Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

A rapid algorithm for identifying NCS in heavy-atom sites is described. N 5 comparisons to be made, where N is the number of sites to be examined, including crystallographically related locations. A method described here based on considering only sets of sites that have common interatomic distances reduces the computational time by several orders of magnitude. Additionally, searches for proper symmetry allow the identification of NCS in cases where only one heavy atom is present per NCS copy.An important component of a fully automated system for structure solution and phase improvement through density modification is a capability for identification of non-crystallographic symmetry as early in the process as possible. Algorithms exist for finding NCS in heavy-atom sites, but currently require of the order of Kleywegt & Read, 1998et al., 1997et al., 1976et al., 1988et al., 1974N 5 comparisons to be examined, where N is the number of heavy-atom sites in the region considered for NCS, including all crystallographically related sites.Non-crystallographic symmetry (NCS) can be a powerful aid in improving the quality of macromolecular electron-density maps might be NCS-related to another set (D–E–F) if all the interatomic distances in the first set match interatomic distances in the second set . The method of Lu (1999The basic idea of this method is similar to that of Lu 1999. Imaginef Lu 1999 is to exA–B–E) cannot possibly be related to a second set (C–D–F) if any one of the three intertomic distances does not match. This means that if A—E does not match C—F, we do not have to even consider the distances A—­B, B—E etc. Furthermore, it means that the pairs A–E and C–F, which have different interatomic distances, never have to be considered as corresponding parts of triplets in combination with any other sites. This vastly reduces the number of comparisons that need to be made.The computational requirements of this method can be greatly reduced by noting that a set might conceivably be NCS-related to any other pair (e.g. C–F). The distances in Table 1A–B, for example, might be related to the pair D–E or D–F (because the interatomic distances are the same), but not to the pairs C–D or C–E or C–F (because the distances are very different).For example, suppose we have six heavy-atom positions in space group C–D, C–E and C–F need never be compared with the pair A–B because they will be far apart in sequence in this list. This is the key element of the present method.It is possible to take advantage of the requirement for pairs of distances to match by sorting all pairs of sites according to their interatomic distances and only performing comparisons using pairs of sites that are close together in sequence in the list. In this way, for examples, the pairs A–B is considered as a possible pair of vertices in a triangle representing three sites in one NCS copy. All possible other pairs that could conceivably be the corresponding two vertices in an NCS-related triangle are then listed. These other pairs must share the same interatomic distance. In this case there are only two such possibilities (D–E and D–F), both of which have the same interatomic distance as A–B (20.6 Å). These matching pairs can be obtained without performing comparisons among all pairs because the three pairs A–­B, D–E and D–F will all be very close together in the list of pairs sorted by interatomic distances.Continuing with the example in Table 1A–B corresponds to D–E. All remaining sites could be considered as possible third vertices in the two triangles. Once again, however, the fact that the interatomic distances must match reduces the number of comparisons that have to be made. In this simple example, there are just two sites (C and F) that are not yet used, but in another case there might be hundreds. The approach in this case is to note that if site C becomes part of the first triangle with A–B and F becomes part of the triangle with D–E, then the distance A—C must match the distance D—F. Accordingly, the pairs A–C and D–F must be close in sequence in the list of pairs sorted by interatomic distances and only such pairs of pairs need to be considered. In this example, A–C and D–F are both 20.6 Å and this combination is plausible. In the case of the twofold axis considered in Table 1A–B–F and D–E–C) is also possible and in fact equally plausible.At this point, a reasonable possibility (among many) for Table 12.m pairs of sites has the potential for representing m NCS copies only if all m pairs share (approximately) the same interatomic distance d.The core of this method is the sorting of all pairs of sites according to their interatomic distances. The possible pairs of sites that need to be considered can then be limited to those with similar interatomic distances. In general, a set of The first step is to generate a list of all unique sites crystallographically equivalent to any one of the heavy-atom sites, but as close to the origin as possible. This list is then expanded using crystallographic symmetry to include all sites within a specified distance of the origin, which by default is chosen to be the smallest of the cell translations. This expansion must be over a large enough volume that all the NCS copies are represented at least once.The second step is to sort all pairs of sites in this list according to their interatomic distances. This is the key step in this procedure; only pairs of sites near to each other in the sequence of this list can be corresponding pairs in different NCS copies.a can only be related to three sites from NCS copy b if each set of two sites from copy a matches a set of two sites from copy b. Consequently, it is possible to build up a potential set of three sites in two NCS copies a and b as follows. Firstly, start with two pairs pair1a and pair1b of sites that have equal interatomic distances d1. Then consider all additional sets of two pairs of sites pair2a and pair2b with equal interatomic distances d2. Finally, consider only the intersection of these two groups where one atom in pair1a is the same as one atom in pair2a and one atom in pair1b is the same as one atom in pair2b. In this case, the three atoms in pair1a and pair2a share all interatomic distances with the three atoms in pair1b and pair2b. These groups are reasonable candidates for being NCS-related. Additionally, any additional sets of three atoms with the same set of interatomic distances are reasonable candidates for being part of a larger group of NCS-related molecules.The third step is to find two or more sets of three sites that have all interatomic distances in common. This step is greatly aided by the sorting of pairs of sites carried out in step 2, because a set of three sites from NCS copy m sets of three atoms is found for which all sets have the same interatomic distances, a set of transformations relating the m NCS copies can be identified . Any additional atoms that are related to other atoms by these transformations can then be identified and grouped into the corresponding NCS copies.Fourthly, once a group of The fifth step is to refine and score potential NCS solutions. A solution is refined by grouping all the heavy-atom sites into NCS copies (or not including them), then refining the NCS transformations to minimize the r.m.s. deviation among NCS-related sites. The scoring is performed in much the same way as described by Lu 1999. A set oa and b are compared. Let N aNCS, and N bNCS, be the numbers of sites that are part of an NCS copy for solutions a and b and let N aSYM, and N bSYM, be the number of NCS copies for solutions a and b. If solution a has the same or higher symmetry compared with solution b and solution a has more sites as part of an NCS copy , solution a is always considered better. Also, if solution a has lower symmetry , but has many more sites as part of an NCS copy , then solution a is always considered better.Based on these guidelines, two solutions aNCS, and r.m.s.d.bNCS,, for solutions a and b, respectively). The second is a variable which is 1 if the NCS has point-group symmetry and 0 if not . The third is the r.m.s. distance among all the sites in each NCS group . Whichever of the two solutions has the lower r.m.s.d. of NCS-related sites from positions predicted by NCS is considered better. If these are equal, then whichever solution has the greater point-group symmetry is considered better. If these are also equal, then whichever solution has the lower r.m.s. distance among all the sites in each NCS group is considered better. If all these are also equal, the solutions are considered to be of equal quality.If all these are equal, then three more quantities are calculated for each solution to help identify which solution is more likely. The first quantity is the r.m.s.d. of the NCS-related sites from positions predicted by NCS , a red fluorescent protein with 26 selenium sites (Yarbrough et al., 2001et al., 2000SOLVE (Terwilliger & Berendzen, 1999These approaches for finding NCS in heavy-atom sites were tested using the locations of Se atoms in four data sets containing between nine and 66 sites and containing either proper twofold or threefold symmetry or improper NCS containing up to six copies Table 2. The casFINDNCS, using defaults for all parameters or half the cell dimensions as limits for the search region, whichever was successful in the shorter time. In the cases of the 26 sites in red fluorescent protein and the 66 sites of AEP, the FINDNCS program was unable to complete the search as a matrix used in calculation was singular.In each case the algorithms described above found the known NCS. The CPU time required for finding, sorting, scoring and coming up with a single solution for each case ranged from 1 to 78 s. This compares with 600 to over 10 000 s using the brute-force methods described by Lu 1999 and implThe approach described here can find NCS relationships in many cases, but does have limitations. For example, some distance cutoff must be used in considering whether two pairs of atoms are likely to be NCS-related, or an infinite number of possibilities would have to be considered. In practice, a cutoff of the smallest of the cell translations works well for this, but in some cases NCS could still be missed. At the other extreme, a cutoff for how similar two distances must be for them to be considered to be NCS-related is also necessary. The cutoff of half the resolution works well in many cases, but might not in cases where heavy-atom sites are not in quite the same places in different molecules. Also, in some cases the scoring system used to choose the NCS may not be optimally weighted. The user has the option to specify the number of NCS copies, however, and this can be used to limit the search to that number.4.RESOLVE (Terwilliger, 2000The methods described here for rapid identification of NCS in heavy-atom substructures are well suited to being a part of automated structure-solution procedures because they are robust and very quick. They have already proven very useful in automatic NCS symmetry averaging in

CXCR2 chemokine ligands CXCL1, CXCL5 and CXCL6 were shown to be involved in chemoattraction, inflammatory responses, tumor growth and angiogenesis. Here, we comparatively analyzed their expression profile in resection specimens from patients with colorectal adenoma (CRA) (n = 30) as well as colorectal carcinoma (CRC) (n = 48) and corresponding colorectal liver metastases (CRLM) (n = 16).Chemokine expression was assessed by microdissection, quantitative real-time PCR (Q-RT-PCR), the enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry (IHC).In contrast to CXCL6, we demonstrated CXCL1 and CXCL5 mRNA and protein expression to be significantly up-regulated in CRC and CRLM tissue specimens in relation to their matched tumor neighbor tissues. Moreover, both chemokine ligands were demonstrated to be significantly higher expressed in CRC tissues than in CRA tissues thus indicating a progressive increase in the transition from the premalignant condition to the development of the malignant status. Although a comparative analysis of the CXCL1/CXCL5 protein expression profiles in CRC patients revealed that the absolute expression level of CXCL1 was significantly higher in comparison to CXCL5, mRNA- and protein overexpression of CXCL5 in CRC and CRLM tissues was much more pronounced in comparison to CXCL1 .Our results demonstrate a significant association between CXCL1 and CXCL5 expression with CRC and CRLM suggesting for both chemokine ligands a potential role in the progression from CRA to CRC and thus, in the initiation of CRC. To date, colorectal cancer (CRC) constitutes one of the leading causes of cancer-related deaths worldwide. In spite of many currently available and continuously improving therapies for early stage colon cancer, the majority of CRC patients develop metastases which worsen the prognosis for survival dramatically ,2.The development of cancer metastases is a complex process consisting of various interacting mechanisms, which involve numerous biochemical and immunological changes like abnormally expressed growth factors and cytokines . One gro+ and ELR- CXC chemokines, based on the presence or absence of the amino acid sequence Glu-Leu-Arg (ELR) preceding the first conserved cysteine amino acid residue in the primary structure of the CXC chemokines. All three chemokines under investigation contain the ELR motif, which is important for ligand/receptor interactions and the regulation of CXC chemokine induced angiogenesis , CXCL5 and CXCLogenesis -15.+ CXC chemokines is mediated by the G-protein-coupled receptor CXCR2 , which has recently been associated with CRC pathology and various other tumor types [+ CXC chemokine family, CXCL6 is a neutrophil chemoattractant that was recently demonstrated to promote tumor growth through its angiogenic effects in human tumors and animal models [All three genes are structurally related to another member of the ELRor types -21. Likel models ,23.Involvement of CXCL5 has also been reported in different neoplastic processes with major focus on non small cell lung cancer (NSCLC), where CXCL5 was shown to be an important angiogenic factor . Accordi2 (PGE2) was shown to induce the expression of CXCL1 in human CRC cells and to induce microvascular endothelial cell migration and tube formation in vitro [The third ELR+ chemokine under investigation, CXCL1, originally identified as melanoma growth stimulating activity, has recently been adressed a role in HIV-infection and corrin vitro . Moreovein vitro and downin vitro .Despite the increasing number of studies indicating a role for CXCL1, CXCL5 and CXCL6 in different cancer types and processes, their relevance with view to the development of CRC is still rather limited. Thus, we were prompted to investigate their expression profiles in colorectal adenoma (CRA) specimens as premalignant stages in the development of CRC, further in CRC tissues of different tumor categories and corresponding colorectal liver metastases (CRLM), to track potential differences in the expression levels between the transition from a premalignant condition to a colorectal malignancy.Surgical specimens and corresponding normal tissue from the same samples were collected from patients with CRA (n = 30), CRC of different tumor categories (n = 48) and synchronous or metachronous CRLM n = 16) who underwent surgical resection at our department between January 2003 and october 2006. Informed consent for tissue procurement was obtained from all patients. The study was approved by the ethics commission of the Ärztekammer of the Saarland, Germany. The clinical variables presented in Table 6 who undet al.) and examined for the presence of tumor cells. As minimum criteria for usefulness for our studies we only chose tumor tissues in which tumor cells occupied a major component (> 80%) of the tumor sample.Tissue samples were collected immediately after resection, snap frozen in liquid nitrogen and then stored at -80°C until they were processed under nucleic acid sterile conditions for RNA and protein extraction. Tumor samples were taken from vital areas of histopathologically confirmed (R.M.B. and M.W.) adenocarcinomas and liver metastases, respectively. As corresponding normal tissue we used adjacent unaffected mucosa, 2–3 cm distal to the resection margin from the same resected adenocarcinoma or liver specimen, respectively. All tissues obtained were reviewed by a minimum of two experienced pathologists . The reaction conditions were 10 min at 25°C, 30 min at 48°C, and 5 min at 95°C.Total RNA was isolated using RNeasy columns from Qiagen according to the manufacturer's instructions. RNA integrity was confirmed spectrophotometrically and by electrophoresis on 1% agarose gels. For cDNA synthesis 5 μg of each patient total RNA sample were reverse-transcribed in a final reaction volume of 50 μl containing 1× TaqMan RT buffer, 2.5 μM/l random hexamers, 500 μM/l each dNTP, 5.5 mM/l MgCl® UNG (Applied Biosystems) and 1 μL gene assay, 8 μL RNase-free water and 1 μl cDNA template (50 mg/l). The theoretical basis of the Q-RT assays is described in detail elsewhere [T values for each RNA sample.Expression profiles of CXCL1, CXCL5 and CXCL6 were monitored in CRA and CRC tissue specimens and corresponding CRLM by Q-RT-PCR. Adjacent, disease and tumor free colorectal epithelium and liver samples served as control groups, respectively. All Q-RT PCR assays containing the primer and probe mix were purchased from Applied Biosystems and utilized according to the manufacturer's instructions. PCR reactions were carried out using 10 μl 2× Taqman PCR Universal Master Mix No AmpEraselsewhere . All reaT values falsely represent the variations, we converted the individual CT values to the linear form as follows:Gene expression of all target genes was analyzed in relation to the levels of the slope matched housekeeping genes phosphomannomutase (PMM1) and cyclophilin C (CycC) . Since rConsequently, the normal tissue becomes the 1 × sample, and all other quantities are expressed as an n-fold difference relative to this tissue.Protein lysates from frozen tissues were extracted with a radioimmunoprecipitation (RIPA) cell lysis and extraction buffer . Total protein content was assessed by using the Pierce BCA protein assay reagent kit (Pierce).Tissue concentrations of CXCL1, CXCL5 and CXCL6 in the lysates were determined by sandwich-type ELISA according to the manufacturer's protocol: R&D systems . The absorbance was read at 450 nm.Operative specimens were routinely fixed in formalin and subsequently embedded in paraffin. Before staining, 4-μm thick paraffin-embedded tissue sections were mounted on Superfrost Plus slides, deparaffinized and rehydrated in graded ethanol to deionized water. The sections were microwaved with an antigen retrieval solution and after blocking of endogenous peroxidase activity with 3% hydrogen peroxide, the sections were further blocked for 30 minutes with normal rabbit serum. Overnight incubation at 4°C with primary goat polyclonal anti-human CXCL5 antibody or primary goat anti-human CXCL1 antibody was followed by incubation of secondary biotinylated biotinylated rabbit anti-goat IgG antibody and the avidin-biotin-peroxidase reaction . After colour reaction with aminoethylcarbazol solution , tissues were counterstained with haematoxylin. Negative controls were performed in all cases omitting primary antibody. All pictures were taken using a digital camera .Laser microbeam microdissection (LMM) was employed for obtaining pure tumor cell and pure normal cell samples for subsequent genetic analysis. LMM was performed on three samples for each tissue type for CXCL1, CXCL5 and CXCL6. Histochemical staining was used on cryo sections before microdissection. Specimen preparation, microdissection and catapulting were performed following a laser pressure catapulting protocol according to the manufacturer's instructions . RNA was extracted using the P.A.L.M. RNA extraction kit and for reverse transcription the invitrogen reverse transcription kit was applied. Subsequently quantitative PCR analysis was performed.P value of 0.05 or less was deemed significant. To measure how variables are related we performed a bivariate correlation analysis using the spearman ρ correlation coefficient.Expression profiles of CXCL1, CXCL5 and CXCL6 in the different groups are shown as mean and standard error of the mean (SEM). Statistical calculations were done with the MedCalc software package . Where aP < 0.001, respectively; Fig. P < 0.05). In contrast, no significant up-regulation of CXCL6 mRNA expression was observed in either tissue type , which did not occur for CXCL1 or CXCL6 as demonstrated in Figures P < 0.05, Fig. CXCL1 and CXCL5 protein expressions, as assessed by ELISA, showed a significant up-regulation in the CRC tissue specimens in comparison to the unaffected corresponding mucosa tissues, respectively (P < 0.05) of almost 14000 pg/ml compared to approximately 4000 pg/ml CXCL5 Fig. .This study provides evidence that significantly increased CXCL1 and CXCL5 expression associates with the transition from a premalignant condition to colorectal malignancies. In contrast, CXCL6 showed no association with colorectal malignancies in our studies. CXCR2, the corresponding receptor, respectively, showed also significant up-regulation in CRC tissues and no significant up-regulation in the CRA tissues thus matching the expression profile of CXCL1 and CXCL5.As we have shown previously (21) CXCL8 mRNA and protein expression is significantly up-regulated in CRC specimens in relation to CRA and UC tissues. Moreover, CXCL8 expression revealed a close correlation with tumor grading. Most interestingly, CXCL8 up-regulation was most enhanced in synchronous and metachronous CRLM, if compared with the corresponding primary CRC tissues thus suggesting an association between CXCL8 expression, induction and progression of colorectal carcinoma and the development of colorectal liver metastases. Thus, we observed for the expression levels of CXCL8, CXCL1 and CXCL5 a significant association with the development of colorectal carcinoma and also CRLM. For CXCL8 we also observed on the protein level that the expression was significantly higher in tumor stage 4 in comparison to the lower tumor stages. Also Q-RT-analysis revealed a similar effect for CXCL8.However, in recent years a number of studies have emerged demonstrating CXCL6 involvement in tumor development and angiogenesis in various animal models and human tumors ,23. ThusDespite the increasing number of studies suggesting a cancer-related role for CXCL6, we observed no significant CXCL6 up-regulation in CRC tissues or CRLM, neither on the RNA nor on the protein level. Moreover, we measured no significant difference in CXCL6 expression between CRA, CRC or CRLM tissues in our patient cohort. In contrast, both other chemokines under investigation, CXCL1 and CXCL5, showed significant RNA and protein up-regulation in all colorectal malignancies comprising CRC and CRLM tissues. Accordingly, our IHC results confirmed that this up-regulation resulted from tumor cells as we detected intense CXCL1 and CXCL5 staining signals in CRC and CRLM specimens mainly concentrated in the epithelial cells of these tissues.These findings are supported by a number of recent studies adressing a cancer-related role to these chemokines.Thus, elevated CXCL5 protein levels have been reported in CRC patients and in h2 induced the expression of CXCL1 in the human CRC cells and also microvascular endothelial cell migration and tube formation in vitro. Moreover, the authors observed that PGE2 promoted tumor growth in vivo by induction of CXCL1 expression resulting in increased tumor microvessel formation. In murine models of squamous cell carcinoma and Lewis lung cancer CXCL1 expression was shown to parallel tumor growth [Also CXCL1 has recently been shown to promote tumor growth and angiogenesis in different tumor types. In human CRC cells, Wang et al demonstrr growth ,39 and ir growth ,41 as wer growth ,42,43 CXr growth . Accordir growth investigr growth .In line with these findings we also observed significant up-regulation of CXCL1 in neoplastic colorectal tissues. Moreover, we found significantly elevated CXCL1 expression in the CRA tissues of our patient cohort. However, both chemokines CXCL1 and CXCL5 were shown to be significantly higher expressed in the CRC tissues in comparison to the CRA tissues. Since CRA constitutes a premalignant condition often preceding the development of colorectal malignancies, we hypothesized that a significant increase of chemokine expression in the CRC tissues with respect to the CRA tissues may indicate a transition from the premalignant condition to the development of the malignancy. This conclusion is supported by previous studies showing elevated GROa expression in the intestinal mucosa of patients with ulcerative colitis and Crohn's disease which are known risk factors for the development of CRC ,45. AlthIn our study, we outlined a prominent expression profile for both chemokines, CXCL1 and CXCL5 with respect to CRC pathology. On the basis of the current literature CXCL1 appears to have a role in CRC related malignancies. However, CXCL5 exhibited a much more pronounced significant overexpression in the CRC and CRLM tissues with respect to the CRA tissues thus indicating a vast progressive increase in the transition from the premalignant condition to the development of the malignant status and thus, in the initiation of CRC. Since our results are based merely on descriptive expression data, future functional tests will be needed for further evaluation of the precise pathophysiological role. However, the CXCL1 and CXCL5 expression profiles outlined in this study strongly recommend monitoring the CXCL1 and CXCL5 expression in patients with CRA and CRC. Thus, we suggest that targeting CXCL1 and CXCL5 signaling may be a useful future tool in CRC pathology.The authors declare that they have no competing interests.All authors read and approved the final manuscript.CR is responsible for the design of the study, interpretation of the results and drafted the manuscript. VOF took part in all experimental elements, performed the ELISAs and IHCs and participated in scientific discussions and interpretation of the results. MW examined the tissue sections for the presence of tumor cells, histopathologically confirmed all tissues under investigation, participated in scientific discussions and data interpretation. JS contributed to the collection of tissue specimens and provided clinical information. SG participated in the statistical analysis. RMB contributed to the histopathological survey and participated in scientific discussions. MKS is responsible for the provision of all the patient material and clinical information, participated in scientific discussions, data interpretation and revision of the manuscript.The pre-publication history for this paper can be accessed here:

Oxidative stress is a state in which there is disequilibrium between pro-oxidant processes and the antioxidant defense system in favor of the former and occurs as a consequence of increased production of free radicals or when the antioxidant defense system is inefficient or a combination of both events. A disturbance in the antioxidant defense system, including antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GSHPx), due to free radical-induced oxidative injury has also been implicated in various neuropsychiatric disorders. Hence the role of these antioxidant enzymes and the changes in their level in blood and correlation with oxidative stress and the overall mechanism of defense were studied in a common psychiatric illness, schizophrenia.Fifty subjects of either sex ranging in age from 18 to 60 years, divided into two age groups (< 40 years and >40 years), diagnosed for schizophrenia; and 50 age- and sex-matched normal subjects as controls were included in the study. Blood samples were collected for the determination of malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GSHPx), and reduced glutathione (GSH).Significantly lower levels of the two antioxidant enzymes were found in schizophrenics compared to normal controls, with an increased oxidative stress as indicated by high blood MDA levels. The condition worsened with advancing age, smoking, among literate masses, and in chronic schizophrenics; whereas gender did not show any effect.It can be concluded that an imbalance in the antioxidant defense system, along with enzymatic antioxidants, occurs in schizophrenia due to the persistent oxidative stress. Modern life style perhaps also contributes to the condition. Free radicals are species normally produced during cellular metabolism in aerobic cells, containing one or more unpaired electrons, highly reactive and can combine with a great variety of biomolecules, changing their physicochemical characteristics. The brai25The potential toxicity of free radicals is counteracted by a number of cytoprotective enzymes and antioxidants that limit the damage.11 This p12n = 25) and elderly subjects . All the subjects were thoroughly screened and diagnosed for schizophrenia at the OPD of Psychiatric Center, SMS Medical College, by one of the authors using the ICD-10 diagnosis criterion. A complete clinical and personal history of the subjects was recorded and consent to participate in the study was taken. Subjects with education up to 10th standard were considered literates. The smokers were taking 10 or more cigarettes per day, and nonsmokers were absolutely free from the habit [The study was performed on 50 schizophrenic patients of either sex ranging in age from 18 to 60 years and divided into two groups: young subjects , an indicator of oxidative stress, measurinResults were statistically explained by Students t-test, and correlation coefficient (r) was done between SOD, GSHPx, GSH, and MDA.P < 0.001) higher in schizophrenics, indicating increase in level of oxidative stress due to schizophrenia.[2.- and H2 O2 produced in plasma, decreased significantly (P < 0.001) in schizophrenics as compared to controls [P < 0.001) reduction in the level of reduced glutathione with increasing oxidative stress [The results of this study indicate an impaired activity of major intracellular antioxidant enzymes SOD and GSHPx due to increased oxidative stress inherent in schizophrenia. The level of MDA, an indicator of oxidative stress and an end product of lipid peroxidation, measured as thiobarbituric acid-reactive substance (TBARS), was significantly to H2 O2 and oxygen, and GSHPx reduces this H2 O2 to water.[The modern stressful living, especially in the literate subjects, and self-pollution in the form of smoking have worsened the situation, thus contributing to oxidative stress. This can be attributed to the disturbance in the overall mechanism of generation of free radicals and their consequent neutralization due to oxidative stress in schizophrenia, where SOD is utilized for neutralizing the free radical superoxide ion (Oto water. Schizophto water.21Age seems to have a definite impact on lipid peroxidation in the presence of antioxidant deficit. This imbalance in the antioxidant enzyme levels may be attributed as a resistance against the developing stress because the antioxidant enzymes are the first line of defense.The disturbance of the oxidant-antioxidant equilibrium now becomes quite evident in schizophrenia owing to the abnormal activity of the critical enzymes SOD and GSHPx. Depleted antioxidant status due to increased utilization with increasing oxidative stress has been reported.2324 Howe23Thus, a disturbance in the activities of antioxidant enzymes occurs in schizophrenia due to the increased oxidative stress, which further intensifies with the aging process and chronic stage of the illness. The gift of modern world, a stressful life; and a polluted environment also take their toll and deteriorate the condition of the schizophrenics. This also emphasizes the importance of nutrient antioxidant supplementation to support the entire antioxidant defense system.

The tissues and organs of multicellular eukaryotes are frequently observed tocomprise complex three-dimensional interspersions of different cell types. It isa reasonable assumption that different global patterns of gene expression arefound within these different cell types. This review outlines general experimentalstrategies designed to characterize these global gene expression patterns, based ona combination of methods of transgenic fluorescent protein (FP) expression andtargeting, of flow cytometry and sorting and of high-throughput gene expressionanalysis.

Hemoptysis is a very common symptom in the practice of pulmonary physicians of India. We present a case of uncontrolled hemoptysis managed with bronchial artery embolization. Bronchial artery embolization is an effective treatment for patients with hemoptysis. Serious complications are rare, but may occur if the arterial supply to other structures is compromised. Massive hemoptysis usually originates from the systemic arterial supply to the lung. Episodes of hemoptysis may be managed by several approaches, depending on the urgency of the situation, ranging from medical management and bronchial artery embolization (BAE) to surgery. Bronchial artery embolization is a well-accepted and effective form of treatment for massive and recurrent hemoptysis. Bronchial arteries are small vessels that arise directly from the descending thoracic aorta and supply blood to the airways of the lung, esophagus, and lymph nodes.‐3 BronchA 69-year-old male patient came with complaints of cough and hemoptysis from last one year. The symptoms were not relieved by conservative medications. There was no contact history with any case of pulmonary tuberculosis in the family or neighbourhood. Patient gave no history of any chronic illness, surgery or hospital admission in the past. The patient was a chronic smoker for the past 30 years. The patient was given a trial of anti tubercular treatment for six months but with no relief. Other than crepitations in right inframammary area, rest of the physical examination and routine laboratory work up was inconclusive. Repeated sputa examination for AFB were negative.Chest X-ray revealed unfolding of aorta, hazy right parahilar and para cardiac area . USG whoSources of pulmonary bleeding include the low pressure pulmonary circulation and the high pressure bronchial circulation (at systemic blood pressure). Bronchial circulation arises from the aorta and therefore has systemic arterial pressure. The bronchial arteries are the main supply of the airways and the supporting structures of the lung while pulmonary arteries supply the lung parenchyma and respiratory bronchioles. Bronchial circulation is the source of massive hemoptysis in 90% of cases.et al.[10et al. and 97%.et al. The probet al.et al 2005[Bronchial artery embolization might be the only treatment option available to patients who are not fit to undergo surgery. Bronchia14et al 2008[et al 2005[et al 1999[et al 2004[µm Embosphere particles. The authors suggested that the Embosphere particles had crossed the bronchiopulmonary shunt into the systemic circulation. Severe but rare complications are neurological deficiencies and pulmonary necrosis.[5BAE is an alternative safe and effective nonsurgical treatment for patients with massive hemoptysis which can be done simultaneously on both sides. Success rate is about 88%. Intervent al 2008 reportedt al 1999 concludet al 1999 There hat al 1999, posterit al 1999 and Acutt al 1999 Vinaya et al 2004 reportednecrosis. Neurolognecrosis. Recurrenecrosis.515 ProximThis case has been presented with the view that in cases of hemoptysis, bronchial biopsy should not be jumped to and the possibility of vascular nature of the tumor should be kept in mind and thoroughly discussed so that if required bronchial artery embolization could be done to control hemoptysis and to avoid massive bleeding during bronchial biopsy.

SALL4 is a member of the SALL gene family that encodes a group of putative developmental transcription factors. Murine Sall4 plays a critical role in maintaining embryonic stem cell (ES cell) pluripotency and self-renewal. We have shown that Sall4 activates Oct4 and is a master regulator in murine ES cells. Other SALL gene members, especially Sall1 and Sall3 are expressed in both murine and human ES cells, and deletions of these two genes in mice lead to perinatal death due to developmental defects. To date, little is known about the molecular mechanisms controlling the regulation of expressions of SALL4 or other SALL gene family members.This report describes a novel SALL4/OCT4 regulator feedback loop in ES cells in balancing the proper expression dosage of SALL4 and OCT4 for the maintenance of ESC stem cell properties. While we have observed that a positive feedback relationship is present between SALL4 and OCT4, the strong self-repression of SALL4 seems to be the “break” for this loop. In addition, we have shown that SALL4 can repress the promoters of other SALL family members, such as SALL1 and SALL3, which competes with the activation of these two genes by OCT4.Our findings, when taken together, indicate that SALL4 is a master regulator that controls its own expression and the expression of OCT4. SALL4 and OCT4 work antagonistically to balance the expressions of other SALL gene family members. This novel SALL4/OCT4 transcription regulation feedback loop should provide more insight into the mechanism of governing the “stemness” of ES cells. The SALL gene family , comprised of SALL1, SALL2, SALL3, and SALL4, was originally cloned based on a DNA sequence homology to the Drosophila gene sal. In humans, SALL1 is mutated in patients with Townes-Brockes Syndrome (TBS), with features that include renal, limb, anal, and ear malformations Parallel to its important role in development, the SALL gene family has been found to be expressed in human and murine ES cells and during early developments. SALL4 is expressed in the 2-cell stage of the embryo, similar to OCT4, while expression of SOX2 and NANOG begins in the blastocystic stage of embryonic developmentGiven its important function in ESC, we sought to investigate the transcriptional regulation of SALL4 in ES cells. We have identified that there are two human SALL4 isoforms (SALL4A and SALL4B) http://www.ncbi.nlm.nih.gov//) to identify mouse expressed sequence taqs (ESTs) with significant homology to human SALL4. ESTs highly homologous to the 5′ or 3′ noncoding regions of SALL4 were selected to design primers to amplify SALL4 cDNAs. The primers used were: 5′ primer, 5′-ATG TCG AGG CGC AAG CAG GCG AAG C-3′, and 3′ primer, 5′-TTA GCT GAC GGC AAT CTT ATT TTC C-3′. The entire coding regions of SALL4A and SALL4B were amplified from a mouse brain marathon- ready cDNA library , The amplified PCR products were cloned into a pcDNA3 vector , and the nucleotide sequences were determined by DNA sequencing.We performed a tBLASTn search of the GenBank database ) were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 10% heat-inactivated FBS and penicillin/streptomycin (P/S). Transfection of plasmids into cultured cells was performed using Lipofectamine 2000 according to manufacturer's recommendations. Human ES cells H9 and mouse W4 ES cells were cultured, either with feeders or in feeder-free conditions, as described previously SALL4 antibody is generated as previously described 6 cells/well in 6-well plates, with or without transient transfection, were processed using a ChIP Assay Kit following the manufacture's protocol. Briefly, cells were cross-linked by adding formaldehyde and incubated for 10 min. Then, chromatin was sonicated to an average size of approximately 500 bp and immuno-precipitated with SALL4 antibodies, preimmune serum, or anti-HA (hemagglutination) antibody. Histone-DNA crosslinks were reversed by heating at 65°C followed by digestion with proteinase K . DNA was recovered by using a PCR purification kit and then used for PCR or QRT- PCR .HEK-293 cells . In brief, cells were grown, cross-linked with formaldehyde and sheared by sonication. The anti-SALL4 antibody and rabbit serum were used for chromatin immunoprecipitation (ChIP). ChIP-purified DNA was blunt-ended, ligated to linkers and subjected to low- cycle PCR amplification. Promoter tiling arrays (RefSeq array) were produced by NimbleGen. The RefSeq mouse promoter array design is a single array containing 2.7 kb of each promoter region (from build MM5). The promoter region is covered by 50–75 mer probes at roughly 100 bp spacing, depending on the sequence composition of the region. The arrays were hybridized, and the data were extracted according to NimbleGen standard procedures. Confirmation of the predicted binding sites was performed using Quantitative real-time PCR (Q-PCR). Detailed procedures are described previously QRT-PCR was performed as previously described GGTAC- GCGTAATAGGGCCAACCTCCATGGGAAG; 3′ primer: GCAAAGCTTCGACATGG- TGCGAGCATCGG) to generate a fragment from nucleolide (Nt) -1 to Nt-2102 upstream of the start codon ATG with MluI and HindIII sites at each end respectively. Genomic DNA isolated from human HEK293 cells was used as a template. The amplified PCR (polymerase chain reaction) fragment was cloned into the promoter-less pGL3-basic luciferase reporter plasmid to generate a SALL4 plasmid (P2102). The human OCT4 promoter reporter plasmid (Nt-1 to −1500), mouse Sall4 promoter fusion reporter plasmids containing fragments from Nt-1 to −2200, −645, −250, −190 and −l50 were created in the same manner as P2102.The 5′-flanking region of SALL 4 was amplified with primers , Twenty-four hours after transfection, cells were extracted with the use of a passive lysis buffer; a 20-µl aliquot was used for luminescence measurements with a luminometer. The data are represented as the ratio of firefly to Renilla luciferase activity (Fluc/Rluc). These experiments were performed in duplicate.Knock down of endogenous Sall4 expression was conducted using the same method as we reported previously Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was carried out in SDS 10% wt/vol polyacrylamide slab gels as previously described In murine ES cells, both over and under-expression of Sall4 causes differentiation We have identified that SALL4 has two isoforms Sequencing of the 5′-flanking region of SALL4 did not reveal a classic TATA or CAAT box. This region, however, was GC-rich and contained several GC boxes. To determine SALL4 promoter activity, a 2.1-kb segment upstream of the ATG translation site was subcloned into the pGL3-basic vector, Luciferase activity driven by the SALL4 promoter in transient transfection assays was tested in various cell types including HEK-293, NIH-3T3 fibroblasts, COS-7, H9 human ES cell and W4 mouse ES cells. As expected, SALL4 promoter activity was higher in stem cell and embryonic kidney cell lines but lower in fibroblasts, as reflected by luciferase assays. The luciferase activity in the tested cells was, respectively, 12, 1.4, 5, 9.8 and 8.2- fold higher than the promoter-less pGL3 vector. The highest level of reporter gene was detected in HEK293 cells .It was reported that murine Oct4 can bind to a murine Sall4 promoter region in a genomic ChIP-chip study To confirm the above mentioned SALL4 promoter auto-regulation, the human SALL4 P2102 construct was co-transfected with either SALL4A or SALL4B expression plasmids in HEK-293, COS-7, H9 and W4 cells. Twenty four hour-post transfection, the self-suppression of SALL4 (both A and B isoforms) on its own promoter activity was observed in all cell lines tested . FurtherUsing an anti-SALL4 antibody, we first performed ChIP-chip assay, and identified SALL4 binding sites on its own promoter region in both 293 cells and H9 ES cells .To further confirm this finding, primers that covered the SALL4 promoter region were designed and used to map the SALL4 binding sites more precisely. The forward and reverse primer set (1–2) amplified strong 290-bp amplicons from the immunoprecipitates in H9 ES cells . ImmunopTo further investigate the putative SALL4 binding site on its own promoter, we next performed more SALL4 promoter assays. In this experiment, we generated a series of shortened SALL4 promoter constructs. Fragments from nucleotides −1 to −2.2 kb, −645 bp, −290 bp and −150 bp were PCR amplified respectively and subcloned into the pGL3-basic reporter vector. The SALL4 self repression assay was performed using each of the promoter constructs. As seen in To examine the effect of SALL4 isoforms on other SALL family genes, the SALL1 and SALL3 promoters were generated using the same pGL3-basic vector. An approximate 2.0-kb sequence upstream of the translation start site of SALL1 or SALL3 was subcloned into the 5′ upstream of the promoterless pGL3-basic luciferase reporter plasmid. The SALL4 responsiveness of the SALL1 or SALL3 promoter was evaluated through co-transfection with 0.3 µg of the SALL1 or SALL3 promoter construct and 0.07 µg of the Renilla plasmid together with 0.9 µg of the SALL4A expression construct. SALL1 or SALL3 or promoter activity was repressed for more than 2-fold or 3-fold respectively . SimilarTo determine if OCT4 stimulates the activity of other SALL gene member promoters, SALL1 and SALL3 promoter constructs (pSALL1 and pSALL3) were co-transfected with OCT4 in HEK-293 cells. As shown in We also tested whether other SALL members had self-suppression autoregulation. We found that this observation was unique to SALL4 and not true for other SALL members, for example, SALL1 failed tSince SALL4 and Oct4 have opposite effects on the promoters of the SALL gene family, we sought to investigate the combination effect of both factors on SALL gene promoters. By cotransfection of SALL4 promoter plasmid P2102, together with different amount of OCT4 and SALL4 expression constructs in HEK293 cells, we observed that the overall regulating effect of these two transcription factors on SALL4 promoter activity is strictly controlled by their expression level and ratios . SALL4 eSALL4 was initially identified as a homologue of Drosophila gene spalt. Its mutations lead to a range of congenial human developmental abnormalities including “DRRS” and IVIC. These findings suggest that SALL4 plays an important role in human developments. More recently, SALL4 was identified as a “stemness” factor involved in murine ES cells. Murine Sall4 is essential for inner cell mass formation, and knocking down Sall4 in murine ES cells leads to loss of pluripotency The molecular mechanism(s) of SALL4 in maintaining the stem cell properties involve at least two processes: SALL4 activates Oct4 as a transcriptional factor, and interacts with Nanog by forming a protein-protein complex. It seems that SALL4 is a “core factor” for this SALL4/Nanog/Oct4 network This leads to a very intriguing question: how is SALL4 regulated? We have previously reported that human SALL4 has two isoforms, which prompts us to study whether these two isoforms have differential effects. In this study, we have shown that both SALL4 isoforms can activate OCT4, and are positively regulated by OCT4. Since SALL4 and OCT4 form a positive feedback loop, there must be some type of negative regulator mechanism present to balance the proper expression(s) of SALL4 and OCT4. We have discovered that SALL4 poses a strong self-repressive auto-regulation, which in turn, acts as a “gate keeper “or a “break” for the SALL4/OCT4positive feedback loop.Other SALL gene family members, in particular, SALL1 and SALL3, have been shown to be present at very early embryonic developmental stages both in human and mice. Heterozygous mutations of SALL1 are associated with TBS, a congenital malformation that includes deformations in digit, heart, ear, kidney and limbs. Sall1 null mice die soon after birth due to renal agenesis. A “knock-in” mouse model resembles human TBS more closely, indicating that domain-negative effort is responsible for the pathogenesis of TBS. There is a significant overlap in the phenotypes of DRRS and TBS. Interestingly, the Sall1 mutant can bind and potentially interact with SALL4, and mutant SALL4 has been shown to form a complex with Sall1 as well Given the essential roles that the SALL gene family members play during development, it is of great interest to explore the interactions between the SALL gene family members, as well as the mechanism(s) which regulate their expressions. In this study, we have shown that consistent with its self-repression function, SALL4 represses the activities of the promoters of SALL1 and SALL3. This is antagonized by the activation of OCT4 on the promoters of SALL1 and SALL3.Based on the above findings, we propose the following hypothesis : SALL4 aIn summary, SALL4 appears to play a dominant role in the SALL4/OCT4 regulatory network. This transcriptional network seems to regulate other SALL gene family members as well, such as SALL1 and SALL3. In addition to its essential role in ES cells, SALL4 is found to be involved in adult tissue stem cells and leukemic stem cells. It is worthy to point out that SALL4 is one of the few genes, if not the only one, that is involved in stem cell properties shared by ES and adult tissue stem cells. More in-depth studies on SALL4 should add to our understanding of the “stemness” feature shared by all stem cells.File S1Supplemental figures. Figure S1. Down-regulation of SALL4 protein in human ES cells. The human ES H9 cells were infected with retroviruses either expressing two SALL4-specific shRNAs (#7410 and #7412) or scramble control shRNAs. Whole cell lysates were immunoblotted with anti-SALL4 as described in (0.11 MB PDF)Click here for additional data file.

The chromosomes of 12 samples of cultured Chinese hamster kidney and prostate cells , whose tissue culture properties have already been described have been examined for numerical change and for the appearance of abnormal markers. Six transformed kidney subclones contained a consistent telocentric marker not present in the normal parental cell, and Giemsa banding demonstrated this to be the centromere and the long (q) arm of the number 4 chromosome in all cases. Two transformed prostate subclones also contained a consistent telocentric marker, not present in similarly derived normal subclones or in the normal parental cell, and Giemsa banding demonstrated this to be a different fragment (the centromere and most of the p arm) of the number 4 chromosome. It is believed that the use of a mixed-serum culture medium, designed to stabilize the karyotype of cultured Chinese hamster cells, is at least partly responsible for the detection of these transformation-associated chromosome changes.

To investigate the attributes of these effector T cells in patients with squamous cell carcinoma (SCC) of the head and neck cancer, venous blood was obtained from 39 individuals with cancer and 45 normal controls (NC). Peripheral blood mononuclear cells were isolated, stained with labelled monoclonal antibodies specific for CD8, CD45RO, CD45RA, CD62L, CD27, TCR-ζ as well as isotype controls and examined by multicolour flow cytometry. Annexin V binding to CD8+ T cells and PMA/ionomycin-induced IFN-γ expression were also evaluated in patients and NC. The proportions of CD45RA+CD45RO− (naïve) and CD45RA−CD45RO+ (memory) cells were found to be comparable within the CD8+ T-cell subset. However, relative to NC, the frequency of effector CD8+CD45RO−CD27− cells was strikingly increased in all SCC patients regardless of the disease status (P=0.0003). The proportion of these cells was found to increase with age in both patients and NC. In NC, stimulated IFN-γ expression was largely restricted to CD8+CD45RO−CD27+ cells, while in patients CD8+CD45RO−CD27− expressed IFN-γ after ex vivo stimulation. Expression of the TCR-associated ζ chain was decreased or absent in freshly isolated CD8+CD45RO−CD27− T cells in patients (P<0.0001). Annexin V was found to bind to a higher proportion of circulating CD8+ T cells in patients than NC (P<0.006), and significantly more Annexin V+ T cells were present in the effector (P<0.0059) than the naïve subset within the CD8+CD45RO− compartment. The data indicate that the expanded CD8+CD45RO−CD27− T cells, which contain precursors of IFN-γ-producing T cells, are ζ-negative and sensitive to apoptosis in the circulation of patients with HNC.A subset of circulating T cells (CD8 They are characterised by a shorter telomeric restriction fragment (TRF) length compared with unprimed cells, express cytolytic activity and abundantly produce IFN-γ and TNF-α of the head and neck. We find that, in contrast to normal controls, the frequency of CD8+CD45RO−CD27− T cells is significantly increased in the circulation of HNC patients. However, these CD8+ effector cells have no or low ζ expression and are thus unable to signal. They also contain increased proportions of Annexin V-binding cells. The data indicate that the CD8+CD45RO−CD27− effector T-cell subset appears to be dysfunctional and destined for apoptosis in patients with cancer.To further evaluate the role of this effector CD8+ T-cell subset and analysis of CD3 ζ-chain expression. An additional 11 patients and seven NC were included in the evaluation of Annexin V binding to the CD8+ effector T cells.Venous blood samples (10–30 ml) were obtained from patients with SCC of the head and neck, who were seen between April 2001 and March 2002 at the Outpatient Otolaryngology Clinic at the University of Pittsburgh Cancer Institute (UPCI). The Institutional Review Board has approved the protocol for collection of patient blood samples. Normal healthy donors (NC) were recruited among the laboratory personnel and other volunteers. A written informed consent was obtained from all individuals participating in this study. Two groups of patients and NC were studied. In total, 28 patients and 38 NC were included in studies of CD8n=2), moderately differentiated (n=29), poorly differentiated (n=7) and undifferentiated (n=1). At the time of blood draw, 25 patients showed no evidence of disease, whereas 14 patients were studied either before surgery (n=12) or had newly diagnosed lymph node metastases (n=2) and were classified as having active disease.The characteristics of all the patients included in this study are shown inex vivo experiments. In each experiment, PBMC obtained from patients were evaluated together with the cells obtained from at least one normal control.Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll–Hypaque density gradient centrifugation, recovered from the gradient interface, washed in Dulbecco's phosphate-buffered saline , counted in a trypan blue dye, and either stained for flow cytometry or used for 6 cellsml−1. Cells were stimulated with phorbol myristate acetate at 0.5 ng ml−1 and 0.5 μM ionomycin (Sigma) for 4, 12 or 18 h followed by 4 h incubation with 2 μM monensin (Sigma). Cells were then harvested for the determination of intracellular IFN-γ expression by flow cytometry. In other experiments, cells were stimulated with anti-CD3 mAb , and incubated for 24 or 48 h in preparation for determinations of ζ-chain expression as described below.PBMC obtained from patients or NC were suspended in AIMV medium containing 10% (v/v) foetal bovine serum (FBS) at a concentration of 2×10ζ-PE, anti-CD62L-FITC and anti-CD27-FITC . Isotype control Abs IgG1− FITC or IgG1-PE were purchased from Becton Dickinson . FITC-conjugated Annexin V was purchased from PharMingen and anti-IFN-γ-FITC mAbs from Beckman Coulter . All antibodies were pretitred on normal PBMC to determine optimal working concentrations. Freshly isolated PBMC were incubated with antibodies for 25 min on ice and washed twice in PBS, containing 4% (v/v) FBS and 0.1% (vv−1) NaN3. After staining, the cells were fixed with 0.5% paraformaldehyde in PBS prior to flow cytometry analysis. Staining for the TCR ζ chain or IFN-γ in CD8+ T-cell subsets was performed as follows: first, the cells were surface stained, then fixed with 0.5% paraformaldehyde in PBS for 10 min at room temperature and washed once with PBS/FBS/NaN3 and once with 0.1% saponin in PBS containing 0.1% bovine serum albumin (BSA). The cells were then stained either with anti-TCR-ζ-PE, IFN-γ-PE or respective isotype control Abs for 30 min on ice in the dark. After the incubation period, the cells were washed once in saponin solution and once in PBS/FBS/NaN3 before fixation with 0.5% paraformaldehyde in PBS.Aliquots of PBMC were stained for flow cytometry, using a panel of labelled monoclonal antibodies (mAbs) specific for cell surface-associated lymphocyte antigens as follows: anti-CD8-PE-Cy5, anti-CD45RO-ECD, anti-CD45RA-PE, anti-CD27-PE, anti-TCR3 and once with Annexin-binding buffer (PharMingen), followed by incubation with FITC-conjugated Annexin V for 15 min at room temperature. Flow cytometry analysis was performed within 60 min on a Coulter Epics XL flow cytometer.To measure apoptosis, cells were surface stained and then washed once with PBS/FBS/NaNvs controls) or the Kruskal–Wallis test for three groups (patients with active disease vs patients with no evident disease (NED) vs controls). Differences with P-values of less than 0.05 were considered to be significant.Linear regression analysis was conducted to assess the association between the phenotypically defined T-cell subsets and age. Estimated regression parameters were tested for homogeneity between patients and controls. If changes in the subsets were associated with age, differences between patients and controls were adjusted to reflect the imbalance in age between the two groups. If changes in subsets were independent of age, group differences were examined using the Wilcoxon test for two group differences or CD45RO (‘memory’) isoforms in patients and NC. There was no significant difference in the proportion of CD45RA+ naïve CD8+ T cells between patients and controls compared to 58% (24–83%) in patients. The CD8+ CD45RO+ memory cells represented 37% (20–75%) of circulating CD8+ cells in NC compared to 43% (17–75%) in patients . We also examined the proportion of the reciprocal subset of naïve CD8+CD45RO−CD27+T cells in the same patients as well as NC, and found that it decreased with age and was significantly lower in patients than in controls (data not shown).The cohorts of patients and NC were not age matched in our study, and it was possible that the observed difference in the proportion of CD8+ T-cell subset was also reported to lack the lymph node homing receptor CD62L relative to NC, (25%±23). Representative data for one patient and an age-matched control are shown in Figure 4In addition to lacking CD27, the effector CD8of 4%±4 . In agre+CD45RO+ lymphocyte subset, the proportions of CD27-negative and CD27+ cells were found to be comparable in patients and NC . The subset of CD8+CD45RO+CD27+ cells decreased with age in both patients and NC, while the reciprocal subset of CD8+CD45RO+CD27− cells showed an increase with age in both groups (data not shown).Within the memory CD8+CD45RO−CD27− T cells was not found to be significantly different among patients with active disease or those who had no evidence of disease (NED). Likewise, patients with tumours at different sites or with tumours at distinct stages of differentiation had similar percentages of effector CD8+ T cells (data not shown).The percentage of effector CD8γ expression and examined by flow cytometry to determine the distribution of precursors of IFN-γ-producing cells among CD8+ T-cell subsets. Stimulated IFN-γ expression was found to be largely confined to CD27+ T cells in NC. However, in cancer patients, most of IFN-γ+ cells were CD27-negative following stimulation with PMA and ionomycin for ζ in patients relative to NC . Thus, although this subset of effector cells was expanded in patients relative to NC, the near absence of ζ expression in effector T cells suggested that their signalling via TcR was compromised. Expression of the ζ chain was also found to be depressed in the naïve and memory subsets of CD8+ T cells in these patients (data not shown). When PBMC of patients and controls were stimulated with anti-CD3 mAb, expression of ζ in CD8+ T cells was lower in patients than in NC at 24 and 48 h of culture (data not shown).In order to verify the functional integrity of the TcR signalling pathway in CD8ζ-chain expression could be related to programmed cell death of circulating CD3+ T cells in patients with cancer . Furthermore, when Annexin V binding to the cells within the CD8+CD45RO− compartment was evaluated in patients, significantly more CD27-negative-Annexin-binding T cells were observed relative to NC (P=0.0059), as shown in Figure 8+ T cells, while in the memory compartment (CD8+CD45RO+), the proportion of Annexin-binding cells was increased in patients relative to NC was somewhat lower and that of memory CD8+CD45RO+ cells higher in patients than in controls by tumour or tumour-associated monocytes , as previously suggested (+ T cells is not increased because of their rapid maturation and transfer to the antigen-experienced compartment. This series of events is consistent with a high rate of lymphocyte turnover in patients with cancer, not unlike that seen in patients with HIV (The seemingly contradictory observations of the expanded effector cell pool and increased apoptosis as well as uggested . Hence,

Junctional ectopic tachycardia (JET) often occurs in the setting of surgery for congenital heart disease . A congeMildh et al identified 51 patients with JET among a group of 1001 children undergoing open heart surgery over a 5 year period, an incidence of about 5% . 8% inciIn case of post operative JET, longer cardiopulmonary bypass time, higher body temperature and higher levels of postoperative troponin T or creatine kinase and high inotropic requirement were associated with JET. These patients also needed longer ventilatory support and intensive care, compared to controls matched for the same type of surgery ,9-11. AgIntravenous infusion of cold saline in addition to surface cooling, to achieve a core temperature of 32-34 ºC was evaluated in a pilot study for the management of post operative JET in 10 patients recently . The medMagnesium supplementation during cardiopulmonary bypass decreased the incidence of JET in a randomized, double blind controlled trial involving 99 children who underwent pediatric cardiac surgery .Amiodarone was useful as first line drug in a group of 40 pediatric cardiac surgical patients, though it was effective in only about half of them. While sinus rhythm was achieved only in 7 of them, a significant decrease in heart rate could be achived in another 11 patients. The lower rate permitted effective atrial or AV sequential pacing to achieve AV synchrony . 13 of 1Dexmedetomidine may be useful in the treatment of perioperative JET, as noted in a preliminary observational report . IntraveRadiofrequency ablation and cryoablation has a success rate of about 80% in the management of JET [Collins 2009], but may be reserved to cases not responding to other pharmacological and non-pharmacological measures. The site of earliest retrograde conduction during tachycardia can be targetted for ablation. Plotting out the entire His bundle system can be done prior to ablation and may be useful for preserving atrioventricular conduction .

