the gastric mucosal lesions of rge-supplemented animals showed less evidence of inflammatory cell infiltration, hyperplasia, and intestinal metaplasia than those of infected animals fed the control diet (fig. 2a, right panel). h. pylori-induced chronic inflammation was reduced by rge treatment. however, none of these differences between h. pylori-infected animals that were supplemented with rge and those that were fed the control diet were significant. taken together, rge improved the histological grade of pmn infiltration, intestinal metaplasia, and hyperplasia in mongolian gerbils, which suggests that rge has an anti-inflammatory effect against h. pylori-induced gastric inflammation. 3a, mpo activity in gastric mucosa was increased by h. pylori infection, and was attenuated by rge supplementation. the reduced mpo activity in the gastric mucosal tissues of the rge-treatment group was associated with reduced infiltration by neutrophils (fig. 2). rge supplementation inhibited h. pylori-induced neutrophil infiltration in the gastric mucosal lesions of mongolian gerbils. the level of lpo, an oxidative damage index, was higher in the gastric mucosal tissues of h. pylori-infected animals than that in noninfected animals (fig. rge supplementation suppressed the h. pylori-induced increase in the lpo level of gastric mucosal tissues. to investigate the inhibitory effects of rge against h. pylori-induced inflammation, the expression levels of important inflammatory mediators (kc, il-1, inos) were determined in the gastric mucosal tissues of animals infected with h. pylori that were and were not supplemented with rge. as shown in fig. 4, the mrna expression of kc, il-1, and inos in gastric mucosal tissues was greater in h. pylori-infected animals than in non-infected animals. il-1, and inos was significantly lower in the rge-treatment group than in the control-diet group. protein levels of kc and inos induced by h. pylori infection were also lower in the rge-treatment group than in the control-diet group, as determined by enzyme-linked immunosorbent assay and western blotting, respectively (fig. 5b, the level of phospho-ib was greater in the h. pylori-infected groups than in the noninfected group, and was lower in the rge-treatment group than in the control-diet group. ib, which was lower in the h. pylori-infected groups than in the noninfected group, was maintained in the rge-treatment group. this suggests that rge supplementation may inhibit nf-b activation by suppressing phosphorylation of ib in the gastric mucosal tissues of h. pylori-infected mongolian gerbils. the present study demonstrates that dietary supplementation of rge fed to mongolian gerbils for 6 wk improves h. pylori-induced gastric lesions, as determined by histological observation. rge moderated the h. pylori-induced increase in neutrophil infiltration, mpo activity, lpo level, and the expression of inflammatory mediators (kc, il-1, inos). rge was also associated with a reduction in i phosphorylation relative to that measured in animals fed the control diet. this demonstrates that rge has an anti-inflammatory effect on h. pylori-induced gastric inflammation in mongolian gerbils. however, the number of viable bacteria obtained from the gastric mucosal tissues of h. pylori-infected animals fed a diet supplemented with rge was not different from that obtained from animals receiving a control diet without rge. rge may not have an antibacterial effect on h. pylori colonization in the gastric mucosa of mongolian gerbils. a previous study demonstrated that panaxytriol isolated from ginseng was effective in inhibiting h. pylori growth with an mic of 50 g/ml. however, our preliminary study using gastric epithelial ags cells showed that rge did not affect the growth of h. pylori for 24 h culture (data not shown). in addition, long-term exposure of rge to the cells and animals infected with h. pylori is necessary to determine whether rge has bactericidal/bacteriostatic effect. even though rge has no cytotoxic effect on the bacterium, rge may be beneficial for preventing and inhibiting the development of the gastric inflammation induced by h. pylori infection by reducing oxidative stress and suppressing the expression of inflammatory mediators in gastric mucosa. kc, an il-8 homolog, is a neutrophil chemoattractant that is involved in murine inflammation by stimulating neutrophil infiltration into infected tissues. increased activity of mpo represents neutrophil infiltration to the infected tissues and propagation of inflammation. h. pylori-associated gastric mucosal injuries, including inflammation, are attributed to the activated neutrophils that adhere to postcapillary venules and subsequently migrate into the interstitium. we found that h. pylori infection increased kc expression and mpo activity, suggesting increased infiltration of neutrophils into gastric mucosal tissues of mongolian gerbils. the results are supported by histological observation showing neutrophil infiltration in h. pylori-infected gastric mucosa in the present study. because rge supplementation reduced kc expression, rge may attenuate gastric inflammation by suppressing kc-mediated neutrophil infiltration into h. pylori-infected gastric mucosal tissues of mongolian gerbils. rge supplementation inhibited the expression of the inflammatory mediators (inos, kc, and il-1) that was induced by h. pylori infection. increased activity of inos and high levels of kc and il-1 have been observed in the gastric mucosa of patients with chronic gastritis and gastric adenocarcinoma. neutrophil infiltration is positively correlated with the expression of inos and inflammatory cytokines in gastric mucosa. these studies showed that the upregulation of inos, kc, and il-1 by h. pylori infection might be associated with neutrophil infiltration. ros are produced from the activated neutrophils in h. pylori-infected gastric mucosa. ros activate oxidant-mediated transcription factors such as nf-b, which induces the expression of inos, kc, and il-1. therefore, rge inhibits the expression of inflammatory cytokines including inos, kc, and il-1 by suppressing the neutrophil infiltration caused by h. pylori infection in the gastric mucosa of mongolian gerbils. because the expressions of inflammatory mediators are critical for gastric inflammation and carcinogenesis, rge may prevent the development of the gastric inflammation and gastric cancer that is associated with h. pylori infection. phosphorylation of ib is required for nf-b activation, which regulates the expression of kc, il-1, and inos. phosphorylation of ib acts as a trigger for ib degradation, allowing the nuclear translocation of nf-b and the expression of nf-b target genes. even though the mongolian gerbil model is good for studying gastric inflammation and gastric cancer induced by h. pylori infection, there are few antibodies reported in the studies using mongolian gerbils. due to lack of antibodies, it is difficult to examine the serum levels of inflammatory mediators such as cytokines, which is a noninvasive way to confirm gastritis. therefore, we assessed the phospho-specific form of ib as a biomarker of nf-b activation in the present study. several studies have demonstrated that h. pylori induces the expression of proinflammatory mediators such as kc, il-1, and inos through the activation of nf-b. in the present study, the results suggest that rge inhibits the expression of kc, il-1, and inos in the h. pylori-infected gastric mucosal tissues of mongolian gerbils by suppressing the phosphorylation of ib, and thus inhibits nf-b activation. lipid peroxidation is involved in the pathogenesis of gastric diseases, including gastritis, that are associated with h. pylori infection. in the present study, the lpo level in the gastric mucosal tissues of mongolian gerbils was increased by h. pylori infection. the inhibitory effect of rge on increases in lpo levels induced by h. pylori infection may be related to a reduction in mpo activity in the gastric mucosal tissues of animals supplemented with rge. the main source of ros production may be host neutrophils that are activated by h. pylori. therefore, rge may decrease the production of ros and lipid peroxidation through inhibition of kc-mediated neutrophil infiltration in h. pylori-infected gastric mucosa. previously, we found that h. pylori itself activates nadph oxidase to produce ros in gastric epithelial cells, resulting in the induction of nf-b-mediated expression of il-8, il-1, and inos [68]. therefore, rge may inhibit nadph oxidase and thus suppress the ros production that activates nf-b and induces expression of il-8, il-1, and inos in gastric epithelial cells. further study should be undertaken to determine whether rge inhibits ros production by suppressing nadph oxidase in h. pylori-infected gastric epithelial cells or gastric mucosal tissues. the present study suggests that rge attenuates h. pylori-induced expression of inflammatory mediators without affecting the number of viable h. pylori. therefore, it is assumed that rge suppresses h. pylori-induced inflammation including nf-b activation and expression of inflammatory mediators, without direct action on h. pylori. even though the first choice of the h. pylori therapy is eradication of the bacteria by antibiotics, the complete clearance of the bacteria is difficult in most patients. the inhibition of h. pylori-induced expression of inflammatory mediators by rge may be useful for prevention of inflammation and possibly carcinogenesis mediated by the h. pylori infection. our findings demonstrate that h. pylori induced oxidative stress (determined by lpo levels in gastric mucosa), inflammation (examined by expressions of cytokines and inos, histologic observation of neutrophil infiltration, and mpo activity), and proliferation (observed by histologic hyperplasia), which were inhibited by rge treatment. the precise mechanism of rge on proliferation, mucosal destruction, inflammation, oxidative stress, and any presence of dysplasia or metaplasia should be determined to evaluate the anti-inflammatory effect of rge using various gastric epithelial cells infected with h. pylori. in conclusion, rge supplementation inhibits neutrophil infiltration and lipid peroxidation, determined by mpo activity and lpo level, and attenuates the induction of inflammatory mediators (kc, il-1, inos), which results in suppression of h. pylori-induced gastric inflammation in mongolian gerbils. therefore, rge may be beneficial for the prevention and treatment of h. pylori-associated gastric inflammation.

helicobacter pylori-induced gastric inflammation includes induction of inflammatory mediators interleukin (il)-8 and inducible nitric oxide synthase (inos), which are mediated by oxidant-sensitive transcription factor nf-b. high levels of lipid peroxide (lpo) and increased activity of myeloperoxidase (mpo), a biomarker of neutrophil infiltration, are observed in h. pylori-infected gastric mucosa. panax ginseng meyer, a korean herb medicine, is widely used in asian countries for its biological activities including anti-inflammatory efficacy. the present study aims to investigate whether korean red ginseng extract (rge) inhibits h. pylori-induced gastric inflammation in mongolian gerbils. one wk after intragastric inoculation with h. pylori, mongolian gerbils were fed with either the control diet or the diet containing rge (200 mg rge/gerbil) for 6 wk. the following were determined in gastric mucosa: the number of viable h. pylori in stomach; mpo activity; lpo level; mrna and protein levels of keratinocyte chemoattractant factor (kc, a rodent il-8 homolog), il-1, and inos; protein level of phospho-ib (which reflects the activation of nf-b); and histology. as a result, rge suppressed h. pylori-induced mrna and protein levels of kc, il-1, and inos in gastric mucosa. rge also inhibited h. pylori-induced phosphorylation of ib and increases in lpo level and mpo activity of gastric mucosa. rge did not affect viable h. pylori colonization in the stomach, but improved the histological grade of infiltration of polymorphonuclear neutrophils, intestinal metaplasia, and hyperplasia. in conclusion, rge inhibits h. pylori-induced gastric inflammation by suppressing induction of inflammatory mediators (kc, il-1, inos), mpo activity, and lpo level in h. pylori-infected gastric mucosa.

PMC3915327

pubmed-526

mutations in psen1 and psen2 genes, which encode polytopic proteins termed presenilin 1 (ps1) and presenilin 2 (ps2), respectively, cause autosomal dominant early-onset familial alzheimer's disease (fad). both ps1 and ps2 proteins (ps) share about 63% homology with the highest similarity in the transmembrane domains where most of the fad-linked mutations are found [2, 3]. since the first report of mutation in the psen1 on chromosome 14, about 170 mutations have been identified, making mutations in psen1 the most common cause of autosomal dominant early-onset ad. in the case of psen2, 18 mutations have been reported so far, although not all have been confirmed to be pathogenic [2, 5]. as a probable explanation for the disparity between the two genes, defects in psen2 function may be offset by the normal function of its homolog psen1. in support of this view, psen2 null mice do not exhibit the phenotypic and functional defects seen in mice lacking psen1 gene. psen1 knockout (ko) mice are lethal, and disruption of psen2 and psen1 genes causes earlier embryonic lethality compared to psen1 ko [610]. as supported by mouse model studies, it appears that ps1 contributes largely to total -amyloid (a) production in the brain [11, 12]. ps is the catalytic subunit of -secretase, the enzyme responsible for intramembraneous cleavage of amyloid precursor protein (app) to generate peptides. fad-linked ps variants enhance the production of highly fibrillogenic a42 peptides that are deposited early in the brains of patients with ad. ps is ubiquitously expressed in the nervous system and peripheral tissue and found localized in secretory and endocytic organelles in all cell types, as well as synaptic structures in neurons [14, 15]. as predicted from its broad pattern of expression, ps's function extends far beyond processing of app and the pathogenesis of ad. for example, ps's catalytic function is required for intramembraneous -secretase cleavage of notch receptors, which releases the notch intracellular domain (nicd). nuclear signaling mediated by nicd is essential during mammalian development; mice with ablated psen1 alleles die in late embryogenesis and exhibit phenotypes reminiscent of mice lacking notch 1 [6, 7]. thus, ps-dependent activation of notch signaling is essential for early development. transgenic expression of fad-linked mutant ps1 fully rescues the developmental phenotypes in mice with psen1 deficiency [16, 17], supporting the notion that fad-linked ps1 variants are functional, but acquired deleterious properties that have profound pathophysiological consequences. candidate approaches and proteomic studies have identified a wide spectrum of type i membrane proteins that undergo -secretase cleavage, including notch ligands, deleted in colorectal cancer (dcc), and cadherins (reviewed in [13, 1821]). uniformly these substrates all undergo an ectodomain shedding by -secretases, which in many cases is triggered by the binding of extracellular ligands. interestingly, several noncatalytic -secretase-independent functions have been assigned to ps, such as its role in regulating intracellular calcium homeostasis (reviewed in). synapses are continuously reconfigured, both structurally and functionally, during embryonic development and throughout adult life, forming the basis for learning and memory [23, 24]. neuronal inability to exhibit such plastic changes has been proposed to be a root cause for various psychiatric and neurodegenerative disorders such as ad [23, 25, 26]. not surprisingly, the duration and severity of cognitive impairments in ad patients closely parallels the extent of synaptic loss, leading to the notion that synaptic dysfunction is a critical element in the pathophysiology of ad. notably, memory and cognitive decline observed in ad patients correlate better with the synaptic pathology than either a plaque load or tangle density, and synapse loss appears to precede neuronal degeneration. findings from several laboratories suggesting that a might play a critical role in synaptic dysfunction have added significant information to the traditional amyloid cascade hypothesis of ad [28, 29]. a can affect synaptic transmission [3033], synaptic protein localization, ampa and nmda receptor trafficking [35, 36], and spine formation [35, 3739]. fad-linked mutations in ps1 were originally thought to enhance the production of a42 peptides by a gain-of-function mechanism. however, it is becoming clear that fad-linked ps1 variants also exhibit partial-loss-of-enzymatic-function observed as diminution of a40 peptide production and defects in the extent of processing certain other transmembrane substrates (reviewed in [40, 41]). for example, fad-linked ps1 mutations are thought to attenuate -secretase processing and generate reduced levels of the intracellular domains of app, notch, n-cadherin, ephb2, and epha4 [4245]. taken together, it is plausible that fad-linked mutations in ps1 exert pathophysiological effects on the synapses by elevating a42 levels and by a-independent mechanisms involving altered processing of -secretase substrates involved in synaptic function. this paper discusses findings from various animal models that reveal the role of ps and fad-linked ps mutations in synapse formation and function. several mouse models (reviewed in; see http://www.alzforum.org/res/com/tra/) and a few rat models [4750] have been developed in order to recapitulate the main pathological features of ad and elucidate the mechanisms by which fad-linked ps mutations contribute to ad pathogenesis. a variety of mouse models have been characterized such as mice expressing fad-linked ps variants harboring point mutations or deletion mutation [51, 52], and fad-linked psen1 knock-in (ki) [m146v variant, i213 t variant and p264l variant], and e10 loop deletion ki. these fad-ps1 single transgenic or ki mouse models do not exhibit significant a deposition in the brain. therefore, the phenotypes described in these fad-ps1 single transgenic mice are not due to classical a pathology. in an attempt to reproduce more closely the human ad pathology, psen1 ki coexpressing app swedish mutant and hyperphosphorylated tau mutants have been made. in order to study the physiological function of ps, ko models of psen1 and psen2 [610], psen1 conditional ko [5860], as well as double psen1 and psen2 conditional ko mice have also been created. in order to examine amyloid pathology, transgenic mice expressing app mutants in a ps null background have been developed; such as psen1 conditional ko coexpressing app v717i variant and app v717f variant. in these models, a deposition is attenuated by the lack of ps1 expression and consequent loss of -secretase activity. besides their utility in examining proteolytic processing of app into a40 and a42 peptides in vivo and phenocopying pathological hallmarks of ad (amyloid deposition and tau phosphorylation), these models have been extensively used to examine changes in synaptic transmission, synaptic plasticity, and associated signaling. in addition, several groups have generated drosophila models (reviewed in), and caenorhabditis elegans models (reviewed in) expressing human ps1 or ps2 bearing fad-linked mutations, in an effort to understand mechanistic contribution of ps to ad pathology and neuronal dysfunction. synaptic transmission and long-term potentiation (ltp) contribute to several forms of memory storage. using slice preparations from transgenic mice, we and others have demonstrated that expression of fad-linked ps1 does not alter basal synaptic transmission, but leads to higher degree of ltp induction in the hippocampus ([ 57, 6569] reviewed in). however, one group has reported impairment of synaptic transmission associated with an increase of paired-pulse facilitation, an index of presynaptic release, in neurons of 6 month-old psen1 m146v ki mice. ltp induction by high-frequency stimulation in hippocampal ca1 area was also enlarged in this animal model. interestingly, in psen1 m146v ki animal model, ltp induced by carbachol (a muscarinic agonist) was reduced in ca1 hippocampal area, suggesting that fad-linked ps1 variant might interfere with cholinergic cellular cascades as well. the ki mouse models allow us to examine the functional properties of molecules associated with pathology when they are expressed at endogenous levels without any alteration in their spatial or temporal pattern of expression. therefore, ki animal models give us the opportunity to rule out pathophysiological consequences (such as protein misfolding) associated with aberrant overexpression of proteins associated with human genetic disorders. interestingly, it has been described that the lack of ps function or overexpression of ps1 mutant was also associated with changes in presynaptic function. we have observed an increase of spontaneous miniature excitatory postsynaptic current in cortical neurons isolated from psen1 ko mice, while others have reported that expression of mutant ps1 in cultured hippocampal neurons depresses synaptic transmission by reducing the number of synapses. another group has also observed that ps1 deficiency increases synaptic release and affects the number and docking of synaptic vesicles. it was also shown that basal transmitter release was increased at the neuro-muscular junction in drosophila lacking ps expression. however, even though basal synaptic transmission seems to be intensified in this later model, synaptic strength and plasticity were impaired after posttetanic potentiation. as a likely consequence,, it has been reported that ltp induction declines more rapidly in ca1 hippocampal area of mice with only one allele of psen1. in agreement with these observations, it has been recently found that a ca3-dependent presynaptic form of ltp in the hippocampus was attenuated in double psen1 and psen2 conditional ko mice. intriguingly, single psen1 conditional ko mice do not show major changes in brain plasticity, suggesting that expression of ps2 might be sufficient to overcome the 6080% loss of ps1 in the forebrain of these animals. first of all, it becomes apparent from these studies that ps is an essential element for the normal synapse function. second, it becomes evident that ps dosage is a critical component for ps-dependent cellular function(s). indeed, ps1 expression is developmentally regulated in rodent brain, reaching a peak of expression during the critical period of synaptogenesis between postnatal days 7 to 14. accordingly, we can stipulate that ps-dependent substrates expressed during embryogenesis or early in development may significantly contribute to synaptic physiology. in this regard, it also remains to be established whether differences in ps-dependent proteolysis of developmentally regulated molecules might underlie changes in synaptic function later on in life. a well-known example is a condition where stress-induced early life biochemical events influence life-span changes in cognitive function and ad-associated abnormalities. accordingly, it has been proposed that age-related decline in cortical cholinergic function in ad patients might have developmental origins. finally, it has also been speculated that ps-dependent modulation of signaling pathways that are important in development may contribute to the neurodegenerative process. taken together, studies from various laboratories suggest that ps is specifically involved in cellular component(s) necessary for synaptic transmission and plasticity, and that fad-linked mutations in ps1 may disrupt the normal cascade of synaptic events. a distinct feature of the nervous system is the intricate network of synaptic connections among neurons. the changes in the strength and efficacy of existing synapses, as well as remodeling of connectivity through the loss and gain of synapses in the neuronal network, are believed to be the basis of learning and memory in the brain. interestingly, ltp has been associated with the increase in spine formation and spine head growth, whereas long-term depression (ltd) has been associated with spine shrinkage and retraction. the morphology of dendritic spines is known to change in response to several factors including learning, age, hormones, and disease conditions. in addition to their morphological plasticity, spine-like protrusions also display rapid motility, changing shape and size in a matter of seconds to minutes. this morphological plasticity suggests that long-term memory might be encoded by alterations in spiny structures and associated synaptic contacts. collectively, these events are critically important in synaptogenesis, in modulating of existing synapses, as well as in long-term synaptic plasticity [83, 84]. it has been reported that a is closely associated with a decrease of spine formation and motility [35, 37, 85]. overproduction of a in ps mutant transgenic mice coexpressing the swedish app mutant causes age-associated decrease of synaptic excitability [57, 86, 87] and spine collapse [38, 88]. however, it has also been reported that acute a application (less than 4 h) was associated with an increase of filopodia and growth cones in hippocampal cultures. in support of this idea, it was shown that application of low levels of a is associated with an increase of ltp, whereas higher concentration of a reduced synaptic potentiation [32, 90]. collectively, these observations suggest that a might have dual roles on synapse formation. conflicting results have also been observed in regard to spine morphology in neurons lacking ps expression. treatment with compound e, a -secretase inhibitor (10 nm; 24 h), produced an increase of spine-like protrusions in isolated neurons [71, 91]; whereas the density of spines was found to be decreased upon prolonged treatment with the same inhibitor (50 nm; seven days). in addition, neurons lacking both ps1 and ps2 expression have marked diminution in spine density. to further support the effect of -secretase inhibition on dendritic spines, recent in vivo study showed that -secretase inhibitor treatment in wild-type mice significantly reduced the number of spine density in somatosensory cortex, while -secretase inhibitor treated app null mice did not exhibit any effect. these findings suggest that app-dependent mechanism may underlie the ps-dependent morphological changes observed. the apparent discrepancy between inhibitor treatment and loss of ps expression on spine density may be also due to differential effects of inhibitors that target mainly -secretase and genetic inactivation of ps that results in reduced -secretase-dependent and -independent function. all together, these observations support the idea that ps gene dosage and the level of expression may differentially influence synaptic morphology. although the molecular mechanisms that underlie these morphological changes are not completely understood, emerging evidence supports at least two important signaling pathways that have been linked to dendrite spine formation and ad etiology: (1) camp-dependent activation of pka has been shown to be critical for the maintenance of the late phase of ltp, and downstream phosphorylation of creb has been linked to formation of new spines. interestingly, it has been shown that a inhibits pka/creb pathway, (2) the rho family of small gtpases, well-known regulators of the actin cytoskeleton, has profound influence on spine formation. among the members of this family rac1, cdc42, rnd1, and ras promote spine formation and growth, whereas rap and rhoa induce shrinkage and loss of spines [80, 95]. p21-activated kinase (pak) is a downstream signaling effector of the rho/rac family of small gtpases and has been shown to be associated to spine formation and memory consolidation. a recent paper by shuai and colleagues suggests that the act of forgetting might also be linked to activation of the rac pathway, using a simplistic model of olfactory learning in the fruit fly drosophila. with the help of genetic manipulation, they were able to distinguish changes in rac activity during passive memory decay, interference learning, and reversal learning, which are three different forms of forgetting events. in drosophila olfactory memory model, it appears that camp/pka and rac/pak-dependent memory acquisition and forgetting events are independent, as suggested by this group and others [98, 99]. in a more complex system, as it has been proposed in the mammals, it seems that memory consolidation might mechanistically require both pathways [96, 100, 101]. as demonstrated by several groups, rac signaling cascade in the brain is directly linked to an increase of spine formation through subsequent activation of pak leading to f-actin polymerization and changes in membrane morphology. besides the known involvement of camp/pka/creb activation cascade, rac/pak-dependent cellular events also appear to be intimately associated with the process of memory consolidation, at least in rodents. it is very exciting to think that perhaps similar cellular pathways as the one described above may be relevant to human disorders associated with memory dysfunction. one of the known hallmarks of ad is that patients do forget recent events, therefore, they are unable to consolidate their new memory. in our lab, we have shown that the lack of ps function or expression in cortical neurons produced an increase of steady-state levels of creb and rac/pak cascade activation, which was also associated with an increase of spine-like protrusions. even though our study shows increase of phosphorylated creb especially in dendritic area, more recently, shen and collaborators have shown that creb transcription was indeed reduced in ps deficient neuron through ps-independent mechanism. are these signaling events meaningful in the context of ad? perhaps. as discussed above, recent studies support the idea that fad-linked mutations in ps1 might cause a partial loss of function [40, 41]. it still remains to be determined whether rac/pak signaling is altered in neurons expressing fad-linked ps1 variants. if this is the case, one might want to consider the possibility that changes in camp/pka/creb or rac/pak signaling in neurons might represent some of the earliest cellular dysfunctions that are relevant to synapse elimination and associated cognitive decline in ad. -secretase-dependent ps function mediates transmembrane proteolysis of several substrates including app, n- and e-cadherins, -protocadherin, cd44, dcc, ephrin/eph receptors, leukocyte-common antigen related, nectin-1, and syndecan (reviewed in [18, 20, 21]). many of these substrates function as cell-adhesion molecules or cell surface receptors and are known for their diverse functions during development and are involved in axon guidance, neuronal outgrowth and synaptogenesis [103113]. in addition, these molecules are also well known to be coupled to diverse intracellular signaling pathways [20, 44, 45, 108110, 114118]. it has been proposed that app can affect synaptic function by its dual roles via its cell adhesive properties or through its putative receptor-like intracellular signaling components [112, 116, 117]. indeed, it has been shown that accumulation of the app intracellular domain can mediate a phosphoinositide-dependant calcium signaling. several other substrates of -secretase are also coupled with intracellular signaling events that can potentially influence synaptic function. for example, eph receptors and n-cadherin are known to be coupled to rac and creb signaling, respectively [45, 115, 117, 120, 121]. lack of ephb expression or kinase-defective ephb is associated with a reduction in glutamatergic synapses and abnormal spine development [120122]. it has also been shown that three substrates of ps, namely erbb4, -protocadherin, and leukocyte-common antigen related, are associated with psd-95 clustering at the synapse [123, 124] and ampa receptor function. consistent with these findings, we have previously reported that the lack of ps function increases axodendritic contacts, which was accompanied by increases of psd-95 clusters, spine-like protrusions, and ampa receptors-mediated synaptic transmission [71, 91]. moreover, ps1 ko neurons and wt neurons treated with -secretase inhibitors exhibited increases in the extent of camp/pka activation [71, 91]. camp/pka signaling plays a critical role in regulating short and long-term synaptic physiology. it has been demonstrated that stimulus-induced activation of pka pathway can also affect the synaptic morphology; therefore, it can indirectly affect basal synaptic transmission. thus, there exists a close relationship between increased phosphorylation of pka substrates and enhanced synaptic transmission in neurons lacking ps function [71, 91]. signaling downstream of dcc, the netrin receptor, is also modulated by -secretase activity. upon binding of the ligand netrin, dcc undergoes metalloprotease-dependent ectocomain shedding, which generates a membrane-tethered dcc c-terminal fragment (ctf) derivative, consisting of the transmembrane segment and the intracellular domain. dcc ctf undergoes intramembraneous proteolysis by -secretase, and accumulation of dcc ctf in neuroblastoma cells treated with -secretase inhibitors stimulates neurite outgrowth [71, 129]. -secretase processing of dcc attenuates camp-dependent signaling cascades associated with dcc ctf. in this case, it is clear that -secretase terminates intracellular signaling associated with dcc. however, it remains to be determined if -secretase cleavage of other substrates would significantly impact cellular functions, especially pertaining to synaptic process, through termination of receptor-mediated signaling events (see our proposed model in figure 1). more recently, it was found that epha4 undergoes ps-dependent endoproteolytic process, and epha4 ctf accumulates following inhibition of -secretase activity or in cells lacking ps expression. accumulation of epha4 ctf was found tightly linked to an increase of spine-like protrusions in hippocampal cultures. overexpression of an inactive rac form abolished the enhancement of dendritic spines in neurons and lamellipodia formation in nih3t3 cell lines. in addition, this study showed that overexpression of membrane-tethered epha4 intracellular domain was also associated with an increase of lamellipodia formation in nih3t3 cell lines. all together, these results suggest that enhanced accumulation of epha4 intracellular domain may induce rac-dependent signaling events that regulate cell morphology. it is clear that loss of intramembraneous proteolysis of -secretase substrates leads to the accumulation of their membrane-tethered cytosolic domains. the ctfs of certain substrates might serve as membrane anchors to facilitate the recruitment of signaling proteins in a manner that enhances phosphorylation of downstream signaling substrates. one of the signalings that have been implicated with ps function is gsk3 (reviewed in). it is well established that ps1 can interact with the gsk3/-catenin complex [131133]. however, besides this direct physical interaction with ps1, it is known that gsk3 is a ligand-receptor signaling molecule downstream of the activation of phosphatidylinositol-3-kinase pathway (reviewed in). specifically, it has been shown that gsk3 signaling is important for axon specification and elongation during the establishment of neuronal polarity (review by). in addition, it has been reported that decrease of gsk3 activity parallels ltp induction paradigms, whereas inhibition of phosphatidylinositol-3-kinase and subsequent activation of gsk3 lead to decrease of ltp (; reviewed in [130, 137]). decreased phosphorylation of gsk3 at the ser 9 residue, indicative of an increase of gsk activity, was also observed in ps1-deficient neurons as well as in ps1 neurons carrying fad-linked mutations [69, 138141]. alteration of phosphatidylinositol-3-kinase /akt signaling cascade has been proposed to be the link between gsk3 activity and ps function [138, 140, 142]. interestingly, increase of gsk3 activity also leads to hyperphosphorylation of tau protein, which underlies one of the known pathological hallmarks of ad, namely the tangle formation (reviewed in). it has been proposed that membrane microdomains rich in cholesterol and sphingolipids, termed lipid rafts, might influence -secretase activity and processing of substrates (reviewed in). lipid rafts play an important role in the maintenance of synapses through dendritic spine formation and ampa receptor function. raft-dependent mechanisms facilitate trafficking of receptors in and out of the synapse and regulate synapse function (reviewed in). lipid rafts are known to serve as membrane platforms that compartmentalize diverse receptor-mediated signaling. indeed, it was found that critical regulation of signaling associated with erbb4, dcc, and epha4, three -secretase substrates, involves their recruitment into lipid raft microdomains [45, 146, 147]. based on the differences in spatiotemporal distribution of -secretase complexes and substrates [148, 149], different ps-dependent substrates might be subjected to different level of proteolysis depending on their membrane microdomain distribution at a given time during embryonic development and in adult life. besides a direct interaction of -secretase substrates with intracellular phosphorylation cascades, one of the key features of ps function is its role in intracellular ca homeostasis (reviewed in [22, 150, 151]). several studies have concluded that fad-linked ps mutant expression in transfected cells and cultured neurons is associated with enhanced ca release from endoplasmic reticulum store. it has been reported that neurons generated from psen1 m146v ki mice exhibit an increase of ip3-evoked ca responses in brain slices as early as in one month old. this ca dysregulation appears to be specific to intracellular endoplasmic reticulum store since it does not affect the voltage-gated ca entry. however, it has been shown that l-type ca channel may be involved after stress induction at the neuromuscular junction in drosophila larvae expressing fad-linked ps1 mutant. accordingly, in this model system, the level of synaptic plasticity and memory paradigm was normal following heat shock stimulation or endoplasmic reticulum stress, but reduced after 24 h of stimulation recovery. these results suggest that mutation in ps might alter synaptic behavior following recovery of stress conditions. it has been also proposed that ps might serve as a passive ca leak channel in the endoplasmic reticulum and fad-linked ps variants might fail to exhibit this property. using reconstituted planar lipid bilayers, tu and collaborators demonstrated that ps by itself could form low-conductance divalent ion channels, which was not the case in several mutated forms of ps. it remains to be determined if results from these experimental conditions are applicable to in vivo situations that are relevant to the disease state. more recently, stutzmann and collaborators have established that the ryanodine receptor-evoked ca release (especially through ryr2 isoform) was increased in ca1 hippocampal slices of psen1 m146v ki mice coexpressing swedish app and hyperphosphorylated tau mutants. as a consequence, they observed an aberrant increase of ryanodine-dependent presynaptic neurotransmission, along with increases of long-term synaptic plasticity. conversely, shen and collaborators have observed a decrease of ryanodine-dependent presynaptic release in hippocampal neurons of ps-deficient mice. all together, stutzmann group concluded from their study that significant ca alterations are present at an early age even though ca homeostasis appears to be maintained. compensatory mechanisms seem likely to take place in order to maintain normal synaptic function in early age. however, these subtle ca-mediated alterations may have profound impact later on that can affect synaptic and cognitive functions in disease states. however, it is becoming clear that fad-linked mutations in ps proteins affect diverse physiological processes in addition to promoting the production of highly fibrillogenic a42 peptides. the identification and characterization of -secretase substrates and the mechanistic details on the successive cleavage of substrates by the -secretase have enhanced our understanding of how partial loss-of-function associated with fad-linked ps mutations can in fact lead to a gain of activities with reference to intracellular signaling associated with certain substrates such as dcc, erbb4, and epha4. at least in some cases, lack of -secretase processing leads to profound changes in synaptic structure and functions as a consequence of sustained intracellular signaling by substrate ctfs. as details begin to emerge on additional -secretase substrates, it will be possible to determine whether -secretase cleavage of neuronal receptors is indeed a regulatory step that modulates physiological signaling downstream of ligand binding and ectodomain shedding. still, the major task is to establish whether or not altered signaling directly contributes to ad pathogenesis and/or ad-related synaptic dysfunction.

mutations in psen genes, which encode presenilin proteins, cause familial early-onset alzheimer's disease (ad). transgenic mouse models based on coexpression of familial ad-associated presenilin and amyloid precursor protein variants successfully mimic characteristic pathological features of ad, including plaque formation, synaptic dysfunction, and loss of memory. presenilins function as the catalytic subunit of -secretase, the enzyme that catalyzes intramembraneous proteolysis of amyloid precursor protein to release -amyloid peptides. familial ad-associated mutations in presenilins alter the site of -secretase cleavage in a manner that increases the generation of longer and highly fibrillogenic -amyloid peptides. in addition to amyloid precursor protein, -secretase catalyzes intramembrane proteolysis of many other substrates known to be important for synaptic function. this paper focuses on how various animal models have enabled us to elucidate the physiological importance of diverse -secretase substrates, including amyloid precursor protein and discusses their roles in the context of cellular signaling and synaptic function.

PMC2925324

pubmed-527

cutaneous metastases are defined as dermal or hypodermal neoplastic tissue that has no contiguity with the primary tumor. skin metastases from internal neoplasms are an uncommon clinical finding with an overall incidence of 5.3% and the most common cause is breast cancer with an incidence of 23.9%.1 in general, skin metastases of breast cancer affect the dermis and histologically appear as malignant ductal epithelial cells in sheets, cords, glands, or are arranged in a diffuse infiltrate.2 the finding of transepidermal elimination on cutaneous metastases is exceptional and has only been reported in a few cases.3,4 mehregan classified transepidermal elimination into three types, and the elimination of dermal tumor nests corresponds to type 3 which involves an active interaction between epidermis and dermal connective tissue.5 although transepidermal elimination is the histological feature of the classical perforating disorders, it is also described in other cutaneous conditions and in tumors such as melanocytic nevus,6 eccrine poroma,7 malignant melanoma,8 pilomatricoma,9 and metastatic carcinoma.3,4 in this report we present a case of perforating cutaneous metastasis from breast cancer with mucin 1 (muci) expression. in february 2010, a 48-year-old argentine woman had undergone tumorectomy in her left breast with diagnosis of an invasive ductal carcinoma with low nuclear and histological differentiation grades; estrogen (er) and progesterone (pr) receptors were negative and her2/neu was positive. in september 2011, a mastectomy with immediate breast reconstruction was performed due to local tumor recurrence and the patient received systemic chemotherapy. in march 2012 physical examination revealed an erythematous nodule that was 4 cm in diameter, polylobulated, and with ulcerated surface on the chest region. multiple erythematous painful nodules from 5 mm to 2 cm were distributed on her chest and over the reconstructed breast (figure 1). a skin biopsy of one of the small lesions revealed skin metastasis from breast carcinoma (er-pr-her2/neu+). muci expression was studied and a strong reaction was found with a mixed pattern at the plasma membrane and in the cytoplasm (figure 2). tumor cells in the papillary dermis appeared to penetrate through the epidermis, suggesting transepidermal elimination. the epidermis showed no signals of ulceration (figure 3), and in some malignant cells, a muci moderate reaction was found. cutaneous metastases from breast carcinoma usually appear months to years after the diagnosis and treatment of the primary malignancy.10,11 the most common localizations are in the chest wall and abdomen, but they can also be found in the scalp and extremities.10 the clinical presentations vary over a wide range of different patterns. nodules are the most common manifestation (80%), followed by telangiectatic carcinoma (11%), erysipeloid carcinoma (3%), en cuirasse carcinoma (3%), alopecia neoplastica (2%), and a zosteriform type (0.8%).12 a diagnosis of cutaneous metastases is based on the clinical manifestations and the histopathologic study of the lesions. histopathologically, cutaneous metastatic nodules show malignant cells in the dermis arranged in nests surrounded with desmoplastic stroma.2 in our patient, clinically, the skin lesions were nodules, but histologically, tumor cells were not restricted to dermal nests since they also showed perforation and transepidermal elimination. altered structures of the dermis and foreign material like neoplastic cells or external substances mehregan5 classified transepidermal elimination into three types which differ in the mechanism of removal. in type 1, nonmotile cells or small particles, which produce minimal or no dermal reaction, can be caught between keratinocytes and carried to the epidermis surface during corneocyte differentiation. in type 2, motile cells or microorganisms actively migrate into the epidermis and are subsequently eliminated with normal desquamation similar to type 1. the phenomenon of transepidermal elimination occurs in certain dermatoses in which altered structures of the dermis and foreign substances induce an inflammatory response causing the release of collagenases, elastases, and proteases. this inflammatory response generates alteration of the matrix with necrosis and perforation, and can also stimulate pseudoepitheliomatous hyperplasia of the epidermis and subsequent formation of transepidermal perforating canals with elimination of the dermal material.4,5 in a case reported by ohnishi et al,3 breast cancer cutaneous metastases with transepidermal elimination presented with epidermotropism of neoplastic cells and pagetoid spread, features that our patient did not show. on the other hand, abbas et al4 published a case of perforating cutaneous metastasis from an ovarian carcinoma which showed malignant cells in the dermis and hypodermis with areas of transepidermal elimination without epidermotropism. immunohistochemical staining of the tumor cells was positive for muci, as we report in our case. almost all breast cancer cells express muci1316 although benign breast neoplasms and normal breast cells express this mucin as well.17,18 it is considered that muci nonapical expression, as well as its overexpression, are the hallmarks of muci reactivity in breast cancer cells.19 although contradictory results have been found between muci expression and survival in breast cancer patients, more than 70% of studies on tumor samples have found that the presence of any muci in the majority of tumor cells is associated with an improved prognosis.20 in relation to subcellular localization of muci, it has been observed that patients with tumors with the lineal (membrane) pattern have better survival.21 23 rahn et al20 reported that aberrantly localized muci in the tumor cell cytoplasm or nonapical membrane is associated with a worse prognosis. in a previous report, we found a significant decrease of muci apical expression frequency according to histological as well as nuclear grade increment. in this sense, it is known that histological grade is an accurate predictor of tumor behavior.24 the presence of apical membrane staining would indicate that muci targeting pathways are intact, and it has been associated with better prognosis that is possibly related to functional differentiation of the tumor.24 rahn et al20 also found a significantly lower mean nuclear grade in tumors with high muci expression (50%). coincidentally, in the primary tumor of our patient, a high nonapical muci expression along with low nuclear and differentiation grades was observed. muci may alter the interaction between tumor cells and their environment, changing the composition. it has been observed that muci cytoplasmic tail interacts with -catenin through a similar motif to that found in e-cadherin and inhibits the formation of an e-cadherin--catenin complex, reducing cell cell adhesion.19 similar to abbas et al,4 it is possible that in our case, the contributing factors to transepidermal elimination could be related to a tumor dermis interaction in which the epidermis does not seem to be implicated. the physical effect by the expanding tumor and the inflammatory response are factors to be considered. also, the possibility of a vascular compromise resulting in necrosis and ulceration of the epidermis as well as muci expression may play a role.

breast cancer is the most common cause of cutaneous metastases from internal malignancies. generally, the neoplastic cells are located in the dermis or hypodermis, while a finding of transepidermal elimination on cutaneous metastases is exceptional. in this report we present a patient with perforating cutaneous metastases from breast cancer with mucin 1 expression. cutaneous, bone, lung, and hepatic lesions were detected two years after the diagnosis of the primary tumor.

PMC3825694

pubmed-528

many potential therapies for severe and/or chronic wounds fail as a result of poor vasculature. hence, strategies to improve blood vessel supply into a wound bed are thought to promote wound healing. transplantations of mesenchymal stem cells (mscs) have shown great potential as a therapeutic agent for the treatment of a range of disorders, including wound healing, and have become the subject of numerous clinical trials. however, whilst the safety of msc transplantation does not seem to be an issue, the effectiveness of such treatment has exhibited considerable variability. this variation in effect is problematic when translating preclinical research into msc-based clinical therapy. we recently demonstrated that human msc-conditioned medium (msc-cm) was stimulatory to epidermal and fibroblast cell adherence and migration. other reports suggest that msc are pro-angiogenic also through their paracrine activity on endothelial cells. whilst there are reports that msc are capable of endothelial differentiation, engraftment into new vasculature is low in vivo. hence, these and other studies have contributed to recent thought that the predominant regenerative activity of mscs is due to their secretion of factors that stimulate endogenous cells at wound sites. in this investigation, we have examined the effects of msc-cm on endothelial cells, using the cell line eahy-926 as a model system. we report that msc-cm promotes endothelial cell adhesion and migration, but that these effects show considerable donor-donor variability. further, we have identified extracellular matrix (ecm) proteins that are secreted by mscs using maldi/tof-tof mass spectrometry. we provide data to suggest that ecm composition plays a major role in the donor-donor variation we have seen. these findings demonstrate proof of principle of the need to screen the msc secretome in order to optimise the application of mscs in the clinic. cell culture and mass spectrometry of conditioned medium eahy-926 endothelial cells were maintained in dmem/f12 culture medium (invitrogen, paisley, uk) supplemented with 10% (v/v) fetal calf serum (fcs) (invitrogen) and 1% (v/v) penicillin and streptomycin (invitrogen), incubated at 37c and in a humidified atmosphere containing 5% (v/v) co2. passaging was performed at ~90% confluence and cells were re-seeded at 1 x 10 cells/cm. mscs were isolated from the iliac crest biopsies of bone marrow donors following ethical approval and with informed consent, as previously described. the adherent cell population obtained was consistent with the characteristics of mscs laid out by the international society for cellular therapy (isct). conditioned medium was generated from msc cultures of equal cell number in serum free conditions, using dmem/f12 supplemented with insulin, transferrin and selenium (invitrogen). protein content of msc cm was determined by maldi-tof/tof mass spectrometry as previously described. characterization of msc after three passages in culture, bone marrow derived cells were assessed by immunoprofiling for cd markers and by examining their differentiation potential to form osteoblasts, adipocytes and chondrocytes, by staining with alkaline phosphatase, oil red o, and toluidine blue respectively as per the criteria established for a msc phenotype by the isct. coating of culture plates culture plates were coated with msc-cm or type-i collagen, decorin, or fibronectin (all sigma-aldrich). protein solutions were diluted in pbs to 0.2mg/ml and added to each well (50l for 96-well plates, 500l for 24-well plates). these were refrigerated for 24 hours before being rinsed with pbs immediately prior to use. cell adherence/spreading coated 24-well tissue culture plates were seeded with 2x10 eahy-926 endothelial cells in dmem/f12 supplemented with 1% penicillin/streptomycin (sigma-aldrich) and 1% its-x (sigma-aldrich) and incubated for 2 hours at 37c and 5% co2 before digital images were captured (progres cf, jenoptik) and analysed using image-j software. scratch assays were established using previously published methods, in protein-coated tissue culture plates (as described above). cell migration was automatically captured and analysed at hourly intervals using an incucyte live-cell imaging system (essen bioscience). data were tested for significance using the mann-whitney u test. those differences that fell within a 95%, 99% or 99.9% confidence interval were considered to be significant, indicated by asterisks within figures (* p<0.05** p<0.01***p<0.001). bone marrow cells obtained from iliac crest biopsies showed characteristics consistent with those expected of msc (figure 1). msc-cm coating of culture plates resulted in the significant enhancement of the spreading of eahy-926 endothelial cells upon the culture surface. this result was subject to a marked inter-donor variability, with conditioned media generated by both msc-1 and msc-3 resulting in a significantly greater degree of eahy-926 endothelial cell spreading than that generated by msc-2 (figure 2a, 2b). eahy-926 endothelial cell adherence on fibronectin coated plates was most advanced after two hours, compared to plates coated in either type i collagen or with decorin (figure 3). on type i collagen-coated plates, the presence of msc-cm appeared to enhance the rate of eahy-926 endothelial cell migration into scratch-wounds compared to unconditioned media (figure 4a, left). eahy-926 endothelial cells in msc-cm closed scratch-wounds to a significantly greater degree than those in unconditioned media over a 12-hour time course (figure 4b, left). once again, the degree of this msc-cm mediated enhancement of eahy-926 endothelial cell migration was subject to inter-donor variability. conditioned medium generated by msc-1 (and msc-3) elicited a greater degree of scratch-wound closure than msc-2 over 12 hours (figure 4b, left). cells isolated from bone marrow meet the minimum criteria for identification as msc.cells are immunoreactive for cd73, cd90 and cd105, whilst lacking immunoreactivity for cd14, cd34 and cd45, as shown by histograms obtained by flow cytometry, and readily differentiate to form osteoblasts, adipocytes and chondrocytes in vitro. representative phase contrast images are shown of cells following tri-lineage differentiation and staining with alkaline phosphotase, oil red o, and toluidine blue (top, left to right). msc-cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading.a: msc-cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading. after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with msc-cm than on plates coated with unconditioned (control) medium. b: after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on msc-cm coated culture plates and 389m2 than those cells on unconditioned (control) medium coated culture plates. data shown are means sem in relative units (***=p<0.001 mann whitney u test). ecm protein coating of culture plates influences eahy-926 endothelial cells adherence and spreading.after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with fibronectin than on plates coated with type i collagen or decorin. b: after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on fibronectin compared to those cells on either type i collagen or decorin. data shown are means sem in relative units (* *=p<0.01,** *=p<0.001, mann whitney u test). eahy-926 endothelial cells closed scratch wounds faster in msc-cm than in unconditioned medium on type i collagen, fibronectin, and decorin coated culture plates. a: eahy-926 cells on fibronectin coated culture plates closed scratch wounds significantly faster than those on either type i collagen or decorin. b: after 12 hours eahy-926 endothelial cells in msc-cm had closed scratch wounds by a significantly greater degree than those in unconditioned control medium. 12 hours post-scratching, eahy-926 endothelial cells on plates coated fibronectin had closed scratch wounds by a significantly greater degree than those on either type i collagen or decorin. on fibronectin and decorin, medium conditioned by msc-2 on type one collagen, medium conditioned by msc-2 was associated with significantly reduced scratch closure compared to msc-1. all three were found to contain fibronectin, collagen type i, collagen type vi, and lumican, whilst cartilage oligomeric matrix protein (comp) and sparc were present in two out of three msc-cm and laminin, decorin, heparan sulphate proteoglycan (hspg) and igfbp-1 were each only observed in one msc-cm (table 1). of these, hence, not only was there clear inter-donor variability in the ecm components of the msc secretome, but the presence of these proteoglycans seemed to be associated with a reduction in the efficacy of msc-cm. when type i collagen, decorin and fibronectin were used as culture substrata, the degree of eahy-926 endothelial cell spreading appeared to be similar upon both type i collagen and decorin and greatly enhanced upon fibronectin (figure 2a, 2b). similarly, scratch-wound closure by eahy-926 endothelial cells in unconditioned media appeared to be similar upon type i collagen and decorin, but markedly greater upon fibronectin (figure 4a, 4b). in the presence of each ecm substrate the presence of msc-cm resulted in significantly enhanced scratch wound closure compared to unconditioned media (figure 4b). as seen previously upon type i collagen coated culture plates, the degree of closure upon both decorin and fibronectin coated plates was either significantly or near significantly (p=0.057 by mann whitney u test) less in the presence of medium conditioned by msc-2, compared to medium conditioned by either msc-1 or msc-3 (figure 4b). mass spectrometry of msc-cm from 3 separate donors.maldi-tof/tof mass spectrometry of msc-cm detected variable protein content between media conditioned by msc from three different patient donors. we have previously shown that msc-cm promotes the migration of skin cells in a wound healing model, and identified numerous potentially beneficial factors that may contribute to this effect. in vivo wound healing is, however, a complex process influenced by a host of cellular events, including angiogenesis. if msc can stimulate endothelial cells as suggested here and elsewhere this supports their potential use in the treatment of cutaneous wounds. in these experiments, this is similar to previous studies in which msc-cm has been shown to stimulate angiogenesis, supporting the investigation of msc-cm as a pro-angiogenic agent. although it is possible for proliferation of eahy-926 endothelial cells to have contributed somewhat to the closure of the scratch wounds, these scratch assay experiments were performed over the course of 12 hours. the reported doubling time for these cells is over 25 hours. to significantly affect the rate of scratch wound closure, those cells at the leading edge of the scratch margins would be required to undergo repeated doublings, and this is unlikely to have had a major influence on scratch wound closure over the time course of these studies. mass spectrometry of msc-cm revealed numerous factors (including fibronectin and collagen) in medium conditioned by each of the three msc examined and some, including laminin and decorin, in one or two but not all three of the msc-cm samples. of these ecm components, fibronectin, collagen and laminin are known to promote or support angiogenesis. unusually, in these experiments collagen did not seem to induce any observable cell response when compared to decorin. fibronectin and collagen contain protein motifs are known to mediate angiogenesis by integrin receptor signaling in vivo and in vitro. decorin inhibits endothelial cell migration and tubule formation in vitro and inhibits the pro-angiogenic effects of vegf. lumican interferes with 21 receptor activity and inhibits angiogenesis both in vitro and in vivo. whilst lumican was present in each of the msc-cm used in these investigations, decorin was only found within the msc-cm that consistently showed significantly less enhancement of eahy-926 endothelial cell migration. as the method (maldi-tof/tof mass spectrometry) used to detect these protein components within msc-cm was not quantitative, it was not possible to determine whether differences in concentrations of each ecm component were related to efficacy of the conditioned media. msc-cm coating of culture plates enhanced eahy-926 endothelial cell adherence, as did coating with fibronectin. cell adherence to these substrata was examined in an indirect fashion, by assessing the average area of cells in the immediate-early period after seeding. as cells settle upon a permissive substrate they spread out from the rounded morphology observed in suspension to adopt a flattened morphology that is usually seen in vitro in adherent cell populations. after prolonged periods of time, cells in culture, including endothelial cells, synthesize matrix molecules that may also promote cell adhesion, potentially masking the initial effects of the original substrate being investigated. of the matrix proteins detected in msc-cm by maldi-tof/tof mass spectrometry, fibronectin was observed to have a profound effect upon cell adherence, similar to those findings concerning cell migration. however, the addition of msc-cm to endothelial cell scratch assays performed upon fibronectin coated culture plates resulted in a further enhancement of endothelial cell migration, suggesting that fibronectin may not be solely responsible for the entire effect. further experiments investigating the effects of msc secreted growth factors and cytokines individually, and in combination, may reveal their relative contribution to the enhancement of endothelial cell migration. the relatively low number of individual donors examined during this study is a clear limitation, and although the results presented support the conclusions that (i) msc donor variation and secretome composition may account for differential effects of mscs on endothelial cells, and (ii) that this variation should be taken into consideration in msc-based regenerative medicine, subsequent investigation of greater numbers of samples is required to further authenticate these findings. angiogenesis depends on endothelial cell migration and the actions of endothelial cell chemotactic factors, e.g. vegf and il-8, and ecm proteins such as collagens, fibronectin and laminin. many of these pro-angiogenic factors have been found to be present within the msc secretome both within this investigation and in previous studies. these experiments have showed that msc-cm enhances both the rate of endothelial cell migration and the adherence of these cells to their culture surface, and that this effect was, in part, mediated by the presence of fibronectin. the effects of msc-cm upon endothelial cell migration were not entirely induced by fibronectin, as suggested by the further enhancement of eahy-926 endothelial cell migration by msc-cm in the presence of exogenous fibronectin. factors such as interleukin (il)-8, vegf, and laminin have all been shown to be stimulatory to endothelial cells and these factors have been shown to be present within msc-cm. it seems likely that these known mediators of angiogenesis might contribute to the effects of msc-cm upon eahy926 endothelial cells observed in these investigations. overall, the data presented here support the hypothesis that msc may stimulate the formation of new vasculature, and that this may be an important aspect of msc-mediated enhancement of wound healing.

mesenchymal stem cells (mscs) stimulate angiogenesis within a wound environment and this effect is mediated through paracrine interactions with the endothelial cells present. here we report that human msc-conditioned medium (n=3 donors) significantly increased eahy-926 endothelial cell adhesion and cell migration, but that this stimulatory effect was markedly donor-dependent. maldi-tof/tof mass spectrometry demonstrated that whilst collagen type i and fibronectin were secreted by all of the msc cultures, the small leucine rich proteoglycan, decorin was secreted only by the msc culture that was least effective upon eahy-926 cells. these individual extracellular matrix components were then tested as culture substrata. eahy-926 cell adherence was greatest on fibronectin-coated surfaces with least adherence on decorin-coated surfaces. scratch wound assays were used to examine cell migration. eahy-926 cell scratch wound closure was quickest on substrates of fibronectin and slowest on decorin. however, eahy-926 cell migration was stimulated by the addition of msc-conditioned medium irrespective of the types of culture substrates. these data suggest that whilst the msc secretome may generally be considered angiogenic, the composition of the secretome is variable and this variation probably contributes to donor-donor differences in activity. hence, screening and optimizing msc secretomes will improve the clinical effectiveness of pro-angiogenic msc-based therapies.

PMC4498319

pubmed-529

carbon monoxide (co) is a colorless, odorless, and nonirritant gas that is lighter than air, and it is a product of incomplete combustion of hydrocarbons.1) accidental, suicidal or homicidal intoxications with co have a long history. acute co poisoning is an important clinical problem and may lead large proportion of patients to fatal death. moreover, frequent neurologic and cardiovascular consequences have been described.2-4) the neurologic manifestations of co poisoning have been well described, and include headache, dizziness, weakness, nausea, and confusion.3)4) cardiac consequences have been reported, including arrhythmias and electrocardiographic alterations, acute myocardial infarction, pulmonary edema, and cardiogenic shock.5)6) among these, myocardial injury is common in patients with moderate to severe co poisoning,2) manifested as elevated cardiac biomarkers and the changes of regional wall motion abnormality in echocardiography.7) on the other hand, an association between thromboembolic accidents and co poisoning has been shown less frequently in the literatures.8-14) we report a co poisoning case complicated by intracardiac thrombus. a 24-year-old female patient with no preexisting disease was brought to the emergency unit for altered mentality due to suicidal exposure to co. the duration of the exposure was unclear. she showed a good general appearance, the level of consciousness was alert: glasgow coma scale was measuring up to 15. vital signs were blood pressure of 132/101 mmhg, pulse rate of 87/min, respiration rate of 20/min and body temperature of 35.4. oxygen saturation measured using pulse oxymetry was 100% when 15 l/min oxygen was applied through a reservoir bag mask. she was 164 cm tall and weighed 50 kg, and her body mass index was 18.6 kg/m. lower and upper limb arterial and venous examination revealed normal circulation. in detailed system examinations, no pathological neurologic signs were detected. laboratory analyses revealed the following: white blood cells, 21200/l; blood urea nitrogen, 17 mg/dl; creatinine, 0.75 mg/dl, and blood glucose, 101 mg/dl, d-dimer 0.28 ug/ml. cardiac enzymes were elevated (ck: 3306 u/l, ck-mb: 90.6 ng/ml, troponin i: 1.899 ng/ml, lactate dehydrogenase: 334 u/l). arterial blood gas was performed and revealed ph 7.40, paco2 33 mmhg, pao2 380 mmhg, hco3 20 mmol/l, and the fraction of carboxyhemoglobin 16.0% (reference range<2%). pain was mainly retrosternal, lasted for several minutes, with no aggravating or relieving factors, and no change in position or respiration. coronary computed tomography (ct) angiography performed to rule out coronary artery disease revealed normal coronary artery. transthoracic echocardiography on the same day showed moderately reduced ejection fraction (42%), and akinesia of left ventricular apex. stress induced cardiomyopathy or ischemic insult of left anterior descending artery were suspected. during comprehensive echocardiographic examination, echogenic mass with multiple nodularity in right atrium (ra) was identified. the size measured about 30 15 mm, and it appeared to be attached to the junction of superior vena cava. transesophageal echocardiography and cardiac magnetic resonance imaging (mri) were requested for further characterization of the mass. in mid-esophageal 140 degree view the mass was highly mobile and oscillating up and down across the tricuspid valve throughout the cardiac cycle (fig. the foremost diagnosis to exclude in this patient was intracardiac thrombus, and therefore we started anticoagulation therapy immediately. cardiac mri 1 day after anticoagulation therapy showed delayed enhancement suggestive of a thrombus, and an obvious reduction in size of the thrombus to 8 mm (fig., she was questioned concerning recent potential precipitating conditions, such as surgery, immobilization and use of medications including oral contraceptives. furthermore, she was evaluated for genetic and connective tissue disease leading to thrombophilic conditions. complete lower extremity ultrasound and abdominopelvic ct was conducted for suspicion of peripheral vein thrombosis and it demonstrated no thrombosis in other organs. the follow-up transthoracic echocardiogram was done on sixth day after anticoagulation, and showed no residual thrombus in the ra and normalized left ventricular (lv) systolic function (fig. the patient has been free of symptoms and there have been no clinical features of neurologic or thromboembolic complications during the 3-months of follow-up. co poisoning has special impact on organs sensitive to oxygen deprivation such as the heart, brain, and kidney. myocardial injury assessed by ecg and cardiac enzyme elevation from moderate to severe co poisoning is common (~40%) than expected.2) the proposed mechanism of global left ventricular dysfunction is tissue hypoxia and resultant myocardial stunning. the affinity of hemoglobin for co is more than 200 times greater than its affinity for oxygen, and competitive inhibition of oxygen release leads to tissue hypoxia.3) usually, the left ventricular dysfunction was transient and would be normalized with conventional treatment including high concentration of oxygen. in our case, left ventricular systolic dysfunction with regional wall motion abnormalities was associated with co poisoning and recovered with conventional therapy. in contrast, an association between thromboembolic accidents and co poisoning has been shown less commonly in the literatures. to our knowledge, this is the first korean case of acute co poisoning combined with ra thrombus formation. besides lv thrombus formation associated with transient apical ballooning of lv,15) there have been several reports regarding arterial and venous system thrombosis and related embolism including popliteal artery,8)9) superior sagittal sinus,10) vein of labbe,11) mesenteric artery,12) basillar trunk,13) and popliteal vein.14) a plausible explanation for thromboembolic events is the effect of co on platelets aggregation. co poisoning leads to some changes in blood vessel and co and nitric oxide exchange on platelet. disturbed mitochondrial mechanisms by no and its derivatives facilitate production of free oxygen radicals.16) oxidative stress enhanced by free oxygen radicals may lead to endothelial damage, and subsequent platelet aggregation.17) although the optimal therapy and duration of anticoagulation for co induced ra thrombus is still unknown, the use of anticoagulant therapy in the acute phase and until complete resolution of thrombus appears to be appropriate in patients with atrial thrombus.18)19) in conclusion, myocardial injury is common in co poisoning. thromboembolism could occur in cardiac chambers and peripheral vessels, although it was less frequent. therefore, patients presented with co poisoning should undergo echocardiographic examination followed by serial ecg and cardiac enzyme evaluation. careful examination should be performed for the assessment of intracardiac thrombus, in addition to the exact evaluation of ventricle function.

carbon monoxide is a nonirritant, odorless, colorless gas. its effects are prominent in organs most sensitive to oxygen deprivation, such as the heart, brain, and kidney. although less frequently, an association between thromboembolic events and carbon monoxide poisoning has been shown in the literatures. in this case, we report a case of atrial thrombus associated with carbon monoxide poisoning.

PMC3542516

pubmed-530

cardiovascular diseases (cvds) account for about 30 percent of all deaths worldwide, and hyperlipidemia, hypertension, and smoking are well known as the three major risk factors of the mortality rates of cvds. regarding the advances in the study and understanding of the mechanisms involved in the positive and negative effects of botanical drugs on health and diseases, one of the areas which has gained attention in recent years is the protective and destructive effects of herbal agents on the cardiovascular system. based on the previous experimental studies and existing traditional and folk medicine knowledge about some of the cardiovascular beneficial effects concerning rosa damascena l. (rd) and quercus infectoria (qi), we have selected these two herbal drugs for the present study. the q. infectoria olivier (fagaceae) is a shrub that grows in asia minor, iran, and greece. the galls of q. infectoria have analgesic cns depressant, antiparkinsonian, antidiabetic [35], anti-inflammatory, and antioxidant activity. recently, the hepatoprotective effects of q. infectoria galls against ccl4-induced tissue damage have been reported. rosa damascena l. is a small plant, that is cultivated all over the world due to its scent and visual beauty. the theraputical effects of rosa damascena l. are due to its anti-inflammatory, analgesic, hypnotic, and antispasmodic [9, 11] properties. antioxidant and antidiabetic [12, 13], heart inotropic, usefulness in treatment of menstrual bleeding, antitussive, tracheal relaxant, and relaxing activity are the other effects that attributed to rosa damascena l. considering the beneficial effects of quercus infectoria and rosa damascena l. reported in the literature, the administration of these agents especially in the eastern societies is growing. in the present study we investigated the effects of chronic administration of quercus infectoria and rosa damascena l. on the hemodynamic, heart performance, lipid profile, and plasma atherogenic indices of rabbits with/without hyperlipidemia to elucidate the outcome of a long-term consumption of these agents on the cardiovascular system. experiments were conformed to the national guidelines for conducting animal studies (ethic committee permission no. 86/123ka kerman university of medical sciences, iran) and were performed on 36 new zealand white rabbits weighing between 2.5 and 3.5 kg. sodium thiopental was purchased from biochemie (austria) and cholesterol from merck (germany). galls of quercus infectoria (qi) and flowers of rosa damascena l. (rd) were collected during the spring of 2012 from isfahan and kerman (provinces of iran), respectively; they were identified and confirmed by the botany department of bahonar, university of kerman, iran. the galls of qi and air-dried flowers of rd (300 g) were grinded and macerated in 1000 ml methanol at room temperature for 3 days. then the mixtures were filtered and evaporated in vacuum to yield a waxy mass extract from rd and a powder mass extract from qi. rabbits were kept under appropriate animal care and were randomly divided into 6 groups as control (ctl), rd, qi, hyperlipidemic (h), hyperlipidemic+rd (h+rd), and hyperlipidemic+qi (h+qi). the rd and qi groups were fed with normal rabbit chow supplemented with 1.5 g rd and qi extracts, respectively, in each kg of the diet for 45 days. this dosage was calculated based on the current using pattern among consumers and previous studies. cholesterol (0.5%) and hydrogenated vegetable oil (16%) were added to the diet of the hyperlipidemic (h) groups during the 45 days of this experiment. the h+qi and h+rd groups received 1.5 g qi and rd extracts, respectively, in each kg of their diet in addition to cholesterol and hydrogenated vegetable oil during the study. the fasting blood sample was taken from ear vein on the first and the 46th day of the experiment in order to measure the plasma total cholesterol (tc), low-density lipoprotein (ldl), high-density lipoprotein (hdl), and the triglyceride (tg) levels by routine laboratory methods. the atherogenic indices of plasma, as markers of plasma atherogenicity, were calculated as tc/hdl and ldl/hdl. at the end of the experiment, animals were anaesthetized by the injection of sodium thiopental (50 mg/kg, ip) and were maintained with a 1% halothane in a 30% o269% n2o mixture during the surgical procedure. deep anesthesia was confirmed and maintained throughout the surgery as judged by the absence of withdrawal response to a pinch stimulus applied to the hind limbs. a heparinized saline-filled (7 units/ml) cannula was connected to a pressure transducer, and a powerlab analog to digital converter (ad instruments, australia) was inserted into the left carotid artery to record the heart rate and arterial blood pressure (bp). the other cannula which went through the right carotid artery was inserted into the left ventricle, and the left ventricular pressure (lvp) was recorded. the gaseous anesthesia was discontinued at the end of the surgery, and the time window for animal recovery from the surgery was 30 min. the mean arterial pressure (map) was calculated by map=pd+(ps pd)/3 formula, where pd is the diastolic arterial pressure and ps is the systolic arterial pressure. the maximum velocity of contraction (max dp/dt) and the maximum velocity of relaxation (min dp/dt) were calculated from the left ventricular pressure pulse. pressure-rate product (prp), an indirect measure of myocardial oxygen demand, was determined as the product of the heart rate and mean arterial pressure (( mapheart rate) 1,000). comparisons were performed between basal and final values in each group by student's paired t-test and among the different groups by one-way anova which was followed by the post hoc tukey's test. the levels of basal plasma lipids and basal atherogenic indices of the different groups had no significant difference. consumption of normal chow alone or along with rd or qi for 45 days did not cause any significant change on the lipid profile and atherogenic indices of the ctl and qi groups. the triglyceride level, however, showed significant increase in the rd group (p<0.01). the high-fat diet induced hyperlipidemia as significant increase in the tc, ldl, and tg and atherogenic indices in all groups compared to its related basal values (table 1, figures 1 and 2). the qi administration along with the hyperlipidic diet decreased the tc and ldl when compared to the h and h+rd groups (p<0.001 and p<0.01, resp.). the level of ldl was also reduced in the h+rd group (p<0.01 versus h group). the level of tg was enhanced in the h group compared with the ctl group (p<0.01); however, the consumption of qi attenuated this effect (p<0.05 versus h group) (table 1). two atherogenic indices of plasma, tc/hdl and ldl/hdl, significantly increased in the h and h+rd groups (p<0.001 versus ctl and rd groups). tc/hdl showed nonsignificant increase in the h+qi group (p<0.055 compared to qi group and p=0.058 compared to the ctl group) (figure 1). the ldl/hdl ratio was associated with a lesser increase in the h+qi group than that of the h and h+rd (p<0.01 when compared to the ctl and qi groups) (figure 2). at the end of this study, the comparison of the blood pressure among the different animal groups did not show any significant effect of rd or qi (each alone) on this parameter. yet, in those animals which received a combination of rd and high-fat diet, systolic, diastolic, and the mean arterial pressures increased significantly whenever it was compared to its corresponding groups, that is, the ctl, rd, and h. in this study, the high-fat regimen alone or plus qi had no significant effect on the blood pressure compared to its matching groups (figure 3). the heart rate, pulse pressure, the maximum velocity of heart contraction (+ dp/dt max=max dp/dt), and the maximum velocity of heart relaxation (dp/dt max= min dp/dt) did not show any significant difference among the animal groups (table 2). the prp was greater in the h+rd and h+qi groups; however, this index was only significant in the h+rd, when compared to the rd group (p<0.05) (table 2). the left ventricular developed pressure (lvdp) and the left ventricular systolic pressure (lvsp) increased significantly in the h+rd group compared to the ctl and rd groups (p<0.05 and p<0.0001, resp.) and in the h+qi groups (p<0.01 versus qi groups). the lvdp and lvsp also increased in the h groups compared to the rd group (p<0.05). the h and the h+rd groups showed maximum levels of left ventricular end diastolic pressure (lvedp); on the contrary, the qi group showed a minimum level of this parameter. in addition, the lvedp had dropped in the h+qi group compared to the h group (p<0.05) (figure 4). this study aimed to assess the influence of the chronic administration of a methanolic extract of two famous herbal drugs, that is, rosa damascena l. and quercus infectoria, on hemodynamic, heart performance, lipid profile, and plasma atherogenic indices of rabbits with/without high-fat diet. the results revealed the obvious beneficial effect of qi on harmful outcomes of a hyperlipidic diet as the attenuation of plasma atherogenic indices, the prevention of hyperlipidemia, and the improvement of the cardiovascular performance. on the other hand, the rd administration showed a mild decreasing effect on plasma lipid profile and the atherogenic indices. however, the administration of rd along with a high-fat diet increased the index of myocardial oxygen consumption and the risk of hypertension. the inhibition of pancreatic lipase (pl) as a pivotal enzyme in the intestinal absorption of triglycerides and hmg coa reductase, the other important enzyme, that is, involved in the endogenous cholesterol biosynthesis, is the target of the pl inhibitors and statins, respectively. in vitro experiments indicated that especially qi and to some extent rd have inhibitory effect on pancreatic lipase and hmg coa reductase enzyme. the results of previous and present in vivo studies obviously have confirmed the antilipidemic effect of qi, but rd had no considerable effect. therefore, a part of the antilipidemic and antiatherogenic effects of qi revealed in the present study may mediate through inhibition of pl and hmg coa reductase enzymes. in addition, qi contains some bioactive agents, and its main component is tannin. this phenolic compound is able to precipitate proteins [28, 29], for example, pl enzyme, and hence may provide a portion of antilipidemic and antiatherogenic effects of qi. previous studies showed that the use of high-lipid diet contains 1% cholesterol for 8 and 10 weeks and had no significant effect on the blood pressure, heart rate, prp, max dp/dt, and min dp/dt indices of rabbits. still, even 4 weeks of a high-cholesterol regimen increases the vascular resistance and decreases the endothelium-dependent vasodilatation. consistent with the previous reports, in our study, 45 days of a highfat diet had no significant effect on hemodynamic and heart performance of the h group compared to the ctl group. however, coadministration of rd and high-fat diet was associated with an increase in the blood pressure, lvsp, and lvdp. the positive chronotropic and inotropic effect of rd has been observed in the isolated heart of guinea pigs. this effect apparently is mediated through the stimulation of -adrenoceptor [33, 34]. the opening of the calcium channels and the elevation of the intracellular camp levels like the effect of phosphodiesterase iii inhibitors are likely to be the other possible mechanisms which may be involved in the inotropic effect of rd. cardiac output, in turn, is the product of stroke volume and heart rate. the increase of heart contractility leads to the increase of stroke volume and consequently the blood pressure. in our study, a nonsignificant increasing trend of max dp/dt as an index of heart contractility in the h+rd group was observed. the discrepancy between our findings and the results of boskabady et al. related to the chronotropic effect of rd may come from the two different conducting methods, in vivo method versus isolated heart method, and hence influence of endogenic factors such as autonomic nervous system feedback in our study. the combination of the negative effect of hyperlipidemia on the vascular vasodilatation along with the partial increase of heart contractility due to positive inotropic effect of rd is a likely reason for explaining the high blood pressure and lvsp in the h+rd group. however, there is the possibility of unknown effects of rd on the arterial vessel that should be investigated in future studies. the results of this study revealed the significant antilipidemic and antiatherogenic effects of qi but not rd. this may be partly mediated by the inhibition of pl and hmg coa reductase enzymes. regarding some side effects of synthetic lipid-lowering drugs, for example, myopathy and liver damages for statins [25, 37] and gastric irritation, flushing, hyperuricemia, dry skin, and abnormal liver function for pl synthetic inhibitors, qi can be considered as a new candidate for reducing plasma lipids in future human studies. in addition, the use of rd along with a high-fat diet increased the risk of hypertension in rabbits. if our results can be extrapolated to human, this adverse effect of rd in cases with hyperlipidemia context should be considered and investigated.

according to the use of quercus infectoria (qi) and rosa damascena l. (rd) for therapeutic purposes and lack of adequate information about their cardiovascular effects, we investigated the cardiovascular indices of rabbits which chronically pretreated with these agents. animal groups were control group (ctl), rd and qi groups with normal chow plus 1.5 g rd and qi extracts, respectively, in each kg of the diet for 45 days; hyperlipidemic (h) group received high-fat diet for 45 days; h+rd and h+qi groups received high fat diet plus qi and rd extracts, respectively. blood pressure was greater in h+rd group than ctl, rd, and h groups. left ventricular developed pressure and left ventricular systolic pressure increased significantly in h+rd group versus ctl and rd groups (p<0.05 and p<0.0001, resp.) and in h+qi groups (p<0.01 versus qi groups). left ventricular end diastolic pressure (lvedp) showed significant reduction in h+qi group versus h group. qi attenuated the values of total cholesterol, ldl, tg, and atherogenic indices of plasma when coadministrated with a high-fat diet. the results suggest the antilipidemic and antiatherogenic effects of qi. in addition, the use of rd along with a high-fat diet may increase the risk of hypertension in rabbits.

PMC3791831

pubmed-531

radial extracorporeal shock wave therapy (rswt) generates pressure waves through the collision of solid bodies1. there are a few recent reports regarding the effectiveness of extracorporeal shock wave therapy (eswt) on neurogenic heterotopic ossification (ho) in the lower extremity, but to our knowledge, the use of eswt or rswt to treat neurogenic ho in the upper extremity has not been reported in the literature4. we report 2 cases of rswt used to treat neurogenic ho in the upper extremities. in both cases, improvements in pain, range of motion (rom), muscle strength, and hand function were observed. each patient gave their written informed consent and agreed to participate in the treatment. this case report was approved by the ethics committee of the sahmyook medical center. a 49-year-old man was admitted to our physical medicine and rehabilitation (pmr) department. a subarachnoid hemorrhage (sa) occurred 10 months prior to admission and neurogenic ho of the left shoulder and elbow was diagnosed 2 months before his admission. he had been taking disodium etidronate 800 mg per day (fig. 1.(a) in case a, bone scan, x-ray, and musculoskeletal ultrasound demonstrate ho in the left shoulder and elbow. arrows indicate the ho sites.ho: heterotropic ossification; subs: subscapularis; cp: coracoid process; un: ulnar nerve; me: medial epicondyle; olec: olecranon). in spite of the medication, he continued to complain of constant pain, limited rom, muscle weakness, and impaired hand function. rswt was administered to the inferior portion of the coracoid process of the left shoulder and the medial epicondyle (me) of the left elbow using ultrasonographic (usg) guidance. the target points of rswt were the ho area that could be seen with usg. (a) in case a, bone scan, x-ray, and musculoskeletal ultrasound demonstrate ho in the left shoulder and elbow.: heterotropic ossification; subs: subscapularis; cp: coracoid process; un: ulnar nerve; me: medial epicondyle; olec: olecranon a 52-year-old man with a 6-month history of hypoxic brain injury was admitted to our pmr and diagnosed with neurogenic ho of the right elbow (fig. 1). rswt was administered to the ho area including the me and olecranon of the right elbow using usg guidance. medications were not subsequently required due to a good response to rswt. in both cases, rswt was administered using the master plus mp 2000 (storz, tgerwilen, switzerland), and the rswt protocol consisted of 3,000 pulses at a frequency of 12 hz during each treatment. the intensity level ranged from 25 bars, and it was administered 5 times a week for 4 weeks, a total of 20 treatments. during rswt, all other treatments, including physical and occupational therapy, were continued as usual. both patients were allowed to take previously prescribed oral medications but additional analgesics or antispastic medications were not permitted. pain assessed with the numerical rating scale (nrs), rom, muscle strength assessed with the manual muscle test (mmt), a hand evaluation test, and the jebsen-taylor hand function test were evaluated prior to each treatment, after treatment, and following 1 month of treatment. pain was reduced from 8 to 0 on the nrs, and the patients remained pain-free for 1 month after treatment. in case a, rom of flexion, abduction, adduction, internal rotation, and external rotation of the left shoulder and additionally, flexion of the left elbow was improved and maintained. the mmt result also showed improvement and the improvement was maintained for 1 month (table 1table 1.range of motion, manual muscle test, hand evaluation test and, jebsen-taylor hand function test resultstestcase acase bbeforeafterfollow up upbeforeafterfollow uprange of motion()shoulderflexion 90140*145*extension 202020abduction90130*130*adduction1020*20*internal rotation6070*70*external rotation2060*60*elbowflexion 90100*100*4080*85*extensionfullfullfullfullfullfullsupination7070706065*80*pronation7060606062*80*manual muscle testshoulderflexionfairfair+*fair+*extensionfairgood*good*abductionfairfair+*fair+*horizontal abductionfairfair+*fair+*horizontal adductionfairgood*good*elbow flexionfairgood*good*fairfairfairextensionfairgood*good*fairfairfairhand evaluation test grasp power (kg)1420*18*121212lateral pinch (kg)3.54.5*5.5*1.52.5*2*tripod pinch (kg)23.0*2.5*211.5nine-hole pegboard (sec)30.625.7*25.0*13865.1*58.7*purdue pegboard test (number) 1112*12*03*1*jebson-taylor hand function test (sec)writing55.3445.00*43.71*ntntntcard turning9.317.87*8.76*11.0411.076.9*small common object12.1610.59*10.15*nt47.3*19.5*feeding13.8112.25*10.94*ntnt25*stacking checkers7.134.50*4.12*ntntntlarge light object (sec)5.845.914.81*8.125.71*6.34*large heavy object (sec)6.945.78*4.63*8.697.12*5.06*follow up period was 4 weeks. functional testing of hand strength and speed of hand movement showed improvements that were maintained at least for 1 month after the end of treatment (table 1). follow up period was 4 weeks. improved score; nt: not testable; affected side in case b, right elbow flexion, supination, and pronation were improved, the improvements were maintained for 1 month. in contrast to case a, improvement in the mmt result was not seen (table 1). in the hand function test, the strength of the hand and speed of hand movement improved, and these improvements were maintained at least for 1 month after the end of treatment (table 1). ho is a complicated and significant medical problem characterized by abnormal growth of bone in soft tissues, commonly around large joints. in its severe form, the condition causes pain, limited rom, and loss of function in the affected joint. neurogenic ho is associated with injuries to the central nervous system, occurs 24 months after a neurological insult, and mainly affects the major synovial joints between spastic muscles6. primary treatment is a combination of gentle passive rom exercises and bisphosphonate medication, such as disodium etidronate or nonsteroidal anti-inflammatory drugs. surgical excision may be considered for complicated cases, but surgical complications and postoperative recurrence are common4. eswt has been described in several case reports as a new treatment strategy for neurogenic ho, but it has been restricted to the lower extremities7. eswt has been shown to promote bone healing in stress fractures, avascular necrosis, and delayed and/or bony nonunion, and it has been widely used for managing the pain of various musculoskeletal conditions8. eswt consists of a sequence of single sonic pulses characterized by high peak pressure (1001,000 bars) of short duration (0.2 s) and has a focused pressure field with deep penetration depth. compared with eswt, rswt is characterized by 110 bars of pressure of 0.20.5 ms duration and has a radial pressure field with shallow penetration depth. despite the physical differences, the stimulation effects and therapeutic mechanisms of eswt and rswt are almost the same1. in our cases, pain, rom, muscle strength, and hand function improved although imaging studies with radiographs and bone scans showed no changes. this result is consistent with previous studies that reported improvement in pain and function without changes in imaging studies7, 8. based on the results of these studies, it is our opinion that imaging findings do not accurately reflect the pain and function caused by neurogenic ho. the mechanism of pain reduction with eswt or rswt is not well known and there are several hypotheses9. eswt or rswt generates oscillations in tissue that lead to improvement of microcirculation and metabolic activity1. immediate pain reduction after eswt could be the result of a hyperstimulation analgesic effect10. the improvements observed in rom, mmt, and hand function of the present two cases could be associated with pain reduction, since proper management of pain caused by neurogenic ho with rswt could have been the cause of the improvements in rom and hand function. as reported by previous studies, in our cases, the improvements in pain, rom, mmt, and hand function were maintained for 1 month after the rswt treatment7. the mechanism of the long-term maintenance of the improvements is not known but rswt in the early phase of neurogenic ho is effective at preventing progression. they were the inferior part of the coracoid process of the left shoulder and the me of the left elbow in case a, and the me and olecranon of the right elbow in case b. imaging guidance when administering rswt for treating neurogenic ho could help to correctly focus on the ho site and avoid the other vulnerable structures such as vessels and nerves2, 10. in conclusion, rswt improved the pain, rom, and hand function of two patients with upper extremity neurogenic ho. further studies are needed to support these results and to understand the mechanism behind the effectiveness of rswt, as well as to devise a protocol for rswt for neurogenic ho.

[ purpose] to report the effects of radial extracorporeal shock wave therapy (rswt) on heterotopic ossification (ho). [subjects and methods] two cases of neurogenic ho in the upper extremity were administered rswt using the master plus mp 2000 (storz, tgerwilen, switzerland) and ultrasonographic guidance. the rswt protocol consisted of 3,000 pulses at a frequency of 12 hz during each treatment. the intensity level ranged from 25 bars, and it was administered 5 times a week for 4 weeks, a total of 20 treatments. [results] rswt improved pain, range of motion, and hand function in 2 patients with neurogenic ho in the upper extremity. [conclusion] further studies are needed to support these results and to understand the mechanism and to devise the protocol of rswt for neurogenic ho.

PMC4793037

pubmed-532

stairway falls are a leading cause of injury in patients less than 5 years of age [1, 2]. while the majority of these injuries occur when a child steps down the stairs, approximately 3% of injuries will be associated with a caregiver falling while carrying a child. this specific mechanism has been shown to result in injury patterns that are more likely to necessitate hospitalization and more likely to involve trauma to the head and fractures to the extremities. while it is often necessary for a parent or caregiver to carry children in their arms while walking down stairs, the child may obstruct the caretaker s view on the stairway (fig. this can lead to a fall by the caretaker and an injury to the child and/or caretaker. to date, several previous studies have been conducted evaluating stairway injuries in children, but none have focused on this specific mechanism (fall from caregiver s arms) or the injuries associated with these falls. the goal of this study was to identify injuries that may occur when a caretaker falls while carrying a child on a stairway, to understand the pathomechanics of this injury, and to perform a cost analysis of the injury. fig. d bird s eye view of how the child can obstruct the caretaker s view on the stairway a side view of the caretaker s unobstructed view on the stairway. d bird s eye view of how the child can obstruct the caretaker s view on the stairway emergency department and orthopedic clinic records were reviewed between 2004 and 2012 to identify patients with an orthopedic injury after a fall from stairs. sixteen children were retrospectively found to have a fracture from a fall-in-arms injury sustained while a caregiver was going down stairs, and were included in this study. patient identification occurred at a routine weekly fracture conference, where every emergency department fracture in which the orthopedic service was consulted was presented. if the patient met the inclusion criteria, they were then added to the database. the following demographic and epidemiologic data were recorded for each patient: age, gender, location of injury, and mechanism of fall. additionally, radiographs were reviewed to assess fracture location, type, displacement, and treatment. cost analysis data was obtained from the hospital billing department and included all emergency department care, inpatient care, and subsequent follow-up. this study was granted a waiver of informed consent, including permission and assent, in accordance with 45 cfr 46.116(d) and 45 cfr 46.408, and a waiver of hipaa authorization per 45 cfr 164.512(i). the study was authorized by the local ethical committee and was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000. sixteen children presented to the emergency room and orthopedic clinic of our hospital after sustaining an injury when their caretaker fell while carrying them down the stairs. our billing records reveal that we, as an institution, treat approximately 9,500 fractures per year, giving an incidence of approximately 1 fracture by this mechanism per 5,000 fractures. interviews with the parents yielded information regarding the specifics of the fall and the possible pathomechanics of the child s injuries. the parent or caregiver noted in all cases that the child was being held in front as they descended the stairs. the child obscured their view and they missed a step and fell (fig. the age at the time of injury averaged 14 months and ranged from 7 months to 51 months of age. eight (50 %) sustained femur fractures, six (38 %) sustained tibia fractures, and one (6 %) sustained a metatarsal fracture. there was one both bone forearm fracture (6 %); this occurred in the eldest child (51 months). four of these patients, however, required a reduction or manipulation, three of which were performed in the operating room. functionally, all patients did well, with no deficits noted at final follow-up. cost analysis was performed amongst our 16 patients to determine the financial burden accrued in relation to these accidental traumas (table 1). the average total charge of the treatment of the fractures was $6,785 (standard deviation $11,183; range $948$45,876). five of the 16 children (31 %) had a skeletal survey, as the treating physicians were concerned about possible child abuse; the average total charge for those receiving a skeletal survey was $7,024. after a social service consultation and a skeletal survey were obtained in these cases, no patient was felt to be the victim of child abuse. for those children not requiring a skeletal survey, three children (19 %) required a closed reduction of their femur fractures in the operating room; their total care charges averaged $23,568. for the children not treated in the operating room, the average charge was $2,912. table 1cost of fall-associated accidental traumasage (months)sexfractured bone(s)costskeletal survey18mtibia/fibula$2,607no7ftibia$2,024no12ffemur$4,276yes10mfemur$7,861yes12mfemur$9,080no16ftibia$2,801no10mmetatarsal$1,328no17mfemur$19,748yes12ftibia/fibula$2,594no7ffemur$4,231yes51fulna$3,907no15.6 (avg. age)$5,496 (avg. injuries incurred on stairs, particularly in patients under the age of five, can occur with relative frequency. three previous studies have been conducted that have evaluated stairway injuries in children [3, 4, 6]. included in these studies were primarily children who fell while walking on the stairs, and none focused on the variable of a caretaker falling while carrying a child. it was noted, however, in these studies that children who sustained injuries while being carried tended to have more severe injuries than those who fell while walking themselves down stairs. in our study, all patients identified had incurred a fracture, and nearly all of these involved the lower extremity. of the 16 children, half (50 %) sustained femur fractures and 38% sustained tibia fractures. these results show that the pattern of injury differs from that of a child who falls while walking down the stairs. however, a child who is dropped, or fallen upon, while being carried appears more likely to sustain a long bone fracture to the lower extremity. pierce et al. have the only series currently published that examines the incidence of femur fractures and falls down stairs. their series evaluated femur fractures that were due to a reported fall down stairs (either solo or in a caretaker s arms), and evaluated a plausibility model to check whether they could identify cases of nonaccidental trauma. in their subgroup of caretaker falls, this mechanism most commonly caused buckle fractures, followed by transverse/short oblique fractures. they examined the energy absorbed by the patients during falls and noted that the greater number of stairs in the fall correlated to the fracture pattern type, noting that spiral fractures were associated with falls from 1 to 3 steps and buckle fractures with falls from 4 to 15 steps. in our study, we saw an even distribution of spiral and buckle fractures that may be associated with the variability in fall heights that were observed in our patient population. pierce et al. also employed a plausibility model to help identify if certain aspects taken from the history could be used as independent identifiers of child abuse. they found that if a caregiver could not give specific details about the fall dynamics as well as the position of the child before and after the fall, the child may have been a victim of abuse. although this model has not been validated, and was not employed here, it may provide guidance to treating physicians and can reduce costs and avoid exposing patients to unnecessary radiation from a skeletal survey. in our series, all caregivers were able to provide a detailed history regarding the nature of their child s injury, and subsequent non-accidental trauma work-ups suggested no cases of abuse. additionally, no child in our study had a concomitant injury other than the fracture. this is consistent with other studies, where abused children tended to have other injuries such as bruising as well head and trunk injuries. the total charge for the children who received a skeletal survey as part of their work-up was $7,024. it is the duty of treating physicians whether they are primary care physicians, emergency room physicians, or orthopedists to be vigilant in the work-up of suspected nonaccidental trauma, and the skeletal survey is frequently the first test ordered following a history and physical. with that said, in cases where the caregiver can provide a clear history, the skeletal survey can be deferred to minimize costs and radiation exposure to the child. three children in our series had to go to the operating room for a surgical reduction. all of these were for diaphyseal femur fractures that were treated with a spica cast. the costs related to the treatment of these femur fractures dwarf the costs of the other patients in this series. when taken as two separate groups, the average charge for femur fracture treatment in the emergency room was $2,912, compared to $23,568 for treatment in the operating room. this study does have limitations and is biased toward orthopedic injuries, as all of the cases reported were obtained through orthopedic emergency room consults and clinic visits. isolated injuries to the head or torso would not involve an orthopedic consult and thus were not included in this group. this most likely underestimates the total number of children seen at our hospital due to a fall down stairs while being carried by a caregiver. additionally, the number of children with relatively minor injuries who did not seek medical treatment further underestimates the true incidence of this mechanism of injury. this paper describes the type of orthopedic injuries sustained during a fall down stairs while in a caregiver s arms. what our study adds to the literature is that nearly one-third of the children underwent a skeletal survey due to concerns regarding child abuse. additionally, the average cost of these injuries was not insignificant and averaged $6,785. thirdly, we believe that the pathomechanics of this injury are as follows: the caregiver descends the stairs carrying a child in front.the size of the child obscures the view of the subsequent stair (fig. 1a d).the caregiver misses the step and falls.the momentum usually causes the caregiver and child to fall forward down the stairs (fig. 2). fig. 2they miss the step and fall, often landing on the child as they fall the caregiver descends the stairs carrying a child in front. the size of the child obscures the view of the subsequent stair (fig. the momentum usually causes the caregiver and child to fall forward down the stairs (fig. 2they miss the step and fall, often landing on the child as they fall they miss the step and fall, often landing on the child as they fall with a better understanding of this mechanism, the treating er physician can avoid routine skeletal surveys when the parent describes a plausible sequence, as we note above. finally, with awareness of this mechanism, prevention of these injuries may be possible. our recommendations are for the caregiver to hold on to the handrail while traversing the steps. in addition to using the handrail, the caretaker s view of the stairs should be unobstructed (fig. 3). this can be accomplished by positioning the child on the opposite side of the body to the handrail. we hope that these recommendations serve to remind healthcare providers as to the dangers of carrying children on stairways. at times this may be necessary, and can be performed safely if the proper precautions are taken. fig. in addition to using the handrail, the caretaker s view of the stairs should be unobstructed the caregiver should hold on to the handrail while traversing the steps. in addition to using the handrail, the caretaker s view of the stairs should be unobstructed in conclusion, a fall in a caregiver s arms while going down stairs can result in multiple orthopedic injuries, particularly to the lower extremity. the costs of treating these injuries are not insignificant, averaging nearly $7,000, and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident. while descending the stairs with a child in their arms, the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm, ideally holding the handrail with the other.

backgroundthe purpose of this study was to describe fractures sustained by children and to analyze the associated costs when a caretaker falls down stairs while holding a child. materials and methodsbetween 2004 and 2012, 16 children who sustained a fracture after a fall down stairs while being carried by a caregiver were identified. parents/caregivers were interviewed to see how the fall occurred, and a cost analysis was performed. resultsthe average age of the patients was 14.5 months (751 months). the lower extremity was involved in 15 of 16 fractures, with 8 involving the femur. the majority were buckle fractures, but all diaphyseal femur fractures were spiral. three patients required a reduction in the operating room. all fractures healed with cast immobilization. five patients underwent skeletal surveys, as the treating physicians were concerned about potential child abuse. the average cost of treatment was $6785 (range $94845,876). detailed histories from the caregivers showed that they missed a step due to the child being carried in front of the caregiver, obscuring their vision. conclusionsa fall in a caregiver s arms while going down stairs can result in multiple orthopedic injuries. the costs of treating these injuries are not insignificant, and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident. while descending the stairs with a child in their arms, the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm, ideally holding the handrail with the other.level of evidenceiv case series.

PMC3935023

pubmed-533

transcutaneous electrical nerve stimulation (tens) is the application of an electric current through the skin to stimulate the nervous system. this type of electrical stimulation activates spinal afferent pathways that connect to spinal gray matter of the dorsal horn modulating sensory afferent traffic. the electric current stimulates the underlying fibers producing painless paresthesias without causing damage to the skin1, 2. its application technique varies depending on several parameters and can be divided into high frequency (50 hz) low intensity and low frequency (10 hz) high intensity tens, both of which are used to relieve both acute and chronic pain3,4,5. acupuncture is also widely used in clinical settings for the relief of pain caused by lower back injury, fibromyalgia, and headache disorders, among others. uniting the technique of acupuncture analgesia with electrotherapy, with certain modifications, has created electroacupuncture which is used as a substitute for conventional acupuncture, and in cases where clinical acupuncture alone has noeffect5, 6. low frequency tens is also called acupuncture like tens, because it interacting with the peripheral nervous system eliciting a pricking sensation, that is modulated by the frequency of electrical stimulation, the current intensity and the pulse duration. to present this kind of sensation, the procedure differs from classical electroacupuncture, as it does not use needles, only electrodes with a high intensity of the electrical current7,8,9. currently, several terms are used to describe the transcutaneous electrical stimulation of acupoint. for example: acu-tens (tens applied to an acupoint) and teas (transcutaneous electric acupoint stimulation) that involves any electric current applied to acupoints10. in this study, two different areas of electrodes, 1 cm and 15 cm, te5 (waiguan) and pc6 (neiguan) acupoints. according to chinese traditional medicine stimulation of the te5 acupoint is indicated for arthritis in the wrist and finger joints, and that of the acupoint pc6 is indicated for pain in the forearm, carpal tunnel, and wrist, median nerve palsy, and pain and contracture in the elbow and arm. this study analyzed whether the areas of electrodes elicit different effects. when tens is applied to acupoints frequency of 10 hz with sufficient intensity to promote muscle jerks. the latency of the pain threshold and its intensity in healthy subjects subjected to cold-induced pain was measured. this was a single-blind, quasi-experimental study with a control and placebo. forty-eight subjects (convenience sample) were recruited from the departmental centres of the university federal of pernambuco (ufpe). they were divided into three groups of 16 subjects, composed of both sexes aged between 18 and 30 years. the groups were formed by the allocation of the subjects who were verbally invited to particpate and sent to the laboratory. all of the participants provided their written informed consent. after reading and accepting the terms of the study, subjects were allocated to three groups: the 1 cm electrode group, the 15 cm electrode group, and the placebo group. the subjects were allocated by raffle in blocks of four to each group in succession. during the period of experimentation subjects showed no pathological state in the region subjected to cold-induced pain, did not use allopathic and/or homeopathic drugs, showed no intolerance or phobia at low temperatures, and the female subjects, were not in a state of pre-menstrual tension or menstrual flow. all experiments were performed in the laboratory of electrothermy at the department of physical therapy of the federal university of pernambuco. the first experimental group (8 males and 8 females) was stimulated by acupuncture like tens on the te5 and pc6 acupoints with 1 cm electrodes; the second experimental group (9 males and 7 females) was also stimulated by acupuncture like tens on the same acupoints with 15 cm electrodes; and the placebo group (10 females and 6 males) were told they were receiving microcurrent stimulation of the deltoid muscle with a 15 cm electrode. the study received approval from the university federal of pernambuco s research ethical committee, under the registration of sisnep fr-294607, caae-0315.0.172.000-9 based on resolution 466/12 national health council. the experimental intervention consisted of three stages (six cycles) which were termed pretreatment time (cycles 1 and 2), treatment time (cycles 3 and 4) and post treatment time (cycles 5 and 6). each cycle lasted ten minutes, making a total of one hour trial. in the first cycle, subjects put their non-dominant hand in a container of warm water (37 c) for five minutes. the temperature was maintained by an electrical water heater and constant measurement by mercury thermometer incoterm-l 212/04. this procedure aimed to equalize the temperature of the hand of all subjects before the procedure of cold-induced pain. after this, the hands were removed from the container and placed into another with icy water 02c (control performed by the mercury thermometer incoterm-l 212/04). the time to pain threshold from when the individuals put their hands into the icy water to the moment when they expressed pain was measured in seconds by digital stopwatch (cronobio sw2018). the subjects were asked to keep their hands in cold water for thirty more seconds, during this time (depending on the tolerance) they were asked to describe the painful sensation using a visual analog scale (values from 0 to 10, where 0 corresponds to no pain and 10 refers to the maximum tolerable pain) to assess pain intensity. after this they were allowed to take their hands out of the icy. after a rest interval, that varied among the individuals, butwas short enough to complete half the period of the last five minutes of the first cycle, the subjects again put their hands for 5 minutes in warm water, beginning the second cycle, followed immersion in cold water. procedure was repeated, completing two cycles of cold-induced pain, with pretreatment time, lasting twenty minutes. in the third cycle after wiring for tens, subjects again put their hands into the warm water for five minutes, and then into the container with cold water. the time to the pain threshold and pain intensity were measured, and the procedure was repeated for a fourth cycle, twenty minutes of tens application in total. acupuncture-like tens (10 hz) was delivered with a balanced, asymmetrical, biphasic pulsed current (tensys et9771 kld) of 1 ms (millisecond) pulse duration, with sufficient intensity of electric current to cause muscle jerks when placed over the te5 and pc6 acupoints, located two from the wrist crease, on the posterior and anterior forearm, respectively. to standardize electrical stimulation the cathode was placed on the te5 and the anode on the pc6 acupoints. the electrical stimulation of acupuncture-like tens was pervormed with 1 cm and 15 cm electrodes. at the end of the treatment period, the subjects were subjected to two more cycles, the fifth and sixth following the same method described above, to evaluate the effect of tens post-treatment (tens off). in the placebo group, subjects were subjected to the same procedure of the cold-induced pain test (pre-treatment, treatment and post-treatment), but the electrodes were placed on the shoulder (without connection to any acupoint) on the belly of the anterior deltoid muscle and the individuals were told that they were receiving a microcurrent treatment, in which they would not feel any sensation. they were told that the microcurrent works with very low intensities, was imperceptible, and had a painkilling effect. they were connected to the first channel of the equipment, and the second channel was connected so that the lights on the device certified that the current was supposedly operating. however the data of the latency of the pain threshold are presented as the mean standard deviation (sd). the results of pain intensity are presented as the average scores on the visual analog scale (vas). the latency of the pain threshold between cycles within each group was examined using repeated measures one-way anova and the post hoc newman-keuls test. for the pain intensity, the analysis between cycles within each group was performed using the friedman test. the groups pain threshold latencies were compared one-way anova followed by, post hoc newman-keuls test, when necessary. the effect size was calculated using cohen s d formula to investigate the clinical significance. a acupuncture-like tens with electrodes with an area of 1 cm showed effects on the pain threshold latency during application, while acupuncture-like tens with 15 cm electrodes showed effects after tens application. the placebo group showed no significant changes in any experimental phase (table 1table 1.the latency threshold (seconds) of pain in the different periods of acupuncture tens with electrodes of 1 cm, 15 cm, and placeboelectrodespretreatmenttreatmentposttreatment1 cm30.9 8.945.78 11.8*39.5 11.615 cm25.5 7.732.0 12.936.3 13.0*placebo25.2 10.725.2 7.622.4 7.4anova and post hoc newman-keuls. results expressed in mean sd (seconds)*significant difference from pre-treatment the intensity of pain was reduced during tens treatment with 1 cm electrodes both in relation to the time before treatment and after treatment (table 2table 2.pain intensity in the different periods of acupuncture-like tens with electrodes 1 cm, 15 cm, and placeboelectrodespretreatment(mean ranks)treatment(mean ranks)posttreatment(mean ranks)1 cm2.91.1**2.0*15 cm1.32.6*2.1placebo2.12.11.7friedman test.*significant difference from pre-treatment.** significant difference from pre-treatment and post-treatment). with the 15 cm electrode the sensation of pain increased in relation to the time before treatment. in the placebo group*significant difference from pre-treatment.** significant difference from pre-treatment and post-treatment table 3table 3.pain threshold latency (seconds) of the groupsplacebo1 cm15 cmpre-treatment22.4 7.425.2 10.725.2 7.6treatment39.5 11.6*30.9 8.945.8 11.8**post-treatment36.3 13.0*25.5 7.732.0 12.9anova and post hoc newman-keuls.*significant difference from the placebo group at pre-treatment.** significant difference between the 15 cm group and placebo group shows the results of the pain threshold latency times of the groups. during the treatment, the 1 cm electrode group showed a longer pain threshold latency than the other two groups. after treatment the tens groups (1 cm and 15 cm) electrodes showed pain threshold latencies longer than the placebo group.*significant difference between the 15 cm group and placebo group the effect size (cohen s d) with 1 cm electrodes was d=0.98 pain and of 15 cm was d=0.88 for the pain threshold latency time and respectively d= 0.96 and d=0.91 post-treatment pain threshold latency time. to induce experimental pain without causing tissue injury we used a model called the cold pressure test, also known as the cold-induced pain test. in this model pain is induced through local hypothermia, since low temperatures (04c) cause to painful sensations through both vasoconstriction11, 12 and the activation of thermal nociceptors (a- and c fibers) that signal potential tissue damage. this information is sent via the peripheral and central pathways to the somatosensory cortex11. this information of pain has different representations in the cerebral cortex, a sensory version and a psychological one, that might be interpreted in this experiment as the pain threshold latency and pain intensity, respectively13. this is due to the characteristics of electric current, that has low frequency and high intensity, activating the supra-segmental pathways of -endorphin and met-enkephalin14. we found that the low frequency, high intensity tens was bearable, and prolonged the pain threshold latency in the acute phase, and that prolongation of the pain threshold latency was dependent on the size of the electrode. a previous study15 demonstrated that analgesia of 80 hz tens for pain induced by mechanical which was measured subjectively by subjects pressure was by increasing the intensity of electrical current. the frequency and pulse duration are also parameters that influence analgesia16. in our study, it was found that the size of the electrode and its location affected analgesia. initially, a high threshold of stimulation was required for both electrodes at the respective coupled acupoints, that are distal from the muscular motor points of the forearm, and required high intensities to promote muscle twitch and sting sensation. a functional magnetic resonance imaging study of healthy subjects subjected to cold-induced pain, and demonstrated that the periaqueductal gray, the superior frontal gyrus, anterior cingulate cortex, thalamus, left insula, right inferior frontal gyrus and left inferior temporal gyrus were activated17. these structures are related to the perception of the pain threshold, but not pain intensity. these structures are also activated when stimuli acupoints, by needles or by transcutaneous electrical current18. as the action of acupuncture-like tens with 10 hz was relatively rapid at prolonging the pain threshold latency, during or after application, it suggests that it acts directly on a- and c fiber, promoting action potentials in them. this would have served as a mechanism of segment concurrence, which is usually seen as fibers a- mediating the stimulation of high frequency tens. when the painful stimulus of low temperature triggered the a- and c fibers they were already receiving electrical stimulus, leaving them less responsive to the cold stimulus. its influence on the pain threshold latency during and after tens application, may be due the concentration of the stimulus in the receptive field of the nerve endings being stimulated by electrical current, the smaller electrode focused on the acupoints, while the larger electrodes encompassed this area and most of the surrounding regions. these acupoints are stimulated by needles, classically, and they have a large concentration of mechanical stimuli in their areas. studies have shown that acupoints located in the areas of dermatomes, myotomes and sclerotomes which are pain afferents, are more effective than acupoints which are distant from them18, 19. in the placebo group, which received no electrical stimulation, no statistical differences were observed among the pre-, and during-, and post-treatment periods. table 3 compares the pain threshold latencies of the groups. during tens treatment, the 1 cm electrode group showed significant differences from the other two groups. this result corroborates the hypothesis that the concentration of eletrical stimulus in a small area is more effective than that over larger areas. acupuncture points have intrinsic neuronal properties, as well as increased conductance, low impedance, and high electric potential compared to other locations. it has been suggested that the meridians are more a functional concept than anatomical, a multiple system incorporating the physiological, neurological, endocrine and immune systems9. the values show that the 1 cm electrode group showed a reduction in pain intensity during the tens treatment compared to pretreatment, while the 15 cm electrode group showed an increase in pain compared to pretreatment. as mentioned above, the pain threshold latency and pain intensity are mediated differently by the central nervous system11. another study14 applied tens to the li4 (he-gu) and pc6 (neiguan) acupoints of subjects submitted to cold-induced pain with a current intensity of 3 ma, pulse duration of 300 s and frequency of 4 hz, and noted a reduction in pain intensity relative to a placebo group over periods of 30 to 170 seconds of cold-induced pain. some other studies1, 20 have also reported significant changes in pain intensity with electroanalgesia, while, others11, 21, 22 have reported that the intensity of pain showed no significant change with the use of tens. items that differed in these works were the experimental pain models, parameters of electrical stimulation, location of the electrodes and the number of subjects involved in each experiment, as well as the recruitment and randomization methods. another controversial point is the measurement of pain using the visual analog scale since, even though it is widely used and accepted, its results tend to be contradictory. the 15 cm electrode group showed an increase in the sensation of pain intensity, rather than a reduction, during the tens treatment, but there was no significant difference in the timeof the pain threshold latency. in the case of the 1 cm electrode, the result was consistent. the intensity of pain is subjective measure which depends on the interpretation and previous experience of each individual. this may cause some confusion at the time of assessment, making it impossible to compare the results of pain intensity between groups. we suggest that as well as the measurement of pain intensity using the vas scale, some objective form of measurement is also used, such as the pain threshold latency, measurement of the conduction velocity of nociceptive fibers. the effect size, as calculated by cohen s d, of the 1 cm electrode group showed a percentage ranging from 88% to 98% when compared to the other groups, indicating that the 1-cm group, during the tens treatment, had this percentage of individuals with higher values than their respective control. at post-treatment the percentage was 9196% compared to the placebo group. this demonstrates there was a clinically significant difference between the 1 cm group and the placebo group. in the literature, we could find no other references reporting statistically significant results for this type of treatment. our findings support the view that acupuncture-like tens at 10 hz frequency, applied to pc6 and te5 acupoints with the parameters described above, increases the pain threshold latency during tens treatment with 1 cm electrodes and post-treatment with 15 cm electrodes. the pain intensity was reduced during tens treatment when applied to the acupoints with an electrode area of 1 cm. the effect size calculations show that tens applied to these acupoints were clinically significant. the combination of acupuncture-like tens and acupoints is a treatment choice for acute pain in the hand region.

[ purpose] this study assesse the effect of low frequency transcutaneous electrical nerve stimulation (tens) of thete5 (waiguan) and pc6 (neiguan) acupoints on cold-induced pain. [subjects and methods] forty-eight subjects were divided by convenience into three groups: tens with electrodes of 1 cm2 area, tens with electrodes of area 15 cm2 and a placebo group. the study consisted of three phases: cold-induced pain without electroanalgesia, cold-induced pain with electroanalgesia or placebo, and cold-induced pain post-electroanalgesia or placebo. [results] acupuncture like tens increased the pain threshold latency during treatment (45.7 11.7s) compared to pre-treatment (30.9 8.9s) in the tens group with 1 cm2 electrodes. in the tens group with 15 cm2 electrodes, the pain threshold latency increased at post-treatment (36.2 12.9s) compared to pre-treatment (25.5 7.4s). the placebo group showed no significant changes. the group with 1 cm2 electrodes showed a significantly higher pain threshold latency (45.7 11.7s) than the other two groups. at post-treatment, the pain threshold latencies of both the 1 cm2 (39.4 11.5s) and 15 cm2 (36.2 12.9s) tens group were higher than that of the placebo group (22.4 7.4s). [conclusion] acupuncture like tens applied to pc6 and te5 acupoints increased the pain threshold latency. the pain intensity was reduced by tens with an electrode area of 1 cm2.

PMC4755978

pubmed-534

tetralogy of fallot (tof) is the most common form of cyanotic congenital heart disease. impairment in exercise tolerance after total repair of tetralogy of fallot has been frequently reported and speculated to be due to variable causes including residual right ventricular outflow tract (rvot) obstruction, branch pulmonary artery stenosis, pulmonary insufficiency, pulmonary pathology, and chronotropic incompetence. pulmonary regurgitation (pr) has been shown to be related to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus. adverse effects of pr include progressive dilatation of rv, reduced exercise capacity, arrhythmia, and sudden death. a number of children have premature ventricular beats after repair of the tetralogy of fallot. these beats are of concern in patients with residual hemodynamic abnormalities; 24-hr electrocardiographic (holter) monitoring studies should be performed to be certain that occult short episodes of ventricular tachycardia are not occurring. exercise studies may be useful in provoking cardiac arrhythmias that are not apparent at rest. the aim of this study was to assess the exercise performance of young patients following the repair of tetralogy of fallot and to assess the influence of different variables related to the surgical repair on exercise testing. this study was carried out at the children's hospital, pediatric cardiology department, ain shams university in the period from march 2008 to february 2010. it included 21 patients operated on for tetralogy of fallot compared to 15 healthy age- and sex-matched children. all patients underwent total correction for tof at ages ranging between 2 and 10 years. total correction was performed by closing the vsd and reconstruction of the rvot via either transatrial-transpulmonary or right ventriculotomy approaches. all patients were subjected to twelve-lead ecg to comment on rate, rhythm, p wave, axis, qrs duration, bundle branch block, and chamber enlargement. m mode, two-dimensional, and color doppler echocardiographic examination using ge health care ultrasound vivid 7 was done for all patients to comment on pulmonary valve regurgitation or residual stenosis, branch pulmonary arteries, right ventricular size, and function, residual vsd and leak across, movement of ivs, left ventricular function, and other associated cardiac anomalies. exercise stress testing was performed by using a schiller mtm-1500 treadmill using the modified bruce protocol. the resting ecgs of all patients revealed normal sinus rhythm and rbbb, 16 patients with complete rbbb, and 5 patients with incomplete rbbb. qrs durations were prolonged but less than 180 msec in 19 patients, and more than 180 msec in only 1 patient. echocardiographic examination showed variable degrees of pulmonary regurge in 20 patients (95%); severe pr in 12 patients, moderate pr in 2 patients, and mild pr in 6 patients. there was abnormal right ventricular dilation in 5 patients (23.8%) detected by 2d echo. residual vsd was detected in 2 patients and branch pulmonary artery stenosis in 5 patients. three patients (14.2%) developed exercise-induced uniform infrequent pvcs during stress testing. sustained ventricular tachycardia was not detected in any patient. while infrequent pvcs developed in 2 control subjects (13.3%). only one patient (4.7%) of the study group developed exercise-induced complete heart block (chb) as detected by stress testing. there was no statistical significant difference between cases and control as regards the work time. cases showed lower work stage and time, but the difference did not reach a significant level p=0.10, 0.22. while they showed significantly lower max sbp, max hr, max mets, and% of mets when compared to control p<0.05 as shown in table 1. cases with aortopulmonary shunt showed significantly lower work time, work stage, and max mets when compared with those without aortopulmonary shunt p<0.05. as shown in table 2. surgical correction of tof is directed at relieving all possible sources of right ventricular outflow tract obstruction. if anatomically and surgically possible, pulmonary valve function is preserved by avoiding a transannular patch. palliative aortopulmonary shunt procedures are performed prior to total correction to increase pulmonary blood flow in severely cyanotic infants. numerous 20 to 30 years follow-up studies have documented the excellent clinical results of surgical repair of tof. however, the nature of the repair leaves each patient with some degree of excessive hemodynamic burden because of residual defects, valvular abnormalities, or myocardial factors. resting ecgs of all patients revealed normal sinus rhythm and rbbb, 16 patients with complete rbbb, and 5 patients with incomplete rbbb, whereas no conduction disturbances were shown in the control group. this was in accordance to sarubbi et al. who assessed the exercise capacity in young patients after total repair of fallot tetralogy and found that all the patients presented complete rbbb, whereas no conductance disturbances were shown in the control group. patients with repaired tof frequently have right bundle-branch block with greatly prolonged qrs duration, usually attributed to the effects of cardiac surgery and this electric abnormality has been recognized not only as a risk factor for sudden cardiac death in these patients but also as a contributor to rv dysfunction. in our study pulmonary regurgitation was observed in 20 patients (95%), 12 of them (57%) had severe pr and 8 (38%) had mild-to-moderate pr. this is in accordance to eyskens et al. who found that all patients had variable degrees of pulmonary regurgitation on standard echocardiography after total correction of tof. pulmonary regurgitation has been attributed to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus. adverse effects of pr include progressive dilatation of rv, reduced exercise capacity, arrhythmia and sudden death. our study showed no statistical significant difference between cases and control as regards the work time. cases showed lower work stage and time but the difference did not reach a significant level. the maximal work time served as a criterion of exercise capacity when maximum o2 consumption can not be measured. this result showed that exercise capacity in patients undergoing surgical repair was generally good as compared with matched control subjects. this was in accordance to pietrucha and rudzinski who assessed the exercise capacity in 23 patients after surgical correction of tof (21 males and two female) with mean age 14.9 2.9 years and 27 patients without any cardiac disorder (19 boys, 8 girls) age- and sex-matched and found that workload achieved by patients after tetralogy of fallot correction was comparable to healthy subjects. found that intermediate-term exercise performance in patients who underwent primary complete repair of tof in early childhood was nearly normal. several previous studies observed an association between pulmonary regurgitation and exercise impairment in the form of decreased exercise time, vo2 max and maximum achieved mets when compared with normal control subjects during exercise stress testing. in our study, this relationship was not detected. however, our results are similar to samman et al. who were unable to demonstrate a relationship between the degree of pulmonary regurgitation and exercise capacity in patients with repaired tetralogy of fallot and ascribed these contradictory finding to the different methods used to measure the degree of pulmonary regurgitation in these studies in comparison with their study. also our results are in accordance to geva et al. who found that pr degree. found no correlation between the presence or degree of pulmonary regurgitation and its effect on exercise capacity after tof repair. as shown in our study, there was no relation between the degree of pulmonary regurge and the exercise capacity in short term followup. as impaired exercise tolerance after tof repair as detected by exercise stress testing (decreased work time, work stage, max hr, and max achieved mets when compared with control subjects) is multifactorial in origin; patients with severe pulmonary regurge may have cardiovascular compensation with good chronotropic response to exercise while those with mild or no pr may have other causes that impair their exercise tolerance as chronotropic incompetence and lack of physical fitness. in the present study, cases with previous aortopulmonary shunt showed significantly lower exercise indices when compared to those without previous aortopulmonary shunt. study who found that prior aortopulmonary shunt procedures were not associated with reduced exercise performance after tof repair. impaired exercise performance in the patients with previous aortopulmonary shunts might be due to sever tof that necessitated the performance of a shunt. moreover, palliation by means of an aortopulmonary shunts that had been initially performed, leading to changes in the pulmonary vascular system, which is pathologically altered and can in turn, negatively affect exercise capacity. we discovered that only one patient (4.7%) of our study group developed exercise-induced complete heart block (chb) as detected by stress testing. the chb revealed by his exercise test probably contributed to the growth impairment of that child. exercise tolerance after total correction of fallot tetralogy is slightly impaired on short-term followup. thus abnormal cardiac function and haemodynamic abnormalities secondary to pr and residual defects appear after longer periods of followup. patients with previous aortopulmonary shunts showed lower exercise performance when compared to those without previous aortopulmonary shunt. the present study did not reveal any serious ventricular arrhythmias since it is seen in those patients with the longest period of follow up. postoperative exercise testing in patients with tof can unmask a complete heart block that was not elicited by the standard 12-lead ecg recording.

tetralogy of fallot (tof) is the most common form of cyanotic congenital heart disease. the aim of this study was to examine the exercise performance of young patients following the repair of tof and to assess the influence of different variables related to the surgical repair on exercise testing. this study was conducted on 21 patients (16 males and 5 females) operated on for tof compared to 15 healthy age- and sex-matched control children. the patients ' median age at time of the study was 8 years (range 513 years) while age at surgical repair was 5 2.1 years (range 210 years). patients were subjected to 2d and color doppler echocardiographic examination. treadmill exercise stress testing was performed for all subjects according to modified bruce protocol. the resting ecgs of all patients revealed normal sinus rhythm and rbbb. cases had lower exercise capacity when compared to control subjects and those with aortopulmonary shunt showed significantly lower exercise performance when compared to those without aortopulmonary shunt. in conclusions, exercise tolerance after total correction of tof is slightly impaired on short-term followup with more affection among patients with previous aortopulmonary shunts. the present study did not reveal any serious ventricular arrhythmia.

PMC3438750

pubmed-535

since its original description by mc burney in 1894, appendectomy has been one of the most common surgical procedures performed by surgeons. in the last decades, laparoscopic appendectomy was an increasingly accepted treatment method for acute appendicitis, particularly for obese or female patients. natural orifice transluminal endoscopic surgery (notes) is a new approach that allows for minimal invasive surgery through the natural orifices such as mouth, anus, or vagina. less incision on the abdomen helps to reduce surgical pain, analgesic requirement, recovery time, hernia formation, intra-abdominal adhesion, and surgical site infection. however, notes has several disadvantages and limitations with the currently available instruments, including limited access and less familiar working angles and operative views. in the past few years this study aimed to summarize the recent clinical appraisals, feasibility, complications, and limitations of transvaginal appendectomy for humans and to outline techniques. electronic searches in december 2013 of the pubmed/medline, cochrane, google scholar, and ebscohost-academic search complete, including cinahl, used the key words [(vaginal or transvaginal) and (appendectomy or appendectomies or appendicectomy or appendicectomies)]. all the studies including congress proceedings and abstracts that describe the clinical course of patients were accepted for the analysis. two reviewers (mehmet ali yagci and cuneyt kayaalp) assessed the list of titles and/or abstracts of the scanned articles at pubmed/medline and cochrane using the key words in a function of [all fields]. if the articles met our inclusion criteria, full-text versions were obtained for assessment. if the articles were obviously irrelevant to the aim of this systematic review, they were excluded. additional studies were also excluded due to their content (editorial letters, reviews, experimental studies, duplicated studies, technical notes not including patient data, and survey studies including questionnaires). after pubmed and cochrane searches, we scanned the ebscohost-academic search complete and google scholar databases with the same key words but using the [title] function. if any additional studies were found, they were added to the first search results. the unpublished, potentially relevant, trials at the registered trials database at https://www.clinicaltrials.gov/ were searched as well. the references of the selected relevant articles were cross checked to decrease the possibility of missing publications. transvaginal appendectomy was defined as a way of natural orifice translumenal endoscopic surgery for the appendix. all the patients were included, irrespective of age, region, race, obesity, comorbidities, or history of previous surgery. no restrictions were made on language, country, or journal. in cases of disagreement during the study selection and analysis data for affiliation, number of the patients, age, clinical findings, inclusion and exclusion criteria, body mass index, history of previous abdominal surgery, trocar sites (pure or hybrid) and types, scope site and types (flexible or rigid), vaginal access and colpotomy closure techniques, intraoperative and postoperative complications, operating time, conversion to conventional laparoscopy or open surgery, postoperative pain, length of hospital stay, time off work, long term sexual function, and cosmetic satisfaction were recorded. a computer program including spreadsheet was used for records (excel 2013, microsoft windows). if there were any missing data, we tried to contact the authors via e-mail. data were tabulated in tables, and column sums were created with the numbers or the means standard deviations, or the ranges of relevant parameters. when studies reported the median and range, we estimated the mean and standard deviation using the method described by hozo et al.. basic calculations were used for the total numbers of the dichotomous outcomes and weighted means with ranges for the continuous outcomes. chi-square test or the fisher exact test (if expected values were less than 5) and student's t-test were used for statistical analysis of both dichotomous and continuous variables (spss 13.0). a total of 154 articles were retrieved from the pubmed/medline database and no additional study was available in the cochrane library. after the elimination of the 96 irrelevant studies, google scholar, ebscohost-academic search complete, https://www.clinicaltrials.gov/, and reference cross-checking defined 26, 17, 6, and 2 studies, respectively (figure 1). after the elimination of repetitive studies in several databases or sources, seven studies were added to the previously selected 58 articles. studies including inadequate patient data, concomitant hysterectomy, experimental studies, and duplicated data were eliminated and finally 13 articles [315] were selected for the analysis (figure 1). two studies [10, 11] belonged to the same clinical series and their data were complementary (early and late results). as a result, we analyzed 12 clinical studies contained in 13 articles. some studies had duplicated results [1622] and their latest or the most comprehensive versions were accepted for the analysis [6, 1013]. there were a total of 112 transvaginal appendectomies. studies originated in europe, north/south america, and asia, and two of them included international multicenter data [6, 13]. publications were generally (11/13) in english but one was in german, and one was in japanese. the patients ' ages were generally in the mid-twenties or mid-thirties; however, there was a large age range (1874 years). all the patients were in the american society of anesthesia (asa) i-ii scores. a diagnosis of complicated appendicitis (perforation, abscess, and mass) was usually an exclusion criterion. kg/m) were also excluded, and the mean body mass index of the patients in this systematic review was 23.2 kg/m (table 2) [4, 79, 13, 14]. previous abdominal or pelvic surgery was not an exclusion criterion in all studies and 11% of the patients had a history of abdominal or pelvic surgery [9, 15]. most of the cases (96%) were of acute appendicitis, while others (4%) were chronic appendicitis or incidental appendectomies. four of them were intraoperative complications: appendicular artery hemorrhage (n: 3) and inability to sustain the pneumoperitoneum (n: 1). those cases required additional abdominal trocar access and were accepted as a conversion to conventional laparoscopy (3.6%), but no case required conversion to open surgery. postoperative complications occurred in five patients and all were treated by nonsurgical methods (table 3). intra-abdominal abscess, urinary retention, urinary infection, and dyspareunia were treated by percutaneous drainage plus antibiotics, foley catheter placement, antibiotics, and just waiting, respectively. the mean length of hospital stay was longer in the german series (3.4 days) because of their national health system, [3, 9], and the mean length of hospital stay was 1.25 days for the rest of the studies. some studies used only the transvaginal access, called a pure or totally transvaginal appendectomy. others used an abdominal assistance (usually a 5 mm umbilical trocar) to the transvaginal access and are called a hybrid technique (table 4). pure transvaginal appendectomy was performed on only 22% of the cases and the remaining were hybrid procedures (78%). when we compared the operating time and the complications for both techniques, there were no differences. the operating times for pure [4, 10] and hybrid [5, 9, 1215] techniques were 48.3 11.8 minutes and 49.6 25.5 minutes, respectively (p=0.83). complication rates for pure [3, 4, 10] and hybrid [5, 79, 1215] techniques were 19.0% and 5.5%, respectively (p=0.09). some authors used flexible endoscopes (20%) and others preferred rigid laparoscopes (80%). operating times with flexible endoscopes [4, 5, 12, 13] and rigid laparoscopes [9, 10, 1315] were 71.9 13.3 minutes and 45.2 21.6 minutes, respectively (p=0.0007). complication rates for using flexible [35, 8, 12, 13] and rigid [7, 9, 10, 1315] scopes were 0% and 11.4%, respectively (p=0.33). transvaginal appendectomy during vaginal hysterectomy was first described in 1949 and, at the time, was performed by the gynecologists with the aim of incidental appendectomy [6, 23]. those studies did not include the acute appendicitis cases and their primary objectives were the treatment of gynecological pathologies, not the appendix. in 2008, the first transvaginal appendectomy without vaginal hysterectomy was reported by palanivelu and coworkers from india and after a short period of time three more cases were reported one from germany and two from georgia. interestingly, these first three separate reports of transvaginal appendectomies all described the totally transvaginal (pure) technique using only an endoscope [3, 4, 22]. in those cases, there was no abdominal trocar for assistance, nor was there any other transvaginal equipment except endoscopes. transection of the appendixes was done with scissors [3, 4] or snares through the endoscopic channels. all the specimens were removed with the help of the endoscope and no extraction bags were used. reported that, before the first successful case, they experienced three prior conversions to conventional laparoscopic appendectomy due to technical difficulties with this pure endoscopic technique. bernhardt et al. used the same technique and reported that their case was not an acute appendicitis, but a recurring subacute appendicitis. we can conclude that, despite its minimal invasiveness, technical difficulties limit the application of the pure transvaginal technique to highly selected cases. but for now, this analysis revealed that this earliest described transvaginal appendectomy technique was the least commonly preferred one relative to others subsequently described. another technique for pure transvaginal appendectomy was reported using the placement of a single incision laparoscopic surgery (sils) port into the incised posterior vaginal fornix. the authors preferred a 5 mm 30 rigid telescope and two working ports (5 mm and 12 mm) on the sils port. they divided the mesoappendix with a stapler or an energy device and the appendix was likewise divided with an endoscopic stapler. they reported almost half the operating time (mean 44.4 minutes) of the previously described endoscope-only pure transvaginal appendectomy. although this new technique seemed more adaptable to daily surgical practice, the authors warned that the sils port was inadequate as it was too short, which made placement difficult. they concluded that there was still room for innovation in the development of the technique. this analysis pointed out that hybrid procedures with umbilical port assistances were more common (72%) than the pure transvaginal techniques. hybrid techniques had some advantages over pure ones, such as safer transvaginal introduction under direct vision, transumbilical view when necessary, and two directional working in the abdominal cavity. a hybrid procedure was started with pneumoperitoneum via a veress needle at the umbilicus and a 5 mm trocar was inserted via the umbilicus to inspect the abdominal cavity. after that a vaginal trocar (1015 mm) was placed at the posterior fornix of the vagina. an additional working port was created in three different ways in the studies: (i) the channel of the laparoscope was used; (ii) a second 5 mm trocar was inserted from the posterior fornix; or (iii) a second 2.3 mm trocar was placed through the umbilicus. using a flexible endoscope instead of no clear benefits of flexible endoscopes over the rigid scopes were seen in this systematic analysis. transferring the surgeons from open surgery to laparoscopic surgery provided the patients with a more comfortable postoperative course and a more rapid recovery. however, its benefits on postoperative pain and patient recovery were not as amazing as in the previous transfer from open to laparoscopy. a recent meta-analysis found no difference on postoperative pain and length of hospital stay between the single port and the multiport laparoscopic appendectomies. natural orifice surgery is a novel technique that can have a positive influence on postoperative pain and recovery. an important drawback of this technique may be the unfamiliarity of the access to the abdomen for surgeons who are generally familiar with abdominal incisions or transanal surgeries. a second point that may keep surgeons away from this technique this systematic review demonstrated that, from the technical point of view, the equipment required for transvaginal appendectomy was not too distinct from the well-known existing conventional laparoscopic appendectomy equipment. there was no need for special equipment such as long trocars or flexible endoscopes. only two studies compared the results of transvaginal and conventional laparoscopic appendectomies [9, 10]. despite the limited number of the patients in those studies, there was a trend towards shorter hospital stays [9, 10], quicker recovery, and less analgesic requirement for the transvaginal groups (table 5). recent meta-analyses including thousands of conventional laparoscopic appendectomies demonstrated that the wound infection rate was 3.34% and the length of hospital stay was 1.92.9 days [24, 25]. when compared to those results, this systematic review demonstrated that transvaginal appendectomy can be a rational alternative to conventional laparoscopic appendectomy in selected patients. it has very low wound infection rates (zero in this study) and short hospital stays (mean 1.9 days). today first, there is not enough data of this technique for the morbidly obese patients. there is a considerable amount of obese people in the western countries and transvaginal appendectomy studies are necessary including morbid obese patients. we believe that minimal invasive surgeries like transvaginal appendectomy can have a place for the morbid obese patients in future. secondly, the risk of delving into the cultural sensitivity of using the vagina as an access point, particularly in third world countries can be a limitation. this can be a problem even in the most promiscuous cultures where virginity still runs some amount of the population. as a conclusion, appendectomy is one of the most common emergency visceral surgical procedures. the early results of transvaginal appendectomy in this systematic review show some promise for improved postoperative pain and patient recovery. using hybrid techniques with rigid laparoscopes may provide an easier adaptation for surgeons to this novel appendectomy method. for now, transvaginal appendectomy looks suitable for nonmorbid obese patients (bmi<35) and noncomplicated appendicitis. of course, its potential advantages and disadvantages will become clearer in the future with comparative studies. more studies are also necessary on the role of transvaginal appendectomy in some subgroups like morbidly obese patients or perforated appendicitis.

background. natural orifice transluminal endoscopic surgery (notes) is a new approach that allows minimal invasive surgery through the mouth, anus, or vagina. objective. to summarize the recent clinical appraisal, feasibility, complications, and limitations of transvaginal appendectomy for humans and outline the techniques. data sources. pubmed/medline, cochrane, google-scholar, ebsco, clinicaltrials.gov and congress abstracts, were searched. study selection. all related reports were included, irrespective of age, region, race, obesity, comorbidities or history of previous surgery. no restrictions were made in terms of language, country or journal. main outcome measures. patient selection criteria, surgical techniques, and results. results. there were total 112 transvaginal appendectomies. all the selected patients had uncomplicated appendicitis and there were no morbidly obese patients. there was no standard surgical technique for transvaginal appendectomy. mean operating time was 53.3 minutes (25130 minutes). conversion and complication rates were 3.6% and 8.2%, respectively. mean length of hospital stay was 1.9 days. limitations. there are a limited number of comparative studies and an absence of randomized studies. conclusions. for now, nonmorbidly obese females with noncomplicated appendicitis can be a candidate for transvaginal appendectomy. it may decrease postoperative pain and enable the return to normal life and work off time. more comparative studies including subgroups are necessary.