This study investigated adolescent males’ decision-making under risk, and the emotional response to decision outcomes, using a probabilistic gambling task designed to evoke counterfactually mediated emotions (relief and regret). Participants were 20 adolescents (aged 9–11), 26 young adolescents (aged 12–15), 20 mid-adolescents (aged 15–18) and 17 adults (aged 25–35). All were male. The ability to maximize expected value improved with age. However, there was an inverted U-shaped developmental pattern for risk-seeking. The age at which risk-taking was highest was 14.38 years. Although emotion ratings overall did not differ across age, there was an increase between childhood and young adolescence in the strength of counterfactually mediated emotions (relief and regret) reported after receiving feedback about the gamble outcome. We suggest that continuing development of the emotional response to outcomes may be a factor contributing to adolescents’ risky behaviour. Adolescents tend to engage in ‘risky’ behaviours—those with high subjective desirability but high potential for harm . These ifeel afterwards. As an example, consider the phenomenon of postcode lotteries. Players pay a small amount of money each week to buy the chance of winning a large sum of money if their postcode is drawn from a pool containing all the postcodes in the country. The EV of playing is negative , since the chance of winning is very small. However, a great many people play, and it is thought that their doing so is partly due to emotion. People anticipate that they will feel very bad if their postcode is drawn and they did not buy a ticket. They will feel regret . The emotion of regret is a counterfactually mediated emotion, as it arises due to counterfactual comparison between what is and the more desirable outcome that might have been if a different decision had been made. The positive counterpart of regret is relief . Anticipation of counterfactually mediated emotions such as relief and regret may influence decision-making. Studies involving gambling tasks have shown deviations from pure EV-maximising behaviour attributable to participants taking into account the regret their decisions may cause them to feel. They are prepared to accept smaller rewards to avoid putting themselves at risk of experiencing the unpleasant emotion of regret , i.e., the summed values of potential outcomes weighted by their respective probabilities. However, decisions are also influenced by how one expects to f regret .Adolescents are thought to show exaggerated or more labile emotional responses to outcomes compared to children or adults . Also, tIn the present study, participants aged 9–35 years engaged in a probabilistic gambling task in whichOur first goal in the current study was to investigate the impact of EV on choice across age. Although EV maximisation may continue to develop, we predicted that even the youngest participants would tend to choose gambles with higher EV, since it has been shown that children as young as age 5 show a rudimentary sensitivity to EV . When 5-Our second goal was to investigate age differences in the impact of risk on choice. Participants’ preference for risk was identified by assessing the contribution of the variance of gambles to behaviour, where a risk-seeking participant is one who shows a tendency to choose gambles with high variance. Because the probabilities and outcomes of gambles were shown to participants, risk-seeking in the present study refers to a true preference for risk. In contrast, seemingly risky behaviour in real life could arise due to a number of factors, including incomplete knowledge of the range of possible outcomes or a reduced ability to judge their probabilities. We predicted an inverted U-shaped pattern of risk-seeking between childhood and adulthood, with its peak in adolescence, similar to that shown in recent studies . Figner feel about what just happened?”) to the outcome of each gamble, using a linear rating scale. On half of the trials , the outcome for the unselected choice was revealed alongside the outcome for the selected choice, whereas on the other half of trials the outcome of the selected choice only was revealed. Previous work with adults has suggested that the complete feedback condition, with outcome of the unselected choice always revealed, gives rise to a counterfactual comparison between the actual outcome and the outcome of a foregone alternative (what might have been), and that this comparison modulates self-reported emotional responses . During the gambling task, participants indicated their emotional response (“How do you esponses . For exaThe emotions participants experience are known as ‘reward-based’ emotions . These a11.1n = 20) were from an urban primary school. Adolescent males were from a secondary school in the same area and at which a proportion of school leavers from the primary school enrol each year. The adolescent group was subdivided into young adolescents and mid-adolescents . Adult males were recruited from a database of former students of the secondary school. Therefore, child, adolescent and adult groups were well matched for educational background and socioeconomic status. Participants were restricted to males to reduce variance attributable to sex differences in traits such as sensation-seeking, which might influence risk preferences . The set of pairs of gambles and the order in which they were presented was the same in each condition.Possible outcomes took discrete values of +200, +50, −50 or −200 points. Outcome probabilities for each wheel were 0.2/0.8 or 0.5/0.5. The two alternatives always differed in EV and in the value of their actual outcomes. Otherwise, pairs of gambles and the combination of probabilities and outcomes for each gamble were split approximately evenly among possible combinations. Thus, the EV of all 120 gambles ranged from −170 to +170, with a mean and median close to or at zero , and a range of differences in EV between the paired gambles across the 30 trials in each condition from −195 to +195 , with a mean and median close to zero , and x2 and y2 represent the highest and the lowest outcome of gamble 2 . The probability of x1 is p and the probability of y1 is 1 − p; the probability of x2 is q and the probability of y2 is 1 − q. The probability of choosing gamble 1 is estimated as:i = individual, t = time and the function F[θ] denotes the function eθ/(1 + eθ). We investigated the effect on choice of the difference in EV and risk between paired gambles ordered in time, defining the variables dEV and dSD as:g1 if [EV(g1) > EV(g2)] (Eq. g1) > stdev(g2)] and the impact of risk (dSD) on behaviour; we also tested for a quadratic relationship between age and EV. In order to directly compare the models testing for linear and quadratic effects of age on the variables dEV and dSD, we conducted a likelihood-ratio test.To ascertain whether the impacts of EV and risk on behaviour were dependent on age, we first orthogonalised the two variables dEV, dSD) and their associated significance levels. A coefficient that is not significantly different from zero indicates that participant behaviour is neutral with respect to that coefficient. For example, participants could be risk-neutral, or insensitive to EV. A coefficient that is significantly different from zero indicates that participants tend to maximise or minimise the decision variable. The sign of the coefficient indicates whether the decision variable increases (+) or decreases (−) the probability of choice. For example, a high, positive coefficient for risk (dSD) indicates that a more risky choice (one with higher outcome variance) has a higher probability of being chosen. We tested for significance of the variables dEV and dSD across participants and within each age group separately, setting the threshold for significance at p < 0.05.The outputs of the logit regressions show the coefficients of model parameters was used in each case to test for age group differences, with a 1.3.3Mean winnings closely follow the proportion of EV-maximising choices, since a participant who maximizes EV will win more points. However, we additionally investigated the relationship between participant age and mean winnings by conducting linear regression analysis. We performed two regressions, one on the entire group and a second on only children and adolescents, to rule out the possibility that this effect was driven by two discrete clusters in age and because we hypothesised that the major differences in performance would occur in this age range.To ascertain whether any effects of age on performance were due simply to slower learning of the task at younger ages , rather 1.3.4p < 0.05, and Bonferroni corrections to post hoct-tests.We hypothesised that the effect on emotion ratings of a counterfactual comparison between the chosen and the unchosen outcome would differ by age. To test this hypothesis, we selected trials for which a counterfactual comparison could either enhance or diminish the degree of satisfaction a participant would feel. That is, we selected trials from the complete feedback condition for which the obtained outcome was either +50 or −50, and the unchosen alternative was either +200 or −200. To clarify, consider a counterexample: if a participant wins +200 points, any unobtained outcome would have been worse; the counterfactual comparison will always be in the downward direction and will always be confounded with outcome magnitude. In contrast, a win of −50 appears satisfactory if the unobtained outcome is revealed to be −200, but unsatisfactory if the unobtained outcome is revealed to be +200. Emotion ratings from the latter trial types were therefore used to examine age group differences, using one-way ANOVA with a threshold for significance at post hoct-tests to investigate simple effects. Because order effects may contribute to a main effect of feedback or interactions thereof, we report only those age-independent effects that replicate previous results did not significantly improve the model (likelihood-ratio test: LR χ2(1) = 1.47, p = 0.226). Therefore, we can conclude the effect of age on dEV is linear.To assess whether the relationship between age and the impact of EV on choice was better described as linear or quadratic, we conducted a likelihood-ratio test. This showed that adding a quadratic component for the interaction between age and 2.1.2F3,85 = 2.354, p = 0.078).One-way ANOVA on the proportion of trials for which participants in each of the four age groups chose the gamble with higher EV was not significant .Linear regression analysis showed that mean winnings across the task were positively correlated with age or age group on the difference in mean winnings between the first and second halves of each condition.Linear regression between age and the difference in mean winnings between the first and second 15 of the 30 trials per condition, as well as one-way ANOVA on the mean difference in winnings between first and second halves of both conditions, with age group as a between-subjects factor, revealed no significant effect of age , but not in the Adult group alone (p > 0.7). Thus, children and adolescents showed a preference for more risky gambles and adults did not.Logit regression analysis showed that across age groups, the difference in risk between gambles see Eq. affected2.2.2dSD indicated that age influenced the extent to which the difference in risk between gambles affected choice to a model only containing the linear component (dSD × age) significantly improved the model (likelihood-ratio test: LR χ2(1) = 5.31, p = 0.021). Therefore, we can conclude the effect of age on the propensity to seek risk is quadratic.A significant quadratic interaction between age and 2.2.3F3,85 = 3.077, p = 0.032. post hoc Bonferroni corrected comparisons showed that the YA group made a significantly greater proportion of risk-maximising choices than did the adult group . Interrogation of the curve resulting from a regression between age2 as a continuous variable and the proportion of risky choices revealed that the point of inflection was located at 14.38 years. That is, 14.38 is the age at which participants made the greatest proportion of risky choices.One-way ANOVA on the proportion of trials for which participants in each age group chose the gamble with higher risk was significant, 2.32.3.1F3,83 = 3.155, p = 0.029; two outliers were excludedpost hoc Bonferroni-corrected comparisons revealed significantly weaker counterfactually mediated emotion ratings in the child than in the YA group , while no other comparisons reached significance and feedback , and an interaction between these factors .In contrast, investigation of overall differences in emotion intensity across age and condition showed no evidence of stronger emotion ratings in adolescence, nor any interactions between age and within-groups factors. This suggests that the age group difference in emotion ratings reported above is specific to reported emotions elicited in response to a counterfactual comparison between chosen and unchosen alternatives. We did, however, replicate previous findings by showi2.3.2post hoct-tests on child vs. YA differences in counterfactually mediated emotion ratings separately for positive and negative outcomes to investigate whether the stronger emotion ratings in YA relative to children were driven by a hyper-responsiveness to positive rather than negative outcomes trials , whereas the same comparison for regret trials was not significant . This post hoc result suggests that the YA group showed an enhanced emotional response to relief or ‘lucky escape’ outcomes relative to the child group.We conducted outcomes . Indepenβ = 0.176, r2 = 0.031, p = 0.103), but was significant within child and YA groups together , and was marginally significant within child, YA and MA groups together . It was not significant in the adult group alone . This suggests that children and adolescents become less cautious in their choices after surprisingly lucky (relieving) wins. However, this conclusion is tentative and requires further investigation because these correlations do not survive Bonferroni correction for multiple comparisons.To assess whether this difference predicted risk-taking, we conducted linear regression analyses between the emotion response on relief trials and the proportion of risky choices. This analysis was not significant for the full sample made a significantly greater proportion of risky choices than did adults, and the age at which risky choices peaked was 14.38 years .These results expand on those from two previous studies that have shown that the tendency to make risky decisions in emotional gambling tasks decreases between adolescence and adulthood they were shown the outcome for the unchosen, as well as chosen, wheel. Previous work with adults has shown that such feedback gives rise to a counterfactual comparison between the outcome of a choice and its foregone alternative (what might have been), and that this comparison influences participants’ emotional responses as well as their subsequent behaviour relative to children, although they did not differ from adults on this measure. We presented tentative evidence that these relief responses predict risky choices. However, further studies are needed to establish which social-emotional and cognitive factors most strongly contribute to adolescent risk-taking both in females and in the males studied here.

Although interventional electrophysiology and the use of radiofrequency energy to cure various arrhythmias primarily developed in the adult population, similar applications in children have grown dramatically over the last decade. The anatomic basis for various arrhythmias is critically important for the pediatric ablationists to appreciate. Such understanding allows the use of alternative technique to affect cure while avoiding complications. Further, because of the relatively small heart and less thick myocardium in children, without the appreciation of the underlying cardiac anatomic relationships, collateral injury, for example to the arterial system, may occur. In this review, the cardiac anatomic consideration important in approaching various supraventricular and ventricular arrhythmias in the normal heart is discussed. The last two decades have witnessed tremendous change in the care of children with symptomatic cardiac arrhythmia. The anatomic basis for various cardiac arrhythmias (in children and adults) has been much better understood, particularly for common supraventricular tachyarrhythmia.While cardiac electrophysiology still forms the basis for electrophysiological study and radiofrequency ablation for supraventricular arrhythmia, pure anatomic approaches are evolving with appropriate adjunctive electrophysiological maneuvers performed prior to energy delivery. Radiofrequency ablation for AV node reentry and paroxysmal atrial fibrillation is performed almost entirely as an anatomy-based ablation in many centers -2.Radiofrequency ablation was initially reported as a feasible, successful, and safe therapy that could be used in children as an alternative to drug therapy in 1991 . There aOver 90% of supraventricular arrhythmia in children is a result of a reentrant mechanism . The secwithout necessarily effecting the His bundle electrogram, yet either advancing or delaying the subsequent atrial electrogram [In the initial few decades of cardiac electrophysiology, AVNRT was thought to represent a reentrant arrhythmia arising entirely from the compact AV node. This was because there was nearly simultaneous activation of the ventricle and atrium observed from the earliest recorded demonstration of this arrhythmia. If this were to have been the case (entire circuit in AV node), radiofrequency ablation for this arrhythmia without heart block would not have been possible. It later became recognized that AV node reentry could be reset and entrained from the atrium particularly the posteroseptal annular atrial tissue . Importactrogram . PioneerThe circuit for this arrhythmia, however, is far from completely understood. While it is accepted that atrial inputs to the AV node are necessary components to the circuit (see below), certain less commonly observed phenomena do suggest a distinct difference from AVNRT and any other macroreentrant atrial tachycardia. AVNRT can be dissociated from the ventricle either with block occurring in an infra-Hisian location (more common) or above the bundle of His. Also clearly observed and well documented are cases of AV node reentry with dissociation of the tachycardia from all recorded atrial tissue .The sinus impulse originates epicardially at the junction of the crista terminalis and the superior vena cava, where as the atrioventricular conduction system is located anteriorly and septally on the annulus. Specifically, the penetrating bundle of His is consistently found at the junction of the noncoronary cusp and right coronary cusp of the aortic valve where it meets the commissure of the anterior and septal leaflets of the tricuspid valve (membranous intraventricular septum). The compact AV node itself is located relatively more atrial and more posteriorly (closer to the coronary sinus) in the mid-septal tricuspid annulus when compared to the penetrating bundle of His. Although the compact AV node is relatively atrial to the His bundle, it is always found ventricular to the Eustachian ridge and the underlying tendon of Todaro within the so-called triangle of Koch. This triangle is bounded anteriorly by the tricuspid annulus, posteriorly by the tendon of Todaro, and inferiorly by the coronary sinus.The atrial inputs into the AV node that carry the sinus node impulse (or paced impulse) are not diffuse but along distinct anatomic pathways. This is because of the anatomic obstacles in the atrium (particularly right atrium) that the impulse must circumvent to reach the AV node. The atrial myocardial input to the AV node that occurs superior to the fossa ovalis and through the apex of the triangle of Koch is referred to as the fast pathway. The posterior inputs to the AV node traverse to this structure along the interatrial septum. These posterior inputs may involve the myocardial sleeves along the coronary sinus and the posteroseptal right atrium in the region of the coronary sinus ostium. The posterior inputs are referred to as the slow pathway and may be more than one in number (right and left-sided slow pathways). The actual junction of these posterior inputs into the AV node is likely through extensions of compact AV nodal and transitional AV nodal tissue called the posterior horns. This anatomic distinction between the atrial myocardial inputs to the AV node forms the essential substrate for AV node reentrant tachycardia.fast pathway.It should be noted that the distinction between the fast and slow pathways, while although partially reflective of the different conduction and refractory properties, is fundamentally an anatomic distinction . In otheThis anatomic distinction of the fast and slow pathway is not easily ascertained in the antegrade direction and involves complex entrainment maneuvers during AV node reentry to provide evidence. On the other hand, retrograde activation of the atrium during AV node reentry or ventricular pacing is straightforward in demonstrating proof of the anatomic separation of the two limbs of the AVNRT circuit. During typical AV node reentry or during ventricular pacing with retrograde activation of the fast pathway, the earliest recordable site of atrial activation is just behind the tendon of Todaro, close to the apex of the triangle of Koch. Whereas with atypical AV node reentry or retrograde activation via the slow pathway during ventricular pacing, the earliest recorded atrial electrograms are in the region of the coronary sinus ostium (posterior).The fact that atrial myocardium is essential to the circuit of AV node reentry is more than semantics and forms the basis for all atrial AVNRT ablation procedures. While ablating either the anatomic fast or slow pathway will prevent future AVNRT, the exit site of the fast pathway is fairly close to the compact AV node and separated only from this structure by the tendon of Todaro. The slow pathway, however, (see below) can be ablated 4 of 5 cm from the compact AV node with little or no risk of AV block. This distinction in the anatomy of the two pathways to the AV node is critical for safe ablation in young children.It is important for ablationists to understand the fluoroscopic anatomy of the fast pathway. In the RAO projection as anticipated, the fast pathway site is more atrial (behind the Eustachian ridge) than the compact AV node and, of course, the penetrating bundle of His. The characteristic fluoroscopic appearance, however, when mapping the fast pathway, is best noted in the LAO projection . As the The slow pathway fibers are funnel-like and triangular in section with the apex of the triangle inserting into the compact AV node and the base fanning out into the posterior interatrial septum both involving the fibers of the coronary sinus and the right posterior septal atrium . Thus, tBecause of the relatively smaller hearts and thus closer proximity of the compact AV node to the atrial input sites, ablation in children should be performed as far away from the compact AV node as possible ,7. UnderBecause of relatively rapid conduction times in children, it can be difficult to distinguish whether retrograde activation is via the slow pathway or fast pathway. Thus, there is often simultaneous activation of the atrium as recorded on the His bundle catheter and the proximal coronary sinus catheter. Specific mapping, understanding the fluoroscopic anatomy as detailed above of the fast pathway will clarify the situation.In children who have a persistent left superior vena cava, the coronary sinus including the ostium can be very large. This can make ablation of the slow pathway difficult. This difficulty is because of the lack of catheter stability created by the large coronary sinus ostium and the fact that multiple slow pathway inputs related to the diverse musculature of the enlarged coronary sinus will require attention. Again, linear ablation including careful ablation within the coronary sinus is most likely to be effective .In children, because of relatively rapid conduction times through the fast pathway, typically AVNRT may present as a long R-P tachycardia. This is because in AVNRT, activation of the atria and ventricle occur from a common turnaround point likely within the compact AV node or next to it (slower common pathway). When fast pathway activation is rapid, then atrial activation proceeds ventricular activation, giving rise to a long R-P interval. The P wave will be narrow and negative in leads 2, 3, and aVF unlike the wide P waves that result from slow pathway activation . Once catheters are placed, specific mapping of the fast pathway will show earlier activation than the anatomic slow pathway region .Activation of the left atrium in sinus rhythm or any right atrial rhythm occurs primarily through Bachmann's bundle and through the coronary sinus musculature. In children, Bachmann's bundle activation can be rapid. This occurrence can give rise to unusual activation patterns in the coronary sinus in children with typical AVNRT . If one Wolff-Parkinson-White syndrome results when an accessory pathway is present that electrically connects ventricular and atrial myocardium and gives rise to reentrant supraventricular tachycardia. The electrocardiographic recognition and electrophysiological approach to management of this syndrome in children is discussed elsewhere . SpecifiAccessory pathways in children, as well as adults, is sometimes classified into endocardial and epicardial types. In a strict anatomic sense pathways are always epicardial. That is the atrioventricular connection occurs exterior to the fibrous annulus . However, most of these pathways can be ablated either on the pathway itself or its atrial or ventricular insertion with standard endocardial techniques. In a few exceptional circumstances the pathway is truly epicardial in that the atriovenous connection occurs through another epicardial structure . In an analogous fashion, pathways that course through the fibrous trigone represent situations where standard endocardial ablation is unlikely to be successful for an anatomic reason.Muscular extensions into most cardiac veins including the superior vena cava, pulmonary veins and the coronary sinus exist ,12. ThisWhile technically atrioventricular connections (accessory pathways) should be possible at any point along the atrioventricular annulus, an exception occurs in the region of the aortic mitral continuity. Thus, left anteroseptal accessory pathways (and left anterior) are exceedingly rare compared to other locations. This is because of the unique position of the aortic valve preventing direct atrioventricular connections as could occur across the annulus in other locations. For accessory pathways to occur here, the cardiac muscle (pathway) would have to apparently cross the central fibrous trigone. While this may occur another possibility more evident from recent case description is a connection from the atrial myocardium to the supra-aortic valvar myocardial extension (see below) under ventricular tachycardia and from there to the ventricular myocardium . The sitAnother non-annular anatomic situation where atrial and ventricular myocardial tissue is apposed is with respect to the appendages. Accessory pathways that involve electrically active myocardial connection occur between the appendages and the underlying ventricle. Although rare, when seen, these connections constitute an accessory bypass tract as conduction can proceed through these fibers independent of the AV node. When such tracts are diagnosed in children, the optimal approach is to ablate in a circumferential manner isolating a portion of the left or right atrial appendage close to its ostium. While the actual connection may also be targeted deep in the appendage, the risk of perforation in children is high. Targeting the ventricular insertion is typically futile as it is often multiple.Some accessory pathways may be located in the typical atrioventricular annular location, however, demonstrate unusual physiological properties such as decremental conduction or lack of typical responses to decremental atrial pacing etc. The nomenclature for these pathways is confusing with historical and contemporary usage significantly different . The anaIn present electrophysiology terminology, a Mahaim fiber is a true accessory bypass tract connecting the free wall of the right atrium to either ventricular myocardium or the infra-Hisian conduction system. Unlike a typical accessory pathway, however, Mahaim fibers have AV node-like characteristics near the annulus and connect to relatively apical myocardium or the infra-Hisian right bundle-branch system through an insulated fascicle similar to the His bundle/right bundle-branch.These pathways, when they occur in children with relatively rapid AV nodal conduction, can be exceedingly difficult to recognize as accessory pathways ,16. TheyWhile Mahaim fibers do not conduct retrograde, pathways that conduct either exclusively retrograde or bidirectionally occur and are responsible for the syndrome labeled PJRT . These pathways are distinguished from Mahaim fibers by having the ventricular and atrial insertions close to the annulus and conducting retrograde. There is no relationship anatomically with these pathways and the normal conduction system. For unclear reasons, retrograde decremental pathways are often found in the region of the pyramidal space, close to the coronary sinus ostium in the posterior right or left atrium . PathwayUnlike a Mahaim fiber that connects atrial myocardium to the ventricular myocardium, nodoventricular pathways connect compact AV nodal tissue either to the fascicular system (right or left bundle branch) or the ventricular myocardium. For these pathways to occur and participate in tachycardia, some form of longitudinal dissociation in the AV node is required, that is antegrade conduction through the AV node and then down the nodoventricular/fascicular tract and then retrograde to AV nodal tissue occurs over a conduction interval too short to be allowed by the usual refractory period of the AV node. The anatomic basis for such dissociation or in fact a convincing example of the anatomy/pathology of these connections is lacking and has prompted some electrophysiologists to question their existence ,20. AlthNormally, there is a fibrous sleeve of insulation on the penetrating bundle of His and the right and left bundle branches until this sleeve disappears and the bundle branch tissue connects to the ventricular myocardium (bundle branch exit). In some patients, there is a breach in this insulation and ventricular excitation occurs closer to the base on the septum either directly from the His bundle or from the proximal bundle branches. This is termed a fasciculoventricular connection or pathway. The reader should note that these do not represent true atrioventricular accessory bypass tracts since anatomically there is no direct connection from the atrium to ventricular myocardium. Importantly, when the AV node blocks, there is no pre-excitation and progressive decrement in AV nodal conduction is not associated with progressive pre-excitation as seen with typical atrioventricular bypass tracts. The pediatric electrophysiologist should be cognizant of this anatomic variant and differentiate these electrophysiologically from true bypass tracts since fasciculoventricular tracts are not associated with tachycardia and should not be targeted for ablation.In the pediatric population, in patients without prior cardiac surgery or congenital heart disease, atrial flutter and atrial fibrillation are uncommon. While atrial flutter is one of the most frequent causes of fetal tachycardia, after birth, the arrhythmia is rarely seen without coexisting cardiac disease. Similarly, atrial fibrillation in the pediatric age group is unusual without coexisting disease such as the Holt-Oram syndrome or with familial/inherited atrial fibrillation. From the anatomic perspective, a few important differences are significant with pediatric ablation and are outlined below .The cavo-tricuspid isthmus also referred to as the subeustachian isthmus is the critical zone for the typical atrial flutter circuit . This isRecognizing the occurrence of this pouch is also important when attempting to cannulate the coronary sinus including for cardiac resynchronization procedures, and this issue if explained more fully in another manuscript in this series.When ablating atrial fibrillation in children, the pulmonary veins are typically isolated. However, the veins tend to be smaller in children and the sleeve of myocardium entering the vein is also smaller . FurtherBecause of the small pulmonary veins and branches, acute occlusion of one of the venous branches may occur during ablation. When venography is performed, it can be difficult to know whether a branch has been occluded or did not exist at all. A simple anatomic rule of pulmonary vein branching can assist the operator in making this decision. Daughter veins that tend to coalesce into a parent trunk have a consistent relationship in terms of the diameter or circumference. The diameter (or circumference) of the daughter veins (tributaries) when added up always is greater (110%) than the diameter (or circumference) of the main vein .Although ventricular tachycardia ablation in children has gone from a rarely performed procedure to more frequently done, it still remains most likely required in children with congenital heart disease or other structural abnormalities. When significant structural abnormality is present , a defibrillator has often been placed, and the ablation procedure performed to minimize frequent shocks. The use of defibrillators in children and principles of radiofrequency ablation in pediatric scar-related VT are covered elsewhere in these discussions and this supplement. In this paper, we will expand on the anatomic basis of the two most common ventricular tachyarrhythmias found in children with otherwise structurally normal hearts.Outflow tract ventricular tachycardia is characterized by exercise-related wide QRS tachycardia that mostly occurs in active older boys and less commonly as paroxysmal VT in postmenarchal girls. In a few children with right ventricular outflow tract tachycardia, underlying cardiomyopathy, particularly arrhythmogenic right ventricular cardiomyopathy is found, but the vast majority have no obvious structural heart disease. An accurate understanding of the underlying anatomy of the outflow tracts is critical to safe catheter manipulation, mapping, and ablation of this arrhythmia in children. Pediatric ablationists should familiarize themselves with the relative positions of the right and left ventricular outflow tracts, myocardial sleeves that extend beyond the semilunar valves, and knowledge of the coronary arterial systems relative to both the left and right ventricular outflow tracts.rightward and posteriorly should prompt consideration of left ventricular outflow tract mapping. Similarly, when mapping the left ventricular outflow tract, leftward and anterior activation sites should prompt reconsideration of meticulous mapping of the posterior right ventricular outflow (a site where catheter positioning is not straightforward) .Myocardial sleeves have been well described that extend beyond the semilunar valves to various lengths endocardial to the great arteries. While these occur in all age groups, the relative lengths of these myocardial sleeves appear to be longer in infants and young children . When maleft main coronary artery. While it is common for ablationists to consider performing coronary angiography when ablating in the left ventricular outflow tract, the proximity of the ostium and initial course of the left main coronary artery is closer to the a catheter position to deliver radiofrequency energy in the posterior right ventricular outflow tract close to the pulmonic valve. Because of the relatively shorter angle formed in very young patients and the lack of thick myocardial separation, particular care when ablating at these locations in children is required. When doubt exists, either intracardiac echocardiography to carefully document the separation between the ablating catheter and the coronary arteries or coronary angiography should be performed [Because the pulmonic valve is cephalad and leftward of the aortic valve, the posterior portion of the right ventricular outflow tract just above and at the level of the pulmonic valve is very close to the erformed .Exercise-related ventricular tachycardia in structurally normal hearts that exhibit a right bundle branch block superior access morphology is usually mapped and ablated in the region of the left posterior fascicle (Belhassen's VT). While the heart is typically structurally normal, tissue that traverses the left ventricular cavity from the septum to the free wall is sometimes found close to the region of successful ablation. These have been variously referred to as false tendons, interpapillary muscle chords, left ventricular chords, or lancisi fibers. While such structures are commonly found even in patients without ventricular tachycardia that has been documented when clearly recognized with an imaging modality (echocardiography), their presence can guide the ablationist, particularly when tachycardia has been difficult to induce.An important trend in contemporary electrophysiology is anatomy-based ablation. Although the pediatric electrophysiologist still needs to clearly understand the physiological principles underlying various mapping, diagnostic, and ablation maneuvers, an appreciation of the underlying cardiac anatomy has become critical.Understanding cardiac anatomy will help minimize complications including collateral damage to the AV conduction system, pulmonary veins, and neighboring structures in the pyramidal space of the heart. Further, an appreciation of the complex anatomy of the ventricular outflow tracts, particularly in children allows accurate correlation between mapping, electrocardiographic, and imaging data. Such understanding again decreases the likelihood of damage to the coronary arteries while facilitating successful ablation.

Solanum lycopersicum L.) is the most intensively investigated Solanaceous species both in genetic and genomics studies. It is a diploid species with a haploid set of 12 chromosomes and a small genome (950 Mb). Based on the detailed knowledge on tomato structural genomics, the sequencing of the euchromatic regions started in the year 2005 as a common effort of different countries. The manuscript focuses on markers used for tomato, on mapping efforts mainly based on exploitation of natural biodiversity, and it gives an updated report on the international sequencing activities. The principal tools developed to explore the function of tomato genes are also summarized, including mutagenesis, genetic transformation, and transcriptome analysis. The current progress in bioinformatic strategies available to manage the overwhelming amount of data generated from different tomato “omics” approaches is reported, and emphasis is given to the effort of producing a computational workbench for the analysis of the organization, as well as the functionality and evolution of the Solanaceae family.Tomato ( Solanum lycopersicum L., formerly Lycopersicon esculentum Miller) is aneconomically important crop worldwide, and a preeminent model system forgenetic studies in plants. It is also the most intensively investigated Solanaceousspecies, with simple diploid genetics, a short generation time, routinetransformation technology, and availability of rich genetic and genomicresources. It has a diploid genome with 12 chromosome pairs and a genome sizeof 950 Mb [2 synteny mapping population and permanent recombinant inbred (RI) mappingpopulations; (iv) BAC libraries and an advanced physical map; (v) TILLINGpopulations; and (vi) tomato microarrays, gene silenced tomato lines, and VIGSlibraries (for transient silencing).Tomato RNA transcription and protein analysis, (ii)screening of posttranslational modifications and protein-protein interactions, and(iii) discovery of metabolic networks. The information generated by large-scalegenome sequencing can lead a major revolution in the understanding of tomatobiology.http://www.sgn.cornell.edu) was createdto facilitate distribution of genomic information for tomato in particular andfor Solanaceous species in general in a comparative genomic context [The International Solanaceae Genome Project(SOL) was established to develop a network of knowledge on the Solanaceaefamily and to coordinate the research efforts of different groups from aroundthe world . The Sol context . ThechaProgress in tomato research will depend on ourability to tie together the independent components into higher-order complexitywith multiple dimensions. Multidisciplinary research efforts, involving theincreased input of chemistry, physics, statistics, mathematics, and computingsciences, are becoming increasingly crucial for the success of such approach.Beginning in the 1980s, different types ofmolecular markers have been developed in tomato. Among crop species, tomato isone of the richest in the number and type of these genetic markers, including restrictionfragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), cleaved amplifiedpolymorphic sequence (CAPS), amplified fragment length polymorphisms (AFLPs),and single nucleotide polymorphism (SNP). Chronologically, RFLPs were thefirst markers developed. Currently, more than 1000 RFLPs have been mapped onthe 12 tomato chromosomes. A subset of RFLP markers has been converted intoPCR-based markers through sequencing of their ends. These sequences areavailable from the SGN Database, thus allowing specific primers for PCRreaction to be designed. Other PCR-based markers were developed both as randommarkers, such as random amplified polymorphic DNA (RAPD), AFLPs, andlocus-specific markers, such as SSRs, CAPS, and conserved ortholog sets (COSs);and many of them have been mapped onto the high-density tomato genetic map .Given the huge number of markers that have beenset up for tomato using different methods, a database collecting the differentdatasets is available at the SGN website. Indeed, all information for more than15,000 markers is collected in the SGN , where ahttp://www.accelrys.com/products/gcg).Most of these SSRs (around 80%) were novel SSRs, since they did not match anyof the the mapped markers, thus being candidates for novel microsatellite markers[Solanum genotypes . These willallow useful PCR marker to be derived that also fall in intron regions, thuscomplementing the detection of polymorphism in the coding regions representedby the ESTs.Recently, large-scale sequencingwork in tomato has been generating sequences of whole BAC and cloned genes,ESTs collected from different cDNA libraries, and the sequences of full-lengthcDNAs. The cataloguing of these sequences in public databases is providinguseful information to develop markers with high resolving power, such as SNPsand InDels, thus initiating an era of insilico tomato marker discovery. The tomato SSRs are an example ofgenetic markers that can be mined from existing sequence data. Smulders et al., by scre markers. In addi markers;and an markers. MoreoveS. lycopersicum and its closely related wild species.Recently, oligonucleotide-based arrays have been used to identify DNA sequencepolymorphisms in different species, since they allow high-throughputdevelopment of markers. Total genomic DNA hybridization methods are also beingexploited in tomato with the aim of identifying markers such as single feature polymorphisms(SFPs). For instance, a 15.27 K gene NimbleGen tomato array was used by Sim etal. for a stS. lycopersicum × S. pennelliiGenetic mapping of morphological traits in tomato started at the beginning of last century, and by 1973 a total of 257morphological and disease resistance markers had been mapped . By theThe Solanaceae is the first family of flowering plants for which comparative mapping was conducted , 18. As A. thaliana, which facilitated the development of PCR-based COS markers using genes shared between distantly related plant taxa [Arabidopsis genome and the genomes of tomato and other Solanceous species, COSII markers are being mapped not only on tomato genome, but also on the genomes of other major Solanaceous species including eggplant, pepper, and Nicotiana (http://www.sgn.cornell.edu/markers/cosii_markers.pl). Also, in order to testthe efficacy of COSII markers for comparative mapping across large phylogeneticdistances, a subset of COSII markers is being mapped on the genomes of bothtomato and diploid coffee (Coffeacanephora) [Comparative genomics research is presently gaining momentum in Solanaceae due to availability of sequencing datafor several species. This will greatly enhance the resolution of comparative mapping in this family. This research activity received further support due to the availability of whole genome sequence of ant taxa , 8. For Besides genetic linkage maps,cytological and cytogenetic maps are also available for tomato. For example,Sherman and Stack developeS. lycopersicon × S. pennellii map. This analysis found 600 markers that unambiguously anchor over 5000 BACs to the genetic map [The availability ofmapped markers and of FISHed BAC allowed the construction of a high-densityintegrated genetic and physical map, whose definition is still in progress, andwhich is the foundation for the tomato genome sequencing project. Overgoanalysis has been used to match BAC to probes based on markers from the etic map . ActuallThe high-density RFLP linkage mapdeveloped for tomato facilitated extensive mapping of qualitative traits suchas various disease resistance genes, for example, , 28. ThiSolanum species and in all casesfavorable wild QTL alleles have been detected for more than 45% of theevaluated traits [2 or BC3), few additionalmarker-assisted generations are required to develop near isogenic lines (NILs)or introgression lines (ILs) that can be phenotyped in replicated trials inorder to confirm the QTL effect and subsequently be used for varietydevelopment. Numerous QTL-NILs or ILs have been developed starting from thetomato AB-QTL mapping populations, and several of them have been characterisedfor numerous quantitative traits, for example, [The above resultsindicated that new molecular breeding strategies need to be devised in order toallow more efficient use of the genetic potential stored in seed banks andexotic germplasm. One such approach, the “advanced backcross QTL mappingmethod” was proposed by Tanksley and Nelson with thed traits . These dexample, , 36.Since exotic germplasm is an important source offavorable alleles for the improvement of quantitative traits, introgressionlines (ILs) developed in tomato have a special significance. This also supportsthe proposal by Zamir for inveS. pennellii (acc. LA716) and the cultivated tomato S. lycopersicum (cv. M82). Presently,this library consists of 76 RFLP-defined ILs which partition the entire geneticmap into 107 bins defined by single or overlapping segments [S. pennellii ILs andtheir hybrids have been phenotyped for more than one hundred traits. For 20different characters, such as yield,fruit morphology, and biochemical traits, repeated measurements areavailable, and the resulting data are presented, in silico, in a search enginecalled “Real Time QTL” [http://zamir.sgn.cornell.edu/Qtl/Html/home.htm).In tomato, the first exotic libraryensuring whole genome coverage was developed by Eshed and Zamir from thesegments . Over thime QTL” .More recently, the eterosis , 45. Fureterosis . The outS.habrochaites, S. pimpinellifolium, S. lycopersicoides, and S. chmielewskii [The advantages of the ILapproach have motivated the public and private sectors to invest in thedevelopment of new library resources starting from interspecific crosses withdifferent wild species of tomato including elewskii , 46–49.http://www.eu-sol.net), a geneticinfrastructure of “exotic libraries” is being further refined from a diverseselection of accessions. Moreover, the IL populations are being anchored to acommon PCR marker-based framework, mostly consisting of COSII markers, whichwill facilitate QTL identification, mapping, cloning of the underlying genes,and the use of the novel variation in marker-assisted breeding.To enhance the rate ofprogress of introgression breeding in tomato, within the framework of acurrently running EU project (EU-SOL) (http://sgn.cornell.edu/solanaceae-project)).A sequencing strategy on a BAC by BAC basis of approximately 220 Mb euchromatinwas proposed. The tomato genome comprises approximately 950 Mb of DNA—more than 75% of which is heterochromatin andlargely devoid of genes [Thetomato genome is being sequenced as the cornerstone of an InternationalSolanaceae Genome Initiative, a project that aims at developing the familySolanaceae as a model for systems biology for understanding plant adaptationand diversification and web repositories, were provided by different partners. Seed BAC and contigswere mapped to each chromosome at Cornell University by means of overgo probes.A fingerprint map of approximately 10X genome equivalents from the LE_HBalibrary has been constructed at the University of Arizona through funding fromthe National Science Foundation (http://www.genome.arizona.edu/fpc/tomato). Recently, a Sanger Initiative was focussed on the generation of additionalfingerprint data from the MboI library in order to allow comparison and integration of the two datasets.Fluorescent in situ hybridization (FISH) was provided to help guide theextension of the tiling path through the euchromatic arms of each chromosomeand to determine the location of heterochromatin regions [In order to facilitate the sequencing task,marker analysis strategies, cytogenetic protocols, and a number ofbionformatics and molecular tools have been developed in recent years. Most ofthe genome sequencing resources, such as BAC libraries was used both to confirm and extend the euchromatin minimal tilingpath (e-MTP). Each BAC-end sequence wassubjected to automated annotation to determine the proportion of ends that arelikely to correspond to genic regions. To improve this process, differentstrategies have been developed. In the Netherlands, BAC walking was supportedusing a sequence-tagged connector approach based on AFLP fingerprinting asoutlined in Peters et al. [S. lycopersicon and S. pennellii in both the resequencedanchor marker region and the BAC-ends allowed positioning of each extending BACon chromosome 12 .After a low-coverage sequencing of each seed BAC, the construction of aminimal tiling path of BAC clones was performed by BLASTing the sequence ofeach “seed” BAC against the BAC-end STC Database to identify BAC with minimaloverlap in either directions. The BAC-end Database consisting of 200,000 clones andchromosome 8 have also been sequenced. In all,more than 800 BAC are in different phases of sequencing, and sequencesbelonging to more than 500 BAC accounting for approximately 21% of total BAC havealready been submitted to the SGN website.Assuming that work on the tomato genome projectwill continue at the current pace, high-quality sequencing of the euchromaticspace should be completed within the next one or two years (by 2008 or 2009).Since the euchromatic portion of the genome is estimated to be approximately220 Mb, the average physical distance between two adjacent seed BAC should beas little as 200 kb. However, the available map has insufficient density and resolutionto provide a template for complete sequencing, since there are large chromosomeregions, which are not yet targeted with markers. Therefore, in order tocomplement the ongoing sequencing project, several new strategies have been undertaken. Forinstance, selection of additional seed BAC with different verification methods has been proposed. The recent release of markersfrom Syngenta to the SGN repository also allowed the identification of newcandidate seed BAC, which are distributed throughout the full genome. This may proveuseful for filling in gene spaces at a later stage of the project. Whole genomeshotgun sequencing and the availability of new generation sequencingtechnologies, including 454/Roche’s sequencer FLX, Solexa’s sequencing system,and ABI’s SOLiD, may also prove useful in completing the whole genomesequencing of the tomato genome.In order to understandthe function of specific genes and their role in metabolic pathways, as also toidentify the key steps in their coregulation mechanisms, several approacheshave been exploited, including mutagenesis, genetic transformation, andtranscriptome analysis.Arabidopsis, and maize, tomato was the focus of early, extensivemutagenesis programs. In a paper published in 1964, Hans Stubbe reviewed over250 tomato mutants arising from the seminal work of the Gatersleben group [http://tgrc.ucdavis.edu). More recently,an extensive mutant population consisting of 6000 EMS-induced and 7000 fast neutron-inducedmutant lines has been obtained (54). This population is probably saturating.For instance, extensive allelic tests confirmed that all the wiry mutants with 3 to 7 alleles presentin TGRC are represented in the population. Two new wiry loci have also been described in the collection, each with 10alleles. A detailed phenotypic description of the mutants is available online (http://zamir.sgn.cornell.edu/mutants).Both classical andinsertional mutageneses have been used in tomato. Indeed, together with barley, en group .To dateInsertional mutagenesis systemsexploiting exogenous transposon systems have also been described in tomato –57. Nevehttp://www.eu-sol.net).In addition to the above,a more recent strategy called targeting induced local lesions IN genomes (TILLING) was described byMcCallum et al. for targSolanum species [Arabidopsis [Strategies for genesilencing have also been widely used as a tool for functional genomics researchin tomato. Indeed, tomato fruit ripening was one of the early systems in whichboth sense and antisense silencing were found to be effective , 63. Mor species , as well species and Arabbidopsis .Transient expression ofexogenous genes has also been achieved through several transient transformationtechniques, such as particle bombardment or agroinfiltration. Recently, anagroinjection technique was developed for tomato fruits , which ahttp://bti.cornell.edu/CGEP/CGEP.html)and soon Tom2 will also be available from the EU-SOL project(http://www.eu-sol.net). The third arrayis an Affymetrix Genechip, which contains probe sets for approximately 9000 independent genes(http://www.affymetrix.com/products/arrays/specific/tomato.affx).As the tomato genome project progresses, a comprehensive, public tomato microarrayplatform will become indispensable.Finally, transcriptionalprofiling is being widely explored since the extensive EST collection availablein tomato has alloomics” approaches is being generated and can be utilizedfor genomics research. Therefore, bioinformatics approaches assume majorimportance in order to convert raw data into biologically meaningfulinformation. The SOL network is planning a bioinformatics infrastructure thatshould support integration of information from Solanaceae research into a“one-stop shop” on the web. This will ultimately allow Solanaceae biology to beapproached from a systems biology perspective. The bioinformatics centers inthe SOL network are all involved in building this infrastructure. It will relyon web service approaches [In order to address key questionsarising from the SOL initiative, an overwhelming amount of data fromdifferent “proaches to implehttp://www.sgn.cornell.edu/sequencing/ITAG/status_html.pl) is currently beingdeveloped through work on batches of sequences, which are generated at the SGNby grouping BAC which are being submitted by each sequencing center. Analyses,such as repeat masking, EST alignment and gene predictions, are performed onthe BAC. These data are fed into the EuGene combiner software [The preliminary effortof the bioinformatician in the SOL network is mainly focussed on setting up adistributed annotation pipeline to provide a high-quality, information-enrichedtomato genome. For this purpose, the International Tomato Annotation Group (ITAG)has been constituted, which is a collaborative effort in annotating the tomatogenome. It involves several groups from Europe, Asia, and the US. These groupsof scientists are organizing data and sharing methodologies to provide areliable tomato genome annotation. The ITAG annotation pipeline, S. pennellii (2), S. habrochaites (1), and thecorresponding “combined” consensus sequences. Other EST resources are as follows: (i) the Tomato Stress EST Database (TSED), which contains ESTs from morethan ten stress-treated substractive cDNA libraries from S. lycopersicum; (ii) theMicro-Tom Database (MiBASE)[S. lycopersicum generatedfrom EST sequences available at the NCBI dbEST Database [Severalspecific EST repositories from orldwide . The TIG(MiBASE), which d(MiBASE), which cDatabase .S. lycopersicum genome project.CAB-developed TomatEST , a seconhttp://www.eu-sol.net) is committed tocollect all EST data from Solanaceae species available in dbEST (Coffea genus (Rubiaceae) were considered in the CAB collection, since coffee and tomato share common gene repertoires [tentative consensus sequences (TCs).The CAB group within the EU-SOL project , an Italian bioinformatics resource for Solanaceae genomics. This effort is conceived to support the analysis of thegenome organization and its functionality in the light of evolutionaryapproaches over the entire Solanaceae family.genome level and the expression level. The cornerstone of the genome level is represented by the tomato genome draft sequences. The founding elements of the expression level are the Solanaceae EST collections and the oligonucleotide probe sets, which have beengenerated for the production of the tomato expression microarrays(http://www.affymetrix.com/products/arrays/specific/tomato.affx). A nonstop crosstalk between the levels is based on data source sharing and on integration of the information, which belongs to the respective under parts.Each level can be independently accessed through specific web interfaces which allow user-driven data investigation (http://biosrv.cab.unina.it/isola/isola.html).ISOL@ is currently organized into two main levels: the S. lycopersicum genomic sequences that are also provided to the distributed pipeline, which was set up within the ITAG effort. To accomplish this task, ESTs from the different plant source collection at CAB (Solanaceaeand Rubiaceae species), and the corresponding TCs, created by assembling ESTs in a cluster, are both used. Noncoding RNAs (ncRNAs) from the Rfam collection [S. lycopersicum genome. The Italian platform also includesalignments of all the RNA sequences from Arabidopsis to the tomato genomic sequences in order to identify genes that are conserved between the two species.In order to provide a preliminary annotation of the BAC sequences while waiting for the whole genome annotation that will beprovided by the ITAG, the CAB group has set up an automated annotation pipeline in order to ensure daily retrieval of new S.lycopersicum BAC sequences from GenBank, which are used to feed the genome annotation process. The BAC annotationprocess aims at identifying genes and other genetic elements on the draft genome sequence. The protein coding “gene finding” process is exclusively based on spliced-alignments of expressed sequence tags (ESTs) tothe llection are alsollection is the rThe collection, as of July 2007, comprises 186 BACsequences which have been uploaded from all the sequencing centers to theGenBank Database. The BAC sequences collected and annotated are released to the scientificcommunity through the Gbrowse web applThis above effort aims atproducing a computational workbench for the analysis of the organization, thefunctionality, and the evolution of genomes in the Solanaceae family. Inaddition, it provides experimental biologists with a preliminary annotation oftomato genome data, and represents a reference point while sequencing thetomato genome. Indeed, thecrosstalk between the sequencing data and the computationally defined TCs maysupport BAC extension and aprIn the “-omics” age, strategies forintegrated genomics that include DNA sequence mining, expression profilingdata, and functional and molecular diversity analyses of candidate genes,combined with the use of introgression lines, can increase the efficiency indiscovery, candidate gene identification, and cloning of target QTLs .Given t

Mapping and monitoring carbon stocks in forested regions of the world, particularly the tropics, has attracted a great deal of attention in recent years as deforestation and forest degradation account for up to 30% of anthropogenic carbon emissions, and are now included in climate change negotiations. We review the potential for satellites to measure carbon stocks, specifically aboveground biomass (AGB), and provide an overview of a range of approaches that have been developed and used to map AGB across a diverse set of conditions and geographic areas. We provide a summary of types of remote sensing measurements relevant to mapping AGB, and assess the relative merits and limitations of each. We then provide an overview of traditional techniques of mapping AGB based on ascribing field measurements to vegetation or land cover type classes, and describe the merits and limitations of those relative to recent data mining algorithms used in the context of an approach based on direct utilization of remote sensing measurements, whether optical or lidar reflectance, or radar backscatter. We conclude that while satellite remote sensing has often been discounted as inadequate for the task, attempts to map AGB without satellite imagery are insufficient. Moreover, the direct remote sensing approach provided more coherent maps of AGB relative to traditional approaches. We demonstrate this with a case study focused on continental Africa and discuss the work in the context of reducing uncertainty for carbon monitoring and markets. The monitoring requirements for reducing emissions from deforestation and forest degradation have been widely discussed and documented in a range of publications, including overviews of the general requirements to meet policy needs as well Basing UNFCCC (United Nations Framework Convention on Climate Change) REDD (Reduced Emissions from Deforestation and Degradation) policies on a carbon stock mapping approach would have a number of benefits relative to approaches based solely on field sampling and forest inventories. This is true not only in terms of improving estimates of carbon stored in forests for the emerging carbon markets, by providing spatially explicit information on the location of carbon stocks, but also with respect to avoiding the ambiguities, uncertainties and outright differences among land cover type classifications . A carboIn the remainder of this overview we use carbon stock and above-ground biomass terminology interchangeably . We recognize that carbon stocks can refer to below-ground and soil carbon as well, neither of which are directly discussed here.-1 [Since the 1960's, SAR has been used to produce images of earth-surface features based on the principles of radio detection and ranging and has been widely used to map AGB ,14. SAR -1 . A numbeLike radar, lidar is based on the concept of actively sensing the vegetation using a pulse of energy, in this case from a laser operating at optical wavelengths (rather than at radio wavelengths). Lidar does not penetrate clouds but has the unique capability of measuring the three-dimensional vertical structure of vegetation in great detail, sometimes with hundreds of measurements in the vertical dimension for each location on the Earth . WhereasOptical remote sensing, i.e., passive sensing of visible and near-infrared reflectance from the earth, forms the basis for much of current global scale mapping . Optical measurements have been widely used in studies that link AGB measurements from the field to satellite observations, based on sensitivity of the optical reflectance to variations in canopy structure, but these have not proven to be consistent over large areas because surface conditions may change more rapidly than the repeat time of the cloud-free satellite observations, producing artefacts in the derived maps. This has been overcome using frequent repeat measurements from sensors such as the Moderate Resolution Imaging Sensors (MODIS) onboard the AQUA and TERRA satellites ,22. DespNo single sensor on any satellite mission, whether radar, lidar or optical, can be expected to provide consistently infallible estimates of biomass, but use of these measurements in a synergistic fashion can potentially overcome the limitations of each . Moreover, some remote sensing observations may be more sensitive to AGB in specific environments or in areas with different AGB densities (e.g. lidar in dense humid forest).A number of approaches have been developed to map carbon stocks and AGB from the satellite observations described above. Each of the approaches relies on calibrating the satellite measurements to in situ estimates of AGB at field study plots. AGB is often determined using a combination of well documented allometric relationships between simple plot-level measurements and AGB, where the latter is determined from trees that have been dissected, oven-dried and weighed ,24,25. TThe simplest approach to derive carbon stock maps is to assign a single value to each of a number of land cover, vegetation type, or other thematic map classes that have been derived from satellite data (or other map sources) and placed into categories . These thematic class areas are then multiplied by the assigned values to estimate total carbon stock values. Land cover maps are widely available from a number of sources, with the most consistent and best-documented effort to date being the Global Land Cover 2000 maps produced by a broad consortium of research groups . This "sAn extension of the stratify & multiply approach is a "combine & assign" approach, which essentially makes use of a wider range of data sets and spatial information to extend the field AGB estimates. For example, population estimates (or maps derived from interpolating population location data) can be used together with vegetation type classes and any of a number of other spatial data layers in a geographic information system (GIS) to provide finer-grained units over which the field data can be applied (given that adequate field data exist to characterize each of the basic map units). A substantial advantage to this approach, besides finer spatial units of aggregation, is that different weights can be applied to various data layers in order to capture information that is known (such as locations where forests are more degraded around settled areas) or to average gradients across large areas (such as variations in vegetation density within type classes). Another advantage of this type of simplified GIS "modelling" is that values can be aggregated and provided for specific political jurisdictions for the DR approach to estimate AGB, further comparison of the maps in Figure Any of the approaches described herein could potentially be used in a framework for monitoring AGB stock changes. An SM approach would use new land cover maps to estimate changes in stocks, but the maps would need to be recreated at both (each) time step at accuracies that exceed those of typical current map products . A CA approach could make use of successive field surveys to update maps derived using GIS models, but field data are unlikely to ever be sampled adequately for monitoring purposes, particularly outside "intact" forests , and theWell documented techniques and satellite data enable reliable mapping of carbon stocks over large areas. Although a number of relatively simple methods exist for assigning field estimates of AGB to categories defined by vegetation type classes or weighted data layers in geographic information system models, the most spatially consistent maps are produced using models that derive continuous values (e.g. between 0 and 500+ tons per hectare) from statistically optimized decision rules. The techniques and data sources described herein are published in the refereed scientific literature and are progressing rapidly as new "data mining" techniques are advanced and imprThe authors declare that they have no competing interests.SJG conceived the review and drafted the majority of the manuscript. NTL, AB and MS conducted the analyses summarized in the Figure and Table. TJ contributed the section on good practice guidance. SJG, WW, JK summarized of types of satellite measurements. RH and the other authors read, edited, and approved the final manuscript.

Background The short- and long-term results of balloon dilation therapy in Crohn'spatients with non-anastomotic obstructive gastrointestinal lesions are investigated. Materials and methods Fifty-five patients with Crohn's disease who had obstructivegastrointestinal lesions were treated prospectively by endoscopic balloon dilation. Short-term results Eight of the initial dilations were unsuccessful giving no symptomaticrelief (14.5%). Long-term results The subjects of the long-term prognosis were 40 cases followed upfor more than 6 months (average 37 months) and their strictures were non-anastomotic inmore than half (59%). Avoidance of surgery, was possible in 31 of 40 patients (78%). Surgerywas avoided in 92%, 81% and 77% of patients after one, two, and three years, respectively(Kaplan–Meier's method). There was no difference in long-term outcome betweenanastomotic strictures and strictures in the absence of prior surgery. Conclusion Our results suggest that, (1) strictures in the absence of prior surgerymight be treated in this way as well as anastomotic strictures; (2) if followed for a prolongedtime period, more than 70% of patients, who have undergone balloon dilation forobstructive gastrointestinal Crohn's disease, may be able to avoid surgery.

Bryostatin 1, an anti-neoplastic agent and protein kinase C activator, has dose-limiting toxicity manifesting as myalgia. Studies in vivo have suggested that this myalgia may be caused by impairment of oxidative metabolism as mitochondrial capacity, muscle reoxygenation and proton washout from muscle are reduced by bryostatin, possibly as a result of vasoconstriction. To investigate these mechanisms further, and to enable use of bryostatin for prolonged periods, the effect of a vasodilator on the established effects of bryostatin on calf metabolism was studied using 31P magnetic resonance spectroscopy and near infrared spectroscopy. Six patients with disseminated melanoma were examined on four occasions: before and 1 week after initiation of long-term nifedipine (10 mg twice daily) treatment and then 4 and 48 h after bryostatin infusion (25 micrograms m(-2)). Nifedipine impaired muscle oxidative metabolism but had no effect on proton efflux or muscle reoxygenation rate. In the presence of nifedipine, two of the effects of bryostatin, impaired reoxygenation rate and reduced proton efflux, were abolished, but the impaired mitochondrial activity remained. These results show that nifedipine counteracted the vasoconstrictive effect of bryostatin 1. However, because nifedipine itself had an unexpected effect on mitochondrial metabolism, it was not possible to assess whether nifedipine modified bryostatin's effect on this variable. There was no additive detrimental effect of bryostatin on mitochondrial metabolism and nifedipine did not reduce the clinical toxicity of bryostatin 1, which cannot therefore be due to vasoconstriction.

Ostrinia nubilalis, and its Asian congeners, Ostrinia furnacalis and Ostrinia scapulalis, exhibit within-species and between-species variation in their pheromone communication. Recently, we reported ultrasound communication in O. furnacalis; however, variations in ultrasounds in the three congeners have not been addressed to date. Here we investigated features of ultrasound production and hearing in O. nubilalis and O. scapulalis, and compared them with those of O. furnacalis. As in O. furnacalis, males of O. nubilalis and O. scapulalis produced ultrasounds during courtship by rubbing specialized scales on the wings against scales on the thorax. The covering of these scales with nail polish muffled the sounds and significantly reduced mating success in O. nubilalis, showing the importance of ultrasound signaling in mating. The ultrasounds produced by O. nubilalis and O. scapulalis were similar, consisting of long trains of pairs of pulses with a main energy at 40 kHz, but distinctly different from the ultrasound produced by O. furnacalis, consisting of groups of pulses peaking at 50 kHz and with substantially more energy up to 80 kHz. Despite overall similarities, temporal features and patterns of amplitude modulation differed significantly among the geographic populations of O. nubilalis and O. scapulalis, which differed in pheromone type. In contrast, no significant difference in hearing was found among the three species with regard to the most sensitive frequencies and hearing threshold levels. The patterns of variations in the songs and pheromones well reflected those of the phylogenetic relationships, implying that ultrasound and pheromone communications have diverged concordantly. Our results suggest that concordant evolution in sexual signals such as courtship ultrasounds and sex pheromones occurs in moths.Moths use ultrasounds as well as pheromones for sexual communication. In closely related moth species, variations in ultrasounds and pheromones are likely to profoundly affect mate recognition, reproductive isolation, and speciation. The European corn borer, Moths have tympanal ears sensitive to ultrasound. The tuning of hearing to bat calls as well as the degeneration of hearing in bat-free areas indicates that ears of moths have most likely evolved to counteract predation by insectivorous bats Ostrinia furnacalis (Crambidae), produce low-intensity ultrasonic courtship songs of ca. 46 dB SPL at 1 cm Achroia grisella), where females show preference for specific temporal and spectral features of ultrasonic calling songs of conspecific males Males of the Asian corn borer moth, Ostrinia species release specific sex pheromones in order to attract conspecific males from a distance O. nubilalis, and the Adzuki bean borer, O. scapulalis, have a similar pheromone, a mixture of (Z)-11- and (E)-11-tetradecenyl acetates (E11- and Z11-14:OAc) O. furnacalis uses a mixture of different positional isomers, (Z)-12- and (E)-12-tetradecenyl acetates O. nubilalis that produce and respond to Z and E type pheromones, respectively O. nubilalis co-occur, strong assortative mating within the races was found to be occurring O. scapulalis seems to vary among localities Sexual communication using female sex pheromones is widespread across various moth species acetates [14], . These results show that male-specific wing scales and thoracic scales play an important role in ultrasound production, and demonstrate the importance of sound communication for increasing mating success.The covering of the male-specific wing scales and thoracic scales with nail polish substantially reduced the levels of ultrasounds in O. nubilalis and O. scapulalis , the ultrasounds of O. nubilalis and O. scapulalis consisted of long trains of pairs of pulses, pulse 1 and pulse 2, which exhibit different temporal features and amplitudes. In the pair, pulse 1 was defined as the one with the shorter pulse interval .O. nubilalis and O. scapulalis were broadband with most energy and peak sound levels (mean  = 45 dB SPL) at high frequencies (≈30–60 kHz) than the other species, but approximately the same peak sound level (46 dB SPL) (The pulses of –60 kHz) . O. furn dB SPL) .O. nubilalis and O. scapulalis, which differ in pheromone types, i.e., three populations of O. nubilalis and two populations of O. scapulalis [Z type (Morioka) and E type (Furukawa) from Japan]. Overall, we found that both spectral features and sound levels differed between pulses 1 and 2 of O. nubilalis and O. scapulalis and among the five populations of the two species. In a population of Z-type O. nubilalis (Darmstadt), the variation in individual spectra of pulses 1 and 2 was small and E type (Warloy) and E type (Furukawa) , and so did peak frequencies of pulse 1 and pulse 2 , whereas peak frequencies did not.We compared features of the ultrasound between the populations of as small . Variati(Warloy) , and in urukawa) . Peak so<0.0001) . Among tO. nubilalis and O. scapulalis and E-type O. nubilalis (Warloy) are well characterized in the patterns of autocorrelation coefficients , but there was no significant difference between pulse 1 and pulse 2 in the five populations. Subsequently, discriminant function analyses and canonical variate analyses (CVA) were performed to examine how the autocorrelation coefficients for pulses 1 and 2 differed among the three populations of O. nubilalis [Z type (Darmstadt and Toulouse) and E type (Warloy)] and two populations of O. scapulalis [Z type (Morioka) and E type (Furukawa)]. Plots of CVA scores showed that the confidence ellipses were well separated from each other in terms of the populations, while the difference between pulse 1 and pulse 2 was small throughout the populations and E types (Warloy and Paris)] and four Japanese populations of O. scapulalis [Z types (Morioka and Tsuchizawa) and E types (Tsuchizawa and Furukawa)] and pulse interval In contrast, a significant populational difference was found only in pulse intervals in O. scapulalis . Similarly, temporal features of pulse 2 were compared among four populations of O. nubilalis and O. scapulalis in O. nubilalis, whereas no significant difference in any features was detected in O. scapulalis. No significant difference in temporal features was found between the two sympatric (Tsuchizawa) populations of O. scapulalis differing in pheromone type either.Levels of variation in pulse duration and pulse interval were high among the populations of rukawa)] , 3. In Oapulalis . A signiO. nubilalis (Darmstadt), the individual hearing threshold curves showed a steep increase in sensitivity over 30 kHz, and gradual decrease beyond 60 kHz as well as Z-type and E-type O. scapulalis (Matsudo) showed similar patterns or in the thresholds at these frequencies . No significant difference was found in the most sensitive frequencies and their threshold levels among the species or pheromone types .In a population of Z-type d 60 kHz . The indpatterns . No signOstrinia moths was tuned to the features of courtship ultrasound. In populations of O. nubilalis and O. scapulalis, the frequency range of male ultrasounds was well within the most sensitive frequency range of hearing (≈30–60 kHz) and marginally lower than those of pulse 2 . These results showed that peak sound levels are above the hearing thresholds in populations of O. nubilalis and O. scapulalis.Hearing in –60 kHz) , 6. A diOstrinia species. The songs of O. nubilalis and O. scapulalis were distinctly different from the song of O. furnacalis in spectral and temporal features, while the sound levels of the songs of the three species were similar (44–46 dB SPL at 1 cm). The songs of O. nubilalis and O. scapulalis were composed of pairs of pulses, clearly contrasting to the chirp structure of the song of O. furnacalis was narrower than that of O. furnacalis (35–80 kHz) . Interesne types , 5. O. nariation .O. nubilalis and O. scapulalis are very closely related to each other, but relatively distantly related to O. furnacalis and that of O. furnacalis.When producing courtship ultrasounds, forewing , which pforewing [7]. TheO. nubilalis and O. scapulalis, but patterns of amplitude modulations did not was 53 cycles/s. This estimate is lower than the rate in O. furnacalis during ultrasound production (74 cycles/s) but close to that in O. furnacalis during free flight (42 cycles/s) Ostrinia species is a plausible cause for the differences in the temporal features of the ultrasound.The wing beat rate during the production of ultrasound can be estimated from the pulse repetition rate O. nubilalis and O. scapulalis was matched to the frequencies and sound levels of the songs also can discriminate between bats and conspecifics Males of pulation . In O. fFemale pheromone communication for mate attraction prevails across various taxonomic groups of moths, that is, more than 16 of 25 superfamilies O. nubilalis and O. scapulalis monomorphic in the production of Z-type pheromone [97–100% of (Z)-11-tetradecenyl acetate and 0–3% of (E)-11-tetradecenyl acetate] or E-type pheromone [0–1% of (Z)-11-tetradecenyl acetate and 99–100% of (E)-11-tetradecenyl acetate] were established from insects collected at different localities in Europe and Japan , southern France, and from mugwort at Warloy , northern France (provided by Sergine Ponsard). O. nubilalis collected from maize and mugwort in France are known to use Z- and E-type pheromone, respectively O. nubilalis in France with E-type pheromone were recently proposed to be considered as O. scapulalisO. nubilalis, according to the established practice . We believe that our interpretation of the results would essentially be unaffected by the proposed change in the species name of the populations from Warloy and Paris. In O. scapulalis, adult females collected at Morioka O. scapulalis culture was checked by gas chromatography as described by Tabata et al. (2003) Ostrinia were maintained in the laboratory as described by Takanashi et al. (2005) Cultures of nd Japan , as descO. nubilalis [Z type (Toulouse) and E type (Warloy)] as described in Nakano et al. (2008) O. nubilalis (Darmstadt) and two populations of O. scapulalis [Z type (Morioka) and E type (Furukawa)] using another condenser microphone as described in Nakano et al. (2006) Sounds were recorded at room temperature during the scotophase using three different systems in laboratories at the University of Tokyo and University of Southern Denmark. At the University of Tokyo, we examined two populations of O. nubilalis (Paris) and of O. scapulalis [Z type (Tsuchizawa) and E type (Tsuchizawa)] were recorded using a bat detector with a microphone for the analysis of temporal features alone. Recordings on the detector with a 3.4s digital memory (sampling at 307 kHz) were saved at a 10-fold reduced clock rate onto a Sony MZ-B10 MD recorder, and digitized and saved on a computer with a sampling rate of 44.1 kHz. The effective sampling rate for later analysis was 441 kHz because the sounds were recorded with the MD recorder at a 10-fold reduced speed.In addition to the above systems, sounds of E-type Temporal features of sounds recorded by the three systems were analyzed using BatSound software. We measured two parameters for the sound pulses: pulse duration and pulse interval see . These pO. nubilalis and O. scapulalis [Z type (Morioka) and E type (Furukawa)]. We then calculated autocorrelation coefficients of these values for up to 30 lags corresponding to 0.1 ms, and used them as explanatory variables in the following analyses. We examined the differences in the autocorrelation coefficients among the pulse pairs from the five populations of the two species using a nested multivariate analysis of variance (MANOVA). Linear discriminant function analyses were subsequently used to examine how many individuals were correctly classified into the original groups of the species, of the populations, and of the pulse pairs. In order to compare the pattern of pulse amplitude modulation, a canonical variate analysis (CVA) In order to extract structural patterns of pulse amplitudes among different populations of moths, we used autocorrelation function analyses O. nubilalis (Darmstadt) and E-type O. scapulalis (Matsudo) were observed as described in Nakano et al. (2008) The scales on the wings and thoraxes of Z-type O. nubilalis (Darmstadt). For muting, sound scales on the mesothorax and forewings were covered with nail polish. For the sham control, ordinary scales, instead of the sound scales, on the mesothorax and forewings were covered with nail polish. All treatments were performed on CO2-anesthetized virgin males under a stereomicroscope one day before the experiments. Seven to ten pairs of operated males and intact virgin females (2 or 3 days old) were introduced into a cubic mesh cage (18×18×18 cm) during the late scotophase when the moths showed high mating activity Mating success was compared between mute-operated and sham-operated males of Z-type Ostrinia, a pair of tympanal nerves runs through a branch of the first abdominal ganglion and the abdominal connective to a thoracic ganglion O. nubilalis [Z type (Darmstadt) and E type (Paris)] and O. scapulalis [Z type (Matsudo) and E type (Matsudo)].In Sound recording and analysis.The acoustic pulses were generated with an oscillator (Wavetek model 186) controlled by a custom-built pulse generator that gave shaped pulses with linear rise and fall times. The stimulus was amplified (Xelex) and broadcast through a Technics tweeter. The loudspeaker was calibrated before and after the experiments using a 1/4 inch microphone according to the method described in Audio S1Ostrinia nubilalis (Darmstadt). The ultrasound was slowed down 10 times by down-sampling of the recorded sound to make it audible to the human ear. The oscillogram of the ultrasound is shown in Courtship ultrasound of Z-type (0.05 MB WAV)Click here for additional data file.Audio S2Ostrinia scapulalis (Morioka). The ultrasound was slowed down 10 times. The oscillogram of the ultrasound is shown in Courtship ultrasound of Z-type (0.05 MB WAV)Click here for additional data file.Audio S3Ostrinia furnacalis. The ultrasound was slowed down 10 times. The oscillogram of the ultrasound is shown in Courtship ultrasound of (0.05 MB WAV)Click here for additional data file.

Immunoglobulin genes are generated during differentiation of B lymphocytes by joininggene segments. A mouse pre-B cell contains a functional immunoglobulin heavy-chain gene,but no light-chain gene. Although there is only one heavy-chain locus, there are two lightchainloci: κ and λ.It has been reported that κ loci in the germ-line configuration are never(in man) or very rarely (in the mouse) present in cells with functionally rearranged λ-chaingenes. Two explanations have been proposed to explain this: (a) the ordered rearrangementtheory, which postulates that light-chain gene rearrangement in the pre-B cell is firstattempted at the κ locus, and that only upon failure to produce a functional κ chain is therean attempt to rearrange the λ locus; and (b) the stochastic theory, which postulates thatrearrangement at the λ locus proceeds at a rate that is intrinsically much slower than that atthe κ locus. We show here that λ-chain genes are generated whether or not the κ locus haslost its germ-line arrangement, a result that is compatible only with the stochastic theory.

A combination of cyclophosphamide, doxorubicin, vincristine and prednisolone (CHOP) has been a standard therapy for histologically aggressive non-Hodgkin's lymphomas for over 20 years, but several newer regimens, referred to as second or third generation, have been reported to give improved results in single-centre studies. Positive evidence from randomised trials has been lacking, and the British National Lymphoma Investigation therefore commenced a randomised comparison of CHOP vs a third-generation regimen, PACEBOM, in November 1987. A total of 459 eligible patients were entered into the trial: 226 in the CHOP arm and 233 in the PACEBOM arm. Overall, there was no significant difference in outcome between the two arms of the trial. In patients with stage IV disease there was an apparent improvement in survival for those treated with PACEBOM, but considerable caution must be exercised with such subgroup analysis.

BRCA1 and BRCA2) are probably responsible for only 40% of the excess familial ovarian cancer risks, suggesting that other susceptibility genes of lower penetrance exist.Recent studies have identified several single nucleotide polymorphisms (SNPs) in the population that are associated with variations in the risks of many different diseases including cancers such as breast, prostate and colorectal. For ovarian cancer, the known highly penetrant susceptibility genes P-trend = 0.006). We did not find statistically significant associations when the combined data for all SNPs were analysed using an admixture maximum likelihood (AML) experiment-wise test for association .After adjusting for population stratification by genomic control, 18 SNPs (5.3%) were significant at the 5% level, and 5 SNPs (1.5%) were significant at the 1% level. The most significant association was for the SNP rs2107425, located on chromosome 11p15.5, which has previously been identified as a susceptibility allele for breast cancer from a genome wide association study (P-trend = 0.0012). When SNPs/genes were stratified into 7 different pathways or groups of validation SNPs, the breast cancer associated SNPs were the only group of SNPs that were significantly associated with ovarian cancer risk (These data suggest that a proportion of the SNPs we evaluated were associated with ovarian cancer risk, but that the effect sizes were too small to detect associations with individual SNPs. One of the strongest risk factors for invasive epithelial ovarian cancer is a family history of the disease; a woman with a single first-degree relative diagnosed with ovarian cancer has a 2–3 fold increased risk BRCA1 and BRCA2 are responsible for the vast majority of families containing multiple cases of ovarian cancer (>3 cases) and two or more cases of breast and ovarian cancer Germline mutations in the high penetrance genes Genetic association studies, which compare the frequencies of common genetic variants between cases and unaffected controls, have become the preferred approach to look for low penetrance cancer susceptibility genes. Candidate gene studies have focused on common variants in genes that may play a role in cancer with some success The analysis of genetic association studies inevitably involves a large number of statistical tests, and there has been much debate about how to correct for multiple hypothesis testing. This has usually been considered a hypothesis-testing problem in which the aim is to control the overall “experiment-wise” type I error. The null hypothesis is that there is no association between any of the SNPs being tested with disease, and the aim is to test whether this global null hypothesis of no association can be rejected. A variety of methods have been proposed to test the global null hypothesis The AML method has been used to evaluate the overall evidence of association between 710 common variants in 117 candidate genes and breast cancer risk Ethics committee approval was obtained for the collection and genetic analysis of all samples, and an informed written consent was obtained from all participants. Ethics approvals were granted by; the Danish Ethical Committees of Copenhagen and Frederiksberg (MALOVA), Anglia and Oxford Multi Centre Research Ethics Committee (SEARCH) and the Institutional Review Boards of Stanford University School of Medicine and Roswell Park Cancer Institute (GEOCS).Three population-based ovarian cancer case-control series were used in this research in vitro functional model of ovarian cancer Candidate gene selection was primarily based on biological pathways that are predicted to be involved in ovarian carcinogenesis. The major pathways evaluated were DNA double strand break repair, cell cycle control and DNA mismatch repair (MMR). We also analysed several known or candidate tumour suppressor genes and oncogenes for ovarian cancer and a series of genes that we identified from the analysis of an 2 of 0.8. If a SNP was poorly correlated with other SNPs, then 2- or 3-marker haplotypes were used, , if the haplotypes tagged the SNP(s) with a minimum r2 of 0.8. SNP tagging reduces the number of SNPs that require genotyping in association studies. The MMR gene study was completed before tagging SNP approaches were widely used due to the lack of available information from the International HapMap Project; and so we analysed SNPs of varying frequencies selected from public databases such as the dbSNP database (http://www.ncbi.nlm.nih.gov/SNP) and from the NIEHS Environmental Genome Project (EGP) (http://egp.gs.washington.edu/) For most genes, a tagging SNP approach was used to select known common variants. Haploview and Tagger were used for the selection of common variants from the reference CEPH genotypes. The approach involved the tagging of common SNPs with a tagging SNP (tSNP) with a minimum rThe genotyping methods used in these studies have been described previously (9–14). All assays were carried out in 384-well plates and included 12 duplicate samples per plate (3%). Genotypes were excluded if duplicate concordance rates for a study were <98%. Plates also included non-template negative test controls. Finally genotypes were excluded from the analysis if call rates were <90% per plate. The average call rates for these SNP were 94% in cases and 96% in controls. A list of the SNPs genotyped in this study is provided in 2 test (heterogeneity test). Both tests were stratified by study to account for any differences within the sample sets. The overall evidence for an excess of associations between common variants and ovarian cancer risk was evaluated with the AML method, which is described in detail in Tyrer et al 2 statistic will be distributed, asymptotically, as a non-central χ2 distribution with the usual degrees of freedom and a non-centrality parameter η. The non-centrality parameter is a measure of the size of effect of the SNP, and is closely related to the contribution of the SNP to the genetic variance of the trait. The non-centrality parameter was assumed to be the same for all SNPs to make the model more parsimonious. This was an approximation but improves power if the non-centrality parameter is roughly the same for associated SNPs as fewer parameters have to be optimized. If η is assumed to be the same for each associated SNP, then both α and η can be estimated by maximum likelihood, and a test of the null hypothesis can then be obtained as a likelihood ratio test. In instances such as this, where some SNPs were correlated, pseudo-maximum likelihood estimates can still be produced by the same procedure, as if the SNPs were independent. Therefore the pseudo-maximum-likelihood method was applied to account for LD between SNPs. Simulation can subsequently be used to establish the statistical significance of the test. We applied the AML method using both the trend and heterogeneity tests. All analyses were adjusted for cryptic population stratification using the method described by Devlin et alAssociations between invasive epithelial ovarian cancer and each SNP were assessed using two tests; the one-degree of freedom Cochran–Armitage trend test and the general two-degrees of freedom χWe have genotyped 340 SNPs in up to 1,491 invasive epithelial ovarian cancer cases and 3,145 unaffected controls from three different population based studies from the UK, Denmark and USA. SNPs were either tagging SNPs located in 84 candidate genes from pathways implicated in ovarian cancer development, or candidate SNPs located in 10 different regions on chromosomes 2, 3, 5, 8, 11, 12 and 17 that had been chosen for validation by the Ovarian Cancer Association Consortium (OCAC) or had been identified in a breast cancer genome-wide association study Using the trend test for association, 22 SNPs (6.5%) were significant at the 5% level, and 5 SNPs (1.5%) were significant at the 1% level. After adjusting for population stratification by genomic control, 18 SNPs (5.3%) were significant at the 5% level, and 5 SNPs (1.5%) were significant at the 1% level . The tesP-trend = 0.0012). The SNP was still significantly associated with ovarian cancer risk after adjustment for population stratification (P-trend = 0.0019).Of the 22 SNPs that were significant at the 5% level, three were SNPs that had been selected because of their association with breast cancer in genome wide association studies (of 16 in that group), eight were from the cell-cycle control pathway (of 101), two were from the DNA mismatch repair pathway (of 43), one was from the DNA double strand break repair pathway (of 28), two were from the MMCT-18 group (of 63) and five were from the OCAC group of SNPs (of 55). However, no single SNP reached a level of significance to provide definitive evidence of association - the most significant association was for a breast cancer associated SNP, rs2107425, located on chromosome 11p15.5 . No other group of SNPs was significant. When all the data were combined, the AML experiment-wise test for association was not significant for both the heterogeneity test (P = 0.051) and the trend test (P = 0.068). This suggests that, although not statistically significant, there is a trend towards a proportion of the SNPs evaluated being associated with disease and that the effect sizes were too small to detect for individual SNPs.P<0.00001 level, which has been suggested as the threshold for candidate gene studies P = 0.0012) and rs3817198 in LSP1 (P = 0.0016), both of which have been identified as susceptibility alleles for breast cancer, and rs9322336, which is located in the oestrogen receptor (ESR1) gene (P = 0.0013). All three SNPs remained significant after adjusting for population stratification.There are many studies in the published literature describing a candidate SNP/gene approach to search for common, germline genetic variants associated with epithelial ovarian cancer risk. These studies provide some evidence of association with disease risk for some SNPs http://pupasuite.bioinfo.cipf.es/) 2 = 1 that is in a region conserved in mice. rs3817198 is in the lymphocyte-specific protein 1 (LSP1) gene, also on chromosome 11p15.5, and also in a region conserved in mice. Loss of heterozygosity in this region has been found in ovarian, breast, lung, stomach and bladder cancers, and has been described as a tumour suppressor region in lung and breast cancers ESR1; no other common variants appear to tag this SNP. ESR1 is a ligand activated transcription factor, which has been implicated in ovarian and breast cancer Even though none of the associations we found were highly statistically significant, we cannot rule out that one or more of these SNPs, or alternative SNPs within the candidate genes we analysed were associated with ovarian cancer risk. The combined sample size from the three case-control studies did not have sufficient statistical power to detect associations with highly stringent levels of statistical significance. For individual variants, the statistical power of the study depends on the minor allele frequency, the risks conferred, and the genetic model. For this study, we had 97% power at the 5% significance level to detect a co-dominant allele with a minor allele frequency of 0.3 that confers an odds ratio of 1.2, and 96% power to detect a dominant allele with a minor allele frequency of 0.1 that confers an odds ratio of 1.3. For the top three SNPs, we used Pupasuite PupaSNP Click here for additional data file.Table S2The logistic regression results for all SNPs.(0.36 MB XLS)Click here for additional data file.

The cellular apoptosis susceptibility (CSE1L/CAS) protein is highly expressed in cancer, and its expression is positively correlated with high cancer stage, high cancer grade, and worse outcomes of patients. CSE1L (or CAS) regulates chemotherapeutic drug-induced cancer cell apoptosis and may play important roles in mediating the cytotoxicities of chemotherapeutic drugs against cancer cells in cancer chemotherapy. CSE1L was originally regarded as a proliferation-associated protein and was thought to regulate the proliferation of cancer cells in cancer progression. However, the results of experimental studies showed that enhanced CSE1L expression is unable to increase proliferation of cancer cells and CSE1L regulates invasion and metastasis but not proliferation of cancer cells. Recent studies revealed that CSE1L is a secretory protein, and there is a higher prevalence of secretory CSE1L in the sera of patients with metastatic cancer. Therefore, CSE1L may be a useful serological marker for screening, diagnosis and prognosis, assessment of therapeutic responses, and monitoring for recurrence of cancer. In this paper, we review the expression of CSE1L in cancer and discuss why CSE1L regulates the invasion and metastasis rather than the proliferation of cancer. Cancer is a disease in which a group of cells in the body displays uncontrolled proliferation, invasion, and sometimes metastasis. Malignant cancers are known by their ability to escape from their original location and metastasize to the lymph nodes or other organs. Metastases are the main cause of cancer mortality; therefore diagnoses of metastatic cancer are critical for making therapeutic decisions. Non-metastatic tumors are usually treatable by surgical resection. For patients with cancer that has spread or metastasized, radiation, chemotherapy, or a combination of chemotherapy and radiation can be offered as treatment. Diagnosing cancer metastasis by assaying the level of serological markers of patients is relatively non-invasive. Serum markers that can detect cancer metastasis should be highly useful for screening, diagnosis, prognosis, assessment of therapeutic responses, and monitoring for recurrence of cancer and thus can provide information for taking medical practice to new levels of precision ,2.Pseudomonas exotoxin, diphtheria toxin, and tumor necrosis factor [CSE1L is the human homologue of the yeast chromosome segregation gene, CSE1, and it encodes a 971-amino acid protein with an approximately 100-kDa molecular masses distributing in the cytoplasm and nuclei of cells [CSE1L/CAS, the cellular apoptosis susceptibility protein, was identified in a studying of an antisense cDNA fragment that is capable of causing MCF-7 human breast cancer cells resistant to apoptosis induced by bacterial toxins such as s factor . CSE1L iof cells . CSE1L cof cells ,6. Sinceof cells . Increasof cells .CSE1L is a cellular apoptosis susceptibility protein and it is highly expressed in various cancers; our recent studies showed that CSE1L plays an important role in regulating cancer cell apoptosis induced by chemotherapeutic drugs ,13. Theret al. using a vector expressing antisense CSE1L cDNA. Their results showed that CSE1L mediated apoptosis induced by Pseudomonas exotoxin, diphtheria toxin, and tumor necrosis factor but did not mediate apoptosis induced by ricin, cycloheximide, staurosporine, or etoposide, a cancer chemotherapeutic drug. Therefore, CSE1L-mediated apoptosis was thought to be limited to selected apoptotic stimuli such as adenosine diphosphate (ADP)-ribosylating toxins and tumor necrosis factor [CSE1L cDNA to reduce the cellular CSE1L level; hence the results of their studies might have been a result of those transfected cells expressing not very low levels of CSE1L. Also, they only tested the cancer chemotherapeutic drug, etoposide. An apoptosis-regulating protein should not only regulate apoptosis induced by just ADP-ribosylating toxins and tumor necrosis factor. CSE1L is highly expressed in cancer; therefore enhancing CSE1L expression rather than reducing CSE1L expression in cells is a more appropriate way to study CSE1L-mediated cancer cell apoptosis. We established HT-29 human colorectal cells and MCF-7 breast cancer cells stably transfected with the pcDNA-CSE1L vector, a eukaryotic expression vector carrying the full-length human CSE1L cDNA to study the effect of increased CSE1L expression on cancer cell apoptosis induced by chemotherapeutic drugs [Apoptosis (or programmed cell death) plays an important role in mediating apoptotic stimuli including chemotherapeutic drug-induced cell cytotoxicity . CSE1L is factor ,15. CSE1s factor . Those sic drugs ,13. The ic drugs ,13. Incric drugs ,13. Theric drugs , thus thic drugs . Low expic drugs . CSE1L iic drugs , and to ic drugs . Cell cyic drugs . Therefop = 0.008) [CPP32 (caspase-3) is one of the central apoptosis executioner molecules, and elevation of cleaved CPP32 is a sign of increased apoptosis . Patholo= 0.008) . Increas= 0.008) . Therefop53 is crucial in mediating cell apoptosis induced by various apoptosis-inducing stimuli, and most chemotherapeutic drugs exert their antitumor activity through a p53-dependent mechanism -28. The CSE1L gene is located on chromosome 20q13, a region frequently harbors amplifications that correlate with cancer aggression [CSE1L gene is increased in breast, colon, and bladder cancer cell lines [CSE1L gene in nasopharyngeal carcinomas [CSE1L gene [et al. investigated a series of 16 low-grade gliomas and their subsequent progression to higher-grade malignancies using a one-megabase bacterial artificial chromosome (BAC)-based array comparative genomic hybridization technique, and reported that the CSE1L gene was associated with the progression of gliomas [CSE1L is highly expressed in various cancer types, and its expression level is positively correlated with high tumor stage, high tumor grade, and worse outcomes of cancer patients. The gression -35. The ll lines . An arrarcinomas and in mrcinomas . The resE1L gene . Idbaih gliomas . The res gliomas . Combine gliomas .p < 0.05) [p = 0.0170), the tumor grade (p = 0.0107), and adverse outcomes (p = 0.0035) [et al. reported that CSE1L protein reactivity was present in 100% of 69 ovarian carcinomas, and a significant reciprocal correlation was observed between high levels of CSE1L and the histological type, FIGO stage III and grade 3, residual tumors of > 2 cm, and 20q13.2 (ZNF217 gene) amplification (> four copies in > 20% cells) [The results of a pathological study showed that expression of CSE1L was not detected in normal hepatocytes, while strong CSE1L expression was detected in hepatocellular carcinoma . Another < 0.05) . In brea < 0.05) . In sero 0.0035) . Peiro e% cells) . A tissu% cells) .p = 0.003). Also, CSE1L expression was higher in grade 3 tumors (p = 0.002) [An analysis of 89 endometrial carcinomas and 56 samples of non-neoplastic adjacent endometrium showed that CSE1L was expressed in 93% of endometrial carcinomas neoplastic tissues, while lower levels of CSE1L expression were observed in the adjacent endometrium compared to the carcinomas (= 0.002) .et al. studied the expression of CSE1L in 27 control benign and 55 malignant melanocytic lesions (including 32 primary and 23 metastatic lesions), and their results showed that only 13 of the 27 benign melanocytic lesions stained positive for CSE1L [n = 7) and nodular (n = 6) melanomas showed medium to high intensity immunoreactivity for CSE1L staining [n = 23) they studied showed strong CSE1L staining [Boni p < 0.0001) [In normal lymphoid tissue and malignant lymphomas, low-grade non-Hodgkin's lymphoma revealed weak CSE1L staining, with 10% to 60% of all cells positive . The exp 0.0001) . Recent 0.0001) .CSE1L gene or high expression of CSE1L protein in various cancer types including hepatocellular carcinomas, endometrial carcinomas, cutaneous melanomas, lymphomas, ovarian carcinomas, breast carcinomas, prostate cancers, nasopharyngeal carcinomas, medulloblastomas, glioblastomas, and colorectal carcinomas. The pathological studies also showed that the expression of CSE1L was positively correlated with a higher cancer stage and higher cancer grade, indicating that CSE1L plays an important role in cancer development and progression.The pathological studies showed amplification of the CSE1 [CSE1 was shown to lead to defects in both chromosome segregation and B-type cyclin degradation; therefore a role of yeast CSE1 in facilitating the mitotic phase (not the S phase) of yeast replication was described [et al. reported that depletion of CSE1 resulted in a defect in the S-phase progression of yeast; therefore they demonstrated that CSE1 plays a role in DNA replication during yeast proliferation [CSE1 mutation or depletion and did not include an experiment to see the effect of increased CSE1 expression on yeast replication. Moreover, an immunofluorescence study of the distribution of human CSE1L in cells showed that CSE1L was associated with microtubules and mitotic spindle of mitotic cells; hence CSE1L was first suggested by Scherf et al. to play a role in promoting the mitotic phase of the cell cycle, and thus CSE1L was assumed to be able to increase the proliferation of human cells [et al. reported that transient transfection of vectors carrying the antisense CSE1L cDNA into HeLa human cervical cancer cells interfered with cell mitosis [Cancer cells are characterized by their uncontrolled proliferative abilities. CSE1L is the human homologue of the yeast chromosome segregation gene, CSE1 . Mutatioescribed ,51. Anotferation . It shou mitosis . Because mitosis ,54. Cons mitosis -10, althCSE1L cDNA from human cells and cloned it into the pcDNA3.1 eukaryotic-expressing vector to obtain the pcDNA-CSE1L vector to study the effect of increased CSE1L expression on cancer cell proliferation [We amplified the full-length feration ,55. Our feration . The forferation . Increasferation . Hence, feration . TherefoCSE1L may be necessary for the M phase cell cycle progression of cells, thus a reduction in the CSE1L level can lead to a defect in chromosome segregation in the mitotic cell-cycle phase. However, it is quite impossible that high expression of CSE1L in cancer cells can enhance chromosome segregation at the mitotic phase of cells and thus increase cancer cell proliferation. First, the key step that determines the rate limitation for cell proliferation is mainly at the G1-S phase of the cell cycle rather than at the M phase . Second,et al. reported that the immunoreactivity of CSE1L was positively related to high cancer grade (p = 0.0107) and adverse outcomes (p = 0.0035) in serous ovarian carcinoma [et al. reported that CSE1L expression was higher in grade 3 tumors (p = 0.002), and a shorter survival was observed for patients whose tumors contained > 50% of CSE1L-positive cells (p = 0.04) [n = 23) they studied [Increased CSE1L expression is unable to enhance the proliferation of cancer cells, thus CSE1L may promote cancer progression by other mechanisms. A pathological study by Brustmann arcinoma . By stud = 0.04) . A tissu = 0.04) . The expp = 0.010 and advep = 0.010 and adveCSE1L can associate with microtubules and the Extracellular matrix (ECM) surrounding tumor and ECM-degrading proteases secreted by tumor cells play crucial roles in modulating cancer metastasis -69. MatrCSE1L is highly expressed in cancer, and its expression level is well correlated with advanced cancer stage and worse patient outcomes. Therefore, CSE1L may play an important role in cancer progression. CSE1L is a microtubule-associated protein . Our recCSE1L as a secretory protein was assessed by immunoblotting with conditioned medium harvested from B16-F10 cancer cells, and the results showed that CSE1L was present in conditioned medium of serum-starved B16-F10 cells . That reMetastasis is the main cause of cancer-related mortality; therefore the screening and diagnosis of metastatic cancer are important for cancer treatment -95. CSE1The authors declare that they have no competing interests.CJT and MCJ wrote the paper. CHH, SCS, and WR L discussed and participated in paper writing. All authors read and approved the final manuscript.

Despite wide promotion, clinical practice guidelines have had limited effect in changing physician behavior. Effective implementation strategies to date have included: multifaceted interventions involving audit and feedback, local consensus processes, marketing; reminder systems, either manual or computerized; and interactive educational meetings. In addition, there is now growing evidence that contextual factors affecting implementation must be addressed such as organizational support (leadership procedures and resources) for the change and strategies to implement and maintain new systems.To examine the feasibility and effectiveness of implementation of a computerized decision support system for depression (CDSS-D) in routine public mental health care in Texas, fifteen study clinicians (thirteen physicians and two advanced nurse practitioners) participated across five sites, accruing over 300 outpatient visits on 168 patients.Issues regarding computer literacy and hardware/software requirements were identified as initial barriers. Clinicians also reported concerns about negative impact on workflow and the potential need for duplication during the transition from paper to electronic systems of medical record keeping.The following narrative report based on observations obtained during the initial testing and use of a CDSS-D in clinical settings further emphasizes the importance of taking into account organizational factors when planning implementation of evidence-based guidelines or decision support within a system. Although state of the art evidence-based clinical guidelines have been available to clinicians for some time, it is now well understood that the implementation or adoption of research information in actual clinical practices lags far behind, with limited potential to change physician behavior -3. UnforWhile there is evidence that studies have demonstrated improved outcomes when guidelines are introduced during a research project , unfortuIn terms of potential solutions, a number of strategies have been suggested to encourage the use of clinical practice guidelines , includiIt is now recommended that implementation of guidelines or other practices should not be undertaken without addressing these contextual factors . Yet, deA recent systematic review of the literature identified barriers to guideline adherence, including a lack of: awareness, agreement, or perceived self-efficacy to change; minimal outcome expectancy; and an inertia associated with faith in existing treatment practices . In addiBy using novel health information technology (IT), researchers can bring guideline information to the exact point within the clinical treatment process where decisions are being made ,17. RecoThe majority of published studies demonstrate that health information technology components positively impact chronic illness care . AspectsOur own group has developed a CDSS based on the Texas Medication Algorithm Project (TMAP) treatment algorithms developed for MDD , schizop1) To assess the feasibility of implementing a CDSS in real world practice;2) To identify barriers to its implementation; and3) To evaluate its impact on workflow issues in busy clinics.The CDSS-D was developed at the University of Texas Southwestern (UTSW) Medical Center, Dallas. The design of the CDSS-D is such that computer interaction is intended to be efficient and advantageous to the clinician by establishing clinical decision making for treatment through the computer as a by-product of every day clinical practice. The decision support system was developed utilizing the guidelines derived from those of the Texas Medication Algorithm Project (TMAP) -23.The CDSS software program can be loaded on any personal computer with the recommended system requirements. The CDSS consists of three separate parts responsible for user interaction, decision-tree reasoning, and storage of clinical data. The relationships between these three parts are as follows:The user interface – is an interactive application written for Microsoft Windows and developed using Visual Basic programming language. Users can navigate through Web-like buttons that provide a user-friendly environment in which to work. The user interface is the only application of the program that is visible to the user.The rules engine – is derived from the clinical algorithms developed by TMAP, which have been translated into specific "rules" by its developers and UTSW computer information systems (CIS) personnel. They have been compiled into a knowledge base and implemented using industry-standard logical inference engine licensed from FairIsaac Software. The Rules Engine application operates behind the user interface to apply the TMAP algorithms to current and historical patient data to provide treatment options to the physician via the user interface.The CDSS database – contains clinical information entered into the CDSS application and is securely stored in the back-end SQL server. The database also stores user-specific data and the reference tables for medications and doses. Because both the reference tables and the rules knowledge base by which the rules engine processes the patient information are stored on a central server, updates to the algorithms can be implemented through the server, without user intervention. The CDSS provides assistance in diagnosis and decision support with appropriate treatment choices, follow-up, and preventive care, while at the same time providing access to physician order entry, alert systems, electronic documentation, and information retrieval.The computer software program has minimal requirements. The CDSS program requires Win2000/WinXP/Win2003 operating systems, Microsoft Internet Explorer 5.5 or higher, and TCP/IP connectivity to the server. In addition, the program requires that each personal computer (PC) be current with Microsoft Windows updates. Other minimum requirements may be applicable depending on how the program is being implemented within a specific environment. For example, if the software and database are loaded on one central server and end users access it through a Web-based portal, minimum levels of speed, bandwidth, and system memory can affect performance, as they would with any software application that transfers data bi-directionally via a Web connection.To examine the feasibility of implementation of CDSS-D and its effects in routine clinical care, five public mental health clinics in Texas participated as clinical sites. Participating sites were recruited after the senior author (MHT) had made contact with local senior medical directors as part of the process of rolling out the Texas Medication Algorithm Project (TMAP). A group of these senior medical directors subsequently expressed interest in being involved with field-testing of CDSS-D. All five sites participating were representative of urban public mental health care in Texas. Fifteen study clinicians (thirteen physicians and two advanced nurse practitioners – APNs) participated across five sites. Participating clinicians were approached by their local medical director and invited to participate if they were interested. The majority of the clinicians approached chose to participate. The field-testing consisted of over 300 outpatient visits by 168 patients, all of whom had clinician-diagnosed MDD based on the Diagnostic and Statistical Manual-Fourth Edition-Text Revision (DSM-IV-TR) .Prior to implementation, the medical directors at each site approached their own IT department to request support for the CDSS-D program. At that point the local IT department was given the program requirements by the UTSW developers. Site set-up for the CDSS-D program started one month before implementation at the clinic. Clinical Information Systems programmers and software developers from UTSW were responsible for data management on the central server and troubleshooting for local hardware and software system installation and support. At some sites, computers and programs had to be upgraded. Instruction on the use of the software was provided during initial physician training, and trained research assistants were available on-site to provide technical assistance to the clinicians with the initial implementation of CDSS-D during normal clinic operating hours. In addition, both technical and medical help desks were available via telephone to software users on a 12 hour/day, 5 day/week basis.The CDSS-D can be deployed as a single-user environment whereby a single personal computer (PC) can run all the components – client and server. In this case, testing was generally limited to ensuring program compatibility with the individual PC and successful installation of the software in a working condition. The CDSS-D program was also designed to support multiple local/remote clients. In this case, a much more comprehensive integration and testing process was required. In order to ensure successful integration, a test database or a "test environment" was set up and the real life use of the program was simulated. In this approach, testing of the inbound and/or outbound parts of the interface was also regarded as essential.Prior to receiving training on the use of the CDSS-D program, clinicians first received extensive training regarding the guideline for treating depression. As part of this process, the senior author (MHT) gave several lectures reviewing treatment strategies for MDD and highlighting the benefits of algorithm-based care. Initial training, conducted by the project's training director (JKK), included a thorough review of treatment strategies for the remission of depressive symptoms, education about the TMAP algorithm for MDD, and hands-on practice in the use of the computerized algorithm. Simulated visits were created to illustrate how the algorithms are used in daily practice. The educational aim of the training workshops was to help participants understand the algorithm, the algorithm stages, and the critical decision points. Additional instruction in the use of CDSS-D software lasted about 4 hours, and involved both demonstration and hands-on training. To ensure a basic knowledge of how to complete a patient visit, each clinician was asked to enter an initial and follow-up visit using simulated patient material in a step-by-step fashion with the instructor, followed by independently entering several additional case scenarios.At the end of the workshop, each clinician was given a written instruction manual, which could also be accessed on the user interface screen when using the program. Clinicians were also instructed in how to access and use the technical support. In addition, research associates familiar with CDSS-D were available on site initially and later by phone to provide clinicians with real-time support as needed.Anticipating workflow transition issues, we also held pre-implementation training sessions for program directors and clinic managers so that they would understand the program and be able to suggest solutions to potential issues and approve any fundamental change in the clinic process that might be required.During the period of field-testing, a series of informal qualitative interviews took place between the training director for the project (JKK) and the participating clinicians and support staff at the sites. It should be noted that during this time the CDSS-D program underwent various modifications so that the participating clinicians worked on multiple versions or builds. After each new build was rolled out and field-tested, the training director spoke to the participating clinicians to obtain their feedback and any necessary additional modifications were made at that point. The following section provides an account of the issues the clinicians and support staff reported.The following describes the experience, including constraints and problems encountered, and feedback received at the five participating public health clinical sites.During this pilot testing we encountered wide variation in levels of computer literacy and confidence among clinicians at the five participating sites, as well as in typing skills. In general, clinicians who were accustomed to using computers in their daily practice adapted better.For many clinicians, technical errors encountered during the introduction and early use of the software program frequently precipitated a loss of confidence with the program. While some clinicians appeared confident in dealing with software error messages, others were not willing to tolerate the experience during a clinical visit. Additionally, clinicians reported increased frustration in those clinics where they had to move between two software systems for each patient visit .We found that technical support to maintain the server and network was crucial to smooth operation and interfacing speed. If the server or network was inadequate, the program became too slow for clinicians to use during busy patient contact times. "Screen loads" – the time that it takes for the next screen to become completely visible and usable to the user – varied by implementation site and from clinic to clinic. For example, at one site, when the CDSS-D program was loaded onto a shared server, the program slowed to the point of becoming unusable. At another site, though the CDSS-D had its own server, the network had inadequate bandwidth, and the screens loaded six to ten times slower at the branch clinics than at the central site. At sites where the program was configured to interface with other client record systems, successful implementation depended on the local IT staff commitment to work with UTSW computer support staff to create and maintain a bridge between the two software systems.Clinic processes and clinic requirements for treatment providers and support staff varied within each system and from clinic to clinic. Established workflow systems often centered on the structure and format of required clinic paperwork. Adaptations had to be made for routine tasks such as requests, approval, and documentation of medication refills and changes outside of scheduled doctor visits. At times, clinicians and support staff voiced frustration when moving from paper and pencil to electronic record. As a result, at times, system changes were necessary which had to be approved by administration.Similarly, different sites used different billing codes and billing software, and the required form names and numbers for the CDSS-D electronically recorded progress notes varied. Certain requirements were met immediately by making changes to the configuration files; however, ultimately, we had to add a "customization tab" within the program so that sites could configure other files to meet these site-specific requirements.In general, while there was full support and buy-in from the local senior medical directors, this was not always the case at the local administrator level, and likely was another factor impeding the implementation process.In order for the software program to be used in all cases in "real world" settings, we found that considerable treatment flexibility was necessary. For example, public health settings frequently include large numbers of difficult-to-stabilize patients who had been in treatment for a long time on an older medication not included in the state-of-the-art TMAP algorithm because of poor efficacy or tolerability issues. Understandably, in certain cases clinicians did not want to change the medication to an algorithm medication when the patient was stable and without problems. In addition, sites often had specific medication formularies that included some of the algorithm medications and excluded others. There were also formulary issues based on payment sources, such as Medicaid and private insurance companies.Despite prior concerns that computer use may depersonalize the clinical encounter, decrease eye contact, and be distracting, feedback from patients in the form of surveys revealed that patients in general felt comfortable with the care being provided by physicians using the CDSS-D. A separate manuscript describing the findings from the patient surveys is currently in progress.Early involvement from all key personnel whose departments would be affected by a transition from pen and paper documentation to an electronic medical record system was essential for successful implementation. Making the transition at a single point in time from pen and paper to an electronic system was the preferred approach, rather than trying to change gradually by operating two systems simultaneously, with clinicians reporting both frustration and confusion when asked to use both systems.One of the primary constraints encountered in the public mental health sector was the fact that the average time allocated per patient visit was only 15 minutes. As with the use of any new software in a work environment, the start-up period was associated with an initial drop in productivity, making it difficult for clinicians to see the same number of patients per day using the regular clinic schedule. Where clinician pay schedules are attached to "productivity" , these issues become substantial.In an effort to overcome this barrier, we tried to unfold the program gradually into the practice by having clinicians use CDSS-D with only one or two patients per day while in training, though it is possible that this approach impacted the clinicians' ability to become familiar or comfortable with the program quickly.Despite wide promotion, clinical practice guidelines have had limited effect in changing physician behavior -3. PreviThe issues raised by clinicians and support staff are similar to those reported previously, including concerns about lack of time and the impact of the program on clinical workflow. Issues that impacted the use of the program can be placed into hierarchical categories: (1) issues that prevented the use of the program, (2) issues that discouraged the use of the program, and (3) issues that make the program more convenient to use.In regard to issues that prevented the use of the program, generally these issues were due to process or workflow conflicts. For example, earlier programs made all of the medications in the Texas Medication Algorithm Project (TMAP) available for use; however, some patients arrived to be treated who were stable and doing well on older psychotropic medications that were not in the algorithm. Clinicians were at a loss as to how to enter the patient into the program. In addition, earlier programs lacked an effective way to titrate, taper, and postpone the start of a medication. These issues prevented the use of the program and were all corrected with subsequent modifications.In regard to issues that discouraged the use of the program, though these issues generally made using the program difficult, they did not stop the clinician from using the program. For example, if clinicians changed their minds regarding the choice of medication during the visit and returned to the medication page to make the change, all of the notes on subsequent pages would erase and the clinicians would have to rewrite the notes. Program speed and reliability also fell into this category. Issues like these were frustrating for clinicians and again were all corrected with subsequent modifications.In regard to issues that made the program more convenient to use, generally these consisted of minor program extras. For example, clinicians wanted spell-check, links to an electronic Physician's Desk Reference, and more editing ability in all fields.Other barriers identified related to specific-site issues and the availability of adequate IT support. Despite the barriers encountered, in terms of feasibility of implementing the CDSS-D, during this initial testing period physician use and compliance with the CDSS-D increased after initial hesitation with the addition of components of IT integration, training, and on-site support. In addition, a number of barriers to change were eliminated through continued modification of the CDSS-D. Increased training time and IT support also aided in the successful implementation. Overall, clinicians reported finding the CDSS to be a useful tool in providing good clinical care. See Tables 2Examples of some of the modifications made in order to increase the likelihood of obtaining support on all levels within the clinic system include the following: addition of a demographic screen to facilitate search by patient number; addition of diagnostic codes for billing purposes; modification of the prescription screen to allow titration, tapering and splitting; and addition of a facility to customize billing on the finishing screen. All of these modifications came about as a direct result of specific requests from the sites and were implemented to facilitate the integration of the CDSS with current site-specific administrative and clinical procedures.A recent editorial suggests that health information technologies are tools whose value is influenced by how clinicians modify their work practices to use them and how organizational change is enacted when they are adopted . Even thOther limitations of the current study include the small sample size and the fact that the information received was in the form of informal feedback from participating clinicians rather than surveys or questionnaires. Specifically, the small sample size and the fact that all participating sites were urban means that the feedback received may not be generalizable to other public mental health sites.Based on reviews to date, there is now increasing evidence that for a change to work and be maintained the relevant clinicians must have the knowledge, skills, and motivation to implement a practice; practical and organizational factors must make the practice feasible; and colleagues, patients, and other important stakeholders must accept it.Many of our observations during the initial testing and use of CDSS-D in clinical care further emphasize the importance of taking into account these factors when planning for the implementation of computerized, evidence-based guidelines and decision support within a system of care. From our own experience, for clinician behavior to change, the associated changes within the system need to be anticipated and planned for carefully on a site-by-site basis with full support and buy-in from administrators from the outset.Based on our experience with field-testing CDSS-D, we have incorporated some of the lessons learned when initially planning the implementation of more recent versions of CDSS-D in real world practice settings. Additional file Other recent strategies developed to facilitate this process have included detailed needs assessment surveys and focus groups conducted with stakeholders, administrators, clinicians, and support staff, with a goal of identifying potential barriers and obtaining support for the project at all levels prior to implementation.We also strongly agree with a recent editorial suggesting that while adoption of technologies is often assumed to be a single event marked by a distinct before and after, it is in fact a multistage process that involves the routinization of the technology after it is implemented . With thOf note, the American College of Medical Informatics (AMIA) in June 2006 released a roadmap for national action on clinical decision support . The AMIat the point of care, based on the clinician's assessment of symptoms and side effects at that clinic visit, thereby directly improving adherence to treatment guidelines. With this in mind and following a comprehensive needs assessment based on lessons observed during early testing of our CDSS-D in our most recent project as mentioned above, we plan on merging CDSS-D with an EHR in a public mental health system.Our experience with the issue of adherence to paper-and-pencil algorithms in both TMAP and STAR*D, as well as data supporting the importance of providing clinician feedback at the time of the patient visit, further illustrates the potential benefits of a state-of-the-art computerized decision support system developed by our group for sequenced treatment approaches. Unlike a paper-and-pencil format, such a computerized system has the advantage of being able to provide evidence-based recommendations regarding medication dosing Madhukar H. Trivedi, M.D. has been a consultant for Abbott Laboratories, Inc.; Akzo ; AstraZeneca; Bayer; Bristol-Myers Squibb Company; Cephalon, Inc.; Cyberonics, Inc.; Eli Lilly & Company; Fabre-Kramer Pharmaceuticals, Inc. Forest Pharmaceuticals; GlaxoSmithKline; Janssen Pharmaceutica Products, LP; Johnson & Johnson PRD; Eli Lilly & Company; Meade Johnson; Neuronetics; Parke-Davis Pharmaceuticals, Inc.; Pfizer, Inc.; Pharmacia & Upjohn; Sepracor; Solvay Pharmaceuticals, Inc.; VantagePoint; and Wyeth-Ayerst Laboratories. He has served on speakers bureaus for Abdi Brahim; Akzo ; Bristol-Myers Squibb Company; Cephalon, Inc.; Cyberonics, Inc.; Forest Pharmaceuticals; GlaxoSmithKline; Janssen Pharmaceutica Products, LP; Eli Lilly & Company; Pharmacia & Upjohn; Solvay Pharmaceuticals, Inc.; and Wyeth-Ayerst Laboratories. He has also received grant support from Bristol-Myers Squibb Company; Cephalon, Inc.; Corcept Therapeutics, Inc.; Cyberonics, Inc.; Eli Lilly & Company; Forest Pharmaceuticals; GlaxoSmithKline; Janssen Pharmaceutica; Merck; National Institute of Mental Health; National Alliance for Research in Schizophrenia and Depression; Novartis; Pfizer Inc.; Pharmacia & Upjohn; Predix Pharmaceuticals; Solvay Pharmaceuticals, Inc.; and Wyeth-Ayerst Laboratories.Ella Daly, M.B. MRC. Psych., Cindy Claassen, Ph.D, Prabha Sunderajan, M.D., Janet Kern, Ph.D. and Bruce Grannemann, M.A. report no competing interests or disclosures.MHT conceived the study, participated in its design and coordination and drafted the manuscript. EJD, JKK, and CAC helped to draft the manuscript. PS worked on testing and technical modifications of the CDSS-D. BDG participated in the design of the study.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6947/9/6/prepubContemporary Clinical Trials article (2007). This article describes the design and rationale for Project IMPACTS (Implementation of Algorithms using Computerized Treatment Systems) – an ongoing, multi-site, NIH-funded study, which aims to evaluate how best to facilitate integration of depression treatment algorithms into routine psychiatric care. The article provides a full description of the Computerized Decision Support System for Depression (CDSS-D).Click here for fileCDSS Surveys. Algorithm Evaluation Questionnaire: Software Application Version. Part I: Ease of UseClick here for file

P for trend 0.04) which suggests a dose–response relationship between visible light and breast cancer risk. © 1999 Cancer Research CampaignA total of 10 935 women with visual impairment were identified from the Finnish Register of Visual Impairment and followed up for cancer through the Finnish Cancer Registry for years 1983–1996. Breast cancer risk decreased by degree of visual impairment (

A comparative study of a new tumour marker, CA242, and CA19-9 was conducted with special reference to their diagnostic usefulness in pancreatic cancer. CA242 showed sensitivity similar to that of CA19-9 for overall cases and early cases (stage I tumour) of pancreatic cancer. For other malignancies, the positive rates of CA242 were lower than those of CA19-9 except for colorectal cancer. An important characteristics of CA242 was that it was only slightly and infrequently elevated in the sera of patients with benign diseases such as chronic pancreatitis, chronic hepatitis and liver cirrhosis. This characteristic was more apparent in the patients with benign obstructive jaundice, indicating that the serum level of this marker was scarcely affected by cholestasis. Using cut-off levels corresponding to a 90% specificity, the clinical results obtained with CA242 in the diagnosis of pancreatic cancer were similar to those obtained with CA19-9, except that CA19-9 was falsely negative in some patients with early-stage pancreatic cancer. These findings suggest the usefulness of this marker for screening pancreatic cancer in patients on their first hospital visit. However, CA242 was found to be influenced by the Lewis blood group system. This unfavourable result is attributed to the C241 catcher antibody of this assay system, which has almost the same epitope specificity as the C50 and the NS19-9 monoclonal antibodies. In conclusion, CA242 is superior to CA19-9 in diagnosing pancreatic cancer by virtue of its higher specificity.