PMC4295586

pubmed-536

dipeptidyl peptidase4 (dpp4) inhibitors improve glycemic control in patients with type 2 diabetes by preventing degradation of two incretin hormones, glucagonlike peptide1 (glp1) and glucosedependent insulinotropic polypeptide (gip), that are secreted from the intestine on ingestion of various nutrients. recent studies have shown associations of dpp4 inhibitors efficacy with age and fasting plasma glucose levels, as well as baseline glycated hemoglobin (hba1c) and body mass index (bmi), but clinical parameters that predict the efficacy of dpp4 inhibitors are largely unknown. the present study showed that alterations in hba1c level on administration of dpp4 inhibitors as monotherapy are associated with estimated intake of fish, estimated intake of dietary n3 polyunsaturated fatty acid (pufa), and serum levels of eicosapentaenoic acid (epa) and docosahexaenoic acid (dha). the protocol was approved by the ethics committee of kansai electric power hospital, and carried out in accordance with the principles of the declaration of helsinki. a total of 72 untreated japanese patients with type 2 diabetes (the japan diabetes society criteria of 2010; age 64.6 11.3 years; duration of diabetes 9.0 8.9 years; baseline hba1c 7.2 0.7%; bmi 24.5 4.3 kg/m) who had been on diet and exercise therapies participated in the current study. dpp4 inhibitors (sitagliptin, alogliptin or vildagliptin) were given for 4 months and no other antidiabetic drugs were used during the period. a total of 59 patients received sitagliptin, 12 received alogliptin and one received vildagliptin. hba1c levels were determined before the initiation of dpp4 inhibitors and 4 months after the initiation of dpp4 inhibitors, and were shown in national glycohemoglobin standardization program values, as recommended by the japan diabetes society. fasting serum levels of dha, epa and arachidonic acid (aa) were determined based on fatty acid composition of total lipids including phospholipids, triglycerides and cholesteryl esters in the serum of 20 patients (age 63.1 11.7 years; duration of diabetes 6.7 5.7 years; baseline hba1c 7.0 0.8%; bmi 24.2 3.1 kg/m) before initiation of dpp4 inhibitors. selfadministered 3day food records, which were recorded during the 4month period, were analyzed for estimated intake of various nutrients using healthy maker pro 501 (mushroomsoft co., ltd., all statistical calculations were carried out using pasw statistics 18 (sas institute inc., cary, nc, usa), including linear regression analyses of the associations between changes in hba1c levels and various parameters. multiple linear regression analyses were carried out to identify the parameters potentially associated with hba1c reduction, and simple regression analyses were carried out to evaluate their contributions. in the present study, dpp4 inhibitors, similarly to previous reports, significantly reduced hba1c levels, but not bodyweight (before initiation of dpp4 inhibitors 7.2 0.7%; 4 months after initiation of dpp4 inhibitors 6.7 0.6% [paired ttest, p<0.01 vs before]). multiple regression analysis of hba1c reduction (hba1c) taking into account sex, age, duration of diabetes, bmi, baseline hba1c and estimated intake of various food categories in 3day food records showed that hba1c was well correlated with baseline hba1c, but not with bmi (table 1). hba1c also showed a significant association with estimated intake of fish and seafood in the food records (figure 1a and table 1). among fish and seafood, estimated intake of fish, but not shellfish and other seafood, showed a significant association with hba1c (table s1). the beneficial effects of fish on human health have been partly attributed to pufa, such as epa and dha. hba1c was significantly correlated with estimated intake of epa and dha, along with baseline hba1c (figure 1b and table s2). as serum epa and dha levels might serve as markers for intake of corresponding fatty acids (figure s1), we analyzed associations of hba1c with serum epa and dha levels. serum levels of epa and dha, but not n6 pufa arachidonic acid, were well correlated with hba1c (figure 1c). although hba1c reduction showed a significant association with estimated intake of milk products (table 1), we were unable to find nutrients in milk products, including saturated fatty acids, that were responsible for the association. multiple regression analysis regarding changes of glycated hemoglobin (hba1c) levels (hba1c) by taking into account sex, age, duration of diabetes, body mass index (bmi), baseline hba1c (national glycohemoglobin standardization program [ngsp ]) and estimated intake of various food categories in 3day food records in 72 patients with type 2 diabetes. statistical calculation was carried out using pasw statistics 18 (sas institute inc.). b and denote nonstandardized and standardized regression coefficients, respectively. for analysis of changes of hba1c levels, the correlation coefficient squared (r) was 0.550 and the fvalue with 15 degrees of freedom was 3.499 for a pvalue of 0.003. (a) correlation between estimated intake of fish and seafood with glycated hemoglobin (hba1c) reduction (national glycohemoglobin standardization program [ngsp], %) 4 months after initiation of dipeptidyl peptidase4 inhibitors (hba1c; n=72). (b) correlation between estimated intake of eicosapentaenoic acid (epa), docosahexaenoic (dha) with hba1c (n=72). (c) correlation between serum levels of epa, dha and arachidonic acid (aa) with hba1c (n=20). linear regression analyses were carried out to calculate the correlation coefficient (r) and pvalues. we find that changes of hba1c levels on administration of dpp4 inhibitors are associated with estimated intake of fish and estimated intake of dietary n3 pufa, as well as serum epa and dha levels. despite being a retrospective cohort study with a limited sample size, these findings are clinically important in two respects: (i) the efficacy of dpp4 inhibitors can be predicted by serum epa and dha levels; and (ii) consuming more fish with diet therapy can enhance the efficacy of dpp4 inhibitors. furthermore, the current findings suggest that the differing efficacies of dpp4 inhibitors found among different ethnicities might be partly a result of differences in fish consumption. although many studies have shown the beneficial effects of dietary n3 pufa from fish, the mechanisms involving dietary n3 pufa in dpp4 inhibitor efficacy have not yet been investigated. although epa and dha have been shown to prevent excessive adiposity, thereby ameliorating insulin resistance in animal models, the effects of n3 pufa on glycemic control in type 2 diabetes itself are somewhat controversial. interestingly, it has been found that epa and dha enhance glp1 secretion, possibly through free fatty acid receptors, such as gpr120, in glp1secreting cells and mice. it is thus possible that dietary n3 pufa and dpp4 inhibitors synergistically increase biologicallyactive glp1 levels to facilitate maintenance of glycemic control, but it remains to be determined whether epa and dha enhance glp1 secretion in patients with type 2 diabetes. in addition, whether the present findings hold true for dpp4 inhibitors in general is not known, as most of the patients in the current study received sitagliptin or alogliptin, and vildagliptin patients were limited. we find that the reduction of hba1c by dpp4 inhibitors significantly correlates with estimated intake of fish, estimated intake of epa and dha, and serum levels of epa and dha. figure s1 correlation between estimated intakesand serum concentrations of eicosapentaenoic acid (epa) anddocosahexaenoic (dha; n=16). table s1 association of glycated hemoglobin(hba1c) reduction and estimated intake of fish, shellfish and other seafood table s2 association of glycated hemoglobin(hba1c) reduction and estimated intake ofpolyunsaturated fatty acids click here for additional data file.

abstractthis study was initiated to identify clinical and dietary parameters that predict efficacy of dipeptidyl peptidase4 inhibitors. a total of 72 untreated japanese patients with type 2 diabetes who received dpp4 inhibitors (sitagliptin, alogliptin or vildagliptin) for 4 months were examined for changes of glycated hemoglobin (hba1c) and body mass index (bmi), and selfadministered 3day food records, as well as serum levels of eicosapentaenoic acid (epa) and docosahexaenoic acid (dha). dpp4 inhibitors significantly reduced hba1c (before initiation of dpp4 inhibitors 7.2 0.7%, 4 months after initiation of dpp4 inhibitors 6.7 0.6% [paired ttest, p<0.01 vs before]). multiple regression analysis showed that changes of hba1c were significantly correlated with baseline hba1c, as well as estimated intake of fish. furthermore, changes of hba1c were significantly correlated with serum levels of epa (r=0.624, p<0.01) and dha (r=0.577, p<0.01). hba1c reduction by dpp4 inhibitors is significantly correlated with estimated intake of fish and serum levels of epa and dha. (j diabetes invest, doi: 10.1111/j.20401124.2012.00214.x, 2012 )

PMC4019247

pubmed-537

total joint replacement usually represents the final route for treatment of degenerative disease of the knee. joint replacements are more and more frequent and routine these days thanks to, for example, the consequent aging of the general population, increased functional requirements, and the development and use of new materials and more sophisticated surgical techniques. in this context, there is a need to develop new protocols for management and use of transfusion therapies in the field of orthopedic surgery. transfusion of homologous blood are frequent and costly and expose patients to potential risks of infection [1, 2]; hence several methods have been proposed to avoid them [3, 4]. preoperative blood donation and intra- and postoperative blood collection and administration of pharmaceutical agents to either reduce blood loss (e.g., tranexamic acid) or stimulate the production of erythrocytes (e.g., erythropoietin) have been proposed as alternative techniques to transfusion of homologous blood in various studies [3, 4]. in the scientific literature, there are several reports of studies where reinfusion of blood collection in postoperative orthopedic surgery, especially in prosthesis surgery [514], is analyzed. the aim of the present study was to verify the safety, the clinical efficacy, and the possible benefits of reinfusion of postoperatively collected autologous blood in total knee replacement procedures, with special emphasis on cost-benefit and reinfusion procedure, by comparing autologous blood transfusion with nonautologous blood transfusion. between 2011 and 2012, one hundred twenty-four patients with a mean age of 71.2 6.8 years and a range between 50 and 84 years were included in the study. the first group consisted of a series of sixty-four consecutive patients (male to female ratio 1: 5, range of age between 62 and 84 years), who underwent one stage unilateral total knee arthroplasty using a blood reinfusion device in 2012. fifty-eight of these patients received autologous transfusion and six patients were excluded, five due to systemic pathologies. the control group consisted of sixty consecutive patients (male to female ratio 1: 3, age ranging from 50 to 79 years). this population was operated on consecutively in 2011 but is not subjected to autologous blood reinfusion because we have been using this device since january 1, 2012. before any study-related measures were taken all patients read and signed informed consent for any possible transfusion of homologous red blood cell and a specific consent for reinfusion, after adequate information on possible risks and benefits of both methods. the manuscript was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000; for this type of study formal consent is not required. antibiotic prophylaxis was obtained by administration of ceftriaxone 1 g intramuscular injection once daily and teicoplanin 800 mg intravenous injection once daily, 30 minutes before inducing anaesthesia. antithrombotic prophylaxis was obtained by administration of enoxaparin sodium 4,000 i.u. once daily by subcutaneous injection for 35 days, 12 hours before surgery; two patients had an urticarial reaction and therefore it has been replaced with fondaparinux sodium 2.5 mg once daily by subcutaneous injection for 35 days. patients were subjected to surgical intervention for unilateral primary arthroplasty knee, by implanting a zimmer's nexgen cemented prosthesis or how medical's triathlon prosthesis. surgery was carried out by the same surgeon on all patients; a standard surgical procedure was performed including a longitudinal medial skin incision and median parapatellar quadriceps splitting approach. limb ischemia was achieved through temporary leg loop tire located at the root of the limb and the tourniquet was deflated after the step of cementing. postoperative pain was controlled with paracetamol 100 ml/10 mg endovenous with a 4-hour minimum interval between each administration. bellovac abt is a drainage system for postoperative collection, filtration, and reinfusion of shed autologous blood. it consists of all components required for collection and reinfusion of one unit of shed autologous blood. the initial negative suction pressure is 90 mmhg (12 kpa), generating safe and efficient drainage. once the recovery of shed blood is completed (within<6 hours) the transfusion bag can be replaced with a collection bag for evacuation only, thus serving as a simple wound drainage (card system technical bellovac abt for drainage and the recovery of the blood postoperative manufacturer: astra tech ab, via cristoni, casalecchio di reno (bo)). for all patients, we decided that a homologous transfusion therapy was only indicated for haemoglobin values below 8 g/dl. the study group consisted of a series of sixty-four consecutive patients with mean age 73.3 5.7 years (14 males and 50 females), while the control group consisted of sixty consecutive patients with mean age 69 7.2 years (18 males and 42 females). we excluded patients with systemic pathologies such as uncompensated diabetes mellitus, cancer, severe cardiovascular pathologies, immunodepression, anticoagulating or antiaggregating therapy, coagulation disorders including deep venous thrombosis, and ongoing infections. we considered as discriminating factors hemoglobin values<12 g/dl for women and<14 g/dl for men. length of surgery was 2.24 0.38 hours in the study group versus 2.06 0.32 hours (p=0.17). hemoglobin values (hb; g/dl) were checked preoperatively, immediately after surgery, on the first day and the second day after the operation, and on discharge. they were later compared between groups. in the study group, patients were subjected to a microbiological culture of a blood sample (20 ml) from the bag of postoperative recovery, at the end of the procedure of reinfusion. in our hospital, the transfusion medicine unite has provided the following expense items: the cost of an autologous blood retransfusion system is around 68,00, while the costs of an allogenic blood transfusion, including cross-matching, delivery, and refrigerated storage, are stated to be 270. added costs of the postoperative drain and the abt system are 20 and 68, respectively. all data are presented as mean sd or median (iqr) as appropriate. groups were compared using the one-way anova or t-test for normally distributed data and the nonparametric kruskal-wallis or mann-whitney u test for non-normally distributed variables. the study group consisted of a series of sixty-four consecutive patients with mean age 73.3 5.7 years, 14 male and 50 female, while the control group consisted of sixty consecutive patients with mean age 69 7.2 years, 18 male and 42 female (p<0.05). the average body weight of the study group was 70.8 8.8 kg and 73.1 8.0 kg (p=0.43). in the study group, all the patients received autologous blood transfusion. in the first six hours 400 122.4 ml (min. 600) was collected and retransfused; within 24 hours there was 198.5 142.4 ml of blood drained in the drainage. in the control group, because of the intraoperative use of a tourniquet, intraoperative blood loss was negligible in both groups. we noticed a reduction rate of allogeneic blood transfusion between the study and the control group (10.3% versus 30%; p=0.08). six patients in the study group, four women and two men, were subjected to allogeneic transfusion, five patients received one unit of homologous blood between the second and fourth days postoperatively, and one patient received two units of homologous blood., we registered 18 patients who received homologous blood transfusion; each one had received a bag of homologous whole blood. the transfusion trigger in the abt group (n=6) was 7.5 0.1 g/dl, whereas that in the control group (n=18) was 7.3 0.2 g/dl (p=0.09). one unit of red blood cells can be expected to result in a hemoglobin increase of 1 g/dl in a typical adult. in the abt group we recorded an increase in hemoglobin equal to 0.7 0.3 (g/dl), after autologous transfusion. in this group we recorded an increase in hemoglobin equal to 1.3 0.2 (g/dl) (n=7 bags) versus 0.9 0.1 (g/dl) (n=18 bags) in the control group after homologous transfusion (p<0.01). therefore, we noticed a greater rise in hemoglobin after homologous transfusion in the group given reinfusion (figure 1). the tourniquet time was 1.13 0.27 hours in study group versus 1.04 0.27 hours in control group (p=0.36). in the study group the mean length of stay at the hospital (los) was 7.88 0.7 days, while it was 8.96 2.47 days for the control group (p=0.03). really, we did not find any significant difference for hemoglobin count between groups from admission to hospital discharge (table 1 and figure 2); as expected, we did not find any difference between groups considering the reduction in hemoglobin for study's time points (table 2 and figure 3). the results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the procedure of reinfusion were negative in all cases. in our study a total knee replacement surgical procedure, along with the complementary use of a device for postoperative collection and reinfusion of shed blood resulted in an average reduction of the length of hospital stay equal to 1.08 0.76 days (p=0.03 versus control). the cost of an autologous blood retransfusion system is around 68,00, while the costs of a allogeneic blood transfusion are stated to be 270, including cross-matching, delivery, and refrigerated storage. in the present study, 18 allogeneic transfusions were given in the no-drainage group, while 7 allogeneic transfusions were given in the abt group, at a cost of 4.860,00 and 1.890,00, respectively. the additional costs of the postoperative drain and the abt system were 20 and 68, respectively, in either group at a cost of 1.160,00 (n=58) and 4.352,00 (n=64). the average cost per patient turned out to be lower in the group receiving reinfusion (97.53 versus 103.79; p<0.01). primarily, autologous blood reduces the need for allogeneic blood transfusion; furthermore, it prevents the transmission of viral diseases (hepatitis c virus, hepatitis b virus, human immunodeficiency virus, and creutzfeldt-jacob virus), transfusion reactions, and transfusion errors [16, 17]. the main advantage of postoperative collection and reinfusion of shed blood is this method's simplicity; hence it finds its application in traumatized patients. however, its main disadvantage is the risk of contamination during blood collection [8, 18]. identify some possible complications of collection of red blood cells, such as nonimmunologic haemolysis, gas embolism, nonhaemolytic transfusion reaction, coagulopathies, contamination with drugs, the intraoperative use of washing solutions in the surgical site and infectious agents, cytokines, and other microaggregates. the risk of complications decreased due to improvement of techniques and practices as well as increased experience with autologous blood collection systems. cleveland clinic has performed a five-year retrospective study of complications, with both homologous and collected shed blood, noting that the incidence of complications with collected blood was around 0.027% compared to 0.14% of homologous blood. in our study the results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the reinfusion were negative in all cases. the purpose of collection of shed blood is to reduce or eliminate the need for homologous blood transfusion and the associated risk of infectious and noninfectious complications. during 2006, a meta-analysis of the recovery of red blood cells in adult elective surgery showed that recovery of blood could reduce the need for homologous blood transfusion. the use of recovered red blood cells has reduced the exposure to allogeneic blood by 39% with an average saving of 0.67 units per patient. in 2013 a meta-analysis proved that the use of a postoperative autotransfusion reinfusion system reduced significantly the demand for allogeneic blood transfusions. it also cut the number of patients who needed allogeneic blood transfusions and the cost of hospitalization after total knee arthroplasty. collection of blood in orthopedic surgery results in greater safety and efficacy [2426]. 94 cases have been studied but a power analysis of the study was not performed; however, we argue that the use of a device for autologous blood collection and washing results in an average reduction of 4 units of allogeneic blood and cost savings of an average of 406.84 dollars per patient. in the literature these authors suggest that autologous blood transfusion drains have no effect on the proportion of transfused patients in primary total knee arthroplasty [2834]. the postoperative hemoglobin levels, the length of hospital stay, and the adverse events are also comparable between groups. in our opinion autologous blood collection and reinfusion, by the use of postoperative systems, is a procedure that allows limiting the transfusion of homologous blood to patients undergoing tkr, improving the postoperative course from a psychophysical point of view and allowing an early transfer to rehabilitation unit. we noticed a reduction in allogenic blood transfusion between the study and the control group (10.3% versus 30%; p=0.08). reinfusion group patients also displayed a reduction in the length of stay in hospital by 1.08 0.76 days (p=0.03 versus control). concerning costs, the question is whether savings derived from the reduction in allogeneic blood transfusion requirements outweighed the extra costs of the abt system. zacharopoulos et al. stated that use of the postoperative blood reinfusion systems is highly effective in reducing the demand for homologous blood transfusion for patients undergoing total knee replacement surgery, resulting in important cost savings in the management of these patients. a previous study observing patients undergoing tka found net savings in different cost scenarios of 5 to 106 per patient with the same abt system as used in this study and 52 to 50 per patient with another abt system. a review of cost-effectiveness on blood-saving measures stated that cell salvage had lower costs compared with all of the alternative blood-saving strategies except acute normovolemic dilution and concluded that autotransfusion may be a cost-effective method to reduce allogeneic transfusions [37, 38]. the evidence that supports the use of red blood cell recovery in knee prosthesis is stronger and comprises randomized studies and one large retrospective review [39, 40]. the average cost per patient was found to be lower in the group receiving reinfusion (97.53 versus 103.79; p<0.01). this work presents a lot of strengths such as the same characteristics of the sample, the surgical technique performed by the same surgeon, and the rigorous cost analysis; on the contrary we are aware of some weaknesses such as the retrospective design. this study has confirmed the absolute safety of the device and the absence of bacteria in examined samples. our results emphasize the effectiveness of this procedure and have the characteristics of simplicity, low cost, easy reproducibility, and safety. in addition, this recovery system replaces the simple postoperative surgical drainage, representing a further saving of economic resources. finally we conclude that the use of the shed blood recovery system bellovac abt constitutes a valid device, which can find wide application in orthopedics, especially in the context of total knee replacement surgery.

surgeries for total knee replacement (tkr) are increasing and in this context there is a need to develop new protocols for management and use of blood transfusion therapy. autologous blood reduces the need for allogeneic blood transfusion and the aim of the present study was to verify the safety and the clinical efficacy. an observational retrospective study has been conducted on 124 patients, undergoing cemented total knee prosthesis replacement. observed population was stratified into two groups: the first group received reinfusion of autologous blood collected in the postoperative surgery and the second group did not receive autologous blood reinfusion. analysis of data shows that patients undergoing autologous blood reinfusion received less homologous blood bags (10.6% versus 30%; p=0.08) and reduced days of hospitalization (7.88 0.7 days versus 8.96 2.47 days for the control group; p=0.03). microbiological tests were negative in all postoperatively salvaged and reinfused units. our results emphasize the effectiveness of this procedure and have the characteristics of simplicity, low cost (97.53 versus 103.79; p<0.01), and easy reproducibility. use of autologous drainage system postoperatively is a procedure that allows reducing transfusion of homologous blood bags in patients undergoing tkr.

PMC4579317

pubmed-538

neural plasticity is the brain's ability to change in response to normal developmental processes, experience, and injury. the mechanisms involved in plasticity in the nervous system are thought to support cognition, meaning that brain function is improved. there is evidence from neuroimaging that subjects achieving high scores on cognitive tasks compared to low performers complete these tests with lower cortical activation particularly in the frontal brain region [1, 2]. hypothesis, assuming that experts with high cognitive performance are characterized by a more efficient cortical function.. suggest that this particular characteristic can only be inferred from brain activation, when experts and nonexperts are compared at similar behavioral performance. within the last years this hypothesis has been extended to experts of movement-related tasks. in this respect, standard eeg techniques have been used to investigate the effect of performance level on the allocation of cortical resources during motor tasks. during the preparation of a shot, haufler et al. observed less cortical activity in skilled shooters compared to novice subjects. in line with this finding, del percio et al. also found decreased cortical activity in experts prior to a shot requiring high precision and interpreted this observation as index for selective event- or task-related cortical activation. neural efficiency has also been confirmed in professional piano players, who completed a motor task involving finger movements with lower cortical activity than less skilled controls. although these findings consistently support the efficiency of cortical function in athletes, some evidences from tasks requiring movements in response to visual stimuli question the general applicability of this hypothesis. in this respect, hung et al. reported higher lateralized readiness potentials during posner's visuoattentional task in elite tennis players compared to nonathletes. in line with these results, endo et al. showed that athletes had greater motor cortex activity than nonathletes during a task, in which subjects were asked to abduct the right index finger in response to visual stimuli. evidence from longitudinal studies investigating effects of motor training consistently supports the efficiency of cortical function in high performers, because motor cortex activity decreased despite improvements on task performance after a training period [5, 10, 11]. similarly, 4 weeks of endurance training in cyclists led to improved aerobic performance but decreased brain cortical activity during exercise. based on those findings, the neural efficiency hypothesis might also be applicable to endurance athletes. so far researches have not yet investigated efficacy of cortical function during exercise between subjects of different aerobic performance levels. however, the current state of research indicates that resting eeg rhythms predict neural efficiency during cognitive and sensorimotor tasks. alpha synchronization at rest represented by high eeg alpha power is related to increased cognitive and motor performance [13, 14]. in line with these findings, elite karate athletes compared to nonathletes show higher alpha-1 power at parietal and occipital regions at rest with eyes closed. moreover, training levels also influence the reactivity to eyes opening, so that athletes maintain higher alpha power than nonathletes. whereas alpha is considered the dominant rhythm in the human brain during mental inactivity, beta activity is regarded as index of information processing at the cognitive level. in previous studies increased alpha power and/or decreased beta power, reflected by a higher alpha/beta ratio, were associated with a decreased level of arousal or vigilance [18, 19]. this pattern is considered normal for the resting state due to a lack of task-specific activation demands. however, endurance exercise increases arousal due to preparedness for external input. applying the neural efficiency hypothesis, high cortical function despite minimal energy consumption should be indicated by an increased alpha/beta ratio in high performers. in previous trials, high and low performers were differentiated by their individual training levels or participation in competitions [4, 15, 21]. for endurance athletes, maximal oxygen consumption allows a more appropriate and objective classification, because this variable is considered gold-standard and predicts time-trial performance. this is due to the concept that an athlete's maximal oxygen consumption is mainly determined by the oxygen delivery to the mitochondria and its utilization, which in turn are limiting the oxidative production of atp required for the energy supply of the working muscles. as neural efficiency is task-related, it is necessary to study brain cortical activity in athletes directly during endurance exercise. the majority of studies investigating brain function while moving predominantly examined subjects during cycling exercise, because it does not create stepping impacts that provoke strong neck muscle contractions and electrode movements. furthermore, experienced cyclists are thought to be able to maintain a stable body position even at demanding workloads, so that the likeliness of movement-related artefacts in the eeg signal is reduced. the present study investigates whether or not aerobic power has an effect on the alpha/beta ratio during exercise. additionally, the authors examine if resting eeg predicts brain cortical activity during exercise. in line with the neural efficiency hypothesis subjects with high maximal oxygen consumption cyclists and triathletes with a minimum cycling training volume of 4 hours per week were directly recruited from local sports clubs. eligible subjects had to be healthy, between 18 and 35 years, nonsmokers, and right handed. before the trial commenced all participants underwent health screening following the s1-guideline of the dgsp, which included personal anamnesis, orthopaedic assessment, and measurement of resting ecg and blood pressure. any complications limiting the performance or safety of exercise led to exclusion from the study. following the screening process, all study procedures were approved by the local ethics committee and followed the guidelines of the declaration of helsinki. two laboratory visits separated by 3 to 5 days were scheduled. in the first laboratory session aerobic and anaerobic performance the second visit included recording of eeg rhythms at rest and during endurance exercise at constant workload. based on maximal oxygen consumption measured on the first visit, the sample was split into a group of lower aerobic power (low; vo2max 49 ml/min/kg; n=15) and a group of higher aerobic power (high; vo2max 50 ml/min/kg; n=14). environmental temperature was held constant at 20c and nutrition was standardized (last main meal2 h; 500 ml30 min). following the assessment of body weight, subjects completed an incremental test with spirometry (cortex medical, metamax 3b, germany) on a high performance cycling ergometer (fes, germany). after a 5 min warm-up at 80 w (f)/100 w (m), the workload was increased by 25 w/3 min until volitional exhaustion. this was defined as the inability to maintain a cadence of at least 60 rpm at the given workload. heart rate and respiratory parameters were recorded continuously. using the enzymatic-amperometric method (dr. mueller geraetebau, super gl ambulance, germany), lactate concentration was analysed in blood taken from an ear lobe after each increment. collected data were processed with winlactat (mesics, germany). according to the dickhuth model, the individual anaerobic threshold (pians) additionally, vo2max was determined as highest value over a 30 s period. on the second laboratory visit eeg was recorded under the following conditions: resting with eyes closed while sitting on the ergometer (2 min) and during cycling at constant load. the exercise protocol included a 5 min warm-up (80 w [f]/100 w [m]), 30 min at 100% of the individual anaerobic threshold, and a 5 min cool-down at a low workload (80 w [f]/100 w [m]). brain cortical activity was recorded over 1 min at 10 and 20 as well as 30 min and subjects maintained a cadence of 90 rpm. heart rate and cadence were displayed in real-time on a monitor placed in the subjects ' natural viewing direction. prior to the assessments, all subjects were instructed to stabilize their body position and avoid head movements and contractions of the jaw throughout the cycling exercise. using a breathable cap, active agcl electrodes were placed on the subject's scalp to record eeg from frontal (f3, f4, fz, f7, and f8), central (c3, c4, and cz), and parietal (p3, p4, pz, p7, and p8) brain regions. the electrodes, which were positioned according to the international 10:20 system, were filled with an electrolyte gel to reduce impedance below 10 k. the eeg signal was amplified by the quickamp system (brainvision, germany) and sampled at 512 hz. following the data acquisition, the analyzer 2.0 (brainvision, germany) was used for processing the eeg recordings. after a reduction of the sampling rate to 256 hz, data were digitally band-pass filtered (time constant 0.0318 s; 24 db/octave) and a frequency range of 3.0 to 40.0 hz remained for analysis. the recorded epochs represented the 10th, 20th, and 30th minutes during constant load cycling at pians. following a manual inspection the artefacts tagged by the software were either rejected or confirmed. subsequently, those segments were averaged individually within each recording period. by using a hanning window (20%), the eeg data were fast-fourier-transformed (fft) to calculate power values in the alpha (7.512.49 hz) and beta (12.532 hz) frequency domain. subsequently, the alpha/beta ratio was calculated and averaged over the epochs representing the recordings during exercise. accurate test-retest reliability for the alpha and beta power during cycling at 90 rpm has been reported with the eeg acquisition and processing methods used in the present study. prior to group comparisons, gaussian distribution of the collected data was verified by the shapiro-wilk test. one-way anova (factor: group) was used to compare anthropometric measures between medium and high fit subjects. the effect of maximal oxygen consumption on alpha/beta ratio was analysed by applying 2 (group: low, high) 2 (condition: rest, exercise) 3 (region: frontal, central, and parietal) anova. in a subsequent analysis frequency (alpha, beta) was included as additional factor to assess the effect of maximal oxygen consumption on eeg spectral power. in case of nonsphericity greenhouse-geisser correction was applied. between-subjects and within-subjects effects as well as interactions were reported and further analysed using fischer's lsd post hoc test. subsequently, linear regression was used to predict brain cortical activity during exercise and maximal power from resting eeg. the adjusted pearson's multivariate coefficient of determination and as standardized coefficient are provided. for all statistical analyses, an alpha level of p brain cortical activity during exercise was recorded at 100% of the individual anaerobic threshold, which was 3.31 0.37 wkg and 2.74 0.45 wkg in high and low (f(1,27)=13.66; p=0.001; eta=0.336), respectively. subjects with higher maximal oxygen consumption also reached greater maximal power (4.67 0.33 wkg versus 4.11 0.49 wkg; f(1,27)=13.28; p=0.001; eta=0.330) than the low group. the statistical analysis revealed main effects of group (f(1,27)=12.04; p=0.002; eta=0.308), condition (f(1,27)=4.24; p=0.049; eta=0.136), and region (f(2,26)=8.50; p=0.002; eta=0.239) on subjects ' alpha/beta ratio. moreover, there was an interaction of condition and region (f(2,26)=4.37; p=0.025; eta=0.139). whereas alpha/beta ratio was increased at central brain region compared to parietal (t(28)=3.36; p=0.002) and frontal sites (t(28)=2.74; p=0.010) in the exercise condition, no regional differences were confirmed for the resting state. furthermore, alpha/beta ratio was significantly different between high and low at all electrode sites (figure 1) in both the resting state (frontal: t(28)=2.86; p=0.008; central: t(28)=2.52; p=0.018; parietal: t(28)=2.67; p=0.013) and the exercise condition (frontal: t(28)=3.19; p=0.004; central: t(28)=2.62; p=0.014; parietal: t(28)=2.37; p=0.025). when frequency was included as additional factor, interactions with condition (f(1,27)=11.37; p=0.002; eta=0.296) and group (f(1,27)=8.43; p=0.007; eta=0.238) were confirmed. compared to the resting state alpha (t(28)=7.39; p<0.001) and beta power (t(27)=12.43; p<0.001) were significantly increased across electrode sites during exercise. moreover, high showed less beta power than low (t(28)=2.45; p=0.020). the relation between resting eeg rhythms, brain cortical activity during exercise, and maximal power is shown in table 3. whereas alpha/beta ratio at rest explained 57% of variance of alpha/beta ratio during exercise at frontal brain region, resting eeg at other electrode sites did not predict brain cortical activity during exercise. when frontal alpha/beta ratio at rest was used as the independent variable for the prediction of maximal power, the model was able to explain 15% of the variance compared to 18% and 26% for the use of central and parietal alpha/beta ratio, respectively. compared to the resting state, the alpha/beta ratio was decreased during cycling exercise as beta power increased more than alpha power. this change towards a higher level of arousal or vigilance has also been reported in a recent review by ludyga et al.. increased beta activity reflecting higher cortical activation might be the result of greater processing demands during exercise and the tendency of the sensorimotor system to maintain the current network set. the decrease of the alpha/beta ratio from rest to exercise was most pronounced at central brain region, where inter alia sensorimotor information of lower extremities is integrated. in this respect, the maintenance of pedaling movements is associated with increasing feedback from sensory afferents and feed-forward due to the recruitment of motor neurons [12, 30]. although the magnitude of the changes in alpha/beta ratio from rest to exercise was similar between groups, high compared to low had a higher index in both conditions. differences between athletes of high and low training or performance levels have also been observed at rest previously [4, 21].. found enhanced cortical synchronization of pyramidal neurons reflected by increased alpha activity in elite karate athletes. as alpha power serves as an inverse indicator of mental alertness or arousal [18, 19], this implies that athletes are more efficient in posing cortical neurons into a nonoperative mode. consequently, it can be assumed that a lower level of arousal at rest, which was also observed in the present trial, is due to greater relaxation ability in subjects with higher maximal oxygen consumption. this is further supported by a lower beta power in high, because a decrease in beta power has been reported to be the eeg response to relaxation. by maintaining a low arousal at rest, attentional resources may be reserved for a subsequent recruitment in movement-related tasks and associated information processing. the present results support this assumption as high resting alpha/beta ratio was associated with high alpha/beta ratio at frontal brain region during exercise. in previous studies resting alpha and beta activity have also been related to different measures of cognitive and motor performance, so that neural efficiency in the resting state is suggested to predict task-related performance [13, 14]. this is also applicable to endurance exercise as arousal at rest was directly related to maximal power during cycling. similar to the resting state, cyclists in high showed a higher alpha/beta ratio than low during exercise at the individual anaerobic threshold. this observation indicates that the neural efficiency hypothesis is applicable to endurance-trained athletes. the present findings are further supported by ludyga et al., who confirmed a negative correlation between changes of aerobic performance and cyclists ' brain cortical activity after a 4-week training period. other studies have also shown that training elicits a decrease of cortical activity and the suppression of task-irrelevant cognitive processes [32, 33] during different movement-related tasks. evidence from animal studies suggests that improved neural processing and increasing influence of the cerebellar thalamic cortical circuit are underlying mechanisms of training-induced enhancement of neural efficiency. in this respect, taniwaki et al. have proposed that this increased influence reflects a change from internal to increasingly external and automatic processing of motor tasks. the execution of highly automated movements, such as handwriting, does not require much attentional resources. therefore, the lower level of arousal during exercise in high could be explained by cycling becoming an increasingly automated process with training. the reservation of cortical sources in experts is further supported by the results of httermann and memmert, who showed that athletes compared to nonathletes had higher cognitive performance during cycling exercise of similar relative intensity. furthermore, improvements in circulatory capacity and cerebrovasculature have also been suggested as underlying mechanisms for differences in eeg spectral power between athletes and nonathletes [21, 38]. maximal oxygen consumption is correlated with cerebral blood flow, which is considered as a proxy for assessing neurogenesis. this indicates an increased formation rate of new neurons and improved cerebral blood flow in high compared to low. these improvements elicited by endurance exercise are thought to improve energy supply by creating a more supportive and nutritive environment for the surrounding neurons. however, future research is necessary to investigate whether or not an optimized energy supply accounts for enhanced neural efficiency during exercise. a methodological concern of eeg recordings during exercise is the potential impact of physiologic and mechanical disturbances. to reduce the possibility and impact of artefacts, the present study used a data acquisition and processing approach, which has proven reliable. additionally, only experienced cyclists were included in the study, because their ability to stabilize the upper body at moderate to high intensity is necessary to reduce movement-related artefacts when eeg is recorded during exercise on a stationary bike. therefore, it remains unclear whether or not the development of the alpha/beta ratio over time was different between groups. nonetheless, the present results indicate a higher level of arousal in cyclists with lower aerobic fitness. as this was observed in both conditions, it can not be ruled out that differences in alpha/beta ratio during exercise between high and low are mainly due to the differences observed in the resting state. whereas previous studies also reported differences in alpha activity at rest between elite-athletes and nonathletes [15, 16, 40], this is not supported by the present findings. this could be due to a lack of high differences in performance and/or training levels between groups and the low sample size of the present study. however, the differences in alpha/beta ratio confirmed between groups imply that this index is sensitive to small differences in aerobic power. nonetheless, further investigations with higher sample size and more aerobic fitness subgroups are warranted to test and extend the current findings. furthermore, it remains unclear whether or not other variables related to neural efficiency, such as cognitive performance and intelligence, have influenced the observed differences between high and low. in conclusion, cyclists with high aerobic fitness compared to peers with less aerobic fitness are able to complete submaximal cycling exercise with a lower level of brain cortical activity. this indicates enhanced neural efficiency in subjects with high aerobic power, possibly due to the inhibition of task-irrelevant cognitive processes. moreover the use of resting eeg rhythms as predictor for task performance is also applicable to cycling as resting state arousal predicted maximal power.

the neural efficiency hypothesis suggests that experts are characterized by a more efficient cortical function in cognitive tests. although this hypothesis has been extended to a variety of movement-related tasks within the last years, it is unclear whether or not neural efficiency is present in cyclists performing endurance exercise. therefore, this study examined brain cortical activity at rest and during exercise between cyclists of higher (high; n=14; 55.6 2.8 ml/min/kg) and lower (low; n=15; 46.4 4.1 ml/min/kg) maximal oxygen consumption (vo2max). male and female participants performed a graded exercise test with spirometry to assess vo2max. after 3 to 5 days, eeg was recorded at rest with eyes closed and during cycling at the individual anaerobic threshold over a 30 min period. possible differences in alpha/beta ratio as well as alpha and beta power were investigated at frontal, central, and parietal sites. the statistical analysis revealed significant differences between groups (f=12.04; p=0.002), as the alpha/beta ratio was increased in high compared to low in both the resting state (p 0.018) and the exercise condition (p 0.025). the present results indicate enhanced neural efficiency in subjects with high vo2max, possibly due to the inhibition of task-irrelevant cognitive processes.

PMC4706966

pubmed-539

obesity is a major public health problem with over two-thirds of americans overweight and greater than one-third obese. while new data have suggested a leveling off of the prevalence of childhood obesity, 12.4% of kindergarteners are obese and overweight five-year olds are four times as likely as normal weight five-year olds to become obese [2, 3]. it has been well documented that obesity leads to cardiac, metabolic, and other systemic health derangements. it has also been shown that these unfavorable changes may start as early as three years of age. well-child checks have long been recognized as opportunities to foster healthy growth and development. these regular visits, which are performed with a health care provider, traditionally occur during the newborn period, at one, two, four, six, nine, twelve, fifteen, eighteen, and twenty-four months and every year thereafter. the goal is to provide continuity of care and allow for anticipatory guidance to be given. recognizing that diet and nutrition are linked with obesity, it is important to address these topics. however, guidelines on nutrition counseling remain vague, and visit time is constrained by a multitude of other encouraged and essential components. yet studies show that when it comes to counseling during well-child checks, less is more and focusing on fewer topics is more effective. however, these are notably imprecise with regard to early and targeted interventions to prevent and treat obesity in pediatric populations. regarding nutrition counseling during well-child care within the first year of life, the american academy of pediatrics (aap) bright future guidelines contains goals for temporal introduction of foods rather than composition of diet. even at the one-year visit, surprisingly, there is no mention of nutrition guidance at the fifteen- or eighteen-month well-child checks and it is not until the two-year visit that the subject of obesity is first addressed in the guidelines. meanwhile, research shows that a rapid transition occurs between the one- and two-year well-child checks, when diet habits seemingly shift to favor fast foods, with the french fry as the number one consumed vegetable consumed by two-year olds. the world health organization (who) strongly advocates for exclusive breastfeeding in the first six months of life and offers recommendations on complimentary feeding habits. these include continuing on-demand breastfeeding until two years of age and starting at 6 months of age, gradually increasing the number of feedings, consistency, and variety of other foods. for a nonbreastfed child, who further recommends providing four to five meals per day, with one or two healthy snacks aimed to meet the child's nutritional needs. these who guidelines are appropriately aimed toward a global audience, with an emphasis on preventing malnutrition and ensuring adequate growth. current literature on prevention and treatment for obesity has overwhelmingly focused on adolescent and school aged populations. the aap recommends screening for obesity starting at two years, while united states preventive services task force (uspstf) suggests waiting until age six [7, 10]. these recommendations bypass a likely window of opportunity for primary prevention prior to the second year of life, and in the case of the uspstf prior to six years. given these vague universal recommendations, we hypothesize that significant variability exists in clinical practice. it has been demonstrated that there is variability among pediatric primary care practices regarding obesity counseling, attitudes, and perceptions. some prior studies have focused on family medicine primary care providers ' (pcps) beliefs and practices pertaining to childhood obesity. however, many of these studies have placed emphasis more specifically on evaluation of treatment modalities, perception of obesity as a disease, and physician training [1318]. further, much of the previous work on childhood obesity appears directed beyond the age of five years, with few interventions studied between two and six years of age. this study builds upon the existing literature by offering a family medicine perspective and focusing specifically on perceived barriers and anticipatory guidance discussed at the early well-child checks particularly those prior to the second year of life. this is further warranted as much of the current literature occurred prior to the updated 2008 aap bright futures guidelines [7, 20]. given the recent emphasis on primary care and the likely influx of pediatric patients via the accountable care act, family physicians will continue to provide a substantial amount of care for pediatric populations. the goal of the present study is to assess the perception of family medicine pcps in a university based family medicine network surrounding the barriers of preventing and treating obesity in the young child and to analyze pcps reported behaviors at well-child checks. in addition, the present study allows for a comparison of attitudes and practice between family medicine pcps and pediatric pcps who participated in an earlier study using a similar survey. the sample included all family medicine physicians, physician assistants (pas), and nurse practitioners (nps) at eleven family medicine duke primary care sites in duke university health systems. the survey used in the present study was developed based on a similar study performed in pediatric practices, current epidemiological literature, and recommendations from the american academy of pediatrics (aap) and the united states preventive services task force (uspstf) [6, 10, 11]. previous authors were contacted for permission to utilize a similar survey tool. the survey contained three independent sections, each with a brief introduction. the sections were as follows: (i) perceived barriers in treating obesity, (ii) current pcp practices at well-child checks, and (iii) demographic information. introductory phone calls with follow-up emails were sent in january 2012, prior to the in-person survey administration. an agreed upon morning or lunch hour time was arranged to include a ten- minute presentation explaining the goals of the project, with subsequent survey administration to all pcps who attended the meetings. an agreement was made to present the study findings to the participating sites at the conclusion of the study. data collection was performed during january and february 2012 and the data were analyzed in march 2012. demographic data are presented as percentages/proportions. for questions related to perceived barriers, we calculated the percentage of respondents who indicated how important each issue was on a likert scale 15 (not important, slightly important, moderately important, very important, and critically important), as well as the combined percentage of those who responded either very important (4) or critically important (5). for pcp behaviors assessing anticipatory guidance, multiple responses were accepted (i.e., mark all well-child checks that apply). this study was reviewed by the research advisory board of the primary care research committee and the institutional review board of duke university and was found to be an exempt study (pro00034169). surveys were completed by 56 of the 78 family medicine pcps (41 family medicine physicians, 8 physician assistants, and 7 nurse practitioners) at the 11 participating clinics, for a 72% response rate. approximately 1/3 (35%) were 4049 years old, 1/3 (33%) were 3039, 27% were 50+years old, and 5% were twenty through twenty-nine years old. the majority of pcps were medical doctors or doctors of osteopathic medicine (md/do) (73%), with physician assistants and nurse practitioners making up 14% and 13%, respectively. the average reported body mass index (bmi) of respondents was 24.71 kg/m (7 of the 54 respondents did not complete the bmi measures). approximately 1/3 (33%) of the pcps were classified as overweight and 0.6% were in the obese category. reported bmi closely mirrored pcps perception of their weight, as 30% indicated they were overweight and 2% believed they were obese. pcps were asked to rate the relative importance of specific barriers to preventing or treating overweight or obese children. these questions related to children of all ages and focused on many factors including the child, parents, family unit, influence of society, and pcp factors. the five barriers that were most often rated as either very important or critically important were as follows: (i) families do not get enough exercise (93%); (ii) families often have fast food meals (86%); (iii) parent is not motivated to change diet or lifestyle (81%); (iv) families watch too much tv (79%); and (v) child is not motivated to change diet or lifestyle (75%) (table 1). the following barriers were rated as very important or critically important by 6072% of pcps: parent is unaware that child is overweight, parents are overweight so they are not concerned that child is overweight, families are too busy to eat home cooked meals, healthy foods are too expensive, tv advertisements promote unhealthy foods, pcps have limited time to discuss nutrition, and pcps are frustrated with the low success rate of treating overweight children. barriers that pcps were less likely to rate as very important or critically important were as follows: overweight child does not act sick, overweight child is a good eater, parents do not have time to shop for healthier foods, families are too busy to eat meals together, healthy lifestyle habits are too complicated to follow, published reports about diet and nutrition are often confusing, school lunches promote unhealthy eating habits, pcps ' time constraints, lack of training to treat overweight children, compensation for obesity treatment, access to nutritionists, and pcps ' weight status or body mass index (table 1). pcps were asked to mark all of the well-child checks in which they discuss a variety of health topics with patients. analyzing the barriers perceived by pcps as most important to preventing and treating obesity revealed trends regarding fast food consumption and physical inactivity. as shown in table 2, even by their own report, most pcps did not discuss fast foods at or prior to the twelve-month visit. at the eighteen-month visit fast foods are discussed by 32% of pcps. meanwhile, the two-year visit is the first well-child visit at which the majority of pcps (68%) discuss fast food. while the majority of pcps ultimately discuss this topic, the discussion is not undertaken by a majority of pcps at a specific encounter until the two- through five-year visits. fruit and vegetable discussion increases in frequency as the child ages, with a peak of 63% of pcps discussing this at the twelve-month visit, before dropping to 51% at the eighteen-month visit. between 22% and 26% of pcps discuss having 3 meals per day by the twelve-month visit, whereas 65% are discussing meal frequency at the two- through five-year visits. physical inactivity/exercise was another area of concern with 93% of pcps recognizing this as a contribution to obesity, yet this topic was discussed by at most 23% of pcps at and/or before the twelve-month visit. by the eighteen-month visit, at most 48% of pcps had ever discussed the topic with their patients or families. the two- through five-year visits are the first time at which the majority of pcps (68%) discuss this topic. the percent of well-child visits where screen time is discussed closely mirrors physical activity/exercise, and a similar trend is seen regarding the discussion of fast foods (table 2). a major finding of the current study involved the relative importance pcps ascribe to perceived barriers in treating obesity. our results reproduced those of a previous study utilizing a similar survey but performed within a pediatric setting. our results confirm that family medicine pcps share the same top six concerns when dealing with perceptions surrounding obesity. these concerns center around physical inactivity, fast food consumption, and motivation to change. the barriers identified were in areas that were inconsistently addressed in practice, specifically prior to the two-year well-child check. despite the apparent lack of congruence between the identified barriers and the actions by pcps in clinical practice, furthermore, due to the self-reported nature, pcps may overestimate how often they address certain issues. a second major finding of the current study was the inconsistency pcps demonstrated concerning when discussion took place for physical activity, fruit and vegetable selection, screen time, juice, and other beverage choices. this study suggests that primary prevention interventions targeting obesity in practice are either misplaced or missed altogether in some cases, which is consistent with other recent studies demonstrating missed opportunity for primary prevention of obesity [2124]. as this study is representative of an academic practice population with close geographic proximity, further study on a larger scale and in other practice populations the aap recommendations make no mention of fruits and vegetables until the five- and six-year well-child visits. in another case, the aap guidelines suggest the discussion of having 3 meals per day at the nine- and twelve-month well-child checks. however, in this study, only 26% of pcps have this discussion specifically at or before the twelve-month well-child visit. interestingly 65% of pcps have this discussion at the two- through five-year well-child visits despite lack of specific recommendation to do so. pcps seem to be aware of existing guidelines but, in this example, delay the delivery. other than this specific recommendation at the five-year well-child visit, all of the earlier well-child visit nutrition and diet guidelines are relatively nonspecific regarding diet composition. this likely contributes toward the variability observed in this study, as many pcps chose to have discussions, such as fruits and vegetables, at differing well-child visits. therefore, we believe that it would be advantageous to the goals of obesity prevention and treatment to have early and targeted interventions that precede adoption of adverse lifestyle choices [2527]. although it is beyond the scope of this paper, innovative approaches in obesity treatment have been identified over the past decade [2830]. comparing this study of family medicine pcps with a similar study done with pediatric providers revealed some similarities in practice behavior. pcps behavior in both studies reflected the general aap anticipatory guidance guidelines pertaining to obesity [7, 11]. however, the anticipatory guidance discussions were not consistently performed at specific visits in either study, with greater variability observed in this family practice study (see table 2). different methodologies were used in data collection, as the study for family medicine pcps was measured using a cumulative approach, whereas the pediatric study was measured at point of first intervention. in comparing these studies, we chose to use the most conservative estimates by summating the percentages of anticipatory guidance being discussed. for example, a single pcp may have indicated that they discussed fast food at both the four- and six-month visits. our study would count both of these as unique interventions being done by different pcps. consequently, these findings may offer a realistic representation or, otherwise, an overestimation of how often topics were discussed at well-child checks. the present study identifies discrepancies in pcps adherence to counseling guidelines for nutrition, exercise, and screen time. in regard to exercise and screen time, this study demonstrates similar increases in the percentage of pcps discussing these topics, with the majority doing so at the two- through five-year well-child checks, and a peak between the six- through eleven-year well-child checks. however, the aap guidelines suggest that a majority of pcps address each of these topics much earlier. it would be beyond the scope of this discussion to address all elements of the survey. therefore, the remainder of this discussion will focus on the results relevant to fast food counseling and nutrition and their role in obesity prevention. a surprising result from this study was that there is no clear consensus as to when pcps are having discussions about fast food. while a prior study indicated that 62% of pediatricians addressed fast foods at or prior to twelve-month well-child visits, this study shows that at most 39% of family physicians did so (table 2). these estimates suggest that there is still a large percentage of the population receiving no counseling on fast food during the entire first year of life. it is not until the two-year well-child visit that a majority of pcps discuss fast food. meanwhile, previous research has shown that there is a profound shift in dietary habits toward fast foods, such as french fries, that occurs between the one- and two-year well-child checks. to address fast food consumption, pcps could consider integrating a universal french fry discussion regularly at the twelve-month well-child care visit. given the recognition that food transitioning towards fast foods such as french fries occurs within the subsequent window from twelve months to twenty-four months, it might be beneficial to offer a specific intervention at this visit. furthermore, prior research has shown that a dedicated intervention targeting two-year olds and their families can significantly reduce bmi. the french fry discussion could take the form of a purposeful talk with family members about the importance of avoiding fast foods, fried foods, and sweetened beverages. for example, using motivational interviewing techniques has been shown to be effective in changing behavior relating to obesity, and this approach may address such a complex behavior [32, 33]. this visit could additionally include handouts or printouts about alternative foods and snacks that are affordable and can be prepared quickly. rather, this should be an individualized discussion, in which family members are encouraged to voice their concerns and devise solutions that meet their unique situation. as such, we would not anticipate a discussion of this relevance requiring anything less than ten minutes of dedicated visit time. the goal of this discussion would be to leverage the patient-physician-family relationship to positively impact lifestyle choices for both the child and the family. further study is needed to examine actual obesity prevention and treatment guidelines in clinical practice and to discern the specifics, feasibility, and benefits of incorporating additional counseling into routine well-child care.

childhood obesity is a complex problem that warrants early intervention. general recommendations for obesity prevention and nutrition counseling exist. however, these are notably imprecise with regard to early and targeted interventions to prevent and treat obesity in pediatric populations. this study examines family medicine primary care providers ' (pcps) perceived barriers for preventing and treating pediatric obesity and their related practice behavior during well-child visits. methods. a written survey addressing perceived barriers and current practices addressing obesity at well-child visits were administered to pcps at eleven family medicine clinics in the duke university health system. results. the most common perceived barriers identified by pcps to prevention or treatment of obesity in children were families not getting enough exercise (93%) and families too often having fast food meals (86%). most pcps do not discuss fast foods at or prior to the twelve-month well-child visit. the two-year visit is the first well-child visit at which a majority of pcps (68%) discuss fast food. conclusion. no clear consensus exists as to when pcps should discuss fast food in early well-child checks. previous research has shown a profound shift in children's dietary habits toward fast foods, such as french fries, that occurs between the one- and two-year well-child checks. consideration should be given to having a french fry discussion at every twelve-month well-child care visit.

PMC4217316

pubmed-540

unawareness, lack of insight, or anosognosia refers to impaired awareness in persons with dementia [17]. awareness is multifactorial and likely modular [4, 810], with each domain separable and potentially unique. most of the literature on awareness in persons with dementia describes the clinical correlates of one awareness domain (reviews by [1, 4, 11]), but the few studies that have contrasted awareness for different domains have found differential patterns of clinical correlates [1215]. this paper provides further support for the modality specific nature of awareness in dementia by contrasting the clinical correlates for awareness of balance in addition to more commonly measured awareness of day-to-day function and memory. awareness quantification remains elusive, and there is no consensus method for measuring awareness (e.g., [4, 9]). awareness has been measured with clinician ratings [16, 17]; or based on discrepancy between self-report versus clinicians ' impression or versus informant report assessed with interview [10, 18] or questionnaires [7, 12, 14, 1921]; or discrepancy between self-report and objective performance [21, 22], which, depending on the task, measures self-monitoring or metacognitive abilities. detail difficulties with patient/informant discrepancies and the assumption that caregiver informants ' or clinicians ' reports are a better reflection of reality. moreover, worry, anxiety, defensiveness, denial, or focus on more important problems can influence reflection for persons with dementia. caregivers ' reports may be more highly correlated with objective measures of cognition than patient self-reports, suggesting there is value in using patient/informant discrepancies. nevertheless, caregiver/patient discrepancies may be a better measurement of patients ' awareness of function, whereas clinician/patient discrepancies may be a better measure of patients ' awareness of cognition. due, in part, to measurement challenges when assessing awareness, the literature on the clinical correlates of awareness in persons with dementia is contradictory. most, but not all, of the cumulative data suggest increasing dementia severity is associated with reduced awareness [1, 16, 18]. others have found few group-based differences, but high individual variability in awareness declines when studied over one year, potentially because severity and awareness are mediated by cognitive reserve. other important clinical correlates of awareness include depression [18, 21, 22, 25], neuropsychiatric status [1921, 26] caregiver burden [10, 11, 14, 26], activities of daily living, and neuropsychological status [12, 19, 20, 22, 2729] which demonstrate variability in associations with awareness across domains and measurement methods. models of awareness suggest awareness is mediated by the frontal lobes [2, 3] or the right frontal lobe [30, 31], and lack of awareness is associated with other behavioural indicators of frontal dysfunction, such as increased apathy. localized imaging has implicated the orbitofrontal cortex, but most have implicated medial structures [34, 35], including the anterior and posterior cingulate in awareness. despite converging evidence for prefrontal involvement in awareness, awareness may or may not be associated with tests of executive function (see review by). some studies demonstrate strong relationships between awareness and executive functioning [12, 19, 20, 27], with others reporting nonsignificant and trivial associations [19, 29]. although clearly composite measures that rely on more basic cognitive functions, many summary scores from traditional tests of executive function are associated with the dorsolateral prefrontal circuit, and awareness has been associated with more midline [3436] or orbitofrontal aspects of the prefrontal cortex. contradictory data on the clinical correlates of awareness is also due to the assumption that awareness is a unitary construct (see reviews by [4, 8]). differential patterns of clinical correlates have been demonstrated for awareness of cognitive deficits versus awareness of behaviours [1215], suggesting that awareness is modality specific. the primary purpose of this paper is to describe the clinical correlates of awareness of balance in addition to the more commonly measured awareness of function in basic and instrumental activities of daily living (badls and iadls, resp.) and awareness of memory. awareness of balance is important in persons with dementia due to its relation with fall risk. we hypothesize that awareness of balance will be associated with physical variables, such as gait, falls, and objectively measured balance. based on the conceptualization of markova and colleagues and work suggesting differential clinical correlates for awareness of specific domains [13, 15], we hypothesize that awareness of functional abilities, memory, and balance will have differential patterns of clinical correlates. a secondary purpose of this paper is to contrast awareness for balance, function, and memory for those diagnosed with mild cognitive impairment (mci). reduced awareness has been demonstrated for persons at high risk for dementia, and specifically for persons with amnestic mci (amci). moreover, since awareness appears to differ based on dementia subtype, awareness for balance, function, and memory could be differentially affected for participants diagnosed with dementia due to ad versus non-ad dementias. therefore, the final comparison will explore awareness in groups of persons diagnosed with amci, non-amnestic mci, ad, and non-ad dementias. patients were from an interdisciplinary memory clinic established to provide early stage dementia differential diagnoses for rural persons. for this irb approved study, patients who were diagnosed with no cognitive impairment were excluded, and only patients who received a diagnosis of dementia or a variant of mci were included. diagnoses in this specialty clinic were consistent with the review of diagnostic guidelines provided by the canadian consensus on the diagnosis and treatment of dementias using recent comprehensive blood work, ct head scan, and interprofessional assessment data from neurology, neuropsychology, and physical therapy. the assessment procedures included standardized approaches (e.g., questionnaires, neuropsychological testing) and also family interviews for clinical history and interviews with the informal caregiver who accompanied patients to the clinic (families were strongly encouraged to attend the assessment and patients were asked to bring someone who knew them well. in the unusual circumstance when patients attended the clinic alone, telephone interviews were conducted with someone who knew them well, but questionnaire data were not collected). the sample consisted of 259 patients (in the clinic's 6th data release), and the vast majority (74%) reported their ancestry as european, 9% were first nations or metis, and 17% chose other, rather than selecting one of the aforementioned categories, african or asian ancestry. table 1 includes descriptive information for the total clinical sample (n=259 patients) and details the subgroups based on diagnosis. patients with dementia due to ad was the most common diagnosis (n=113), and another heterogeneous subgroup (n=100) was created of patients with non-ad dementias (i.e., vascular dementias, mixed dementias, diffuse lewy body disease, dementia due to parkinsons ' disease, huntington's dementia, variants of frontotemporal lobar degeneration, and dementias not otherwise specified). in addition, a third group included patients diagnosed with amnestic (single or multiple domain) mild cognitive impairment (amci; n=23) and a fourth group included patients diagnosed with nonamnestic mci (non-amci; n=23; single or multiple domains, which included those with diagnoses of vascular cognitive impairment, no dementia). although most of the clinic data were focused on patients for diagnostic purposes, informal caregivers (n=244) provided important collateral and personal information. caregivers (m age=61.40, sd=14.63) were typically family members and most of many were females (64%): 33% were wives, 20% were husbands, 31% were daughters, 10% were sons of the patient, with a remaining 7% whose relationship status included grandchildren, nieces, nephews, or friends. clinical correlates of awareness measures (1) assessment of severity. the clinical dementia rating (cdr) is a standardized and psychometrically sound clinician-based rating scale (0 to 3; no impairment to severe impairment), but summing the box scores of the six rating areas of the cdr (cdr-sob) provides a more detailed quantitative measure of global dementia severity and is more sensitive to detecting changes in dementia severity over time. patients rated their performance on the reliable and valid lawton instrumental activities of daily living (iadl higher scores indicating independent functioning). patients ' caregivers rated patients ' performance of adls on two psychometrically strong scales: the functional assessment questionnaire (faq) and the bristol adl questionnaire where higher scores indicate impaired performance. the neuropsychiatric inventory (npi) is a well-researched and psychometrically strong caregiver rating of patients ' behaviours and associated caregiver distress. the centre for epidemiologic studies of depression (cesd), a reliable and valid screen of depression, was self-rated by patients, with four factors: (1) depressed affect (2) lack of positive affect (3) somatic/vegetative and (4) interpersonal measuring social disconnectedness. self-report of caregiver burden was assessed with the short form of the zarit burden interview, which was shown to be psychometrically similar to the longer versions. the global severity index from the brief symptom inventory (bsi) measured caregiver self-report of overall psychological distress. (5) assessment of physical variables. a comprehensivephysical therapy assessment included the psychometrically strong berg balance scale (bbs) and the performance oriented mobility assessment (poma, which is a measure of gait and balance). caregiver and patient reports of falls within the past 6 months were combined with bbs to estimate the probability of falling. patient self-report on the activities-specific balance confidence (abc) scale measured self-reported confidence in balance while doing a variety of day-to-day activities. each patient received a comprehensive neuropsychological assessment (see for a review of the strong psychometric properties of these tests), and selected measures of executive function and working memory were analyzed. the ability to alternate attention was measured with the trail making test part b (tmt b). the ability to inhibit an automatic response was measured with the stroop interference score. cognitive flexibility with speeded retrieval of language-based knowledge was measured using animal naming and phonemic fluency (benton oral word association test). digit span backward subtest from the wechsler adult intelligence scale 3rd edition (wais-iii) measured working memory. finally, the index scores from the repeatable battery for the assessment of neuropsychological status (rbans) were analyzed. awareness of functional deficits (af) was operationalized using patient/caregiver congruence on reports of the patient's ability to independently perform six iadls: management of finances, use of telephone, use of transportation, shopping, meal preparation, and performance of housework (patient self-report version of the lawton iadl scale; and caregiver report of patient's function from the bristol adl scale). for each iadl, congruence was ranked on a 5-point scale; the congruence ranking was summed across the six iadl items for a total of 30 possible points, with higher scores indicating greater awareness. data were available for 201 participants, and as can be seen in table 1, most patients had good awareness of their functional abilities. af was significantly higher in the two mci diagnostic groups when compared with the two groups with dementia diagnoses. awareness of memory (am) was based on congruence between patient's self-reports of memory on a standardized scale (self-rating of memory scale) and performance on a neuropsychological test of new learning (repeatable battery for assessment of neuropsychological status; rbans delayed memory index score). the delayed memory measure was chosen since it best captured consolidation difficulties asked about in the self-rating of memory scale. both the self rating of memory standardized scores and the rbans index scores were transformed into a linear ranked scale from 1 to 5, with 1 indicating the lowest self-rating of memory and the lowest memory performance. the am score was created based on the congruence in ranking between self-reported and objectively measured memory, with 5 indicating perfect congruence. complete data were available for 192 participants. as can be seen in table 1, most participants ' am was at the mid-point of the scale, but the ad and the amci subgroups reported significantly lower am than the non-ad dementia and non-amci groups. awareness of balance (ab) was based on congruence between patients ' ratings of balance confidence on the abc scale and the probability of falling. the abc and probability of falling were each transformed into ranked scores with 1 indicating low confidence or high probability of falling and 4 representing high confidence or low probability of falling. the ab score was created based on the congruence in ranking between self-reported balance confidence and objectively measured probability of falling, with 1 indicating low congruence and 4 indicating perfect congruence. perfect congruence between balance confidence and objective measurement may not be sufficient for stability; rather underestimation of balance (i.e., less confidence than objective measurement would support) has been shown to be associated with greater stability (e.g., [38, 65]). consistent with this premise, ab ranking of 5 represented an underestimation of balance confidence relative to objectively measured balance. approximately one third of the sample (36%) reported equivalent balance confidence to measured stability, 27% reported greater balance confidence than would be supported by objective measurement (i.e., reduced awareness), and 37% reported an underestimation of balance, which may be appropriate awareness for maximal stability (e.g., [38, 65]). although the sample size was relatively small, ab was high for all groups and did not differ significantly for patients with diagnoses of amci, non-amci, ad, or non-ad dementias (see table 1). zero-order correlations were completed separately for af (table 2), am (table 3), and ab (table 4). only variables with significant correlations were used to minimize specification errors (potential over- or undercorrection) as predictors in simultaneous multiple regression equations. for each measure of awareness, analyses were conducted for the overall sample, but also for each of the four diagnostic groups. descriptors of magnitude of association were consistent with guidelines for small, medium, and large effect sizes provided by cohen. as can be seen in table 2, af was highly correlated with caregiver report of adls (faq and bristol adl each large magnitude associations). together these data suggest af was highly associated, but not redundant, with more comprehensive measures of day-to-day function. similarly, am was highly associated, but not redundant with the measures used to create it. as can be seen in table 3, these associations were strong for the non-ad dementia and two mci groups but trivial for the ad group. finally, ab also demonstrated moderate, but nonredundant, associations with the variables used to create it. as can be seen in table 4, the association with the abc scale was a moderate magnitude overall and for all diagnostic groups except the non-amci group. also seen in table 4, ab was associated with both fall history in the past 6 months for the larger samples and overall. ab was associated with probability of falling only for specific diagnostic groups and the overall sample. the cell sizes for the poma were below 10 for the mci groups, but the small association was significant for the overall sample. overall, the correlations provide evidence for the convergent validity for each of the derived awareness measures. of interest, each measure of awareness appeared orthogonal: awareness of function was not associated with either awareness of memory (rs=0.026, p>0.05, trivial magnitude) or balance (rs=0.207, p>0.05, small magnitude), and the latter two measures of awareness are similarly not well associated (rs=0.153, p>0.05, small magnitude). for the overall sample, regression diagnostics suggested the bristol adl-caregiver, npi-distress, and rbans immediate and total scale indices were multicollinear, so these variables were excluded from the regression equation. the remaining predictors of cdr-sob, iadl-patient, faq-caregiver, npi-severity, zbi, probability of falling, bbs, clock drawing, rbans language, and visuospatial/constructional indices accounted for a large proportion of af variance (r=0.688, p<0.001). not all predictors were equally predictive, however, and only the faq-caregiver (t=4.64, p<0.001) and zbi (t=3.06, p=0.003) were significant predictors of af. equivalent regression procedures were conducted separately for the four diagnostic subgroups, and across these analyses only measures of function were significant predictors of af (ad group faq-caregiver t=3.29, p=0.002; non-ad group faq-caregiver t=3.03, p=0.004; amci group iadl-patient t=2.30, p=0.035; and non-amci group badl-caregiver t=2.37, p=0.029). awareness of memory demonstrated a different pattern of zero-order correlations (see table 3), and the results of the regression analyses also suggested that the clinical correlates of am clearly differed from those of af. for the overall sample, the initial regression diagnostics resulted in removal of npi-severity and distress in addition to the rbans total scale index score due to multicollinearity. the overall model accounted for a large proportion of variance in am (r=0.736, p<0.001), but of the predictors (iadl-patient, cesd overall, cesd depressed affect, cesd somatic/vegetative, cesd interpersonal, bsi global severity, animal naming, and rbans immediate memory were excluded) only the cesd-lack of positive affect (t=3.19, p=0.002), the rbans visuospatial/constructional index (t=2.63, p=0.01), and the rbans delayed memory index (t=8.65, p<0.001) remained significant. the regression equations for the diagnostic groups differed from the predictors for the overall group. for the non-amci group the overall model was nonsignificant (likely due to only 9 participants having all variables complete). for the non-ad dementia group the rbans delayed memory index was the only significant predictor of am (t=2.32, p=0.028), but for the few amci patients with all predictors complete the delayed memory was not significant (t=2.22, p=0.053). perhaps most salient was the radically different associations between am and the clinical correlates for the ad group. here, only the iadl-patient (t=2.15, p=0.035) and cesd lack of positive affect (t=2.32, p=0.024) predicted am. the zero-order correlations that drove the regression equations for ab are shown in table 4. the regression equations for the overall sample were less plagued by small sample size problems than the two mci groups. the clinical correlates of probability of falling, poma, and the bbs were excluded, however, due to multicollinearity. the remaining predictors were all significant: faq-caregiver (t=4.77, p<0.001), the abc scale (t=6.61, p<0.01), and fall history in last 6 months (coded yes/no, t=8.01, p<0.001) and together accounted for a large proportion of variance in ab (r=0.757, p<0.001). when compared across the diagnostic groups, the two regression equations for the mci groups were not statistically significant, likely due to small sample sizes. for both dementia groups the abc scale was a significant predictor of ab (ad group t=4.61, p=0.038, non-ad t=2.34, p=0.014) but, in addition, for the non-ad group the fall history in last 6 months was significant (t=3.81, p=0.001). these data support the hypothesis that awareness for different domains, specifically awareness of function, memory, and balance, would differentially relate to clinical correlates. this is in keeping with early work on awareness demonstrating differential clinical correlates for specific awareness domains [1215] and provides support for the assertion by markova and colleagues that awareness must be conceptualized as specific to the domain being measured, and that research on one domain can not be generalized to another domain. in addition to finding differential patterns of clinical correlates across domains of awareness, these data suggest that diagnostic group is also an important consideration in the clinical correlates of awareness. this was most evident in the clinical correlates for the ad group versus the non-ad and amci groups for awareness of memory. here, the relationship between specific symptoms of depression and awareness of memory was only evident for the ad group. in contrast, the clinical correlates for the other groups remain restricted to measures of memory. regarding caution in cross-domain generalization is not sufficient, and diagnostic grouping is another important consideration, at least for some domains of awareness. awareness of function was lower for the groups diagnosed with dementia than those with mci whereas awareness of memory was lower for the group with ad dementia and the group with amci, often considered a precursor to ad, than for the non-ad dementia or non-amci groups. our data suggest that awareness of specific domains was orthogonal: awareness of function was not associated with awareness of memory or awareness of balance. this was in contrast to the findings by ott and colleagues who found moderate correlations between awareness of memory and awareness of function. our method for measuring awareness of function was similar to that used by ott and colleagues (namely, patient/caregiver discrepancy), but we used a discrepancy between performance and self-report to assess memory and balance awareness, which may account for these inconsistent findings. evidence for the modality specific nature of awareness is provided by the differential patterns of clinical correlates depending on domain measured. we found that the relation between caregiver burden and distress depended on the modality of awareness measured: reduced awareness of function was associated with increased caregiver reports of burden, which is consistent with findings from previous research [10, 11, 14]. balance awareness was the only awareness measure associated with physical variables such as past history of falls and self-reported balance confidence. the relation between balance awareness and falls is consistent with previous research demonstrating a strong relationship between proprioception and balance or falls. balance awareness was not related to any measure of neuropsychological functioning, despite previously reported relationships between risk of falls and measures of executive function. although none of the domains of awareness were associated with measures of executive function, awareness of memory was associated with neuropsychological variables of the delayed memory index and the visuospatial/constructional indices from the rbans. the associations with neuropsychological variables differed, however, when the diagnostic groups were considered separately. interestingly, awareness of memory was not associated with the delayed memory scores for the ad group. a floor effect in the delayed memory score appears to have created problems with heteroscedasticity in the bivariate memory awareness relationship, which may have attenuated any associations. the possible floor effect in memory measures did not, however, impact the association between depressive symptoms and awareness of memory, only for the ad group. the findings of differential clinical correlates for awareness of memory based on diagnostic group may speak to some of the most contradictory findings regarding correlates of awareness. neuropsychological function is inconsistently related to awareness [1, 12, 19, 20, 27, 29], and the relationship between awareness in dementia and depression is complicated, with clinical lore and empirical data supporting the notion that increased awareness is associated with more symptoms of depressed mood [18, 25], but increased awareness and depression may only be related to subclinical (or dysthymia) rather than major depression. our data suggest that in addition to modality of awareness being considered when measuring associations of neuropsychological and depressive symptoms with awareness, diagnostic group is an additional important consideration. patients with dementia due to ad appear to have differential clinical correlates for awareness of memory versus patients with non-ad dementia, for example. although the prediction of differential clinical correlates for the different domains of awareness was supported, some of our predictions regarding these clinical correlates were contrary to previous research. in zero-order associations, severity was associated with awareness of function, but with no other domain of awareness. moreover, severity did not account for sufficient unique variance in awareness of function and was, therefore, not a significant predictor. this finding is in contrast to the cumulative cross-sectional data demonstrating an association between severity of cognitive impairment and awareness (see for a thorough review) and is contrary to the more compelling longitudinal data demonstrating decreasing awareness with increasing cognitive impairment [16, 18]. these contrasting findings likely speak to the orthogonal and domain-specific nature of the construct of awareness. aalten and colleagues ' and mcdaniel and colleagues ' prospective studies measured awareness by clinician ratings based on an interview with patient and caregiver regarding the patient's history of cognitive deficits and their impact on function. finally, all measures of awareness were associated with some measure of independence in daily function, particularly instrumental activities of daily living which is evidence against modality specificity. assessment of functional abilities as a clinical correlate for measures of awareness is not often reported in the literature, but the few studies that do exist suggest that decreased awareness is associated with increased functional limitations, which is consistent with our data. despite adding to the converging research on the modality-specific nature of awareness [4, 810], these data are limited by the inconsistency in the measurement methods used for each modality of awareness. measurement of awareness of function was based on caregiver/patient discrepancy, whereas awareness of memory and of balance was based on discrepancy between self-report and objective measures of performance. if awareness is a true construct, it should not be highly dependent on how it is measured. if, for example, awareness of function differs greatly when measured with caregiver/patient discrepancy versus patient/observation discrepancy, then this would not be a construct at all and would be considered an artifact of measurement. if awareness is an artifact of measurement, future research measuring awareness of different modalities of awareness with different methods for measuring awareness will find markedly different clinical correlates than those presented here. another more problematic limitation of these data is the fact that this sample is derived from a specialty clinic. specialty clinic patients have been postulated to have higher awareness than the general dementia population due to the referral process for specialty clinics. it is unclear how having higher awareness may have impacted the differential patterns of clinical correlates for these multiple domains of awareness. although replication is required, these data demonstrate differential patterns of clinical correlates for awareness of function and memory. in addition, this study provides a novel contribution by describing the clinical correlates for awareness of balance. these data provide evidence for modality specific relations between awareness and clinical correlates in a database with a wide range of standardized measures of clinical correlates including severity, function, neuropsychiatric symptoms, depression, caregiver burden and distress, and a comprehensive assessment of neuropsychological status. differing patterns of clinical correlates for awareness of function, awareness of memory, and awareness of balance provide support for the modality specific uniqueness of awareness measures for each of these domains. data demonstrating different patterns of awareness based on diagnostic group (namely, amci, non-amci, ad, and non-ad dementia diagnoses) provides further evidence for the modality specific nature of awareness. modality specificity, if replicated in different populations, for example, stroke patients, could have implications for rehabilitation. these data would suggest that rehabilitation needs to be targeted to a domain of awareness since awareness is not a unitary construct. future research is needed on the clinical course and implications for day-to-day care associated with impairments in specific modalities of awareness for persons with dementia.

awareness in dementia is increasingly recognized not only as multifactorial, but also as domain specific. we demonstrate differential clinical correlates for awareness of daily function, awareness of memory, and the novel exploration of awareness of balance. awareness of function was higher for participants with mild cognitive impairment (amci and non-amci) than for those with dementia (due to alzheimer disease; ad and non-ad), whereas awareness of memory was higher for both non-amci and non-ad dementia patients than for those with amci or ad. balance awareness did not differ based on diagnostic subgroup. awareness of function was associated with instrumental activities of daily living and caregiver burden. in contrast, awareness of balance was associated with fall history, balance confidence, and instrumental activities of daily living. clinical correlates of awareness of memory depended on diagnostic group: associations held with neuropsychological variables for non-ad dementia, but for patients with ad dementia, depression and instrumental activities of daily living were clinical correlates of memory awareness. together, these data provide support for the hypothesis that awareness and dementia are not unitary and are, instead, modality specific.

PMC3914567

pubmed-541

an adrenal incidentaloma is an adrenal mass, larger than 1 cm in diameter, detected on imaging studies performed for other indications than adrenal disease [1, 2]. the increasing use of computed tomography (ct) scans and magnetic resonance imaging (mri) causes a marked increase in incidence of adrenal incidentalomas. in approximately 6% of all autopsies and 4% of all abdominal ct scans an incidentaloma of the adrenal gland is discovered [4, 5]. the incidence of adrenal incidentaloma increases with age to an incidence of 10% in patients over 70 years old. adrenal incidentalomas are characterized by size, growth, imaging characteristics, and functional status. although rare, the normal function of the adrenal gland can be disrupted by adrenal incidentalomas. in most cases adrenal incidentalomas will be a small, nonhormonal active cortical adenoma, a benign impediment (80%). some adrenal incidentalomas cause hormonal hypersecretion (15%) or appear to be a primary or secondary malignancy (< 5%) [6, 7]. adrenal incidentalomas can cause disease by hypersecretion of hormones. conditions due to hormonal activity of adrenal incidentaloma include hypercortisolism, (cushing's syndrome), catecholamine excess (pheochromocytoma), or hyperaldosteronism (conn's syndrome). subclinical autonomous cortisol hypersecretion is the most frequent hormonal abnormality in patients with adrenal incidentalomas. some of these patients eventually develop overt clinical cushing's syndrome. adrenal cortical adenomas with or without hormonal overproduction vascular lesions of the adrenal are suggestive of a medullary derived pheochromocytoma, but confirmation of a pheochromocytoma by serum or urine measurement of metanephrines is required to diagnose pheochromocytoma. not only will the radiologist appoint this finding in the radiology report, the radiologist will often also add a recommendation for the next diagnostic procedure. this retrospective study aims to get a clear view on the detection rate of adrenal incidentalomas on abdominal ct scans in our hospital, and the subsequent diagnostic procedures used after detection of this incidental finding. this retrospective study was designed to investigate the detection rate of adrenal incidentalomas on abdominal ct scans. for inclusion in this investigation, an adrenal incidentaloma was defined as an adrenal mass, greater than 1 cm in diameter, initially discovered by diagnostic imaging for a clinical condition not related to, or suspicious for, adrenal disease. two investigators learned from an expert radiologist to examine ct scans of the abdomen for primarily the adrenal gland. each investigator independently evaluated 180 ct scans out of 360 ct scans, of many patients, that were indicated for diagnostics of hepatic, pancreatic, or renal pathology between 2005 and 2007. age, gender, indication for ct scan, and abnormalities in size or morphology, were noted. at the time of examining the adrenal glands, the investigators were not aware of the content of ct scans ' radiology report or indication for ct scan. only after their own judgement about size and aspect of the adrenal glands, indication for ct scan and the radiology report an expert abdominal radiologist (over 45,000 abdominal ct scans examined) reviewed the ct scans marked by the investigators with abnormal adrenal glands in size or morphology and results were compared. if an adrenal incidentaloma was mentioned in the original radiology report, the patients ' record was reviewed to determine whether additional investigations, for example, hormonal studies, additional imaging, or interventional diagnostic studies, were performed after the ct. an interobserver test was performed to evaluate the resemblance of the way of evaluation between the investigators and expert radiologist. the ct scans performed for suspected hepatic, pancreatic, or renal pathology of 75 new patients, between 2007 and 2008, were evaluated for this purpose. the interobserver variability was calculated with the friedman test, a non-parametric test for coupled observations, with independent observers. of the 360 patients studied, 206 (57%) were men and 154 (43%) were women. of the total of 360 patients, 4 patients were excluded because suspected adrenal pathology was also an indication for imaging in these patients. in the remaining 356 ct scans evaluated, the investigators discovered independently a total of 44 (12%) abnormal adrenal glands in 42 patients (2 bilateral adrenal incidentalomas). each radiology report was checked for adrenal incidentalomas which were already noted. in 25 (7%) of 356 patients an adrenal mass the expert radiologist reassessed the ct scans of 42 patients; the radiologist discovered 17 patients with an adrenal incidentaloma. two patients had bilateral incidentalomas, giving a total of 19 adrenal incidentalomas not noted previously (figure 1). the total number of adrenal incidentalomas was 44/356 (12%) in 42 patients. figure 3 shows an enlarged right adrenal not mentioned in the initial radiology report. in 64 of 356 (18%) patients, a malignancy was the indication for imaging. patients with an adrenal incidentaloma were more likely to have a malignancy as indication for ct scan, 20/42 (48%). the 25 patients that had an adrenal incidentaloma mentioned in the initial radiology report were checked for additional diagnostic procedures performed. in 3/25 patients a follow-up ct scan none of these patients showed hormonal overproduction caused by the adrenal lesion. in 2 patients (8%) a second ct scan was performed to exclude increase in adrenal size; there was no growth of the adrenal lesion shown. one patient who underwent a hemihepatectomy had a simultaneous resection of the right adrenal incidentaloma. the interobserver variation was calculated using a friedman analysis test to exclude or to demonstrate a significant difference in perception between different readers. the friedman test showed that there was no statistically significant difference in perception between the investigators and the radiologist (p=.867). the detection of adrenal incidentalomas in this study was 7% and the actual incidence of adrenal abnormalities was 12% after focused assessment of ct scans. this is high compared to other studies and can be explained by the relatively large group of patients who underwent imaging examination because of a malignancy [7, 11]. however, because of the absence of histological examination of the enlarged adrenal glands, it can not simply be concluded that these patients had metastases in the adrenal gland. the incidence of adrenal incidentalomas in the literature varies from 0.5% to 15% and depends mainly on the age of the investigated group [11, 12]. only 6 of 25 (24%) patients with an adrenal incidentaloma were further investigated with hormonal workup or imaging. one reason for the lack of additional diagnostic testing and treatment after detection of an adrenal incidentaloma is the lack of a clear evidence based guideline. also unfamiliarity with adrenal incidentalomas by the physician who has requested the ct scan will cause lack of additional screening. another reason for the lack of additional diagnostic testing of adrenal incidentalomas is the apparent lack of direct clinical consequences [13, 14]. undetected hormonal hypersecretion will probably reveal itself in time and the chance of an adrenal carcinoma is low with 0.72/million/year [10, 13]. because of this low risk of malignancy and because of the limited impact of hormonal overproduction in an asymptomatic patient, it is not clear whether a guideline for diagnosis and treatment of adrenal incidentaloma is necessary. such a guideline may cause an increase in diagnostic procedures with additional burden and uncertainty for the patient. a comprehensive cost-effectiveness study showed however that hormonal analysis of an adrenal incidentaloma is cost effective. the cost effectiveness of additional imaging of the adrenal gland is less clear in this study. in addition, the radiation dose to the patient becomes more important and therefore complementary imaging with an mri scan has its advantage. the optimal strategy for screening and followup of an adrenal incidentaloma is still under discussion. the guideline of the nih (2002) seems to be the best alternative in this debate, but the nih already recognized that the guideline is not based on hard evidence. (table 1) protocols on the diagnostic procedures of adrenal incidentalomas are described in several other publications as well, without describing additional prospective data on the clinical results of these protocols [9, 10, 1518]. there are currently no prospective studies that have examined the effects of an additional diagnostic procedure for adrenal incidentalomas. following this study a guideline for additional screening and followup was made (figure 2). in each radiology report a recommendation will be added for every patient with an adrenal incidentaloma and the referring physician is pointed to a webpage with a brief summary about adrenal incidentalomas. this website also contains the brochure with information for patients, which can be printed. in conclusion, it is not always noted by the radiologist and focused assessment of abdominal cts increased the detection rate of this abnormality form 7% to 12%. when detected and mentioned in the radiologist's report, only a small percentage of patients receives additional hormonal or imaging investigations to determine the nature of the incidentaloma .

objectives. the aim of this study was to investigate the detection rate of adrenal incidentalomas and subsequent workup. design. retrospective cohort study. methods. two investigators evaluated the adrenals on abdominal ct scans. abnormalities were compared to the original radiology reports and an experienced abdominal radiologist reviewed the ct scans. all additional imaging and laboratory tests were assessed. results. the investigators detected 44/356 adrenal incidentalomas (12%). in 25 patients an adrenal incidentaloma had been noted in the radiology report. the expert radiologist agreed on 19 incidentalomas in 17 patients, two with bilateral incidentalomas. of the 25 incidentaloma patients, 4 (16%) patients were screened for hormonal overproduction and 2 (8%) patients had follow-up imaging studies. conclusions. 12% of the patients had an adrenal incidentaloma (42 of 356). 17 (40%) had initially not been reported by the radiologist. when diagnosed with an adrenal incidentaloma, only a small percentage of patients (16%) is screened or undergoes repeated imaging (8%) as proposed in the national institutes of health (nih) guidelines on adrenal incidentalomas.

PMC4045521

pubmed-542

top down mass spectrometry describes an analytical process for the identification and characterization of whole proteins. the canonical top down experiment consists of a precursor scan to obtain the intact mass of the proteoform(s) under study and a tandem mass spectrum (ms/ms) obtained using ion fragmentation techniques such as ecd, etd, hcd, cid, or uvpd. the defining characteristic of a top down experiment is that the precursor ion is an intact proteoform, not the typical small peptides (less than 3 kda) produced from intentional enzymatic digestion prior to mass spectrometry (ms). thus, the mass of the precursor ion should represent a native proteoform present in the sample, with its fragment ion masses providing extensive characterization and verification of the primary structure. as larger proteins are targeted, experiments tend toward acquisition logic involving spectral averaging for both the precursor and fragment ions to improve the data quality. these combined data are then analyzed to infer the neutral masses of all intact and fragment ion species observed. for proteins analyzed by electrospray ionization, this analysis to infer mass (aim) uses either isotopic spacings for direct charge state assignment and/or deconvolution of protein charge states. historically, top down mass spectrometry has targeted the in-depth characterization of a small number of proteoforms; however, the past 5 years has seen a gradual transition to while the number of proteins able to be identified has risen into the thousands, the extent of characterization of each individual proteoform varies and currently there is no scoring framework that captures this aspect of top down proteomics. in certain cases, a protein (arising from a specific gene) may be identified confidently with no inference problem whatsoever, yet may be only partially characterized as shown in figure 1. in figure 1b, two equivalent proteoforms, one with a post-translational modification (ptm) in the first position and the other with the ptm in the second, will each have the same number of matching fragment ions. scoring systems based only on matching ions will report equal scores for these two proteoforms. this example illustrates how a proteoform can be clearly identified (i.e., the evidence supporting the identification of either of the two positional isomers is strong), yet not fully characterized. this problem of ptm site localization is encountered in bottom up, and has been dealt with in various ways. in targeted top down ms generating just a few spectra, manual reanalysis of data, or curation of the primary literature, can be used to select one protein form over another highly related one. in such cases, expert decisions are made to distinguish proteoforms with similar primary structures taking into account cleavage propensity of pairs of amino acids, complementary ion pairs, sequence tags, and mass errors of precursor and fragment ions. incomplete fragmentation may or may not lead to partial characterization of a protein molecule. in panel (a), the matched fragment ions uniquely determine the location of the post-translational modifications (ptms). in panel (b), incomplete fragmentation in the middle of the protein backbone does not yield a definitive ptm localization. in this particular example, the ptm could be located at either of two amino acids, resulting in an identified, but partially characterized proteoform. the c-score framework was developed to handle such cases, routinely encountered in top down proteomics. n-terminal fragment ions are colored red, while c-terminal fragment ions are shown in blue. the numbers below the fragment ions indicate how many ptms are reported on by each ion. with the shift to high-throughput, fully automated data collection, we now seek a framework for scoring of protein identification and proteoform characterization that builds in domain knowledge to achieve the quality of manual analysis without requiring it. all of the mathematical symbols used below are aggregated into table 1. fundamentally, the problem of identifying which proteoform is most consistent with an experiment combines both aspects of protein identification (which gene) and characterization (which proteoform). in practice, the problem is one of testing a series of hypotheses about which proteoform was present in the mass spectrometer, and then picking the each candidate proteoform (not simply its protein sequence) constitutes a hypothesis, but since candidate proteoforms does not represent all possible hypotheses to be tested, a scoring system must allow for the possibility that the best scoring proteoform is near the correct answer, but not exactly correct. further, it is frequently the case that the observed data can not conclusively differentiate between two or more related proteoforms (as in figure 1b), or the case where multiple proteoforms were actually fragmented together. typically, the way a proteoform score is used experimentally is not too dissimilar the use of scores in annotating novel nucleotide sequences with blast. for a given search, a minimum cutoff threshold is picked by the operator (a priori), and for each query the answer accepted as correct must be both the highest scoring result and greater than the cutoff threshold. the problem of inferring which proteoform, from the articulated prior list of proteoforms in a database, was observed within the mass spectrometer is well-suited to a bayesian approach (figure 2). in this case, bayes law can be rearticulated as follows:1where (1) pr(proteoformi|datams/ms) is read as the probability of the ith proteoform given the ms/ms data, and is known as the posterior probability of proteoform i given the observed data; (2) pr(proteoformi) is known as the prior probability of proteoform i; (3) pr(datams/ms|proteoformi) is read as the probability of the data given proteoform i, and is known as the likelihood of the data given proteoform i; (4) pr(datams/ms) is known as the probability of the data. by convention, this can be taken as the sum of all prior probabilities multiplied by their likelihoods across all hypotheses. notice that this term scales the posterior probability to be the fraction of the total of the numerators over all proteoforms interrogated. thus, a multiple testing correction across the database search is integral in this approach. this differs from controlling for the overall false discovery rate of an experiment which can, for example, be handled posthoc with a search against a scrambled sequence database in a manner analogous to that used in earlier work. problem of assigning which proteoform was present in the mass spectrometer during automated data collection can be envisioned as sorting a list of candidate proteoforms based on the observed ms data and a mathematical model of the process by which the observations were collected. bayes law provides a useful foundation for building these models. in practice, it is not required that the list of candidate proteoforms be explicitly articulated prior to the analysis. it is sufficient that all candidate forms can be calculated for an explicitly stated set. for example, listing base protein sequences and the ptms to be considered on these sequences defines a list of proteoforms, even if the list is never explicitly written. to be precise, we will define the following variables to restate bayes law from eq 1. let mo=observed precursor mass, mi=mass of the ith of n observed fragment ions, so {mi}i=1n is the set of all n observed fragment ions, and q=the qth of k candidate proteoforms in the database. the posterior probability of hypothesis q, as per eq 1, can be restated aswhere pr(q) is the prior since the probability of the data is, by convention, known, two values are needed to calculate the posterior probability for each hypothesis: the prior probability and the likelihood for the data. in many applications, the prior probabilities can be taken to be all hypotheses are equally probable (i.e., uniform prior probabilities). if there are k competing hypotheses, that is, k proteoforms in the candidate list, then each proteoform has a prior probability of 1/k, but this does not need to be the case. it is possible that one would want to assign proteoforms of proteins that contain experimentally demonstrated ptms (or transcripts informed by rna-seq) higher prior probabilities than proteoforms that contain chemically possible, but otherwise rarely observed modifications. for example, if there are two proteoforms that differ only in the location of a ptm such as in figure 1b, and one of the ptms was known to occur, while the other had never been reported, and the set of observed fragment ions failed to differentiate the two forms, then the known form should be considered the most probable form to have been observed. this degree of differentiation can be achieved with such a scoring system by first setting and then improving the prior probabilities with continued experimentation. prior probabilities are, by definition, based on information known prior to data collection and are in practice always somewhat arbitrary in their determination. in sharp contrast, the likelihood of the data given the proteoform is calculated under an explicit mathematical model of the processes used to generate top down ms data; calculation of this likelihood requires generative models. generate the probability of the observed data, given the proteoform in question. therefore, they take as input the proteoform, and as much knowledge of the measurement process as can be encoded in the model-creation process. for example, a generative model could include the propensity of individual pairs of amino acids to dissociate during fragmentation (e.g., x-p cleavage in ecd and etd is not possible, yet dp bonds are preferentially cleaved in threshold dissociation), or the model could include a function for the difference between the observed and theoretical intact mass. the more knowledge of the measurement process the generative model includes, the better, but since the task is to rank order the list of candidate proteoforms (figure 2), some details can be safely excluded from the generative model if they do not shift the proteoform rankings. for example, during manual data interrogation of an error-tolerant, top down search result, many researchers prefer the observed intact mass to match the theoretical, but allow for the possibility that the masses may not match because the best proteoform in the database is not the correct one. any scoring system that does not include the closeness of the observed ms1 to the theoretical ms1 is ignoring a valuable observation. next, this bayesian framework explicitly states the process in the form of two generative models; one for the precursor mass, and the other for the fragment ion masses. since the models are clearly articulated, they can be defended, rejected, or modified based on community discourse. in practice, this means that the process model can be modified and updated to reflect new understanding of the measurement process, or to reflect changes to the process used. for example, an automated data analysis system can use the same scoring mechanism, but employ different parameter sets that reflect experimental differences. experiments that use cid or hcd will employ different parameter sets in the generative models used for scoring than the same top down experiment employing ecd/etd or uvpd for protein ion fragmentation. it should be noted that the calculation of scores in this system differs from bayesian approaches commonly seen in biological sequence analysis. in those applications, the generative models usually have unknown parameters that need to be estimated from the sequence data, which is usually taken as being perfectly known. the application here is more like that of edwards where the process is considered known. as will be seen, our generative models have no unknown parameters; instead all values are taken from our knowledge of mass spectrometry, or from prior studies that focused on determining the needed value. thus, instead of inferring values from the data collected for the study in question, we have a framework for applying knowledge gained in analytic chemistry to the problem of protein inference. currently, prosightpc and prosight ptm report an expectation, or e-value, for each proteoform. this score is calculated by multiplying the probability of getting at least the observed number of matching fragment ion due to chance by the number of proteoforms interrogated. for this calculation, the probability of getting at least a given number of matching fragment ions is determined using poisson-based model. here we describe the implementation of this bayesian approach to scoring, and compare one set of generative models to the prosight ptm expectation value used within prosightptm and prosightpc. we show that our implementation, with its current generative models, provides an improvement over the existing scoring system as measured by area under the curve (auc) on the resulting roc chart (auc of 0.99 versus 0.78 for a complex human example and auc 0.85 versus 0.80 in pseudomonas). the observed data in a canonical ms/ms experiment includes (a) the neutral precursor mass, which gives the total molecular weight of the proteoform under study, and (b) a set of neutral fragment ion masses, that is, masses of the products resulting from fragmentation of the proteoform. also required is a database of possible proteoforms, each of which serves as a hypothesis that could potentially explain the observed ms/ms data. the database of possible proteoforms was generated by combinatorial expansion of all potential proteoforms using the known modification information in the uniprot knowledgebase. since the observed data mo and each fragment ion, mi, are independently conditioned on q, we could take unfortunately, this approach suffers from two limitations. first the magnitude of i=1n pr(mi|q) scales with n. larger lists of ms2 fragment ions lower the calculated value of the ms2 likelihood, relative to lists with few fragment ions, which makes it impossible to directly compare scores between separate queries with differing numbers of ms2 fragment ions. this can be mitigated by weighting by the geometric mean of the number of ms2 fragment ions; 1/n. second, this approach weighs the ms1 data as simply a single additional matching fragment ion. to avoid this, we introduce two scaling functions, f and g, to map the ranges of the individual generative model to a normalized range; for the precursor generative model, the function f is simply the identity function. for the fragment ion generative model, we define g by its logarithm base, which is simply a linear function on the logarithm base 10 of the fragment probability; g sets the logarithm base 10 of the minimum possible fragment probability to the logarithm base 10 of the minimum possible precursor probability and likewise for the maxima. if min1 is the minimum precursor probability, max1 is the maximum precursor probability, min2 is the minimum fragment probability, and max2 is the maximum fragment probability, then under an assumption of uniform prior, and given the likelihood functions from above, we have2equation 2 therefore reduces the posterior probability of a hypothesis to the data likelihood computation, with a normalization factor equal to the sum of the likelihoods under all possible hypotheses. since we have assumed that the given database of proteoforms is an exhaustive set of hypotheses, these generative models must allow for the possibility of observing related proteoforms that are not present in the database. the c-score system requires two generative models; one for the precursor mass mo and the other for the set of observed fragment ion masses, {mi}. these models fully prescribe how to compute the likelihood terms on the right-hand side of eq 2. note that the particular form of eq 2 implies that all the likelihood (probability) terms need only be computed up to a constant factor. this constant factor cancels between the numerator and denominator of the rhs of eq 2. the probability pr(mo|j) of an arbitrary protein sequence j (of theoretical mass mj) producing the observed precursor mass mo can be modeled as a function of m, the difference between the mo and mj. we create the probability distribution pr(mo|j) such that masses within m of mj have the highest probability, and this probability reduces as a truncated gaussian function with =1, =30 da, and a minimum value of 1 10. notice that we only need to specify pr(mo|j) to a constant factor (i.e., we only need to specify a non-negative function f (mo, j) proportional to the probability), and the normalization factor (1/0max(mo)f(mo,j)dmo) that converts it to a probability density function is assumed implicitly. to specify the probability distribution pr(mi|j), we need an ms2 generative model based on our knowledge of the measurement process during tandem mass spectrometry. we note that each fragmentation event involves cleavage of the intact proteoform at one bond on the protein backbone, resulting in exactly two fragments (although both may not be observed in the spectrometer). the fragmentation propensity depends on the pair of adjacent amino acids flanking the cleavage site. the generative model we choose is based on this observation, and uses the following basic ideas: (1) each theoretically possible fragment ion mass defines a region of width 2m (m m, m+m) called a permissible region. an observed mass mi within a permissible region has a probability proportional to the cleavage propensity of gas phase protein ions at that permissible region. (2) an observed fragment ion mass mi outside of any permissible region has a small, constant probability. these ideas are captured in the probability distribution function of figure 3. in principal, for any given j, the probability distribution pr(mi|j) is constructed by assigning a height to every point in the range (0, mj), where mj is the theoretical precursor mass. in practice, ms2 mass lists can contain unexpected ions with mass values greater than mj, and so an arbitrarily large mass of 4 million daltons is taken in place of mj. (the value of 4 million daltons was selected as it is safely above the mass of the largest protein known, titin at 3.9 mda, and allows for a modified form of titin to be present. in practice, this value is effectively infinity.) the assigned heights across the entire range are divided by the total area under the curve, thus defining a probability density function. the heights are assigned as follows: step 1: determine all theoretical fragment ions that j can give rise to, noting their mass and the n- and c-terminal flanking amino acids at each cleavage site. step 2: for each theoretical fragment ion, calculate a weight,, proportional to the product of the cleavage frequencies for both flanking amino acids as previously determined for the appropriate fragmentation method. thus, if and are the two flanking amino acids, and f and f are their respective cleavage frequencies, we set =ff. the permissible region associated with a theoretical fragment ion mass, m, is assigned a consistent height equal to the weight computed for the corresponding theoretical fragment ion. step 3: any point in the range (0, mj) but outside of all permissible regions is assigned a height of noise, which is a constant. ms2 generative model for fragment ions observed in tandem mass spectrometry (ms/ms). for instruments capable of ms/ms with accurate mass, thin (e.g., low part-per-million wide) permissible regions occur with a search-defined width around each theoretical fragment ion mass. the heights of these regions are scaled by the propensity of the cleavage events required to form the theoretical ion. different fragmentation methods require different weights, for example ecd has different fragmentation propensities than cid. a very low probability, the weight for chemical or electronic noise, is assigned to any observed mass that does not match one of the theoretical masses. we noted above that the probability density function is obtained by dividing the above-mentioned height function by the sum of the area under the curve, which is different for different j. this total area, denoted by tj, is computed as follows: the kth permissible region has a height equal to k and a width equal to 2m. regions outside of permissible regions have a height of noise and a total width of p 2(len 1)m, where len is the length of the protein sequence. the resulting probability density function is3 the expressions on the right-hand side specify a probability density while the expression on the left-hand side is a probability mass, which, strictly speaking, should be equated to the probability density over a very small mass interval ,. however, such a correction can be safely ignored here because the probability mass pr(mi|q) is used only in the context of eq 2, with equal powers of in numerator and denominator. using eqs 2 and 3, it is now possible to calculate a posterior probability pr(q|mo,{mi }) for every sequence q in the database. this posterior probability is proportional to the likelihood pr(mo,{mi}|q) since we assume uniform priors (eq 2). therefore, our search for the maximum a posteriori hypothesis q is equivalent to a maximum likelihood estimation (mle) search, that is, we report the q that maximizes pr(mo,{mi}|q). we report the best hypothesis q along with its phred-like characterization score, which can be written as c=10log10(1 pr(q|mo,{mi })). this final c-score transformation scales the posterior probability of q to the familiar range used in many other bioinformatic applications. c-scores span the standard phred-like score range of 0 to>500. practical ranges of the c-score are evaluated with specific examples and reported in the main text below. therefore, a c-score of 40 is sufficient to judge a proteoform as extensively or fully characterized, while proteoforms with c-scores between 3 and 40 are identified, but only partially characterized. a c-score below 3 indicates insufficient evidence for either identification or characterization. note also that since the c-score represents a nonlinear transformation of the posterior probability, which is itself normalized by pr(datams/ms), there is a functional relationship between the highest score in a search, and the second highest score (supporting information figure 1). the typical usage of a score such as the c-score is in high throughput data processing. an operator picks a threshold level of the score and then asserts that any query scoring above the threshold identifies the target data. this is done routinely in annotating dna sequences with tools such as blast. to test the utility of a new scoring model, a set of data where the correct answer can be considered known is needed; this forms the ground truth of the analysis. when the new scoring system gives the known true answer both as the highest score, and the scoring above the operator-defined threshold, the system is said to have delivered a true positive. likewise, when the best proteoform scoring above threshold is not the known correct answer, it is scored as a false positive, and so on for both true and false negatives. sensitivity is the proportion of positives which are actually classified as such for a given threshold. likewise, specificity is the proportion of negatives that are correctly identified as such. for any given arbitrary threshold of a score, a specificity and sensitivity can be calculated from a known data set. by iterating over a number of thresholds, and plotting the resulting sensitivity against its corresponding specificity (or by convention, against 1-specificity) a receiver operating characteristic curve this curve is known to be indicative of the utility of the classifier. by repeating this iterative analysis of with multiple scoring systems, the relative utility of the systems so, to compare the new c-score with the existing prosight e-value, test input data sets with known correct answers are needed. these data sets are searched against the appropriate proteoform database and, for each proteoform returned, the e-value and c-score is calculated. next, an arbitrary list of threshold values is generated for each score, and for each threshold value in this list, a list of identified proteoforms is generated. the identified proteoform is taken as the form that is both above the threshold score, and to be the highest scoring proteoform. it is therefore possible for a search not to return a proteoform, if no proteoform scores above the cutoff threshold. when searching a test data set with known correct answers, it is possible to classify the search results as either a true positive, true negative, false positive, or false negative. from these classifications, these specificity and sensitivity couplets then become points on the roc chart curve for a given score. the human data files used in this analysis were acquired in the course other studies published previously. briefly, mitochondrial membrane proteins were isolated from hela s3 cells and separated using a gelfree 8100 fractionation system (expedeon) as described previously. for the analysis at hand, 295 top down experiments from a nanolc-velos orbitrap elite ms analysis of a gelfree fraction containing 1520 kda proteins were selected for intensive manual interrogation to provide a set of highly curated known positives to test parameter sets within the generative models used in development of the c-score framework. pseudomonas aeruginosa were grown on rich media to mid-log phase, were isolated by centrifugation, lysed, separated with gelfree, and analyzed with mass spectrometry using the methods referenced above. for the secondary data set, a descriptive analysis of intact and tandem mass spectral data was performed using rawmeat 2.1 (http://vastsci.com/rawmeat/, vast scientific). using these data, related ms2 scans were merged and individual prosight upload format (puf) files were created for each data set. a combination of qualbrowser and prosightpc 3.0 (both thermofisher, san jose, ca) was used, and all potential precursors predicted to have been in the ms1 isolation window were added as potential proteoforms for the experiments. both ms1 and ms2 data were deisotoped using the xtract algorithm embedded within prosightpc 3.0, generating 623 single experiment puf files. (containing 460 000 forms) and homo_sapiens_2012_02_top_down_complex (containing just over 10 million forms) which are prosight warehouses (.pwf files) for human proteins built against uniprot release 2012_02, available for download (ftp://prosightftp:[email protected]/2012_02/eukaryotes/homo%20sapiens/). experiments with single proteoforms were selected and verified by at least two group members trained in top down proteomics data analysis, to be considered as true answers, and while subjective each met the following two criteria: the most abundant fragment ions must be accounted for, and the intact mass difference between theoretical and experimental must be small (< 10 ppm) or must be explainable (1 da errors from deisotoping, a previously unknown or unannotated post-translational modification, oxidation, etc.). this will typically involve the assignment of>50% of fragment ions appearing at a signal-to-noise of 10:1 or higher. however, we note that both experimental conditions (e.g., overfragmentation, generating internal ions) and the selection of data processing parameters will affect the quality of data and thus the fraction of ions matched for each experiment. if evidence was not sufficient to uniquely identify one proteoform for an experiment (arising either from poor data quality or from multiple proteins being fragmented simultaneously), the experiment was excluded from further study here. using these heuristics, 295 puf files where only one proteoform was present were selected for use here. these files are described in supporting information table 1 and provided in supporting information data set 1. to facilitate a comparison of c-scores and e-values, a custom c #this application takes, as input, a collection of puf files, the list of manually validated correct answers, and the c-score version number (with a specific parameter set) to use. the c-score version allows various iterations of generative models to be tested against the e-value and each other. the output from the application is an excel spreadsheet containing a correct score and actual score for both the e-value and the c-score. during execution, this application runs prosightpc absolute mass and biomarker searches on each puf file to compile actual search scores. the correct scores are then calculated using the list of correct answers (supporting information table 1). the c-score will be available for testing within the proteoform characterization tool, hosted by the consortium for top down proteomics (http://www.topdownproteomics.org). to compare the e-value to the c-score, we chose as our first input a set of 295 puf files (described above) and a c-score version of 1.0. the list of correct proteoforms for each of the 295 targets was provided as a csv file. the custom console application was then used to generate an excel spreadsheet that was further analyzed. two roc curves (one for each score) were plotted on the same chart by checking, for each target, whether the top scoring proteoform was the correct proteoform (figure 4). subsequently, additional roc curves were generated, where a target was counted as incorrect if the correct proteoform merely tied for the best score, but other proteoforms also shared the same score value. we also calculated the area under each curve as a quantitative measure of difference. two additional roc curves where generated as before but the correct answer would only be considered a true positive if it uniquely had the best score. thus, for these curves, if the correct proteoform failed to out-score all other proteoforms in the database it was not considered a true positive. this process was repeated for 136 proteoforms from pseudomonas aeruginosa (data are provided in supporting information data set 2). (a) receiver operating characteristic curves comparing c-scores and e-values on the 295 experiments in the manually curated test data set. the area under the curve for the blue c-score is 0.99 compared to 0.78 for the orange e-value. notice the large difference in sensitivity of the e-value in the low fpr region, between when ties for the best score are considered as acceptable for identification or not. although present in c-scores, the problem is much less pronounced, and at a much higher sensitivity. (b) histogram of the 295 c-scores obtained from searching the human database (forward) compared to the c-scores obtained from searching the same experimental data against a scrambled decoy database. of the decoy hits, only 7% had a c-score above 40, likewise 42% of the forward c-scores are above this value. the c-score was substantially better than the e-value at identifying and characterizing the correct proteoform from the data set of 295 human test cases, as well as the 136 pseudomonas test cases. figure 4 shows a receiver operating characteristic (roc) curve for both scores on the human data, and the area under the curve for the c-score was 0.99 compared to only 0.78 for the e-value. for the pseudomonas test cases, the c-score also outperformed the e-value with aucs of 0.85 to 0.80, respectively. clearly, the c-score (with the v1.0 parameter set) dominates the e-value for all levels of specificity and sensitivity. since the e-value is simply a nonlinear transformation of the number of matching fragment ions, it seems reasonable to assert that this improvement comes from the new score s ability to include additional factors such as known fragmentation propensities and ms1 mass differences both of which are known to be relevant in characterizing proteoforms. these and other such factors are not considered by the current e-value, nor is the score easily extended to consider such factors. when the data are sufficient to completely characterize a proteoform, the c-score is often well above 40, indicating hyperconfidence in the characterization power of the underlying data (figure 5a). however, a major limitation of the e-value occurs when many proteoforms share the same (seemingly confident) score. this can be seen in figure 4 as the vertical distance between the two e-value lines in the specificity range of 0.81.0 (fpr 0.00.2). figure 5b and c shows two example cases where there is equal evidence for two distinct proteoforms, one with an n-terminal acetylation and the other with the acetylation localized to k7. in this example, these two proteoforms share a confident e-value of 7 10; however, their c-scores are tied, yet at a much less confident value of 3. using the data from these two manually annotated sample sets, and with the understanding of the c-score model, we assert three operating ranges for the c-score: c-score>40 proteoform is both identified and fully characterized; 3 c-score 40 proteoform is identified, but only partially characterized; c-score<3 proteoform is neither identified nor characterized. (a) a result with a very high c-score of 525, indicating a fully characterized proteoform of protein cytochrome b-c1, o14957. (b, c) two proteoforms with equivalent e-values and c-scores for 10 kda heat shock protein, p61604. these data show the complementarity between the e-value (scores protein identification well) and the c-score (reflects confidence in characterization of related proteoforms on a phred-like score from 0 to>500). to achieve separation between the two proteoforms in figure 5b and c, future iterations of the c-score will allow for differential probabilities for n-terminal acetylation and internal acetylation. n-terminally acetylated, so one may posit that, in the absence of evidence to the contrary, n-terminal acetylation is more likely than internal acetylation. the c-score model can incorporate this bias and many similar issues that provide biochemical and biological context. to achieve even more specificity and sensitivity in the c-score framework, one may use a proteomic database, such as gpmdb, to use peptide-level information linked to the specific gene product to inform these differential probabilities in top down proteomics experiments. in the case of uniprot entry p61604, gpmdb reports that n-terminal acetylation was observed in 69/69 studies, making the proteoform reported in figure 5b a much more likely than the proteoform reported in figure 5c. the characterization of high-throughput lc ms/ms experiments, where hundreds of ms/ms targets are automatically generated for each lc run, forms the foundation of high throughput top down proteomics. our probabilistic formulation leverages the knowledge of fragmentation propensities and may be further extended to incorporate other types of prior information to improve the scoring (vide supra). to characterize unknown ptms (e.g., a previously unknown methylation), we can extend our c-score model to give a higher probability to common ptm mass shifts (i.e., 42.0105 da for acetylation, 79.966 da for phosphorylation, etc.), thereby boosting the data likelihood. this will be particularly useful in complex eukaryotic proteomes where the inclusion of all theoretically possible proteoforms in the database (even at search run time) is computationally prohibitive. this framework provides a great deal of flexibility for having an appropriate scoring systems for a given experimental procedure. our current assumption of uniform priors on candidate proteins makes our procedure a maximum likelihood (ml) inference, but the framework can be readily extended to allow for nonuniform priors without additional overhead. nonuniform priors may be useful when researchers have a priori belief that some protein forms (e.g., particular combinations of ptms or splice variant) are more likely to be present in the sample (e.g., from rna-seq data). further, the score remains robust when used with instruments with decreasing mass accuracy. supporting information figure 2 shows the roc chart resulting from rerunning the analysis on the human test data set with increasing mass tolerances. as tolerance increases, the discriminative power of the score decreases as more fragment ions will match by chance. in sum, we have shown a promising scoring system for protein identification and proteoform scoring to better capture the information content in high-resolution top down proteomics. the c-score model lays forth a path to increase the sophistication of protein identification and characterization platforms to extract maximum value from ms-based proteomics in automated fashion. the conceptual and demonstrable advances outlined above provide a deterministic process to advance the utility of proteomics for nonexperts. non-bioinformaticists/non-proteomicists to advance protein-based science based on proper description of the fully articulated primary structure for whole proteoforms. when coupled with high value experimentation, we posit that the faithful and more efficient conversion of data streams into knowledge will significantly advance major breakthroughs in mechanistic biology and on the front lines of disease research including improved discovery and validation of protein-based biomarkers .

the automated processing of data generated by top down proteomics would benefit from improved scoring for protein identification and characterization of highly related protein forms (proteoforms). here we propose the c-score (short for characterization score), a bayesian approach to the proteoform identification and characterization problem, implemented within a framework to allow the infusion of expert knowledge into generative models that take advantage of known properties of proteins and top down analytical systems (e.g., fragmentation propensities, off-by-1 da discontinuous errors, and intelligent weighting for site-specific modifications). the performance of the scoring system based on the initial generative models was compared to the current probability-based scoring system used within both prosightpc and prosightptm on a manually curated set of 295 human proteoforms. the current implementation of the c-score framework generated a marked improvement over the existing scoring system as measured by the area under the curve on the resulting roc chart (auc of 0.99 versus 0.78).

PMC4084843

pubmed-543

chest physiotherapy is routinely employed as a prophylactic measure prior to major surgery and postoperatively to prevent respiratory complications such as atelectasis and pneumonia.1 at present, only limited evidence is available for some of the physiotherapeutic techniques used in patients with copd.2,3 physiotherapy treatment enhances sputum evacuation4 and can be applied as a single technique but usually a combination of techniques is applied to patients with copd. intrapulmonary percussive ventilation (ipv) is a ventilatory technique that uses a device to deliver small bursts of high-flow air into the lungs at high rates, superimposed upon the spontaneous breathing pattern. this causes airway pressures to oscillate between 5 and 35 cm h2o and the airway walls to vibrate in synchrony with these oscillations. a unique sliding venturi, called a phasitron, which is powered by compressed gas at 0.6 to 6 bar, generates these oscillations in the range of 80 to 650 cycles per minute.5 although several studies have addressed the physiological effects of ipv when used in copd patients, there is need for confirmation of its clinical effectiveness. previously, the effects of ipv in copd patients were assessed using lung function parameters, arterial blood gases, and duration of hospitalization. recently developed assessment techniques may give new insights into the effectiveness of airway clearance techniques. one promising new technique is computational fluid dynamics applied to the three-dimensional (3d) images made by ct scanning; this technique allows evaluation of flow and resistance of separate parts of the lung.6,7 in the present study, this novel imaging was used, in addition to more conventional outcome parameters, to visualize the effects of a single ipv treatment in copd patients. five moderate to severe copd patients (three females and two males) with global initiative for chronic obstructive lung disease stages 3 to 4, who were hospitalized for an acute exacerbation, were included in this study. tests were performed before and after ipv treatment in a specific order to minimize the influence on other tests. for pre-treatment tests, the sequence was set as follows: forced oscillation technique (fot) in upright sitting and supine positions, conventional lung function measurements (including spirometry and body plethysmography measurements), in- and expiratory muscle strength, diffusion capacity, arterial blood gases sampling, and finally a 3d low-dose ct scan was taken within 1 hour prior to the ipv treatment. patients were asked to score their dyspnea on a borg dyspnea scale before and after the treatment. no significant changes were evident in the spirometric or body plethysmographic indices due to ipv treatment. respiratory muscle strength after a single session tended to decrease, but the changes in inspiratory and expiratory muscle strength were not significantly different. we observed a small but nonsignificant change in the dlco/va (diffusion capacity of carbon monoxide): corrected for alveolar volume ratio (p=0.066). four out of five patients coughed up one or more flumes during the ipv treatment. all patients reported that they subjectively felt better after the treatment (the change in borg dyspnea score, however, was not significant: p=0.083). arterial saturation tended to increase after a single ipv session but the changes were not statistically significant (sao2 at baseline and post-ipv treatment: 95% 3% and 96% 1%, respectively; p=0.066). 3d airway reconstructions based on the computed tomography (ct) images were made for each patient. for example, some peripheral airways that were blocked before the treatment (possibly due to mucus plugging) were reopened after the treatment. some airway branches were opened up after ipv and other airways were closed after a single ipv session (figure 2). the resistance measurements by body plethysmography and fot both showed a tendency toward an increase in airway resistance. the increase, however, was not statistically significant (p=0.109 and p=0.080 alveolar volume for body plethysmography and fot, respectively). computational fluid dynamics (cfd) were used to calculate the local resistances for the different branches in the airways. specific airway resistance, calculated for the local changes in airway resistance, showed changes after the ipv treatment; however, none of the changes were statistically significant. although the 3d computer models showed no changes in the overall airway resistance, local changes were observed, as indicated in figure 2. branches with airway blockage in the preintervention scan were reopened in the post scan. in these branches, airway resistance seemed to decrease, possibly due to movement of mucus; however, this is yet to be confirmed by the use of a control group. table 2 gives an overview of the airway changes observed in the different patients after a single ipv session. although data shown here are not compared with the data of a control group, 3d ct imaging has the potential to evaluate the displacement of mucus plugs and removal of mucus plugs in some copd patients after an ipv treatment. although we saw changes, the use of a control group is needed to confirm our findings. our study focused on the visualization of the short-term effects of a single ipv treatment. we used functional imaging to demonstrate that the airway geometry was changed by the ipv session whereas lung function parameters did not show any significant differences. the sample size in the present study is small; more patients are needed to verify these findings. the accuracy of ct imaging has been confirmed for the assessment of the bronchodilator response in asthmatic patients8 and for the particle deposition of an aerosol in the lung.9 the usefulness of 3d imaging and cfd processing has also been shown in the assessment of changes in upper airways 10 and small airways.11 for example, cfd can detect changes in airway resistance in patients with asthma.8 one of the main advantages of the cfd method is that this technique allows investigators to make specific models of the patient s airways for use in analyses.12 in our study, we demonstrated that the effect of a single ipv treatment could be evaluated using functional imaging. despite its small sample size, this study demonstrated that local treatment effects could be visualized with 3d imaging of the airways. the resulting models allow a calculation of the change in airway volume and change in airway resistance. the technique can be used for comparison with traditional outcome parameters, which opens up perspectives for evaluation of physiotherapeutic drainage techniques, and may allow standardization and validation of different airway clearance techniques. further research should focus on the relationship between mucus displacement and local changes in airway flow and resistance.

objective: chest physiotherapy enhances sputum evacuation in copd patients. it can be applied as a single technique or as a combination of techniques including intrapulmonary percussive ventilation (ipv). recently developed assessment techniques may provide new insights into the effect of airway clearance techniques.participants:five moderate to severe copd patients (three females and two males; mean forced expiratory volume in 1 second of 39.49% predicted) who were admitted in the hospital for an acute exacerbation were included in this study. methods:a novel imaging technique was used, together with other conventional techniques, to visualize the short-term effects of a single ipv treatment in copd patients. results:no significant changes were noted in the lung function parameters or arterial blood gases measured within 1 hour after the end of the ipv session. computed tomography images detected changes in the airway patency after the ipv treatment compared with before treatment. local resistances, calculated for the three-dimensional models, showed local changes in airway resistance. conclusion:the effects of a single ipv session can be visualized by functional imaging. this functional imaging allows a calculation of changes in local airway resistance and local changes in airway volume in copd patients without affecting conventional lung function parameters.