Mycobacterium tuberculosis isolates obtained in Alabama since 1994. Of 2,452 isolates, 1,013 (41%) had fewer than 6 bands of IS6110; 348 (14%) had a single two-band pattern (JH2). With conventional epidemiologic methods, we identified three groups of related patients with JH2 isolates. Spoligotyping and pattern of variable number of tandem repeats identified 10 molecular groups; two found by conventional methods were subdivided.We conducted a population-based molecular typing of all Mycobacterium tuberculosis isolates identified since 1994 in Alabama. The state contains a mixture of rural and urban settings with a stable population, and the proportion of tuberculosis cases among the foreign-born and HIV-positive groups is low elimination, disease control efforts must be based on a thorough understanding of transmission patterns among the general population and among groups at particular risk ,2. In cl6110 restriction fragment length polymorphism (RFLP) method and have combined the results of molecular analysis with an aggressive contact investigation program. We found that 1,013 (41%) of the IS6110 patterns had ≤6 bands, including 348 (14%) with a two-band RFLP pattern called JH2. Conventional epidemiologic techniques identified three groups with related JH2. Resistance to a single drug (isoniazid or streptomycin) was associated with two groups, and homelessness was associated with a large group. Results from the latter group have been previously reported –based methods for secondary typing methods, spacer oligonucleotide type (spoligotyping) and variable number of tandem repeats (VNTR). Isolates were selected for further molecular typing to determine which method or combination of methods could help us understand the epidemiology of this important RFLP pattern in Alabama and the extent of molecular relatedness in the JH2 cluster.6110 RFLP strains. Groups of isolates identified through conventional epidemiologic links were selected for evaluating the secondary molecular typing techniques. Fifteen isolates from northeast Alabama were obtained from a conventional epidemiologic investigation that showed a convenience store as the site of transmission (We selected 102 (29%) of the 348 JH2 pattern isolates from the Alabama genotype database that represented two-band ISsmission . Twenty-M. tuberculosis were cultured on Lowenstein-Jensen or 7H11 Middlebrook plates for at least 4 weeks before DNA extraction. Chloroform-isoamyl alcohol was used to extract chromosomal DNA from isolates, and IS6110 RFLP typing was performed according to international standards contained 55 isolates. The other 3 clustered patterns were designated CDC spoligotype 3 (n=12 isolates), CDC spoligotype 545 (n=14 isolates), and CDC spoligotype 550 (n=3 isolates). Two of the clusters previously identified through contact epidemiology were subdivided.Eighty-six strains were typed with VNTR, which generated 15 different VNTR profiles , of whic Among those isolates with both secondary typing results, we identified 10 clusters plus 9 unique isolates. Clustered cases accounted for 77 of 100 cases. The largest spoligotype cluster of 55 isolates (CDC spoligotype 9), after combination with the VNTR results, was reclassified into nine unique profiles, including seven different clusters. The largest cluster had 22 isolates. CDC spoligotype 3 was divided into a single cluster of seven isolates and five unique profiles. CDC spoligotype 545 and CDC spoligotype 550 each represented single clusters.6110 fingerprint found during nearly 8 years of TB genotyping surveillance in Alabama. This pattern matches National Tuberculosis Genotyping Fingerprint Pattern (NTGFP) 00016 in the database of the National Tuberculosis Genotyping Surveillance Network. 00016 was also the most common fingerprint pattern found during 5 years of the TB genotype project and was reported from all seven sentinel surveillance sites with a final frequency of 5% of all isolates.The two-band JH2 pattern was the most common IS6110 patterns. The smaller band at 1.46 kb is conserved, and the larger band is located in direct repeat 24, a common insertion site. Consequently, the size of the larger band varies, depending on the number of direct repeats located upstream of spacer 24. A strain’s spoligotype can predict the size of the larger band; the larger bands analyzed in our study were 4.5 kb–4.8 kb. The resolution of the gel and the Whole Band Analyzer do not discriminate well between these sizes, which could result in different spoligotypes of a single IS6110 insertion pattern being considered as different RFLP patterns. Pattern JH2 represents a group of similar IS6110 pattern. A group of strains likely spread throughout the general population early in the TB epidemic (19th and early 20th centuries) and remain endemic in the 21st century in the United States. Although this pattern is found rarely in European isolates, some countries in Africa report a high prevalence ( The prominence of pattern JH2 (NTGFP 00016) statewide and throughout the network suggests an older, more stable ISevalence .6110 pattern found in Alabama, we could define only a few distinct groups through conventional epidemiologic methods. Using VNTR and spoligotyping techniques to reexamine some of these clusters, we gained a better understanding of disease transmission among community groups. Two clusters previously classified by conventional epidemiologic methods were confirmed by this study. Both clusters were associated with unique drug resistance patterns in outbreaks involving a school bus (isoniazid resistance) and a neighborhood convenience store (streptomycin resistance). The largest cluster, which involved the homeless community, revealed multiple molecular-based subclusters not identifiable by routine epidemiologic study, drug susceptibility data, or both. These subclusters signify the actual genetic diversity of this most prevalent IS6110 pattern. Despite large numbers of the IS6110 strains is well accepted ( The importance of secondary typing for low -copy ISaccepted –12(as isaccepted . We foun

The remaining coordination sites are occupied by two N atoms of a 1,10-phenanthroline ligand and two O atoms of a 6-hydroxy­naphthalene-1-carboxyl­ate ligand. The crystal packing is stabilized by O—H⋯O hydrogen-bonding inter­actions.The title complex, [Cd DOI: 10.1107/S1600536809043475/bt5107Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Available evidence suggests that international medical graduates have improved the availability of U.S. health care while maintaining academic standards. We wondered whether studies had been conducted to address how international graduates were treated in the post-graduate selection process compared to U.S. graduates.We conducted a Medline search for research on the selection process.Two studies provide strong evidence that psychiatry and family practice programs respond to identical requests for applications at least 80% more often for U.S. medical graduates than for international graduates. In a third study, a survey of surgical program directors, over 70% perceived that there was discrimination against international graduates in the selection process.There is sufficient evidence to support action against discrimination in the selection process. Medical organizations should publish explicit proscriptions of discrimination against international medical graduates (as the American Psychiatric Association has done) and promote them in diversity statements. They should develop uniform and transparent policies for program directors to use to select applicants that minimize the possibility of non-academic discrimination, and the accreditation organization should monitor whether it is occurring. Whether there should be protectionism for U.S. graduates or whether post-graduate medical education should be an unfettered meritocracy needs to be openly discussed by medicine and society. The United States owes a huge debt of gratitude to its physicians who graduated from non-U.S. medical schools . DespiteThe proportion of IMGs practicing in the U.S. is considerable. About one-quarter of practicing U.S. physicians are IMGs, up from 15 percent in 1967 and 6.3 percent in 1959. In 2004, 28 percent of the residency cohort was represented by IMGs, and more so in some specialties, such as psychiatry and nephrology [Recent studies indicate that medical educators, perhaps because of improved information from the U.S. Medical Licensing Exam (USMLE) and the Educational Commission for Foreign Medical Graduates (ECFMG), are becoming better at selecting and educating IMGs. For example, since 1995 non-U.S. graduates have outperformed U.S. graduates (USMGs) on the In-Training Examination [Physicians from other countries have enriched U.S. medicine clinically, scientifically and culturally . RelyingDespite the benefits that IMGs have brought to the U.S., we have perceived discrimination against IMGs during the residency selection process. We wondered whether there was research evidence in the medical literature to support our impression.On 5-27-09 we queried Medline using the following search string using MESH headings: "biomedical research" AND "Education, Medical, Graduate" AND "Foreign Medical Graduates". This search produced one irrelevant article. We then used the following string: AND ((graduate OR postgraduate) AND "medical education"). We found 1543 papers from 1961 to the present. We manually reviewed this listing for scientific studies of the recruitment process. We found two papers that used paired data designs to determine whether U.S. graduate medical educational programs responded to requests for applications by U.S. and international medical graduates differently. We then used the "related articles" feature on each of these papers which led us to another paper that surveyed surgical program directors about international medical graduates which we used in the discussion section. We searched the reference lists of these papers and found no additional research articles.We report the author's statistics for the two studies that requested applications. They used McNemar's chi-square for correlated proportions or the continuity-corrected McNemar's chi-square. In addition to the authors' calculations, we calculated relative response rates. For dichotomous variables from the survey study, we calculated 95% binomial confidence intervals using the binconf function in Harrell's Hmisc library in S-Plus .We found three relevant studies. Two were directed at the application process and used similar paired data designs, while a third surveyed surgical residency program directors for their perceptions about IMGs .Directory of Graduate Medical Education Programs, 1991-1992 (38% sampled) [One study sent applications to 146 family practice residency programs randomly selected from the 384 programs in the When analyzed at 6 weeks by any response, 102 programs (71%) responded to the fourth-year medical student and 57 (40%) to the foreign graduate . Of the 46 programs responding to both, 9 required the foreign graduate to meet standards that exceeded requirements set by the ECFMG. When analyzed by reception of application forms, 39 programs sent applications to both (27%), 60 to only the U.S. medical student applicant (42%), 10 to only the foreign graduate (7%) and 34 to neither (24%) .The second study sent identical requests (details not provided) for a program application to 193 psychiatry residency training programs, omitting those in Michigan since the persons requesting applications were enrolled in a Michigan program. The letters differed in only two respects: the names of the writers (one "American" and one "Pakistani") and the medical schools from which they graduated . Letters were sent one week apart. Five programs reported they were closed, leaving 188 for analysis.When analyzed by any response, 99 programs (53%) responded to both applicants, 60 only to the USMG (32%), 6 only to the IMG (3%) and 23 to neither requestor (12%) . When analyzed by reception of application forms, the USMG received 159 responses with application forms (85% response rate) while the IMG received 87 responses with application forms (46%) . The autThe third study surveyed all 283 members of the Association of Program Directors of Surgery in 2007 . Of thesIn response to five-point Likert-scale questions, 69 percent of directors strongly agreed, agreed or were neutral to the statement that on standardized exams IMGs perform as well as USMGs and 79 percent strongly agreed, agreed or were neutral to the statement that surgical skill level, as measured by performance in the operating room, is equal or better for IMGs compared to USMGs. For the statement, "In reality, all things being equal, our program would rather offer positions to USMGs than to IMGs", 97 percent agreed or were neutral . In response to a yes or no question, 18 percent of directors answered that they had felt external pressure not to rank a better qualified IMG over a USMG and 71 percent felt that IMGs are discriminated against.Despite the difficulty of performing research on discrimination, we were able to find two studies conducted with family practice and psychiatry programs that reported similar methods and findings. In addition, a survey of directors of surgical residency program reported that more than 70 percent of directors believed IMGs were discriminated against in the selection process and nearly 20 percent reported that they had been pressured to discriminate against IMGs in favor of USMGs.The paired-study technique used by two of the studies is a strong design and has a long biometrical application history. A large random sample of programs was used in one study but sampling bias was not an issue in the other, since it used an enumerative design: all programs in the specialty, with a few feasibility exceptions, were studied. The effect sizes in both studies were large and consistent. The differences in responses and responses to requests for applications in each study were large and statistically significantly biased in favor of USMGs over IMGs by a 50 to 100 percent margin.Nonetheless, it would have been helpful to see similar studies in other larger specialty residency programs such as internal medicine and surgery, though inferences to the latter specialty programs are strengthened by the findings from the surgical program directors' survey. A listing of the details of the request letters or a sample figure would have been helpful. A higher response to the survey would have strengthened point estimates on the questions, but the findings are disconcerting despite this limitation. For example, if all of the non-responders had answered that they did not feel that there was discrimination against IMGs, 31 percent of directors would have agreed with this statement -- still a worrisome figure. Finally, a more extensive search using sources in addition to Medline might have discovered other relevant studies.Our findings provide scientific evidence to bolster opinions in the medical literature that there is discrimination against IMGs in the selection process. This bias could be operationalized in three ways: categorical refusal to consider non-U.S. applicants, quota systems and hierarchical two-rank systems. In a quota system, a program determines the percentage of IMGs that it will allow. Quotas are facilitated by the present system that allows IMGs (and osteopathic and former USMGs) to be taken into a program outside the National Resident Matching Program (NRMP). A program may choose a certain number of IMGs before the match to meet its quota and then rank only USMGs for the remaining approved spots. A hierarchical two-rank system works by ranking USMGs first, then IMGs, regardless of qualifications.Part of the bias against IMGs by residency programs in the past may have been evaluative bias. It had been very difficult to ascertain whether IMGs were adequately trained or prepared for U.S. residency programs . HoweverIf evaluative bias is no longer a factor, then why would U.S. programs discriminate against IMGs during the application process? Possibilities include additional educational burden and costs imposed on programs by IMGs, conflict over goals for medical and post-graduate medical education, protectionism for USMGs, concerns about image, administrative simplification, and discrimination based on xenophobia, country of origin, chauvinism, or other factors.There is no doubt that IMGs impose an extra educational burden on U.S. residency programs, especially in the first year of residency. These graduates have to be acculturated to the U.S. and its health care and laws, the epidemiology of disease in the U.S., patient-physician cooperative decision making, the willingness and ability of the U.S. to spend much more to improve quality and length of life than their home countries, and perhaps evidence-based medicine, AIDS care in the U.S. and cultural competence, among others. These knowledge deficits are not trivial and take real resources in the form of special curriculum and faculty time to resolve. However, experience indicates that they can be expunged .We suspect that post-graduate medical education has been protectionistic because educators conflate academic considerations with social policy. If U.S. residency programs were pure meritocracies, there should be no categorical refusal to consider IMGs and no quotas, and USMGs and IMGs should be intercalated in match lists of all programs. Applicants from all countries, including the U.S., would be ranked solely on individual merit. This approach would allow the best and brightest from throughout the world to compete for U.S. residency positions.Those who favor protectionism might argue that federal or state legislatures made a social contract with their citizens that if they undertook the rigors, expense and, oftentimes, indebtedness of medical education, they would be guaranteed a residency position in this country. The available evidence suggests that this is the implicit policy followed by the majority of U.S. programs. Whether such an approach leads to the best physicians for a country needs to be studied. U.S. medical organizations need to lead the discussion on these issues and develop explicit policies for selecting IMGs.raison d'être of their post-graduate programs may conflict with those of residency program leadership. If a primary purpose of the residency programs is perceived to be assisting medical school graduates to obtain U.S. residency positions, residency programs might use different selection strategies than if their goal were academic excellence. For example, they might rank U.S. students in the tenth percentile on the USMLE ahead of IMGs in the ninety-ninth percentile or not rank the latter at all. This potential conflict of interest between residency program and sponsoring medical schools needs to be openly discussed.Medical schools' perceptions of the inter alia. Once these sources of bias have been eliminated, there remains the likelihood that discrimination based on xenophobia, racism, chauvinism or other factors is operative.Medical educators may want to limit the number of IMGs in their programs because of general perceptions among faculty, residents, U.S. applicants and even non-U.S. applicants that programs with IMGs are inferior . They maAt this point in a manuscript it is customary for authors to suggest that further studies be undertaken to strengthen and extend existing findings. We doubt that this would be possible for at least the studies that used paired comparison. In the nearly fifty years of articles analyzed by our search, the three studies that we identified were conducted in an eight year period between 1994 and 2002. We could not find any indication that the studies were approved by an institutional review board and they used some degree of deception in order to gather data. Since 2002, very little has changed to encourage residency programs to use just and unbiased methods to deal with all applicants.Much can be done to prevent or eliminate discrimination against IMGs. Interested stakeholders could convene task forces to deal with the overarching issue of meritocracy and social policy and medical schools' posture towards post-graduate education, and give program directors clear guidelines for selecting applicants. Such transparent policies could assist program directors in dealing with the deluge of IMG applicants, so that categorical refusal to considers these applicants is not used for administrative simplification. Research studies could be undertaken with the assistance of the NRMP to better understand and monitor the occurrence of categorical non-ranking of non-U.S. applicants and two-tiered hierarchal match lists. U.S. medical schools and specialty organizations could explicitly mention IMGs in their diversity statements and actively monitor perceptions of discrimination with confidential questionnaires. The LiIt is time for the U.S. to re-examine its residency selection process and develop explicit and just selection policies for all applicants. Farra has expressed it aptly: "We have a duty to help this group that is so important. When you get a chance, ask your IMG colleagues about their stories and struggles to become accepted in this country. Let us welcome more of them into our large House of Medicine so that we can continue to make it better for everyone, especially our patients" . A recenThe authors declare that they have no competing interests.ND did the literature search and wrote the manuscript drafts. HV was involved in many discussions and critical revisions. Both authors read and approved the final manuscript.ND recently retired from the Chattanooga Unit of the University of Tennessee College of Medicine where he was Chair and Professor of Medicine. HV is Clinical Professor of Medicine at the University of Wisconsin Medical School and Director of the Marshfield Clinic Research Foundation. They represent a combined 60 years of experience as medical educator and have served either as members of residency program selection committees, program director of residency programs or a chair of a department of medicine.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/10/5/prepub

Dear Editor,I read with interest the article by Agrawal in the March issue of your journal. It suffeIn the abstract it is mentioned that 68 eyes of 41 patients were included in this study. However, in the results section of the main text, it is mentioned that only 37 eyes of 25 patients were included. Perhaps the author meant that 37 eyes were analyzed, but 68 eyes were ‘included’. However, what is the purpose of inclusion if no analysis was done?In the abstract it is also mentioned “All eyes completed was 12 months of follow-up and 37 eyes had one year follow-up” This sentence is grammatically incorrect and does not convey any meaning.In the main text of the ‘Material and methods’ section, the topical anesthetic used is incorrectly spelt. The correct generic name is Proparacaine. Why was the manufacturing company name not mentioned? This is inconsistent with the rest of the article, where drugs made by multinationals were mentioned with the manufacturers' names in parenthesis (immediate next para).In the main text of the ‘Materials and methods’ section, why are generic names mentioned for antibiotics and steroids and the trade name mentioned for an ocular lubricant?

Patients with symptomatic severe aortic stenosis (AS) benefit from aortic valve replacement surgery, but the management of patients with asymptomatic severe AS is more controversial. While cholesterol and angiotensin have been linked to AS progression, we should await the results of ongoing randomized trials before medical therapy to lower cholesterol or inhibit angiotensin can be recommended to limit disease progression. Clinical factors, echocardiographic parameters, valve morphology, exercise stress testing results, and cardiac biomarkers may be useful in identifying patients who will have early development of symptoms during follow-up and require closer monitoring. The risks associated with aortic valve replacement outweigh the benefits in the majority of patients with asymptomatic severe AS. Normal aortic valve cross sectional area is 3.0 to 4.0 cm2. A valve area index <0.6 cm2/m2 is also indicative of severe AS [In patients with normal left ventricular systolic function, severe AS is defined as a peak AS velocity >4 m/s, a mean transaortic pressure gradient >40 mmHg, or an aortic valve area (AVA) <1 cmThis paper focuses on the natural history of AS, specifically looking at medical therapy that may slow the progression of the disease, and factors that can be used to risk stratify patients with asymptomatic severe AS to identify those who may benefit from surgical intervention.2 per year [The natural history of AS begins with a long asymptomatic period that is associated with minimal mortality. There is significant individual variability in the rate of progression of severity of AS. On average, peak aortic jet velocity increases by 0.32 ± 0.34 m/s per year, mean transaortic pressure gradient increases by 7 ± 7 mmHg per year, and AVA decreases by 0.12 ± 0.19 cmSymptoms rarely occur until the valve becomes severely stenotic. The classic symptoms of AS are exertional angina, syncope, and dyspnea (i.e. heart failure). After the onset of symptoms the average survival is only 2 to 3 years with a high risk of sudden death . PatientPatients who are asymptomatic have a good prognosis. Overall survival in 126 patients with asymptomatic severe AS is comparable to age and sex matched controls from the general population . The ratIn developed countries the great majority of valvular AS is caused by calcification of a trileaflet or congenitally bicuspid or unicuspid valve -9. While“Early” changes are due to subendocardial thickening secondary to chronic inflammation. This involves disruption of the basement membrane and cellular infiltration of macrophages and T-lymphocytes , 11. TheLipids are central to multiple pathways in the development of fibrosis and calcification of AS. The lipid lowering and anti-inflammatory effects of hydroxymethylglutaryl-coenzyme A reductase inhibitors, or statins, and their proven disease modifying ability in atherosclerosis make them a potential agent for halting the progression of AS.Valvular and supravalvular AS are known complications of familial hypercholesterolemia -20. An a2 [2 per year in the rosuvastatin group versus 0.10 cm2 per year in the control group, P=0.041).Prospective studies have shown variable results. The RAAVE study looked at 121 patients with asymptomatic moderate to severe AS with aortic valve area of 1.0 to 1.5 cm.21 cm2) and foll2; range 0.7-2.0 cm2) who underwent baseline and one-year echocardiography and electron-beam computed tomography [The effect of statin treatment on aortic valve calcification was prospectively evaluated in 61 patients with AS , there was no difference in measures of AS progression between the two groups Fig. (1).Currently, the only published randomized controlled trial looking at statin therapy in AS is the SALTIRE study . One hunThis study is limited by a relatively small sample size, which was not powered to assess clinical end points or small differences in valvular progression, and the large percentage of patients with severe AS, who may have too advanced disease to be amendable to medical therapy. Finally, patients with an LDL ≥4.0 mmol/L were excluded from SALTIRE, a group that might be expected to benefit from statin therapy.Two larger clinical trials will help clarify this issue. The ASTRONOMER trial (The Aortic Stenosis Progression Observation: Measuring Effects of Rosuvastatin) has completed randomization of patients with mild to moderate AS (peak AS velocity 2.5 to 4.0 m/s) independent of valve morphology to 40 mg daily of rosuvastatin or placebo with a minimum follow-up of 3 years . The SEAAngiotensin-converting enzyme (ACE) and angiotensin II type 1 and type 2 receptors are have been found in stenotic aortic valves , suggest2) were retrospectively identified and the rates of hemodynamic progression of AS were compared between patients who were taking an angiotensin converting enzyme inhibitor (ACEI) versus those who were not [Angiotensin inhibition has also been assessed to prevent aortic valve disease progression. Two hundred and eleven patients with asymptomatic AS with a peak AS velocity of >2.5m/s Guidelines no longer recommend prophylaxis of bacterial endocarditis for patients with native valvular disease including AS . HoweverThere is no medical therapy proven to alter the rate of progression of AS. Empiric statin therapy cannot be recommended. Trials are ongoing which should help clarify the role of statins in AS. Only limited data is available on the use of ACEI in this population. Prospective studies are needed to further assess ACEI in patients with AS.ACC/AHA indications for aortic valve replacement in patients are as follows :Symptomatic severe ASSevere AS in patients undergoing coronary artery bypass grafting, other valve surgery, or surgery on the ascending aortaLeft ventricular systolic dysfunction (ejection fraction <50%) secondary to severe ASBased on these guidelines, patients with asymptomatic severe AS are not recommended to undergo valve replacement surgery. However, there are concerns with this conservative approach and some advocate earlier consideration for surgical treatment , 43. WhiThus, an ideal approach to minimize the risk of adverse events would be to identify and refer patients for surgery just before the onset of symptoms. Various methods have been proposed to attempt to identify patients with asymptomatic severe AS who are at risk for adverse events. These include assessing clinical and hemodynamic predictors, valve morphology, exercise stress testing, and the use of cardiac biomarkers.One hundred and twenty-three asymptomatic patients with a peak AS velocity >2.5m/s and thickened aortic leaflets with reduced excursion were followed with regular clinical assessment, echocardiography, and exercise treadmill testing for 2.5 years to determine prognostic factors [2) were followed for 5.4 years to assess the risks and predictors of mortality in asymptomatic severe AS [A large cohort of patients with asymptomatic severe AS with peak AS velocity ≥4 m/s , echocardiographic assessment of AS severity (AS velocity or AVA) was not predictive of future events, nor were any other clinical or hemodynamic parameters .A recent prospective study involving 133 asymptomatic patients with a peak transaortic pressure gradient ≥60 mmHg and normal left ventricular systolic function found that only a reduction in ejection fraction over time was an independent predictor of symptom onset or sudden cardiac death (P=0.001) . However2). The ability of valve morphology to predict future events was assessed in 128 consecutive patients with asymptomatic severe AS (peak AS velocity >4 m/s) . In thisThe combination of moderate to severe valvular calcification with a rapid increase in AS velocity was a particularly high risk combination. An increase in AS velocity of ≥0.3 m/s per year in the group of patients who had moderately or severely calcified valve leaflets predicted a 79% likelihood of surgery or death within 2 years of the observed increase. The importance of valvular calcification as a predictor of the rate of AS progression had also been shown when the calcification was determined by angiography .2 underwent treadmill exercise stress testing to determine its prognostic value [Sixty-six patients with asymptomatic severe AS based on an AVA <1.0 cmic value . The mai2 (mean AVA 0.9 cm2) underwent exercise treadmill testing and were followed for 12 months after the stress test [One hundred and twenty-five patients with asymptomatic moderate to severe AS based on an AVA <1.4 cmess test . Endpoin2 [Exercise echocardiography has been used for risk assessment in 69 patients with asymptomatic severe AS defined by an AVA ≤1.0 cm.81 cm2) . Stress Multiple studies have shown that a positive stress test has the ability to predict the onset of spontaneous symptom and thus requirement for valve replacement surgery -51. The Contradictory to conventional opinion, carefully monitored exercise stress testing in patients with severe AS is safe. No complications were reported in the studies discussed above -51 whichBrain natriuretic peptide (BNP) is a neurohormone secreted by the ventricles in response to volume and pressure overload , 53. BNPBNP and its aminoterminal portion Nt-BNP are increased in patients with symptomatic AS compared to those who are asymptomatic. Natriuretic peptides progressively increase with higher New York Heart Association functional class and with lower AVA -66. Thes2 [One of these studies involved 130 patients with severe AS based upon peak AS velocity >4 m/s and/or an AVA <1.0 cm.64 cm2) . Baselin.64 cm2) .Nt-BNP but not BNP is a predictor of post-operative survival in patients who undergo aortic valve replacement . In patiElevated plasma BNP is clearly associated with AS severity and cardiac symptoms in patients with AS. It also has prognostic value in patients scheduled to undergo surgical treatment. However, there continue to be limitations to the utility of BNP. First, BNP values vary with age, sex , and bod1). Many features can be used to identify patients with asymptomatic severe AS who are likely to develop early symptoms (Table In deciding whether to perform aortic valve replacement in asymptomatic patients with severe AS, the risk of not operating compared to the risk of surgery must be considered. Limitations associated with watchful waiting include the subjectivity of patients’ symptoms, concern about sudden death, and the risk of asymptomatic left ventricular systolic dysfunction. However, as earlier discussed, many papers have shown that the risk of sudden death is quite low at <1% per year -6, 47-51Operative mortality for isolated aortic valve replacement is 3-4% , 71, hig1 may be useful. In particular, serious consideration should be given to performing a carefully monitored exercise test which has been shown to be safe, clarifies the symptomatic state, and provides useful hemodynamic information predictive of prognosis. Assessment of patients with equivocal symptoms, such as those who are sedentary or whose history is unreliable can be challenging. In this subgroup, the markers listed in Table The progression of AS is highly variable. At this point there are no medical therapies that have been proven to delay the progression of AS. Aortic valve replacement is indicated for patients with symptomatic severe AS. In the great majority of patients with asymptomatic severe AS, the risk of surgery outweighs the risk of watchful waiting. There are clinical, echocardiographic and biochemical indicators which can help identify those likely to develop symptoms. A carefully monitored stress test appears safe and useful in patients with equivocal symptoms.

There is an interest for intervention studies aiming at the prevention of disability in community-dwelling physically frail older persons, though an overview on their content, methodological quality and effectiveness is lacking.A search for clinical trials involved databases PubMed, CINAHL and Cochrane Central Register of Controlled Trials and manually hand searching. Trials that included community-dwelling frail older persons based on physical frailty indicators and used disability measures for outcome evaluation were included. The selection of papers and data-extraction was performed by two independent reviewers. Out of 4602 titles, 10 papers remained that met the inclusion criteria. Of these, 9 were of sufficient methodological quality and concerned 2 nutritional interventions and 8 physical exercise interventions.No evidence was found for the effect of nutritional interventions on disability measures. The physical exercise interventions involved 2 single-component programs focusing on lower extremity strength and 6 multi-component programs addressing a variety of physical parameters. Out of 8 physical exercise interventions, three reported positive outcomes for disability. There was no evidence for the effect of single lower extremity strength training on disability. Differences between the multi-component interventions in e.g. individualization, duration, intensity and setting hamper the interpretation of the elements that consistently produced successful outcomes.There is an indication that relatively long-lasting and high-intensive multicomponent exercise programs have a positive effect on ADL and IADL disability for community-living moderate physically frail older persons. Future research into disability prevention in physical frail older persons could be directed to more individualized and comprehensive programs. Frail elderly people are at much higher risk for falls, infections, disabilities, hospitalization, institutionalization, and death, compared with their age-matched non-frail counterparts -3. In scA widely accepted definition and clear criteria for frailty are lacking ,5,13. MaOn May 16 2007 databases PubMed, the Cochrane Central Register of Controlled Trials (CENTRAL) and CINAHL were searched for randomized- and controlled clinical trials by using "frail*", "vulnerable", "at risk", "high risk", "low functioning", and the MESH terms "chronic disease" and "disabled persons" in combination with the MESH term "aged". Search terms for outcomes focused on disability measures and included terms like "disabil*", "functional decline", "functional capabilit*", "functional performance", "independen*" and MESH terms "activities of daily living", "quality of life" and "well being". To restrict the search to interventions that targeted community-dwelling elderly terms like "home*", "in-home*", "communit*", "independent living" and MESH term "primary care" were added. Additionally studies were searched by hand-searching reference lists from relevant papers. The search was restricted to articles in English, Dutch and German. There was no restriction for type of intervention or year of publication.Clinical trials where community-dwelling frail elderly were the target group were included. Studies had to include frail elderly based on at least one of the physical frailty indicators as described by Ferrucci et al. . Table 1A first selection of relevant studies was made on title-level using a conservative approach, meaning that in case of doubt an article would always be screened on abstract-level. The second (abstract-level) and third selection phase (full-text level) were independently undertaken by two reviewers (RD and EvR) scoring 'relevant', 'doubt' or 'irrelevant' on forms. In case of inconsistencies, the reviewers discussed the scoring. Consensus on 'irrelevant' led to the exclusion of an article. On one occasion the reviewers asked for the involvement of a third party (LdW) in order to reach consensus. The same reviewers also performed independently the quality assessment of included studies as well as the data extraction. Inconsistencies in scoring between reviewers was discussed until consensus was reached. As the included trials all turned out to be randomized controlled trials the methodological quality was assessed using an adaptation of the Cochrane Back Review Group list of criteria Table 19]. Th. Th19]. Four thousand six hundred and two titles were identified in the literature search. After screening the titles, 127 studies were considered relevant for further screening on abstract-level. Of these, another 69 studies were excluded, because of not meeting the inclusion criteria and focused on the physical condition of the participants, except for one that indThe inclusion criteria used varied from rising from a chair, to descending stairs, knee extensor strength, oxygen-uptake, physical inactivity, involuntary weight loss, low BMI, dietary assessment, gait test, balance test and mobility problems , howeveOut of the 10 randomized controlled trials that evaluated interventions for physically frail community-living elderly on disability, 9 were considered to be of sufficient methodological quality. No consistent findings were found in these 9 trials regarding their effect on disability.There is no evidence that nutritional interventions for frail elderly, despite an observed effect on total energy intake and weight gain , result The differences between the interventions hamper the interpretation of elements that consistently produced successful outcomes. Although malnutrition and physical frailty markers are considered strong indicators for functional decline in the elderly ,32, the A systematic review was conducted to assess the content, the methodological quality and the effectiveness of intervention studies for the prevention of (ADL/IADL) disability in community-dwelling physically frail older persons. There is no evidence that nutritional interventions for frail older persons, despite an observed effect on total energy intake and weight gain, result in positive effects on disability-level. No evidence appeared that single lower extremity strength-training, despite the effect on strength and walking function, has an effect on disability for physically frail older persons. There is some indication that long-lasting high-intensive exercise programs for moderate physically frail older persons can have an effect on disability outcomes.The authors declare that they have no competing interests.RD, EvR, LdW and WvdH developed the original idea for the review. RD performed the search strategy and the selection, extracted the data and wrote the manuscript. EvR was involved in the selection process and data extraction. EvR, LdW, WvdH and GIJMK provided valuable comments during the process of writing this manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Table 4: General characteristics and outcomes of included trials. The data provided informs about features of interventions, measurements and outcomes of trials included in the systematic reviewClick here for file

Camptothecins are DNA topoisomerase I-directed anti-tumour drugs with a novel mechanism of action. Topotecan (TPT), a hydrophilic derivative of camptothecin, is currently undergoing phase II clinical trials in small-cell lung cancer (SCLC). Human SCLC OC-NYH cells were made more than 6-fold resistant to topotecan by stepwise drug exposure and resistance was stable for 70 passages without drug. NYH/TPT cells had half the topoisomerase I level and activity of wild-type cells. However, no difference in camptothecin or topotecan inhibition of topoisomerase I-mediated DNA relaxation was found, indicating that the enzyme itself was unchanged in the resistant cell. In NYH/TPT cells, topoisomerase II alpha and beta levels were increased approximately 2-fold. Accordingly, the topoisomerase II-directed drug etoposide (VP-16) induced an increased number of DNA single-strand breaks in NYH/TPT cells. However, sensitivity to different topoisomerase II-targeting agents in NYH/TPT cells varied from increased to decreased, indicating a role for as yet unidentified factors acting on the pathway to cell death after topoisomerase II-induced DNA damage has occurred. Of 20 anti-cancer agents tested, only hydroxyurea showed marked collateral hypersensitivity in NYH/TPT cells.

Tendon disorders (tendinopathies) pose serious biomedical and socioeconomic problems. Despite diverse treatment approaches, the best treatment strategy remains unclear. Surgery remains the last resort because of the associated morbidity and inconsistent outcomes. We hypothesized that, similar to fibroblasts in various organs, tendon fibroblasts (tenocytes) might be responsive to stimulation with interleukins (ILs), particularly IL-4 and IL-13. These two cytokines share sequence homology, receptor chains and functional effects, including stimulation of fibrogenesis. It is unknown whether tenocytes are responsive to stimulation with IL-4 or IL-13. If true, local use of these cytokines might be used to facilitate tendon repair in patients with tendinopathies or used for tendon tissue-engineering approaches to facilitate tenocyte growth on scaffolds in culture.Tendon tissues that would normally be discarded were obtained during reconstructive surgery procedures performed for clinical indications. Primary tenocytes were derived from Achilles, posterior tibial, flexor digitorum longus and flexor hallucis longus tendon tissue samples. Reverse transcriptase quantitative PCR (RT-qPCR) experiments revealed that mRNAs for the receptor (R) chains IL-4Rα, IL-13Rα1 and IL-13Rα2, but not the common γ-chain were present in all tested tendon tissues and in cultured tenocytes. Levels of IL-13R chain mRNAs were significantly higher than those of IL-4R mRNA. The cultures responded, in a dose-dependent fashion, to stimulation with recombinant human IL-4 or IL-13, by increasing proliferation rates 1.5 to 2.0-fold. The mRNA levels of 84 genes related to cell cycle regulation were measured by RT-qPCR after 6 h and 24 h of activation. The expression levels of several genes, notably CDK6 and CDKN2B changed more than twofold. In contrast to their effects on proliferation, stimulation with IL-4 or IL-13 had little if any effect on the levels of collagen mRNA or protein in cultured primary tenocytes. The mRNA levels of 84 other genes related to extracellular matrix and cell adhesion were also measured by RT-qPCR; expression of only five genes was consistently changed.in vivo or to aid in tendon tissue engineering, through stimulation of tenocyte proliferation.Stimulation with IL-4 or IL-13 could be used to facilitate tendon repair Tendon disorders (tendinopathies) are common, and are responsible for much morbidity in sportspersons ,2, militThe treatment approaches to tendinopathies are diverse, but the optimum treatment remains undetermined, with surgery being the last resort, because of the associated morbidity and inconsistent outcomes . We propc). They also share numerous immunomodulatory effects and, relevant to our study, effects on proliferation and gene expression in fibroblasts of diverse tissue origin [Interleukin (IL)-4 and IL-13 are prototypic immunomodulatory T-helper (Th)2 cytokines known to have profibrotic effects -18. These origin -18. We hPatients with tendinopathies of the AT or PTT were enrolled in this study. All procedures were reviewed and approved by the MedStar Research Institute and the University of Maryland Institutional Review Boards. Informed consent was obtained from all patients.Tendon tissues that would otherwise be discarded were obtained from normal and injured/diseased tendons during reconstructive surgery procedures performed for clinical indications. These tissues included the tendinopathic portion of the PTT or AT, and the healthy (non-tendinopathic) portion of the flexor digitorum longus (FDL) tendon, the flexor hallucis longus (FHL) tendon or the AT. The diseased sections of the tendon were identified by the characteristic thickening of the outer diameter, fissuring, surface irregularity, fibrillation, and a more gelatinous consistency and yellowish discoloration compared with normal tendons; some of the diseased tendons were also ruptured or attenuated. The specific numbers of patients involved in each experiment are indicated in the Results and the figure legends.3 pieces under sterile conditions, and digested with 0.25% trypsin (w/v) in ethylenediaminetetraacetic acid (EDTA) for 5 min. The digested tissues were transferred to 35-mm culture dishes and incubated in 5% CO2/95% air at 37°C with Dulbecco's modified Eagle's medium/nutrient mix F-12 (DMEM/F12) medium containing 10% fetal bovine serum and 1% antibiotic mixture as described above. The culture medium was changed twice a week. Emerging cells were split by trypsinization, seeded into 75-cm2 culture flasks at 1 × 105 cells per flask, and cultured in the same high serum (10%) cell culture medium, until they were split again after reaching approximately 1 × 106 cells per flask. Tenocyte identity was confirmed by assessing the expression of a tenocyte-specific gene (scleraxis) and genes for collagens α1(I), α2(I) and α1(III) in real-time PCR assays with specific primers. Cells were used for experiments at passages 3 to 5. For experiments, cells were trypsinized, seeded into six-well plates at 2.5 × 105 cells/well or 96-well plates at 2.5 × 103 cells/well, and incubated overnight in dialyzed low serum (0.5%) cell culture medium. All experiments were then performed in the same low serum medium. All cell culture reagents were from Invitrogen .Separate primary cell cultures were established from healthy and diseased portions of tendon tissues obtained from each patient. Harvested tendon tissues were used either for mRNA purification or for primary explant cell cultures. For cell culture, the tissues were rinsed twice in phosphate-buffered saline containing 1% antibiotic mixture (100 μg/ml penicillin and 100 μg/ml streptomycin), cut into 1 mmCultured tenocytes were stimulated with rhIL-13 or rhIL-4, which were purchased from R&D Systems . Changes in cell proliferation rates were assessed in quadruplicate, using a cell proliferation assay in accordance with the manufacturer's recommendations, as previously described . The assChanges in gene expression were assessed in real-time quantitative (q)PCR assays as described below. Western blotting assays for type I collagen levels in tenocyte cell cultures were performed and assessed by densitometry of the specific protein bands as previously described .3 in size, frozen in liquid nitrogen, and pulverized under liquid nitrogen with mortar and pestle. The tissue pellet was transferred into a glass tube homogenizer where it was further homogenized in TRIzol reagent . Total mRNA was purified from the processed tendon tissues or from cultured tenocytes using TRIzol, and reverse transcription performed in accordance with the manufacturer's recommendations. Purification of mRNA from cultured primary cells was also performed using TRIzol as recommended. The resulting cDNA samples were used for real-time qPCR using the following three approaches, in all of which the 2-ΔΔCt method was used to assess the amplitude of changes in gene expression induced by IL-13 and IL-4.To obtain mRNA, the tendon tissue samples were immediately sectioned into pieces < 3 mmThe initial pilot experiments were performed on cDNA samples from total human tendon tissues in TaqMan assays with specific primers and probes that were designed based on GenBank sequences for human IL-4Rα or IL-13Rα2 using Primer Express V.2.0 software and synthesized by Integrated DNA Technologies . Primers and TaqMan probe for glyceraldehyde-3-phosphate dehydrogenase (GADPH) (Applied BioSystems) were used as positive controls. PCR assays were performed in a thermal cycler , with all samples tested in triplicate for each target.c, and the collagen chains COL1A1, COL1A2 and COL3A1. As a reference sequence, 18S rRNA was used. All pre-validated primers and chemistry for SYBR Green detection were from SABiosciences . The lack of primer dimers and the specificity of amplification were further confirmed by agarose gel electrophoresis of PCR products, which all gave a single band of expected size, and by automated sequencing of PCR products. Thermal cycling was performed using a real-time PCR system , and all samples were tested in triplicate for each target.Experiments on cultured tenocytes measured expression levels of scleraxis, IL-13Rα1, IL-13Rα2, IL-4Rα, γ2 qPCR System (SABiosciences) and the StepOnePlus system. This approach allowed simultaneous real-time qPCR analyses of the mRNA levels of 84 relevant genes, normalized to five different reference targets . Combined tenocytes derived from the AT of two separate donors were stimulated with 150 ng/ml rhIL-13 or rhIL-4, each on two separate occasions, for 6 h or 24 h as indicated, and RT-qPCR analyses performed. To be selected, genes had to have a cytokine-stimulated increase or decrease in gene expression that was consistently equal to or greater than twofold in both IL-13- and IL-4-stimulated cultures compared with non-stimulated controls in each independent stimulation. In addition, the absolute level of expression for each gene was required to be sufficient, as judged by amplification occurring earlier than an arbitrarily established threshold of 32 cycles of PCR amplification.Finally, quantitative profiling of genes related to cell cycle regulation or, separately, connective tissue, was performed using the RTc in combination with IL-4Rα chain. Quantitative analyses . The average increase in proliferation rates at this single concentration of either IL-13 or IL-4 was 1.75 ± 0.27-fold compared with non-stimulated control cultures.Stimulation with rhIL-13 or rhIL-4 leads to dose-dependent increases in tenocyte proliferation rates Figure . One-wayTo identify the molecular pathway through which IL-13 and IL-4 may regulate tenocyte proliferation, we used RT-qPCR to assess changes in the expression level of 84 molecules known to be involved in the cell-cycle regulation. We combined equal amounts of tenocytes derived from the ATs of two volunteers, stimulated them with rhIL-13 or rhIL-4 for 6 and 24 hrs on two independent occasions, and performed RT-qPCR and analyzed gene expression as described in Methods. The expression levels of only four genes were changed at 6 h, but those of 16 genes were changed at 24 h, with only two genes (CDK6 and CDKN2B) consistently changed at 6 h and 24 h .We then assessed whether IL-13 or IL-4 can induce production of collagen in cultured primary AT, PTT or FDL tenocytes. AT tenocytes were derived from separate healthy or diseased tendon sections taken from the same donor. PTT and FDL tenocytes were from a separate patient, and were tested on two independent occasions. Steady-state levels of COL1A1, COL1A2 and COL3A1 mRNAs were assessed at 0, 1.5, 3, 6 and 24 hrs of stimulation with 50, 150 or 300 ng/ml rhIL-13. The-fold difference between stimulated and non-stimulated tenocytes cultures varied from 0.8 to 1.3, and did not reach significance in any instance . By contrast, stimulation of tenocytes with 1 ng/ml of recombinant human transforming growth factor-β (used as a positive control) induced a 3.3 ± 0.2-fold increase in the density of the collagen band .Western blotting assays assessed production of type I collagen protein in separate primary AT tenocyte cultures derived from healthy and diseased sections of the tendons, each from three different patients, and in a primary FHL tenocyte culture from a fourth patient. Each experiment was repeated on two independent occasions. The changes in the density of collagen bands varied from 0.9 to 1.2-fold in IL-13-stimulated samples compared with non-stimulated controls was used to measure gene expression for 84 genes related to the ECM, with results normalized to those from five housekeeping genes. In these experiments, AT tenocytes from two volunteers were pooled and stimulated with 150 ng/ml of IL-4 or IL-13 for 6 h, each on two independent occasions, and the gene expression was tested by RT-qPCR. Again, there were no significant changes in the expression of collagen type I or type III chain genes, nor were there consistent changes in the expression of the majority of tested genes within two-fold differences. Only five genes -related genes, RT-qPCR or participate in classic immune reactions ,23, furtc chain. Both rhIL- 4 and rhIL-13 stimulate tenocyte proliferation and regulate expression of several genes, including genes whose protein products control the cell cycle; however, neither cytokine consistently regulates production of collagen in primary tenocytes. These observations suggest that local administration of IL-4 and/or IL-13 to the healing tendon might be beneficial in accelerating recovery in patients with tendinopathies, without affecting systemic regulation of inflammation or immunity by these cytokines. These cytokines might be also used in tendon tissue-engineering applications, to facilitate the growth or primary, including autologous, tenocytes on scaffolds, to be used as implants in reconstructive tendon surgery.Primary human tenocytes derived from healthy and diseased tendon tissue express IL4Rα, IL-13Rα1 and IL-13Rα2 chains but not the γThe authors had no competing interests that might affect experimental data, data analyses or interpretations or conclusions in this study.All authors have read and approved the manuscript and contributed to the study design, data acquisition and analysis, interpretation of the data, and drafting and revision of the manuscript. JPC, LCS and SPA had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of data analysis. The study was designed by LCS and SPA. Data were acquired and partially analyzed by JPC, IGL, CBZ, JFR and LCS. Complete data analyses and interpretations were performed by JPC and SPA. Statistical analyses were performed by SPA. The manuscript was prepared by JPC and SPA.

Analysis of amino acid repeats in four mammalian and one bird genome shows that many are associated preferentially with intrinsically unstructured regions. Amino acid repeats (AARs) are common features of protein sequences. They often evolve rapidly and are involved in a number of human diseases. They also show significant associations with particular Gene Ontology (GO) functional categories, particularly transcription, suggesting they play some role in protein function. It has been suggested recently that AARs play a significant role in the evolution of intrinsically unstructured regions (IURs) of proteins. We investigate the relationship between AAR frequency and evolution and their localization within proteins based on a set of 5,815 orthologous proteins from four mammalian and a bird (chicken) genome. We consider two classes of AAR (tandem repeats and cryptic repeats: regions of proteins containing overrepresentations of short amino acid repeats).Mammals show very similar repeat frequencies but chicken shows lower frequencies of many of the cryptic repeats common in mammals. Regions flanking tandem AARs evolve more rapidly than the rest of the protein containing the repeat and this phenomenon is more pronounced for non-conserved repeats than for conserved ones. GO associations are similar to those previously described for the mammals, but chicken cryptic repeats show fewer significant associations. Comparing the overlaps of AARs with IURs and protein domains showed that up to 96% of some AAR types are associated preferentially with IURs. However, no more than 15% of IURs contained an AAR.Their location within IURs explains many of the evolutionary properties of AARs. Further study is needed on the types of IURs containing AARs. Saccharomyces cerevisiae [Amino acid repeats (AARs) are segments of proteins made up of simple patterns of amino acids, often strings of a single amino acid. They have long been recognized to be common features of eukaryotic proteins -4. Polygrevisiae ,13,14 anrevisiae a consisrevisiae . Finallyrevisiae have shorevisiae . Removinrevisiae , again iAAR size difference between orthologous human and mouse proteins correlates with protein nonsynonymous substitution rate . A studyIntrinsically unstructured regions (IURs), also called disordered regions, are regions of protein, ranging in size from short loops to complete proteins, that do not form a compact tertiary structure under normal solvation conditions . They haA variety of computational methods exist to detect repeated sequences in proteins. These range from SEG, which looks for regions of low complexity , to aligPan troglodytes, Mus musculus, Rattus norvegicus and Gallus gallus) we show that the most common AARs show strong preferences to be located within IURs in all five proteomes. We also confirm that sequences flanking AARs evolve more rapidly than the remainder of their respective proteins. We conclude that the forces shaping the evolution of IURs and AARs are strongly linked, although AARs are present in only a subset of IURs.Using a set of orthologues to human genes from four species . It should be noted that numerous other non-homogeneous C4 motifs were detected; these are not considered here.Our protein set contained 5,815 orthologous proteins. Figure P < 0.01 or less after Bonferroni correction) ranging from 0.555 (chicken) to 0.718 (rat). Despite this broad similarity it was noteworthy that L4 repeats were absent amongst C4 repeats, although relatively common among tandem repeats.Comparing the frequencies of homogeneous C4 repeat types with their tandem equivalents showed significant correlations (P << 0.001) for all six pairwise comparisons. The distribution for chicken correlates less well with those seen in mammals, showing correlation coefficients ranging from 0.894 (human-chicken) to 0.929 (rat-chicken). In general, chicken proteins contained fewer tandem repeats than mammalian proteins . Serine tandem repeats were less extreme in this respect, chicken proteins containing 193 repeats compared to 241, 230, 219 and 215 for the mammals.The frequency distributions of the tandem repeat types are highly similar between the four mammals, with correlation coefficients > 0.99 (P << 0.001) correlations between frequencies in all five species, ranging from 0.870 for chimpanzee-rat to 0.989 for human-chimpanzee. C4 repeats were rarer in chicken proteins than mammalian proteins, glycine (G4) and glutamine (Q4) C4 repeats being particularly underrepresented in chicken.We also calculated inter-species correlation coefficients between the frequencies of the commonest homogeneous C4 repeats. These C4 repeats also showed strong and significant .To estimate more precisely the relative increase of evolutionary divergence in the neighborhood of repeats, we carried out regression analysis. The slope of the regression of the flanking sequence divergence on the corresponding protein remainder divergence represents the relative enhancement of flanking sequence divergence in a given dataset. Regression results for human-mouse, human-rat and human-chicken comparisons are summarized in Table P < 0.05 after adjustment for false discovery rate) at levels 3 and 4 of the GO molecular function hierarchy. We carried out the analyses for human and chicken to characterize any differences reflected in the different repeat frequencies seen in the chicken and mammal proteomes.A number of authors have discussed associations of tandem and cryptic AARs with transcription factors and protein kinases in particular -15,34-36Results were broadly similar to those obtained previously for yeast and other species ,15 Figu. All of 4 repeats with RNA binding (level 3: nucleic acid binding). In humans, Q4 repeats showed qualitatively similar associations to those seen for tandem Q repeats. E4 repeats also showed an association with cytoskeleton protein binding in chicken, which is to some extent similar to the cytoplasmic roles identified for tandem E repeats.C4 repeats showed fewer common associations between the human and chicken proteins sets. The only shared association was found for P4 and S4 and 24% for Q4.To investigate the relative distribution of tandem and C4 repeats between structured and unstructured protein regions, we related the locations of repeats to protein domains, as defined by a search against the SUPERFAMILY database4) and 40% (E4) of common homogeneous C4 repeats also lay within identifiable domains.These proportions represent a lower bound on the proportion of repeats lying within structured regions of proteins because structures have not been determined for all domains. An approximate upper bound can be estimated by considering the proportion lying within domains identified by InterProScan searches . Many of these represent regions of proteins with functional associations but no known structure. Between 25% (for Q) and 95% (L) of tandem repeats lay within domains identified by InterProScan. Slightly lower proportions, between 0% algorithm , which wResidues with RONN scores of > 0.5 are predicted to be disordered , whereas residues with scores < 0.5 are predicted to be ordered. Repeats were inferred to overlap IURs if they lay entirely within them. Figure 4 repeats showed the highest level of disorder while A4 showed a higher degree of order. Corresponding tandem and C4 repeats showed similar distributions between ordered and disordered regions. The exceptions to this trend were Gln repeats, which showed a higher tendency to be within structured regions as C4 repeats (32%) than as tandem repeats (13%).Most repeats showed a strong tendency to lie in unstructured regions; for tandem repeats the proportions lying within unstructured regions ranged from 96% for E and S to 67% for A, compared to 22% for the average amino acid within a protein. The exceptions were L repeats, which were predicted to be predominantly ordered. Among C4 repeats, all the common repeat types again showed a strong preference for highly disordered regions. As for tandem repeats, EFinally, we considered the proportion of IUR regions that contain an AAR. These proportions differ depending on the minimum length permitted for an IUR. For a minimum IUR length of 10, on average 85% of proteins contained a predicted IUR. Twenty to 21% of mammalian proteins and 13% of chicken proteins contained some kind of tandem AAR and 12% of mammalian proteins and 9% of chicken proteins contained some kind of C4 repeat; 4.6% of IURs contained a tandem AAR and 0.5% a C4 AAR. The proportion of proteins containing an IUR reported here is higher than the generally accepted proportion of around 40% . We therNumerous predictors of IURs are available - for a comparison see . We compS. cerevisiae proteome as measured by SIMPLE [Although tandem repeats of amino acids are easily recognized features of proteins and have been extensively studied, protein sequences show more widespread repetitive features. This is shown by the high proportion of proteins containing repetitive segments - approximately 50% as measured by SEG and overy SIMPLE . In thisAfter excluding C4 motifs that overlap tandem repeats, many of the C4 motifs detected in these genomes are clearly related to common tandemly repeated amino acids .The biggest difference in frequency between tandem and cryptic repeats was seen for Leu, which is rare among C4 repeats. In addition, Qvolution ,49) but Repeat frequencies were highly similar between the mammals, but the chicken proteome showed a distinct frequency distribution in which most repeat frequencies were lower. A partial exception to this pattern were tandem S repeats, which although rarer in chicken than in mammals, were the most common class in the chicken proteome. A trivial explanation for these differences could be the currently lower quality of the chicken genome sequence. However, this is unlikely to be the main explanation as the dataset we used contained only clearly identifiable orthologues. Another, and more interesting, possibility is that the lower frequency in chicken is the result of the general reduction of genome size in birds. The chicken genome is approximately one-third the size of the human genome while biPrevious analyses of the evolution of Gln repeats have suggested that in the early stages of their emergence, when encoded by pure codon repeats, they appear preferentially in regions of proteins that are subject to relatively low levels of purifying selection ,21,22. IIURs are regions of proteins that do not form stable tertiary structures under native conditions. Analyses of the extent of disorder in whole genomes suggest that in eukaryotes more than 40% of proteins are either completely disordered or contain significant regions of disorder . In thisWe obtained inconsistent predictions on the level of structure shown by A repeats. They were predicted to be predominantly unstructured by two methods, RONN and DISOPRED, but not by a third, IUPRED. This disagreement may reflect the different methodologies employed by the different algorithms as IUPRED takes account of the chemical characteristics of the sequence being analyzed whereas RONN and DISOPRED use structural analyses of proteins. The ambiguous position of A in these analyses is interesting in the light of its role as the second major cause of human repeat expansion disease, after Q. Gln repeats are notable in showing markedly higher proportions of disorder as tandem repeats than as C4 repeats, suggesting that expansion of Q repeats could have a destabilizing effect on proteins, as suggested previously .et al. [Seven of the eight most common tandemly repeated amino acids in our dataset correspond to the seven disorder-promoting amino acids defined by Dunker et al. . Lise anet al. in theiret al. , N repeaet al. and consL tandem repeats form interesting exceptions to the general association of AARs with unstructured regions as they are predicted to be 100% structured. The amino acids found in tandem repeats tend to be hydrophilic; all the most hydrophilic amino acids are founThe majority of AARs have arisen during evolution within protein regions with the characteristics of IURs. This is true both of tandem and cryptic repeats, which have many common characteristics such as relative frequency and, to a lesser extent, GO associations. The dynamics of the evolution of most AARs are, therefore, likely to mirror those of IURs. Some, but not all, IURs, evolve more rapidly than the proteins they are part of ,28. DespIURs are thought to play an important role in protein-protein interactions. Repeat accumulation may, therefore, play a role in the evolution of protein-protein interactions in transcriptional and signaling networks by expanding the repertoire of disordered regions. Because they evolve rapidly, repeat sequences potentially provide a means for organisms to rapidly tune their transcriptional and signaling protein-protein interaction networks .Leu (and Ala) repeats form a special class in being hydrophobic amino acids that commonly form repeat structures. Leu repeats are consistently predicted to be structured, and Ala repeats often are. Glu repeats, which are very common, are also often found within structured regions, although Glu is disorder-promoting. Further studies of the evolution of these repeat classes are therefore merited as repeat variation in structured regions may be expected to have significant effects on protein structure and/or stability.For the analyses presented in this paper we prepared a set of orthologous proteins present in all five species, extracted from the Ensembl database version 41 . We downPerfect tandem AARs were identified using a standalone JAVA program. Tandem repeats are defined here as continuous runs of a single amino acid with a length of more than four residues.4), these correspond to regions that fall just below our definition of a tandem AAR. By looking at C4, rather than tandem repeats of a shorter length, we were also able to look at interrupted, tandem-like cryptic structures. It should be noted that using longer motif lengths would essentially replicate searches for tandem repeats of different lengths. Using shorter motif lengths (one to three) produces results more similar to those for tandem repeats than those seen for C4 repeats (data not shown).Cryptic repeats were identified using version 3 of the program SIMPLE with modTo confirm whether the flanking regions of AARs have evolved more rapidly than the whole protein, we constructed multiple alignments of orthologs from the five species using the default settings of CLUSTALW .Replication slippage has been implicated as a mutational mechanism giving rise to variation in cryptically repetitive sequences as well We then used Protdist from the PHYLIP package to estimFatiGO+ was usedTo test whether C4 and tandem repeats are embedded within functional domains or proteins, we searched for domains annotated in the Interpro database using the InterproScan web service -70. The IURs were predicted using the RONN algorithm . ResultsAAR: amino acid repeat; GO: Gene Ontology; IUR: intrinsically unstructured region; RONN: Regional Order Neural Network.MS carried out most of the data acquisition and analysis and drafted parts of the manuscript. JMH supervised the project, carried out some of the analysis, and compiled the final manuscript.

The Web-based software tool Genevestigator provides powerful tools for biologists to explore geneexpression across a wide variety of biological contexts. Its first releases, however, were limited by the scalingability of the system architecture, multiorganism data storage and analysis capability, and availability ofcomputationally intensive analysis methods. Genevestigator V3 is a novel meta-analysis system resultingfrom new algorithmic and software development using a client/server architecture, large-scale manualcuration and quality control of microarray data for several organisms, and curation of pathway data for mouseand Arabidopsis. In addition to improved querying features, Genevestigator V3 provides new tools to analyzethe expression of genes in many different contexts, to identify biomarker genes, to cluster genes intoexpression modules, and to model expression responses in the context of metabolic and regulatory networks. Being a reference expression database with user-friendly tools, Genevestigator V3 facilitates discoveryresearch and hypothesis validation. Aless prevalent but fundamental approach is the modeling of networks at theorganism level by including quantitative information about where, when, and whyspecific components are active. Dissecting the organism network (in contrast tothe cellular network) of multicellular organisms helps to understand mechanismsthat drive development, the functions of system components, and regulatorynetworks that trigger responses to environmental cues or to geneticperturbations.Systems biology explores interactions betweencomponents of a biological system. Frequently, the term To build such networks at multicellular scale, bothexpression data and contextual information have to be analysed simultaneously. Although gene expression data and statistical tools are now widely available–4, the scurated and quality controlled more than 20,000Affymetrix expression microarrays from human, mouse, rat, Arabidopsis, andbarley,manually curated pathway reaction networks for mouseand Arabidopsis see ,developed an architecture to distribute the analysistask between the client and the server such that computationally intensivealgorithms can run on the client computer,designed a database model which provides highscalability and organism-independent modeling,performed major improvements in existing analysistools,implemented a more efficient and flexible workflowincluding workspace storage and figure export, anddeveloped a set of new analysis tools for biomarkeridentification, clustering, biclustering, and pathway analysis.In , 6, we pThe large number of simultaneous users, the increasingload of server side data processing, and the need to implement advancedanalysis tools required the choice of a technology that shares the load betweenserver and client machines. In fact, some analyses such as the clustering oflarge data matrices require considerable CPU time, frequently overloading asingle machine if multiple clustering jobs are sent to it simultaneously. Atthe same time, we looked for a technology that minimizes hardware and softwareadaptations on the user side.A careful analysis of possible technologies revealedthat a combination of Java and relational database (RDB) technologies wouldrepresent the optimal combination to handle the complex problem of providing alarge centralized database and complex, highly interactive analysis tools tousers in the biology community. We therefore verified the penetration of Java(and its various versions) in the Genevestigator user base , to be sGenevestigator V3 comprises four main components: (1) adatabase, (2) an application server, (3) a Java client application, and (4) awebsite for user support and management. More specifically, Genevestigator V3is a multitier Java/Java/Mysql system in which a thick Java client communicateswith a farm of server machines running a Tomcat application server which, inturn, communicates with a distributed system of database instances to retrievethe queried data see . Except The Genevestigator V3 client application is a signedapplet loaded and running within the Internet browser. New versions of theclient are distributed on the fly from the server once they are available.The task of the application server is to cache andquickly provide the compressed data to the client computer, where they could beprocessed with visualization and clustering algorithms. The application serverprovides also the data-mining functionality with presampling algorithms toquickly retrieve the data according to biologically meaningful ranking functions.The database system behind the application server wascarefully designed to accommodate multiorganism data and to provide thepossibility to switch quickly between different organisms. Another challengewas posed by the experiment classification database subsystem, which stores themeasurement data according to ontologies representing the sample experimentalcontext, in particular the anatomy part, developmental stage, stimulus applied,and genetic background. In a further database subsystem, metabolic andregulatory pathways are mapped to multiple organisms and microarray data.In order to build the Genevestigator referenceexpression database, we collected hundreds of Affymetrix experiments from thepublic domain, controlled the quality of the data using several Bioconductorpackages (see ),and mahttps://www.genevestigator.ethz.ch/). In brief;An overview of the Genevestigator V3 data- andworkflow is shown in Meta-Profile analysis toolset includesseveral tools that provide information about when, where, and in response to what genes of interest areexpressed. Specifically, they visualize gene expression across experiments orbiological contexts such as anatomy, development, stimulus, and mutation.The Biomarker Search toolset allows users toeasily identify genes that are specifically expressed in a set of biologicalstates (anatomy or development) or specifically up- or downregulated inresponse to a set of perturbations (stimulus or mutation). An explanation onhow to use these tools is provided on the website.The Clustering Analysis toolset: (1)hierarchical clustering, and (2) biclustering. Both methods have been shown toreveal biologically significant associations between biological components orgene networks [The clustering tools in Genevestigator V3 group genesthat show similarity in their summarized expression levels . These tools can also be used to cluster array-level profiles. Two types of methods are currently provided in the networks , 9.Pathway Projector toolset allows the visualization of expression data on a pathwayor network level. Several conceptual features distinguish it from mostcurrently available pathway analysis tools. First, all pathways were verifiedmanually from the literature and modeled into a single reaction network, inwhich each reaction is represented only once, even if it is shared betweenseveral pathways. The user can find locations within the network usingclassically defined pathway terms. Nevertheless, network analysis focuses onidentifying expression modules within the global reaction network, irrespectiveof classical pathway boundaries. For example, the user can start with a singlereaction or pathway and create subnetworks by extending them with neighbor reactionsor pathways according to their expression. A second distinguishing feature isthe projection of expression metaprofile data onto these networks. The user cancreate virtually any type of comparison selected from the database and projectit onto the network, for instance, compare one state of development withanother, a tissue against another tissue, or a treatment against its controlset.The In contrast to the previous versions, GenevestigatorV3 integrates all the different analysis tools. For example, marker genesidentified using the Biomarker Search tool can be further analyzed by switchingto the Meta-Profile or Clustering analysis toolsets. Another major improvementis that all organisms are integrated into the same user client interface,allowing the user to study genes from several organisms in parallel and in thesame session.Besides these analysis tools, several novel usabilityfeatures have been added to the client, such as saving workspaces, exportingfigures in Web or print resolution, saving pathway views, or exporting lists ofgenes. Users can submit their workspaces or pathway views to be placed on thecommunity page of the Website. This allows other users to view thecorresponding results without having to upload arrays or genes again, or toredesign network structures. Additionally, a role-based access control systemallows confidential data to be visualized in the context of all otherexperiments in the database, without being seen by nonauthorized users. Upon request,confidential data from laboratories are quality-controlled and entered into thedatabase by Genevestigator curators to ensure comparability and systematicannotation.It is generally accepted that the integration ofmultiple data types will be essential to model biological systems. Transcriptomics data from single experiments provide an informative butselective view of biological processes. There is an increasing evidence,however, that mining microarray data simultaneously from many different experimentsand organisms make this type of data highly informative and valuable forfunctional genomics and systems biology applications. The Genevestigator V3discovery tool and reference database therefore covers a broad range of academic and commercialresearch interests. Until now, most researchers have used Genevestigator inmolecular biology research for discovery or experimental validation. Morerecent tools in Genevestigator V3 now allow researchers to develop applicationsin plant and animal genomics, toxicogenomics, biomarker discovery, cropbiotechnology, disease and clinical research, as well as pathwayprioritization. Its multiorganism capabilities allow researchers to performcross-species studies to confirm orthologs and facilitate gene functiondiscovery.Genevestigator tools are made available in threeforms: OPEN-ACCESS, CLASSIC, and ADVANCED. For academic users, the first twoare freely available, while access to ADVANCED is made available for a moderatesubscription fee (in the range of reagent kits that are frequently used in thelab) to support our costs of curation and development. The tools and featuresavailable for each form are described on the Genevestigator website.http://www.genevestigator.ethz.ch.In summary, Genevestigator V3 provides a large andcontinuously growing reference database of systematically annotated andhigh-quality microarray data from several organisms. Powerful but user-friendlytools for the meta-analysis of transcriptomes allow to visualize geneexpression through a large library of biological contexts, facilitating themodeling of gene regulatory networks and the identification of specificmarkers. The tool is accessible at The supplementary material provides an example list of all treatments, diseases, and other perturbations mapped within the human datasets in Genevestigator (as of March 2008). Many of them are available from two or more independant studies. This list continues to grow as more data is being curated and made available to the users.Click here for additional data file.