PMC3459658

pubmed-544

gastrointestinal stromal tumors (gists) are the most common mesenchymal neoplasms of the gastrointestinal tract, with a mean annual incidence of 1015 cases per million people, affecting mainly older individuals at a median age of 5565 years [14]. radical surgery is the treatment of choice in primary resectable gists, but almost all gists are associated with a risk of recurrence, and approximately 4050% of patients with potentially curative resections develop recurrent or metastatic disease [5, 6]. radiotherapy has restricted efficacy in the management of gists, principally because the tumor location is surrounded by dose-limiting vital organs. the prognosis of patients with inoperable or metastatic gists was poor until the beginning of the 21st century, when significant progress in understanding the molecular pathogenesis of gists resulted in development of a treatment that has become a model of targeted therapy in oncology. the introduction of imatinib mesylate (gleevec or glivec; novartis), a small-molecule selective inhibitor of receptor tyrosine kinases, has revolutionized the treatment of gists, both in the adjuvant setting and in advanced (i.e., inoperable and/or metastatic) cases. on the basis of recently published results of a clinical trial comparing 12 and 36 months of adjuvant imatinib therapy, demonstrating clinical benefit of longer imatinib treatment in terms of delaying recurrences and improving overall survival (os), both the us food and drug administration (fda) and the european medicines agency (ema) have updated their recommendations and approved 36 months of imatinib treatment in patients with v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog (kit)-positive gists (also known as cd117-positive gists) at high risk of recurrence after surgical resection of the primary tumor. gists may originate anywhere in the gastrointestinal tract most frequently in the stomach, followed by the small intestine. they comprise a heterogeneous group of tumors ranging from small lesions with clinically benign behavior to highly aggressive malignant tumors [810]. metastases develop mainly in the liver or intraperitoneally and may even occur more than 10 years after surgery on the primary lesion, necessitating long-term follow-up of gist patients [9, 11]. gists are believed to arise from progenitors related to the interstitial cells of cajal, which are the pacemakers for peristalsis [1214]. approximately 8595% of gists express kit, which is currently used for routine immunohistochemical diagnosis. other well-established immunohistochemical markers used for differential diagnosis include dog1 [discovered on gist-1; encoded by the ano1 (anoctamin 1, calcium activated chloride channel) gene], cd34 (a hematopoietic progenitor stem-cell antigen), smooth muscle actin, s100 protein, and desmin (a muscle cell marker) [1621]. characteristic genomic alterations in both benign and malignant gists mainly involve chromosomal losses of 1p, 14q, and 22q. additional cytogenetic abnormalities present in metastatic gists involve losses of chromosomes 13q, 15q, and 18, and partial deletions of 11p and 9p [including tumor suppressor genes cdkn2a (cyclin-dependent kinase inhibitor 2a) and cdkn2b], as well as gains of 5p, 8q, and 17q [2228]. approximately 7580% of sporadic gists harbor kit-activating mutations, and another 513% of sporadic gists carry platelet-derived growth factor receptor, alpha polypeptide (pdgfra)-activating mutations [29, 30]. about two thirds of all mutations in gists occur at the 5 end of kit exon 11. less common primary mutation sites in kit include the 3 end of exons 11 and 9. the most frequently mutated region in pdgfra is exon 18, typically exhibiting the p.d842v substitution. approximately 1015% of gists do not present detectable mutations in kit or pdgfra [2940]. kit/pdgfra wild-type gists arise mainly from the stomach and are characterized by distinct clinical and pathological features, including predominant incidence in young female patients, epithelioid morphology, frequent lymphovascular invasion and lymph node metastases, and unpredictable clinical behavior. wild-type gists carry inactivating mutations in genes coding for mitochondrial succinate dehydrogenase (sdh) complex ii subunits a, b, c, and d, which are components of the krebs cycle and the respiratory chain. additionally, this subgroup of gists express insulin-like growth factor 1 receptor (igf1r). wild-type gists are commonly associated with carney s triad, carney-stratakis syndrome, or neurofibromatosis type 1 [4151]. table 1 summarizes the most important molecular features of gists in terms of kit and pdgfra mutational status. table 1molecular classification of gastrointestinal stromal tumors (gists) according to v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog (kit) and platelet-derived growth factor receptor, alpha polypeptide (pdgfra) mutational statusgenotypefeatureskit mutations (7580% of sporadic gists) exon 11most common mutation in sporadic gists (6570 %); present in tumors localized at all gastrointestinal sites; best response to imatinib; also reported in familial gists exon 9more common in gists originating from the small bowel/colon; intermediate/dose-dependent response to imatinib in advanced gists exon 13present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib; reported in familial gists; more often as secondary mutations in imatinib-resistant tumors exon 17present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib (except for p.d816v); reported in familial gists; more often as secondary mutations in imatinib-resistant tumorspdgfra mutations (513% of sporadic gists) exon 12present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib exon 14only a few cases described in the literature; more common in gists originating from the stomach exon 18more common in gists originating from the stomach, usually with epithelioid morphology; often related to indolent clinical behavior; p.d842v is the most common and is resistant to imatinib; other exon 18 mutations are sensitive to imatinibkit/pdgfra wild typefrequent in pediatric gists; poor response to imatinib; typical for gists related to neurofibromatosis type 1, carney s triad (gastric gist+pulmonary chondroma paraganglioma), or carney-stratakis syndrome (gist+paraganglioma, characterized by mutations in genes encoding sdh subunits sdha, sdhb, sdhc, sdhd), and/or igf1r expressionigf1r insulin-like growth factor 1 receptor, sdh succinate dehydrogenase molecular classification of gastrointestinal stromal tumors (gists) according to v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog (kit) and platelet-derived growth factor receptor, alpha polypeptide (pdgfra) mutational status igf1r insulin-like growth factor 1 receptor, sdh succinate dehydrogenase imatinib mesylate was initially developed for the treatment of chronic myelogenous leukemia, to specifically inhibit the tyrosine kinase activity of breakpoint cluster region c-abl oncogene 1, non-receptor tyrosine kinase (bcr abl) fusion oncoprotein. however, in preclinical studies, it was demonstrated that imatinib also inhibited the activity of kit, pdgfra/b, abl1, and abl2 (also known as arg) tyrosine kinases [53, 54], which encouraged examination of imatinib therapy for other neoplasms driven by constitutive receptor tyrosine kinase activation. the first report describing imatinib treatment in a gist patient with multiple metastatic lesions demonstrated a dramatic response to this therapy. as early as 2002, imatinib was registered for treatment of advanced gists (i.e. in metastatic and/or recurrent and/or inoperable disease). the results of several clinical trials confirmed the high efficacy of imatinib in the treatment of gists in the majority of patients with inoperable/metastatic disease [5660], prolonging median survival from 1019 months (historical data) to approximately 5 years. two large, parallel, very similar international studies comparing a standard imatinib dose of 400 mg daily with a high dose of 800 mg daily demonstrated a similar response rate and os with the two imatinib doses but better progression-free survival (pfs) in the high-dose treatment arm [6062]. moreover, data from these trials have shown that the response of gists with kit exon 9 mutations depends on the dose of the drug, and that these patients benefit from a higher dose (800 mg daily) of imatinib, demonstrating significantly longer pfs (18 months) than patients receiving a standard dose of 400 mg daily (6 months). unfortunately the spectacular activity of imatinib is time limited, and secondary resistance develops in the majority of patients [11, 61]. although the treatment of choice in primary resectable localized gists is radical resection with negative margins, almost half of the patients ultimately develop recurrent or metastatic disease after potentially curative surgery. therefore, the idea of adjuvant therapy with imatinib after primary resection has been evoked to delay or prevent relapse and to prolong patients survival. the role of imatinib therapy in the adjuvant setting has been evaluated in several phase ii and iii clinical trials, namely acosog z9000 and z9001 (conducted by the american college of surgeons oncology group), ssgxviii/aio [7, 65] (conducted by the scandinavian sarcoma group and the sarcoma group of the arbeitsgemeinschaft internistische onkologie xviii), rtog s0132 (conducted by the radiation therapy oncology group), and eortc 62024 (conducted by the european organization for research and treatment of cancer). table 2 presents the most important clinical trials of adjuvant imatinib in gists. data from the phase iii acosog z9001 trial evaluating 1 year of adjuvant therapy with imatinib 400 mg daily versus placebo in patients after microscopically radical (r0) resection of gists at least 3 cm in diameter showed a significant reduction in the risk of recurrence from 17 to 2% at 1 year (during 20 months of follow-up) [p=0.0001], with a hazard ratio (hr) of 0.35. although the treatment was well tolerated, no significant impact on os was demonstrated, thus implying that adjuvant imatinib delays rather than prevents relapse. the eligibility criteria for this trial were clearly inadequate because more than 40% of patients had tumors between 3 and 6 cm in size, which in the majority were at low risk of relapse and did not require adjuvant therapy after surgery. nevertheless, in 2008, imatinib was approved for use in adjuvant therapy after resection of primary gists in patients at significant risk of relapse. importantly, the initial approval lacked definite guidance concerning the optimal duration of treatment and risk assessment criteria. table 2the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors (gists)studystudy designno. 2009 one arm, open, multicenter; imatinib 400 mg daily for 1 year107primary gist kit-positive after radical resection; high risk of relapse: tumor size 10 cm or tumor rupture or<5 intraperitoneal metastasesos at median follow-up of 4 years; 1-year os: 99 %; 2-year os: 97 %; 3-year os: 97% rfs at median follow-up of 4 years; 1-year rfs: 94 %; 2-year rfs: 73 %; 3-year rfs: 61% kang et al. 2009 one arm, open, multicenter, prospective; imatinib 400 mg daily for 2 years47primary gist with exon 11 kit mutation after radical resection; high risk of relapse: tumor size 10 cm or mitotic index 10/50 hpfs or tumor size 5 cm and mitotic index 5/50 hpfsrfs at median follow-up of 26.9 months; 1-year rfs: 97.7 %; 2-year rfs: 92.7% li et al. 2011 open, non-randomized, prospective, one center; imatinib 400 mg daily for 3 years versus observation56 (imatinib), 49 (observation)primary gist kit-positive after resection; intermediate or high risk of recurrence (nih classification): tumor size>5 cm and/or mitotic index>5/50 hpfssignificantly better rfs in the imatinib arm as compared with observation at median follow-up of 45 months (hr 0.188, 95% ci 0.0850.417; p<0.001); 1-year rfs: 100 versus 90 %; 2-year rfs: 96 versus 57 %; 3-year rfs: 89 versus 48% significantly decreased risk of death due to gist with adjuvant imatinib therapy in comparison with observation at median follow-up of 45 months (hr 0.254, 95% ci 0.0700.931; p=0.025)jiang et al. 2011 non-randomized, one center, prospective; imatinib 400 mg daily for 5 years versus observation35 (imatinib), 55 (observation)primary gist kit-positive after r0 resection; high risk of relapse (modified nih classification)significantly better rfs with imatinib as compared with observation at median follow-up of 44.0 months (hr 0.122, 95% ci 0.0410.363; p<0.001); 1-year rfs: 100 versus 70.9 %; 2-year rfs: 88.0 versus 37.8 %; 3-year rfs: 88.0 versus 27.5% acosog z9001, dematteo et al. 2009 [76, 86]double-blind, placebo-controlled, randomized, multicenter; imatinib 400 mg daily versus placebo for 1 year359 (imatinib), 354 (placebo)primary gist kit-positive after radical resection; tumor size 3 cm; low, intermediate, or high risk of relapsesignificant improvement in 1-year rfs in the imatinib arm (98 %) as compared with placebo (83 %); median follow-up time 19.7 months; hr 0.35; p<0.0001lack of statistically significant difference in 1-year os between study arms (hr 0.66; p=0.47)ssgxviii/aio, joensuu et al. 2012 [7, 65]two arms, open, randomized, multicenter, prospective; imatinib 400 mg daily for 1 versus 3 years200 (1 year), 200 (3 years)primary gist kit-positive after radical resection; high risk of relapse (modified nih classification): tumor size>10 cm or mitotic index>10/50 hpfs or mitotic index>5/50 and tumor size>5 cm or tumor rupturesignificant improvement in rfs with 3-year imatinib therapy as compared with 1-year therapy at median follow-up of 54 months (hr 0.46, 95% ci 0.320.65; p<0.0001); 5-year rfs: 65.6 versus 47.9% significant improvement in os with 3-year imatinib therapy as compared with 1-year therapy at median follow-up of 54 months (hr 0.45, 95% ci 0.220.89; p=0.019); 5-year os: 92.0 versus 81.7% eortc 62024, hohenberger at al. 2012 two arms, open, randomized, multicenter, prospective; imatinib 400 mg daily for 2 years versus observation906primary gist kit-positive after radical resection; intermediate or high risk of relapse (nih classification): tumor size>5 cm and/or mitotic index>5/50 hpfstime to imatinib failure at relapse (changed from os)rfs, os, safety: results are expected in 2013acosog american college of surgeons oncology group, aio arbeitsgemeinschaft internistische onkologie, ci confidence interval, eortc european organization for research and treatment of cancer, hpfs high-powered fields, hr hazard ratio, kit v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog, nih national institutes of health, os overall survival, r0 microscopically radical resection of the tumor, rfs recurrence-free survival, ssg scandinavian sarcoma groupstudies evaluating adjuvant therapy with imatinib for at least 3 years the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors (gists) acosog american college of surgeons oncology group, aio arbeitsgemeinschaft internistische onkologie, ci confidence interval, eortc european organization for research and treatment of cancer, hpfs high-powered fields, hr hazard ratio, kit v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog, nih national institutes of health, os overall survival, r0 microscopically radical resection of the tumor, rfs recurrence-free survival, ssg scandinavian sarcoma group studies evaluating adjuvant therapy with imatinib for at least 3 years only recent updates of the european society for medical oncology (esmo) and national comprehensive cancer network (nccn) guidelines have included the recommendation for 36 months of adjuvant imatinib therapy in adult patients with kit-positive gists at high risk of relapse. however, the optimal duration of imatinib therapy is still unknown. the latest fda and ema approvals for imatinib were based on the results of the ssgxviii/aio trial, which demonstrated that prolonged treatment extends both recurrence-free survival (rfs) and os. data from the ssgxviii/aio trial, comparing 12 and 36 months of adjuvant imatinib treatment after resection of gists in patients with a high risk of recurrence, were first presented in 2011 at the 47th annual meeting of the american society of clinical oncology. in the 36-month treatment arm, a significant improvement was observed in terms of both rfs (5-year rfs: 65.6 vs. 47.9 %; p<0.0001) and os (5-year os: 92.0 vs. 81.7 %; p=0.01; hr 0.45). the study demonstrated that prolonged imatinib treatment was generally well tolerated, and the most common adverse events included anemia, leukopenia, periorbital edema, fatigue, nausea, diarrhea, muscle cramps, and elevated blood lactate dehydrogenase levels. more patients discontinued imatinib therapy in the 36-month treatment arm than in the 12-month arm, for reasons other than gist recurrence (25.8 vs. 12.6 %; p<evaluation of the risk factors for recurrence after primary surgery is essential for reliable prognosis, scheduling of follow-up, and identification of patients who may potentially benefit from adjuvant therapy. the main criteria taken into account in a few existing risk stratification systems include the tumor site, size, mitotic index, and tumor rupture; however, the uniform risk criteria remain difficult to determine. the national institutes of health (nih) consensus criteria formulated in 2001 provided the first evidence-based categorization and a practical scheme for risk assessment in the clinical course of this disease. this risk classification was based on the tumor size and mitotic rate [evaluated per 50 high-powered fields (hpfs)] as the most reliable prognostic factors. this scheme was complemented in 2006 by miettinen and lasota from the armed forces institute of pathology (afip), who recognized the significance of the tumor location as an independent prognostic factor in gists. they created a new risk assessment scheme (recommended by the nccn and commonly used) which reflected better prognosis of gastric gists compared with intestinal gists of the same mitotic index and size [21, 6770] (table 3 and fig. 1). the same prognostic factors were taken into account in the nomogram created by gold et al., which seems to vaguely outperform the nih and nccn afip criteria. moreover, it has been demonstrated that tumor rupture (either spontaneous or iatrogenic) is an important risk factor, which strongly correlates with the risk of recurrence in gists [72, 73]. this observation has led to the development of modified nih criteria and novel non-linear risk stratification systems, including prognostic contour maps and heat maps, constructed on the basis of the tumor size, site, mitotic index, and incidence of tumor rupture [7375]. these features may provide even more accurate estimation of the risk of recurrence and are appropriate for individualizing risk stratification for adjuvant therapy in gists. subgroup analysis of the acosog z9001 trial confirmed that the major clinical benefit of adjuvant therapy was limited to the group of patients at high risk of relapse according to the nccn afip criteria (an improvement in 2-year rfs from 41 to 77 %; p<0.0001) . table 3national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk criteria after resection of primary gastrointestinal stromal tumors (gists), according to miettinen and lasota tumor parametersprimary tumor location and risk of recurrencesizemitotic indexstomachduodenumsmall intestinerectum2 cm5/50 hpfs0% 0% 0% 0%>2 cm, 5 cmvery low (1.9 %) low (8.3 %) low (4.3 %) low (8.5 %)>5 cm, 10 cmlow (3.6 %) high (34 %) intermediate (24 %) high (57 %)>10 cmintermediate (12 %) high (52 %) 2 cm>5/50 hpfsinsufficient datainsufficient datahigh (50 %) high (5271 %)>2 cm, 5 cmintermediate (16 %) high (5086 %) high (7390 %)>5 cm, 10 cmhigh (5586 %)>10 cmhpfs high-powered fieldsfig. 1recurrence-free survival in small-bowel gastrointestinal stromal tumors (gists), according to national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk categories (based on the authors own data from 659 primary gists after radical resection, presented during the european society of surgical oncology conference) national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk criteria after resection of primary gastrointestinal stromal tumors (gists), according to miettinen and lasota hpfs high-powered fields recurrence-free survival in small-bowel gastrointestinal stromal tumors (gists), according to national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk categories (based on the authors own data from 659 primary gists after radical resection, presented during the european society of surgical oncology conference) in addition to clinicopathological factors, molecular features may also present added value to risk stratification of gists. several studies have demonstrated better prognosis for patients harboring kit exon 11 point mutations or insertions, as well as pdgfra exon 18 mutations. on the other hand, tumors carrying kit exon 11 deletions (especially involving codons 557 or 558) and kit exon it has also been proposed that genomic complexity, defined by a genomic index determined by array comparative genomic hybridization, may serve as a useful adjunct to the current risk stratification systems, which are often uninformative in the case of intermediate-risk patients [84, 85]. it is worth noting that the updated fda and ema approvals for 36 months of imatinib treatment apply to patients who specifically meet the inclusion criteria determined in the ssgxviii/aio trial [7, 65]. in that trial, patients were eligible for the trial if they had kit-positive gists and demonstrated at least one of the following features: longest tumor diameter>10 cm, mitotic index>10/50 hpfs, longest tumor diameter>5 cm and mitotic index>5/50 hpfs, or tumor rupture prior to or at the time of surgery. this classification represents a modified nih risk-stratification system, complemented with tumor rupture as an independent prognostic factor. gastric gists constituted approximately half of the cases in both the 12- and 36-month arms, followed by small-intestine gists (37 and 31% of cases, respectively), and gists located in the colon or rectum constituted 8 and 10% of cases, respectively. in 7% of patients in each arm, the results of the ssgxviii/aio trial demonstrated that mutational analysis of gists may have predictive value for the clinical response to adjuvant imatinib therapy, similar to data observed in the metastatic setting. from the molecular point of view, resistance to imatinib has its origins in kit/pdgfra mutational status. data reported by joensuu and colleagues showed that patients with kit exon 11 mutations benefit the most from prolonged adjuvant treatment. similar data were shown for patients treated in the acosog z9001 trial; the 2-year rfs rate was 91% for patients treated with adjuvant imatinib harboring kit exon 11 mutations, as compared with 65% in a group of patients with the same genotype receiving placebo (p<0.0001). on the other hand, primary imatinib resistance in the adjuvant setting has been demonstrated especially in cases carrying a pdgfra exon 18 p.d842v mutation, presumably because of the structural alterations at the imatinib binding site. this mutation is detected in approximately 10% of operable gists [75, 87], especially in tumors originating from the stomach (exceeding 20% of cases in this location). adjuvant imatinib should not be recommended in cases of gists harboring a pdgfra exon 18 p.d842v mutation. in the acosog z9001 trial, interestingly, it has been demonstrated that patients with advanced gists harboring mutations in kit exon 9 may benefit from an imatinib dose increase to 800 mg daily. this indicates that patients with this mutation may be underdosed when receiving 400 mg of imatinib daily, but it has never been examined in any clinical trial in the adjuvant setting. in wild-type gists, the tumor size and mitotic index poorly predict clinical outcome; therefore, current risk stratification systems seem to be inapplicable in this subgroup of patients [50, 51]. moreover, wild-type gists present a limited response to imatinib treatment, in comparison with gists carrying imatinib-sensitive mutations. adjuvant imatinib efficacy in kit exon 9 mutants and wild-type gists warrants further study; however, the numbers of patients in these subgroups are usually small, and so statistical significance is difficult to reach when these categories are analyzed. nevertheless, kit and pdgfra genotyping in gists should be performed routinely in the adjuvant setting, since it may help to tailor the treatment to patients who are more likely to respond to imatinib therapy, or to exclude patients with imatinib-resistance mutations [86, 88]. in the ssgxviii/aio trial, patients were monitored for their response to imatinib with contrast-enhanced computed tomography or magnetic resonance imaging at 6-month intervals for the first 7 years and annually thereafter. an initial staging examination was performed within 28 days before the introduction of imatinib treatment. blood biochemistry and cell counts were performed at 1- to 3-month intervals in the course of the treatment. gist relapse is usually observed at the highest frequency within the first 2 years after completion of adjuvant treatment; therefore, regular imaging in this period is especially important for early detection of recurrence [64, 76]. the majority of patients who develop gist recurrence after completion of adjuvant imatinib respond to an imatinib rechallenge regardless of the prior treatment duration. on the basis of the clinical behavior of advanced gists, it may be anticipated that in patients who relapse during adjuvant treatment or within the first few weeks after completion of adjuvant treatment, an increased dose of imatinib or introduction of another tyrosine kinase inhibitor, such as sunitinib, may be beneficial because these cases are probably primarily imatinib resistant. generally, only a few patients in the ssgxviii/aio trial developed gist recurrence during imatinib treatment (2% of patients in the 12-month arm and 6% of patients in the 36-month arm). this suggests that acquired resistance to adjuvant imatinib (related mainly to occurrence of secondary kit/pdgfra mutations) is infrequent in this patient population [7, 65]. we still do not know if adjuvant imatinib therapy can cure a patient by preventing relapse or can only delay it. in the metastatic setting, interruption of imatinib therapy has been associated with disease relapse at a median of 6 months after stopping imatinib after 1, 3, or 5 years of treatment [89, 90]. the significant improvement in os associated with 3 years versus 1 year of adjuvant imatinib in the ssgxviii/aio trial [7, 65] was based on the limited number of deaths that occurred at median follow-up of 54 months, and so longer follow-up is needed to confirm the os advantage related to 3-year adjuvant imatinib therapy. there are still several unresolved issues concerning future use of adjuvant imatinib in gists. in the coming years, adjuvant imatinib treatment for at least 3 years will be standard therapy in high-risk gist patients harboring sensitive mutations. in intermediate-risk patients, adjuvant imatinib should be considered, provided there is better characterization of individual prognostic features. the role of adjuvant imatinib therapy in patients with wild-type gists or kit exon 9 mutations should be better defined, and the appropriate initial dose of imatinib400 or 800 mg daily in patients with kit exon 9 mutants must be established. the optimal duration of adjuvant imatinib therapy beyond 3 years requires further investigation and should preferably be determined on the basis of randomized controlled trials. furthermore, the optimal follow-up schedule after discontinuation of the therapy is not well established. the only issue that seems to be incontestable in the immediate future is the necessity for genotyping of every primary gist considered for adjuvant therapy. despite the striking efficacy of imatinib, recurrent or metastatic gist is still not a curable disease. this implies that prevention of disease recurrence following surgical resection of the primary tumor is the key to further improvement of the clinical outcomes of patients affected by gists. three years of adjuvant imatinib treatment, as opposed to 1 year of treatment, significantly reduced the risk of recurrence and improved os in patients with kit-positive gists at high risk of recurrence after surgery. currently, 3 years of adjuvant treatment for patients at high risk of recurrence may be considered as a standard of care. however, it is not clear whether patients who are classified as intermediate risk should be treated with adjuvant imatinib. results from several phase ii studies support the idea that at least 2 years of adjuvant imatinib treatment is beneficial for intermediate-risk gists (especially those harboring kit exon 11 mutations) and may be considered in this subgroup of patients [9297]. on the other hand, patients with very low-risk or low-risk tumors are likely to be cured by surgery alone and should not receive adjuvant imatinib. beyond risk assessment for proper selection of patients for adjuvant imatinib therapy it may help to tailor the treatment to patients carrying more sensitive mutations, such as kit exon 11 mutations, or to exclude patients with imatinib-resistance mutations, such as a pdgfra p.d842v mutation. thus, kit and pdgfra genotyping of patients with gists is obligatory in the adjuvant setting [86, 88] .

on the basis of the recently published results of a clinical trial comparing 12 and 36 months of imatinib in adjuvant therapy for gastrointestinal stromal tumors (gists), which demonstrated clinical benefit of longer imatinib treatment in terms of delaying recurrences and improving overall survival, both the us food and drug administration and the european medicines agency have updated their recommendations and approved 36 months of imatinib treatment in patients with v-kit hardy-zuckerman 4 feline sarcoma viral oncogene homolog (kit)-positive gists (also known as cd117-positive gists) at high risk of recurrence after surgical resection of a primary tumor. this article discusses patient selection criteria for extended adjuvant therapy with imatinib, different classifications of risk of recurrence, and assessment of the response to therapy.

PMC3565084

pubmed-545

while the physical disability aspect of multiple sclerosis (ms), the most common demyelinating disease of the central nervous system in young adults, is of great importance, it is now well recognized that it does not reflect all of the facets that patients consider important in their life. fatigue, depression, and physical disability are only one aspect of a person's experience with ms; it is well documented that cognitive, emotional, and psychological functions contribute to their quality of life (qol). the qol measurements are being considered increasingly important with regard to evaluating disease progression, treatment and the management of care provided to ms patients [2, 3]. the us food and drug administration (fda) and the european medicines agency encourage the use of qol assessment in patients with chronic illnesses [4, 5], and several groups have published detailed recommendations for qol assessment [6, 7]. in ms research, 118 studies that have reported qol as an outcome were performed with ms patients in the clinical trials registry (clinicaltrials.gov, december 31, 2012). despite the acknowledged need to consider qol issues, qol assessment may be considered to be an unfulfilled promise [911]. therefore, these issues should be explored and understood to promote both the use and usefulness of measuring qol in ms clinical practice. here, we explore the difficulties for clinicians to choose and determine the most appropriate qol measure, to be convinced by the clinical utility of the qol assessment implementation in clinical practice and to interpret qol scores. qol is commonly assessed using self-reported questionnaires. to fully understand and explore the effectiveness of any intervention for the management of ms, it is important to have robust, valid, reliable, and universally applied measures. generic instruments are generally used to compare qol across different populations, while disease-specific instruments focus on particular health problems and are more sensitive for detecting and quantifying small changes. in ms clinical practice, ms-specific questionnaires are more appropriate due to a better ability to discern qol differences in patients than the 36-item short form. a large number of disease-specific qol instruments have been validated for use in ms patients. the most popular questionnaires are the multiple sclerosis quality of life questionnaire (msqol54), the functional assessment of multiple sclerosis questionnaire (fams), the hamburg quality of life questionnaire in multiple sclerosis (haquams), the quality of life index-multiple sclerosis (qli-ms), the multiple sclerosis quality of life index (msqli), the leeds multiple sclerosis quality of life scale, the ms impact scale (msis-29), the disability and impact profile (dip), the extension of quality-adjusted time without symptoms of disease and toxicity of treatment, and more recently, the multiple sclerosis international quality of life questionnaire. while some reviews tried to describe the different questionnaires as designed specifically for ms patients [2, 25, 26], a clinician contemplating these various rules and instruments may be overwhelmed by their level of complexity. the multiplicity of scales used requires describing their psychometrics and the theoretical and conceptual foundations. clinicians should be provided better guidance and training that includes evidence of the respective contributions of the various available instruments, the degree to which the tools measure what they claim to measure, and their respective strengths and shortcomings. high-level requirements for development and metric validation of qol measures, especially among the most recent instruments, are now well acknowledged [28, 29]. briefly, we can mention some limitations about the process of validating the qol questionnaires that may compromise the robustness of the instrument. first, one important issue concerns the conceptual problems related to the definition of qol. the researchers should have well-validated questionnaires based on a clear conceptual basis for qol. one major challenge to explaining the content of the qol dimensions to be measured is to ensure that the subjects ' perceptions are accurately taken into account. interviews with patients are commonly considered as the best method to capture the patient's perceptions [30, 31] and provide the content of the questionnaire. few ms-specific qol questionnaires were exclusively based on the patient's point of view. second, the responsiveness or sensitivity to change, defined as the ability to detect a meaningful change, is a core psychometric property of a measuring instrument. given the availability of many qol instruments, little research has been conducted to test the responsiveness of the qol tools in ms. the haquams showed satisfactory responsiveness to change, the msis-29, msqol-54, and fams moderately detected change in health status [33, 34]. also, clinicians should prefer the use of the haquams to detect health changes over time of ms patients. future studies should provide comparisons with responsiveness indices using a direct head-to-head comparison to make the situations in which they were tested comparably. finally, another point that should be mentioned is related to the number of available languages of the questionnaire. the msqol54 [15, 3537] and the musiqol [24, 3841] these questionnaires were developed simultaneously in a number of countries and thus represent a major strength. environmental barriers have been described to explain why qol measures have not been routinely implemented in clinical practice. time and resource are both constraints on clinicians whose main role is providing patient care. a great asset of the qol questionnaire is its acceptability, which concerns the ergonomics of the questionnaire, such as the length of the questionnaire, the paper or electronic format, and the concept of computer adaptive testing. some authors have suggested that questionnaires intended for use in clinical populations should be as brief as possible because of the nonadaptability with a clinical evaluation and the difficulties of the concentration and perception faced by patients with a cognitive dysfunction [8, 30], such as ms patients. it is common to accept that the average time of completion of a questionnaire should not exceed 10 minutes to be fully compatible with clinical practice. providing shorter questionnaires in ms qol measures, as is already done in other chronic diseases, may contribute both appropriate and useful for use in clinical practice. a potential opportunity for questionnaire development exists in the growing use of electronic records and e-health research. to our knowledge, there are not any studies that evaluate the feasibility of e-form qol questionnaires in ms patients. however, it is not certain that e-form questionnaires would allow for obtaining qol data in an efficient real-time manner because of the logistics feasibility and the lack of computer stations and hand-held devices. while most qol questionnaires are initially fixed in content and length, future challenges now focus on the concept of computer adaptive testing. the number of items can be reduced substantially by use of item-response theory and computer adaptive testing to target questions through an iterative process in which responses determine which items are subsequently presented. this approach requires development and validation of algorithms in addition to development and validation of the original questionnaire. today, the neurology quality-of-life measurement initiative is a standardized approach based on extant items used for measuring qol across common neurologic conditions, including multiple sclerosis, for both adults and children [47, 48]. the next challenge is to develop credible strategies for integrating qol data in clinical practice. to enhance the use of qol measures in clinical decision making, improving knowledge about the determinants of qol changes and the potential predictive role of qol on disability may reinforce the conviction of clinicians to use these measures in their ms clinical practice. in the same way, demonstrating that qol feedback should improve health status of ms patients may confirm the relevance of including qol in clinical practice. clinicians can use qol assessments to check whether interventions have been as effective from the patient's point of view as from the clinician's, and to determine whether further action is required. knowledge of which factors are determinants of qol in patients with ms would assist clinicians in choosing the most appropriate interventions. several determinants of qol have been identified with varying strengths of association and include both disease-related variables (disability status [49, 50], disease duration [50, 51], fatigue [52, 53], depression [49, 54]), cognition, sociodemographic variables (age and sex [55, 56], level of education, and marital status). a number of these factors might be amenable to treatment intervention, which might be expected to improve qol: fatigue, depression, and cognition. predictive factors of long-term disability in patients with ms were also previously reported [60, 61]: sociodemographic variables [62, 63], initial edss score or initial change in edss score [61, 64], number or types of relapses [61, 62], nature of the initial symptoms, and mri findings. the weight of these factors is poorly understood and does not explain the entire change of disability that is observed. in contrast to domains such as heart disease and cancer, few studies have examined the predictive value of qol on disability in patients with ms. longitudinal studies have described whether the qol level, in addition to conventional clinical and sociodemographic factors, provides prognostic information about the evolution of disability in patients with ms [6770]. these studies have found that scores of mental health qol [67, 69], scores of physical-like dimensions [68, 69, 71], and the score of global qol are independent predictors of disability as assessed using the edss score. there must be at least one plausible mechanism responsible for the link between poor qol and progression in disability. qol could be a more subtle measure of early disability that is not detected by the edss scale. the identification of early predictors of the long-term evolution of disability status may be useful to identify both high-risk patients who require early and more aggressive therapies and low-risk patients who could avoid lifelong, expensive, and potentially troublesome treatments. thus, this identification procedure may favor a more homogeneous selection of patients for clinical therapeutic trials. patient-reported baseline qol levels provide additional prognostic information on ms disability beyond traditional clinical or sociodemographic factors. these findings provide strong support for the integration of qol into clinical practice, in addition to other standard assessments, and reinforce the importance of incorporating a patient's evaluation of their own qol level during patient monitoring and the assessment of treatment effects. future studies should provide data from longer follow-up times and will likely highlight other robust findings. the impact of qol assessment on health status and other health-related outcomes of patients has already been accomplished in oncology [7375]. to our knowledge, there are no studies that have explored the effect of assessing qol in ms care management. this effect is defined by the negative expectations that derive from a clinical encounter and lead to poor health outcomes and therapy adherence. this theme constitutes an important avenue of ms research in clinical settings for the coming years. in some specific situations, clinicians can be perplexed when interpreting qol scores: (1) what does a qol score mean in the absence of normative/reference values? (3) what is the meaning of qol scores for an individual with cognitive impairment? the practical and clinical interpretations of qol data in a given disorder are difficult unless these data are presented with a reference system. one of the difficulties encountered when interpreting a qol score for clinicians is the lack of norms values. sf36, a generic instrument, is commonly used because normative data from healthy adults and individuals with a variety of illnesses are available. to our knowledge, no norms were provided for any ms-specific questionnaire. at this time, the qol scores of the reference population described in the validation publication are implicitly used as norms. it is rare to have scores according to sex, gender, and clinical form. additionally, it becomes imperative to produce norms for the most popular ms-specific instruments. another concern expressed by clinicians is the interpretation of qol measures in longitudinal studies because qol, self-reported by the patient, might be influenced by psychological phenomena such as adaptation to illness. adaptation to illness is a potential explanation in cases where, for example, the qol of an individual who has experienced a serious health event or chronic condition is similar to the qol of a healthy individual. most people with a long-term chronic condition such as ms do not say that physical disability is their primary concern but mention involvement in everyday activities and psychological and emotional well-being. an important mediator of this adaptation process is response shift (rs) which involves changing internal standards, values, and the conceptualization of qol [78, 79]. rs can be divided into (1) reconceptualization (i.e., a redefinition of qol), (2) reprioritization (i.e., a change in the importance attributed to component domains constituting qol), and (3) recalibration (i.e., a change in a patient's internal standards of measurements). true change may be over- or underestimated when rs is present, leading to biased estimates of the magnitude of change. a recent meta-analysis revealed a substantial body of literature on rs phenomena and concluded that rs was common and significant in qol measurement. some studies have already investigated this phenomenon in ms populations using the most established methods: the then-test, structural equation modeling (sem), latent trajectory analysis of residuals, recursive partitioning tree analysis as a data mining method, and, more recently, the random forest method.. it would be premature to conclude which method is best for detecting rs in ms patients. future explorations should be performed to compare the capacity of these methods for detecting rs and the degree of convergence of the isolated phenomena. however, the rs does not necessarily invalidate qol measures when it appears under the reprioritization component. change in values may simply represent a mechanism by which people gain true changes in qol. determining how to integrate the rs in the interpretation of qol scores in ms clinical practice is now the next challenge. prior studies of the relationship between cognitive impairment and qol have been contradictory, highlighting either negligible [8790] or strong links [51, 91, 92] between cognitive disturbances and qol alterations. the use of self-reported outcomes in subjects with cognitive dysfunction is of particular concern. the extent to which ms patients with cognitive dysfunction can validly self-report their qol is a crucial issue that has only partially been examined. while some authors argue that cognitively impaired individuals are unable to produce valid qol measures [94, 95], others reported empirical evidence suggesting that individuals with a moderate degree of cognitive impairment can perform reliable qol assessments [92, 96]. two recent papers reported data providing strong arguments to support the conclusion that ms patients with executive dysfunction, as determined by the stroop test, and memory dysfunction, as determined by the grober and buschke test, are reliable and consistent when answering a well-validated ms-specific qol questionnaire, the musiqol [24, 38]. these studies provided new evidence about the suitability for using self-reported qol data in these specific populations. the assessment of qol using the musiqol questionnaire could be more widely used without concern over the adequacy of this approach for cognitively impaired patients. however, it has to be acknowledged that a single test of cognitive functioning will never be entirely appropriate. an interdisciplinary approach would be most effective in addressing this deficit [1, 12]. future studies should provide similar results according to other definitions of cognitive dysfunction that integrate combinations of different composites (i.e., memory, attention, and concentration) and other qol questionnaires. using qol measures may provide clinicians with information regarding the general health status of their ms patients who might otherwise go unrecognized. neurologists should consider qol measures in the same way as routine objective measures such as symptomatic evaluation scales, laboratory tests, and radiographs to manage the care of ms patients. in this paper, we discussed several avenues to convince clinicians of the clinical relevance and accuracy of qol instruments and ultimately to enhance the use of qol measures in clinical practice for ms patients.

while the physical disability aspect of multiple sclerosis (ms) is of great importance, quality of life (qol) measurements are being considered increasingly important with regard to evaluating disease progression, treatment, and the management of care provided to ms patients. despite the acknowledged need to consider qol issues, qol assessment remains underutilized in clinical practice. these issues should be explored and understood to promote the use of measuring qol in ms clinical practice. we explore the difficulties for clinicians: choosing and determining the most appropriate qol measure and how to best integrate qol measurements into clinical practice. this paper discusses several avenues to provide to clinicians arguments of the clinical relevance and accuracy of qol instruments and ultimately to enhance the use of qol measures in clinical practice for ms patients.

PMC3603557

pubmed-546

noise in schools deserves special attention, as appropriate learning situations depend on good acoustic conditions. established by the brazilian association of technical standards (abnt), the standard nbr 10152 recommends that noise levels in schools should not exceed 50 db sound pressure level (spl) and remain below that of the human voice, which is 60 db (spl) at normal intensity1. in the school environment, children are exposed to several types of noise, such as external noise, environmental noise, and noise generated in the classroom. previous studies have shown that in children, noise impairs the academic performance related to memory, motivation, and reading ability2. thus, in this environment, students can develop difficulties in writing, reading, and maintaining attention and concentration, which can result in disciplinary problems2. the presence of noise in the communication process often causes difficulties in speech perception and high levels of stress, even in people with normal hearing3. researchers have demonstrated that children are the most affected by background noise both in speech perception and in auditory comprehension4. with this knowledge of the effects of noise on the learning process, it becomes necessary to measure the noise levels in the school environment in order to investigate the factors that may interfere with this process and propose educational and/or environmental modifications to minimize these adverse effects5. high levels of background noise are common in the natural environment of children, and are a major contributing factor to learning problems. a study developed in kindergartens and schools demonstrated that children's voices produce considerable noise levels. over an 8-hour period, the authors recorded average noise levels of 80.1 db (a) near the teacher's ear and 70.87 db (a) in the classroom. the maximum noise level near the teacher's ear was 112.55 db (a) and that in the classroom was 103.77 db (a)7. thus, the aim of this study was to evaluate the spl to which students are exposed in a municipal preschool. this study was conducted in a municipal preschool located in a suburb of the city of marlia, whose population is of low socioeconomic status. the project was first presented to the municipal secretary of education, and after receiving approval, it was carried out at the school that had agreed to the study. are 4 classrooms, the principal's office, library, toilets and bathroons and courtyard; there is a covered court and a cafeteria on the second block. the classrooms are constructed from concrete blocks, have ceramic-tiled floors, padded ceilings, iron doors that open to the outside, and wooden doors that open to the inner courtyard; 2 rooms face the street and the other 2 face the park. the cafeteria walls are made of concrete blocks; it has a plastic ceiling with acoustic treatment and a ceramic-tiled floor. the school furniture consists of iron cabinets, tables, and chairs with iron legs, and these do not occupy a fixed position in the school. the spl measurement was performed on 4 different days over a period of 8 hours per day, totaling 1920 minutes. the measurement was carried out in 2 classes that attended school in the integral period. on the first 2 days, we followed up the activities of 26 children who were 5 years of age (preschool ii), and on the other 2 days, we followed 28 children who were 4 years old (preschool i). an audiologist performed the measurements using an audio dosimeter, monitoring the children's activities at school. these activities were held in different parts of the school, and most took place outdoors (court and park). the equipment used for this study was an sv 102 svantek audio dosimeter; the device was calibrated and checked before the beginning of each measurement according to the technical specification. a and with a slow response in order to monitor low levels and continuous sounds in the environment studied according to the recommendations of regulatory standard-15 (nr-15)8 and the fundacentro standard of occupational hygiene (nho-01)9. measurements were obtained for the following parameters: maximum (lmax), minimum (lmin) and equivalent noise level (leq). the equipment was programmed to operate at nps intervals (spl) between 40 and 140 db. for the offsetting, we used the values proposed in the nr-15 and nho-018 9. in brazil, 2 standards deal with the measurement of noise and its harmful effects; they were created to establish the criteria for occupational noise exposure. 1 the limit of tolerance for continuous or intermittent noise, and the other is the nho-01, which provides criteria for the assessment of personal exposure to noise that are more accurate but does not have legal authority9. neither standard specifies changes in measurement parameters and analysis based on an open or enclosed environment. one difference between the 2 standards is the recommended rate of duplicity: the nr-15 states that it is equal to 5 db, while the nho-01 states that it is equal to 3 db. we used these 2 standards in this study, articulated with that advocated in the abnt standard nbr 101521. the results were analyzed using descriptive statistics based on the spl measurement parameters: lmax, lmin and leq. complementary analysis was performed to compare the measured values (as related to both the nho-01 and nr-15) for preschool i and ii; the mann whitney test was used, the significance level was 5% (p<0.05), and the confidence interval was constructed with 95% statistical confidence. there were differences in the spls measured according to the 2 standards. the noise intensity measured at the school ranged between 40.6 db (a) and 105.8 db (a) on the nr-15 and between 40.6 db (a) and 116.6 db (a) on the nho-01 (table 1). legend: max-maximum; min-minimum; leq-equivalent noise level. when we analyzed table 1, it showed that according to the nr-15, leq was 73.9 db (a) and 75.5 db (a) in preschool i, and 76.1 db (a) and 82.1 db (a) in preschool ii. in this sample, the band intensity of a higher recurrence of spl was 5355 db (a) and 6580 db (a) in preschool i and 5357 db (a) and 7185 db (a) in preschool ii (figure 1); the mann whitney test used to compare the standards determined that there were no statistically significant differences (nr-15, p=0.427; nho-01, p=0.186). this suggests that despite the older children producing a higher spl than the younger children, quantitative analysis determined that this difference was not significant. the frequency spectrum of the spl measured in the octave bands was concentrated in the frequency range between 500 hz and 4000 hz (figure 2). distribution of the sound pressure level measured at preschool i and ii according to frequency spectrum (octave bands). the activities performed by preschool i (chart 1) were related to the spl measurement (figure 3) during the 8-hour period. the spl varied according to the activity: painting and writing were quieter activities and free activities and games were noisiest; these activities were carried out in the classroom. the only time the spl was within the standards was during the childres nap time. the results demonstrated that most of the time, the noise level at school is higher than that recommended by the abnt and the world health organization1 10. a study conducted in a school showed that the noise levels measured in the classrooms and the school yard were the same as that caused by heavy traffic, race cars, and subway trains, ranging from 80 db to 110 db10, and this shows that the measurements obtained in this study are not appropriate for the school environment, the physical and mental health of children in this learning phase, and for other school professionals11. in this study, the average spl, determined from 4 days ' measurement, was 73.9 db (a) and 75.5 db (a) in preschool i and 76.1 db (a) and 82.1 db (a) in preschool ii; these results are similar to those found in the literature. in other studies involving schools, the spls in classrooms ranged 4975 db (a), 59.571.3 db (a), 5987 db (a), and 71.196.2 db (a)12 13 14 15. in daycare centers and schools, children's voices produce considerable levels of noise; the equivalent noise levels (leq) measured over 8 hours were 80.1 db (a) near the teachers ' ears and 70.87 db (a) in the classroom. the lmax was 112.55 db (a) near the teachers ' ears and 103.77 db (a) in the classroom7. a study that measured the influence of external noise in an empty classroom obtained a leq of 56.2 db (a) when there was activity in only one classroom in the school and 63.3 db (a) when activity was carried out in another 3 classrooms16. this difference in spls observed in the literature can be explained by the influence of different factors, such as equipment position, the number of children in the classroom and/or activity, type of activity performed, the environment acoustic characteristics, and school location. the noise levels in schools should not exceed 50 db (spl), remaining below the human voice, which is 60 db (spl) at normal intensity1. measurements in the classroom demonstrated that excessive noise is a more relevant issue than the poor acoustics of the room, and the levels of environmental noise are almost always higher than the 35 db (a) recommended by the abnt, even in empty rooms1. the spl measured at the school in octave band was concentrated in the frequency range between 500 hz and 4000 hz, the frequencies that favor speech perception. this finding suggests the interference of spl in the understanding of speech due to the signal-to-noise ratio. several studies have indicated that the contribution to the intelligibility of speech is specific to certain frequency bands, and speech sounds consist of low and high frequencies that vary continuously in intensity17. for sounds below 500 hz, there is a concentration of 60% of the energy; however, only 5% contributes to speech intelligibility. at frequencies of 5001000 hz, the energy and intelligibility are around 35%, and finally, at frequencies above 1000 hz, only 5% of the acoustic energy is responsible for 60% of the intelligibility and information18. research has shown that children are the most affected by background noise, either in speech perception or in listening4. regarding the recommendations for noise in schools, we observe that concern has increased because noise from internal sources (conversations, furniture, and equipment) and external sources (traffic, movement of people, and proximity to urban centers) has increased. thus, the teaching learning process suffers interference, as the environment does not favor concentration and understanding of speech19. in this study, the spls in the classroom reached values above 80 db (a) according to the activity performed, where painting and writing were the quietest activities. during free activities periods and games that took place on the covered court and playground, the spl exceeded 90 db (a), and these were the noisiest activities in this sample. these findings contradict the recommendations endorsing the classroom-tolerated limit of 4050 db1. in the literature, studies have reported that the spl depended on the activity performed in the classroom12 20 21. in elementary schools, the noise levels measured were 44 db (a) when the children were silent, 56 db (a) when they were carrying out some activity in silence (silent reading), 65 db (a) when they were carrying out individual work in a noisy environment (conversation), and 7077 db (a) when group work was being done20 21. students ' activities are a dominant source of noise in the classroom, even when they are quiet and well behaved. in this environment, any activity can increase the noise level by 510 db (a)19. a recent study measured noise during recess, demonstrating that the noise was excessive during both periods (morning and afternoon), reaching maximum values of 88.7 db (a) in the morning and 102 db (a) in the afternoon15. the authors stated that these peaks are caused by the objects falling or being used, furniture being moved, or students shouting. the peaks interrupted the teacher's activity and the student group lost its focus19. in this study, the children of preschool ii, aged between 5 and 6 years, produced a higher level of noise than the younger children did. it has been reported that kindergarten rooms frequented by children aged 5 years were noisier than rooms frequented by high school students22. we used 2 different standards (nr-15 and nho-01) to analyze the results and observed differences in the measurements obtained, and these differences were justified by the parameters used, for example, the duplicity rate of the dose. it is worth mentioning that the rules that deal with noise measurement and its harmful effects were created to establish criteria for occupational noise exposure. however, as there are no specific rules in brazil for noise measurement in schools, we decided to use these standards1. the criteria established by the nho-01 are based on modern concepts and scientific and technical parameters, follow current international trends, but without the commitment of equivalence with the legal criteria. thus, the results obtained and their interpretation when applying this standard may differ from those compared against the nr-15. when we consider the high spls found in schools and their negative impact in this environment, it is essential to implement actions that aim to minimize this disadvantage. it is important to remember that a good acoustic design ensures efficient distribution of the desirable sounds, as well as the exclusion of unwanted noise (noise from the roof, floor, ceiling, and walls)23. the high level of noise in the school environment was reported as a disturbing finding in a study because it impairs the academic activities of students. this problem goes beyond the perception of the discomfort caused by noise: it demands reflection about the physical layout of the school environment, classroom acoustics, and student and staff awareness of the noise generated at school24. researchers have stated that noise should be considered a risk factor in the school environment. once the acceptable noise levels for classrooms are exceeded, it is necessary to reduce them within the legal and medical scope. smaller classes built with acoustic materials and suitable furniture could be examples of immediate actions14. changes in students ' attitudes, such as behavior in the classroom, will affect the noise level. a reduced noise level combined with treatment for the acoustic environment would produce a significant beneficial effect19. the spls measured at the school were higher and exceeded the maximum permitted level according to the reference standards. therefore, the implementation of actions that aim to minimize the negative impact of noise in this environment thus becomes essential.

summary aim: to evaluate the sound pressure level to which preschool students are exposed. method: this was a prospective, quantitative, nonexperimental, and descriptive study. to achieve the aim of the study we used an audio dosimeter. the sound pressure level (spl) measurements were obtained for 2 age based classrooms. preschool i and ii. the measurements were obtained over 4 days in 8-hour sessions, totaling 1920 minutes. results: compared with established standards, the spl measured ranged from 40.6 db (a) to 105.8 db (a). the frequency spectrum of the spl was concentrated in the frequency range between 500 hz and 4000 hz. the older children produced higher spls than the younger ones, and the levels varied according to the activity performed. painting and writing were the quietest activities, while free activities period and games were the noisiest. conclusion: the spls measured at the preschool were higher and exceeded the maximum permitted level according to the reference standards. therefore, the implementation of actions that aim to minimize the negative impact of noise in this environment is essential.

PMC4423315

pubmed-547

cigarette smoking is the most important preventable cause of mortality all over the world. also, it is responsible for many non-communicable diseases such as cancers and cardiovascular diseases. moreover, cigarette smoking is the cause of half of the death of those who smoke for a long time. in the year 2000, about 5 million adults died as a result of cigarette consumption (about 12% of total deaths in the year 2000). it is estimated that this rate reaches 8.3 million per year by the year 2030, which 70% of these deaths will occur in developing countries. according to the who estimation, there are about 1.3 billion smokers worldwide that comprise one third of the world population over the age of 15 years. if this pattern of smoking remains unchanged, this rate will reach 2 billion by the year 2030. meysamie a and colleagues reported that prevalence of cigarette smoking is 23.4% and 1.4% in iranian males and females, respectively. teachers and other groups like clergymen who can be role models, play an important role in persuasion or prevention of cigarette smoking among the youth. also, as students will enter the society and play key roles such as physicians, engineers, and teachers and so on; studying their smoking behaviors is very important. therefore, students are also role model for the younger, as well as being a representative of youth in the population. the rate and tendency toward smoking among students has increased as shown by several studies. for example, a national survey in the us demonstrated that during a 5-year period, the rate of smoking among students increased from 22% to 29%. also, a study in iran found similar results showing that 5% of the female students in medical schools who were non-smokers in their first year of study became cigarette users in their seventh year of education. these rates among male students were 2% in the first and dramatically increased to 34% in the seventh year. heydari et al. also showed that prevalence of smoking was significantly higher in students in their last year of study compared with whom in the first year. in addition, several studies have demonstrated that prevalence of smoking was higher among students who had smoker teachers compared to those who had non-smoker. these imply the importance of study of prevalence of smoking in these groups and also their knowledge, attitude and practice on the matter. since the clergymen in any religion are one of the most influential groups in the society, study of their smoking habits has been of interest and several studies looked at the prevalence of smoking in this group. for example, a study on buddhist monks demonstrated that prevalence of daily smoking was 12%, which was lower than general population. this study also showed that buddhist monks with no history of smoking had a better knowledge and attitude towards the hazards of smoking. however, there is no study about smoking status of clergymen in islamic countries including iran. the aim of this study is to estimate and compare the prevalence of smoking in 3 groups of male teachers, clergymen and university students and also their knowledge, attitude and prediction of future smoking. this is the first study in iran, which compares not only the prevalence of smoking but also evaluates knowledge, attitude and their future prediction of smoking and investigates inter-relationship in these 3 groups. university students, clergymen and teachers were studied in tehran, iran during 2009. in this cross sectional study, the knowledge, attitude towards tobacco consumption and their prediction of smoking in the next 5 years of participants were asked by questionnaire. since the understudy clergymen were all males, only males first, tehran islamic religious school and shahid beheshti university were randomly selected from the corresponding lists. then, four medical and randomly four non medical faculties from the shahid beheshti university were selected. one class per grade (from grade 1 to 4) was also randomly selected in these faculties. besides, in tehran islamic religious school one class per grade (from grade 1 to 5) was also selected randomly. the students and clergymen were all 18-25 years old. in each class, after explaining the aim of the study and also the confidentiality, all the students were invited to participate in the study. male teachers (20-29 years) who thought boys in middle schools in tehran were also randomly selected. first, from the list of districts provided by the ministry of education and training 5 districts randomly selected. third, in each school, on average, about 10 teachers were randomly selected. for calculation of the required number of subjects in each of 3 groups, the formula for sample size calculation for proportion was used. considering p=50%, =0.05 and precision of 0.05, a minimum sample size of 385 was computed for each group. a total of 1,271 university students were enrolled (765 medical and 506 non-medical). also, 549 clergymen and 551 teachers were randomly studied. therefore, in all 3 groups, we examined a larger population than the calculated required number, which generally can increase the power and precision of the analysis. to examine knowledge and smoking status of the study subjects, a self-report questionnaire was adapted from the standard questionnaire of the global adult tobacco survey. this questionnaire evaluates age of smoking initiation, place of birth, history of smoking (one with consumption of at least 100 cigarettes was defined as a smoker person), smoking status at present, also knowledge about tobacco consumption (including 4 general knowledge multiple choice questions with 4 options), attitude towards tobacco consumption (4 multiple choice questions with 5 options) and contains one question about the probability of tobacco consumption in the next 5 years, which is presented in details by heydari et al. considering the subjects total scores of knowledge and attitude, the answers were categorized into 2 groups of poor/inappropriate (no correct answer) and moderate or good/appropriate (at least one correct answer). the answer to the question about probability of smoking in the next 5 years was divided into 2 groups of yes or no. data was entered and analyzed using spss (11.5) and stata (11.0). chi-squared test and logistic regression were used for comparison of smoking status, knowledge, attitude, and probability of smoking in the next 5 years among the 3 groups. in this study, 1,271 students, 549 clergymen, and 551 teachers were interviewed in tehran during 2009. as table 1 shows, 395 (31.1%) of students, (95% ci: 28.5%-33.6%) had a history of smoking more than 100 cigarettes. this rate was 21.9% (95% ci: 18.3-25.3%) among clergymen and 27.2% (95% ci: 23.4%-30.9%) among teachers. as presented in this table, the highest prevalence was seen among students and the lowest among clergymen (p<0.0001). logistic regression showed that prevalence of smoking was significantly higher among students and teachers than clergymen (p<0.0001 and p=0.04). however, the 3.9% difference in prevalence of smoking between students and teachers was not found significant (p=0.09). also, among the 3 groups, there was borderline difference in age of smoking initiation (p=0.06). neither, such difference was detected in terms of successful quit attempts, occasional smoking and daily cigarette consumption (p=0.99). no significant difference was found in the amount of daily smoking (less than 10 cigarettes, 11-20 cigarettes and more than 20 cigarettes) between the 3 groups (p=0.64). smoking status of male students, teachers and clergymen in tehran there was a significant difference between the understudy groups in terms of their knowledge, attitude and probability of smoking in the next 5 years (p<0.0001) as presented in table 2. also, table 2 shows, 61.9% (787) of students had poor knowledge; whereas, this rate was 38.8% (213) among clergymen and 42.1% (232) among teachers. inappropriate attitude (tendency) towards smoking was observed in 23.1% (294) of students, 10.2% (56) of clergymen and 12.7% (70) of teachers. in addition, 11.9% (151) of students, 5.8% (32) of clergymen and 7.3% (40) of teachers predicted that they will smoke cigarette in the next 5 years. it worth mentioning that the knowledge, attitude, and probability of smoking in the next 5 years of two groups of medical and non-medical students were not statistically significant (p=0.29; p=0.28; p=0.30; data not shown), respectively. this was the reason that we combined these two groups of the students for comparisons between 3 groups. knowledge, attitude and prediction of smoking in the next 5 years among male students, teachers and clergymen in tehran table 3 shows the odds ratio of smoking initiation in the understudy groups based on their level of knowledge, and attitude. odds ratio of smoking cigarette was not significant in students with poor knowledge (or=1.2; 95% ci: 0.9-1.6). whereas, odds ratio of smoking cigarette in clergymen (or=3.1; 95% ci: 2.0-4.6) and teachers (or=2.7; 95% ci: 1.9-4.0) with poor knowledge was significantly higher than those with moderate or good level of knowledge. also, in all 3 groups, the odds ratio of smoking cigarette was higher among those with inappropriate attitude compared to those with appropriate attitude towards smoking. this chance was significantly more in clergymen than teachers and was the lowest amongst students (p=0.01; table 3). likelihood of smoking in the next 5 years of male students, teachers and clergymen based on their knowledge and attitude in tehran in addition, when examining the effect of current smoking status on the likelihood of smoking cigarette in the next 5 years, the corresponding odds ratios for students, clergymen and teachers were 1.4, (95% ci: 0.98-2.0), 4.0 (95% ci: 1.9-8.2) and 2.9 (95% ci: 1.5-5.6) respectively, which were significantly different (p=0.0001). the results of study of association between knowledge, attitude and prediction of smoking in the next 5 in three groups are presented in table 4. as shown in this table, 25.9% (204) of students with poor level of knowledge had also inappropriate attitude towards smoking cigarette; whereas, only 15% (32) of clergymen and 17.2% (40) of teachers with poor knowledge had this attitude (p<0.0001). also, 7.8% (61) of students with poor knowledge predicted that they may smoke cigarette in the next 5 years, where these rates were 3.8% (8) and 4.3% (10) among clergymen and teachers, respectively (p in addition, it was found that 20.4% (60) of students with inappropriate attitude predicted that they may smoke cigarette in the next 5 years however these were 28.6% (16) and 28.6% (20) in clergymen and teachers (p=0.008). these finding revealed that although frequency of inappropriate attitude was higher among students, the chance of smoking in the next 5 years in this group was lower than clergymen and teachers. as it is stated the age rage of the students and clergymen were 18 to 25 years and of the teachers 20 to 29 years. when significant test was carried on grade (as a representative of age) of students and clergymen it was not significant (p=0.37). also, given the rage of age (20 to 29 years), the mean age of teachers is not generally far from the other 2 groups to alter the findings. the results of this study showed that prevalence of smoking was higher among students (31.1%) and teachers (27.2%) in comparison with clergymen (21.0%) and other males in general population (23.4%). although, the lowest consumption was seen among clergymen, it was not significantly lower than general population (p=0.40). also, level of knowledge, attitude and prediction of smoking cigarette in the next 5 years were more favorable in teachers and clergymen. although, whenever the range of age extended or the females are enrolled the findings could be different. in general, limited studies have compared smoking status in different groups in a community, although there are many researches focusing on a specific group of people. they evaluated 280 medical students in isfahan university of medical sciences and found that prevalence of smoking was 34% among male students who were in last year of their training. another study conducted in saudi arabia showed a relatively similar prevalence of smoking among students of different majors. in this study, which was conducted on 202 medical and 300 non-medical students, they demonstrated that the rate of smoking was 27.8% and 39.5% among medical and non-medical students, respectively. frisch et al. in malaysia examined the pattern of smoking, level of knowledge and attitude of 146 medical and nursing students towards smoking and found that only 11% of male students and none of the female students smoked which is much lower than ours. the level of knowledge and attitude were significantly lower in students compared with other groups in our study. however, other studies conducted in different countries demonstrated that level of knowledge and attitude of medical students towards smoking were more appropriate. a study conducted in the united kingdom on 181 dental students showed that more than 90% of dental students had moderate or good knowledge and more than 80% had an appropriate attitude towards smoking pizzo et al. in a study aiming to examine prevalence of smoking among dental students and their knowledge and attitude towards quitting showed that of 220 students 65% of students had appropriate knowledge and 87% had appropriate attitude towards smoking cessation activities. although in their study, the level of knowledge and attitude of dental students were higher than our students, no significant difference was observed between prevalence of smoking. this indicates that appropriate knowledge and attitude alone can not result in a proper behavior and other confounding factors like socioeconomic and family issues should also be taken into account., in the netherlands examined knowledge, attitude and rate of smoking in 3 groups of medical students (725 subjects), residents (126 subjects) and psychology counselors (236 subjects) and found that prevalence of smoking among medical students and residents was lower than the general population; whereas, prevalence of smoking among counselors was not different from general population. they also found that counselors had poorer knowledge and more inappropriate attitude towards smoking compared to the other 2 groups. the results of glantz study on prevalence of smoking in comparison with general population were in contrast with ours, however he found similar association between knowledge, attitude and prevalence of smoking cigarette with our study. limited studies have been conducted on the smoking status among clergymen of other religions and those available have been mostly performed on buddhist monks. a study conducted on 318 buddhist monks in cambodia showed that 44% were smokers; whereas, prevalence of smoking in cambodian general population was 65%. in addition, most monks had a poor knowledge about hazards of smoking but as the result of social stigma, prevalence of smoking among them was lower than the general population. another study conducted on buddhist monks in laos showed that prevalence of smoking among them was about 12%, which is much lower than the neighboring countries like cambodia. this study also demonstrated that lao monks had a good knowledge about hazards of smoking. the results of these 2 studies were in accord with those of ours demonstrating that islamic clergymen and buddhist monks both had a lower prevalence of smoking than general population and also had an appropriate level of knowledge in this respect. in general, the majority of studies performed on teachers only studied the prevalence of smoking. our study findings regarding high prevalence of smoking among teachers were in agreement with the findings of talay et al., in turkey, and sorensen et al. in india. on the contrary, a study in bahrain on 1,140 teachers demonstrated that only 8.7% of bahraini teachers smoked, which was lower than their general population. they also reported that these teachers had acceptable level of knowledge about hazards of smoking. the results of this study revealed that clergymen and teachers with poor knowledge had lower chance for becoming a smoker. in all 3 groups, the odds ratio of smoking in those with inappropriate attitude was significantly different from those with appropriate attitude. however, this chance was not significantly different in clergymen than teachers. also, it was found that smoking status had no significant effect on the probability of smoking in the next 5 years among students. however, for clergymen and teachers, likelihood of smoking in the next 5 years among current smokers was significantly different from non-smokers. in a study on 5,112 teachers in malaysia it also showed that teachers attitude affected their smoking status, which is in concord with our study findings. another study conducted in bosnia on 273 physicians and nurses found a significant difference in their knowledge and attitude towards smoking. while, in each group, prevalence of smoking. also found a significant relationship between prevalence of smoking and level of knowledge and attitude in each group of medical students, psychologists and medical residents. preventing the initiation of smoking in the adolescents and decreasing the prevalence of smoking in adults are the most important methods for prevention of cancer and various diseases. these programs may include increased price of cigarettes, ban of smoking in public places, limiting cigarette advertisements, restricting tobacco advertising, and establishment of counseling and treatment centers for nicotine dependence. however, for implementation of such programs at the national level, a correct estimate of the prevalence of smoking in different social and occupational groups seems necessary. cigarette consumption has increased among the youth of various social levels in the recent years. this study also showed that prevalence of smoking was higher among male students (which represents the youth in the community) than general population. considering this increase, new strategies the strength of this study was looking at these 3 groups for the first time, having standard questionnaire, trained research staff and acceptable executive process. the weakness of the study was because the clergyman were male the other 2 groups were selected from males. also, limiting the information on grades of the students and clergymen and age rage of teachers and not recording exact age of participants was of the limitations of the study. this study showed that prevalence of smoking among male students and teachers was higher than general population and clergymen, who smoked equally. also, level of knowledge and attitude and prediction of future smoking in students were worse than teachers and clergymen, which is alarming.

background: students, clergymen and teachers as role models can be very important in encouragement or prevention of cigarette smoking in young people. the aim of this study was to compare prevalence of smoking in 3 male groups of teachers, clergymen and university students. also, study their knowledge and attitude towards it and the prediction of their future consumption. methods:in a cross sectional study in 2009 in tehran, iran, 1,271 male students, 549 clergymen and 551 teachers were randomly enrolled. each participant completed the global adult tobacco survey questionnaire. knowledge, attitude and prediction of smoking for the next 5 years were questioned in these 3 groups. chi-squared test and logistic regression were used for analysis. p<0.05 was considered significant. results:prevalence of cigarette smoking was 31.1%, 21.9% and 27.2% among students, clergymen and teachers, respectively. smoking in students was not associated with poor knowledge but were in teachers and clergymen. the odds ratio of smoking in students, clergymen and teachers was higher among those with having inappropriate attitude towards it (or=1.6, 6.1 and 4.5). those with poor knowledge had an inappropriate attitude and predicted higher chance of cigarette consumption in the next 5 years (p<0.0001). inappropriate attitude in all 3 groups resulted in higher prediction of future smoking (p=0.008). conclusions: this study revealed that the prevalence of smoking among male students and teachers was higher than general population and clergymen who equally smoked. also, level of knowledge and attitude of students were lower than teachers and clergymen.

PMC3733187

pubmed-548

pemphigus is an autoimmune blistering disease characterized by blisters and erosions on the skin or mucosal membranes or both. the two main types of pemphigus are pemphigus vulgaris (pv) and pemphigus foliaceus (pf). in most countries, pv accounts for about 70% of all cases of pemphigus, presenting with skin or mucosal symptoms or both. pf, on the other hand, accounts for about 20% of cases in most countries, where there are not endemic forms of pf, and presents only with skin manifestations [1-3]. because pemphigus is an autoimmune disease, immunosuppressive agents have been employed to control and manage the disease. since the advent of systemic corticosteroids, the mortality associated with pemphigus has reduced from 90% to 10% and is now usually related to complications of treatment. steroids are still the mainstay of treatment, usually used at high doses initially to get the disease under control and then in conjunction with a steroid-sparing agent for maintenance. because of the side effects associated with long-term systemic corticosteroids such as hypertension, diabetes mellitus, osteoporosis, and ocular complications, a lot of the recent research in pemphigus has been directed at finding the optimal steroid-sparing agent. though many treatments have been tried in the management of pemphigus, often demonstrating clinical benefit in individual case reports and case series, the evidence supporting their use has not been confirmed in rcts. this is due to the rarity of the disease in most countries where rcts have been performed and difficulty in recruiting patients, resulting in underpowered studies. a recent cochrane review comparing treatments for pemphigus found significant heterogeneity amongst the rcts with respect to the study designs, primary outcome measures, and therapeutic end-points. such variation prevented the authors from performing direct comparisons and a meaningful meta-analysis. to solve this problem of variation between studies, a panel of international bullous experts convened on many occasions to form a consensus paper on the definitions of disease and therapeutic end-points for pemphigus. the goal of this consensus paper was to facilitate researchers and clinicians to design studies with similar study end-points so that even if an rct was underpowered, its data could be used in conjunction with other similar studies in a meta-analysis. it is hoped that in the coming years the rcts will incorporate the end-points and definitions from the consensus paper in their study designs so that meaningful comparisons and meta-analyses can be performed. this paper looks at the evidence from rcts that have assessed treatments for pemphigus. as mentioned above, systemic corticosteroids are employed as first-line treatment with lower doses used as maintenance. though higher doses (120 mg/day) result in a more rapid control of disease than lower doses (60 mg/day), there is no evidence that the higher doses are beneficial in the long term. therefore, it is recommended that 1 mg/kg per day be the initial dose for managing pemphigus. steroid-sparing agents are introduced immediately if safe to do so (for example, after normal results from a thiopurine s-methyltransferase [tpmt] test). once consolidation has been achieved in accordance with the consensus definitions for pemphigus (that is, disease progression has been halted), a slow standardized tapering of corticosteroid is commenced over about a 4-month period, which we term the werth taper. steroid-sparing agents are employed to reduce the cumulative exposure and side effects associated with long-term steroid use. such agents include azathioprine, mycophenolate mofetil, intravenous immunoglobulin (ivig), rituximab, cyclophosphamide, methotrexate, and cyclosporine. an rct comparing a combination of prednisolone plus azathioprine to prednisolone plus placebo in 56 patients with newly diagnosed pv found no statistically significant difference between the 2 groups after 1 year of treatment. the steroid-sparing effects of adjuvants were also demonstrated in another rct, which showed similar efficacy with azathioprine, mycophenolate mofetil (mmf), and intravenous cyclophosphamide. the steroid-sparing effect was demonstrated only when all three agents were pooled together as one group. because of the similarities in efficacy and side effect profiles, clinicians often use azathioprine or mmf as first-line therapy. no study has been able to prove one to be more effective than the other [11-13]. though mmf is a steroid-sparing agent that is safe and effective, a recent rct was unable to demonstrate clinical benefit in adding it to steroids in terms of outcome at one year, but in subanalysis it had benefits at other time points. rcts to date have failed to show a beneficial effect of cyclosporine in the management of pemphigus. remission and relapse rates were similar in all three groups, and there was no clear benefit of using a combination treatment. in fact, they noticed more side effects in the combination groups compared with using steroids alone. a multicenter rct comparing various doses of ivig found patients treated with a higher dose of ivig had a better outcome. patients received one of three doses: 0 mg/kg per day (placebo infusion), 200 mg/kg per day, or 400 mg/kg per day. there was a dose-response relationship with more patients benefiting from the higher dose and objectively this correlated with lower desmoglein (dsg)-1 and dsg-3 autoantibody titers. the limitation of these studies was their short-term follow-up, so that relapse rates could be compared with other options. rituximab, an anti-cd20 monoclonal antibody, is effective in recalcitrant pemphigus and is typically prescribed for patients who are unable to taper steroids without flare of their disease or in patients who are still flaring despite combination therapy (steroids+steroid-sparing agent). rituximab is associated with a reduction in autoantibodies (dsg-1 and -3) and b cell depletion. the clinical benefits are noticed within 2 to 3 months of infusion and can last years. one study found that the combination of rituximab for 3-weeks and ivig for the fourth week followed by maintenance monthly rituximab and ivig results in rapid clinical resolution, steroid cessation, and prolonged remission. another study found similar response and relapse rates with rituximab alone. despite case reports suggesting a potential role for cyclophosphamide in pemphigus treatment, benefits have not been reproduced in rcts, not even for cyclophosphamide with pulses of dexamethasone randomized against prednisone with azathioprine. there are some issues with the design of this rct, with modifications of the cyclophosphamide treatment arm compared with the original protocol and timing of cyclophosphamide doses and cessation of treatment. in clinical practice, there is reservation from clinicians and patients using this medication given the potential long-term side effects of infertility, bladder cancer, and hemorrhagic cystitis, although these adverse effects have not been demonstrated in pemphigus rcts. nevertheless, the lack of level 1 evidence and the potential harmful side effects make cyclophosphamide a second- or third-line steroid-sparing agent. it is typically not considered unless alternative therapies have failed and should not be used on young patients unless they were not planning on having further children. hence, further evidence is required to attest to the benefit of this modality in treating pemphigus. although the long-term efficacy of many of the therapies in pemphigus has not been evaluated in studies, it has been noted that 60% of patients with severe pemphigus treated with rituximab were in long-term remission of 6 years. in comparison, the remission rates for patients managed in the ratnam 5-year study were 36% (4/11) with a dose of 120 mg/kg per day and 9% (1/11) with a starting dose of 60 mg/kg per day. rituximab has not been officially approved by the food and drug administration or european medicines agency for pemphigus, although there are reports of success with its off-label use. ivig is approved for relapsing and recalcitrant pemphigus by medicare and the blood bank/official funding agencies of various countries and has also been approved by the therapeutics goods administration in australia. systemic corticosteroids are the mainstay of treatment for pemphigus. much of the recent research has been assessing the efficacy of steroid-sparing agents, most commonly azathioprine, mmf, rituximab, methotrexate, ivig, and cyclophosphamide. although strong evidence in the form of rcts is lacking, it does not mean that these systemic treatments are ineffective. because of the rarity of the disease, studies are often underpowered and fail to demonstrate a statistically significant difference between the active and control groups. the evidence to date indicates that adding an adjuvant to steroids has a significant steroid-sparing effect, reducing the cumulative exposure to steroids. azathioprine and mmf are often considered first-line therapies for pv with good improvement. rituximab is beneficial in patients who have poorly controlled disease despite high-dose steroids or steroid-sparing agents (or both) or are contra-indicated for receiving steroids. ivig in short-term studies is effective for recalcitrant cases but its duration of treatment needs further investigation. as more studies incorporate the definitions of disease and therapeutic end-points of the recent consensus statement, it is hoped that valuable and meaningful meta-analyses will provide more definitive answers.

pemphigus is an autoimmune blistering disease characterized by cutaneous and mucosal blisters and erosions. though systemic corticosteroids have been the mainstay of treatment for pemphigus over the years, more recently research has focused on steroid-sparing agents. this review looks at the commonly used steroid-sparing agents in pemphigus and the evidence from randomized controlled trials (rcts) supporting their use.

PMC4017903

pubmed-549

varicella zoster virus (vzv) disease is one of the most frequent infectious complications after allogeneic hematopoietic stem cell transplantation (allo-hsct); during the first year, its incidence ranges from 13 to 55% (1). although cutaneous herpes zoster is the most common clinical form of reactivation, allo-hsct recipients may present with fatal systemic dissemination (1,2). among the various types of vzv infection, infections of the central nervous system (cns), especially meningitis and encephalitis, are only rarely reported; however, they represent severely life threatening conditions and may compromise the patient's quality of life (3). we herein report a case of post-transplant vzv meningitis and myelitis that developed after the cessation of immunosuppressant therapy, which was successfully treated with the intravenous administration of foscarnet. a 42-year-old chinese man with myelodysplastic syndrome (mds, raeb-2) underwent cord blood transplantation (cbt) from a japanese donor in october 2011. the conditioning regimen consisted of total-body irradiation (tbi) (12 gy), cyclophosphamide (total dose, 120 mg/kg), and cytarabine (total dose, 12 g/m). prophylaxis against graft-versus-host disease (gvhd) consisted of cyclosporine (csa) and a short course of methotrexate. acyclovir (acv) (1,000 mg/day, orally) was administered from day -7 to 35 as prophylaxis against herpes virus. this was maintained at a reduced dose of 200 mg/day until day 213. the patient's serum immunoglobulin g (igg) levels remained within the normal limits, and his peripheral post-transplant leukocyte counts remained within the normal range. on day 241 after cbt, the patient presented with blisters on his face and on day 245, a herpes zoster rash developed on his face, body, and extremities. the patient was clinically diagnosed with a systemic vzv infection and intravenous acv (5 mg/kg three times a day) was promptly administered. the cutaneous lesions were reduced on the 8th day after the initiation of acv treatment, and the treatment was then switched to oral valaciclovir. however, the patient developed a high fever, paralysis of the lower extremities, ischuria, neck stiffness, and spinal automatism on the second day of valaciclovir treatment. the patient's cerebrospinal fluid (csf) showed an increased number of mononuclear cells (77/l), an elevated protein level, and a normal glucose level. the enzyme immunoassay (eia) values in the patient's csf and serum were 2.56 and 13.5, respectively, for vzv-igg, and 5.32 and 3.90 for vzv-igm. vzv-dna was not detected in a polymerase chain reaction (pcr). at 5.3, the presentation of spinal automatism, paralysis of the lower extremities and ischuria led to a diagnosis of vzv meningitis, myelitis, and radiculitis. intravenous acv was resumed at an increased dose (10 mg/kg, three times a day), on the 12th day after the initial diagnosis of the vzv infection. magnetic resonance imaging (mri) of the thoracic vertebrae and the lumbosacral spinal cord on days 6 and 7 after the resumption of acv, respectively, revealed no evident abnormalities. seventeen days after the resumption of acv, a high mononuclear cell count (69/l) was still present in the patient's csf, and the patient's paralysis and ischuria showed no improvement. acv was then switched to foscarnet (90 mg/kg, twice a day) on day 20 after the initial diagnosis. after 12 days of foscarnet treatment, the patient showed a complete recovery from ischuria and was able to walk by himself. the patient's csf showed a significantly decreased cell count, and foscarnet was discontinued after 51 days of treatment. on day 25 after the discontinuation of foscarnet therapy, the vzv-igm level in the patient's csf dropped to negative value of 0.78, whereas the vzv-igg level in the patient's csf rose to 7.53; in contrast, the value at time of the patient's diagnosis was 2.56. the patient has been in complete remission without recurrent neurological symptoms for 3.5 years since transplantation. the long-term administration of acv after transplantation has been recommended to reduce the risk of vzv reactivation (1). a large retrospective study showed that the prophylactic administration of acv for 1 year reduced the incidence of vzv disease, and that the incidence was further decreased by the continuation of prophylaxis in patients who remained on immunosuppressive drugs (4-7). however, the cumulative incidence of vzv disease after the cessation of long-term acv is reported to be approximately 28.4% at 1 year (8), suggesting that further studies are required to evaluate the optimal duration of low-dose acv prophylaxis. our patient had a normal peripheral blood lymphocyte count and serum immunoglobulin levels; thus, we discontinued prophylaxis with low-dose acv after the cessation of csa, which may have been associated with the reactivation of vzv. furthermore, one report described the case of a patient without any known risk factors who developed vzv meningoencephalitis at 22 months after hsct following the cessation of immunosuppressants and prophylactic treatment with low-dose acv (9). these rare experiences suggest that vzv meningitis is a complication that may occur in any allo-hsct recipient at any time after transplantation. the initial symptoms of vzv meningitis and myelitis in post-transplantation patients vary and may include dermatomal zoster before the onset. leveque et al. (10) reported two recipients who developed meningitis without skin manifestations. in contrast, fukuno et al. (11) described a bone marrow transplantation recipient in whom vzv meningoencephalitis occurred suddenly at 21 days after the completion of acv therapy for a localized cutaneous vzv infection. our patient's disseminated skin lesions developed first, and his neurological symptoms became obvious as the skin rash disappeared after acv therapy. thus, cns infections should always be considered when cns symptoms emerge without skin lesions or develop after a cutaneous vzv infection. although we could not detect vzv dna in this patient's csf, the patient's csf was positive for anti-vzv igm and igg, which was helpful in establishing the diagnoses of vzv meningitis and myelitis. the detection of anti-vzv antibodies in the csf appears to have greater sensitivity in the diagnosis of vzv infections of the nervous system, than the detection of viral dna. reported that vzv-dna positivity and the detection of antibodies in the csf can dramatically change during the clinical course of a viral infection (12). in this report, 0% and 61% of the csf samples that were collected within the first 7 days after the onset of rash were positive for anti-vzv antibodies and vzv dna, respectively however, after 7 days the rate of anti-vzv antibody-positive samples increased to 83%, while the rate of vzv dna-positive samples decreased to 25%. in our present case, csf sampling was performed on day 15 after the onset of rash, which was a relatively late time point. we hypothesize that the vzv dna in the csf decreased to an undetectable level while the csf became antibody-positive. thus, both assays are recommended in the assessment of csf samples in order to accurately diagnose vzv infections (13). vaccination may help decrease the risk of reactivation. although the data on the safety and efficacy of live-attenuated varicella vaccines in allo-hsct recipients are limited (14,15), no serious adverse events were reported in a previous study involving 110 adult allo-hsct patients (16). thus, the guidelines recommend varicella vaccination at 2 or more years after transplantation in allo-hsct patients without active chronic gvhd or ongoing immunosuppressive therapy (evidenced-based rating: ciii) (17,18). however, even at 2 years after hsct, 30-40% of the patients are considered to be ineligible for vaccination (19,20). for these recipients, the continuation of acv treatment for an extended period of time may be necessary to decrease the incidence of serious vzv reactivation. intravenous acv (10 mg/kg, every 8 hours), is the recommended treatment for vzv infections of the cns (21). however, acv activation is dependent on intracellular virus-encoded thymidine kinase (tk), which implies that tk-deficient vzv strains are resistant to acv. described a case in which a patient with vzv encephalitis was successfully treated with the addition of foscarnet to acv (22). the pharmacological action of foscarnet is tk-independent, which enables the elimination of acv-resistant vzv (23). in our case, acv appeared to be insufficient for improving the patient's neurological symptoms, and the patient was then successfully treated when acv was switched to foscarnet, suggesting that an acv-resistant vzv strain was involved in the patient's meningitis. it is possible that the strain of vzv that caused the meningitis was the same strain as that which caused the cutaneous infection, and the present patient might have been a late responder to acv. however, several reports have shown that the interval between the initiation of acv treatment and clinical improvement ranged from 3 to 9 days in patients with zoster- or varicella-induced myelitis (24-27). the paralysis and ischuria of the present patient showed no improvement during the 17 days in which he received a sufficient dose of intravenous acv, and the number of mononuclear cells in the patient's csf showed a minimal decrease. we therefore hypothesized that the strain of vzv that was responsible for the patient's meningitis was acv-resistant and that it was unlikely that the patient was a late responder to acv, and decided to switch the therapy to foscarnet. in conclusion, we described the case of a patient with vzv meningitis, radiculitis and myelitis after the cessation of immunosuppressant therapy and long-term acv prophylaxis. vzv cns infections may be severe life threatening events and have the potential to compromise a patient's quality of life. thus, when initial acv therapy is found to be insufficient for the treatment of vzv infections in transplant recipients under long-term acv prophylaxis, physicians should immediately consider changing to second line therapies, such as foscarnet. further investigation is necessary to develop optimal prophylactic strategies and effective vaccination schedules may be needed to eradicate post-transplant vzv disease.

infections of the central nervous system (cns) with varicella zoster virus (vzv) is a rare occurrence after allogeneic hematopoietic stem cell transplantation. we herein report a case of vzv meningitis, radiculitis and myelitis that developed 8 months after cord blood transplantation, shortly after the cessation of cyclosporine and low-dose acyclovir. although treatment with acyclovir did not achieve a satisfactory response, the patient was successfully treated with foscarnet. our report indicates that vzv infection should be considered in allo-hematopoietic stem cell transplantation (hsct) patients with cns symptoms and that foscarnet may be effective for the treatment of acyclovir-resistant vzv infections of the cns. the development of optimal prophylactic strategies and vaccination schedules may eradicate post-transplant vzv disease.

PMC5348462

pubmed-550

endothelial dysfunction is an early predictor of cardiovascular disease [13], and might be the causal pathological mechanism of a variety of metabolic diseases, also referred to as the common soil hypothesis. endothelial function has been shown to be impaired in patients with coronary artery disease, type ii diabetes mellitus, hypertension, obesity, renal failure, and hypercholesterolemia [59]. it is conceivable that improvement of endothelial function will be an important target in the treatment of these conditions. therefore, availability of methodology that can be used to reliably assess the effects of (pharmacological) treatments on endothelial function is of critical importance. endothelial dysfunction is commonly described as the inability of the artery to sufficiently dilate in response to an appropriate endothelial stimulus. it can be assessed by measurement of the arterial pulse wave at a finger artery or by the measurement of flow-mediated dilation (fmd) of the brachial artery after occlusion of the blood flow. although the exact mechanisms causing fmd are not entirely known, the main mechanism inducing fmd is thought to be an increase in shear stress, leading to the release of nitric oxide from endothelial cells which causes blood vessel dilation. currently, fmd is assessed clinically in a noninvasive manner using high-resolution ultrasound of the brachial artery. the technique is widely used and has been shown to be a suitable tool to assess endothelial dysfunction. however, the method has several disadvantages: it is operator dependent, and as fmd is measured at one arm only, there are no possibilities to correct for potential measurement-induced changes in the systemic hemodynamics, such as those resulting from alterations in the autonomous nervous system tone. to overcome these problems, the endopat was developed. this device allows non-invasive measurement of vasoreactivity without the disadvantages of conventional ultrasound measurement. the endopat detects plethysmographic pressure changes in the finger tips caused by the arterial pulse and translates this to a peripheral arterial tone (pat). endothelium-mediated changes in vascular tone after occlusion of the brachial artery are reflecting a downstream hyperemic response, which is a measure for arterial endothelial function. measurements on the contralateral arm are used to control for concurrent nonendothelium-dependent changes in vascular tone. in addition, the endopat provides a measure for arterial stiffness: the augmentation index (ai). in theory, the endopat could be a useful device in clinical research as the test is easy to perform, not operator-dependent, and with comprehensive automatic analysis. in a group of 89 adult patients suffering from chest pain, peripheral arterial tone correlated positively with fmd. in the framingham study, a significant inverse relation was observed between endothelial function as determined by the endopat (endoscore or reactive hyperemia index, rhi) and multiple cardiovascular risk factors (male sex, body mass index, total/hdl cholesterol, diabetes, smoking, and lipid-lowering treatment). the endoscore was reported to be significantly decreased in patients with coronary artery disease, hypertension, hyperlipidemia, diabetes, glucose intolerance, and tobacco users (group sizes of 15 to 70 subjects) [12, 1418]. several endopat studies have demonstrated an improvement in endothelial function as a result of lifestyle modification (smoking cessation, and dietary change) [1922] or prolonged pharmacological intervention [23, 24]. however, there is only limited information on the performance of the endopat for repeated measurements in a relatively short time frame. this information is pertinent as in many clinical (pharmacology) studies repeated measures are performed in populations consisting of 6 to 12 subjects. therefore, we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function and arterial stiffness with repeated measurements and to assess the discriminating power of the endopat in different populations. first, we investigated the variability of endothelial function and arterial stiffness, as measured by the endopat, in patients with chronic kidney failure on three different days. endothelial function, as assessed by high-resolution ultrasound, is known to be severely impaired in this patient population, despite intensive treatment (3060% reduction) [2528]. in addition, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2, another patient population with a strongly reduced endothelial reactivity as determined using conventional techniques (3035% reduction) [2931]. finally, we investigated the capability of the device to detect changes in endothelial function induced by two acute and robust interventions (smoking and glucose administration) in healthy volunteers. cigarette smoking acutely impairs endothelial function in healthy volunteers by causing oxidative stress and reducing the production of nitric oxide due to the free radicals present in cigarette smoke [2, 32]. also high blood glucose levels lead to an attenuated endothelial function, as has been demonstrated by plethysmography and high-resolution ultrasound [33, 34]. the experiments were approved by the medical ethics committee of leiden university medical center (lumc). endothelial function and arterial stiffness were assessed in 6 renal patients (creatinine clearance between 30 and 70 ml/min) and 16 patients with diabetes mellitus type 2 (8 using metformin and 8 using metformin plus sulfonylurea). intervention studies were performed in apparently healthy males and females, not using any medication. in all experiments, subjects were fasted for at least 3 hours before endopat measurements. reactive hyperemia index (rhi), which is a measure for endothelial function, and augmentation index (ai), which is a measure for arterial stiffness, were assessed using the endopat 2000 device (itamar medical, israel). both measures were calculated using a computerised automated algorithm (software version 3.1.2) provided with the device. briefly, the subjects were in supine position for a minimum of 20 minutes before measurements, in a quiet, temperature-controlled (2124c) room with dimmed lights. the subjects were asked to remain as still as possible and silent during the entire measurement period. each recording consisted of 5 minutes of baseline measurement, 5 minutes of occlusion measurement, and 5 minutes postocclusion measurement (hyperemic period). the occlusion pressure was at least 60 mmhg above the systolic blood pressure (minimally 200 mmhg, and maximally 300 mmhg). endothelial function and arterial stiffness were investigated in six patients with chronic kidney failure (subject characteristics in table 1, glomerular filtration rate was estimated by calculation of creatinine clearance using a 24-hour urine collection). all measurements were performed in the morning. per subject, 3 measurements were performed, separated by one to two weeks. patients were allowed to use medication needed for their medical condition, except for corticosteroids and erythropoietic medication within one month before study participation. endothelial function and arterial stiffness were investigated in 16 patients with diabetes mellitus type 2 (subject characteristics in table 2). all subjects were on oral antidiabetics to control glucose metabolism: 8 subjects were using metformin, and 8 subjects were using metformin plus sulfonylurea. per subject, two endopat measurements were performed: one time during continuation of the antidiabetic therapy and one time after two weeks of therapy discontinuation, with the sequence randomized. patients were allowed to use medication needed for their medical condition, except for medication known to affect glucose homeostasis (other than biguanides and sulphonylurea), anti-inflammatory drugs, nonselective beta blockers, oral anticoagulants, and systemic glucocorticoids or other immunosuppressive drugs. six nonsmoking female subjects (mean age 23 3 years) participated in the oral glucose intervention study part. after the baseline endopat measurement was performed, an oral glucose solution (75 g glucose in 300 ml) was consumed within 4 minutes. at 30 minutes and 90 minutes after the oral glucose consumption six male cigarette smoking subjects (mean age 32 10 years) participated in this study part. subjects refrained from smoking until at least 2 hours before the start of the study. after a baseline measurement was performed, the participants smoked a cigarette (tar 10 mg, nicotine 0.8 mg and carbon monoxide 10 mg) within 4 minutes. at 30 minutes and 90 minutes after smoking unpaired t-tests were used to compare rhi and ai between healthy volunteers and patients and between diabetic patients using metformin only and patients using metformin plus sulfonylurea, while paired t-tests were used to compare rhi and ai between diabetic patients who continued their medication and patients who discontinued their medication. the intervention experiments were carried out in groups of 6 healthy volunteers; a sample size based on the observed intraindividual variability in rhi and the level of impairment of endothelial function determined by conventional techniques (high-resolution ultrasound, plethysmography) in intervention studies as reported in literature. our experiments were powered such that a group size of 6 would have 80% power to detect a 25% change in baseline rhi using a 2-sided alpha of 5%. paired t-tests were used to compare the difference in rhi between baseline and the postintervention measurements, which was considered to be statistically significant when p value<0.05. to assess the performance of the endopat, we investigated the variability of endothelial function (rhi) and arterial stiffness (ai) in patients with chronic kidney failure on three different days, separated by one to two weeks. average rhi over three days was 2.9 1.4 (table 3). for most patients, the rhi values exceeded a value of 2 (range: from 1.7 to 5.5). official reference values for rhi are not available, but in general rhi values below 2 are categorized as endothelial dysfunction, whereas higher rhi values are considered normal or improved endothelial function (itamar product information). the average intra-individual variability for the rhi was 13% (ranging from 1% to 29% for individuals, data not shown). this is in line with the expectation, as normal arterial stiffness is defined by an ai between 30% and 10%, increased arterial stiffness by an ai between 10% and 10%, and abnormal arterial stiffness by an ai above 10%. the mean intra-individual coefficient of variation was 37% (ranging from 13% to 67%, data not shown). these data indicate that whereas endothelial function is a relatively stable measure over a longer period of time, arterial stiffness as determined by the endopat is rather variable. next, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2, 8 subjects using metformin and 8 subjects using metformin plus sulfonylurea. endothelial function and arterial stiffness were determined during continuation of the antidiabetic therapy and after two weeks of therapy discontinuation. arterial stiffness, as determined by ai, was not different between patients using metformin or metformin plus sulfonylurea or between patients continuing and discontinuing antidiabetic medication (table 4: 5.9 9.4 versus 9.0 13.0 and 14.3 18.8 versus 16.3 16.0, resp.). however, rhi was significantly higher in patients using a combination of metformin plus sulfonylurea, compared to patients using metformin only (table 3: 2.5 0.7 versus 1.8 0.3 in patients continuing therapy and 2.7 1.1 versus 1.8 0.4 in patients discontinuing therapy; p=0.02 and 0.04 resp.). the increasing effect of sulfonylurea treatment on rhi was independent on continuation or discontinuation of the use of antidiabetics. finally, we investigated the capability of the endopat to detect changes in endothelial function induced by two acute interventions in healthy volunteers. neither the oral glucose load nor the smoking intervention resulted in significant effects on endothelial function (figure 1). for the glucose intervention, the difference in rhi from baseline measurement was 0.08 0.50 (95% ci, confidence interval: from 0.44 to 0.60) for the 30 min assessment and 0.44 0.86 (95% ci: from 0.46 to 1.34) for the 90 min assessment. for the smoking intervention, the difference in rhi from baseline measurement was 0.49 0.92 (95% ci: from 0.47 to 1.46) for the 30 min assessment and 0.39 0.53 (95% ci: from 0.16 to 0.95) for the 90 min assessment. ai and rhi were compared between the investigated patient groups and the healthy volunteer group. as expected, ai was higher in renal patients compared to healthy subjects (table 4: 26.1 13.9 in patients versus 6.0 14.2 in healthy volunteers, p=0.001). ai was also higher in diabetic patients compared to healthy subjects, independent of type of oral antidiabetics (metformin or metformin plus sulfonylurea) or continuation or discontinuation of therapy (table 4: 5.9 9.4, 9.0 13.0, 14.3 18.8, and 16.3 16.0, resp., in patients versus 6.0 14.2 in healthy volunteers, 0.01<p<0.05). however, there was no difference in rhi between the renal patients and the healthy volunteers (table 3: 2.9 1.4 in patients versus 1.8 0.5 in healthy volunteers, p=0.15). furthermore, rhi values did not differ between diabetic patients using metformin and healthy volunteers (table 3: 1.8 0.3 in patients continuing therapy and 1.8 0.4 in patients discontinuing therapy versus 1.8 0.5 in healthy volunteers). rhi was significantly higher in diabetic patients using a combination of metformin plus sulfonylurea compared to healthy volunteers (table 3: 2.5 0.7 in patients continuing therapy and 2.7 1.1 in patients discontinuing therapy; p=0.04 and 0.01 resp. versus healthy volunteers). endothelial dysfunction is present in several systemic pathological conditions [59], associated with considerable morbidity and mortality. as a consequence, endothelial dysfunction is expected to gain interest as potential target for (pharmaceutical) intervention within the coming years. currently, endothelial function is assessed mainly by high-resolution ultrasound of the brachial artery. however, this technique has important practical limitations: it is strongly operator-dependent, and it offers no correction for autonomous activation of the nervous system, as vascular dilation is only studied in one arm. to overcome these problems, the endopat was developed, allowing noninvasive measurement of endothelial function via assessment of reactive hyperemia. although in several studies the endopat appeared to be feasible to demonstrate improvement of endothelial function as a result of lifestyle modification or pharmacological intervention [1924], the information in literature on the performance of the endopat in intervention trials is limited. therefore, we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function with repeated measurements and to assess the discriminating power of the endopat for endothelial function and arterial stiffness in different populations. we assessed the variability of endothelial function (by rhi) and arterial stiffness (by ai), as measured by the endopat, in patients with impaired renal function on three different days. next, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2. finally, we investigated the applicability and feasibility of the endopat to detect changes in endothelial function in healthy volunteers after interventions known to be associated with robust acute changes in endothelial function in an adequately powered experiment. generally, augmentation index, calculated from carotid, aortic, or radial artery pressure waves using conventional techniques, is a reliable and reproducible measure to define arterial stiffness. however, the influence of variables such as heart rate and vasomotor tone of the arterial system can affect the variability of the technique. we demonstrated that when using the endopat, the intra-individual variability in ai was substantial over a longer period of time (cv: coefficient of variation, 37%). this indicates that arterial stiffness as determined by the endopat is also not a stable measure, which limits its usefulness to assess the effects of (pharmacological) interventions. arterial stiffness as measured by the endopat was higher in renally impaired patients with vascular disease compared to healthy subjects. this is in line with reports in literature in patient populations: compared to healthy volunteers, arterial stiffness is increased in a variety of pathological conditions, such as coronary artery disease, metabolic syndrome, and chronic kidney disease [3739]. compared with arterial stiffness, rhi proved to be a more stable measure (cv 13%). surprisingly, endothelial function, as determined by reactive hyperemia index, was not impaired in the renal patient group. importantly, observed rhis in the patient population were scattered over a broad range, covering both endothelial dysfunction (rhi<2) and exceptionally good endothelial function (rhi>3). given the fact that all subjects were renally impaired and treated for hypertension, it is very unlikely that 4 out of 6 patients had an (exceptionally) good endothelial function. obviously, all patients used medication with pertinent effects on endothelial function (table 1: statins, ace inhibitors, and calcium channel blockers), but literature data suggest that despite optimal (cardiovascular) therapy, a considerable increased risk for cardiovascular morbidity in this population still exists. importantly, although most chronic kidney disease patients use antihypertensive medication and other drugs that could affect endothelial function (statins, potassium, and ace inhibitors), they still exhibit a significantly impaired endothelial function as demonstrated by laser doppler flowmetry (32% reduction). interestingly, gordon et al. reported that pulse contour analysis obtained by finger plethysmography, which is comparable with the endopat methodology, may not be suitable to measure endothelial function in subjects with extensive coronary artery disease, as no effect of administration of strong vasodilators (salbutamol and nitroglycerin) could be observed. we investigated whether the endopat could discriminate in vascular function between healthy volunteers and patients with diabetes mellitus type 2. as expected, arterial stiffness was higher in diabetic patients compared to healthy subjects, irrespective of treatment with oral antidiabetics. however, endothelial function (as measured by the endopat) was not impaired in diabetic patients using metformin compared to healthy volunteers, neither during continuation of treatment nor after two weeks of treatment discontinuation. this is contrasting with literature, which demonstrates that endothelial function, measured using conventional techniques (endothelium-dependent flow-mediated dilatation of the brachial artery, by ultrasound), is substantially impaired in diabetic patients (reduction of endothelial function versus healthy controls or subjects with coronary artery disease without diabetes ranging from 27% to 43%) [2931]. this discrepancy could not be explained by an effect of treatment with oral antidiabetics, as rhi was assessed both during treatment continuation and after a two-week period of treatment discontinuation. rhi was significantly increased in patients using a combination of metformin plus sulfonylurea, compared to healthy volunteers and to patients using metformin only. this stimulating effect of sulfonylurea treatment on rhi was still observed after two weeks of treatment discontinuation, implicating a long-lasting effect of sulfonylurea on endothelial function. this is remarkable as the general point of view is that the use of pancreatic -cell-specific sulfonylurea (i.e., glimepiride, as used by 6 out of 8 diabetic subjects in our study) does not affect endothelial function [4345]. possibly, endothelial function as measured by the endopat (rhi) is a physiologically different process than endothelial function as measured by conventional techniques such as high-resolution ultrasound (endothelium-dependent fmd). the exact nature of this difference is currently unknown, and should be investigated in detail before the endopat can be considered a useful tool in drug development or clinical practice. we evaluated the performance of the endopat to detect the effects of two different acute interventions on rhi in healthy subjects. the literature shows that fmd decreases by 4065% after smoking one cigarette, which is detected directly after smoking and lasts for 1 hour [2, 32, 46, 47]. also hyperglycaemia, induced by the administration of a standardised oral glucose load, has been reported to acutely lead to a 2545% impairment of endothelial function, as assessed by fmd or forearm blood flow plethysmography [33, 34, 48]. however, we were unable to replicate these findings on endothelial function using the endopat, demonstrating that the device is currently not suitable to detect acute changes in endothelial function after different robust interventions. there could be several explanations for our findings. in the automated analysis, the endopat software uses a fixed time frame during the hyperemic response to calculate the rhi. inspection of the data and manual analysis of the rhi showed that the maximal hyperemic response does not always occur in the same time period after occlusion (data not shown), an observation that is supported by literature. for example, the time course of fmd is strongly influenced by age: comparison of young and older subjects indicates that the time frame to reach maximal vasodilatation after occlusion is significantly prolonged in older subjects. this may be remedied by refinement of the endopat software to allow for interindividual differences in hyperemic time course. although inter-individual differences in hyperemic time course is a potentially confounding factor when using the automatic analysis, manual analysis of our data did not result in significantly different findings (data not shown). there are some indications that endothelial function is subject to a circadian rhythm, with a lower reactive hyperemic response in the morning, but this is not unambiguously supported [5154]. in fact, the presumed circadian variability is probably more related to changes in physical activity, blood pressure and shear stress, and changes in plasma lipids. whatever the explanation may be, our experiments were performed within a short fixed time frame of maximally 2 hours, in a fasted condition and in complete rest, thereby reducing the influence of these confounding factors. as a consequence, it is unlikely that circadian variability has influenced our measurement outcomes. finally, it is possible that previous experiments using ultrasound or plethysmography to assess the acute effect of an intervention on endothelial function are flawed because measurements were performed (in the majority of the cases) in the vasculature of one arm only, and thus relatively uncontrolled for concomitant systemic hemodynamic changes. we are well aware that the group sizes of our intervention experiments were small and that no formal control groups were included. however, the experiments were sufficiently powered to detect intervention-induced changes in endothelial function at effect sizes that are reported in literature using fmd or forearm blood flow plethysmography. in conclusion, whereas the reactive hyperemia index (a measure for endothelial function), as determined by the endopat, is rather stable over time, the augmentation index (a measure for arterial stiffness) showed substantial intra-individual variability, limiting its value for evaluation of (pharmacological) interventions. surprisingly, the endopat did not demonstrate differences in endothelial function between healthy volunteers and renally impaired patients with known vascular disease or diabetic patients. in the latter patient group, an unexplained improving effect of sulfonylurea on reactive hyperemia index was demonstrated by the endopat. this could indicate that endothelial function as measured using the endopat might be physiologically different from endothelial function as measured by conventional techniques. furthermore, the endopat was not useful to detect the effect of robust interventions on endothelial function while the experiments were adequately powered. taken together, our findings suggest that the endopat is at present not suitable to assess (changes in) endothelial function and arterial stiffness in populations with sizes that are commonly employed in clinical pharmacology studies.

endothelial dysfunction is a potential target for (pharmaceutical) intervention of several systemic pathological conditions. we investigated the feasibility of the endopat to evaluate acute changes in endothelial function with repeated noninvasive measurements and assessed its discriminating power in different populations. endothelial function was stable over a longer period of time in renally impaired patients (coefficient of variation 13%). endothelial function in renally impaired and type 2 diabetic patients was not decreased compared to healthy volunteers (2.9 1.4 and 1.8 0.3, resp., versus 1.8 0.5, p>0.05). the endopat did not detect an effect of robust interventions on endothelial function in healthy volunteers (glucose load: change from baseline 0.08 0.50, 95% confidence interval 0.44 to 0.60; smoking: change from baseline 0.49 0.92, 95% confidence interval 0.47 to 1.46). this suggests that at present the endopat might not be suitable to assess (changes in) endothelial function in early-phase clinical pharmacology studies. endothelial function as measured by the endopat could be physiologically different from endothelial function as measured by conventional techniques. this should be investigated carefully before the endopat can be considered a useful tool in drug development or clinical practice.

PMC3303545

pubmed-551

several chemoprotective properties of lycopene on prostate cancer have been proposed, including potent antioxidant properties, decreased lipid oxidation, inhibition of cancerous cell proliferation at the g0-g1 cell cycle transition, and protection of lipoproteins and dna [1, 2]. these mechanistic studies have stimulated the examination of lycopene and its primary source, tomato products, on risk of prostate cancer. however, studies on lycopene and tomato intake and prostate cancer incidence have yielded mixed results. the study of this relationship has been complicated by unique and challenging epidemiologic considerations in the measurement of lycopene and on the influence of prostate-specific antigen (psa) screening on prostate cancer incidence and progression. as with all epidemiologic studies, this paper briefly describes the methodology essential for conducting studies on the association between lycopene and prostate cancer incidence and provides an updated review of studies of lycopene and tomato products with prostate cancer risk. lycopene is a carotenoid devoid of vitamin a activity. the major source by far, particularly in western populations, is tomato and tomato products; a few other foods such as watermelons and pink grapefruit also contain lycopene. in epidemiologic studies, approaches to assess an individual's lycopene intake or status include studies that estimate intake of lycopene (based on reported intake of foods and food content of lycopene from food composition databases), studies that assess tomato product intake as a surrogate of lycopene intake, and studies that measure lycopene levels in the serum or plasma. an issue that is not unique for lycopene, but perhaps of special importance for this carotenoid, is the variable absorption of lycopene from different food sources. in particular, cooking in an oil medium substantially enhances bioavailability of lycopene in the intestine because lycopene is highly bound to plant source matrices and is highly lipophilic. the measure of lycopene in the serum has theoretical advantages of accounting for absorption and not relying on study participants ' food recall and accuracy of food composition tables. on the other hand, serum studies have frequently relied on a single measure, and how well a single measurement reflects long-term intake is not entirely clear. also, since lycopene comes largely from tomato sources, circulating lycopene level may be acting as a surrogate of tomato product intake, and other components of tomatoes may account for any observed association with cancer risk. finally, a population that consumes overall low levels of lycopene or similar levels of lycopene across individuals may result in insufficient contrast between high and low consumers. psa release into the serum occurs with tissue breakdown between the prostate gland lumen and capillaries. the original purpose of the psa measurement was to monitor prostate cancer progression and recurrence. the food and drug administration approved psa testing for monitoring disease status in men with prostate cancer in 1987 and expanded its use to diagnosing prostate cancer in 1992. this approval was followed by professional society guidelines that supported the use of psa testing for prostate cancer screening. consequently, psa became widely used as a screening test in the united states and increasingly in other countries. as a screening modality, the sensitivity and specificity of psa varies based on the cut-off. for example, a psa level of 3 ng/ml has a sensitivity of 32% for detecting any prostate cancer and 68% for high-grade prostate cancer and a specificity of 85%. if this level were increased to 4 ng/ml the sensitivity would decrease to 21% for any prostate cancer and 51% for high grade prostate cancer but specificity would improve to 91%. elevated serum psa may precede invasive carcinoma by a minimum of 510 years. thus, psa testing enabled earlier detection of prostate cancer. the rate of first-time psa testing was strongly correlated with prostate cancer incidence rates. with the onset of psa for screening, prostate cancer incidence increased and peaked in 1992 and declined thereafter. prior to widespread psa use for screening, prostate cancer diagnosis was largely prompted by physical exam findings of an enlarged prostate or symptoms ranging from urinary incontinence to more advanced spinal cord compression and bony pain from metastasis; therefore, prostate cancer was mostly detected in relatively advanced stages. invasive carcinoma prevalence increases with age: 2% for men in their 30 s compared with 64% for men in their 70s. one-third of men under age 80 will have prostate cancer detected on autopsy. the lifetime risk of prostate cancer is 16% while the risk of mortality from prostate cancer is 2.9%. thus a psa screening era beginning in 1988, fda approved in 1992, and peaking between 1992 and 1998 has been referred to as a period in which prostate cancers diagnosed by serum psa alone encompassed a variety of stages of prostate cancers, including clinically indolent cancers [4, 7]. in addition to diagnosing biologically indolent cancers, psa elevation occurs with benign conditions including benign prostatic hypertrophy, prostatitis, subclinical inflammation, ejaculation, digital rectal exams (potentially performed just prior to patients having their psa lab drawn), perineal trauma, prostatic infarction, urinary retention, biopsy, and transurethral resection of the prostate. the influence of psa on prostate cancer mortality has been controversial, with randomized trials not yielding a clear answer. however, undoubtedly psa screening has caused an increase in the number of indolent cancers being treated aggressively and ultimately led to increased morbidity from side effects of treatment. the majority of newly diagnosed prostate cancers were clinically localized and unlikely clinically significant to involve aggressive medical and surgical therapy such as radical prostatectomy with radiation ablation intended to cure early-stage cancers. for these reasons, in 2011 the united states preventive services task force recommended against psa screening for prostate cancer regardless of age, race/ethnicity, and family history. beyond the clinical consequences, psa screening has altered the landscape of prostate cancer epidemiology. many more cancers are diagnosed, including a substantial proportion of relatively indolent cancers, and the cancers are diagnosed earlier in their natural history, often before evidence of aggressive behavior is manifested. thus, depending on at what stage and on what subtype of prostate cancer a risk factor may be acting, the relationship between this risk factor and prostate cancer risk may differ in populations exposed or not exposed to widespread psa screening. by increasing the heterogeneity in prostate cancers being diagnosed, psa screening has added complexity to the epidemiologic study of prostate cancer. a number of randomized clinical trials have examined lycopene and prostate cancer progression and mortality in men diagnosed with prostate cancer. the randomized studies have been small and inconclusive. in a double-blind randomized placebo-controlled trial, 105 african american male veterans recommended for biopsy to detect prostate cancer were administered tomato sauce containing 30 mg/day of lycopene or placebo over 21 days. psa and lycopene levels were measured, and the group randomized to lycopene had an increase in serum lycopene and decrease in psa while the placebo group had the reverse, with a decrease in serum lycopene and increase in psa. this study did not report a significant decrease in prostate cancer risk for individuals administered lycopene, but the study duration of 21 days was likely inadequate to significantly influence prostate cancer risk. one study reported a decline in psa in the lycopene as well as placebo group after 1 month of intervention but return to baseline psa levels for both groups after 4 months of followup. in general, the clinical trials have been considerably limited by size, length of study duration, and other methodological issues and do not provide strong support or refutation of an association between lycopene and prostate cancer risk. prospective and nested case control studies have been published previously in qualitative [13, 14] and quantitative reviews. in a meta-analysis of prospective studies up to 2003, high intake of raw but not cooked tomatoes was associated with a decreased risk of prostate cancer (relative risk (rr) 0.71, 95% confidence interval (ci): 0.570.87). subsequent cohort studies on dietary lycopene intake [16, 17] have not reported significant inverse associations with prostate cancer risk. however, these studies were conducted in the post-psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers. among prospective dietary studies, four [1821] of six cohorts report an inverse relationship between lycopene or tomato consumption and prostate cancer incidence. the largest and only study with multiple assessments of diet was conducted in the health professionals follow-up study (hpfs) [18, 19]. the hpfs first reported an inverse association between lycopene intake in 1986 with prostate cancer diagnosed between 1986 and 1992: rr for high versus low quintile of intake=0.79 (95% ci: 0.640.99, ptrend=0.04). high intake of tomato-based products was associated with a 35% decreased risk of total prostate cancer (rr 0.65, 95% ci: 0.440.95) and 53% decreased risk of advanced stage prostate cancer (rr 0.47, 95% ci: 0.221.00; ptrend=0.03). the hpfs analysis was updated for prostate cancer cases between 1992 and 1998 using cumulative average updated intakes (i.e., averaging intake from all the dietary questionnaires up to the time period of risk) of lycopene from 1986 to 1998 with a similar inverse association detected: rr=0.83 (95% ci: 0.700.98, ptrend=0.02). the hpfs assessed dietary intake every four years, and the timing of intake in relation to period of risk for prostate cancer was assessed. when baseline lycopene intake in 1986 was evaluated for prostate cancer cases during the entire follow-up period, however, statistically significant inverse associations were found when using the questionnaire closest in time to the time period of risk (rr for high versus low lycopene intake=0.84, 95% ci: 0.740.96, ptrend=0.02) and cumulative average updated lycopene intake (rr for high versus low lycopene intake=0.84, 95% ci: 0.730.96, ptrend=0.003). alternatively, a single measurement of dietary intake at baseline may not be the best measurement to reflect the potential impact of lycopene in altering prostate carcinogenesis, compared with multiple updated dietary measurements. individual tomato products were examined in relation to prostate cancer risk, and the strength of the association corresponded to association of the food item with serum lycopene levels, which were concurrently available in the hfps. for example, tomato sauce, the most bioavailable form of lycopene, was most strongly related to decreased prostate cancer risk (rr for 2 servings/week versus<1 serving/month=0.77, 95% ci: 0.660.90), followed by tomato and pizza but not tomato juice. there was an even stronger association for advanced prostate cancer: rr for 2 servings/week versus<1 serving/month of tomato sauce=0.65 (95% ci: 0.420.99, ptrend=0.02). a similar magnitude decrease in prostate cancer was reported in the california seventh day adventist cohort between 1974 and 1982 for men with high tomato consumption. high intake of tomatoes was associated with a statistically significant 40% decreased risk of prostate cancer (rr 0.60, 95% ci: 0.370.97). in another study, a 50% lower risk of prostate cancer was reported for high compared with low tomato consumption in us men between 1987 and 1990: rr 0.50 (95% ci: 0.300.90, ptrend=0.03), but few details were provided. dietary cohort studies that did not report associations with prostate cancer incidence frequently had lower lycopene and tomato intake compared with studies that report an association. a dietary cohort study based in the netherlands between 1986 to 1992 did not report an association between tomato intake and prostate cancer incidence. while this cohort took place between the same time period as the initial hpfs analysis, tomato consumption was low compared with the hpfs. in addition, consumption of tomato-based products, which contain more bioavailable lycopene, was not specifically addressed. a diet-based cohort study of individuals in the prostate, lung, colorectal, and ovarian screening trial examined intakes of lycopene and top food sources of lycopene but did not find inverse associations for lycopene, raw tomatoes, canned tomatoes, or other processed tomato products (ketchup, tomato sauce, pizza, lasagna, tomato and vegetable juice, chili) with total or nonadvanced prostate cases. predominately white men (90.7%) enrolled in this study between 1993 and 2001 received baseline psa screening or digital rectal examination and completed annual questionnaires. men with a psa level>4 ng/ml or digital rectal examination concerning for prostate cancer were referred to their medical provider for further diagnostic evaluation and staging of prostate cancer. the majority (92%) of prostate cancers nonadvanced disease (gleason score<7 or stage i or ii) comprised 61% of total prostate cancer cases and was not associated with total lycopene intake or lycopene from processed foods. greater consumption of spaghetti/tomato sauce and pizza was associated with decreased incidence of advanced disease but did not reach statistical significance (rr 0.81, 95% ci: 0.571.16 and rr 0.79, 95% ci: 0.561.10, respectively). the association of tomato products with advanced but not nonadvanced prostate cancer suggests a possible stronger role for lycopene in advanced disease. limitations of this study include the assessment of lycopene intake from a single baseline measurement. in addition, intake for all but raw tomatoes was low in this population, with no more than two servings per week (mean total lycopene intake 11,511 and standard deviation 8,498 g/d). further, a large portion of prostate cancer cases were diagnosed by initial psa screening, and total prostate cancers reflected a heterogeneous mix of mostly nonadvanced prostate cancer cases. dietary lycopene was not reported to have an association with prostate cancer risk in a prospective study from the prostate cancer prevention trial. the pcpt originated as a randomized trial of finasteride but was converted to a prospective observational study. men with an abnormal digital rectal examination or psa level 4 ng/ml or greater were encouraged to receive a prostate biopsy. at the final study year this resulted in the inclusion of incidental cases of prostate cancer that contributed to the substantial 24.8% of prostate cancer cases diagnosed in men originally randomized to the control group. the majority of cancers were localized and detected by screening or incidentally discovered, and it is possible that low-grade cancers have different characteristics from high-grade cancers. in addition, it may be necessary to assess lycopene through simple updated or cumulative average updated intakes rather than a single baseline measurement. a number of studies have examined serum or plasma lycopene from biobanks in relation to subsequent prostate cancer risk. the studies were typically nested case control in design; incident cases and matched cancer-free controls over the follow-up period were identified, and serum or plasma lycopene was measured in the banked biospecimens. in a meta-analysis of prospective studies up to 2003, high serum lycopene levels were associated with significant decreased risk of prostate cancer: rr=0.78 (95% ci: 0.611.00). subsequent studies on serum lycopene levels conducted in the post-psa era [2328] have not reported significant inverse associations with total prostate cancer risk. one of the earliest studies to report an inverse association between serum lycopene and prostate cancer risk was a nested case control study of 103 prostate cancer cases matched with 103 controls among 25,802 male residents of washington county, md who donated blood in 1974. a nonsignificant 50% reduction in prostate cancer risk was reported (or 0.50; 95% ci: 0.201.29). two of the largest nested case control studies reported inverse associations between plasma lycopene and prostate cancer risk [30, 31]. plasma lycopene levels were higher in these multicentered us cohorts compared with other studies, which may reflect the higher education level in these populations. a nested case control study within the physicians ' health study, a randomized, placebo-controlled trial of aspirin and -carotene, assessed incident prostate cancer cases in 578 men compared with 1294 age- and smoking-status-matched controls. men with higher plasma lycopene had a borderline significant decreased risk of prostate cancer (highest quintile rr=0.75; 95% ci: 0.541.06; ptrend=0.05). there was a significantly greater decreased risk for aggressive (high stage or high grade) prostate cancer: highest quintile plasma lycopene, rr=0.56 (95% ci: 0.340.91; ptrend=0.05). these associations were not confounded by covariates including age, smoking status, body mass index, physical activity, alcohol intake, multivitamin use, or plasma total cholesterol level. in a nested case control study within the prospective hpfs cohort, 450 incident cases of prostate cancer diagnosed between 1993 and 1998 were matched with 450 controls by age, time, month, season, and year of blood donation. a nonsignificant inverse association was reported for plasma lycopene and risk of prostate cancer: rr for highest versus lowest quintile, 0.66 (95% ci: 0.381.13). this association was statistically significant for men older than 65 years at time of plasma donation: rr for highest versus lowest quintile, 0.47 (95% ci: 0.230.98), but was not observed for younger men. serum lycopene was recently assessed in a nested case control study within the prostate cancer prevention trial (pcpt). there was no association between serum lycopene and prostate cancer incidence, but incidentally diagnosed prostate cancer cases by end-of-study biopsies were analyzed alongside prostate cases diagnosed by screening. in a reanalysis that included only cancers diagnosed from abnormal screening the cancers assessed by end-of-study biopsy were relatively static (e.g., no psa elevation or sign of clinical progression) during the study period, so may not be appropriately considered as several other serum lycopene studies reported nonsignificant inverse associations [2325, 27] or no association [26, 32] with prostate cancer risk. however, these studies were conducted in the post-psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers. as with the pcpt, an association with lycopene could be missed. in the large european study (epic) by key et al., a statistically significant inverse association was observed for cases diagnosed at an advanced stage. in this study, men in the highest versus lowest quintile of lycopene level had a rr of 0.40 (95% ci: 0.190.88). several studies retrospectively examined the association between tomatoes, tomato-based products or lycopene, and prostate cancer risk, with mixed results. in a meta-analysis of case control studies through 2003, high intakes of raw tomatoes, cooked tomatoes, and lycopene were not associated with decreased prostate cancer risk. a strong inverse dose-response relationship between lycopene intake and histopathologically confirmed lycopene intake was assessed using a reproducible and validated 130-item food frequency questionnaire for elderly men in china. for lycopene intakes of 16093081, 30814917, and>4917 g/d, the rrs of prostate cancer compared with lycopene intake<1609 g/d were 0.47 (95% ci: 0.250.86), 0.40 (95% ci: 0.210.77), and 0.17 (95% ci: 0.080.39), respectively. the rrs reported for lycopene and prostate cancer in this study were stronger than some prior studies. this study also examined green tea and vegetable and fruit intake and reported strong, significant inverse associations for all these associations. the incidence of prostate cancer is lower in developing countries such as china, compared with western countries. in china psa screening while further information and stratification based on prostate cancer grade and staging were not provided in this study, the lower prevalence of psa screening practices in china compared with the usa suggests prostate cancer cases in this cohort were more likely to be at advanced stages. the strong association between lycopene and probable advanced prostate cancer suggests a role for lycopene in influencing risk of aggressive cancer. a significant inverse association between tomato intake and prostate cancer was similarly reported in a case control study of 617 canadian men with prostate cancer and 636 age-matched controls conducted between 1989 and 1993. the rr of prostate cancer was 0.64 (95% ci: 0.450.91) for tomato intake>73 g/day compared with<24 g/day. there was no significant association reported for lycopene intake and prostate cancer. in a case control study of 130 prostate cancer cases in iranian men, tomato consumption of greater than 100 g/week was nonsignificantly inversely associated with decreased prostate cancer risk (rr 0.45; 95% ci: 0.092.12). food intake was assessed based on the past two months of intake, and tomato intake questions included tomato extract and dressing. however, it is unclear whether this tomato group included both raw and processed tomatoes. an additional study reported a nonsignificant inverse association between dietary lycopene and prostate cancer risk while several reported no association [3840]. three case control studies of plasma lycopene reported strong inverse associations with histopathologically confirmed prostate cancer [4143]. one study of non-hispanic caucasian men used high-pressure liquid chromatography (hplc) to examine plasma lycopene isoforms. cis-lycopenes 2 through 5 individually and in sum as total cis-lycopene and trans-lycopene were not associated with prostate cancer risk. this study suggests the structural type of lycopene measured may influence the ability to detect an association, as one cis isomer but not total cis- or trans-lycopene was associated with decreased prostate cancer risk. however, a study in the hpfs found that the isomers were highly correlated with each other, making any specific effects difficult to distinguish. the multicentered case control third national health and nutrition examination survey (nhanes iii) of u.s. caucasian and african american men aged 4079 years reported a significant inverse association between serum lycopene and aggressive prostate cancer (highest compared with lowest quartile rr=0.37; 95% ci: 0.150.94; ptrend=0.04) and nonsignificant association between serum lycopene and prostate cancer (highest compared with lowest quartile rr=0.65; 95% ci: 0.361.15; ptrend=0.09). caution should be used in interpreting results from case control plasma or serum studies because the cancers could possibly be influencing lycopene level, resulting in reverse causation. this paper focused on prostate cancer incidence that may or may not have been detected by initial psa screening and highlights differences in the association with lycopene based on prostate cancers initially screened with psa testing compared with cancers diagnosed in more advanced stages. elevated psa may be attributed to a number of benign factors, including the highly prevalent benign prostatic hypertrophy in older men, and should not be used in isolation along with single serum measurements for the diagnosis of prostate cancer. randomized interventions of lycopene and prostate cancer risk have been limited in scope, and some used psa as an endpoint [10, 11]. thus, trials do not provide strong support either for or against a causal association. the epidemiologic literature on lycopene intake or level and prostate cancer based on observational studies has been inconsistent overall. one potential explanation is that there was a relative over-reporting and publishing of positive studies in the earlier years, followed by a correction of this publication bias as the hypothesis grew in interest and null studies were published. if so, then it may be concluded that there is unlikely to be a causal connection between lycopene intake and risk of prostate cancer. an alternative possibility is that the earlier studies were conducted largely before the onset of psa screening, where diagnosis of prostate cancer usually implied a period of increasing aggressive behavior leading to the diagnosis. thus, the exposure was linked to the development of aggressive behavior in cancers with biologic potential to progress. in the psa era, 19921998 with peak in 1992 following fda approval as a screening test for prostate cancer, the diagnosis of prostate cancer is not typically linked to aggressive behavior [4, 7]. an example of this phenomenon may be the subgroup of cancers in the pcpt that were diagnosed at end of study biopsy. there was a high prevalence of undiagnosed prostate cancer, even among the youngest group of men in the study (5559 years), which suggests that most of the cancers eventually diagnosed during the study period were present at baseline. throughout the 7-year followup, the cancers diagnosed at end-of-study biopsy showed no evidence of clinical or biochemical progression. prior studies have shown that most cancers, even many with high-grade gleason scores, do not progress over prolonged time, and it is well established that only a fraction of prostate cancers result in the most advanced and clinically significant stage and mortality. thus, the majority of these cancers was likely present at the onset of the study and may be considered static cancers. in fact, when reanalyzed as a case-only study, higher serum lycopene levels in the pcpt appeared to be inversely associated preferentially with cancers that showed evidence of progression relative to cancers that showed no indication of progression. in modeling two patterns of prostate cancer progression, one with low lycopene exposure and rapid tumor growth that reaches a threshold psa level for clinical diagnosis and the second with high lycopene exposure and slow progression, the latter may be diagnosed at a much later time through an incidental random biopsy rather than psa. thus, asymptomatic cancers diagnosed at the end-of-study by biopsy may signify cancers that were inhibited rather than incident cancer. thus, a possible interpretation is that high levels of lycopene may have inhibited some existing cancers to undergo progression. some evidence supports the premise that psa screening and type of tumor endpoint are critical. for example, the hpfs was analyzed before and after peak psa testing in the early 1990s. before psa testing (19861992) tomato sauce intake was inversely associated with prostate cancer incidence and stronger for advanced stage cancers. while the association for total prostate cancer incidence was attenuated during the psa era (19921998), the association with metastatic prostate cancer persisted. in addition, in the large epic study serum lycopene level was inversely associated with risk of advanced stage prostate cancer but not nonadvanced prostate cancer. as discussed above, studies based on intake are limited by the assessment of intake, food composition databases, and differences in bioavailability. future studies may be improved by better taking into account bioavailability differences among diverse foods. prospective studies are preferable to avoid various biases, such as recall bias, or reverse causation in studies of circulating lycopene. with increasing use of psa, it is becoming increasingly difficult to examine advanced stage prostate cancer, at least in some populations. examining potential mediators or markers of aggressive behavior in tumor tissue may be another useful approach in the further study of lycopene and prostate cancer risk.

lycopene has been proposed to protect against prostate cancer through various properties including decreased lipid oxidation, inhibition of cancer cell proliferation, and most notably potent antioxidant properties. epidemiologic studies on the association between lycopene and prostate cancer incidence have yielded mixed results. detection of an association has been complicated by unique epidemiologic considerations including the measurement of lycopene and its major source in the diet, tomato products, and assessment of prostate cancer incidence and progression. understanding this association has been further challenging in the prostate-specific antigen (psa) screening era. psa screening has increased the detection of prostate cancer, including a variety of relatively indolent cancers. this paper examines the lycopene and prostate cancer association in light of epidemiologic methodologic issues with particular emphasis on the effect of psa screening on this association.

PMC3368367

pubmed-552

common causes of bronchopleural fistula (bpf) are lung resection, thoracic surgery, thoracic trauma, pulmonary koch's, rupture of lung abscess and rupture of emphysematous bullae, as was seen in this case. bpf is an important cause of morbidity and mortality and its management depends on various factors like size of fistula, respiratory reserve of the patient, associated diseases and general condition of the patient. bpfs, which are small in size or are due to minor parenchymal leaks, usually close spontaneously whereas large bpf, those arising from the major bronchi or causing respiratory compromise usually require intervention in the form of bronchoscopic closure, video-assisted thoracic surgery (vats), muscle flap closure, decortication, lobectomy, pneumonectomy and thoracoplasty. many times, a combination of techniques and/or multiple interventions are required. various flaps used for the closure of bpf and reported in the literature are intercostal muscle flap, pericardial flap, latissimusdorsi muscle flap, serratus anterior muscle flap, rectus abdominis muscle flap and omentum. the intercostal muscle flap, as was used in this case, is easy to harvest, causes no functional disability, has adequate vascularity, has adequate length to reach most of the sites and is harvested through the same incision used for thoracotomy. bronchoscopic techniques used for the closure of bpf include application of glue, gelfoam and/or stents; these techniques are usually successful when the size of the fistula is small. large bpf and those associated with entrapped lung or empyema thoracis are managed with surgery. a 50-year-old male patient, a known case of copd, presented with the features of bpf on the right side for 1 month. the patient was a chronic smoker and did not give any history suggestive of pulmonary koch's or any other associated disease apart from copd. the patient had sudden-onset breathlessness and chest pain 1 month before, which was diagnosed as spontaneous pneumothorax, and an intercostal drain was inserted but even after 1 month of all conservative measures, the lung remained collapsed [figure 1a] and there was a large air leak in the intercostal drain; negative suction on the intercostal drain was also not effective. ct chest revealed collapsed and entrapped lung [figure 1b and c], with surgical emphysema of the subcutaneous tissues due to rupture of the emphysematous bullae on the right side along with presence of emphysematous bullae on the left upper lobe. surgical repair was planned as with all the conservative measures, the lung remained collapsed and the air leak persisted. the patient was emaciated and weak and was pre-operatively optimized with a high-protein diet, multivitamins, bronchodilators, incentive spirometry and antibiotics for another week before surgery. general anesthesia was given using double-lumen endotracheal tube and supplemented with thoracic epidural analgesia and invasive arterial pressure and central venous pressure monitoring were also performed. the right posterolateral approach was chosen, intercostal muscle flap was harvested and part of the fifth rib was resected. the lung was found completely entrapped in a fibrous peel [figure 2a] and decortication of the thickened visceral peel was performed from the entire right lung [figure 2b] and inferior pulmonary ligament was also ligated and divided. the site of the bpf was localized in the segmental bronchus to apical segment of the right upper lobe and closure of the fistula with polypropylene 40 sutures was performed and reinforced with intercostal pedicled muscle flap [figure 2c]. there were multiple small unruptured bullae present near the site of the bpf, and they were also closed with polypropylene 40 sutures. the repair site was tested for air leak after pouring saline in the thoracic cavity and after ensuring no major air leak, two intercostal drains were inserted and standard thoracotomy closure was carried out. the patient was extubated in the operating room and deep breathing exercises were started from the first post-operative day to keep the lungs expanded. chest roentgenogram on the second post-operative day [figure 3a] revealed partial re-expansion of the lung along with presence of residual space in the upper zone. with continued chest physiotherapy and respiratory exercises, there was complete re-expansion of the lung with obliteration of the remaining space in the upper zone [figure 3b]. histopathological examination of the resected visceral peel revealed non-specific inflammation without any evidence of granuloma formation or dysplasia and cultures were sterile. (a) pre-operative chest roentgenogram showing collapsed right lung with intercostal tube in situ. (b) pre-operative computed tomography of the chest in the axial section showing collapsed and entrapped right lung. (c) pre-operative ct chest in the sagittal section showing collapsed and entrapped right lung (a) intraoperative photograph showing collapsed and entrapped right lung. (c) intra-operative photograph showing use of intercostal muscle flap for closure of bronchopleural fistula (a) post-operative chest roentgenogram showing lung expansion on the second post-operative day. (b) post-operative chest roentgenogram showing expanded right lung on the 10th post-operative day after removal of the intercostal drain bpf is commonly associated with empyema or empyema develops subsequently if management of bpf is delayed. in this case, pleural fluid and sputum culture were sterile and total and differential leukocyte counts were within the normal range, probably because the patient was on antibiotics. this case is reported to highlight the advantages of intercostal muscle flap for repair of bpf and typical presentation of entrapped lung and its management. vats is now-a-days commonly used for the management of early-stage empyema before the development of thickened peel. closure of bpf through vats may be performed using pleural or pericardial flaps and/or application of glue. open surgery is usually required for late stages of empyema and for muscle flap closure of bpf. lobectomy or even pneumonectomy may be required in cases of bpf with complete destruction of the underlying lobe or lung, respectively, with or without the use of muscle flaps. acute bpf due to dehiscence of bronchial stump after lung resection like pneumonectomy or lobectomy is a serious condition and requires urgent drainage of the pleural space along with intervention for closure of bronchial opening. the intervention can be either through bronchoscopic techniques using gel foam or glue or in unsuccessful cases through surgical approach by revision of the bronchial stump along with the use of muscle flaps. thoracoplasty can be used in some cases where there is recurrence of bpf after muscle flap repair, but the procedure leads to reduction of pulmonary function and chest wall deformity. sometimes the bpf is associated with empyema or infected pleural space; even in those cases, use of intercostal muscle flaps is associated with favorable outcome because of the good vascularity and autologus nature of the flap thereby increasing the chances of healing. free flaps have also been described in cases like redo surgery where pedicled flaps have already been used or are of insufficient length. use of intercostal muscle flap is an easy and effective technique for the repair of bpf.

a 50-year-old male patient, a known case of chronic obstructive pulmonary disease (copd), presented with the features of bronchopleural fistula (bpf) on the right side for 1 month. the patient was a chronic smoker and did not give any history suggestive of pulmonary koch's. the patient had sudden-onset breathlessness and chest pain 1 month before, which was diagnosed to be due to spontaneous pneumothorax. an intercostal drain was inserted but even after 1 month of all conservative measures, the lung remained collapsed and there was large air leak in the intercostal drain. computed tomogram (ct) of the chest revealed collapsed and entrapped lung with surgical emphysema of the subcutaneous tissues due to rupture of the emphysematous bulla on the right side along with the presence of emphysematous bullae on the left upper lobe also. surgical intervention in the form of decortication of entrapped lung and repair of the bpf with intercostal muscle flap was performed. the patient recovered well and was discharged after 10 days.

PMC4372869

pubmed-553

all bacterial isolates related to the outbreaks (1 per patient) were obtained from clinical samples. the strains were identified phenotypically by rapid i d 32 strep (biomrieux, marcy letoile, france), which yielded profile 22025001100 (leuconostoc spp. (biolog, hayward, ca, usa) (98%, t=0.708). the results were confirmed by 16s rdna sequence analysis, by a previously reported method (9), and the analysis of 1,4201,500 bp showed 99% probability that the species were lm, when compared with genbank database sequences. antimicrobial drug susceptibility was determined by microdilution, with dademicroscan system (baxter health care, west sacramento, ca, usa), and mics were confirmed by e-test (ab biodisk, solna, sweden). for interpretation of antimicrobial drug susceptibility, clinical and laboratory standards insitute criteria (10) for leuconostoc spp. or when appropriate streptococcus spp. the antimicrobial drug susceptibility profiles were almost identical for all genotypes and showed susceptibility to penicillin and gentamicin (mics of 0.25 mg/l and<2 mg/l, respectively) and to levofloxacin, tetracycline, quinupristin-dalfopristin, linezolid, daptomycin, erythromycin, clindamycin, and chloramphenicol. a pulsed-field gel electrophoresis (pfge) technique was used to assess the possibility of a clonal relationship among the 48 lm strains. genomic dna was extracted, restricted with apai, and electrophoresed with chef-driii apparatus (bio-rad laboratories, richmond, ca, usa). no differences in the band profile were observed among the 42 strains of the first outbreak (genotype 1). analysis of the 6 strains isolated in the 2006 outbreak showed different dna band patterns from those corresponding to genotype 1 (figure 2). of the 6 isolates, 4 shared the same genotype, designated genotype 2, whereas the remaining 2 isolates showed 2 new genotypes (genotypes 3 and 4). one lm strain, isolated from the parenteral nutrition catheter of a patient involved in the 2006 outbreak (genotype 2), was identical to those isolated from blood of the same patient (figure 2) and from 3 other patients involved in the 2006 outbreak (data not shown). mw, molecular weight marker at indicated sizes; lines 1 to 9, representative lm isolates from the first outbreak (genotype 1); lines 10, 11, lm isolates obtained from parenteral nutrition catheter and blood from the same patient (genotype 2) and identical to those from 3 different patients infected in the second outbreak (data not shown); lines 12, 13, lm isolates from 2 different patients involved in the second outbreak (genotypes 3 and 4) most of the 42 patients infected with lm genotype 1 in the first outbreak displayed severe underlying diseases (table 1); 9 of the patients died, and 3 of the deaths (7.1%) were directly related to the leuconostoc infection. the bacterial isolates were isolated from blood (52.1%), catheter (21.8%), or both (26.1%). to assess risk factors related to acquisition of lm strains, we performed a case control study. control-patients (n=61) were randomly selected among remaining patients with another nosocomial infection caused by a non leuconostoc spp. microorganism isolated from a catheter, blood, or both, who were admitted to the same department and at the same time as the patients defined as case-patients. sd, standard deviation; or, odds ratio; ci, confidence interval; ns, variable did not meet criterion for remaining in the multivariate model. predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable simultaneous adjustment. any process that modifies the gastrointestinal barrier (inflammation, atresia, resection, obstruction). nosocomial infection criteria were those previously established by the centers for disease control and prevention (atlanta, ga, usa) (12). a multiple logistic regression model was developed to identify potential independent factors associated with acquisition of lm strains. predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable adjustment. statistical analyses were conducted with spss 14.0 software (spss inc., chicago, il, usa). according to the multivariate analysis, previous infections (38.2% were bacteremias) (odds ratio [or]=4.2) and parenteral nutrition (or=27.8) all case-patients received parenteral nutrition, with the exception of 2, although they received enteral nutrition. parenteral nutrition is a putative source of the infection because all parenteral and enteral nutrition bags are prepared in the central hospital pharmacy and then distributed to the different medical units in the hospital. this possibility was further supported by 1 finding: pfge analysis of isolates obtained from a parenteral nutrition catheter connected to a patient during the second outbreak yielded the same genotype as the isolates obtained from blood from the same patient (figure 2) and from another 3 physically separated, infected patients. the physical distance between these patients as well as the impossibility of retrograde displacement of the bacterial isolate from patient s blood makes it unlikely that the lm strain was acquired by contamination from the blood and indicates parenteral nutrition as the main source of lm transmission in the hospital outbreak. microbiologic controls of parenteral nutrition were reinforced during the second outbreak, and as stated, only 6 cases were detected. moreover, during the second outbreak, microbiologic analysis of environmental samples as well as samples from the digestive tract, skin, and throat of all patients involved did not yield any leuconostoc strains. parenteral nutrition controls performed in the hospital pharmacy department are now routinely assayed for lm isolation. since the last lm outbreak in november 2006, that 42 lm isolates from the first outbreak shared the same genotype and 4 of 6 isolates in the second outbreak also shared the same (another) genotype rules out the possibility of endogenous infections among patients and suggests a common source for each outbreak. the occurrence of cases in patients in areas that were physically separated rules out the possibility of indirect patient-to-patient spread through the hands of healthcare workers or contaminated hospital equipment (different departments do not share healthcare workers and equipment). enteral and parenteral nutrition has previously been described (13,14) as a risk factor associated with leuconostoc-infections, although no microbiologic evidence was provided in any of the studies. with regard to previous infections in the multiple logistic regression model, this may be related to the alteration of the immune system caused by the microorganism that caused the previous infections. two previous reports have described hospital transmission of leuconostoc spp (7,15); both outbreaks affected a small number of patients, and no epidemiologic studies were conducted to clarify the genetic relationship among the bacterial strains involved or the source of the nosocomial infection. although up to 88 cases of leuconostoc infection have been reported in the scientific literature in the past 25 years, these cases may not be comparable to those reported here, the largest nosocomial outbreak caused by leuconostoc spp. worldwide. this outbreak highlights the importance of lm as an emerging hospital pathogen in patients with underlying diseases and in whom parenteral nutrition may be the source of the initial infection and its spread. every infection with lm could be a yet undetected outbreak and should result in an investigation that focuses on parenteral nutrition or products manufactured in a centralized hospital pharmacy.

from july 2003 through october 2004, 42 patients became infected by strains of leuconostoc mesenteroides subsp. mesenteroides (genotype 1) in different departments of juan canalejo hospital in northwest spain. during 2006, 6 inpatients, also in different departments of the hospital, became infected (genotypes 24). parenteral nutrition was the likely source.