Infertility patients are a vulnerable group that often seeks a non-medical solution for their failure to conceive. World-wide, women use CAM for productive health, but only a limited number of studies report on CAM use to enhance fertility. Little is known about traditional and religious forms of therapies that are used in relation to conventional medicine in Turkey. We investigated the prevalence and types of complementary and alternative medicine (CAM) used by infertile Turkish women for fertility enhancement.A face-to-face questionnaire inquiring demographic information and types of CAM used for fertility enhancement were completed by hundred infertility patients admitted to a primary care family planning centre in Van, Turkey between January and July 2009.The vast majority of infertile women had used CAM at least once for infertility. CAM use included religious interventions, herbal products and recommendations of traditional "hodja's" . Of these women, 87.8% were abused in the last 12 months, 36.6% felt not being supported by her partner and 80.5% had never spoken with a physician about CAM.Infertile Turkish women use complementary medicine frequently for fertility enhancement and are in need of information about CAM. Religious and traditional therapies are used as an adjunct to, rather than a substitute for, conventional medical therapy. Physicians need to approach fertility patients with sensitivity and should be able to council their patients about CAM accordingly. According to the World Health Organization (WHO), more than three-quarters of the world's population rely upon complementary and alternative medicine (CAM) for health care. The Cochrane Collaboration's definition of CAM is "a broad domain of healing resources that encompasses all health systems, modalities, and practices and their accompanying theories and beliefs other than those intrinsic to the politically dominant health systems of a particular society or culture in a given historical period". There has been a rise in the use of CAM as a health care option in recent years globally -4. In thCAM are commonly used in conjunction with conventional medical treatments, however information about CAM use is generally not inquired by doctors nor provided by them to their patients -21.It is assumed that infertility affects 15% of Turkish couples and an increasing number of couples seek assisted reproductive technologies (ART) to achieve parenthood. The pressure to conceive means that some women become 'desperate' to try anything to conceive. World-wide, women use CAM fore productive health, but only a limited number of studies report on CAM use to enhance fertility -24. WhilWe could not find any study in Turkey that explored the use of CAM during pregnancy or for the treatment of infertility. However, various complementary therapies, including spiritual are well known among the community in Turkey ,29, mostThe current study was planned to investigate CAM use among infertile Turkish women for the enhancement of fertility. The objective was to find out which nonmedical treatments are being used by infertile women seeking assisted reproduction treatment, and to determine accompanying characteristics.Data was gathered from women seeking knowledge about infertility treatment at a family planning centre in Van, Turkey. The Centers for Mother-Child Health and Family Planning (CFP) in Turkey offer routine care for women and children. In general, one centre exists in a city displaying a supervisory role for the health personnel from the other primary health care centers through in-service educational activities. The CFP in Van operates policlinics including gynecology, family planning counseling, and routine antenatal care. Three family physicians, two primary care physicians, six midwifes give service to the population of Van.The female population admitted to the center is homogeneous in terms of ethnicity, religion and language. All patients in our sample were born and grown up in this region, were Muslims and all were speaking Kurdish (and some spoke Turkish). According to the data of the local health administrative, a total of 238.582 women aged 15-49 were recorded, with a crude birth rate of 25.9/1000 in the year 2008. There are no data about infertility rates from this region. Including criteria of the women were being 18 years or older, born and living in Van region, and being treated with ovulation induction.A face-to-face questionnaire was undertaken with consecutive 100 infertile patients admitted to the Family Planning Centre in Van, Turkey from January to July 2009.The questionnaire was structured after preliminary discussions with patients and health professionals who were also informed by a literature review. Women, who admitted to the centre seeking information about ovulation induction, were invited to participate.In the first part, subjects were investigated regarding demographic information that was suspected to influence the patients' health-related behaviors including age, education and income level, years of infertility, gravidity, parity, household structure and locality. Questions inquiring partner support, intimate partner violence (IPV) and knowledge about CAM were also asked. In the second part, respondents were asked to mention therapies they had used expressly for the purpose of getting pregnant.All of the interviews were conducted by trained female family physicians. Interviews took place in the visit room individually and lasted approximately 20 minutes. A midwife speaking Kurdish was ready for translation.Because the study was descriptive by nature, no power analysis was performed in advance. Demographic information was not compared between those using alternative treatments and nonusers because of the insufficient number of nonusers. This study was determined to be exempt from review by the institutional review board at the University of Yuzuncu Yil. All participants gave informed consent.A total of 100 women accepted to participate the study out of 115 invited (86.0% response rate). Overall, 82% of the women had used CAM once for infertility. Mean age of these CAM users was 26.7 (range of 18 - 40 years). Mean duration of infertility was 8.0 years (7-months - 27 years). Educational and economical level was low in general. Of the women who had used CAM for infertility treatment, 87.8% was abused in the last 12 months, 36.6% felt not supported by her partner and 80.5% had never spoken with a physician about CAM stating that they sought help from faith healers (hodja's) and accepted to use several folkloric remedies recommended by them. The proportion of patients who used herbals and visited faith healers was 36.6% (30). The use of herbals alone and folkloric methods was reported by 29.3% (24) and 11.0% (9), respectively.The patterns of CAM used by the patients reflected well-known herbal medicines but local traditional remedies were also reported.Urtica dioica L.) are boiled in water and steeped for 3-5 minutes. It is consumed several times a day as a hot (tea) or cold beverage.Dried leaves or roots of nettle (Pinus nigra Arnold) and subspecies Pinus nigra ssp. caramanica [European black pine (ramanica belonginViola tricolour L.) or heartsease (Narcissus pseudonarcissus) are squeezed together to form an ovule like small pill, which are inserted to the vagina before sexual intercourse.Fresh leaves of Johnny jumpup of the female rabbit (Oryctolagus cuniculus) is cooked and eaten before sexual intercourse.hodja has a special spiritual power, acquired through inheritance (lineage) or a lifetime of devotional acts, allows him to communicate directly with God and thus act as a mediator between God and the people. Hodja's offer a number of treatments and practice traditional systems of medicine, which involves use of a variety of herbs and minerals. Amulets (tawiz), containing verses from the Koran written by hodja's are usually worn around the neck; act as a defense against evil spirits or the evil eye (nazaar). Hodja's may also give cure through their breaths by blowing his breath over the body. He also may blow water or food and then the blessed water is drunk or the food is eaten.Patients may consult to religious healers. The jinns), which must be exorcised. However, only specialist hodja's have the specific knowledge to perform exorcisms. There is a widespread belief amongst Muslims that jinns are spiritual beings - created from smokeless fire rather than the spirit of dead people - that live on earth in a world parallel to mankind. Jinns have the ability to possess and take over the minds and bodies of other creatures, including humans, and to behave in either a good or evil manner. Jinns possess people for different reasons. Most of the time possession occurs because the jinn is simply malicious and wicked.When the problem is thought to be spiritual, the hodja may diagnose possession by evil spirits to seek forgiveness of sins and alleviation of illness. At some holly places, people light candles or bind pieces of their cloths to the trees with a wish to conceive.Additional file This study shows that many infertile Turkish women are using nonmedical treatments and interventions in addition to those used in medical practice. The most prevalent intervention included items summarized as religious healing which can exert positive influences on health by contributing to a sense of hope and allowing coping with the stress of infertility treatment . People Religion has a strong influence on people's beliefs about illness and treatments resulting in acceptance of methods recommended by religious healers (hodja) without rational criticism. In our study, all of our patients were praying for cure in routine and nearly half of them had visited a faith healer (hodja) and complied with his methods, even if they were inconceivable.Spiritual healing methods are known to be used regularly for relive by Turkish patients and in tHowever, one might argue this is a true reflection of the patients' culture where prayer and spiritual believes are part of people's everyday life and may not be included in CAM.Some religious methods included in this study have never been shown to directly affect fertility, but some may indirectly influence health in a negative way. Remedies recommended by hodja such as "holly breath and foods" must be mind confusing. Methods such as exorcism could have a devastating effect on the psychological health of the patients who already are suffering emotional distress. They are based on the false belief that illness is the expression of sins that can be manipulated by some religious interventions. Generally, these interventions are sold to the patients with the promise that they can cure multiple diseases, such as infertility. All are aimed at vulnerable clients desperate for anything that promises hope.Few herbal supplements have been subjected to adequate study regarding efficacy on fertility. We found stinging nettle to be the most frequently used herbal supplement, and it is recommended for many illnesses including cancer ,37-40.A review of literature on nettle, however, does not find adequate support for its use in infertility . Nettle The use of medicinal tar for dermatological disorders dates back to the ancient times. Although coal tar is utilized more frequently in modern dermatology, wood tars have also been widely employed. Wood tars have been used in the treatment of various cutaneous disorders, including psoriasis and atopic dermatitis, and have no photosensitizing effects . An incrNo relevant information was found in the literature on the benefits of tar to infertility.Narcissus pseudonarcissus was found effective in one mouse model of nociception, para-benzoquinone induced abdominal constriction, but not in another, the hot plate test. However, at these concentrations it also caused significant toxic effects [In one scientific study, the ethanol extract of the bulbs of effects .Viola tricolor is one of many plant species containing cyclotides. These small peptides have proven to be useful in drug development due to their size and structure giving rise to high stability. One such cyclotide, vitri A, found in Viola tricolor is said to contain cytotoxic characteristics [eristics meaning For other folkloric interventions stated here, no data exist. The opinion that ingesting organs of highly reproductive animals will make conception more likely could be dating back to old times but will never be studied and are generally only of cultural interest. This is also true for the combination of wheat germ and heating the female genitourinary tract, which may exhibit a response to the cold climate of this region with long and severe winters.Given that infertility rituals are described more in less developed cultures, cultural and national influences are likely to affect the use of nonmedical treatments. The nonmedical therapies identified by this study are prevalent in this community, and may not be generalized to other cultures and time periods. Still, many of these recommendations have existed for generations, and the fact that they are still in use suggests that some must be useful or effective. Very few, however, have actually been studied for evidence of their efficacy.Studies from developing, Eastern or pronatalist countries tend to focus on society's stigmatization of infertility ,48), theFurthermore, we also documented that infertility patients were subject to IPV, which in general originates from husbands. Intimate partner violence is known to be frequent among Turkish couples, and infertile women report high rates -59. We sLiving with parents-in-law may create some emotional pressure from mothers' and fathers' in-law, which is well documented all over the world -62. MothAttributing the causes of infertility to supernatural causes such as evil spirits and God's retribution, and seeking help from faith and traditional healers may be a projection of the social stigmatization for infertile women and the strong desire for motherhood. This desire was described by infertile women as a willingness to try almost anything to maximize their chances of becoming pregnant, reflected in the variety of CAM modalities they invested in and their use of ART .The prevalence of CAM use in this sample of infertile Turkish women indicates the appropriateness of counseling these patients about CAM through evidence based knowledge. Successful programs in dealing with infertility need to include the establishment of a community based intervention strategy including primary care physicians to educate people about infertility and to give guidelines for treatment options. Because of the popularity of these non-prescription treatment methods, it is important for healthcare providers to be prepared to initiate discussions with their patients and provide counseling.This study has several limitations including the collection of data by means of the questionnaire, which introduced the threat of selection bias. The validity of the findings is dependent on the individual's memory and accuracy in reporting CAM use. The survey methodology also carries an inherent selection bias. A relatively small fraction of patients in one health facility chose to complete the survey. Women who have an interest in complementary and alternative medicines might have been more likely to take the time to complete the questionnaire. The sample in this study reflects only one area of Turkey and the findings should be limited to this population. Nevertheless, this is the first study on CAM use in fertility patients in Turkey.For the most part, nonmedical treatments in this study were irrational and possibly dangerous. Although religious interventions are of little proven benefit, they may contribute positively to infertility treatment either by giving a sense of empowerment or control or by helping to relieve some of the stress. On the other hand, some interventions may involve substantial emotional distress, such as exorcism, with no known benefit. Some herbal preparations may even have an ill effect on health and well-being. It is important that health professionals are aware of their patients' lay beliefs about illness and the CAM that they may choose. Medical personnel need to take into account the religious dimensions of the experience of infertility while caring for patients. Physicians providing care for infertile patients may therefore should inquire about such nonmedical practices and be able to counsel their patients accordingly.The authors declare that they have no competing interests.TE participated in the design of the study, acquisition and interpretation of data, helped to draft the questionnaire, and participated in writing the discussion and revised it. SGA participated in the design of the study, helped to draft the questionnaire and to discuss the results. SG conceived of the study, and participated in its design and coordination and helped to draft the manuscript. AK discussed and evaluated the results and corrected the manuscript for publication. RY helped draft the manuscript, discussed the results and participated in the revision of the study. EA evaluated the results, participated in the discussions and in the revision of the study. MC participated in the design and survey and in the revision of the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6882/10/11/prepubTable S1. Non-medical treatments used for infertility in the region of Van as reported by the participants, Turkey 2009.Click here for file

Fifty-three premenopausal patients presenting with advanced breast cancer have been treated with a potent new luteinising hormone-releasing hormone agonist Zoladex (ICI 118630) in a phase I clinical trial. On progression of disease 26 patients have undergone therapeutic oophorectomy. We present the clinical and endocrinological responses to treatment in 45 assessable patients. The response rate to Zoladex in this series was 31% and the ER status of the primary tumour was predictive of a response to the luteinising hormone-releasing hormone.

Recent identifications of associations between novel variants in inflammation-related genes and several common diseases emphasize the need for systematic evaluations of these genes in disease susceptibility. Considering that many genes are involved in the complex inflammation responses and many genetic variants in these genes have the potential to alter the functions and expression of these genes, we assembled a list of key inflammation-related genes to facilitate the identification of genetic associations of diseases with an inflammation-related etiology. We first reviewed various phases of inflammation responses, including the development of immune cells, sensing of danger, influx of cells to sites of insult, activation and functional responses of immune and non-immune cells, and resolution of the immune response. Assisted by the Ingenuity Pathway Analysis, we then identified 17 functional sub-pathways that are involved in one or multiple phases. This organization would greatly increase the chance of detecting gene-gene interactions by hierarchical clustering of genes with their functional closeness in a pathway. Finally, as an example application, we have developed tagging single nucleotide polymorphism (tSNP) arrays for populations of European and African descent to capture all the common variants of these key inflammation-related genes. Assays of these tSNPs have been designed and assembled into two Affymetrix ParAllele customized chips, one each for European and African populations. These tSNPs have greater coverage for these inflammation-related genes compared to the existing genome-wide arrays, particularly in the African population. These tSNP arrays can facilitate systematic evaluation of inflammation pathways in disease susceptibility. For additional applications, other genotyping platforms could also be employed. For existing genome-wide association data, this list of key inflammation-related genes and associated subpathways can facilitate comprehensive inflammation pathway- focused association analyses. Inflammation is an essential component of immune-mediated protection against pathogens and tissue damage. Immune responses are also responsible for the unfavorable rejection of tissue/organ transplants, hypersensitivity reactions , and septic shock. Aberrant or unchecked immune responses may lead to a state of chronic inflammation http://nihroadmap.nih.gov/inflammation/index.asp).Inflammation may also be a contributing factor for some diseases. The role of chronic inflammation in a wide variety of diseases is well-appreciated, including rheumatoid arthritis and other autoimmune disorders Cias1 account for all cases) MEFV, five founder missense mutations, when homozygous, account for 74% of cases) TNF (encoding TNF-α) and increased risk for asthma PTPN22 (encoding a lymphoid-specific protein tyrosine phosphatase) is modestly associated with multiple autoimmune diseases IRF5 (interferon regulator factor 5) genetic variants and increased SLE risk have been highly replicated IFIH1, encoding an innate immunity viral mRNA detector , is strongly associated with type 1 diabetes risk CTLA4 has been consistently replicated CARD15, the gene encoding the microbial nucleotide detector Nod2, is a major risk factor for Crohn's disease IL23R (IL-23 receptor β-chain) and increased risk of inflammatory bowel disease has been reported for a genome-wide association study and confirmed in three independent populations IL4R variant modestly increases risk for atopic asthma Numerous genetic linkage and case-control association studies have implicated genetic variations in genes important in immunity and inflammation and inflammatory diseases. Single missense heritable mutations can be the sole or major determinant for inflammatory diseases, such as Familial Cold Autoinflammatory Syndrome (missense mutations in exon 3 of CASP8 (caspase 8) and TGFB1 (TGF-β1) variants impart risk, albeit low penetrance, for breast cancer TNF may also be a low-penetrance risk factor for breast cancer PTGS2 (COX-2) genetic variants and colorectal cancer risk COX2 variant allele decreases prostate cancer risk In addition to inflammatory/autoimmune diseases, polymorphisms in inflammation-associated genes may also contribute to risk for diseases in which inflammatory/immune-disorders are not the primary characteristic. There is evidence from the Breast Cancer Association Consortium that CFH (complement factor H) and age-related macular degeneration have been replicated in numerous studies CFH risk allele. Significant associations were detected for a C7 and MBL2 variants and severity of macular degeneration in the context of the complement pathway analysis and the CHF risk allele, and these associations would not have been significant in a genome-wide analysis of the data.Because genetic associations of disease and genetic variations in inflammatory genes are often relatively modest, it is likely that polymorphisms in multiple inflammatory genes cooperate in an additive or synergistic manner to impact disease risk. Pathway analyses may help to reveal gene-gene interactions or risks imparted independently from other genes in the pathway. The advantages of performing analyses at pathway levels are illustrated by Dinu et al. phases of immune responses were considered in choosing genes for the SNP array panel, outlined in Various aspects of immunity contribute to the development of an overall inflammatory immune response. These phases include the development of immune cells, sensing of danger, influx of cells to sites of insult, activation and functional responses of immune and non-immune cells, and resolution of the immune response. To broadly cover most aspects of inflammatory responses, the various Priority was given first to genes of known function in inflammatory responses (in both immune and non-immune cells), and then to genes expressed in immune cells with function implied by homology to other genes but exact function not clear. Ubiquitously expressed genes required for the normal function of most cell types of diverse origin were given lower priority. However, special emphasis was placed on genes at nodes for signaling to and from multiple pathways, most notably genes in NF-κB, MAPK, and PI3K signaling pathways.Pathways were built using Ingenuity Pathways Analysis, as described in danger signal during a gram-negative bacterial infection involves innate pathogen recognition of LPS by the TLR4 complex. TLR4 transduces signals via NF-κB, MAPK, and PI3K signaling pathways, stimulating synthesis of eicosanoids and cytokines to signal other cells of the danger. LPS may also stimulate expression of stress-induced proteins, such as MIC-A and MIC-B and T cell co-stimulatory molecules (B7 family proteins).Multiple functional pathways are involved each of the immune response phases, and each functional pathway may contribute to several of the immune response phases. For example Fig. 2, functional pathways:Because immune response phases utilize multiple functional pathways and these pathways are overlapping among phases, the genes chosen for the SNP array panel were assigned to one of the following Adhesion-Extravasation-Migration: adhesion molecules; chemoattractants and chemoattractant receptors; cytoskeletal rearrangement signaling, motility proteins.Apoptosis signaling: death receptors and ligands and extrinsic apoptosis pathway signaling; mitochondrial-dependent, intrinsic apoptosis pathway signaling; cellular stress signaling.Calcium signaling: NF-ATs; calcineurins; calcium/calmodulin-dependent kinases.Complement cascade: components of classical, alternative, and lectin-dependent complement pathways.Cytokines and cytokine signaling: cytokines; cytokine receptors; cytokine-dependent signaling, including JAK-STAT and interferon-regulatory factor (IRF) pathways; suppressor of cytokine signaling proteins (SOCS).Eicosanoid synthesis and receptors: enzymes involved in synthesis of prostanoids, leukotrienes, hepoxylins (12-HETE), and lipoxins from arachidonic acid; prostanoid and leukotriene receptors.Glucocorticoid/PPAR signaling: nuclear receptors for glucocorticoids; steroid-interacting proteins; PPARs and associated proteins.G-Protein Coupled Receptor Signaling: GPCRs (other than eicosanoid receptors and chemokine receptors); G-protein-dependent signaling pathways, including cAMP-PKA and phospholipase B2.Innate pathogen detection: Toll-like receptors (TLRs); intracellular nucleotide detectors ; peptidoglycan recognition proteins; associated signaling molecules linking these detectors to major signaling pathways.Leukocyte signaling: Signaling molecules, receptors, and adaptors important for regulation of leukocyte activation beyond major signaling pathways ; including, but not limited to, T cell receptor (TCR) and B cell receptor (BCR) signaling components, B7 family, phosphatases, Foxp3, immunoglobulin receptors, leukocyte inhibitory receptor (CD85) family, scavenger receptors.MAPK signaling: p38 stress-activated protein kinase, p42/p44 extracellular-regulated kinase (Erk), and Jun kinase (Jnk) signaling pathways.Natural Killer Cell Signaling: Natural killer (NK) cell-specific activating and inhibitory receptors; adaptors and signaling molecules for transducing NK cell-specific receptor signaling.NF-kB signaling: Molecules for regulation of NF-κB activation, including adaptors linking. other pathways to and from the NF-κB pathway .Antigen presentation: Major Histocompatibility Complex (MHC) molecules and associated proteins; proteins involved in uptake, processing, and loading of peptides on MHC molecules.PI3K/AKT Signaling: Molecules involved in regulation of PI3K-dependent signaling, including adaptors linking other pathways to and from the PI3K pathway.ROS/glutathione/cytotoxic granules: Molecules involved in the generation and response to leukocyte-derived cytotoxic agents (reactive oxygen species (ROS), nitric oxide, cytotoxic granules of granulocytes and natural killer cells), including contents of granulocyte and NK cell cytotoxic granules; glutathione peroxidases; peroxiredoxins; catalase; proteinases; superoxide dismutase.TNF superfamily and signaling: Receptors and ligands of the TNF-α superfamily; adaptors and signaling molecules involved in transducing signals from receptor stimulation to other major signaling pathways .Supplementary Table S1.Examples of the functional subpathways and types of genes chosen for the different phases of immune responses are presented in a priori evidence it is difficult to choose a handful of candidate genes to fully cover the potential genetic risk factors contributing to the inflammatory component of a particular disease. For this reason, panels of single nucleotide polymorphisms (SNPs) in an array of inflammation-related genes broadly covering most aspects of immunity and inflammation based on our assembled list will be critical in objectively evaluating the impact of genetic variations in inflammation-related genes on an inflammation-dependent outcome.Because the components comprising inflammation are very numerous and interacting across many pathways, without strong http://www.affymetrix.com/support/technical/datasheets/humanimmune_9k_snp_datasheet.pdf). However, the rationale for choosing the ∼1,000 immunity and inflammation genes in this panel is not clear, and the coverage of these genes, regardless of their biological functions, may not be sufficient. In order to investigate the impact of genetic variations in a broad array of inflammation-related genes on disease risk, we created two tagging SNP (tSNP) panels, one each for populations with either Caucasian or African ancestries, for Affimetrix ParAllele genotyping chips. These tSNP panels were designed to capture majority of the genetic variations in these 1027 inflammation candidate genes.There is a commercially available product, Affymetrix GeneChip® Human Immune and Inflammation 9K SNP panel, that attempts to serve the purpose. This application -specific panel contains ∼9,000 SNPs to cover ∼1,000 immunity- and inflammation- related genes . tSNPs were chosen separately for the CEU (representing European ancestry) and YRI populations (representing African ancestry). In order to accommodate as many relevant inflammation genes as possible, less stringent criteria with r2 threshold >0.5 were employed for intronic regions (excluding 5kb in the beginning and end of these big introns) greater than 50kb in certain large genes with >100 tSNPs. There were seven genes in this category, and the intronic regions for which a less stringent r2 threshold was applied are listed in Supplementary Table S2. For genes without genotype information from HapMap, additional SNPs in six inflammation genes were chosen to be included based on information from other resources (see Supplementary Table S3), as described in tSNPs for the 1027 inflammation-associated candidate genes were chosen based on a pair-wise rSupplementary Table S1 . Additionally, the annotation file for the SNPs included in the WFINFLAM-CEU and WFINFLAM-YRI panels, including the chromosomal locations, their associated genes and the sub-pathways, can also be found in Supplementary S5 (and our website: http://www1.wfubmc.edu/Genomics/PublicationsandData/). The coverage for the 1027 inflammation candidate genes in CEU is better compared to other widely used genome-wide association panels. For the coverage of the 1027 inflammation-associated candidate genes, 90.4% of the genes have 90% or more SNPs within these genes that can be captured by r2≥0.8 in CEU using WFINFLAM-CEU panel, compared to 78.9% for the Illumina HumanHap 550 genome-wide panel and 45.8% for the Affymetrix 500k genome-wide panel. For populations with African ancestry, the coverage for the 1027 inflammation candidate genes in YRI is greatly improved compared to other widely used genome-wide association panels. For the coverage of the 1027 inflammation-associated candidate genes, 88.2% of the genes have 90% or more SNPs within these genes that can be captured by r2≥0.8 in YRI using WFINFLAM-YRI panel, compared to 27.1% for the Illumina HumanHap 650k genome-wide panel (which was designed to capture more genetic information from YRI population), and 12.5% for the Affymetrix 500k genome-wide panel. The coverage for all these genotyping panels is detailed in Supplementary Table S6.The resulting inflammation tSNP panels, WFINFLAM-CEU for Caucasians and WFINFLAM-YRI for African descent, include 12,011 SNPs and 21,542 SNPs respectively in 1027 inflammation-associated candidate genes. There is an average of 11.7 and 21 SNPs in each candidate gene in WFINFLAM-CEU and WFINFLAM-YRI panels, respectively. Various components and complex interactions comprise immune and inflammation responses, and numerous genes are involved in this complex network. With a thorough review of various aspects of inflammatory immune responses, and a systematic search for gene-gene interactions using Ingenuity Pathway Analysis, we have provided a comprehensive list of inflammation-associated genes and subpathways for genetic association studies.Genome-wide association studies have been a very popular approach to test the association between disease phenotypes and genetic variations. However, we believe there are still several advantages for a pathway-focused study. First of all, compared to whole-genome analyses, restricting analyses to SNPs in a specific pathway reduces the number of multiple tests performed in the analysis of a study population, thereby reducing the probability of false positive associations and increasing the effective power of the study. This kind of study design is particularly effective when inflammation plays an important role in disease etiology and the goal of the studies is to delineate genetic variations in inflammation pathway to disease risk and/or progression. A related second advantage of restricted pathway analysis is in study design. A large proportion of investigators may not have access to the very large number of subjects and multiple confirmation populations needed to overcome false positive associations due to multiple testing in genome-wide association studies. Studies restricted to a pathway analysis permit the use of study populations that are not large enough for use in whole-genome association studies. When target diseases are not prevalent and inflammation is obviously involved in disease etiology, researchers will gain the most out of an inflammation pathway-specific study design. Although some genes not related to inflammation found in whole-genome panels may impart some risk to inflammation-associated diseases, associated genetic variants would be anticipated to be concentrated in a panel of SNPs in inflammation-associated genes. Therefore, the drawback of potentially missing associated non-inflammation genes is offset by the increased probability of detecting true associations in an inflammation-restricted panel. Thirdly, pathway analysis is far less expensive to perform than whole-genome analysis, especially considering the cost for second, and/or third stage confirmation studies needed to follow-up the significant results from an initial screening in order to rule out false positive associations. Lastly, the functional subpathways are also pre-defined with available biological information. This refined information provides investigators with the opportunity to test gene-gene interactions within subpathways in which synergistic interactions are more likely to be concentrated. Additionally, the interplays between subpathways are also clearly defined to enable investigators to test biologically feasible interactions between subpathways.a priori before beginning the study.However, the results from this manuscript also have potential utility for investigators who have more interests in surveying the whole genome. For whole-genome analyses where there is a prior hypothesis for inflammation being associated with the outcome, the inflammation pathway and subpathways defined in this manuscript may provide a framework for testing whether SNPs in the inflammation pathway or subpathways as a whole are overrepresented for significant associations to the outcome. Although pathway networks can be constructed for whole-genome analyses, such networks should be designed 2 based method, for choosing SNPs based on the inflammatory gene list provided here could also be considered. For example, researchers may specifically focus on “high-prior” polymorphisms that are known to be functional or have been previously linked to the specific diseases under study, alone or in combination with the tSNPs provided in the WFINFLAM panel. This approach may be more efficient and powerful than the r2 based method alone, especially if the targeted “high-prior” polymorphisms are causal and their linkage to the nearby tSNPs is incomplete.The WFINFLAM and WFINFLAM-YRI SNP array panels for inflammation-associated genes provide a powerful tool for analyzing the contribution of genetic variation in diseases that have inflammatory components. Although whole-genome SNP panels are currently available that include almost all of the genes included in the WFINFLAM panels, the coverage of SNPs in genes included in the WFINFLAM array is superior to the coverage of currently available in whole-genome arrays, especially for populations with African ancestry background. For researchers who would like to use other genotyping platforms, the inflammatory gene list provided here would be a good starting point for designing genotyping assays for other platforms. Additionally, alternate approaches, other than rIn addition, precaution may be warranted for tSNP panels designed based on the HapMap project. The transferability of the LD patterns between populations studied in HapMap project and other study populations may need to be validated. The transferability of HapMap-based selection of tSNPs using the reference CEU population to several other diverse populations of European ancestry has been demonstrated to be almost as effective for overall SNP coverage in selected genomic regions or randomly selected SNPs in the respective populations In summary, pathway analysis of inflammation-associated genes is a powerful approach for determining genetic risk factors for both inflammatory diseases and other diseases that may have an under-appreciated modest inflammatory component, such as cancers. The inflammation pathway gene list and functionally-defined subpathways provide useful tools for assessing the impact of genetic variations in inflammation pathways on disease risk, in situations where either pathway-focused studies or genome-wide analyses are employed.Results and www.analysis.ingenuity.com). Both pre-defined ‘canonical pathways’ and custom-built pathways based on our own queries for genes/pathways not included in the canonical pathways were used to establish these networks. Canonical pathways included: actin cytoskeleton signaling; antigen presentation pathway; apoptosis signaling; B cell receptor signaling; calcium signaling; cAMP signaling; chemokine signaling; complement and coagulation cascade; death receptor signaling; ERK/MAPK signaling; FcEpsilon receptor signaling; G-coupled protein receptor signaling; GM-CSF signaling; IGF-1 signaling; IL-10 signaling; IL-2 signaling; IL-4 signaling; IL-6 signaling; integrin signaling; interferon signaling; JAK/STAT signaling; leukocyte extravasation signaling; natural killer cell signaling; NF-kB signaling; nitric oxide signaling; notch signaling; p38 MAPK signaling; PI3K/Akt signaling; PPAR signaling; protein ubiquination pathway; PTEN signaling; SPK/JNK signaling; T cell receptor signaling; TGF-β signaling; Toll-like receptor signaling.Networks of genes involved in the regulation of the phases of immune responses ;adding additional genes to bridge networks within a subpathway and to include appropriate genes not included in the canonical pathways ;trimming the networks of genes with low priority for inclusion in the inflammation panel. Genes with lower priority include: genes not expressed in immune cells or not directly involved in cells responding to inflammation, including non-immune cells ; genes with unknown function, though genes with high homology to known inflammatory mediators were considered . Special emphasis was placed on genes at nodes for signaling to and from multiple pathways, most notably genes in NF-κB, MAPK, and PI3K signaling pathways.http://www.broad.mit.edu/mpg/tagger/server.html). The target sequences included genomic regions containing the entire candidate genes, 5kb before transcription start site, and 2kb after the transcription end site, based on annotation in NCBI Build 35. When candidate regions for two or more genes overlapped, the combined genomic regions were used for choosing tSNPs. Two separate lists of non-synonymous coding SNPs for the CEPH population (CEU) and for the Yuruba population (YRI) were downloaded from HapMap (rel21a_NCBI_Build35) and forced in as tagging SNPs for ancestry-specific panels. Pair-wise r2 threshold of 0.8 and MAF≥5% were used. For genes without genotype information from HapMap, SNPs in Affymetrix 500k array, as well as SNPs with frequency data from the Innate Immunity PGA (IIPGA) (http://innateimmunity.net/), were manually chosen to be included in the list based on allele frequencies and inter-SNP distance . Some tSNPs were dropped out from the final list because they did not pass the Affymetrix design review due to the following reasons: non-biallelic SNPs, existing SNPs or ambiguous bases too close to the SNP of interest, SNPs exceeding Tm ranges, or SNPs failing BLAST searches. In the attempt to fill in the gaps due to tSNPs failing design criteria, tSNPs for genes with dropped-out tSNPs were chosen again by forcing out the tSNPs failing design review and forcing in the remaining tSNPs when running Tagger. In total, there are 12,011 SNPs in WFINFLAM panel for Caucasians and 21,542 SNPs in WFINFLAM-YRI for African descents in 1027 inflammation-associated candidate genes that passed the Affymetrix design review.Tagging SNPs (tSNPs) for candidate genes were chosen using Tagger server (http://www.affymetrix.com/support/developer/tools/devnettools.affx) to estimate the coverage of the 1027 inflammation-associated candidate genes with both WFINFLAM panel for Caucasians and WFINFLAM-YRI panel for African descents. We have also computed the coverage of several commercial genotyping arrays, including Affymetrix Mapping 500K, Illumina HumanHap 550 and HumanHap 650, for these 1027 genes. Single-marker coverage (pairwise r2) and multiple-marker coverage (multiple-marker r2) were computed and combined to estimate the coverage for the genomic regions containing the entire candidate genes, 5kb before transcription start site, and 2kb after the transcription end site. The summary for the coverage for these genes in all these genotyping panels are detailed in Table S6.We used LdCompare Click here for additional data file.Table S2Genes with big intronic regions(0.06 MB XLS)Click here for additional data file.Table S3SNPs chosen for the six genes without HapMap genotyping data(0.04 MB XLS)Click here for additional data file.Table S4Annotation for tSNPs in WFINFLAM_CEU panel(1.64 MB XLS)Click here for additional data file.Table S5Annotation for tSNPs in WFINFLAM_YRI panel(3.39 MB XLS)Click here for additional data file.Table S6Summary for gene coverage of Wfinflam panels and other genome wide association panels(0.04 MB XLS)Click here for additional data file.

Integrated vector management for malaria control has received a lot of recent interest. Attacking multiple points in the transmission cycle is hoped to act synergistically and improve upon current single-tool interventions based on the use of insecticide-treated bed nets (ITNs). In the present study, we theoretically examined the application of larval habitat source reduction with ITNs in reducing malaria transmission. We selected this type of environmental management to complement ITNs because of a potential secondary mode of action that both control strategies share. In addition to increasing vector mortality, ITNs reduce the rate at which female mosquitoes locate human hosts for blood feeding, thereby extending their gonotrophic cycle. Similarly, while reducing adult vector emergence and abundance, source reduction of larval habitats may prolong the cycle duration by extending delays in locating oviposition sites. We found, however, that source reduction of larval habitats only operates through this secondary mode of action when habitat density is below a critical threshold. Hence, we illustrate how this strategy becomes increasingly effective when larval habitats are limited. We also demonstrate that habitat source reduction is better suited to human populations of higher density and in the presence of insecticide resistance or when the insecticidal properties of ITNs are depleted. Vector management is the primary means of malaria prevention and control in Africa There are, however, limitations to ITNs as a stand-alone strategy for malaria control. Insecticidal properties of ITNs have been shown to diminish considerably after just 6 months of use Larval habitat source reduction is expected to impact the transmission of malaria on multiple fronts. In addition to reducing the growth potential of the mosquito population, larval habitat source management will reduce the rate at which gravid females will encounter oviposition sites. This is an important point first raised by Killeen et al. (2004) who accounted for this additional delay in their model by reducing the average daily human bite rate of mosquitoes. In their study, multiple vector management scenarios were assessed including water management, larvicide application, physical domestic protection and zooprophylaxis, and it was concluded that all measures in combination are 100 fold more effective in reducing malaria transmission than any single measure used in isolation Anopheles gambiae Giles sensu stricto, which is almost exclusively anthropophilic In the present study, we model both the separate and combined impact of larval habitat source reduction and ITNs on reducing malaria transmission. We focus on the primary vector of malaria in Africa, Anopheles gambiae mosquitoes need human blood meals for egg production and larval habitats for oviposition. Therefore, human blood meals and larval habitats are considered important resources for the mosquitoes. Intuitively, as resources become more available, delays in the gonotrophic cycle (G) resulting from the finite searching ability of the mosquito (s) are reduced . An interesting finding illustrated in θ) does not confer any additional reduction in the delay in the gonotrophic cycle. At this point, the duration of embryogenesis exceeds the delay in locating breeding sites ε) summed with the delay in locating the blood meal (σ is human host density).0R due to its effect on the gonotrophic cycle duration. Consequently, reduction of 0R is far more rapid when habitat source availability is lower. This makes biological sense; eliminating breeding sites has a proportionally greater impact when locating them becomes a rate-determining step in the mosquito's gonotrophic cycle.When larval habitats are abundant, habitat source reduction has a nearly linear effect on the basic reproductive number of malaria under our assumptions . Such an0R through a decreased mosquito to human ratio, m, is maximally countered by the increased 0R through decreased G . Interrupting malaria transmission is shown to be more amenable for human populations of lower densities. Incomplete killing by the insecticides due to bed net deterioration (or resistance in the mosquito population) results in a requirement for greater bed net coverage. For example, when human density is high and the ITNs are only 40% effective, approximately 75% coverage is necessary for 0R to be driven below 1 in human settlements of medium-to-high density. At this point and beyond, our analysis shows that the target of an 80% bed net coverage rate as proposed by the WHO's Roll Back Malaria program is insufficient to eliminate local malaria transmission. Of additional concern are studies such as Arredondo-Jiménez et al. (1997) which have found in the case of Anopheles albimanus that quite a high proportion of female mosquitoes (up to nearly 40%) could secure a bloodmeal from people sleeping under a bednet c, is multiplied by a maximum protection threshold) we show in the supplementary material but they also incur a delay in securing a blood meal (decreasing 0R). Whether or not the overall effect is an increase or decrease in 0R is dependent on the human density. Only at a low human density, will the increased bite rate experienced by the non-users of bed nets be negated by the increased delay in the mosquito seeking a blood meal. Hence, this undesirable effect is only experienced when the human population density exceeds the optimal level portrayed in This potentially undesirable effect is explained by the relationship between 0R occurs more readily as mosquitoes that are better searchers are simulated. For example, while an increased 0R cannot occur in medium density human populations when the mosquitoes are poor searchers, it can occur when mosquitoes have increased search ability. This is because the optimal human density for disease persistence is reduced as a function of the increased mosquito search ability (see Equation 3).0R is reduced more effectively by increasing bed net coverage than by attempting to complement ITNs with environmental management. This is illustrated by the more pronounced decrease in 0R generally seen with increased ITN coverage (across the x-axis) than with increased habitat destruction (up the y-axis) in 0R below 1.0R when breeding sites are naturally at a density that is low enough to impose a delay in the mosquito's gonotrophic cycle. Very little benefit arises through integrating larval habitat resource reduction with ITNs when mosquito breeding sites are at a naturally high level. The greatest benefit of integrating these vector management tools is therefore when the insecticidal efficiency of bed nets is notably compromised and when the larval habitats are at a naturally low level.0R by decreasing mosquito growth potential and extending the gonotrophic cycle duration 0R have a more complicated relationship than previously reported. We split the gonotrophic cycle into three components: the time required for mosquitoes to secure a blood meal, the embryo maturation duration and the delay in locating a larval habitat for oviposition. We show how a synergistic benefit in reducing 0R through habitat source management is only applicable when larval habitats are so sparse as to delay oviposition for longer than the duration of embryogenesis. In other words, for oviposition to become a rate-determining step in the gonotrophic cycle, gravid Anopheles gambiae s.s. mosquitoes would have to take more than (in the order of) 3 days to seek out breeding sites.Here, we described the conditions under which habitat source availability might be expected to significantly impact the risk of malaria epidemics. It has been suggested that larval habitat management acts multiplicatively in reducing We also examined the relationship between the gonotrophic cycle and the availability of human blood meals. While it is generally acknowledged that malaria control initiatives ought to be adapted to specific locations with regards to endemicity One mode of action of ITNs is that they reduce the availability of human hosts for blood feeding and the mosquito spends more time locating a blood meal as a consequence. Although it is generally acknowledged that bed nets therefore benefit the whole community and not just the users 0R relative to homogenous mixing. Recently, Smith et al. 0R may underestimate by as much as ten-fold. Again, the search capability of An. gambiae–an aspect of vector ecology for which data is almost completely absent - has a marked impact on the likelihood of this occurrence. Quantifying the potential of this threat is therefore not possible until mosquito searching ability is better understood. Once details of this behavior are known, it might be prudent to allow for two separate variables in denoting ovipositional searching and host searching. The formulation of our model could easily allow for this future adaptation.Concern for this detrimental effect was first voiced decades ago There is concern that ITN use will decrease in time as the community experiences initial alleviation from malaria morbidity 0R resulted. It was hoped that as both measures might be expected to reduce the bite rate We show interesting results for integrating habitat management with ITNs where, in general, only minor improvements in reducing Our findings suggest that habitat source reduction would be of greatest use as a supplementary tool for malaria transmission reduction when it can be achieved to such a level that ovipositional searching becomes rate-determining in the gonotrophic cycle. Hence, environmental management is expected to be of greatest benefit when larval habitats are naturally scarce. Additionally, combining both strategies is more effective when human populations are higher and when the killing-efficacy of the bed nets is significantly compromised.As with other theoretical studies, in order to present transparent relationships between outcomes and causes we have had to simplify the system significantly. There are numerous aspects that we feel warrant further analysis. The gonotrophic cycle duration is not only affected by resource density, but by multiple biotic and abiotic factors. Combining the effects of the local microclimate 0R. With a minor modification to the model of Macdonald (1957), 0R is expressed as:We modeled the effects of larval habitat source reduction and the use of ITNs on the basic reproductive rate of malaria, m is the ratio of mosquitoes to people, μ is the force of mosquito mortality T is the extrinsic incubation period of malaria, r is the recovery rate and G is the average length of the gonotrophic cycle. μ can be estimated by −ln(P), where P is the daily mosquito survival rate G replaces T in the exponential term of the nominator i.e. the female mosquito must survive the gonotrophic cycle period as well as the extrinsic incubation period of malaria before it can make a secondary, infectious bite. All parameters used in the present study are defined in Here, 0R through both the ratio of mosquitoes to humans (m) and the gonotropic cycle duration (G) variables. If we assume that 1) larval habitat distribution is random, 2) all habitats are equivalently suitable, 3) gravid female mosquitoes randomly select larval habitats for oviposition, and 4) the relationship between larval habitat abundance and adult mosquito abundance is linear, we expect the larval habitat source reduction will reduce m proportionally with the rate of habitat source reduction, and the gonotrophic cycle duration will increase as the gravid mosquito takes longer to locate oviposition sites. Assuming that females seek out potential oviposition sites while the embryos develop, this searching behavior only becomes rate-determining in the gonotrophic cycle if it exceeds the delay incurred by embryogenesis. Therefore, the average length of the gonotrophic cycle (G) is calculated as:Larval habitat source reduction decreases ε is mosquito embryo development duration, s is mosquito searching ability, σ is human density, and θ is larval habitat density. This expression differs from previous studies Where 0R through both the m and G terms, the human population density affects 0R through two opposing mechanisms: 0R is decreased for settlements of high human density through a decreased m, however, it is increased through the G term. Under the condition that G<T, the optimal human density for the persistence of malaria, σ*, can be calculated:While reducing the number of breeding sites reduces is assumed to take 3 days r) is the reciprocal of the average human infectious period (100 days). Mosquito daily survival rate (P) was estimated to be 0.85 T) is assumed to be 14 days. Analysis was performed on the effects of larval resource management and ITNs both independently and in conjunction across a broad range of base-line human and breeding site densities and for mosquitoes of varying resource-searching abilities .Parameters values which are typical of malaria-endemic settings in Africa were used. Appendix S1The calculation of optimal human density(0.05 MB DOC)Click here for additional data file.Figure S1R0 of malaria relative to the coverage and mosquito killing efficiency (ω) of ITNs. In the top-right of the plots is the maximum extent by which mosquito-human contact is eliminated by bed net protection . For example, ‘0.6’ indicates that sleeping under an ITN only reduces the person's chances of being bitten by 60%. (0.05 MB TIF)Click here for additional data file.

Both the phosphine and arsine ligands are equatorial with respect to the Ru3 triangle. Additionally, each Ru atom carries one equatorial and two axial terminal carbonyl ligands. The three phenyl rings of the phosphine make dihedral angles of 86.89 (19), 82.1 (2) and 63.0 (2)° with each other. The dihedral angles between the two phenyl rings are 73.8 (2) and 82.2 (3)° for the two diphenyl­arsino groups. An intra­molecular C—H⋯O hydrogen bond stabilizes the mol­ecular structure. In the crystal packing, mol­ecules are linked into chains down the b axis via inter­molecular C—H⋯O hydrogen bonds.In the title DOI: 10.1107/S1600536809049940/sj2681Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

In branch retinal vein occlusion (BRVO), abnormal arteriovenous crossing with vein compression, degenerative changes of the vessel wall and abnormal hematological factors constitute the primary mechanism of vessel occlusion. In general, BRVO has a good prognosis: 50–60% of eyes are reported to have a final visual acuity (VA) of 20/40 or better even without treatment. One important prognostic factor for final VA appears to be the initial VA. Grid laser photocoagulation is an established treatment for macular edema in a particular group of patients with BRVO, while promising results for this condition are shown by intravitreal application of steroids or new vascular endothelial growth factor inhibitors. Vitrectomy with or without arteriovenous sheathotomy combined with removal of the internal limiting membrane may improve vision in eyes with macular edema which are unresponsive to or ineligible for laser treatment. Eligible studies were identified through a comprehensive literature search of electronic databases . Additional articles were selected from review of the reference lists of the articles generated from the above search. The following keywords and combinations of these words were used in compiling the search: branch retinal vein occlusion, retinal circulatory disorders, pathogenesis, hematological disorders, risk factors, therapy methods, visual prognosis. In total, 150 of these were used for this mini-review.,Retinal vein occlusion (RVO) is the second most common retinal vascular disorder after diabetic retinopathy and is a significant cause of visual handicap. Its prevalence has been shown to vary from 0.7% to 1.6%.1,7,4The first case of BRVO was reported by Leber in 1877.4The pathogenesis of RVO is multifactorial while BRVO may be due to a combination of three primary mechanisms: compression of the vein at the arteriovenous (A/V) crossing, degenerative changes of the vessel wall, and abnormal hematological factors. In the following sections these factors are discussed.Koyanagi in 192812,A number of studies have investigated the histological changes of vessel wall at the A/V crossing.14,2,12,17Systemic hypertension, diabetes mellitus, atherosclerosis, and smoking are reported to be more common in patients with RVO.1,Some studies have revealed an association between BRVO and hyperviscosity due to high hemotocrit.18–30–35,21Protein C is serine proteinase whose activated form is a potent inhibitor of coagulation factors V and VIII.24,26,34,37–40In recent studies of patients with RVO, no significant association with a deficiency of antithrombin or with prothrombin mutation was found.21Antiphospholipid antibodies (APA) consist of a heterogeneous group of immunoglobulins, mainly anti-cardiolipin antibodies (ACA) and lupus anticoagulants (LA). Circulating APA leads to a hypercoagulable state and recurrent thrombosis through thrombocyte activation and inhibition of the natural anticoagulant pathways by binding of membrane phospholipids. Both the presence of LA and increased level of ACA are associated with a 3- to 10-fold increased risk of venous thrombosis.41,An elevated level of the amino acid, homocysteine is now generally accepted to be a risk factor for systemic vascular disease.21,51,The development of macular edema (ME) followed by BRVO has been hypothesized to be caused by fluid flux from vessels to tissue according to Starling's law,47In general, diagnosis of BRVO is not a problem owing to its classical features. Major BRVO can be asymptomatic or with visual blurring usually involving the sector of visual field corresponding to the area of the retina involved. In macular BRVO, there is always a central visual disturbance with normal peripheral vision. Acute BRVO presents characteristic clinical features with flame-shaped, dot and blot hemorrhage, soft and hard exudates, retinal edema, and dilated, tortuous vein in a segmental distribution. Signs of old occlusion are vascular sheathing and venous collaterals. The diagnosis is based on clinical examination under slit lamp and fundoscopy in artificial mydriasis. VA is of great importance for future visual prognosis. BRVO often leads to retinal non-perfusion zones in the occlusion area. Fluorescein angiography is particularly useful in determining the extent of ME and ischemia, although the ischemic areas are often obscured by the presence of intraretinal hemorrhage. Retinal neovascularization occurs in 36% of eyes with an area of non-perfusion greater than 5 disc diameter.54RVO is associated with an increase in vascular causes of death in large prospective follow-up studies.–56–54,58,57,The visual outcome following the natural course of BRVO is well documented.56,56,58,64–p < 0.05). Our analysis shows that in eyes with an initial VA 20/50 or better, the visual prognosis is good even without treatment. It could also be concluded that the cases of BRVO with an initial VA of 20/200 or worse have a statistically significantly poorer visual prognosis than those with an initial VA of 20/50 or better. Subramanian et al.VA is a very sensitive indicator of the oxygen situation in the macula. For this reason, pre-treatment VA may be an important prognostic factor. Six studies analyzing the relation between initial and final VA were found.53Current treatment options focus on the sequelae of the occluded venous branch, such as ME, retinal neovascularization, vitreous hemorrhage, and traction retinal detachment. There have been a number of treatment modalities advocated for the management of BRVO . Many stSystemic treatment with oral acetylsalicylic acid, subcutaneous heparin, or intravenous thrombolysis have not been shown to be effective treatments for CRVO, while for BRVO no randomized clinical trials have been published as of the date of this review. Thrombolysis using administration of tissue plasminogen activator intravitreally or directly into the retinal vein has been demonstrated to improve VA in patients with CRVO,Houtsmuller et al.,Troxerutin has been suggested to inhibit erythrocyte and platelet aggregation and to improve erythrocyte deformability, thus reducing blood viscosity and the retinal microcirculation.Both studies mentioned that investigated the medical treatment of BRVO are limited by a small sample size and short follow-up period (6 and 4 months).p = 0.03). Patients with ME and a VA 20/40 or worse underwent 3 months after including into the study macular grid laser photocoagulation (MLG). Sector photocoagulation was applied if ocular neovascularization developed or if, at 3 months, the fluorescein angiogram showed an area of capillary non-perfusion greater than 5 disc areas. 28% of the hemodiluted patients required MLG compared to 44% of the control group; this difference was not statistically significant (p = 0.2). Sector photocoagulation was required by 50% of both groups of patients.20Chen et al.n = 10), hemodilution combined with heparin for 21 days (n = 10), or heparin treatment for 21 days followed by anti-vitamin K drugs for a further 30 days (n = 5). The study showed that, for those receiving heparin followed by anti-vitamin K drugs, mean VA remained unchanged to baseline values by 60 days. For those treated with hemodilution and heparin, a statistically significant increase in VA was found by 60 days. For those treated with hemodilution alone, a significant improvement in VA was found by day 14. In a randomized study by Hansen et al.p < 0.005). Reported complications of hemodilution include headache, exertional dyspnea, tiredness, deep vein thrombosis, and hypotension. The treatment was noted to be generally well-tolerated even in elderly patients.20,73,74Hydroxyethylstarch has a capacity to expand the plasma volume by up to 172% of the volume infused and has a duration of action of approximately 36 hours.The use of hemodilution to treat BRVO is currently not generally accepted. Interpretation of the above-mentioned studies is difficult because most of them incorporated other treatments in combination with the hemodilution. Further prospective randomized trials with adequate controls and sufficient follow-up are required for any definitive conclusions and recommendations.–75–77,80,97,Osterloh and Charles75–p = 0.003). In patients treated by TA, VA improved significantly, from 0.82 at baseline to 0.23 at 9 months after injection (p = 0.04). VA in the group of patients treated by MLG remained the same. The results of this study are limited, however, owing to the different ME etiologies in evaluated patients; only 6 patients had ME secondary to BRVO. Oh et al.p < 0.001) from 1.01 at baseline to 0.55 at one month after the injection. VA after 3 months was 0.56, and at the end of follow-up was 0.62. The authors concluded that intravitreal application of TA may be helpful in patients who do not respond to laser photocoagulation. However, in published studies, the resulting reduced macular thickness and improved VA, is only temporary and requires repeated treatment. One to four times re-application has been reported. Cekic et al.119,In several nonrandomized comparative studies, intravitreal corticosteroids were successfully used for the treatment of BRVO. Currently published randomized studies are very rare and limited by virtue of evaluating patients with ME of different etiology, making comparisons difficult. In various studied doses from 4 to 25 mg, triamcinolone acetonide (TA) has been reported to be effective99https://web.emmes.com/study/score). In each of the two disease areas, 630 participants will be randomized in a 1:1:1 ratio to one of three groups: standard care, intravitreal 4 mg of TA, or 1 mg of TA. The follow-up is planned for 3 years. The results are not published as yet. Biodegradable intravitreal implants may allow steroid delivery over a more sustained period, permitting longer duration of action. A multicenter randomized clinical trial which evaluates implantation of dexamethasone 350 μg or 700 μg (Posurdex) versus observation (no therapy) for ME secondary to a variety of retinal disorders (including BRVO) has been reported.p < 0.001 versus 700 μg group; p = 0.04 versus 350 μg group). The results were similar for patients with diabetic retinopathy, retinal vein occlusion, or uveitis or Irvine-Gass syndrome. In total, 60 patients with BRVO were randomized 1:1:1 to receive 350 μg or 700 μg dexamethasone or observation (no therapy). In the case of RVO, the effect of the treatment was evaluated only in a common group (CRVO and BRVO patients together): an improvement in VA of 10 letters or more was achieved in 15% of untreated patients versus 31% of patients treated with dexamethasone 700 μg. The number of patients with an increase in intraocular pressure of more than 10 mmHg from baseline anytime during the study was 12% for 350 μg, 17% for 700 μg, and 3% for the untreated controls.117Most published studies on intravitreal TA for BRVO, however, suffer from two serious flaws: either the designs are not randomized or they often do not clearly differentiate between nonischemic types and ischemic types of occlusion. To compare the effectiveness and safety of standard care versus TA injection in the treatment of ME in patients with CRVO and BRVO, the multicenter randomized study SCORE is ongoing are ongoing. Case reports, small retrospective or prospective non-controlled studies of VEGF inhibitors in the treatment of ME and retinal neovascularizations secondary to BRVO, have been published.124–126,128Rosenfeld et al.125–140Campochiaro et al.136Prospective, controlled studies are mandatory to develop standardized treatment protocols that allow safe and effective application of anti-VEGF drugs.Laser treatment is an established method for use in patients with BRVO. A large number of publications concerning the role of photocoagulation in the management of BRVO have appeared. Various laser techniques can be used: macula grid photocoagulation and the method of arterial crimping for treatment of ME, and peripheral scatter photocoagulation for treatment of retinal and/or disc neovascularization.,61,62,63,141,144The Branch vein occlusion study group remains the largest randomized prospective trial that has evaluated the efficacy of grid-pattern laser photocoagulation for the treatment of ME in BRVO.142The randomized controlled study by Branch vein occlusion study group54–An alternative type of laser treatment involves arteriolar constriction and may be considered in order to reduce the inflow into the affected area if the ME is excessive. This procedure was first described by L'Esperance147The pathogenesis of BRVO is multifactorial. Its resulting visual loss is due primarily to ME, macular nonperfusion, and retinal neovascularization. A large number of treatments have been advocated in its management. Unfortunately, almost all of these lack sufficient evidence for their effectiveness. Randomized prospective trials are essential. The only one established treatment for ME is macular grid photocoagulation in patients with BRVO longer than 3 months and a VA of 20/40 or worse. Additionally, the initial VA may play a crucial role in the prognosis of BRVO and determinates the final VA.