PMC2600284

pubmed-554

the immunosuppressive receptor pd-1 and its ligand pd-l1 have been identified by dr. tasuku honjo and his colleagues at the kyoto university as factors that induce programmed cell death. since the mechanism mediated by pd-1 and its ligand was shown to be important for immune suppression and tolerance, it has also been reported to be involved in pathogenetic mechanisms of various diseases. pd-1 and pd-l1 are single-pass transmembrane molecules expressed on the cell surface, which belong to the b7 family. their expression is induced by immune-activating stimuli and is understood as a negative feedback mechanism to suppress excessive immune reactions and let immune responses cease. when the receptor pd-1 is bound by its ligand, src homology 2-domain-containing tyrosine phosphatase 2 (shp-2) and shp-1 are recruited to immunoreceptor tyrosine-based inhibitory motif and immunoreceptor tyrosine-based switch motif in the intracellular region of pd-1 and suppress antigen receptor signaling mediators. this process results in reduced production of cytokines, such as interferon (ifn)- and interleukin (il)-2, reduced cell proliferation and suppressed immune cell activation. in addition to the close involvement in homeostasis of the living body as summarized above, recent studies have shown that immunosuppressive factors, pd-1 and pd-l1, are also involved in immunosuppression in cases of tumors and chronic infections. while generally not highly expressed in normal tissues, pd-l1 is expressed at a high rate in tumor tissues in melanoma, lung cancer, colorectal cancer and ovarian cancer, and has been demonstrated to be involved in immune evasion by tumors. in patients with renal cell cancer and gastric cancer, pd-l1 has been shown to be an important prognostic determinant; also, the disease progression is faster, and the mortality is higher in patients with tumors expressing pd-l1 than in patients without detectable pd-l1 expression [51, 53]. in addition, pd-l1 expression has also been reported for other tumors including breast cancer, pancreatic cancer and bladder cancer, and pd-1 expression in tumor-infiltrating lymphocytes has been confirmed in many types of tumors including melanoma, lung cancer and intrahepatic bile duct cancer. these findings have revealed the importance of the pd-1/pd-l1 pathway as an immunosuppression mechanism in a variety of tumors. based on the series of studies on pd-1/pd-l1 in tumor diseases, therapeutic means targeting this pathway are being developed. specifically, these new therapeutics are biopharmaceuticals based on anti-pd-1 antibodies, anti-pd-l1 antibodies or recombinant proteins that inhibit the pd-1/pd-l1 pathway. these biopharmaceuticals have been reported to show good anti-tumor effects regardless of the tumor type and are attracting growing attention as a new, promising class of anti-tumor therapy. fully humanized anti-pd-1 and anti-pd-l1 antibodies have already been produced and are actively tested as therapeutic agents in clinical studies (trials), with good anti-tumor effects continuing to be reported in patients with melanoma, lung cancer, renal cell cancer and some other types of cancer. in melanoma, which has a very poor prognosis, clinical trials conducted in japan and the united states have reported not only the suppressed growth of cancer cells, but also complete remission in some cases. on september, 2014, the anti-pd-1 antibody was finally released by ono pharmaceutical as a new anti-tumor therapeutic agent, and it has become a pioneer for innovative immune checkpoint inhibitors (ono pharmaceutical: https://www.opdivo.jp/contents/action/). this immune checkpoint-targeted immunotherapy was selected as breakthrough of the year 2013 by the journal science as a global revolutionary technology. currently, merck, roche and other major pharmaceutical companies around the world are accelerating their efforts to develop similar antibody-based drugs; this class of therapeutics is gaining so much momentum and attention that the conventional concept of anti-tumor therapy is being overturned. the causative factors of bovine leukemia can be divided into viral and non-viral. non-viral bovine leukemia is sporadic and can be subdivided into calf type, thymic type and cutaneous type involving unknown causes. on the other hand, enzootic bovine leukemia, which is caused by blv, accounts for the vast majority of cases of bovine leukemia, and its prevalence continues to increase. blv infections are latent in the aleukemic (al) state, but can emerge as persistent lymphocystosis (pl) with non-malignant polyclonal expansion of cd5 b-cells that predominantly harbor blv provirus and rarely as malignant b-cell lymphoma in various lymph nodes after long periods of latency. the progression of enzootic bovine leukemia is accompanied by marked suppression of cell-mediated immunity [8, 9, 16], and as the pathogenetic mechanism remains unknown, there are no effective vaccines or therapeutic methods available, meaning that affected animals eventually die. bovine leukemia was designated as a communicable disease obligated to notify under the act on domestic animal infectious diseases control when it was revised in 1997. in 2015, 2,896 cases of bovine leukemia were reported (of which the largest number of 494 cases occurred in hokkaido), representing the disease reported in a greater number than any other bovine disease required to monitor by the act (http://www.maff.go.jp/j/syouan/douei/kansi_densen/kansi_densen.html). this number is 29.3-fold the number of cases reported in 1998 (96 affected animals), indicating that the increase has not yet been halted. requests for urgent measures against this disease have been voiced very frequently by people practicing veterinary medicine and animal husbandry. however, a large-scale survey conducted by the national institute of animal health using specimens collected from 2009 to 2011 showed an approximate blv-positive rate of 35%, demonstrating the difficulty of implementing any project to select and replace infected cattle. comparative analyses of blv-infected cattle by clinical condition have suggested that animals with a high viral load and persistent lymphocytosis are at a high risk of disease onset, often serving as infection sources, have a high risk of vertical transmission and have increased levels of cd4cd25foxp3 treg cells, showing increased susceptibility to opportunistic infections due to transforming growth factor-beta produced by treg cells, which reduces the production of interferon-gamma and tumor necrosis factor-alpha by cd4 t cells and impairs cellular immunity mediated mainly by the cytotoxic activity of nk cells [28, 48]. moreover, the proliferative ability of lymphocytes in response to blv was also significantly reduced in cattle with persistent lymphocytosis, and lymphocytes were found to produce reduced levels of anti-viral cytokines, such as ifn-, il-2 and il-12 [13, 18]. therefore, we analyzed the expression of pd-1 and its ligand, pd-l1. results showed that the pd-1 expression in cd4 and cd8 cells and the pd-l1 expression in virus-infected b cells increase as the disease progresses. furthermore, pd-l1 expression negatively correlated with the ifn- expression level, an indicator of immunosuppression, while positively correlating with leukocyte count, virus titer and provirus level. antibodies to bovine pd-1 and pd-l1 were established, and the results from pd-1 and pd-l1 binding inhibition assays confirmed that they activated anti-viral immunity and that the increase in ifn- production positively correlated with the pd-1 expression rate on cd4 t cells. and also, recombinant bovine pd-l2 (pd-l2-ig) significantly enhanced ifn- production from virus antigens-stimulated pbmcs derived from blv-infected cattle. interestingly, the pd-l2-ig-induced ifn- production was further enhanced by treatment with anti-bovine pd-1 antibody. these results indicated that the pd-1/pd-l pathway constitutes a part of the immunosuppressive mechanism in bovine leukemia (table 2table 2.change of immune inhibitory molecules in the cause of bovine leukemia virus infectionreceptor/liganduninfectedinfected(disease status)referencesalpllymphomapd-1/pd-l1///// lag-3/mhcclass ii////n.d [17, 41]tim-3/gal-9///// ctla-4/cd80, cd86/n.d/n.d/n.d/n.dn.d n.d: not demonstrated.) we also analyzed immunosuppressive receptors other than the pd-1/pd-l1 pathway, such as lymphocyte-activation gene 3 (lag-3) [17, 41], t-cell immunoglobulin and mucin domain-containing protein 3 (tim-3), and cytotoxic t-lymphocyte antigen 4 (ctla-4; cd152) expressed in antigen-specific lymphocytes and found that expression levels of lag-3, tim-3, ctla-4 and their ligands on lymphocytes increased as the disease progressed and anti-viral immunity was activated in binding inhibition assays, as was the case for pd-1 (table 2). currently, clinical studies of these drugs are being carried out at the hokkaido university and other institutions. although there are many diseases in cattle involving immune abnormalities (impairments), the mechanisms underlying these diseases remain unknown. our previous analyses have shown that immunosuppressive factors, such as pd-l1, are also involved in immune suppression seen in diseases other than bovine leukemia, namely johne s disease and bovine anaplasmosis. furthermore, recent evidence suggests that immunosuppressive factors, such as pd-1, are involved in the reduced immune function in chronic infectious diseases, such as mastitis, bovine mycoplasmosis and bovine tuberculosis (manuscript in preparation). our laboratory has been working on the development of a blv vaccine for many years. it is based on a vaccine antigen that was found to be promising in in vitro studies. however, although we tried various procedures, the vaccine did not prevent infection or even disease onset despite the fact that effector cells were present in vivo (data not shown). results from the present analysis suggested that the virus s immune evasion mechanism for lymphocyte exhaustion might be related to the ineffectiveness of the vaccine. future measures against chronic infectious diseases will require the development of a new, pre-emptive control method that targets this formidable immune evasion mechanism. to achieve this goal, results from more detailed analyses of immune exhaustion in other chronic infections are awaited. for use in humans, several immune checkpoint-targeting biopharmaceuticals have been successively developed, including those described above, and they are being actively tested in clinical trials. in the future, it is anticipated that they will be applied to veterinary medicine and animal husbandry, including diseases in cattle.

recently, dysfunction of antigen-specific t cells is well documented as t-cell exhaustion and has been defined by the loss of effector functions during chronic infections and cancer in human. the exhausted t cells are characterized phenotypically by the surface expression of immunoinhibitory receptors, such as programmed death 1 (pd-1), lymphocyte activation gene 3 (lag-3), t-cell immunoglobulin and mucin domain-containing protein 3 (tim-3) and cytotoxic t-lymphocyte antigen 4 (ctla-4). however, there is still a fundamental lack of knowledge about the immunoinhibitory receptors in the fields of veterinary medicine. in particular, very little is known about mechanism of t cell dysfunction in chronic infection in cattle. recent our studies have revealed that immunoinhibitory molecules including pd-1/ programmed death-ligand 1 (pd-l1) play critical roles in immune exhaustion and disease progression in case of bovine leukemia virus (blv) infection, johne s disease and bovine anaplasmosis. this review includes some recent data from us.

PMC5289228

pubmed-555

placenta accreta is a pathology characterized by abnormal and firm attachment of the placenta to the myometrium.1 the depth of penetration of the placental villi into the myometrium defines three severity levels of placenta accreta; accreta, increta, and percreta. accreta, the least severe and most common of the three, occurs when the placental villi attach directly to the myometrium rather than to the decidua basalis. percreta, the most rare and severe manifestation of accreta, is the invasion of the placental villi through the entire thickness of the myometrium, and even further.2 placenta accreta tends to reoccur; however, little is known regarding the pathophysiological processes leading to this invasive placentation. the most severe complication of placenta accreta is spontaneous rupture of the uterus, which poses diagnostic challenges and management dilemmas, and can be a life-threatening event to the mother and fetus. herein, we describe a woman diagnosed with repeated placenta accreta that was complicated by spontaneous rupture of the uterus. this case demonstrates increasing placental invasiveness and, to the best of our knowledge, is a first report of this kind. furthermore, repeated invasive placentation occurred at the same site, and not at the cesarean section (cs) scar, which raises a fundamental question regarding the mechanism of trophoblast implantation and location of recurrence of placenta accreta. understanding the processes that influence the timing and location of this life-threatening complication may set the basis for better diagnosis and management protocols. a 32-year-old woman in her fourth pregnancy, with parity of 2, presented at 19 weeks gestation to the gynecologic emergency department with lower abdominal pain for the past 2 days. her obstetric history included retained placenta in both first and second deliveries, which necessitated manual revision of the uterine cavity and curettage. she had a perforation of the left posterior uterine wall during curettage in her second delivery that was laparoscopically repaired. in her third pregnancy, she presented with an acute abdomen at 19 weeks gestation and underwent exploratory laparoscopy that demonstrated a 2.5 cm rupture in the posterior uterine wall at the site of the previous perforation. laparoscopy was turned into laparotomy; the rupture was sutured and the patient recovered well. magnetic resonance imaging (mri) performed at 21 weeks gestation demonstrated placental tissue penetrating, but not perforating, the myometrium of the posterior uterine wall, which was indicative of placenta increta (figure 1). after counseling, the couple chose to terminate the pregnancy, and hysterotomy was performed at 22 weeks gestation. in the current pregnancy, upon admission to the emergency department, the patient presented normal vital signs, and the gynecologic examination revealed 19 weeks gestation this suspicion raised by sonography, together with the patient s history, prompted an mri at 24.2 weeks that demonstrated the presence of placenta percreta at the site of the previous placenta increta (figure 2a). following counseling, the couple decided to continue the pregnancy, and the patient was hospitalized for observation. rapid bedside ultrasound examination demonstrated intraabdominal bleeding, and emergency cs was performed. during laparotomy, massive intraabdominal bleeding was observed, originating from a uterine rupture with a perforating placental tissue (figure 2b). following the delivery of the fetus and complete placental removal, as well as suturing of the uterine wall, the bleeding stopped and hysterectomy was avoided. the mother recovered well, while her neonate died of prematurity complications. due to the ominous nature of the patient s obstetric history, placenta accreta, at any level of severity, is a rare obstetric complication with an estimated incidence of between 1 in 533 (as reported by wu et al3) and 1 in 2,500 pregnancies (as reported by miller et al1). however, once placenta accrete is diagnosed, it has a tendency to reoccur in subsequent pregnancies.4,5 little is known about recurrence of placenta accreta, and specifically its location, histopathological invasiveness, and prognosis. the only known risk factor for repeated placenta accreta is parity.6 here we report, for the first time, a case of four consecutive pregnancies complicated by abnormal placentation. in primary placenta accreta, the strongest independent risk factor has been found to be previous cs.1,7 this is explained by the tendency of implantation and placentation to occur in the scarred area.1 in the case presented here, recurrence occurred in the left uterine cornu, the site of the previous placenta increta, rather than the cs scar. additionally, the clinical manifestation was aggravated with each consecutive pregnancy: retained placenta necessitating manual lysis and curettage in the first and second, placenta increta in the third, and spontaneous uterine rupture due to placenta percreta in the fourth. therefore, this case presents not only placenta accreta recurrence but also increased invasiveness of the placentation. even though placentation is prone to develop within previous cs scars, other prior uterine injuries may play a similar role, and hence are considered to be a risk factor for placenta accreta.7 it is not known whether injury location affects the risk for placenta accreta. the correlation between scarred uteri and placenta accreta is explained by a relative hypoxic environment in the scar tissue8 or the histologically abnormal structure of the scar. this abnormal structure is characterized by defective re-epithelialization and relative abundance of extracellular matrix.9 alternatively, prior uterine injury is associated with dynamic changes in decidual leukocyte distribution,10 which subsequently affects the homing of the blastocyst to its implantation site. once placenta accreta is diagnosed, proper counseling and discussion with the patient should be undertaken regarding further management of the pregnancy in light of the complications involved.11 the most severe complication is spontaneous rupture of the uterus, as seen in this case, which poses both a diagnostic challenge and an immediate risk to the life of both mother and fetus. the incidence of spontaneous uterine rupture is reported to be approximately one in 5,000; however, this includes etiologies other than placenta accreta.12 uterine rupture due to placenta accreta is extremely rare, and a systematic review of reported cases is yet to be done. in the past, most cases were managed by hysterectomy, but conservative treatment is becoming common recently.13,14 during the operation, active bleeding stopped promptly and the patient remained hemodynamically stable. completing the procedure outweighed the risk of blood loss involved in hysterectomy, and uterine repair was technically feasible. the location where spontaneous uterine rupture occurs has not been thoroughly studied; however, some reports associate first trimester ruptures with the fundus and third trimester ruptures with the lower uterine segment.15 in case of previous cs, the rupture usually occurs at the site of the old scar.12 in our patient, the rupture appeared in the left uterine cornu, where the placenta was invading through the myometrium, rather than in the cs scar. this could be explained by the fact that the uterine wall was already disrupted by the placenta percreta prior to the rupture, as was seen in the mri. as with rupture location, factors affecting the timing of uterine rupture due to placenta accreta while it is well established that spontaneous uterine rupture usually occurs in the third trimester,15 there have been reports of first8 and second1619 trimester ruptures as well. in our case, spontaneous rupture occurred at 24 weeks gestation; a critical time for the fetus. this gestational age marks the limit of viability, since preterm delivery around this time results in 50% long-term survival probability of the newborn.20 in the face of immediate risk for the mother, urgent cs was inevitable, even when considering the probable prematurity complications for the fetus. with the increase in conservative management of placenta percreta although systematic reviews of these complications are not yet available, this insight should be taken into account during counseling following conservative management of placenta accreta. notes: transabdominal two-dimensional ultrasound in the transverse plane showing an abnormal placenta with thinning of the myometrium in the left posterior uterine wall, indicated by an asterisk. similar findings are seen in the longitudinal plane in addition to fundal placental lacunas (arrow head) with increased blood flow by color doppler scanning.

placenta percreta is an obstetric condition in which the placenta invades through the myometrium. this is the most severe form of placenta accreta and may result in spontaneous uterine rupture, a rare complication that threatens the life of both mother and fetus. in this case report, we describe a 32-year-old woman in her fourth pregnancy, diagnosed with repeated placenta accreta, which was eventually complicated by spontaneous uterine rupture at 24 weeks gestation. this patient had a history of abnormal placentation in prior pregnancies and previous uterine injuries. this case demonstrates a pattern of escalating placental invasiveness, and raises questions regarding the process of abnormal placentation and the manifestation of uterine rupture in scarred uteri.

PMC4846064

pubmed-556

polycystic ovary syndrome (pcos) is the most common endocrine disorder in women of reproductive age. pcos produces symptoms in approximately 5 to 10% of women of reproductive age (1245 years old) and is thought to be one of the leading causes of the female subfertility. pcos is a medical condition, in which there is an imbalance of the female sex hormones i.e. elevated levels of testosterone, dhea-s, androstenedione, prolactin, and lh along with a normal, high or low estrogen levels. according to the rotterdam criteria, a diagnosis of pcos can be made in a woman if she has 2 of the following 3 manifestations: irregular or absent ovulation, elevated levels of androgenic hormones, and/or enlarged ovaries containing at least 12 follicles each. other conditions with similar presenting signs, such as androgen-secreting tumors or cushing's syndrome, must be ruled out before a diagnosis of pcos is established. controversies in continuation of metformin therapy throughout pregnancy, in women who have conceived after treatment of pcos, has remained a controversial topic till date. hyperinsulinaemia, insulin resistance and impaired glucose tolerance are very common in women with pcos, particularly in those with a body mass index (bmi)>30, but insulin resistance may occur in lean women with pcos. an insulin action in the ovary is mediated via the insulin receptor rather than the type 1 insulin-like growth factor (igf) receptor, which binds igf-i with high affinity and insulin with low affinity. hyperinsulinaemia has shown to increase androgen production by the ovaries and hence it may play a central role in the pathogenesis of pcos. in a randomized, placebo-controlled, double blind study, done on 257 pregnant women with pcos, aged 18-42 years, who either received metformin or placebo from first trimester to delivery, failed to demonstrate any reduction of pregnancy-related complications, such as gestational diabetes, pre-eclampsia and pre-term delivery in the metformin group. on the contrary, a prospective study done on 98 pregnant women with pcos who received metformin (1700 3000 mg/day) before conception and up to 37 weeks of pregnancy vs. 110 normal pregnant controls, showed a significant reduction of pregnancy complications, such as gestational diabetes and gestational hypertension but an insignificant decrease in pre-eclampsia incidence with comparable mean neonatal apgar scores, weight and length between the 2 groups. metformin has been shown to have encouraging effects on several metabolic aspects of polycystic ovarian syndrome, such as insulin sensitivity, plasma glucose concentration, and lipid profile and since women with pcos are more likely than healthy women to suffer from pregnancy-related problems like early pregnancy loss, gestational diabetes mellitus and hypertensive states in pregnancy, the use of metformin therapy in these patients throughout pregnancy may have beneficial effects on early pregnancy loss and development of gestational diabetes. however, there is little evidence of its beneficial effect on hypertensive complications in pregnancy. in a 3-year case controlled study, conducted on 197 pregnant women with pcos (confirmed by rotterdam criteria), in which cases comprised of women who continued metformin throughout pregnancy while controls were women who stopped metformin after the first trimester, it was concluded that in comparison to the control group, the study group had a significant reduction in early pregnancy loss. besides reducing the rates of miscarriages, continuing its use in pregnancy is devoid of any adverse effects on the new born as demonstrated by a case-controlled study, measuring pregnancy outcomes, conducted on 137 women with pcos (rotterdam criteria), in which there were 3 groups. the study found that the group, which continued metformin use throughout the entire pregnancy, had diminished incidences of fetal growth restriction, preterm labor, and increased live birth rates. there were also no congenital anomalies, intrauterine deaths or stillbirths reported in the test subjects, suggesting metformin use is not related to teratogenicity. besides the above, the group which continued metformin use in the entire pregnancy had reduced incidences of early pregnancy losses and gestational diabetes. continuing the use of metformin during the first trimester of 66 pregnant women with pcos, demonstrated a lower percentage of small (< 10 centile) and large (> 90 centile) for gestational age babies as compared to the 66 control groups of normal women without pcos who did not use metformin. neonatal hypoglycemia was also less commonly reported in the metformin group with fewer babies requiring intravenous glucose therapy. metformin is excreted in breast milk, but the amount secreted is clinically insignificant and there have been no reported adverse effects on breastfed infants with mothers who take metformin. a study which measured growth, motor-social development and illness in 61 nursing infants (21 males and 40 females) and 50 formula-fed infants (19 males and 31 females) born to 92 mothers with pcos who were taking metformin (median of 2.55 gm/day) throughout pregnancy and lactation, reported that none of the children had any delay in either growth or in developmental milestones. an important link exists in patients between having an abnormal glucose tolerance test and a history of recurrent spontaneous abortions. since women with pcos are more prone than healthier women to have an abnormal glucose tolerance test during pregnancy, these women may also be at an increased risk of having spontaneous first trimester abortions. a prospective clinical-controlled trial concluded that metformin use in pregnant patients with an abnormal glucose tolerance test and history of recurrent spontaneous abortions effectively reduced the chances of first trimester abortion with improved chances of a successful pregnancy. other attributed causes for miscarriages in women with pcos are elevated levels of androgens and luteinizing hormone. metformin with its favorable effects on androgen and lh levels may be useful in reducing rates of early pregnancy loss when used pre conception and continued through pregnancy. its modification of lh levels are evident by a prospective randomized controlled trial, conducted on 32 women with pcos with high pretreatment lh values and 32 women with normal cycles who were recruited to receive metformin (850 mg b.i.d) or placebo, for an average duration of 40 days. there was a significant reduction of lh values in pcos women to normal baseline with metformin therapy while the fsh and tsh levels remained normal. these women also showed reduction in their prolactin levels as compared to their previous high pretreatment levels demonstrating the effect of metformin on the pituitary. contrary to the results of the above-mentioned study, meta-analysis of 17 randomized controlled trials found that metformin use before conception does not reduce abortion risk in women with pcos. women with polycystic ovaries are more insulin-resistant than weight-matched women with normal ovaries. an insulin resistance is seen in 10 15% of slim and 20 40% of obese women with pcos, and women with pcos are at increased risk of developing type 2 diabetes. obesity can negatively influence chances of conception, response to fertility treatment as well as increase risks of miscarriages and congenital anomalies along with increasing the risks for pregnancy related complications. even a moderate amount of weight loss (5-10% body weight), before pregnancy, with or without metformin use has shown to be sufficient in improving metabolic markers. metformin used throughout pregnancy in women with pcos may reduce gestational diabetes incidence by as much as 9-fold. its use during pregnancy in women with pcos facilitates primary and secondary prevention of gestation diabetes. the reduction in incidence of gestational diabetes mellitus has been attributed to metformin's metabolic, endocrine, vascular, and anti-inflammatory effects. these effects of metformin were demonstrated in a prospective cohort study wherein 360 non-diabetic pcos patients participated who conceived while on metformin by different treatment modalities. the study group comprised of 200 women who continued metformin (1000-2000 mg/ day) throughout pregnancy while the control group of 160 women discontinued metformin. the results of the study concluded in favor of the women who continued metformin use who demonstrated statistically significant prevention or reduction in the incidence of gestation diabetes mellitus. of the other studies, which were performed on patients with gestational diabetes, mellitus one was a case controlled study, done on 100 women with gdm who were exclusively treated with metformin, were compared with 100 with gdm-treated exclusively with insulin matched for age, weight, and ethnicity, showed similar baseline maternal risk factors in both groups and similar incidences of gestational hypertension, pre-eclampsia, induction of labor and rate of cesarean section, but significantly greater mean maternal weight gain from enrollment to term in the insulin group. the pregnancy outcomes in the women who were treated with metformin alone, demonstrated lesser incidence of prematurity, neonatal jaundice and admission to neonatal unit with an overall improvement in neonatal morbidity as compared to the women treated with insulin alone. there was no significant difference in the incidence of fetal macrosomia between the 2 groups of women. interestingly, a recent randomized controlled trial, done on 100 women with gdm who did not attain euglycemia with diet, were randomized to receive therapy with insulin or oral metformin concluded that metformin was better suited than insulin for prevention of fetal macrosomia, especially in lean or in moderately overweight women developing gdm in late gestation, and insulin was preferred therapy for women with considerable obesity, high fasting blood glucose levels and an early need for pharmacological treatment. the beneficial effects of metformin in pcos women further include weight loss in obese women with significant changes in waist-to-hip ratio, normalization of abnormal lh/fsh ration, and impaired glucose tolerance as well as significant reduction in insulin resistance. additionally, the use of metformin has a relatively low cost and diminished hazards as compared to those associated with surgical interventions.[2931] a rare but serious side effect reported within 3 weeks of imitation of metformin therapy is a mixed (hepatocellular and cholestatic) type of hepatic damage with raised ast, alt, alp and bilirubin levels.[3234] however, immediate discontinuation of metformin demonstrated an improvement in symptoms and return of liver enzymes to normal baseline value within 3 weeks. hence, it is advisable to monitor liver function tests in patients receiving metformin therapy. it has encouraging effects on several metabolic aspects of polycystic ovarian syndrome, such as insulin sensitivity, plasma glucose and lipid profile. its use in patients with pcos during pregnancy reduces a number of pregnancy-related complications, such as gestational diabetes and gestational hypertension. use of metformin throughout pregnancy in women with pcos has shown to reduce the rates of early pregnancy loss, preterm labor, and prevention of fetal growth restriction. there have been no demonstrable teratogenic effects, intra-uterine deaths, still births or developmental delays reported with metformin use in pregnancy. despite these favorable effects of metformin use with scarce serious side effects, no definite guidelines recommending metformin use in pregnant women with pcos exists and hence further research on the topic

use of metformin throughout pregnancy in women with polycystic ovary syndrome (pcos) has shown to reduce the rates of early pregnancy loss, preterm labor, and prevention of fetal growth restriction. metformin has been shown to have encouraging effects on several metabolic aspects of polycystic ovarian syndrome, such as insulin sensitivity, plasma glucose concentration and lipid profile and since women with pcos are more likely than healthy women to suffer from pregnancy-related problems like early pregnancy loss, gestational diabetes mellitus and hypertensive states in pregnancy, the use of metformin therapy in these patients throughout pregnancy may have beneficial effects on early pregnancy loss and development of gestational diabetes.

PMC3493830

pubmed-557

the mucoadhesive polymer containing oral drug delivery systems has the capacity to prolong residence time of drugs at the absorption site and facilitate intimate contact with underlying absorptive surface to enhance bioavailability. polymers used in the mucoadhesive formulations include natural, semisynthetic, and synthetic ones. in recent years, a growing interest has been identified in the development of natural polymer-based drug delivery systems due to their biodegradability, biocompatibility, aqueous solubility, swelling ability, easy availability, and cost-effectiveness. amongst various natural polymers, alginates have been widely used in the development of drug delivery applications [36]. it is composed of linear copolymers of two monomeric units, that is, -d-mannuronic acid and -l-guluronic acid. sodium alginate (sa) undergoes ionotropic-gelation by ca to form calcium alginate due to an ionic interaction between carboxylic acid groups of alginate chain and ca. sodium alginate has mucoadhesive property; however, the cross-linked alginates are usually fragile [9, 10]. therefore, blending of different mucoadhesive polymers is one of the most popular approaches to formulate ionotropically cross-linked alginate-based mucoadhesive beads [9, 11, 12]. again, blending with suitable polymers, may improve the drug encapsulation, which is found comparatively lower in alginate-based beads prepared by ionotropic-gelation method. ispaghula (plantago ovata f.) husk is an indigenous product of south asia and is widely used herbal product both in traditional and modern medicines. the ispaghula husk mucilage (ihm) is white, hydrophilic in nature, and forms a colorless gel in presence of water [1416]. ihm contains a high amount of highly branched neutral arabinoxylan (arabinose 22.6%, xylose 74.6%, and traces of other sugars) and about 35% of nonreducing terminal sugar residues. few investigations had been carried out to formulate mucoadhesive beads as drug delivery matrices using both untreated ispaghula husk and alkaline treated ispaghula husk directly as polymeric blend with sodium alginate [1, 17, 18]. however, no attempt has been taken to formulate mucoadhesive alginate-based beads using isolated ihm as polymeric blend for the use in drug delivery. in the current investigation, the utility of isolated ihm, as a possible natural polymeric-blend with sa for the development of new ihm-blended alginate beads containing glibenclamide through ionotropic-gelation, glibenclamide is a sulfonylurea used in the treatment of non-insulin-dependent diabetes mellitus (niddm, type-ii) [2, 19]. its plasma half-life is 46 hours, which makes multiple dosing to maintain the therapeutic blood level. therefore, it would be beneficial to develop a mucoadhesive system of glibenclamide using ihm-alginate for oral use, which might facilitate an intimate contact with the mucous membranes (i.e., mucoadhesion or bioadhesion) in the gastrointestinal tract, and thus the gastric residence could be prolonged to release glibenclamide at the target site at controlled rate over an extended period to maximize the therapeutic effect. in the development of any pharmaceutical formulation, an important issue is to design a formulation with optimized quality in a short time period and minimum number of trials [20, 21]. traditionally, pharmaceutical formulators develop various formulations by changing one variable at a time while keeping others fixed. however, many experiments do not succeed in their purpose because they are not properly thought out and designed, and even the best data analysis can not compensate lack of planning. therefore, it is essential to understand the influence of formulation variables on the quality of formulations with a minimal number of experimental trials and subsequent selection of formulation variables to develop an optimized formulation using established statistical tools [5, 2224]. factorial designs, where all the factors are studied in all possible combinations, are considered the most efficient in estimating the influence of individual variables and their interactions performing minimum numbers of experiments. a computer-aided optimization technique based on 3 (two factors and three levels) factorial design and response surface methodology was employed to investigate the effects of two independent process variables (factors), that is, sa: ihm and cross-linker (cacl2) concentration on the properties of glibenclamide-loaded ionotropically gelled ihm-alginate beads such as drug encapsulation and drug release. india), sa (central drug house, india), ispaghula husk (shree baidyanath ayurved bhawan pvt. the mucilage from ispaghula (plantago ovata f.) husk was extracted according to the previously reported method [26, 27]. an amount of 10 ml of 0.1 m hcl was heated to boil in a 100 ml flask and 1 gram of plantago ovata f. husk was added. after total change of color, the flask was finally removed from heat and the solution was filtered through a clean muslin cloth while still hot. in order to separate residual traces of mucilage, the seeds were washed twice with 5 ml of hot water and the solution obtained each time was filtered. the combined filtrate, containing the dissolved mucilage, was mixed with 60 ml of 95% ethyl alcohol, stirred, and allowed to stand for 5 hours. finally, the supernatant liquid was decanted and the precipitate in the beaker was dried in an oven at 50c. the dried ihm cake was grounded with a mortar and passed through a sieve (0.15 mm mesh size). the isolated ihm powders were packed in a plastic bag and kept airtight desiccators until further use. the glibenclamide-loaded ihm-alginate beads were prepared by ionotropic-gelation technique using calcium chloride (cacl2) as cross-linker. briefly, sa and ihm aqueous dispersions were prepared separately using distilled water. these dispersions were well mixed with stirring for 15 min at 1000 rpm using a magnetic stirrer (remi motors, india). the ratio of drug to polymer was maintained 1: 2 in all formulations. the final mixtures were homogenized for 15 min at 1000 rpm using a homogenizer (remi motors, india) and ultrasonicated for 5 minutes for debubbling. the added droplets were retained in the cacl2 solution for 15 min to complete the curing reaction and to produce rigid beads. the wet beads were collected by decantation and washed two times with distilled water and dried at 37c for 24 h. the dried glibenclamide-loaded ihm-alginate beads were stored in a desiccator until used. a 3 factorial design was employed for optimization with sa: ihm (x1) and concentration of cacl2 (x2) as the prime selected independent variables, which were varied at three levels, low (1), medium (0), and high (+ 1). the drug encapsulation efficiency (dee, %) and 10 hours (r10 h, %) were used as dependent variables (responses). the matrix of the design including investigated responses, that is, dee and r10 h, is shown in table 1. the effects of independent variables upon the all measured responses were modelled using the following quadratic mathematical model generated by 3 factorial design: (1)y=b0+b1x1+b2x2+b3x1x2+b4x12+b5x22, where y is the response, b0 is the intercept, and b1, b2, b3, b4, b5 are regression coefficients. x1 and x2 are individual effects; x1 and x2 are quadratic effects; x1x2 is the interaction effect. one-way anova was applied to estimate the significance (p<0.05) of generated models. the response surface methodology was applied to analyze the effect of independent factors (sa: ihm and cacl2 concentration) on the measured responses (dee and r10 h). accurately weighed, 100 mg of beads were taken and were crushed using pestle and mortar. the crushed powders of drug containing beads were placed in 500 ml of phosphate buffer, ph 7.4, and kept for 24 hours with occasionally shaking at 37 0.5c. after the stipulated time, the mixture was stirred at 500 rpm for 15 min on a magnetic stirrer. the polymer debris formed after disintegration of bead was removed filtering through whatman filter paper (no. 40). the drug content in the filtrate was determined using a uv-vis spectrophotometer (shimadzu, japan) at 228.5 nm. the dee of beads was calculated using this following formula: (2)dee (%)=actual drug content in beadstheoretical drug content in beads100. particle size of 100 dried beads from each batch was measured by optical microscopic method for average particle size using an optical microscope (olympus). samples were gold coated by mounted on a brass stub using double-sided adhesive tape and under vacuum in an ion sputter with a thin layer of gold (3 ~ 5 nm) for 75 seconds and at 20 kv to make them electrically conductive, and their morphology was examined by scanning electron microscope (zeiss evo 40, japan). samples were reduced to powder and analyzed as kbr pellets by using a fourier transform-infrared (ftir) spectroscope (perkin elmer spectrum rx i, usa). spectral scanning was taken in the wavelength region between 4000 and 400 cm at a resolution of 4 cm with scan speed of 1 cm/second. the release of glibenclamide from various ihm-alginate beads was tested using a dissolution apparatus usp (campbell electronics, india). the baskets were covered with 100-mesh nylon cloth to prevent the escape of the beads. glibenclamide-loaded ihm-alginate beads equivalent to 30 mg glibenclamide were taken in 900 ml of dissolution medium (0.1 n hcl, ph 1.2 for first 2 hours and phosphate buffer, ph 7.4 for next 8 hours). an amount of 5 ml of aliquots was collected at regular time intervals, and the same amount of fresh dissolution medium was replaced into the dissolution vessel to maintain sink condition throughout the experiment. the collected aliquots were filtered and suitably diluted to determine absorbance using a uv-vis spectrophotometer (shimadzu, japan) at 228.5 nm against appropriate blank. in order to predict and correlate the in vitro release behaviour of glibenclamide from formulated glibenclamide-loaded ihm-alginate beads, it is necessary to fit into a suitable mathematical model. the in vitro drug release data were evaluated kinetically in different mathematical models [5, 6]: (i)zero-order model: q=kt+q0, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant;(ii)first-order model: q=q0e, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant;(iii)higuchi model: q=kt, where q represents the drug released amount in time t, and k is the rate constant;(iv)korsmeyer-peppas model: q=kt, where q represents the drug released amount in time t, k is the rate constant, and n is the diffusional exponent, indicative of drug release mechanism. zero-order model: q=kt+q0, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant; first-order model: q=q0e, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant; higuchi model: q=kt, where q represents the drug released amount in time t, and k is the rate constant; korsmeyer-peppas model: q=kt, where q represents the drug released amount in time t, k is the rate constant, and n is the diffusional exponent, indicative of drug release mechanism. the korsmeyer-peppas model was also employed in the in vitro drug release behaviour analysis of these formulations to distinguish between competing release mechanisms [5, 6]: fickian release (diffusion-controlled release), non-fickian release (anomalous transport), and case-ii transport (relaxation-controlled release). when n is 0.43, it is fickian release. the mucoadhesivity of optimized glibenclamide-loaded ihm-alginate beads was evaluated by ex vivo wash-off method [11, 12]. freshly excised pieces of goat intestinal mucosa (2 2 cm) (collected from slaughterhouse) were mounted on glass slide (7.5 2.5 cm) using thread. fifty beads were spread onto the wet tissue specimen, and the prepared slide was hung onto a groove of disintegration test apparatus. the tissue specimen was given regular up and down movement in a vessel containing 900 ml of 0.1 n hcl (ph 1.2) and phosphate buffer (ph 7.4), separately, at 37c. after regular time intervals, the machine was stopped and the number of beads still adhering to the tissue was counted. in vivo studies were performed in alloxan-induced diabetic albino rats of either sex (weighing 266342 grams). the experimental protocol was subjected to the scrutiny of the institutional animal ethical committee and was cleared before starting. the animals were handled as per guidelines of committee for the purpose of control and supervision on experimental animals (cpcsea). all efforts were made to minimize both the suffering and number of animals used. the rats were made diabetic by intraperitoneal administration of freshly prepared alloxan solution at a dose of 150 mg/kg dissolved in 2 mm citrate buffer (ph 3.0). after one week of alloxan administration, alloxanized rats with fasting blood glucose of 300 mg/dl or more were considered diabetic and were employed in the study for 12 hours. the alloxan-induced diabetic rats were divided randomly into 2 groups of 6 rats each and treated as follows. group a was administered with pure glibenclamide in suspension form, and group b was administered with optimized formulation of glibenclamide-loaded ihm-alginate beads, both at a dose equivalent to 5 mg glibenclamide/kg body weight using oral feeding needle. blood samples were withdrawn (0.1 ml) from tail tip of each rat at regular time intervals under mild ether anesthesia and were analyzed for blood glucose by oxidase-peroxidase method using accu-chek sensor comfort (roche diagnostics, germany) test strips. statistical optimization was performed using design-expert version 8.0.6.1 software (stat-ease inc. the in vivo data were tested for significant differences (p<0.05) by paired samples t-test. all other data was analyzed with simple statistics. the simple statistical analysis and paired samples t-test ihm was isolated from ispaghula (plantago ovata f.) husk, and the average yield of ihm was found 39.86% w/w. for the 3 factorial design, a total of 9 trial formulations were proposed by design-expert version 8.0.6.1 software. according to this trial proposal, various glibenclamide-loaded ihm-alginate beads were prepared by ionotropic-gelation technique. when various dispersion mixtures containing polymer-blend (sa and ihm) and glibenclamide were dropped into the solutions containing calcium ions, gelled glibenclamide-loaded ihm-alginate beads were formed instantaneously due to electrostatic interaction between negatively charged alginate ions and positively charged calcium ions present in the cross-linking solutions. overview of matrix of the design including investigated responses (dee and r10 h) was presented in table 1. the values of dee and r10 h, measured for all trial formulations, were fitted in the 3 factorial design to get model equations. the design-expert version 8.0.6.1 software provided quadratic model equations involving individual main factors and interaction factors for all response parameters. the results of the anova indicated that these models were significant for all response parameters (table 2). the model equation relating dee (%) as response became dee (%)=87.24 5.22x1 2.49x2 0.06x1x2+ 0.41x1+ 0.35x2 (r=0.9999; f value=10398.24; p<0.05). the model equation relating r10 h(%) as response became r10 h (%)=83.94+ 2.37x1+ 0.01x2+ 0.34x1x2 0.13x1 0.23x2 (r=0.9981; f value=309.07; p<0.05). model simplification was carried out by eliminating nonsignificant terms (p>0.05) from previously mentioned model equations, giving dee (%)=87.24 5.22x1 2.49x2 0.06x1x2+0.41x1+ 0.35x2 and r10 h(%)=83.94+2.37x1+0.01x2+0.34x1x2 0.23x2. linear correlation plots between the actual, the predicted response variables are presented in figures 1 and 2, and their corresponding residual plots showing the scatter of the residuals versus predicted values are presented in figures 3 and 4. the influences of main effects (factors) on responses (here, dee and r10 h) were further elucidated by response surface methodology. response surface methodology is a widely proficient approach in the development and optimization of drug delivery devices [5, 8, 28]. response surface methodology encompasses the generation of model equations of the investigated responses over the experimental domain to determine optimum formulation (s). the three-dimensional response surface plot is very useful in learning about the main and interaction effects of the independent variables (factors), whereas two-dimensional contour plot gives a visual representation of values of the response. the three-dimensional response surface plot relating dee (figure 5) indicates the increment of dee with the lowering of sa: ihm (x1) and increasing of cacl2 concentration (x2). however, an increment in r10 h values with the increasing of sa: ihm (x1) and lowering of cacl2 concentration (x2) is indicated by the three-dimensional response surface plot relating r10 h (figure 6). all the two-dimensional contour plots relating measured responses (figures 7 and 8) showed nonlinear relationships between independable variables, investigated for this study. numerical optimization technique using the desirability approach was employed to develop optimized formulations with desired response (optimum quality). the desirable ranges of the independable variables (factors) were restricted to 1.00 x1 1.50 and 9.50 x2 11.50, whereas the desirable ranges of responses were restricted to 95.00 dee 100.00% and 60.00 r10 h 65.00%. the optimal values of responses were obtained by numerical analysis using the design-expert version 8.0.6.1 software based on the criterion of desirability. the desirability plot indicating desirable regression ranges for optimal process variable settings was presented in figure 9, and overlay plot indicating the region of optimal process variable settings was presented in figure 10. in order to evaluate the optimization capability of these models generated according to the results of 3 factorial design, optimized glibenclamide-loaded ihm-alginate beads were prepared using one of the optimal process variable settings proposed by the design (prediction r=1). the selected optimal process variable setting used for the formulation of optimized formulation was x1=1.35 and x2=10.99. the optimized beads containing glibenclamide (f-o) were evaluated for dee (%) and r10 h(%). table 3 lists the results of experiments with predicted responses by the mathematical models and those actually observed. the optimized glibenclamide-loaded ihm-alginate beads (f-o) showed dee of 94.43 4.80% and r10 h of 65.78 3.44% with small error values (0.94, and 3.69, resp.), indicating that mathematical models obtained from the 3 factorial design were fitted well. the dee (%) of all these glibenclamide-loaded ihm-alginate beads was within the range between 68.03 1.77 and 94.43 4.80% w/w (tables 1 and 3). it was observed that dee (%) was increased with the lowering of sa: ihm in polymer-blend, which may be due to increase in viscosity of the polymeric solution by the ihm addition as polymeric-blend with sa. this might have prevented drug leaching to the cross-linking solution and the elevation of cross-linking by cacl2. again, the dee of these beads was increased with increasing cacl2 concentration in cross-linking solutions, due to the high degree of cross-linking by the concentrated calcium ions. the glibenclamide-loaded ihm-alginate beads prepared using lower cacl2 concentration might have larger pores due to insufficient cross-linking, and drug leaching may occur through the pores that may result in lower drug encapsulation. the average bead size of glibenclamide-loaded ihm-alginate beads was within the range of 0.80 0.06 to 1.47 0.12 mm (table 4). increase in the average size of beads was found with the increasing incorporation of ihm as a polymer-blend with sa. this could be attributed due to the increase in viscosity of polymer-blend solution with incorporation of ihm in increasing ratio that in turn increased the droplet size of polymer-blend solutions to the cross-linking solutions during preparation. again, the decrease in average size of these formulated ihm-alginate beads was observed, when concentrated cacl2 solution was used for cross-linking, which might be due to shrinkage of polymeric gel by higher degree of cross-linking. the surface morphological analysis of glibenclamide-loaded ihm-alginate beads was visualized by sem and presented in figure 11. their surface morphologies appeared to have rough with characteristic large wrinkles and cracks, as it was evident from the sem photographs. these cracks and wrinkles might be caused by partly collapsing the polymeric gel network during drying. the ftir spectra of pure glibenclamide, glibenclamide-loaded ihm-alginate beads, and ihm-alginate beads without drug are shown in figure 12. the ftir spectrum of pure glibenclamide and the principal absorption peaks appeared at 3314 cm due to the nh stretching, 3116 cm for aromatic hydrogen absorption, and a peak at 1717 cm occurs due to c=o absorption peak. in the ftir spectrum of glibenclamide-loaded ihm-alginate beads, this indicates that glibenclamide maintained its identity after formulation of ihm-alginate beads through ionotropic-gelation technique. in both the ftir spectra of glibenclamide-loaded ihm-alginate beads and ihm-alginate beads without drug, the strong and broad absorption band peaks had been observed between 36003200 cm due to oh stretching along with some complex bands in the region 12001030 cm due to c o and c o c stretching vibrations, which are the characteristic of the natural polysaccharides. in addition, absorption bands in the regions 930820 cm and 785730 cm were also observed due to vibrational modes of pyranose rings of polysaccharides. the presence of strong asymmetric stretching absorption band between 1650 cm and 1620 cm and weaker symmetric stretching band near 1420 cm supported the presence carboxylate anion of alginate structure. the ftir analysis confirmed the compatibility of the glibenclamide with sa and ihm used to prepare the glibenclamide-loaded ihm-alginate beads by ionotropic-gelation technique. the in vitro glibenclamide release studies were carried out for glibenclamide-loaded ihm-alginate beads in the 0.1 n hcl (ph, 1.2) for first 2 hours and then in phosphate buffer (ph, 7.4) for next 8 hours. glibenclamide release from these ihm-alginate beads in the acidic ph was found slow due to the shrinkage of alginate at acidic ph. the trace amount of drug release at the initial stage of the dissolution study could probably be due to the surface adhered drug. after that, glibenclamide release was observed faster in phosphate buffer (ph, 7.4) comparatively, due to the higher swelling rate of these beads in phosphate buffer. the cumulative drug released from these formulated beads containing glibenclamide in 10 hours (r10 h, %) was within the range of 65.78 3.44% to 92.07 4.05%, and this was found to be higher with the decreasing sa to ihm ratio in the polymer-blend and increasing cacl2 concentration in cross-linking solution. in case of comparatively higher ihm containing beads, the more hydrophilic property of ihm could bond better with water to form viscous gel-structure. this might blockade the pores on the surface of beads and sustain drug release profile. again, the glibenclamide release from ihm-alginate beads prepared using higher cacl2 concentration was comparatively sustained than the beads formulated with that of lower concentration. the higher concentration of cacl2 (cross-linker) could produce high degree of cross-linking and thereby slower the drug release from highly cross-linked glibenclamide-loaded ihm-alginate beads. the in vitro drug release data from various glibenclamide-loaded ihm-alginate beads were evaluated kinetically using various mathematical models like zero-order, first-order, higuchi, and korsmeyer-peppas models. the result of the curve fitting (r) into various mathematical models is given in table 5. when the respective r of glibenclamide-loaded ihm-alginate beads was compared, it was found to follow the zero-order model (r=0.992 to 0.997) over a period of 10 hours. this was also observed to be closest to korsmeyer-peppas model (r=0.985 to 0.994). the best fit of zero-order model indicated that the glibenclamide release from these ihm-alginate beads followed controlled-release pattern. the values of diffusional exponent (n) determined from korsmeyer-peppas model ranged from 1.025 to 1.115, indicating the drug release from these glibenclamide-loaded ihm-alginate beads following the super case-ii transport mechanism controlled by swelling and relaxation of polymeric-blend (sa-ihm) matrix. this could be attributed due to polymer dissolution and polymeric chain enlargement or relaxation. the ex vivo wash-off behavior of optimized glibenclamide-loaded ihm-alginate beads (f-o) using goat intestinal mucosa was found faster in intestinal ph (7.4) than that in gastric ph (1.2). in gastric ph, the percentage of beads adhered onto the goat intestinal mucosal tissue varied from 64.88 5.06% over 10 hours, whereas this was 30.47 3.86% in intestinal ph (figure 14). thus, the results of the ex vivo wash-off test indicated that the newly developed optimized glibenclamide-loaded ihm-alginate beads had good mucoadhesivity. in alloxan-induced diabetic rats, the comparative in vivo blood glucose level and the mean percentage reduction in blood glucose level after oral administration of pure glibenclamide and optimized glibenclamide-loaded ihm-alginate mucoadhesive beads (f-o) are presented in figures 15 and 16, respectively. in case of the group treated with pure glibenclamide (group a), a rapid reduction in blood glucose level was observed within 2-3 hours of administration, and after that, the blood glucose level recovered rapidly towards the normal level. in case of the group (group b) treated with optimized glibenclamide-loaded ihm-alginate mucoadhesive beads, the reduction in blood glucose level was found slower than that of the group treated with pure glibenclamide (group a) up to 3 hours. significant differences (p<0.05) were found between the blood glucose levels after administration of pure glibenclamide and optimized glibenclamide-loaded ihm-alginate mucoadhesive beads (f-o) at each time point measured. however, the reductions in glucose level were increased gradually with the increment of time in case of group b (treated with optimized glibenclamide-loaded ihm-alginate mucoadhesive beads) and were sustained over 10 hours. a 25% reduction in glucose level is considered a significant hypoglycemic effect. therefore, the significant hypoglycemic effect by the optimized glibenclamide-loaded ihm-alginate mucoadhesive beads (f-o) was observed over 10 hours. in this investigation, glibenclamide-loaded ihm-alginate mucoadhesive beads were successfully developed and optimized. these developed optimized mucoadhesive beads demonstrated high drug encapsulation, good mucoadhesivity with the biological membrane, sustained drug release profile at a controlled rate, and significant antidiabetic activity in alloxan-induced diabetic rats over prolonged period after oral administration. therefore, these glibenclamide-loaded ihm-alginate mucoadhesive beads were found suitable for prolonged systemic absorption of glibenclamide through sustained drug release and mucoadhesive properties after oral administration maintaining tight blood glucose level and improved patient compliance in the management of non-insulin-dependent diabetes mellitus. moreover, the technique for the preparation of these beads was found simple, economical, and consistent. this type of beads can also be exploited for drug delivery of other drugs to improve their bioavailability and therapeutic efficacy.

the current study deals with the development and optimization of ispaghula (plantago ovata f.) husk mucilage- (ihm-) alginate mucoadhesive beads containing glibenclamide by ionotropic gelation technique. the effects of sodium alginate (sa) to ihm and cross-linker (cacl2) concentration on the drug encapsulation efficiency (dee,%), as well as cumulative drug release after 10 hours (r10 h,%), were optimized using 32 factorial design based on response surface methodology. the observed responses were coincided well with the predicted values by the experimental design. the optimized mucoadhesive beads exhibited 94.43 4.80% w/w of dee and good mucoadhesivity with the biological membrane in wash-off test and sustained drug release profile over 10 hours. the beads were also characterized by sem and ftir analyses. the in vitro drug release from these beads was followed by controlled release (zero-order) pattern with super case-ii transport mechanism. the optimized glibenclamide-loaded ihm-alginate mucoadhesive beads showed significant antidiabetic effect in alloxan-induced diabetic rats over prolonged period after oral administration.

PMC4590812

pubmed-558

muscle morphological characteristics, such as anatomical muscle cross-sectional area (csa), muscle length, and muscle volume (mv) are important physiological variables for assessing the functional capacity of a muscle. although magnetic resonance imaging (mri) and computed tomography scans are the gold standard for measuring anatomical csa and mv, ultrasound is a utilizable technique that can be easily applied to clinical assessment and field surveys1. in a small muscle, anatomical csa and mv can be measured using multiple images of individual muscles created by portable ultrasound. one study2 investigated the validity and reliability of mv measurements of the medial gastrocnemius using three-dimensional ultrasound, and reported that ultrasound overestimated mv by approximately 2 ml (1.1%) and underestimated muscle length by 3 mm (1.3%) across all joint angles compared to mri-measured values. in addition, the same study reported excellent reliability for repeated measures of mv (intrarater correlation coefficient (icc)=0.99) and muscle length (icc=0.97). these results suggest that multiple ultrasound images of a small muscle can accurately measure muscle morphological variables. the foot is the point of direct contact between the body and ground surface during standing and walking. muscle forces generated by the toes and ankles may play an important role in maintaining balance because muscle strength is essential for posture and stability3, 4. a few studies have reported that toe flexor muscle strength is associated with postural control. for example, handa et al.5 reported significant positive correlations between toe flexor strength and one-leg standing balance with the eyes open (r=0.443, p<0.01) as well as functional reach (r=0.620, p<0.01), in an analysis grouping men and women together. kurihara et al.6 examined the relationships between toe flexor muscle strength and intrinsic and extrinsic foot muscle sizes in young men and women and found significant correlations between toe flexor muscle strength and mri-measured anatomical csa in the medial parts (r=0.775, p<0.01) and lateral parts (r=0.739, p <0.01) of foot intrinsic muscles. recently, abe et al.7 reported a significant positive association between toe flexor muscle strength and accelerometer-determined light and moderate physical activities and average step counts. the results of these previous studies suggest that bigger intrinsic foot muscles in active individuals may be associated with greater toe flexor strength as well as good postural control. in a previous mri study6, however, only one mri image was used to determine the anatomical csa of individual intrinsic foot muscles, even though the foot has several toe flexor muscles with differing distributions among the toes. therefore, the purpose of this study was to test the hypothesis that toe flexor muscle strength is related to the anatomical and physiological csa of intrinsic toe flexor muscles and that these morphological and functional variables associate with physical performance. thirty-four young adults aged 20 to 35 years (17 men and 17 women) were recruited through printed advertisements and by word of mouth. before accepting their informed consent, a written description of the purpose and safety of the study was distributed to all of the potential subjects. all subjects were healthy and free of overt chronic disease (e.g., neuromuscular disorders, arthritic disorders, etc) as assessed by self-report. the rate of regular sports activity (at least twice a week), among the subjects was 65% (82% in men and 47% in women). the main types of sports activities were judo (29%), resistance exercise (21%), and soccer (21%) for men, and jogging/running (50%) and canoeing (25%) for women. the study was conducted in accordance with the principles of the declaration of helsinki and was approved by the ethics committee for human experiments of the national institute of fitness and sports in kanoya, japan. anatomical csa was measured using b-mode ultrasound (aloka prosound 6, tokyo, japan) with a 7.5 mhz linear array transducer (76 mm wide) in two intrinsic toe flexor muscles, the flexor digitorum brevis (fdb) and abductor hallucis (abh), as described previously8. all subjects lay in the prone position during scanning of the two muscles. using anatomic landmarks described by crofts et al.8, a linear transducer coated with water-soluble transmission gel was placed on the skin surface of the measurement sites, and cross sections of each muscle were imaged. ultrasound images of each site were stored on a personal computer, and anatomical csa was measured using image-j software. the mean values (two images) of each site were used for data analysis. all ultrasound measurements were performed on the left (non-dominant) foot, and dominance was ascertained by asking each subject which foot they used to perform well-learned skills using a questionnaire9. the muscle volume and muscle length of the fdb were estimated using multiple ultrasound images from the sole of the foot. after foot length (the distance between the tip of the great toe and the edge of the heel) measurements, all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions. 1.before the start of ultrasound testing, foot length (the distance between the tip of the great toe and the edge of the heel) was measured and then all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions. typical ultrasound images (young woman, 20 yr) revealing transverse scans of the foot at contiguous 1-cm intervals from the point of 50% of the foot lengthfdb: flexor digitorum brevis) and the anatomical csa of the fdb was measured using the procedure described above. muscle volume was calculated by multiplying anatomical csa by distance interval (1 cm). the distance between the most proximal image and the most distal image in which the fdb was visible was defined as the length of the fdb muscle. to calculate physiological csa, the fiber length of the fdb was estimated using the ratio of fiber length to muscle length (average of the second, third, fourth toes) as reported by kura et al10. the physiological csa of the fdb was calculated by dividing muscle volume by fiber length. the test-retest reliability (icc, sem and minimal difference) was previously determined using the data of 7 young subjects (5 men and 2 women) scanned twice within 7 days (at least one day apart) for anatomical csa of the fdb (0.924, 0.13 cm, 0.36 cm) and abh (0.949, 0.21 cm, 0.58 cm) and muscle volume of fdb (0.971, 0.57 cm, 1.57 cm). before the start of ultrasound testing, foot length (the distance between the tip of the great toe and the edge of the heel) was measured and then all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions. typical ultrasound images (young woman, 20 yr) revealing transverse scans of the foot at contiguous 1-cm intervals from the point of 50% of the foot length fdb: flexor digitorum brevis toe flexor muscle strength (tfs) was measured using a toe-grasp dynamometer (tkk3361, takei, tokyo, japan), as described previously11, 12. while barefoot, subjects stood in front of a wall and the left foot then the subjects were instructed to lift the right foot and maintain a one-legged upright standing position on the dynamometer, with both hands on the wall in front of them, while holding the dynamometer grasp bar with their toes. the distance between the bar and the heel was adjusted to the foot size of the subjects so that the distal phalanges of the great toe and fifth toe and the middle phalanges of the second to fifth toes could be placed on the toe grasp bar. subjects were allowed to perform one test trial, followed by two maximum effort trials (tfs-5-toes), and the best value of the left foot was used for the data analysis. the subjects also performed two maximum effort trials to measure toe flexor muscle strength without the contribution of the great toe (tfs-4-toes). in these trials, a small metal plate was placed between the great toe and the toe grasp bar during these measurements for preventing the great toe from grasping the toe grasp bar of the dynamometer. maximal toe flexor strength divided by body weight was calculated to evaluate the relative toe flexor strength. the test-retest reliability of toe flexor strength (tfs-5-toes and tfs-4-toes) measurements using the icc, sem and minimal difference was previously determined using the data of 7 young subjects (5 men and 2 women) tested twice within 7 days (at least one day apart): 0.962, 1.2 kg and 3.3 kg for tfs-5-toes and 0.883, 1.1 kg and 3.1 kg for tfs-4-toes. maximum walking speed was measured by timing each subject as they walked along a 10-meter corridor with a ceramic floor surface. the total length of the marked corridor was 14 meters, allowing 2-meter acceleration and deceleration zones. the width of the corridor was constricted to 1 meter to encourage subjects to maintain a straight course. subjects used their own footwear and had to start 2 meters before the beginning of the start line, and to continue until the 2 meters past the goal line. after one practice trial, subjects performed two maximum speed timed trials. subjects were asked to walk down the corridor as fast as possible without running. times were measured with an electronic timing system (nearest 0.01 s, brower timing system, draper, usa). the best time was converted to a maximum speed measurement (unit, m/s) and the best value was used as the maximum walking speed. the test-retest reliability of this measurement using the icc, sem and minimal difference was previously determined using the procedure described above: 0.930, 0.14 the functional reach test was measured using the method described in a previously reported study4. before the start of the test, subjects were instructed to stand with both feet touching a marked line and to maintain that foot position throughout testing. the subject then performed shoulder forward flexion with the right shoulder until an angle of 90 degrees was reached. next, the subjects tried to extend their middle finger as far forward as possible without moving their feet and keeping their arm parallel to the ground. the distance moved by the end of the middle finger between the starting position and maximum forward position subjects performed two trials, and the best value was used for the functional reach test. the test-retest reliability of this measurement using the icc, sem and minimal difference was previously determined fusing the procedure described above: 0.889, 2 cm and 5 cm, respectively. before comparisons were made, the distributions of the dependent variables were tested for normality using the shapiro-wilk test. the difference between men and women was tested for significance using the unpaired student s t-test, and when variables were not normally distributed, the mann-whitney u test was used. pearson product correlations were performed to determine the relationships between toe flexor muscle strength and intrinsic toe flexor muscle size as measured by ultrasound and between the morphological and functional variables of toe flexor muscle and physical performance. men were taller and heavier than women. compared with women, men had higher anatomical csa in the fdb and abh, as well as muscle volume and physiological csa of the fdb. maximum tfs-5-toes and tfs-4-toes were higher in men than in women; however, the specific strength (tfs-4-toes per unit physiological csa) of the fdb, walking speed and functional reach were similar for both men and women (table 1table 1.maximum toe flexor muscle strength, physical performance and ultrasound measurements of intrinsic foot muscle sizes of young men and womenmenwomenoverall(n=17)(n=17)(n=34)age (yrs)24 (4)24 (4)24 (4)height (m)1.71 (0.05)*1.60 (0.05)1.66 (0.07)body mass (kg)72.9 (11.4)*52.1 (5.1)62.5 (13.6)body mass index (kg/m)24.8 (3.1)*20.4 (2.0)22.6 (3.4)foot length (cm)25.2 (1.2)*22.6 (0.7)23.9 (1.6)flexor digitorum brevisacsa max (cm)2.61 (0.38)*1.65 (0.33)2.13 (0.60)mv (cm)11.95 (2.93)*6.66 (2.10)9.31 (3.67)pcsa (cm)6.38 (1.04)*3.95 (0.97)5.17 (1.58)abductor hallucisacsa (cm)2.89 (0.69)*2.02 (0.59)2.46 (0.77)tfs-5 toes (kg)29.1 (5.3)*21.2 (4.7)25.1 (6.4)tfs-4 toes (kg)10.4 (3.2)*6.4 (2.6)8.4 (3.5)tfs-4 toes/pcsa (kg/cm)1.63 (0.40)1.62 (0.56)1.63 (0.48)walking speed (m/s)3.19 (0.65)3.14 (0.66)3.17 (0.64)functional reach (cm)38.1 (6.3)39.1 (4.0)38.6 (5.2)maximum toe flexor muscle strength with (tfs-5 toes) and without (tfs-4 toes) the contribution of the great toe; acsa, anatomical cross-sectional area; mv, muscle volume; pcsa, physiological cross-sectional area.*maximum toe flexor muscle strength with (tfs-5 toes) and without (tfs-4 toes) the contribution of the great toe; acsa, anatomical cross-sectional area; mv, muscle volume; pcsa, physiological cross-sectional area.*significant difference from women, p<0.001 there was a significant correlation between tfs-5-toes and tfs-4-toes of men (r=0.739, p <0.001) and women (r=0.731, p<0.001). both tfs-5-toes and tfs-4-toes correlated positively with the maximum walking speed of men (r=0.584, p=0.014 and r=0.553, p= 0.021, respectively), women (r=0.748, p<0.001 and r=0.533, p=0.028, respectively) and the whole sample (r=0.535, p=0.001 and r=0.459, p=0.006, respectively). however, the correlations between tfs-5-toes and functional reach of both men (r=0.399) and women (r=0.166) were not significant (p>0.05). anatomical csa of the abh did not significantly correlate with tfs-5-toes of either men (r =0.034, p=0.896) or women (r=0.387, p=0.125); however, the correlation of the whole sample was significant (r=0.454, p=0.006). for women, there were significant positive correlations between tfs-5-toes and anatomical csa max (r=0.713, p=0.001), muscle volume (r=0.604, p=0.010), and physiological csa (r=0.687, p=0.002) of the fdb. for men, however, the observed anatomical csa max (r=0.143, p=0.584), muscle volume (r=0.332, p =0.192), and physiological csa (r=0.333, p=0.191) of the fdb did not correlate significantly with tfs-5-toes. physiological csa of the fdb correlated positively with tfs-4-toes of men (r=0.541, p=0.025), women (r=0.573, p=0.016) and the whole sample (r=0.720, p<0.001) (fig. 2fig. 2.relationships between physiological cross-sectional area (csa) in the flexor digitorum brevis (fdb) and toe flexor muscle strength (tfs-4 toes) of young men and women. tfs-4 open circles are men and filled circles are women). relationships between physiological cross-sectional area (csa) in the flexor digitorum brevis (fdb) and toe flexor muscle strength (tfs-4 toes) of young men and women. tfs-4 the main findings of the present study were that physiological csa of the fdb was significantly correlated with tfs-4-toes of both men and women; physiological csa of the fdb was significantly correlated with tfs-5-toes of women, but not that of men; there was a significant correlation between toe flexor muscle strength and maximum walking speed in both genders. in the present study, the fdb was selected as representative of the intrinsic toe flexor muscles, because a more accurate estimation of muscle volume by ultrasound and calculation of physiological csa of the muscle can be achieved than of the other intrinsic toe flexor muscles. the fdb muscle volume reliability results (icc of 0.971 and sem of 0.57 cm) indicate that the ultrasound method of the present study is a good repeatable technique for measuring muscle volume. the fdb is located in the sole of the foot and separates into four tendons that insert onto the middle phalanges of the four lateral toes10 (without the great toe). therefore, our results demonstrate that the physiological csa of the fdb is associated with tfs-4 toes of both men and women, even though the correlation was only moderate. toe flexor muscle strength is generated from a combination of the intrinsic and extrinsic foot muscles. in the hand, the grip strength decreases by approximately 50% after median and ulnar nerve (intrinsic muscles) blocks compared with the pre-block measurement13. accordingly, the contribution of extrinsic toe flexor muscles may reflect the moderate correlations between tfs-4 toes and physiological csa of the fdb. in addition, individual differences in the moment arm (located between the center of curvature of the metatarsal head and the center of the flexor tendon) and/or differences in the dominant/non-dominant sides may also be unknown factors14. our findings show that the anatomical and physiological csa of the fdb of women were significantly correlated with tfs-5 toes. for men only one study6 has examined the relationships between toe flexor muscle strength and intrinsic and extrinsic foot muscle sizes in young sedentary adults (14 men and 12 women) and a pooled sample was used for data analysis. that study reported significant correlations between tfs-5 toes and mri-measured anatomical csa of the medial parts (r=0.775, p<0.01) and lateral parts (r=0.739, p<0.01) of the foot intrinsic muscles, although only one mri image was used in that investigation. in the present study, the reason for the lack of a significant correlation between tfs-5 toes and the fdb muscle size observed in men is unknown. approximately half of our young women were sedentary and the other half performed mainly jogging/running or canoeing. therefore, our women participants may have had relatively homogeneous morphological and functional properties of the toe flexor muscles, which might partially explain the significant correlations. on the other hand, most of our young men were physically active and performed different sports including judo, resistance exercise and/or soccer. a likely explanation is that physical activity in different sports may elicit non-homogeneous features among toe flexor muscles, especially between the great toe and the four other toes. together, the results of the present and previous studies suggest that differences in sports experience may be a factor underlying the poor correlation of tfs-5-toes and fdb muscle size in young men. additional research into these issues is needed. in the present study, both tfs-4-toes and tfs-5-toes this finding is consistent with the results of previous studies5, 15 which found significant correlations between 10-m walking performance and tfs-5-toes (r=0.459, p<0.01)5 and improved 50-m dash time following 8 weeks of toe flexor strength training15. thus, the results of the present and previous studies demonstrate that toe flexor muscle strength is an important factor determining maximum walking speed. on the other hand, no significant correlation of tfs-5-toes and functional reach of either young men or women was found. although a pooled sample with a wide age range (20 to 84 yrs) was used, one study reported a significant positive correlation (r=0.620, p<0.01) between tfs-5-toes and functional reach5. the discrepancy in the results of the present and that previous study is not known, but the difference in subject age ranges between the two studies may have played a role. in conclusion, although toe flexor muscle strength correlated positively with walking speed in both genders, its correlation with functional reach was not statistically significant. the lack of a significant relationship between tfs-5-toes and physiological csa of the fdb in men may be related to different experiences in sports.

[ purpose] to investigate the relationships between toe flexor muscle strength with (tfs-5-toes) and without (tfs-4-toes) the contribution of the great toe, anatomical and physiological muscle cross-sectional areas (csa) of intrinsic toe flexor muscle and physical performance were measured. [subjects] seventeen men (82% sports-active) and 17 women (47% sports-active), aged 20 to 35 years, volunteered. [methods] anatomical csa was measured in two intrinsic toe flexor muscles (flexor digitorum brevis [fdb] and abductor hallucis) by ultrasound. muscle volume and muscle length of the fdb were also estimated, and physiological csa was calculated. [results] both tfs-5-toes and tfs-4-toes correlated positively with walking speed in men (r=0.584 and r=0.553, respectively) and women (r=0.748 and r=0.533, respectively). physiological csa of the fdb was significantly correlated with tfs-5-toes (r=0.748) and tfs-4-toes (r=0.573) in women. in men, physiological csa of the fdb correlated positively with tfs-4-toes (r=0.536), but not with tfs-5-toes (r=0.333). [conclusion] our results indicate that physiological csa of the fdb is moderately associated with tfs-4-toes while toe flexor strength correlates with walking performance.

PMC4755967

pubmed-559

cardiomyogenesis (generation of cardiomyocytes) had not been convincingly demonstrated in the adult mammalian heart until very recently; the potential for myocardial regeneration was only recognized in organisms such as fish and amphibians. however, carefully designed and performed studies have produced compelling evidence for the existence of cardiomyocytes in the adult heart, that were formed well after birth, in rodents and even humans. although the various studies do not agree about the rate of cardiomyocyte renewal in adults, this is clearly low and inadequate to replenish the substantial losses of cells after major injuries such as a myocardial infarction. in addition, controversy surrounds the putative cellular sources of postnatal cardiomyogenesis: do new myocytes arise from proliferation of pre-exisiting ones or from cardiomyogenic differentiation of endogenous progenitors? in this review, we will present the evidence supporting the contribution of these two mechanisms in adult cardiomyogenesis and discuss their relative importance in different settings, such as normal ageing and post-myocardial injury. we will also critically present the existing methodologies that allowed the investigation of these mechanisms, with emphasis on their strengths and limitations. while lower vertebrates (such as newts and zebrafish) and neonatal mice possess a robust ability for myocardial regeneration, the ability of the mammalian heart to generate myocytes beyond the early neonatal period has been controversial. during the 20th century, the postnatal mammalian heart was viewed as a post-mitotic static organ, in which increases in mass occur exclusively through myocyte hypertrophy (i.e. increase in cell size), rather than hyperplasia (increase in cell number). the first studies hinting towards postnatal cardiomyogenesis in the human heart can be traced back to the 1970s. by employing histopathological, biochemical and cytophotometric techniques (to measure dna content and nuclear ploidy), adler et al. they found that while normal hearts contained 2 billion cardiomyocytes, hearts with pathologic hypertrophy contained up to 4.8 billion cardiomyocytes. these findings suggest that adult human hearts may generate new cardiomyocytes during pathologic hypertrophy. in 1998, the anversa group examined explanted human hearts obtained from end-stage heart failure patients and from control subjects (who died of non-cardiovascular causes). fluorescent immunohistochemistry (ihc), for sarcomeric proteins and propidium iodide (pi, a dna dye which labels the cell nucleus), demonstrated the presence of cardiomyocytes undergoing mitosis (either nuclear division [karyokinesis] or cell division [cytokinesis ]) in control hearts (14 mitotic myocytes/million myocytes). in end-stage heart failure hearts, the number of mitotic cardiomyocytes increased 10-fold (140 mitotic myocytes/million myocytes). these rates of myocyte mitosis (if they translate into genuine proliferation) project to an annual turnover of 10% in the healthy adult human heart and 107% in the failing human heart. fluorescent ihc for sarcomeric proteins, pi and ki67 (a protein expressed in the nucleus of cells in the active phases of the cell cycle [late g1, s, g2, and m phase ]) in human hearts obtained from patients who died 412 days post myocardial infarction demonstrated ki67 expression in 4% of myocyte nuclei in the infarct border zone and in 1% of myocytes in the remote myocardium. mitosis (karyokinesis or cytokinesis) was observed in 0.08% of myocytes (800 mitotic myocytes/million myocytes) in the border zone and 0.03% of myocytes (300 mitotic myocytes/million myocytes) in the remote myocardium. if such exceptionally high rates of myocyte cell cycling could be persisted and resulted in genuine proliferation (while no significant myocyte loss occurred post-myocardial infarction beyond the initial ischemic insult), then all myocytes lost after an infarct affecting 30% of the left ventricle could be replaced within as little as 18 days. more recently, the anversa group investigated the rates of myocyte turnover in the aging human heart. fluorescent ihc for sarcomeric proteins, ki67, phosphorylated histone h3 (h3p, a marker of karyokinesis) and aurora-b-kinase (a marker of cytokinesis) was performed in explanted hearts from human subjects who died of non-cardiovascular causes. the investigators reported that myocyte turnover increases with age, and that female hearts possess a higher regenerative capacity compared to male hearts. in the female heart, myocyte turnover occurs at an annual rate of 10%, 14%, and 40% at 20, 60, and 100 years of age, respectively. the corresponding values in the male heart are 7%, 12%, and 32% per year. the investigators calculated that from 20 to 100 years of age, the myocyte compartment is replaced 15 times in women and 11 times in men. performed fluorescent immunocytochemistry for h3p in dissociated myocytes isolated from explanted hearts from human subjects who died of non-cardiovascular causes. fluorescent immunohistochemistry (in tissue sections) for mitotic kinesin-like protein was employed for investigation of myocyte cytokinesis. the investigators reported a decrease in myocyte turnover with age: annual myocyte turnover is 100% during the first year of life, decreases to 1.9% at 20 years of age and drops to 0.04% in subjects older than 40 years. the investigators calculated that during the first two decades of life, the total number of myocytes in the left ventricle increases 3.4 fold. however, it needs to be noted that while cardiomyocyte karyokinesis was detectable throughout life, no instances of myocyte cytokinesis were observed beyond 20 years of age. while the aforementioned studies demonstrate that human myocytes can re-enter the cell cycle and may possess some ability to proliferate beyond the early postnatal period, the calculated turnover rates need to be interpreted with caution. estimations of the total number of myocytes per heart (as performed by adler et al.) are complicated, require numerous assumptions and can be confounded by problematic discrimination of myocyte versus non myocyte nuclei (which in those studies was performed based on nuclear size and morphology). quantification of cardiomyocyte cycling with histology (as performed by the anversa group) is prone to sampling error and can be complicated by the fact that conventional histology has been shown to be problematic for identification of cardiomyocyte nuclei (this will be discussed later). finally, estimation of turnover rates based on exceedingly rare and brief (mitosis in adult rat cardiomyocytes lasts 1.8 h in vitro) events that may not represent instances of genuine myocyte division (mitotic events involving in karyokinesis and myocyte multinucleation, but not cytokinesis and generation of daughter cells) leaves significant room for error. ideally, slow processes (like myocyte regeneration) need to be quantified over time, rather than based on a single snapshot. to that end, a more reliable approach to study birth of new myocytes over prolonged periods of time is the pulse-chase approach. in pulse-chase experiments cells (in our case cardiac myocytes) are exposed to a labeled compound (pulse), and then are followed for a period when the labeled compound is no longer administered (chase). however, while pulse-chase approaches can be readily implemented in experimental animals (where pulsing is typically performed through administration of nucleoside analogues), extraordinary circumstances are required for this approach with humans. examples of such extraordinary circumstances were the above-ground nuclear testing during the cold war, which resulted in the temporary release of large quantities of c into the atmosphere between 1955 and 1963 (c pulse). after the limited nuclear test ban treaty in 1963, atmospheric c concentration dropped exponentially (chase), resulting in unique pulse-chase conditions. in a seminal study, bergmann et al. hypothesized that postnatally generated cardiomyocytes the concentration of c in dna of myocytes can be used to retrospectively establish a date mark for when myocytes were born (by identifying the year that atmospheric c levels were similar to c levels in myocyte dna). this can be achieved since: a) c levels in the human body reflect those of the atmospheric air (c reacts with oxygen in the atmosphere to form co2, which then enters the biotope through photosynthesis); and b) dna remains stable following the last cell division. by measuring c concentration (with accelerator mass spectrometry) in dna extracted from fluorescence-activated-sorted myocyte (troponin positive) nuclei isolated from explanted hearts (12 hearts total, 10 from subjects who died of non-cardiovascular causes and 2 from patients who died due to an acute myocardial infarction), bergmann et al mathematical modeling demonstrated that postnatal cardiomyogenesis decreases with age: cardiomyocyte turnover is 1%/year at the age of 25 and gradually decreases at 0.45%/year at the age of 75, resulting in an exchange of 45% of myocytes during a 50-year span. a more recent study by the anversa group employed similar methods but yielded strikingly different results. performed carbon dating with accelerator mass spectrometry in dna extracted from myocytes obtained from 19 healthy hearts and 17 hearts with cardiomyopathy. it should be noted that in this study myocytes were isolated based on density centrifugation, rather than fluorescence-activated cells sorting of troponin positive nuclei (as in the study by bergmann et al.). the investigators found that the healthy adult human heart replaces its entire myocyte compartment 8 times between 20 and 78 years of age. somewhat unexpectedly, the turnover rate of myocytes was found to be similar to that of endothelial cells and cardiac fibroblasts. it has been argued that staining of myocyte nuclei for troponin (as performed by bergmann et al.) only identifies nuclei of senescent myocytes; this could result in significant underestimation of myocyte turnover. another unique circumstance allowing for implementation of a pulse-chase approach to measure myocyte turnover in the human heart is the use of radiosensitizing nucleoside analogues for therapeutic purposes in cancer patients. nucleoside analogues are incorporated into newly-synthesized dna of cycling cells and can therefore serve as markers of dna synthesis. investigated incorportation of the thymidine analogue iododeoxyuridine (idu) into dna of myocytes by fluorescent immunohistochemistry in hearts explanted from 8 cancer patients that had previously (8 days 4 years before death and heart explantation) received infusions of the radiosensitizing agent. the investigators found idu labeling (i.e. dna synthesis) in 2.546% of myocyte nuclei, which projects to an annual myocyte turnover of 22%. concerns have been raised that such high turnover rates are difficult to reconcile with high labeling indices of idu after long chase periods: rapid cell turnover would presumably translate into death of a significant portion of idu-labeled myocytes as well as into substantial dilution of idu (to undetectable levels) due to rapid cell proliferation during the chase period; both processes would result in significantly lower myocyte labeling indices of idu at the time of death. a perhaps more logical explanation for the high rates of idu myocyte labeling in that study is that a substantial portion of the measured dna synthesis may represent instances of abortive cell-cyle re-entry, resulting in polypolidization or binucleation, rather than genuine myocyte proliferation (more on that later). while the investigators attempted to rule out polyploidization as a significant confounding factor (they surprisingly reported that>80% of human myocyte nuclei are diploid, in contrast to several other studies suggesting that the majority is polyploidy), no effort was undertaken to quantify to the potential contribution of bi/multinucleation to the measured rates of dna synthesis. the estimated rates of myocyte turnover measured in adult mammalian hearts (human and mouse) are depicted schematically in figure 1. taken together, even though reported rates of myocyte turnover vary wildly (by more than 1 order of magnitude), the aforementioned studies convincingly establish that the human heart can generate new myocytes beyond the early postnatal period. however, studies in human subjects can not provide insight into the cellular origins of postnatal mammalian cardiomyogenesis: do newly-generated myocytes arise from division of pre-existing myocytes or from cardiomyogenic differentiation of endogenous progenitors? a landmark study by soonpaa and field in 1998 demonstrated convincingly that preformed cardiomyocytes can actively cycle in the adult mouse heart. pulse-chase experiments were performed in transgenic mice, in which a nuclear-localized -galactosidase reporter gene was expressed in cardiomyocytes (driven by the -myosin heavy chain [mhc] promoter). adult mice received injections of h-thymidine and were sacrificed 4 h after the last injection. heart sections were processed for x-gal reaction (to identify cardiomyocyte nuclei) and autoradiography (to identify incorporation of h-thymidine into the dna, i.e. dna synthesis). normal adult hearts had a myocyte labeling index of 0.0006% (1/180000 cardiomyocyte nuclei had incorporated h-thymidine). this projects to an annual myocyte turnover of 1% (if dna synthesis is accompanied by genuine cell division). after myocardial injury (focal cauterization), myocyte cycling in the border zone increased 14-fold (labeling index of 0.0083% [3/36000 cardiomyocyte nuclei had incorporated h-thymidine]). with regard to the cellular origins of cycling cardiomyocytes, identification of morphologically mature cardiomyocytes that have synthesized their dna within 4 h after a single injection of a nucleoside analogue) can only be attributed to dna synthesis in pre-existing myocytes (as differentiation of progenitors to mature myocytes would take longer). more recently, an elaborate study by the lee group investigated the contribution of resident myocyte proliferation to postnatal cardiomyogenesis by a combination of genetic fate-mapping, stable isotope labelling and multi-isotope imaging mass spectrometry. the investigators employed an inducible fate mapping approach utilizing bitransgenic mhc- mercremer/zeg mice. in these mice, induction of cre recombinase activity (driven by mhc promoter) by 4-oh-tamoxifen results in efficient (80%) permanent genetic labeling of myocytes (and their progeny) by green fluorescent protein (gfp). 4-oh-tamoxifen-pulsed adult, healthy bitransgenic mice underwent pulsing with n-thymidine over a 10-week period. multi-isotope imaging mass spectrometry (which has a resolution capacity of< 1 m and thus can readily distinguish cardiomyocyte nuclei from adjacent non-cardiomyocyte nuclei) in sections from explanted hearts revealed a n myocyte labeling index of 0.8% over 10 weeks; this projects to an annual rate of myocyte dna replication of 4.4%. the investigators undertook extensive efforts to calculate the contribution of abortive cell cycle re-entry (resulting in polyploidization and/or multinucleation, rather than genuine cell division) to the measured dna synthesis. perhaps not surprisingly, they found that the majority of dna synthesis occurred in polyploid and/or multinucleated myocytes. however 17% of the measured dna synthesis could not be explained away by these confounding factors, leaving generation of new myocytes as the only likely explanation and suggesting an annual myocyte turnover of 0.74% in the healthy adult mouse heart. with regard to the cellular origins of postnatal cardiomyogenesis, n+ cardiomyocytes expressed gfp at a similar frequency as n- myocytes, suggesting that in the normal heart new myocytes are generated mainly through proliferation of pre-existing myocytes, rather than differentiation of endogenous progenitors. similar experiments performed in adult mice post-myocardial infarction showed a 20-fold increase in myocyte division in the infarct border zone during the first 8 weeks following injury, which was also attributed to proliferation of pre-existing myocytes rather than contributions of endogenous progenitors to the myocyte pool. in a parallel study at the marbn laboratory, we attempted to quantify postnatal cardiomyogenesis and trace its cellular origins using a combination of genetic fate mapping with long-term pulsing with the nucleoside analogue bromodeoxyuridine (brdu). healthy adult bitransgenic mhc-mercremer/zeg mice were pulsed with 4-oh-tamoxifen to genetically label pre-existing cardiomyocytes with gfp. figure 2 depicts two genetically labeled pre-existing cardiomyocytes (pseudocolored in green) that have incorporated brdu (pseudocolored in white). measurement of dna synthesis (brdu incorporation) in pre-exisiting (gfp+) cardiomyocytes by different methods (flow cytometry of whole cells, flow cytometry of isolated myocyte nuclei, fluorescent immunocytochemistry of dissociated cardiomyocytes and fluorescent immuhistochemistry in cardiac sections) demonstrated that 0.4% of pre-existing (gfp+) myocytes synthesized dna during 5 weeks of brdu pulsing, suggesting an annual rate of dna replication in resident myocytes of 4%. actively cycling cardiomyocytes were smaller and more-often mononucleated compared to non-cycling myocytes. quantification of the contributions of polyploidization and multinucleation to the measured rates of brdu incorporation demonstrated that abortive cell-cycle re-entry without genuine cell division could explain 69% of the observed dna synthesis; thus the calculated annual rate of myocyte turnover due to cardiomyocyte proliferation in the adult healthy mouse heart was 1.3%. myocardial infarction resulted in a 2-fold increase in the total number of proliferating myocytes in the left ventricle during the first 5 weeks post-injury; this increase was attributed to an upregulation in proliferation of pre-existing myocytes in the border zone (10 fold compared to normal heart), but not in the remote myocardium. taken together, the aforementioned studies suggest that mammalian myocytes retain a limited but measurable capacity to proliferate in the healthy adult heart, and that myocyte proliferation increases modestly in the border zone following myocardial infarction. during the past decade several studies supported the notion that the adult mammalian heart contains its own reservoir of stem cells. numerous populations of putative adult endogenous cardiomyocyte progenitors have been proposed (including c-kit cells, sca-1 cells, side population cells, cardiosphere-forming cells, ssea-1 cells, pdgfr cells and neural-crest derived cells) largely based on expression of surface markers or functional properties that have been used to mark progenitors in other organs. the high number of distinct populations of putative endogenous myocyte progenitors is difficult to reconcile with the limited regenerative capacity of the adult mammalian heart. importantly, while several cell types have been shown to express cardiac proteins in vitro or after delivery into recipient hearts following ex vivo expansion, their physiologic importance and contribution to cardiomyocyte replenishment in the normal or injured adult heart remains controversial. genetic fate mapping is a powerful tool that enables study of cardiac regeneration in vivo. perhaps the most compelling evidence indicating postnatal contribution of endogenous progenitors to the adult myocyte pool comes from a landmark study performed at the lee laboratory. using mhc-mercremer/zeg adult bitransgenic mice, hsieh et al. achieved inducible genetic labeling of 80% of preexisting myocytes with gfp, without any detectable labeling of progenitor-like cells (which in their inactive state presumably do not express mhc). in the normal heart, the percentage of gfp+ myocytes remained unchanged over 1 year of follow-up, indicating that progenitor cells do not contribute significantly to myocyte renewal during normal aging. in contrast, when mice were subjected to myocardial infarction the percentage of gfp+ cardiomyocytes decreased from 83% to 68% in the border zone and to 77% in the remote myocardium over a 3-month follow-up period. following pressure-overload, the percentage of gfp+ myocytes decreased from 83% to 76% over 3 months. these results indicate that post-cardiac injury, unlabeled progenitors undergo cardiomyogenic differentiation, resulting in dilution of gfp+ myocytes by gfp myocytes (generated from unlabeled precursors) (figure 3a). alternatively, the observed dilution of the labeled myocyte pool could be attributed to intrinsic differences between gfp+ and gfp- myocytes, i.e. increased proliferative capacity of gfp- myocytes post-injury or increased susceptibility of gfp+ myocytes to injury (even though the latter hypothesis has not been shown to occur). brdu pulsing revealed increased incorporation of brdu in gfp- myocytes (compared to gfp+ myocytes) post-injury, a finding also compatible with generation of new myocytes from progenitors. based on these findings, the contribution of endogenous precursors to the myocyte pool post-injury appears to be quite substantial: over a 3-month period, 15% of myocytes in the border zone and 6% of all myocytes in the left ventricle arise from cardiomyogenic differentiation of progenitors. the results of this study (particularly the increased brdu labeling of gfp- myocytes) do not fully agree with a more recent study from the same group (described earlier), in which no increased n incorporation into gfp myocytes could be detected by multi-isotope imaging mass spectrometry, suggesting no significant contribution of endogenous precursors to the myocyte pool post-injury. this discrepancy may be a result of the very small number of mononucleated/diploid n+ myocytes (16 n+ myocytes/ 7063 myocytes analyzed) detected in injured hearts by multi-isotope imaging mass spectrometry (an extremely time-consuming method that precludes analysis of large amounts of tissue); this number may be too small to detect differences in the rate of n incorporation in gfp+ and gfp myocytes. at the marbn lab after inducible genetic labeling of cardiomyocytes by gfp, adult bitrangenic mhc-mercremer/zeg mice received daily brdu injections for 5 weeks. comparison of brdu incorporation in gfp+ and gfp cardiomyocytes (by flow cytometry, immunocytochemistry and histology) revealed similar rates of brdu labeling in both myocyte subsets in healthy mice. these findings indicate that in the normal adult mouse heart, myocyte turnover occurs predominantly through proliferation of resident myocytes, without any measurable progenitor-mediated myocyte formation. however, post-myocardial infarction we could detect a contribution of endogenous precursors to the myocyte pool (1% of myocytes in the left ventricle arose from progenitor cell differentiation over a 5-week period post-injury) (figure 4). a different technique (viral gene tagging) to study endogenous cardiac regeneration was employed by the anversa group. injected lentiviruses expressing gfp in the atria and ventricular apex (presumably sites of cardiac stem cell niches) of adult mice. one to 5 months later, nested polymerase chain reaction revealed common viral integration sites in c-kit+ cells, cardiomyocytes, endothelial cells and fibroblasts isolated from the infected hearts. since lentiviruses are semi-randomly integrated in the host genome of infected cells, these results suggest that postnatally-generated cardiomyocytes, endothelial cells and fibroblasts in the healthy adult mouse heart derive from clonal activation of endogenous stem cells. six months after viral injection, 25% of myocytes in the mid-portion of the left ventricle (a myocardial region away from the sites of viral injections) were gfp+, presumably arising from migration of gfp+ infected progenitor cells to that region and subsequent differentiation. these results indicate a remarkable capacity of the adult mouse heart for stem-cell mediated cardiomyocyte replenishment. however, it needs to be emphasized that viral gene tagging can not reveal the identity of the parental stem cell. the fact that c-kit cells shared similar viral integration sites as cardiomyocytes, endothelial cells and fibroblasts could be a result of viral infection of a yet unknown progenitor that gives rise to all four celltypes. fate mapping of resident myocytes or viral gene tagging can not reveal the identity of endogenous progenitors, as they indirectly capture the net result of their activation and differentiation. this can only be performed through forward fate mapping experiments in which endogenous progenitors (but not pre-existing myocytes) are genetically labeled in a prospective manner, enabling direct visualization of their future contributions to the myocyte pool (figure 3b). such an approach was undertaken at the fukuda lab in order to investigate the contribution of neural-crest derived cells to postnatal cardiomyogenesis. tamura et al. used bitransgenic mice in which activation of cre-recombinase (under the control of protein-0 promoter) induces gfp expression, resulting in genetic labeling of neural-crest derived cells by gfp. in the healthy heart, neural-crest derived (gfp+) cardiomyocytes were undetectable during the first week after birth but appeared at 2 weeks postnatally and increased in number thereafter; however, their absolute contributions to the myocyte pool were minimal (0.3% gfp+ cardiomyocytes in the septum,< 0.1% gfp+ cardiomyocytes in the rest of the left ventricle). after myocardial infarction, small gfp+ cardiomyocytes (presumably arising from differentiation of neural-crest-derived cells) first appeared in the border zone 2 weeks post-injury and gradually increased in number thereafter (comprising 3% of total cardiomyocytes in the border zone at 12 weeks post-injury). while this study is limited by the fact that the activity of cre-recombinase was not temporally controlled in an inducible manner (and thus spontaneous activation of the protein-0 promoter in resident cardiomyocytes would result in gfp labeling) it suggests that progenitor cells may contribute to generation of new myocytes (especially post-injury). using a similar forward fate mapping approach, ellison et al recently reported that endogenous c-kit+ cardiac cells are a source of newly formed cardiomyocytes, after myocardial injury, in adult rodents. the investigators used a model of a single, high isoproterenol dose that produces severe, albeit spontaneously resolving, myocardial injury. endogenous c-kit+ cardiac cells were genetically labeled by exogenous administration of a lentivirus expressing cre-recombinase. under the control of a c-kit promoter, in hearts of ryp reporter mice. in this mouse model, expression of cre-recombinase in c-kit+ cell results in genetic labeling of infected c-kit+ cells with yellow fluorescent protein (yfp). after isoproterenol injury, a significant fraction of cardiomyocytes were yfp+, indicating that they comprise newly generated cardiomyocytes arising from cardiomyogenic differentiation of infected c-kit+ cells. while this study suggests an important role of progenitor cell-mediated cardiomyogenesis post-injury, it is in contrast with previous studies, reporting that adult c-kit+ cells have only angiogenic but not cardiomyogenic potential. in addition, the implemented spontaneously-resolving model of heart failure may not be physiologically relevant. finally, it needs to be emphasized that c-kit is not a specific marker of stem cells, but it is rather expressed in a variety of cells (e.g. mast cells) and more importantly in myocytes themselves during both proliferation and differentiation. thus, the precise expression pattern of c-kit in forward fate mapping models has to be delineated at baseline prior to temporal assessment of possible progeny, before concrete conclusions can be reached. currently, several studies using forward fate-mapping approaches for putative markers of endogenous progenitors (including c-kit, sca-1 and nkx2-5) are ongoing in multiple labs. taken together, the aforementioned studies suggest that endogenous progenitors may generate new myocytes in the adult heart. while their role in postnatal cardiomyogeneis during normal ageing appears to be limited (as most studies concur that myocyte turnover in the healthy heart most likely occurs through proliferation of pre-existing myocytes), multiple studies indicate progenitor cell-mediated cardiomyocyte renewal occurs following myocardial injury. it needs to be emphasized that the two proposed mechanisms of myocyte turnover (cardiomyocyte proliferation and differentiation of endogenous progenitors) are not mutually exclusive. the adult mammalian liver has an impressive capacity to regenerate; following acute 70% partial hepatectomy, the adult liver can fully regenerate within days (in rodents) to weeks (in humans), through division of mature hepatocytes and cholangiocytes, which re-enter the cell cycle and divide. however, during chronic liver injuries, hepatic progenitor cells also become activated and contribute to liver regeneration. in addition, inherent characteristics of cardiac tissue architecture and cardiomyocyte biology further complicate quantification of postnatal cardiomyogenesis and tracing of its cellular origins in the mammalian heart. below, we review the major challenges when studying endogenous postnatal cardiac regeneration. first, since postnatal cardiomyogenesis in the mammalian heart most likely occurs at very low levels, pulse-chasing approaches with long pulsing periods are preferable in experimental animals, as they maximize the chance of capturing rare events of myocyte proliferation. however, long-term administration of radiolabeled thymidine or halogenated nucleoside analogues (like brdu) may be toxic and could affect the cycling rates of cardiomyocytes. nevertheless, we did not observe any differences in the rates of actively-cycling (ki67 +) cardiomyocytes in mice that received brdu for up to 5 weeks compared to mice that did not receive brdu. second, the use of conventional histology (which typically employs confocal microscopy for analysis of cardiac sections stained for sarcomeric proteins, dna [for nuclear identification] and [in some cases] cellular borders) to identify cardiomyocyte nuclei is problematic. ang et al. performed a careful study to investigate the fidelity of conventional myocyte nuclear identification using confocal microscopy. a transgenic mouse in which cardiomyocyte nuclei are genetically labelled (by a nuclear-localized -galactosidase reporter gene driven by the mhc promoter) was used as the gold-standard. the investigators demonstrated that conventional histological approaches typically misidentify myocyte nuclei 10% of the time, thus significantly compromising accurate quantification of rare events (like active cycling of myocytes). the limitations of conventional microscopy can be overcome by use of transgenic lineage reporters that mark cardiomyocyte nuclei, implementation of approaches with powerful resolution capacity (e.g. multi-isotope imaging mass spectrometry), or analysis of enzymatically dissociated cardiomyocytes. third, it needs to be emphasized that dna incorporation of nucleoside analogues or nuclear expression of cell-cycle proteins, while demonstrating cell-cycle activity, does not necessarily translate into genuine cell division and proliferation; important confounding factors that need to be accounted for include polyploidization (dna proliferation without karyokinesis and cytokinesis) and bi/multinucleation (dna proliferation and karyokinesis without cytokinesis), cell fusion and dna repair (figure 5). while cell fusion and dna damage and repair are exceptionally rare events that can not account for the magnitude of measured turnover rates, polypolidization and bi/multinucleation are particularly relevant when studying cardiomyogenesis, as abortive cell-cycle re-entry is quite prevalent in myocytes (most myocytes in the mouse heart are diploid and binucleated, while most myocytes in the human heart are polyploid and mononucleated). we and others have found that the majority of the measured myocyte cell-cycle activity in the normal or infarcted mouse heart can be attributed to polyploidization and binucleation, rather than true myocyte division. cardiomyocyte cytokinesis is a brief (the m phase occupies 2% of the cell cycle) and rare event, and detection of the cleavage furrow between diving myocytes (a hallmark of cytokinesis) is complicated by the compact myocardial architecture as well as by division of adjacent non-myocyte cells (which actively cycle at substantially higher rates compared to myocytes); thus myocyte division is difficult to visualize convincingly and quantify accurately. a more viable strategy may be to quantify the magnitude of abortive cell-cycle re-entry and subtract it from the total measured dna synthesis. to that end, measurements of ploidy levels (by flow cytometry for dna content or by visualization of the number of sex chromosomes by fluorescence is situ hybridization) and number of nuclei (preferably by analysis of dissociated myocytes) should be performed in cardiomyocytes that have incorporated nucleoside analogues. finally, while genetic fate mapping is the only reliable tool that can be used to trace the cellular origins of organ regeneration in vivo, its implementation in studies of postnatal cardiomyogenesis does not come without problems. while several groups have used the mhc-mercremer/zeg bitrasngenic mouse for inducible marking of pre-existing myocytes, multiple studies have reported activity of the -mhc promoter in non-myocyte cells that possess characteristics compatible with endogenous cardiac progenitors. in addition, development of new lineage-tracing models that could allow for forward fate mapping of cardiac progenitors (in order to prospectively investigate their contributions to the myocyte pool) is complicated by lack of specific cardiac stem cell markers and by potential re-expression of such markers in cardiomyocytes during stress-induced activation of a fetal-gene program (figure 3). there is now ample and compelling evidence that cardiomyogenesis does occur in the adult mammalian heart, albeit at an insufficient rate to restore cardiac function after substantial cell losses such the ones that occur after a myocardial infarction. proliferation of pre-existing cardiomyocytes appears as the dominant mechanism of generation of novel cardiomyocytes, at least during normal ageing, although after myocardial injury, differentiation of progenitor cells may also contribute to this phenomenon. cell therapies have already reached the stage of clinical trials; most of the cells currently under investigation (with the exception of embryonic stem cells and induced pluripotent stem cells) do not differentiate into functional cardiomyocytes and act through paracrine activation of endogenous reparative and regenerative pathways. recently, insight has been provided to the mechanisms that control exit and re-entry of cardiomyocytes to the cardiac cycle, together with ways to manipulate the potential of cardiomyocytes for division and proliferation. it is reasonable to expect that therapeutic amplification of endogenous regenerative mechanisms will bolster cardiomyocyte repopulation of injured myocardium and will result in effective therapies for cardiovascular disease and heart failure, in the not so remote future.

in recent years, several landmark studies have provided compelling evidence that cardiomyogenesis occurs in the adult mammalian heart. however, the rate of new cardiomyocyte formation is inadequate for complete restoration of the normal mass of myocardial tissue, should a significant myocardial injury occur, such as myocardial infarction. the cellular origin of postnatal cardiomyogenesis in mammals remains a controversial issue and two mechanisms seem to be participating, proliferation of pre-existing cardiomyocytes and myogenic differentiation of progenitor cells. we will discuss the relative importance of these two processes in different settings, such as normal ageing and post-myocardial injury, as well as the strengths and limitations of the existing experimental methodologies used in the relevant studies. further clarification of the mechanisms underlying cardiomyogenesis in mammals will open the way for their therapeutic exploitation in the clinical field, with the scope of myocardial regeneration.

PMC3963760

pubmed-560

however, due to the high computational cost required for reconstruction, its real-time imaging applications remain challenging. bolus-chasing computed tomography (ct) angiography is a primary example which demands real-time ct feedback. to address this problem, for example, xtrillion (by terarecon, inc.) uses an application-specific pci card, while mercury computer systems relies on blade-based linux clusters. however, the specialized hardware is expensive and unsuitable for general purpose applications. alternatively, efforts are made using graphic cards [2, 3], since the main operation for commercial ct reconstruction is backprojection, similar to texture mapping in computer graphics. although graphics cards are highly optimized, they do not support floating-point calculations. that the latest graphics cards can implement virtual floating-point calculations [3, 5], they do not support full 32 bits floating calculations. another bottle-neck is that the graphic cards require data exchange between cpu and gpu. in this paper, a multi-core pc-based acceleration scheme is proposed for filtered-backprojection-(fbp-) based image reconstruction. third, the single-instruction multiple-data (simd) technique is employed for data-level parallel processing. fourth, the multithreading programing is done to take advantage of multi-core processors, realizing the true parallel computation capability. finally, an intel c++ complier is used to optimize the code for intel processors. the ct reconstruction algorithm is overviewed, and then each of our acceleration techniques is described. in section 3, numerical experiments on various datasets and different pcs are presented to evaluate the speedups with our scheme and the conventional implementation. in section 4, relevant issues and research directions are discussed. the most popular multislice ct reconstruction methods remain data rebinning-based fan-beam reconstruction filtered backprojection (fbp) algorithms. therefore, our work is focused on the typical fan-beam fbp algorithm. note that the application of our scheme is not limited to the fan-beam case, because it can also be applied to accelerate the latest approximate cone-beam algorithms [68], which can be treated as generalized fan-beam reconstruction algorithms. in a typical ct setting, the data acquisition system (an x-ray source and a detector assembly) is rotated rapidly in the gantry while the patient on a table is translated into the gantry opening. this process is illustrated in figure 1. because the multi-row detector arrays span a very small cone angle, acquired helical scan data are usually rebinned into a series of virtual circular scan data for reconstruction of a stack of images. here we assume a method from, in which the virtual fan-beam projection data are calculated according to the following formula: (1)pc (,,z0)=ph(,,z())zbza +zb +ph(,+2,z(+2))zaza +zb, where=+ k 2, k n, so that za z0 zb, pc denotes virtual circular scan data, ph denotes acquired helical projection, za and zb are the distances from projections a and b to the virtual circular plane, respectively, in figure 2, and are the projection angles shown in figure 3. after transforming helical projection data ph to circular fan-beam projection data pc, the conventional fan-beam reconstruction algorithm can be used. as the rebinning cost is insignificant, our optimization targets the reconstruction process: (2a)f(x, y, z0)=021l2pc, f(0,,z0)d, (2b)pc, f(,,z0)=pc(,,z0)dcos 22sin2h(), (2c)l=d2+r22drcos(), (2d)0 =arcsinrsin() l, where f is an object function to be reconstructed, pc, f are the filtered projection data, d is the distance from the source to the center of rotation, and h() is the ramp filter. while the inner convolution is the filtration process, the outer integration is the most time-consuming backprojection process, as shown in figure 4(a). since the backprojection is the bottleneck, let us analyze the backprojection process as shown in algorithm 1. clearly, a large part of the computational cost is due to the inner loop that calculates 0, 1/l, interpolation coefficients, and accumulates the incremental contributions to the final reconstruction. in the following, we show how the backprojection can be speeded up using various techniques. for our circular fan-beam reconstruction, two types of symmetries are available, which are referred to as the right-angle symmetry and complement symmetry. the right-angle symmetry, or 90-degree symmetry, is shown in figure 5. that is, a new pair of source and pixel positions is obtained by applying a 90-degree rotation to a current pair of source and pixel positions. the resultant 4 pairs of source and pixel positions share the same 1/l and 0, which can be calculated from (3) and (4), respectively. as the interpolation coefficients required by the backprojection are determined by 0, they are the same as well. therefore, for the four sets under consideration, the calculations of these parameters need to be done only once: (3)lset1 =d2+r22drcos ()=d2+(xp2+yp2)2drcos(tan1(xp, yp))=d2+(yp2+xp2)2drcos(+2tan1(yp,xp))= lset2 =d2+(xp2+yp2)2drcos(+tan1(xp,yp))= lset3=d2+(yp2+xp2)2drcos(+32tan1(yp, xp))= lset4, (4)0,set1=arcsinrsin(tan1(xp, yp))l=arcsinrsin(tan1(yp, xp)/2)l=0,set2=arcsinrsin(tan1(xp, yp))l=0,set3=arcsinrsin(tan1(yp, xp)3/2)l =0set4, where (xp, yp) denotes the pixel in the first quadrant. the following two requirements, which are usually satisfied in practice, are necessary to use the right-angle symmetry. the first requirement is that the projection data must be available at the involved four angles. namely, the number of projections in a full scan must be divisible by 4, which is reasonable for current medical ct scanners. for instance, a somatom system generates 1160 projections per turn, while a lightspeed scanner produces 984 projections per turn. the other requirement is that the reconstruction region must be symmetric about the x- and y-axes, such as a square or a circle in the clinical imaging situation. the second type of symmetry is the complement symmetry, as shown in figure 6. here, a pair of source and pixel positions complements the other pair of source and pixel positions if they are symmetric with respect to a diagonal line (e.g., y=x). for these 2 pairs of source and pixel positions, l s are the same, while 0 for one has the opposite sign of that for the other, as shown by (5) and (6), respectively, (5)lset1 =d2+r22drcos ()=d2+(xp2+yp2)2drcos(tan1(xp, yp))=d2+(yp2+xp2)2drcos(2tan1(yp, xp))= lset2c, (6)0,set1=arcsinrsin(tan1(xp, yp))l=arcsinrsin(tan1(yp, xp)(/2))l=0,set1c. therefore, such a symmetry can also be used to reduce the computational cost. the requirements for use of the complement symmetry are the same as those for the right-angle symmetry. using these two types of symmetries, the backprojection can be significantly speeded up, since only one set of parameters needs to be calculated for the eight sets. the implementation of the backprojection is accordingly modified, as shown in algorithm 2. note that after the calculation of 0 and l once for 8 pairs of source and detector positions, 8 filtered projection values are put to 8-pixel positions together in the inner-loop. to evaluate the computational complexity, the time for cpu to access data must be considered, especially for the ct reconstruction process because the backprojection requires frequent visits to a great amount of filtered projection and image data. the cpu data access mechanism with multi-level caches is illustrated in figure 7. specifically, a cache can be used to reduce the average time to access data in the main memory (ram). the cache is a smaller, faster memory chip which stores copies of data from the most frequently used main memory locations. as long as a majority of memory accesses are to the cached memory locations, the average latency of memory accesses will be reduced to the cache latency, instead of the main memory latency. the l2 cache is faster than ram and about 1 2 mb. the slowest ram is 1 4 gb. when the processor needs to read from or write to the main memory, it first checks if the data is in the cache. if it is in the cache, we say that a cache hit has occurred; otherwise a cache miss is counted. in the case of a cache hit, however, in the case of a cache miss, it takes much longer time to access the data. due to the limited cache capacity, one way to execute the code efficiently is to increase the hit rate by optimizing the data structures. usually, projection data are sequentially stored in the order of, while reconstructed images are stored rowwisely. thus, for implementation of the right-angle and symmetry, the access to 8 pairs of projection and image data will very likely result in cache misses due to the address gaps, as shown in figure 8. such misses within the inner loop will cause a significant latency. to address this problem, in our optimized data structures all the data are arranged into blocks indexed to reflect symmetric relationships. therefore, the cache miss rate can be greatly reduced in the inner loop. the simd technique enables the data-level parallelism like in a vector processor, as shown in figure 9. with an simd processor, one instruction can process a block of data at a time instead of just one datum, which is much more efficient than the conventional single instruction single-data (sisd) technique. small-scale (64 or 128 bits) simd operations are now popular supported by general pc cpus, such as those from intel and amd [12, 13]. we use the intel sse (streaming simd extensions) instruction set to implement the simd technique in our backprojection process. within the inner loop, we backproject 8 projection data onto 8 pixels, according to the same instructions such as interpolation, weighting, and accumulation. therefore, we have a perfect situation to employ the simd technique. as the sse only supports simultaneous processing of 4 floating data at a time (128-bits register), 8 data are processed in two groups. in recent years their efforts have now shifted from improving the clock speed to increasing the number of cores within a processor. however, a processor with more than one core can not achieve a better performance unless parallel computation schemes are applied. therefore, to take advantage of multi-core processors, multi-threaded programing must be done. from the flowchart of our algorithm, thus, the backprojection can be implemented in parallel by assigning different loop ranges to various cores of the processor. after all the threads are finished, the final result can be assembled from the results of each thread. in our implementation (figure 4(b) and algorithm 2), we divide the loop of y, instead of the loop of. usually, the number of cores on a pc is 2, 4 or 8, it is not common for n/4 to be an integer, but it is always the case for ny to be 256, 512, or 1024. our parallel implementation on a multi-core pc is more efficient than that on a pc cluster in terms of time required for data exchange between threads. in our case, the data exchange is via on board ram bus, while the pc cluster's data exchange via local network is significantly slower. the intel c++ compiler creates applications that can run at the fastest speeds on the intel processors. it can take the full advantage of the intel processors when compiling codes and generating object files. this provides an integrated development environment. in our implementation, we use it to optimize the code for pentium d and xeon processors. to test the gain of our scheme, we ran our accelerated code on pentium d and xeon pcs., different sizes of projection datasets and reconstructed images were tested to evaluate the efficiency under various conditions. here to test effeteness of each technique, the reconstruction times and speedups are tested by applying them gradually. the reconstruction experiments are done based on our hp6200 workstation and reconstructing a 512 512 image from a projection dataset (1160 672). the reconstruction results are shown by applying techniques step by step (table 2). the overall speedup and individual speedups for each technique are also calculated to show the efficiency of them. the speedup results for different projection datasets and image matrix sizes are shown in tables 3, 4, and figure 10. significant speedups were achieved using our scheme. in the case of 1160 views and 512 512 image, the reconstruction time was decreased from 52 seconds to 1.35 seconds. for a one-core computer, the speedup was more than 20 times. for a two-core computer, the images reconstructed using our scheme and the conventional method are shown in figure 11. all the images were reconstructed using 32-bit floating-point data and were displayed in the same window [0.97, 1.05]. the images reconstructed using our accelerated and conventional schemes are essentially the same. as the ct reconstruction algorithm is highly parallelizable, the speedup can be improved with more cores almost linearly. for example, with two quad-core processors, the speedup that could be achieved is more than 100. as compared to other acceleration techniques, such as those based on specialized hardware and graphics cards, our general purpose pc-based scheme is much cheaper without compromising image quality. for example, a general purpose hp or dell workstation with a top-line two quad-core processor and 8 gb ram is less than $7000. all calculations are based on 32-bit floating point data, providing sufficient accuracy for medical imaging applications. in terms of the absolute reconstruction time for a 512 512 image from 1160 projection views if the latest multi-core processor is used, the total time can be easily decreased by several folds. as the computers we have still use the previous generation processor, the potential improvement is at least 5 times if we are equipped with the latest quad-core processors, that is, the reconstruction time may be reduced to 0.3 second. hence, it is quite promising for real-time ct applications, such as project on bolus-chasing ct angiography. in conclusion, our acceleration scheme has integrated several techniques including utilization of geometric symmetry, optimization of data structures, single-instruction multiple-data (simd) processing, multi-threaded computation, and an intel c++ complier. as a result, it has speeded up the reconstruction process by 40 times, as compared to the conventional implementation on a general purpose pc with 2 cores. further work is in progress to improve our results using the latest pcs and extend our scheme for cone-beam reconstruction.

expensive computational cost is a severe limitation in ct reconstruction for clinical applications that need real-time feedback. a primary example is bolus-chasing computed tomography (ct) angiography (bca) that we have been developing for the past several years. to accelerate the reconstruction process using the filtered backprojection (fbp) method, specialized hardware or graphics cards can be used. however, specialized hardware is expensive and not flexible. the graphics processing unit (gpu) in a current graphic card can only reconstruct images in a reduced precision and is not easy to program. in this paper, an acceleration scheme is proposed based on a multi-core pc. in the proposed scheme, several techniques are integrated, including utilization of geometric symmetry, optimization of data structures, single-instruction multiple-data (simd) processing, multithreaded computation, and an intel c++ compilier. our scheme maintains the original precision and involves no data exchange between the gpu and cpu. the merits of our scheme are demonstrated in numerical experiments against the traditional implementation. our scheme achieves a speedup of about 40, which can be further improved by several folds using the latest quad-core processors.

PMC1986783

pubmed-561

the amination of c h bonds provides a route to n-alkyl and n-aryl amine derivatives that avoids typical functional group interconversions and reactants containing a functional group already present at the position where a c n bond is desired. n bonds are particularly challenging to achieve, but such reactions could directly modify complex molecules, create chemical feedstocks, or create functionalized polymers. methods for the oxidation of alkanes by the combination of peroxides and iron complexes have been developed, but intermolecular functionalization of purely unactivated c h bonds with reagents that form products containing common nitrogen-based functionality are rare. h bonds have been catalyzed by copper complexes and occur at benzylic or allylic positions. reactions catalyzed by dirhodium complexes are the most developed for the synthesis of complex molecules. although remarkable developments and applications have been reported for intramolecular reactions, intermolecular reactions are more limited. h bond of the substrate, such that the preferred sites of reactions are tertiary, benzylic, and secondary c h bonds. when a nitrene is the reactive intermediate, the nitrogen-based reagent is limited to those containing just one substituent. we sought an alternative route to the intermolecular functionalization of alkyl c h bonds that could form n-alkyl amides, carbamates, and imides, in addition to the formation of sulfonamides. amides, carbamates, and imides are more common synthetic intermediates or final products than those generated by prior copper-catalyzed reactions with alkyl c h bonds. we also sought to conduct these transformations with readily accessible complexes of first-row metals. although copper-catalyzed reactions at allylic and benzylic c h bonds with carboxylic acids and sulfonamides in the presence of peroxides is well-known (karasch-sosnovsky reaction), and the mechanism of these reactions has been studied, the amidation of c h bonds with such reagents has been limited to reactions at benzylic c h bonds. we report the reactions of common amides, carbamates, and imides with alkanes to form n-alkyl derivatives with simple copper catalysts and a peroxide (scheme 1). the amidation of alkanes under our catalytic conditions preferentially forms the products from amidation at secondary sites over tertiary sites and even leads to the functionalization of primary c mechanistic data from the stoichiometric reactions of isolated copper amidate or imidate complexes indicate that the transformation of alkanes to n-alkyl products likely occurs by the reactions of a alkyl radicals with copper(ii) amidate and imidate complexes. h bonds, we evaluated the reactivity of benzamide (0.5 mmol) and cyclohexane (10 equiv) with 2.55.0 mol% of various copper precatalysts and oxidants. results for the copper-catalyzed amidation of cyclohexane with benzamide are presented in table 1. the combination of copper and tbuootbu was crucial for catalysis; other peroxide-based oxidants and redox-active 3d transition metals did not yield the amidation product. conditions: 0.5 mmol of benzamide, 5.0 mmol of cyclohexane, 0.0125 mmol of catalyst, 0.0125 mmol of ligand, 1.0 mmol of oxidant, 1 ml of phh at 100 c for 24 h. gc yield with n-dodecane as the internal standard. the reactions catalyzed by cu(i) and cu(ii) salts without ligand gave the n-cyclohexylbenzamide in low yields (entry 14, 1027%). however, the reactions catalyzed by cu(i) and bipyridine (bipy), gave n-cyclohexylbenzamide in a measurably higher 36% yield. reactions catalyzed by the well-defined [(l1)cucl] precatalyst (entry 8) (l1=(( (2-(dimethylamino)ethyl)imino) methyl)phenoxide) provided 83% of n-cyclohexylbenzamide. finally, we found that the reaction of benzamide with cyclohexane catalyzed by the simple combination of phenanthroline (phen) (entry 6) or 4,7-dimethoxy-phenantronline (( meo)2phen) (entry 7) and cui formed n-cyclohexylbenzamide in nearly quantitative yield. the scope of benzamides that undergo this c h bond amination reaction is summarized in table 2. benzamides containing electron-withdrawing groups, such as cl, br, f, and cf3 (a d), underwent the reaction to give good yields of the corresponding amidation product (7382%). benzamides containing electron-donating groups, such as me, bu, and ome (e k), also underwent the amidation process, but the isolated yields of the amidation products were slightly lower (5578%) than those of the benzamides containing electron-withdrawing groups. heteroaromatic amides, such as 2-thienylamide (m) and 2-pyridylamide (l), also underwent the oxidative coupling with cyclohexane to give the corresponding n-alkyl products. the reaction of the 2-pyridylamide is noteworthy because the 2-pyridylamide product could form a strong chelating ligand that would prevent catalysis. the position of the substituent on the benzamide (ortho, meta, or para) did not have a pronounced effect on the reaction yields. conditions: 0.5 mmol of amide, 5.0 mmol of cyclohexane, 0.0125 mmol of cui, 0.0125 mmol of (meo)2phen, 1.0 mmol of tbuootbu, 1 ml of phh at 100 c for 24 h. four equivalents of oxidant. the reactions of cyclohexane with primary and secondary alkyl amides, carbamates and imides also occurred (table 2). the yields of the reactions of cyclohexane with acetamide (n), tert-butylcarbamate (o), and toluenesulfonamide (p) to form n-cyclohexylacetamide, tert-butyl-n-cyclohexylcarbamate, and n-cyclohexyltoluenesulfonamide (38%, 42%, and 55%, respectively) were lower than those that formed n-alkyl benzamides. however, the reaction of tert-butylcarbamate, with excess tbuootbu (4 equiv) gave tert-butyl-n-cyclohexylcarbamate in 75% yield. the reactions of cyclohexane with secondary nitrogen sources (n-methylbenzamide, phthalimide, pyrrolidinone, and n-me-p-toluenesulfonamide) also occurred to form the corresponding n-alkyl products. the yields of these reactions were variable (1075%) (q t), but they do demonstrate that the mechanism can not involve a nitrene intermediate. the reaction of phthalimide was improved from 20% to 75% by changing the solvent from benzene to 1,2-dichlorobenzene to increase the solubility of the reagent. the selectivities for amidation of various alkanes with benzamide are presented in table 3. h bonds formed products from functionalization at the secondary c h bonds (entry 15). for example, the major products of the reactions of benzamide with trans- and cis-1,4-dimethylcyclohexane (entry 1,2) resulted from amidation of secondary c h bonds, while the minor products resulted from the amidation of primary c no product was formed from amidation of the tertiary c h bond. likewise, the reaction of 3-ethylpentane (entry 5) occurred preferentially at secondary and primary c the reaction of 2,4-dimethylpentane (entry 7), in which the secondary c h bond is hindered, occurred exclusively at the primary c h bond. this product distribution contrasts that of most c h oxidations by a radical mechanism. for reactions of cycloalkanes ranging from cyclopentane to cyclododecane, the ring size did not affect the yield of the corresponding n-alkyl products (6980%) (entry 8). conditions: 0.5 mmol of benzamide, 1 ml of alkane (1017 equiv), 0.0125 mmol cui, 0.0125 mmol of (meo)2phen, 2.0 mmol of tbuootbu, 1 ml of o-c6h4cl2 at 100 c for 36 h. regioselectivity determined by crude h nmr. yield for the reaction with t-butylcarbamate. to assess whether copper-amidate and copper-imidate complexes with cu in the oxidation state of+1 and+2 are intermediates in the catalytic amidation reactions, we synthesized and characterized a variety of these amidate and imidate complexes supported by phen and 2-(dimethylamino)ethyl)imino)methyl) phenoxide (l1) (scheme 2). salt-metathesis reactions of [(phen)cucl]2(-cl)2 with potassium phthalimide (kphth) or a combination of naotbu and h2nso2ph or h2ncoph in thf at room temperature yielded air- and moisture-stable [(phen)cu(phth)2] (1-phth2), [(phen)cu(nhso2ph)2] (2), and [(phen)cu(nhcoph)2] (3), respectively. phen-ligated cu(i) complexes containing benzamidate and benzenesulfonamidate ligands were isolated from the reaction of [cu(mes)]n with phen, followed by the addition of benzenesulfonamide and benzamide to produce the corresponding products [(phen)2cu][cu(nhso2ph)2] (4) and [(phen)2cu][cu(nhcoph)2] (5). the complex [(phen)cu(phth)] (1-phth) salt-metathesis reactions of [(l1)cucl] with phthalimide (hphth), benzenesulfonamide, and benzamide produced the corresponding cu(ii) complexes of [(l1)cu(phth)] (6), [(l1)cu(nhso2ph)] (7), and [(l1)cunhcoph] (8) (scheme 2). previous structural characterizations of phen-ligated copper(i) amidate and imidate complexes revealed that these complexes can exist as mononuclear or ion-pair species. therefore, we assessed the atomic connectivity of 1-phth2 and 4 by single crystal x-ray diffraction (xrd) analysis. all pertinent bond distances and angles for these complexes are listed in the caption of figure 1. phen-ligated cu(ii) phthalimidate 1-phth2 is mononuclear in the solid state with a square planar geometry around the cu(ii) ion (figure 1). molecular structures of [(phen)cu(phth)2] (1-phth2), [(phen)2cu] [cu(nhso2ph)2] (4), [(l1)cu(phth)] (6), and [(l1)cu(nhso2ph)] (7) shown with 50% thermal ellipsoid. selected bond lengths () and angles () of 1-phth2: cu1n1=2.0480(14); cu1n2=2.0363(14); cu1n3 =1.9667(14); n1cu1n3=170.29(5); n1cu1n2 =93.45(5); n1cu1o1=92.5(3). selected bond lengths () and angles () of 4: cu1n1 =1.9920(15); cu1n2=2.1079(16); cu1n3=1.8553(17); n1cu1n2=81.75(6); n3cu1n3 =178.92(10). selected bond lengths () and angles () of 6: cu1n1=1.938(7); cu1n2=2.045(7); cu1n3=1.958(7); cu1o1=1.919(6); n1cu1n3 =175.2(3); n1cu1n2=83.4(3); n1cu1o1 =92.5(3). selected bond lengths () and angles () of 7: cu1n1=1.956(6); cu1n2=2.104(6); cu1n3=1.972(6); cu1o1=1.993(5); n1cu1n3 =170.0(2); n1cu1n2=83.7(2); n1cu1o1 =91.2(2). in contrast, the copper(i) compounds were ion pairs in the solid state. the structure of phen-ligated benzenesulfonamidate 4 is an ion pair consisting of the cationic [(phen)2cu], in which cu(i) is ligated by two phen ligands in a distorted tetrahedral environment, and the linear anion [cu(nhso2ph)2] (figure 1). in contrast to the diverse molecular structures of phen-ligated copper species, complexes 6 and 7 containing the tridentate amino imine phenoxide ligands are mononuclear cu(ii) species with square-planar geometries in the solid state (figure 1). these structures are also mononuclear in solution, as evidenced by x-band epr spectroscopy recorded at 20 k in ch2cl2 indicating an axial environment. to determine whether the structures of 1-phth2 and 4 in solution differ from those in the solid state we measured the conductivities of 1-phth2, and 4 in dmso. the conductivities of 1-phth2, and 4 (1.0 mm in dmso, 25 c) were compared to those of a 1.0 mm (dmso) solution of ferrocene (0.2 cm mol) and n(bu)4cl (11.1 cm mol). the conductivity of the solutions of cu(i) complexes 4 and 5 in dmso (1.0 mm) were 33.0 and 23.1 cm mol, respectively. these values are similar to the reported values for related (phen)cu(i) amidate and imidate complexes. in contrast, the conductivity of the solution of 1-phth2 was 0.0 cm mol, showing that 1-phth2 retains its neutral, mononuclear structure in dmso. moreover, the results for conductivity of 6 (0.0 cm mol) and 7 (0.1 cm mol) also revealed that these complexes are neutral molecules in solution. unfortunately, the insolubility of 1-phth2 and 4 in benzene prevented the measurement of their conductivities in a less polar solvent. to gain information on the mechanism of the catalytic amidation of alkanes, we conducted catalytic and stoichiometric reactions with isolated [(phen)cu(phth)n] (n=1, 2) complexes. these well-defined complexes contain a reactive phthalimidate group bound to copper in the oxidation states of+1 and+2. first, we investigated the effect of the oxidation state of the metal in the copper complexes lying on the catalytic reaction. the reactions of cyclohexane with hphth catalyzed by 2.5 mol% of 1-phth2 and 2.5 mol% of 1-phth produced n-cyclohexylphthalimide (cy-phth) in 54% and 80% yield, respectively (scheme 3). n-methylphthalimide (me-phth) was observed in 13% and 20% yields in the reactions catalyzed by 1-phth2 and 1-phth, respectively. the observation of this side-product implies the intermediacy of a tert-butoxy radical because this radical is known to undergo -me scission to generate a methyl radical. this methyl radical can then combine with 1-phth2 to form me-phth (scheme 3). the observation of this side product suggests that the n-cyclohexylphthalimide forms from a reaction between 1-phth2 and a cyclohexyl radical generated from hydrogen atom abstraction of cyclohexane by a tert-butoxy radical. in the reaction catalyzed by 1-phth, the orange solution of 1-phth rapidly transformed to a light-blue suspension. a similar light-blue suspension was also observed in the reaction catalyzed by 1-phth2. moreover, 1-phth2 was isolated from a reaction of 1-phth, tbuootbu, and hphth in benzene at 100 c for 0.5 h (scheme 4). the identity of 1-phth2 was confirmed by comparison of its ir spectrum to that of the authentic sample of 1-phth2, prepared by the method in scheme 2, and by elemental analysis. the isolation of 1-phth2 from the reaction catalyzed by 1-phth clearly demonstrates that a cu(i)-imidate or amidate is a short-lived species in the presence of excess oxidant and imide or amide under catalytic conditions. therefore, under the catalytic condition, the predominant species in the system is a cu(ii)-amidate or imidate complex. second, we investigated the role of oxidant in the catalytic reaction by conducting a series of stoichiometric reactions with 1-phth and 1-phth2 in the presence and absence of tbuootbu. c h bond amidations of cyclohexane by copper complexes have been proposed to occur by insertion of a copper-nitrene intermediate into a c h bond or by hydrogen atom abstraction. in one study, a copper-nitrene species stabilized by sc and an isolated bridging copper-nitrene complex were shown to undergo stoichiometric reactions with cyclohexane to form n-cyclohexyl-4-methylbenzenesulfonamide and n-cyclohexyladamantane, respectively. in another study, an isolated, three-coordinate cu(ii)-nhad (ad =adamantane) complex was shown to react with cyclohexane to form n-cyclohexyladamantane; this reaction was proposed to occur by abstraction of a hydrogen atom from cyclohexane and capture of the cyclohexyl radical by cu(ii). a mechanism involving a nitrene intermediate in our system is ruled out by the reaction of secondary nitrogen reagents (i.e., phthalimide) with cyclohexane to form the corresponding n-alkyl product, but reaction of the amidate and imidate complexes with the alkane could occur. thus, we tested the potential reactions of the copper amidate and imidate complexes with cyclohexane. to do so, we performed stoichiometric reactions of 1-phth and 1-phth2 with cyclohexane. these reactions would assess whether these complexes are capable of abstracting a hydrogen atom from cyclohexane. the reaction of 1-phth or 1-phth2 with cyclohexane (80 equiv) in mecn or benzene without tbuootbu at 100 c for 2472 h produced no cy-phth detectable by gc (scheme 5, a). the absence of any cy-phth product from these reactions rules out a mechanism involving hydrogen atom abstraction by the cu(i) or cu(ii) phthalimidates and combination of the resulting alkyl radical with the copper complexes. however, the stoichiometric reaction of 1-phth2 with cyclohexane and tbuootbu (16 equiv) for 24 h produced cy-phth (70% yield based on copper), me-phth, and cy-otbu in a 70:25:35 ratio (scheme 5, b). the analogous reaction of 1-phth with cyclohexane and tbuootbu (16 equiv) also produced cy-phth (73% yield based on copper), me-phth, and cy-otbu in a 73:21:32 ratio (scheme 5, c). formation of the ether product has been observed from cu(i)-catalyzed decomposition of tbuootbu and recombination of a cyclohexyl radical with a cu otbu functionality. moreover, the observation of cy-otbu suggests that [(phen)cu(phth)(otbu)] is a likely intermediate in these reactions lacking free phthalimide; reaction of the cyclohexyl radical with this complex would form cy-phth and cy-otbu. the formation of n-alkyl amides in the presence of tbuootbu, but not in the absence of tbuootbu, was observed for copper complexes 1-phth2 or 1-phth. complexes 26 also reacted with cyclohexane to produce their corresponding n-alkyl products in the presence of tbuootbu, but not in the absence of tbuootbu. these studies provide further evidence that tbuootbu leads to formation of tert-butoxy radical, which cleaves the alkane c h bond. to investigate if the cu(ii) complex 1-phth2 and the cu(i) complex 1-phth react by a common pathway, we measured the kinetic isotope effect of the amination reactions catalyzed by these two complexes. reactions of the combination of cyclohexane and cyclohexane-d12 in a single vessel containing phth, tbuootbu, and 2.5 mol% 1-phth2 occurred with a primary kie of 2.7 0.1. the reaction of 1-phth under the same experimental conditions occurred with a primary kie of 3.0 0.3. the similarity of these values is consistent with reaction of cu(i) and cu(ii) complexes through the same c h bond cleavage step. furthermore, the catalytic reaction of cyclohexane and cyclohexane-d12 in the same vessel with benzamide and 2.5 mol% of the phen-ligated cu(ii) benzamidate complex 5 occurred with a primary kie value of 2.8 0.4. these results imply that the same c h bond cleavage step occurs for reactions of the different copper-amidate complexes. results from the stoichiometric and catalytic reactions of 1-phth2 and 1-phth strongly suggest that a tert-butoxy radical is responsible for the c h abstraction of cyclohexane. to assess this hypothesis further, we performed experiments that would trap the tert-butoxy and alkyl radicals. first, we conducted the catalytic reaction in the presence of diphenylmethanol (2.5 equiv) (scheme 6, a), a common probe for tert-butoxyl radical. this alcohol can react with an alkoxy radical by abstraction of the c h hydrogen atom from cu(ii)-diphenylmethoxide to form a cu(ii)-ketyl radical that is then oxidized to form benzophenone to regenerate cu(i). alternatively, an alkoxy radical abstracts the c h bond of diphenylmethanol to form a ketyl radical. this ketyl radical undergoes another hydrogen atom abstraction at the oh group by another alkoxy radical to form benzophenone. consistent with the generation of an alkoxy radical, the catalytic reaction conducted in the presence of diphenylmethanol formed the n-cyclohexyl benzamide product in only 47% yield, based on benzamide. instead of the n-cyclohexyl amide, a large amount of benzophenone (2.4:1.0 ratio of benzophenone to n-cyclohexyl benzamide) formed. this reaction to form benzophenone decreases the amount of available tert-butoxy radical for hydrogen atom abstraction of cyclohexane and thus decreased the yield of the n-cyclohexyl benzamide product. second, we probed for the formation of tert-butoxy radical by conducting the reaction in the presence of the hydrogen atom donor 9,10-dihydroanthracene. the tert-butoxy radical should abstract the weak c h bond of 9,10-dihydroanthracene over the stronger c h bonds in cyclohexane. indeed, the catalytic reaction of benzamide with cyclohexane conducted under the standard conditions, except for the addition of 3 equiv of 9,10-dihydroanthracene, yielded anthracene as the only organic product besides tert-butanol (scheme 6, b). finally, to probe for a transient cyclohexyl radical in the reaction, we performed the catalytic reaction in the presence of cbr4 (scheme 7, a), which would trap a cyclohexyl radical to form bromocyclohexane. the reaction of benzamide with cyclohexane and tbuootbu at 100 c for 24 h did not form any product from the amidation of cyclohexane. instead, bromocyclohexane formed in 90% yield, based on benzamide. this result is consistent with the intermediacy of a cyclohexyl radical in the catalytic reaction. the reaction of this alkane in the presence of cbr4 and 2.5 mol% cui/(meo)2phen in benzene at 100 c for 24 h (scheme 7, b) formed the products from bromination at the tertiary and the secondary sites: cis- and trans-1-bromo-1,4-dimethylcyclohexane and cis- and trans-2-bromo-1,4-dimethylcyclohexane. the two sets of constitutional isomers formed in a ratio of 1.7:1 and a combined 86% yield based on cbr4. the 1-bromo-1,4-dimethylcyclohexane diastereomers were obtained as a 1.2:1 mixture, indicating that the transient tertiary radical formed under this condition undergoes facile racemization. to investigate whether an alkyl radical would react with the copper imidates to form an n-alkyl product, we conducted reactions of the phthalimidate complex 1-phth2 with precursors to alkyl radicals. we chose to use peroxides as the precursors to alkyl radicals, and we performed these reactions with 1-phth2 instead of 1-phth because our data indicate that 1-phth2 is the predominant complex under catalytic conditions. the reaction of 1-phth2 with tbuootbu and (ph(me)2co)2 at 100 c for 18 h generated me-phth in 64% and 81% yield based on copper, respectively (scheme 8). the rate of -me scission of the cumyloxide radical is faster than that of the tert-butoxy radical. thus, the higher yield of n-alkyl product from the reaction of dicumyl peroxide than from the reaction of tbuootbu is consistent with the rate of generation of the methyl radical. these results with radical probes and alkyl radicals provide strong evidence that an alkoxy radical generates an alkyl radical by hydrogen atom abstraction and that the alkyl radical combines with a copper(ii)-amidate and -imidate species to produce the amidation and imidation products. the formation of products from halogenation at the tertiary c h bond of the dimethylcyclohexane indicates that the absence of the products from amination at the tertiary c n bond (vide infra). reactions in acetonitrile provide evidence against a carbocationic intermediate that could form by oxidation of the radical and combination of the cation with the copper amide or imidates. the amidation of cyclohexane with hphth in wet acetonitrile (scheme 3) produced me-phth (80%), and this result argues against a transient carbocation in our system. additional measurements of kie values were conducted to determine the turnover-limiting step (tls) of the catalytic reaction. the kie determined from independent measurements of the rates of amidation of cyclohexane and cyclohexane-d12 catalyzed by 10 mol% of 3 was 2.9 0.1. this primary kie indicates that hydrogen atom abstraction of cyclohexane by a tert-butoxy radical is the turnover-limiting step in the catalytic process. to identify the tls and to explain the observed primary kie we obtained the kinetic data by measuring the concentration of cyclohexylbenzamide and n-methylbenzamide versus time by the method of initial rates with varied concentrations of oxidant, cyclohexane, and benzamide. at copper concentrations of 23 mm, the reaction was found to be first-order in oxidant, first-order in cyclohexane, and zero-order in benzamide. the reaction order of oxidant and cyclohexane is consistent with turnover-limiting c the dependence of the reaction rate on the concentration of oxidant and cyclohexane was lower for reactions conducted with higher concentrations of these two reagents. when the concentration of oxidant and cyclohexane exceeded 1.0 m, there was little dependence of the rate of cyclohexane amidation on the concentration of these two species. the order of cu is complex; our data indicates that the reaction rate is positively dependent on the concentration of cu. however, the order of the reaction in the concentration of copper varied between first-order and essentially zeroth-order. a similar dependence of reaction rate on the concentration of copper was reported for copper-catalyzed allylic oxidation of cyclohexene by tert-butyl perbenzoate in benzene. at low concentration of copper, the rate of allylic oxidation increased with increasing concentration of copper; however, the rate of this reaction was less dependent on the concentration at higher concentrations of copper. in addition to the difference in dependence of the rate on the concentration of copper, we observed a difference in yield of the amination products as a function of the concentration of copper. reactions conducted with a higher mol% of the cu catalyst formed the n-alkyl amide product in lower yields than the reactions conducted with a lower loading of the cu catalyst. specifically, reactions of cyclohexane conducted with 2.8417.0 mm 5 yielded 9499% of the n-cyclohexy benzamide product, while those conducted with 34.045.5 mm 5 gave the n-cyclohexyl benzamide product in 76% yield, along with menhcoph (10%) and unreacted benzamide. perhaps, at higher loading of cu(i), faster decomposition of peroxide leads to a higher concentration of tert-butoxy radical, relative to the concentration of copper complex, and the tert-butoxy radical undergoes processes that do not lead to the n-alkyl amide product. the tert-butoxy radical is known to undergo multiple nonproductive pathways: (1) -me scission for the methylation of the bound cu(ii)-amidate; (2) coupling of methyl radicals; and (3) reaction of tert-butoxy radical with cu(i) to form cu(ii)-otbu. the quenching of the tert-butoxy radical at high concentration of copper offers one possible explanation for the lower yield of product at high loading of cu(i) compared to low loading of cu(i) and the lower order in copper. regardless of the origin of the effect of the concentration of copper on yield, a copper complex does not directly participate in the c h bond cleavage of cyclohexane. several pieces of data provide evidence that copper is not required for c h cleavage of cyclohexane. for example, in the absence of copper, the reaction of adamantane with tbuootbu and cbr4 at 100 c for 24 h produced a mixture of 1-bromoadamantane and 2-bromoadamantane in a ratio of 2.6:1, respectively. the same reaction conducted in the presence of copper, formed a mixture of products containing 1-bromoadamantane and 2-bromoadamantane in a 2:1 ratio. the similarity of the ratio of products in the presence and absence of copper suggest that copper is not directly involved in the c h cleavage step. first, copper catalyzes the decomposition of tbuootbu to generate tert-butoxy radical, which is the species that cleaves the c h bond of the alkanes. specifically, reaction of 1-phth with tbuootbu and hphth in the absence of a hydrogen atom donor (i.e., cyclohexane) leads to rapid oxidation of 1-phth to 1-phth2 and exclusive formation of me-phth, in which the methyl radical is derived from tert-butoxy radical by -me scission. additional evidence for copper-catalyzed formation of tert-butoxy radical is the observation of benzophenone from diphenylmethanol under catalytic conditions. second, copper participates in the events after the turnover-limiting step of c h activation by tert-butoxy radical to form the n-alkyl product. this proposal is corroborated by the reaction of methyl radicals, derived from the tertiary alkoxy radical precursors ro-or (r=tbu, ph(me)2c), with 1-phth2 to generate the me-phth product. our proposed mechanism for c h amidation of cyclohexane by 1-phth is summarized in scheme 9. our proposed mechanism begins with the decomposition of tbuootbu initiated by 1-phth to produce a tert-butoxy radical and a potential intermediate containing an alkoxide and a phthalimidate ligand [(phen)cu(phth)(otbu)]. the tert-butoxy radical can regenerate tbuootbu by secondary geminate recombination or can abstract a hydrogen atom from an alkane to form an alkyl radical. in this case, the turnover-limiting step is abstraction of a hydrogen atom from cyclohexane by a tert-butoxy radical to produce a cyclohexyl radical, which recombines with 1-phth2 to expel cy-phth and regenerate 1-phth to close the cycle. this species could be a transient cu(iii) intermediate ligated by a cyclohexyl and amidate ligand. such a species could undergo rapid reductive elimination to release the n-alkyl product and to regenerate cu(i). prior mechanistic and dft investigations of the kharasch-sosnovsky reaction have led to the conclusion that these oxidative reactions occur by formation of a cu(iii) species, which forms the c o bond by reductive elimination. conversely, dft calculations on the combination of a cyclohexyl radical with the three-coordinate [(nacnac)cu(ii)-otbu] (nacnac=[arnc(me)]2ch; ar=2,6-cl2c6h3) to form cy-otbu suggest that capture of the alkyl radical at the oxygen atom of the otbu ligand is thermodynamically favorable (g=13.4 kcal/mol), whereas combination of the alkyl radical at cu(ii) to form the square planar complex [(nacnac)cu(iii)(cy)(otbu)] is thermodynamically disfavored (g=+ 14.9 kcal/mol). thus, it is possible that the alkyl radical reacts directly with the imidate or amidate ligands to form the n-alkyl imide and amide products. the selectivity of secondary (2) and primary sites (1) over tertiary (3) sites for the amidation of alkanes by this copper system is different from the selectivity of 3>2 >1 for hydrogen abstraction by a tert-butoxy radical. this selectivity for secondary over primary and tertiary sites has been observed in the copper-catalyzed amidation of benzylic c h bonds, and the rationale for such selectivity was based on steric effects. h bonds results from the recombination of alkyl radicals with phen-ligated cu(ii) amidate and imidate complexes; we propose that the tertiary radical is too hindered to recombine with phen-ligated cu(ii) amidate and imidate complexes and the alkyl radical undergoes decomposition. to address this proposal, we determined the mass balance of the reaction. this information would provide insight into the fate of all the alkyl radicals that could form. the amidation of adamantane afforded a ratio of 1.6 n-(adamantan-1-yl)benzamide to 1.0 n-(adamantan-2-yl)benzamide and 1-phenyladamantane. the 1-phenyladamantane product likely results from the direct reaction of 1-adamantyl radical with benzene. the observation of 1-phenyladamantane reveals another pathway by which tertiary alkyl radicals decompose in the reaction. the alkene likely forms from the decomposition of the tertiary radical, and this decomposition likely occurs because the combination of the tertiary radical with the phen copper amidate or imidate is sterically disfavored. in summary, we have described a copper-catalyzed amidation of unactivated alkanes by benzamide, sulfonamide, carbamate, phthalimide, and their derivatives. the amidation of alkanes under our catalytic conditions preferentially forms the products from amidation at secondary sites over tertiary sites. h bonds to form n-alkyl products is observed when the secondary c h bonds are hindered. potential cu(ii)-amidate and -imidate intermediates were isolated, characterized, and demonstrated to be intermediates for c h amidation of cyclohexane. our mechanistic data imply that the tert-butoxy radical, not a copper-nitrene or copper-aminyl species, leads to the activation of aliphatic c

we report a set of rare copper-catalyzed reactions of alkanes with simple amides, sulfonamides, and imides (i.e., benzamides, tosylamides, carbamates, and phthalimide) to form the corresponding n-alkyl products. the reactions lead to functionalization at secondary c h bonds over tertiary c h bonds and even occur at primary c h bonds. [(phen)cu(phth)] (1-phth) and [(phen)cu(phth)2] (1-phth2), which are potential intermediates in the reaction, have been isolated and fully characterized. the stoichiometric reactions of 1-phth and 1-phth2 with alkanes, alkyl radicals, and radical probes were investigated to elucidate the mechanism of the amidation. the catalytic and stoichiometric reactions require both copper and tbuootbu for the generation of n-alkyl product. neither 1-phth nor 1-phth2 reacted with excess cyclohexane at 100 c without tbuootbu. however, the reactions of 1-phth and 1-phth2 with tbuootbu afforded n-cyclohexylphthalimide (cy-phth), n-methylphthalimide, and tert-butoxycyclohexane (cy-otbu) in approximate ratios of 70:20:30, respectively. reactions with radical traps support the intermediacy of a tert-butoxy radical, which forms an alkyl radical intermediate. the intermediacy of an alkyl radical was evidenced by the catalytic reaction of cyclohexane with benzamide in the presence of cbr4, which formed exclusively bromocyclohexane. furthermore, stoichiometric reactions of [(phen)cu(phth)2] with tbuootbu and (ph(me)2co)2 at 100 c without cyclohexane afforded n-methylphthalimide (me-phth) from -me scission of the alkoxy radicals to form a methyl radical. separate reactions of cyclohexane and d12-cyclohexane with benzamide showed that the turnover-limiting step in the catalytic reaction is the c h cleavage of cyclohexane by a tert-butoxy radical. these mechanistic data imply that the tert-butoxy radical reacts with the c h bonds of alkanes, and the subsequent alkyl radical combines with 1-phth2 to form the corresponding n-alkyl imide product.

PMC3985719

pubmed-562

micropolar fluids are those fluids consisting of randomly oriented particles suspended in a viscous medium, which can undergo a rotation that can affect the hydrodynamics of the flow, making it a distinctly non-newtonian fluid. they constitute an important branch of non-newtonian fluid dynamics where microrotation effects as well as microinertia are exhibited. modelling and analysis of the dynamics of micropolar fluids have been the field of very active research due to their application in a number of processes that occur in chemical, pharmaceutical, and food industry. such applications include the extrusion of polymer fluids, solidification of liquid crystals, cooling of a metallic plate in a bath, animal bloods, exotic lubricants, and colloidal and suspension solutions, for example, for which the classical navier-stokes theory is inadequate. the essence of the theory of micropolar fluids lies in the extension of the constitutive equations for newtonian fluids so that more complex fluids can be described by this theory. in this theory, rigid particles contained in a small fluid volume element are limited to rotation about the centre of the volume elements described by microrotation vector. it is well known that heterogeneous mixtures, such as ferro liquids, colloidal fluids, most slurries, and suspensions, are some liquids with polymer activities which behave differently from newtonian fluids. the main difference is that these types of fluids have a microstructure and exhibit microrotational effects and can support surface and body couples which are not present in the theory of newtonian fluids. in order to study such types of fluids eringen developed the theory of microfluids which include the effect of local rotary inertia, the couple stress, and inertial spin. this theory is expected to be successful in analyzing the behavior of non-newtonian fluids. eringen also developed the theory of micropolar fluids for the case where only microrotational effects and microrotational inertia exist. he extended the theory of thermomicropolar fluids and derived the constitutive law for fluids with microstructure. an excellent review of micropolar fluids and their applications was given by ariman et al.. in view of lukaszewicz, micropolar fluids represent those fluids which consist of randomly oriented particles suspended in a viscous medium. several authors have studied the characteristic of the boundary layer flow of micropolar fluid under different boundary conditions. takhar and soundalgekar [6, 7] studied the flow and heat transfer of micropolar fluid past a porous plate. further, they [8, 9] discussed these problems past a continuously moving porous plate. often experimental and analytical investigations of free convection flows are carried out by the researchers, since in many situations in technology and nature, one continually encounters masses of fluid arising freely in an extensive medium due to the buoyancy effects. [10, 11] investigated the natural convection from a heated vertical plate in micropolar fluid. the problem of flow and heat transfer for a micropolar fluid past a porous plate embedded in a porous medium has been of great use in engineering studies such as oil exploration and thermal insulation. raptis and takhar and kim have considered the micropolar fluid through a porous medium. all the above mentioned studies are limited only to applications where radiative heat transfer is negligible. the role of thermal radiation in the flow heat transfer process is of great relevance in the design of many advanced energy conversion systems operating at higher temperatures. thermal radiation within these systems is usually the result of emission by hot walls and the working fluid. nuclear power plants, gas turbines, and the various propulsion devices for aircraft, missiles, satellites, and space vehicles are examples of such engineering areas. perdikis and raptis illustrated the heat transfer of a micropolar fluid in the presence of radiation. raptis studied the effect of radiation on the flow of a micropolar fluid past a continuously moving plate. recently, elbashbeshy and bazid and kim and fedorov have reported on the radiation effects on the mixed convection flow of micropolar fluid. makinde examined the transient free convection interaction with thermal radiation of an absorbing emitting fluid along moving vertical permeable plate. rahman and sattar studied transient convective flow of micropolar fluid past a continuous moving porous plate in the presence of radiation. moreover, when the radiative heat transfer takes place, the fluid involved can be electrically conducting in the sense that it is ionized owing to high operating temperature. accordingly, it is of interest to examine the effect of the magnetic field on the flow. thermal radiation effects on hydromagnetic natural convection flow with heat and mass transfer play an important role in manufacturing processes taking place in industries for the design of fins, glass production, steel rolling, casting and levitation, furnace design, and so forth. the process of fusing of metals in an electrical furnace by applying a magnetic field and the process of cooling of the first wall inside a nuclear reactor containment vessel where the hot plasma is isolated from the wall by applying a magnetic field are examples of such fields where thermal radiation and magnetohydrodynamics (mhd) are correlative. this fact was taken into consideration by abd-el aziz in his study on micropolar fluids. raptis and massalas studied magnetohydrodynamic flow past a plate by the presence of radiation. the rotating flow of an electrically conducting fluid in presence of magnetic field has got its importance in geophysical problems. investigation of hydromagnetic natural convection flow in a rotating medium is of considerable importance due to its application in various areas of geophysics, astrophysics, and fluid engineering, namely, maintenance and secular variations in earth's magnetic field due to motion of earth's liquid core, internal rotation rate of the sun, structure of the magnetic stars, solar and planetary dynamo problems, turbo machines, rotating mhd generators, rotating drum separators for liquid metal mhd applications, and so forth. it may be noted that coriolis and magnetic forces are comparable in magnitude and coriolis force induces secondary flow in the flow-field. changes that take place in the rotation suggest the possible importance of hydromagnetic spin-up. taking into consideration the importance of such study, unsteady hydromagnetic natural convection flow past a moving plate in a rotating medium mention maybe made of research studies of singh, raptist and singh, tokis, nanousis, and singh et al.. this problem of spin-up in magnetohydrodynamic rotating fluids has been discussed under varied conditions by takhar et al.. the study of heat and mass transfer due to chemical reaction is also very importance because of its occurrence in most of the branches of science and technology. the processes involving mass transfer effects are important in chemical processing equipment which is designed to draw high value products from cheaper raw materials with the involvement of chemical reaction. ibrahim and makinde investigated radiation effect on chemically reactive mhd boundary layer flow of heat and mass transfer past a porous vertical flat plate. babu and satya narayan examined chemical reaction and thermal radiation effects on mhd convective flow in a porous medium in the presence of suction. das and sivaiah investigated studied the effect of chemical reaction and thermal radiation on heat and mass transfer flow of mhd micropolar aid in a rotating frame of reference. convection problems associated with heat sources within fluid-saturated porous media are of great practical significance in geophysics and energy-related problems, such as recovery of petroleum resources, cooling of underground electric cables, storage of nuclear waste materials groundwater pollution, fiber and granular insulations, chemical catalytic reactors, and environmental impact of buried heat generating waste. [32, 33] presented an analysis on mhd free convection and mass transfer adjacent to moving vertical plate for micropolar fluid in a rotating frame of reference in presence of heat generation/absorption and a chemical reaction using perturbation technique. babu and narayana analyzed unsteady free convection with heat and mass transfer flow for a micropolar fluid through a porous medium with a variable permeability bounded by a semi-infinite vertical plate in the presence of heat generation, thermal radiation and first-order chemical reaction. the current development of magnetohydrodynamics application is toward a strong magnetic field (so that the influence of electromagnetic force is noticeable) and toward a low density of the gas (such as in space flight and in nuclear fusion research). under this condition the rotating flow of an electrically conducting fluid in the presence of a magnetic field is encountered in cosmic fluid dynamics, medicine and biology. mhd was pioneered cowling and he emphasized that when the strength of the applied magnetic field is sufficiently large, ohm's law needs to be modified to include hall current. the hall effect is merely due to the sideways magnetic force on the drafting free charges. the electric field has to have a component transverse to the direction of the current density to balance this force. in many works of plasma physics, much attention is not paid to the effect caused due to hall current. however, the hall effect can not be completely ignored if the strength of the magnetic field is high and the number of density of electrons is small as it is responsible for the change of the flow pattern of an ionized gas. hall effect results in a development of an additional potential difference between opposite surfaces of a conductor for which a current is induced perpendicular to both the electric and magnetic field., saha et al., and ahmed et al. have presented some model studies on the effect of hall current on mhd convection flow because of its possible application in the problem of mhd generators and hall current. preeti and chaudhary analyzed an unsteady hydromagnetic flow of a viscoelastic fluid from a radiative vertical porous plate, taking the effects of hall current and mass transfer into account. studied the heat and mass transfer in unsteady free convection flow with radiation absorption past an impulsively started infinite vertical porous plate subjected to strong magnetic field including the hall effect. investigated the simultaneous effects of hall current and free stream velocity on the magneto hydrodynamic flow over a moving plate in a rotating fluid. recently, seth et al. investigated the problem of an unsteady mhd free convective flow past an impulsively started vertical plate with ramped temperature immersed in a porous medium with rotation and heat absorption taken into account the hall effect. when heat and mass transfer occur simultaneously in a moving fluid, the relations between the fluxes and the driven potential are important. it has been found that an energy flux can be generated not only by temperature gradients but by composition gradient as well. the energy caused by a composition gradient is called the dufour or the diffusion-thermo effect, also the mass fluxes can also be caused by the temperature gradient and this is called the soret or thermal diffusion effect; that is, if two regions in a mixture are maintained at different temperatures so that there is a flux of heat, it has been found that a concentration gradient is set up and in a binary mixture, one kind of a molecule tends to travel toward the hot region and the other kind toward the cold region. the dufour effect is neglected in this study because it is of a smaller order of magnitude than the magnitude of thermal radiation which exerts a stronger effect on the energy flux. soret or thermal diffusion effect has been utilized for isotope separation in mixtures between gases with very light molecular weight (h2, he) and medium molecular weight (n2, air) and it was found to be of a magnitude that it can not be neglected due to its practical applications in engineering and sciences. soret effects due to natural convection between heated inclined plates have been investigated by raju et al.. m. g. reddy and n. b. reddy investigated soret and dufour effects on steady mhd free convective flow past an infinite plate. mohamed studied unsteady mhd flow over a vertical moving porous plate with heat generation and soret effect. practically, in many engineering applications, the particle adjacent to a solid surface no longer takes the velocity of the surface. the particle at the surface has a finite tangential velocity; it slips along the surface. this flow regime is called the slip-flow regime and this effect can not be neglected. the fluid slippage phenomenon at the solid boundaries appear in many applications such as microchannels or nanochannels and in application where a thin film of light oils is attached to the moving plates or when the surface is coated with special coating such as thick monolayer of hydrophobic octadecyltrichlosilane, that is, lubrication of mechanical device, where a thin film of lubricant is attached to the surface slipping over one another or when the surfaces are coated with special coating to minimize the friction between them. chaudhary and jain examined the effects of radiation on the hydromagnetic free convection flow set up due to temperature as well as species concentration of an electrically conducting micropolar fluid past a vertical porous plate through porous medium in slip-flow regime. chaudhary and sharma [49, 50] studied the free convection flow past a vertical porous plate with variable suction in slip-flow regime. have considered the magnetohydrodynamic unsteady flow of a viscous stratified fluid through a porous medium past a porous flat moving plate in the slip flow regime with heat source. singh and kumar presented the fluctuating heat and mass transfer on unsteady free convection flow of radiating and reacting fid past a vertical porous plate in slip flow regime using perturbation analysis. kumar and chand have studied the effect of slip conditions and the hall current on unsteady mhd flow of a viscoelastic fluid past an infinite vertical porous plate through porous medium. recently, oahimire et al. investigated the effects of thermal-diffusion and thermal radiation on unsteady heat and mass transfer by free convective mhd micropolar fluid flow bounded by a semi-infinite vertical plate in a slip-flow regime under the action of transverse magnetic field with suction. to the best of our knowledge, considerably less work has been done concerning the combined effect of hall current and soret effect on chemically reactive magnetomicropolar fluid flow incorporating the effect of rotation in slip flow regime in the presence of radiation and heat absorption. the results are in accordance with the physical realities which validate the correctness of our work presented here. consider an unsteady hydromagnetic flow of an incompressible, viscous, and electrically conducting micropolar fluid past an infinite vertical permeable plate embedded in a uniform porous medium in slip-flow regime and in a rotating system taking hall current, thermal radiation, soret effect, and chemical reaction into account. the coordinate system is chosen in such a way that x-axis is considered along the porous plate in vertically upward direction, y-axis is taken along the width of the plate, and z-axis normal to the plane of the plate in the fluid as shown in figure configuration (figure 1). since the plate is infinite in extent in x- and y- directions, hence all physical quantities will be independent of x and y and they are functions of z and t only; that is, u/x=u/y=v/x=v/y=0, and so forth. a magnetic field of uniform strength b0 is applied in a direction parallel to z-axis which is perpendicular to the flow direction. it is assumed that the induced magnetic field generated by fluid motion is negligible in comparison to the applied one. this assumption is justified because magnetic reynolds number is very small for liquid metals and partially ionized fluids which are commonly used in industrial applications. it is assumed that there is no applied or polarized voltage so the effect of polarization of fluid is negligible. this corresponds to the case where no energy is added or extracted from the fluid by electrical means. the entire system is rotating with an angular velocity about the normal to the plate. it is assumed here that the hole size of the porous plate is significantly larger than the characteristic microscopic length scale of the porous medium. the fluid is considered to be a gray, absorbing-emitting but nonscattering medium and the rosseland approximation is used to describe the radiative heat flux. the radiative heat flux in the x-direction is considered negligible in comparison with that of z-direction. when the strength of the magnetic field is very large, the generalized ohm's law in the absence of electric field takes the following form: (1)j+eeb0jh=evh+1enepe. under the assumption that the electron pressure (for weakly ionized gas), the thermoelectric pressure and ion-slip conditions are negligible; now the above equation becomes (2)jx=eh01+m2mvu, jz=eh01+m2mu+v, where u is the x-component of v, v is the y-component of v, and m (= ee) is hall parameter. the suction velocity is assumed to be w=w0(1+aet with these foregoing assumptions, the governing equations under boussinesq approximation can be written in a cartesian frame of reference as follows consider the following: (4)ut+wuz2v =+r2uz2+gttt+gccc ukr2z+e2h02mvu1+m2,vt+wvz+2u =+r2vz2uk+r1ze2h02mu+v1+m2. consider the following: (7)ct+wcz=dm2cz2+dmkttm2tz2rccc. the initial and boundary conditions suggested by the physics of the problem are (8)u=v=0, 1=2=0,t=t, c=ckkkkkkkkkkkkkkikkfor t0,(9)u=ur+luz, v=0,1=12vz, 2=12uz,t=tw, c=cwikkkkkkkkkkkkkkkkkkkat z=0u0, v0, 10,20, tt, ccikkkkkkkkkkkkkkkkkkkkkias zikkkkkkkkkkkkkkkkkkkkkkikfor t>0. the boundary condition for microrotation components 1 and 2 describes its relationship with the surface stress. in the above boundary condition (9) the plate is in uniform motion and subjected to variable suction and slip boundary condition. in the parameter l=(( 2 m1)/m1)l, l is the molecular mean free path and m1 is the tangential momentum accommodation coefficient. integration of continuity equation (3) for variable suction velocity normal to the plate gives (10)w=w01+aet, where w0 represents the normal velocity at the plate which is positive for suction and negative for blowing. the radiative heat flux term by using rosseland approximation is given by (11)qr=43art4z. we assume that the temperature differences within the flow are such that t may be expressed as a linear function of the temperature t. this is accomplished by expanding t in a taylor series about t and, neglecting higher-order terms, we have (12)t44t3t3t4. by using (11) and proceeding with analysis, we introduce the following dimensionless variables: (14)u=uur, v=vur, z=zur,t=tur2, =ur2, 1=1ur2, 2=2ur2,gr=gttwtur3, gc=gccwcur3,r=2ur2, s=w0ur, =r,=tttwt, c=cccwc, k=kur22,m=eh0ur, =j, pr=cpk, sc=dm, f=4t3kar, q=q2ur2k, sr=dmkttwttmcwc, =rcur2, h=lur. in view of (14), the governing equations (4)(7) and (13) reduce to the following dimensionless form: (15)uts1+aetuzrv =1+2uz2+gr+gmm21+m2+1ku 2z+mm21+m2v,(16)vts1+aetvz+ru =1+2vz2m21+m2+1kv+1zmm21+m2u,(17)1ts1+aet1z=21z2,(18)2ts1+aet2z=22z2,(19)ts1+aetz=1pr1+4f32z2qpr,(20)cts1+aetcz=1sc2cz2+sr2cz2c. the boundary conditions (8)-(9) in view of (14) are then given by the following dimensionless form: (21)u=v=0, 1=2=0, =0, c=0kkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t0u=1+huz, v=0, 1=12vz,2=12uz, =1, c=1kkkkkkkkkkkkkkkkkkkkkkkkkat z=0u0, 10, 20,0, c0kkkkkkkkkkkkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkfor t>0. to simplify (15)(18), we substitute the fluid velocity and angular velocity in the complex form as v=u+iv, =1+i2 and we get (22)vts1+aetvz+irv =1+2vz2+gr+gmm21+m2+1kv izimm21+m2v,ts1+aetz=2z2. the associated boundary conditions (21) become (23)v=0, =0, =0, c=0kkkkkkkkkkkkikkkkkkkkkkfor t0v=1+huz, =i2vz, =1, c=1kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkiat z=0v0, 0, 0, c0kkkkkkkkkkkkkkkkkkikkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t>0. in order to reduce the above system of partial differential equations to a system of ordinary differential equations in dimensionless form, we represent the translational velocity v, microrotation velocity, temperature, and concentration c as (24)vz, t=v0z+etv1z+o2,z, t=0z+et1z+o2,z, t=0z+et1z+o2,cz, t=c0z+etc1z+o2. by substituting the above equations (24) into (19), (20), (22)-(23) and equating the harmonic and nonharmonic terms and neglecting the higher-order terms of o(), we obtain the following pairs of equations for (v0, 0, 0, c0) and (v1, 1, 1, c1). zero-order equations are: (25)1+v0+sv0a1v0+gr0+gmc0+i0=0,0+s0=0,3+4f0+3prs03q0=0,c0+sscc0scc0=sr0. first-order equations are: (26)1+v1+sv1a2v1+gr1+gmc1 +av0+i1=0,1+s11=sa0,3+4f1+3prs13q+pr1 =3prsa0,c1+sscc1sc+c1=sscac0srsc1. the prime denotes differentiation with respect to y. the corresponding boundary conditions can be written as (27)v0=1+hv0z, v1=hv1z,0=i2v0z, 1=i2v1z,0=1, 1=0, c0=1, c1=0 at z=0v00, v10, 00,10, 00, 10,c00, c10kkkkkkkkkkkas z. solving (25)-(26) satisfying the boundary conditions (27) we obtain the expression for translational velocity v, microrotation velocity, temperature, and concentration c as (28)vz, t=b11er5z+b8er1z+b9er3z+b10es/z+etb20er7z+b13er1z+b17er5z+b18es/z+b19er6z +b14er2z+b15er4z+b16er3z+b17er5z+b18es/z+b19er6z,(29)z, t=d1es/z+etd2er6z+b12es/z,(30)z, t=er1z+etb1er1zer2z,(31)cz, t=b3er3z+b2er1z+etb4er3z+b5er1z+b6er2z+b7er4z. the exponential indices and the coefficients appearing in (28)(31) are given in the appendix. in technological applications, the wall shear stress, the wall couple stress, and the heat and mass transfer rate are often of great interest. the skin friction coefficient (cf) at the wall in dimensionless form is given by (32) cf=wz=0ur2=1+1+i2vzz=0(33) =1+1+i2 b11r5+b8r1+b9r3+b10s+b17r5+b18s+b19r6 +etb20r7+b13r1+b17r5+b18s+b19r6 +b14r2+b15r4+b16r3+b17r5+b18s+b19r6. the couple stress coefficient (cm) at the plate is defined by (34)mw=zz=0 and in the dimensionless form it is given by (35)cm=mwjur=1+2zz=0=1+21zz=0+i2zz=0=1+2d1s+etd2r6+b12s. knowing the temperature field, it is interesting to study the effect of the free convection and thermal radiation on the rate of heat transfer and this is given by (36)qw=ktz43art4zz=0. using t4tt 3t the above equation becomes (37)qw=ktwtur1+4f3zz=0. the rate of heat transfer between the fluid and the plate is studied in terms of nondimensional nusselt number, which is given by (38)nu=xqwktwt=rex1+4f3zz=0, where rex=urx/ is the local reynolds number (39)nurex1=1+4f3zz=0=1+4f3r1+etb1r1r2. the definitions of the local mass flux and the local sherwood number are, respectively, given by (40)jw=dmczz=0,shx=jwxdmcwc=rexczz=0,shxrex1=czz=0=b3r3+b2r1+etb4r3+b5r1+b6r2+b7r4. in the preceding sections, the governing equations along with the boundary conditions are solved analytically employing the perturbation techniques. the effects of main controlling parameters as they appear in the governing equations are discussed on the temperature, concentration c, translational velocity v, microrotation, skin-friction cf, nusselt number, and sherwood number. in order to get a physical insight of the problem the above physical quantities are compiled numerically and displayed graphically. in the entire calculations we have chosen =0.01, =0.1, t=1 and a=1 while pr, s, f, q, sr, sc, m, m, gr, gm, r, h, k,, and are varied over the range which are listed in the figure legends. the numerical values of fluid temperature computed from the analytical solutions (29) are illustrated graphically versus boundary layer coordinate z in figure 2 for various values of prandtl number (pr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). the values of prandtl number are chosen as pr=0.71, 0.025, and 7.0 which physically correspond to air, mercury, and water at 25 temperature and one atmospheric pressure. it is inferred that the temperature falls more rapidly for water in comparison to air which is physically true thus the thermal boundary layer falls quickly for large value of prandtl number. the thickness of thermal boundary layer is greatest for pr=0.025 (mercury) than for pr=0.71 (air), thereafter for pr=7 (water) and finally the lowest for pr=11.62 (water at 4c); that is, an increase in prandtl number results in a decrease of temperature. the reason underlying such a behavior is that pr signifies the relative effects of viscosity to thermal conductivity and smaller values of prandtl number possess high thermal conductivity and therefore heat is able to diffuse away from the surface faster than at higher values of pr. the fluid temperature also decreases with an increase of heat absorption parameter (q) and suction parameter (s). the temperature decreases with an increase in the heat absorption parameter because when heat is absorbed the buoyancy forces decrease the temperature profiles. the effect of thermal radiation parameter (f) is to enhance the fluid temperature throughout the boundary layer region. this is consistent with the fact that thermal radiation provides an additional means to diffuse energy because thermal radiation parameter f=4t/kar and therefore an increase in f implies a decrease in rosseland mean absorption coefficient ar for fixed values of t and k. thus it is pointed out that radiation should be minimized to have the cooling process at a faster rate. the temperature profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z. hence the accuracy is checked and it validates that the analytical results for temperature is correct. graphical results of concentration profiles c for different values of schmidt number (sc) and chemical reaction parameter () are displayed in figure 3(a). the values of schmidt number are chosen to represent the most common diffusing chemical species which are of interest and they are sc=0.22 (hydrogen), sc=0.3 (helium), sc=0.6 (water vapor), sc=0.94 (carbon dioxide) and sc=2.62 (propylbenzene) at 25c temperature and one atmospheric pressure. a comparison of curves in the figure show the concentration distribution decreases at all points in the flow field with an increase in schmidt number because smaller values of sc are equivalent to increasing chemical molecular diffusivity (d). this shows that the heavier diffusing species have a greater retarding effect on the concentration distribution. furthermore, it is interesting to note that concentration profiles fall slowly and steadily for hydrogen (sc=0.22) and helium (sc=0.30) but falls very rapidly for water vapor (sc=0.6) and propylbenzene (sc=2.62). physically this is true because of the fact that the water vapor can be used for maintaining normal concentration field whereas hydrogen can be used for maintaining effective concentration field. similar effects are seen in the case when chemical reaction parameter () is increased. further, this figure clearly demonstrates that the concentration profiles decrease rapidly when chemical reaction parameter is increased this is due to the fact that boundary layer decreases with an increase in the value of in this system, results in the consumption of the chemical and hence result in decreasing concentration profile. the effects of heat absorption parameter (q) and soret number (sr) on concentration profiles across the boundary layer are displayed in figure 3(b). the results show that concentration boundary layer suppresses with an increase in heat absorption parameter and soret number. the profiles fall rapidly with an increase of soret number and thereafter increase and tend to zero as z. figure 3(c) is plotted to show the effects of radiation parameter (f) and suction parameter (s) on the species concentration profiles. it is revealed that the presence of suction parameter diminishes the concentration distribution whereas reverse phenomena are observed with increasing values of radiation parameter. in figures 3(a)3(c) the concentration profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z. hence it is found to be in good agreement with boundary condition given in (23). moreover these figures provide a check of our analytical solution for the concentration field. the microrotation profiles () against span wise coordinate z incorporating the effect of various parameters influencing the flow field are demonstrated in figures 4(a)4(h). it is revealed from figures 4(a)4(h) that these profiles attain a distinctive maximum value near surface of the plate and decrease properly on increasing boundary layer coordinate z to approach free stream value. figure 4(a) shows the influence of prandtl number (pr), suction parameter (s) and radiation parameter (f) on microrotation profiles. physically, it is true due to the fact that an increase in prandtl number increase the viscosity of the fluid, so the fluid becomes thick and consequently leads to a decrease in velocity. this figure further indicates that the microrotation profiles decrease with an increase in suction parameter (s) because sucking decelerates the fluid particles through the porous wall and hence reduce the growth of the fluid boundary layer as well as thermal and concentration boundary layers. indicating the usual fact that suction stabilizes the boundary layer growth. this is because when the intensity of heat generated through thermal radiation increases, the bond holding the components of the fluid particle is easily broken and the fluid velocity will increase. from figure 4(b) it is perceived that microrotation profiles decrease with an increase in heat absorption parameter (q). figure 4(c) elucidates the influence of magnetic parameter (m) and hall parameter (m) on microrotation profiles (); it is clear from these curves that these profiles increase when magnetic parameter and hall current parameter are increased. the profiles corresponding to m=0 reveals that microelements close to the wall are unable to rotate; hence, is very small. figure 4(d) demonstrates the effect of thermal and concentration buoyancy forces, that is, grashof number (gr) and modified grashof number (gm) on the microrotation profiles. here the negative value of grashof number (gr<0), physically, corresponds to heating of the plate while the positive value (gr>0) represents cooling of the plate. hence, it is observed from the comparison of the curves that an increase in thermal grashof number leads to an increase in the velocity due to an enhancement in buoyancy forces. an increase in grashof number indicates small viscous effects in the momentum equation and consequently causes an increase in the velocity profiles. furthermore, the comparison of the curves illustrates that velocity increases with increasing gm. the modified grashof number (gm) represents the relative strength of concentration buoyancy forces to viscous hydrodynamic force. as expected, the fluid velocity increases and the peak value is more distinctive due to an increase in the species buoyancy force. the profiles attain a maximum value near the wall and then decrease rapidly to approach the free stream value. hence we are confident at the accuracy of our solution given by (30). for various values of rotational parameter (r), figure 4(f) presents the effect of viscosity ratio () and material parameter () on. the magnitude of microrotation is greater for a newtonian fluid (= 0) with given parameters as compared with micropolar fluids (0). also, it is observed that the magnitude of microrotation profiles decrease with an increase in material parameter () and viscosity ratio (). rarefaction effects that give rise to slip flow become significant when the molecular mean free path is comparable to characteristic length of the system. the microrotation profiles presented in figure 4(g) incorporate the influence of rarefaction parameter (h) and permeability parameter (k). it is noticed that an increase in the value of rarefaction parameter decreases the magnitude of microrotation profiles while the comparison of curves for different values of permeability parameter (k) reflects that profiles increase with increasing values of k. a similar behavior is also expected because when we increase the permeability it increases the size of the pores inside the porous medium due to which the drag force decreases and hence the magnitude of microrotation profiles increases. microrotation profiles showing the variation of soret parameter (sr), schmidt number (sc), and generative chemical reaction () are presented in figure 4(h). it is analyzed that the influence of sr, sc, and is to reduce the magnitude of microrotation profiles. comparison of the curves in this figure indicate that the magnitude of microrotation profiles is the greatest for helium (he: sc=0.3) and then for carbon dioxide (co2: sc=0.94) and the lowest for propylbenzene (c9h10: sc=2.62). physically it is justified this figure also displays the fact that these profiles decrease during the destructive reaction (> 0). figures 5(a)5(h) illustrate graphically the behavior of translational velocity (v) versus boundary layer coordinate z for various involved parameters governing the flow field. for various values of prandtl number (pr), suction parameter (s), and radiation parameter (f), it is clearly evident that translational velocity decreases on increasing pr because since prandtl number is the ratio of kinematic viscosity to thermal diffusivity, so as pr increases, the kinematic viscosity of the fluid dominates the thermal diffusivity of the fluid which leads to decreasing of the velocity of the flow field. moreover, it is noticed that velocity first increases in the region adjacent to the plate and then decreases on moving away from the plate with increase in the suction parameter (s) showing the suction has a stabilizing effect on the flow field. this figure also incorporates the fact that radiation (f) tends to accelerate the translational velocity throughout the boundary layer region. physically, it is true, as higher radiation occurs when temperature is higher and ultimately the velocity rises. the velocity distribution attains maximum value in the neighborhood of the wall and then decrease to approach the free stream value. the effect of heat absorption parameter on translational velocity (v) is depicted in figure 5(b) and it is found that velocity reduces due to the presence of heat absorption parameter (q). figure 5(c) incorporates the influence of magnetic parameter (m) and hall parameter (m) on the translational velocity profiles (v). this phenomenon has an excellent agreement with the physical fact that the presence of transverse magnetic field in an electrically conducting fluid always generates a resistive type of force called lorentz force which is similar to drag force and hence serves to decelerate the flow. form this figure it is also found that hall currents (m) tends to accelerate the fluid velocity throughout the boundary layer region which is consistent with the fact that hall currents induces flow in the flow field. the combined effect of thermal and concentration buoyancy forces on the translational velocity are depicted in figure 5(d). it is evident from this figure that with an increase in grashof number (gr) and modified grashof number (gm), which is a measure of thermal and concentration buoyancy forces, there is a substantial growth in the momentum boundary layer for the same reasons as explained earlier in this section. figure 5(e) depicts the effect of rotational parameter (r) on the fluid velocity and it is perceived that rotation tends to retard fluid velocity throughout the flow field. this is due to the reason that coriolis force is dominant in the region near to the axis of rotation. variation of translational velocity profiles for different values of soret parameter (sr), schmidt number (sc), and chemical reaction () are displayed in figure 5(f). the comparison of the curves shows that the velocity of the flow field decreases due to an increase in schimdt number and soret number. it is also observed from this figure that velocity decreases during the destructive reaction (< 0). figure 5(g) depicts the influence of viscosity ratio () and permeability parameter (k) on the translational velocity (v). for different values of permeability parameter this figure shows that velocity increases with increasing values of k while an increasing viscosity ratio () results in an enhancement of the total viscosity in fluid flow because is directly proportional to vortex viscosity which makes the fluid more viscous and so weakens the convection currents and hence the velocity decreases. figure 5(h) incorporates the effect of slip or rarefaction parameter (h) and material parameter () on the translational velocity (v). it is observed that an increase in the values of rarefaction parameter result in an enhancement of the flow field inside the boundary layer. this behavior is readily understood from the velocity slip condition at the surface (23). the case when h=0 corresponds to the no slip condition and in the present case it reduces to the case when the plate moves with constant velocity in the longitudinal direction. the effects are more visible in the region near to the plate and afterwards it fall slowly and steadily to its free stream value as z. lastly the velocity decreases with increasing material parameter (). in figures 5(a)5(h) we observe that the velocity become maximum in the vicinity of the plate and then decreases away from the plate and finally takes asymptotic values far away from the plate. the numerical values of nusselt number computed from the analytical solution given in (39) are presented graphically versus time (t) in figure 6 for various values of prandtl number (pr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). it is noteworthy that the prandtl number, suction parameter, heat absorption parameter, and radiation parameter enhance the rate of heat transfer at the surface of the plate. the reason behind this phenomenon is explained earlier in the text. the rate of heat transfer is more for water (pr=7.0) than that of air (pr=0.71). c(0) at the porous plate versus time (t). from all these figures it is analyzed that sherwood number increase with an increase in schmidt number (sc), chemical reaction parameter (), soret number (sr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). the variation of couple stress coefficient (cm) for various involved parameters is displayed in figures 8(a)8(h) versus time (t). figure 8(a) exhibits that couple stress coefficient decreases with increasing values of radiation parameter (f) and suction parameter (s) it increases with increasing values of prandtl number (pr). the effect of heat absorption parameter (q) on cm is shown in figure 8(b) and it is found that couple stress coefficient enhances with the rise in the values of q. from figures 8(c)8(f) it is apparent that the effect of increasing values of magnetic parameter (m), hall parameter (m), grashof number (gr), modified grashof number (gm), rotational parameter (r) and viscosity ratio () are to decrease the values of couple stress coefficient whereas reverse effect is found on increasing the values of material parameter (). figure 8(g) shows a substantial growth in couple stress coefficient with increasing values of slip parameter (h) while reverse happen for increasing values of permeability parameter (k). finally, the schmidt number (sc), soret number (sr), and chemical reaction parameter () have the tendency to increase couple stress coefficient and this is clearly visible in figure 8(h). from all these figures from figures 8(a)to 8(h) it is understandable that as time progresses couple stress coefficient (cm) is getting enhanced whereas from figures 9(a)to 9(h) it is visible that skin friction coefficient (cf) is getting suppressed for increasing values of time (t). the skin friction is an important phenomenon which characterizes the frictional drag at the solid surface, so the numerical values of skin friction coefficient (cf) computed from (33) is presented in figures 9(a)9(h) taking different values of f, s, pr, q, m, m, gr, gm, r, sc, sr,, ,, k, and h. the skin friction coefficient increases with increasing values of radiation parameter while it decreases with increase in suction parameter, prandtl number, and heat absorption parameter and this fact is depicted in figures 9(a) and 9(b). it is noticed from figure 9(c) that the skin friction coefficient is reduced due to an increase in magnetic field strength as expected, since the applied magnetic field tends to impede the flow motion and thus reduces the surface friction force while the hall parameter tends to increase the skin friction. figure 9(d) demonstrates the growth in skin friction for increasing values of thermal buoyancy parameter (gr) and modified grashof number (gm) because an increase in buoyancy effect in mixed convection flow leads to an acceleration of the fluid flow which increases the friction factor. an opposite trend is observed for increasing values of rotational parameter; that is, cf decreases with an increase in r. the influence of schmidt number (sc), soret number (sr), and chemical reaction parameter () on skin friction coefficient is exhibited in figure 9(f) and all these parameters tend to retard the surface friction forces. finally, figures 9(g) and 9(h) exhibit a significant growth in cf with increasing values of viscosity ratio, permeability parameter, and slip parameter while reverse happens with increasing material parameter. the effects of various parameters on the temperature, concentration c, translational velocity v, microrotation, skin-friction cf, nusselt number, and sherwood number are examined. from the present calculations, we arrive at the following findings.thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number, suction parameter, and heat absorption parameter.the species concentration profiles decrease at all points in the flow field with an increase in schmidt number, chemical reaction parameter, heat generation parameter, soret number, and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number.thermal radiation, magnetic parameter, hall parameter, and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles decrease with an increase in prandtl number, material parameter, slip parameter, soret number, schmidt number, and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles and couple stress coefficient decrease with an increase in suction parameter, rotation parameter, and viscosity ratio.thermal radiation parameter, permeability parameter, and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin-friction coefficient.prandtl number, magnetic parameter, suction parameter, rotation parameter, soret number, schmidt number, chemical reaction parameter, viscosity ratio, and material parameter tend to enhance both translational velocity profiles and skin-friction coefficient.slip parameter increases the translational velocity profiles but decreases the skin-friction coefficient.thermal radiation parameter, prandtl number, suction parameter, and heat absorption parameter tend to enhance dimensionless rate of heat transfer, that is, nusselt number. thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number, suction parameter, and heat absorption parameter. the species concentration profiles decrease at all points in the flow field with an increase in schmidt number, chemical reaction parameter, heat generation parameter, soret number, and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number. thermal radiation, magnetic parameter, hall parameter, and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient. microrotation profiles decrease with an increase in prandtl number, material parameter, slip parameter, soret number, schmidt number, and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient. microrotation profiles and couple stress coefficient decrease with an increase in suction parameter, rotation parameter, and viscosity ratio. thermal radiation parameter, permeability parameter, and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin-friction coefficient. prandtl number, magnetic parameter, suction parameter, rotation parameter, soret number, schmidt number, chemical reaction parameter, viscosity ratio, and material parameter tend to enhance both translational velocity profiles and skin-friction coefficient. thermal radiation parameter, prandtl number, suction parameter, and heat absorption parameter tend to enhance dimensionless rate of heat transfer, that is, nusselt number.

an analysis study is presented to study the effects of hall current and soret effect on unsteady hydromagnetic natural convection of a micropolar fluid in a rotating frame of reference with slip-flow regime. a uniform magnetic field acts perpendicularly to the porous surface which absorbs the micropolar fluid with variable suction velocity. the effects of heat absorption, chemical reaction, and thermal radiation are discussed and for this rosseland approximation is used to describe the radiative heat flux in energy equation. the entire system rotates with uniform angular velocity about an axis normal to the plate. the nonlinear coupled partial differential equations are solved by perturbation techniques. in order to get physical insight, the numerical results of translational velocity, microrotation, fluid temperature, and species concentration for different physical parameters entering into the analysis are discussed and explained graphically. also, the results of the skin-friction coefficient, the couple stress coefficient, nusselt number, and sherwood number are discussed with the help of figures for various values of flow pertinent flow parameters.

PMC4897587

pubmed-563

we report a case of sle-associated myopericarditis in a young male without clear evidence of viral infection based on viral markers in blood. the patient's cardiac function dramatically improved after treatment with steroids without any additional complications. a 19-year-old male was admitted to the combined armed forces hospital with a 7-day history of fever, cough, dyspnea, orthopnea, and chest pain. based on the chest radiograph and computed tomography, he was diagnosed with a pericardial effusion and pneumonia (fig. 1a), and was transferred to our hospital for evaluation of the cause and treatment. his blood pressure was 110/70 mmhg, pulse rate was 112 beats/min, respiratory rate was 24 breaths/min, and body temperature was 38. jugular veins were engorged. on cardiac auscultation, the cardiac rhythm was regular and rapid, summation gallops were heard at the cardiac apex, and there were pericardial friction rubs along with left lower sternal border in the sitting position. bilateral pretibial pitting edema was present on admission. on admission, blood tests showed white blood cell count of 5,420/mm, hemoglobin 10.6 g/dl and platelet count of 94,000/mm. c-reactive protein was 4.59 mg/l (normal, 0-3 mg/l). the blood chemistry revealed blood urea nitrogen to be 24.0 mg/dl, creatinine 1.1 mg/dl, total protein 5.7 g/dl, and albumin 2.6 g/dl. the levels of cardiac markers were elevated; troponin-i 0.87 ng/ml (normal, 0-0.05 ng/ml) and myoglobin 371 ng/dl (normal, 16.3-96.5 ng/dl). an electrocardiogram (ecg) revealed sinus tachycardia and diffuse t-wave inversion in which leads (fig. echocardiography demonstrated severe left ventricular systolic dysfunction {left ventricular ejection fraction (lvef) was 18%} with severe global hypokinesia and preserved wall thickness (fig. a large amount of pericardial effusion was observed 13 mm anterior to the right ventricle, 18 mm around the right atrium and 2 mm posterior to the lv. at first, we suspected viral myopericarditis, and started conservative treatment for congestive heart failure and pericarditis. but, there was no improvement in lvef as well as in the clinical findings. viral markers for cytomegalovirus, coxsackie virus b type 2, herpes simplex virus, and epstein-barr virus were all negative. during conservative treatment, he complained of new-onset ankle joint pain and tender erythematous swellings in both the ankles. the immunofluorescence tests were positive for anti-nuclear antibody (1: 640 titre), anti-dsdna antibodies (683.4 iu/ml), and anti-extractable nuclear antigen antibodies (anti-sm, anti-rnp, anti-ro, and anti-la), and the complement level was low (table 1). we concluded that the patient had sle according to the american rheumatism association/american college of rheumatology classification criteria for sle. on the 13th day of admission, we started treatment with high-dose glucocorticoids (methylprednisolone 1,000 mg intravenously daily for three days followed by 1 mg/kg per day in divided doses). on follow-up examination, ecg showed normalization of t-wave inversion (fig. 2c) and echocardiography obtained just before discharge showed improved systolic function (fig. chest x-ray also showed improving consolidation in both the lung fields and cardiomegaly (fig. complement 3 was normalized and anti-dsdna antibodies decreased from 683.4 iu/ml to 383.8 iu/ml (who u/ml, normal 0-93). he was discharged on the 33rd day of admission with oral prednisolone, and he visited the outpatient department 1 month later. in this 1 month, he had no symptoms. echocardiography revealed normal lvef, without significant valvular disease and pericardial effusion compared to the last examination (table 2). subsequently, the steroid medication was tapered and it was planned to maintain him on sle-specific treatment in the rheumatologic department. sle is an autoimmune inflammatory disease of unknown etiology that affects various parts of the body, including all components of the cardiovascular system.1) the prevalence of lupus ranges from approximately 40-150 cases per 100,000 in the usa.2) in adults, the female-to-male ratio is 7-15: 1.3) cardiac involvement in sle may comprise of involvement of the pericardium, myocardium, endocardium, heart valves, and coronary or pulmonary arteries.4) pericardial involvement is the most frequent cause of symptomatic cardiac disease5) and is the most common echocardiographic finding in sle patients. the pericardium can be involved by acute and chronic inflammatory changes; granular deposition of immunoglobulin and c3, demonstrated by direct immunofluorescence,6) supporting the role of immune complexes in the development of pericarditis. myocarditis is an uncommon, often asymptomatic manifestation of sle with a prevalence of 8-25% in different studies.7) global hypokinesis may be an echocardiographic indication of myocarditis and is present in approximately 6% of sle patients.8) the gold standard for diagnosing myocarditis in sle remains the endomyocardial biopsy.9) however, an endomyocardial biopsy is invasive with procedure-related risks and the diagnostic yield is low in 10-20% of cases, so it is not powerful enough to confirm the diagnosis.10) lupus myocarditis can be diagnosed based on clinical suspicion and echocardiographic evidence of a reduced lvef and segmental or global wall motion abnormality, once the other etiologies, such as viral and ischemic cardiomyopathy, have been excluded.9)11) immunofluorescence studies demonstrate fine granular immune complexes and complement deposition in the walls and perivascular tissues of myocardial blood vessels, supporting the hypothesis that lupus myocarditis is an immune complex-mediated disease. lupus myocarditis, although mild, has to be treated immediately with high-dose corticosteroids. in the most severe forms, it is necessary to use intravenous pulse corticosteroid therapy (methylprednisolone 1 g/day for three consecutive days) followed by high doses of oral prednisone. immunosuppressants, namely cyclophosphamide or azathioprine, and intravenous igg may be beneficial in the treatment of myocarditis.5) early mechanical circulatory supports help to save the life and prevent multi-organ failures in patients with fulminant myocarditis.12) in the present case, the patient was initially diagnosed with myopericarditis on the basis of his symptoms, diffuse t-wave inversion on ecg, elevated cardiac markers and echocardiographic findings. however, there was no improvement in his symptoms and the common cardiotrophic viral markers were all negative. also, the patient had pericarditis, thrombocytopenia and proteinuria. because the previous typical clinical signs and the positive immunofluorescence tests were suitable for making the diagnosis of sle, we confirmed the diagnosis of myopericaditis associated with sle in this patient. after a provisional diagnosis of myopericarditis with sle was made, he was treated with intravenous corticosteroid pulse therapy (methylprednisolone 1 g/day for three consecutive days) followed by high doses of oral prednisone. after 3 days of steroid therapy, the patient's signs and symptoms were stabilizing and echocardiographic findings were improved. initially, we had considered myopericarditis to be caused by viral infection; however, the final diagnosis was myopericarditis during presentation of primary sle based on the clinical manifestations, echocardiography, immunofluorescence tests and good response to steroid therapy. because the treatment of sle induced myopericarditis should be needed for some specific therapy such as corticosteroid, this case shows that careful investigation is needed for search of the cause of myopericarditis in a young male, and not only viral infection but also autoimmune disease should be investigated for. in this report, we described the first case of a korean young male sle patient in whom the first manifestation was of myopericarditis and treatment with glucocorticoids resulted in a good clinical outcome.

myocardial involvement with clinical symptoms is a rare manifestation of systemic lupus erythematosus (sle), despite the relatively high prevalence of myocarditis at autopsies of sle patients. in this review, we report the case of a 19-year-old male sle patient who initially presented with myopericarditis and was successfully treated with high dose of glucocorticoids.

PMC3132697

pubmed-564

a 4-year-old male neutered domestic shorthair cat was presented to the oregon state university cardiology service for suspected pericardial effusion. cardiac tamponade was documented and pericardiocentesis yielded purulent fluid with cytologic results supportive of bacterial pericarditis. the microbial population consisted of pasteurella multocida, actinomyces canis, fusobacterium and bacteroides species. conservative management was elected consisting of intravenous antibiotic therapy with ampicillin sodium/sulbactam sodium and metronidazole for 48 h followed by 4 weeks of oral antibiotics. re-examination 3 months after the initial incident indicated no recurrence of effusion and the cat remained free of clinical signs 2 years after presentation. bacterial pericarditis is a rare cause of pericardial effusion in cats. growth of p multocida, a canis, conservative management with broad-spectrum antibiotics may be considered when further diagnostic imaging or exploratory surgery to search for a primary nidus of infection is not feasible or elected. pericardial disease in cats is relatively uncommon, with a reported prevalence ranging from 1.0-2.3% in post-mortem studies. the most common causes of pericardial effusion in cats results from congestive heart failure secondary to cardiomyopathic disease and neoplasia. other less frequently cited etiologies include trauma, disseminated intravascular coagulation, uremic pericarditis, peritoneopericardial diaphragmatic hernia, feline infectious peritonitis, coagulopathy, hypoalbuminemia and infective pericarditis. infective pericarditis includes viral, bacterial, fungal or parasitic colonization of the pericardium, and is rarely reported in cats. this case report describes a cat with bacterial pericarditis with previously undocumented microorganisms and a favorable clinical response to conservative medical management. a 4-year-old male neutered domestic shorthair cat presented to the primary veterinarian after being found recumbent and dyspneic at home. mild pyrexia (39.5c), muffled heart sounds and weak femoral pulses were identified on physical examination. thoracic radiographs revealed a globoid cardiac silhouette, and the cat was referred immediately to the oregon state university (osu) cardiology service for suspected pericardial effusion (figures 1 and 2). review of the incoming thoracic radiographs suggested a large-volume pericardial effusion with a small amount of concurrent pleural effusion. the cat s past pertinent history was unremarkable; it was an indoor cat with no historical altercations with the other household cat. there is a generalized increase in cardiac silhouette size with dorsal deviation of the thoracic trachea. the increased opacity of the cranial mediastinum is most consistent with fat infiltration ventrodorsal radiograph. the cat is positioned obliquely upon presentation to osu, the cat was depressed but responsive. it was hypothermic (36.7c) and tachypneic (60 breaths per minute) with a high-to-normal heart rate (220 beats per minute). its mucous membranes were blanched and tacky; no capillary refill time could be obtained. the cat s heart sounds were muffled and femoral pulse quality was poor. echocardiography was performed emergently, confirming a large volume of anechoic pericardial effusion with cardiac tamponade (figure 3; see also supplementary material). a small volume of pleural effusion was also present, likely due to impaired filling of the right heart with cardiac tamponade. pericardiocentesis was prioritized and buprenorphine (0.15 mg/kg iv, buprenex; rickitt benckiser healthcare) was administered for sedation. following aseptic skin preparation of the right fourth sixth intercostal space at the costochondral junction, pericardiocentesis performed with an 18 g intravenous catheter resulted in the removal of 80 ml of malodorous opaque red-tinged fluid flecked with white particles. cytologic evaluation of the pericardial fluid indicated a markedly increased nucleated cell count (138,100/l; international system of units si: 138.1 10/l) consisting of 20% macrophages and 80% degenerative neutrophils, many with intracellular bacteria of various types. these findings were consistent with a septic suppurative exudate; consequently, the pericardial fluid was submitted for aerobic and anaerobic bacterial culture and antimicrobial susceptibility. testing for non-bacterial microorganisms (fungal, viral etiologies) was not performed. diastolic collapse of the right atrium and ventricle was noted, consistent with cardiac tamponade. the lumens of the right ventricle (rv) and left ventricle (lv) are labeled. the pericardial effusion is diffusely present around the ventricles (*) the signs of cardiogenic shock resolved following pericardiocentesis. the echocardiographic examination was completed with no evidence of structural heart disease or neoplastic masses. cardiac tamponade was abolished and a small amount of residual pericardial and pleural effusions remained after pericardiocentesis. other diagnostics performed included complete blood count (cbc), chemistry panel, urinalysis, feline immunodeficiency virus (fiv) and feline leukemia virus (felv) antigen testing (idexx laboratories), blood pressure measurement and ecg. the cat s blood pressure was 130 mmhg (doppler method) and its ecg indicated sinus rhythm with a left anterior fascicular block-like pattern. the relevant laboratory test abnormalities are listed in table 1; abnormalities were consistent with sepsis (eg, transitional leukogram, mild hyperbilirubinemia). the urine sample was obtained several hours after fluid therapy, indicating a urine specific gravity of 1.018 without bilirubin, glucose, protein, cells or bacteria present. wbc=white blood cell diagnostic and therapeutic options were discussed with the cat s owners, including the recommendation to pursue computed tomography (ct) to search for a local thoracic or distant source of infection. owing to financial limitations, the owners elected to pursue conservative management with hospitalization and empiric parenteral antibiotic therapy. ampicillin sodium/sulbactam sodium (30/kg mg iv q8h; aurobindo pharma), metronidazole (15 mg/kg iv q12h; claris lifesciences) and intravenous fluid therapy (lactated ringer s solution) were initiated. the cat s 5% dehydration deficit was replaced over 6 h, followed by a maintenance fluid rate of 20 ml/h. over the next 48 h, a cbc and chemistry panel were repeated 2 days after presentation; the relevant results are presented in table 1. after 2 days of hospitalization, the cat was transitioned to oral medications and discharged with instructions to receive amoxicillin/clavulanic acid (20 mg/kg po q8h; pfizer) and metronidazole (10 mg/kg po q12h; watson pharma private) for 4 weeks. at the time of discharge, the pleural effusion was likely either residual pleural fluid from impaired diastolic filling of the right heart during cardiac tamponade, or the result of pericardial effusion leakage following percardiocentesis. the final aerobic culture results yielded heavy growth of both pasteurella multocida and actinomyces canis. aerobic antimicrobial susceptibility testing suggested p multocida was sensitive to ampicillin though resistant to clindamycin and tobramycin. the cat presented to osu for re-evaluation 1 week after discharge and was reported to have normal appetite, energy and demeanor at home. a recheck cbc indicated normalization of the white blood cell count (8970/l; si 8.97 10/l) with an unremarkable leukogram. furthermore, the chemistry panel indicated complete resolution of the previous electrolyte disturbances, as well as normalization of creatine kinase and alanine aminotransferase. continuation of the antibiotic regimen was recommended and recheck examination was advised following completion of the course. the cat was re-evaluated by echocardiography 3 months after its initial presentation, and no recurrent effusion was noted. feline bacterial pericarditis has been sparsely reported in the veterinary literature. in a large-scale retrospective study of pericardial effusion in 146 cats, several mechanisms can result in septic pericarditis, including pericarditis secondary to localized spread of infection (eg, pneumonia, suppurative mediastinal lymphadenitis), hematogenous infection, extension of endocarditis/myocarditis, or direct inoculation resulting from penetrating wounds, migrating foreign material or surgery. the associated clinical signs are often related to hemodynamic compromise from pericardial effusion or related to systemic infection (eg, pyrexia, weight loss). of the published case reports, some have shown a documented predisposing infection, whereas the inciting etiology was not conclusively identified in others. a cat in one report developed bacterial pericarditis in close temporal proximity to a dental prophylaxis with a common oropharyngeal microorganism, peptostreptococcus. clavulanic acid for approximately 3 weeks and a full recovery was reported 6 weeks after completion of the antibiotic course. another recent case report described bacterial pericarditis in an intact female cat with pyometra and hematogenous spread of escherichia coli. that cat responded well to a 4 week course of enrofloxacin and metronidazole following peri-cardiectomy, and remained clinically stable 1 year later. conversely, another published report of feline bacterial pericarditis identified infection with a mixed population of enterobacteriaceae species and coagulase-negative staphylococcus species without an obvious predisposing cause. an anaerobic culture was not performed, and the cat responded favorably to an 8 week course of broad-spectrum antimicrobial therapy. owing to the multiple organisms involved, direct inoculation via a penetrating wound or foreign material the case reported here did not have a readily apparent systemic or focal infection, or any immune-modulating systemic diseases; however, an exhaustive search was not pursued. bite wounds are generally associated with the oral flora of the biting animal rather than the skin flora of the victim. the most common aerobic isolate in cat bites is p multocida, and anaerobic isolates commonly include fusobacterium and bacteroides species. though the cat reported here was exclusively housed indoors, another cat was present in the household and may have incited the infection through an unwitnessed altercation. less likely, this infection may have resulted from atraumatic hematagenous spread of bacteria and alternate sources of infection (eg, odontogenic, esophageal, pleuropulmonary) were not systematically excluded. while the incidence and causes of septic pericarditis vary across species, the diagnostic approach and therapeutic goals remain the same. identification of the specific pathogen(s), related antibiotic susceptibility and source of the infection are paramount. cytology and culture of the pericardial fluid is crucial in the diagnosis of septic cases, unlike most other causes of pericardial effusion. in addition, blood cultures are advised in humans as they are positive in 4070% of cases. aerobic and anaerobic susceptibility testing is also recommended, although most laboratories do not routinely perform susceptibility testing on anaerobic isolates. as anaerobic pericarditis is associated with odontogenic infection, esophageal disease, pleuropulmonary infection, abdominal infection and pelvic infection in humans, a thorough search for adjacent and distant infections owing to the low incidence and small number of published case reports, the ideal therapy for septic pericarditis in cats is unclear. results of susceptibility testing facilitate antibiotic selection, although, if unavailable, broad-spectrum coverage is recommended based on the wide range of bacterial isolates reported. the standard of care in affected humans involves aggressive medical management, including an indwelling pericardial catheter for drainage and targeted antibiotic therapy. in dogs affected by bacterial pericarditis, eradication of the source of the infection is imperative and surgical exploration is indicated in cases that have failed medical management or have suspected abscessation identified on diagnostic imaging. consequently, advanced imaging, exploratory surgery and pericardectomy could be advised in affected cats, although, interestingly, complete recovery has been reported with antibiotics alone in previous cases and the cat reported here. the development of constriction is an important potential sequela to septic and non-septic pericarditis, and should be assessed on patient follow-up. constriction is theorized to occur secondarily to the influx of inflammatory cells into the pericardial space, ultimately leading to proliferation of fibrotic connective tissue and neovascularization. these changes can result in a loss of pericardial elasticity and thus limit diastolic filling. in a prospective human study, 9/500 (1.8%) patients developed constriction over a median follow-up time of 72 months. while overall constriction is a rare complication of human viral or idiopathic pericarditis (< 0.5%), the risk of constriction was highest in the bacterial pericarditis group (33%). the prevalence of constriction in cats is unknown, although echocardiographic evidence of constrictive physiology was identified in one cat with septic pericarditis. constrictive pericarditis is difficult to definitively diagnose, but echocardiographic findings of a thickened pericardium and respiratory variation of>25% in mitral inflow velocities can be highly suggestive. in the case presented here, no subjective or clinical evidence of constrictive pericarditis was identified during the limited echocardiograms during recheck examinations; however, concern exists for its development nonetheless. the cat reported here fully recovered following conservative therapy consisting of pericardiocentesis and broad-spectrum antibiotic treatment. larger retrospective or prospective studies could help further characterize treatment strategies and prognosis in affected cats.

case summarya 4-year-old male neutered domestic shorthair cat was presented to the oregon state university cardiology service for suspected pericardial effusion. cardiac tamponade was documented and pericardiocentesis yielded purulent fluid with cytologic results supportive of bacterial pericarditis. the microbial population consisted of pasteurella multocida, actinomyces canis, fusobacterium and bacteroides species. conservative management was elected consisting of intravenous antibiotic therapy with ampicillin sodium/sulbactam sodium and metronidazole for 48 h followed by 4 weeks of oral antibiotics. re-examination 3 months after the initial incident indicated no recurrence of effusion and the cat remained free of clinical signs 2 years after presentation.relevance and novel informationbacterial pericarditis is a rare cause of pericardial effusion in cats. growth of p multocida, a canis, fusobacterium and bacteroides species has not previously been documented in feline septic pericarditis. conservative management with broad-spectrum antibiotics may be considered when further diagnostic imaging or exploratory surgery to search for a primary nidus of infection is not feasible or elected.

PMC5361993

pubmed-565

germline mutations in the tumor suppressor genes brca1 and brca2 account for 3% to 5% of all breast cancer cases and 10% to 15% of ovarian cancer cases. the lifetime risk of breast cancer in brca1 and brca2 mutation carriers is estimated at 47% to 66% and 40% to 57%, respectively. the ovarian cancer risk in brca1 and brca2 mutation carriers is estimated at 35% to 46% and 13% to 23%, respectively. the median onset age for breast cancer in brca mutation carriers is 40 to 50 years, while that for sporadic cases is 60 to 70 years. previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastect-omy effectively reduces the residual lifetime risk of breast cancer to<5%. however, this evidence was derived from retrospective and short-term follow-up prospective studies, so it is not clear whether a bilateral risk-reducing mastectomy (rrm) provides better survival when compared with intensive surveillance. risk-reducing salpingo-oophorectomy (rrso) has been demonstrated to reduce risk of ovarian cancer to 85%, also derived from retrospective and short-term follow-up. they recommend rrso for brca mutation carriers especially upon completion of child-bearing in the national cancer center network guidelines because of the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer, although they hold rrm to an option for brca mutation carriers. in japan, risk-reducing surgery as well as genetic counseling or genetic test is outside the health insurance, so we perform risk-reducing surgery for brca mutation carriers in the limited hospital facilities after the ethics committee granted permission. the safety and feasibility of nipple-sparing mastectomy (nsm) or skin-sparing mastectomy (ssm) in brca mutation carriers is debatable, and a consensus of which procedure should be performed has not yet been reached. we report a 38-year-old japanese women diagnosed with brca2 mutation that underwent prophylactic bilateral ssm with excision of the nipple to preserve the areola skin. furthermore, we provide a review of the literature on the risk management of brca mutation carriers, especially the concepts and procedures of rrm. a 38-year-old japanese woman was diagnosed as a brca2 mutation carrier after genetic counseling and testing and was referred to kitano hospital in april 2014 to undergo risk-reducing surgery. her father had been diagnosed with prostate cancer when he was 49 years old; he had died from the disease 2 years later. her mother was alive but had a history of arrhythmia that was diagnosed when she was 64 years old. her paternal grandmother had been diagnosed with breast cancer when she was 54 years old and had died from the disease 10 years later. although her maternal grandfather died at the age of 72 years because of metastatic cancer, the precise details were not known. her ancestry was japanese, and she was unaware of any ashkenazi jewish heritage. because of her family history, the fact that she was a widowed mother with three children, and her knowledge of hereditary breast and ovarian cancer, she worried about that, and consulted a genetic counselor to undergo brca mutation testing. after genetic counselor showed all of the risk management options for brca mutation carriers, frequent mammography, breast magnetic resonance imaging (mri), clinical breast examinations, chemoprevention, and prophylactic surgery including extent of cancer risk reduction, risks associated with surgeries, reconstructive options, management of menopausal symptoms, and reproductive desires, addressing psychosocial, social, and quality of life aspects, she finally desired rrm and rrso. the ethics committee granted permission for the rrm in may 2014, and we provided informed consent prior to the rrm. the need for rrso remained to be discussed because of concerns associated with rrso such as menopausal disorders caused by iatrogenic fertility. breast mri showed rapid early enhancement with linear and ductal distribution in both the breasts, and the possibility of ductal carcinoma in situ could not be ruled out. axillary node enlargement was not observed. in july 2014, to improve aesthetic and psychological outcomes according to her preference, she underwent a bilateral ssm with excision of the nipple to preserve the areola skin. using indigo carmine, we demarcated the perimeter of the breast tissue preoperatively to ensure complete excision of the mammary gland. immediate breast reconstruction was performed using the standard prosthetic reconstructive technique of two-stage expander-implant reconstruction. on pathological examination she was disease-free at a 1-year follow-up and her general condition was good. although the american society of clinical oncology has previously recommended that brca mutation testing should be conducted only for those with at least a 10% likelihood of carrying a mutation, it is currently recommended for any individual with a suggestive family history if the result would affect the magnitude of medical management. risk management for brca mutation carriers includes frequent mammography, breast mri, clinical breast examinations, chemoprevention, and prophylactic surgery. previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to<5%. conducted a prospective study of 139 pathogenic brca1/2 carriers, among whom, 76 underwent prophylactic mastectomy and 63 were followed by regular surveillance. they showed that there were no cases of breast cancer after rrm with a mean follow-up 2.91.4 years, whereas there were eight cases of breast cancers in the surveillance group after a mean follow-up of 31.5 years. conducted a retrospective study of 639 women with a family history of breast cancer that underwent prophylactic mastectomy. with a median follow-up of 14 years, they reported that prophylactic mastectomy was associated with a 90% reduction in the incidence of breast cancer, with only seven women developing breast cancer. however, randomized controlled trials to evaluate the potential impact of rrm on survival have not been conducted, and it remains unclear whether bilateral rrm improves survival compared with intensive surveillance. the only available data is derived from risk estimates assessed using mathematical models of risk-reducing interventions. developed a monte carlo model of breast screening with annual mammography plus mri in subjects aged 25 to 69 years; rrso was performed in those aged 40 to 50 years and rrm was performed in those aged 25 to 50 years. they reported that rrm at age 25 plus rrso at age 40 years maximizes survival probability, substituting mammography plus mri screening for rrm seemed to offer comparable survival. as far as chemoprevention is concerned, tamoxifen reduced breast cancer incidence among healthy brca2 carriers by 62%. in this case, after we discussed all of the risk management options for brca mutation carriers recommended by the national comprehensive cancer network (nccn) guidelines, she has finally chosen to have rrm, because she has believed rrm might release from the fear of future cancer more than other cancer preventive options. she made choice to have rrm by her responsibility that 37-year-old widowed mother with three young children, concerning that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to<5% which is superior than chemoprevention, although addressing psychosocial effect of mastectomy, and risks associated with surgeries. bresser et al. reported that 95% of women opted for rrm because of decreased cancer-related psychological distress. they tend to have young children and a greater awareness of the genetic nature of cancer in the family compared with those who opt for regular surveillance, as well as in this case. for brca1 or brca2 mutation carriers at high risk for ovarian cancer, the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer have impelled them to the performance bilateral rrso after completion of childbearing, ideally by age 35 to 40 years. as to the chemoprevention option, oral-contraceptive use protected against ovarian cancer both for carriers of the brca1 mutation (odds ratio, 0.5; 95% confidence interval, 0.30.9) and for carriers of the brca2 mutation (odds ratio, 0.4; 95% confidence interval, 0.21.1). in this case, the need for rrso remained to be discussed in the ethics committee, and she underwent rrm at first before rrso, as following reasons: firstly, the most important reason is that there is the difference between the risk of breast cancer and of gynecologic cancer in age of 30s in brca2 mutation. the timing of rrso is controversial, while nccn guidelines panel recommends rrso for women with a known brca1 or brca2 mutation, typically between ages 35 and 40 years and upon completion of childbearing. it is well established that among women with brca2 mutation, the risk of gynecologic cancer is only 2% to 3% by the mean age of 50 years, while it increases in the late 30s in women with brca1 mutation. however, the risk of breast cancer is over 20% in 30s in women with brca2 mutation. secondly, mutation carriers who undergo rrso at a young age face medical problems such as osteoporosis, and cardiovascular disease, as well as quality-of-life issues associated with menopause, hot flashes, vaginal dryness, sexual dysfunction, sleep disturbances, and cognitive changes. thirdly, women who undergo bilateral mastectomy but who have ovaries intact can use oral contraceptive safety for protecting against ovarian cancer. oral contraceptive use has been associated with a small increase in the risk of breast cancer in young and old women. in a large meta-analysis, current use of oral contraceptives was associated with a relative risk 1.2 for breast cancer. she has not use oral contraceptive even after rrm, because she desire to have children, but she can take oral contraceptive after she gave up having children. fourthly, short-term hormone replacement therapy after rrso may be useful after rrm to improve their quality-of-life for women without increasing the risk of breast cancer, when no history of breast cancer has confirmed pathologically. as far as the method of rrm is concerned, ssm and nsm are increasingly performed instead of the conventional total mastectomy to allow for immediate breast reconstruction and to achieve a natural aesthetic outcome. the oncological risk associated with remaining mammary gland is unclear, and there remains a small risk of cancer arising beneath the nipple and areola in nsm. reynolds et al. evaluated 62 nipple-areolar complex (nac) tissues from 33 female brca1/2 mutation carriers who underwent mastectomy and found that 24% of nacs contained terminal duct lobular units (tdlus), with only 8% found in the nipple papilla, and they estimated that nsm might be appropriate and oncologically safe for women with brca mutation carriers, but tdlus can be found in the nac and are more likely at the base of the nipple, so the significance of this for long-term risk is unknown. however, hartmann et al. reported that no significant difference in the incidence of breast cancer between women who underwent subcutaneous mastectomy and those who underwent total mastectomy. the prose study followed 105 brca1/2 mutation carriers who underwent a bilateral prophylactic mastectomy, at least 30% of whom had subcutaneous mastectomies. at 6.4 years of follow-up, two women who underwent subcutaneous mastectomies developed breast cancer, with one developing metastatic breast cancer in the axilla and the other developing breast cancer in residual breast tissue. in a review of the literature, van verschuer et al. reported that 21 primary breast cancers occurred after 6,044 prophylactic mastectomies, three occurred after a total mastectomy, and 17 occurred after a conservative mastectomy, but that the majority of primary breast cancers did not originate near nac or skin flap but were found in the chest wall or axilla. they suggested that oncological surgeons should be diligent, ensuring complete removal of all glandular tissue, especially in the axillary tail and chest wall, and that the skin flaps and nac should be dissected as thin as possible. current nsm and ssm techniques aim for skin flaps<5 mm and for a nac thickness of 2 to 3 mm. ssm and nsm using peri-areolar or inframammary incisions can be challenging, because of difficulty of removal of remaining mammary gland in all quadrants and in the axillary tail. detection of brca1/2 mutations gave rise to a new concept in prophylactic medicine, although risk management for brca1/2 mutation carriers requires further discussion. it is generally accepted that a randomized controlled study design would allow a better evaluation of risk reducing surgery on cancer risk and mortality reduction, it is generally accepted that randomized approach would not be ethical for the management of these patients and therefore, this field of research is limited to undertaking observation studies, which intrinsic methodological limitation. the patient finally described herein chose to undergo bilateral ssm for rrm with the excision of the nipple and preservation of the areola skin. the best choice of risk reduction for brca mutation is different from each others, so it is important that the decision making should be made with knowledge of risk management options, through receiving counseling about the risks and benefits of each options.

women with brca1/2 mutations have a high risk of breast cancer and may opt for risk-reducing mastectomy (rrm). we report a 38-year-old japanese woman who was diagnosed as a brca2 mutation carrier. she underwent prophylactic bilateral skin-sparing mastectomy (ssm) with excision of the nipple and preservation of the areola skin. it is unclear whether a bilateral rrm leads to better survival compared with intensive surveillance. the oncological risk associated with the presence of remnant breast glandular tissue after ssm or nipple-sparing mastectomy has been obscure. we report the first case of rrm for a japanese brca mutation carrier and provide a literature review on risk management for brca mutation carriers with a focus on the concepts and procedures of rrm.

PMC4929266

pubmed-566

chronic kidney disease (ckd) is a public health problem that affects more than 20 million people in the us. an average dialysis patient may require more than 12 medications. a pooled analysis identified 1,593 medication-related problems in 385 dialysis patients, with over- or under- dosing errors accounting for 20.4% of these issues. despite the large number of patients affected and the devastating consequences of medication related problems, our understanding of the impact of kidney disease on drug disposition is incomplete, particularly for those drugs eliminated primarily by non-renal pathways. obviously, clearance of drugs that depend primarily on the kidneys for elimination is reduced, but significant changes also occur in drug exposure with medications that are eliminated by the liver, intestine, and possibly other organs. in 2009, the fda published a survey of new drug applications (nda) approved between january 2003 and july 2007 that assessed the impact of renal impairment on systemic exposure of new molecular entities. in this analysis, nda sponsors for 37 orally administered drugs included renal impairment studies as part of their submission; 23 (62%) of these were eliminated by non-renal pathways (defined as fraction eliminated via renal route<15). despite being cleared non-renally, 13 of these 23 new drugs (57%) showed an average 1.5-fold increase in area under the plasma concentration-time curve (auc) in renally impaired patients compared with health controls. in fact, the change in drug exposure for five drugs cleared mainly by hepatic metabolism and/or transport were of a magnitude (viz. duloxetine auc+2.0-fold, tadalafil auc+2.7- to 4.1-fold, rosuvastatin cplasma+3-fold, telithromycin auc+1.9-fold, solifenacin auc+2.1-fold) that required labeling recommendations for dose adjustment in renally impaired patients. seven other drugs showed an effect of renal impairment on drug exposure but did not require dosage adjustment (aliskiren, alfuzosin, aprepitant, ranolazine, vardenafil, darifenacin, and lanthanum). these data along with a large body of earlier literature suggest that ckd alters the pharmacokinetics of drugs that are cleared by non-renal mechanisms; however, the underlying molecular mechanisms accounting for these pharmacokinetic changes remain poorly defined (reviewed by nolin, leblond and others). the purpose of the present mini-review is to highlight the present gaps in our understanding of the impact of ckd on non-renal drug clearance involving metabolism and transport processes and to identify areas of opportunity for future research. the following is a brief introduction to the key drug-metabolizing enzymes and drug transporters whose function is known to be altered in ckd. phase i drug metabolism, involving oxidation, reduction, and hydrolysis, generally converts drug molecules to more polar or water soluble metabolites that are readily excreted by the kidneys or via the biliary system. drug oxidation, which is particularly known to be altered in ckd, is catalyzed by two large families of enzymes, namely the cytochrome p450 (cyps) and flavin-containing monoxygenases (fmos). many of the cyps exhibit genetic polymorphisms which range from gene duplication resulting in gene overexpression to null mutations producing a non-functional enzyme. the recent focus of cyp research is on enzymes expressed in the liver and the intestinal mucosa, which govern the oral bioavailability (i.e., first-pass metabolism) and systemic metabolic clearance of drug molecules. human hepatic cytochrome p450s include cyp3a4 and 3a5 (40% of total liver p450 content), cyp2cs (25%), cyp1a2 (18%), cyp2e1 (9%), cyp2a6 (2%), cyp2d6 (2%) and cyp2b6 (< 1%), as well as fmo3. human intestinal cyps that are functionally important include cyp1a1, cyp3a4, cyp3a5, and cyp2j2. cyp1a1, cyp1a2, cyp3a5, cyp4a1, and fmo1 are also expressed in human kidneys, but at levels much lower than in the liver and intestine. many drugs or their phase i metabolites also undergo conjugation reactions mediated by phase ii enzymes. in particular, n-acetylation and o-glucuronidation of drugs or drug metabolites are known to be altered in ckd. the liver and intestinal mucosa are the major sites for the biotransformation of drugs and drug metabolites by phase ii enzymes (figure 1). it should be noted that the products of phase i and phase ii metabolism are not always pharmacologically inactive or less toxic than the parent drug. transporters are transmembrane proteins facilitating the passage of both drugs and other xenobiotics across biological barriers encountered during drug absorption, tissue distribution, and excretion. transporters, like drug-metabolizing enzymes, are expressed differentially across body tissues and are characterized as either uptake or influx transporters (transport into the cellular barrier) or efflux transporters (transport out of the cellular barrier). the importance of transporters in governing the intestinal absorption of drugs and nutrients and renal tubular secretion or reabsorption of drugs or their metabolites is increasingly being recognized. on the other hand, the role of hepatic sinusoidal transporters in regulating the access of drug substrates to the hepatocellular enzymes and that of canalicular transporters in biliary excretion of drugs and/or their conjugate metabolites are not as widely appreciated. recent studies in experimental models of ckd have demonstrated altered expression and/or activities of intestinal and hepatic drug transporters that could modulate the respective intestinal absorption and hepatic uptake and metabolism of drugs. more than 75 commonly used drugs have been reported to exhibit altered non-renal clearance in patients with ckd (see table 1 for compilation). only a few are subject to primary phase ii metabolism, namely o-glucuronidation (diacerein, morphine, oxprenolol, and zidovudine) and n-acetylation (isoniazid and procainamide). in almost all cases, reduced non-renal clearance, along with an increase in oral bioavailability in some cases (especially for drugs that undergo first-pass metabolism in the intestinal mucosa and/or liver), was observed in ckd. a case in point is the diminished non-renal clearance of nimodipine, which could result in as much as a 7-fold increase in its auc, although the increase in drug exposure is usually more modest (1.5-3.0-fold), variable across patients, and dependent upon the degree of renal impairment and the dialysis regimen in patients near or at the end-stage of renal disease. increased clearance has been reported for a handful of drugs, including phenytoin, fosinopril, cefpiramide, nifedipine, bumetanide, and sulfadimidine. at least in the case of phenytoin, the apparent acceleration in non-renal clearance is attributed to reduced binding of phenytoin to albumin in uremic serum resulting in a higher fraction of circulating drug being available for uptake and metabolism by the liver. a number of mechanisms have been hypothesized for the impairment of drug metabolism in ckd, particularly metabolic pathways mediated by cyp enzymes. the supporting evidence is drawn largely from experimental studies in animal models of acute and chronic renal failure. the proposed mechanisms include: alterations in gene transcription and protein translation, reduced cyp expression due to inhibition of hemoprotein biosynthesis and/or increased enzyme degradation, depletion of co-factors (e.g., supply of nadph), and direct competitive inhibition of cyp enzyme by circulating uremic constituents. supply of -aminolevulinic acid is recognized as a rate-limiting step in the hepatic synthesis of cytochrome p450 hemoproteins. total microsomal cytochrome p450 content is consistently reduced in various experimental models of renal failure, and mitochondrial -aminolevulinic synthetase activity is depressed in the two-step 5/6 nephrectomy model in rats. leber et al. reported that intraperitoneal supplementation of -aminolevulinic acid in rats following subtotal nephrectomy normalized the level of cytochrome p450 in the liver, but did not reverse the reduction in cyp activities; hence, interference of hemoprotein synthesis is not a major mechanism of uremia s effect on cyp functioning in the rat. in addition, there is no experimental evidence in support of a diminished pool of hepatic nadph/nadh in renal failure, thereby limiting microsomal oxidation reactions. currently, the two most likely mechanisms are transcriptional and/or translational modifications and direct competitive inhibition of the cyp enzymes. nolin et al. have provided a thorough summary of experimental studies conducted over the past decade, which clearly demonstrated reduced expression of cyp genes and gene products (i.e., reduced mrna and protein, or reduced protein with no change in mrna) in several animal models of ckd. the precise mechanism(s) of the down-regulation of cyp genes in these ckd models remains unknown. also, there is no prima facie evidence that transcriptional and/or translational modifications in cyp genes involved in drug metabolism occur in humans with ckd. the only available human data come from ex vivo studies of uremic serum obtained from patients with end-stage renal disease (esrd), which showed that incubating rat hepatocytes in primary culture with uremic human serum led to a decrease in protein expression and activity for all the major xenobiotic-metabolizing cyps (i.e., 1a, 2c, 2d, 3a and 4a families), except for cyp2e1. observed that, while pre-hemodialysis serum caused significant reductions in cyp protein expression compared to serum from healthy controls, post-dialysis serum showed no effect. fractionation of uremic serum by ultrafiltration and size-exclusion hplc revealed that the inhibitory constituents have a molecular weight range between 10 and 15 kda. these investigators postulated that proinflammatory cytokines and parathyroid hormone, which have the requisite molecular size and are known to be elevated in ckd, could mediate the down-regulation of cyps in ckd. indeed, a follow-up study by the same group provided strong evidence that parathyroid hormone was a major component in uremic rat serum responsible for cyp down-regulation, and parathyroidectomy abolished the alteration in cyp transcription and translation. possible mechanisms of parathyroid hormone s effect on cyp gene regulation include increased camp production, elevations in intracellular calcium, and/or activation of the nf-b pathway. down-regulation of cyp gene expression in response to proinflammatory cytokines and other mediators of acute phase response (e.g., interleukin-1, interleukin-6, tumor necrosis factor-, interferon) are well established. it is also possible that circulating uremic constituents interfere with signaling of nuclear receptors involved in transcriptional activation of cyp genes, such as pregnane-x-receptor (pxr) and constitutive androstane receptor (car). also, uremic plasma ultrafiltrate and peritoneal dialysate have been shown to inhibit vdr-rxr hetero-dimerization and attenuate activation of vitamin d responsive genes, which include cyp3a4. the ex vivo evidence for uremia-induced transcriptional and translational modifications appears convincing, but there are caveats. interspecies differences exist in the binding and activation of nuclear receptors (e.g., pxr) that regulate transcription of cyp genes, particularly between rodents and humans. in addition, the human orthologs of rat cyp enzymes often have vastly different drug substrate selectivity. the degree of uremia in animal models often exceeds that observed in stage iii ckd subjects and may not be generalizable to this population; however, it may mimic the uremic state observed in patients with stage iv ckd or in sub-optimally dialyzed stage v subjects. hence, caution should be exercised in extrapolating genomic and functional data gathered from studies with rat hepatocytes and severely uremic animal models to the clinical context in ckd patients. it would be of considerable interest to repeat the ex vivo studies of uremic human serum on short term cyp regulation using a three-dimensional human hepatocyte culture system (vide infra). the presence of circulating, competitive inhibitor(s) of cyp enzymes in uremic blood or plasma was demonstrated in some of the early experimental studies. as early as 1985, terao et al. showed a reduced extraction of s-propranolol a high intrinsic clearance cyp substrate, by livers isolated from normal rats perfused with uremic blood. furthermore, livers from acute renal failure rats showed no reduction in s-propranolol extraction when perfused with normal blood from control rats. this set of cross-perfusion experiments presented the first evidence of a rapidly acting inhibitory factor(s) in uremic blood directly affecting the functioning of hepatic cyp enzymes. a later study by the same laboratory showed that a low molecular weight ultrafiltrate fraction (< 10 kda) of uremic plasma obtained from esrd patients was capable of inhibiting the oxidative metabolism of s-propranolol in human liver microsomes mediated by cyp2d6 and cyp1a2. corroborating evidence of circulating uremic inhibitors have also been provided by yoshitani et al. who showed that uremic sera from experimental models of acute renal failure in rats were capable of inhibiting oxidative metabolism of losartan in rat liver microsomes. likewise, taburet et al. reported that uremic plasma from esrd patients inhibited the metabolism of the cyp2c9 probe tolbutamide and the cyp3a probe midazolam in human liver microsomes from donors with normal renal function. another piece of indirect evidence comes from pharmacokinetic studies in esrd patients undergoing hemodialysis; where the metabolic clearance of both propranolol and telithromycin following oral administration was partially or completely normalized when the drug was given shortly after a regular dialysis session compared to before dialysis. the rapid reversibility of uremia s effect is more consistent with dialytic removal of competitive enzyme inhibitors than reversal of uremia-induced down-regulation of cyp. while the latter process normally takes several days to achieve in accordance to the turnover half-life of cytochrome p450s (24 hours), downregulation in the expression of one or more cyp proteins until now, no systematic investigation has been undertaken to identify the putative cyp inhibitors in uremic blood of ckd patients. unfortunately, our incomplete understanding of the effect of uremia on drug metabolism means that we are unable to predict which drug substrates and under what clinical circumstance would we expect to encounter a significant perturbation in metabolic clearance that warrants dosage adjustment. early on, it was hypothesized that uremic inhibition of metabolic clearance may be confined to drug substrates of select cyp subfamilies if competitive enzyme inhibition by circulating uremic inhibitors is cyp specific. soon it became apparent that uremic inhibition is observed in members of nearly every major drug-metabolizing cyp subfamilies; more puzzling is the fact that inhibition is inconsistent in its manifestation across substrates for the same cyp isoenzyme. for example, most of the lipophilic -adrenergic blockers are metabolized to a large extent by cyp2d6. whereas the first-pass and systemic clearance of orally administered propranolol and bufuralol are significantly reduced in ckd patients resulting in 3- to 5-fold increases in auc, the same is observed with substrates of cyp3a: first-pass metabolism and systemic clearance of midazolam are not affected by renal dysfunction; in contrast, increased oral bioavailability and decreased systemic clearance have been reported for other cyp3a-selective substrates, such as the antidepressant reboxetine and the dihydropyridine calcium channel blockers nicardipine, nimodipine, and nitrendipine. thus, until we have identified the uremic constituents that modulate cyp-mediated metabolism, we will not begin to appreciate the exact nature and complexity of the effects of kidney disease on drug metabolism. for cyp enzymes exhibiting allosteric behavior, such as cyp1a1, cyp2b6, cyp2c8, cyp2c9, and cyp3a4/5, heterotropic cooperativity induced by two substrates or a substrate-inhibitor pair can lead to either apparent activation or inhibition in metabolism. the outcome of interactions become even harder to predict when multiple inhibitors are present, which is the likely scenario in uremia; such complex uremia retention solute-drug interactions will require meticulous enzyme kinetic studies. for those substrates whose first-pass metabolism is inhibited, we will need to delineate the separate effects of uremia on drug extraction at the intestinal mucosa versus that at the liver. leblond et al. have shown that uremia-induced down-regulation of some cyps is tissue-specific; for example, chronic renal failure in rats induced by two-stage, 5/6 nephrectomy resulted in a significant down-regulation in cyp1a2 in the intestine but not in the liver, whereas the opposite is observed with cyp2c11. some of the variability in the effects of renal disease on drug metabolism undoubtedly reflects differences in the stage of kidney disease and severity of uremia of patients between studies. there is always the problem of unrecognized confounders, such as differences in diet and nutritional support that may give rise to variations in composition and levels of uremic toxins, and the ever present problem of assessing drug-drug interactions. there is increasing awareness that uptake transport of drugs across the sinusoidal membrane of hepatocytes regulates the access of drug substrates to hepatocelluar enzymes as well as canalcular transport into the bile canaliculi, and can be a rate-limiting step in the overall process of hepatic drug clearance. in 1984, bowmer, yates and their colleagues reported that the hepatic uptake of two anionic dyes (indocyanin green and bromosulfophthalein) that are non-selective oatp substrates were reduced in acute renal failure rats. the functional and clinical significance of these findings did not become evident until a series of recent investigations showed that inhibition of uptake transport into the liver may explain to a large extent the reduced non-renal clearance observed in ckd patients for several commonly used drugs that are moderately good to high affinity substrates of human hepatic oatps: erythromycin, eprosartan, fexofenadine, and digoxin. the inhibitory mechanism(s) of hepatic drug uptake was explored to a limited extent in the above referenced studies. incubated normal rat hepatocytes with uremic serum drawn from patients with esrd and showed a 29% decrease in oatp1a4 expression and a 37% increase in p-gp expression in rat hepatocytes exposed to uremic serum compared with those exposed to healthy serum; the effect on oatp is consistent with the in vivo finding of a 63% decrease in the oral clearance of fexofenadine. a subsequent in vitro investigation with digoxin by tsujimoto et al. also yielded similar findings it would be important to replicate these findings in human hepatocytes since the complement of human sinusoidal oatps (oatp1b1, oatp1b3, and oatp2b1) are not functional orthologs of rat sinusoidal oatps. it is also relevant to note that among the various anionic uremic toxins tested, 3-carboxy-4-methyl-5-propyl-2-furanpropionic acid (cmpf) was consistently shown to be the most potent inhibitor of roatp or hoatp for the uptake of erythromycin, eprosartan, and digoxin, with a ki in the order of 20 to 50 m, which is within the plasma concentration range reported in uremic patients (median 254 m, maximum 392 m). another uremic constituent, p-cresol it is important to recognize that sinusoidal uptake transport and intracellular processing by hepatocellular metabolism and canalicular secretion into bile are coupled kinetic processes; moreover, either or both transport and metabolic steps can be altered by uremia to produce the net effect of reduced hepatic clearance. hence, in vitro modeling of functional disruption of hepatocellular processes must be evaluated in a cell-based system that maintains the coupling of transport at the sinusoidal membrane and enzymatic function at the endoplasmic reticulum. all in vitro studies conducted to date in this area have used hepatocytes isolated from rat or human livers and maintained in short-term, conventional monolayer culture; as a result, the hepatocytes do not retain cell polarity (i.e., sinusoidal versus canalicular membrane domain) and rapidly de-differentiate. over the past decade, the sandwich-cultured human hepatocyte model (sch) has gained favor in order to study the complex interplay between metabolic enzymes and transporters. when cultured on a substrate of biocoat with an overlay of matrigel or collagen, primary hepatocytes develop a cuboidal three-dimensional structure with intact bile canaliculi and proper localization of efflux transporters (e.g., oatps, p-gp, mrps, and concentrative/equilibrative nucleoside transporters), while maintaining functional metabolic enzymes (e.g., cyps, udp-glucuronosyltransferases). this system features the connecting between sinusoidal uptake, intracellular metabolism, and efflux into the bile canaliculi, and allows assessment of the net effects of these sequential processes on heaptic drug processing. exposing sch to uremic serum or its derived fractions could provide a more realistic in vitro model for investigating the alterations in drug metabolism and transport observed in ckd patients. an emerging novel approach to enhancing in vitro tissue or organ system models relevant to altered drug metabolism microphysiological systems utilize microfluidic technologies, can incorporate three dimensional architecture and mimic physiological fluid shear stress. these microphysiological systems frequently use human cell sources to overcome concerns about species differences in drug transport and metabolism. human microphysiological systems are currently under development at the university of washington and other institutions, and should expand our ability to explore the interactions between kidney disease and hepatic drug metabolism and transport. microphysiological systems can also feature microvascular endothelial cells and perivascular cells cultured on a 3-dimensional scaffold that form luminal or microvasular structures; hence, the systems can recapitulate normal perfusion flow and the resulting physiological dynamics of solute transport. it is conceivable that eventually we will be able to capture the impact of impairment in kidney function on hepatocyte function through coupling of vascularized microphysiological systems based on human kidney and liver. great strides have been made in understanding the effects of ckd on drug disposition in the past 15 years, particularly on how uremia affects hepatic drug metabolism and coupled transport. nonetheless, as highlighted in this review, important questions remain regarding the underlying uremic mechanisms. until we fully understand uremia s impact on drug metabolism and transport at the cellular and molecular level, it will be difficult to develop a rational strategy for drug dosing in the ckd population. it is also clear that progress will depend on the application of novel techniques and methodologies to delineate the complex and multiplex details of uremia s effect on the drug disposition system.

the pharmacokinetics of non-renally cleared drugs in patients with chronic kidney disease is often unpredictable. some of this variability may be due to alterations in the expression and activity of extra-renal drug metabolizing enzymes and transporters, primarily localized in the liver and intestine. studies conducted in rodent models of renal failure have shown decreased mrna and protein expression of many members of the cytochrome p450 enzyme (cyp) gene family and the atp-binding cassette (abc) and solute carrier (slc) gene families of drug transporters. uremic toxins interfere with transcriptional activation, cause down-regulation of gene expression mediated by proinflammatory cytokines, and directly inhibit the activity of the cytochrome p450s and drug transporters. while much has been learned about the effects of kidney disease on non-renal drug disposition, important questions remain regarding the mechanisms of these effects, as well as the interplay between drug metabolizing enzymes and drug transporters in the uremic milieu. in this review, we have highlighted the existing gaps in our knowledge and understanding of the impact of chronic kidney disease on non-renal drug clearance, and identified areas of opportunity for future research.

PMC4276411

pubmed-567

because of the therapeutic potential of inhibiting fatty acid amide hydrolase (faah) for the treatment of pain, inflammatory, or sleep disorders, there is a continuing interest in the development of selective inhibitors of the enzyme. the distribution of faah is consistent with its role in regulating signaling fatty acid amides including anandamide (1a) and oleamide (1b) at their sites of action (figure 1). although faah is a member of the amidase signature family of serine hydrolases for which there are a number of prokaryotic enzymes, it is the only well-characterized mammalian enzyme bearing the family s unusual ser ser lys catalytic triad. early studies following the initial identification of the enzyme led to the disclosure of a series of substrate-inspired inhibitors that were used to characterize the enzyme as a serine hydrolase. subsequent studies disclosed several classes of inhibitors that provide opportunities for the development of inhibitors with therapeutic potential. these include the reactive aryl carbamates and ureas that irreversibly carbamylate the faah active site catalytic serine. a second, and one of the earliest classes, is the -ketoheterocycle-based inhibitors that bind to faah by reversible hemiketal formation with the active site catalytic serine. many of these reversible, competitive inhibitors have been shown to be selective for faah versus other mammalian serine hydrolases as well as efficacious analgesics in vivo. in these studies, 2 (ol-135) emerged as a potent (ki=4.7 nm) and selective (> 60300 fold) prototypical faah inhibitor that induces analgesia and increases endogenous anandamide levels. it lacks significant off-site target activity, does not bind cannabinoid (cb1 or cb2) or vanilloid (trp) receptors, and does not significantly inhibit common p450 metabolism enzymes or the human ether-a-go-go related gene product (herg). the analgesic effects of 2 are observed without the respiratory depression or chronic dosing desensitization characteristic of opioid administration or the increased feeding and decreased motor control characteristic of cannabinoid (cb) agonist administration. it possesses a relatively short duration of in vivo activity relative to irreversible inhibitors, although further conformational constraints in the c2 acyl chain of 2 have provided inhibitors that are not only orally active but also exhibit extended durations of in vivo activity. activity relationship (sar) studies on 2 exploring substitution of the central oxazole, the c2 acyl side chain, and the central heterocycle, the x-ray characterization of inhibitor-bound complexes defined key features that impact inhibitor affinity and selectivity. these include not only the ser241 hemiketal formation with the inhibitor electrophilic carbonyl and its interaction with the enzyme oxyanion hole but also an unusual ser217-mediated oh h-bond to the activating heterocycle and the key anchoring interaction of the terminal phenyl group of the c2 acyl chain. the structural studies also revealed that cys269 is located adjacent to c5 of the inhibitor pyridine substituent, which in turn is engaged in a series of intricate interactions in the enzyme cytosolic port. herein, we report results of a systematic study of candidate inhibitors containing modifications at the pyridyl c5-position of 2 and related inhibitors that in principle could covalently trap this proximal cys269 to provide inhibitors that alkylate or cross-link the faah active site. in turn, this could be expected to enhance their potency, potentially enhance their selectivity, and extend their in vivo duration of action (figure 2). herein, we detail the systematic inhibitor modifications that led to the discovery and characterization of such inhibitors and the unexpected trends that the additional strategically placed electrophiles display. the series 1 analogues (322) were accessed from 5-(tributylstannyl)oxazole 1e(36) by stille coupling with the appropriate 2-chloro- or 2-bromopyridine (scheme 1). this was followed typically by tbs ether deprotection (bu4nf) and oxidation of the liberated alcohol with dess martin periodinane (dmp) to provide the corresponding -ketoheterocycles: 3, 7, 9, 14, and 1822. the remaining inhibitors were accessed by further modification of the pyridyl c5 substituent (scheme 1). the second series, in which the pyridine of 2 is replaced with an alkyl linker to the pendant electrophile, was accessed by sonogashira coupling of 5-bromooxazole 1f(43) with the appropriate alkyne (scheme 2). the alkyne intermediate was reduced to the corresponding alkane with h2 and palladium on carbon or palladium hydroxide. this was followed by tbs ether deprotection (bu4nf) and oxidation of the liberated alcohol with dess martin periodinane (dmp) to yield the series 2 c5-substituted oxazoles: 23 and 28. further elaboration of the terminal electrophile (r group) yielded the remaining compounds: 2427 and 2932. the initial characterization of the candidate inhibitors and their comparison with 2 was conducted using purified recombinant rat faah (rfaah) expressed in escherichia coli(55) at 2023 c as previously disclosed. the initial rates of hydrolysis (> 1020% reaction) were monitored using enzyme concentrations below the initially measured ki values by following the breakdown of c-oleamide, and ki values were established as previously described (dixon plot). series 1 was developed directly on the basis of 2 (ki=4.7 nm), placing a potential thiol-capturing electrophile at the 5-position of the pyridine ring (58, 11, 12, 14, and 1622). thioesters 5 and 16 were expected to be the most straightforward traps for the cys269 thiol by thioester exchange. without preincubation of the inhibitors with the enzyme, these inhibitors along with their precursors (322) were tested for binding and inhibition of rfaah (figure 3). all display potencies similar to 2, exhibiting ki values in the low nanomolar range. in series 2, the pyridine ring was replaced by an alkyl chain of appropriate length capped with the thiol-engaging moiety. as modeled, this flexible linker is able to reach through the cytosolic pocket and place the potentially reactive electrophile proximal to cys269. like the series 1 inhibitors and without preincubation with the enzyme, all series 2 inhibitors exhibited effective faah inhibition with potencies that approach or match that of 2 (figure 3). because the cys269 alkylation was expected to be slow relative to the rapid hemiketal formation, the time-dependent inhibition of faah was examined. this was accomplished by preincubation of the inhibitors with recombinant rfaah for a period of 16 h. as previously observed, reversible, competitive inhibitor 2 does not display time-dependent inhibition of faah, and its ki value remains unchanged with the enzyme in contrast, a select subset of inhibitors (11, 14, 17, and 2022) in series 1 exhibited significant increases in potency, displaying 220-fold improvements in ki over the same time period, consistent with slow irreversible inhibition of faah. surprisingly, thioesters 5 or 16 did not exhibit this time-dependent increase in enzyme inhibition potency. similarly, chloride 12 was found to be relatively nonpotent and insensitive to preincubation with the enzyme, whereas the corresponding bromide 11 was initially more potent and exhibited the most pronounced time-dependent increase in potency of all inhibitors. both nitrile 7 and its imidate 8, where the candidate electrophile is attached directly to the pyridyl ring, did not display time-dependent increases in potency, whereas both the homologated nitrile 14 and its imidate 17, where a methylene spacer separates the electrophile and pyridyl ring, did exhibit increases in potency with the enzyme inhibitor preincubation. of the series of inhibitors that might be expected to serve as michael acceptors for a thiol conjugate addition (1822), including the ,-unsaturated ester 18 and nitrile 19, only those bearing the weaker activating substituents (2022 vs 18 and 19) that would be expected to react slower and to be intrinsically less reversible displayed the exceptionally potent and time-dependent faah inhibition improvements. notably and throughout this series, it was not the anticipated electrophiles that exhibited the time-dependent inhibition of faah characteristic of a slow irreversible inhibitor, but rather it was a less-well-recognized alternative (14 and 17 vs 16, 11 vs 12, and 2022 vs 1819). finally, no inhibitor in series 2 that bears the flexible linker to the second electrophile displayed the time-dependent increases in potency, indicating that the conformationally restricted placement of the second electrophile is important to observation of the targeted alkylation. for the inhibitors that displayed time-dependent increases in inhibitor potency, enzyme activity did not recover after this time period and is indicative of irreversible enzyme inhibition. the compounds that demonstrated time-dependent improvements in potency were further investigated by lineweaver -ketoheterocycle inhibitors including 2 were shown to display well-behaved competitive, reversible inhibition kinetics. despite expectations but consistent with the lack of time-dependent faah inhibition, lineweaver burk kinetic analysis of thioesters 5, 16, and 25 after 3 h preincubation with the enzyme confirmed that they also behave as reversible, competitive inhibitors, analogous to 2 and related -ketoheterocycle inhibitors (figure 5). thus, despite the expectations of a facile transthioesterification with cys269, the thioesters exhibit enzyme inhibition characteristic of reversible inhibitors, suggesting that reaction with cys269 does not occur. significantly, thioesters 5 and 25 were recovered unchanged from the assay buffer (6 h) and from enzymatic assays (5), indicating that they are not undergoing chemical hydrolysis or transient enzyme adduct formation and subsequent hydrolysis under the conditions of the assay. burk kinetic analysis of 5, 16, and 25 demonstrate reversible, competitive inhibition. in contrast, the inhibitors that demonstrated a time-dependent increase in inhibitor potency also exhibited noncompetitive inhibition of faah when preincubated with the enzyme for 3 h prior to lineweaver this is expected of irreversible enzyme inhibition and consistent with cys269 alkylation or addition to the pendant electrophile. in the case of 11, this entails cys269 thiol nucleophilic displacement of the benzylic bromide to provide the corresponding thioether, and its structure has been confirmed by x-ray analysis of the inhibitor bound to faah. the noncompetitive enzyme inhibition presumably entails thiol nucleophilic addition to the electrophile to provide the cys269-linked thioimidate for 14 and 17, and it presumably involves an apparent irreversible thiol conjugate addition to 2022. interestingly, both the ,-unsaturated nitrile 19 and ester 18, which do not exhibit time-dependent increases in inhibitor activity or the potent ki values consistent with irreversible inhibition, displayed mixed kinetics, exhibiting competitive inhibition at low inhibitor concentrations and noncompetitive inhibition at high concentrations. presumably, this indicates that the thiol conjugate addition products derived from 18 and 19 are either formed less effectively or, more likely, that they may be sufficiently reversible at 23 c to less effectively trap cys269 as an apparent irreversible inhibitor of the enzyme. burk analysis demonstrates noncompetitive faah inhibition for (a) 11, (b) 14, (c) 17, (d) 20, (e) 21, and (f) 22. dialysis dilution (4 c, 18 h, 370-fold) of the faah-inhibitor mixture following 3 h of preincubation with 2 restored full enzyme activity, consistent with its reversible enzyme inhibition, whereas the mixtures containing 11, 14, and 1722 remained relatively unchanged, failing to restore faah activity, indicative of irreversible enzyme inhibition under the conditions monitored (4 c, ph 9, figure 7). it is notable that 14 and 17 (not shown), which presumably form a cys269 thioimidate adduct, do not appear to be even slowly reversible under these conditions. similarly, 2022 displayed irreversible inhibition of faah, consistent with their time-dependent, noncompetitive enzyme inhibition. interestingly, dialysis dilution at 4 c also did not restore enzyme activity with both the ,-unsaturated nitrile 19 and ester 18, which do not exhibit time-dependent faah inhibition and displayed concentration-dependent mixed competitive/noncompetitive kinetics in the lineweaver this suggests that their inhibition of faah following the 3 h incubation (22 c) is not reversible at 0 c. unfortunately, the reversibility of 18 and 19 at 23 c could not be established because of the instability of faah at 23 c over the dialysis time frame. faah mixtures illustrates reversible inhibition by 2 and establishes irreversible faah inhibition by 11, 14, and 1722. after 3 h preincubation of purified recombinant rat faah with compounds at concentrations that result in inhibition of ca. 80% enzyme activity (22 c; 3 h; 100 nm, 2; 80 nm, 11 and 14; 100 nm, 18 and 19; 150 nm, 20; and 80 nm, 21 and 22), and following measurement of residual enzyme activity, dialysis dilution (4 c, 18 h, 370-fold dilution) of the mixtures resulted in nearly full recovery of enzyme activity for 2 but little or no recovery of enzyme activity for 11, 14, and 1722 under the conditions monitored (4 c, ph 9); conducted in triplicate and reported as the percent enzyme inhibition sd. the selectivity of the time-dependent, irreversible faah inhibitors 17 and 2022 were examined along with 11 and 14 that were recently disclosed using activity-based protein profiling (abpp) of the serine hydrolases. abpp methods permit the testing of serine hydrolases in their native state and eliminate the need for their recombinant expression, purification, and the development of specific substrate assays. because inhibitors are screened against many enzymes in the proteome in parallel, both relative potency and selectivity can be simultaneously evaluated. previous studies have shown that the -ketoheterocycle class of inhibitors are selective for faah, although four enzymes have emerged as potential competitive targets: triacylglycerol hydrolase (tgh), hydrolase containing domain 6 (abhd6), monoacylglycerol lipase (magl), and the membrane-associated hydrolase kiaa1363. each inhibitor was tested for its effects on the fluorophosphonate (fp)-rhodamine probe labeling of serine hydrolases in the mouse brain (contains kiaa1363, magl, and abhd6) and heart membrane (contains tgh) proteome at concentrations ranging from 10 nm to 100 m. the selectivity assessments were conducted following 6 h inhibitor incubation with the proteomes and all inhibitors showed superb selectivity for faah over kiaa1363 and abhd6 (> 10-fold), excellent selectivity over magl (> 200-fold), and good selectivity over tgh (figure 8). abpp selectivity screen in mouse brain membrane proteome (1 mg/ml) with fp-rhodamine (100 nm), inhibitor preincubation with the proteome was conducted for 6 h. in initial efforts to screen for in vivo inhibition of faah and its subsequent pharmacological effects, the set of inhibitors displaying the time-dependent, irreversible faah inhibition (11, 14, 17, and 2022) were examined alongside of 2 for their ability to increase the endogenous levels of a series of lipid amide signaling molecules that are substrates for faah in both the brain (cns effect) and liver (peripheral effect, not shown). thus, the effects of the inhibitors on the endogenous levels of the faah substrates anandamide (aea), oleoyl ethanolamide (oea), and palmitoyl ethanolamide (pea) were measured. notably, it is the increase in endogenous levels of anandamide and its subsequent action at cannabinoid (cb1 and cb2) receptors that are thought to be responsible for the analgesic and anti-inflammatory effects of faah inhibitors. administration of inhibitor in three mice per time point for an initial screen (30 mg/kg). significantly, increases in endogenous levels of anandamide in the brain requires>90% inhibition of faah for in vivo enzyme inhibition. with the exception of imidate 17, which matched the increased anandamide levels observed with 2 after 3 h, each of the additional inhibitors proved to be roughly equivalent (11, 14, and 20>21 and 22), increasing anandamide levels approximately 2-fold over that of 2 and approximately 3-fold over vehicle treatment (figure 9)., 30 mg/kg, n=3). with pea and oea, which show significant enhancements in endogenous levels with partial enzyme inhibition and are less sensitive to the extent of faah inhibition, all of the inhibitors that displayed time-dependent, irreversible faah inhibition matched or exceeded the activity of 2, producing elevations of 312-fold over vehicle. of these as a result, more detailed dose- and time-dependent studies of 11 and 14 were conducted as reported elesewhere. the results of these studies revealed that they cause accumulation of all three lipid amides in the brain with peak levels achieved within 1.53 h, that these elevations exceed those achieved with the reversible inhibitor 2, that these elevations are maintained >6 h (vs 23 h for 2), consistent with irreversible enzyme inhibition, and that they exhibit long acting in vivo activity in a mouse model of neuropathic pain. the design, synthesis, and characterization of -ketoheterocycles that additionally target the remote cys269 nucleophile found in the cytosolic port of faah provided inhibitors that slowly react with the enzyme nucleophile, effectively providing time-dependent, irreversible inhibitors of the enzyme that maintain or enhance their selectivity for faah over other serine hydrolases. the electrophiles capable of targeting cys269 were incorporated as a c5 substituent on the pyridyl group of the 5-(pyrid-2-yl) oxazole of 2 and ranged from the reactive benzylic bromide 11 to the otherwise benign nitrile 14. the irreversible inhibitors of faah displayed an expected sensitivity to the position of the electrophile introduction, but those that were successful exhibited surprising trends in apparent reactivity toward cys269 that would not be easily predicted. a preliminary in vivo characterization of the identified irreversible faah inhibitors confirmed their ability to raise endogenous brain levels of the enzyme substrates, including anandamide, in mice to a greater extent (> 2-fold) and for a longer duration (> 6 h) than the reversible -ketoheterocycles on which they are based. two of these (11 and 14) were characterized in greater detail, as reported elsewhere, along with their long acting in vivo efficacy in a mouse model of neuropathic pain. c-labeled oleamide was prepared from c-labeled oleic acid as described. the truncated rat faah (rfaah) was expressed in e. coli and purified as described, and the purified recombinant rfaah was used in the inhibition and reversibility assays unless otherwise indicated. the purity of each tested compound (> 95%) was determined on an agilent 1100 lc/ms instrument using a zorbax sb-c18 column (3.5 mm, 4.6 mm 50 mm, with a flow rate of 0.75 ml/min and detection at 220 and 253 nm) with a 1098% acetonitrile/water/0.1% formic acid gradient (two different gradients). the enzyme reaction was initiated by mixing 1 nm rfaah (800, 500, or 200 pm rfaah for inhibitors with ki 12 nm) with 20 m c-labeled oleamide in 500 l of reaction buffer (125 mm triscl, 1 mm edta, 0.2% glycerol, 0.02% triton x-100, and 0.4 mm hepes, ph 9.0) at room temperature in the presence of three different concentrations of inhibitor. the enzyme reaction was terminated by transferring 20 l of the reaction mixture to 500 l of 0.1 n hcl at three different time points. the c-labeled oleamide (substrate) and oleic acid (product) were extracted with etoac and analyzed by tlc as detailed. burk kinetic analysis was performed as described, confirming competitive, reversible inhibition for 5, 16, and 25 and noncompetitive inhibition for 11, 14, 17, and 2022 (figures 5 and 6). the reversibility of faah inhibition by 2, 11, 14, and 1722 was assessed by dialysis dilution using purified recombinant rfaah. the enzyme was placed in 15 ml of faah assay buffer (125 mm tris, 1 mm edta, 0.2% glycerol, 0.02% triton x-100, and 0.4 mm hepes, ph 9.0). the dialysis experiment was performed in the predialysis mix at or near the apparent ic80. the final assay inhibitor concentrations used were 100 nm, 2, 18, and 19; 80 nm, 11, 14, 21, and 22; and 150 nm, 20. samples were preincubated with the enzyme for 3 h at room temperature (22 c) before 300 l was removed and assayed in triplicate in a faah activity assay. the remaining sample (2.7 ml) was injected into a dialysis cassette employing a 10 000 mw cutoff membrane. the mixture was dialyzed against 1 l of pbs at 4 c on a stir plate for 18 h. the postdialysis faah activity was assessed by assaying 300 l samples taken from the dialysis cassettes in triplicate. faah activity is expressed as a percentage of vehicle-treated faah (dmso alone) and is shown in figure 7. mouse tissues were dounce-homogenized in pbs buffer (ph 8.0), and membrane proteomes were isolated by centrifugation at 4 c (100 000 g, 45 min), washed, resuspended in pbs buffer, and adjusted to a protein concentration of 1 mg/ml. proteomes were preincubated with inhibitors (10100 000 nm, dmso stocks) for 6 h and then treated with fp-rhodamine (100 nm, dmso stock) at room temperature for 10 min. reactions were quenched with sds-page loading buffer, subjected to sds-page, and visualized in-gel using a flatbed fluorescence scanner (mirabio). labeled proteins were quantified by measuring integrated band intensities (normalized for volume); control samples (dmso alone) were considered to have 100% activity. inhibitors were prepared as a saline emulphor emulsion for intraperitoneal (i.p.) administration by vortexing, sonicating, and gently heating neat compound directly in an 18:1:1 v/v/v solution of saline/ethanol/emulphor. male c57bl/6j mice (< 6 months old, 2028 g) were administered inhibitors in saline emulphor emulsion or an 18:1:1 v/v/v saline/emulphor/ethanol vehicle i.p. at a volume of 10 l/g weight. after the indicated amount of time (1, 3, or 6 h), mice (n=3 for each compound at each time point) were anesthetized with isofluorane and killed by decapitation. total brains (400 mg) and a portion of the liver (100 mg) were removed and flash frozen in liquid n2. animal experiments were conducted in accordance with the guidelines of the institutional animal care and use committee of the scripps research institute. tissue was weighed and subsequently dounce-homogenized in 2:1:1 v/v/v chcl3/meoh/tris ph 8.0 (8 ml) containing standards for lipids (50 pmol of d4-pea, 2 pmol of d4-aea, and 10 nmol of pentadecanoic acid). the mixture was vortexed and then centrifuged (1400 g, 10 min). the organic layer was removed, dried under a stream of n2, and resolubilized in 2:1 v/v chcl3/meoh (120 l), and 10 l of this resolubilized lipid was injected onto an agilent g6410b qqq instrument. lc separation was achieved with a gemini reverse-phase c18 column (5 m, 4.6 mm 50 mm, phenomonex) together with a precolumn (c18, 3.5 m, 2 mm 20 mm). mobile phase a was composed of 95:5 v/v h2o/meoh, and mobile phase b was composed of 65:35:5 v/v/v. the flow rate for each run started at 0.1 ml/min with 0% b. at 5 min, the solvent was immediately changed to 60% b with a flow rate of 0.4 ml/min and increased linearly to 100% b over 10 min. this was followed by an isocratic gradient of 100% b for 5 min at 0.5 ml/min before equilibrating for 3 min at 0% b at 0.5 ml/min (23 min total per sample). the following ms parameters were used to measure the indicated metabolites in positive mode (precursor ion, product ion, collision energy in v): aea (348, 62, 11), oea (326, 62, 11), pea (300, 62, 11), d4-aea (352, 66, 11), and d4-pea (304, 62, 11). the capillary was set to 4 kv, the ionization source was set to 100 v, and the delta emv was set to 0. lipids were quantified by measuring the area under the peak in comparison to the standards (n=3 for each inhibitor at each time point).

a series of -ketooxazoles incorporating electrophiles at the c5 position of the pyridyl ring of 2 (ol-135) and related compounds were prepared and examined as inhibitors of fatty acid amide hydrolase (faah) that additionally target the cytosolic port cys269. from this series, a subset of the candidate inhibitors exhibited time-dependent faah inhibition and noncompetitive irreversible inactivation of the enzyme, consistent with the targeted cys269 covalent alkylation or addition, and maintained or enhanced the intrinsic selectivity for faah versus other serine hydrolases. a preliminary in vivo assessment demonstrates that these inhibitors raise endogenous brain levels of anandamide and other faah substrates upon intraperitoneal (i.p.) administration to mice, with peak levels achieved within 1.53 h, and that the elevations of the signaling lipids were maintained>6 h, indicating that the inhibitors effectively reach and remain active in the brain, inhibiting faah for a sustained period.

PMC3940414

pubmed-568

to introduce a case of iridoschisis patient who underwent cataract surgery successfully without pupil device. a 64-year-old female who showed iridoschisis of her both eyes underwent cataract operation at her right eye without a pupillary device. the preoperative and postoperative ophthalmologic examinations including visual acuity, intraocular pressure, reaction of anterior chamber, and degree of damage on iris was evaluated respectively. iris fibrils were held in place by ophthalmic viscosurgical device (ovd, sodium hyaluronate 3%-sodium chondroitin sulfate 4%, viscoat) that was injected into the anterior chamber. a small capsulorrhexis was made and the nucleus was delivered with low-power phacoemulsification, most of which was performed under the anterior capsule. there were no intraoperative complications such as tear of the iris, hyphema, loss of mydriasis, or rupture of the posterior lens capsule. the edema of corneal stroma and inflammation of anterior chamber was shown at immediate-postoperative period, but completely subsided 2 weeks later. in iridoschisis patients, there is a risk of aspiration of iris fibers during cataract surgery. with adequate use of ovd and careful modulation of surgical devices, a 64-year-old female presented with gradual loss of vision in the right eye (od) of one year duration. about six months ago, she had undergone intracapsular cataract extraction, anterior vitrectomy, and scleral fixation of intraocular lens (iol) in the left eye (os). at that time, the preoperative best corrected visual acuities (bcva) were 20/400 od, 20/30 os. the slit lamp biomicroscopy of both eyes (ou) showed clear cornea, deep and clear ac, and the angle was wide open. both eyes had splitting of the anterior layers of the iris with fibrillar degeneration extending from 3 to 6 o ' clock od, and from 4 to 6 o ' clock os. additionally, there was diffuse atrophy of iris from 11 to 1 o ' clock os (fig. the right eye showed nuclear and cortical cataract associated with posterior subcapsular cataract, and the left eye was pseudophakia. specular microscopy of the od revealed regular, hexagonal shape of endothelial cells without any abnormalities like bullae or guttae, and the endothelial cell count was 2865 cells/mm. pupil dilation is performed using 3 drops of tropicamide 0.5% and phenylephrine hydrochloride 0.5% at 5-minute intervals 1 hour prior to surgery. topical anesthesia was applied using alcaine and 3% lidocaine, and a paracentesis was done at 10 o ' clock. a 2.75 mm main clear corneal incision was performed using the keratome blade. a dispersive ophthalmic viscosurgical device (ovd), sodium hyaluronate 3%-sodium chondroitin sulfate 4% (viscoat, alcon) was injected through the clear corneal wound to stabilize the anterior chamber and protect the iris stroma by displacing aqueous from the ac and pushing the iris strands from the pupillary aperture. an anterior continuous curvilinear capsulorhexis not exceeding over the pupillary margin was performed using the 26 g needle and capsular forceps. after hydrodissection and hydrodelineation, careful phacoemulsification was performed (allergan sovereign phaco system, sov680330) for nucleus removal with special care not to touch the iris tissue. aspiration was used to clean residual cortical fibers from the capsular bag. when a loss of the protective effect of viscoelastic material was observed during surgery, the maximum limit of the vacuum was 300 mmhg and the aspiration rate, 20 cc/mmhg. the height of the irrigation bottle is maintained less than 60 cm to minimize the turbulence within the chamber. total us time was 48 seconds with a mean final rate of 10% of potency. the capsular bag was inflated with viscoelastics, and a single-piece acrylic intraocular lens (acry-sof sa60at, alcon) was inserted. the iol was safely placed in the capsular bag and centered, followed by aspiration of the residual viscoelastics. finally, bss carbacol (carbachol 0.01%, miostat) was used to constrict the pupil. postoperatively, the inflammatory response in the ac was moderate, some fibrillar materials were seen. the cornea showed some descemet folds, and the pupil was round and undamaged (fig. one week after surgery, the uncorrected visual acuity was 20/100 od, and improved to 20/30 on the two weeks postoperative day. there were traces of cells in the ac, but no fibrillar materials were seen (fig. the patient's last visit was 1 month after surgery when ucva was 20/40, and bcva 20/20. iridoschisis is a very rare condition resulting in one or more layers of the anterior iris surface. a localized area of iris stroma is cleaved in two with the anterior atrophic portion disintegrating into fibrils. the separated stromal fibers go through a degenerative process in which they detach and free float in the anterior chamber, creating a " shredded wheat " appearance. the condition primarily affects the inferior iris quadrants and rarely superior quadrants.9-13 glaucoma occurs in 50% of the cases and is of the angle closure type.15 whether iris changes are responsible or iridoschisis occurs more frequently in eyes that are predisposed to angle closure is unclear.16 while primary angle closure glaucoma has been implicated in iridoschisis formation, the affected fibers may bow forward, leading to anterior synechiae and angle closure glaucoma.5,6,14,15 in the present case, the anterior chamber angle was wide open and the iop were within normal limits. it is a matter of concern that the clinicians are prone to misdiagnose this condition, especially in the case with dark colored iris. there have been only three cases of report in 1990's.13,14 differential diagnosis must include axenfeld-reiger anomaly, ices, or other conditions which accompany the degenerative change of iris stroma. an abnormal corneal endothelium that migrates across the chamber angle on to the surface of the iris is the common feature of the ice syndromes.17 the iris in ices is usually atrophic rather than split, and peripheral anterior synechiae (pas) extends to schwalbe's line specular microscopy has shown the abnormal corneal endothelial cells, so called " ice cells ", which are pleomorphic and resemble corneal guttata. it occurs mostly unilateral and the clinical symptoms are presented earlier than iridoschisis (about 3 or 4 decades). there is hypoplasia of the iris stroma with filaments connected to abnormal peripheral cornea.18 in this case, the clinical features most coincidence with iridoschisis, rather than ices or axenfeld-reiger syndrome. the condition was bilateral and there was no pas or connection of iris fibrils with peripheral cornea. specular microscopy showed normal shape and count of corneal endothelial cells. considering that our patient had been diagnosed as bilateral ices before, there may have been other misdiagnosed and unreported cases. because iridoschisis is associated with aging, cataract is often a concomitant issue.2 the disorganized anterior layer of the iris and fibrillar material in the pupillary axis has a tendency to become drawn in by the suction of the i/a cannula and phaco tip during phacoemulsification. pupil dilation in these patients is also poor because this condition may be associated with pseudoexfoliation syndrome or atrophy of the pupillary margin.11 if the loose iris fibrils become drawn and entrapped in the aspiration port, there is a strong chance of complications like bleeding, iris tears, loss of mydriasis, and disruption of the blood-aqueous barrier.9 many methods have been tried to stabilize the iris fibers during cataract operation in the presence of iridoschisis. most of them are based on mechanical restraint of the disorganized iris using flexible iris hooks, iris retractors or pupil expanders, such as multiple iris hooks or graether pupil expander.2,9,11,12 these mechanical supports provide additional pupillary dilation, stabilize the capsule, and trap some of the fibers at pupillary margin during phacoemulsification. but these supportive devices can also induce strain and trauma to iris tissue resulting in increased inflammation after postoperative period. sometimes they lead to defects in the pupillary margin or to an atonic pupil.11 moreover, long, free-floating, torn fibers may not be trapped and may still extend over the rim into the surgical field.9 in withdrawing these instruments, iris fibers can be trapped in the stab incisions, and such fibers may act as an entrance for epithelial cells and micro-organisms.9 in this case, without mechanical restraint of iris, we minimized the iris trauma through the right choice of the viscoelastic material, careful manipulation of phaco tip or i&a cannula, and reducing the turbulence by using the minimum required fluidic parameters achieved with lowering the total phaco power and the height of the irrigation bottle. the allergan sovereign phaco system has a peristaltic fluidic pump system with vacuum range of 0~500 mmhg and flow range of 0~40 cc/min. the maximal fluidic parameters showed in the presented case were relatively lower than the values that had been usually set for conventional cataract surgery. viscoat has been known to have a very high dynamic viscosity at high shear rate. this property and a poor cohesion provide a better corneal endothelial protection during in vitro phacoemulsification. 19,20 although the removal time of ovd is longer with dispersive viscoat than other cohesive ovds (sodium hyaluronate 1.4%, healon gv, or sodium hyaluronate 1.0%, provisc),21 viscoat is less influenced by turbulent flow while cohesive ovds tend to be washed out suddenly which could result in sudden collapse of anterior chamber.21,22 furthermore, the cohesive ovd fragment behind the iol is exposed to too little turbulent flow to move towards the aspiration port unless the i&a tip is placed behind the iol or a special technique is used.23 a small capsulorhexis that did not extend vertically beyond the middle of the pupil was performed deliberately to allow he anterior capsule to act as an additional barrier between the iris and instruments. to protect the friable and disorganized iris from further damage, if a loss of the protective effect or the movement of iris fibril were observed, the ovd was injected additionally. the machine settings, including flow rate and vacuum limit, as well as port diameter are different between phacoemulsification needle and i/a tip. the former is related to the retention ability of ovds and the latter to removal property.23 although we were not able to manage the diameter of phaco or i&a tips, the minimum possible amount of us energy, bss flow rate and vacuum limit enabled the surgical procedures to be performed under safer environment. there was no iris trauma, intraoperative iris bleeding, or posterior capsular rupture during surgery. the corneal edema had disappeared by two weeks after surgery, and the ac inflammation had subsided after one month postoperatively. the final bcva od had improved from the preoperative one, from 20/400 to 20/20. this is a case which emphasizes the importance of exact preoperative diagnosis and differential diagnosis in iridoschisis. in the absence of proper clinical impression and proper preoperative preparation, our patient had been diagnosed as ices, and underwent icce, anterior vitrectomy and scleral fixation of iol on the contralateral eye (os). in conclusion, for iridoschisis is a very rare condition and easy to be confused with other diseases, one must consider this condition into differential diagnosis if the iris abnormalities are suspicious.

purposeto introduce a case of iridoschisis patient who underwent cataract surgery successfully without pupil device. methodsa 64-year-old female who showed iridoschisis of her both eyes underwent cataract operation at her right eye without a pupillary device. the preoperative and postoperative ophthalmologic examinations including visual acuity, intraocular pressure, reaction of anterior chamber, and degree of damage on iris was evaluated respectively. resultscataract surgery was performed under topical anesthesia through a clear corneal incision. iris fibrils were held in place by ophthalmic viscosurgical device (ovd, sodium hyaluronate 3%-sodium chondroitin sulfate 4%, viscoat) that was injected into the anterior chamber. a small capsulorrhexis was made and the nucleus was delivered with low-power phacoemulsification, most of which was performed under the anterior capsule. the iris came into contact with the ovds only and received no mechanical trauma. there were no intraoperative complications such as tear of the iris, hyphema, loss of mydriasis, or rupture of the posterior lens capsule. the edema of corneal stroma and inflammation of anterior chamber was shown at immediate-postoperative period, but completely subsided 2 weeks later. the visual acuity showed improvement from 20/400 to 20/30. conclusionsin iridoschisis patients, there is a risk of aspiration of iris fibers during cataract surgery. with adequate use of ovd and careful modulation of surgical devices, cataract surgery was successfully performed without using extra pupil-supporting device.