An outbreak of infectious diarrhea with 70 laboratory-confirmed cases (58 with Giardia lamblia) and 107 probable cases occurred in U.K. tourists who stayed in a hotel in Greece. After a cluster of six cases in persons who had stayed at the hotel was reported, the Communicable Disease Surveillance Centre began active case ascertainment. This outbreak illustrates the value of an approach to surveillance that integrates routine surveillance data with active case ascertainment.

As in many areas of health care, treatments for cancer may differ only moderately in their effects on major end points, such as death. But, such differences are worth knowing about, particularly in common diseases in which they could represent a substantial benefit to public health. Large-scale randomized evidence allows moderate differences to be investigated reliably, and one way to achieve this is by meta-analyses of updated and centrally collected individual patient data from all relevant trials. This paper illustrates why this form of research can often be important in cancer. It also offers the first list of such projects, as a source of information on current and past research in this area.

Adaptation to constant stimulation has often been used to investigate the mechanisms of perceptual coding, but the adaptive processes within the proprioceptive channels that encode body movement have not been well described. We investigated them using vibration as a stimulus because vibration of muscle tendons results in a powerful illusion of movement.We applied sustained 90 Hz vibratory stimulation to biceps brachii, an elbow flexor and induced the expected illusion of elbow extension (in 12 participants). There was clear evidence of adaptation to the movement signal both during the 6-min long vibration and on its cessation. During vibration, the strong initial illusion of extension waxed and waned, with diminishing duration of periods of illusory movement and occasional reversals in the direction of the illusion. After vibration there was an aftereffect in which the stationary elbow seemed to move into flexion. Muscle activity shows no consistent relationship with the variations in perceived movement.We interpret the observed effects as adaptive changes in the central mechanisms that code movement in direction-selective opponent channels. The level of adaptation of a sensory system depends on the statistics of past stimulation-its sensory ‘diet’-and it can be defined operationally in terms of a stimulus evoking a neutral or indifferent response active movements Adaptation in the proprioceptive system has been extensively studied for A widely-used tool for investigation of movement perception is tendon vibration; it activates muscle spindle endings and induces an illusory sensation of movement Our aim was to fill the gap in knowledge about adaptation to movement stimuli in the proprioceptive system. We used quantitative methods to investigate adaptation to a long-lasting movement signal induced by vibration. Adaptation has been successfully used as a tool to infer the properties of visual cortical processes in humans A recent study by Kito and colleagues during a long-lasting stimulation as well as the aftereffect. We applied vibration for a long period of time (6 minutes) and recorded modulations in perceived movement throughout this period as well as after vibration, with some surprising results suggesting further analogies between processing of motion in vision and proprioception. Specifically, we found that during vibration, ‘reversals’ of movement were occasionally perceived. Thus the unchanging stimulation resulted in a changing percept. In a follow-up experiment we also recorded electromyographic activity (EMG) from biceps and triceps to determine whether it correlated with perceptual effects.Our study is primarily psychophysical and it investigates adaptation Participants reported by keypress the direction and speed of illusory arm movement, if any, throughout a 6-minute period of vibration of the biceps tendon, and in the 2 minutes after the vibration. They used one key to indicate elbow extension, and the other to indicate flexion. The frequency of keypresses indicated the relative speed of the perceived movement. In the absence of a movement sensation, keypresses stopped.Vibration of the biceps induced the expected illusion of elbow extension. Representative individual results shown in during vibration, extensions and flexions . In addition, a lack of response for periods of three seconds or longer indicated that no movement was perceived. On average, the illusion of extension was present for 48% (±25% SD) of total vibration time in Run 1 and illusion of flexion for 9% (±10% SD) of the time. The corresponding values in Run 2 are 42% (±24%) and 4% (±9%).Two kinds of responses occurred The probability of occurrence of illusory movement among the participants is shown in The changing pattern of responses with ongoing vibration is shown in any illusory movement was less likely to be experienced in Run 2. The mean probability of perceived elbow extension was lower in Run 2: 0.43 compared to 0.50 in Run 1 (t(359) = 8.22; p<0.001). The corresponding values for reversals were 0.04 and 0.10 (t(359) = 12.38, p<0.001).Comparison between the runs reveals that ). Their duration in both runs was usually less than 10 s, with group median values of 6–8 s, and a long tail of events of greater duration. Periods of no movement followed a similar, positively skewed distribution. The difference between the mean duration of the extension responses in the two runs was significant at the 0.05 level , while the differences for flexion responses and no-movement periods were not significant.Individual bursts of movement tended to be shorter in Run 2 in Run 1. After ∼20 s, this aftereffect decreased sharply . A similduring vibration also experienced longer periods of the flexion after vibration with a correlation of 0.72 (p<0.01).In the post-vibration period, the illusion of flexion was present on average for 22% (±0.24% SD) of total time, and illusion of extension for only 2% (±0.06%) of the time. Individuals with longer periods of perceived extension The perceived speed of the movement aftereffect during the first 30 s after vibration is similar to that of the movement experienced during vibration . Figure Results of the main experiment were replicated in a follow-up experiment (N = 7), in which vibration lasted 3 minutes, post-vibration period 2 minutes, and EMG was recorded from the biceps and triceps muscles. EMG from one or the other muscle correlated with perceptual experience in some subjects some of the time, but showed little or no correlation in others see Table 2.Stimulation of muscle spindles by vibration is known to generate illusions of limb movement in the direction that would stretch the vibrated muscle. We found that prolonged, continuous activation of muscle spindle endings with vibration results in a changing percept. The illusion of elbow extension comes in bursts or waves separated by periods of no illusory movement. Sometimes there is an illusory movement in the opposite direction (flexion), especially after a relatively long period of stimulation. The duration of waves of illusory extension decreases with time, both during ongoing vibration, and in a subsequent application of the same stimulus. With ongoing stimulation, the opposite movement directions cancel out, gradually bringing the average velocity closer to zero. However, perceived speed of movement during individual waves does not decrease. Cessation of stimulation is followed by an aftereffect. This consists of illusory movement in the opposite direction with a similar speed to the vibration-induced movement. The aftereffect lasts longer in individuals who experience longer total periods of movement during adaptation.extents of illusory movement and aftereffect after each trial. Thus rather than directly reflecting experience of movement, the responses reflected a memory of perceived displacement, or perhaps displacement inferred from perceived movement. This ambiguity is undesirable because it is known that movement and displacement illusions are not necessarily equivalent, and may not depend on the same underlying mechanisms The findings concerning the aftereffect of vibration corroborate those of Kito and colleagues Our findings regarding the modulation in perceived movement during vibration, including reversals of perceived movement direction, are new. Combined with the aftereffect, these findings shed light on the mechanisms for processing signals of movement in the proprioceptive system. Their significance can be better understood if compared to vision in which adaptation has been used to probe the mechanism of sensory coding.In vision, two aspects of motion adaptation have been studied that might have proprioceptive analogues: a gradual decrease in the perceived velocity of a constantly moving pattern below the spontaneous firing rate in the opponent, non-stimulated channels, which could generate reversals. Another shift in overall activity occurs when stimulation ceases, because the adapted channel fires less than the others; this would produce the movement aftereffect. Even though the latter effect (perception of movement when none occurs) hardly seems adaptive, it is brought about by mechanisms that are essential to ensure efficient everyday functioning of sensory systems. According to this functional view of adaptation Barlow and Hill motor channels correlates with perception. Kito and colleagues cause some muscle activity, rather than be its consequence. Kito and colleagues emphasize the activity in motor pathways without clearly explaining its role in perception.There is now also evidence that unbalanced excitability in the opponent two opponent channels encoding direction of movement would suffice to explain the findings in the current study because movements in the elbow joint are limited to two directions. For joints that allow multidirectional movements e.g. wrist, a distribution-shift model would be more appropriate. According to the distribution-shift model of motion in vision To conclude our discussion of models of adaptation in proprioceptive channels, it is worth noting that only Even if we ignore the fact that vibration does not activate all the afferents which can contribute to movement perception We report perceptual consequences of prolonged stimulation of a proprioceptive movement channel, and place them in a theoretical framework that attributes functional significance to them. The changes we observed can be summarized as a reduced ability to perceive movement and the shift from a clear perception of one-directional movement towards a multistable perceptual state in which extension alternates with flexion and no-movement periods during invariant stimulation. The aftereffect of stimulation, in absence of proprioceptive afferent activity, restores a perception of movement in the direction opposite to that perceived during stimulation. We propose that these changes are parts of an adaptive process which functions to keep the organism in tune with the environment and to best use the information capacity of the sensory system.and motor channels on one side, and adaptation and related phenomena in conscious perception on the other.Two broad directions seem to be promising in this little explored line of research. One is the exploration of mechanisms common to different modalities–vision, proprioception and possibly other-in processing of dynamic stimuli. The other is to explore issues specific to propriception, such as the relationship between sensory Twelve participants completed the main experiment, including two authors (JT and JS). They were volunteers recruited from staff at the Prince of Wales Medical Research Institute and psychology undergraduates at the University of Sydney. Seven participants completed a follow-up experiment, including three authors . The study was approved by the Human Research Ethics Committees of the University of New South Wales and University of Sydney and all the participants (except for the authors) signed the informed consent.A custom-built wooden board supported the left forearm in the horizontal plane, approximately 10 cm below the shoulder level, at 130° relative to the upper arm. The 90-Hz vibrator (Breville HM500) was attached to the side of the board, and its head held against the biceps tendon using an elastic band.Vibration), followed by 2 minutes of post-vibration period (Post-vibration). Participants closed their eyes and used the right hand to signal movement about the left elbow with two keys on a standard keyboard. The index finger indicated movement to the left, and the middle finger movement to the right. The rate of presses indicated the relative speed of perceived movement. The Vibration-Post-vibration cycle was performed twice, with at least 3 min break between the runs. Before experimental runs, participants received a short practice in which they varied the frequency of presses from slow to fast. In a control condition performed at the end of the session, they were asked to press one key at a constant rate for 6 minutes.The vibration was applied for 6 minutes and sampled to computer (2000 Hz) via a laboratory interface .extension, and the other, flexion. We derived three measures from running averages based on 3-s time periods: A. Probability of responding as a function of time, or the number of participants that had pressed one or other key at a given time. The probability was measured with one-second precision, using running averages as described above. B. Standardized response rate indicating perceived velocity. Data were normalized to account for individual differences in the absolute number of responses per second. For each participant, all the responses in both runs were normalized to the greatest response frequency indicating elbow extension during the vibration period of Run 1. From this we computed a) overall perceived velocity, using sign to indicate direction of movement (positive for extension and negative for flexion) and zero to indicate periods in which no movement was perceived; b) perceived velocity during movement, calculated separately for extension and flexion responses, and excluding periods of no movement. C. Duration of periods when uninterrupted movement (extension or flexion) was perceived, or when no movement was perceived. A 3-s period during which neither key was pressed counted as an interruption.Raw data were the number of keypresses per second. These indicated the perceived relative speed of arm movement, with one key indicating elbow For the follow-up study, root mean square (rms) EMG was calculated for each 1-s interval during vibration and post-vibration. These measures were smoothed using a 5 point running average before correlation with the perceived velocity of movement for each subject.

Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped virus, bearing severe economic consequences to the swine industry worldwide. Previous studies on enveloped viruses have shown that many incorporated cellular proteins associated with the virion's membranes that might play important roles in viral infectivity. In this study, we sought to proteomically profile the cellular proteins incorporated into or associated with the virions of a highly virulent PRRSV strain GDBY1, and to provide foundation for further investigations on the roles of incorporated/associated cellular proteins on PRRSV's infectivity.In our experiment, sixty one cellular proteins were identified in highly purified PRRSV virions by two-dimensional gel electrophoresis coupled with mass spectrometric approaches. The identified cellular proteins could be grouped into eight functional categories including cytoskeletal proteins, chaperones, macromolecular biosynthesis proteins, metabolism-associated proteins, calcium-dependent membrane-binding proteins and other functional proteins. Among the identified proteins, four have not yet been reported in other studied envelope viruses, namely, guanine nucleotide-binding proteins, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase, peroxiredoxin 1 and galectin-1 protein. The presence of five selected cellular proteins in the highly purified PRRSV virions was validated by Western blot and immunogold labeling assays.Taken together, the present study has demonstrated the incorporation of cellular proteins in PRRSV virions, which provides valuable information for the further investigations for the effects of individual cellular proteins on the viral replication, assembly, and pathogenesis. Porcine reproductive and respiratory syndrome (PRRS) is an economically important disease of swine throughout the world, characterized by severe reproductive problem with late term abortions in sows and severe respiratory ailment leading to increased mortality in young pigs ,2. The dPorcine reproductive and respiratory syndrome virus (PRRSV), the causative agent of PRRS, is an enveloped, non-segmented, single positive-stranded virus belonging to the family Arteriviridae in the order Nidovirales . PRRSV pNumerous host proteins have been identified that incorporate into the membranes or inside the envelopes of the virions during their budding from the host cells, but the role and importance of these host cellular proteins in virus infection are not fully understood -16. ExteHowever, the identities of the cellular proteins incorporated in PRRSV virions have not been investigated. We infected African green monkey kidney epithelial cell line (Marc-145) with PRRSV and purified the virions by Cesium chloride (CsCl) gradients centrifugation coupled with sucrose gradients centrifugation. The highly purified PRRSV virions were analyzed by two-dimensional gel electrophoresis (2-DE) coupled with mass spectrometric approaches, that identified sixty one different cellular proteins. Furthermore, the presence of five selected cellular proteins in the purified PRRSV virions was validated by Western blot and immunogold labeling assays.Marc-145 cells were infected with a PRRSV strain i.e., GDBY1, isolated from dead pig. 96 h poThe purity and quantity of PRRSV virions were crucial for proteomic analysis. Although porcine alveolar macrophages (PAM) are the main target cells of PRRSV, yet the infection by PRRSV of PAM primary cultures gave poor yields, making them impractical to obtain highly purified PRRSV virions for proteomic analysis. For another reason, the porcine genome is not yet fully annotated and this would restrict the identification of host proteins. Alternatively, the cell lines would support high levels of PRRSV growth and cells can be used to search the most extensive protein database (i.e. human).To obtain a detailed composition of PRRSV virion proteins, the highly purified virions were analyzed by 2-DE with 200 μg of protein loaded on 18 cm gel strip (pI 3-10). To minimize inter-gel and inter-sample variation, three repeats of independent sample preparations and three repeats of independent 2-DE PAGE were performed under identical conditions. All the gels provided high resolution spots for the separation of proteins. After image analysis, a total of 104 protein spots were detected on the silver stained gel and Gene Ontology Databases. A total of sixty one host proteins were successfully identified and categorized into eight different groups as follows: cytoskeleton proteins, stress proteins, macromolecular biosynthesis proteins, metabolism-associated proteins, calcium-dependent membrane-binding proteins, glycoprotein, regualte apoptosis protein and other functional proteins Table . The proFollowing the identification of cellular proteins by proteomic method, immunoblot analysis was carried out to confirm their presence. In Western blot analysis, apart from five structural proteins, Beta actin, Tubulin, Annexin A2, S100 and Hsp27 were successfully detected both in purified PRRSV virions and protease-treated PRRSV virions Fig. . In thisIn order to exclude the possibility of contaminants derived from inefficiently removed protease treatment, immuno-gold labling was performed for purified PRRSV, which provided additional evidence for the location of host cellular proteins in PRRSV virions. The subtilisin protease treated PRRSV virions were incubated with 1% v/v Triton X-100 for 2 min to increase the permeability of PRRSV envelope. By doing so, the microvesicles become lighter than the virions and virions can be isolated by density centrifugation. Proteins present inside the virion are protected by lipid envelope and therefore will be present after the protease treatment. Virus particles were incubated with antibodies of Beta Actin, Tubulin, Annexin A2, S100, Hsp27 and normal mouse IgG Fig. which wePRRS is pandemic in swine producing regions throughout the world resulting in severe economic losses. However, the underlying mechanism of PRRSV pathogenesis remains to be well defined. In this study, we obtained highly purified PRRSV virions by CsCl gradients combined with sucrose gradients ultracentrifugation. Virion-associated proteins were identified by using 2-DE/MS proteomics approach followed by Western blot and electron microscopy. A total of six viral proteins and sixty one host proteins were successfully identified. Number of evidences show that some of virion-associated host proteins may play an important role in virus infectivity ,32. HoweThree of structural proteins GP2a (pI 10.0), N (pI 10.4) and M (pI 9.99) all belong to alkaline proteins, therefore none of them could be detected by utilizing 2-DE gels. Several glycosylation sites have been identified on GP5 protein, which may change GP5 pI. Meanwhile, GP3 and GP4 which belong to non-major structural proteins were not identified on the 2-DE gels, which can be due to low concentration. Moreover, the two proteins (GP3 and GP4) which are involved in post-translational modification of glycosylation, and can change the proteins pI were not detected in 2-D gels. Our viral proteomics study of PRRSV virons identified several host cytoskeleton system proteins, which have the maximum profusion among the identified cellular proteins, including Actin, Keratin, Annexin, Coronin, Tubulin, Tropomyosin, and Cofilin. Enveloped viruses acquire their envelope through budding from the host cell, thus cytoskeletal proteins may be integrated inside the virions because of their propinquity to viral assembly and budding sites.Available evidences indicate that host cytoskeletons, especially Actin, are involved in several animal virus budding processes . InteresIn this study three annexin family members were successfully identified in purified PRRSV virions. Annexin A2 is a calcium-regulated membrane-binding protein whose affinity for calcium is greatly enhanced by anionic phospholipids and implicated in a number of membrane-related events, including regulated exocytosis . It bind2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Hepatitis B virus (HBV) interacting with S100 A10 (p11) which binding to annexin II, have an important role in modulation of HBV function and implicates PML nuclear bodies and intracellular Ca2+ in viral replication . The virus pellet was resuspended in TNE buffer, layered on the top of 10-50% (w/v) CsCl gradients and concurrently centrifuged at 160,000 × g at 4°C for 12 h. The banded virus was collected, diluted with TNE buffer and then layered on the top of 25-65% (w/v) sucrose gradients and at the same time centrifuged at 160,000 × g at 4°C for 4 h. The PRRSV particles band were harvested and pelleted at 160,000 × g for 2 h to remove the traces of sucrose. In order to get highly purified PRRSV virions, the collected banded virus was purified for a second time according to the same purification procedure. The purified virus was stored at -80°C for further use.African green monkey kidney epithelial cell line (Marc-145) is a very convenient research model as PRRSV host cell. Marc-145 cells with 80% confluence were infected with high pathogenic PRRSV grouped into Type II (Genebank accession no: GQ374442) at a multiplicity of infection (MOI) of 0.01. After 72-96 h post infection, the supernatant was harvested and clarified by centrifugation at 10,000 × Highly purified virus (3 μl) was adsorbed to Formavar-supported, carbon-coated nickel grids (230 mesh) for 2 min at room temperature (RT). The grids were then negatively stained with 3% phosphotungstic acid and examined under a JEM-1400 electron microscope operated at 120 kV.SDS-PAGE was performed to validate the purified PRRSV virions. Proteins from the purified virus (20 μg) were denatured at 100°C for 10 min in 1 × (SDS-PAGE) sample buffer and were then separated by SDS-PAGE. Coomassie Blue R250 was used for protein staining.g for 20 min at 4°C. The supernatant was collected and the concentration was determined by 2-DE Quant kit .The highly purified PRRSV virions were lysed in lysis buffer containing protease inhibitor cocktail (Sigma) for 1 h at 4°C. After lysing by sonication for 5 min with 40% power output, the lysates were clarified by centrifugation at 20,000 × The first-dimension separation was performed using 18 cm immobilized pH gradients (IPG) strips at nonlinear pI 3-10 for isoelctric focusing (IEF) and vertical SDS-PAGE for second dimension. The IPG strips were rehydrated with 350 μl of rehydration buffer containing 200 μg protein for 12 h at 20°C with passive rehydration. IEF was performed as follows:100 V, linear, 200 Volt-Hours (Vhs); 200 V, gradient, 200 Vhs, 500 V, linear, 500 Vhs; 1,000 V, linear, 2,000 Vhs; 4,000 V, gradient, 4,000 Vhs; 8,000 V, linear, 32,000 Vhs. The IPG strips were equilibrated for 15 min with gentle shaking in equilibration buffer containing 2% DTT, followed by additional equilibration for 15 min in SDS equilibration buffer containing 2.5% iodoacetamide. The second-dimensional separation was carried out by using 5-17.5% continuous gradient SDS-PAGE. The gels were stained by the modified silver staining method compatible with MS and scanned at a resolution of 600 dpi using ImageScanner(Amersham Pharmacia Biotech). The image analysis was carried out with Image Master 2D Platinum 5.0 according to the manufacture's protocol .2O, destained in 1:1 solution of 30 mM potassium ferricyanide (K3Fe(CN)6) and 100 mM ammonium bicarbonate (NH4HCO3). After hydrating with 100% acetonitrile (ACN) and drying in a SpeedVac for 20 min, the gels were rehydrated in a minimal volume of sequencing grade porcine trypsin solution (20 μg/ml in 25 mM NH4HCO3) and incubated at 37°C overnight. The supernatant was collected and transferred into a 200 μl microcentrifuge tube, while the gels were extracted once with extraction buffer (67% ACN containing 5% trifluoroacetic acid TFA) at 37°C for 1 h. Finally, the peptide extracts and the supernatant of the gel spots were combined and then completely dried in a SpeedVac centrifuge.The protein spots on the silver-stained gels were excised and transferred into 0.5 ml Eppendorf tubes, washed 3 times with ddHin situ tryptic digestion.Protein digestion extracts were resuspended with 5 μl of 0.1% TFA, and then the peptide samples were mixed (1:1 v/v) with a matrix consisting of a saturated solution of α-cyano-4-hydroxy-trans-cinnamic acid (CHCA) in 50% ACN containing 0.1% TFA. Digested protein (0.8 μl) of each sample was spotted onto stainless steel target plates and allowed to air-dry at room temperature. Three bright bands were cut from one dimensional polyacrylamide gel ranging from the molecular masses of 10-26 kDa, and subjected to Peptide mass spectra were obtained on an Applied Biosystem Sciex 4800 MALDI TOF/TOF Plus mass spectrometer . Data were acquired in positive MS reflector using a CalMix5 standard to calibrate the instrument . Mass spectra were obtained from each sample spot by accumulation of 900 laser shots in a mass range of 800-3500. For MS/MS spectra, the 5-10 most abundant precursor ions per sample were selected for subsequent fragmentation and 1,200 laser shots were accumulated per precursor ion.Combined MS and MS/MS spectra were submitted to MASCOT searching engine by GPS Explorer software (Applied Biosystems) for proteins identification. Parameters for searches were as follows: taxonomy of primates, trypsin of the digestion enzyme, one missed cleavage site, partial modification of cysteine carboamidomethylated and methionine oxidized, none fixed modifications, MS tolerance of 60 ppm, MS/MS tolerance of 0.25 Da. A total of 133,518 sequences in the database actually were searched. MASCOT protein score (based on combined MS and MS/MS spectra) of greater than 64 (p≤0.05) or the total ion score (based on MS/MS spectra) of greater than 30 (p≤0.05) were accepted.in situ tryptic digestion prior to mass spectrometric analysis. EttanTM MDLC system was applied for desalting and separation of tryptic peptides mixtures. In this system, samples were desalted on RP trap columns , and then separated on a RP column . Mobile phase A (0.1% formic acid in HPLC-grade water) while the mobile phase B (0.1% formic acid in acetonitrile) were selected. 20 μg of tryptic peptide mixtures was loaded onto the columns, and separation was done at a flow rate of 2 μl/min by using a linear gradient of 4-50% B for 120 min. A Finnigan TM LTQTM linear ion trap MS (Thermo Electron) equipped with an electrospray interface was connected to the LC setup for eluted peptides detection. Data-dependent MS/MS spectra were obtained simultaneously. Each scan cycle consisted of one full MS scan in profile mode followed by five MS/MS scans in centroid mode with the following Dynamic Exclusion TM settings: repeat count 2, repeat duration 30 s, exclusion duration 90 s, while each sample was analyzed in triplicate.The visible proteins were cut from SDS-PAGE gel and subjected to http://www.ncbi.nlm.nih.gov. The peptides were constrained to be tryptic and up to two missed cleavages were allowed. Carbamidomethylation of cysteines were treated as a fixed modification, whereas oxidation of methionine residues was considered as variable modifications. The mass tolerance allowed for the precursor ions and fragment ions was 2.0 Da and 0.0 Da, respectively. The protein identification criteria were based on Delta CN (≥0.1) and cross-correlation scores .MS/MS spectra were automatically searched against the non-redundant PRRSV protein data base g at 4°C for 4 h. The PRRS virion were subjected to Western blot analysis after sedimentation.Purified PRRSV particles equivalent to 50 μg protein was incubated with 100 μg subtilisin protease (Sigma) for 14 h at 37°C . The treMouse monoclonal antibodies against Actin, Heat shock protein Hsp27 and S100 were purchased from Millipore, and rabbit polyclonal antibody against Annexin A2 and Tubulin were products of Abcam Corporation. The negative control of non-viral infected MARC-145 cells lysate was prepared by using the same method as purifying PRRSV virions. Equal amounts of purified PRRS virions, protease-treated PRRSV virions and purified Marc-145 cells lysate were suspended in 1 × loading buffer and denatured by heating at 100°C for 5 min. After separated by SDS-PAGE, the viral proteins were transferred to ployvinylidene difluoride (PVDF) membrane (Millipore) for 20 min at 15 V. The membrane was then blocked in 5% nonfat milk-Tris buffered saline buffer (TBS)-0.1% Tween-20 overnight at 4°C. The PVDF membrane was washed three times with TBS plus 0.2% Tween-20 and incubated with properly diluted primary antibodies for 2 h at RT. Following three washes with TBS, the secondary antibody conjugated to horseradish peroxidase (HRP) was added for 1 h at RT. Immunoreactive protein bands were visualized with ECL plus Western Blot Detection System .In order to assess the locations of the host proteins in the PRRSV particles, the immunoelectron microscopy technique was performed as previously described . AliquotPRRSV: porcine reproductive and respiratory syndrome virus; PAM: primary cultures of porcine alveolar macrophages; MALDI-TOF: matrix-assisted laser adsorption ionization-time of flight; LC-MS: liquid chromatography tandem mass spectrometry; 2-DE: two-dimensional gel electrophoresis; CSCL: cesium chloride; HRP: horseradish peroxidase; PI: isoelectric point; MW: molecular weight; RT: room temperature; MS: mass spectrometric; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; IEF: isoelctric focusing; BSA: bovine serum albumin; TBS: tris buffered saline; IPG: immobilized pH gradients; DTT: dithiothreitol; IAA: iodoacetamide; ACN: acetonitrile; TFA: trifluoroacetic acid.The authors declare that they have no competing interests.CZ performed the main proteomic experiments, data analysis and drafted the manuscript. CX participated in the detailed experimental design. YL and XL assisted in the propagation and purification of PRRSV. QK and XR contributed to the initial phase of the proteomic experiments. DS, YB and YC conceived study, and participated in its design, coordination and helped to sketch the manuscript. All authors have read and approved the final manuscript.

Some 1.38 million offspring up to age 55 years with 50.6 million person-years were included. Poisson regression analysis included age at diagnosis, birth cohort, socio-economic status and region of residence as other explanatory variables. The only significant associations were an increasing risk for breast cancer by birth order and a decreasing risk for melanoma by birth order and, particularly, by family size. When details of the women's own reproductive history were included in analysis, birth orders 5–17 showed a relative risk of 1.41. The effects on breast cancer may be mediated through increasing birth weight by birth order. For melanoma, socio-economic factors may be involved, such as limited affordability of sun tourism in large families. Testis cancer showed no significant effect and prostate cancer was excluded from analysis because of the small number of cases. © 2001 Cancer Research Campaign

Method-specific suicide trends varied across countries, and studies of the trends in different countries can contribute to the understanding of the epidemiology of suicide. The purpose of this study was to examine the changes in suicide trends by sex, age and method in the years 1971 to 2005 in Taiwan.Mortality data files of suicide and undetermined deaths for the years 1971–2005 were obtained for analyses. Age-, sex- and method-specific suicide rates were calculated by four age groups and five suicide methods .Both sexes experienced downward trends from 1971 to 1993, and then an upward trend since 1993. People aged 65 years and above had the highest suicide rates throughout the study periods. However, males aged 25–64 years experienced the steepest increasing trends. As to suicide methods, an annual increase, since 1991, of people jumping from heights to commit suicide, and a marked increase, since 1998, of people completing suicide by poisoning with other gases were observed.Suicide by means of charcoal-burning and jumping from heights has become a serious public health problem in Taiwan. Preventive measures to curb these increasing trends are urgently needed. Suicide is an important public health problem throughout the world. Approximately one million people committed suicide in 2000 . In the However, most of the previous studies on suicide trends and suicide methods were based on data from Western countries. Data from non-Western countries, such as Asian countries, might illustrate different trends. For example, in Hong Kong, suicide rates were on the increase among the young and the old in 1981–1994 and jumping from heights was the most favored method . So, knoTaiwan, a country with 23 million people, has experienced rapid economic growth and industrialization during the past 30 years, and a gradual liberalization of social and political restraints in the most recent decade. A resurgence in suicide trends was found in the late 1990s , and suiThe aim of this study was to examine changes in suicide trends by sex, age and use of specific methods among defined subgroups during the periods between 1971 and 2005 in Taiwan, especially focusing on contemporary trends.Electronic mortality data files of those aged 15 years and above were provided by the Department of Health of the Executive Yuan of Taiwan for the years 1971–2005.Since suicide mortality statistics are usually under-estimated, and the most commonly misclassified category is death from undetermined causes ,14, suicSex-, age- and method-specific death rates were calculated to examine suicide trends. Age-adjusted suicide rates were calculated using the world population structure as a standard. Victim age was divided into four groups: 15–24, 25–44, 45–64, and 65 years and older. The different suicide methods were grouped into five categories: solids/liquids poisoning (E950 and E980), poisoning by other gases (E952 and E982), hanging (E953 and E983), jumping from heights (E957 and E987) and other methods .For further analysis of the method-specific suicide trends in sex- and age-specific subgroups in the contemporary years of 1991–2005, we combined 3 years of data to minimize the effect of yearly fluctuations.A V-shape suicide trend was noted from 1971 to 2005. Both sexes experienced downward trends from 1971 to 1993, and then an upward trend from 1993 , and 13-fold in females in the most recent 15 years.In 1998, only 32 people completed suicide by poisoning with other gases. However, more than 1300 people used this method to kill themselves in 2005. The age-adjusted suicide rate of poisoning with other gases increased 33-fold in males , and 126-fold in females , an astonishing upsurge.In the contemporary years of 1991–2005, nearly all method-specific suicide rates seemed to increase in the four age groups in both sexes had a relatively lower sex ratio than Western countries The maleMarked age differences in suicide trends have been noted in Taiwan in the recent decade. A prominent increase in suicide rates occurred among those aged 25–64 years old, particularly males. The continuing increase of annual unemployed rates in the middle and late 1990s in Taiwan might alIn some Western countries, such as Scotland and New Methods of suicide differed across countries . For exaPoisoning by other gases as a method of suicide has become epidemic recently among both sexes aged 25–44 years in Taiwan. Among the other gases suicide deaths, at least 60% of them were charcoal burning in Taiwan . It is hMethods of suicide also differed among both sexes. Many studies have indicated that females tended to use drug overdoses and males more frequently used more lethal methods, including hanging, carbon monoxide poisoning, and firearms . HoweverOne limitation of using official suicide rates is the underreporting . In TaiwIn conclusion, a substantial rise in suicide rates was found among males aged 25–64 in the most recent decade in Taiwan. Suicide by means of charcoal-burning and jumping from heights has become a serious public health problem in Taiwan. Preventive measures are urgently needed to curb these escalating trends.The author(s) declare that they have no competing interests.JJL contributed to the study design, analysis and interpretation of the data and drafted the paper. THL contributed to the study design, obtained the data and commented on the interpretation. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Solanum carolinense (horsenettle) is a highly successful weed with a gametophytic self-incompatibility (SI) system. Previous studies reveal that the strength of SI in S. carolinense is a plastic trait, associated with particular S-alleles. The importance of this variation in self-fertility on the ability of horsenettle to found and establish new populations will depend, to a large extent, on the magnitude of inbreeding depression. We performed a series of greenhouse and field experiments to determine the magnitude of inbreeding depression in S. carolinense, whether inbreeding depression varies by family, and whether the estimates of inbreeding depression vary under field and greenhouse conditions. We performed a series of controlled self- and cross-pollinations on 16 genets collected from a large population in Pennsylvania to obtain progeny with different levels of inbreeding. We grew the selfed and outcrossed progeny in the greenhouse and under field conditions and recorded various measures of growth and reproductive output.In the greenhouse study we found (1) a reduction in flower, fruit and seed production per fruit in inbred (selfed) progeny when compared to outbred (outcrossed) progeny; (2) a reduction in growth of resprouts obtained from rhizome cuttings of selfed progeny; and (3) an increase in the ability to self-fertilize in the selfed progeny. In the field, we found that (1) outcrossed progeny produced more leaves than their selfed siblings; (2) herbivory seems to add little to inbreeding depression; and (3) outcrossed plants grew faster and were able to set more fruits than selfed plants.Solanum carolinense experiences low levels of inbreeding depression under greenhouse conditions and slightly more inbreeding depression under our field conditions. The combined effects of low levels of inbreeding depression and plasticity in the strength of SI suggest that the production of selfed progeny may play an important role in the establishment of new populations of S. carolinense. In many species of angiosperms, both male and female reproductive structures are found in the same flower. This arrangement is thought to facilitate the deposition and collection of pollen by pollinators in just one visit. However, it also creates the potential for self-fertilization. Self-fertilization is problematic because it increases homozygosity, thereby reducing the contribution of overdominance to fitness and exposing deleterious recessives to selection. As a consequence, selfed progeny tend to suffer from inbreeding depression, i.e. a reduction in fitness of selfed offspring compared to outcrossed offspring ,2.Inbreeding depression has been measured for a wide variety of species possessing a range of mating systems -8. TheseBecause of its adverse effects on fitness, inbreeding depression has been regarded as a major force in the evolution of plant mating systems -38. ManyS-locus; each polymorphic variant is referred to as an S-allele that produced the seed) on the percentage of germinated seeds . In the greenhouse study, selfed progeny set significantly fewer seeds following outcross pollinations than outcrossed progeny indicates that the self progeny seem to have become more self-compatible (Table p < 0.10) effect on many of our measures of vegetative vigor and reproductive output and 6 outbred (outcrossed) progeny from 16 genets of y Tables . Althougy Tables indicatile Table . We alsout Table . In addiEpitrix hirtipennis and E. fuscula), the tobacco hornworm (Manduca sexta) and both the Colorado and false potato beetle (Leptinotarsa decemlineata and L. juncta), all of which are specialists on the Solanaceae and include some of the most important pests of cultivated species in this family. In the nonsprayed plots there was severe herbivory resulting in the death of 25 plants (14 cross progeny and 11 self progeny) and 79% of those plants that did survive failed to flower or set fruit (63 cross progeny and 69 self progeny). For those plants that survived, the outcrossed progeny had a greater number of leaf nodes six weeks after transplanting and a higher ratio of fruits per flower . In contrast to the greenhouse study, we found no significant effects of Genet or Genet by Cross interactions on vegetative vigor or reproductive output under field conditions.After completion of the greenhouse study, two rhizome cuttings from each of the self and cross progeny from each of the 16 original genets were transplanted into two field plots. One plot was sprayed weekly with an insecticide. In this sprayed field plot, outcrossed plants had a significantly greater number of leaf nodes at six weeks after transplanting than selfed progeny Tables , 4. TherSolanum carolinense has an RNase-mediated self-incompatibility system × the number of seeds per fruit [R = 0.87]) is 0.83, indicating that the average inbred progeny suffers a reduction of 17% in reproductive output. Similarly, the multiplicative effects of inbreeding on reproductive output in the field experiment (sprayed plot), flower number per plant (R = 0.80) × fruits per plant (R = 0.79) is 0.63, indicating that on average, inbred plants suffer a moderate 37% reduction in reproductive output due to inbreeding depression compared to outbred progeny (at least under our field conditions). In contrast to other predominately outcrossing species, the overall impact of inbreeding on reproductive output in S. carolinense is low (greenhouse estimate of δ = 0.17) or moderate (field estimate of δ = 0.37) ; this correction was done because a smaller value of herbivory is considered a higher estimate of fitness. We estimated the overall value of δ on reproductive output under field conditions (sprayed plot) as the multiplicative effects of flower and fruit production using the same formula described for the greenhouse study. Because of high mortality and the failure of a large number of plants to reproduce in the unsprayed plot, plants in the sprayed and unsprayed treatments were analyzed separately.In order to determine if the estimate of inbreeding depression differs under field conditions, we made rhizome cuttings from each of inbred and outbred progeny from each of the 16 maternal plants (Genets) used in the greenhouse experiment. Three equal sized (approximately 7.5 cm long) cuttings per progeny were obtained and sown into 1-liter pots. These cuttings were allowed to resprout and grow in the greenhouse for three weeks. We then recorded the plant height and the number of leaves. We randomly selected two ramets per cross per genet and transplanted them into two 15 m × 30 m experimental plots at The Pennsylvania State University Agricultural Experimental Station at Rock Springs, PA in the summer of 2005. Each plot contained six progeny per Cross per Genet (6 selfed progeny + 6 outcross progeny × 16 genets = 192 plants); these ramets were distributed randomly within the plot. One of the two plots was sprayed weekly with Asana XL (Dupont), a contact insecticide. The other plot was not sprayed. We recorded the number of leaf nodes at one week and six weeks after transplanting, the number of perfect and staminate flowers once per week, and the number of fruits set following natural (open) pollination. Because each flower last for 5–7 days under field conditions the flower counts are an unbiased underestimate of total flower production. It was our intention to determine total flower production by counting flower scars on inflorescences at the termination of flowering as we did in the greenhouse study. However, heavy herbivory on several plants prevented us from doing so. We assessed the level of herbivory by recording the amount of herbivore damage on the 4 youngest leaves on each plant once every two weeks; we measured damage per leaf area using a qualitative scale from 0–5, with 0 being no herbivory and 5 being more than 75% of leaf area removed by herbivores. To determine the occurrence of inbreeding depression under field conditions, we performed a mixed model ANOVA with CrJIM collected and prepared the parental population, participated in the design of the study and in the collection of greenhouse and field data, performed the statistical analysis and drafted the manuscript. LHK performed the greenhouse and field data collection and helped draft the manuscript. AGS conceived of the study, participated in its design and coordination and helped draft the manuscript. All authors have read and approved the final manuscript.

I atom in the title compound, [Ag(C3H3N4O2)(C18H15P)3]·H2O, exists in a distorted tetra­hedral environment. The uncoordinated water mol­ecule forms only one hydrogen bond to the uncoordinated carbonyl O atom.The Ag DOI: 10.1107/S1600536809048144/hy2246Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Endometriosis is the presence of functioning endometrium outside the uterus. Endometriosis rarely occurs in the abdominal wall. Majority of abdominal wall endometriosis occur in or adjacent to surgical scars, following caesarean section or hysterectomy. Laparotomy scar endometriosis following salpingectomy for ectopic pregnancy has rarely been reported. We report a case of scar endometriosis following laparotomy for chronic ectopic, and diagnosed by fine needle aspiration cytology (FNAC). Excision biopsy confirmed the FNAC diagnosis of scar endometriosis. Endometriosis is defined as the presence of functioning endometrium outside the uterus.–4 It occ323A 28-year-old (G2P1) female presented with a painful nodule of 2 years duration over the lower abdominal wall. She underwent laparotomy for chronic ectopic 3 years prior. Examination revealed a well-defined, 3×3 cm, firm and slightly tender nodule in the subcutaneous plane above the pfannenstiel scar. Ultrasonography revealed an ill-defined hypoechoic, 21×16 mm lesion in the subcutaneous plane. Patient was referred for fine needle aspiration cytology (FNAC) with a clinical diagnosis of desmoid tumor.FNAC smears were cellular, showing monolayered sheets of polygonal epithelial cells having scant cytoplasm, uniform round to oval nuclei with inconspicuous nucleoli along with irregular stromal fragments of spindle cells with ovoid or elongated nuclei and moderate amount of cytoplasm arranged around prominent vascular network. Mixed inflammatory cell infiltrate, naked stromal nuclei and occasional hemosiderin laden macrophages were present in a hemorrhagic background . Based oThe excised mass was composed of 5×5 cm fibrofatty tissue with central fibrous grey-white area containing minute cystic spaces . MicroscExtrapelvic endometriosis is an uncommon disorder with a prevalence of 8.9–15%.1 It rarel5Endometriosis in a postoperative scar is rare. Majority of the reported cases have been observed in and adjacent to surgical scars following caesarean sections, hysterectomy, hysterotomy and rarely following surgeries on fallopian tube, appendicectomy, amniocentesis and episiotomy.The incidence of endometriosis developing in the scar depends on the indication for the original surgery, being 1.08% for mid-trimester abortion and 0.03–0.4% following caesarean sections. The higher incidence in mid-trimester abortions may be due to pluripotential capability of early deciduas, resulting in cellular replication producing endometriomas.8et al.[et al.,[et al.[The first case of scar endometriosis was reported by Meyer in 1903.[et al. reported.[et al., seven caTwo theories concerning the pathogenesis have been proposed: (1) the most favored metastatic theory states the transport of endometrial cells to adjacent locations via surgical manipulations, hematogenous or lymphatic dissemination and (2) primitive pluripotential mesenchymal cells undergo specialised differentiation and metaplasia into endometrial tissue (metaplastic theory).Clinically, the features diagnostic of scar endometriosis are lump in the scar, pain, increasing size of lump, bleeding and skin discoloration. Cyclicity of symptoms during menstruation is not characteristically seen in all cases, however, if present, is pathognomonic of scar endometriosis. The inte5Smears from the endometriomas show varying cellularity comprising epithelial and spindle stromal cells, with variable number of hemosiderin laden macrophages and inflammatory cells.10 The prThe lesions in the differential diagnosis of mass associated with abdominal scar have well-defined cytological features. Desmoid tumor and fibrosis show less cellularity with benign appearing mesenchymal cells. Suture granuloma shows nonspecific inflammation with or without granulomatous elements and foreign material. Fat necrosis shows foamy macrophages, inflammatory and multinucleate giant cells, fragments of adipose tissue and no epithelial cells. Nodular fasciitis shows myxoid background and pleomorphic cells. Smears from primary or metastatic malignancies show hypercellularity with frankly neoplastic cells.The imaging modalities are non-specific but useful in determining the extent of the disease and planning of operative resection, especially in recurrent and large lesions. So, FNACen bloc resection of the myofascial elements.[The treatment of choice is wide local excision.7 Abdominelements.Scar endometriosis is an uncommon condition that primarily affects women of reproductive age. Patients usually present 2–5 years following uterine or fallopian tube surgery, with a painful nodule that may become more symptomatic during menstruation. FNAC is a relatively inexpensive, less traumatic, rapid and accurate diagnostic tool for diagnosis and to rule out other common conditions.

Temporomandibular disorders (TMDs) are characterized by persistent orofacial pain and have diverse etiologic factors that are not well understood. It is thought that central sensitization leads to neuronal hyperexcitability and contributes to hyperalgesia and spontaneous pain. Nonsteroidal anti-inflammatory drugs (NSAIDs) are currently the first choice of drug to relieve TMD pain. NSAIDS were shown to exhibit anticonvulsant properties and suppress cortical neuron activities by enhancing neuronal voltage-gated potassium KCNQ/Kv7 channels (M-current), suggesting that specific activation of M-current might be beneficial for TMD pain.In this study, we selected a new anticonvulsant drug retigabine that specifically activates M-current, and investigated the effect of retigabine on inflammation of the temporomandibular joint (TMJ) induced by complete Freund's adjuvant (CFA) in rats. The results show that the head withdrawal threshold for escape from mechanical stimulation applied to facial skin over the TMJ in inflamed rats was significantly lower than that in control rats. Administration of centrally acting M-channel opener retigabine (2.5 and 7.5 mg/kg) can dose-dependently raise the head withdrawal threshold of mechanical allodynia, and this analgesic effect can be reversed by the specific KCNQ channel blocker XE991 (3 mg/kg). Food intake is known to be negatively associated with TMJ inflammation. Food intake was increased significantly by the administration of retigabine (2.5 and 7.5 mg/kg), and this effect was reversed by XE991 (3 mg/kg). Furthermore, intracerebralventricular injection of retigabine further confirmed the analgesic effect of central retigabine on inflammatory TMJ.Our findings indicate that central sensitization is involved in inflammatory TMJ pain and pharmacological intervention for controlling central hyperexcitability by activation of neuronal KCNQ/M-channels may have therapeutic potential for TMDs. Temporomandibular disorders (TMDs) are an assortment of clinical conditions characterized by pain in the temporomandibular joint (TMJ) and/or the masticatory muscles . The maiTMDs are often managed clinically by modifying drug regimens to achieve desired therapeutic end points, but treatment of TMDs remains a clinical challenge because its diverse etiologic factors are not well understood ,3,4. Alt+ current that serves as a brake to suppress abnormal ectopic discharges of neurons and control neuronal hyperexcitability [The anticonvulsant retigabine which was discovered in the 1980 s has been shown to attenuate inflammatory and neuropathic pain in rodent animal models , and to tability ,15,20-22Nonsteroidal anti-inflammatory drugs (NSAIDs) that act as nonselective inhibitors of COXs (cyclooxygenases) are widely used as first-line drugs for TMD treatment ,23, but We started by validating CFA induces TMJ inflammation in rats. As previously described, the injection of CFA into the temporomandibular joint (TMJ) induced significant mechanical hypersensitivity in the TMJ region associated with inflammation -27. TwenIn behavioral tests, the mechanical head withdrawal threshold was measured at time points 6, 12, 24, 48 and 96 hours after CFA injection into the TMJ region. Mechanical hypersensitivity developed and reached the lowest head withdrawal threshold at 12 hours as a positive control reversed the decreased head withdrawal threshold of rats with inflamed TMJ Figure . We thenIt is known that the specific KCNQ/Kv7 channel blocker XE991 can reverse the effect of retigabine on inflammatory and neuropathic pain . To furtTo further confirm the effect of retigabine, we also measured food intake. The amount of food intake is negatively associated with TMJ pain due to the limited movement of the TMJ after inflammation ,31. AfteIn contrast, food intake was significantly decreased in rats with TMJ inflammation Figure . AdminisIn order to further confirm attenuation of allodynia with inflamed TMJs was due to reduction of central excitability by activation of KCNQ channels, we injected retigabine into the rats with TMJ inflammation intracerebroventricularly (i.c.v). Retigabine (45 or 15 μg) as well as the positive control morphine (1 μg) significantly elevated the mechanical head withdrawal threshold, as compared with the vehicle control Figure . SimilarWe were intrigued by the recent study in which two NSAIDs, the class of drugs which are the first line clinical treatment for TMD pain, were shown to suppress epileptic activities by activation of neuronal voltage-gated KCNQ/Kv7 channels . This ob+ channel conductance can suppress the hyerexcitability, thus providing a therapeutic potential for chronic pain. The voltage-gated potassium channels play a common role in repolarizing membrane potential of neurons during action potential firing. Typical neuronal firing is characterized by a specific voltage threshold for action potential, and the opening of potassium channels below the threshold (or subthreshold) will lead to the inhibition of initiation and propagation of action potential.TMD pain is considered to be a disorder characterized by central hyperexcitability and sensitization, and this is further supported by the fact that central-acting pharmacological agents including the anticonvulsant gabapentin show clinical efficacy for analgesia and anti-hyperalgesia in treatment of TMDs ,8. NeuroHead withdrawal is a response to nociceptive stimuli applied to the facial skin, and head withdrawal threshold is regulated by excitability of TRG neurons innervating the TMJ . It has The existence of a low-threshold, depolarization activated potassium current was described in 1980 and is referred to as the "M-current" because it was inhibited by the cholinergic agonist muscacine ,35. The There are no previously published studies in the literature evaluating the analgesic effect of retigabine on TMJ pain. Pharmacological treatment of TMDs remains a clinical challenge because of diverse etiologic factors that contribute to the severity of TMDs pain. Without a clear rationale based on mechanism for selection of drugs, a wide-spectrum of available drugs such as NSAIDs, antidepressants, benzodiazepines, muscle relaxants, corticosteroids, anticonvulsants and opioids etc, has been used to achieve desired therapeutic end points for TMDs. Accumulating clinical evidence shows that patients with TMDs have generalized central hypersensitivity, suggesting that anticonvulsant drugs may have therapeutic potential ,5,8. RetThis study shows the analgesic effect of retigabine operates through specific activation of neuronal KCNQ/Kv7 in TMDs in rats. Because of the central acting property of retigabine, our results indicate that the central hypersensitivity of TMD patients may be an important mechanism in this disease. Therefore, the reduction of central hyperexcitability by anticonvulsant agents may represent a potential therapeutic alternative for TMDs.Adult male Sprague Dawley rats (190-220 g) were used in this study. The experimental protocols were approved by the Animal Use and Care Committee of Peking University and were consistent with the Ethical Guidelines of the International Association for the Study of Pain. The rats were housed under controlled temperature (22 ± 1°C), on a 12 hr light/dark cycle and had free access to food and water.Because TMD pain is significantly related to synovitis, internal derangement and osteoarthritis, indicating that joint inflammation could be a major reason for TMD pain, TMJ inflammation is used universally to mimic TMD pain -47. AfteThe TMJ was removed and fixed in 4% paraformaldehyde in phosphate buffered solution (PBS) and demineralized in 15% EDTA. The specimens were dehydrated in graded alcohols and xylene, embedded in paraffin, and cut serially into 5-μm sagittal sections. The sections were stained with hematoxylin-eosin. After the staining, the sections were imaged using Olympus BX60 system microscope containing ApogeeKX85 digital camera and the images were acquired by Image Pro Plus software without any subsequent image manipulation.At least 1 week before the mechanical nociceptive threshold testing, the rats were housed in the testing room with 3-4 animals per cage. The head withdrawal threshold was measured as previously reported . BrieflyFood intake is negatively associated with TMJ inflammation/pain and can be used as an indicator of TMJ inflammation/pain ,30,31. WBefore behavioral testing, the anticonvulsant retigabine or the KCNQ/Kv7 channel blocker XE991 was dissolved in tween 80 and saline. The vehicle used in this study was a mixture of tween80 and saline in a ratio of 1:9 (v/v). Drugs were diluted to desired concentrations one day before the experiments and were stored at -20°C. All drug solutions were administered to rats intraperitoneally at a volume of 10 ml per kilogram body weight. Intraperitoneal (i.p.) injection of drug solutions and behavior testing were conducted on the basis of a double-blind and randomized design, in which one experimenter took the charge of drug injection and randomized rats dividing, whereas another experimenter who was blind to drug administration and grouping, conducted the measurements of head withdrawal threshold and food intake.Surgery was carried out as previously described . Brieflyp < 0.05 was considered to be statistically significant.Statistical analysis was performed with GraphPad Prism for Windows. All data were presented as mean ± s.e.m. Statistical significance between multiple groups was examined by one or two-way ANOVA with appropriate post hoc test (see figure legends for details). A value of ANOVA: analysis of variance; CFA: complete Freund's adjuvant; CNS: central nervous system; COXs: cyclooxygenases; DMSO: dimethyl sulfoxide; DRG: dorsal root ganglion; GABA: gamma-aminobutyric acid; NSAIDs: nonsteroidal anti-inflammatory drugs; RTG: retigabine; S.E.M.: standard error of mean; TMD: temporomandibular disorders; TMJ: temporomandibular joint.The authors declare that they have no competing interests.WX carried out behavioral assays, animal surgery, imaging and histological experiments and drafted the manuscript. YPB, LT, and YWW participated in double blind behavioral experiments. YPB and YWW helped with animal surgery, histological and imaging experiments. KWW designed and finished the final draft of the manuscript. All authors read and approved the final manuscript.

The crystal structure is stabilized by a C—H⋯π inter­action between a benzene H atom and the benzene ring of a neighbouring mol­ecule, and by inter­molecular N—H⋯S inter­actions.The title compound, C Å b = 5.8140 (7) Å c = 13.703 (4) Å β = 94.05 (3)°V = 794.5 (4) Å3 Z = 4 Kα radiationMo −1 μ = 0.34 mmT = 293 (2) K 0.20 × 0.10 × 0.02 mm Oxford Diffraction Xcalibur2 CCD diffractometerCrysAlis RED; Oxford Diffraction; 2004T min = 0.929, T max = 0.967Absorption correction: analytical (7237 measured reflections962 independent reflectionsI > 2σ(I)855 reflections with R int = 0.023 max = 23.1°θ R[F 2 > 2σ(F 2)] = 0.029 wR(F 2) = 0.077 S = 1.09 962 reflections101 parametersH-atom parameters constrainedmax = 0.20 e Å−3 Δρmin = −0.19 e Å−3 Δρ CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008PLATON (Spek, 2003PLATON.Data collection: 10.1107/S1600536808015043/lx2055sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808015043/lx2055Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Five lines of human breast-carcinoma xenografts have been tested for sensitivity to cyclophosphamide, methotrexate, 5-fluorouracil, adriamycin, vincristine and melphalan, alone and in combination, using tumour growth delay as an end-point. The xenograft lines were established and passaged in mice immune-suppressed by thymectomy and whole-body irradiation. There was a considerable range of sensitivity of the different lines to the agents studied, and within this variation there was evidence that the most effective single agent or combination differed for each tumour. Combination chemotherapy was more effective than single agents in 3 of the lines, but melphalan was more effective than either combination in the other 2. It is suggested that a panel of human breast tumours grown in immune-suppressed mice may prove useful in testing new cytotoxic agents for activity against breast cancer before their use in clinical trials, and that more effective combinations of existing drugs might be designed with the aid of this system.

Many medical images suffer from the partial volume effect where aboundary between two structures of interest falls in the midst ofa voxel giving a signal value that is a mixture of the two. Wepropose a method to restore the ideal boundary by splitting avoxel into subvoxels and reapportioning the signal into thesubvoxels. Each voxel is divided by nearest neighbor interpolation. The gray level of eachsubvoxel is considered as “material” able to move betweensubvoxels but not between voxels. A partial differential equationis written to allow the material to flow towards the highestgradient direction, creating a “reverse” diffusion process. Flowis subject to constraints that tend to create step edges. Materialis conserved in the process thereby conserving signal. The methodproceeds until the flow decreases to a low value. To test themethod, synthetic images were downsampled to simulate the partialvolume artifact and restored. Corrected images were remarkablycloser both visually and quantitatively to the original imagesthan those obtained from common interpolation methods: onsimulated data standard deviation of the errors were 3.8%, 6.6%, and 7.1% of the dynamic range for the proposedmethod, bicubic, and bilinear interpolation, respectively. Themethod was relatively insensitive to noise. On gray level, scannedtext, MRI physical phantom, and brain images, restored imagesprocessed with the new method were visually much closer tohigh-resolution counterparts than those obtained with commoninterpolation methods.