PMC2644092

pubmed-569

song et al.1 first reported the anterolateral thigh (alt) flap as a septocutaneous flap based on the descending branch of the lateral circumflex femoral artery (lcfa) in 1984. recently, the alt flap has become a popular option for soft tissue reconstruction of the oral cavity23. it is easily raised and has long and good caliber vascular pedicles with suitable vessel diameter, different tissues with large amounts of skin are available, and there is minimum morbidity at the donor site2. however, the alt flap has been criticized due to variations in vascular pedicles and perforator anatomy, making flap elevation challenging4. kimata et al.5 and kawai et al.6 reported anatomical variations in the alt flap in the japanese population and surgical concerns regarding dissection of the flap. valdatta et al.7 and yu8 reported flap characteristics in the western population. the alt flap is mostly supplied by one to three perforators of the descending branch of the lcfa. it can be located clinically by measuring the midpoint of a line drawn from the anterior superior iliac spine (asis) to the superolateral border of the patella. however, there is some variation in the location of these perforators. in addition, the oblique branch of the lcfa often runs between the descending and the squatransverse branches of the lcfa9. however, many reports have shown that harvested alt flap has more musculocutaneous perforators (up to 87%)13. in the present study, we investigated the surgical anatomy of the alt flap in a series of eight cases, focusing on the pattern of perforators and variation in pedicle course compared with previous studies. cases of reconstructive surgery using alt free flaps were enrolled from the database of all patients who underwent ablative surgery for oral and maxillofacial cancers from 2014 to 2015 in the department of oral and maxillofacial surgery in asan medical center (seoul, korea). eight patients were included in the study, and their medical records were carefully reviewed. demographic data included gender, age, pathological data, tumor stage, primary site, and whether adjuvant raidotherapy was performed. operative records were reviewed regarding flap size, thickness, pedicle length, and anastomosis of vessels. the number of perforators included in the skin peddle was counted, and the perforators feeding skin were investigated as to whether they ran through the septum in the vastuslateralis muscle (septocutaneous) or through the intramuscular portion (musculocutaneous).(fig. 1) yu8 and urken et al.10 noted that the course of the main pedicle in alt free flaps derived from three origins of the lcfa. variation in the pedicle course was recorded according to classification as types i, ii, and iii. in type i, the vascular pedicle derives from the descending branch of the lcfa, and that in type ii from the transverse branch of the lcfa. 2) we considered the pedicles of type iii unusable, as did yu8 and urken et al.10, due to the small caliber and short length. therefore, patients with type iii variation were excluded because it was not possible to use the alt flap. the study protocol was reveiwed and approved by the institutional review board of asan medical center (s2016-1056-0001). the mean age of patients was 61 years, and the male to female ratio was 4:4. the eight cases comprised six squamous cell carcinomas, one adenoid cystic carcinoma, and one osteosarcoma. (table 1) microvascular reconstructions with alt free flaps were performed for all surgical defects in the maxilla (five cases), buccal mucosa (two cases), and floor of the mouth (one case). (table 1) the mean flap size was 10.05.6 cm, and the mean thickness was 1.0 cm. lcfas were anastomosed with the facial artery in four cases, superior thyroid artery in two cases, and superficial temporal artery in two cases. in vein anastomosis, one or two venae comitantes were used, and recipient veins included the facial, superior thyroid, superficial temporal, external jugular, and branches of internal or external jugular veins.(table 2) all flaps successfully survived. although one case showed partial necrosis at the edge of flap, it did not affect the result of reconstruction. 3) type i pedicles were present in five patients, and type ii pedicles in three patients who needed intramuscular dissection for flap elevation. however, type iii pedicles, which are reported to occur in 1% to 5% of patients810, were not observed in the eight cases.(table 3) it has moderate thickness, low morbidity at the flap donor site, long pedicle length, and appropriate vessel diameter. in addition, a simultaneous two-team approach can be used, with the feasibility of two skin islands based on two separate cutaneous perforators28. with these advantages, the alt flap has become the workhorse for oral and maxillofacial reconstruction. in our serial cases, flaps of various sizes were elevated according to defect size in the oral and maxillofacial area, which ranged from 4 to 7 cm in width and 7 to 12 cm in length. harvested soft tissue of these sizes was considered adequate to cover most defects caused by resection of oral and maxillofacial cancers except in rare cases of a huge tumor mass that might be inoperable or should only be covered by a latissimus dorsi flap. in a study of alt flap characteristics in the western population by yu8, the mean flap thickness was 19.9 mm in women and 12.9 mm in men. nakayama et al.11 reported the average thickness of alt flap in asian population to be 7.1 mm, with intermediate thickness of subcutaneous fat compared to other free flaps used in oral and maxillofacial reconstruction such as the radial forearm free flap and rectus abdominis flap. the thickness of the harvested flap in our cases ranged from 0.6 to 1.5 cm (mean, 1.0 cm), which was comparable to the previous results. a flap thickness of about 20 mm might be the limit for use in soft tissue reconstruction of the oral and maxillofacial area, especially for the buccal mucosa and tongue except in total glossectomy. in our study, the maximum thickness of an alt flap was 1.5 cm. the thickness of the alt flap was considered appropriate for oral and maxillofacial defects regardless of gender. urken et al.10 reported that the vascular pedicle of alt flaps varied from 8 to 16 cm, although this could vary depending on patient stature, extent of proximal dissection of the lcfa, and location of skin perforators. the length of pedicles in alt free flaps might be not a limitation for reconstruction of oral and maxillofacial area. in our series, there were no problems related to pedicle length, even when used for large defects in the maxilla with microvascular anastomosis of the flap to neck vessels such as the facial, superior thyroid, and superficial temporal vessels. despite these many advantages, the complicated distribution of feeding perforators and the anatomical variation of pedicle courses in the muscular structures of the alt area yu8 reported that perforators are most consistently located around the midpoint of the reference line from the asis to the superolateral border of the patella. kimata et al.5 also reported that cutaneous perforators were concentrated near the midpoint of this reference line. chana and wei12 reported that the majority of skin perforators were located within a circle of 3 cm radius centered at this midpoint. xu et al.13 reported that at least one perforator was located in the inferolateral quadrant of this circle in 80% of cases. however, choi et al.2 reported that the cutaneous perforators were broadly distributed from 4/10 to 8/10 area between the asis and the superolateral border of the patella. in this study, the flaps in four cases included one perforator, and the flaps in the other four cases included two perforators. however, the number of perforators did not affect the survival or viability of the harvested flaps. we could find at least one main perforator in a circle of 3 cm radius centered at the midpoint of the reference line. feeding perforators can be classified into two categories: septocutaneous perforators, which were first reported by song et al.1, run in the intermuscular space, and musculocutaneous perforators penetrate the vastus lateralis muscle14. valdatta et al.7 reported that only five of 34 perforators identified were septocutaneous (14.7%). kimata et al.5 reported that 31 of 171 perforators (18.1%) were septocutaneous perforators. in 38 elevations of alt flaps from a total of 160 perforators in a cadaver study by choi et al.2, 28 perforators (17.5%) were septocutaneous and 132 perforators (82.5%) were musculocutaneous. similarly, xu et al.13 and zhou et al.15 reported that septocutaneous perforators were found in 40.8% of 42 cadavers and in 37.5% of 32 patients. these studies suggest that the blood supply of the alt flap is mostly derived from musculocutaneous perforators. therefore, a more refined surgical technique is required to dissect these perforators through the vastus lateralis muscle2. this additional procedure was time-consuming and cumbersome, but did not affect the design or size of flap that could be harvested. the second important consideration is the course of the main pedicle of the alt free flap. 2) in type i, the most common (90%), the descending branch sends off one to three cutaneous perforators to the flap. surgical dissection type ii accounts for 4% of the cases and requires tedious dissection to free the pedicle from the vastus lateralis along its entire length16., the alt flap can not be used for free tissue transfer, and the cutaneous perforator is a direct branch of the profundus femoris vessels. it pierces the rectus femoris muscle to reach the skin and is therefore more anteriorly located. because of the small caliber and short pedicle length, however, it has been reported that the flap could be converted to an anteromedial thigh flap1017. in our cases, the alt free flap could be used for reconstruction of various soft tissue defects, including those of relatively large size.. some anatomical variations, such as the distribution of perforator and courses of pedicles, might be a barrier for the application of alt free flap to various reconstruction cases. however, these problems can be overcome with an understanding of anatomical variation and meticulous surgical dissection. alt free flaps are considered reliable options for reconstruction of soft tissue defects of the oral and maxillofacial area.

objectivesto gain information on anatomical variation in anterolateral thigh (alt) flaps in a series of clinical cases, with special focus on perforators and pedicles, for potential use in reconstruction of oral and maxillofacial soft tissue defects. materials and methodseight patients who underwent microvascular reconstructive surgery with alt free flaps after ablative surgery for oral cancer were included. the number of perforators included in cutaneous flaps, location of perforators (septocutaneous or musculocutaneous), and the course of vascular pedicles were intraoperatively investigated. resultsfour cases with a single perforator and four cases with multiple perforators were included in the alt flap designed along the line from anterior superior iliac spine to patella. three cases had perforators running the septum between the vastus lateralis and rectus femoris muscle (septocutaneous type), and five cases had perforators running in the vastus lateralis muscle (musculocutaneous type). regarding the course of vascular pedicles, five cases were derived from the descending branch of the lateral circumflex femoral artery (type i), and three cases were from the transverse branch (type ii). conclusionanatomical variation affecting the distribution of perforators and the course of pedicles might prevent use of an alt free flap in various reconstruction cases. however, these issues can be overcome with an understanding of anatomical variation and meticulous surgical dissection. alt free flaps are considered reliable options for reconstruction of soft tissue defects of the oral and maxillofacial area.

PMC5104868

pubmed-570

techniques involving solid supports play crucial roles in the development of genomics, proteomics, and in molecular biology. however, solid-phase tools have been employed to a much lesser extent in glycobiology and glycomics. there are a number of classical methods for immobilization of mono- and oligosaccharides to commercially available matrices and supports. these methods have, for example, been used for the preparation of affinity columns with specific ligands. increased attention has been given to the development and application of magnetic separation techniques, which employ small magnetic particles. antibodies, dna/rna/oligonucleotide/aptamer binding proteins, albumin, hemoglobin, and enzymes have been purified by magnetic techniques. in our laboratory fe3o4 magnetite particles prepared by coprecipitating fe2 and fe3 with either dacron or a network of polysiloxane-polyvinyl alcohol, magnetic particles containing levan, a homopolysaccharide of fructose residues in 2, 6-glycosidic linkage, are proposed to purify lectins. the latter glycoproteins and/or oligomeric proteins are found in a diverse assortment of organisms and have the extraordinary property of binding specifically, reversibly, and noncovalently to carbohydrates. lectin-carbohydrate interactions are extensively studied in different scientific disciplines, from basic to applied natural and clinical sciences. such inter- and multidisciplinarity corroborates the importance to develop new methodologies for the study of lectin-saccharide interactions and the potential applications in clinical diagnostics. in the present work a composite of the carbohydrate levan and magnetite lectins complexed specifically to the composite were separated from other contaminant proteins by washing with a high ionic strength solution and obtained from composite with specific monosaccharide. the washing procedures were facilitated by the magnetic field and all process can be automated. the seed lectins from cratylia mollis (camaratu bean), cramoll [9, 10] and canavalia ensiformis (con a) were used as models. con a and potato lectin from solanum tuberosum have already been purified by magnetic techniques using dextran and chitosan as ligands, respectively. the aim of this work was to evaluate the use of zimomonas mobilis levans insolubilized and ferromagnetized (fmzag-12l), to purify fructose/specific lectins using lectin preparations of c. mollis seeds. cramoll 1, 4 and cramoll 1 were obtained through a previously established protocol from a c. mollis seed extract (10%, w/v) that was ammonium sulfate fractionated; fraction (f) 40 to 60% saturated (f4060) was affinity chromatographed in sephadex g-75 (cramoll 1, 4) followed by ion exchange chromatography in cm-cellulose (cramoll 1 and cramoll 4). cramoll 3 was also obtained from the above mentioned seed extract through a previously described protocol; the 0 to 40% ammonium sulfate fraction (f040) was molecular exclusion chromatographed in sephadex g-100. levan (l) was produced by zimomonas mobilis strain zag-12 (departamento de antibiticos, universidade federal de pernambuco, brazil) and abbreviated from now on as zag-12l. a solution containing fe and fe ions in a molar ratio of 1.1 m: 0.6 m was prepared from fecl36h2o and fecl24h2o in distilled water; 50 ml of 2% zag-12l in distilled water was then added and the ph was raised to 11.0 by adding drop wise 1 m nh4oh. mixture was then heated up to 85 3c and incubated for 30 minutes with vigorous stirring. the ferromagnetic levan obtained (fmzag-12l) was centrifuged 5 times to remove solid material. the product was dried for 24 hours at 50c, ground and kept at room temperature. aqueous suspensions of magnetic particles were prepared by coprecipitation of fe (iii) and fe (ii) in the presence of nh4oh and polymer. the protein content was carried out by lowry et al. using bovine serum albumin as standard, at a range of 0500 g/ml and absorbance reading at 720 nm. lectin sample solutions (50 l) were serially 2-fold diluted in 0.15 m nacl, in microtiter u-plates and incubated with of a 2.5% (v/v) suspension of glutaraldehyde treated erythrocytes from new zealand white rabbit (50 l). the titer, defined as the lowest sample dilution which showed hemagglutination, was established after 45 minutes incubation according to correia and coelho. hemagglutinating activity (ha) corresponded to the reciprocal titer. the ha inhibition (hai) was assayed by 2-fold serial dilution of lectin sample solutions (50 l) in 50 l of 200 mm levan or fructose solutions, followed by 15 minutes incubation and addition of erythrocyte suspension. h unidimensional spectra were recorded in a bruker drx 400 mhz (bruker, germany) with a triple resonance 5-mm probe. the lectins (1 ml) con a, cramoll 1, 4, cramoll 3, and f4060 were each incubated with fmzag-12l particles (1 ml containing 10 mg) for 2 hours at 4c, under constant agitation. afterwards, the magnetic particles were recovered by a magnetic field (6 000 oe) and supernatant was collected. the remaining unspecific bound proteins were eluted with 0.15 m nacl (1 ml) by recovering the magnetic particles under the magnetic field and collecting the supernatant. finally, adsorbed lectin was eluted with either 0.3 m d-glucose (con a and cramoll 1, 4) or d-galactose (cramoll 3 incubation) in 0.15 m nacl (1 ml) recovering the magnetic particles. the collected supernatants had their absorbancies at 280 nm and ha analyzed; page for native and basic proteins were performed according to reisfeld et al.. c. mollis (camaratu bean) is a native forage from the semi-arid region of pernambuco state, northeastern of brazil, and belongs to fabaceae family, taxonomically related with c. ensiformis species from which seeds are obtained con a. c. mollis seeds have been considered an important lectin source, giving multiple cramoll molecular forms with different carbohydrate specificities: cramoll 1, cramoll 2, and cramoll 4 are specific for glucose/mannose whereas cramoll 3 is galactose specific. a preparation containing cramoll 1 and cramoll 4 together (cramoll 1, 4) showed a higher hemagglutinating activity (ha) when compared with the isolated cramoll 1 and cramoll 4 as well as con a. these lectin preparations (cramoll 1, cramoll 4, and cramoll 1, 4) are inhibited by different carbohydrates (d-glucose, d-mannose, -d-methyl-mannoside, and d-fructose, among others) in distinct concentrations. cramoll 1, 4 and cramoll 1 were successfully used in different biological assays as well as in structural and electrochemical studies [1521]. the nmr analysis of zag-12l used in this work revealed a spectrum profile corresponding to the fructose residues protons. h nmr spectrum shows seven protons between 3.4 and 4.2 ppm indicating that the polysaccharide produced by z. mobilis was levan type with the linkage of (2 6) fructofuranoside (figure 1). no signals in the anomeric region (5.3 to 4.3 ppm) levans from erwinia herbicola, acetobacter xylinum, and bacillus subtilis (natto) showed the same structural characteristics analyzed by nmr. hai of cramoll 1, cramoll 1, 4, cramoll 3, and con a by fructose and levan revealed that all lectins presented ha inhibited by fructose and its polymeric derivative (table 1). however, inhibition of cramoll 1, 4 activity by the commercially acquired levan was less intensive. previous studies of this preparation specificity using different monosaccharides showed that d-fructose inhibited cramoll 1, 4 ha at the same d-mannose proportion. mo et al. reported that con a did bind to d-fructofuranosyl groups present in plant and microorganism levans whereas banana (musa acuminate) lectin reacted only with microorganism levans. it is important to observe that banana lectin and con a (structurally similar to cramoll 1) are both glucose/mannose specific. the inhibition of lectins by levans suggested that magnetized levan could be potentially used as an affinity matrix to investigate or purify lectins that recognize fructose. figure 2 shows the con a elution profile by using particles of ferromagnetic levan composite (fmzag-12l). proteins unspecifically bound to the particles were completely washed out with 0.15 m nacl from the 1st to the 8th washes (8 ml) and a second peak emerged after 0.3 m glucose addition at the 10-11th fractions. it is worthwhile to draw attention to the fact that equal profile was attained four times indicating its reproducibility and the reuse of the particles. this preparation containing both lectin isoforms was previously purified from c. mollis seed extract by ammonium sulfate fractionation and affinity chromatography in sephadex g-75. the particles washed with 0.15 m nacl again showed that from the 1st to 8th fraction (8 ml of washes) all unspecifically bound proteins were removed and a second peak emerged after 0.3 m glucose introduction. similar to con a purification this procedure was four times reproduced using the same fmzag-12l. the protein peak eluted at the 14th fraction showed two bands (cramoll 1 and cramoll 4) by polyacrylamide electrophoresis to basic and native proteins (figure 3(b)) similar to previously reported pattern. none specific binding to fmzag-12l was detected when cramoll 3 was used (data not shown). recently, the importance of protein-protein interaction has been pointed out in certain oligomeric lectins since differences among their quaternary organizations appear to be directly related to those among their functions. lectin binding sites have been deeply characterized by many workers to understand carbohydrate interaction of these versatile proteins [2729]. the evaluation of fmzag-12l to purify cramoll lectins from f4060 preparation is presented in figure 4(a). three different concentrations of the ammonium sulfate preparation per 10 mg of fmzag-12l were used: 1.8 mg/mg, 1 mg/mg, and 0.5 mg/mg of protein/mg magnetic particles. all concentrations showed a second protein peak (9th-10th fractions) eluted by 0.3 m glucose addition at the 8th washing with 0.15 m nacl. the polyacrylamide gel electrophoresis to basic and native proteins of the fraction (10th) collected from the 10 mg f4060 purification showed only cramoll 1 protein band (figure 4(b)). furthermore, the pure lectin cramoll 1 showed ha of 256 and was inhibited by all levans (table 1). the purification of this lectin is relevant due to its several applications such as neoplastic tissue marker. cramoll 1 showed a higher intensity of staining to transformed tissues than normal ones: also, encapsulation of cramoll 1 into liposomes produced an improvement in its in vivo antitumor activity against sarcoma 180 compared with free cramoll 1 solution. the lectin purification using only the ferromagnetic particles, namely, absent of levan, did not show any protein peak after 0.3 m glucose addition (control). it is interesting to notice that cramoll 4 was collected when a purified preparation was incubated with the fmzag-12l (figure 3(b)) but it was not obtained when a lesser purified preparation (f4060) was used (figure 4(b)). probably, higher amounts of cramoll 1 than cramoll 4 in preparation f4060 and/or different binding constant values for the magnetic levan-lectin can justify these discrepancies. furthermore, the ferromagnetic composite of levan is synthesized by a simple and inexpensive method. cramoll 1 was purified by this fast two-step procedure (ammonium sulfate fractionation and fmzag-12l affinity binding) instead of the laborious and time consuming three-step protocol previously described. finally, it is important to investigate if other polysaccharides could replace the levan in the composite synthesis and be used to lectin purification.

a simple and inexpensive procedure used magnetite and levan to synthesize a composite recovered by a magnetic field. lectins from canavalia ensiformis (con a) and cratylia mollis (cramoll 1 and cramoll 1, 4) did bind specifically to composite. the magnetic property of derivative favored washing out contaminating proteins and recovery of pure lectins with glucose elution. cramoll 1 was purified by this affinity binding procedure in two steps instead of a previous three-step protocol with ammonium sulfate fractionation, affinity chromatography on sephadex g-75, and ion exchange chromatography through a cm-cellulose column.

PMC2696615

pubmed-571

postoperative pulmonary complications are found to be associated with increased morbidity and mortality following abdominal surgeries. they also lead to additional health cost and prolonged length of hospital stay. according to the findings reported in an australian study, postoperative pulmonary complications are 13% prevalent and significantly prolong length of hospital stay. however, various rates of pulmonary complications had been reported in the literature due to lack of proper criteria for pulmonary complications. available evidences suggest that early postoperative mobilization following abdominal surgery contributes to improved lung volume which eventually reduces incidences of postoperative pulmonary complications [5, 6]. preoperative counseling regarding hospital stay and patient's role in recovery has proven to reduce anxiety, reduce length of stay, and have better compliance with postoperative care plan including early mobilization. eventually, preoperative counseling may contribute towards early mobilization that can reduce postoperative pulmonary complications following abdominal surgery. counseling regarding surgical procedures is commonly employed at every setup but less importance is given to additional counseling regarding postoperative management. this study aims at evaluating the effect of preoperative counseling regarding postoperative mobilization and its impact on reducing pulmonary complications in a developing world. the randomized control trial was conducted at the department of general surgery of a tertiary care hospital of karachi, pakistan, from september 2012 to march 2013. participants were recruited from outpatient clinic as well as from emergency department of the hospital. minimally invasive surgeries and patients whose score was>2 on the american society of anesthesiologist (asa) scale were excluded. moreover, patients who were smokers and had abnormal findings on x-ray were also excluded. every second patient who visited selected study setting was recruited in group i, whereas others were kept in group ii. group i received informed consent regarding surgical procedure as well as counseling related to early postoperative mobilization and its impact on surgical outcome, whereas group ii received information regarding surgical procedure only. to reduce biasness, senior residents who were not part of the study conducted these counseling sessions. explanation was given about nature of study, rights of study participants, privacy and confidentiality of participants, and rights of withdrawal from study. in addition, history of previous illness, comorbidity, and any barrier to early postoperative mobilization were assessed. both groups received counseling regarding nature of surgery and its complications, what to expect during hospitalization, postoperative pain management, and possible complications associated with surgery and anesthesia, whereas group i received additional information regarding postoperative mobilization and its impact. patients were encouraged and assisted to mobilize once they were fully awake, with stable blood pressure and pulse, no dyspnea on rest, and pain score of<8 on visual analogue scale. the time at which surgery ended and the time when patient first got out of the bed (bed to chair) were recorded. in addition, time from end of surgery to first mobilization of>10 minutes was also recorded. patients who had prolonged duration of surgery and who were smokers underwent chest physiotherapy and incentive spirometry with the help of physiotherapy staff. postoperative pulmonary complications following abdominal surgery were assessed via criteria of scholes et al. postoperative pulmonary complications are as follows.chest x-ray showing collapsed lung or consolidation.increased body temperature>38c for more than one consecutive postoperative day.sputum culture providing evidence of infection.productive yellow or greenish sputum.unexplained increased white blood cell count.abnormal breath sound on auscultation.diagnosis of pulmonary complication by physician. the criteria for postoperative pulmonary complications were reviewed from preoperative health status. in the current study, 2 participants in group i and 5 participants in group ii were excluded from study because of poor surgical outcomes. 1 participant from group i declined to continue further as part of the study because of low pain threshold. data from 113 participants from group i and 111 participants from group ii were analyzed. mean age of participants in group i was 36.70 8.69 years (median: 37 years, range: 38 years) with male to female ratio of 49: 64, whereas in group ii mean age of participants was 37.01 8.43 years (median: 38 years, range 33 years) with male to female ratio of 38: 73. there was no significant difference noted in mode of admission among these two groups (p=0.43). diagnosis of the patients and procedure performed in both groups were almost the same as shown in table 1. similarly, there was no significant difference in the duration of surgery (p=0.51) and pain score (p=0.32) among both groups. mean duration of surgery for group i was 64.91 mins (median: 65 mins, range: 75 mins), whereas for group ii it was 63.3 mins (median: 60 mins, range: 80 mins). similarly, participants in group i reported mean pain score on 3.8 (median: 5, range: 3) on given visual analogue scale (vas); however, mean pain score for participants in group ii was 3.9 (median: 4, range 5). on evaluating postoperative status of patients, significant difference was observed in participants of both groups in terms of early mobilization to bed to chair and upright mobilization for more than 10 minutes (p<0.001). patients in group i were mobilized earlier from bed to chair (mean: 342.9 mins, median: 340 mins, and range: 105 mins) in comparison to patients in group ii (mean: 1511.1 mins, median: 1500 mins, and range: 680 mins). likewise, patients in group i had earlier mobilization for more than 10 minutes (mean: 360.7 mins, median: 360 mins, and range: 125 mins) in contrast to patients in group ii (mean: 1570.5 mins, median: 1570 mins, and range: 680 mins). participants in group i who were early mobilized had fewer pulmonary complications (7.1%) compared to group ii who had 29.7% participants suffering from pulmonary complications. as shown in table 2, whoever fulfilled any three of the scholes et al. on exploring the impact of counseling and support from staff for physiotherapy from group i participants, the majority of them (68.14%) reported that counseling was very effective in providing them with motivation for early mobilization, as shown in table 3. the primary aim of this study was to evaluate effect of preoperative counseling along with physiotherapy support on facilitating early mobilization among patients undergoing abdominal surgery. the findings of current study revealed that early mobilization is not associated with type of abdominal surgery and its duration. likewise, previous study has also indicated no significant difference in length of anesthesia and mobility. postoperative early mobilization in combination with physiotherapy serves as a prophylaxis to reduce postoperative pulmonary complications. it has also been reported that change of position from supine to fowlers increases minute ventilation significantly. similarly, findings of current study revealed that delayed mobilization increases the risk of postoperative pulmonary complications as indicated by presence of fever, abnormal breath sounds, and cough. this finding supports that early mobilization can prevent postoperative complications associated with surgery. in line with findings of current study. moderate level of mobility also improves muscle strength and alleviates adverse effects of immobility. hence, optimal level of mobilization is desirable among surgical patients to prevent morbidity associated with inappropriate mobilization. in the current study, patients who were mobilized earlier reported that preoperative counseling and support of physiotherapy staff were effective. in line with the current study findings, the literature revealed that increase in physical activity can be achieved among preoperative patients via continuous support. postoperative physical activity interventions have also proved to be effective in providing better surgical outcome [14, 15]. one of the study findings revealed that preoperative instructions about exercise impact postoperative compliance with exercise. such preoperative cognition interventions have proved to be effective in increasing postoperative physical activity. moreover, in developing countries where literacy level is low such interventions can significantly affect outcome of abdominal surgeries. thus, preoperative counseling and support of physiotherapy staff can improve compliance with early mobilization which is proved to be effective in reducing postoperative pulmonary complications. early postoperative mobilization following abdominal surgery is proved to be effective in reducing pulmonary complications. in addition, preoperative counseling along with physiotherapy support can foster early mobilization among patients undergoing abdominal surgery. hence, counseling regarding early postoperative mobilization should be promoted among patients undergoing abdominal surgery to improve surgical outcome.

background and objectives. preoperative counseling is effective to foster early postoperative mobilization that reduces pulmonary complications following abdominal surgery. this study aims at evaluating the effect of preoperative counseling regarding postoperative mobilization and its impact on reducing pulmonary complications. design and setting. randomized control trial was conducted at the department of surgery of a tertiary care hospital, karachi. patients and materials. patients who underwent abdominal surgery and met inclusion criteria were recruited. all participants were randomly divided into two groups. both groups received information about the surgery and group i received additional counseling for postoperative mobilization. all patients were encouraged for postoperative mobilization. scholes et al. criteria were used to evaluate postoperative pulmonary complications. results. in total 232 participants were recruited and divided into two groups. there was no significant difference in participants ' age (p=0.79), duration of surgery (p=0.5), and pain score (p=0.1) of both groups. however, significant difference was identified in mobilization from bed to chair and mobilization for>10 minutes. patients in group i experienced less pulmonary complications in comparison with group ii.

PMC4897513

pubmed-572

cancer is universally recognized as the century s major health concern, and its mounting escalation during the past few decades and detrimental impact on all physical, emotional, spiritual, social, and economic aspects of human life have rendered experts concerned more than ever. of all types of cancer breasts are symbols of femininity and as such the majority of women find the prospect of losing them unthinkable. a woman s reaction to any kind of actual or suspected disease may include fear of deformity, loss of attraction, and death; consequently, breast cancer is indubitably horrifying to any woman. breast cancer treatments such as radiotherapy, chemotherapy, and surgery could cause serious physical and psychological side effects, making treatment programs and rules more difficult to follow. patients may, therefore, find it harder to adhere to the treatment protocol and inadvertently undermine the efficacy of the treatment, which could negatively impact their own life expectancy. at this stage, patients suffering from breast cancer are liable to complain of various kinds of problems such as sleeping disorders, high levels of anxiety, and reduced quality of life sometimes even 2 years after the initial diagnosis. since modern treatment methods have turned cancer on many occasions into an acute and often curable disease out of an incurable one, various aspects of cancer psychiatry such as reaction toward diagnosis and also treatment have become increasingly prominent. one dimension of human life is spirituality, which enables individuals to communicate and integrate with the universe. communication and integration endow hope and meaning to human life and elevate it beyond the confines of time and place. religious/spiritual group therapy is a form of psychotherapy drawing upon special principles and religious/spiritual techniques to empower patients to attain a nonmaterial understanding of self, universe, incidents and phenomena, and ultimately health and growth. the results of a research carried out by meraviglia under the title of effects of spirituality in breast cancer survivors on 84 women aged between 34 and 80 years suffering from breast cancer whose disease had been diagnosed 5 years earlier, along with his another study conducted on 60 patients aged between 33 and 83 years suffering from lung cancer, showed that patients should be encouraged to seek spirituality as an effective tool in dealing with physical and psychological responses to cancer. given the reach and influence of religious culture in iranian society, drawing upon religion as an important source of compatibility is anticipated. due to the lack of research evidence in this domain in our country, the present study was conducted to investigate the efficiency of spiritual group therapy in enhancing patients well-being and spiritual health. the present research was a quasi-experimental project of pretest-posttest type with a control group carried out between march and june 2011, in collaboration with shiraz university of medical sciences. the study population was selected from among patients referring to amir hospital and omid hospital. for the purpose of this research, among a large number of patients suffering from breast cancer and aged between 18 to 65 years, 24 individuals were selected after clinical interviews through the available sampling method. all the 24 participants were tested using the research tools, comprising structured clinical interview for dsm-iv (scid-i), quality-of-life questionnaire (whoqol-26), and spiritual health scale (swb-20). the test group members thereafter received 12 sessions of group spiritual treatment (table 1), whereas the control group members did not receive any kind of treatment until the test group members were fully treated and the second group of questionnaires was collected. treatment sessions in brief the inclusion criteria for the present research were as follows: having elementary education and literacy levelbeing at least 18 and at most 60 years of agenot having the diagnostic criteria for clear psychiatric disorders such as psychosis, major depression, obsessive-compulsive disorder, and personality disorders based on the scid-i conducted by the researcher having elementary education and literacy level being at least 18 and at most 60 years of age not having the diagnostic criteria for clear psychiatric disorders such as psychosis, major depression, obsessive-compulsive disorder, and personality disorders based on the scid-i conducted by the researcher subsequently, all the participants under test completed the research questionnaire in 2 rounds. the test group participated in the 12 group-treatment sessions in the form of a 120-minute session in a week. from the 24 participants, 43% were 50 and 57% under 50 years old, while 21% were single and 79% were married. apropos education, 37.5% of the study population were below the high school diploma, 50% had a high school diploma, and 12.5% had college education. also, 65% of the participants in each group underwent chemotherapy or there were significant differences in quality of life and some of its dimensions (psychological and social dimensions) between the 2 groups following the spirituality group-therapy sessions among the experimental subjects. however, as regards the physical dimension, no significant difference was observed between the 2 groups after the therapy sessions. comparison of the results of the statistical analysis of covariance at pretest and posttest in the experimental and control groups the eta-squared in this table shows that 39%, 5%, 26%, and 2% of the changes in the scores of quality of life, physical, psychological, and social aspects were created by the implementation of our treatment method. with respect to the spiritual health dimension additionally, 36%, 2%, and 38% of the changes in these variables were caused by the implementation of our treatment method. as is demonstrated in table 3, there was no significant difference in the social aspect of quality of life between the 2 groups. in parallel with the findings of the present research, it has been previously observed that religiosity and spirituality can play a significant role in enhancing quality of life among patients with cancer. abedi et al. suggested that prayers and religious practices could affect not only emotional moods but also physical quality and that such practices could sometimes improve a patient with physical disease in a few moments or in a few days. quing, mccola, and larson also reported that many of their patients acknowledged the positive effects of religion on their mental and physical health. concluded that spiritual/religious group therapy could generally be effective in mental improvement in patients with schizophrenia. rocha and falek concluded that spirituality and religion could have no impact on the social dimensions of quality of life. prayer reduces anxiety, promotes spirituality, and is an appropriate method for coping with diseases. in a research conducted by hojjati et al., a direct relationship was reported between prayer and well-being: more prayer was correlated with better health.one study probed into well-being, religious adaptation, and quality of life among african-american women who had undergone treatment for breast cancer and reported that the women who probed into well-being and religious adaptation had more positive adaptation and that there was a meaningful relationship between spiritual well-being, physical and emotional aspects of quality of life, and performance health. askari et al. posited that religious beliefs and optimism were predictors of spiritual health. spiritual and religious beliefs and practices are effective in promoting adaption to cancer by affecting existential concerns such as the search for the meaning of life and hope. today, faith and spirituality are regarded as some of the most significant sources of physical health and quality of life. evidence shows that spiritual interventions could be helpful in preventing or improving an extensive range of physical problems and coping with acute pains, diseases, and death. various studies have confirmed a meaningful relationship between spirituality and religion and quality of life, spiritual well-being, and meaning of life. our results revealed that spiritual group therapy enhanced quality of life and its psychological and social dimensions as well as spiritual well-being and its religious and existential aspects. furthermore, there is a great deal of evidence indicating that religion is a protective factor against depression and that it facilitates recovery. prominent among the salient points of spiritual group therapy is that it can improve the patient s attitude toward life or disease. the importance of stressors is determined through cognitive evaluations under the influence of beliefs and personal values such as self-control and existential and spiritual beliefs. individuals make use of available resources and various coping strategies in order to manage their stress. based on this standpoint, it can be argued that values affect significant cognitive evaluations in the process of dealing with a problem; thus, spirituality can help individuals assess negative events in different ways. hence, spirituality offers a stronger sense of control and herewith leads to more psychological compatibility. the second factor that should be taken into account is the coordination of therapy sessions in groups. in addition, when surrounded by others afflicted with the same problem, the individual does not consider the problem as something exclusive and tends to become more hopeful. the third factor of note is the particular characteristics of patients suffering from cancer and some national and cultural features of our society. conflicts, diseases, and severe traumas usually drive individuals away from their routine course of life and make them aware of temporary values and goals. individuals in such situations need some tool to seek more long-lasting goals and values. experts believe that spirituality is described and formed by acceptable actions and beliefs in a certain culture. the fourth noteworthy factor in regard to spiritual group therapy is related to some procedures and techniques and also the impact of prayer, benediction, and communication with god. essa zadegan reported that therapeutic metaphor could be an innovative method whereby patients utilize their power of imagination to achieve better insight. the therapist had inadequate experience in treating patients suffering from cancer via group therapy and spiritual therapy. according to our patients statements as well as the results of our statistical analyses, spiritual group therapy could be deemed a suitable method for treating disorders such as depression and promoting the quality of life as well as the religious and existential dimensions of spiritual health in patients suffering from breast cancer.

cancer is deemed the century s major health problem, and its increasing growth during the last decades has made experts concerned more than ever. of all types of cancer, breast cancer is regarded as the second most common disease among women. the aim of this study was to determine the effectiveness of spiritual group therapy on quality of life and spiritual well-being among patients suffering from breast cancer. the present research was carried out between march and june 2011. the sample consisted of 24 participants randomly assigned to 2 groups: an experimental group (n, 12) and a control group (n, 12). all the subjects completed questionnaires on quality of life and spiritual well-being in pretest and posttest. the experimental group received 12 sessions of spiritual group therapy. the results demonstrated improvement in quality of life and spiritual well-being in the experimental group. in conclusion, spiritual group therapy can be used to improve quality of life and spiritual well-being (religious health and existential health) among patients with breast cancer.

PMC4764964

pubmed-573

breast cancer, as the most common malignancy, is the major cause of cancer-related deaths of women worldwide [1-3]. age plays a critical role in the incidence of this type of cancer, as it has been found that young breast cancer patients have worse outcomes than older premenopausal or postmenopausal patients. a large number of studies point out the fact that the survival rates in patients aged up to 34 years is very poor. data suggest that hormonal mechanisms may play key roles in this age prognosis relationship, as the difference in survival patterns between age groups were seen only in patients with hormone receptor positive tumors and not in those with hormone receptor negative tumors. epidemiological data have shown that the incidence of breast cancer in women is closely related to a high fatty diet. furthermore, breast cancer cells have significant lipogenic capacity, and inhibition of fat metabolism in these cells is associated with their growth arrest and apoptosis. breast cancer treatment involves surgery, chemotherapy, radiation therapy, hormonal therapy, or combination therapy. breast cancer tumors, which are estrogen/progesterone receptor (er/pr)-positive, are 60% more likely to respond to hormonal therapy, whereas er/pr-negative tumors show only 5% to 10% response to hormonal therapy. hormonal therapies for breast cancer are usually done after surgery, chemotherapy, and/or radiotherapy. this therapy is designed to help prevent the recurrence of the disease by blocking the effects of estrogen. tamoxifen, a drug taken by some women for up to 5 years after the initial treatment of breast cancer, helps in preventing the recurrence of tumor by blocking the ers on breast cancer cells. the role of hormonal therapy drugs is to slow down the growth rate of cancer cells, which are growing in response to the presence of estrogen and its receptor. nearly 60% of all cancer patients are treated with radiation, either alone or in combination with surgery and chemotherapy [10-12]. unfortunately, the efficacy of conventional radiotherapy is limited by 1) the presence of hypoxic, intrinsically radio-resistant, and repair-proficient tumor cells; 2) genetic, metabolic, and microenvironmental heterogeneity of tumors; and 3) undesirable damage to the normal healthy tissues. therefore, significant improvement in therapeutic efficacy can be achieved only by developing effective approaches based on a comprehensive understanding of the radiobiology of the tumor and normal tissues, to selectively enhance the radiation damage in tumors while reducing the damage to normal tissues. however, some cancer cells are intrinsically resistant to ionizing radiation induced damages, and such a treatment can actually induce tumor cell proliferation and repopulation, resulting in a diminished response to radiation and poor tumor local control. more important, hypoxia has been associated with drug resistance and reduced sensitivity to radiation therapy, partly because of the upregulation of hypoxia inducible factor 1 (hif-1) and activation of survival molecules such as akt and nuclear factor kappa-light-chain-enhancer of activated b cells (nuclear factor-b). therapeutic resistance associated with hypoxia is a significant problem in the clinical treatment of cancer, and inhibition of glycolysis may provide a novel approach to overcoming such a resistance. in fact, some studies showed that, under hypoxic conditions, cells exhibited increased sensitivity to the glycolytic inhibitor, 2-deoxy-d-glucose (2-dg). hexokinase, the first enzyme in the glycolytic reaction, may be the key regulator in 2-dg induced apoptosis, as it causes glucose to undergo metabolism (figure 1). recently published data support the role of hexokinase activity in the prevention of apoptosis mediated by akt. it is also unregulated by hif and, therefore, the cell may become more resistant as there are more enzymes to be inhibited by a given amount of 2-dg. accelerated glucose uptake during anaerobic glycolysis (warburg effect) [14-17,20-26], and loss of regulation between glycolytic metabolism and respiration, are the major metabolic changes found in malignant cells. in general, cancer cells have increased rates of glycolysis as well as pentose-phosphate cycle activity and slightly reduced rates of respiration. enhanced glucose uptake and glycolysis in tumors arise as a result of multiple reasons including oncogenic transformation-linked alterations in gene expression, mitochondrial mutations, and hypoxia in the case of solid tumors, which result in enhanced levels and activities of glucose transporters and glycolytic enzymes. studies have shown that glucose deprivation can induce cytotoxicity in transformed human cell types via metabolic oxidative stress. in addition, transformed human cell types appear to be more sensitive to glucose deprivation induced cytotoxicity and metabolic oxidative stress than non-transformed human cell types. glucose analogues have been found to profoundly inhibit glucose metabolism in cancer cells in vitro and in vivo. of the many glucose analogues that have been investigated, 2-dg has been proven to be the most effective in inhibition of cell metabolism and adenosine triphosphate (atp) production. 2-dg is a structural analogue of glucose differing at the second carbon atom by the substitution of hydrogen for a hydroxyl group (figure 2a) and appears to selectively accumulate in cancer cells by metabolic trapping because of increased uptake, high intracellular levels of hexokinase or phosphorylating activity, and low intracellular levels of phosphatase (figure 2b). once inside the cell, 2-dg is phosphorylated by hexokinase to 2-deoxy-d-glucose-6-phosphate (2-dg-6-p). therefore, once formed, 2-dg-6-p is not further metabolized, and, therefore, the output from glycolysis and the pentose phosphate pathway gets reduced, and 2-dg-6-p will accumulate in the cell until dephosphorylated by phosphorylase [16-18,23]. cellular processes leading to the error-free repair and fixation of dna lesions require a continuous flow of metabolic energy, which is frequently supplied by enhanced glycolysis in cancer cells. however, in normal cells, the respiratory pathway is the major contributor to energy (atp) production. two properties of 2-dg, namely, the inhibition of glycolysis and the preferential accumulation in cancer cells, have formed the basis for further investigating the mechanism of 2-dg for its use as an antitumor agent. it has been speculated that, cancer cells, which are initially treated with 2-dg, exhibit a stress response caused by a depletion of intracellular energy. the stress response results in increased levels of glucose transporter expression and increased glucose uptake, which allow more 2-dg to enter the cell. as a consequence of high intracellular 2-dg concentrations, hexokinase and hexose phosphate isomerase are inhibited; energy stores such as atp are further depleted; and finally, the cell activates the cell death pathway. in addition, increased pro-oxidant production and profound disruptions in thiol metabolism consistent with metabolic oxidative stress were also noted in cancer cells during glucose deprivation or when treated with the glucose analogue 2-dg. however, malignant transformation of cultured cells with oncogenes or oncoviruses results in an absolute increase in the amount of glucose transported into the cell. this is mediated by transcriptional activation of the glut1 glucose transporter gene resulting in increased levels of glucose transporter mrna and protein. glut1 protein expression is increased in cancer cells and has been reported to increase during cellular stress and also during glucose deprivation. studies have shown that the cytotoxic effect of 2-dg is heterogeneous among different tumor cell lines. while profound growth inhibition and cell death have been found in some cells, a marginal effect on growth and clonogenicity a number of factors contribute to these two diversified responses, which includes the extent of glucose dependence and glycolysis, energy deprivation in the form of atp depletion and imbalance in the oxidative stress (mitochondrial metabolism), levels of glucose transporters, c-myc status, p53, and p21 status, and the levels of apoptosis regulating b-cell lymphoma (bcl) family of proteins, particularly the bcl2/bcl-2-associated x protein (bax) ratio. the cytotoxic effects of 2-dg are found to be higher under hypoxic conditions and the knockdown of hif-1 significantly enhances the sensitivity of cells under hypoxia to 2-dg, suggesting that inhibition of hif-1 may improve the clinical efficacy of glycolytic inhibitors such as 2-dg. 2-dg has been found to be more toxic to tumor cells grown as spheroids (which develop microregions of hypoxia) when compared to monolayer cultures (mlcs). cell death, induced by 2-dg, could be either apoptotic or necrotic depending on the cell type and environmental factors. while the induction of apoptosis has been found in c-myc overexpressed cells, enhanced apoptotic death has been reported in drug-resistant human carcinoma cells (kb-dr) that could be linked to overexpression of glut receptors induced by 2-dg. it has been shown that induction of apoptosis by 2-dg has been independent of bcl2, and cytotoxic effects of 2-dg do not correlate with p53 status. susceptibility of p53 overexpressing cells to 2-dg is reduced by higher levels of catalase or glutathione peroxidase suggesting that the mechanism underlying enhanced cell killing by 2-dg in p53 overexpressing cells involves oxidative stress. glucose and oxygen are potent regulators of glycolytic enzyme gene transcripts and, therefore, genetic alterations other than c-myc activation are also expected to sensitize transformed cells to glucose deprivation. furthermore, glucose by itself stimulates transcription of gene encoding glycolytic enzymes through the carbohydrate response element (chore), a cacgtg motif, which has the same sequence as the core binding site for c-myc. analyzing the radiomodifying effects of 2-dg observed in several tumor cell lines reveal that the time of administration of 2-dg with respect to irradiation plays a critical role in determining the effects. sensitization is generally found to be higher when 2-dg is added either just before (< 5 minutes) or immediately after (< 5 minutes) irradiation, is present in the incubating medium for 2 to 4 hours. it has also been shown that the presence of the glycolytic inhibitor, 2-dg, for a few hours after irradiation can selectively inhibit the post irradiation repair processes in cells with high rates of glycolysis, such as cancer cells, thereby enhancing the damage caused by radiation. alterations in the expression of many genes involved in damage response pathway including dna repair and apoptosis, transcriptional regulators, cell signaling, besides energy metabolism have been reported, which can significantly influence the radiosensitization of tumor cells. a great degree of heterogeneity in the 2-dg-induced modifications in radiation responses has been observed among the various human tumor cell lines that does not correlate well with the extent of decrease in the energy status (atp levels), suggesting thereby that other disturbances caused by 2-dg also play important roles in the modifications of cellular responses to damage caused by radiation and chemotherapeutic drugs. these include (but are not restricted to) level of glucose transporters (glut1 and glut2), prosurvival and prodeath regulators, namely, c-myc, ras, p53, p21, bcl2/bax ratio, and so on, and imbalances in the oxidative stress. the degree of radiosensitization by 2-dg in multicellular tumor spheroids (mts) generated from human glioma cell line (bmg-1) was found to be nearly 2.5-fold higher than in the mlcs, which correlated with the enhanced glycolysis in mts, and with the role of synergy between endogenous oxidative stress related to tumors and induced metabolic oxidative stress. many studies suggested that 2-dg enhances the damage caused by chemotherapeutic drugs and ionizing radiation selectively in cancer cells while reducing the damage to normal cells. 2-dg sensitizes cancer cells to radiation through mechanisms such as inhibiting dna repair processes and recovery from potentially lethal damage. however, despite of several past attempts to test the role of 2-dg in radiation therapy, only one clinical trial study on human cerebral gliomas has demonstrated that 2-dg improves the efficacy of radiotherapy. radiosensitization has also been suggested to be due to disruption of thiol metabolism resulting in oxidative stress-related cell death in the form of apoptosis. it is pertinent to mention here that an inappropriate design of protocols may in fact reduce the efficacy of primary therapeutic agents by 2-dg as has been reported for a combination of radioimmunotherapies. treatment of human breast cancer cell lines with 2-dg results in the cessation of cell growth in a dose dependent manner. however, evaluation of glucose usage, lactate production, and energy status could be useful for predicting the responses of tumors to the combined treatment of radiation and 2-dg. 2-dg acts synergistically with specific chemotherapeutic agents in causing cell death, and the class of chemicals that are most sensitive appears to be those that cause dna damage [19-21,23]. furthermore, 2-dg has been shown to inhibit the transcription of human papilloma virus, suggesting it to be an ideal adjuvant for enhancing the efficacy of chemotherapy in the treatment of drug-resistant cervical cancers. 2-dg also enhanced the cytotoxicity of cisplatin and doxorubicin. according to the results of some studies, it has been proposed that 2-dg may be a good chemosensitizer for chemoresistant patients as it alters reactive oxygen species (ros) or redox state and sensitizes the cells to further damage caused by chemo agents. it was found that the combination of 2-dg and doxorubicin have a significant cell killing capability in rapidly dividing cells (such as t47d breast cancer cell line) compared with 2-dg or doxorubicin alone, whereas no effect was seen in slowly growing cells (such as mcf-7 breast cancer cell line). 2-dg has shown promising results as an adjuvant of radiation therapy and chemotherapy both in vitro and in vivo. cancer cells, in contrast, have lost responsiveness to most external growth signal, and as a consequence, nutrient supply in the form of glucose likely plays a unique role in maintaining cancer cell viability. thus, normal and transformed cells respond to nutrient depletion or glucose deprivation in opposing manners. whereas normal cells compensate by increased glucose transporter expression or modification, transformed cells are stressed by glucose-deprivation leading to the expression of an array of stress related genes, which is subsequently followed by cell death. in many normal cell types, glucose deprivation results in an increase in the maximum velocity of glucose transport this has been attributed to one of several mechanisms; translocation of transporter from an intracellular compartment to the plasma membrane, changes in the glycosylation pattern of the glut1 transporter with decreased turnover of the protein, or by increased synthesis of mrna and protein. when glycolysis is inhibited, the intact mitochondria in normal cells enable them to use alternative energy sources such as fatty acids and amino acids to produce metabolic intermediates channeled to the tricarboxylic acid cycle for atp production through respiration. as such, cells with normal mitochondria 2-dg produced a four to five fold greater effect in anaerobically growing cells than in aerobically growing cells. consequences of glycolysis blocking is different in aerobic versus hypoxic cells. in the aerobic cell, if glycolysis is inhibited by 2-dg, atp can not be generated by this pathway. however, since o2 is available to the mitochondria, amino and/or fatty acids can act as energy-providing carbon sources for oxidative phosphorylation (oxphos) to take place, producing atp. in contrast, when glycolysis is blocked in the hypoxic cell the other carbon sources can not be used by mitochondria as o2 is unavailable and consequently oxphos can not take place. thus, when glycolysis is blocked in the hypoxic cell, it has no alternative means for generating atp and, therefore, will eventually succumb to this treatment. in general, cancer cells exhibit increased glycolysis and pentose-phosphate cycle activity, while demonstrating only slightly reduced rates of respiration. initially these metabolic differences were thought to arise as a result of " damage " to the respiratory mechanism, and tumor cells were thought to compensate for this defect by increasing glycolysis. however, if cancer cells increase glucose metabolism to form pyruvate and nicotinamide adenine dinucleotide phosphate (nadph) as a compensatory mechanism, in response to ros formed as byproducts of oxidative energy metabolism, then inhibition of glucose metabolism would be expected to sensitize cancer cells to agents that increase levels of hydroperoxides (i.e., ionizing radiation and chemotherapy agents such as quinones that are known to the redox cycle and produce ros). although it is not possible to deprive cells of glucose in vivo, it is possible to treat tumor-bearing animals and humans with 2-dg, a relatively non-toxic analogy of glucose that competes with glucose for uptake via the glucose transporters as well as being phosphorylated by hexokinase at the entry point to glycolysis. competition between 2-dg and glucose is thought to cause inhibition of glucose metabolism, thereby creating a chemically induced state of glucose deprivation. although there are reports that the phosphorylated form of 2-dg (2-dg-6-p) can proceed through the first step in the pentose cycle (glucose-6-phosphate dehydrogenase) leading to the regeneration of one molecule of nadph, 2-dg-6-p appears to be incapable of further metabolizing in the pentose cycle as well as incapable of metabolism to pyruvate. ahmad et al. have shown that administration of 2-dg to mice could be an effective way to inhibit glucose metabolism without causing toxicity until very high levels are achieved (lethal dose 50 2 g/kg body weight) and could be tolerable in humans when administered up to 200 mg/kg. therefore, using 2-dg as an inhibitor of glucose metabolism in vivo may provide a very effective addition to multi modality cancer therapies designed to limit hydroperoxide metabolism for the purpose of enhancing radio- and chemosensitivity in human cancers. singh et al. have shown that the growth rate of rapidly dividing du145 prostate cancer cells depend on high levels of glucose consumption, whereas the growth rate of relatively slow-growing lncap cells are much less dependent on glucose. they found a direct correlation between glycolytic capacity and degree of growth inhibition in response to glucose deprivation for these two cell lines. their results are also consistent with earlier studies that showed a direct relationship between glycolytic capacity and growth rate for several rat hepatoma tumors, and lend further support to the hypothesis that high glucose consumption is required for rapid proliferation of most cancer cells. have also showed that increased aerobic glycolysis is a hallmark of cancer and that inhibition of glycolysis may offer a promising strategy to preferentially kill cancer cells. they proposed that trastuzumab to have remarkable efficacy in treatment of avian erythroblastosis oncogene b2 (erbb2)-positive breast cancers when used alone or in combination with other chemotherapeutics. in their study, it is suggested that trastuzumab has antitumor effects in combination with glycolysis inhibitors in erbb2-positive breast cancer by inhibiting glycolysis via downregulation of heat shock factor 1 (hsf1) and lactate dehydrogenase a (ldha) in erbb2-positive cancer cells, resulting in tumor growth inhibition it is understood that glucose metabolism appears to be involved in the detoxification of intracellular hydroperoxides, and other authors have suggested that tumor cells demonstrate increased intracellular hydroperoxide production. it is proposed that the extent to which tumor cells increase their metabolism of glucose is predictive of tumor susceptibility to glucose deprivation induced cytotoxicity and oxidative stress. therefore, when deprived of glucose using inhibitors of glycolytic metabolism (i.e., 2-dg), tumor cells with high glucose utilization will be more sensitive to cell death resulting from respiratory dependent metabolic oxidative stress than tumor cells with low glucose utilization and normal cells. it was hypothesized that the reason for this is because cancer cells with high glucose utilization generate more o2 and h2o2 from their mitochondrial electron transport chains. 2-dg is clinically a relevant competitor for glucose, thereby creating a chemically induced state of glucose deprivation. 2-dg inhibits glucose metabolism in animals, and it is not toxic to them except at very high levels (> 2 g/kg body weight). it is tolerable in humans up to 200 mg/kg of body weight. zhang and aft, on analyzing the effect of 2-dg with/without some other chemodrugs (figure 3), have reported that there was a greater additive effect on cell cytotoxicity of 2-dg in combination with doxorubicin, 5-fluorouracil, trastuzumab, and cyclophosphamide. on one hand, they did not observe enhanced cytotoxicity of 2-dg with cisplatin in breast cancer cells, which exists in head and neck cancers. on the other hand, in vivo obtained data have shown radio-sensitization effects of 2-dg. in this study, treatment with 2-dg or with radiation significantly inhibits tumor growth compared to the control group. while high doses of radiation almost completely suppressed tumor growth in the radiation-treated group, addition of 2-dg further enhanced the efficacy of radiation. more importantly, the radiation enhancement effect is stable long after the combined treatments of 2-dg and radiation. some previous studies also showed that 2-dg increases the effect of radiation in pancreatic cancer and in head and neck cancers in mice. thus, with p53-positive cancer, a lower dose of radiation could be effective when used in combination with 2-dg. the precise molecular mechanisms underlying the cellular responses to metabolic stress induced by 2-dg alone and in combination with other cytotoxic agents such as ionizing radiation and chemotherapeutic agents appear to be complex and remain to be completely elucidated. elucidation of various mechanisms underlying radiosensitization and chemosensitization by 2-dg using established tumor cell lines will be very useful in designing effective protocols using 2-dg in cancer therapy.

breast cancer is the most common malignancy, and it is also the major cause of cancer-related deaths of women worldwide. breast cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy, and novel strategies are needed to boost the oncologic outcome. the non-metabolizable glucose analogue, 2-deoxy-d-glucose (2-dg) which inhibits glucose synthesis and adenosine triphosphate production, is one of the important discoveries involving the disturbances that can be caused to the process of the metabolism. the glucose analogue, 2-dg, is known as a tumor sensitizer to irradiation (ir) and chemotherapy, which help improve the treatment rates. it enhances the cytotoxicity via oxidative stress, which is more redundant in tumor cells than in normal ones. this article provides a brief summary on studies related to 2-dg chemo-/radio-sensitization effects by combination therapy of 2-dg/ir or 2-dg/doxorubicin.

PMC3395736

pubmed-574

activation of mast cell degranulation has been demonstrated to be an important mediator of allergic disease and more recently, as an initiator or contributor to autoimmune disease [1-4]. mast cells are granulocytes that emanate from myeloid progenitors in bone marrow and play a critical role in innate immunity as vital sentinel cells that combat invading microorganisms at tissue/environment interfaces [1-4]. mast cells are phagocytic and can directly destroy pathogens; they also release inflammatory mediators which promote inflammation by recruiting and activating other leukocytes. as regulators of adaptive immunity, mast cells promote antigen presentation, naive t cell differentiation into helper t cells, and induction of acquired immunity towards parasites via ige/fcr binding [1-4]. the major contribution of mast cells to both immune function and dysfunction results from the release of a plethora of inflammatory mediators through a process known as regulated exocytosis [1-5]. this process occurs in many cell types and involves the storage of intracellular pools of inflammatory mediators, hormones or neurotransmitters in pre-formed granules/vesicles. upon activation of the cell, fusion can be activated through receptor stimulation or by membrane depolarization via 2 messengers, for example ca. the transport, fusion and release of vesicle contents through exocytosis is mediated by a family of proteins known as the snares [7-11]. soluble n-ethylmaleimide-sensitive factor attachment protein receptors have been demonstrated to play a pivotal role in regulated exocytosis (degranulation) in mast cells [12-22] and represent a mechanical step involved in inflammatory mediators release that can be targeted for the design and development of therapeutics. we review the expression, localization and operation of various functional snare complexes in both murine and human mast cells. we evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation. vesicular trafficking of essential molecules between cellular compartments and into and out of cells is required for cell function and survival. in neurons, neurotransmitter release is widely acknowledged as critical for the development and function of the nervous system in all higher organisms. the snare family of proteins mediates the highly regulated processes of vesicular assembly and disassembly [6, 810]. numerous proteins are involved in the formation and disassembly of active snare complexes during membrane fusion. each set of snare proteins act as a vesicle loading signal, a mechanical address (delivering the vesicle to the correct target membrane), and in the mechanical process of fusing two opposing membranes. the neuronal and immunological snare proteins have a another layer of complexity added to this paradigm, the vesicles are loaded with cargo, but dock and await a chemical fusion signal. the snare family of evolutionarily conserved proteins was first identified in the 1980s in yeast and a decade later in mammalian cells. snares are found in most eukaryotic cells; 25 members have been identified in saccharomyces cerevisiae, 54 members in arabidopsis thaliana and>36 members in humans. the proteins are composed of a simple domain structure highlighted by a snare motif, a stretch of 6070 amino acids arranged in a heptad repeat [6-11]. core complexes form stable structures, which are composed of four intertwined parallel -helices contributed by three to four different snare members [6-11]. these complexes consist of a central core of three glutamine residues and one arginine residue bordered by hydrophobic stacked layers of side chains. soluble n-ethylmaleimide sensitive factor attachment protein receptors can be classified on the basis of whether they contain a q or r residue in their motif and are referred to as either a qa, qb, qc, qbc, or r-snares based on the position of their contributing motif in the assembled snare complex. the vesicle-associated membrane protein (vamp) family of snares are examples of the r-snare sub-type and are characterized by a single transmembrane domain, a snare motif and a n-terminal domain containing profilin-like folds [8, 10]. the syntaxin family of snares is an example of the qa or qc sub-type and are characterized by a single transmembrane domain, a snare motif and a n-terminal domain made up of anti-parallel three-helix bundles [8, 10]. the synaptosome-associated protein (snap) family of snares is an example of the qbc subtype and contain two snare motifs joined by a flexible linker and that is palmitoylated and therefore lacks a transmembrane domain [8, 10]. the snap family is unique in that they contribute two snare motifs to the snare complex. soluble n-ethylmaleimide-sensitive factor attachment protein receptors were previously classified based on whether they localized to the vesicle membrane (v-snares; e.g. vamps) or to the target plasma membrane (t-snares; e.g. syntaxins and the snap families) but these classifications have subsequently been shown to have a number of exceptions. soluble n-ethylmaleimide-sensitive factor attachment protein receptors localized on opposing membranes [vesicle: vesicle or vesicle: plasma membrane] drive fusion of membranes using the free energy released during the formation of the stable four-helix bundle. post-fusion snare proteins end up on the interior surface of the target membrane. these bundles are recycled via dissociation mediated by n-ethylmaleimide-sensitive factor (nsf) and other co-factors such as snap (soluble nsf attachment protein). mechanical models [6-11] all predict that snares function to bring opposing membranes into close proximity initiating fusion events. the presence of ca is indispensable, acting to bridge the opposing membranes, which leads to the exclusion of water allowing lipid mixing, fusion and subsequent exocytosis. ca-regulated snare complexes are involved in neurotransmitter release [8, 23]. the neuronal snare complex was the first snare complex identified and the most vigorously dissected. docked vesicles containing snare complexes composed of syntaxin 1a and snap-25 on the plasma membrane and vamp-2 on the vesicular membrane allow for the rapid (millisecond) release of neurotransmitters upon ca influx. free, uncomplexed membrane snares form cis-snare acceptor complexes on the plasma membrane in response to the actions of regulatory proteins. these acceptor complexes on the plasma membranes interact with snares on opposing vesicular membranes and form trans-snare complexes that are fusion ready. these docked vesicles persist for a substantial period of time until ca influx triggers the final step of fusion and cargo (neurotransmitter) release through the actions of ca sensors such as synaptotagmin and complexins. various investigators have reported the expression of multiple snares in murine and human mast cells [12, 13, 15, 17, 1922, 2431]. composite rt-pcr data identifying snare mrna in murine and human mast cells are presented in table 1. the neuronal snare snap-25 showed weak mrna expression in human mast cells, but was not detected via western blot in the same study. multiple studies report the expression of several vamp family representatives mrna [vamp-1, 2, 3, 7, 8 (r snares)] and several members of the syntaxin family [syntaxin 1, 2, 3, 4 (qa snares)] as well. snare family mrna expression in murine and human mast cells immunoblotting studies confirm that snap-23 is the consensus representative of the qb, c family in both murine and human mast cells (see composite of protein expression data presented in table 2). interestingly, two groups have reported the expression of the neuronal snap-25 qb, c snare protein in primary murine mast cells via immunoblot and immunohistochemistry [25, 27]. these data could not be recapitulated in published work by several groups in primary murine mast cells [12, 22] and the rat cell line rbl-2h3 [13, 22, 24]. the reason[s] behind this discrepancy is not clear, but may involve specificity of antibodies and/or limits of detection of signal. protein expression of vamp and syntaxin family members correlate well with mrna studies, as the majority of snares detected via rt-pcr were also detected via immunoblot. snare family protein expression (via immunoblotting) in murine and human mast cells immunohistochemistry studies in primary murine mast cells [12, 18, 21] have demonstrated that snap-23 and syntaxin 4 localize to the plasma membrane, while syntaxin 3, vamp-2 and vamp-8 appear to localize to secretory granules. detected snap-25 expression in the secretory granules of rat primary mast cells (rpmc). similar immunohistochemistry results in rbl-2h3 cells [13, 14, 24, 29, 31] have been reported demonstrating plasma membrane localization of snap-23, syntaxin 4 and syntaxin 3; and secretory granule localization of syntaxin 3, vamp-2, 3, 7 and 8. in human mast cells, sander et al. demonstrated that snap-23 and syntaxin 4 localize in the plasma membrane while vamp-3, vamp-7 and vamp-8 are dispersed throughout the cytoplasm, suggesting granule localization. however, upon activation of the mast cell, only vamp-7 and vamp-8 appear to redistribute to the periphery of the cell, suggesting fusion and degranulation. immunoprecipitation (ip) pull-down studies in primary murine mast cells, rbl-2h3 cells, and human mast cells have identified snare complexes composed of snap-23 and syntaxin 4 in complex with the r-snares, vamp-2 [13, 18, 28, 29], vamp-8 [13, 15, 17, 18, 22]; vamp-7 and vamp-3. in addition, complexes composed of snap-23, syntaxin 3 and vamp-8 also co-precipitated.. demonstrated that ip with anti-snap-23 antibody in rbl-2h3 cells pulled down syntaxin 2, 3, 4 and vamp-2, 3, 8. interestingly, n-ethylmaleimide (nem) treatment was required to observe vamp-8 co-precipitation. it was also demonstrated that ip with anti-syntaxin 4 resulted in the co-precipitation of snap-23, vamp-2, vamp-3 and vamp-8, while ip with anti-syntaxin 2 or syntaxin 3 only pulled down snap-23. these data suggest that ternary complexes in rbl-2h3 cells consist of snap-23, syntaxin 4 and a member of the r-snares family, presumably vamp-2, 3 or 8. showed that in rbl-2h3 cell lysates; syntaxin 4 co-precipitated with snap-23 and vamp-8 within and outside of lipid rafts; however, syntaxin 3, snap-23 and vamp-8 co-precipitates were found to be complexed only within lipid rafts. the implication of these two different complexes and their unequal distribution in the membrane remains unclear. additional studies by hepp et al. demonstrated co-precipitated complexes of snap-23, vamp-2 and syntaxin 4 in rbl-2h3 cells and also showed that most of the snap-23 associated with vamp-2 and syntaxin 4 in these complexes is phosphorylated. an elegant study by puri et al. demonstrated that snap-23, syntaxin 4, vamp-2 complexes are present in lipid rafts and showed that snap-23 functions to recruit non-lipid raft-associated syntaxin 4 into a functional complex. once again it was demonstrated that a predominant proportion of the snap-23 in complexes was phosphorylated, implicating snap-23 phosphorylation as a key prerequisite to complex formation. our group has demonstrated that in rbl-2h3 cells, snap-23 co-precipitates with syntaxin 4 and vamp-8; however, nem treatment was needed to observe vamp-8 association. in human mast cells isolated from surgical tissues, sander et al. demonstrated that snap-23 co-precipitated with syntaxin 4, vamp-7 and vamp-8, but not vamp-2 and vamp-3. in derived mast cells, vamp-8 was shown to associate preferentially with syntaxin 4 and snap-23, and to a lesser degree, vamp-2. however, it appears that vamp-2 and vamp-3 may act to substitute for vamp-8 in vamp-8-deficient cells, perhaps due to an unusual compensatory mechanism. isolation of ternary complexes of snare proteins after cellular activation has proven anything but trivial. previous data have demonstrated that only 5% of the snap-23 present in rbl-2h3 cells is actually capable of forming a complex after activation. furthermore, it is suggested that snare complexes have limited lifespans after activation-induced formation [35, 36]. using recombinant snare proteins, foster et al. demonstrated the in vitro association of the recombinant snares, snap-23, vamp-2 and syntaxin 4 and further demonstrated that deletion of the amino terminus and the second coiled-coil domain of snap-23 inhibited binding to both vamp-2 and syntaxin 4. although immunolocalization and ip studies identify the individual snare proteins and their complexes associated with mast cell function, functional studies aimed at disrupting snare complex formation/action provide a practical method to dissect the role of these complexes in mast cell degranulation. snare proteins also function to mediate constitutive trafficking events through both endocytic and secretory pathways; reviewed in hong et al. previously published functional data have implicated the snares snap-23, syntaxin 4, vamp-2, vamp-3, vamp-7 and vamp-8 in mast cell degranulation in studies using streptolysin-o-permeabilized cells and inhibitory recombinant snare proteins, snare neutralizing antibodies [12, 17, 19]; overexpression studies [13, 14, 22, 29, 38], rna interference methods [20, 22, 39] and snare-deficient mice [18, 21]. a compilation of functional data implicating the various snare proteins is presented in table 3. functional data implicating snare proteins in mast cell degranulation the most compelling evidence for the role of snare proteins in mast cell degranulation is presented in data describing vamp-8-deficient mice [18, 21].. demonstrated that mast cells derived from the bone marrow of these mice [bmmc] had a 50% decrease in their ability to release -hexosaminidase and serotonin but had normal histamine and tnf- release. tiwari et al. showed that bmmc from vamp-8-deficient mice resulted in a 50% decrease in -hexosaminidase and histamine, but no changes in cytokine/chemokine release. our group has shown via sirna that we could demonstrate about a 50% knockdown in rbl-2h3 degranulation after targeting vamp-8 mrna/protein. interestingly, puri et al. also showed that vamp-2 and vamp-3 do not play a role in mast cell degranulation as bmmc derived from vamp-3-deficient animals and mast cells derived from vamp-2-deficient stem cells showed normal degranulation. these data are confirmed by studies with tetanus toxins [17, 40], which are known to cleave and inactivate vamp-2 but do not have any effect on mast cell degranulation. supporting evidence for the role of vamp-8 in mast cell degranulation comes from sander et al., who demonstrated that neutralizing anti-vamp-8 antibodies inhibit degranulation in streptolysin-permeabilized human mast cells by 60%. data from this report also demonstrated a role for vamp-7 (50% inhibition) but not vamp-2 and vamp-3. similarly, lippert et al. demonstrated that recombinant vamp-8 inhibited ca-/gtps-mediated degranulation in permeabilized rbl-2h3 cells by 30%. our group's sirna studies also implicate snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation, as knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment. in support of our data, salinas et al. demonstrated that in permeabilized rpmc, neutralizing antibodies to snap-23 and syntaxin 4 resulted in 25% and 65% inhibition of histamine release. in addition, sander et al. demonstrated that neutralizing antibodies to snap-23 and syntaxin 4 inhibited histamine release from permeabilized human mast cells with inhibition reaching 90% and 40%, respectively. earlier studies by guo et al. demonstrated that anti-snap-23 neutralizing antibody decreased rpmc degranulation, although this inhibition required high antibody concentrations (500 g/ml). recently, suzuki et al. demonstrated that a shrna to snap-23 knocked down degranulation in stimulated rbl-2h3 cells by 30%, similar to the maximal inhibition we have observed for snap-23. in addition, liu et al. demonstrated that treatment of rbl-2h3 cells with syntaxin 4 sirna resulted in a decrease in antigen-induced histamine and -hexosaminidase release. interestingly, various groups [13, 14, 29, 37] have implicated syntaxin 4, vamp-7 and snap-23 in mast cell degranulation via overexpression studies. overexpression of syntaxin 4, vamp-7 and snap-23 all had an effect on degranulation in rbl-2h3 cells, although the effects were manifested as either an augmentation or inhibition of degranulation. the exact mechanism leading to augmentation or inhibition has yet to be elucidated but may involve competition for free snare proteins or competition for regulatory proteins. because many of the snare-deficient transgenic mice are embryonic lethal (table 4), sirna methods may represent the only efficient way to characterize degranulation pathways in both in vitro and in vivo models of anaphylaxis and autoimmune disease. mast cell phenotype of snare knockout animals/cells these reports provide evidence that these snares do not participate in the mast cell degranulation process. there are a number of studies published recently that utilize sirna to validate the role of individual snares or snare complexes mediating trafficking events in various cell types [46-54]. however, an interesting report published recently eloquently suggests that the abundance of snare-member isoforms and therefore the overall increase in snare redundancy may play a major role in the lack of snare sirna cellular efficacy. in addition, the authors describe the phenomenon that many cell types appear to express a sizeable reserve of snare proteins not required for normal physiological cellular processes (a so-called snare reserve). interestingly, the literature is scant with respect to sirna studies characterizing snare-protein function in mast cells. in addition, as snares are intracellular targets, the use of biotherapeutics such as recombinant proteins or neutralizing antibodies is not possible as these large proteins can not as of yet be targeted to the inside of the cell. therefore, interfering rna offers an exciting new approach for the development of a snare-directed therapy. to date, several sirna-based therapies have initiated clinical trials for the treatment of viral diseases, cancer and macular degeneration. in addition, our sirna data identifies snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation, and knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment. these studies reflect the effect that a snare sirna therapeutic could have as we utilized whole cells stimulated with physiologic stimuli. however, additional studies focused on in vivo delivery of these sirna and testing in animal models of disease are warranted. sec1/munc18 (sm) proteins are arch-shaped cytosolic proteins that have been demonstrated to bind syntaxins and regulate intracellular trafficking [57, 58]. specifically, munc182 has been demonstrated to play a role in mast cell degranulation [15, 26, 31]. sm proteins appear to regulate snare activity in several ways [57-60]. they can bind non-complexed syntaxins and act as negative regulators of snare assembly and interestingly, can also bind to trans-complexes and promote fusion. members of the munc13 family of accessory proteins also have been demonstrated to act as positive regulators of mast cell degranulation. complexins are cytosolic snare regulatory proteins that bind snare complexes and lock the snare machinery into a primed state awaiting a final trigger of fusion events [57, 60]. specifically, complexin ii has been demonstrated to function as a positive regulator of mast cell degranulation as sirna to complexin ii attenuates ige-induced degranulation. synaptotagmins are type i membrane calcium binding proteins that facilitate the formation of the snare calcium phospholipid complex that triggers final fusion and release of mediators from the cell [57, 60]. in mast cells, the rab family of gtpases has been implicated in the control of degranulation in mast cells. secretory carrier membrane proteins (scamps) are accessory proteins that play a role in the regulation of mast cell degranulation. scamp-1 and scamp-2 are postulated to function at the later stages of membrane fusion, in concert with phospholipase d, to form functional fusion pores. finally, as previously mentioned vide supra, snare disassembly is mediated by the proteins snap and the atpase nsf [60, 64]. snap functions to capture the snare complex and allow the binding of nsf and the subsequent disassembly of the snare complex. the important qb, c and qa snares on the plasma membrane unequivocally appear to be snap-23 and syntaxin 4, while the most likely r-snare partners on the vesicle membranes appear to be both vamp-7 and vamp-8 (fig. 1). functionally, there is growing evidence that ternary complexes of the above snares are critically involved in the mast cell degranulation process. disruption of these complex's formation or interactions with regulators may offer a window for therapeutic intervention and the development of novel small molecules for the treatment of allergic and autoimmune disease. model of the mast cell snare complex mediating degranulation based on functional findings [1214, 1622, 29, 3738]. (a) snap-23 and syntaxin 4 represent the consensus plasma membrane snares involved in mast cell degranulation. under normal physiological conditions, vamp-7 and/or vamp-8 represent the secretory granule (vesicle) snare that interacts with snap-23 and syntaxin 4 to form a functional ternary complex. (b) in the absence of vamp-8, it appears that a compensatory mechanism may allow vamp-2 and/or vamp-3 to associate with snap-23 and syntaxin 4 to mediate ternary complex formation and possible function.

mast cell function and dysregulation is important in the development and progression of allergic and autoimmune disease. identifying novel proteins involved in mast cell function and disease progression is the first step in the design of new therapeutic strategies. soluble n-ethylmaleimide-sensitive factor attachment protein receptors (snares) are a family of proteins demonstrated to mediate the transport and fusion of secretory vesicles to the membrane in mast cells, leading to the subsequent release of the vesicle cargo through an exocytotic mechanism. the functional role[s] of specific snare family member complexes in mast cell degranulation has not been fully elucidated. here, we review recent and historical data on the expression, formation and localization of various snare proteins and their complexes in murine and human mast cells. we summarize the functional data identifying the key snare family members that appear to participate in mast cell degranulation. furthermore, we discuss the utilization of rna interference (rnai) methods to validate snare function and the use of sirna as a therapeutic approach to the treatment of inflammatory disease. these studies provide an overview of the specific snare proteins and complexes that serve as novel targets for the development of new therapies to treat allergic and autoimmune disease.

PMC3822836

pubmed-575

genetic factors significantly influence late-onset alzheimer's disease (ad) though by some estimates 3065% of the genetic variance remains unexplained by the four established ad genes (tanzi, 2012; mahley and rall, 2000). polymorphisms of the apoe gene, specifically the epsilon 4 (4) allele, account for most of the known heritability of late-onset ad (tanzi, 2012). a positive family history is a risk factor for late-onset ad (tanzi, 2012; cupples, 2004; silverman, 1994), with studies indicating a 24-fold larger risk in first-degree relatives. some of this risk is additive to the known risk conferred by the apoe gene suggesting a missing heritability. no measure of self-reported fh status to evaluate subjects at risk hence, studies examining the effect of fh on biomarker phenotypes may improve the interpretation of biomarker tests and the counseling of at risk subjects. several studies have examined the effect of fh on biomarkers (lampert, 2013; honea, 2011; xiong, 2011; andrawis, 2012; okonkwo, 2012). for example, several cross-sectional studies in mild cognitive impairment or normal subjects report that first-degree relatives have a higher prevalence of abnormal cerebrospinal fluid beta-amyloid and/or tau phenotypes, even after accounting for the known effects of age and apoe4 (lampert, 2013; xiong, 2011). one of these studies also estimated that the unexplained genetic heritability in fh (for an effect on beta-amyloid in mci) was about half the size of the apoe4 effect (lampert, 2013). prior studies have also examined the effect of fh on hippocampal volume (lampert, 2013; honea, 2011; andrawis, 2012; okonkwo, 2012). in a prior cross-sectional study of normal, mci, and ad subjects, we failed to find an effect of fh on hippocampal volume (lampert, 2013). however, in another study of normal subjects derived from the ku brain aging project, maternal fh was reported to influence 2-year volume loss in the precuneus, parahippocampal and hippocampus independent of apoe4 (honea, 2011). supporting this was another 1-year multisite study, which found that maternal (but not paternal family history) was associated with increased hippocampal atrophy in mci subjects but not in normal or ad subjects (andrawis, 2012). however, another 4-year study of middle aged normals, in the wisconsin aging study, found that fh status predicted greater atrophy only within a posterior sub-region of the hippocampus but not in other gray matter regions, and that there was no effect of maternal versus paternal history (okonkwo, 2012). reasons for discrepancy may be differences in inclusion criteria, sample size, follow-up duration, image analyses, and covariates used. the alzheimer's disease neuroimaging initiative (adni) is a highly successful national longitudinal biomarker research study (weiner, 2010) and as such it is ideal for more definitive testing of preliminary results generated by single site studies. stringent subject selection criteria, serial mri scans using qualified scanners and phantoms, and standardized central mr image analyses are some of the many strengths of adni. the goal of this present analysis was to use adni data to test the effect of fh on longitudinal atrophy rates (up to 48 months) of 20 brain regions in subjects with mci. we decided to focus on subjects with mild cognitive impairment for three reasons: adni included twice as many mci subjects as controls; mci subjects are at greater risk for progression to ad than normal controls; mci subjects have a greater rate of atrophy than normal controls. hence, the mci group offered greater power for testing our hypotheses and was also more relevant to the type of subject seen in routine clinical practice. our primary hypothesis was that a positive fh would be associated with greater rate of atrophy in brain regions known to degenerate early in ad such as the hippocampus, amygdala, entorhinal cortex, and cortical gray matter. data used in the preparation of this article were obtained from the alzheimer's disease neuroimaging initiative (adni-1) database (http://adni.loni.usc.edu) (weiner, 2010). the adni was launched in 2003 by the national institute on aging (nia), the national institute of biomedical imaging and bioengineering (nibib), the food and drug administration (fda), private pharmaceutical companies, and nonprofit organizations, as a 5-year public private partnership. the primary goal of adni has been to test whether serial magnetic resonance imaging (mri), positron emission tomography (pet), other biological markers, and clinical and neuropsychological assessment can be combined to measure the progression of mild cognitive impairment and early alzheimer's disease (ad). determination of sensitive and specific markers of very early ad progression is intended to aid researchers and clinicians to develop new treatments and monitor their effectiveness, as well as lessen the time and cost of clinical trials. the principal investigator of this initiative is michael w. weiner, md, va medical center and university of california san francisco. adni is the result of efforts of many co-investigators from a broad range of academic institutions and private corporations, and subjects have been recruited from over 50 sites across the u.s. and. the initial goal of adni was to recruit 800 subjects but adni has been followed by adni-go and adni-2. to date these three protocols have recruited over 1500 adults, ages 5590, to participate in the research, consisting of cognitively normal older individuals, people with early or late mci, and people with early ad. the follow-up duration of each group is specified in the protocols for adni-1, adni-2 and adni-go. subjects originally recruited for adni-1 and adni-go had the option to be followed in adni-2. for up-to-date information, for additional details readers can also refer to the adni-1 procedures manual (adni, 2013; alzheimer's disease neuroimaging initiative, 2013). only subjects with a baseline diagnosis of mci were eligible for this study. additionally, subjects selected for analysis were required to have data for all of the following parameters: baseline age, race, gender, and years of education; baseline mini-mental state examination (mmse) score; apoe genotyping results; and family history status of ad. subjects also needed initial visit 1.5 t mr scans analyzed centrally by freesurfer software (v.4.4) to derive cortical thickness and sub-cortical volume data; and a minimum of two other follow-up mri time points (6, 12, 18, 24, 36, or 48 months from baseline) with centrally freesurfer analyzed mri data. to be classified as mci in adni a subject needed an inclusive mmse score between 24 and 30, subjective memory complaint, objective evidence of impaired memory calculated by scores of the wechsler memory scale logical memory ii adjusted for education, a score of 0.5 on the global cdr, absence of significant confounding conditions such as current major depression, normal or near normal daily activities, and absence of clinical dementia. for a detailed list of all selection criteria readers fh data was collected by an interview with the subject and their study partner regarding the presence of ad in the subject's parents and siblings. a control typically self-reported while the study partner was the main source of information for memory-impaired subjects. a positive family history (fh+) was characterized as having a parent or sibling, living or deceased, who had been reported as diagnosed with ad. a negative family history (fh) meant having no reported parents or siblings with a history of ad. apoe allele genotyping of all subjects was executed using dna extracted from peripheral blood cells with details given elsewhere (adni, 2013). adni used 1.5 t mp-rage t1-weighted mr images that were later pre-processed and corrected for nonlinearity via gradwarp. the scans were implemented using a standardized adni protocol adjusted for use at each specific collection site and then underwent scaling and vetting to meet quality control criteria. for more detailed information regarding the specific mr acquisition protocols and control methods used we selected 20 brain regions of interest, including 4 regions known to atrophy in early ad (hippocampus, amygdala, cortical gray matter volume, and entorhinal cortex) as well as other regions of exploratory interest. specific details about these techniques have been previously described in publications (sgonne, 2004; fischl, 2002; sled et al., 1998; fischl et al., 2001; fischl et al., 1999; fischl and dale, 2000; han, 2006; hostage et al., 2014). for more information please see http://adni.loni.usc.edu. for each region of the brain, the longitudinal variation in thickness/volume was modeled as a log-linear function of time and other subject information. the response vij(t) is the thickness/volume in the jth region of the brain, j=1, 2,, 20 for the ith subject, i=1,, 184, measured at the tth time point, t=0, 6, 12, 18, 24, 36, or 48 months. the terms in the model include j, the baseline thickness volume, measured at time 0, for a 75 year old male subject with no family history of alzheimer's. the baseline subject represents the most common subject characteristics in the study, and the reference age represents the first quartile of ages in the study. there is also a subject specific random effect, ai, assumed to have a gaussian distribution with 0 mean and sd a. this term accounts for subject specific variation in the baseline brain volume, due to factors such as difference in intra-cranial brain volume. in addition, we have a linear effect of age (centered at 75), with coefficient aj, an additional effect for females, fj, as well as an effect of positive family history, fhj. the aforementioned effects are all at t=0 and specific to region j. next, we model atrophy (or volume increase) as a linear function in time, decomposed into effects of the demographic variables: firstly, j is the baseline rate of atrophy, corresponding to the baseline subject described above. there is also a subject specific random rate of atrophy, bi, assumed to have a gaussian distribution with 0 mean and sd b. this term allows the rate of atrophy to vary across subjects, as a proxy for terms not explicitly included in the model, such as genetic and lifestyle factors. we also have an additional atrophy effect for females, fj, as well as an atrophy effect of positive family history, fhj. finally, ijt is a random measurement error, assumed to have a zero mean gaussian distribution with sd. the brain volumes vij(t) were log transformed to ensure that the distribution of the estimated error terms (residuals) of the model better conformed to the assumption of gaussianity. we also used a second model, where additional genetic information was incorporated:(1.2)log(vij(t))=j+aij+ajage+fj+fhj+e4j+jt+bijt+fjt+fhjt++e4jt+ijt. in model (1.2), the common terms represent the same things as in model (1.1), except that the baseline subject additionally possesses the apoe 3/3 allele. the term e4j denotes the additional baseline effect of the apoe 4+allele, while e4j denotes the additional atrophy effect of the apoe 4+allele. both models were fit separately to data from each region of the brain, using restricted maximum likelihood (reml), as implemented in the nmle package [pinheiro et al. linear and nonlinear mixed effects models. r package version 3.1-113, 2013] in the r computing platform (http://www.r-project.org). our a priori primary hypothesis regions included those well known to atrophy in early ad such as the hippocampus, amygdala, entorhinal cortex and cortical gray matter. there were no significant differences by fh for gender, years of education, or mmse score. there was a difference in age (p=0.05), and as expected there was an overrepresentation of the apoe4 allele in fh+ subjects (p=0.002). total follow-up was up to 48 months, and the mean follow-up time for the fh group (27.8 months) was not significantly different from the fh+ group (29.5 months, p<0.25). as shown in the first three columns in table 2, most brain regions showed a significant atrophy over time (i.e. base rate). age and gender, subjects with a positive fh had greater atrophy of the cerebral cortex (p<0.009), amygdala (p<0.01), entorhinal cortex (p<0.01) and hippocampus (p<0.053). table 3 depicts the estimated effects and significance of apoe 4+and fh on longitudinal atrophy rates. in this model, some 15 regions showed a significant apoe4+effect including all the predicted primary regions (such as the hippocampus, amygdala, entorhinal cortex and cerebral cortex). however, none of the primary predicted regions showed a significant fh effect in this model and the atrophy rate attributable to fh was considerably smaller than that attributable to apoe4. 1 compares atrophy rates due to apoe4+versus those due to fh+ it shows that most fh effects are small relative to apoe4+effects, as evidenced by the wider spread of apoe4+effects while most fh+ rates remained close to zero. table 4 summarizes the model when fit to only 3 homozygotes there was no significant fh effect on any predicted region and effect sizes (cohen's d) ranged from 0.05 to 0.22. for example, the fh effect size on the amygdala atrophy rate was 0.17 (p<0.14). exploratory analyses comparing the effect of fh in apoe 4+versus 3/3 subjects showed that some regions exhibit a slightly greater fh effect on atrophy in the 3/3 group (e.g. amygdala) whereas some other regions have a greater fh effect in the 4+group (e.g. hippocampus) but none of these were statistically different. duration of follow-up available for cognition was longer than that available for mri scans and we examined the baseline and last available time point within the 4 year window. duration of follow-up tended to be longer in fh+ subjects (mean 43.7 months) than fh subjects (mean 38.5 months) (p=0.02). fh+ subjects (57%) had numerically higher rate of conversion from mci to dementia than fh subjects (45%) but the difference was not statistically significant. fh+ subjects (mean 7 points 10) had numerically greater decline in cognition (adas-cog) than fh subjects (mean 5.7 points 9) but the fh effect was not statistically significant in a multivariate model with age, gender, education, baseline cognition, e4 and time. gender and apoe4 genotype (p=0.313) were significant in this model. to our knowledge, this is the first national long-term (up to 48 months) examination of the effects of fh on atrophy rates of multiple regions in mci subjects at risk for future ad. we found that a positive fh was associated with accelerated atrophy rates for three key structures (amygdala, hippocampus, and entorhinal cortex) plus cortical gray volume in mci but that the residual fh effect on atrophy rate, after covarying for apoe e4, was no longer significant for any brain structure. we also found that in the subset of apoe3 homozygotes, there was no significant fh effect on any key structure. these data suggest that any missing heritability within fh (other than apoe4) for explaining atrophy rate in mci subjects is likely to be quite small and nonsignificant. lastly, given the large size of the main e4 effect relative to the main fh effect in mci subjects, our data suggests that much of the e4 effect may not be contained wholly in the fh effect. there appeared to be a weak interaction between apoe status and fh in that the effect of fh on amygdala atrophy rates seemed larger in e3 homozygotes than e4 carriers, but this too was not significant. prior studies of fh effects on csf [reviewed in lampert, 2013] and fdg-pet [reviewed in mosconi, 2007] biomarkers have generally found consistent changes. however, prior studies of fh effects on longitudinal hippocampal atrophy rates have yielded potentially conflicting findings (honea, 2011; andrawis, 2012; okonkwo, 2012). honea (2011) found a positive effect for maternal fh, independent of e4 status, on 2-year hippocampal atrophy rate in normal controls and proposed that this supported the mitochondrial hypothesis of ad. andrawis (2012) did not find a significant effect of fh on 1-year atrophy rates in normal controls or ad patients but did find an effect for maternal fh in mci subjects. yet another study of normal middle-aged adults, by okonkwo (2012), found a fh effect on atrophy only in a posterior subregion of the hippocampus and only in e4 subjects there was no fh effect in e4+subjects. in addition, okonkwo et al. found no significant difference between maternal and paternal fh on atrophy rate (okonkwo, 2012). the follow-up in okonkwo's study was 4-years and longer than prior studies but their controls were younger. these studies relied on just 2 mri scans (baseline and follow-up) to extract atrophy rates. our study extends these data by examining mci subjects over a longer follow-up period (3 mri scans and up to 48 month follow-up) and by examining multiple brain regions. the use of 3 mri scans over this period may have allowed for a more accurate estimate of the slope of change than in prior studies. further, our examination of 20 different brain regions allowed us to examine changes in regions associated with cognitive brain circuits known to be affected early in ad. overall, our data do not support a significant residual (after covarying for apoe status) fh effect on rates of atrophy of any key brain region. since we did not examine maternal versus paternal fh a strength of this current study is the use of a relatively large sample of carefully selected mci subjects, data collected in a standardized manner from many sites across the country, multiple imaging time points, and relatively long duration of follow-up. fh status was ascertained via interviews with the subjects and their study partners, so it is possible that there may have been a reporter bias (for example, some respondents may not know the difference between ad and dementia). that said, our findings are still relevant because fh is collected by simple history in most clinics and biomarker research studies. we studied only mci subjects and did not examine interactions of fh with amyloid or tau phenotypes. prior studies have shown that amyloid positivity may be linked to e4 status [reviewed in lampert, 2013] and accelerated atrophy [reviewed in honea, 2011], and so it is conceivable that there may also be an interaction of amyloid status with fh. we also did not analyze subregions of the hippocampus and hence could not directly test findings that fh might affect only specific subregions (okonkwo, 2012). we also did not examine the effect of fh on glucose metabolic status, another marker that has been linked to fh (mosconi, 2007). thus, our findings can not be generalized to other biomarkers or other diagnostic groups. as stated earlier, we did not test maternal versus paternal fh since we did not collect that data. likewise, we were unable to test parental versus sibling fh as there is a vast majority of patients with an affected parent (n=51 parental, n=9 both, n=18 sibling; 77% parental) and therefore not enough power to separate the two. future directions of this study should include further analysis to determine if there are other genetic factors (e.g. whole genome data) in addition to apoe4 that predict atrophy rates in brain regions susceptible to ad as well as studies examining the effect of fh on multiple biomarkers (mri, csf, pet) over longer periods of time. since fh has been linked to beta-amyloid positivity and amyloid deposition in turn has been linked to atrophy, future studies should examine fh effects in healthy controls who are amyloid positive (i.e., preclinical ad). only a subset of adni-1 subjects had csf or amyloid pet data. adni2, where every subject underwent florbetapir pet, will allow for a better test of this theory in the near future. such information may serve to further improve personalized testing and drug development for at-risk patients. experimental regionsabbreviationhippocampus total volumehippocampus.total.volamygdala total volumeamygdala.total.volentorhinal cortexentorhinal.cortex.taparahippocampal taparahippocampal.taposterior cingulate taposterior.cingulate.taprecuneus taprecuneus.tasuperior.parietal tasuperior.parietal.tasuperior.temporal tasuperior.temporal.tatemporal.pole tatemporal.pole.tatransverse.temporal tatransverse.temporal.tacerebral cortex total volcerebral.cortex.total.volfusiform gyrus tafusiform.gyrus.tainferior parietal tainferior.parietal.tainferior temporal tainferior.temporal.tamiddle temporal tamiddle.temporal.tacerebellar cortex (total volume)cerebellar.cortex.total.volcerebellar white mater (total volume)cerebellar.wm.total.volumepericalcarine cortexpericalcarine.tapostcentral gyruspostcentral.taprecentral gyrusprecentral.ta

a positive family history (fh) raises the risk for late-onset alzheimer's disease though, other than the known risk conferred by apolipoprotein 4 (apoe4), much of the genetic variance remains unexplained. we examined the effect of family history on longitudinal regional brain atrophy rates in 184 subjects (42% fh+, mean age 79.9) with mild cognitive impairment (mci) enrolled in a national biomarker study. an automated image analysis method was applied to t1-weighted mr images to measure atrophy rates for 20 cortical and subcortical regions. mixed-effects linear regression models incorporating repeated-measures to control for within-subject variation over multiple time points tested the effect of fh over a follow-up of up to 48 months. most of the 20 regions showed significant atrophy over time. adjusting for age and gender, subjects with a positive fh had greater atrophy of the amygdala (p<0.01), entorhinal cortex (p<0.01), hippocampus (p<0.053) and cortical gray matter (p<0.009). however, when e4 genotype was added as a covariate, none of the fh effects remained significant. analyses by apoe genotype showed that the effect of fh on amygdala atrophy rates was numerically greater in 3 homozygotes than in e4 carriers, but this difference was not significant. fh+ subjects had numerically greater 4-year cognitive decline and conversion rates than fh subjects but the difference was not statistically significant after adjusting for apoe and other variables. we conclude that a positive family history of ad may influence cortical and temporal lobe atrophy in subjects with mild cognitive impairment, but it does not have a significant additional effect beyond the known effect of the e4 genotype.

PMC4215425

pubmed-576

is there a formula for turning young people from diverse backgrounds into scientists? as our country s demographics change, and as so-called minorities become majorities in many locations, it might be argued that our cultural differences make a one-size-fits-all educational strategy sound nave and even insensitive. yet there are some similarities among successful youth programs that might serve as good examples to follow. one program that is showing great promise in engaging urban teens of various ethnicities in meaningful science activities, including some citizen-science work, and steering them into science, technology, engineering, and mathematics (stem) careers is the science career continuum (scc) at the chicago botanic garden. the scc is an extracurricular program that strives to prepare a new generation of scientists, representing all ethnic backgrounds, and provide them with the education and training needed to address the environmental and conservation challenges of our time. for 20 years, this grant-funded program for students attending chicago public schools has offered an opportunity to explore science-related programs at the chicago botanic garden (the garden). participant selection has targeted african-american and latin american youth who have expressed an interest in science and nature, with preference given to students from lower-income households and who are the first in their families to attend college. most of these students do not have family members who could help them make college selection and course choices for science majors because they are unfamiliar with the field. the scc includes three programs that a student may participate in for five or more years. it begins with science first, a four-week summer day camp for 40 students who are entering grades 8, 9, or 10 in the fall. students engage in the content and practices of science while also studying environmental issues in their lives such as the impact of climate change or the availability of quality grocery stores and health care services in urban neighborhoods. recent projects have included measuring the effectiveness of different insulating materials, testing and comparing the effectiveness of different weed-control practices, and studying the pollinator-attraction properties of flowers. twenty students in total are selected to continue with an eight-week program, college first. they may be those who showed the most enthusiasm and promise while participating in science first, similar qualified students from comparable programs at other institutions, or a mix of the two. selection is based on the work students contributed to the science first research project or city science fair, class participation during the summer, and other behaviors that demonstrate a commitment to returning to the garden for a summer of engagement with a summer science research project before their junior and senior years of high school. college first combines a college environmental field study course with an extended research project working alongside garden professionals. some students may perform dna tests and analyze results to assist researchers in measuring the genetic diversity of a jackfruit tree population in bangladesh, which is a concern of the agricultural community there, while other students may assist with ongoing research on the impact of the invasive asian buckthorn tree and its ability to alter soil and air conditions and harm native species. still other students might help their mentors assess the conditions of local ravines in order to recommend remedial work, or sprout seed samples from the seed bank collection in order to measure the viability of seeds exposed to long-term extreme cold storage. college first students also attend monthly meetings during the school year to learn about college selection, application, and the financial aid that they will need to pursue their passion for doing this kind of work. the third formal program in the scc is a ten-week research for undergraduates (reu) program. three students who have successfully completed college first, are declaring a science major, and have demonstrated academic achievement in college are selected for the program. students work with scientists and graduate students to do independent research on topics related to their mentors research, such as plant pathology, genetic diversity, or soil quality. garden educators have used a variety of methods and indicators to determine student progress and program effectiveness, including content knowledge assessment, attitude surveys, and science grades in school. 100% of scc students graduate high school, as compared with the chicago public school rate of 66% in 2014 (1). furthermore, 94% of scc alumni enrolled in college within a year after high school graduation, with 66% choosing to major in a stem field. to understand what makes the scc and similar programs successful, the garden gathered together 32 institutions with stem-focused youth programs to compare successes and identify best practices for encouraging students to pursue stem careers. the hive chicago-funded pathways to stem success (2) wrapped up in early 2015 with a list of recommendations for successful recruitment, retention, and release of students from our programs. first, scc identifies individuals who demonstrate interest and aptitude in science while they are in middle school, when they are beginning to understand their own interests. students at this age may be influenced by peers who do not share the same interests and may discourage science-minded students from participating in science at school. the scc pools students from different schools into an affinity group of diverse students that will encourage each other s passion for the subject matter. students are introduced to stem careers early in the program so they have time to acclimate to the idea that this may be an exciting and attainable career choice. being able to do the work alongside science professionals and college students enables participants to imagine working as professionals in these fields one day. the scc makes science learning accessible by providing transportation and financial support so that there is no cost to the students. moreover, it conquers emotional barriers by establishing a safe community of like-minded students who come from different backgrounds and feel comfortable sharing their interests with each other. college first students get to work with scientists, professionals, and older students, participating in science research, horticulture, and interpretation programs that are happening every day at the garden. a second critical element in any stem pathway program is retention of students. the scc achieves continuity through the multi-year format and by providing challenging educational experiences with increased expectations each year. students receive mentoring from professional staff as well as students who are at the next level of the program their near peersreinforcing the continuity, accessibility, and nurturing aspects of the program. this support extends to the group of students within their own cadre. a recent youth program quality assessment (ypqa) the ypqa is a self-assessment tool used to measure a program s strengths and weaknesses based on a set of established metrics for successful youth programs. the ypqa examines student engagement, safety, rapport with instructors, personal interaction, and other factors that prove significant in youth programs. the study is used internally by the institution to improve the program and, as such, is not published. the scc ypqa revealed that students form a bond of friendship and stay in touch with each other outside of the program. this is despite coming from different ethnic backgrounds, attending different schools, and living in distant neighborhoods, and demonstrated for garden staff that the program is building support between program participants it is not enough to offer a program and turn students loose without any further support. best practices tell us that how we release students is as important to their success as how we recruit them. scc staff members remain in contact with alumni and help connect these former students to internships and other opportunities as appropriate. best practices also dictate that programs should be flexible to various outcomes of success for participants. scc staff members recognize that not all students will become scientists, but all of them leave the program more confident in their abilities, more scientifically literate, and motivated to pursue their interests. the scc has shown that when students from diverse backgrounds are given an opportunity to participate in real scientific research under the mentorship of a caring professional over multiple years, they are better able to envision themselves pursuing stem careers. by establishing a community of learners who share a passion for science and support each other s personal achievement, the scc expands participants notions of what is possible and brightens their futures, regardless of career choices they make.

the science career continuum at the chicago botanic garden is a model program for successfully encouraging youth from diverse backgrounds into stem careers. this program has shown that when students are given an opportunity to participate in real scientific research under the mentorship of a caring professional over multiple years, they are more likely to go to college and pursue stem careers than their peers. journal of microbiology&biology education

PMC4798821

pubmed-577

. the cornea acts as a shield against external dust or microbes and prevents them to enter the eye globe. damage or disturbance to the cornea due to scar, foreign bodies, or other diseases or disorders can lead to poor visibility. cornea is made up of six layers which are responsible for the organization of the corneal cellular matrix which in turn is important for guiding the light to the retina. the corneal layers are the epithelium, basement membrane, bowman's layer, stroma, descemet's membrane, and endothelium (figure 1). each layer has its own specificity, but when corneal transplantation especially penetrating keratoplasty (pk)/endothelial keratoplasty (ek) is considered, the endothelium has a more important role to play as it does not have the capacity to regenerate and hence should be left viable and undisturbed. endothelial damage or poor viable cell count is assumed to be majorly responsible for graft rejection. corneal lamellar keratoplasty (lk) is a surgical technique that allows preserving healthy portions of the cornea while selectively replacing the dysfunctional segments. the best action to treat corneal disorder is a replacement of the damaged recipient cornea (complete/partial) with a healthy donor corneal tissue. deep anterior lamellar keratoplasty (dalk) is a surgical technique that is considered the best for treating the patients with anterior layer (epithelium, bowman's layer, and stroma) disorders. descemet's membrane endothelial keratoplasty (dmek) is currently pursued to treat the patients with endothelial dysfunction. with time, descemet's stripping automated endothelial keratoplasty (dsaek) has evolved drastically with an instrument such as a microkeratome, which is more standardized, efficient, and safe to create corneal grafts or lenticules. new tools and advanced machineries like ultrasonic pachymetry, microkeratomes, excimer laser, and more recently femtosecond (fs) lasers have enhanced the ability to work with more safety and accuracy in tedious microsurgical environments. viscoelastics and artificial chambers have proved beneficial to maintain the cellular viability. the above mentioned surgeries have enlarged the view of corneal surgery by achieving higher visual outcomes as compared to pk while limiting the rate of rejection and increasing the long-term graft stability. further research is showing promising results with ek using thinner tissues and an expected long-term visual outcomes and graft stability [35]. alk targets the replacement of the damaged anterior segment (epithelium and part of stroma) of the recipient's cornea with the anterior part of the healthy donor tissue. the deeper layers (posterior) of the recipient cornea, specifically the endothelium and the descemet's membrane, are left intact which reduces the risk of rejection and therefore has a distinct advantage over pk. deep anterior lamellar keratoplasty (dalk) replaces both, the epithelium and most of the stroma with the donor tissue. this is favorable for those disorders which affect the anterior segment of the cornea [69]. according to the literature, with new instruments, dalk has now shown equal results as pk, if not better than pk, that are also based on best spectacle corrected visual acuity (bscva) [6, 10]. smoothness of the stromal interface is ultimately related to better visual outcome; however, scarring of the stroma is still an issue with dalk. it has been found that instruments like fs lasers have been successfully used to cut the lamellar flaps, and it is believed that they could also be used for dalk in order to reduce the irregular scarring. thus, with less compromise to the endothelium, dalk is considered as the primary choice of treatment for most anterior corneal disorders. ek selectively replaces the diseased corneal endothelium with healthy donor tissue through a small limbal incision while retaining the healthy anterior part of the patient's cornea. this surgical technique has multiple advantages over pk as the recipient cornea remains structurally intact and resistant to injury. in addition, since it is a suture-less surgery, the results lead to quick rehabilitation and better visual outcomes. in general this procedure is the first hand/primary technique with excision of the posterior recipient stroma and endothelium with small curved scissors and trephine. the donor tissue is folded for insertion through a small incision near the limbus region. the posterior membrane which includes the descemet's membrane and the endothelial cells is excised and transplanted. the thinnest possible lamellar graft is transplanted with the intention of better and faster visual recovery and outcomes. the cellular mortality after the preparation of the graft can be a major concern if the dmek is created by stripping it off manually. a recent study described by dapena et al. showed a no-touch technique for dmek surgery. as per this study, the technique could provide best corrected visual acuity (bcva) of 20/25 or more with a good endothelial cell density after 6 months from surgery. the steps include incision and descemetorhexis (excision of descemet's membrane from the recipient cornea), preparation and implantation of dmek graft followed by orienting, unfolding, centering, positioning, and fixing the dmek graft. this technique claims to be more standardized with near complete visual recovery and minimal endothelial cell loss. it further explains that approximately 95%of the cases may gain a bcva of 20/40 or better and 75% may attain 20/25 within 6 months post-op. another report cited a combination of two procedures, that is, preparation of no-touch dalk and dmek grafts from the same donor. the rolled tissue was placed on a soft contact lens which was used for trephination of the endothelial graft using a custom-made trephination system. this technique claims to produce undamaged grafts with better handling of the tissues especially for thin descemet's membrane. as the undamaged anterior cornea could also be used after separating the descemet's membrane, this method increases the availability of the donor tissue by using two different grafts from the same donor. no clinical signs of graft dysfunction, primary/secondary graft failures, or graft detachments were observed. the endothelial cell density and the relative mortality showed no significance in terms of cell loss before and after technique. descemet endothelial graft (deg) can be isolated as in the studies described above or isolated after pneumatic dissection (inserting pressurized gas for creating mechanical motion) using air bubble technique and preserving the lenticules for 7 days in organ culture. in the latter studies, the anterior stroma was removed using the microkeratome followed by air injection to separate the descemet's membrane and the stroma and then attached to a silicone weight using a scleral ring. this technique showed that the dmek tissues can be pre-prepared in the eye banks and can be preserved with a minimum endothelial cell loss. however, a similar study showed that although using air as a medium to create the bubble could be useful, the lenticule demonstrated the presence of residual stroma in all the tissues that were harvested (n=5; average stromal residue=12.45 micrometers). this concludes that although with a possibility of creating a thin lenticule, the presence of stroma indicates that the technique should not be termed as dmek but a very thin dsek. similarly, microkeratome and barraquer sweep assisted lamellar preparation was another technique for harvesting donor dm and endothelium which also showed minimal stromal interference with higher endothelial cell integrity and minimal cell loss. the anterior stroma was removed using moria one microkeratome, whereas the residual stromal bed over the central cornea was removed by blunt dissection using a barraquer sweep. this technique explains that a thin rim of posterior residual stroma permits easy donor button trephination and tissue manipulation. this technique also shows the presence of residual stroma; therefore, although with a very thin lenticule preparation, could this technique be termed as dmek? a corneoscleral disc was mounted on a barron artificial anterior chamber with endothelial side facing up. this technique showed less endothelial cell loss and claimed to be a potential method as it required no special surgical instruments. although the endothelial cell density was noted, the mortality after the lenticule preparation was not recorded. therefore, the hypothesis could be (a) the cell loss was due to the recipient acclimatization post-op or (b) the transplanted cells were damaged or dead after graft preparation. the mortality checks therefore become an important parameter and an issue that needs to be highlighted for the dmek surgeries. there are several methods that have been introduced which have different approaches to retrieve the deg, preserve and supply as either precut tissue from the eye banks or preprepare at the surgical theatre. however, there is a lack of a standardized method which can repeatedly prove the reduction of risk or complications that are usually seen due to unidentified parameters like mortality and other risks or complications such as graft failure due to detachment or poor endothelial cell count post-op. even with its limitations, ek has succeeded pk as the first choice of treatment for endothelial dysfunction due to its advantages like quick and efficient surgery with reduced manipulation, low surgical risk, and better visual outcome. innovations in ek with modification in donor preparations have broadened its use and improved intraoperative ease, and reduced postoperative complications have therefore been responsible for its emerging popularity as shown in figure 2. a mechanical microkeratome is used to simplify the donor tissue dissection, thus, making the procedure more standardized and easy with lesser damages to the prepared graft. furthermore, as the anterior corneal surface is not manipulated, it does not result in any of those refractive errors that is usually seen after pk. however, it might show a slight hyperopic shift due to changes in the curvature or astigmatism. this method includes a little stromal interference and therefore is not a specific deg preparation-based technique. where laser-assisted in situ keratomileusis (lasik) helps to correct the refractive errors, improved fs laser engines are proving to be useful for lamellar and cataract surgeries. earlier settings for lk used microkeratome which is less expensive, standardized, and provided smoother surfaces for lenticules. however, microkeratome had certain limitations related to poor depth adjustments, poor thickness reproducibility due to microkeratome head sizes, and irregularity of the lenticule interface. fs lasers reduced the complication rate due to flap creation and improved the predictability of flap dimensions and quality of the optical surfaces as compared to the flaps that were obtained by microkeratome [1924]. other advantages of the fs laser include (a) precise cuts at specific sites; (b) higher reproducibility; (c) reduced dissection issues; (d) standardized procedures with specific thickness; (e) establishing safe and reliable procedure due to satisfactory outcomes with smoother stromal surfaces which is important for long-term visual outcomes. both safety and reliability of corneal lamellar cuts using intralase fs laser (ifs) have been demonstrated extensively for lasik and recently for ek. lenticules created with ifs are more planar shaped and thinner, which is essential for better visual outcomes. nevertheless, the smoothness and regularity of the stromal interface could still be improved. the quality of the surfaces obtained is determined by programmable parameters like the laser spot and line separation and the energy delivered per pulse. the new fs laser machines are well equipped with higher engine speed and closer spot and line separation to create smoother cuts. as described earlier, studies have reported the use of fs lasers to create donor tissues for ek [2629], whereas others showed better results with alk [30, 31]. rousseau et al. showed that the issues arise with the donor corneas when determining the optimal amount of energy for a lamellar cut. the optimal setting should be enough to penetrate deep into the posterior stroma, overcome diffraction, and prevent any keratocyte activation or inflammatory reactions. posterior collagen lamellae are less interweaved and distributed systematically which impairs the regularity of lamellar cuts performed in the posterior stroma. as the corneal anatomy becomes more compact as we go more posterior, cuts made with laser below 220 m become more rough and irregular due to reduced laser beam focus. it is believed that setting the spots closer together with more focal energy and adjusting the spot and line separation can help to create a smoother dissection even while creating deeper cuts. the interface gets rough when the laser reaches deep towards the corneal stroma for full lamellar cut. it has already been studied that ifs lasers can create endothelial lenticules with a good quality of stromal interface which is comparable to refractive surgery. the use of the fs laser to perform lamellar keratoplasty was thus evaluated in several in vitro and animal models [35, 36]. in 2007, cheng et al. reported the first fs laser-assisted endothelial keratoplasty by preparing the donor cornea using the fs laser. the 60 khz fs laser allows closer spot and line separation with lower energy levels and results in smooth stromal interface also in deeper cuts which states that higher frequency with lower energy and closer spot and line separation can create smoother stromal bed surfaces [19, 20]. bethke noted that enhancements to 150 khz fs laser can show better outcomes considering important features like (a) speed, (b) flap creation, and (c) angle variation. it is observed that increasing speed helps to place the laser ablations close together individually, simplifies flap lifts, and smoothens the surface with an overall faster procedure. the speed allows the user to place the laser ablations closer together individually and row by row. thus, increased laser speed of 150 khz over 60 khz allows the surgeon to perform the procedure in a shorter period of time with a tighter spot and line separation. microkeratome is a manual procedure and therefore standardization is less feasible as compared to fs lasers which are software-based programs. therefore, fs lasers with higher engine speed and closer spot and line separation units can be a good rescue for preparing the donor grafts for dmek. dsaek is a standardized method to perform ek, unlike dmek. as it reduces the risk of complications and allows a better and faster recovery and visual outcomes, it has become a goldstandard amongst the eye bankers and surgeons. although good results have been achieved against pk, many surgeons have speculated that dsaek can perform even better in terms of visual acuity. however, the reason for poor performance is mostly based on a hypothesis related to the presence of a stromal interface. therefore, the next challenge was to completely remove the stromal interface and create a deg. in 2006, melles introduced dmek procedure where only the donor's deg was stripped off, thus, removing most of the stromal interface. this procedure reported a number of patients with 20/20 or better, but did not exceed 40%. it was therefore concluded primarily that the stromal interference during the ek could not be the only reason of poor visual outcome post-op. moreover, dmek requires high surgical skills, tissue preparation followed by surgical time, unlike dsaek. in addition, a high rate of tissue loss and detachment rate with a huge amount of graft failures have discouraged most surgeons to adopt this technique [2, 4]. another argument for the graft failure or high rejection rate could be the presurgery mortality checks. again, the majority of surgeons who prepare the grafts before surgery do not check the endothelial mortality after preparation of the graft and therefore it is difficult to determine the accuracy of the procedure, viability of the transplanted graft and endothelial cell density post-op. therefore, we highly recommend taking this point into consideration as the surgery success depends not only on the acceptance of the graft but also on the recovery and long-term visual outcomes which is also based on viable endothelial cells. recent studies have demonstrated that dsaek grafts that are thinner than 131 micrometers have shown 20/20 vision post-op. dsaek graft thickness has not been validated or standardized at various places and therefore, it is very difficult to relate the visual outcomes to dsaek graft thickness. to reduce this complication, a new approach to the conventional dsaek surgery was introduced in 2009 and named ultrathin (ut) dsaek by busin. the preparation procedure, manipulation, and the transportation of the grafts have completely been customized. ut-dsaek uses a modified conventional microkeratome, which can cut the cornea twice. the first cut is to debulk the donor tissue and the second one to cut the final thickness up to 100 micrometers. this procedure claims to reproduce results with optimal smoothness of the stromal interface and thickness. other benefits include creating a thin tissue which reduces the wastage of donor tissue significantly. the microkeratome-assisted ut dsaek preparation showed that double cuts can create lenticules with<100 m of thickness. the endothelial cell density before and after preparation showed an average loss of approximately 3-4%, although the difference was not found significant. if it is proved that the residual stroma does not interfere with the visual outcome post-op, ut dsaek could be the future due to its benefits that include standardization, lesser manipulation, or manual error. with the current studies, dmek, which makes use only of the descemet's membrane and the endothelium for transplantation, is not a standardized procedure and due to the requirement of high surgical skills only a small number of surgeons are capable of performing it. moreover, the major drawbacks include the preparation, manipulation of donor material, unpredictable complications, and graft failure rates. although it has a<40% success rate, up to 16% of graft failure before surgery, approximately 63% of cases with detachments and 8% with primary graft failure, it is still used by some surgeons due to lack of a better option. mortality of the cells is another crucial issue in dmek, but many surgeons prefer to eliminate the mortality checks once the tissue has been prepared as they mainly target post-op visual outcomes. dsaek, an alternative surgical option for corneal endothelial disorder, has shown better postoperative results. ultrathin dsaek can cut the tissue to the minimum by removing the majority of the stroma (depending on corneal thickness) using 2 cuts which is not the case in conventional dsaek. some studies have shown that the best visual outcome can be influenced by graft thickness. according to the hypothesis, if the endothelium is left untouched, then minimum manipulation will result in reduced mortality. ease of transportation and quick surgery to reduce the overall expenses should be the next goal. as we speculate, the eye banks will play an important role in the near future for the development of new surgical techniques in collaboration with the clinicians. one of the issues for eye bankers today is that there is no standard or threshold limit for the requirement of the viable endothelial cell count for critical surgeries like dmek. this creates a lot of confusion, when a surgeon demands a precut tissue for dmek or when a surgeon is preparing the graft before surgery. moreover, as mentioned earlier, the majority of surgeons do not calculate the mortality or the endothelial cell density after the tissue preparation, which addresses a challenge to the eye bankers to standardize the mortality issue. this also results in a false positive post-op endothelial cell survival study although the results for surgical success and visual recovery are documented to be positive. thus, in general, the possible future challenges and the key issues which need to be identified and demonstrated for the standardization of the ek procedures could be the following.thickness: can thinning the tissues to the minimum (deg) be really useful in terms of visual outcome?viable endothelial cell density: should the surgeons evaluate the mortality or the viable endothelial cell density after dmek graft preparations before surgery?standardization: can a standardized and validated pre-cut, preloaded tissue help to reduce the risk, time, and cost of the surgery? thinning the tissues using ut dsaek has provided better results, but needs to undergo a strong confirmation to practically prove the repeatability and long-term beneficial effects of this procedure. if thinning the tissues can create a more suitable visual outcome, then the amount of thickness and the detachment or other associated risks should be justified. moreover, thinning the tissue can result in unwanted effect of rolling the deg on itself which can decrease the cell viability. a perfect dmek/deg usually has a thickness of 1530 micrometers which is not enough to hold the lenticule without getting damaged. therefore, it is very important to understand and validate the mortality threshold for the deg. this will help to prepare a pre-cut dmek/deg in the eye banks and increase the quality control levels, save time, cost, and risks associated with the graft failure due to surgeon preparatory mistakes. therefore, we believe that a more standardized, validated and ready to transplant tissue should be the future of dmek surgery. moreover, the recent advances in the use of fs lasers for donor graft preparation could be advantageous in terms of increasing the stromal interface smoothness and cuting it with more ease; however, it might be more expensive than the conventional techniques. furthermore, it is also important to validate the procedure for dmek graft preparation using fs lasers in terms of energy/frequency levels and thickness of the required graft. in the future, use of fibrin glue could prove beneficial for sampling, handling, and transporting the dmek tissues with ease of surgery, although the pros and cons need to be identified if used in vivo. thickness: can thinning the tissues to the minimum (deg) be really useful in terms of visual outcome? viable endothelial cell density: should the surgeons evaluate the mortality or the viable endothelial cell density after dmek graft preparations before surgery? standardization: can a standardized and validated pre-cut, preloaded tissue help to reduce the risk, time, and cost of the surgery? according to a study, if the cost analysis of surgeon-cut and the eye-bank cut donor corneal tissue for ek is valued, then the cost per surgeon-cut donor corneal tissue decreases if the number of cases performed increases per year. excluding other factors such as opportunity costs, the eye bank processing charge is almost equal to the expenses associated with a surgeon-cut cornea if the surgeon was to perform approximately 15 cases/year. the microfinance study was based on costs of equipments, consumable supplies, labor charges, building space, and risk of attempted damage. even if the cost is low, the risk associated with the graft preparation during the surgery is of major concern. therefore, we believe that a prevalidated tissue could be a better option for surgeons to reduce the presurgery time, effort, and risks associated with graft failure. thus, we envision that standardizing the posterior lamellar graft preparation methods will reduce unnecessary manipulation of the tissue in the operating theatre and reduce the high surgical skill or risk quotient. in the near future, the deg could be supplied as pre-cut tissues which would reduce the overall intervention costs and save time. a recent study has shown a moderate decrease in endothelial cell density if the deg is left in storage under organ culture, which concludes that a pre-cut dmek preservation is possible for future transportation. the final graft would reduce the severe efforts of manipulation by the surgeons thus providing better quality tissue for patients. hence, the intention should be to achieve an easy, efficient, and a validated procedure for dmek surgery.

descemet membrane endothelial keratoplasty (dmek) is a corneal surgical technique which selectively replaces the damaged posterior part of the cornea with a healthy donor graft retaining the rest of the tissue intact. there is a need to validate and standardize the donor tissue before grafting due to certain issues that can lead to consequences such as graft failure due to poor endothelial cell count, higher mortality, detachment of the graft, or increased surgical expenses, time, and effort. thus, prospective potential surgeons and eye banks should now aim at developing new improved surgical techniques in order to prepare the best suited, validated, precut, preloaded, and easy to transplant tissue to reduce pre- and postsurgical complications. this could be achieved by defining parameters like graft thickness, accepted mortality threshold of the endothelial cells, and behavior of grafts during preservation and transportation along with using more sophisticated instruments like microkeratome and femtosecond lasers for graft preparation. thus, a rapport between the eye banks and the surgeons along with the advanced instruments can overcome this challenge to find the best possible solution for endothelial keratoplasty (ek).

PMC3683473

pubmed-578

mandibular third molars are found in 90% of the general population while 33% of them having at least one impacted third molar. mandibular third molar surgery is one of the most frequent surgical procedures carried out by oral surgeons. there are various reasons for m3 surgery such as caries and their outcomes, germination disorders, orthodontic problems, infection, trauma, and prevention or improvement of periodontal defects in the adjacent second molars. surgical procedures for extraction of impacted third molars are associated with the significant morbidity including pain, swelling, trismus, and potential complications such as nerve injury and injury to adjacent teeth. an important question to address is the risk of persistent or developing new periodontal defects on the distal aspect of the mandibular second molars following extraction of third molars. there is controversy about the incidence of periodontal defect at the distal aspect of the second molars after surgical extraction of the third molars. some authors have shown improvement of periodontal health distal to the adjacent second molar, whilst others have demonstrated loss of al and reduction of alveolar bone height. hence, the aim of our study was an evaluation of the periodontal parameters; pd, and al, on the distobuccal aspect of the second molar after surgical extraction of the impacted third molar. the sample was derived from the cohort of subjects enrolled in the clinical trial. to be included in the cohort, the subjects must be healthy young patients with a mesioangular impacted mandibular third molar that categorized at c1 class based on the pell and gregory classification [figure 1]. class c mandible third molar impaction; the occlusal plane of the impacted tooth is apical to the cervical line of the adjacent tooth the original cohort was composed of 50 subjects, with the mean age of 20.9 (range from 18 years to 25) years, of which 42 completed the study regular follow-up. all lower third molars were extracted by one surgeon under local anesthesia, generally with lidocaine in a 2% solution with epinephrine at 1:100,000. the surgeon raised a full-thickness triangular flap, which was protected by a minnesota retractor. sterile moderate speed (30,000 rpm) handpieces and sterile saline solution were used for ostectomy and tooth sectioning when necessary. to close the wound, no. 3-0 vicryle suture was used and after 7 days the suture was removed [figure 2]. pre-operative panoramic view of a class c impacted mandibular third molar (a), post-operative panoramic view of the same tooth (b) periodontal pd was measured on the distobuccal aspect of adjacent second molars with using a customized occlusal stent as a guide for the path of insertion of periodontal probe and michigan o periodontal probe (hu-friedy, chicago, il) before surgery (pd1) and 6 months after surgery (pd2). al also was measured from cementoenamel junction (cej) with using occlusal stent, before surgery (al1) and 6 months after surgery (al2) on the distobuccal aspect of the second molars. one sample t-test was used to examine the mean difference of the pd1 between the sample and the known value of the normal pd. this comparison showed that the mean of sample's pd1s was not statistically different from normal values. indeed, samples before surgery were similar in term of this parameter to the right standard. data analyses were conducted by using spss software (version 19) and a probability level of 0.05 was used throughout. the results were analyzed statistically using one sample t-test and paired-sample t-test. during the study interval, 50 patients enrolled in the study; 42 of them completed the study. seven patients were excluded from analyses because they failed to complete regular follow-up. the pre-operative baseline pd (pd1) and 26 weeks post-operative (pd2) were measured; they ranged from a mean sd of 2.71 0.59 mm to 3.60 0.88 mm respectively. the al measurements ranged from a mean sd of 3.62 0.69 mm pre-operative (al1) to 3.48 0.74 mm 26 weeks post-operative (al2). for the periodontal pd measures, there was a statistically significant increase between the pre-operative baseline pds (pd1) and 26 weeks post-operative (pd2) measurements. furthermore, there were a statistically significant decrease between the pre-operative als (al1) and 26 weeks post-operative (al2) measures (p<0.05) [table 1]. pre-operative and 26 weeks post-operative results and evaluation of them by the t-test when managing impacted mandibular third molar in the adult population, the risk for developing or having persistent periodontal defects on the distal aspect of the mandibular second molar should be considered. the results of this study showed that routine surgical management of full impacted mesioangular third molars resulted in statistically significant increased pd on the distal aspect of the mandibular second molars and the decrease in al were also statistically significant 6 months after surgery. three important factors were found to influence periodontal status at the distal aspect of the second molar: patient's age, third molar impaction type and depth and pre-surgical periodontal defects. because of importance of above mentioned factors, two of the primary competency requirements for entrance to the study were the state and type of impaction. only asymptomatic fully impacted mesioangular third molars were evaluated to avoid confounding factors related to exposure to the oral cavity and prior inflammatory/infectious processes. patient's age is another important risk factor commonly referenced in the literature. for this reason, the sample analyzed in our study represented a group of young patients with the mean age of 20.9 (range from 18 to 25) years. a small, specific sample group was selected (42 mandibular third molars from 50 patients) and given the statistically significant findings, by definition, the sample size was adequate. as in almost all longitudinal studies, the duration of follow-up was 6 months because there is a higher risk of patient dropout after 6 months. in nearly all peer-reviewed studies, as in our study, only one specific pd site was noted but some reported the average measurements of two to three sites. because the entire distal aspect of the second molar is at risk from the presence of pre-operative infrabony defects and iatrogenic injury during third molar surgery, it is more valuable that, the periodontal parameters be measured at three sites at the distal aspect of the second molar to provide a more detailed visualization of this area. previous studies showed that extraction of impacted mandibular third molar had no negative effects on the periodontal status of the adjacent second molar and in many patients it has resulted in improvement of the pd of second molars. other studies revealed the formation of periodontal defects at the distal aspect of second molars after surgical extraction of the mandibular third molars. these studies did not classify the types of impaction, but our study concentrated on the mesioangular impacted third molars categorized in the c1 class based on the pell and gregory classification. in this study, a period of at least 6 months following surgery had been elapsed prior to clinical examination for sufficient hard and soft-tissue healing to have occurred. as localized periodontal lesions may remain symptomless until the periodontal attachment loss is very advanced, these may easily escape detection by the patient and an attending dentist. one study showed a greater reduction of deep intrabony defects persisting post-extraction in the 20-years-old age group versus the 30-years-old age group. another study found no correlation between age and increase pd at the distal aspect of the second molars after extraction of the third molars. in our study, all patients were in the same age group (18-25 years), so the influence of age on the periodontal parameters of the second molar after surgical extraction of the third molar was not shown. pre-operative condition of periodontal tissue at the distal aspect of the second molars may affect post-operative pd. the effect of different flap designs on post-operative periodontal pocket formation at the distal aspect of the second molar and other squeals has been reported. we used sulcular incision with the releasing incision at the mesial aspect of second molars due to the necessity for wider access to the fully impacted third molars. some other studies suggest reconstruction of bone defects after surgical removal of the impacted third molar. first, the change of pd was evaluated in the target population after 6 months and second, the change of al at the distal aspect of the second molar was evaluated after surgical removal of the third molar. we concluded that the extraction of deeply impacted third molars causes increased pd at the distal aspect of the second molars, but al decreased. further studies using reconstructive procedures are recommended for preventing or resolving persistent periodontal defects on the distal aspect of the second molar after surgical removal of the impacted mandibular third molar.

background: several conflicting findings have been published in the previous literature regarding the effects of impacted third molar surgery on the periodontal parameters of the adjacent second molar; some authors have shown improvement of periodontal health distal to the adjacent second molar, whilst others have demonstrated loss of attachment level (al) and reduction of alveolar bone height. the purpose of this study was to evaluate the changes in periodontal health parameters distal to the adjacent second molar following extraction of an impacted third molar. materials and methods: out of 50 patients participated in the study, 42 patients completed the study. the mean age of the sample was 20.9 (range, 18-25) years. all teeth were mesioangular impacted mandibular third molars categorized at c1 class based on the pell and gregory classification. all surgeries were performed by one surgeon and the same surgeon recorded the pre-operative and post-operative measurements of probing depth (pd) and al on the distobuccal aspect of the second molars. data analysis were carried out with the spss software (version 19), using the paired-samples t-test and one sample t-test. results:surgical extraction of impacted mandibular third molar resulted in a significant increase of pd on the distobuccal aspect of the second molars, whereas al was decreased significantly after surgery (p<0.05). conclusion: unlike plenty of researches that have shown improvement of periodontal parameters of the second molar after extraction of impacted third molar, our study showed a significant increase in pd at the distal aspect of the second molar. further follow-up on clinical and radiological parameters are required for more profound understanding of the long-term effects of third molar extraction on the periodontal parameters of the adjacent second molar.

PMC3793418

pubmed-579

autologous peripheral blood hematopoietic cell transplantation (auto-pbhct) is a well-established therapeutic option for patients with a variety of hematologic malignancies. mobilization of peripheral blood progenitor cells (pbpc) for auto-pbhct can be accomplished by using cytokines, most commonly granulocyte-colony stimulating factor (g-csf), either alone or in combination with chemotherapy (e.g., cyclophosphamide, etoposide, cytarabine, etc.) or plerixafor [1, 2]. recently reported phase iii studies have also shown superiority of the combination of g-csf with plerixafor over g-csf alone for mobilizing pbpc in patients with non-hodgkin lymphoma (nhl) and multiple myeloma (mm) [3, 4]. plerixafor acts by selective and reversible antagonism of cxcr4 on cd34+hematopoietic stem cells (hsc). this results in disruption of its interaction with cxcl12 (formally sdf1) on bone marrow stromal cells, that cause a rapid release of stem and progenitor cells from bone marrow into peripheral blood. while plerixafor-based pbpc mobilization can circumvent the need for chemotherapy to mobilize cd34+pbpcs, to our knowledge no prospective trials comparing plerixafor plus g-csf to chemomobilization have been published to date. limited data on murine models suggest that a combination of plerixafor and chemotherapy may be more effective than the use of plerixafor alone for pbpc mobilization. despite the promising results of plerixafor and g-csf for pbpc mobilization in patients with mm and nhl [3, 4, 68], the use of chemotherapy and g-csf-based regimens to mobilize pbpc remains standard practice in many transplant centers. this decision is often influenced by a desire to improve collection yield, reduce mobilization failures especially in patients who are elderly, heavily pre-treated, and have poor bone marrow cellularity, and/or as an attempt to provide disease control [911]. limited data are available on the preemptive use of plerixafor salvage in patients failing to collect adequate numbers of pbpc with chemotherapy and g-csf-based mobilization [1214], and this topic has been reviewed recently. herein we report our experience from two north american transplant centers in a series of patients who received plerixafor salvage while failing chemotherapy and g-csf mobilization. for patients undergoing chemotherapy and g-csf-based mobilization, it is standard operating procedure at both transplant centers to measure peripheral blood cd34+cell count daily when the patient's white blood cell (wbc) count recovers to 4,000/l or from day+12 (after chemotherapy) onwards (whichever occurs first). patients destined to fail pbpc chemomobilization were defined as (i) those with a peak peripheral blood cd34+cell count of<10/l following wbc count recovery (wbc count of 4,000/l) after chemotherapy-induced nadir or (ii) those who failed to collect at least 1 10 cd34+cells/kg after two apheresis sessions. in these patients failing chemomobilization, we administrated plerixafor at a dose of 0.24 mg/kg subcutaneously 10 hours prior to apheresis in conjunction with g-csf (10 g/kg), as a preemptive salvage strategy. all collections were performed with a cobe spectra apheresis system (caridianbct, lakewood, co), by processing three to four blood volumes. it is the institutional policy at both transplant centers to routinely target collection of 5 10 cd34+cells/kg. determination of peripheral blood cd34+cell count and cd34+cell content of the apheresis product was performed at the georgia health sciences university hla laboratory and west virginia university hospitals flow cytometry laboratory. the bd facscanto ii flow cytometer, (becton dickinson, san jose, ca) was used for all analyses. after red blood cell lysis, washed samples were used for cd34+enumeration with pe-labeled, 8g12 clone, immunoglobulin g1 (becton dickinson, san jose, ca) based on international society of hematotherapy and graft engineering (ishage) guidelines. the final products were cryopreserved in 10% dmso using a controlled rate freezer and stored in liquid nitrogen. successful mobilization was defined as a total of 2 10 cd34+cells/kg patients body weight in the final product. data was collected on mobilization and transplant outcomes through an electronic data base, prospectively maintained at each participating institution and analyzed utilizing spss version 13.0. patient characteristics and transplantation outcomes of 16 patients who were failing chemomobilization (as defined above) and received preemptive plerixafor are summarized in table 1. patients had received a median of two lines of therapies (range 13) prior to pbpc mobilization. after recovering from chemotherapy-induced count nadir (i.e., wbc 4000/l), 15 patients had a peak peripheral blood cd34+cell count of<10 l. five patients underwent at least 2 sessions of apheresis but were unable to collect 1 million cd34+cells/kg. these patients subsequently received a median of two doses of plerixafor salvage (range 18). the median number of apheresis sessions was 3.5 (range 27), and the median number of cd34+cells collected was 3.9 10 cells/kg (range 2.47.8). utilizing a cutoff of 2 10 cd34+cells/kg, all patients who received plerixafor had a successful collection. nineteen percent of the patients were able to collect 5 10 cd34+cells/kg. three patients (one with hodgkin lymphoma and two with nhl) required more than four doses of plerixafor, but all eventually collected 2 10 cd34+cells/kg. the median peak peripheral blood cd34+cell count prior to plerixafor administration was 3.5/l (range 015) and increased to 6/l (range 247) after the first dose of plerixafor (p=0.03). 93% of the patients had a peak peripheral blood cd34+cell count of<10/l before plerixafor salvage. four patients had a peak peripheral blood cd34+cell count of 1/l before plerixafor salvage. kinetics of peripheral blood cd34+cell and wbc count changes after each dose of plerixafor for these 4 patients is shown in table 2. after transplantation, the median time to neutrophil and platelet engraftment was 10 days (range 915) and 20 days (range 929), respectively. in order to identify predictors of response to plerixafor salvage, as expected, patients with a higher peripheral blood cd34+cell count at the time of the first plerixafor dose had a higher magnitude of change in their peripheral blood cd34+cell counts (r=0.58, p=0.01). only three patients had a cd34+cell count of 10/l before the first dose of plerixafor, and their median increase was 18/l compared to 6/l for patients who had peripheral blood cd34+cell counts of<10/l however, this difference was not statistically significant (p=0.3). we did observe a positive correlation between peak peripheral blood cd34+cell count before the first dose of plerixafor and the total number of cd34+cells collected at apheresis (r=0.62; p=0.01). of the 41 collections with plerixafor, the mean cd34+cell dose collected was 0.79 10 cd34+cells/kg from 25 collections in patients with a peripheral blood cd34+cell count<10/l versus 2.09 10 cd34+cells/kg from 16 collections in patients with a cd34+cell count greater than 10/l (p=0.001). correlation analyses were performed in order to define an optimal cutoff of wbc count that can be used as a marker for the initiation of plerixafor salvage, which showed that wbc count had no correlation with a change in cd34+cell count after the first dose of plerixafor (r=0.21, p=0.41). utilizing the median wbc count of 32/l at the time of administration of plerixafor in our patients, we found that we were able to collect a higher number of cd34+cells in patients who had a wbc count 32/l as compared to those with a wbc count>32/l (1.67 10/kg versus 0.8 10/kg, p=0.02 resp.). our limited multicenter outcomes data suggest that the addition of plerixafor as a preemptive salvage may rescue patients who are destined to fail chemotherapy and g-csf-based pbpc mobilization. in our series we used plerixafor salvage to rescue an otherwise failed attempt for chemomobilization, which contrasts with prior studies where plerixafor was used to remobilize patients who had failed prior mobilization attempts. this is also in contrast to studies where plerixafor was routinely given to patients undergoing chemomobilization. in our series plerixafor was given after recovery from chemotherapy-induced count nadir (median of 11.5 days after chemotherapy) and resulted in successful cd34+cell collection in all patients, who were otherwise likely to fail chemomobilization. interestingly patients with a wbc count of 32/l were able to collect a higher number of cd34+cells. this is in contrast to earlier data [1215] that indicated limited efficacy of plerixafor in patients with a lower wbc count. this discrepancy can be a reflection of the decreased efficiency of the collection process in patients with a higher wbc count or possibly a reflection of timing of plerixafor administration. generally a cd34+cell count of 1013/l is used as a cutoff for initiating apheresis following cytokine only, cytokine plus plerixafor, or chemomobilization in majority of transplant centers in the country. the median cd34+cell count of our patients was only 3.5/l with 82% less than 10/l at the time of the first plerixafor dose, and all patients were able to collect a minimum of 2 10 cells/kg. however, a valid cutoff for peripheral blood cd34+cell count to initiate apheresis when plerixafor is used as a salvage for failed chemomobilization is unknown. patient characteristics and institutional preference will likely continue to influence the choice for mobilization strategy in patients undergoing an auto-pbhct. while no prospective data are available to demonstrate better efficacy or cost effectiveness of plerixafor-based mobilization over chemotherapy-based mobilization, our preliminary data provide safety and efficacy data for plerixafor salvage to rescue patients failing chemotherapy-based pbpc mobilization.

the combination of filgrastim (g-csf) and plerixafor is currently approved for mobilizing peripheral blood progenitor cells in patients with non-hodgkin lymphoma and multiple myeloma undergoing autologous peripheral blood hematopoietic cell transplantation. however, chemotherapy and g-csf-based mobilization remains a widely used strategy for peripheral blood progenitor cell collection. in this paper we describe our experience from two north american transplant centers in a series of patients who received salvage plerixafor while failing chemotherapy and g-csf mobilization. patients received a median of two doses of plerixafor salvage upon failure to mobilize adequate number of peripheral blood progenitor cells at neutrophil recovery. the use of plerixafor was associated with a 2.4-fold increase in peripheral blood cd34+cell count and 3.9-fold increase in total cd34+cell yield. all patients were able to collect 2 106 cd34+ cells/kg with this approach. these results were more pronounced in patients with a higher cd34+cell count at the time of the first plerixafor dose. interestingly, peripheral blood white blood cell count was not shown to correlate with a response to plerixafor. our results provide safety and efficacy data for the use of plerixafor in patients who are destined to fail chemomobilization.

PMC3335320

pubmed-580

many studies on unruptured aneurysms have reported a prevalence of approximately 3.6 to 6% and a bleeding rate of approximately 2.3 to 0.3%/year.1)18) for the giant aneurysm (25 mm), a rupture rate of 6% has been reported for one year since the first diagnosis, and based on the natural history, it was considered bad due to high lethality.1)15)20) however, with technological developments in the fields of surgery and anesthetics since the 1970s-1980s, the mortality and morbidity associated with the operation have shown a rapid decrease. in addition, advances in diagnostic technology have made it possible to find and treat an unruptured aneurysm that has already been diagnosed prior to the rupture.8-10) accordingly, most studies on unruptured aneurysms have reported symptoms that appear prior to the rupture of an aneurysm, and have discussed correct diagnostic procedures, various treatments and results. the last path of the natural history of an unruptured aneurysm concerns death or disability caused by the rupture. however, few studies on unruptured aneurysms that have disappeared by spontaneous cure have been reported. due to medical ethics, conduct of such clinical studies we report on a large right middle cerebral artery (mca) aneurysm, which induced subarachnoid hemorrhage (sah) after rupture and showed spontaneous occlusion after a wrapping operation. the characteristics and causes of the aneurysm and possible spontaneous cure no abnormal findings were observed on the first neurologic examination, while other medical examinations also showed normal findings. findings on brain computed tomography (ct) examination showed a slightly high-density intra axial mass lesion measuring approximately 2.5 cm lateral sides on the right sylvian fissure. it showed no edema around the mass, iso-density and strong enhancement without calcification inside (fig. according to findings on a three-dimensional ct angiogram (3-d cta) examination, the mass was diagnosed as a saccular aneurysm in the right mca bifurcation (fig. t2 weighted images from a brain magnetic resonance image (mri) examination showed a high signal in the aneurysm and a heterogeneous peripheral low signal. at the back of the aneurysm sac, a t1 weighted image showed a low signal in a part close to the circle of willis and an iso signal far from it. like the ct image, it showed a slightly low signal with dense contrast enhancement and difference in filling in the aneurysm sac (fig. in addition, sah was not found on the ct examination; however, a small amount of sah was noted around the aneurysm and along the sylvian fissure. in the right internal carotid artery (ica) angiogram (three-dimension subtraction image) posterior to anterior view, an aneurysm measuring 21.6 20.9 mm in the right mca bifurcation was observed in a lateral direction. it formed a broad neck along an inferior branch of m2 and several perforating branches were observed around the neck (fig. it is specific in the angiogram that the filling of the aneurysm in the early arterial phage was not partially performed. filling of the aneurysm in the later arterial phage was completed, without excretion up to the capillary phage. direct clipping in the operation field was difficult; therefore, the operation was completed after wrapping the ruptured portion using surgical glue. the patient was discharged from the hospital without complications. according to findings on the mri examination performed approximately months after discharge, a target sign that appeared as a high signal, and a low signal in a slightly inner portion and a high signal again in a central portion, an examination after 19 months showed that the size of the aneurysm had decreased considerably (fig. 5b). finally, according to findings on the angiogram and mri examination (which were performed after three years and eight months), there was no trace of the mass in the sylvian fissure due to the considerable reduction in the size of the aneurysm and almost everything in the m2 branch was intact (fig. occlusion of an aneurysm due to spontaneous thrombosis was first reported in 1955.2) the risk of a ruptured aneurysm became known in the mid 1970s, however, due to high mortality and morbidity associated with the operation, administration of an active treatment for ruptured aneurysm was difficult. they have been widely spread by yasargil since the mid-1970s, which led to an increase in the success rate of operation and a decrease in complications from anesthesia. it also led to a rapid decrease in mortality and morbidity from the operation.21) however, according to the development of diagnostic technologies, including ct, mri, and other methods, the number of cases of diagnosed unruptured aneurysm has shown a continuous increase, and treatment of unruptured aneurysm has recently become a controversial issue. in addition, questions arose regarding the bleeding rate in the natural history of an unruptured aneurysm, or whether to treat the aneurysm or monitor its progress by comparing the bleeding rate, and mortality and morbidity of the operation. likewise, a randomized controlled study is the most ideal approach to understanding the natural history of a ruptured aneurysm. many papers have reported a high bleeding rate in the natural history of an unruptured giant aneurysm, while several case reports on spontaneously cured aneurysms have been published. loevnet et al.12) reported a large basilar artery aneurysm found nine months after a seven-year-old boy received a trauma, which showed complete disappearance after six years. morn et al.14) reported on a traumatic posterior cerebral artery aneurysm of a six-year-old boy, which disappeared completely after five years. other cases of spontaneous occlusion of a traumatic aneurysm have been reported, insisting that less than 15% of traumatic aneurysms were cured spontaneously.15) krapt et al.11) suggested that a congenital, unruptured giant aneurysm in a nine-month-old female infant was completely occluded and absorbed, based on three-year examination. there have also been papers on infants who could not undergo an operation or spontaneous occlusion of a traumatic aneurysm, however, few reports on the natural history of an un-ruptured aneurysm have been published. vasconcellos et al.3) proposed that 25% (five cases) of 20 cases showed courses of spontaneous occlusion during observation of giant carotid cavernous aneurysms of the internal carotid artery with a relatively low risk of bleeding. the possibility of spontaneous occlusion was relatively high in cases of improvement of initial symptoms, such as retrobulbar pain or migraine during courses of carotid cavernous giant aneurysms. a factor to analogize spontaneous occlusion of an unruptured aneurysm is the volume-to-orifice ratio.20)29) through analysis of the results for the ratio of the size (mm) of the aneurysm neck to the aneurysm volume (mm) from studies on 21 aneurysms, a value greater than 25 mm indicates the potential for thrombosis, and a value greater than 28 mm indicates a strong possibility of thrombosis. thus, it is assumed that as the volume-to-orifice ratio grows larger, thrombosis appears more frequently by inducement of red blood cell aggregation thrombosis due to blood stasis in the aneurysm. accordingly, the pathophysiology of thrombosis is not clear, however, it has received the most support. the volume-to-orifice ratio calculated in our case was 28 mm, and the results of angiography showed partial dye filling in the aneurysm in the early arterial phage, maximum filling in the late arterial phage, and slow filling delayed excretion in the capillary phage. the other study insisted on the possibility that thrombosis could cause intermittent vasospasm or dehydration caused by non-ionic contrast media while reporting cases of aneurysm that has caused thrombosis after angiography. however, it was impossible to demonstrate the correct mechanism.7) partial thrombosis of a giant aneurysm from 48 to 76% has been reported, however, sources demonstrating complete thrombosis are scarce.6) through observation reports on 22 cases of giant intracranial aneurysms, whittle and et al.19) overthrew the conventional assumption that partial thrombosis in an aneurysm can reduce hemorrhage risk, by demonstrating that there was no difference in incidence of sah in 12 cases of thrombosis and non-thrombosis. they also insisted that mortality generated after sah, and mortality and morbidity before and after surgery did not differ. as a result, they reported that partial thrombosis of the aneurysm did not reduce the risk of sah and only aneurysms with total thrombosis reducing the risk of sah. they also argued that partial thrombosis did not influence procedures or methods for treatment of giant aneurysms. due to the dynamic and reversible courses of thrombosis of aneurysms, observation of a course over a long period of time is necessary. in addition, its generation and resorption are performed repeatedly, and complications such as thromboembolic infarct can occur.13) whittle et al. insisted that wrapping of a ruptured aneurysm had an effect on small aneurysms, but that wide-based, large, or giant types of mca aneurysms are associated with a high risk of rebleeding and fatal outcomes. wrapping was generally known as an inadequate method of treating an aneurysm.5)16) accordingly, it is impossible for wrapping to stop rebleeding of the aneurysm.5)17) deshmukh et al.4) reported that according to angiographic follow-up studies on 34 patients who underwent wrapping of an aneurysm for an average of 3.4 years, there was no change in the size and shape of the aneurysm. despite reports on rupture caused by wrapping or a change in size, there was no basis for occlusion of the aneurysm after wrapping, as manifested in our case. the authors report on a case of spontaneous occlusion and absorption of a saccular aneurysm of mca bifurcation. it was assumed that in the pathophysiology of spontaneous occlusion of an aneurysm, sluggish flow in the aneurysm may be the cause and the volume-to-orifice ratio of the angiography, slow filling, and delayed excretion through prediction of slow flow may manifest. in cases of inoperable aneurysm, however, long-term observation is more critical for an aneurysm that does not involve a stationary lesion and one that has dynamic courses. conduct of further studies on the characteristics and types of aneurysms that will undergo spontaneous occlusion is needed.

there are few observation papers regarding the natural history of an aneurysm. we report on a case of a completely occluded middle cerebral artery (mca) aneurysm. a 47-year-old female patient presented with a headache and was diagnosed with rupture of a right mca aneurysm. due to a high risk of direct neck clipping, she received conservative treatment after craniotomy and wrapping of her aneurysm. the patient's condition showed improvement, with complete occlusion of the aneurysm and considerable reduction of the aneurysm in size after approximately three years. this is a rare case of an aneurysm of mca that showed spontaneous resolution. finally, on the angiogram, characteristics of an aneurysm to occlude spontaneously will be presumed based on literature reviews.

PMC3543918

pubmed-581

hardware removal is indicated for infection, nonunion, failure of fixation, pain, soft tissue irritation, and anticipated strenuous activity after fracture healing [14]. during removal cases subsequent removal of broken hardware increases surgical time, and retained metalwork potentially complicates future surgeries (figure 1). although there have been several articles that have discussed titanium implant failure, most have discussed this issue within the context of hardware failure during fracture healing, and not particularly during removal of hardware [69]. to our knowledge, none have been specific to the elbow, which merits its own discussion due to its unique anatomy. the distal humerus of the elbow is unique in that is has a high ratio of cortical to cancellous bone. therefore, in this study we set out to investigate incidence of bone screw failure during hardware removal procedures and we were interested in comparing titanium and stainless steel bone screws because these are the most common types of metallic fracture implants in circulation. in addition, we set out to determine whether the duration of implantation and the anatomic location of the bone screws about the elbow were associated with bone screw failure during removal procedures. a better understanding of metallic hardware failure during removal procedures may help surgeons in the preoperative planning stages of these cases, in terms of surgical tool selection and staff availability. after institutional review board (irb) approval, all cases performed by orthopaedic trauma or upper extremity surgeons between 1/1/2000 and 10/1/2009 at our level 1 trauma center were reviewed. inclusion criteria were (1) deep implant removal cases, (2) hardware removed from the distal humerus or the proximal ulna, and (3) isolated elbow injuries. the exclusion criteria were (1) cases that did not have relevant or inaccessible elbow x-rays, (2) single screw fragment extraction cases (because in these cases the hardware had previously broke and was small in size, which we believe was not representative of the other screws being removed), (3) patients younger than 17 years, and (4) cases that were originally performed at an outside institution (unavailable medical records). the factors considered were (1) whether or not the bone screws broke during removal and the type of implant metal used (titanium alloy, ti6al4v or stainless steel), (2) the length of time between initial implantation and removal, where cases were divided into two groups based on a conservative estimate of the time period required for osseointegration of titanium implants [10, 11]: one group was for cases where the duration of time between implantation and removal was less than 12 months and the second group was for cases where the duration between implantation and removal was 12 months or more; and (3) anatomic location about the elbow (distal humerus or proximal ulna). the data was extracted from the medical record. due to the small sample size, fisher's exact test was used to determine statistical differences between two sets of categorical data. an independent t-test was used to compare the means of two independent groups. differences that had less than 0.05 probability of occurring from chance were considered statistically significant. we identified a total of 47 cases, of which 21 met the inclusion criteria. we carried out an independent t-test to determine if there were any differences between the ages of patients that had broken screws and those that did not, and no statistical significance was found, p=0.740. out of 21 cases, screws broke during removal in 5 cases (23.8%). in 16 out of 21 cases, the reasons for hardware removal were infection in 7/21 cases, symptomatic, prominent hardware in 7/21 cases, nonunion in 6/21 cases, and contracture in 1/21 cases. 14 involved titanium alloy and 7 involved stainless steel implants. within the titanium hardware group, in 10 cases removal was uneventful, and in 4 cases, fracture of at least one screw occurred. in comparison, out of the 7 stainless steel hardware removal cases, there was one case that resulted in one or more broken screws. overall, compared to stainless steel, failure of titanium alloy screws during removal was not found to be statistically significant (p=0.61). in order to determine whether there were any association between the duration of implantation and hardware failure during removal, cases were divided into two groups: group (1) duration of hardware implantation was 12 months or less (mean 7.7, range two to 12 months), and group (2): duration of implantation was more than 12 months (mean 41.6, range 16 to 74 months). twelve cases had hardware removed within 12 months of implantation and nine cases had hardware removed after 12 months of initial implantation. bone screws that were removed after 12 months of surgery were more likely to break during removal (p=0.046). when titanium screws were analyzed separately, those removed within 12 months of surgery were more likely to be removed intact as compared to those removed more than 12 months after implantation (p=0.003). the small number of stainless steel cases (seven) did not warrant statistical calculations. with respect to anatomic location, there were 12 distal humerus and 15 proximal ulna cases (table 1). six cases involved the distal humerus only, nine cases involved the proximal ulna only, and six cases had simultaneous proximal ulna and distal humerus involvement. in one case where titanium screws broke and in one case where stainless steel screws broke, it was unclear where the location was and these cases were discarded from the analysis. in general, bone screw failure was equally likely to occur when removed from the distal humerus and the proximal ulna (p=0.28). hardware failure during removal cases is a commonly seen problem in orthopaedics (figure 1). currently, there is no single hardware removal technique that is uniformly successful, and several different methods may be employed during the same case. such techniques include the use of screw extractors, trephines, extraction bolts, pliers, and various other devices. the purpose of this article was to determine the incidence of bone screw failure during hardware removal procedures, and we were interested in comparing titanium and stainless steel bone screws. in addition, we set out to determine whether the duration of implantation and the anatomic location of the bone screws about the elbow had any association with bone screw failure during removal procedures. we believe that prior knowledge of the type of metal implanted (mainly titanium) and the duration of implantation to be useful information that can help in the preoperative planning of hardware removal procedures. firstly, this may allow surgeons to request hardware removal kits, thus saving precious operative time. second, it is our experience that hardware removal procedures are often considered not technically demanding and are often delegated to less experienced surgical staff such as junior residents who may be more likely to break the hardware. therefore, we believe that experienced staff surgeons should be available during procedures where titanium is being removed. having broken hardware in the elbow may complicate future surgeries in the same region of the limb. with regards to orthopaedic implants, it is known that both titanium alloy and commercially pure titanium hardware are more predisposed to in situ fracture relative to stainless steel [69]. as compared to stainless steel, titanium alloy is lighter, has a lower modulus of elasticity, and has superior corrosion resistance and biocompatibility, but inferior ductility and notch sensitivity. the literature search performed for this review did not reveal any previous studies that compare hardware removal from the elbow in vivo for titanium and stainless steel fracture implants. in contrast to titanium implants remaining in situ for less than 12 months, we observed that the titanium implants remaining in situ for more than 12 months had a tendency to fail during extraction. in this series, it is likely that a combination of titanium alloy's fatigue properties secondary to notch sensitivity and osseointegration were responsible for this observation. the fatigue strength of titanium alloy is generally comparable to stainless steel 316l, but notch sensitivity in both commercially pure titanium and titanium alloy has been shown to significantly shorten the fatigue life of these implants in comparison to stainless steel [1214]. osseointegration has been observed to occur within 310 months in titanium alloy [10, 11]. the degree of bone ingrowth and on-growth, however, continues to increase for years after initial implantation (figure 2). although there have been studies showing evidence of stainless steel osseointegration, it is generally accepted that commercially pure titanium and titanium alloy are more biocompatible and more likely to osseointegrate than stainless steel. in our series, it is likely that as osseointegrataion became more complete, greater removal torques contributed to the failure of titanium alloy screws in this series. given these properties, we postulate that over longer periods and increased loading cycles, the development of micofractures and osseointegration contributed to screw breakage during implant removal. secondly, the cases studied were not uniform; there were a wide variety fractures and hardware systems involved. in addition, due to the small number of cases it was necessary to include multiple surgeons. in addition, not all x-rays were available for review; therefore we were not able to account for the type of hardware, such as locking or non locking plate technology. in this study, there appears to be a time-related association for bone screw failure during removal cases, and for titanium alloy in particular. this is likely due to the increased bone ingrowth and the adverse effect of notch sensitivity on titanium alloy's fatigue properties.

a retrospective review of 21 patients that underwent bone screw removal from the elbow was studied in relation to the type of metal, duration of implantation, and the location of the screws about the elbow. screw failure during extraction was the dependent variable. five of 21 patients experienced hardware failure during extraction. fourteen patients had titanium alloy implants. in four cases, titanium screws broke during extraction. compared to stainless steel, titanium screw failure during removal was not statistically significant (p=0.61). screw removal 12 months after surgery was more likely to result in broken, retained screws in general (p=0.046) and specifically for titanium alloy (p=0.003). bone screws removed from the distal humerus or proximal ulna had an equal chance of fracturing (p=0.28). there appears to be a time-related association of titanium alloy bone screw failure during hardware removal cases from the elbow. this may be explained by titanium's properties and osseointegration.

PMC4063128

pubmed-582

during storage of animal feed many different processes may occur which alter their initial natural proprieties. first of all, lipids undergo peroxidation, the process during which they are deteriorated in a free radical autocatalytic oxidation chain reaction with atmospheric oxygen. lipid autooxidation is a cascade phenomenon ensuring continuous delivery of free radicals, which initiate continuous peroxidation. this process results in food rancidity which manifests itself as the change of taste, scent, and color as well as decrease in shelf life of the product. natural or synthetic antioxidants are usually used to slow down or stop lipid peroxidation and in consequence to preserve freshness of the product. many natural antioxidants, such as tocopherols, vitamin c, flavonoids, for a short period, may be effective in food preserving, but in many cases such protection is not sufficient. therefore synthetic antioxidants are widely used, among which bht (butylated hydroxytoluene), bha (butylated hydroxyanisole), and eq (ethoxyquin) are the most frequent. however, some effects of synthetic antioxidants are not always beneficial for our health. antioxidants such as bha or bht have been widely used for many years to preserve freshness, flavor, and colour of foods and animal feeds as well as to improve the stability of pharmaceuticals and cosmetics. some experimental studies have reported that both bht and bha have tumour-promoting activity [1, 2]. on the other hand, there were reports on anticarcinogenic properties of these antioxidants when they are used at low concentrations. human exposures are at least 1000-fold below those associated with any neoplastic actions in laboratory animals thus it is assumed that they are not harmful for human beings [3, 4]. the third compound, eq, is one of the best known feed antioxidants for domestic animal and fish. however, some of the authors have suggested that it is responsible for a wide range of health-related problems in dogs as well as in humans [59]. due to the increased use of this antioxidant it was nominated by fda (us food and drug administration) for carcinogenicity testing. the tests were carried out by monsanto company (usa), eq producer, and after that in 1977 fda requested for optional lowering of the maximum level of eq in complete dog foods from allowed 150 ppm (0.015%) to 75 ppm (0.0075%). at the same time new studies were started by the pet food institute to determine whether even lower eq levels (between 30 and 60 ppm) would provide antioxidant protection for dog food. it was originally developed in rubber industry to prevent rubber from cracking due to oxidation of isoprene. the monsanto company (usa) taking into account its high antioxidant efficiency and stability as well as low costs of synthesis refined it later for use as a preservative in animal feeds because it protects against lipid peroxidation and stabilizes fat soluble vitamins (a, e). presently, ethoxyquin is used primarily as an antioxidant in canned pet food and in feed intended for farmed fish or poultry. the use of ethoxyquin is not permitted in foods intended for human, except preserving powdered paprika and chili colour and using it as an antiscald agent in pears and apples (inhibition of brown spots development). however, because eq is used as a feed antioxidant it can be also found in other products intended for human consumption like fish meal, fish oils, and other oils, fats, and meat (table 1). an acceptable daily intake (adi) of eq for human (00.005 mg kg bw) based on the results obtained from studies on dogs this paper presents characteristics of ethoxyquin with regard to its properties, metabolism, toxicity, possible carcinogenicity, and antioxidant activity. for the first time eq was synthesized in 1921 by knoevenagel. the synthesis was based on condensation of aniline with molecules of acetone or its analogues [15, 16]. synthesized eq from p-phenetidine (4-ethoxyaniline) and diacetone alcohol in the presence of p-toluenesulfonic acid or iodine. pure ethoxyquin (eq; 6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline; cas number 91-53-2; figure 1) is a light yellow liquid, but it changes color to brown if it is exposed to oxygen the scent of eq is described as mercaptan like. as a nonpolar substance eq is soluble only in organic solvents. peak blood concentration of the compound is observed within 1 h. distribution of eq in animal body is similar when it is administered orally and intravenously. small amounts of parent eq were detected in liver, kidney, and adipose tissue and fish muscles [2024]. metabolism of eq was studied in rats, mice, dogs, chickens, and fish, as well as in plants [13, 21, 25]. the most important eq metabolites observed in rat urine and bile result from o-deethylation at position 6-c, and then conjugation with sulphate or glucuronide residues. the other metabolic pathways include hydroxylation and glucuronidation at position 8-c, deethylation at 6-c and epoxidation between positions 3-c and 4-c. mainly glucuronide metabolites were detected while in rats those result from conjugation of eq with sulfate. in the studies of bohne et al. [23, 26] parent eq, dem-ethylated eq (deq), quinone imine (qi), and eq dimer (eqdm) were observed in salmonid fish after long-term dietary exposure to eq. eq is considered as a model inducer of phase ii enzymes involved in the metabolism of xenobiotics, but influence of eq on phase i enzyme gene transcript levels was also observed [28, 29]. the key role in mediating phase i reactions (e.g., oxidation or reduction) producing more hydrophilic compounds is played by the cyp (cytochrome p450) enzyme family. [28, 29] observed the alteration of cyp3a gene expression; an increase in the amount of cyp3a transcripts was detected in salmon after feeding them with the diet containing eq at the highest dose used (1800 mg kg). the authors speculate that eq may regulate cyp3 gene expression by interaction, for example, with pregnane x nuclear receptor (pxr) whose function is to sense the presence of toxic xenobiotics and in response enhance the expression of proteins involved in their detoxification. on the other hand, cyp1a1 gene expression, which was described as an exposure biomarker to both endogenous and exogenous compounds, was not increased after dietary exposure of salmonid fish to eq and during the depuration period a trend toward downregulation was noted [28, 29]. such an effect was observed despite the increase in the expression of ahr mrna (ahr, cytosolic transcription factor responsible for changes in gene transcription). for example, the parent eq may bind cyp1a1 protein and as a result may inhibit the gene expression and activity of protein. hepatic antioxidant response elements (are) or ahr repressor (ahrr) together with basic-helix-loop-helix-pas (per-ahr/arnt-sim homology sequence) of transcription factor usually associated with each other to form heterodimers (ahr/arnt or ahrr/arnt) may be also involved in the cyp1a1 downregulation process. these heterodimers can influence gene expression by binding are sequences in the gene promoter regions. however, eq as other phenolic antioxidants, first of all causes induction of phase ii xenobiotic-metabolizing enzymes. [28, 29] observed elevated dose-related uridine diphosphate glucuronosyl-transferase (udpgt) mrna expression after dietary exposure to eq. as udpgt reacts with the compounds that have the hydroxyl group (-oh) parent eq can not be the potential substrate for glucuronidation, only its metabolites, for example deq (6-hydroxy-2,2,4-trimethyl-1,2-dihydroquinoline; table 3), the metabolite identified by berdikova bohne et al. in atlantic salmon changes in the expression of glutathione s-transferase (gst) gene were also observed after feeding animals with eq containing feed. the alterations in gst activity caused by eq were documented in atlantic salmon [28, 29], in rodents [33, 34], and in nonhuman primates. in addition to udpgt and gst, some other enzymes are involved in phase ii metabolism of eq, for example, nadp(h): quinone oxidoreductase and epoxide hydrolase. the expression pattern of both phase i and ii enzymes involved in eq metabolism may vary in different animals and should be considered in relation to the ratio of parent eq and its metabolites (first of all deq, qi, and eqdm) in the liver [29, 37]. the research concerning this issue is currently in progress. ethoxyquin is also registered as an antioxidant to control scald (browning) in apples and pears. the eq plant metabolites/degradation products were detected, and it was shown that in general they are different from those observed in animals (table 3). in pears treated with ring-labeled [c]ethoxyquin the following compounds were detected: n n and c n dimers, demethylethoxyquin (dmeq), dehydrodemethylethoxyquin (dhmeq), and dihydroethoxyquin (dheq) [14, 25]. it was shown that ethoxyquin was rapidly degradated or metabolized but itself it was not translocated into the pulp of fruit where the residues were detected (less than 0.5% of total radioactive residue was eq). toxicity of eq metabolites, meq, dhmeq, and dheq was studied in dogs (oral administration, single doses of 50 to 200 mg kg bw), and it was found that they did not show any significant toxicity. in the report of gupta and boobis the rank order of toxic potency for the plant metabolites and eq is meq<eq<dheq<dhmeq (the least toxic first). meq, dhmeq, and dheq were also evaluated for genotoxicity in in vitro and in vivo tests. the compounds did not cause gene mutations in salmonella typhimurium and escherichia coli strains, but they induced chromosomal aberrations or/and endoreduplication in chinese hamster ovary cells. on the other hand, plant metabolites/degradation products did not exhibit genotoxic potential in vivo. adi intake for humans for meq, dhmeq, and dheq was estimated at the same level as for eq (00.005 mg kg bw). it is very efficient in protecting lipids which are present in food against oxidization [38, 39]. specifically it is used to retard oxidation of carotene, xanthophylls, and vitamins (like vitamins a or e). in animals treated with ethoxyquin three times higher level of vitamins a and e in blood plasma was observed. high efficiency of this antioxidant results not only from chemical features of eq itself but also from the fact that products of its oxidation also possess antioxidative properties [12, 39, 41]. studies on eq antioxidant properties were performed by taimr with the use of alkylperoxyls, and it was shown that the reaction rate of eq with them is very high. in the presence of high oxygen concentrations eq reacts with alkylperoxyl molecule to form aminyl radical (6-ethoxy-2,2,4-trimethyl-1,2-dihydroquinolin-1-yl) which subsequently may enter various pathways. in nonoxidizing conditions it can be stabilized both by the loss of methyl group and aromatization of heterocycle to form 2,4-dimethyl-1,2-dihydroquinoline (dehydrodemethylethoxyquin (dhmeq)) and through dimerization to form eq dimer (eqdm) [39, 42]. on the other hand, in an oxidizing medium other molecules can be formed, for example, 2,6-dihydro-2,2,4-trimethyl-6-quinolone (qi) or nitroxide radical (6-ethoxy-2,2,4-trimethyl-1,2-dihydroquinolin-n-oxyl) which is also a strong antioxidant [39, 42]. products of eq oxidation were detected by different authors in fish oil and meal [22, 4345]. according to he and ackman the following oxidization products of eq dominate in fish meal and fish feed: 2,6-dihydro-2,2,4-trimethyl-6-quinolone (qi) and 1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) (eqdm). at high storage temperature neither qi nor eqdm accumulates; however, another product of eq oxidation, 2,4-dimethyl-6-ethoxyquinoline, is stable. the eqdm and qi show 69% and 80% of eq efficacy, respectively (studies on fish meal). on the other hand, in the studies of thorisson et al. quinone imine (qi) and eq nitroxide were also powerful antioxidants, while eqdm, the main product of eq oxidation, showed little or no antioxidant behavior. antioxidant activity of eq was also demonstrated in experiments performed both in vivo and in vitro. antimutagenic effect of this antioxidant was observed in mice, rats, and chinese hamsters treated with cyclophosphamide, an agent widely used in cancer chemotherapy [4749]. during cyclophosphamide bioactivation reactive oxygen species eq reduced the number of chromosome aberrations, micronuclei, and dominant lethal mutations induced by the anticancer drug [4749]. there were also some reports that eq can modify carcinogenic response to different carcinogens [35, 52, 53]. eq given to fischer 344 rats in diet completely prevented the formation of aflatoxin b1-induced preneoplastic liver lesions [52, 53]. in in vitro experiments with human lymphocytes, antioxidant activity of eq was observed in the comet assay (the method used to detect single- and double-strand dna breaks, cross-links, and alkaline labile sites) and in micronucleus test (the method for the detection of micronuclei induced by clastogens or aneugens). eq used at the concentrations ranging from 1 m to 10 m protected human lymphocytes against dna damage caused by hydrogen peroxide (h2o2, 10 m). this antioxidant also reduced the number of micronuclei caused by h2o2 used at concentration of 75 m. however, the significant reduction was evident only in the case of lower eq concentrations (5 m, 10 m) with no effect at higher concentration. different phenolic antioxidants may be used in animal feed, such as bha (butylated hydroxyanisole), bht (butylated hydroxytoluene), and the most efficacious eq. the levels of the antioxidants in finished feed should not be higher than 150 ppm for eq and 200 ppm for bht and bha (u.s. the fact that efficient antioxidants work optimally when they are used at low concentrations is their remarkable characteristic. on the other hand, when antioxidants are used at high concentrations they act as prooxidants. the impact of these compounds depends on their concentration as well as on other factors such as metal-reducing potential, chelating behaviour, solubility, and ph. the effect of antioxidants on living organisms also depends on their bioavailability and stability in tissues [54, 55]. it was shown that dissolved eq may exist partly in the free radical form which it was also detected in the compound itself. therefore, ethoxyquin nitroxide which is produced by eq oxidation similarly as other nitroxide molecules (e.g., tempol) may also show prooxidative properties. formation of free oxygen species as a result of using too high eq concentrations can cause adverse health effects in animals fed with eq containing feed or in people consuming meat from farmed animals, for example, different fishes. the studies on eq prooxidant activity and toxicity associated with it were performed both in vivo and in vitro. dogs are most susceptible to the harmful effects of eq, and first reports of such effects were received by fda in 1988. the symptoms observed by dog owners and veterinarians were liver, kidney, thyroid and reproductive dysfunction, teratogenic and carcinogenic effects, allergic reactions, and a host of skin and hair abnormalities. according to the studies on dogs and laboratory animals it was shown that ethoxyquin had little acute toxicity, except when it is administered parenterally. values of ld50 for eq are 1700 mg kg bw (rats, oral gavage),>2000 mg kg bw (rats, dermal treatment, 24 h), ~900 mg kg bw (mice, intraperitoneal administration), and ~180 mg kg bw (mice, intravenous administration). despite species differences in the majority of animals treated with eq at the concentrations higher than those permitted in animal feed, the same characteristic symptoms and pathologies appeared such as weight loss, liver, and kidney damage, alterations of alimentary duct (table 4). the concentration of 100 ppm (equivalent to 2.5 mg kg bw per day) was considered to be a minimal-effect level for clinical signs of toxicity and liver effects in dogs, the most susceptible animals [13, 14]. detrimental effects of eq were also seen when the experiments were performed at the cell metabolism level. analysed the impact of eq on the metabolic pathways of rat renal and hepatic cells, as well as on mitochondria and submitochondrial particles obtained from bovine heart and kidney. the authors suggested that eq interacted with site i of the mitochondrial respiratory chain, and it resulted in inhibition of oxygen consumption in the mitochondria of kidney and liver cells when glucose was a respiratory substrate. more than 30 years ago when eq began to be more commonly used in animal feed research started to assess its mutagenicity with the use of ames test which is performed on different salmonella typhimurium strains. the results were equivocal as some results were negative [6668], but the positive effects were also observed [69, 70]. it was also shown that eq enhanced the mutagenic activity of dmba (3,2-dimethyl-4aminobiphenyl), a compound having carcinogenic properties. ethoxyquin was reported to both enhance and inhibit genetic changes induced by known carcinogens; on the other hand it can also lead to cancer in exposed animals. manson et al. observed in fischer 344 rats that eq caused severe damage in kidney. many hyperplastic and putative preneoplastic tubules were found which suggested that eq may be exerting a carcinogenic effect. similar effects were observed earlier by ito et al. in relation not only to the kidney but also to the urinary bladder. possible carcinogenicity of eq is probably connected with its prooxidant activity and induction of reactive oxygen radicals which cause dna damage. dna damage is usually repaired by cellular repair system, but if it is severe or there are too many lesions, this leads to programmed cell death (apoptosis). sometimes, however, the programmed cell death pathway is damaged so when the defense mechanisms fail there is no way to stop a cell from becoming a cancer cell. some in vitro studies showed both cytotoxic effects of eq leading to cell apoptosis or necrosis and damage of genetic material at dna or chromosome levels. cytotoxic effects of pure eq (purity>97%) were studied in vitro with the use of human lymphocytes. the ic50 value (the concentration causing 50% growth inhibition) for eq determined after 72-hour treatment of the cells in the mtt assay was 0.09 mm. this antioxidant significantly reduced viability of lymphocytes detected with trypan blue exclusion method after 24-hour treatment at the concentrations of 0.25 and 0.5 mm (cell divisions were stimulated by phytohemagglutinin, (pha)) or of 0.05 mm and higher when 1-hour treatment was performed. eq-induced apoptosis by observed in in vitro cultured human lymphocytes starting from 0.05 mm concentration and the detected number of apoptotic cells depended on the treatment time. ethoxyquin caused also dna damage in the comet assay however, most lesions could be repaired by cellular dna repair systems. on the other hand, the results obtained with the use of chromosome aberration test showed that unrepaired dna damage induced by eq could lead to permanent changes in genetic material [16, 74].. showed that this antioxidant induced chromosome aberrations such as breaks, dicentrics, atypical translocated chromosomes, or chromatid exchanges in human lymphocytes and chinese hamster ovary cells. because of adverse health effects caused by eq it is reasonable to search for new antioxidants as effective in scavenging free radicals as eq which produce no such problems. in the paper of de koning nine analogues of eq prepared to compare their antioxidant efficacy with that of the parent chemical are presented. the compounds have been tested in a refined fish oil and subsequently some of the most promising ones have been also tested in fish meal. it was noted that the results obtained in fish oil were not always the same as in fish meal, for example, hydroxyquin (1,2-dihydro-6-hydroxy-2,2,4-trimethylquinoline; figure 1) was 3.5 times as effective as eq in fish oil, while only 3/4 of its efficacy was observed in fish meal. in the case of another compound 1) antioxidant efficacy in relation to eq was 101% in fish oil and 52% in fish meal. despite the lower efficiency of this compound in fish meal the reason is that preparation of hydroquin based on aniline and acetone is more cost-effective than that of eq whose production requires p-phenetidine (more expensive than aniline). the 2-year dermal research with the use of f344/n rats and b6c3f1 mice conducted under the national toxicology program showed that the compound was not carcinogenic, but the studies performed by sitarek and sapota showed its teratogenic properties. in 2000 dorey et al. presented the report concerning the synthesis and biological properties of a new class of antioxidants based on the eq backbone. the studies were performed to search for new quinolinic derivatives with radical scavenging activity, potential candidates for central nervous system protection. eq is not suitable for that as it has been shown to exhibit significant hypothermic effect, probably as a result of an inhibition of electron transport in the mitochondrial respiratory chain. dorey et al. synthesized and studied many 1,2-dihydro and 1,2,3,4-tetrahydroquinolines and then selected for further evaluation a group of antioxidants (5 compounds) with high radical scavenging capacities, relatively low toxicity, and moderate hypothermia. the compounds belonging to the group of 1,2,3,4-tetrahydroquinolines (e.g., 6-ethoxy-2,2,5,7-tetramethyl-1,2,3,4-tetrahydroquinoline, characterized with the lowest toxicity and high radical scavenger capacity) are structurally similar to 2,2,4,7-tetramethyl-1,2,3,4-tetrahydroquinoline synthesized and tested in our laboratory (figure 1). the latter compound also had promising features: its antioxidant activity was comparable to that of eq, but its cytotoxicity and genotoxicity studied with the use of human lymphocytes in vitro were significantly lower. we believe that this chemical is worth of detailed studies to confirm its usefulness as a food preservative. some other eq derivatives and salts were also studied for cytotoxicity, genotoxicity, and antioxidant activity, namely, the complexes of ethoxyquin with flavonoids (rutin or quercetin), ethoxyquin hydrochloride, ethoxyquin phosphate, ethoxyquin l-ascorbate, ethoxyquin n-hexanoate, ethoxyquin salicylate, and ethoxyquin salt of trolox c [19, 7982]. the biological properties of the compounds were analysed with the use of mtt, tunel, and trypan blue staining methods (cytotoxicity testing), comet assay (genotoxicity testing), and micronucleus test (mutagenicity testing). from among the compounds tested ethoxyquin phosphate (eq-f) was the least toxic (table 5)its cytotoxic and genotoxic activities in comparison with those of eq were reduced positively (ic50=0.8 mm versus 0.09 mm for eq). on the other hand, antioxidant activity of eq-f was observed, but it was the lowest of the tested compounds. the studies showed that all the tested compounds were less toxic to human lymphocytes than eq, and the antioxidant activity of four of them (ethoxyquin n-hexanoate, ethoxyquin complex with quercetin, ethoxyquin l-ascorbate, and ethoxyquin salicylate) was comparable with that of eq [7982].. the level of this antioxidant in animal feeds should not be higher than 150 ppm (u.s. the approved uses of ethoxyquin in animal feeds are addressed in the code of federal regulations (cfr), title 21, parts 573.380 and 573.400, and established tolerances are in part 172.140. on the one hand, the observed adverse health effects (firstly in dogs) could be caused by the fact that the animals ate a lot of feed containing eq, but on the other hand, it could also be the result of its excessive amounts in the feed. ethoxyquin is added to animal feed either directly or indirectly as a component of an ingredient. from time to time fda reminds industry about labeling and safe use requirements for ethoxyquin, but if it is added at the ingredient level this is not always indicated. another important safety issue is the presence of eq oxidation and eq metabolism products in animal feed or in foods prepared from farmed animal meat. de koning described main products of eq oxidation which can be observed in stored feeds or in fish meal: eq dimer (eqdm, 1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) and quinone imine (qi, 2,6-dihydro-2,2,4-trimethyl-6-quinolone). both compounds were shown to be potent antioxidants, but they can also have detrimental effect, especially so because the half-life of the dimer was considerably greater than that of eq [26, 28]. in the recent studies no adverse toxicological effects of eqdm, in terms of kidney and liver function, were observed in in vivo experiments with f344 rats exposed for 90 days to the compound. on the other hand, augustyniak et al. showed that eqdm, similarly as eq, was cytotoxic and genotoxic to human lymphocytes. toxicity of qi has not been studied yet, but the results obtained by the authors indirectly indicated that the compound could be cytotoxic to human cells. the levels of the parent compound (eq) in meat of farmed animals are usually lower than mrl (maximum residue level) [20, 84], but eq oxidation products are usually not controlled. it was shown that eqdm and other eq residues can be present in different animal tissues [23, 24, 26, 28, 37]. in the studies of bohne et al. in which atlantic salmons were fed for 12 weeks with the feed containing this antioxidant, four compounds were identified in their muscles: parent eq (6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline), deethylated eq (6-hydroxy-2,2,4-trimethyl-1,2-dihydroquinoline), quinone imine (2,6-dihydro-2,2,4-trimethyl-6-quinolone, qi), and eq dimer (1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline, eqdm). it was also shown that the concentration of eq in fish muscle was proportional to the duration of exposure and the level of eq in the feed. the same linear increase was seen for eqdm, the main metabolite of eq, and the sum of eq and eqdm.. found that the level of eq and its metabolites in fish muscle could be predicted from the level of dietary eq and then controlled, but because it is not the only factor which may affect the levels of eq and its metabolites in the salmon tissue (others for example are fish size and age), the concentration of eq and eqdm in fish ready for consumption may be higher than that observed in their studies. in their experiments it was shown that the elimination of eq from salmon was concurrent with significant increase in the level of eqdm, and they concluded that mandatory 14 days of depuration were not sufficient for elimination of eq residues it is mainly because eqdm is characterized by the considerably longer half-life than that of eq. moreover, eqdm accounted for 99% of the sum of the two compounds (eq and eqdm), and its toxicological effects in animals and humans are unknown. eq and eq dimer were also detected in similar amounts not only in atlantic salmon, but also in other commercially important species of farmed fishes (halibut, rainbow trout) by lundebye et al.. they found that in atlantic salmon, halibut, and rainbow trout the concentration of eqdm was more than 10-fold higher than that of eq. the authors estimated that consumer exposure to eq from a single portion (300 g) of skinned-fillets of different species of farmed fish could amount up to 15% of the adi. in the light of data concerning the presence of eqdm in the body of farmed fishesand providing that eq dimer was included in the adi, the eq and eqdm intake from a single portion of atlantic salmon would be close to adi. farmed fish is probably the major source of eq and its residues for european consumers (its use as a food additive is forbidden). in our opinion, however, both fish and other farmed animals, for example, chickens, should be controlled for the presence of not only eq, but also eqdm, its main oxidation product. ethoxyquin has been used as an antioxidant in animal feed for several decades and despite the search for new compounds that could be used as free radical scavengers, it is still the most effective antioxidant. the negative health effects in domestic animals fed with eq containing feed were observed some years ago, but the presence of its approved doses should not be hazardous. toxicity and mutagenicity of eq were observed in in vivo and in vitro studies showing its potential harmful effects. this makes it very important to label all products and ingredients to which eq is added and to comply with the recommended doses. additionally, the results of the studies on products of eq oxidation, especially eqdm, detected in farmed animal tissues indicate that it should be under control and some regulations should be introduced.

ethoxyquin (eq, 6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline) is widely used in animal feed in order to protect it against lipid peroxidation. eq can not be used in any food for human consumption (except spices, e.g., chili), but it can pass from feed to farmed fish, poultry, and eggs, so human beings can be exposed to this antioxidant. the manufacturer monsanto company (usa) performed a series of tests on ethoxyquin which showed its safety. nevertheless, some harmful effects in animals and people occupationally exposed to it were observed in 1980 's which resulted in the new studies undertaken to reevaluate its toxicity. here, we present the characteristics of the compound and results of the research, concerning, for example, products of its metabolism and oxidation or searching for new antioxidants on the eq backbone.

PMC4745505

pubmed-583

seizures are the most common neurological events of childhood with approximately 35% of children experiencing a seizure at some point in their lives 25% of whom subsequently go on to develop epilepsy. the prevalence of epilepsy in india is 4.9 to 6.2 per 1000 population. of these patients with epilepsy, 43% comprises of children and adolescents. intractable epilepsy is defined as a failure to respond to at least two antiepileptic drugs (aeds) given over at least a two-year period. a single definition for intractable epilepsy can not suit all situations as definitions of intractability are individualized to the patient. of these patients deemed to be intractable, approximately 50% are estimated to have surgically remediable epilepsy [4, 5]. hemispheric epilepsy (he) refers to epileptiform activity in all four lobes of one hemisphere, and when it involves more than two lobes of the brain, it is termed subhemispheric epilepsy (she) [4, 6, 7]. these hemispheric brain lesions are commonly associated with early onset of catastrophic epilepsies and multiple seizure types that inhibit brain development. these respond well to early hemispheric/subhemispheric disconnective/resective surgeries [69]. an analysis was done of the pre- and postsurgical data of 34 children who underwent disconnective epilepsy surgeries, that is, a peri-insular hemispherotomy (pih) or a peri-insular posterior quadrantectomy (pipq) for hemispheric/subhemispheric epilepsy from april 2000 to march 2011. the hemisphere contralateral to the hemiparesis was shown by radiological (mri/computerised tomography (ct)) and functional (scalp eeg/eeg video telemetry) imaging to have a unilateral diffuse abnormality and the remaining hemisphere was normal. when the epileptogenic zone encompassed large areas of the temporal, parietal and occipital lobes with sparing of the frontal lobe the decision was dependant on good concordance between the imaging (mri, ct, nuclear studies), eeg, clinical and neuropsychological evaluations, and a clear localization of the lesion to the unilateral-affected region. the indications for pipq were the same as for hemispheric epilepsy, the pathology being localized to involve the temporal, parietal, and occipital lobes. the presence of residual voluntary motor function of the contralateral distal musculature, that is, finger opposition and foot tapping, was the indication for pipq preserving eloquent uninvolved sensorimotor cortex. all patients went through a presurgical evaluation including a study of the seizure semiology, neurological examination, multiple electroencephalogram (eeg) examinations (video telemetry), magnetic resonance imaging (mri), and neuropsychological evaluation. the focus of the evaluation was to identify a surgically remediable epilepsy syndrome with good electro-clinico-radiological concordance. if the structural lesion responsible for epilepsy could be safely removed without causing deterioration in the functional status, the patient was considered for epilepsy surgery. however, if there was no concordance in investigations in the phase i evaluation, the patient would enter a phase ii evaluation which would include prolonged invasive eeg monitoring, nuclear medicine studies (positron emission tomography (pet) and single photon emission computerized tomography (spect)), and a wada (sodium amylobarbital) test. however, none of our patients required a phase ii evaluation. (figure 1) this is a surgical method of functional hemispherectomy that enables disconnection of the hemisphere through peri-insular windows requiring limited removal of the fronto-parieto-temporal opercular cortices. following the surgical principles of anatomical subtotal removal of the hemisphere and complete disconnection, the pih is a radical hemispheric tractotomy based on the concept of maximum disconnection with minimal excision. it resulted from the demonstration that the hemisphere could be disconnected, made nonfunctional, through very small removal of brain tissue [9, 14, 15]. a pipq was performed in all cases of subhemispheric epilepsy and the surgery tailored to encompass the whole epileptogenic lesion yet preserving the central region, which is still functional. (figure 2) in this technical variant, there is a minimal removal of brain tissue but complete disconnection of the remaining major part of the abnormal cortex, which is left anatomically intact and viable by preservation of the arteries and veins irrigating these lobes. the primary motor and sensory cortices are identified and recognized from the study of the mri and correlation with intraoperative surface anatomy, based on gyral pattern, arteries, and veins [6, 7]. the identification of the functional cortex is also aided by electrophysiological means under general anaesthesia before the disconnection. this identification maximizes both the extent of resection and the safety of surgery [6, 7]. in this variant, the mesial temporal structures are resected, but the temporal neocortex is disconnected and not resected followed by a parieto-occipital disconnection [6, 7]. the data was analyzed with nonparametric tests because of the small sample size among the children with poor outcome following surgery (engel's class ii nonparametric square test and mann-whitney u test was were to compare the categorical and continuous variables between the groups. p<0.05 (two tailed) was considered significant and data was analyzed using spss (version 19). the mean age of seizure onset was 3.8 years (range: from neonates to 12 years). the mean duration of epilepsy was 4 years (range: from 3 months to 14 years). 28 children (82.3%) had a seizure frequency of 2 episodes/day, while 11 (32.3%) had at least one episode of status epilepticus prior to surgery. epilepsy was due to rasmussen's encephalitis (re; n=11) (figure 3), infantile hemiplegia seizure syndrome (ihss; n=12) (figure 4), hemimegalencephaly (hm; n=3) (figure 5), sturge weber syndrome (sws; n=4) (figure 6), and postencephalitic sequelae (pes; n twenty-seven (79.4%) patients underwent pih for lesions causing hemispheric epilepsy, and seven (20.6%) underwent pipq for lesions causing subhemispheric epilepsy. the seizure outcome after surgery was assessed by engel's classification and is described along with followup in table 1. we recorded 11 variables and analyzed them to arrive at predictive variables of a complete seizure freedom. we found that age of seizure onset (p=0.03) and the etiology of the disease causing epilepsy (p=0.007) were predictive variables for the same. patients who had re, sws, pes, and ihss had good seizure outcomes following surgery. the results of our cognitive outcomes that have been published before show that the mental and social age showed a steady increase after surgery. however, in the long term, intelligence quotient (iq) showed only a gradual gain on followup. older age of onset of seizures and a shorter duration of seizures prior to surgery were predictive of positive cognitive gains following surgery. complications in this series included pseudomeningocele in 2 (5.8%) and low pressure hydrocephalus in 1 (2.9%) who required a low pressure ventriculoperitoneal shunt. this is quite low as compared to other published series (table 4) [911]. we also had 15 patients who developed postoperative fever, but csf cultures were sterile. this could have been due to an aseptic meningitis due to the presence of blood products in the disconnected cavity. our series documents 91.1% seizure freedom, which is similar to other published studies [9, 12, 1621]. following functional hemispherectomy, seizure free outcomes have ranged from 52 to 90% [9, 1621]. this range could be explained by differences in patient selection or technical pitfalls such as incomplete removal in anatomical hemispherectomy and incomplete disconnection in functional hemispherotomy [14, 19]. we found the age of seizure onset to be a strong predictor of seizure freedom (table 2). this finding is also supported by other studies [3, 22, 23]. a younger age of seizure onset is usually seen in children with developmental cortical malformations and multifocal epilepsy, which are proven to have poor seizure control. the etiology of the disease producing epilepsy is also a strong predictor of seizure freedom (table 3). the best results in our series were obtained in children suffering from re, sws, pes, and ihss (table 3). ihss and sws are seen in the perinatal age group, and they are generally unilateral with complete sparing of the opposite side. there has been evidence to support that in such cases, early surgical intervention facilitates good seizure control and helps the uninvolved hemisphere to develop and take over the functions of both sides. however, in one patient with ihss, we had a class ii seizure outcome and this was in the initial part of the series, which could be attributed to incomplete disconnection, and this patient was lost to follow up. all patients with re had a class i seizure outcome as this disease also strictly affects only one hemisphere. however, the seizure outcome in patients with hm was not satisfactory as described in literature, and this has been reported in other series too [9, 1721]. the likely explanation could be the presence of migrational abnormalities in the so-called preserved hemisphere or early development of an epileptic encephalopathy, already in utero. we found a significant gain in the mental and social age in the immediate postsurgical period which continued into the second and third years of followup. our study also showed that older age of onset of seizures showed positive mental and social age gains at followup. onset of intractable epilepsy within the first 24 months of life is a significant risk factor for mental retardation, especially if seizures occur daily [12, 24]. most of these children have a low dq/iq to begin with and the improvement in cognitive skills after surgery is poorer in these children. furthermore, our study also showed that a shorter duration of seizures prior to surgery is predictive of positive mental and social age gains, a finding that is in keeping with those of freitag and tuxhorn and basheer et al.. in general, children with ie in our country are not exposed adequately to environmental stimuli as schooling is discontinued in the presence of seizures. with good postoperative seizure control, the child's attention capacities increase and they engage in social interaction with their family and peers. an improved school attendance due to seizure freedom improves their adaptive skills that in turn helps the child improve his performance in activities of daily living. in our experience, over 90% of children with hemispheric and subhemispheric epilepsy syndromes achieve an excellent seizure outcome with less morbidity following epilepsy surgery. age of seizure onset and etiology of the disease causing epilepsy are independent predictive variables of a good seizure outcome. following seizure freedom, improvement of function in the residual brain occurs that in turn leads to improvement in adaptive and social functions and quality of life.

objectives: to study the outcome of disconnective epilepsy surgery for intractable hemispheric and sub-hemispheric pediatric epilepsy. methods: a retrospective analysis of the epilepsy surgery database was done in all children (age<18 years) who underwent a peri-insular hemispherotomy (pih) or a peri-insular posterior quadrantectomy (pipq) from april 2000 to march 2011. all patients underwent a detailed pre surgical evaluation. seizure outcome was assessed by the engel's classification and cognitive skills by appropriate measures of intelligence that were repeated annually. results: there were 34 patients in all. epilepsy was due to rasmussen's encephalitis (re), infantile hemiplegia seizure syndrome (ihss), hemimegalencephaly (hm), sturge weber syndrome (sws) and due to post encephalitic sequelae (pes). twenty seven (79.4%) patients underwent pih and seven (20.6%) underwent pipq. the mean follow up was 30.5 months. at the last follow up, 31 (91.1%) were seizure free. the age of seizure onset and etiology of the disease causing epilepsy were predictors of a class i seizure outcome. conclusions: there is an excellent seizure outcome following disconnective epilepsy surgery for intractable hemispheric and subhemispheric pediatric epilepsy. an older age of seizure onset, re, sws and pes were good predictors of a class i seizure outcome.

PMC3299362

pubmed-584

mutations in codons 12 and 13 of kirsten rat sarcoma viral oncogene homolog (kras) and b-raf murine sarcoma viral oncogene homolog b1 (braf) genes are frequently present in tumors of patients with metastatic colorectal cancer (crc); they are observed in 30-45% and 5-20% of cases respectively 1. less commonly detected crc tumor mutations are codon 61, 146 of the kras oncogene, and at other sites in the braf gene. kras and braf mutations have been frequently described as mutually exclusive in crc, in that tumors usually have neither, or only one, of these specific mutations. rarely patients may have crc with coincident kras and braf mutations; herein we report three such cases and review of the literature. although highly uncommon, identification of this dual tumor genotype is important, as current clinical trials are being designed enriching for patients whose tumors harbor either a kras or braf mutation, but haven't addressed those patients with coincident kras and braf mutations. due to the infrequent rate of coincident mutation, it is not known if these patients have a tumor biology distinct from kras or braf mutant tumors. under an institutional review board approved retrospective chart review protocol (dr-11-0113), we reviewed samples tested at a clinical laboratory for tumor kras and/or braf mutations from 2008-2011. dna was extracted from microdissected paraffin-embedded tumor and analyzed by a polymerase chain reaction (pcr)-based dna sequencing method to examine codons 12, 13 and 61 of the kras proto-oncogene. the sensitivity of detection of this assay is approximately 1 in 10 mutation-bearing cells in microdissected area. dna was also analyzed by pcr and a pyrosequencing method for codons 595 to 600 of exon 16 of braf oncogene; the methods for these assays have been described elsewhere 2. a total 6,633 crc patient tumors were screened for mutation analyses and of those 1,483 case were tested for both kras and braf mutations. 644 were kras-mutant (43%) and 3 (0.2%) of these were bearing a concomitant braf (v600e) mutation. the first patient is a 65 year-old woman who presented with small bowel obstruction. the patient underwent a biopsy of the metastatic liver lesion that was sent for kras mutation and braf mutation analysis; a tumor mutation was detected in codon 12 (ggt to gat) of the kras gene that would change the encoding amino acid from glycine to aspartic acid (g12d) and codon 600 (gtg to gag) in exon 15 of the braf gene that would change the encoding amino acid from valine to glutamine (v600e). the second case identified was a 72 year-old woman with rectal cancer metastatic to the lungs; similar tumor mutations were detected in kras (g12d) and braf (v600e) proto-oncogenes. in both cases the tumors were microsatellite stable; concomitant braf and kras mutations were not identified among patients samples ' whose tumors were microsatellite instable. the third case is 51 year-old man who presented with abdominal pain and was found to have a descending colon cancer with liver metastasis. in specimen from liver lesion, coincident kras and braf mutations appear to be rare entity (present in 3 out of over 1,928 samples tested). due to the infrequent observation of this phenomena, it is not clear whether or not these tumors have a different biology and natural history than kras or braf mutant tumors, or which of the two mutations is the dominant oncogene driving tumor proliferation. a prior study has demonstrated that concomitant tumor mutations have been relatively frequently observed human crc cell line; in this study, of 24 human crc cell lines, one cell line (gp2d) demonstrated mutations in both kras and braf oncogenes (however the braf mutation was in the less frequently observed at the codon 529 site) 3. in an analysis of 250 patients tumor specimens with microsatellite stable disease, kras mutations were identified in 45.2% of primary tumors, and that concomitant kras and braf mutations were found in 10 lymph nodes (35.7%) from a total 28 samples whereas only 3 of primary tumor with negative lymph nodes were positive for coincident mutation (2.3%)4. there was also noted to be a higher proportion of concomitant mutations based on the degree of transmural penetration of the tumor; 1/36 (2.8%) for t2 tumors and 3/32 (9.4%) for t4 tumors, suggesting activation of both genes is associated with progression of disease. since kras mutation testing became standard-of-care for determining lack of treatment efficacy with antibody anti-epidermal growth factor (egfr) monoclonal antibody therapy in patients with advanced crc, large studies involving kras and braf mutation analysis crc screenings have been undertaken; the results of studies with over 200 patients is demonstrated in table 1. unlike study by olivera et al 4, all of these large data sets demonstrated that in crc kras and braf mutations were mutually exclusive, except in one case 5. in one other series, two patients had tumors with two distinct kras mutations 6. molecular profiling demonstrates that kras and braf mutant tumors have very different gene signatures suggesting different signaling pathways are activated 12. in addition early data suggest outcomes with the use of anti-egfr monoclonal antibody therapy appear to be different depending on the site of kras mutation 13. at this time it is not known which gene expression profile pattern of concomitant kras and braf tumors is, and whether it more represents a kras tumor gene signature or braf signature. given fact of tumor heterogeneity and the large variety of mutations observed in this disease, as well as epigenetic changes observed, it is likely that in the future, tumor gene expression profiling will provide a better indication of the activation of tumor signaling, and be a better biomarker of treatment efficacy. strengths of our study are screened large patient population and available detailed clinical and pathological information. the main limitation, however, were retrospective nature of study and possible artefactual mutation detection. further multi-center prospective studies are necessary to understand true frequency and the role concomitant kras and braf mutations. concomitant kras and braf tumor mutations are rare enough to be considered virtually (albeit not entirely) mutually exclusive. since kras and microsatellite instability analysis are the only validated negative biomarkers of therapy efficacy in crc, routine analysis for braf mutations in kras wild type tumors is not recommended. however if patients are being considered for clinical trial, especially those in which the eligibility require the presence of a kras mutation, braf mutation analysis would be highly advisable. future enriched clinical trials for kras or braf should specifically address eligibility of patients whose tumors harbor a concomitant kras and braf mutation.

kras mutations occur frequently in colorectal cancers (crc) and predict lack of response to anti-epidermal growth factor receptor (egfr) monoclonal antibody therapy. crc braf mutations, most commonly at v600e, occur less than 10% of the time, and occur usually in kras wild-type tumors, and more frequently in microsatellite instable tumors. concomitant kras and braf mutant crcs are rare (occurring in 0.001%); braf mutations should not be routinely tested in patients with kras mutant tumors, unless the patients is participating in a clinical trial enriching for the presence of a kras or braf tumor. clinical trials treating patients with either kras or braf mutant tumors should address eligibility of patients with concomitant kras and braf mutations.

PMC3619093

pubmed-585

apolipoprotein (apo) a-v-is an enigmatic modulator of plasma triacylglycerol (tg) homeostasis. apoa-v is expressed solely in the liver and, following secretion, circulates at extremely low concentrations (~150400 ng/ml plasma). this value is approximately 10,000 fold lower than that of apoa-i, the major apo of high density lipoprotein (hdl). given the paucity of circulating apoa-v, it is logical to consider that it does not function as a typical member of the apolipoprotein class. despite this supposition, apoa-v possesses sequence homology with other apo s, is recovered in association with plasma lipoproteins and displays high lipid-surface seeking activity. using recombinant protein, it has been demonstrated that apoa-v binds heparan sulfate proteoglycans (hspg), members of the low-density lipoprotein receptor (ldlr) family and the endothelial cell surface protein, glycosylphosphatidylinositol-anchored-high-density lipoprotein binding protein 1 (gpih-bp1). this latter function has been invoked to explain the ability of apoa-v to enhance lipoprotein lipase (lpl) mediated hydrolysis of lipoprotein associated tg. what is not explained, however, is how this can be achieved at such low circulating apoa-v concentrations. for example, it has been estimated that, in the postprandial state, there is only enough apoa-v present to associate with ~1 in 24 apob containing lipoproteins. thus, it would appear that apoa-v is either an exceptionally potent apolipoprotein or it possesses additional functionality that has yet to be revealed. genome wide association studies (gwas) have identified apoa5 as a determinant of plasma tg concentrations. there is also strong evidence that abnormally high concentrations of tg are associated with atherosclerosis. given this connection, it is important to consider whether apoa5 may be a risk factor for disease processes that develop from chronic elevation of plasma tg. the fact that ~ 40 million adults in the united states have high tg (200 mg/dl) and ~4 million of these have hypertriglyceridemia (htg; 500 mg/dl) indicates the scale of this health problem. in the prospective cardiovascular munster study, a six-fold increase in coronary heart disease (chd) risk was measured in subjects with tg values>200 mg/dl. likewise, in the scandinavian simvastatin survival study, the authors reported increased risk of coronary events as tg levels increased above 220 mg/dl. in this study the 5- year event rate was significantly increased in untreated patients with mixed dyslipidemia (including those with htg) compared to those with elevated ldl-cholesterol alone. finally, the bezafibrate infarction prevention study found that, in men and women with established chd, elevated plasma tg increased the risk of cardiovascular mortality, stroke and transient ischemic attacks. it is widely recognized that numerous genes play a role in determining plasma tg levels. in addition to apoa5, well-studied modulators of plasma tg homeostasis include lpl, apoc2, apoc3, gpihbp1 and others. according to prevailing models, plasma apoa-v functions to facilitate lipoprotein binding to gpihbp1. as a component of tg-rich lipoproteins, apoa-v binding to gpihbp1 coordinates lpl and apoc-ii interactions in a manner that promotes efficient tg hydrolysis. indeed, when any one of these proteins is missing or defective, htg ensues. further complexity is introduced when the effect of apoa-v on plasma tg is examined in different physiological settings. in mice, for example, an inverse correlation between apoa-v and tg is well documented. these authors showed that gene disruption of apoa5 leads to a marked increase in plasma tg while transgenic overexpression of apoa5 induces a significant decline. by contrast, in human populations with htg, plasma apoa-v and tg are oftentimes positively correlated! thus, it is likely that, depending on the genetic background/physiological conditions that lead to htg, apoa-v may actually accumulate along with tg. in a recent study, do et al. investigated the correlation between rare apoa5 variants and early onset myocardial infarction (mi). in this tour de force study, the authors conducted exome sequencing on over 9,700 human subjects with premature mi (50 years of age in males and 60 years in females) along with mi-free controls. they sought to identify genes in which rare mutations contribute to the risk of early-onset mi in the population. two genes (ldlr and apoa5) were identified in which rare coding mutations were more frequent in mi cases compared to controls. likewise, in apoa5, those subjects with rare non-synonymous mutations were at 2.2-fold increased risk for mi. when compared to non-carriers, ldlr mutation carriers had higher plasma ldl cholesterol while apoa5 mutation carriers had higher plasma tg. it may be anticipated that subjects identified to be at risk for premature mi as a result of harboring these rare apoa5 mutations could improve or normalize their plasma tg concentration, and reduce the risk of mi, by augmentation with wild type (wt) apoa-v. a basic question emerging from the above investigation relates to the underlying mechanism whereby elevated plasma tg increases the risk of heart disease. certainly the correlation between chronic elevated plasma tg and atherosclerosis is less clear than that for cholesterol. while the tg content of plaque is far less prominent, evidence suggests that, in cells located in and around plaque deposits, tg-rich lipoproteins induce inflammation and related atherogenic processes. elevated tg also correlates with the formation of small dense ldl, lipoprotein particles that are positively associated with chd risk and inflammation. given the very low concentration of apoa-v in plasma under normal circumstances, any decrease will likely impact lipoprotein-associated tg hydrolysis by lpl, thereby interfering with tg-rich lipoprotein clearance. the resulting increase in circulating tg-rich lipoproteins will promote inflammatory cytokine release, contributing to endothelial injury. studies in mouse models of dyslipidemia have provided evidence that apoa-v is athero-protective. crossed apoa5 transgenic mice with apoe2 knock in (ki) mice (deficient in apoe and transgenic for apoe2). compared to control apoe2 ki mice, plasma tg levels were lower and atherosclerotic lesion size was reduced when apoa-v levels were increased. subsequently, grosskopf et al. crossed apoa5 transgenic mice with apoe (-/-) mice. in this study a significant decrease in vldl and remnant lipoproteins, together with a 70% reduction in aortic lesion area, was noted. in both of these studies, the apoa-v concentration in plasma was increased by expression of the transgene. of interest, however, a dysfunctional apoe protein is present while in apoe (-/-) mice no apoe is present. it is conceivable that, since apoa-v and apoe share the ability to bind hspgs and members of the ldl receptor family, augmenting apoa-v levels in the absence of functional apoe compensates for the missing or defective apoe. these mice manifest delayed catabolism of vldl and chylomicrons owing to an abundance of apoc-iii bound to the surface of these particles. to study the effect of apoa-v augmentation on apoc-iii overexpression-dependent htg, qu et al. used adenovirus mediated gene transfer to increase apoa-v production in apoc3 transgenic mice. apoa-v gene transfer into apoc3 transgenic mice caused a reduction in apoc-iii content on vldl that, in turn, led to an increase in lpl-mediated tg hydrolysis. as discussed above, and previously by sharma et al., relatively common apoa5 snps are associated with increased plasma tg. for example, individuals homozygous for the c.553 g>t apoa5 snp (rs2075291) have extremely elevated plasma tg levels. recent studies have shown that htg in these subjects is due, at least in part, to production of a dysfunctional apoa-v protein. it may be anticipated that an increase in circulating levels of wt apoa-v in homozygous carriers of this snp will induce tg lowering, thereby reducing the risk of related disease processes. another coding snp strongly associated with elevated plasma tg is c.56c>g apoa5 (rs3135506). this snp, which introduces an amino acid substitution (ser19trp) in the signal sequence of apoa-v, is thought to impede processing/secretion of the mature protein. along the same lines, a rare homozygous apoa5 deletion mutation has been identified in the signal sequence (c.16_39del; p.ala6_ala13del), generating a variant apoa-v protein that is not secreted. the missing amino acids are required for translocation of nascent apoa-v to the endoplasmic reticulum and, as a result, this protein accumulates in the cytoplasm in association with lipid droplets. in both c.56c>g and c.16_39del, the mature protein is predicted to be identical to wt apoa-v. mutation- and snp-induced effects on signal sequence function or cleavage decrease secretion efficiency resulting in diminished, or complete lack of, circulating apoa-v. however, despite the fact that individuals harboring the c.56c>g snp may secrete less apoa-v, if this polymorphism is not the sole or primary underlying cause of htg, then apoa-v levels will likely accumulate in plasma along with tg and it is doubtful augmentation with apoa-v will induce tg lowering. non-coding snps located within the apoa5 gene locus are also associated with elevated plasma tg, most likely due to effects on apoa5 gene expression. for example, the -1131t>c snp (rs662799), located upstream of the transcription start site, has been proposed to reduce transcription efficiency. likewise, an ivs3+3 g>c mutation causes a frameshift in the donor splice site of intron 3 creating a premature stop codon that results in a nonsense protein. other rare mutations in apoa5 result in severe truncation of apoa-v and abolish function altogether. given this, it may be anticipated that individuals with htg caused by deleterious apoa5 snps or mutations would benefit from increased circulating levels of wt apoa-v (table1). likewise, as seen above, if htg is caused by enhanced apoc-iii production, it may be anticipated that increased circulating levels of apoa-v would be beneficial. on the other hand, if htg is associated with a diagnosis of metabolic syndrome, for example, simply adding to the pool of apoa-v is not expected to improve the tg profile owing to the multifactorial causation of this disorder. from a practical standpoint, if htg is observed, then the apoa5 gene should be examined for the presence of deleterious snps or loss of function mutations. if present, then wt apoa-v augmentation may induce tg lowering. on the other hand, subjects with htg unrelated to apoa5 or from a combination of apoa5 variation and other genes, this predicted differential response provides a plausible explanation for the conundrum emerging from analysis of apoa-v genetically engineered mouse models (wherein a clear inverse correlation between apoa-v and plasma tg exists) and human population studies that reveal a positive correlation between apoa-v and tg. the importance of discriminating between predicted responders and non- responders is illustrated below. for subjects harboring apoa5 mutations, specific criteria must be met prior to consideration for supplementation with wt apoa-v. these include persistent elevated plasma tg, continuing low plasma apoa-v protein levels and a lack of polymorphisms/mutations in other known tg modulating genes. based on the above discussion, it is conceivable that deleterious apoa5 snps or mutations (e.g. interfere with apoa-v secretion efficiency or produce an apoa-v protein with compromised function) may increase the risk of atherosclerosis due to chronically elevated plasma tg levels. to investigate the potential benefit of direct addition of apoa-v, shu et al. administration of apoa-v containing reconstituted hdl induced a 60% decline in plasma tg after 4 h that was attributed to enhanced catabolism and clearance of vldl. despite the reduction in plasma tg observed in this experiment, the effect was short-lived, suggesting that this approach may not represent a feasible therapeutic strategy. in an effort to increase the duration of tg-lowering induced by apoa-v, aav2/8-mediated gene transfer of wt apoa-v was performed in apoa5 (-/-) mice. in this study, apoa-v expression lasted at least 8 weeks and induced a 50% decline in plasma tg levels, suggesting that gene therapy may be beneficial in some instances. it is noteworthy that recent advances suggest gene transfer technology may constitute a feasible therapeutic option for a subset of individuals with chronic htg. for this purpose, vectors most commonly used for treatment of metabolic disorders are adeno-associated virus (aav) and lenti-virus. among these furthermore, compared to other viral vectors, aav induces a minimal host immune response. in fact, aav vectors have been used to deliver genes to over 500 study subjects by various routes of administration for potential treatment of genetic disorders including cystic fibrosis, hemophilia and canavan, batten, parkinson's and alzheimer's diseases, without significant safety concerns. among approved aav-based therapies, glybera (uniqure) long- term gene expression (> 1.5 years) has been demonstrated after aav transduction in animal models including canine, murine and hamster. moreover, it has been demonstrated that aav can successfully be transduced into a variety of cell and tissue types, including brain, liver and muscle. an advantage of the aav serotype 2/8 is that it efficiently targets liver. given that apoa-v is expressed solely in liver, aav2/8 is a strong candidate vector for studies involving apoa-v gene transfer. given the role of apoa5 in modulation of plasma tg documented in studies of genetically engineered mice, gwas, human population loss of function studies and large-scale exome sequencing, therapies designed to promote its athero-protective effects are very attractive. whereas it may be possible to develop a small molecule therapeutic capable of inducing endogenous apoa-v expression, individuals harboring common snps or rare mutations in apoa5 may not benefit from this approach. on the other hand, gene therapy represents a safe, robust and efficient means to achieve sustained expression of wt apoa-v. by controlling plasma tg homeostasis in this manner

abstractapolipoprotein (apo) a-v is a novel member of the class of exchangeable apo's involved in triacylglycerol (tg) homeostasis. whereas a portion of hepatic-derived apoa-v is secreted into plasma and functions to facilitate lipoprotein lipase-mediated tg hydrolysis, another portion is recovered intracellularly, in association with cytosolic lipid droplets. loss of apoa-v function is positively correlated with elevated plasma tg and increased risk of cardiovascular disease. single nucleotide polymorphisms (snp) in the apoa5 locus can affect transcription efficiency or introduce deleterious amino acid substitutions. likewise, rare mutations in apoa5 that compromise functionality are associated with increased plasma tg and premature myocardial infarction. genetically engineered mouse models and human population studies suggest that, in certain instances, supplementation with wild type (wt) apoa-v may have therapeutic benefit. it is hypothesized that individuals that manifest elevated plasma tg owing to deleterious apoa5 snps or rare mutations would respond to wt apoa-v supplementation with improved plasma tg clearance. on the other hand, subjects with hypertriglyceridemia of independent origin (unrelated to apoa-v function) may not respond to apoa-v augmentation in this manner. improvement in the ability to identify individuals predicted to benefit, advances in gene transfer technology and the strong connection between htg and heart disease, point to apoa-v supplementation as a viable disease prevention/therapeutic strategy. candidates would include individuals that manifest chronic tg elevation, have low plasma apoa-v due to an apoa5 mutation/polymorphism and not have deleterious mutations/polymorphisms in other genes known to influence plasma tg levels.

PMC4820885

pubmed-586

systemic chemotherapy is the main treatment modality in the management of patients with metastatic disease. after chemotherapy, oncologists evaluate tumor response by observing tumor behavior, i.e. growth, reduction or stability in its dimensions [2, 3]. nowadays, tumor response to therapy as determined by imaging methods is generally used to inform decisions regarding either maintenance or interruption of treatment. in the late 1970s the world health organization (who) introduced a standard assessment of tumor response, proposed by miller et al. and adopted internationally, defining objective responses of lesions measurable in two dimensions, such as pulmonary metastasis assessed by x-rays. this evaluation is performed by comparison of tumor area, the sum of all lesions greater perpendicular diameter products, measured in a planar image. more recently a new set of guidelines has been introduced by the response evaluation criteria in solid tumors (recist) group with the purpose of reviewing the former criteria and better standardizing response evaluation. this model uses a unidimensional approach taking the sum of the longest diameters instead of the sum of the areas. with the introduction of cross-sectional imaging methods, the number of measurable metastatic lesions detected in a single patient has increased dramatically, and most oncologists (as well as study protocols) recommend the use of one lesion or a few representative lesions to evaluate response in individual patients with multiple lesions. metastatic nodules are not uniform and consist of a heterogeneous cell population with diverse biological behavior that could account for differences in chemotherapy response. a wide range of growth patterns in pulmonary metastases of patients not previously submitted to treatment has been observed. this variation in behavior, if observed in patients being evaluated for chemotherapy response, could influence the response perception. the selection of one or a few nodules, instead of including all identifiable nodules in the response evaluation, could lead to misevaluation and consequently to the continuity of ineffective treatment or the interruption of potentially effective therapy. the present study used ct to quantify the variation in tumor response of pulmonary metastases of solid tumors of varied histology in individual consecutive patients that were submitted to ct studies in order to evaluate response to chemotherapy. we submitted each pulmonary nodule individually, as if it were a solitary metastasis, as well as all the nodules of the same patient combined, to both the who and the recist criteria and compared the response evaluations in each setting. we prospectively evaluated two consecutive chest ct scans of patients with the diagnosis of solid tumor and pulmonary metastases receiving systemic chemotherapy and being routinely evaluated for tumor response. we included in this study 41 chemotherapy response evaluations in 33 patients (20 women and 13 men), with ages ranging from 14 to 81 years (median 46 years). in eight patients the attending physician (department of clinical oncology) established the diagnosis of pulmonary metastases usually by the presence of new pulmonary nodules and progression of metastatic disease and the type of chemotherapy used. the interval between the ct evaluations varied from 1.25 to 8.8 months (median: 3.9; mean (sd) 3.8 (1.6) months) and the number of cycles varied from 2.0 to 6.0 cycles (median: 4; mean sd: 3.7 1.2 cycles). helical scan techniques were performed on ct prospeed and ct hispeed scanners (general electric). the slices obtained were contiguous with 7 mm thickness and a pitch of 1.5 or less. the two larger perpendicular diameters on the axial plane were measured in images printed in lung windows. the number of nodules in an individual patient varied from 2 to 69 (median: 7; mean sd: 13.8 15.0 nodules). the nodules initial larger diameter ranged from 2 to 82 mm (median: 10; mean sd: 11.6 8.5 mm). in each set of ct scan examinations performed to assess tumor response to chemotherapy, who and recist criteria classified each nodule individually. for the patient s response evaluation a modified version of the who and recist criteria was used by considering the sum of measurements of all pulmonary nodules in each patient to better represent the total tumor volume change for each patient. the bidimensional who criteria of tumor response categories are: (a) partial response when area reduction is 50% or more; (b) stable disease for a reduction of less than 50% or an increase less than 25%; and (c) disease progression for an increase of 25% or more. the unidimensional recist criteria of tumor response categories are: (a) partial response if linear larger dimension reduction is 30% or more; (b) stable disease for a reduction less than 30% or an increase less than 20%; and (c) disease progression for an increase of 20% or more. the disappearance of the lesion(s) is considered a complete response by both assessment criteria and both consider the presence of any new nodule as progression of disease, independent of the behavior of any other nodule. the following parameters were determined: (a) individual nodule response rate evaluation; (b) response evaluation for each patient, as a whole, according to the who and the recist criteria; (c) intra-individual distribution of response for every patient s nodule; and (d) the proportion of nodules evaluated differently from the patient s response, taking the sum of all nodules into consideration. the nodules response category distributions for different types of cancer, chemotherapy, and initial number of nodules were compared by chi-square test. the agreement between both response evaluation criteria was calculated by the kappa-interrater agreement index. half (n=283) of the nodules showed a reduction in size considering only the larger measured diameter, while 126 (22%) remained unaltered comparing both ct scan studies and 157 (28%) increased in size. according to the who criteria, 113 (20%) had a complete response, 66 (12%) had a partial response, 258 (46%) were stable and 129 (23%) progressed. using the recist criteria, 134 nodules were considered measurable as having a diameter twice the size of the slice thickness utilized (> 14 mm). of these, 22 (16%) nodules had a complete response, 17 (13%) a partial response, 67 (50%) were stable and 28 (21%) progressed. classification was different by the two criteria in 13 (10%) of the 134 measurable nodules. the kappa interrater agreement for both criteria evaluations was 0.85 (table 2). evaluating the patients response, taking into account the sum of all nodules, by the who criteria, one patient was classified as having complete response, five partial response, 15 stable disease and 20 progressive disease; and by the recist criteria one patient was classified as having complete response, five partial response, 16 stable disease and 19 progressive disease. the kappa interrater agreement for both criteria evaluations was 0.90 (table 3). the intra-individual variation for metastases response evaluation was quite diverse by both criteria, with no relation to type of cancer, chemotherapy or number of nodules. by the who criteria: from the total of 41 response evaluations, all the patients nodules had the same response classification in four; in 16 evaluations there were nodules in two distinct classifications; in 12 three different classifications; and in seven, nodules in the four possible categories (fig. 1). by the recist criteria: measurable nodules were present in 33 of the 41 response evaluations; in seven there was only one nodule; in 11 all the patients nodules had the same response classification; in 12 evaluations there were nodules in two distinct classifications; and in three evaluations there were nodules in three different classifications (fig. eighteen patients presented 82 new nodules observed at the second ct scan, varying from 1 to 21 per patient (median 2, mean 4.8), in a proportion of the initial total number of nodules ranging from 5% to 525% (median 25%, mean 75%). by the recist criteria, in one of the 19 patient evaluations resulting in disease progression no new nodule was present and in 14 a new nodule was the sole criterion for disease progression classification (table 4). by the recist criteria, the proportion of measurable nodules classified differently from the patient evaluation, taking the sum of all measurable nodules into consideration, varied from 0% to 100% (median: 25%; mean sd: 30% 33%). in a patient with three lung metastases, the patient evaluation by comparison of the sum of diameters of the three nodules resulted in partial response. in 15 evaluations there were measurable lesions and there were no new nodules; when the measurable response was the only considered factor, the proportion of measurable nodules classified differently from the patient evaluation, taking the sum of all measurable nodules into consideration, varied from 0% to 100% (median: 33%; mean sd: 35% 35%). after chemotherapy, evaluation of tumor response is obtained by observing the progress of lesion size. difficulties arose when the number of lesions per patient that could be evaluated increased, mainly after the introduction of cross-sectional imaging methods. nowadays most radiologists and oncologists use only one lesion or a few representative lesions to evaluate tumor response in patients presenting with multiple nodules. thus, it is important to know the intra-individual variability of response rate evaluation for different tumors in the same patient. clinically, the response rate of solid tumors has been calculated by taking the tumor diameters in observations separated by the treatment, and by determining tumor shrinkage, stability or growth. for many years the world health organization criteria for treatment response evaluation have been the criteria used by most oncologists and in most clinical trials. more recently, several organizations involved in clinical research have reviewed these criteria on the basis of experience acquired since they were introduced and a new set of guidelines has been developed with a model by which response rates could be derived from unidimensional measurement lesions instead of the former bidimensional approach. according to this model, the use of only one lesion dimension simplifies the task of evaluating tumor response and correlates well with the lesion s area, previously used. the recist group tested their criteria in several historical study protocols and obtained good correlation with the who criteria. more recently, studies have shown both good and poor correlation between the unidimensional and bidimensional response evaluations [8, 9]. in this present study a high correlation between the who and the recist criteria in the evaluation of individual nodules and patients was achieved. the advantage of using the recist criteria is the simplicity of taking only one measurement per lesion. nowadays, the best method of assessing tumor response in most clinical situations is ct scan, leading to detection of a larger number of lesions, with smaller diameters, and more precision on measuring when compared to other methods [10, 11]. even though pulmonary metastases evaluated by ct scan should be one of the best scenarios in terms of measurement of lesions, since the low-density lung provides natural contrast for the dense pulmonary nodule, variability in the application of response criteria could compromise the reproducibility of results. major potential sources of response evaluation variation are imaging techniques, inter-observer variability, and the selection of target lesions [12, 13]. in order to minimize observer variation, this study applied helical ct scanning and had the lesions measured by the same radiologist to evaluate response of the multiple metastases in the same patient, as routinely done in the clinical setting and in study protocols. the presence of a new nodule was the main factor for determining disease progression, and the proportion of these new nodules in some cases was as low as 5%. the systematic evaluation of all the patients nodules is then necessary to guarantee the identification of a new nodule. the individual nodules in the same patient have individual and unpredictable behavior and can be evaluated as independent lesions. by using the who and the recist criteria of tumor response to therapy we verified that there were nodules labeled as disease progression in patients classified as stable, and unaltered nodules in patients evaluated as having progressive disease. in our patient population the proportion of nodules in a patient with response evaluation different from that obtained taking the sum of all nodules together amounted to 35%. the results confirmed our previous impression that the application of the who or the recist method to one or some nodules in a patient, as frequently utilized by protocols, could also be misleading. in the same patient, one could select a stable nodule, a nodule with growth or a nodule in regression, and this could result in a decision error regarding the treatment regimen. the use of the sum of the evaluation of all nodules together maximizes the reproducibility of response evaluations. in this study we tried to reproduce what seem to be the usual conditions for tumor response evaluation in most protocols and institutions; some of these conditions are limitations for the best possible response evaluation accuracy, but are close to clinical practice standard conditions. there was no histological proof of the metastatic nature of the lung nodules, and some could have been infectious or inflammatory; in clinical practice, however, histological proof is rarely required and the presence of new pulmonary nodules and overall oncologic disease progression are the criteria adopted by the oncologist for a diagnosis of lung metastases. when this study was conducted nowadays many institutions with faster and multiple detector cts adopt 5 mm or less in the evaluation of lung metastases. however, the recommendation of the authors of the recist group criteria was followed in measuring lesions no smaller than twice the size of the slice thickness. hard copy measurements were taken, despite having been shown to be less reproducible than computer display methods, as computer measurement is not always available, especially to the oncologist. in conclusion, there is a high correlation between the world health organization criteria and the recist group criteria. intra-individual variation in tumor response of pulmonary metastases is elevated in some patients, and chemotherapy response evaluation utilizing only one or some of the patient s nodules could lead to inappropriate reproducibility in therapeutic response perception. intra-individual distribution of response evaluation of pulmonary metastases by world health organization criteria. intra-individual distribution of response evaluation of pulmonary metastases by the response evaluation criteria in solid tumors (recist) group criteria. distribution of primary types of metastatic solid tumor response evaluation of measurable nodules (> 14 mm) assessed by the who and the recist criteria response evaluation of patients assessed by the who and the recist criteria impact of the presence of new nodules in the patient s global response evaluation assessed by the recist criteria bold type indicates evaluations in which a new nodule was the sole criterion for disease progression.

objective: with the introduction of cross-sectional imaging methods the number of lesions per patient that can be evaluated is frequently large and most oncologists and study protocols use only one lesion or a few representative lesions to evaluate chemotherapy response. intra-patient response variability can therefore affect evaluation reproducibility. this study evaluates intra-individual variation in response to chemotherapy in patients with multiple lung metastases. methods: we prospectively studied chest ct images of patients with solid tumors and pulmonary metastases under systemic chemotherapy being evaluated for tumor response. the response of 566 pulmonary nodules in 41 evaluations was determined by both who and recist criteria in order to determine intra-individual tumor response variation. results: there was almost perfect agreement between the who and the recist criteria for the evaluation of tumor response. high intra-individual variability of tumor response was observed in a significant proportion of the evaluations. a new nodule was the main criterion for determination of disease progression. a mean of 35% of the total number of nodules of a patient have a response evaluation different from that calculated with all the nodules together. conclusions: intra-individual variation in tumor response of pulmonary metastases is elevated in some patients. selecting any or some nodules for response evaluation could significantly influence therapeutic response perception.

PMC1693775

pubmed-587

the spinal dural arteriovenous fistula (sdavf) is the most common type of spinal vascular malformation, but it is rare condition in overall incidence561013171820). it is characterized by progressive, insidious, and non-specific symptoms that are similar to those of more common etiology, such as degenerative spinal disorder and peripheral neuropathy5131920). the fistulas of sdavf are located intradurally at the sleeve of the nerve root, and the obliteration of fistulas is the treatment goal for sdavf513182223). sdavf can be treated by surgical interruption and endovascular embolization. to help ensure successful treatment, we present a patient with sdavf and a history of paraparesis during spinal angiography who was treated successfully using stereotactic radiosurgery (srs) using novalis system. a 43-year-old man presented with slow progression of back pain, voiding difficulty, and boring pain on both lower extremities during 5 months. neurological examination showed 420motor weakness of grade iv in both legs and his anal tone was grade zero. about 14 years ago, he had pain in the left leg and was diagnosed with spinal arteriovenous malformation. at that time, magnetic resonance imaging (mri) of the thoracolumbar spine revealed a vascular anomaly at the thoracolumbar level, and physicians performed spinal angiography for definite treatment. however, spinal angiography had failed three times in two other hospitals due to vasospasm and paraparesis. he recovered from these symptoms spontaneously, and he had not undergone any treatment thereafter. mri in our hospital showed a vascular anomaly with enhancement at the t12, l1, and l2 levels (fig. axial images of the l1 level revealed a mass lesion, located on the left side of the intraspinal canal (fig. we recommended selective spinal angiography, but the patient refused because of his experience, requesting a non-invasive technique for diagnosis and treatment. however, we required an alternative modality to selective spinal angiography for obtaining accurate information on diagnosis, level of the lesion, and follow-up after treatment. thus, a three-dimensional volumetric sagittal time-resolved imaging of contrast kinetics (tricks) abdominal magnetic resonance angiography (mra) using 1.5 t mri system were performed in quiet respiration (tr/te/flip=4.2/1.1/45, fov 330330, equivalent slice thickness of 3 mm, matrix 256160). contrast medium (15 ml gadolinium) the study was post-processed into maximum-intensity projection (mip) images (fig. the target, involving the dura margin, was constructed to include the fistula during structural segmentation under spinal computed tomography (ct) images (fig. we used 10 conformal beams and a total irradiation of 18 gy with three fractions (fig. we checked the three-dimensional sagittal tricks abdominal mra using 1.5 t for follow-up 7 months after srs, and three-dimensional sagittal tricks abdominal mra using 3.0 t mri system (tr/te/flip=10.0/1.5/30, fov 380380, equivalent slice thickness of 4 mm, matrix 384160) was performed 3 years after radiosurgery. the size of the spinal lesion was decreased and the flow through the fistula was diminished on the 7-month post-treatment images (fig. 4a), and the sequelae of the previous lesion was presented on follow-up mri and mra images (fig. sdavf represent a rare pathological condition, but they account for 6080% of all spinal vascular malformation61317182023). they are acquired lesions, and usually present with insidious and progressive symptoms, such as paraparesis and sensory deficits of the bladder, bowel, and lower extremities10131718). as they present with non-specific and misleading clinical symptoms, their most common site is the thoracolumbar region, and the arteriovenous shunt is a low-flow shunt located at the dural sleeve of the spinal nerve root56101323). the pathophysiology of sdavf-induced spinal cord ischemia and myelopathy is due to increased venous pressure, venous congestion, and decreased spinal cord perfusion caused by shunting arterial blood into the venous side56121315171823). treatment methods for these lesions are microsurgery and endovascular embolization. because the selection of treatment method is mediated by the physician's preference, selective spinal angiography is regarded as an essential procedure to confirm and treat sdavf5). for successful surgery or endovascular coiling, selective spinal angiography is necessary to know the architectures and hemodynamics of the lesion561215181922). however, even with experienced neuro-interventionists, selective spinal angiography can sometimes cause complications from vasospasm, increased venous pressure, and spinal cord infarction6812151720). in our case, the patient experienced paraparesis three times during spinal angiography. although it occurred 14 years previously, the patient refused the spinal angiography. because the patient wanted a noninvasive method for diagnosis and treatment, we found an imaging technique to provide information about the lesion and be available for follow-up. there are some advanced imaging techniques for sdavf, such as contrast enhanced magnetic resonance angiography with high resolution, tricks sequence, gradient echo, and spinal angiography with a 256-slice ct23152024). although the role of advanced imaging techniques is limited to reducing the exposure of contrast and radiation during the subsequent selective spinal angiography61215202124), it is sufficient for diagnosing sdavf and localizing the fistula235152024). of these imaging techniques, we used the three-dimensional sagittal tricks abdominal mra to obtain information about the spinal lesion and plan the srs. srs for sdavf is not an established method, so reports regarding sdavf treated by srs are very rare. however, in terms of radiosurgery for cranial dural arteriovenous fistulas, radiosurgery for sdavf is not an impossible treatment option22). gao et al.7) reported that high expression state of endothelial progenitor cells (epcs) presented in the brain and spinal arteriovenous malformation (avm) tissue. other authors have published the results from an experimental study that radiosurgery decreases angiogenic activity in avm tissue, compared to that in untreated avm tissue1). moreover, in an experimental study by jahan et al.9), srs for an artificial animal avm model showed a reduction in the size of the lesion, compared to that in the non-radiosurgical model. although these studies are not results for sdavf, we thought that it was possible to perform radiosurgery for sdavf. dalyai et al.4) reported that srs for arteriovenous fistula lesions did not clearly show the mechanisms of treatment results, but they induced smooth muscle expansion, adventitial fibrosis, and an intimal response of arterial feeders, and eventually achieved obliteration of the fistula. however, it is not easy to find the exact location of fistulas with ct and mri-based image-guided structural segmentation. thus, we planned the target area to include the dura margin, because fistulas of sdavf are located at the sleeve of the nerve root in the intradural space5131822). the planning of the radiosurgical dose was based some study, which the appearance of myelopathy from srs to spinal lesions appear rare (< 1%) when the maximum spinal cord dose is limited to the equivalent of 13 gy in a single fraction or 20 gy in three fractions1114). however, these studies did not provide sufficient long-term data, and our patient had preexisting myelopathy. thus, we treated him with a slightly lower dose than those in the references. advanced imaging studies, including the three-dimensional sagittal tricks sequence, may be useful for obtaining information about sdavf and in performing srs and follow-up after srs when selective spinal angiography has failed. and we think that srs may be another treatment option, especially, for patients preferring non-invasive procedures. our study has the obvious limitation of only including one treatment case, so additional cases of sdavf treated by srs are necessary to determine if it is an effective treatment for this condition.

the spinal dural arteriovenous fistula (sdavf) is rare, presenting with progressive, insidious symptoms, and inducing spinal cord ischemia and myelopathy, resulting in severe neurological deficits. if physicians have accurate and enough information about vascular anatomy and hemodynamics, they achieve the good results though the surgery or endovascular embolization. however, when selective spinal angiography is unsuccessful due to neurological deficits, surgery and endovascular embolization might be failed because of inadequate information. we describe a patient with a history of vasospasm during spinal angiography, who was successfully treated by spinal stereotactic radiosurgery using novalis system.

PMC4954894

pubmed-588

incompetence in locating, cleaning and shaping or obturating the complete root canal system causes primary and post-treatment infections which often lead to endodontic treatment failures. however, the most significant reason for the root canal treatment failure is insufficient knowledge about the root canal morphology and its variations. this is because such unexplored areas of root canal system remain unaffected by instruments and antimicrobial substances and form the seat for the persistent infection. thus, it is critical to assess the numerous morphological variations of the root canal system before initiating the endodontic procedure. however, certain internal and external morphological variations in the mandibular canine like single or bifid roots with two or three canals have been reported in the literature. till date, no case report on management of two rooted three canaled mandibular canine with a fractured instrument has been reported in the literature. in the documented case, dental operating microscope is used to bypass the fractured instrument in the middle canal of a three canaled mandibular canine with the patients consent. a 38-year-old healthy asian woman was referred to the endodontic clinic by a general dentist. the patient presented to her dentist with a severe pain in left mandibular region ten days ago. the dentist initiated the root canal treatment in left mandibular canine (tooth #22). during the cleaning and shaping procedure, an iso #10 k-file the dentist could not bypass the fractured instrument and hence the case was opted for the referral. on clinical examination, tooth #22 did not appear to have any coronal morphological variations and was identical to its right counterpart except it was mesially rotated. it was tender to percussion without any evidence of mobility, swelling or sinus tract. careful pre-operative radiographic examination revealed a two rooted three canaled (i.e. buccal, middle and lingual canals) mandibular canine with a fractured instrument in the middle canal [figure 1]. buccal (a), middle (b) and lingual (c) with a fractured instrument in the middle canal prior to the initiation of root canal treatment, patient was explained about the aberrant root canal morphology and presence of a separated instrument in the middle canal. patient was administered local anesthetic solution with adrenalin (2% lidocaine with 1: 100000 epinephrine, lox 2% neon lab, india). under rubber dam isolation (hygienic, coltne whaledent inc., usa), access opening was re-defined with the help of ultrasonic tips (pro ultra endo tips no. 2 and 3, dentsply maillefer, new york, usa). careful clinical explorations of access opening with a dg-16 endodontic explorer (hu-friedy, chicago, il, usa) revealed two root canal orifices in bucco-lingual direction and were present more towards the buccal side. moreover, a bleeding point was noted lingually at the end of a developmental fusion line indicating the location of unexplored third root canal orifice. troughing the developmental fusion line lingually with ultrasonic tips under a dental operating microscope (carl zeiss surgical gmbh, oberkochen, germany) revealed a third root canal orifice [figure 2]. all three root canal orifices buccal (a), middle (b) and lingual (c) present alongside the developmental fusion line (d) are located with the help of ultrasonic tips and dental operating microscope all the three root canal orifices were coronally pre-flared using a nickel-titanium (niti) protaper sx rotary file (dentsply maillefer, ballaigues, switzerland) with a brushing outstroke action to improve the straight-line access. dental operating microscope was used to visualize the fractured instrument present in the apical third of the middle canal. the maneuver to bypass the instrument was initiated in the presence of glyde (dentsply maillefer, tulsa, ok) by wedging an iso #8 k-file (dentsply maillefer, tulsa, ok) between the fractured instrument and the canal walls with frequent radiographic checks. the file was then advanced and withdrawn repeatedly in an attempt to widen the canal space and loosen the retained fragment from the root canal. so it was decided to prepare the entire root canal system, and incorporate the fragment into the obturation. the space created between the fractured instrument and the canal walls was enlarged with the larger sized files sequentially till iso #25 k-file. working lengths for all three canals were determined with an apex locator (root zx; morita, tokyo, japan) and were confirmed radiographically [figure 3]. all three canals were prepared using protaper niti rotary instruments (dentsply maillefer, ballaigues, switzerland) according to manufacturer's recommendations. protaper s1/s2 rotary files were used with brushing outstroke action. finishing files f1 and f2 irrigation was performed using triple distilled water, 2.5% sodium hypochlorite solution (cmident, india) and 15% edta (largal ultra, septodont, saint maur des fosses, france). 2% chlorhexidine digluconate (r4, septodont, saint maur des fosses, france). were used as the final irrigant. the canals were dried with sterile paper points (dentsply maillefer, tulsa, ok). the access cavity was sealed temporarily with intermediate restorative material (irm, caulk dentsply, milford, de). the root canals were again irrigated with triple distilled water to remove the intracanal dressing of calcium hydroxide. obturation was done by a single cone technique with the use of gutta-percha cones and epoxy resin-based root canal sealer (ah plus sealer, dentsply maillefer, tulsa, ok). in the middle canal, tooth was restored using light cured composite resin (z100; 3 m dental products). subsequent follow-up x-ray was taken at 12 months [figure 4b]. working length radiograph with fractured instrument bypassed in the middle canal (a) post-obturation radiograph with inclusion of a fractured instrument in the obturation. essential pre-requisites for a successful endodontic treatment are careful interpretation of pre-operative radiographs, a thorough knowledge and detailed exploration of internal root canal morphology and its divergence under the magnification and illumination. straight radiograph provides information about the mesio-distal root canal orientation where as angled radiographs (radiographs at two different horizontal angulations) provide information about the facio-lingual canal position. any attempt to reduce the required number of radiographs runs the risk of missing information of the complex canal morphology. furthermore, a careful tracing of periodontal ligament space suggested the presence of two separate roots with three canals. the access cavity was extended buco-lingually with the help of ultrasonic tips in order to conserve the tooth structure while searching for an extra and elusive canal orifice. the internal and external morphological variations of the mandibular canine were clearly appreciable from the radiographic and clinical examination in the present case. hence, cone beam computed tomography (cbct) scan was not done to reduce any extra radiation dosages. even though the mandibular canine shows a single root and a single root canal with single apical foramen in about 92.2% of cases, clinicians should always search for any possible extra root or canal. root canal morphological variations reported in the mandibular canine include two canals and one apical foramen in 4.9% of cases, two canals and two apical foramens in 1.2% of cases and two different roots each one with one canal in 1.7% of the cases. also two distinct case reports of mandibular canine with three canals in one root or two roots were reported in the past. hence, it is always prudent to consider all anatomical variations in the mandibular canine while performing a root canal treatment. any pre-determined assumption about the root canal morphology leads to failure to locate any morphological variation, if present. it hinders the effective cleaning and shaping and creates a nidus of infection that directly compromises the long term prognosis of the tooth. in the documented case, the fractured k-file in the middle canal prevented the negotiation and thorough biomechanical preparation of the canal. however, the chances of uneventful retrieval of the fractured instrument were not predictable considering the impossibility of visibility of instrument under dental operating microscope, strategic importance of tooth, the location of the instrument and the limited thickness of the root. success in management of fractured instrument is defined as the complete removal or complete bypass of the fragment without creating a perforation. hence, decision was made to bypass the instrument under dental operating microscope to enhance the visualization of operating field and to conserve the maximum root structure. during the bypassing maneuver, higher magnification was used with frequent radiographic checks to avoid intra-operative complications like root perforation, ledge formation, pushing the instrument more apically etc. so, a clear understanding of pulp anatomy and its variations is essential if effective cleaning, shaping and obturation of the pulp space are to be achieved to assure the successful and predictable outcome of endodontic treatment. mandibular canine with variations in number of roots and root canals should be treated without any pre-operative assumptions regarding its typical single rooted and single canaled anatomy. thus the present case report highlights the endodontic management of an unusual case of mandibular canine with two roots and three canals. it also highlights the need for use of dental operating microscope and ultrasonics in locating the elusive canal orifices. so it is important to note the internal and external root canal morphological variations so that similar anatomy may be predicted and managed successfully. sometimes retrieval of a fractured instrument is impossible or undesirable. in these cases, bypassing the instrument under magnification is a valid alternative, which can lead to a favorable outcome as presented in the given case.

it is important to assess the root canal morphology and its variations before initiating the endodontic procedure. this is because the inability to clean the complete root canal system forms the seat for the persistent infection which ultimately leads to endodontic treatment failure. this case reports the use of dental operating microscope for the successful endodontic management of a two rooted and three canaled mandibular canine with the fractured instrument in the middle canal of a 38-year-old healthy asian woman. this case report highlights the need to use the dental operating microscope and ultrasonics in locating the elusive canal orifices. it is important to note the internal and external root canal morphological variations before starting the endodontic treatment without any pre-operative assumptions about the usual anatomy of the toot.

PMC4001281

pubmed-589

one of the most serious threats dental students face during their clinical training is the possibility of exposure to blood-borne pathogens, with the attendant risk of hiv. needlestick injuries are a hazard for people who work with hypodermic syringes and other needle equipment. these injuries can occur at any time when people use, disassemble, or dispose of needles. when not disposed of properly, needles can become concealed in linen or garbage and injure other workers who encounter them unexpectedly. aids is making new demands on the health service and the competence of health workers. dental students are exposed to various oral infections or lesions, which may be due to manifestations of aids. dental students share this responsibility especially in the overcrowded hospitals, where they have to perform tooth extractions commonly and dispose/destroy the used needle or syringe. the risk of accidental needlestick injuries are more during invasive procedure such as giving injection (nerve blocks) and recapping the needle after use. there is confusion regarding correct responses to such accidents both at the administrative levels where policy decisions for institutions are to be made as well as amongst the dental staff and students themselves who are not aware the preventive aspects and of the immediate prophylactic steps to be taken in case of such accidents. there should be a well-formulated coordinated approach for the provision of information support, and referral from healthcare workers who sustain occupationally related management of occupational exposures varies between institutions and often reflects the level of staff education and previous experience in areas of infection control and transmission of blood-borne diseases. despite published guidelines and training programs, thus the aim of the present study was to assess the knowledge, attitude and practice regarding the risk of hiv infection among dental students after an accidental needlestick injury and to make relevant suggestions. of these 40, 40 and 40 were in third year, fourth year and interns, respectively. these students were selected as they are exposed to blood and blood-borne pathogens during their clinical training programs. a cross-sectional study was done amongst the third, fourth year and interns at ame's dental college hospital and research centre, raichur, during the academic year of 201011 from january 6, 2011 to april 17, 2011. a semi-open self-administered questionnaire with questions pertaining to knowledge, attitude and practice of risk of hiv transmission after needlestick injury was used and the results were subjected to statistical analysis using chi-square test using spss 17.0 version software. to compare the knowledge, attitude and practice among students p<0.05 was set as statistical significance. the questionnaires were distributed to all 120 students and the rate of response was 100%. of the 120 students, 13 (11%) were not even aware that virus could be transmitted through infected needles; among them 22.5% were third year students. in the present study, 107 (89%) students were aware of possibility of transmission of hiv through infected needles [table 1, graph 1]. knowledge regarding transmission through infected needle knowledge regarding transmission through infected needle in all 26 (22%) said they would recap the used needles, 53 (44%) said they would destroy the needle using needle destroyer, 18 (15%) said they would destroy in puncture-resistant container with disinfectant, 15 (12.5%) said they would throw the needle directly into the dustbin and 8 (7%) said they would bend the needle and through into dustbin [table 2, graph 2]. knowledge and awareness regarding methods of disposal of disposable needles and syringes knowledge and awareness regarding methods of disposal of disposable needles and syringes when enquired as to what they would do after an accidental needlestick injury, 37 (30%) said they would take post-exposure prophylaxis, 31 (26%) said they would wash the site of injury with surgical spirit or sterilium. thirty one (26%) said they would promote active bleeding at the site of injury, 14 (12%) said they would wash the site of injury thoroughly with soap and running water and 7 (6%) said they would check hiv status of the patient [table 3, graph 3]. needlestick injuries transmit infectious diseases, especially blood-borne viruses. in recent years, concern about aids (acquired immunodeficiency syndrome), hepatitis b and hepatitis c has prompted research to find out why these injuries occur and to develop measures to prevent them. occupational exposure rates have been ex-pressed in terms of examinations for all dental care, persons per year, procedures, and other variations. different studies may include undergraduates, postgraduates, and/or the entire team of professionals in the dental field. the rates found in the present study of 9/10 000 re-ports of percutaneous exposure in relation to the num-ber of procedures performed (83 reports for 93 892 procedures) and 12.8/10 000 consultations (eighty-three reports in 64 414 examinations for all dental care) are similar to findings in a prospective observational study carried out by cleveland et al. divergences with other results can be attributed to the methodology employed, as well as other factors. lower rates were observed in studies based only upon reported accidents, which did not represent the totality of occupational exposure, such as findings by ramos-gomez et al. the influ-ence of underreporting has also been demonstrated in studies by younai et al. and kotelchuck et al., car-ried out at the same dental school in new york. despite published guidelines and training programs, needlestick injuries remain an ongoing problem. aids imposes on the dental students as lot of stress is associated with a sense of professional and personal inadequacy and fear of becoming infected. studies have reported that hiv infection can be acquired through occupational injury during intervention on hiv infected patient. the hiv sequences of the doctor and patient were encoded, analyzed and compared and found to be closely related. based on data from over 5100 exposures from 26 studies worldwide, the centre for disease control and prevention estimate that the overall risk of infection from accidental exposure is 0.3% if exposure is parental, 0.1% if via mucous membrane. in another study amongst the healthcare workers from over 300 healthcare institutions, there are many misconceptions about the risk of transmission through infected needles that need to be corrected. the risk of hiv transmission through accidental needlesticks injury does exist through the risk is low. universal biosafety precautions if strictly adhered to while working in a healthcare setting reduces the risks further. as per who recommendations, needles should not be recapped, bent, broken, removed from disposable syringes or otherwise manipulated by hand as these procedure increase the risk of needlestick injuries. these practices should be stopped by introducing educational programs for enhancing the knowledge and skills of the dental students early in the course. as the students lack the necessary skills and training, they may be at more risks of accidental injuries. hence making them aware of the protective steps and relevant institutional policies regarding such episodes is a necessity. in comparing reports of occupational exposure and reporting rates among dental students at a u.s. dental school, peres et al. stated the evident com-bination of some not-yet-fully understood factors intercede between clinical events, identification, and management in the post-exposure protocol established by the school. according to these authors, the psychological constructs that involve the fear of occupational exposure and the personal interpreta-tion of the significance of occupational exposure are probably among the factors that influence the belief in reporting. while the level of occupational risk is low, the consequences of infection with hiv are dire and should not be underrated. there is no effective vaccine available as yet. through chemoprophylaxis for healthcare workers after accidental hiv exposure is now recommended by international aids society, they are not within the reach of many institution. hence there is a need to improve the knowledge of dental students regarding the risks, the universal biosafety precautions and appropriate responses to accidental injuries early in their course. there was substantial improvement in compliance with universal precautions in an emergency department following institution of a policy. healthcare workers who receive injuries need to have confidence that by immediately reporting the injury they will receive appropriate advice and treatment as well as support and encouragement. thus it is of utmost importance that each institution should have a clear cut and uniform policy regarding prevention of such accidents and the correct steps to be taken after such an episode in the form of referral services. all healthcare workers should be made aware of these policy and necessary supportive services provided for its implementation.

background: injuries from occupational accidents are associ-ated with agents of biological risk, as they are the gateway to serious and potentially lethal infectious diseases that can be spread by contact between people. several studies have demonstrated that dental students are among the most vulnerable to blood-borne exposure. objectives:to assess the knowledge, attitude and practice regarding risk of hiv transmission through accidental needlestick injury amongst dental students and providing supportive and proper guidelines regarding needlestick injuries and hiv infection.study design: this was a cross-sectional study done at a dental college attached to a tertiary care hospital, which included third, fourth year students and interns. the results obtained were subjected to statistical analysis using chi-square test. results:of the 120 students, 13 (11%) were not even aware that virus could be transmitted through infected needle. a significant proportion of the third year students i.e. 27 (67.5%) were not aware of correct method of disposal of disposable needles and syringes as against interns 17 (42.5%). around 31 (26%) said that they would promote active bleeding at the site of injury and 37 (30%) said they would take post-exposure prophylaxis. conclusion:dental professionals are at a risk of occupational acquisition of hiv primarily due to accidental exposure to infected blood and body fluids. there is a need of correcting the existing misconceptions through education programs early in the course and providing supportive and proper guidelines regarding needlestick injuries and hiv infection.

PMC3343388

pubmed-590

marc sprenger, director of the who s secretariat for antimicrobial resistance, recently stated that many such infections are rapidly becoming resistant to life-saving drugs;1 thus, we may be on the verge of the post-antibiotic era. indeed, it was also proposed that many of the procedures and conditions such as simple operations or cancer immunosuppression, which we take for granted today, may become impossible due to these organisms.2 extended-spectrum beta-lactamases (esbl) have become a global scourge in the past 20 years. initially thought to be only nosocomial problems have now become commonplace in community-acquired infections. it has been predicted that soon esbl-producing escherichia coli will be as common as methicillin-resistant staphylococcus aureus (mrsa). the dissemination of esbl mechanisms has been facilitated by the spread of plasmids, which may in fact carry other multiple resistance mechanisms. recent surveillance programs have illustrated the frightening scale of the presence of esbls, from 55%65% in china to 67%79% in india. perhaps most worrying is the report that 96% of klebsiella pneumoniae were esbl producers with 50% from community infections.3 although rates of these pathogens are lower in the us and most of europe, the rapid expansion of global travel leads us to realize that an infection may initiate anywhere and be manifested elsewhere. there are three definitions of resistance, which apply to more and more pathogens; these are multidrug resistant (ie, resistant to at least three different drug classes), extensively drug resistant (ie, resistant to all but one or two drug classes), and pan resistant (ie, resistant to all approved antibiotics).4 all of these infections are very challenging from a clinical perspective, besides the escalating epidemiological issues. more recently, the spread of carbapenem-resistant enterobactericeae (cre) has become a global issue. the carbapenem class of antibiotics has become the go-to group of drugs in light of esbls, which are increasing in frequency and diversity. however, in the face of carbapenem resistance, only colistin has, until recently, been a reliable last resort treatment. moreover, a major recent development has been the emergence of colistin-resistant strains from china; this mechanism is potentially a global threat and as such is the first sign of our last therapeutic weapon becoming less effective.5 in particular, it is the recent escalation of multiple mechanisms of resistance among gram-negative species, which are causing the greatest concern. these species go beyond pseudomonas aeruginosa or acinetobacter baumannii, which are acknowledged to be major problems, but now include various members of the enterobacteriaceae notably e. coli, k. pneumoniae, and enterobacter cloacae. these species often harbor multiple mechanisms of resistance to classes of antibiotics as diverse as fluoroquinolones, aminoglycosides, tetracyclines, and -lactams. indeed, the latter class can be rendered ineffective due to multiple methods of resistance including enzymes that can destroy many -lactams, altered cell wall porins, and increased efflux mechanisms, which adversely regulate the entry or exit of antibiotics.6 it has been the recognition of the emergence of the -lactamase enzymes, which has caused huge concerns. in response to exposure to extensive use of various penicillins and cephalosporins, bacteria have evolved and disseminated over 1,300 different hydrolyzing enzymes, most of which can be transferred from one bacterial species to another by virtue of plasmids or similar genetic methods.7 these multidrug-resistant species can then spread globally by virtue of rapid air travel across continents. a good example is the recent ndm-1-containing klebsiella strains from india to europe and beyond. although several -lactam-lactamase combinations have been or are in development such as ceftazidime/avibactam and ceftolozane tazobactam, they do not cover all the various classes of -lactamase enzymes. there are gaps in spectra of many of the current compounds (table 1). thus, it has been proposed that one way to avoid or, at least, reduce the damage of -lactamase enzymes outside the bacterial cell would be to ensure that the drugs are rapidly able to access the intracellular spaces and withstand internal -lactamase enzymes.8 moreover, in addition to neutralizing the destructive effects of diverse -lactamase enzymes, the outer membrane of the gram-negative cell wall poses a significant hurdle. various species can downregulate certain outer membrane proteins to exclude certain antibiotics, including -lactams. examples of these altered outer membrane proteins include oprd, ompk, and caro.9 in addition to prevention of cell access, efflux pumps are another significant mechanism of bacterial resistance. bacterial efflux pumps are divided into five groups, namely, the major facilitator superfamily, the small multidrug-resistant (mdr) family, the multidrug and toxic compound extrusion family, the atp-binding cassette family, and the resistance-nodulation-cell division family. the latter is the most clinically relevant in terms of antibiotic resistance.10 it has been hypothesized that it may be possible to harness a vital bacterial survival mechanism to enable access to the bacterial cell. bacteria secrete aggressive iron-complexing proteins known as siderophores, which scavenge iron from their environment to survive. this process could be compared to mining by solubilizing iron ions in mineral form or biologically complexed iron ions such as iron bound to transferrins. siderophores (from the greek iron carriers) can strip iron ions out of these situations and create a complex of iron and protein; this iron-siderophore is recognized by specific bacterial uptake systems, which enable the binding of the complex to outer membrane receptors. these complexes are taken up and then released into the periplasmic space and into the cytoplasm. there are several siderophore agents that operate in the same manner, but use slightly different carrier molecules, eg, microcins, sideromycins, and natural siderophores such as ferrimycin. human interest in this smuggling approach to conveying iron and other molecules into cells began over 50 years ago. this method of conveying compounds into other cells such as bacteria has been likened to the trojan horse legend. legend has it that odysseus built a huge wooden horse, the emblem of the trojans; this enabled greek soldiers to be carried within the wooden horse and into the city of troy, allowing the greeks to attack troy from within. this technique became known as the trojan horse.11 it is this analogy that is used by current antibiotic developers in an effort to overcome gram-negative resistance. a major hurdle in creating effective gram-negative antibiotics is the need to cross the outer membrane into the gram-negative periplasmic space. figure 1 illustrates the concept of coupling of iron ions to the siderophore cephalosporin complex and then transport of the complex into the periplasmic space in which the released cephalosporin attaches to the critical cell wall penicillin-binding proteins. beyond the periplasmic space -lactam antibiotics have been the most studied class as a possible carriers for siderophore conjugates, but the concept can also be applied to other classes of antibiotic including fluoroquinolones where cellular access has been reduced or stopped due to porins or efflux mechanisms. -lactam the side chains added to the central active agent can be quite varied with catechols, which seem to be the most effective. however, there are significant technical issues with susceptibility testing of these agents in that the standardized methods, eg, committee for laboratory standards institute or european committee for antimicrobial susceptibility testing, as they require specific media, such as mueller hinton broth (mhb) supplemented with certain ions such as calcium and magnesium. however this medium, and possibly other test media, contains levels of iron, which are not representative of physiological concentrations of ferrous or ferric ions. thus, in standard media, minimum inhibitory concentrations (mics) tend to be 432 times higher than in iron-depleted settings. there have been two approaches to removing these iron ions by using cation-binding resins, which are added to mhb. the two tested agents are apo-t (solid media)12 and chelex (broth media).13 these agents remove all ionic components but require subsequent addition of essential zinc, calcium, and magnesium ions to be supplemented to the test media after cation-binding treatment. these laboratory methods have been validated by in vivo or animal infection models, which are clearly depleted in terms of free iron ions.14 this technical approach will need to be overcome once the drugs move into late clinical development as routine approaches will yield inaccurate and inappropriate, misleading high mics. currently, there are three such trojan horse complexes in development. each has a different structure, but all are based on siderophore technology, thereby gaining access to the bacterial cell. these agents are mc-1, a siderophore-conjugated monocarbam, from pfizer; bal30072, a siderophore monosulfactam, from basilea; and s-649266, a catechol cephalosporin antibiotic, from shionogi pharmaceuticals. in vitro activity is the initial measure of the potential of a compound, and for the three examples of siderophore agents, in vitro data are presented in tables 2 and 3. the reported studies focus on both routine clinical isolates and specific genetically modified species such as p. aeruginosa. to date, there have been no hea1-head in vivo comparisons reported as all three agents are in clinical development, although they are at different phases and are not readily available. mc-1 is a novel siderophore-conjugated monocarbam antibiotic, which has shown activity against mdr p. aeruginosa and esbl-producing members of the enterobacteriaceae. mcpherson et al15 examined the in vitro activity of mc-1 against an isogenic library of strains of e. coli, which were created by synthesizing a representative -lactamase from each class and then using that clone as a template for further mutagenesis to construct the desired genetic variants. table 2 shows the activity of mc-1 alone and in combination with the commonly used -lactamase inhibitor tazobactam and against bal30072 (a siderophore monosulfactam), aztreonam, ceftazidime, cefepime, and meropenem against a selection of clinically relevant -lactamase enzymes. mc-1 showed mic90 values of 0.060.25 mg/l including metallo -lactamase (mbl) strains that exhibited high mics to meropenem, cefepime, and ceftazidime. additionally, an isogenic panel of p. aeruginosa was constructed to estimate the cellular entry of mc-1; a total of 30 mutants were examined against mc-1, bal30072, and aztreonam. consistently, mc-1 was the most active agent tested with mics in iron-low medium in the order of 0.251 mg/l, while bal30072 showed mics of>264 mg/l and aztreonam 4 or>4 mg/l.15 the authors concluded that mc-1 was active against porin-mutated strains of p. aeruginosa and a wide range of gram-negative-resistant strains including those having -lactamase and porin alterations. an interesting observation that is common to siderophore studies was the discordance between in vivo murine septicemia model and in vitro mics in standard susceptibility test media mhb. this drug does not appear to be in clinical development according to clinicaltrials.gov (august, 2016), and thus, no human tolerability data are available. bal30072 is a monosulfactam conjugated with an iron-chelating dihydroxypyridone moiety, which was developed by basilea pharmaceutica. it has been investigated in combination with a range of antibiotics commonly used against gram-negative organisms, but with the emergence of multidrug-resistant strains, they are less active. gram-negative pathogens with -lactam-resistant phenotypes were evaluated and compared with the activities of reference drugs, including aztreonam, ceftazidime, cefepime, meropenem, imipenem, and piperacillin/tazobactam. the mic90s were 4 g/ml for mdr acinetobacter spp. and 8 g/ml for mdr p. aeruginosa, whereas the mic90 of meropenem for the same sets of isolates was>32 g/ml.16 table 2 shows these results. p. aeruginosa, even against strains that produced metallo--lactamases that conferred resistance to all other -lactams tested, including aztreonam. the compound was also shown to trigger spheroplast formation and lysis as opposed to extensive filamentous formation. this is probably due to the points of interaction with three penicillin-binding proteins such as pbp1a, pbp1b, and pbp3. bal30072 was subsequently tested in combination with imipenem, meropenem, and doripenem against selected strains of enterobacteriaceae, p. aeruginosa, and a. baumannii using 1 mg/l of each combination. broadly these showed activity against 70%80% of strains, whereas the carbapenems alone were ineffective and bal30072 was only 20%40% effective. no antibiotic combinations were antagonistic. a murine model of septicemia supported the enhanced synergy of meropenem and bal30072.17 in the direct comparison of bal30072 with mc-1, the latter agent was more active in vitro against all enzyme isogenic strains, although the difference among metallo--lactamases and oxa strains was similar having mic90s of 0.125 and 0.25 mg/l, respectively.15 this drug was not listed in current clinical trials (clinicaltrials.gov accessed august 2016); thus, no human tolerability data are available. s-649266, or cefiderocol, is a novel siderophore cephalosporin antibiotic with a catechol moiety on the 3-position side chain (fig. two sets of recent clinical isolates were used to evaluate the antimicrobial activity of s-649266 against enterobacteriaceae. these sets included 617 global isolates collected between 2009 and 2011 and 233 -lactamase-identified isolates, including 47 kpc, 50 ndm, 12 vim, and 8 imp producers.18 the mic90 values of s-649266 against the first set of e. coli, k. pneumoniae, serratia marcescens, citrobacter freundii, enterobacter aerogenes, and e. cloacae isolates were all 1 g/ml, and there were only 8 isolates (1.3%) among these 617 clinical isolates with mic values of 8 g/ml, see table 3. s-649266 was evaluated against gram-negative bacteria, including mdr strains and carbapenem nonsusceptible strains, and compared with cefepime, piperacillin/tazobactam, and meropenem. mic90 values of s-649266 were 14 g/ml against mdr p. aeruginosa, mdr a. baumannii, metallo beta-lactamase-producing p. aeruginosa, and ndm-1 producers.18,19 on the other hand, mic90 values of comparators were>16 g/ml. mic90 values of s-649266 against carbapenemase nonproducing esbl producers of e. coli, k. pneumoniae, and e. cloacae were 0.25, 0.5, and 4 g/ml, respectively. while the mic90 values of cefepime and piperacillin/tazobactam were 32 g/ml. the antibacterial activity of s-649266 against carbapenemase producers and its stability against clinically relevant carbapenemases were also investigated. the catalytic efficiencies (kcat/km) of imp-1, vim-2, and l1 for s-649266 were 0.0048, 0.0050, and 0.024 m s, respectively, which were more than 260-fold lower than that for meropenem. ndm-1 hydrolyzed meropenem threefold faster than s-649266 at 200 m.20 it is increasingly appreciated that adaptation is a major mechanism associated with the acquisition and evolution of antibiotic resistance. adaptive resistance is a specific type of nonmutational resistance that is characterized by its transient nature. it occurs in response to certain environmental conditions or due to epigenetic phenomena like persistence. it has been proposed that this type of resistance could be the key to understanding the failure of some antibiotic therapy programs equally the genetics behind some of the changes involved in adaptive resistance may explain the phenomenon of baseline creep, whereby the average (mic) of a given species increases steadily but inexorably over time, making the likelihood of breakthrough resistance greater. previous siderophore-based -lactam compounds, such as monobactam (mb-1) and the monocarbam (smc-3176), demonstrated inconsistent activity probably due to development of adaptive resistance.21,22 thus, ghazi et al23 examined s-64926, mb-1, and smc-3167 in the neutropenic mouse model to determine the relative penetration through outer membrane via iron transporter systems as well as the stability of the three molecules against serine- and metallo-carbapenemases. using this established thigh infection model, p. aeruginosa was examined to explore the pharmacodynamic profile of these compounds with respect to efficacy and development of adaptive resistance. mics were determined by broth microdilution in triplicate (iron deficient) and modal mic was reported. groups of three mice were inoculated, and two hours later, they were treated with ascending doses of s-649266 or humanized doses of siderophore -lactams mb-1 and smc-3167, as determined in previous studies.21,22 after 24 hours, the animals were sacrificed for bacterial enumeration and determination of the change in bacterial density (log10 cfu) relative to the starting inoculum. unlike the previously reported variable efficacy with siderophores mb-1 and smc-3175 against the p. aeruginosa studied, s-649266 displayed sustained antibacterial effects for all isolates over the treatment period. enhanced bacterial kill was observed over the dose range studied, and as previously observed,% ghazi et al proposed that catechol substitution may impart improved activity compared to other siderophore-conjugated -lactams, suggesting that adaptive resistance was not observed in this model. clearly broader clinical exposure will test these results, but based on these lower adaptive resistance results, s-649266 appears to have a lower potential for resistance selection. a pharmacokinetic model providing probability of target attainment (pta) data described the time courses of s-649266 concentrations in plasma and urine, which were used to predict efficacy for optimizing dosage regimens.24 the simulations for the subjects with normal renal function suggested that s-649266 at 2 g q8h would exhibit efficacy for the target pathogens (ie, carbapenem-resistant e. coli, k. pneumoniae, p. aeruginosa, and a. baumannii; mic90: 0.5, 2, 2, and 8 g/ml, respectively). the 3-hour infusion would provide an adequate pta, while patients on 1 g q8h dosing would probably be insufficient. this hypothesis was examined in a rat lung infection model.24 the model described plasma and urine concentration data, which yielded pta values with 2 g q8h with 1-hour or 3-hour infusion. for 2 g q8h with either infusion time, the pta was>90% at 8 and 4 g/ml of mic for 50% and 75% of ft>mic, respectively. the pta for both ft>mic targets at 2 g q8h with 3-hour infusion was higher than that observed with 1-hour infusion. the predicted fifth percentiles of urine concentrations over 8 hours were>100 g/ml with 2 g with 1-hour infusion. the simulations for the subjects with normal renal function confirmed that a 2 g dose every 8 hours s-649266 would provide adequate efficacy for most target pathogens while a 1-hour infusion was likely to be inadequate, especially if the mics were slightly elevated. thus, 2 g given every 8 hours would probably achieve urinary concentrations likely to eradicate most mdr gram-negative pathogens.24 the clinical development of these three siderophore agents is less than clear. only shionogi pharmaceuticals with s-649266 is registered on clinicaltrials.gov with their phase 2/3 program, which is comparison of s-649266 with imipenem/cilastatin for the treatment of complicated urinary tract infections in adults. this is a multicenter, double-blind international study with a focus on enrolling patients with multidrug-resistant, carbapenem-susceptible, gram-negative pathogens.25 there is no clinical trial information on either mc-1 or bal30072. a novel (phase 3) study of s-649266 will enroll only patients with evidence of carbapenem-resistant pathogens, regardless of the primary infection site. this pathogen-focused study will rely on rapid diagnostic technologies to identify eligible patients. the onslaught of multidrug-resistant bacteria is a global problem with the emergence and geographical expansion as a major clinical threat. in the past few years, we have seen several novel approaches to combatting bacterial resistance; these include synthetic peptides, cationic antimicrobial peptides (camps), lantibiotics, lipophosphoxins, nosokomycins, and -sitosterol. the synthetic peptides have been studied as potential antibacterial agents for over 20 years, a recent focus on multidrug-resistant gram-negative species. mcgrath et al have engineered a synthetic peptide that shreds and dissolves the double-layered membrane, which are considered to be a prime defensive mechanism of gram-negative species. this spiral peptide called klaklakklaklak acts by puncturing this unique bacterial bilayer without affecting eukaryotic cells. however, these peptides are subject to normal host enzyme destruction of some enzymes excreted by the bacterium itself. thus, in order to combat this negative impact, increase in dosing will be needed, which may bring increased toxicity and manufacturing costs. the authors showed in vitro activity against key nosocomial pathogens with a dose-dependent killing. this synthetic peptide eliminates biofilms that may be important in settings where bacteria establish microcolonies and then seed to cause infection such as bone and joint infections. animal models are now required to fulfill the next steps of drug development.26 camps are essential natural innate immune defense mechanisms that inhibit colonization by pathogens and aid in the clearance of infections. gram-negative species are a major target but some evolved resistance mechanisms. such mechanisms undoubtedly contribute to virulence and survival of pathogens. camps destabilize the bilayer membrane by interacting with anionic head groups and hydrophobic fatty acid chains. it has been hypothesized that camps also have intracellular targets that also contribute to cell wall disruption and cell death. two camps are in clinical use, namely, polymyxin b and colistin (polymyxin e); however, bacterial resistance has recently been reported in china27 and very recently in usa.28 bacterial resistance occurs via surface remodeling, usually lipopolysaccharide modification, capsule production, biofilms, efflux pumps, and proteolytic degradation.29 clearly with such an array of camp resistance mechanisms, this may limit the value of the class in the clinical setting. it has been proposed that establishment of some of these camp resistance mechanisms are additions to the bacterial pathogenicity. deeper understanding of the camp resistance mechanisms may help yield further gram-negative antibiotics. in an effort to overcome some of these issues, torcato et al30 designed and characterized two new molecules, namely, r-bp100 and rw-bp100. these analogs have two amino acids, in which tyr is replaced with a trp and/or the lys residues replaced with arg. these analogs are active against a wide range of gram-negative species as well as, unusually for peptides, all tested gram-positive bacteria. these minor, but significant, structural changes may yield potential new class of antibacterial agents for a broad range of multidrug-resistant species. draper et al31 examined posttranslationally modified ribosomally synthesized antimicrobial peptides, lantibiotics, with a broad-spectrum antimicrobial activity. draper et al tested the enhancement of 3147 with polymyxin b and e using synergism tests. using low levels of a polymyxin, the lantibiotic 3147 activity against gram-positive and some gram-negative species. they hypothesized that use of 3147 may allow for use of lower, thus less, toxic concentrations of polymyxin. panova et al32 discovered a new series of compounds termed lipophosphoxins (lppos), which showed specific activity toward gram-positive species. lppos are bactericidal in activity and localize to the plasma membrane in bacteria but not in eukaryotic cells.. of key concern with any new class of compound toxicity to humans is essential thus showing no genotoxicity in the ames test, do not cross monolayer of caco-2 cells and well tolerated by mice when given orally but not via the peritoneum. as the agents withstand low ph, it has been proposed that they may not be viable systemic antibiotics but may have a role as nonabsorbed antibiotics such as in clostridium difficile of helicobacter pylori agents. mrsa is still a major nosocomial pathogen, although recent additions to the armamentarium such as modified glycopeptides and oxazolidinones have recently been approved for clinical use; it is undisputed that mrsa will find a way to resist these new agents. tomoda33 reported on a new member of the phosphoglycolipid family, the nosokomycins from streptomyces cyslabdanicus using a silkworm model. the proposed target site is penicillin-binding proteins specific to mrsa. although these data are very preliminary, they suggest a novel approach to inhibiting gram-positive cell wall production. li et al34 reported the use of a phytosterol, -sitosterol, to protect against cell lysis by pneumococcal pneumolysin, a potent virulence mechanism of streptococcus pneumoniae. mouse model studies showed the protection of cells from cholesterol-dependent toxins that contribute to pneumococcal infections. there is clearly a huge amount of research into alternative methods to combat antibiotic-resistant bacterial infections. however, many of these molecules are still in their early stages with very few having been exposed to humans. indeed, so although there is much excitement at these innovations, we have to turn to classes we understand and have a long-standing safety record. thus, we resort to the exploration of one of the oldest antibiotic classes, the -lactams. most recently, extension of the -lactam/-lactamase inhibitor combinations (eg, ceftazidime/avibactam or ceftolazane/tazobactam) and modified carbapenems are clinical options. of particular interest is the recent announcement of the initial phase 3 clinical study of meropenem vaborbactam in complicated urinary tract infections, which was compared with piperacillin/tazobactam. notably the clinical efficacy was 98.4%; yet, the microbiological eradication was 66.7% compared with 57.7% reported with piperacillin/tazobactam.35 the second phase 3 study comparing this new combination with best available therapy may be more instructive with regard to the strains producing inhibitor-resistant tems, complex mutant tems, or ampc -lactamases, which were found to be generally resistant to older inhibitor combinations, and the presence of these enzymes is probably due to the increased use of -lactam/-lactamase inhibitor combinations, which is escalating. importantly, novel -lactamase inhibitors do not address the multifactorial resistance mechanisms in gram-negative bacteria, particularly, p. aeruginosa and a. baumannii, which are mediated by porin mutations and efflux overproduction. thus, with these changes, clinicians are turning to relatively toxic agents such as colistin or multiple drug combinations to manage infections such as pneumonia, bacteremia, wound, urinary tract, and other serious systemic infections. the utility of siderophore antibiotics by virtue of their activity against an array of esbls and cell access mechanisms is an encouraging development and may be one that clinicians are in need of, but we await the initial clinical findings with s-649266.

antibiotic resistance has been emerged as a major global health problem. in particular, gram-negative species pose a significant clinical challenge as bacteria develop or acquire more resistance mechanisms. often, these bacteria possess multiple resistance mechanisms, thus nullifying most of the major classes of drugs. novel approaches to this issue are urgently required. however, the challenges of developing new agents are immense. introducing novel agents is fraught with hurdles, thus adapting known antibiotic classes by altering their chemical structure could be a way forward. a chemical addition to existing antibiotics known as a siderophore could be a solution to the gram-negative resistance issue. siderophore molecules rely on the bacterial innate need for iron ions and thus can utilize a trojan horse approach to gain access to the bacterial cell. the current approaches to using this potential method are reviewed.