Non-ketotic hyperglycinemia (NKGH) is an autosomal recessive disorder of glycine metabolism. Defective glycine cleavage results in elevated concentrations of glycine in plasma, urine and cerebrospinal fluid. The accumulation of glycine, an inhibitory neurotransmitter, leads to a clinical presentation of apnea, lethargy, hypotonia, seizures, and severe psychomotor retardation. There are four clinical variants of NKHG, which have been described in the medical literature. Neonatal NKHG is the most common as well as the most devastating and lethal form of the disorder. Given the multi-system involvement of the disorder, there are several perioperative concerns of such patients with delayed emergence requiring supported ventilation being a common postoperative outcome for NKHG patients. We report the perioperative management of a 4-year-old boy with NKGH who required anesthetic care during an adenoidectomy and tonsillectomy for obstructive sleep apnea. Glycine encephalopathy, also known as non-ketotic hyperglycinemia (NKHG), is an autosomal recessive disorder caused by a defect in the glycine cleavage system. NKHG is classically associated with neonatal apnea, lethargy, hypotonia, and seizures followed by severe psychomotor retardation. Glycine, like gamma amino-butyric acid (GABA), is an inhibitory neurotransmitter in the central nervous system (CNS). However, both inhibitory and excitatory CNS features may occur in NKHG. To date, there are no reports regarding the perioperative care of such patients. We present a 4-year-old boy with NKHG who required adenoidectomy and tonsillectomy for obstructive sleep apnea (OSA). The perioperative care of such patients is discussed.3, hemoglobin of 15.4 gm/dL, hematocrit of 43%, and a platelet count of 429,000/mm 3. During the sleep study, the lowest O2 saturation recorded was 86%, which occurred with a 22 s partial episode of OSA. End-tidal CO 2 waveforms were suboptimal due to mouth breathing. There were no central apneas and no episodes of periodic breathing. There were 33 obstructive apneas and 39 partial obstructive apneas. The apnea-hypopnea index was 10.7.Review of this patient’s medical records and presentation of this case report was conducted within the standards of the Institutional Review Board of the University of Missouri. The patient was a 4-year-old, 12.7 kg boy who presented for a tonsillectomy and adenoidectomy for OSA. Prior to the scheduled surgery, he was evaluated in the ENT clinic for suspected upper airway obstruction and chronic aspiration, and was determined to have OSA documented by a sleep study. His past medical history was significant for NKHG, developmental delays, static encephalopathy, and multiple admissions for treatment of a partial complex seizure disorder and other medical disorders related to NKHG. His past surgical and procedural history included a recent Nissen fundoplication, G-tube placement, and serial injections of botulinum toxin for treatment of spasticity. Following the recent Nissen fundoplication, he required postoperative mechanical ventilation due to prolonged awakening. Current medications, all administered via his G-tube, included sodium benzoate 300 mg TID, phenobarbital 40 mg BID, loratadine 2.5 mg every day, levocarnitine 300 mg BID, vitamin B6 (pyridoxine) 25 mg once a day, levetiracetam 300 mg BID, leucovorin 15 mg every morning, glycopyrrolate 1 mg TID, baclofen 20 mg BID, dextromethorphan 60 mg TID. The patient had no known drug allergies. Physical examination revealed a neurologically impaired child, who was awake and alert, but non-communicative. He was microcephalic. There were random eye and head movements. The examination of the oral cavity and oropharynx was remarkable for marked tonsillar hypertrophy. Heart and lung sounds were normal. There were no signs of stridor, retractions, or cyanosis. His muscle tone was increased in all extremities. Vitals included a temperature of 37.4°C, pulse rate of 102 beats/minute, respiratory rate of 24 breaths/minute, blood pressure of 130/66 mmHg, and an oxygen saturation of 96% on room air. Laboratory data revealed a white blood cell count of 19,700/mmnil per os for solids for 6 h and clear liquids for 2 h. No premedication was administered and he was transported to the operating room where standard ASA monitors were placed. Prior to the administration of any medications, a bispectral index (BIS) monitor was placed and demonstrated an awake BIS value of 41. The patient was preoxygenated with 100% oxygen and a 22 gauge peripheral intravenous catheter was placed. Anesthesia was induced with remifentanil (2 μg/kg) and propofol (2.5 mg/kg). After demonstration of adequate bag-valve-mask ventilation, endotracheal intubation was facilitated by cis-atracurium (0.15 mg/kg). Additional medications included dexamethasone (0.5 mg/kg), glycopyrrolate (5 μg/kg), ondansetron (0.15 mg/kg), and acetaminophen (40 mg/kg per rectum). Using train-of-four (TOF) monitoring, the ablation of the T 4 occurred at 80 s. Anesthesia was maintained with 70% nitrous oxide in oxygen and a remifentanil infusion was started at 0.2 μg/kg/min. During the procedure, the BIS varied from 32 to 55. Remifentanil was titrated according to the hemodynamic parameters in a dose that varied from 0.2 to 1 μg/kg/min. No additional cis-atracurium was administered. The return of T1 of the TOF was noted at 15-17 min and four twitches were present at 20-22 min. The surgical procedure was completed in 25-30 min and residual neuromuscular blockade was reversed with neostigmine and glycopyrrolate. The remifentanil infusion was discontinued and within 10 min, the patient’s trachea was extubated. Postoperatively while in the post-anesthesia care unit, he received two doses of nalbuphine for analgesia. With both of these doses of nalbuphine, the patient’s respiratory rate decreased to 8-10 breaths per minute and his agitation ceased. He was admitted to the Pediatric ICU for monitoring. On postoperative day #1, he developed an oxygen requirement and became febrile. A postoperative chest radiograph was unremarkable. Over the next 24 h, he required frequent suctioning of the oropharynx to help with the clearance of secretions. The patient’s temperature returned to normal and his respiratory status improved. On postoperative day #2, he was discharged home.The patient was held NKHG, also termed glycine encephalopathy, is an autosomal recessive disorder of glycine metabolism. This rare, but severe neurologically disabling disorder, has an incidence of approximately 1:200,000. A defect in the mitochondrial glycine cleavage system results in an elevation of the glycine concentration in the plasma, urine and cerebrospinal fluid (CSF).2 Like γ-a4There have been four clinical variants of NKHG described in the medical literature. Neonatal NKHG is the most common as well as the most devastating and lethal form of the disorder. As noted in our patient, it generally presents in first few days of life with poor feeding, failure to suck, lethargy, hypotonia, apnea, coma, and seizures. Even with supportive therapy, 30% of infants die and the remainder develop profound psychomotor retardation and intractable seizures. Infantile NKHG presents in a similar manner as the neonatal form; however, signs and symptoms develop after 6 months of age in a previously healthy infant with seizures being the most common presenting sign. The infantile form generally has a milder course than the neonatal form although there is some degree of developmental delay. Late onset NKHG has only been described in a few patients with the age of onset varying from 2 years into the third decade of life. The transient form of NKHG is also exceedingly uncommon. It presents in a manner similar to that of the neonatal form, but there is normalization of the blood and CSF glycine levels and resolution of the signs and symptoms by 2 to 8 weeks of life.[The laboratory diagnosis of NKHG begins with the measurement of plasma and CSF glycine levels. A CSF/plasma glycine ratio ≥ 0.08 is considered diagnostic for NKHG. Confirmation of the diagnosis requires mitochondrial enzymatic analysis obtained from a liver biopsy, which is typically not done in most patients because of the difficulty in obtaining an adequate sample size. Early treatment with sodium benzoate and dextromethorphan has been shown to improve clinical and electrophysiologic outcome in some cases. Sodium benzoate, after activation to its coenzyme A ester, conjugates with glycine to form hippurate, which is efficiently excreted in the urine. Providing high doses of benzoate allows for the removal of large amounts of glycine in urine and results in a reduction of plasma glycine levels to normal. This treatment reduces seizures and improves alertness, but does not prevent the development of mental retardation. Additional therapy which may be helpful in the control of seizures and other neurologic manifestations of NKHG includes dextromethorphan. Dextromethorphan antagonizes the effects of glycine at the NMDA receptors, thereby reducing the seizure frequency and improving electroencephalographic findings in NKHG patients.8The challenges regarding the anesthetic management of patients with NKHG are related to the potential interaction of various anesthetic agents and the neuroinhibitory pathophysiology of the disorder as well as the various end-organ manifestations of the disordered. Delayed emergence from general anesthesia was noted previously in our patient following the use of sevoflurane and fentanyl during anesthetic care for a Nissen fundoplication. Liu and Fan reported delayed emergence from anesthesia following the administration of only sevoflurane during performance of a bronchoscopy in a 3-year-old girl with NKHG. The patiOur patient presented with an awake BIS value of 41. Therefore, we attempted to tailor our anesthetic care to provide a rapid awakening by avoiding the use of the potent inhalational anesthetic agents and instead using a technique employing nitrous oxide and the short acting opioid remifentanil. Given its metabolism by non-specific esterases, there are limited changes in its pharmacokinetics regardless of the patient’s age or the presence of co-morbid disease processes.11 Even iAn additional concern in our patient was postoperative respiratory function as he presented with signs and symptoms of OSA due to tonsillar hypertrophy. The potential for airway compromise was augmented by other co-morbid factors including hypotonia, frequent seizures, and the baseline altered mental status (awake BIS of 41). These factors may have been further magnified by the potential for pharyngeal edema related to the surgical procedure. In such patients, the use of short-acting anesthetic agents may also be beneficial as it would help to eliminate the effects of residual anesthetic agents on respiratory function and the control of upper airway patency. The potential for postoperative respiratory compromise in patients with co-morbid diseases such as NKHG is illustrated by our patient who developed an oxygen requirement and became febrile on postoperative day 1. Although a postoperative chest radiograph was unremarkable, these clinical signs and symptoms were likely related to atelectasis further emphasizing the need for close postoperative monitoring of respiratory function in such patients. Additionally, during the initial 24 h postoperative period, frequent suctioning was required to facilitate the clearance of secretions. We would also suggest that given the neurologic involvement that is present with NKHG, there may be the potential for increasing sensitivity to opioids in patient as there was a rather dramatic decrease in our patient’s respiratory rate when nalbuphine (0.1 mg) was administered for the treatment of pain in the post-anesthesia care unit.4 of the TOF occurred at 80 s. T1 of the TOF was noted at 15-17 min and four twitches were present at 20-22 min. Despite the spontaneous return of neuromuscular function, we chose to reverse residual neuromuscular blockade to eliminate any potential for residual weakness which might affect postoperative respiratory function. Alternatively, if avoidance of a NMBA was desired, successful endotracheal intubation can be accomplished under deep sevoflurane anesthesia or with a combination of propofol and remifentanil.[An additional concern in any patient with hypotonia is the choice of neuromuscular blocking agent (NMBA). Although an NMBA was not necessary for the completion of the surgical procedure in our patient, given that we were using a nitrous oxide-opioid based technique, we chose to use a single dose of NMBA to facilitate endotracheal intubation. Although there is no information regarding the use of neuromuscular blocking agents in patients with NKHG, we chose to extrapolate data from other patients with hypotonia and therefore would caution against the use of succinycholine and suggest that a short-acting non-depolarizing agent may be most appropriate. In patients with various myopathic conditions, previous authors have reported the successful use of mivacurium, which unfortunately is no longer available.13 As sucfentanil.15A universal finding in patients with NKHG is the presence of seizures. In general, most patients with seizures require no special perioperative management other than that of the underlying disease. We would recommend the documentation of adequate preoperative plasma concentrations of anticonvulsant medications and the continuation of perioperative dosing. This may include preoperative administration on the morning of surgery and intraoperative dosing as required. Intravenous preparations of many anticonvulsant medications are available and these should be administered intraoperatively to maintain therapeutic serum concentrations and avoid perioperative seizures which may impact on postoperative respiratory function. Postoperatively, if intravenous preparations are not available, rectal administration may be feasible for many of these medications. In patients with NKHG, other medications are administered to lower plasma glycine concentrations (sodium benzoate) or antagonize the effects of glycine (dextromethorphan). Ongoing administration of these medications should also be continued perioperatively including preoperative dosing on the morning of surgery.Given the involvement of the NMDA system in the pathogenesis of the disease process, it has been suggested that other medications which block the NMDA receptor such as ketamine or magnesium should be considered during anesthetic care in patients with NKHG.17 Given 2 -antagonists) or agents which speed gastric motility and emptying (metoclopramide) thereby decrease the volume of gastric secretions.Like many other neurological disorders that result in altered mental status and hypotonia, NKGH patients may be prone to gastroesophageal reflux and thereby at risk for perioperative acid aspiration and its consequences. In our patient, we felt that this risk had been minimized by the previous performance of a Nissen fundoplication and lack of parental reports of issues related to gastroesophageal reflux such as vomiting. If there are concerns regarding the potential for acid aspiration, typical therapies to be considered include rapid sequence induction, the application of cricoid pressure, or the administration of medications with either decrease the pH of gastric secretions (non particulate antacids, proton pump inhibitors or HIn conclusion, we suggest that the perioperative management of patients with NKHG should involve tailoring the anesthetic care to enable rapid awakening and avoidance of residual anesthetic effects which may impact postoperative respiratory function and upper airway control. When necessary, the choice of NMBA should consider the myopathic nature of the disorder. Additional perioperative concerns include ongoing administration of medications aimed to control plasma glycine levels and its end-organ effects as well as continuation of anticonvulsant medications. Given the progressive CNS deterioration that accompanies this disorder, aspiration prophylaxis should be considered in patients with gastroesophageal reflux. Postoperative monitoring should be considered given the potential for perioperative airway and respiratory complications.

Myosin-Vb has been shown to be involved in the recycling of diverse proteins in multiple cell types. Studies on transferrin trafficking in HeLa cells using a dominant-negative myosin-Vb tail fragment suggested that myosin-Vb was required for recycling from perinuclear compartments to the plasma membrane. However, chemical-genetic, dominant-negative experiments, in which myosin-Vb was specifically induced to bind to actin, suggested that the initial hypothesis was incorrect both in its site and mode of myosin-Vb action. Instead, the chemical-genetic data suggested that myosin-Vb functions in the actin-rich periphery as a dynamic tether on peripheral endosomes, retarding transferrin transport to perinuclear compartments.In this study, we employed both approaches, with the addition of overexpression of full-length wild-type myosin-Vb and switching the order of myosin-Vb inhibition and transferrin loading, to distinguish between these hypotheses. Overexpression of full-length myosin-Vb produced large peripheral endosomes. Chemical-genetic inhibition of myosin-Vb after loading with transferrin did not prevent movement of transferrin from perinuclear compartments; however, virtually all myosin-Vb-decorated particles, including those moving on microtubules, were halted by the inhibition. Overexpression of the myosin-Vb tail caused a less-peripheral distribution of early endosome antigen-1 (EEA1).All results favored the peripheral dynamic tethering hypothesis. Whilekaryotes . Biophyskaryotes -12, but Myosin-Vb, originally named myr 6 , is a meOverexpression of tail fragments of unconventional myosins has been the standard technique for their inhibition, and data from these experiments are usually interpreted in the context of point-to-point transport. For myosin-Vb in transferrin trafficking, overexpression of a tail fragment in HeLa cells caused accumulation of transferrin in perinuclear compartments, suggesting that myosin-Vb functions in the transport of vesicles between perinuclear recycling endosomes and the plasma membrane . By contThese apparently contradictory results could be reconciled if myosin-Vb acts peripherally as a dynamic tether that antagonizes the retrograde transport of transferrin to perinuclear compartments, possibly by holding the parental organelle in the periphery during fission. We also observed an increase in plasma-membrane transferrin receptor upon myosin-Vb inhibition , suggestOur hypothesis is illustrated in Fig. after transferrin loading will neither cause accumulation of transferrin in perinuclear compartments nor prevent transferrin from moving from perinuclear compartments to the plasma membrane; and third, overexpression of the myosin-Vb tail fragment will cause at least some peripheral endocytic markers to assume more perinuclear distributions. The new data generally contradict the transport hypothesis. In addition, our data suggest that members of the myosin-V family may play a ubiquitous function in modulating vesicle transport along microtubules, as they are available to interact with passing actin filaments as passengers. Applied more broadly, our data suggest that identifying endocytic compartments by their positions within the cytoplasm may be unreliable in the context of significant experimental disruptions.In this study, we have employed three different perturbations of myosin-Vb function to further test the dynamic tethering hypothesis, which makes clear predictions: first, overexpression of full-length, functional myosin-Vb will prevent transferrin from reaching perinuclear compartments; second, chemical-genetic inhibition of sensitized mutant myosin-Vb in cells We have shown that expression of low levels of exogenous myosin-Vb (25–40% of endogenous levels) does not alter the trafficking of transferrin . HoweverFigure before and during overexpression of eGFP-myosin-Vb sequestered transferrin in large peripheral compartments decorated with myosin-Vb -ADP (PE-ADP) [In a previous study, we used a chemical-genetic approach to show that induction of tight binding of sensitized myosin-Vb to actin, artments . Our hypant Fig. and wild(PE-ADP) . Only ceWhile the inhibition of the Y119G sensitized mutant myosin-Vb in preloaded cells did not cause transferrin accumulation in perinuclear compartments, the data were not as simple as they were predicted to be by the dynamic tethering hypothesis, as myosin-Vb inhibition retarded the depletion of transferrin from perinuclear compartments relative to control cells Fig. . Upon clThe arrest of microtubule-based motility of myosin-Vb-decorated particles was unexpected, and we initially suspected that it might have been an artifact of high effective ADP concentration in the form of the microinjected PE-ADP analog. To test the hypothesis that myosin-Vb interacts transiently with actin filaments during microtubule-based transport under normal conditions, we measured the speeds of particles decorated with wild-type eGFP-tagged myosin-Vb before and after the addition of latrunculin A. If myosin-Vb (or other myosins) normally interacts with actin filaments, latrunculin A treatment should increase both mean speed and the proportion of vesicles moving at 0.7–1.0 μm/sec. This prediction was confirmed, as latrunculin treatment nearly doubled the proportion of particles exhibiting rapid movement Figure , in contThe dynamic tethering hypothesis further predicts that some markers found in peripheral endocytic compartments are likely to be shifted to a more perinuclear distribution by myosin-Vb tail overexpression Fig. . We testBased on the change in distribution of EEA1 coupled with its failure to colocalize with the myosin-Vb tail, we hypothesize that in the presence of the tail, endosomes still are transported to more perinuclear regions of the cytoplasm, but the fission between their domains that normally occurs in peripheral regions occurs in a more perinuclear location. We then confirmed the effect of the myosin-Vb tail on Rab11a redistribution. As observed by Lapierre et al., the dispersed pattern observed in untransfected control cells . The sensitized Y119G mutant eGFP myosin-Vb was created by shuttling a 989-bp yosin-Vb . The con6 cells/ml. The cell suspension (80 μl) was added to the DNA/liposome mixture and plated as 40-μl dots in live-cell chambers or glass coverslips, incubated for 1–2 h and then flooded with complete medium. Cells were used in experiments 24–48 h after transfection.HeLa cells were cultured as described . For traEEA1 was detected using a monoclonal antibody (BD Transduction Laboratories 610456). The primary antibody was detected with Alexa-546- or Alexa-647-labeled goat anti-mouse secondary (Invitrogen). For cell outlines, actin was stained with Alexa-647-labeled phallacidin (Invitrogen).Transfected cells were incubated in serum-free medium for 60 min, then exposed to 10 μg/ml Alexa 546-labeled transferrin (Invitrogen) for 1 min, washed 3 times with PBS and incubated in pre-equilibrated complete medium for the duration of live-cell experiments. For concomitant labeling with transferrin before expression of exogenous eGFP-myosin-Vb Fig. , fluoresAll images were obtained using a Nikon TE2000E equipped with a Q57 12-bit CCD camera (Roper Scientific) controlled by MetaMorph software. Images were obtained through a 60× (1.2 NA) water-immersion lens that was maintained at 37°C using an objective heater (Bioptechs). For time-lapse movies, images were obtained at a rate of 1 frame/sec over a 1-min time course. Fluorescence imaging of the dextran to identify injected cells was performed following the time-lapse imaging. Instantaneous speeds of individual particles were measured by observers using the Track Points package of MetaMorph and the data were exported to Microsoft Excel. Measurements were obtained from 5–10 cells per condition, and numbers of particles are provided in the Figure All videos are of HeLa cells.N6-(2-phenylethyl)-ADP.EEA1: early endosomal antigen-1; and PE-ADP: DWP performed most of the experiments, performed most of the data analysis, and designed the project. EJA, PRW, and DZC analyzed particle speeds and assisted in experiments as summer research interns. CMS assisted in performing experiments. JAM designed the project with DWP, performed data analysis, and wrote the manuscript.Low-level expression of full-length eGFP-myosin-Vb (green) shows rare, dynamic colocalization (circles) of myosin-Vb and transferrin (red); same cell as shown in Figure Click here for fileOverexpression of full-length eGFP-myosin-Vb (green) in the presence of transferrin produces enlarged, less-motile peripheral endosomes decorated with myosin-Vb and containing transferrin at 24 h post transfection; same cells as shown in Figure Click here for fileOverexpression of full-length eGFP-myosin-Vb produces enlarged, less-motile peripheral endosomes decorated with myosin-Vb; same field as shown in Figure Click here for fileOverexpression of full-length eGFP-myosin-Vb (not shown) prevents entry of Alexa 546-labeled transferrin (shown) into perinuclear compartments; same field as Additional file Click here for fileOverlay of Additional file Click here for fileRab11a (red) colocalizes with eGFP-myosin-Vb (green) at high myosin-Vb expression levels. Frame acquisition rate, 0.5/sec; frame display rate, 6/sec.Click here for fileRab4 (red) does not colocalize with eGFP-myosin-Vb (green) at high myosin-Vb expression levels. Frame acquisition rate, 0.5/sec; frame display rate, 6/sec.Click here for fileRab5 (red) does not colocalize with eGFP-myosin-Vb (green) at high myosin-Vb expression levels. Frame acquisition rate, 0.5/sec; frame display rate, 6/sec.Click here for fileChemical-genetic inhibition of sensitized mutant (Y119G) eGFP-myosin-Vb by PE-ADP microinjection does not prevent movement of transferrin-positive particles. Cells were loaded with fluorescent transferrin (red) 30 min before myosin-Vb was inhibited in the center cell by PE-ADP. Frame acquisition rate, 1/sec; frame display rate, 3/sec.Click here for fileChemical-genetic inhibition of sensitized mutant (Y119G) eGFP-myosin-Vb by PE-ADP microinjection (cell on left) halts movement of all myosin-Vb-decorated particles, including those being transported via microtubules; same field as Figure Click here for fileSame conditions as Additional file Click here for fileNegative control cell expressing wild-type eGFP-myosin-Vb; PE-ADP injection (immediately before imaging) does not halt movement of myosin-Vb-decorated particles. Frame acquisition rate, 1/sec; frame display rate, 10/sec.Click here for file

Cartilage oligomeric matrix protein (COMP) is a homopentameric protein in cartilage. The development of arthritis, like collagen-induced arthritis (CIA), involves cartilage as a target tissue. We have investigated the development of CIA in COMP-deficient mice.COMP-deficient mice in the 129/Sv background were backcrossed for 10 generations against B10.Q mice, which are susceptible to chronic CIA. COMP-deficient and wild-type mice were tested for onset, incidence, and severity of arthritis in both the collagen and collagen antibody-induced arthritis models. Serum anti-collagen II and anti-COMP antibodies as well as serum COMP levels in arthritic and wild-type mice were measured by enzyme-linked immunosorbent assay.COMP-deficient mice showed a significant early onset and increase in the severity of CIA in the chronic phase, whereas collagen II-antibody titers were similar in COMP-deficient and wild-type controls. COMP antibodies were not found in wild-type mice. Finally, COMP-deficient and wild-type mice responded similarly to collagen antibody-induced arthritis, indicating no difference in how collagen II antibodies interact with COMP-deficient cartilage during the initial stages of arthritis.COMP deficiency enhances the early onset and development of chronic arthritis but does not affect collagen II autoimmunity. These findings accentuate the importance of COMP in cartilage stability. Rheumatoid arthritis (RA) is a human autoimmune disease that affects the synovial membranes of the peripheral joints. RA characteristically involves the infiltration of leukocytes into the synovium, which undergo inflammation and swelling . RA in hIn 1977, Trentham and colleagues developeCOMP is a 524-kDa homopentameric extracellular matrix glycoprotein and a member of the thrombospondin (TSP) family . To dateWe have previously generated COMP-deficient mice to study the role of COMP in cartilage tissues . SurprisTo test whether COMP deficiency, like collagen IX deficiency, influences the antigenic/immunogenic properties of the cartilage, we decided to study COMP-deficient mice in the CIA and CAIA models. In this paper, we present results indicating that COMP deficiency makes arthritic mice develop an early onset and more severe disease during the chronic phase. We also present data showing that the exacerbation of the disease in arthritic COMP-deficient mice is independent of how pathogenic antibodies penetrate the cartilage in the acute stage of the disease, which is contrary to the case in collagen IX-deficient mice . Finallyad libitum in the animal house of the Department of Pathology, Lund University . All experiments described here were performed on age-matched mice between 8 and 10 weeks of age. The Lund-Malmö laboratory animal ethics committee approved the animal experiments described in this article.The generation of COMP-deficient 129/Sv mice has been described previously . COMP-deThe mice were injected subcutaneously at the base of the tail with 100 μg of rat CII emulsified in 0.1 M acetic acid combined with an equal amount of complete Freund's adjuvant . CII was purified from the Swarm rat chondrosarcoma as previously described . At day Escherichia coli 055:B5 (25 μg/mouse) was injected intraperitoneally to enhance the incidence and severity of arthritis. The mice were monitored daily for arthritis development after antibody injection (both before and after LPS injection), using the same macroscopic scoring system as described above for CIA.To induce CAIA, the mice were injected with a mixture of equal concentrations of sterile filtered CIIC1 (IgG2a), M2139 (IgG2b), CIIC2 (IgG2b), and UL1 (IgG2b) monoclonal antibodies against different CII epitopes . Mice weNM016685] and comprising the entire COMP open reading frame, except the signal peptide, was amplified by polymerase chain reaction (PCR), using primers mCOMP-TNT-F (5'-CAGGGCCAGATCCCGCTG-3') and mCOMP-TCG-R (5'-CGTGCTAGCCTAAACTCTCTGCAGCC-3'), introducing a downstream Nhe I restriction site. The PCR product was subcloned into plasmid pCR-SCRIPT and sequenced. This revealed a mutation compared with the reference sequence. This may represent a naturally occurring allele, but since the mutated residue is conserved in human, chimp, bovine, equine, and rat COMP, the cDNA sequence was corrected by site-directed mutagenesis using the QuikChange kit and primers FwdMUT (5'-CCCCCTGGGTTCAGCGGGCCCACCCACGAGGGCGTGGGACTGACC-3') and RevMUT (5'-GGTCAGTCCCACGCCCTCGTGGGTGGGCCCGCTGAACCCAGGGGG-3'). The corrected COMP cDNA fragment was isolated by digestion with Bgl I and Not I restriction enzymes and ligated into the corresponding sites in the expression vector pCEP4-BM40-hisEK. The resulting mouse COMP expression plasmid was transfected into 293-c18 cells (ATCC CRL-10852) and selected with hygromycin. Afterwards, conditioned medium was collected and the his-tagged recombinant mouse COMP was purified through Ni2+-metal chelating and MonoQ ion exchange chromatography. Protein content was determined by measuring absorbance at 280 nm, using a calculated extinction coefficient of 71,390/M per cm.Production of recombinant mouse cartilage oligomeric matrix proteinA mouse COMP cDNA clone was kindly provided by Liu Chan Ju . A cDNA fragment corresponding to nucleotides 72 to 2,282 in the mouse COMP reference sequence [GenBank Antibody levels against COMP in serum were analyzed by enzyme-linked immunosorbent assay (ELISA) using recombinant mouse COMP. Recombinant COMP , pH 7.4) was used for coating overnight at 4°C, and plates were pre-blocked with 1% bovine serum albumin in PBS to avoid background disturbance. All washings were performed by using PBS with 0.1% Tween 20 (pH 7.4). The serum was diluted in PBS and analyzed in duplicate, and then biotin-conjugated goat anti-mouse heavy- and light-chain antibodies were added, followed by europium-labeled streptavidin , and enhancement solution ; the amount of antibody was detected by dissociation-enhanced time-resolved fluoroimmunoassays research fluorometer. Serum samples from COMP-induced arthritis mice were used as a positive control. Antibody titers against CII in serum were determined by sandwich ELISA similar to COMP antibody assay, except the plates were coated with 10 μg/mL CII . AntibodSerum concentration of COMP was determined by a competitive ELISA . Rat COMt test. Severity comparison was performed by the Mann-Whitney U test. All results obtained from COMP-deficient mice were compared with those obtained from B10.Q wild-type littermate controls. Differences were considered to be statistically significant for P values of less than 0.05.Quantitative data are expressed as mean ± standard error of the mean, and significance analysis of disease onset was performed by using the Student q molecule allowing an immune response to CII [To determine a possible effect of COMP deficiency on CIA and CAIA, we backcrossed COMP-deficient 129/Sv mice with B10.Q mice. The B10.Q mouse has a C57BL/10 genetic background and a DBA/1-derived congenic fragment containing the MHC class II gene AP < 0.05). There was no change in severity during the acute phase between COMP-deficient mice and wild-type mice and chronic phase (from days 66 to 158), because there was a decrease in the mean arthritis score after day 66 in wild-type mice. COMP deficiency led to early onset of the disease, with a mean onset of arthritis at 37.5 ± 2.81 days in COMP-deficient mice compared with 48.4 ± 13.7 days in the wild-type littermate group (Antibodies have been shown to play an important role in arthritis onset and the severity of the disease ,31. BothThe serum COMP level is used as a biomarker both in humans and in experimental animals to detect ongoing inflammation in the joints as well as a measure of severity of the arthritis induced -5. HenceTo induce CAIA, the mice were injected with a standard cocktail of CIIC1, M2139, CIIC2, and UL1 monoclonal antibodies directed against dominant B-cell epitopes of CII. We observed a possible influence on disease onset in COMP-deficient mice, with the mean onset day in COMP-deficient mice of 5.1 ± 3.35 days compared with 6.85 ± 3.4 days in control mice. This difference was not significant. Consistent with CIA results, no difference was found in the incidence of arthritis between COMP-deficient and wild-type littermate controls Figure . Both grCOMP is a major non-collagenous component of cartilage and contributes about 1% of the wet weight of articular cartilage . COMP haHere, we show that COMP-deficient mice develop an early-onset CIA and more severe arthritis during the chronic phase of the disease.The findings that COMP-deficient mice develop severe autoimmune CIA indicate that COMP deficiency makes the cartilage more susceptible to an inflammatory attack. Antibodies play a critical role in the initiation of CIA ,31. The It has been reported that pentameric COMP binds to collagen I/collagen II and collThe primary target cartilage antigen in CIA is CII, which initiates the autoimmune reaction leading to arthritis. In the course of the disease, when the erosion of the cartilage is taking place, it is possible that immune reactions to other cartilage proteins are initiated and contribute to the disease course. In the CIA model, COMP was found to be released to serum. Using COMP-deficient mice as a negative control and mice immunized with COMP to induce arthritis as a positive control, we investigated whether there was an immune response against COMP during CIA. We did not find COMP antibodies at any point during the whole disease course, suggesting no involvement of immune response against COMP in CII-induced arthritis.COMP deficiency in mice subjected to CIA did not affect either incidence or anti-CII antibody titers but caused a significant early onset and increase in the severity of the disease during the chronic phase of arthritis. Arthritic B10.Q mice suffering from CIA did not respond immunologically to COMP by means of COMP antibody synthesis. Results of the CAIA study demonstrate that antibodies accessed CII epitopes similar in COMP-deficient and COMP-sufficient mice. Our results emphasize the importance of COMP in cartilage stability, and the mechanism underlying the exacerbation of CIA in COMP-deficient mice is assumed to be found in COMP-dependent changes in the cartilage erosion/repair process.CAIA: collagen II antibody-induced arthritis; CIA: collagen-induced arthritis; CII: collagen II; COMP: cartilage oligomeric matrix protein; ELISA: enzyme-linked immunosorbent assay; LPS: lipopolysaccharide; MED: multiple epiphyseal dysplasia; MHC: major histocompatibility complex; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; PSACH: pseudoachondroplasia; RA: rheumatoid arthritis; TSP: thrombospondin.The authors declare that they have no competing interests.HG was responsible for the majority of the practical work and the writing of the manuscript. The study was originally designed by RM, AA, ÅO, and SC in collaboration with RH. KSN helped with CAIA experiments. All authors were involved in different methodological parts, the interpretation of data, and the writing of the manuscript. All authors read and approved the final manuscript.

In order to make it easy to perform computed tomography (CT)-guided vertebroplasty a stereotactic guidance system called the "stereo-guide" was designed. A method to perform CT-guided vertebroplasty using this system is described.The device is a rectangular flat plastic block. One of the flat surfaces of the block has deeply grooved protractor markings at 5-degree intervals; ranging from 0 to 30 degrees. The procedure is performed on the CT table. Based on distances and angle measurements obtained from CT images the device is placed on an appropriate location on the back of the patient and the needle is advanced to the target through the pedicle guided by the grooves on the device. Ten procedures were performed in nine patients with lumbar and thoracic pathology.The system was easy to use and proved to be accurate. No complication resulted from the procedure.The stereo-guide proved to be simple and easy to use. Intraoperative scans helped to plan the trajectory and follow the injection of the cement. Vertebroplasty is a common procedure for compression fractures of vertebral bodies associated with pain. The proc1235The device . Six procedures were at L1; two at L2; and one each at L3 and T10.This is a simple device with straightforward methodology. In our small experience it was found to be useful. Since it is handheld it can introduce errors. However, because intraoperative scans are obtained these errors are corrected to get accurate placement of the needle. Furthermore, the procedures were done under general anesthesia to prevent patient movement. The system could be improved by having a rigid system to hold it in place; and by having a rigid probe holder.Though fluoroscopic images offer a straightforward technique, the distinct advantage of CT images is that they provide images in the axial, coronal and sagittal planes. In addition, we were able to have entry to the target through only one pedicle; because it is easy to plan a trajectory to a target close to the middle of the vertebral body using this device.There may be concern about how quickly one can obtain scans while following the entry of the cement into the vertebral body. Fortunately, most modern scanners are very fast and have a viewing screen in the scanner room. It is, therefore, possible to obtain a successive series of scans and observe the flow of the cement in the scanner room during injection. In addition, one can also use the CT-fluoroscopic mode.Most CT scanners can display images in all three planes almost immediately after the scans are obtained. Therefore, display of the needle in all three planes as it is being advanced to the target makes this system particularly useful for patients who have severe compression fractures. Similarly, it also makes it easy to follow the flow of the cement in all three planes, especially when there is concern of flow of cement into the spinal canal in patients who have minimal retropulsion of fractured segment.In summary, a simple device and methodology for CT-guided vertebroplasty is described. Use of intraoperative CT scans made this procedure accurate. Furthermore, axial CT images enabled us to perform the procedure through a single pedicle.

Non-small-cell lung carcinomas (NSCLCs) exhibit poor prognosis and are usually resistant to conventional chemotherapy. Absence of p21WAF1/CIP1, a cyclin-dependent kinase (cdk) inhibitor, has been linked to drug resistance in many in vitro cellular models. RNA activation (RNAa) is a transcriptional activation phenomena guided by double-strand RNA (dsRNA) targeting promoter region of target gene.In this study, we explored the effect of up-regulation of p21 gene expression on drug-resistance in A549 non-small-cell lung carcinoma cells by transfecting the dsRNA targeting the promoter region of p21 into A549 cells.Enhanced p21 expression was observed in A549 cells after transfection of dsRNA, which was correlated with a significant growth inhibition and enhancement of chemosensitivity to cisplatin in A549 cells in vitro. Moreover, in vivo experiment showed that saRNA targeting the promoter region of p21 could significantly inhibit A549 xenograft tumor growth.These results indicate that p21 plays a role in lung cancer drug-resistance process. In addition, this study also provides evidence for the usage of saRNA as a therapeutic option for up-regulating lower-expression genes in lung cancer. Lung cancer is the most common cause of cancer mortality worldwide. Non-small-cell lung carcinomas (NSCLCs), which represent around 80% of lung tumors, exhibit poor prognosis and are usually resistant to conventional chemotherapy. Cisplatin is one of the most potent anticancer agents, displaying significant clinical activity against a variety of solid tumors. The most effective systemic chemotherapy for non-small cell lung cancer (NSCLC) was cisplatin-based combination treatment. Unfortunately, the outcome of cisplatin therapy on NSCLC seems to be unsatisfactory. The use of cisplatin in cancer chemotherapy is limited by acquired or intrinsic resistance of cells to the drug. The cytotoxicity of cisplatin is believed mainly due to interaction with DNA, forming inter-and intra-strand adducts, hindering both RNA transcription and DNA replication, leading to cell cycle arrest and apoptosis. Numerous cellular mechanisms potentially contributing to clinical cisplatin resistance have been proposed, including changes in cellular drug accumulation, detoxification of the drug, inhibition of apoptosis and repair of the DNA adducts but the precise mechanisms are still need to be validated. It has been reported that P21 expression level is involved in the resistant phenotype of this drug .p21WAF1/CIP1 (p21) is a well-characterized cyclin-dependent kinase (cdk) inhibitor that belongs to the Cip/Kip family of cdk inhibitors. It mainly inhibits the activity of cyclin/cdk2 complexes and negatively modulates cell cycle progression -6. Loss RNA-induced gene activation is a transcriptional gene activation phenomenon specifically induced by double small RNA (dsRNA) molecule targeting gene promoter regions. This phenomenon was termed RNAa and the dsRNA molecules were designated small activating RNAs (saRNAs). By targeting gene promoter regions, saRNAs induce the demethylation of histone, leading to transcriptional gene activation. It has been demonstrated that saRNA could inhibit cell proliferation and viability via up-regulation of p21 and E-cadherin in human bladder cancer cells -13. SincIn this study, we explored the effect of up-regulation of p21 gene expression on drug-resistance in A549 non-small-cell lung carcinoma cells by transfecting the saRNA targeting the promoter region of p21 into A549 cells. We observed activation of p21 expression in A549 lung carcinoma cells after transfection of saRNA. The enhanced p21 expression was correlated with a significant growth inhibition and enhancement of chemosensitivity to cisplatin in A549 cells in vitro and vivo. These results provide evidence of an additional therapeutic strategy for lung cancer therapy especially for chemoresisitance lung carcinomas.saRNA targeting the promoter of p21 at position-322 relative to the transcription start site was termed as dsP21-322 and designed as previously described . Scrambl2 incubator at 37°C. Cells were seeded into six-well plates with growth medium at a density of 0.8 × 105 cells/well respectively and cultured overnight to (30-50)% confluence prior to transfection. Cells were then transfected with 100 pmol/well of dsP21-322 or scramble dsRNA, respectively, using the LipofectamineTM2000 reagent according to the manufacturer's protocols.Human lung carcinoma cells (A549) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin (100 Units/ml)/streptomycin(0.1 mg/ml) in 5% COTotal RNAs were extracted from dsP21-322, scramble dsRNA and mock transfected A549 cells by using TRIzol reagent according to the manufacturer's instructions. Complementary DNA (cDNA) was generated from total RNA by reverse transcription using moloney murine leukemia virus (M-MLV). PCR amplification of the cDNA was performed in a reaction mixture with a final volume of 30 μL containing 2 μL of 4 × dNTPs, one unit of Taq DNA polymerase, and 10 mmol/L of each paired primer specific to p21 gene. The primers used for RT-PCR of p21 were forward primer, 5'-TTGATTAGCAGCGGAACA-3' and reverse primer, 5'-TACAGTCTAGGTGGAGAAACG-3'.The cells from experiment group and control groups were harvested and washed with PBS (pH 7.4) twice and resuspended in lysis buffer on ice. The cell extracts were clarified by centrifugation and the protein concentrations were determined by using the Bio-Rad protein assay kit . Each protein extract (25 μg) was electrophoresed on a 12% SDS-polyacrylamide gel, transferred to PVDF membrane in a buffer containing 25 mM Tris-HCl (pH 8.3), 192 mM glycine, 20% (v/v) methanol, and blocked in 5% (w/v) skimmed milk in Tris buffered saline-Tween 20 for 1 hour at room temperature, and probed with specific primary antibodies overnight at 4°C. Then primary antibodies were removed and the blots were extensively washed with TBST for three times. Blots were then incubated for an hour at room temperature with the secondary antibodies in 1% (w/v) skimmed milk dissolved in TBST. Following removal of the secondary antibody, blots were extensively washed as above for an hour and developed using the Enhanced Chemiluminescence Kit . The primary antibodies used in this experiment for western blotting analysis were anti-p21 and anti-β-actin antibody.3 cells/well for proliferation assay. Then for 5 days, every 24 h a batch of cells were stained with 20 μl sterile MTT dye at 37°C for 4 h, then culture medium was removed and 150 μl of DMSO was added and thoroughly mixed in for 10 min. Spectrometric absorbance at 490 nm was measured by using a microplate reader. All experiments were performed in triplicate.MTT assay was performed to assess the effect of p21 expression on cell proliferation. Transiently transfected lung carcinoma cells were plated in 96-well plate at a density of 3.0 × 103 A549 cells transiently transfected with dsP21-322, scramble dsRNA and mock were plated in 100-mm culture dishes, respectively. After 18 days, cells were fixed with methanol and stained with 0.1% crystal violet. Visible colonies were manually counted.Approximately 0.5 × 106 A549 cells transiently transfected with dsP21-322, scramble dsRNA and mock, respectively, were harvested and analyzed by Flow Cytometry .An annexin V-fluorescein isothiocyanate apoptosis detection kit was used to detect cell apoptosis. Approximately 1 × 104 cells/well. The cells were then treated with 5 μg/ml cisplatin for 48 h.Then, 20 μl of MTT stock solution (5 mg/ml) was added to each well, and the cells were incubated at 37°C for 4 h. The supernatant was replaced with DMSO to dissolve formazan production. The A490 nm values were assayed in a microplate reader. The ratio of the absorbance of treated cells relative to that of the control cells was calculated and expressed as a percentage of cell viability. The mean of three parallel samples was calculated. Experiments were performed in triplicate and standard deviations were calculated based on the average of three experiments.The dsP21-322, scramble dsRNA and mock transfected A549 cells were seeded in 96-well plate at a density of 5 × 106) were injected subcutaneously into the right posterior limb of BALB/c nude mice (4-6 weeks old). When palpable tumors (about 100-130 mm3) arose within 16-21 days, mice were randomized to treatment and control groups. Three groups (five mice each) received intratumoral injections of mixture of 30 μg of LipofectamineTM2000-encapsulated dsP21-322, scramble dsRNA and PBS respectively, every 3 days for 3 weeks. The other two groups received intratumoral injection of PBS combined with cisplatin or dsP21-322 combined with 5 mg/kg cisplatin, individually, every 3 days for 3 weeks. Tumor growth was monitored by caliper-measuring two perpendicular tumor diameters every 3 days, and the volume of the tumor was calculated from the formula: V = (width2 × length × 0.5). At the end of the experiment, tumor weight was assessed by sacrificing the mice, and by removing and weighing the tumor. Animal experiments in this study were carried out in accordance with the medicine institutional guidelines of Fourth Military Medical University.A549 cells (1 × 10The sections of the tumor tissues embedded in paraffin were stained using mouse anti-p21 antibody (Santa Cruz) at 1:50 dilution overnight at 4°C. After brief washing, all slides were stained and visualized with a Histofine SAB-PO(M) kit according to the manufacturer's instructions.Results were expressed as Means ± standard deviation (SD). Statistical analyses were performed using SPSS statistical software. Student's t-test and one-way analysis of variance (ANOVA) followed by Dunnett's multiple comparison tests were adopted. Values of p < 0.05 were considered as significant and indicated by asterisks in the figures.As an initial test of our study, we transfected saRNA targeting the p21 gene promoter at position-322 relative to the transcription start site (dsP21-322) into A549 cells for 72 h Figure . SemiquaAn important characteristic of tumor cells is their increased proliferative capability, which is often caused by impaired regulation of the cell cycle. It has been reported that p21 can regulate the cell cycle process by binding and inhibiting cyclin-dependent kinases, so we examined the effect of p21 transcriptional activation on the proliferation of A549 cells in vitro. In this experiment, cell proliferation was monitored by MTT assay daily for 5 days. The cell growth curve showed that proliferation of dsP21-322 transfected A549 cells was significantly inhibited in a time-dependent manner, while scramble dsRNA transfected A549 cells showed no significant inhibition of the proliferation Figure . Trypan It has been shown that overexpression of p21 results in G1-, G2-, or S-phase arrest -16, we e50. The results showed that the IC50 of dsP21-322 transfected cells was decreased to 1.23 μg/ml compared with those of mock and scramble dsRNA transfected groups (4.15 μg/ml and 3.84 μg/ml respectively) Figure . To furtIn view of these findings in vitro, we further tested the efficacy of dsP21-322 as an in vivo chemosensitivity strategy in nude mouse xenograft model. When palpable tumors arose in the right flank of mice, the mice received PBS, scramble dsRNA, dsP21-322, PBS combined with cisplatin or dsP21-322 combined with cisplatin intratumorally every 3 days until the end of the experiment. The tumor size was monitored every 3 days for three weeks. As shown in Figure Lung cancer is considered usually to acquire resistance to chemotherapy during multiple courses of therapy, which leads to poor prognosis, compared with other types of human malignancies. Thus, attempts at improving the survival of patients affected by this disease depend largely on strategies targeting development of tumor cell resistance to chemotherapy drugs, which cannot be rationally planned without a detailed knowledge of the mechanisms underlying this phenomenon. Searching for molecular targets participating in the process of drug-resistance and utilizing these targets to oppose drug-resistance in chemotherapy will be beneficial to the clinical therapy. There is evidence that alteration of CDK inhibitors in cancer may affect the response to chemotherapeutic treatment. Loss expression of p21 has been linked to drug-resistance in many in vitro cellular models. However, to date, evidence about the relationship between this CDK inhibitor and lung carcinoma drug-resistance has been lacking.It has been reported that genetic and epigenetic abnormalities can induce lower expression of p21, which is linked to chemoresistance in many in vitro cellular models . Colon cIn this study, we elevated the expression of p21 in lung carcinoma A549 cells by using saRNA targeting the promoter region of p21, which has been demonstrated to transcriptionally activate the expression of p21 gene. We detected up-regulation of p21 after tranfection of saRNA compared with scrambled dsRNA in A549 cells, the results showed that the expression of p21 could be increased in lung cancer cells by saRNA transfection.To explore the phenotype changes induced by p21 up-regulation in A549 cells, we detected the proliferation, colony formation, apoptosis and cell cycle change of saRNA transfected cells. The results showed that up-regulation of p21 by transcriptional activation inhibited the proliferation and colony formation of lung cancer cells. Cell cycle analysis showed that endogenous p21 up-regulation induced cell accumulation both in the G1/G0 phase in lung cancer cells, which leads to proliferation inhibition of lung cancer cells, but there was no apoptosis cells detected after dsP21-322 transfection. It was reported that p21 plays dual roles as both as pro and anti-apoptotic gene. Whether p21 exhibits pro or anti-apoptotic effects is likely to depend on the specific cellular context . In our In summary, this study demonstrates that up-regulating expression of p21 in lung cancer by RNAa technique can inhibit proliferation, enhance chemotherapeutic sensitivity to cisplatin in vitro and vivo, which may significantly contribute to therapy of lung cancer, especially for drug-resistance tumor therapy.All authors declare that they have no financial or personal relationships with other people or organizations that could inappropriately influence (bias) their work.YH and TH carried out the cellular studies, XW and JHR carried out the animal model studies, FL carried out the immunoassays. JXW, JZ and ML participated in the design of the study, performed the statistical analysis and drafted the manuscript. HZZ conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/632/prepubToxicity assay of paclitaxel on dsP21-322 transfected A549 cells. The IC50 of dsP21-322 treated cells was decreased to 0.17 μg/ml compared with mock or scramble dsRNA transfected group (0.29 μg/ml and 0.30 μg/ml respectively)Click here for file