PMC5063921

pubmed-591

bovine lung fragments, deep nasal swab specimens, and trans-tracheal aspiration liquids were submitted to the laboratoire dpartemental danalyses de sane-et-loire (mcon, france) and tested for classical respiratory pathogens. the unit mixte de recherche, interactions htes agents pathognes 1225 (toulouse, france), received and tested 134 samples by using real-time reverse transcription pcr for influenza d virus as previously described (3). we tested 25 archived samples per year for 20102013 and 34 samples collected during january march 2014. six (4.5%) were positive for influenza d virus: 1 each in 2011 and 2012 and 4 in 2014; cycle threshold (ct) values ranged from 15 to 35 (table 1). co-infections were detected with pasteurella multocida, mannheimia haemolytica, histophilus somni, bovine respiratory syncytial virus, and/or bovine herpesvirus 1 in 4 of the influenza d positive specimens. two samples (nos. 5831 and 5920, collected in 2014) were negative for all tested respiratory pathogens, despite reports of clinical signs in the animals (table 1).*ct, cycle threshold; bcov, bovine coronavirus; bohv-1, bovine herpesvirus i; bpiv3, bovine parainfluenzavirus 3; brsv, bovine respiratory syncytial virus; flud, influenza d virus; i d, identification; n, negative; nc, not communicated; nt, not tested; p: positive (ct<35), wp: weakly positive (35<ct<40). the specimen with the lowest ct value, d/bovine/france/2986/2012 (ct 15) was selected for further molecular characterization, and its full genome was amplified by pcr (primers in table 2) and sequenced on a 3130xl applied biosystems capillary sequencer (applied biosystems, foster city, ca, usa). the 7 gene segments of d/bovine/france/2986/2012 clearly clustered with us influenza d strains from pigs and cattle (c/ok, c/bovine/minnesota/628/2013, c/bovine/minnesota/729/2013, and c/bovine/oklahoma/660/2013) (figure), which suggests a common origin of these new influenza viruses. we found no evidence of reassortment between influenza c and d (c/ok-like) viruses. in addition, the splicing pattern of the matrix gene segment and the reduced 5-n-acetyl binding pocket in the hemagglutinin-esterase (he) protein of d/bovine/france/2986/2012 was similar to that of c/ok and different from that of human influenza c virus, confirming the similarity of d/bovine/france/2956/2012 and the newly described swine and bovine us influenza d virus strains. the estimated ranges of evolutionary distances (in number of substitutions per site using the maximum composite likelihood model) between d/bovine/france/2986/2012 and the 4 us influenza d viruses ranged from 0.8 to 5.7% and were as follows: 1.9%2.1%, 0.8%0.9%, 2.1%2.5%, 2.3%2.7%, 1.8%3.8%, 3.6%4.2%, and 5.1%5.7% for polymerase basic (pb) 2, pb1, polymerase 3/polymerase acidic, nucleoprotein, matrix, nonstructural protein, and he gene segments, respectively. phylogenetic trees of the 7 gene segments of d/bovine/france/2986/2012 influenza virus at the nucleotide level. maximum-likelihood analysis with 500 bootstrap replicates (bootstrap values>75 are indicated on the tree nodes). the gene sequences of d/bovine/france/2986/2012 (in large bold underlined font) were compared with representatives of all the orthomyxoviridae genera: all the viral strains used in (1). p, polymerase, nucleoprotein, pb, polymerase basic scale bars indicate nucleotide substitutions per site. forty unique amino acid substitutions were identified throughout the genome, but the limited available data on influenza d genomes make a functional interpretation of the substitutions difficult to determine. in addition, although the he proteins of human influenza c and c/ok viruses contain 7 and 6 potential glycosylation sites, respectively, d/bovine/france/2986/2012 has just 5: at positions 28, 54, 146, 346, and 613 (atg numbering), identical to 5 of the 6 identified for c/ok virus. for influenza a viruses, modifications of n-linked glycosylation sites in the globular head of the hemagglutinin protein have been linked to changes in virulence, antigenicity, receptor-binding preference, fusion activity, and immune evasion (4). for example, an increase in glycosylation site numbers has been associated with early stages of influenza a(h1n1) virus evolution, and changes in the positional conversion of the glycosylation sites have been associated with later evolutionary stages of the virus (5). the missing potential glycosylation site in d/bovine/france/2986/2012 is located at position 513, probably likely in the f3=he2 fusion domain of the protein (6) and not in the globular head of the protein. thus speculating on the putative time course of virus emergence between c/ok-like and d/bovine/france/2986/2012-like strains further studies are needed to understand the phenotype(s) associated with aa substitutions in influenza d viruses. webster et al. suggested the existence of a common ancestor for influenza a, b, and c viruses and a more recent common ancestor to influenza a and b viruses only considering the different genome organizations between influenza a/b and influenza c viruses (6). recently estimated the time of divergence between influenza c and d virus gene segments at 334 years for pb1 to 1,299 years for he (7). the time of emergence and evolutionary rate of influenza d viruses need to be examined as more data become available. a puzzling question raised by our current study is the geographic origin of influenza d strains: were cattle in france contaminated by their north american counterparts or vice versa? did co-evolution occur? did the pathogen originate from a distinct location or from a distinct host? retrospective studies with archived samples would help date the emergence of influenza d viruses and enable an understanding of their evolution. the pathogen may have spread to swine and cattle in recent years only; efforts should be made to find the virus host range and its reservoir species and to evaluate the public health relevance of this new pathogen. finally, surveillance projects with larger cohorts, as well as experimental infections, need to be conducted before 1) the causality between respiratory symptoms and influenza d virus infection in cattle can be established, 2) recommendations on samples to collect can be given, and 3) prevalence can be compared in different geographic areas. although the causative agent(s) of some respiratory infections in the field remain(s) unknown (g. meyer, pers. comm.) and although 2 of the positive specimens in our study originated from young cattle with respiratory symptoms but no identified respiratory pathogen, further studies are also warranted to provide an understanding of the pathobiology of influenza d virus in cattle and its putative role in complex bovine respiratory disease.

a new influenza virus, genus d, isolated in us pigs and cattle, has also been circulating in cattle in france. it was first identified there in 2011, and an increase was detected in 2014. the virus genome in france is 94%99% identical to its us counterpart, which suggests intercontinental spillover.

PMC4313661

pubmed-592

strokes produce important physical, psychological and social consequences, in spite of advances in prevention and early care1. several studies highlight the importance of cognitive activities such as attention, memory and action observation on the nervous system plasticity2, 3. the experiences and the information generated by these cognitive activities influence motor learning4, 5. hence, the importance of providing the patient with learning experiences and sensory stimuli enriched by the interaction with a therapist6. after stroke, achieving patients functionality (e.g. being able to turn a door handle) has become the focus of the therapeutic action. the emphasis of treatment has virtually always been focused on performing the task, regardless of how it was executed, whereas the qualitative aspects of the activity have not been considered to be important7, 8. taking into account the knowledge on motor learning which highlights not only the motor processes but also the sensory and cognitive strategies5, it is possible to direct the therapeutic performance to recovery instead of compensation. this implies focusing the intervention more on the quality of execution rather than on the final result, promoting an adequate activation of the existing patterns prior to the injury5, 9. a therapeutic strategy that addresses these approaches is the cognitive therapeutic exercise based on the neurocognitive rehabilitation theory described by the neurologist carlo perfetti10, 11. this theory connects the activation of cognitive processes with sensory-motor recovery by means of the patient learning new interaction patterns with their surroundings10, 11. although its effectiveness in orthopedic rehabilitation has been recently demonstrated12,13,14, there is a need for well-designed studies in neurological patients. a prior randomized clinical trial15 in acute stroke used a protocol with an unclear and non-specific methodology and it concluded without statistically significant evidence between the two groups. recently, significant differences were found on upper limb functions from chronic stroke patients, regarding activities of daily living and quality of life16. our study has implemented a protocol based on the neurocognitive approach considering and acting on the individual s motor, sensory and cognitive characteristics. the aim was to determine its feasibility and evaluate whether subjects treated with this protocol improved qualitative upper extremity (ue) movement. we hypothesized that subjects who received the neurocognitive protocol would show greater improvements on motor, sensory and cognitive functional aspects when compared with those treated with a conventional protocol, and these positive changes would also demonstrate clinical and significant improvements on ue functionality with maintenance at follow-up. the inclusion criteria were: diagnosis of subacute ischemic stroke (from 15 days to 3 months, middle cerebral artery territory), age between 25 and 80, mini-mental test 24, motor deficits in ue caused by stroke (motricity index<99) and enough trunk control to be able to sit with dorsal support. exclusion criteria were: global aphasia, somatoagnosia or neglect, modified ashworth scale>2 and carrying out other types of therapies at the same time as the study with the exception of the occupational therapy treatment applied to all participants of the study. the study was approved by the hospital s clinical investigation ethics committee (register number: ac-11-094) and conducted according to the helsinki declaration. following enrollment, participants were randomized consecutively for 10 months by a random number table into two groups: the control group (cg) which received conventional physical therapy and the experimental group (eg) with the neurocognitive protocol. the evaluator was a widely experienced and trained physical therapist in assessing and treating stroke patients. the percentage of adherence rate of 80 and 100% required for treatment and assessments (a), respectively, as well as the percentage of retention rate of 85% were established and controlled by both therapists. a panel of scales was applied at the beginning of the study (a1), at 5 weeks (a2), at the end of the treatment in the 10th week (a3) and at a follow-up 10 weeks later (a4). the primary outcome was the motor evaluation scale for upper extremity in stroke patients (mesupes) score to assess ue functionality. the result is obtained by adding together the points at each assessment (a1234). each item is scored from 0 (inability to adapt muscle tone to the movement) to 5 (ability to correct and complete motion without help). mesupes-hand consists of 9 wrist and finger items scored on a 3-pointed rating scale: no movement or incorrect=0; movement incomplete=1; movement complete=28, 17. the minimal detectable change (mdc) for the total score with 95% confidence level was calculated and resulted in a score difference of 8 to be necessary for a genuine change of function additional outcomes included: the motricity index test, validated for the quantitative assessment of paretic ue muscle strength. in this study the arm score is the result of adding together the points for the 3 arm test+1 at each assessment (a1234)18. the revised nottingham sensory assessment is a standardized scale for evaluating sensory impairment in stroke patients19. the kinesthesia subscale is applied bilaterally on the shoulder, elbow, wrist and metacarpal-phalangeal joint at each assessment (a1234). it is scored from 0 (absent sensation) to 3 (correct position). the light touch subscale displays the result of adding together every assessment score on the shoulder, elbow, wrist and palm. it is scored on a 3 point rating scale: absent sensation=0; impaired sensation=1; normal sensation=219. the kinesthetic and visual imagery questionnaire assesses the cognitive aspect of imagining a movement in its two main dimensions, visual and kinesthetic20. it shows the result of adding together the points of each upper extremity item at each assessment with the exception of a2 when no change was expected to be observed. both dimensions evaluated shoulder elevation, forward shoulder flexion, elbow flexion/extension, thumb-fingers opposition on a score from 1 (no image or sensation) to 5 (image as clear as seeing or as intense as executing the action)20. the values obtained with mesupes at a1 allowed the blinded evaluator to determine the level of motor involvement required by every participant (passive, active-assisted or active). the evaluator also recommended sensory and cognitive difficulties of the exercises, but those recommendations were only followed by the physical therapist in the eg treatment. in both groups the intervention consisted of passive, active-assisted and active mobilizations with freedom of directions. proprioceptive joint information was provided on the shoulder, elbow, wrist and fingers segments in addition to tactile information, using different textured surfaces (rough, fine, etc.), on palms and fingers21, 22. both groups performed a 30-minute treatment with 3 individual sessions/week for 10 weeks23, 24. fifteen minutes were dedicated to shoulder, elbow and wrist and 15 minutes to the affected hand. the participant was positioned in a supine position for the first part and in a sitting position for the second one8. during ue mobilizations and the contact with different surfaces, eg participants received the proposal of sensory discrimination tasks organized in a hierarchy (from lower to higher difficulty)12, 13, 22, 25, 26 (table 1table 1.hierarchy of sensory tasks with cognitive activationsensory taskdifficulty level (low to high)cognitive activity requiredkinestheticjoint movement discriminationrecognition of change between presence and absence of movement: tell me when you feel the changerecognition of the presence or absence of the movement: tell me when you feel that the joint x movessimple parameter joint movement discriminationrecognition of the joint moved: which joint has been moved?recognition of the direction of movement of the joint x: in which direction is it moving?complex parameter joint movement discriminationrecognition of the distance of movement in the joint x: how far has it moved ?; in what position are you?recognition of the static position (spatial relations): where is your elbow in relation to your shoulder?copying spatial relations with the contralateral extremity: try to imitate exactly the same position with your other armtactilecontact discriminationrecognition of change between presence and absence of contact tell me when there is a changerecognition of the presence or absence of contact tell me if you feel there is an area in contact with your palm and fingerscontact location discriminationrecognition of the contact location: where do you feel the contact?tactile surface discriminationrecognition of similarities and/or differences: is this tactile surface the same or different from the one you felt before?recognition of touch (surface categorization) what does this tactile surface feel like ?; what surface do you think it is?). resolution of these tasks involved cognitive activation of learning strategies such as observation, motor imagery, imitation, etc12, 13, 25,26,27. every task was proposed as a problem to be resolved with closed eyes13, 22, 25, 26. the physical therapist began with the most suitable task for each participant and continued with the following one after the satisfactory completion of the first task5, 12, 13. in addition, the physical therapist could constantly adapt the protocol to the individual s level based on daily observation but always under the protocol guidelines, designed by an experienced physical therapist and based on the neurocognitive theory12, 13. no discrimination tasks were established in the cg although mobilizations and different surfaces were proposed28, 29. hence, cg participants received the same type of information (propioceptive and tactile) but they were not asked to resolve any problem nor to be aware of their body sensations. individual characteristics and therapy adherence were expressed as mean standard deviation (sd). the therapy adherence rate (%) was also reported. outcome measure data were reported as score differences between the post and pre-study (a4a1) for each participant, the a1 and a4 median (md) for each group as well as between each assessment (md of a2a1, a3a2 and a4a3). nonparametric statistical tests were employed. the pearson test and mann-whitney u test the wilcoxon signed rank test allowed pre-post clinical evolution from the beginning to the end of the study to be determined in both groups and the mann-whitney u test was used to compare the changes between groups on a1 and a4. a significance level of 0.05 has been used in all analyses but considered only in an exploratory sense. seven subjects with involvement of the right middle cerebral artery and one of the left were finally considered for analysis. one subject withdrew after a2 because of personal reasons and was discarded (retention rate=89%). the average age was 53.4 9.6 years old, seven males and one woman, all of whom were right-handed. no statistically significant differences between groups were found relating to gender (p=1) and injured hemisphere (p=1) nor age (p=0.89) and time from stroke onset to treatment (p=0.89). all the participants attended at least 80% of the treatment sessions and all four assessments. this represents an adherence intervention rate of 95.8% in the 10-week treatment period and an assessment rate of 100% in the 20-week study period. although not statistically significant, there were more relevant pre-post study improvements in the eg on mesupes arm and hand subscales. these changes appeared earlier and lasted throughout the study in the eg. despite random assignment, significant differences between groups were found at a1 with lower hand values in the cg (p=0.03). in terms of the minimal detectable change (mdc), all the participants of the eg and 2 of the cg (participant 1 and 4) reached pre-post clinical changes. the secondary outcome measures showed neither statistically significant differences (p>0.05) between groups nor pre-post study changes for each group (table 2table 2.change of functionality, muscle strength, sensory discrimination and motor imagery abilityoutcome measurescg (n=4)eg (n=4)mesupes-armpre18 (12, 29.5)32.5 (29, 35.5)post22 (11, 34.5)38 (36, 40)45.5mesupes-handpre2 (0.5, 4.5)8.5 (8, 12.5)post6.5 (0, 15.5)17.5 (15, 18)4.59mipre39.5 (26.5, 54.5)67 (58.5, 73)post51 (32, 76)77 (77, 85)11.510rnsa-light touchpre8 (6, 8)4 (3.5, 5.5)post8 (6, 8)6.5 (5, 8)02.5rnsa-kinesthesiapre8.5 (8, 10.5)10 (8.5, 10.5)post11 (10, 12)12 (11, 12)2.52kviq-visualpre17 (14, 19.5)13.5 (10.5, 16.5)post19.5 (19, 20)20 (14.5, 20)2.56.5kviq-kinesthesiapre18 (17, 19.5)18 (15, 20)post19.5 (17.5, 20)18.5 (14, 20)1.50.5all data are expressed as medians with interquartile range: md (min, max)cg: control group; eg: experimental group; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnairetested by wilcoxon signed rank test. in particular, muscle strength improvements were found mainly in the first 5 weeks for both groups, the same as the kinesthetic results in the cg. the kinesthetic improvements in the eg were reached at the end of the treatment period as well as the maximum visual image results for both groups. all data are expressed as medians with interquartile range: md (min, max) cg: control group; eg: experimental group; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire tested by wilcoxon signed rank test. significance level of 0.05 primary and secondary outcome results of each participant in both groups are shown in table 3table 3.primary and secondary outcome results of each participantoutcome measurescga1a2a3a4a4a1ega1a2a3a4a4a1mesupes-armp.1373838392p.5364040404p.214101086p.6353840405p.3101315144p.7283033368p.4222828308p.8303034366mesupes-handp.1613171812p.5816171810p.210001p.6161717182p.300000p.791114134p.436151310p.881117179mip.16477778521p.57393939320p.2342934295p.6737777774p.31924293516p.75673777721p.44567676722p.86173777716rnsa-light touchp.188880p.578881p.244640p.644484p.388880p.744451p.488880p.835652rnsa-kinesthesiap.1121212120p.510912100p.29109101p.6111012121p.381011124p.7101212122p.481111102p.87911125kviq-visualp.11920201p.5111292p.21519194p.610202010p.32020200p.71612204p.41320196p.81720203kviq-kinesthesiap.12020200p.51412113p.21720203p.62020173p.31920190p.71616204p.41720161p.82020200a: assessment; cg: control group; eg: experimental group; p: participant; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire. a: assessment; cg: control group; eg: experimental group; p: participant; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire this study aims to show the influence of motor, sensory and cognitive aspects on ue recovery in subacute stroke patients through the comparison between a neurocognitive protocol and a conventional treatment. the combined use of a panel of scales is also proposed as it allows the different components involved in motor control to be segregated and assessed. in particular, mesupes has allowed us to determine the individual s initial and successive states in terms of movement quality concerning functional tasks. the preliminary results of both groups suggest the use of mesupes to obtain stratified sampling in larger studies. thus, by obtaining more accurate information, the adaptation of the protocol to the characteristics of each individual is facilitated. the high adherence of participants in treatment and assessments sessions could be explained by both these factors. although the results were not statistically significant, due partially to the small sample studied, they are of important clinical relevance. furthermore, it resulted in a considerable improvement in the functional autonomy of the ue. in particular, all the eg participants and 2 of the cg showed the score differences (mdc) needed to obtain a clinical change. the mesupes scale shows improvements in both groups indicating that neurocognitive and conventional treatments have been useful to ue functionality (table 2); but also demonstrating that the neurocognitive one (eg) promotes more benefits in all segments (shoulder, elbow, wrist and hand). this group presented superior pre-post changes on arm and hand subscales. in previous studies by lang et al.30,31,32, a higher recovery of the proximal segments is questioned and lack of differences between proximal and distal joints is reported. our pilot study highlights a greater distal recovery, where the changes for the hands were higher, and occurred earlier in the eg, as a probable consequence of giving greater importance to their treatment. this is consistent with perfetti s concept of the hand10, 11, considered as an essential element for the interaction with the objects inside the action, in which the movements of the more proximal segments are involved and acquire their significance. to do so, it should be noted that the exercises proposed for the hands included kinesthetic and tactile information due to their importance concerning hand functionality25, 26. the evolution of both groups supports the importance of starting treatment as soon as possible33,34,35 and maintaining it for at least 10 weeks. with exception of some studies on chronic stroke, there is little evidence on the effectiveness of rehabilitation beyond this period, because no further treatments are usually maintained 3 months after the stroke36. in the present study, these months coincide with the period between a3 and a4, in which there was an overall stabilization of the evolution of ue functionality in the cg, while improvements in the eg were still observed. in addition, the improvements from a1 to a4 may indicate the importance of both motor learning strategies through the discrimination tasks5, 37 and also the need to extend the treatment beyond this period of time for a better recovery38. in concordance with previous studies34, 35 that show the correlation between the individual s initial state and the prognosis, we have also found that subjects with mild or moderate severity have a better functional outcome reached in a shorter time compared to those with higher severity, despite the fact that these subjects are also expected to show an evident improvement at the end of the rehabilitation. earlier and superior improvements in muscle strength were found in the eg. these gains obtained mainly in the first 5 weeks for both groups did not correlate with increased functionality throughout the 10 weeks of treatment. this is evidenced by the mesupes scale for all segments in the eg and for the hand in the cg. this would indicate that although muscle strength, assessed by the motricity index, is gained at the beginning in all segments, more time is needed to translate its gains into functionality improvement through training28. moreover, it would indicate that favorable progression in ue movement depends mainly on parameters such as accuracy, fluidity, coordination or correlation between joints7, 32, 39, 40. all of these are qualitative aspects in which sensory discrimination has an important role25, 26. there are still few studies about the effects of passive movement in brain areas during the processing of tactile and kinesthetic information; but van de winckel et al.25, 26 have already observed that, under both normal and stroke conditions, passive sensory discrimination causes the activation of parietal, pre-motor and motor areas in a similar way as active exploration. there are different studies about sensory treatment protocols on stroke patients for recovering sensory impairments21, 22. on the other hand, our pilot study aims for movement recovery by sensory processing tasks. despite the need for more homogeneous research into the impact of sensory impairments on motor and functional ue recovery41 the importance of maintaining the treatment during at least 10 weeks is also supported by sensory results. the light touch trend of improving after the treatment period could be an indicator of the learning factor which is highlighted in the neurocognitive protocol. in the eg, kinesthetic maximum values were obtained at the end of 10 weeks, unlike the cg where improvements were mainly in the first 5 weeks. considering that kinesthesic median values at a1 in both groups were high, there was not a great deal of margin for improvement (table 2). these results lead us to highlight the role of tactile and kinesthetic discrimination in improving ue functionality. finally, the cognitive element assessed has been the ability to imagine the ue movement. as in some studies20, 43, the values of healthy ue were higher in its two dimensions (visual and kinesthetic). these results suggest that motor and sensory deficits affect the capacity to imagine the body part involved, despite still being in the subacute phase (15 days to 3 months), but this capability changes within a short period of time (days or a few weeks). in the present study both groups evolved favorably and similarly over the 10 weeks of treatment, until almost reaching the maximum score of the visual image. we can hypothesize that, unlike the kinesthetic image, this component is altered in early stages (acute and subacute). conversely, the constant arrival of pathological information as well as the probable difficulty in remembering the correct movement sensations would subsequently cause a kinesthetic image disorder. the recovery of motor memory needs a better and stable representation of the primary motor area achieved with guided therapeutic exercises44. a potential limitation in the study is that other cognitive elements also activated in the discriminatory tasks, such as memory or attention, were not evaluated. some studies45, 46 have demonstrated the facilitation of tactile processing in the primary sensory area through attention. other limitations of this study include the lack of neuroimaging techniques to gather further data and a small sample size that resulted in unequal comparison groups with respect to mesupes outcomes despite random assignment. this study used a blinded evaluator to decrease the likelihood of biased assessment measures. in general, our results support the protocol feasibility and the use of a panel of scales in order to obtain more accurate evidence of the neurocognitive approach effectiveness by means of a larger study. despite the fact that some clinical trials have been recently published about neurocognitive treatment using a similar approach, their results are not easily comparable to ours, because chanubol et al.15 and lee et al.16 performed protocols without establishing clearly either the selection criteria of exercises level or their progression. sensory and cognition assessments were not applied and the other assessments were only performed before and after treatment. despite the lack of statistical significance, this pilot study indicates that upper extremity movement deficits improve when exercises with motor, sensory and cognitive components are performed following a neurocognitive approach. a careful selection of the appropriate difficulty for each individual as well as the guidance of a therapist in the cognitive and sensory processes allow greater and prolonged improvements over time on the upper extremity, especially for the hand function. the neurocognitive approach is a safe, useful and easily applicable way to work with stroke patients in any rehabilitation center. although further research is necessary, the feasibility of the proposed protocol facilitates the carrying out of a clinical trial to consolidate evidence of these findings.

[ purpose] this study aims to describe a protocol based on neurocognitive therapeutic exercises and determine its feasibility and usefulness for upper extremity functionality when compared with a conventional protocol. [subjects and methods] eight subacute stroke patients were randomly assigned to a conventional (control group) or neurocognitive (experimental group) treatment protocol. both lasted 30 minutes, 3 times a week for 10 weeks and assessments were blinded. outcome measures included: motor evaluation scale for upper extremity in stroke patients, motricity index, revised nottingham sensory assessment and kinesthetic and visual imagery questionnaire. descriptive measures and nonparametric statistical tests were used for analysis. [results] the results indicate a more favorable clinical progression in the neurocognitive group regarding upper extremity functional capacity with achievement of the minimal detectable change. the functionality results are related with improvements on muscle strength and sensory discrimination (tactile and kinesthetic). [conclusion] despite not showing significant group differences between pre and post-treatment, the neurocognitive approach could be a safe and useful strategy for recovering upper extremity movement following stroke, especially regarding affected hands, with better and longer lasting results. although this work shows this protocol s feasibility with the panel of scales proposed, larger studies are required to demonstrate its effectiveness.

PMC5430270

pubmed-593

because double stranded (ds) dna cleavage is much harder to repair than single stranded (ss) dna cleavage, ds damage is particularly efficient in inducing self-programmed cell death or apoptosis. these compounds, often hailed as the most potent family of anticancer agents, produce cleavage of both strands of dna duplex via two hydrogen abstractions from two opposite strands of dna backbone by a reactive biradical, p-benzyne, generated from the enediyne core via a process, called the bergman cyclization [46]. however, natural enediynes not only lack selectivity towards cancer cells, but also do not cause the ds cleavage with 100% efficiency. thus, design of compounds which are capable of more efficient ds dna cleavage and combine this efficiency with selectivity towards cancer cells remains the focal point of the anticancer therapeutic agents targeting dna. we have found that dna damaging potential of enediynes can be increased if their reactivity is tuned towards c1c5 photocyclizations, a new reaction discovered in our lab which leads to incorporation of four rather than two hydrogen atoms from the environment [8, 9]. because c1c5 cyclization proceeds under photochemical conditions for thermal c1c5 cyclization, see [10, 11], it takes advantage of the high degree of spatial and temporal controls over reactivity inherent to the photochemical activation. the use of tissue-penetrating light allows for efficient, and selective, spatial and temporal control over prodrug activation as light can be delivered directly to the tumor when it contains a high concentration of the prodrug. skin cancer is the most obvious target for this therapy and, in 2006, the uk national institute of health and clinical excellence (nice) recommended pdt for basal cell carcinoma. however, pdt can be also used to treat tumors on the lining of internal organs or cavities. other tumors can be targeted with low-energy tissue penetrating photons, especially if the three-dimensional control of activation is provided by the two-photon excitation mode. for two photon excitation of enediynes, see [1214]. in addition, this radical-anionic c1c5 cyclization of enediynes is triggered by photoinduced electron transfer (pet). this mechanistic feature increases cellular selectivity because activation is possible only in the direct vicinity of a suitable electron donor such as dna to occur. in the absence of such a donor, tfp-substituted enediynes (scheme 1) we have also found that related tfp-substituted monoacetylenes are capable of photochemical alkylation of electron rich -systems [1517] and investigated whether this reaction can be also used for controlled dna-modification. a priori, efficient dna-cleavage by monoalkynes incapable of the bergman or c1c5 cyclizations can involve several possible mechanisms like base alkylation, hydrogen abstraction, generation of reactive oxygen species as well as pet. in order to increase solubility of tfp-warheads in water and their affinity to dna, we combined them with lysine via carboxyl moiety of the amino acid, figure 1. importantly, this mode of attachment leaves both amino groups of lysine available for an acid-base reaction which converts them into cationic ammonium groups. we found that dna-damaging ability of such hybrid molecules can be fine-tuned in the narrow range of physiological ph conditions which results in a dramatic increase in reactivity at the lower ph of hypoxic tumor cells. less basic -amino group is protonated at the lower ph than 7 and this protonation not only prevents quenching the excited state of the chromophore but also provides tighter binding to negatively charged dna. remarkably, the change in reactivity occurs at a relatively narrow and predefined ph point (~ph 6). these dna-photocleavers provide the dna cleavage ratios of up to the 1: 2 ds: ss at ph 5.5 at concentrations and irradiation times where almost no ds cleavage is observed at the ph of healthy cells. this dramatic increase of ds dna cleavage at the lower ph renders these molecules more efficient ds dna cleavers than calicheamicine under the conditions suitable for selective targeting of acidic cancer tissues (figure 2(a)). we also found that the c-lysine conjugates bind selectively to nicks and gaps in a dna duplex and, upon photochemical activation, transform the easily repairable ss-dna damage into much more therapeutically important ds-dna damage (figure 2(b)). the medicinal potential of these molecules has been illustrated by a>90% lncap cancer cell death induced by photochemically activated tfp-acetylene-lysine conjugate 3 in one treatment at concentrations as low as 10 nm. similar increases in reactivity upon activation with light were observed in parallel experiments with umrc3, umrc6, and 786-o cancer cell lines. in summary, our previous work led to the development of a family of powerful and tunable dna cleaving reagents which have been shown to cleave both plasmid dna and dna oligomers outside of cells [15, 18]. we have also proven that these reagents can induce cancer cells death at the low concentrations. however, our previous work offered no evidence for dna-damage by tfp-enediynes and acetylenes inside of cells. such evidence is important because cell death can result from mechanisms other than dna cleavage and because dna-cleavage of intracellular dna should be more difficult since this dna is compactly organized around histone proteins. the aim of this work is to test the efficiency of our light-activated ds-dna-cleavers towards intracellular dna using single cell gel electrophoresis assay which can measure dna damage in individual eukaryote cells [2125]. this assay has been used as a standard technique for evaluation of dna damage/repair, biomonitoring, and genotoxicity testing [2633]. the cleaved dna fragments are able to migrate out of the cell under an electric field after lysis and alkali treatments while undamaged dna moves slower and remains with the confines of the nucleoid. reagent kit for single cell gel electrophoresis assay kit, cometassay, and control cells containing different levels of dna damage, cometassay control cell, were purchased from trevigen, inc. the cc0 sample corresponds to cells with undamaged dna whereas cc1, cc2, and cc3 have different levels of dna-cleavage induced with etoposide. olympus bx61 microscope attached with the dp71 color digital camera was used to take fluorescence images of scge assay. tail moment, the ratio of tail length to head diameter (l/h), dna percentage in tail, and tail length were used to estimate dna damage. the tail moment has been regarded as an appropriate index of induced dna damage by computerized image analysis. it represents both the amount of damaged dna and the distance of migration by a single number. the tail moment was calculated by multiplying the percentage of dna in the tail by the tail length; see. lncap cells (p.35) were plated in 6 (100 mm) plates at density of 250,000 cells/well and were maintained in rpmi 1640 medium supplemented with 10% fbs, sodium bicarbonate (2 g/l). when they reach 70% confluence, compound 3 was dissolved in serum-free rpmi 1640 medium supplemented with sodium bicarbonate (2 g/l). after the rpmi 1640, medium containing the compound 3 (0, 10, and 50 m) were added to the cells and the cells were placed in the incubator for 4 hours. the cells were exposed to uv with cover removed for maximum exposure for 10 minutes and were trypsinized and counted. solutions in ice cold 1 pbs (ca and mg free), with 1 10 cells/ml, were prepared based on cometassay instruction from trevigen, inc. lmagarose was melt in boiling water bath for 5 minutes and placed in 37c water bath for at least 20 minutes to cool. cells at 1 10/ml were combined with molten lmagarose at a ratio of 1: 10 (v/v) and 50 l of the mixture was transferred on cometslides. the slides were placed at 4c in the dark for 30 minutes and they were immersed in prechilled lysis solution. after 30-minute immersion at 4c, the slides were immersed in alkaline solution prepared freshly with naoh (0.6 g), 200 mm edta (250 l), and dh2o (49.75 ml) for 20 minutes at room temperature, in the dark. then, the slides were removed from alkaline solution and washed by immersing in 1 tbe buffer for 5 minutes twice. after adding 1 tbe buffer not to exceed 0.5 cm above slides in electrophoresis tank, the voltage at 1 volt per cm was applied for 10 minutes. the slides were immersed in dh2o twice for 10 minutes, then in 70% ethanol for 5 minutes. the samples were dried at 45c for 15 minutes and 100 l of diluted sybr green i was placed on the gels and the slides were stored at refrigerator. after 5 minutes, excess sybr solution was removed by gentle tapping and the slides were completely dried at room temperature in the dark. the control scge assay results for undamaged cells (cc0) and commercially obtained cells with variable amount of dna damage (cc13) are summarized in the top part of figure 3 (entries (a)(d)). as expected, while scge assay with healthy cells showed no tails indicative of dna damage, the assays with the damaged cells produced characteristic tails, the size of which correlates with the extent of dna damage in these cells. with the pretreated control cells (table 1, (b)(d)), 33, 47, and 98% of dna were detected in tails, respectively. tail moment values are also consistent with different levels of dna damage. after confirming that assay conditions work in the control cells, we proceed to investigate dna damage induced by conjugate 3 in lncap cancer cells. to find whether uv itself or thermal reactions of compound 3 may be responsible for the dna cleavage in cancer, we included two control experiments with cells exposed to uv for 10 minutes in the absence of a dna-cleaver (figure 3(f)) and with cells treated with 50 m of compound 3 for 4 hours without photochemical activation (figure 3(g)). this result confirms that neither uv nor compound 3 in the dark can damage dna under these experimental conditions. in contrast, photochemical activation of 50 m of compound 3 produced very efficient dna damage (more than 90% dna in the tail, table 1) in individual cells (figure 3(h)). irradiation in the presence of 10 m of compound 3 also showed significant dna damage (~40% dna in the tail, figure 3(i)). these results confirm that compound 3 can penetrate into the nucleus of the cancer cell and damage highly compacted dna photochemically. the concentrations of lysine conjugates used in our comet experiments are significantly higher than>0.01 mm concentrations sufficient to cause significant photocytotoxicity to several cancer cells lines. this difference is not limited to the comet assay our earlier experiments with pure dna also required micromolar concentrations of the conjugate to observe the cleavage [18, 19]. first, it suggests (somewhat surprisingly) that the efficiency of cleavage for isolated plasmid dna and compacted cellular dna is not drastically different, thus indicating that our compounds should accumulate in the cell nucleus rather efficiently. second, this observation may indicate the presence of an additional, even more efficient, mechanism for cytotoxicity which may not be based on dna cleavage. alternatively, it may also mean that even small amount of dna cleavage (which is not detected by the conventional, relatively insensitive assays) is still sufficient for causing apoptosis. although we can not distinguish between these two mechanisms at this point, this mechanistic ambiguity renders important the observation that lysine-acetylene conjugate can indeed target and damage cellular dna. interestingly, the fluorescence images of cells treated with compound 3 (figures 3(g) and 3(i)) showed blue fluorescence in the nucleus region on top of the green fluorescence from the dna-staining dye, sybr green i. because this blue fluorescence is not observed in control cells without the conjugate, the emission is likely to result either from compound 3 itself which has the maximum emission at 440 nm (figure 4) or from one of the respective photoproducts derived from the dna-photocleaver. this observation provides additional evidence that conjugate 3 can be uptaken into the nucleus of cancer cells. it is also interesting that there is no residual blue fluorescence in figure 3(h), where the dna is broken completely. scge assays confirm the occurrence of efficient cleavage of highly compacted intracellular dna by a light-activated c-lysine acetylene conjugate. this result provides a key mechanistic link between efficient dna cleavage and significant cytotoxicity in cell proliferation assays.

previously, we reported the design and properties of alkyne c-lysine conjugates, a powerful and tunable family of dna cleaving reagents. we also reported that, upon photoactivation, these molecules are capable of inducing cancer cells death. to prove that the cell death stems from dna cleavage by the conjugates, we investigated intracellular dna damage induced by these molecules in lncap cancer cells using single cell gel electrophoresis (scge) assays. the observation of highly efficient dna damage confirmed that lysine acetylene conjugate is capable of cleaving the densely compacted intracellular dna. this result provides a key mechanistic link between efficient dna cleavage and cytotoxicity towards cancer cells for this family of light-activated anticancer agents.

PMC2930354

pubmed-594

organizations increasingly use teams to do their work which was traditionally given to individuals (1). the reason why organizations seek teamwork is that teams can, in most cases, be more successful than individuals who work alone. more effective and better decisions can be made when people work together (2). moreover, team works are often more efficient and more effective than individual work (3). in addition, using teams can result in increased safety (4), improved people s attitudes, and decreased number of absentees (5). there is enough evidence on the importance of people s participation in health care teams (6). teams in health care organizations are made up of physicians, nurses and other health technicians who officially work to achieve organizational goals (7). the basic idea is that patient s health and safety is not only a function of complex treatments and advanced therapeutic technologies but also a function of a degree based on which health care professionals fulfill their duties effectively as a team (8). in addition to promoting mutual support and understanding among members of the health care teams, multidisciplinary teams have the potentials to improve relationships, increase efficiency and coordination and finally improve patient s health (9). although there is not much documentation about the evaluation of individual s team skills in health care section (6), evaluating teams is an important tool in order to increase efficiency and productivity of teams (10). in this case, what is agreed upon is that its members must experience sufficient time and togetherness so as to rate the team s performance in terms of six scales: 1) teamwork 2) decision-making 3) leadership support 4) trust and respect 5) recognition and reward 6) focusing on customers (2). different studies show the importance of teams and their effective roles in achieving the goals in health care organizations. brewer and mendelson suggested that multidisciplinary teams were necessary but not enough to be effective. in addition, effective teams need both integrity and diversity (11). as well as, nancarrow et al highlighted ten basic effective features of multidisciplinary team working (12). in their research on developing and testing self-evaluation tools for cancer improvement multidisciplinary teams, taylor et al stated that self-evaluation of team performance could lead to the development of multidisciplinary teams (13). as there is scant evidence regarding the assessment of hospital teams in iran and due to researches on team performance in non-hospital sectors in other countries, we decided to conduct this research because knowing the attitudes of team members in an iranian context can have a significant effect on managing health care teams and the resultant would be better performance. since health care teams present health care in the form of hospital committees in iran hospitals and concerning the effective roles of these teams at hospitals, the aim of this research was to determine the attitudes towards team working among hospital committee members in kerman hospitals. the study population consisted of 171 members of clinical teams in committees of 4 educational hospitals in kerman, iran. the 30 item testing team attitudes questionnaire (t-taq) was used to collect data that was jointly proposed in 2008, as team strategies&tools to enhance performance&patient safety (team stepps), by the american agency for healthcare research and quality and the american department of defense as the american national standard (14). this questionnaire has 5 domains in titled: team structure, leadership, situation monitoring, mutual support, communication, in which each domain includes 6 questions. respondents were asked to rate the statements on a five-point scale ranging from 1 to 5 (1 strongly agree and 5 strongly disagree). the total score of all five domains determined the team work attitude of the hospital committees. external, formal and content validity and reliability of this questionnaire were determined and confirmed in a study by najafi et al in 2012 (15). the study population consisted of 220 medical personnel who were members of at least one hospital committee. all questionnaires were completed anonymously during the committee meetings and confidentiality of the data was maintained. to collect data, a written permission was obtained from hospital authorities and kerman university of medical sciences (kums). data were analyzed using descriptive statistics, statistical tests, t-test, anova, and linear regression. of 171 personnel who participated in this study, 111 participants (64%) were women and 144 (84%) participants were married. the average age of participants was 36 years (sd=7.9), and the average work experience was 10.5 years (sd=7.7). 102 participants (60%) worked in the health care field and 69 participants worked (40%) in the administrative field. the total mean score of hospital committees regarding team attitude was 3.9 out of 5 (sd=0.31). of all sub-criteria of team attitude, leadership and mutual support had the highest and lowest scores respectively (4.9 and 3.7). the mean score of hospital committees in terms of team attitude in all five areas was as follows: leadership 4.19 (sd=0.4); monitoring status 4 (sd=0.5); team structure 3.8 (sd=0.4); communication 3.8 (sd=0.5); and mutual support 3.7 (sd=0.5). mean score of teamwork attitude questions the highest team attitude score was related to afzalipour hospital, while the lowest score was given to shahid beheshti hospital and shafa hospital (table 2). teamwork attitude s mean score in kerman hospitals table 3 shows the relationship between team work attitude sub-scales and variables such as employment, work experience, age, gender, education, marital status, and responsibility. regression analysis indicated that responsibility was the most important factor (= -0.184, p=0.024). among the sub-scales of team work attitude, employment, marital status, and responsibility marital status played a role in leadership; responsibility had a role in situation monitoring; and work experience had a role in domains of communication and mutual support. positive attitudes towards behaviors related to effective teamwork and safety among nurses and surgeons were also reported by flin et al (16). among the five teamwork attitude sub-scales, this shows that participants had a good attitude towards the role of leadership in health care teams. we can conclude that the team leader had the ability to coordinate activities appropriately, was sure that care programs were completely understood and care duties were fulfilled properly. similarly, edmondson mentioned the proper role of cardiologists in leading health care teams. facilitating communications among team members and developing the art of correct communication among team members, he improved their performance (17). in a study carried out by mercer et al, suitable communication i.e. transmitting information between the members of a team or between them and the patients was reported (18). by the same token, kilner et al showed suitable communication in a team and positive attitude towards teamwork. in this study, good communication in hospital teams in emergency centers not only improved patients and employees satisfaction, but also reduced errors and improved patient s safety (19). in a study by christian et al on patient s safety in the operating rooms, lack of communication and sharing information were two main factors which risked the patient s safety (20); moreover, committee members had a moderate attitude towards communication. campion et al reported that the aim of organizational support is to achieve goals (21). according to friedlander, organizational support is having clear objectives and a proper combination of experience, skills and sufficient resources (22). monitoring members of a team and their knowledge of conditions of their team members and patients caused people to have more effective roles in their teams (23). according to a study by loughry et al, monitoring a team member by his teammates was considered as a benchmark for his effectiveness (24). in the present study, however, the participants had a moderate attitude in this regard. participants attitude towards mutual support had the lowest score in the present study. however, mutual support reduced workload and increased patients safety (25). in a study by liebman and hyman, health care providers who needed more support were more willing to talk with patients about errors, to answer questions and to express their feelings (26). poor attitude of members towards mutual support can be due to cultural aspects of personnel, lack of awareness, and inadequate training. we could also observe that gender and education level had no significant impact on the attitude of team members. this finding is not in line with a study conducted by thomas who showed that team attitude had a significant impact on physicians and nurses (27). the results of regression analysis revealed that people who had some responsibilities in health care teams (compared to those with no responsibility) had more positive attitude towards their teams. however, curran stated that work experience and age had an impact on the attitude of team members (9). the role of responsibility in increasing the team attitude in the present study might be due to in-service training courses held for officials in medical teams. concerning attitude of members of hospital teams towards team structures, responsibility, marital status and area of employment (health/administrative) had a significant role. the positive impact of employment on the attitude towards the structure of hospital teams might be due to the attentions of administrative personnel working in teams to establish relationships with other organizations, paying attention to the organization, managing the hospital and their roles in guiding the teams. the role of work experience regarding team attitude towards communication and mutual support could be due to the work experience, having more relationships with others, and having no conflicts. one of the limitations of this study was the small study sample thus; similar studies with a larger sample size in non-governmental hospitals are recommended. some of the benefits of this research included evaluating the attitude of hospital teams using a team tool to improve performance and patient s safety (team stepps). the efficiency of a health care team and its goals can be achieved if there is a presence of effective communication among health care staff and between members of a team and patients as well as strong team leadership and support within an organization. by training hospital personnel and paying particular attention to main elements of effectiveness in a health care team future studies can be conducted on determining the attitude of health care teams and the relationship between team attitude and productivity, job rotation and patient s safety in iran.

introduction: patients health and safety is not only a function of complex treatments and advanced therapeutic technologies but also a function of a degree based on which health care professionals fulfill their duties effectively as a team. the aim of this study was to determine the attitude of hospital committee members about teamwork in kerman hospitals. methodology:this study was conducted in 2014 on 171 members of clinical teams and committees of four educational hospitals in kerman university of medical sciences. to collect data, the standard team attitude evaluation questionnaire was used. this questionnaire consisted of five domains which evaluated the team attitude in areas related to the team structure, leadership, situation monitoring, mutual support, and communication in the form of a 5-point likert type scale. to analyze data, descriptive statistical tests, t-test, anova, and linear regression were used. results:the average score of team attitude for hospital committee members was 3.9 out of 5. the findings showed that leadership had the highest score among the subscales of team work attitude, while mutual support had the lowest score. we could also observe that responsibility was an important factor in participants team work attitude (= -0.184, p=0.024). comparing data in different subgroups revealed that employment, marital status, and responsibility were the variables affecting the participants attitudes in the team structure domain. marital status played a role in leadership; responsibility had a role in situation monitoring; and work experience played a role in domains of communication and mutual support. conclusions:hospital committee members had a positive attitude towards teamwork. training hospital staff and paying particular attention to key elements of effectiveness in a health care team can have a pivotal role in promoting the team culture.

PMC4733557

pubmed-595

the receptor for advanced glycation end products (rage) is a cell surface receptor of immunoglobulin superfamily. rage activation through ligand binding can induce chronic inflammation and oxidative stress, and it has been linked with diseases like diabetic complications, cardiovascular and neurodegenerative diseases, and cancer. a soluble form of rage (srage), which is a splice variant of full-length rage or a shedding/cleavage product of membrane-bound rage, has been found circulating in the plasma [2, 3]. the srage can bind and sequester rage ligands and thereby can reduce rage activation. therefore, the srage is generally considered as protective against diseases originating from rage activation [13]. rage-ligand interaction was previously claimed to be involved in the pathogenesis of autoimmune diabetes, and treatment with srage was shown to effectively prevent transfer of diabetes into nod/scid mice that receive spleen cells from a diabetic nod donor. subsequently, blockade of high-mobility group box 1, a rage ligand, was shown to inhibit insulitis progression and diabetes development in nod mice. a minor role of genetic variation in rage was also suggested to be associated with insulin resistance (ir) in a human population. however, recent studies have suggested that low levels of circulating srage may be involved in the development of diabetes mellitus [79]. a declining level of srage at the time of seroconversion to autoantibody positivity has been suspected to be a predictor of type 1 diabetes [7, 8], and an independent association has been found between low levels of srage and development of type 2 diabetes mellitus (t2 dm). however, the relationship of srage with the underlying pathophysiological mechanisms of t2 dm has not been specifically explored. the ir and beta cell dysfunction are two core defects of t2 dm, and the prediabetes is a category of increased risk of developing t2 dm in subjects who have not yet fulfilled the criteria to be diabetic. to explore the involvement or participation of srage in the development of t2 dm, present study was designed to assess whether srage levels alter in prediabetes and correlate with ir and beta cell function in prediabetes and newly diagnosed t2 dm. a total of 158 participants were recruited from those who came for diabetes screening at the bangabandhu sheikh mujib medical university, dhaka, bangladesh, after giving written consent. this cross-sectional study was conducted according to the declaration of helsinki and was approved by the institutional ethical review committee. participants were grouped as control (normoglycemic), prediabetes, and newly diagnosed t2 dm based on their blood glucose (fasting and 2 hrs after 75 grams glucose load) and hba1c levels. as recommended by american diabetic association (ada), diabetes was considered with a fasting glucose level 7.0 mmol/l and/or 2 hrs blood glucose 11.1 mmol/l and/or hba1c 6.5%; and prediabetes was considered with a fasting glucose level 5.66.9 mmol/l (impaired fasting glucose, ifg) and/or 2 hrs blood glucose 7.811.0 mmol/l (impaired glucose tolerance, igt) and/or hba1c 5.76.4%. subjects with previous history of diabetes and those suffering from hypertension, chronic liver and kidney diseases, or any other acute/chronic inflammatory conditions as well as pregnant and lactating women and regular drug users were excluded. a detailed medical history was taken and clinical examination including height, weight, and blood pressure data were recorded for all subjects. a fasting blood sample was collected after an overnight fasting of>8 hours and a second blood sample was collected 2 hours after 75 grams glucose load on the same day from all subjects. fasting and 2 hours after glucose levels were measured by enzymatic spectrophotometric method using dimension rxl max clinical chemistry analyzer (siemens healthcare diagnostics inc., hba1c levels were measured by ion-exchange high-performance liquid chromatography in a bio-rad d-10 instrument (bio-rad laboratories inc., hercules, ca, usa). fasting serum insulin levels were measured by microparticle enzyme immunoassay technique (abbott diagnostics, wiesbaden, germany) using an abbott axsym system with an interassay coefficient of variation (cv)<5%. fasting serum srage levels were measured by elisa in triplicate, as suggested by the manufacturer (r&d systems, minneapolis, mn, usa) with an interassay cv of<7%. the ir and beta cell function were calculated as homeostasis model assessment of ir (homa-ir) [(glucose insulin)/22.5] and homeostasis model assessment of beta cell function (homa-%b) [(20 insulin)/(glucose 3.5)], respectively, where glucose was in mmol/l and insulin was in u/ml. statistical analysis. data are presented as mean sd. variables with a skewed distribution are expressed as median (interquartile range) and were log transformed before statistical analysis. comparison among multiple groups was done by one-way anova followed by bonferroni corrected t-test. stepwise multivariate linear regression models were calculated to demonstrate independent relationships of srage and other variables with homa-ir and homa-%b. the homa-ir was used as dependent variable in one model and the homa-%b as dependent variable in another model with the following independent variables: age, sex, bmi, systolic and diastolic bp, glucose 2 hours, hba1c, srage, and homa-ir/homa-%b. a p value of 0.05 for f-values was taken as criterion for entering variables in the model and p 0.1 for f-values was taken as criterion for exclusion of variables from the model. fasting glucose and insulin levels were not included in the models since they were directly used for calculation of homa-ir and homa-%b. a two-tailed value of p<0.05 was considered statistically significant. as shown in table 1, the age (40.2 8.7; 2058 years) and sex (m=73, f=85) distributions of the 158 study participants were found similar among control subjects (n=40) and people with prediabetes (n=52) and diabetes (n=66). the bmi, systolic and diastolic bp, and fasting insulin levels were also found similar among the three groups. but the fasting and 2 hours blood glucose and hba1c levels were found significantly (p<0.001) elevated in people with diabetes compared to control subjects and people with prediabetes. homa-ir was found significantly higher in people with diabetes than control subjects (p<0.001) and people with prediabetes (p=0.005). as expected, homa-%b was found markedly decreased in people with diabetes (p<0.001) compared to control subjects and people with prediabetes. however, as shown in figure 1, serum srage levels in people with prediabetes (656, 463968; median, interquartile range in pg/ml) did not show any significant difference compared with that of control subjects (626, 413864) and people with diabetes (646, 493817). we next investigated the relationship of srage with markers of ir and beta cell function by using pearson's correlation test. the srage level did not show any significant correlation with homa-ir in all the study subjects (r=0.007, p=0.94), in people with diabetes (r=0.07, p=0.64) or prediabetes (r=0.22, p=0.17). similarly, srage level did not show any significant correlation with homa-%b in all the study subjects (r=0.02, p=0.87), in people with diabetes (r=0.04, p=0.80) or prediabetes (r=0.24, p=0.12) (data not shown in the table). for further statistical analysis, we merged the people with prediabetes and newly diagnosed type 2 diabetes together (pd+dm group, n=118) considering that both groups have similar underlying pathophysiological defects responsible for glucose intolerance and hyperglycemia. characteristics of the participants of this pd+dm group as well as relationship of homa-ir and homa-%b with other variables were shown in table 2. of note, srage levels did not show any significant correlation with homa-ir and homa-%b even in the participants of this pd+dm group (table 2). but homa-ir showed marginal correlation with 2 hours glucose levels (r=0.20, p=0.05) and significant correlation with homa-%b (r=0.27, p=0.007), and homa-%b showed significant correlation with 2 hours glucose levels (r=0.70, p<0.001) and hba1c (r=0.72, p<0.001) (table 2). a stepwise multivariate linear regression model with homa-ir as dependent variable and age, sex, bmi, systolic and diastolic bp, 2 hours glucose level, hba1c, srage, and homa-%b as independent variables showed independent association of homa-ir with bmi (= 0.21, p=0.03), 2 hours glucose levels (= 0.67, p<0.001), and homa-%b (= 0.74, p<0.001) in pd+dm group (r=0.405) (table 2). another model with homa-%b as dependent variable and age, sex, bmi, systolic and diastolic bp, 2 hours glucose level, hba1c, srage, and homa-ir as independent variables showed independent association of homa-%b with 2 hours glucose level (= 0.33, p=0.028), hba1c (= 0.41, p=0.005), and homa-ir (= 0.46, p<0.001) in pd+dm group (r=0.629) (table 2). furthermore, the above regression models when applied separately for the people with prediabetes (not shown in the table) showed significant association of homa-ir with bmi (= 0.33, p=0.006) and homa-%b (= 0.62, p<0.001) (r=0.530) and homa-%b only with homa-ir (= 0.67, p<0.001, r=0.433). such models when applied for the people with diabetes (not shown in the table) showed significant association of homa-ir with hba1c (= 0.43, p=0.009) and homa-%b (= 0.92, p<0.001) (r=0.536) and homa-%b with hba1c (= 0.52, p<0.001) and homa-ir (= 0.61, p<0.001) (r=0.694). but none of the above models showed any significant association of srage with homa-ir and homa-%b in people with prediabetes and newly diagnosed t2 dm. the t2 dm develops insidiously with gradual impairment of glucose tolerance due to ir and beta cell dysfunction. before development of overt diabetes mellitus people with prediabetes suffer from increased risk of developing t2 dm in near future compared with people with normal glucose tolerance. in the present study we investigated the srage levels in prediabetes and the relationship of srage with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm. we found that srage levels do not alter in people with prediabetes compared with normoglycemic control subjects. moreover, we did not observe any correlation or statistical association of srage with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm. higher, lower, and even similar levels of srage have been reported in people with t2 dm compared with control subjects without diabetes (reviewed in). the reason for this discrepancy among studies is not clear but the presence of confounding variables like the duration of diabetes, presence of hypertension and use of antihypertensive drugs, smoking habit, and chronic kidney and inflammatory diseases may contribute to this [11, 12]. it has been shown that longer duration of diabetes is associated with increased advanced glycation end products (age) generation and age-stimulated increased rage expression. the increased rage expression in turn may increase srage level by shedding of membrane-bound rage. if so, people with prediabetes and newly-diagnosed t2 dm may not show a significant alteration in srage level since they may not have experienced a heavy load of age yet. in fact, a large study recently found no difference in srage levels between children with newly diagnosed type 1 diabetes and control subjects and emphasized the importance of evaluating srage levels in children with prediabetes. but, to our knowledge, the srage status in people with prediabetes was unknown until recently. during the preparation of this paper, di pino et al. published cardiovascular risk profile in prediabetes and type 2 diabetes, where they found similar levels of srage in control subjects and in people with prediabetes and new-onset t2 dm as we found in the present study. however, it should be noted that 68% of the people with prediabetes of the study by di pino et al. were normal glucose tolerant (without having ifg or igt) since di pino et al. grouped the study subjects only on the basis of hba1c.. would be equally valid for people with prediabetes defined by standard ada criteria (ifg and/or igt and/or hba1c 5.76.4%). in the present study, we significantly added to the findings of di pino et al. by showing that srage levels do not alter in people with prediabetes, defined by standard ada criteria, compared with control subjects and people with newly diagnosed t2 dm. the ir and beta cell dysfunction are two core defects that are found in variable extent in people with t2 dm. however, the relationship of srage with ir and beta cell function was so far not clear. to our knowledge, basta et al. previously found negative correlation between srage level and ir taken control subjects and people with diabetes together in the analysis. but this relationship disappeared when they analyzed the data in age-selected control subjects and people with diabetes separately. furthermore, an independent negative association of srage with ir also disappeared when they performed multivariate regression analyses on control subjects and people with diabetes separately. in fact, the people with diabetes of the study by basta et al. were significantly different from control subjects in respect to age, number of hypertensive subjects, and use of antihypertensive drugs, factors that are known to affect srage levels. taken together, the negative relationship between srage and ir shown by basta et al. in the present study in a relatively homogenous set of study subjects we found that srage levels do not correlate and do not show any association with ir in people with prediabetes and newly diagnosed t2 dm. furthermore we found for the first time that srage levels do not correlate and do not show any association with beta cell function in people with prediabetes and newly diagnosed t2 dm. the global prevalence of diabetes mellitus is rapidly rising and it is generally considered that sedentary but stressful life-style along with unhealthy food habits and other environmental factors may be responsible for this. it has been shown that dietary factors may contribute to excess accumulation of ages in the body, and ages have been suggested to promote beta cell dysfunction [17, 18] and dietary restriction of ages has been reported to reduce the incidence of diabetes in a mouse model of autoimmune diabetes. moreover, ages can act through rage activation, and the exogenous srage and other inhibitors of rage ligand were shown to inhibit the development of diabetes in nod mice [4, 5]. recently several studies have shown a decrease in circulating concentrations of srage at the time of seroconversion to autoantibody positivity in children with prediabetes before development of type 1 diabetes [7, 8]. these authors proposed that a declining level of srage with simultaneous decrease in srage/age ratio at seroconversion may represent a failing protection of beta cells against harmful ages since srage can bind excessive ages. at the same time, low circulating srage at baseline has recently been shown to be significantly and independently associated with future risk of t2 dm, coronary heart disease, and all-cause mortality during a median of 18 years of follow-up in a community-based population. however, this latter study was criticized as previous studies had shown higher, but not lower, levels of srage are independently associated with the risk of future cardiovascular disease and all-cause mortality [11, 2022]. moreover, circulating srage levels were shown to be 1,000 times lower than needed to be efficiently capturing the circulating ages and therefore it is unlikely that the low levels of endogenous srage to counteract the detrimental effect of ages might be involved in the future risk of t2 dm or cardiovascular disease [11, 22]. our present finding of no relationship of endogenous srage with ir and beta cell function also supports this explanation. it was previously uncertain whether srage levels alter in prediabetes and whether srage levels hold any relationship with the underlying core defects of diabetes during development of t2 dm, which in the present study we have tried to explore. however, we are fully aware of the limited sample size and the cross-sectional nature of our study. future studies are therefore required to prospectively and serially measure srage levels in the same subjects who develop t2 dm from normoglycemia through prediabetes and to compare srage with the evolution of ir and beta cell dysfunction in those individuals. in summary, we concluded that srage levels do not change in prediabetes and do not show any relationship with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm. these findings suggest that srage is unlikely to be an important predictor of insulin resistance and beta cell dysfunction during development of t2 dm. however, further studies are needed to explore the dynamics of srage during development of t2 dm.

this study examined whether circulating levels of soluble receptor for advanced glycation end products (srage) alter in prediabetes and correlate with insulin resistance (ir) and beta cell function in prediabetes and newly diagnosed type 2 diabetes mellitus (t2 dm). subjects without previous history of diabetes were recruited and grouped as control, prediabetes, and newly diagnosed t2 dm. the control subjects (n=40) and people with prediabetes (n=52) and diabetes (n=66) were similar in terms of age, sex, bmi, systolic and diastolic bp, and fasting insulin level. homa-ir was found significantly higher in people with diabetes than control subjects (p<0.001) and people with prediabetes (p=0.005); and homa-%b was found significantly deteriorated in people with diabetes (p<0.001) compared to control subjects and people with prediabetes. however, serum srage levels did not show any significant alteration in people with prediabetes compared to control subjects. moreover, univariate and multivariate analyses did not identify any significant correlation and statistical association of srage with homa-ir and homa-%b in people with prediabetes and newly diagnosed t2 dm. our data suggest that serum srage levels do not alter in people with prediabetes compared to control subjects and do not correlate or associate with ir and beta cell function during development of t2 dm.

PMC4452360

pubmed-596

radicular low back pain is one of the most common medical problems that cause decreased work competence and a heavy cost. accurate diagnosis of this radicular pain has a paramount important role in proper treatment planning. history taking and physical examination are the first steps in diagnosis of lower extremity radicular pain. in clinical examination of these patients, in addition to the radicular pain, reduced muscle strength, a sensory deficit, and decreased deep tendon reflexes are reported. the use of imaging techniques such as magnetic resonance imaging (mri) is indicated in the patients with atypical or refractory complains to confirm the clinical diagnosis or help to select the proper approach if surgery is necessary. despite the accuracy of the history, physical examination and mri in the lower extremity radicular pain, in some cases for more accurate diagnosis, although mri has sufficient accuracy in the diagnosis of some nondiscogenic sciaticas such as spinal tumors, epidural varicosis, and infectious spinal stenosis, it is incapable of diagnosis in many far out (extraforaminal) spinal stenosis lesions. electrodiagnostic tests can especially provide useful information about the exact location of the nerve damage. among all the electrodiagnostic studies, electromyography (emg) technique has a very high accuracy and specificity in the diagnosis of nerve root pathologies such as denervation and dysfunction [68]. there is little research comparing the accuracy of mri with electrodiagnostic methods in the diagnosis of lower extremity radicular pain; therefore, the aim of this study was to do this in relation to history and clinical findings. at first, 165 patients with sciatica (accompanying lbp) participated in the study. these subjects have been referred to our orthopedic department from november 2008 to december 2011. our inclusion criteria were sciatica>6 weeks, age>15 years, and assignment of the informed consent, while we excluded those cases with a history of lumbar spine surgery, previous trauma, presence of associated disease (like parkinson's disease, tuberculous spondylitis or brucellosis), underlying malignancy or autoimmune disease, and those patients that medically have contraindications for mri or electrophysiologic studies. the remaining 152 patients, 96 patients (63.2%) were males and the rest (56 cases; 36.8%) females. the mean age of the patients was 43 5.8 (range from 22 to 73 years). after a complete explanation of the project was given to the patients, they signed the informed consents. demographic individual profile was recorded in a checklist. the history obtained from patients was about the nature of pain, period of pain, patient's occupation, and other symptoms that all were recorded in the individual checklist. all the patients had lumbosacral x-ray and mri scanning that both were reported by an experienced radiologist. for electrodiagnostic study including both emg and ncv, tibial, peroneal, and femoral nerves were evaluated while for sensory study, sural, saphenus, superficial peroneal, lateral, and posterior cutaneous nerves of thigh were checked. when the nerve root irritation was founded in both mri and electrodiagnostic test, there was a concordance between mri and electrodiagnostic findings. after collection of data forms, positive findings between clinics and paraclinics were compared and analyzed by software package for statistical analysis (spss, version 11), chi-square, and independent t-tests. 67 cases (44.1%) had radicular pain in left lower limb, 46 (30.3%) in right, and 39 (25.6%) in both lower limbs. clinical and paraclinical findings in our patients were shown in tables 1 and 2, respectively. prevalence of abnormal findings in our paraclinical studies is as follows: 104 cases (68.4%) had shown some type of abnormalities in both mri and electrodiagnosis, 30 (19.7%) had shown this abnormality only in mri, 21 (13.8%) only in electrodiagnosis, while 10 cases (6.5%) had both normal mri and electrodiagnostic studies. when the history and physical examination are taken into account, clinical accuracy of our paraclinical studies in lower extremity radicular pain is as shown in table 3. coordination rate (concordant) between mri and the results obtained by the electrodiagnosis was 54%, while concordance of mri and electrodiagnosis with clinical findings was 58.6% and 89.5%, respectively. for example in a paracentral l5-s1 disc herniation, it is obvious that imaging finding would not correlate with its clinical examination or nerve conduction studies. our study compared mri with electrodiagnosis and showed a high positive likelihood ratio for mri, and therefore this method is considered a better modality to confirm the disease, while negative likelihood ratio for electrodiagnosis was high, or this method is a better one to roll out the disease. disc herniation in mri scanning of the asymptomatic patients is a very common finding and therefore decision for surgery based on only mri findings is not justified. as our study showed in the patients with lower extremity radicular pain the high concordance of electrodiagnosis with final clinical diagnosis (89.5% relative to 58.6% in mri scanning) indicated the high accuracy of this modality in these patients. in this study, we found that mri has a less accuracy and more false positive in patients with canal stenosis and the use of electrodiagnosis is very effective especially in cases with multilevel canal stenosis to determine the location of pain. as coster et al. emphasized, electrodiagnosis can not be replaced with mri scanning. in the nondiscogenic sciaticas, the main etiology of the disease (like epidural varicosis, facet joint synovial cyst, etc.) can not be found with this modality. there is not a gold standard method in the diagnosis of lower extremity radicular pain, and especially in deciding to select between surgical and nonsurgical planning, other methods in addition to history and physical examination are sometimes needed. although, mri scanning is a very popular method used to confirm the clinical diagnosis of radicular limb pain, in some cases, it is not suffice to decide the proper treatment planning. in a study conducted by pfirrman et al. (2004), they showed that mri scanning has high accuracy in the diagnosis of discogenic radicular pain, but it is less accurate in the cases with nondiscogenic sciatica. patel and lauerman in a separate study also found the same result. in our research, the highest accuracy rate was found in the patients with disc herniation and spinal stenosis. our study showed that the accuracy of mri scanning in the diagnosis of radicular limb pain (except in discogenic sciatica) is limited and to achieve a definitive diagnosis and treatment planning, other diagnostic methods are sometimes needed. grover in a review confirmed this result. in their study, when mri scanning failed to be helpful in diagnosis and treatment planning, other paraclinical diagnostic methods such as electrodiagnosis have been used successfully. although electrodiagnostic studies are not used as a routine procedure in diagnosis of lower extremity radiculopathies, they may be useful as a diagnostic aid in certain cases. these studies are useful in determining the relatively exact location and extent of nerve root involvement and they may be especially helpful in selecting appropriate treatment planning in mri negative patients (cases with neuritis, diabetic neuropathy, and radiculopathy of an improved herniated disc). clinically, neuropathic pain is sometimes too similar to the sciatic pain. to differentiate between the two, (2007) found that needle electromyography is useful in differentiating symptomatic from asymptomatic disc herniation. they noted that this modality has a lower false positive rate than mri in asymptomatic older patients that being evaluated for lower limb radicular pain. in conclusion, although electrodiagnosis is not used as a routine and standard procedure in the diagnosis of lower extremity radiculopathy, in many mri negative but symptomatic patients, this modality has an important diagnostic value.

introduction. radicular low back pain is one of the most common medical problems. the aim of this study was to evaluate the diagnostic accuracy of mri and electrodiagnosis in lower extremity radicular pain in relation to history and clinical findings. methods. in this cross-sectional study, we studied 165 sciatalgic subjects. a comprehensive history and physical examinations were taken from the subjects and recorded, and then mri scanning and electrodiagnostic (nerve conduction velocity and electromyography) tests were performed. results. from 152 subjects who remained in the study, 67 cases (44.1%) had radicular pain in left lower limb, 46 (30.3%) in right, and 39 (25.6%) in both lower limbs. 104 cases (68.4%) had shown some type of abnormalities in both mri and electrodiagnosis, 30 (19.7%) had shown this abnormality only in mri, and 21 (13.8%) only in electrodiagnosis, while 10 cases (6.5%) had both normal mri and electrodiagnostic studies. coordination rates of mri and electrodiagnosis with clinical findings were 58.6% and 89.5%, respectively. conclusion. in many mri negative but symptomatic subjects, electrodiagnosis has an important diagnostic value.

PMC4045533

pubmed-597

insulinoma is a rare neuroendocrine tumor of the pancreas, accounting for 2% of all pancreatic tumors. its occurrence is 1:100,000 and it is more common in women over 50 years of age. insulinomas are usually solitary benign tumors, and less than 10% of them are malignant2,3). malignant insulinomas are diagnosed when metastases occur, but distinguishing malignant insulinomas from benign insulinomas is difficult histologically. focal nodular hyperplasia (fnh) represents a localized liver cell hyperplasia containing central and/or stellate fibrous scar4). children account for only 7% of cases of this tumor, and fnh comprises only 2% of all pediatric liver tumors5,6). we report a case of an insulinoma in an 11-year-old child who subsequently developed multifocal nodular lesions of the liver after resections of the insulinoma. an 11-year-old girl was admitted for evaluation of recurrent seizures that had begun 5 months before admittance, especially in the morning, despite administration of oral antiepileptic medication. although brain magnetic resonance imaging (mri) and electroencephalogram studies were all normal 2 months before admittance, she again had a seizure and was prescribed with oral levetiracetam to control her seizure attacks. ten days prior to admittance, the patient had been brought to the emergency department due to an ongoing seizure. her serum glucose level was 35 mg/dl and she was controlled seizure by intravenous infusion of 10% dextrose fluids. after discharge, she experienced 3 additional attacks of seizures that had been relieved by grape juice. upon admittance, her height was 161.3 cm (> 97th percentile), and her weight was 47.6 kg (75th<percentile<90th) and her body mass index was 18.8 kg/m (50th<percentile<75th). all vital signs and the physical characteristics of the organs were all normal. initial laboratory results, including a serum glucose level of 104 mg/dl, were unremarkable. a 72-hour fast test was initiated, and the patient demonstrated drowsiness, trembling, and tachycardia after less than 6 hours. laboratory test results during the fast period showed hyperinsulinemic hypoglycemia without ketonuria: the serum insulin level was 50.1 u/ml (normal range, 2.0-25.0 u/ml), serum c-peptide level was 1.81 ng/ml (0.59-1.56 ng/ml), and plasma glucose level was 21 mg/dl (70-100 mg/dl). subsequent glucagon stimulation test results revealed an increase in insulin level to 85.8 u/ml. the mri studies revealed a solid mass, 3 cm2.4 cm in size, with lobulated margins, in the pancreatic tail (fig. 1), with no metastasis, while abdominal ultrasonography (us) and computed tomography (ct) results were normal. the tumor was easily detected due to its superficial position at the end of the pancreatic tail, and no enlarged lymph nodes were detected around the pancreas or metastatic lesions in the abdominal cavity. the pathologic examination indicated that the resected tumor (3 cm3 cm2.5 cm in size) was multilobulated and not encapsulated, and no necrosis was evident. the tumor was of neuroendocrine origin, well differentiated, with an intermediate grade (mitoses 4/10 high-power fields) with angioinvasion. the ki-67 index, a cellular marker for proliferation which<3% means a low grade tumor, was 1% (fig., fasting serum glucose levels were maintained between 110 to 140 mg/dl without any treatment. follow-up mri studies were conducted 2 months after tumor removal, and revealed multiple hypointense nodular lesions in the hepatic segments s5, s6, and s8 (fig. us-guided needle biopsy of the liver yielded a diagnosis of the lesions as fnh, with no necrosis or mitotic activity was noted. since then the patient has been free of hypoglycemia for 2 years, and there was not the learning problem in her school. recent mri studies have shown that the fnh lesions have decreased in size, without any evidence of metastasis. the classical diagnosis of insulinomas is based on whipple's triad: hypoglycemia of serum glucose lower than 50 mg/dl, neuroglycopenic symptoms (such as behavioral or personality changes and seizure), and prompt alleviation of symptoms after administering glucose. malignant insulinoma is extremely rare in the pediatric population, with only a few cases reported in the english literature. distinctions between benign and malignant insulinomas are based on metastasis or the invasion of the primary tumor into the lymph nodes, tissues, or other organs8). insulinomas larger than 3 cm are also more likely be malignant, with local invasion or metastases to the liver9). recently, janem et al.3) reported a pediatric case of malignant insulinoma in the context of a literature review of 9 preceding cases. among the nine cases, five cases showed liver metastasis, two cases showed capsular invasion, and data for the remaining two cases were not available. considering the criteria of malignant insulinoma, which require metastasis or local invasion of adjacent lymph nodes or tissues, these five cases with liver metastasis-together with the case reported by janem et al.3) involving metastasis to the liver, bone, and bone marrow-may be the only true reported malignant insulinomas to date. however, sata et al.10) and janez11) reported cases of malignant insulinomas initially diagnosed as benign, that recurred as liver metastases 8 and 15 years, respectively, after initial removal. neither of these studies confirmed metastasis or invasion during the initial surgery or in subsequent histologic exams of the initial specimens. thus, insulinomas may be considered as tentatively malignant because these rare tumors have unpredictable features and progression through the body. neuroendocrine tumors have recently been identified as risk factors that are strongly associated with aggressive tumor behavior leading to malignancy12). histopathologic grading of tumor cells based on mitosis may aid in prediction of future insulinoma outcomes, as the biologic behavior of low-grade tumors is often rather nonaggressive, whereas high-grade tumors are very aggressive12). our histopathologic findings showed a well-differentiated, intermediate neuroendocrine tumor of the resected insulinoma and our operation field findings revealed no evidence of metastasis. nevertheless, the possibility of malignancy was included due to the size of the tumor and its histological angioinvasion. the unusual multifocal hepatic lesions following tumor removal it has been infrequently documented in adults and children following chemotherapy, radiotherapy, and stem cell transplantation for different types of solid tumors13). the cause is unknown, although one hypothesis is that obstruction of hepatic vessels or abnormal vascularization could account for fnh, as suggested by the reported association with clinical and anatomic findings like hypoplasia or agenesis of the portal vein, vascular malformations, hemangioma and vascular dysplasia, budd-chiari syndrome, and hereditary hemorrhagic telangiectasia14). although ct and mri findings of fnh may commonly include the presence of a central scar and typical enhancement patterns, biopsy is necessary in difficult cases with differential diagnosis of liver adenomas and carcinomas. treatment recommendations regarding fnh are based on longitudinal follow-up of a small series of patients. because fnh is a benign tumor with rare complications, most lesions are followed nonoperatively with serial us or mri, provided that a reliable diagnosis can be achieved using radiologic imaging3,15). hepatic lesions can induce diagnostic problems when metastasis must be ruled out. in our case, hepatic nodular lesions were identified as fnh by needle biopsy, but the association of an insulinoma with the fnh after surgery remains unclear. to our knowledge, this is the first pediatric case report of an insulinoma in which diagnosis was confused due to newly discovered hepatic lesions after tumor resection. close observation and follow-up imaging studies are required in patients who show malignant potential on histopathologic findings.

insulinoma, which arises from insulin-producing pancreatic beta cells, is a rare tumor in children. only 5%-10% of insulinomas are malignant and undergo metastasis. we report a case of an 11-year-old girl who experienced hypoglycemia-related seizures induced by an insulinoma; after resection of the primary tumor, she developed hepatic focal nodular hyperplasia (fnh). laboratory test results indicated marked hypoglycemia with hyperinsulinemia. abdominal ultrasonography (us) and computed tomography results were normal; however, magnetic resonance imaging (mri) showed a solid mass in the pancreatic tail. therefore, laparoscopic distal pancreatectomy was performed. two months after the surgery, an abdominal mri revealed multiple nodular lesions in the liver. an us-guided liver biopsy was then performed, and histological examination revealed fnh without necrosis or mitotic activity. the patient has been free of hypoglycemia for 2 years, and recent mri studies showed a decrease in the size of fnh lesions, without any evidence of metastasis. even though no metastatic lesions are noted on imaging, close observation and follow-up imaging studies are required in a child with insulinoma that has malignant potential on histopathologic findings.

PMC4357775

pubmed-598

cancer is the second leading killer in the usa, accounting for 25% of all deaths. prostate cancer is the most common cancer in males, followed by lung and colorectal. for women however, it should be noted that lung cancer is the number one cancer killer for both men and women (1). an abundance of evidence suggests that lifestyle factors, including exposure to chemical carcinogens (smoking, etc.), diet and inactivity play a major role in the development of these common cancers. in order to understand how lifestyle changes might reduce the risk for the most common cancers we must first understand how cancer develops. unfortunately, many chemicals in the environment are capable of inducing free radical formation to damage dna in the body. thus, at any given time most, if not all, of us might have a number of pre-neoplastic cells. if we are fortunate, the damaged dna sends a signal to genes such as p53 announcing the damage and increasing the protein products of these genes to stop the pre-neoplastic cell from dividing and hopefully repair the damaged dna. if the repair does not work, the cell should be directed to apoptosis or programmed cell death. since cancer is so common in the usa, this might be the result of defects in the p53 gene or the fact that the gene is suppressed by certain factors. defects in the p53 gene have been identified in about half of all cancers, but these defects are usually observed in end-stage cancer. for prostate cancer all early-stage cancer has an intact p53 gene that is suppressed from acting, as we will discuss later. if the p53 gene does not eliminate the defective pre-neoplastic cell, the cell is stimulated to divide (promotion stage) by certain co-carcinogens, leading to the formation of a tumor. thus, to avoid cancer we should try to reduce the initiation stage by reducing exposure to many of the noxious chemical carcinogens present in our environment such as cigarette smoke, pesticides and many other commonly used household products. according to ames (2), the typical western diet also contains a variety of mutagens and carcinogens that may act through the generation of oxygen radicals and lead to the initiation of cancer as well as other degenerative diseases. a diet high in fat and/or refined sugar has been shown to induce oxidative stress (35). consumption of red meat has been associated with cancers of the colon and rectum, breast and prostate. whether it is the meat itself or the associated fat content is not known. cooking meat at moderate to high temperatures forms carcinogenic heterocyclic amines, shown in animal studies to induce colon, breast and prostate cancer (6). conversely, a diet high in whole grains, fruits and vegetables would contain large amounts of natural antioxidants that might play an important role in preventing free radical formation and cancer (2). this type of diet has been shown to reduce oxidative stress in the body (7). a diet high in whole grains, fruits and vegetables, especially if it includes an abundance of soy products would increase the intake of isoflavones, thought to reduce the risk of cancer (8). genistein, the most abundant isoflavone in soy, has been shown in cell culture experiments to increase p21 and caspase 3 to cause cell cycle arrest and induce apoptosis of tumor cells (8). consumption of soy might explain the large difference in many cancers between western and eastern cultures. another factor that has been suggested to explain the difference is the consumption of green tea by eastern cultures. green tea contains epigallocatechin gallate, also shown to be protective in cell culture and animal studies (8). attention has also been focused on the value of omega-3 fatty acids found primarily in fish and certain nuts and seeds. these fatty acids block cox-2 expression and reduce inflammation that has been implicated in the early stages and/or progression of prostate, breast and colon cancers (911). conversely, omega-6 fatty acids found in meat and many vegetable oils increases cox-2 expression. recent studies have shown that non-steroidal anti-inflammatory drugs (nsaids) that block the cox pathway reduce the development of adenomas, precursors of colon cancer, and reduce the risk for prostate cancer (1214). regular exercise has also been shown to increase the body's antioxidant mechanisms (15). in addition to preventing the initiation of cancer, diet and exercise may play an important role in reducing the promotion of cancer and inducing apoptosis by altering hormones such as insulin, testosterone and estrogen or growth factors such as insulin-like growth factor-i (igf-i). the link between smoking and lung cancer was established in the first surgeon general's report in 1964. however, a number of epidemiological studies have reported that exercise lowers the risk for lung cancer as reviewed by lee (16). the large norwegian study of 81 516 men and women followed for 19 years reported a 25% reduction in lung cancer risk for men who walked or cycled for at least 4 h per week, after controlling for smoking habits and the number of cigarettes smoked (17). the mechanism by which exercise might reduce the risk for lung cancer has not been investigated but may be related to the ability of exercise to reduce serum insulin and subsequently igf-i. igf-i has been reported to be a risk factor for lung cancer (18). a high consumption of fruit and vegetables has also been associated with a reduced risk for lung cancer (19). prostate cancer is the most common male cancer in the usa, but has a very low incidence in asia. however, when asian men migrate to the usa and adopt the us lifestyle the incidence of prostate cancer approaches that of us men, suggesting the involvement of lifestyle factors as opposed to a genetic difference (20). in addition, as the developing countries with a low incidence of prostate cancer become more westernized, prostate cancer increases (21). the two lifestyle factors that have received the most attention are diet, especially the fat content, and being sedentary. the international data show a positive correlation between dietary fat and prostate cancer mortality with the lowest rates found in east asian men and the highest rates found in us and european men (22). most of the prospective cohort studies within a given population, however, have failed to show a relationship between dietary fat or fatty food consumption and prostate cancer risk as discussed by moyad (23). the negative results from the cohort studies may be due to the fact that in any given population there is little variation in the dietary fat consumption, or may be due to the inability of questionnaires to accurately measure habitual fat consumption. current evidence implicates omega-6 fatty acids in the promotion of cancers and omega-3 polyunsaturated fatty acids and omega-9 monounsaturated fatty acids as being protective (24). it may also be that in the international data not only do men with a low incidence of prostate cancer mortality consume much lower fat diets, they also tend to be more physically active. epidemiological studies have reported that increased physical activity can reduce the risk for prostate, and other forms of cancer, in us and european men. in a recent review of the literature on physical activity and the risk for prostate cancer, thune and furberg (25) found that 14 of 28 epidemiological studies reported that increased occupational or leisure-time activity reduced the risk for prostate cancer by 1070%. in order to investigate possible mechanisms involved in the roles that diet and exercise play in the progression of prostate cancer, tymchuk et al. (26) developed a bioassay using serum to stimulate prostate cancer cells in culture. by placing men on a low-fat diet consisting primarily of grains, fruits and vegetables, and regular, supervised exercise they examined serum changes in vivo and their effect on prostate cancer cell growth in vitro. the subjects were participants or employees from the pritikin longevity center residential program. during their stay at the center, food was prepared and served buffet style to the participants and consisted of 1015% of calories from fat (polyunsaturated/saturated fatty acid ratio=1.24), 1520% of calories from protein, and 6575% of calories from carbohydrates, primarily unrefined. carbohydrates were in the form of high-fiber whole grains and other complex carbohydrates (5 servings/day), vegetables (4 servings/day), and fruits (3 servings/day). protein was primarily derived from plant sources with non-fat dairy allowed for up to 2 servings/day. fish or fowl was served in 3.5 ounce portions 1 day/week and in soups or casseroles 2 days/week. the diet contained<100 mg of cholesterol per day and alcohol, tobacco and caffeinated beverages were not allowed during the program. prior to starting the exercise training, subjects underwent a graded treadmill stress test. based on the results, the subjects were provided with an appropriate training heart rate value and given an individualized walking program. the exercise regimen consisted of daily walking at the training heart rate for 4560 min. in the initial study tymchuk et al. (26) found that just 11 days of the low-fat diet and exercise program reduced serum-stimulated lncap prostate cancer cell growth by 30%. serum samples obtained from men (employees) who had adhered to the low-fat diet and exercise program for an average of 14 years showed an additional 15% reduction in lncap cell growth. lncap is a well-established, androgen-dependent cell line, developed from a patient with prostate cancer. when the serum samples from the men following the low-fat diet and exercise program were used to stimulate pc-3 cells, an androgen-independent cell line typical of advanced prostate cancer, no reduction in cell growth was found (26). in a subsequent study ngo et al. (27) confirmed the diet and exercise reduction in lncap cell growth using another androgen-dependent, patient-derived cell line, lapc-4. a control group of similar aged men without any intervention were studied over an 11-day period and no change in lncap cell growth was found. in an earlier study tymchuk et al. (28) had reported that men attending the pritikin longevity center low-fat diet and exercise program had significant reductions in serum insulin and significant elevations in sex hormone-binding globulin. the increase in shbg should lower the serum levels of free testosterone and estradiol, and might be a factor in the reduction in lncap cell growth observed following diet and exercise as this cell line is androgen dependent and has a mutated androgen receptor that binds both testosterone and estradiol. (26,29) confirmed the reduction in serum free testosterone in the pritikin participants and subsequently reported that insulin, testosterone and estradiol could individually stimulate the growth of lncap cells. however, when these hormones were added individually, or in combination, to the post diet and exercise serum they could only account for half of the reduction in lncap cell growth, indicating the involvement of other important factors. (30) developed a model similar to figure 2 and started to investigate igf-1 and its binding proteins. the igf axis consists of igf-i, igf-ii, six different binding proteins (igfbp 16) and two receptors, igf-ir and igf-iir. igf-i is a peptide growth factor produced by the liver and other tissues, and is known to play a pivotal role in regulating cell growth, differentiation and apoptosis (programmed cell death) (18,31). it is also a potent mitogen for most tissues including the prostate (18,31). according to yarak et al. igfbp-3 is the most abundant and binds 90% of the circulating igf-i but is not affected by different metabolic states and ngo et al. (33) found that the low-fat diet and exercise program decreased not only the fasting serum level of insulin, but also igf-i while increasing igfbp-1. these changes in serum levels of igf-i and igfbp-1 are thought to be due to the changes in serum insulin and its impact on the liver. (34) reported that insulin stimulated the production of igf-i by hepatocytes. (27) added igf-i back to the diet and exercise serum, the reduction in lncap cell growth was completely eliminated. when igfbp-1 was added to the baseline serum, they observed a significant reduction in lncap cell growth. in addition to being a regulator of cell growth, igf-i has been reported to be a suppressor of apoptosis in several different studies (35). (27) studied apoptosis in their cell culture system using two different methods, annexin-v and tunel. almost no apoptotic or necrotic cells were found in the fetal bovine serum (fbs) control or the pre diet and exercise samples. however, both the annexin-v and tunel staining methods showed a significant increase in apoptosis in the post diet and exercise-serum-stimulated samples. the fact that very little apoptosis was observed in the control serum-stimulated lncap cells may be the result of the high levels of igf-i and low levels of igfbp-1 in the control serum and may help to explain why prostate cancer is so prevalent in the usa. in an attempt to separate out the individual effects of diet versus exercise observed in their earlier studies with the androgen-dependent prostate cancer cell lines, barnard et al. (36) obtained serum samples from men who had been involved in the adult fitness program at the university of nevada, las vegas. the men were matched in age with a control group of men on no diet or exercise program, and for age and duration of participation to the long-term diet and exercise subjects previously studied. volunteers were requested who had participated in the program for at least 10 years; the average was 14.7 years. the program was held 5 days per week for 1 h and consisted of warm-up and flexibility activities followed by 4550 min of continuous, strenuous exercise including calisthenics and swimming laps in the pool. serum insulin and igf-i were lower in the exercise and diet+exercise groups compared to controls, but were not significantly different from each other. igfbp-1 was higher in both the exercise and the diet+exercise groups compared to controls and was significantly higher in the diet+exercise group compared to the exercise group. when the serum was used to stimulate the lncap cells in culture, growth was reduced in both the exercise (65% fbs control) and diet+exercise (55% fbs control) groups compared to the control group where the growth was 99% of the fbs. the staining results from the two methods demonstrated that exercise as well as diet and exercise intervention increases apoptosis in the lncap cells. when the slides from the tunel staining were quantitatively analyzed, almost twice as much apoptosis was found in the diet and exercise samples compared to the exercise-only samples. the fact that apoptosis was higher in the diet+exercise subjects is in agreement with the significantly higher igfbp-1 levels compared to the exercise-only group. in an attempt to focus on the possible mechanisms involved in the reduction in lncap cell growth and increased apoptosis observed in the exercise-serum-stimulated samples, leung et al. several studies have shown that igf-1 suppresses the action of p53 that is phosphorylated and stabilized when defects are found in dna. the increase in p53 protein normally activates other genes or factors to cause cell cycle arrest, dna repair or to induce apoptosis (34). the serum-stimulated cell cultures were lysed, centrifuged and the supernatant analyzed for p53 protein and was found to be significantly increased in the lysates from the exercise-serum-stimulated lncap cells compared to controls. these results also demonstrate that the lncap cells have an intact p53 pathway that is suppressed with serum from control subjects. according to gurumurthy et al. (35) an intact p53 pathway is characteristic of all early stage prostate cancer. in end-stage prostate cancer defects have been reported in the p53 gene. to further investigate the involvement of the p53 pathway in the exercise-serum-stimulated lncap cell growth reduction and induction of apoptosis, leung et al. ln-56 is a lncap-derived cell line in which p53 was rendered non-functional by expression of a dominant negative fragment of p53, known as genetic suppressor element 56. the results from the growth assay showed no significant difference between the control and exercise groups when the serum was used to stimulate the cells. the exercise-serum-stimulated growth in the ln-56 cells was 91% of the fbs control compared to 65% of fbs control for the lncap cells. when they examined apoptosis in the ln-56 cells, the exercise-serum-stimulated cells showed half the apoptosis observed with the control-serum-stimulated cells. this was opposite to the response observed in the lncap cells where apoptosis was greatly increased in the exercise-serum-stimulated cells. collectively, the results from these experiments indicate that the reduction in serum igf-i and increase in igfbp-1 resulting from adopting a very-low-fat diet and/or regular exercise allows the prostate tumor cells to stabilize the p53 protein and activate downstream effectors to reduce cell growth and induce apoptosis. these data also provide a mechanism to explain the epidemiological data showing a reduction in the risk for prostate cancer in men who take part in regular exercise (25). if the observations of reduced cell growth and the induction of apoptosis reported for the cell culture studies with androgen-dependent prostate cancer cell lines also occur in the body, then a very-low-fat diet and exercise program might be of value in the treatment of prostate cancer patients, especially those with early-stage cancer. in order to investigate the possible effectiveness of a very-low-fat diet and exercise program on prostate cancer patients, ornish and colleagues (38,39) randomized a group of men on watchful waiting to control or to diet and exercise intervention. the patient all had biopsy-documented prostate cancer, psa ranging from 4 to 10 ng/ml, and a gleason sum of<7 prostate adenocarcinoma. the men in the diet and exercise intervention group were prescribed a vegan diet with 10% of calories from fat supplemented with soy, 3 g/day fish oil (omega-3 fatty acid) and 400 iu/day vitamin e. the exercise was to be aerobic (walking, jogging etc.) for 3060 min 6 days/week. patients were also encouraged to practice stress management techniques including yoga, breathing, imagery etc. for 1 h/day. after 1 year, changes in serum psa were small but statistically significant, with the control group showing an increase and the diet and exercise group showing a drop. also, at the end of 1 year, six of 43 in the control group had gone on for conventional treatment due to rising psa while none of the 41 in the diet and exercise group had treatment. there was very high adherence to the diet and exercise program and even some in the control group had made significant lifestyle changes. serum samples from these patients were used in the lncap cell bioassay. compared to baseline, cell growth was reduced by 9% in the control group and by 60% in the diet and exercise group. the growth rate in the baseline samples was not significantly different from what had previously been observed with serum from men without prostate cancer. breast cancer is the most common female cancer in the usa and, like prostate cancer, is hormone-dependent in the early stages. the influence of lifestyle factors in breast cancer is supported by the large international variation and the migration studies (40,41). even though breast cancer is initially an estrogen-dependent cancer, most breast cancer occurs in postmenopausal women. with the menopause estrogen levels drop but do not completely disappear as estrogen is produced via aromatase activity, primarily in fat cells. thus, it is not surprising that obesity is a risk factor for postmenopausal breast cancer. elevated serum estradiol has also been shown to be a risk factor for breast cancer in postmenopausal women (42). like prostate cancer, the international data show a strong, positive correlation between per capita fat consumption and breast cancer incidence and mortality (40). epidemiological studies in countries with a high incidence of breast cancer, such as the usa, have shown that regular exercise reduces the risk for breast cancer. in their review, thune and furberg (25) reported that occupational or leisure time physical activity reduced the risk for breast cancer in 26 of 41 studies by 30% in pre-, peri- and postmenopausal women. in 16 of 28 studies a graded dose heber et al. (43) studied postmenopausal women attending the pritikin center and reported that the 3-week, low-fat diet and exercise program lowered serum estradiol from 18.1 3.6 to 9.4 2.4 pg/ml. in a subsequent study (44) they reported serum changes in premenopausal women placed on the pritikin diet for 2 months at the ucla clinical research center. however, serum estradiol was reduced by 25% during the follicular phase and by 22% during the leuteal phase while serum estrone was reduced by 19 and 18%, respectively, during the two phases. shbg, produced primarily in the liver, regulates the amount of free hormone available to interact with the hormone receptors. insulin suppresses the production of shbg by the liver. in a more recent study (45) with postmenopausal women attending the pritikin 3-week diet and exercise program, serum insulin was reduced by 39% and shbg increased by 39% in women on hormone replacement therapy (hrt). in women not on hrt, insulin was reduced by 19% and shbg increased by 42%. the drop in insulin may be very important as insulin has been reported to be a risk factor for both estrogen positive and negative breast cancer (46). barnard rs, liva m, ngo tm, varr bc and hong j (unpublished) recently studied changes in the igf axis in postmenopausal women attending the pritikin program. in 18 women on hrt, igf-i was reduced from 170 22 to 142 13 pg/ml and igfbp-1 was increased from 55 8 to 71 10 pg/ml while insulin was reduced from 14.5 2 to 9.1 1 iu/ml. these changes in the igf axis are important as igf-i has been reported to be a risk factor for breast cancer and it is now well established that there is interaction between the igf and estrogen receptor pathways in breast cancer (18,47). cancer of the colon and/or rectum is the second leading cause of cancer deaths in the usa and is the third most common cancer in both men and women. over the years there has been a lot of controversy regarding the involvement of lifestyle factors in intestinal cancer. this may be due, in part, to different site-specific etiologies of the cancer. like the previous two cancers, colorectal cancer shows a large international variation that armstrong and doll (40) attributed to the variation in dietary fat consumption. prior to this, burkitt (48) suggested that other dietary factors such as fiber and refined sugar played a more important role. he suggested that the removal of fiber by refining carbohydrates reduced stool bulk and increased transit time as well as adversely affecting intestional flora. adenomas are precursor lesions of colorectal cancer and are informative endpoints for assessing cancer risk. (49) showed inverse associations between fiber intake and colorectal adenoma. on the other hand, studies in the usa, finland and sweden reported no protective effect of fiber (5052). one large cohort study in us men, the health professionals follow-up study, did find a significant inverse association of distal adenomas and soluble but not insoluble fiber intake (53). the exact reason for the inconsistency in the cohort studies is not known but may be due to the fact that the populations have been rather homogeneous with relatively low fiber intakes or may be due to the inability of food questionnaires to accurately predict habitual fiber intake. the recent european prospective investigation into cancer and nutrition (epic) study involved 519 978 individuals with fiber intakes that ranged from 13 g/day for the lowest quintile to 34 g/day for the highest quintile (54). comparing the highest to the lowest quintile of fiber intake they found a relative risk for large bowel cancer of 0.75. even this intake of 34 g/day was lower that the 50+ g/day originally described by burkitt. after evaluating the scientific evidence, the european cancer prevention consensus panel concluded in 1998 that there was good evidence to support the protective effect of fiber against colon (and breast) cancer (55). two recent papers have suggested that hyperinsulinemia resulting from consumption of high-fat, refined-sugar diets may be an important factor in the etiology of colorectal cancer (56,57). this might be related to our proposed model for prostate cancer as igf-i has also been found to be a risk factor for colon cancer (18). a high-fat diet (corn oil) has also been reported to increase colon mucosa igf-i receptors in rats (58). the involvement of hyperinsulinemia and elevated igf-i might also be related to the epidemiological studies showing a reduction in intestinal cancer with increased physical activity. according to friedenreich and orenstein (59), the most definitive evidence for an association between physical activity and cancer exists for colon cancer. of 51 studies on colon or colorectal cancer, 43 demonstrated a reduction in risk in the most physically active men and women with an average reduction of 4050% and values as high as 70% for the most physically active. (60) recently examined the relationship between lifestyle factors and p53 mutations in colon tumors. they concluded that a western-style diet high in refined sugar and red meat was correlated with p53 mutations while no association was found with physical activity. this, to our knowledge, is the first study to show a relationship between diet and p53 mutations, whether or not a western-style diet can cause p53 mutations remains to be demonstrated. reddy et al. (61) studied colon cancer risk factors in eight women attending the pritikin program by collecting stool samples over 2 days and diet records over 3 days before the start and at the end of the 3-week program. dietary fat intake decreased from 34 to 7% of calories and fiber increased from 17 to 37 g/day during the residential program. total stool bile acid was reduced from 9.7 2 to 4.5 1 mg/g dry weight. more important was the very significant reduction in the secondary bile acids, deoxycholic and lithocholic acid that suggests a change in the intestinal flora. the reduction in secondary bile acids should be important as they are thought to be the most carcinogenic bile acids (62). intervention trials with bran, soluble fiber or vegetables have not reduced recurrence rates of adenomatous colorectal polyps (6365). going back to burkitt's original work, not only did the african natives have a very low incidence of colorectal cancer with a high fiber intake, they also consumed a very-low-fat diet and were very physically active. thus, it may be that total lifestyle modification is needed to reduce cancer risk, not simply modification of one aspect. in his presidential address to the american cancer society in 1966, joseph burchenal (66) suggested that the study of one form of cancer might provide guide-posts to the understanding of another related form of cancer. this suggestion seems to relate to hyperinsulinemia, the igf axis and their associations with several forms of cancer. however, the true unifying factor for most cancers seems to be lifestyle: smoking, a high-fat and refined-sugar diet along with a lack of physical activity. these lifestyle factors can easily be changed and may prevent most types of cancer. by adopting a diet consisting primarily of whole grains, fruits and vegetables with limited amounts of meat, primarily chicken or cold-water fish, and doing 4560 min of daily exercise, one could achieve significant changes in hormones and growth factors known to be associated with cancer as shown in figure 3. primary prevention trials to test this hypothesis are difficult to conduct due to the large number of subjects, the prolonged time required and the cost. however, secondary prevention trials like the ornish study (38,39) with prostate cancer or the colorectal adenoma recurrence studies may provide important scientific evidence for the value of these lifestyle changes. a model showing steps in the development of cancer. a model explaining the role of diet and a sedentary lifestyle in the development of prostate cancer [after barnard et al. a model explaining how a change in lifestyle to include a low-fat, high-fiber diet plus regular exercise might reduce the risk for cancer.

cancer is the second leading cause of death in the usa and an abundance of evidence suggests that lifestyle factors including smoking, the typical high-fat, refined-sugar diet and physical inactivity account for the majority of cancer. this review focuses on diet and inactivity as major factors for cancer promotion by inducing insulin resistance and hyperinsulinemia. elevated levels of serum insulin impact on the liver primarily, increasing the production of insulin-like growth factor i (igf-i) while reducing the production of insulin-like growth factor binding protein 1 (igfbp-1) resulting in stimulation of tumor cell growth and inhibition of apoptosis (programmed cell death). adopting a diet low in fat and high in fiber-rich starch foods, which would also include an abundance of antioxidants, combined with regular aerobic exercise might control insulin resistance, reduce the resulting serum factors and thus reduce the risk for many different cancers commonly seen in the usa.

PMC538507

pubmed-599

microbial contamination and side effects of synthetic antioxidants are two important major concerns of food and pharmaceutical industries. increasing propensity for replacing synthetic antioxidant by natural one on one side and development of microbial resistance to existing antibiotics from the other has encouraged researchers toward appraising medicinal plants for dual antioxidant and antimicrobial properties. though, since immemorial time, medicinal plants have been used to treat and prevent various human ailments and they are considered as reservoir of bioactive compounds.1, 2 till date, biological properties and bioactive compounds of many medicinal plants are not studied. extensive investigation of medicinal plants for biological activities and bioactive compounds is the crucial and the foremost step in development of effective alternative medications. in view of this, in the present study, bergenia ciliata sternb. (family saxifragaceae), a high value plant of the sikkim himalaya, has been investigated for antioxidant, antimicrobial activity and bioactive compounds. it is an important perennial medicinal herb that grows widely in the temperate himalaya between 1500 and 3000 m asl. the plant has been in use as folklore medicine since ancient times for dissolution of kidney and gall bladder stones.4, 5 in sikkim himalaya, bergenia rhizome is used to treat fractured bones, fresh cuts, wounds, diarrhea, pulmonary infections, vomiting, fever, cough and boils by locales.6, 7, 8 bergenia is also used for the treatment of heart disease, haemorrhoids, stomach disorders and ophthalmia. in addition, it is accredited with analgesic, antiviral, anti-inflammatory and antimalarial properties.9, 10 the plant's virtues, to a large extent, are attributed to its secondary metabolites such as bergenin, gallic acid and catechin which are therapeutic and account for its use in traditional medicine.11, 12 despite the widespread use of this plant in traditional medicine, the scientific literature with respect to its biological properties is scanty. to the best of our knowledge, so far, antioxidant, antimicrobial properties and the bioactive compounds associated with the leaf of bergenia plant, growing in the sikkim himalaya, have not been investigated. therefore, the present study was conducted with the objectives to (1) obtain the most effective solvent for extracting the potent bioactive compounds, especially phenolics and flavonoids, (2) investigate different extracts for antioxidant and antimicrobial activities and, (3) quantify the amount of bergenin, catechin and gallic acid present in the leaf extracts of b. ciliata. leaves of b. ciliata were collected during flowering season (march 2014) from the plants growing in the arboretum of g.b. pant institute of himalayan environment and development (gbpihed), sikkim unit, gangtok, india (latitude 27 21 35.7n; longitude 88 37 24.4e), situated at the elevation of 2047 m asl. the leaves were washed thoroughly under running tap water and finally with distilled water and dried on blotting paper at room temperature to get consistent weight. 2 g powder was soaked separately in 10 ml of different solvents (ethyl acetate, methanol and hexane) for 24 h. the supernatant was transferred into a new tube and the residue was re-extracted twice with 10 ml solvent. each extract was resuspended in the methanol to yield a 50 mg/ml stock solution. the yield of the extraction was calculated from {(w1/w2) 100 }, where w1 is the weight of extract after evaporation of solvent and w2 is the dry weight of the plant sample. solutions of each extract (100 l; 1 mg/ml) were taken individually in test tubes. to this solution, 2.5 ml of 10-fold diluted folin after 3 min, 2.0 ml of 7.5% na2co3 solution was added and the mixtures were incubated for 30 min. the absorbance of the reaction mixtures was measured at 760 nm by using a spectrophotometer (uv-1800, shimadzu, kyoto, japan). gallic acid was used as a standard and tpc of bergenia extracts was expressed in milligram gallic acid equivalents (mg gae/g extract). total flavonoid content was determined by the aluminum chloride calorimetric method, with some modifications. then, the sample solution (2 ml) was mixed with 2 ml of 2% alcl3. after 10 min of incubation at ambient temperature, the absorbance of the solution was measured at 435 nm by using a spectrophotometer (uv-1800, shimadzu, kyoto, japan). the flavonoid content was expressed as milligram quercetin equivalent (mg qe/g extract). the effect of extracts on 2,2-diphenyl-1-picrylhydrazyl (dpph) radical was determined using the method of liyana-pathiranan and shahidi. a solution of 0.135 mm dpph in methanol was prepared and 1.5 ml of this solution was mixed with 1.5 ml of extract in methanol. the reaction mixture was mixed thoroughly and left in the dark at room temperature for 30 min. the ability of sample to scavenge dpph radical was calculated by the following equation: dpph radical scavenging activity (%)=[(abs control abs sample)]/(abs control) 100where abs control is the absorbance of dpph radical+methanol; abs sample is the absorbance of dpph radical+extract/standard. ic50 value is the concentration of extracts at which dpph radicals are scavenged by 50%. the lower ic50 value indicates higher radical scavenging capacity and vice versa. the 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) the abts radical cation solution was prepared by mixing equal quantities of abts (7 mm) and ammonium persulfate (2.45 mm) and allowing them to react for 1620 h at room temperature, in dark. the working solution was then prepared by diluting the previous solution with methanol until the absorbance at 734 nm was 0.706 0.02. plant extracts (1.5 ml) were allowed to react with equal volume of the abts working solution and the absorbance was taken at 734 nm after 7 min using the spectrophotometer. the abts scavenging capacity of the extracts was compared with that of bht and the percentage inhibition was calculated as: abts radical scavenging activity (%)=[(abs control abs sample)]/(abs control) 100where abs control is the absorbance of abts radical+methanol; abs sample is the absorbance of abts radical+extract/standard. abts radical scavenging activity of extracts was determined by ic50 value as mentioned above in dpph assay. total eight strains (4 bacteria, 2 actinomycetes and 2 fungi) were taken from microbial culture collection established in the microbiology laboratory of gbpihed institute, almora, india. initially test organisms were grown on the respective media i.e. bacteria and actinomycetes in tryptone yeast extract (ty) and fungus on potato dextrose broth (pd) in conical flask, at 25c for 24 h. antimicrobial activity was performed on ty and pd agar plates following disc diffusion assay at 25c, 2 days for bacteria and 6 days for actinomycetes and fungus. minimum inhibitory concentration (mic) of extracts was determined following the protocol of clinical and laboratory standards institute (clsi).17, 18 all of the experiments were performed in triplicate, and results were expressed as diameters (mm) of inhibition. detection and quantification of catechin, gallic acid and bergenin were carried out using shimadzu 20 ad, hplc system (shimadzu, japan) consisted of uv detector, a binary pump, a 10 l injection loop, and reverse phase c-18 column of dimensions 4.6 250 mm. the mobile phase used for catechin was 75% a (water+0.1% trifluoroacetic acid) and 25% b (methanol) with a flow rate of 0.8 ml/min. the eluted samples were detected by the uv detector at 280 nm. for gallic acid, mobile phase used was 90% a (water+1% acetic acid) and 10% b (acetonitrile) with a flow rate of 1.0 ml/min. for analysis of bergenin, elution was carried out with solvent 75% a (water+0.1% trifluoroacetic acid) and 25% b (acetonitrile) as mobile phase having flow rate of 1.0 ml/min. calibration curve was constructed by plotting the peak area (y) against concentration in g/ml of standard solutions (x). the standard equation obtained from the curve all the experiments were performed in triplicate and the experimental data were expressed as mean standard deviation (sd). one-way analysis of variance (anova) and duncan's multiple range tests were carried out to determine significant differences (p<0.05) between the means by spss (version 16.0). results showed that leaf extraction yield of b. ciliata varied considerably as a function of solvent nature and ranged from 8.3 to 38.2% with a descending order of methanol>ethyl acetate>hexane (table 1). extraction with methanol resulted in the highest amount of total extractable compounds whereas the extraction yield with hexane was small in comparison to other solvents. higher extraction yield in methanol might be due to the fact that it easily penetrates the cellular membrane and extracts the intracellular ingredients from the plant material. moreover, results indicated that the plant contains more of polar substances than the others. earlier reports have also suggested that methanol give higher extraction yield than the other solvents such as acetone, diethyl ether, ethyl acetate and water.19, 20 the antioxidant activity of medicinal plants, fruits and vegetables has been reported to be positively correlated to their total phenolic contents due to their ability to scavenge free radicals.21, 22 it becomes, therefore, mandatory to estimate total phenolic compounds present in the bergenia extracts. in the present study, the content of extractable phenolic compounds was determined through a linear gallic acid standard curve (y=2.271x+0.18; r=0.995). the highest content of total phenolic compounds was detected in the bergenia methanolic extract (473.4 mg gae/g extract) followed by ethyl acetate extract (249.7 mg gae/g extract) (p<0.05). in the hexane these results demonstrate clearly that the content of phenolic compounds is dependent on the polarity of the solvent used; higher the polarity of the solvent, higher the content of phenolic compounds. these results are in agreement with the previous study of singh et al. that reported methanol as an effective solvent for antioxidant extraction, phenolic compounds in particular. flavonoids are common secondary metabolites present in plants which are responsible for many plant biological activities. the solvent efficiency on tfc, in ascending order was: hexane<methanol<ethyl acetate. the highest flavonoid content of 208.4 mg qe/g extract was observed in the extract of ethyl acetate followed by methanol extract (89.9 qe/g extract). these results are in agreement with the report of hajji et al. which reported that flavonoid content in extract depend on solvent polarity. the dpph free radical scavenging activity in leaf extracts of b. ciliata is presented in fig. 1. the methanolic leaf extract showed excellent free radical scavenging activity (ic50=53.5 g/ml). in other two leaf solvent extracts, the free radical scavenging activity in ethyl acetate extract (ic50=2593.3 g/ml) was superior to that of the hexane extract (ic50=3026.7 g/ml). nevertheless, when compared to standard, the bht, all the tested bergenia leaf extracts showed significantly (p<0.05) lower dpph radical scavenging activity. these results are indicative of the influence of the solvent on the antioxidant activity of the biological extracts. it has been reported that in plant compounds with different polarity and structure are present that dissolve in specific solvents having similar polarity.24, 25 the difference in the dpph radical scavenging activity in different solvent extracts implies towards the preference of the solvents for extraction of different types and concentrations of bioactive compounds.24, 25 strong dpph radical scavenging activity of b. ciliata methanolic extract can be due to higher content of total phenolic compounds. the free radical scavenging activity of bergenia extracts was also determined using abts radical. significant difference (p<0.05) was revealed between abts scavenging capacities of extracts measured as ic50 value (fig. 2). the highest abts radical scavenging activity was found in methanol extract with an ic50 value of 5.4 g/ml, whereas hexane extract exerted the lowest ability to scavenge abts radical with an ic50 value of 51 g/ml. strong abts radical scavenging ability of b. ciliata methanol and ethyl acetate extracts can be attributed to the presence of flavonoids. earlier, it has been reported that abts radical scavenging ability of bioactive compounds depends on its molecular weight, structure and presence of number of aromatic rings. the correlation coefficients determined between the antioxidant activities and the total phenolic and flavonoid contents in all the b. ciliata leaf extracts revealed the presence of significant high correlation (p<0.1). the correlation for dpph ic50 value vs tpc and dpph ic50 value vs tfc were 0.913 and 0.056, respectively. results indicate clearly that the dpph activities of extracts are mainly due to the total phenolic compounds. negative correlation indicated that with the increase in phenolic and flavonoid content, concentration of extract required to inhibit free radical decreases. the correlation for abts ic50 value vs tpc and abts ic50 value vs tfc were 0.911 and 0.782, respectively, imply that both the total phenol and flavonoids of b. ciliata are responsible for abts activities. these differences in correlation between phytochemicals and antioxidant assays could be attributed to the different mechanism of the radical antioxidant reaction. in accordance with this study, li et al. have also reported high negative linear correlation between the phenolic contents and ic50 values in angelicae sinensis confirming that phenolics are likely to contribute to the antioxidant activity of the extracts. however, presence of other metabolites which have significantly contributed in antioxidant activity of b. ciliata extracts can not be ruled out. the results of the disc diffusion assay (table 2) revealed that all the extracts tested were effective against the bacteria and actinomycetes studied, but showed no activity against fungi. among the tested extracts, methanol extract was found to be the most effective which showed the highest effects against bacillus megaterium strain with inhibition zone of 9.8 mm, followed by nocardia tenerifensis and bacillus subtilis with inhibition zones of 9.7 and 8.8 mm, respectively. the ethyl acetate extract showed the similar pattern of microbial inhibition with highest inhibition zone of 7.5 mm for b. megaterium, followed by 6.2 and 5.5 mm inhibition zone for n. tenerifensis and b. subtilis, respectively. in contrary to methanol and ethyl acetate extract, the hexane extract had the greatest inhibitory effects against serratia marcescense (5.0 mm) and b. subtilis (4.7 mm). the minimum inhibitory concentration (mic) was determined in the methanolic extracts of b. ciliata due to its higher antimicrobial activity in disc diffusion assay against the tested organisms. the methanol extract gave the lowest minimal inhibitory concentration against b. subtilis with mic of 1250 g/ml (table 3). the highest antimicrobial activity of methanolic extract could be due to the high contents of phenolic compounds and flavonoids present in the extract. these results are in accordance with a previous study where similar observations were recorded in case of bergenia ligulata leaf extracts. b. ciliata is reported to contain a wide array of pharmaceutically important bioactive compounds.9, 29, 30 among all, three main compounds viz., bergenin catechin and gallic acid are the most sought after compounds of the plant species. during the past years, efforts have been made for identification and quantification of the major bioactive compounds from bergenia spp.5, 28, 30, 31, 32 however, till date, b. ciliata plant of the sikkim himalaya has never been analyzed for secondary metabolites. to the best of our knowledge, this is the first report on this aspect. in the present study, different extracts of b. ciliata were analyzed by hplc for the identification and quantification of bergenin, catechin and gallic acid. standards showed high linearity at tested concentrations with correlation coefficients (r) of 0.99, 0.96 and 0.99 for catechin, gallic acid and bergenin, respectively. the chromatographic peaks of the analytes were confirmed by comparing their retention time with those of the standards. from the standard equation obtained (table 4), the amount of bergenin, catechin and gallic acid calculated in different extracts is presented in table 5. bergenin was detected in all the extracts and amount of bergenin was found in the order: methanol>ethyl acetate>hexane. the methanol extract contained bergenin (2.43 0.08%) in amounts that were orders of magnitude higher than those in the ethyl acetate (1.63 0.17%) and hexane (0.0024 0.00%) extracts. hplc analysis of catechin and gallic acid revealed that these compounds were present in methanol extracts only (table 5). in this study, the antioxidant and antimicrobial activities of b. ciliata plant growing in the sikkim himalaya are reported for the first time. the methanolic extracts of b. ciliata leaves, that were shown to contain the highest total phenolic and flavonoid compounds, exhibited high free radical scavenging activity against dpph and abts radicals. further, hplc analysis of different extracts for catechin, gallic acid, and bergenin showed that methanolic extract contained significantly higher amount of these bioactive compounds.

bergenia ciliata sternb., commonly known as paashaanbhed, is a well known herb of sikkim himalaya with various pharmaceutical properties. however, scientific exploration of b. ciliata, growing in the sikkim himalaya, for phytochemicals and pharmacological properties is in infancy. with this view, the present study was undertaken to investigate b. ciliata leaf extracts for antioxidant, antimicrobial activity and bioactive compounds. three solvents viz., methanol, ethyl acetate and hexane were used for extraction and the respective leaf extracts were analyzed for total phenolic and flavonoid contents along with the antioxidant and antimicrobial activities. amongst the tested solvents, methanol was found to be the best solvent for extraction with highest total phenolic contents and the lowest ic50 values for the 2,2-diphenyl-1-picrylhydrazyl (dpph) and 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (abts) assays. methanol extract also exhibited effective antimicrobial activity, particularly against bacteria and actinomycetes. further, high performance liquid chromatography (hplc) analysis revealed that methanolic extract contains the highest amount of all the three analyzed bioactive compounds viz. bergenin, catechin and gallic acid. the current study suggests that the methanol extract of b. ciliata is a potential source of natural antioxidant and antimicrobial compounds that can be used in food and drug industries.

PMC5388066

pubmed-600

abo incompatible blood transfusions are rare, result in haemolytic transfusion reactions (htr), and they can be fatal in 2 to 6% of cases. it is enough to transfuse only 10-15 ml of abo incompatible blood to cause following symptoms of acute htr: fever, hypotension, disseminated intravascular coagulation (dic), complement-induced acute intravascular hemolysis and acute renal failure. in adults, thrombotic thrombocytopenic purpura (ttp) is idiopathic in approximately one-third of cases and in the remainder it is encountered in a variety of potentially triggering clinical situations (so-called secondary ttp), including pregnancy, malignancies, drugs, infection, auto-immune disorders and after haemopoietic stem cell transplantation. secondary thrombotic ttp is a life-threatening condition and is characterized by an aggressive course, it requires prompt treatment at the outset. in case of delayed or inadequate treatment mortality rate may be close to 100%. to date, there is no report in the literature about secondary ttp caused by abo incompatible blood transfusion. we present a case of ttp developed after a htr in the setting of cardiac bypass surgery. a 64-year-old male patient developed nausea, vomiting and chills during red blood cell (rbc) suspension transfusion on the second day of coronary by-pass surgery. caring physicians recognized an error in labeling of the rbc suspension. with a preliminary diagnosis of abo incompatible transfusion reaction, hemoglobin values dropped and lactate dehydrogenase (ldh) and serum creatinine levels started to increase proportionally. urine color was darkened with a gradual development of oligo-anuria and acute kidney injury (aki). on the 7 day of transfusion, ttp was diagnosed according to following criteria: thrombocytopenia, microangiopathic anemia, increase in ldh level, and development of aki. after 11 and 15 sessions of hemodialysis and plasmapheresis, respectively, platelet, ldh, urea, creatinine levels and urine output improved. the patient showed a dramatic improvement, and plasmapheresis and hemodialysis were stopped subsequently. on the 41 day of admission he had bloody diarrhea and c. difficile toxin a was found to be positive in feces and vancomycin was administered for pseudo-membranous enterocolitis. on the 50 day, multiple infarctions were seen on cranial ct that was performed for the evaluation of confusion. blood urea, creatinine and ldh levels increased, hemoglobin and platelet levels decreased again. the pertinent laboratory data and major interventions are chronologically illustrated in [table 1]. every 1 of 14000 blood transfusions are erroneous, and among them 1 of 13000 are abo incompatible. the pathogenesis of htr is most likely related with activation of complement and hemostatic system, which leads to attachment of host antibodies to red blood cell antigens of incompatible donors blood. as a result, it can modify the intravascular hemolysis and initiate symptoms such as nausea, vomiting, chills, fever and dark appearance of urine, which were evident in our patient during and after transfusion. in addition, studies presented relation between abo groups, clearance of ultra large von willebrand factor multimers (ulvwf), deficiency of adamts13 and risk of ttp development. adamts13 is a circulating zinc metalloprotease, responsible to cleave the ulvwf, thereby the multimers become progressively smaller due to cleavage by adamts13. deficiency of adamts13 leads to a shift of plasma ulvwf multimers to larger sizes, adhesion with platelets and its aggregation, leading to endothelial injury with activation of thrombosis cascade. data from terrell et al. demonstrated that blood group o is an independent risk factor for ttp associated with severe adamts13 deficiency. o abo blood group, but we could not documented the adamst13 deficiency due to unavailability of the lab technique at our institution at that time. the initiating mechanism of secondary ttp include drug toxicity, radiation and high-dose chemotherapy, angioinvasive fungal or viral infections, surgery and acute graft versus host disease. ttp also appear to differ in their response to therapy. primary or idiopathic form responds to plasmapheresis 80% of the cases whereas this rate is very low in secondary forms. the clinical course of our patient showed a severe relapse despite an initial complete biochemical and clinical response. recently canadian apheresis group conducted a phase ii trial to test the beneficial effects of rituximab in idiopathic ttp. in this form of the disease, actually this study was planned after reporting of many cases in which rituximab was shown to be beneficial. and the authors concluded that autoimmune deficiency of adamts 13 may be due to yet unidentified autoantibodies and while plasmapheresis clears circulating autoantibodies, treatment modalities such as rituximab precludes further antibody production via blockage of b cells. postoperative ttp have been described after a number of surgical operations, most common of which is open heart surgery. ttp developed after five to nine days after surgical operation in most of the case reports. however, it has been proposed that extensive endothelial damage during surgery may lead to release of high-molecular weight von willebrand factor (hmw-vwf) multimers in substantial amounts sufficient to overwhelm the capacity of the vwf-cleaving enzyme. however, despite thousands of cabg operations worldwide at each year, only a handful of cases have been reported. this may in part be related to presence of confounding factors such as blood loss, hemodilution, severe infection, dic, and heparin induced thrombocytopenia commonly in the early course of cabg. another explanation may be the rare patients who have genetically low levels of cleavage enzyme. ttp secondary to abo incompatible blood transfusion has never been reported in the literature to date. we hypothesize a potential mechanism which may account for the development of ttp in this setting. however, ttp developed in our patient in the setting of open heart surgery. after the abo incompatible blood transfusion, dic usually develops if sufficient amount of incompatible blood is transfused. we know that dic is self-limited provided that underlying inciting disease is well controlled. however, thrombocytopenia in our patient developed 1 week after the offending event and lasted for weeks despite normal coagulation tests (inr and aptt), which is unusual in the setting of dic. another supporting finding in favor of ttp was a favorable response to plasmapheresis performed with fresh frozen plasma. it is very difficult to discriminate whether transfusion of abo incompatible blood or open cardiac surgery or the combination of the two actually initiated the process. perhaps, both factors worked hand-in-hand. however, one clinical observation supports our hypothesis of blood transfusion as the initiating factor. none of the ttp cases secondary to surgery had relapsed unless the patient underwent a second operation. however, this was not the case in our patient who developed a relapse after near complete improvement of laboratory and clinical parameters. despite initial recovery, he developed a second bout which was complicated by multiple cerebral thrombi and subsequently died. given the complex picture of early postoperative phase of cabg and the presence of potential confounders, many cases of postoperative ttp may have been missed. prompt recognition is of utmost importance because of not only high mortality rate when left untreated but also to institute specific therapies availability of efficient therapeutic maneuvers to our knowledge, this is the first report of ttp secondary to abo incompatible blood transfusion.

the triggers of secondary thrombotic thrombopcytopenic purpura (ttp) include drug toxicity, radiation and high-dose chemotherapy, angioinvasive infections, surgery and acute graft versus host disease. ttp secondary to surgery have been reported in a number of cases. most of the cases have been occurred after open heart surgery. extensive endothelial damage is held responsible as the initiating mechanism in postoperative ttp cases. however, there is no report of secondary ttp describing development owing to abo incompatible blood transfusion. here, we describe a patient who developed ttp after transfusion of abo incompatible blood during hospitalization for bypass surgery. we also propose a hypothesis which may account for the possible underlying mechanism.

PMC3796903