Borrelia burgdorferi, the bacterial pathogen of Lyme borreliosis, differentially expresses select genes in vivo, likely contributing to microbial persistence and disease. Expression analysis of spirochete genes encoding potential membrane proteins showed that surface-located membrane protein 1 (lmp1) transcripts were expressed at high levels in the infected murine heart, especially during early stages of infection. Mice and humans with diagnosed Lyme borreliosis also developed antibodies against Lmp1. Deletion of lmp1 severely impaired the pathogen's ability to persist in diverse murine tissues including the heart, and to induce disease, which was restored upon chromosomal complementation of the mutant with the lmp1 gene. Lmp1 performs an immune-related rather than a metabolic function, as its deletion did not affect microbial persistence in immunodeficient mice, but significantly decreased spirochete resistance to the borreliacidal effects of anti-B. burgdorferi sera in a complement-independent manner. These data demonstrate the existence of a virulence factor that helps the pathogen evade host-acquired immune defense and establish persistent infection in mammals. Borrelia burgdorferi, causes disease in many parts of the world, resulting in multi-system complications in infected humans and animals. The microbe produces certain antigens in response to host environments that potentially allow it to persist and cause disease. Here, we analyzed the expression of B. burgdorferi genes encoding potential membrane proteins in infected hosts and show that one of them, termed Lmp1, is dramatically expressed in infected mice, most prominently in cardiac tissue during early infection. Mice and humans diagnosed with Lyme borreliosis also develop antibodies against Lmp1. Deletion of lmp1 in an infectious isolate of B. burgdorferi impairs the pathogen's ability to persist in murine tissues, especially the heart, and to induce disease, which was reversed when the gene was inserted back into the chromosome of the mutant. Lmp1 performs an immune-related, rather than a metabolic, function as its deletion does not affect microbial persistence in immunodeficient mice, but decreases the spirochete's ability to resist the borreliacidal effects of anti-B. burgdorferi sera. These data identify the existence of a surface-located antigen of B. burgdorferi that helps the pathogen evade host-acquired immune defense and establish persistent infection and disease in mammals.The pathogen of Lyme borreliosis, Borrelia burgdorferi sensu lato, is the most prevalent tick-borne human disease in the United States, Europe and many parts of Asia Ixodes ticks, it establishes a localized infection at the bite site, then disseminates to distant cutaneous sites and various internal organs, including the spleen, bladder, joints, heart and central nervous system B. burgdorferi persists in several tissue locations in mammals, only a limited set of organs, most frequently the joints and the heart, experience robust host-inflammatory responses resulting in clinical complications, such as Lyme arthritis and carditis. Antibiotic treatment is usually, but not always, successful, and some patients develop a form of antibiotic-resistant arthritis that is thought to be unrelated to persistent infection Lyme borreliosis, caused by B. burgdorferi transcriptome undergoes dynamic changes during the complex enzootic cycle of the spirochetes B. burgdorferi grown in laboratory medium or within host-implanted dialysis membrane chambers readily responds to altered environments, adapting to changes in temperature, pH, nutrients, and host immune responses B. burgdorferi genome (8.6%), or 150 genes, could be differentially expressed in vitro in response to physiochemical alterations in growth conditions, and a major proportion of these genes (46%) encode proteins with predicted export signals B. burgdorferi lipoproteins have outer membrane export signals, some are retained in the periplasm by sequence-specific signals B. burgdorferi genes which are preferentially expressed in specific mammalian and arthropod environments and gene deletion studies B. burgdorferi genes bbk32, dbpA/B and bmpA/B are selectively expressed in mammals and facilitate B. burgdorferi infection of the murine host ospA/B, bb0365 and bb0690 are highly expressed during specific stages of B. burgdorferi persistence in ticks and support the spirochete life cycle in the arthropod ospD is dispensable for infectivity in vivoB. burgdorferi genome harbors significant clusters of paralogous genes in addition to large numbers of unique genes with unknown functional annotations B. burgdorferi survival in vivo and pathogenesis is important for the development of preventative strategies.The B. burgdorferi-induced host inflammatory responses B. burgdorferi persistence in local environments, antigens, especially those exposed on the microbial surface, could directly participate in host–pathogen interactions contributing to the genesis of organ-specific pathogenesis. Therefore, we assessed the expression levels of a selected set of B. burgdorferi genes in diverse murine tissues because of their putative membrane localization. We sought to determine if B. burgdorferi gene products that are preferentially expressed at high levels in clinically-relevant host microenvironments directly contribute to microbial virulence. The characterization of microbial ligands that are differentially expressed during the pathogen's life cycle is important for the identification of novel vaccine targets and the prevention of the multi-system disorders caused by B. burgdorferi.The clinical complications of Lyme borreliosis are primarily triggered by B. burgdorferi persists in diverse tissue environments of the mammalian host. To identify B. burgdorferi genes that are expressed at high levels in vivo, particularly in a tissue-specific manner, we employed a sensitive quantitative RT-PCR (qRT-PCR) approach to compare spirochete transcriptomes in multiple murine tissues and in vitro. A total of 91 spirochete genes were selected for expression analysis, based on their putative association with the spirochete membrane as determined by the database annotation and in silico analysis for extracellular exposure (B. burgdorferi (105 cells/mouse) and skin, joints, heart and bladder tissue were collected following 1, 2, 3 and 4 weeks of infection. Total RNA was isolated, and corresponding tissues from the indicated time points were combined into four separate pools of skin, joint, heart and bladder samples. qRT-PCR analysis was performed using gene-specific primers as detailed in the B. burgdorferi genes (out of 91 assessed) were not transcribed at detectable levels in vivo. The remaining 47 genes displayed variable expression across different tissues, which is presented as fold increase in transcript levels relative to flaB, together with corresponding in vitro expression levels , which encodes an exported protein with type I signal peptide with unknown function exposure . Groups n levels . B. burglmp1 throughout the B. burgdorferi infection in mice. A similar qRT-PCR experiment . Therefore, a detailed expression analysis of lmp1 focused on the early phases of B. burgdorferi infection in the murine host. To accomplish this, groups of C3H/HeN mice were infected with B. burgdorferi, and tissues were isolated at 7, 10, 15, and 20 days. Isolated total RNA was converted to cDNA and subjected to qRT-PCR to measure copies of lmp1 transcripts, relative to flaB expression. The expression of lmp1 was selectively upregulated in the heart at 7 and 10 days post-infection, compared to that in the skin, joints, bladder and infected ticks and 85 (±8%) of the respective wild type levels (data not shown). The lmp1 mutant spirochetes contained a similar protein profile to that of the wild type . qRT-PCR analysis .Although the function of protein . Polycloenerated and usedenerated . To furtbination . A DNA cd bb0211 . qRT-PCRild type and, as protein . We nextanalysis and cultlmp1 mutant B. burgdorferi was infectious in the murine host, the mutant was unable to establish persistent infection in mice and failed to induce disease, as assessed by the development of arthritis and carditis. To rule out the possibility that the observed phenotypic defects of the lmp1 mutant B. burgdorferi to infect the murine host were the result of anomalous effects of genetic manipulation, we sought to complement the lmp1 mutant spirochetes with a wild type copy of the lmp1 gene in cis, and use this isolate in murine infection studies. As lmp1 lacks an obvious upstream promoter, we first fused the open reading frame of lmp1 with the B. burgdorferi flaB promoter. The flaB-lmp1 fusion, along with the streptomycin resistance cassette, aadAB. burgdorferi chromosome . RT-PCR and immunoblotting showed that the lmp1-complemented isolate produced both lmp1 mRNA . The spirochete burdens in heart, skin, bladder and joints were evaluated at day 7, 10, 15, 21 and 28 following B. burgdorferi infection. The results showed that, except for the initial time point (day 7), lmp1 mutants were severely impaired in their ability to colonize all murine tissues and were undetectable in the heart after 10 days of infection (B. burgdorferi infection showed that the lmp1 mutant spirochetes could not be recovered (data not shown). In contrast, both wild type and lmp1-complemented B. burgdorferi readily persisted in all tested murine tissues throughout infection, with significantly higher burdens than lmp1-deficient spirochetes–heart (P<0.001), skin (P<0.006), bladder (P<0.004) and joints (P<0.002). Both wild type and lmp1-complemented B. burgdorferi caused severe inflammation, but lmp1 mutants induced less severe disease, as reflected by the histopathological signs of carditis . However, lmp1 mutants were impaired to persist in the immunocompetent murine hosts following the first week of infection. We next assessed whether Lmp1 function in vivo is related to the metabolic or immune environment of the host. To accomplish this, we compared the infectivity of wild type and lmp1 mutant B. burgdorferi in the established immunodeficient murine model of Lyme borreliosis using severe combined immunodeficient (SCID) mice 5 wild type, lmp1 mutant, or lmp1-complemented B. burgdorferi. The spirochete burdens in the heart, skin, bladder, and joints were evaluated at day 7, 14 and 21 following B. burgdorferi infection using quantitative PCR. In parallel, the viability of the spirochete was determined by culture of murine blood and spleen isolated at day 7, 14 and 21. The results showed that the wild type, lmp1 mutant and lmp1-complemented B. burgdorferi could be cultured from murine tissues at all time points (data not shown) and that there was no significant difference in B. burgdorferi burdens in all tested murine tissues throughout the infection , indicating that lmp1 deletion enhances the borreliacidal effects of antibodies in a complement independent manner. Like parental isolates, the lmp1 mutants were not susceptible to bactericidal activities by the non-immune serum collected from naïve mice (data not shown), suggesting that Lmp1 is not required for serum resistance by spirochetes. Together, these data suggest that Lmp1 contributes to B. burgdorferi defense against host-acquired immune responses by enhancing resistance to the bactericidal antibodies that develop during infection.The analysis of spirochete growth in the culture media indicated that the wild type, nfection . Consist mutants . As neutith lmp1 . The susB. burgdorferi is maintained through a complex enzootic cycle B. burgdorferi can establish persistent infection in a variety of tissue locations. Limited studies suggest that spirochete genes expressed in higher levels in infected host tissues could be important for B. burgdorferi survival B. burgdorferi genes encoding potential membrane proteins covering spirochete infectivity in multiple murine tissues. Our data show that few of the genes analyzed are differentially or highly expressed in the selected tissues. Targeted deletion of one of the spirochete genes that is highly expressed in cardiac tissue, lmp1, while resulting in the initial clearance of pathogen burden in infected hearts, also affected overall virulence of B. burgdorferi in murine infectivity and reduced the outcome of Lyme disease. Our results show that lmp1 mutants persist in SCID mice at similar levels to parental isolates and are susceptible to borreliacidal antibody-mediated killing in vitro, suggesting that Lmp1 contributes to B. burgdorferi defense against host-acquired immune responses. Identification of hitherto unrecognized virulence genes of B. burgdorferi, such as lmp1, that support pathogen infectivity in mammals could shed light on the pathogenesis and prevention of Lyme disease.In nature, in vivo could be important for B. burgdorferi persistence in nature, possibly allowing spirochete adaptation to highly heterogeneous metabolic and immune environments. While assessment of pathogen gene expression in vivo is an important prerequisite to understanding microbial pathogenesis, microarray analysis is of limited use for the assessment of the B. burgdorferi transcriptome in vivo, primarily due to the low level of pathogen RNA in infected tissues B. burgdorferi RNA can be isolated from spirochetes grown in vitro or in a host-implanted dialysis membrane, and microarray-based studies have been used to assess B. burgdorferi gene expression in these ‘host-like’ conditions that have yielded important information on the role of B. burgdorferi genes in pathogen infectivity in vivo. This method is reproducible, as two independent sets of animal infection studies identified the same set of 47 B. burgdorferi genes as expressed in vivo, and a majority of them displayed higher expression levels in mice, than in vitro. The variable expression of these genes in multiple tissue locations possibly reflects the adaptive responses of the pathogen to local host environments, enabling immune evasion, adhesion, or nutrient uptake, among other possibilities. Furthermore, regardless of their functional role in pathogen persistence, antigens that are highly produced in certain host sites, such as the joints and heart, could participate in the genesis of inflammatory disease. Our qRT-PCR analysis also identified a set of 44 B. burgdorferi genes that may not be important for mammalian infectivity, as none of these displayed detectable transcription within the first 4 weeks of infection. On the other hand, a set of 26 genes encoding potential lipoproteins displayed detectable expression in vivo and, with the exception of bbo40, expression of many genes agreed with a previous study that evaluated the expression of B. burgdorferi lipoproteins in murine dermis B. burgdorferi transcripts highly expressed in vivo, rather than proteins, these mRNA are likely the signatures of translated antigens. This speculation is supported by the recent study that identified 103 spirochete immunogens by screening in vitro translated genome-wide proteomic arrays with B. burgdorferi-specific immune sera B. burgdorferi genes expressed in murine tissues and 7 and 7 . Insteadtro data , might cB. burgdorferi genes encoding potential membrane proteins that are expressed during murine infection. Many of these in vivo-expressed genes are differentially expressed in various host tissues, including joints and heart, and can participate in pathogen persistence and the genesis of disease. Here, we present direct evidence that one microbial gene expressed at higher level in the cardiac tissue, lmp1, encodes an essential virulence factor that plays an important role in immune evasion and dramatically influences spirochete persistence in murine tissues and the genesis of inflammation. Whereas previously identified B. burgdorferi virulence antigens are mostly plasmid-borne, and thus have greater instability and sequence divergence, Lmp1 is chromosomally encoded and is relatively conserved among orthologs in related infectious spirochetes. Further identification of B. burgdorferi virulence determinants that actively support spirochete persistence in vivo could contribute to the development of effective therapeutic strategies against Lyme borreliosis.In summary, we have identified a select set of Borrelia burgdorferi infectious isolate A3 B. burgdorferi whole genome sequenced strain B31 M1 5 spirochetes per mouse. All animal procedures were performed in compliance with the guidelines and with the approval of the Institutional Animal Care and Use Committee. Ixodes scapularis ticks used in this study belong to a colony that has been reared and maintained in the laboratory.B. burgdorferi genes are indicated in B. burgdorferi target genes www.tigr.org) and PSORT in silico analysis B. burgdorferi (105 spirochetes/mouse), and samples of skin, heart, tibiotarsal joint and bladder were collected and frozen in liquid nitrogen at one-week intervals between 1 and 4 weeks of infection. Total RNA was extracted from tissue samples using the TRIzol reagent (Invitrogen). To reduce traces of contaminating DNA, samples were further digested with RNase-free DNaseI (Qiagen), purified using the RNeasy kit (Qiagen) and reverse transcribed to cDNA using the AffinityScript cDNA synthesis kit (Stratagene). The relative levels of B. burgdorferi cDNA in each sample were assessed by quantitative PCR (qPCR), and DNA contamination in each sample was measured using an equal volume of purified RNA as a template. Samples from each time point were pooled by tissue type, and final pools of skin, heart, joints and bladder were used in the qPCR analysis. The primers used for qPCR reaction were designed using OligoPerfect Primer design software (Invitrogen) based on the B. burgdorferi B31 M1 genomic sequence B. burgdorferi genes. Each primer pair was tested for efficiency and non-specific amplification by melt-curve analysis using B. burgdorferi genomic DNA as a template. In one case of paralogous genes, the same set of primers was assigned for the detection of both genes as indicated in in vivo gene expression data and to further ensure specific amplification of B. burgdorferi cDNA in murine tissue samples, the qPCR amplification in each well was followed by melt-curve analysis, and wells showing non-specific amplification were discarded from data analysis. The amplification cycle consisted of initial denaturation at 95°C for 5 min followed by 45 cycles each at 95°C for 10 sec, 60°C for 20 sec and 72°C for 30 sec and final melt curve analysis: 55°C for 30 sec, increase 0.5°C per cycle to 95°C. The amplification was performed in an iQ5 real-time thermal cycler (Bio-Rad) using SYBR Green Supermix (Bio-Rad) as detailed. For expression screening of B. burgdorferi genes, we simultaneously assayed 8 candidate genes in each 96-well PCR plate using duplicate wells of template cDNA with parallel positive (B. burgdorferi genomic DNA) and negative (no template) controls. Transcript levels of individual genes were assessed in spirochetes grown in vitro in BSK medium (107 cells/ml) and in each of the murine samples, calculated using the 2−ΔΔCt method flaB transcripts and presented as fold increase in gene expression. Two independent mouse experiments used the same parameters of gene expression analysis to ensure the reproducibility of the assay. For detailed temporal and spatial analysis of lmp1 expression by qRT-PCR analysis, amounts of target transcripts were calculated from standard curves prepared from known quantities of flaB and lmp1 DNA as described B. burgdorferi (105 spirochetes/mouse) or via tick feeding using B. burgdorferi–infected nymphs. Infected murine samples, the heart, skin, bladder and tibiotarsal joints, were removed at different timepoints and frozen in liquid nitrogen. B. burgdorferi–infected ticks were isolated by allowing ticks to feed on 15-day infected mice as described B. burgdorferi burden in infected tissues, flaB transcripts were measured in infected samples and normalized to mouse or tick β-actin levels.The identity and oligonucleotide primer sequences for the quantitative RT-PCR analysis of B. burgdorferi are indicated in lmp1-deficient B. burgdorferi was created by exchanging a 2068 base pair DNA fragment encompassing the 5′ terminus of the lmp1 gene with a kanamycin-resistance cassette via homologous recombination as described lmp1 gene were PCR-amplified using primers P1–P4 and inserted into two multiple-cloning sites flanking the kanAn cassette in plasmid pXLF10601 B. burgdorferi B31 isolate A3. Transformants were selected for growth in the presence of kanamycin (350 µg/ml). Ten clones were isolated and PCR analysis was used to confirm the intended recombination event using primers P1–P9. The presence of all endogenous plasmids contained in the parental A3 isolate was also assessed in the mutant clones as described lmp1 mutant clones that retained the same complete set of plasmids as the wild type isolate was used in additional experiments.The oligonucleotide primers used for mutagenesis and genetic complementation of lmp1 mutant was achieved by re-insertion of a wild type copy of the lmp1 gene in the B. burgdorferi chromosome lmp1 open reading frame (ORF) overlaps with the preceding gene by a few nucleotides, lacking an intergenic region with a discernible promoter. We, therefore, fused the lmp1 ORF with the B. burgdorferi flaB promoter B. burgdorferi DNA fragments encompassing the full-length lmp1 gene and the flaB promoter were PCR-amplified, fused and cloned into the BamHI and SalI sites of pKFSS1 housing a streptomycin-resistance cassette (aadA)flaB promoter-lmp1 gene fusion and the aadA cassette was cut with BamHI and SmaI from the recombinant plasmid pKFSS1-lmp1 and inserted into the corresponding restriction sites of the plasmid pXLF14301 B. burgdorferi chromosomal locus bb0444–0446. The plasmid construct was sequenced to confirm its identity and 25 µg of the plasmid DNA was electroporated into the lmp1 mutant. Four clones were isolated by their ability to grow in the presence of both kanamycin and streptomycin. PCR analysis was used to confirm the intended recombination event, and one of the lmp1-complemented clones that contained the same plasmid profiles as the wild type was chosen for further study. For in vitro growth analysis, an equal number of wild type and genetically-manipulated spirochetes were diluted to a density of 105 cells/ml and grown at 33°C in BSK-H medium until they reached the stationary phase (108 cells/ml). Aliquots of spirochetes were assessed every 12 hours, under a dark-field microscope, for motility, cell clumping and numbers of spirochetes counted using a Petroff-Hausser cell counter.Genetic complementation of the lmp1 mutants and lmp1-complemented isolates in vivo, B. burgdorferi were injected into groups of mice via needle-inoculation (105 spirochetes/mouse) intradermally on the back. Mice were sacrificed at 7, 10, 15, 21 and 28 days following inoculation. Skin, heart, joints, bladder and blood samples were collected and B. burgdorferi burdens were measured by quantitative PCR analysis as previously described B. burgdorferi infection. The ticks were allowed to feed to repletion and were immediately analyzed for quantitative RT-PCR measurement of B. burgdorferi burden as detailed earlier For phenotypic analysis of E. coli using the bacterial expression vector pGEX-6P1 (Amersham-Pharmacia Biotech) with specific primers as indicated in B. burgdorferi via syringe inoculation (105 cells/mouse). Murine antiserum generated against recombinant Lmp1 was used in a Proteinase K accessibility assay to determine surface exposure of the Lmp1 as described Generation of murine polyclonal antibodies against recombinant Lmp1, ELISA and immunoblotting were performed as described 5 cells/well) in L929-conditioned DMEM media. The cells were then washed and resuspended in serum-free DMEM and incubated with B. burgdorferi at a multiplicity of infection (MOI) of 10 at 37°C for 2 hours. Cells were washed with cold PBS to remove unbound B. burgdorferi and fixed in 3.7% paraformaldehyde, and processed for confocal immunofluorescence as described B. burgdorferi goat IgG (KPL), phalloidin-Texas Red (Invitrogen), and DAPI (Invitrogen), respectively.Bone marrow derived macrophages were isolated from naïve C3H mice as described 7 spirochetes/ml and exposed to active or heat-inactivated 50% sera isolated from mice infected for 15 days with B. burgdorferi. Samples were incubated at 33°C for 24 to 48 hours and spirochete viability was assessed using dark-field microscopy. Susceptibility of spirochetes to borreliacidal activities in infected mouse sera were also tested in parallel using a combination of two vital stains that specifically label live and dead spirochetes, as described BacLight Viability kit (Invitrogen) according to the manufacturer's instructions.Susceptibility of wild type or genetically manipulated spirochetes to borreliacidal activities in infected mouse sera was performed as described B. burgdorferi–infected mice were examined for swelling of the tibiotarsal joints as detailed earlier B. burgdorferi infection, and the development of ankle swellings was monitored and tabulated on a weekly basis until the sacrifice of the mice. For histological evaluations of arthritis and carditis, at least 5 ankle joints and 5 hearts were collected from each group of mice infected with the different isolates. For histology, joints and hearts were fixed in 10% formalin and processed for Hematoxylin and Eosin staining. Twenty randomly chosen sections from each mouse group were assessed for histopathological comparisons. Signs of arthritis were evaluated as described B. burgdorferi-induced inflammation t test.Results are expressed as the mean±standard deviation (SD) or standard error mean (SEM). The significance of the difference between the mean values of the groups was evaluated by two-tailed Student Figure S1B. burgdorferi genes during infection of the murine hosts. Total RNA was isolated from B. burgdorferi grown in vitro, and multiple tissues of mice, between 1 and 4 weeks of B. burgdorferi infection, were pooled by tissue type and converted to cDNA for measuring gene-specific transcripts using quantitative PCR. Fold increase in the expression of individual genes in each of the murine samples was calculated based on threshold cycle (Ct) values using the 2−ΔΔCt method flaB Ct values. Bars represent the mean±SD from four quantitative PCR analyses of two independent infection experiments.Relative expression of selected (0.8 MB EPS)Click here for additional data file.Figure S2lmp1 is highly expressed in the murine heart during early phases of tick-borne B. burgdorferi infection. Total RNA was isolated from multiple murine tissues following 7 days of challenge with B. burgdorferi–infected nymphal ticks , converted to cDNA, and used for measuring lmp1 transcripts in quantitative PCR assay. The relative expression levels of lmp1 are presented as copies of lmp1 transcript per 1,000 copies of flaB transcripts. Bars represent the mean±SEM from three independent experiments. The transcript levels of lmp1 in the heart were significantly higher than corresponding expression levels in the skin, joint, or bladder (*P<0.02).(0.4 MB EPS)Click here for additional data file.Figure S3B. burgdorferi Lmp1 by immune sera. (A) Development of Lmp1-specific antibody response in B. burgdorferi–infected mice and humans. Fifty nanograms of recombinant Lmp1 was probed with normal and B. burgdorferi–infected sera. Arrow indicates the development of Lmp1-specific antibody response in both B. burgdorferi–infected mice and human sera. Infected serum used for immunoblotting was pooled from infected mice following 15 days of syringe-based infection or from a Lyme disease patient as detailed in the text. (B) Reactivity of antibodies in human sera to recombinant Lmp1 as assessed by ELISA. Sera from randomly chosen normal healthy controls (n = 5) and Lyme disease patients (n = 16) were tested for detection of antibodies specific for recombinant Lmp1.Recognition of (0.3 MB EPS)Click here for additional data file.Figure S4B. burgdorferi Lmp1. Murine antibodies generated against Lmp1 specifically recognize native protein in B. burgdorferi. One microgram of B. burgdorferi lysates was probed with normal mouse serum (NMS) or murine anti-serum against Lmp1 (anti-Lmp1). Murine polyclonal antibodies used in the immunoblotting were generated by immunization of mice against recombinant Lmp1 in mice as described in the text. Arrow indicates detection of native B. burgdorferi Lmp1.Detection of native (0.3 MB EPS)Click here for additional data file.Table S1Oligonucleotide primers used in the study(0.2 MB DOC)Click here for additional data file.Table S2Oligonucleotide primers used in the study(0.07 MB DOC)Click here for additional data file.

Bacillus subtilis. BSKs are widely distributed in spore-forming Bacillus and Clostridium species, and have a dynamic evolutionary history. Sequence and structure analyses indicate that the BSKs are CAKs, a prevalent group of small molecule kinases in bacteria that is distantly related to the eukaryotic protein kinases. YtaA has substantial structural similarity to CAKs, but also displays distinctive features that broaden our understanding of the CAK group. Evolutionary constraint analysis of the protein surfaces indicates that members of the BSK family have distinct clade-conserved patterns in the substrate binding region, and probably bind and phosphorylate distinct targets. Several classes of BSKs have apparently independently lost catalytic activity to become pseudokinases, indicating that the family also has a major noncatalytic function. Proteins 2010. © 2009 Wiley-Liss, Inc.Bacterial spore formation is a complex process of fundamental relevance to biology and human disease. The spore coat structure is complex and poorly understood, and the roles of many of the protein components remain unclear. We describe a new family of spore coat proteins, the bacterial spore kinases (BSKs), and the first crystal structure of a BSK, YtaA (CotI) from Bacillus anthracis and Clostridium botulinum.4Many Gram-positive bacteria form endospores in response to stress. Spores are highly resistant to destructive agents such as heat, chemicals, and radiation, and can persist in harsh environments for many years.Bacillus subtilis.1Bacterial spores have a layered structure which includes a protective protein coat. The coat must exclude harmful agents, while also allowing nutrients to enter to trigger germination.B. subtilis is a member of a family of proteins specific to the phylum Firmicutes, which are implicated in spore formation and often form part of the spore coat.YtaA (CotI) of choline and aminoglycoside kinase members, which were the first structures to be described.The BSKs constitute a new family within the CAK kinases.M ammonium sulfate, 0.1M citric acid pH 5.57. Ethylene glycol was added as a cryoprotectant to a final concentration of 15% (v/v). The YtaA crystal was indexed in hexagonal space group P6422 , inflection (λ2), and peak (λ3) of a selenium MAD experiment. The datasets were collected at 100 K with a MarMosaic 325-mm CCD detector using Blu-Ice.1) dataset. Data and refinement statistics for YtaA are summarized in Table Multiple-wavelength anomalous diffraction (MAD) data were collected at the SSRL on beamline BL11-1 at wavelengths corresponding to the high-energy remote, columns and partial sequences . The alignment was evaluated with PHYML39http://kinase.com/microbial/bsk.All supporting information is available at Firmicutes, mostly within spore-forming species in the orders Bacillales and Clostridiales and largely absent from nonsporulating species (Supporting Information Tables S1 and S2). Multiple BSKs exist in many species, with four predominant within the Bacillales, while in Clostridiales six distinct BSKs are found in Clostridiaceae and one in Lachnospiraceae within the CAK kinases. Homologs were from the phylum B. subtilis and many other Bacillaceae: YutH and YsxE are present in almost all spore-forming species, whereas YtaA and CotS are more restricted. All four are experimentally implicated in sporulation. CotS and ytaA share a common promoter, controlled by the spore-specific factors σK and GerEE.yutH or ysxE also produce spores that are morphologically normal, but more sensitive to lysozyme, hypochlorite, and predation,Four BSKs are found in Clostridium within the family Clostridiaceae I . This suggests that the expanded family in Clostridium may have diverged into spore-associated and nonspore-associated functions.Six distinct BSKs are found in members of the spore-forming genus Clostridiales and Bacillales have BSKs and vice versa, but there are exceptions. A single gene, BSKC7, is present in the Lachnospiraceae, in both spore formers and nonspore formers (Supporting Information Table S1). Conversely, Clostridium difficile , making phylogenetic reconstruction difficult, with low-bootstrap values at many basal branches . However, when coupled to known species relationships, our results suggest that the most parsimonious evolutionary scenario requires independent expansions in see Fig. .Heliobacterium modesticaldum , an unusual phototrophic member of a distinct family in Clostridiales.H. modesticaldum that may be related to the shared sporulating phenotype .In addition to the highly represented BSKs, several divergent members are found in some species (Supporting Information Table S1). Most notable are four homologs seen within Clostridiales may form a bridge between this order and Bacillales. Clostridium thermocellum contains YtaA, CotS, and BSKC4. Symbiobacterium thermophilum and Desulfotomaculum acetoxidans have no BSKCs, but have YtaA (Supporting Information Table S1). Although horizontal transfer cannot be ruled out, C. thermocellum could represent an ancestral state, from which expansion in ytaA could produce the Bacillales genes, and expansion in BSKC4 could produce Clostridiales genes.Several sporulating species in YtaA (D166PKA), which coordinates the target substrate hydroxyl group in substrate-bound structures,51The sequence motifs required for enzymatic activity in PKL kinases have been extensively explored and mapped to the structure of PKA,YtaA, along with other motifs generally required for enzymatic function, and we predict that they are pseudokinases.Bacillales and Clostridiales, and possibly in Lachnospiraceae and D269YtaA (D220PKA), which form hydrogen bonds to stabilize the fold of the C-terminal lobe,YtaA (H164PKA) which forms hydrogen bond interactions that directly stabilize the geometry of the active site,Caldicellulosiruptor saccharolyticus and Anaerocellum thermophilum (Supporting Information Tables S1 and S3). BSKC6L appears to be the ancestral form of BSK6, though it still lacks residues required for enzymatic activity.These five pseudokinase BSKs have a variety of inactivating mutations, in addition to the loss of D239see Fig. . Three eThe remaining members of the BSK family display substantial selective conservation of known CAK catalytic motifs . This pattern strongly suggests that these proteins will be active kinase enzymes see Fig. . HoweverYtaA, it frequently loses the DxD motif and N244YtaA have a CotS that retains all active site residues (Supporting Information Tables S1 and S3). Thus, as with BSKC6, we can directly observe an apparent ongoing process of loss of functionality within CotS through the examination of current genome sequences.Interestingly, while CotS is a putatively active BSK, it may also be a pseudokinase in some species. Although it conserves D239see Fig. . These mYtaA and cotS form a conserved chromosomal cluster with a pair of related glycosyl transferases and a set of enzymes involved in nucleotide sugar metabolism . Our phylogenetic model suggests that there have been multiple coordinated losses of these genes, sometimes linked to losses of the ytc and ytd genes. Four of the 17 sequenced strains of B. thuringiensis have a chromosomal cluster containing both BSKs and both glycosyl transferases, ytcB and ytdA. The other 13 strains lack all six genes. Similarly, of six Geobacillus species, one (WCH70) lacks both BSKs and both glycosyl transferases, whereas another (Y412MC10) has lost one of each and both have also lost some of the ytc/ytd genes. Two of eight B. cereus species have both BSKs and both glycosyl transferases, and the rest lack both.This linkage is further supported by coordinated gene loss in several species. No genome has a Clostridium species, where BSKCs 2, 6, and 1 are clustered in a single operon and BSKC4 is nearby , an enzyme involved in threonine biosynthesisYtaA retains two CAK-specific structural elements in the C-terminal lobeThe YtaA structure reveals a distinctive ATP binding pocket that is broadly similar to other CAKs, but has key elements that help to define BSKs as a distinct family. In some aspects, the YtaA pocket is more like that of ChoK, but in others it is more like the APH pocket.PKA in β2 and A70PKA in β3.YtaA and F208ChoK). Although this side chain emanates from the same backbone location, in YtaA aromatic π-π stacking is observed, while in ChoK the rings interact in a perpendicular manner. As a result, in ChoK the face of the adenine ring also packs against L144ChoK in β3 , and stacks atop the adenine ring in a similar fashion to W123 in YtaA . While the ribose of ATP still forms a hydrogen bond, it is to the backbone upstream from β7 to interact with the negatively charged ATP phosphates. APH retains a similar K44APH-E60APH ion pair, which fulfills a similar role in the APH structure , but completely lacks the Glu partner, replacing it with S84YtaA , N244YtaA (N171PKA), and D257YtaA (D184PKA), are in approximately standard conformations for a PKL kinase , indicating that this protein is very likely to be catalytically active. The three key residues D239YtaA D16PKA, N24YtaA, Y90YtaA, S151YtaA, and Y154YtaA, which is strongly associated with likely enzymatic activity , which directly coordinates the substrate hydroxyl group.49Previous structures of CAKs bound to substrate have defined a substrate binding region incorporating residues from α1i–α2i, the catalytic loop, αF, and α4i–α5i.Clostridiales, with BSKC6 having a particularly poorly conserved site, further emphasizing its rapid evolutionary degradation. This pattern strongly suggests that each protein in the family has distinct substrate binding properties. The equivalent residues in HSK2 also differ substantially, (see Fig. Although the substrate binding region is generally conserved throughout the BSKs, each group of orthologs in the family displays distinct subsets of highly conserved residues within the pocket Fig. , formingsee Fig. , indicatThe BSKs are a new family of bacterial kinases with distinctive structural features and an unusual subcellular location, with most members packaged into the bacterial spore coat. Although the precise functions of BSKs are unknown, our integrated genomic, phylogenetic, and structural approach has highlighted several attributes of the family.C. difficile, and the mild phenotypes of BSK mutants.The dynamic evolutionary pattern seen in BSKs suggests that they provide multiple specific functional enhancements to different species, rather than acting as core structural elements of the coat. This notion is supported by the absence of BSKs from some sporulating species, such as The structure of YtaA also illuminates the remarkable innovations that have occurred in the active site of CAK kinases. Although the ePK family is very diverse, the mode of ATP binding and the conservation of active site residues is almost identical across the entire family, with only a few narrow exceptions.

Tandemly arrayed genes (TAGs) are duplicated genes that are linked as neighbors on a chromosome, many of which have importantphysiological and biochemical functions. Here we performed a surveyof these genes in 11 available vertebrate genomes. TAGs account foran average of about 14% of all genes in these vertebrate genomes, andabout 25% of all duplications. The majority of TAGs (72–94%) haveparallel transcription orientation in contrast to the genome, which has about 50% of its genesin parallel transcription orientation. The majority of tandem arrayshave only two members. In all species, the proportion of genes thatbelong to TAGs tends to be higher in large gene families than in smallones; together with our recent finding that tandem duplication playeda more important role than retroposition in large families, this factsuggests that among all types of duplication mechanisms, tandem duplicationis the predominant mechanism of duplication, especially inlarge families. Finally, several species have a higher proportion of largetandem arrays that are species-specific than random expectation. Evolution by Gene Duplication )As SSTAs are more likely to be recently born than arethe non-SSTA arrays that are shared by multiple species, we expect that underneutral evolution, the sizes of SSTAs should be on average smaller than the sizes of non-SSTA arrays. As most of theSSTAs are of size-two , we expeHere weperformed a genome-wide survey of TAGs in 11 assembled vertebrate genomes. Insummary, when using a stringent criterion for TAG identification , we observed a consistentpattern of tandem duplication contributing to the number of genes in thegenomes and to genome wide duplications: on average, about 14% of the genes invertebrate genomes are TAGs, and about 25% of all duplicated genes are tandemlyarrayed.These numbers most likely underestimate the extent oftandem duplication in these genomes. Our recent study shows that more than 25%to 40% of the recent gene duplications are generated by tandem duplications inhuman and mouse . TherefoArabidopsis thaliana and rice, respectively[It has beenshown that ∼80% and ∼88% of tandem arrays are in paralleltranscription orientation in ectively. How thiSo why is there disproportionately less convergent anddivergent transcription orientation in TAGs than in the genome? One explanationis that tandem duplications occur at a higher rate on the same strand than ondifferent strands. Little is known about what determines the rates of tandem duplicationon the same strand or different strands. Therefore, how much differential ratesof tandem duplication between same-strand and different-strands contribute tothe observed dominance of parallel orientation across all the studied speciesremains an open question. Another possible explanation is related to longinverted repeats (LIRs). It has been shown that LIRs can substantially increasegenome instability. For example, in the mouse, LIRs in germ lines can lead toelevated genome rearrangements due to increased levels of illegitimaterecombination, gene conversion, and deletion mediated by LIRs , 32. In All plant andanimal genomes that we have studied so far show that the majority of tandemarrays contain only two members. It is likely that large arrays are destroyedby various genome rearrangements and become smaller arrays over time, whichmight be the case for most of the tandem arrays. For the large TAG arrays suchas the 18S and 28S ribosomal RNA genes in the vertebrates , mechaniDrosophilamelanogaster, 18S and 28S rRNA genes contain 150 to 250 tandemly arrangedrepeats in wild-type flies [The fluctuation of array sizes has been observed innatural populations of many species such as humans and fliepe flies , 36 and pe flies , 38. TheAt the same time, a variety of mechanisms can reduceor prevent size change in a tandem array. For example, insertion of irrelevantgenes into the array mayeffectively reduce the frequency of unequal crossovers. The divergence of arraymembers can also reduce the frequency of unequal crossover. Therefore,observation on array sizes across multiple animal and plant genomes reflectsnot only a snapshot of current genomes, but also most likely a stable state ofTAGs as a result of joint processes of selection, drift, and mutation on thearrays.The positivecorrelation between the extent of tandem duplication and the sizes of genefamilies indicateConsistent with the current observation, our recent studyshows that tandem duplication generated more duplicated genes thanretroposition did in large families in both humans and mice . Many geTo answer the question, we need to compare thedifferences among various mechanisms of gene duplication. There are three majormechanisms of gene duplication: genome duplication, retroposition, and tandemduplication . Among tIt has been shown that retroposition seems to be moreactive in highly expressed genes in germline cells , 40. HowIdentifying thehomologous relationships for TAGs across speciesis a challenging task. Frequent gene conversion within tandem arrays andgeneTo circumvent the homology assignment problem, westudied two aspects regarding the evolution of TAGs in the 11 species that donot require identification of exact homology relationships among TAGs. Thefirst aspect is to examine the evolutionary closeness of the 11 species interms of TAG quantities in different gene families. There are two TAGquantities that one can describe for a particular gene family. One is the totalnumber of arrays in the family and the other is the total number oftandemly-arrayed genes in the family. It is expected that the two quantitativedescriptions should show similar evolutionary closeness to what the speciestree reflects. Our K-means clustering resultsuggests that the two quantities, to a large extent, are able to reflect thephylogenetic relationship of the species. The exception is the grouping of dogand cattle, which is always clustered with the nonmammals. A possibleexplanation is that many genes have not yet been annotated in these twospecies, especially those mammalian-specific TAGs, which makes them appearcloser to nonmammals. Alternatively, it may also mean that some ancestralmammalian TAGs are broken up in dog and cattle.The second aspect is related to species-specifictandem arrays (SSTAs). Apparently, the definition of SSTAs determines that SSTAstatistics are sensitive to the number, the kind, and the annotation quality ofthe species that are sampled. For example, it is expected that the more speciesincluded in a sample, the less likely an array will be an SSTA. Meanwhile, thenumber of SSTAs in a certain species is directly influenced by the species'distance to its closest related species in the sample. For instance, the numberof SSTAs in human in the human-mouse-rat sample will certainly be higher thanthe number of SSTAs in human in the sample that also includes chimp. Moreover,if the annotation qualities of the two species are different, for instance inthe case of human and chimp, there would be more SSTAs in the better annotatedspecies human than in the less well-annotated species chimp.SPANX gene family, containing two tandem arrays with a totalof 6 genes, has been reported to have gone through rapid evolution andamplification in hominids [Despite these caveats, study of SSTAs, or moregenerally, species-specific duplication, can potentially provide insight intothe adaptive evolution of species-specific traits and life styles. For example,one of the human SSTAs, the sperm protein associated with the nucleus on the Xchromosome hominids . Our anaWe haveprovided a quantitative account of TAGs and their contribution to duplicationsin vertebrate genomes. This is a first step towards understanding the evolutionof these genes. As it has been increasingly realized that how genes arearranged on chromosomes plays an important role in determining gene function,TAGs stand out for their unusual spatial arrangement. Future research can bedirected towards further understanding the intricate differences of tandemduplication from other types of duplication and the impact on the ultimate fateof duplicated genes.http://ensembl.org/). Therefore, we focused on these 11 species includinghuman (Homo sapiens), chimp (Pan troglodytes), mouse (Musmusculus), rat (Rattus Norvegicus), macaca (Macaca mulatta),cattle (Bos taurus), dog (Canis familiaris), opossum (Monodelphisdomestica), chicken , zebrafish (Danio rerio),and tetraodon (Tetraodon nigroviridis). Previously, we studied TAGs inthe genomes of human, mouse, and rat [There arealtogether 11 vertebrate genomes assembled and available in Ensembl Version 41( and rat . Howeverhttp://ensembl.org/). The total number of genes is shownin http://ensembl.org/ for details). All data were stored in MySQL database forsubsequent analysis.Annotation of genes for all 11 species was obtainedusing Ensembl Biomart ; allowing 1 spacer, we will have 1 arraywith 5 members .TAGs are usually defined as genes that are duplicatedtandemly on chromosomes. Members of tandem arrays may be separated by otherunrelated genes . During evolution, various genomerearrangements, such as transposition and insertion of genes that are unrelatedto array members , can disrupt the spatialarrangement of the TAGs. Allowing different numbers of spacers in between twomembers of an array will result in a different number of TAGs. For example,consider an array with the spatial arrangement of d denote the absolute difference of the indicesbetween two genes on the same chromosome. d − 1 is equal to the number of spacers betweenthese two genes S.When S = 0,it is a perfect TAG gene pair with no spacers. For certain S,we marked those gene pairs with d ≤ S + 1 and clustered them using a single-linkagealgorithm, which ensures that within each tandem array, there exists at leastone TAG link between any two array members. A TAG link is the relationship oftwo genes that can be seen as a TAG pair under the certain number of spacersallowed. We screened TAGs under each TAG definition (spacers 0–10) for everyspecies.To obtain TAGs, we sorted all the genes of eachspecies chromosome by chromosome and indexed them in ascending order based ontheir physical locations. Let

The metals are all six-coordinate with distorted octahedral geometries. The [CoII(dipicCl)(H2O)3] complexes are neutral, with one tridentate ligand and three water molecules. The [CoII(dipicCl)2]2− complexes each have two tridentate ligands. The [Na2CoII(H2O)12]4+ cluster has a central CoII ion which is coordinated to six water molecules and lies on a crystallographic inversion center. Four of the water molecules bridge to two sodium ions, each of which have three other water molecules coordinated along with an O atom from the [CoII(dipicCl)2]2− complex. In the crystal structure, the various units are linked by O—H⋯O hydrogen bonds, forming a three-dimensional network. Two water molecules are disordered equally over two positions.The title compound, [Co DOI: 10.1107/S1600536807067141/su2035Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The dihedral angle between the thio­phene and nitro­phenyl rings is 75.15 (2)°. In the crystal, inter­molecular N—H⋯N and C—H⋯O inter­actions lead to the formation of a supra­molecular chain extending along the c-axis direction.The title compound, C Å b = 13.4447 (7) Å c = 8.2237 (4) Å β = 106.794 (2)°V = 1405.30 (11) Å3 Z = 4 Kα radiationMo −1 μ = 0.24 mmT = 295 K 0.27 × 0.19 × 0.17 mm Nonius KappaCCD diffractometer9590 measured reflections3241 independent reflectionsI > 2σ(I)2351 reflections with R int = 0.051 R[F 2 > 2σ(F 2)] = 0.057 wR(F 2) = 0.174 S = 1.06 3241 reflections192 parametersH-atom parameters constrainedmax = 0.45 e Å−3 Δρmin = −0.38 e Å−3 Δρ COLLECT used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997WinGX (Farrugia, 1999Data collection: 10.1107/S1600536810035439/tk2704sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536810035439/tk2704Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

We aim to solve the problem of determining word senses for ambiguous biomedical terms with minimal human effort.We build a fully automated system for Word Sense Disambiguation by designing a system that does not require manually-constructed external resources or manually-labeled training examples except for a single ambiguous word. The system uses a novel and efficient graph-based algorithm to cluster words into groups that have the same meaning. Our algorithm follows the principle of finding a maximum margin between clusters, determining a split of the data that maximizes the minimum distance between pairs of data points belonging to two different clusters.On a test set of 21 ambiguous keywords from PubMed abstracts, our system has an average accuracy of 78%, outperforming a state-of-the-art unsupervised system by 2% and a baseline technique by 23%. On a standard data set from the National Library of Medicine, our system outperforms the baseline by 6% and comes within 5% of the accuracy of a supervised system.Our system is a novel, state-of-the-art technique for efficiently finding word sense clusters, and does not require training data or human effort for each new word to be disambiguated. Word sense disambiguation is a central problem for biomedical text mining. A variety of applications depend on it, such as biomedical information extraction and liteExisting techniques include supervised systems and knowledge-based systems, which both require extensive manual effort per ambiguous term in order to build an accurate system. Supervised systems require multiple examples of each sense of a word in context, manually labeled with the correct sense.From this data, a supervised system can learn to predict the correct sense of the same word in a new context. However, these data sets are labor-intensive, time-consuming, and expensive to produce, and thus far have been produced for only several dozen ambiguous terms. It is impractical to scale this kind of technique to all terms used in the biomedical literature.et al. for some w). Furthermore, the word that they shared must not have appeared in more than Max documents. This restriction prevents the comparison of documents if they share only function words like "the" or other relatively uninformative words that appear in almost every document. This algorithm has previously been shown to limit the number of comparisons made between documents to O(|V| log |V|) is the size of the subtree that is rooted at V1 and is connected to the rest of the tree along edge . It includes nodes V7 through V11. Notice that this subtree is different from the subtree rooted at V1 and connected to the rest of the tree by edge – that subtree includes all nodes except V9, V10, and V11.The first step in the algorithm is to calculate the size of each subtree in the MST. We first define a set of V0 in the figure). We then perform a breadth-first traversal of the tree, adding each node to a stack with a pointer to its parent along the way. The direction of the tree traversal is indicated by directed edges in Figure x with parent y is popped from the stack, the algorithm calculates:The calculation of the subtree sizes begins by choosing a random vertex as the root of the MST , V1] will be calculated as the sum of the slots for , , and , plus one for V1 itself.So, for example, Slot is 7, which is greater than the size of any of V1's other subtrees. Next, the algorithm will add V2 and V10 to the backbone, which both have slot values equal to 3. At that point, the Backbone-Finding algorithm stops, since none of V2 and V10's children has a slot value ≥ T.Suppose we have After finding the backbone of this MST, our complete algorithm operates by cutting the largest-weighted edge on the backbone, and then clustering all other nodes according to which part of the backbone they are connected to in the backbone. Note that this procedure accomplishes our original goal of forcing the algorithm to cut large edges that are not simply separating outliers from the rest of the group. Experiments below validate our intuitive approach.O(N) time for N vertices. It then requires popping each of the nodes and adding the slot values of incoming edges. Since there are N - 1 edges in a tree of N vertices, and each edge is considered at most twice during this step, it also takes O(N) time. Calculating the leftover slots after popping the stack requires visiting each edge again, for another O(N) steps. Determining the backbone from the MST with slot values uses a simple, greedy expansion technique that visits each node at most once. In total, the whole Backbone-Finding procedure requires O(N) time.As with our MST algorithm, the Backbone-Finding procedure is designed to operate efficiently so that it can be applied to large collections of documents. The calculation of slot values requires a breadth-first traversal of the tree, which takes ENSATIONAL system against both unsupervised and supervised systems.We performed two experiments to test the accuracy of our SENSATIONAL on two data sets. To compare SENSATIONAL with a supervised system, we tested it on a standard data set of ambiguous biomedical terms available from the National Library of Medicine (NLM) [et al., we evaluate on the subset of 15 terms for which the majority sense makes up at most 70% of the examples; this way, there is a reasonable amount of data for the system to learn patterns identifying the minority sense(s).We tested Sne (NLM) . Leroy ane (NLM) have devENSATIONAL on a data set of keywords from the NLM data set, plus a set of additional terms, including a number of acronyms. We collected a data set of PubMed abstracts for these terms. On average, we collected 271 documents per keyword; no keyword had fewer than 125 documents, and the largest collection was 503 documents. We filtered out abstracts that were less than 15 words. We manually labeled each occurrence of each term with an identifier indicating its sense in the given context . We collected data for a total of 21 keywords. Two of these were used for training (described below), and the other 19 for our tests. Most keywords had only 2 senses in the data, with five exceptions: "BPD", "cold", "inflammation", and "nutrition" had 3 senses each, and "MCP" had four. For all five cases, the largest two senses always covered at least 70% of the examples.The NLM data set contains a variety of biomedical terms, but it leaves out an important type of ambiguous keyword: acronyms. We further evaluated S). [For the PubMed data set, we provide two unsupervised comparison points for our system. The first is the SenseClusters system by Purandare and Pedersen (available for download at ). ,10 Like The SenseClusters system actually represents a large collection of different WSD techniques that have been developed over a number of years. In order to compare against SenseClusters, we had to select one of these techniques. The SenseClusters package has four different parameters, with between 2 and 12 values for each of them, for a total of 188 different configurations. We did not have access to any training procedures or ways of selecting values for these parameters from training data or by hand, so to be as fair as possible in our comparison, we adopted the following procedure: we ran all configurations on our test data, and chose the best-performing system to compare against. Note that this is an optimistic estimate of SenseClusters' performance, since we are in effect training the four parameters of SenseClusters on the test set.ENSATIONAL is a common baseline that is well-known to be difficult for unsupervised WSD systems to beat, which we call the All-in-1 baseline. All-in-1 works by putting all word instances into a single cluster, and represents a system that assumes all words have only a single meaning. Its accuracy is equal to the fraction of examples that belong to the largest cluster in the true clustering.The second unsupervised comparison point for SENSATIONAL has one parameter, which we train on a holdout set of two keywords ("MCP" and "white") from our PubMed data set. The unknown parameter is the pruning threshold for the Backbone-Finding algorithm, and we train it using a linear search over fixed intervals. The optimal setting on this training set turned out to be a setting where the backbone stops growing if the next subtree contains fewer than one-tenth of all nodes in the graph. We use this setting for all further experiments. As we note before, we use the test data to optimize SenseClusters' four configuration parameters. SENSATIONAL and SenseClusters were both restricted to providing at most 2 clusters during testing. As we mention above, we refer to both SenseClusters and SENSATIONAL as "unsupervised" systems despite the fact that we train them on manually-labeled training data. This is because they each have a small number of parameters that could easily be set by hand, but it is more rigorous to set them using a small amount of holdout data. Referring to sysems with a small number of free parameters as "unsupervised" is common practice in Natural Language Processing literature, regardless of whether they are set by hand or with small amounts of training data [Leroy and Rindflesch train and test their algorithm using 10-fold cross validation on the NLM data set. Sing data ,7.We measure the accuracy of our unsupervised systems as follows. We first find the best possible alignment between the output clusters from the system and the clusters in the labeled data set. The "best" possible alignment is defined to be the one which results in the highest number of elements in the output clusters being aligned with a cluster in the labeled data that contains the same elements. This task is a bipartite graph-matching problem, and we use the well-known Hungarian algorithm to compuENSATIONAL is able to outperform the baseline All-in-1 system, by 6% on average across the keywords. It does not perform as well as the supervised system by Leroy and Rindflesch, which is to be expected given that their system has access to training examples as input. However, SENSATIONAL is able to come within 5% of this supervised system without the need for a significant amount of manual input per term. Differences in accuracy between SENSATIONAL and the other two systems are statistically significant using the Chi-squared test with 1 degree of freedom. See Table On the standard NLM data set, SENSATIONAL requires at least 30 documents per sense in order to determine accurate clusters. Additional terms in the NLM data set did not meet this requirement, and SENSATIONAL performed below baseline on average for these terms. This is an unsurprising result, since Leroy and Rindflesch found that having fewer than 30 examples for a minority sense made it difficult for even a supervised system to find discriminating patterns in the data. Fortunately, it is much easier to add additional documents to SENSATIONAL's data set than to a supervised system's, since the data set does not need to be manually labeled. In future work, we plan to investigate more closely SENSATIONAL's accuracy as a function of the number of (unlabeled) examples it sees for each sense.We found that SENSATIONAL provide statistically significant gains over the baseline All-in-1 technique, SENSATIONAL achieving an improvement of 25% over the baseline on average across the keywords. Importantly, SENSATIONAL's Max-margin technique combined with its Backbone-Finding algorithm are also able to outperform the state-of-the-art unsupervised WSD system, SenseClusters, by a statistically significant margin of 2% . The SENSATIONAL technique not only works well on average, but it also works consistently well, outperforming SenseClusters on most keywords and outperforming the All-in-1 technique on all but 2 keywords. On 8 of the keywords, it achieved a 90% accuracy or more, and on two it achieved a perfect accuracy. The data set contains a variety of ambiguous terms, and SENSATIONAL is able to perform well on all of these kinds of words, including the acronyms. These encouraging results indicate that our system may prove applicable to arbitrary biomedical terms, without the need for manual input for each term.Results for our unsupervised comparison appear in Table ENSATIONAL's clustering algorithm can run in time O(N log N), making it a highly attractive framework for large-scale WSD.Max-margin clustering using minimum spanning trees and our Backbone-Finding technique achieves state-of-the-art results for unsupervised word sense disambiguation without manual resources. The technique outperforms existing unsupervised techniques and comes close to the performance of a supervised technique on a variety of ambiguous biomedical terms. In addition, SENSATIONAL. Further experiments are necessary to evaluate SENSATIONAL's performance, especially how much it can improve as we add more and more unlabeled data. In future work, we plan to incorporate methods to automatically determine how many clusters exist in the data. Furthermore, we plan to incorporate existing knowledge about particular word usages from the UMLS and other databases to help disambiguate terms that already have well-defined senses.Thus far, we have concentrated on achieving scalability and accuracy with SUMLS: Unified Medical Language System; NIST: National Institute of Standards and Technology; WSD: Word Sense Disambiguation; NLM: National Library of Medicine; MST: minimum spanning tree; ML: Machine Learning; SVM: Support Vector Machines; JDI: Journal Descriptor Indexing; L&R: Leroy & Rindflesch.The authors declare that they have no competing interests.WD implemented the software and carried out the clustering experiments. MS participated in the design of the study and the creation of the test data sets. AY conceived of the project, participated in its design and coordination, and drafted the manuscript.

Precision was evaluated using a liquid-type reagent, Thrombocheck Fib(L), on automated coagulation analysers. Coefficient of variation for within-run, intraday and between-day precision of the purified materials was 0.7-3.5%. In comparison, the coefficient of variation for plasma materials ranged from 1.2 to 5.3%. These results suggest that materials prepared from purified fibrinogen can be useful to laboratory quality control by improving overall precision of fibrinogen measurement and are applicable to automated coagulation analysers.Plasma fibrinogen measurement is a routine laboratory procedure commonly performed on automated coagulation analysers. Its determination is quantitative, not quantitative. Yet, a lack of precision has been an issue for fibrinogen measurement. A control material derived from plasma comprises many proteins, inhibitors and fatty acids, any or all of which can interfere in the fibrinogen assay. This study has attempted to develop a quality control material using purified human fibrinogen and has compared measurement precision between both purified and plasma materials. Purified fibrinogen was prepared using Cohn fraction 1 and glycine precipitation. Purified fibrinogen clottability was greater than 95%, with no main plasma proteins, lipids or fibrinogen degradation products observed. Two purified control materials were lyophilized at normal (2.30 g l

Crassostrea gigas).DNA methylation is an epigenetic mechanism with important regulatory functions in animals. While the mechanism itself is evolutionarily ancient, the distribution and function of DNA methylation is diverse both within and among phylogenetic groups. Although DNA methylation has been well studied in mammals, there are limited data on invertebrates, particularly molluscs. Here we characterize the distribution and investigate potential functions of DNA methylation in the Pacific oyster (C. gigas genes and demonstrated that this species possesses intragenic methylation. In silico analysis of CpGo/e ratios in publicly available sequence data suggests that DNA methylation is a common feature of the C. gigas genome, and that specific functional categories of genes have significantly different levels of methylation.Methylation sensitive PCR and bisulfite sequencing PCR approaches were used to identify CpG methylation in Crassostrea gigas, particularly in gene families that have inducible expression, including those involved in stress and environmental responses.The Pacific oyster genome displays intragenic DNA methylation and contains genes necessary for DNA methylation in animals. Results of this investigation suggest that DNA methylation has regulatory functions in Epigenetic mechanisms induce changes in gene activity without alteration to the underlying DNA sequence . Common Drosophilia melanogaster , one of seven CpGs sites displayed methylation in 25% of the clones sequenced was used. Five genes predicted to be hyper-methylated, and five predicted to be hypo-methylated (based on CpG observed to expected ratio) were randomly selected for analysis. Valid PCR products were produced for two of the genes. This is a typical result as the conversion of unmethylated cytosines results in challenges for primer specificity. Four individual clones were sequenced for each of the two products. There was a 100% conversion rate for non-CpG cytosines for each of the clones sequenced. In the first fragment, a 136 bp fragment with homology to the amino terminal fragment of the human neuromedin-u receptor [Swiss-Prot: d Figure . In a sed Figure . The latC. gigas transcriptome. This approach is based on the known hyper-mutability of methylated cytosines, which readily deaminate to thymine residues [The ratio of observed to expected CpG dinucleotides (CpGo/e) was used to predict methylation status in the residues . This Cpresidues . Consequresidues ,19,22,28C. gigas contig database, 'GigasDatabase' version 6 [C. gigas expressed sequence tag (EST) contigs is illustrated in Figure A non-redundant ersion 6 was utilThe ratio of observed to expected GpC dinucleotide frequencies (GpCo/e) was calculated in order to be assured that the bimodal distribution of CpGo/e was not biased toward G+C content of specific genes as there are no known mechanisms for preferential depletion of the GpC dinucleotide. As predicted, the ratio of observed to expected GpC's approaches 1.0 following a unimodal Gaussian distribution Figure inset. IIn order to determine any functional difference that may exist among those genes with lower than expected CpGo/e ratios, data were analyzed in the context of each gene's biological process GO Slim term Figure . SeveralCrassostrea gigas) genome is methylated. Further evidence supporting the presence and importance of methylation in C. gigas is the identification of genes that encode DNA methyltransferases (DNMT), the family of proteins responsible for the enzymatic conversion of cytosine to 5-methylcytosine. Animals that lack DNA methylation such as C. elegans also lack essential DNMTs, while invertebrates with an intermediate level of DNA methylation such as honey bees, sea urchins and urochordates have the full set of DNMT genes [de novo methylation), DNMT1 (associated with maintenance methylation), and methyl-CpG-binding domain protein 2 (mediation of the effects of DNA methylation) are present in a publicly available C. gigas contig database, GigasDatabase version 6 [C. gigas as it functions primarily as a tRNA methyltransferase and shows only weak DNA methyltransferase activity in vitro [Results of methylation specific PCR and bisulfite sequencing PCR indicate that the Pacific oyster and show a significantly bimodal distribution, suggesting that DNA methylation is a common feature of the C. gigas transcriptome, and that certain groups of genes have significantly different levels of methylation. The bimodal distribution of CpGo/e is similar to the pattern observed in the honey bee A. mellifera, where authors reported a hyper-methylated fraction that was enriched in genes involved with general metabolic functions and a hypo-methylated fraction enriched with genes that are associated with caste-specific functions [C. gigas transcripts were clustered according to their functional annotations using GO Slim terms, we see that the two distributions are comprised of functionally distinct classes of genes with varying regulatory requirements. Specifically, genes predicted to be hyper-methylated are associated with housekeeping functions and those predicted to be hypo-methylated are associated with general immune functions. Hyper-methylation of intragenic regions of housekeeping genes is consistent between C. gigas and A. mellifera [C. gigas could be important for repressing transcription outside of promoter regions as previously discussed. It has also been proposed that hyper-methylation of housekeeping genes in A. mellifera indicates epigenetic control of gene activity in housekeeping genes [C. gigas.Within the transcriptome of the Pacific oyster, a significant difference in methylation pattern was observed across gene families. A majority of unctions . Similarellifera , but staellifera . Constitng genes . FurtherA. mellifera (CpGo/e >1.0). One explanation as to why it would be advantageous for this class of genes to be hypo-methylated is that it allows for greater epigenetic flexibility and higher regulatory control. Oysters have been shown to have high phenotypic plasticity in response to environmental changes and stress [C. gigas would be an important step toward uncovering the nature of these epigenetic marks.Highest CpGo/e ratios were observed in genes involved in the oyster's innate immune response, including categories of cell adhesion, cell-cell signaling, and signal transduction. Our experimental data using MSP supports the predicted hypo-methylation of this class of genes as only 1 of the 5 immune related genes were methylated. Our results do not indicate that DNA methylation is entirely absent from genes in the hypo-methylated group as CpG depletion is still observed (CpGo/e 0.7) which stands in contrast to the hypo-methylated genes in d stress ,39 and id stress -42. It hd stress . The ideDaphnia magna, has shown transgenerational heritability of DNA methylation patterns after exposures to 5-azacytidine [C. gigas it may provide a mechanism not only for regulating responses to stress, but also for adapting to local stressors through heritability of DNA methylation patterns. Investigating the potential of epigenetic control in mechanisms of local adaptation may prove useful in understanding impacts of anthropogenic inputs in aquatic ecosystems and populations. Likewise, it is possible that epigenetic mechanisms may provide an explanation for other phenomena associated with heritability such as inbreeding depression and hybrid vigour.DNA methylation patterns have been shown to be heritable in mammalian taxa , and chacytidine . If DNA D. magna [Elucidating functional significance of DNA methylation in aquatic invertebrates may change the way we study impacts of environmental change in aquatic organisms. A range of factors such as diet ,48, xenoD. magna ,51. UndeIn silico analysis reveals intragenic regions are targeted for methylation consistent with reports of methylation in other invertebrate species. Results of this investigation suggest that DNA methylation has regulatory functions in Crassostrea gigas, particularly in gene families involved in stress and environmental response. Experiments are underway in our lab to investigate relationships between the environment, DNA methylation, and control of gene expression to better characterize this process. In-depth analysis of methylation patterns in Crassostrea gigas, will help to advance the field of evolutionary epigenetics and will serve to illuminate functions of DNA methylation in invertebrates.The Pacific oyster genome displays methylation. C. gigas populations in Puget Sound, Washington. To isolate genomic DNA, 25 mg of gill tissue was processed according to the manufacturer's protocol using the DNeasy Blood & Tissue Kit .Oysters used in this study were collected from naturalized Oyster genomic DNA was enzyme digested with either HpaII or MspI. Five immune related genes containing one or more CCGG recognition sites and covering a broad range of predicted methylation status (based on CpGo/e) were selected from a set of ESTs generated from a cDNA library of plated hemocytes . PCR priGenomic DNA was bisulfite converted using the Epitect Bisulfite conversion kit . Briefly, 1.75 ug of DNA was subjected to treatment with sodium bisulfite at increased temperature to deaminate unmethylated cytosine residues to uracil. Following treatment, the solution was desulfonated on a column, washed and eluted.To identify methylated cytosines in expressed regions of the oyster genome, Meth Primer was usedPCR products were separated using gel electrophoresis. Single bands were excised from the gel, purified using Ultra-DA purification columns and cloned using TOPO TA Cloning kit (Invitrogen). Four clones were sequenced for each primer pair. Methylation status was determined by comparing the sequence of bisulfite treated DNA to sequence of untreated DNA using Geneious 4.5.4 software and annotated using BLAST .in silico analysis, the non-redundant C. gigas expressed sequence tag (EST) contig database, 'GigasDatabase' version 6 , was ute genome ,12.l is the number of nucleotides in the contig:CpG observed/expected ratio (CpGo/e) was calculated using the following equation where p1 + p2 = 1. Hence the data Ci, are distributed as:To evaluate the distribution of Pacific oyster contigs, a mixture model was fit to the CpGo/e ratios using the mixtools package in R 5656 yieldiThe log likelihood statistic of the bimodal mixture model was compared to the normal null model to test for a significant improvement in fit.http://www.informatics.jax.org[In order to evaluate the variation of CpGo/e within and among functional classes of genes, contigs from the GigasDatabase annotated with a biological process GO term were assigned a functional group based on the MGI GO Slim database s.jax.org. Since eMG and SR conceived of the study and prepared the manuscript. MG carried out the laboratory procedures. All authors read and approved the final manuscript.Matrix of p-values for comparisons between GO Slim categories based on CpGo/e. CpGo/e for GO Slim categories were compared with Tukey's multiple comparison test. This file contains the p-values of each comparison. Significant differences (p < 0.05) are highlighted.Click here for filePrimer Sequences. This file contains primer sequences used for methylation sensitive PCR and bisulfite sequencing PCR analysis.Click here for file

Elevated blood pressure (BP) levels are common following acute stroke. However, there is considerable uncertainty if and when antihypertensive therapy should be initiated.Economic evaluation alongside a double-blind randomised placebo-controlled trial of 112 hypertensive patients receiving an antihypertensive regimen within 36 hours post stroke versus 59 receiving placebo. Outcomes were incremental cost per incremental: QALY, survivor, and patient free from death or severe disability at three months and 14 days post stroke.Actively treated patients on average had superior outcomes and lower costs than controls at three months. From the perspective of the acute hospital setting, there was a 96.5% probability that the incremental cost per QALY gained at three months is below £30,000, although the probability may be overstated due to data limitations.Antihypertensive therapy when indicated immediately post stroke may be cost-effective compared with placebo from the acute hospital perspective. Further research is required to confirm both efficacy and cost-effectiveness and establish whether benefits are maintained over a longer time horizon. Approximately 52,000 patients experience first stroke , and 135Elevated blood pressure (BP) levels are common following onset of acute stroke, and observational data suggest that both high and low BP levels are associated with poor short and long term prognosis -16. The In view of the uncertainty surrounding appropriate response to BP control in the acute post-stroke phase, the Control of Hypertension and Hypotension Immediately Post Stroke (CHHIPS) trial aimed to establish the safety, efficacy and cost-effectiveness of reducing BP with labetalol or lisinopril in hypertensive patients with acute cerebral infarction or haemorrhage, and of raising BP with phenylephrine in hypotensive patients with ischaemic stroke.As resources are finite, decision making requires consideration not only of the benefits to a patient of a health care intervention, but its impact on other patients consuming other diverse health care services: committing resources to one intervention means they cannot be employed, or must be withdrawn from, elsewhere. An economic evaluation considers the cost and consequences of two or more treatment strategies, and shows the change in both cost and outcome by adopting a new strategy in place of old . The chaWe report a cost-utility and cost-effectiveness analysis of therapeutically reducing blood pressure compared with no therapeutic reduction in blood pressure in hospitalised hypertensive patients with acute cerebral infarction or haemorrhage.Full details of the methods and outcome measures in the study are reported elsewhere -23. The Briefly, 179 patients aged 18+ years with a clinical diagnosis of stroke with onset ≤ 36 hours and systolic blood pressure (SBP) ≥ 160 mmHg were enrolled into this randomised double-blind placebo-controlled trial. Exclusion criteria included on antihypertensive therapy at time of stroke onset or an urgent indication for BP lowering, significant co-morbidity, or a life expectancy ≤ six months due to non-stroke causes prior to stroke onset.Following baseline assessment and National Institute of Health Stroke Scale (NIHSS)), patients were randomised on a 2:1 ratio between active treatment and placebo.Active treatment comprised stepped doses of oral (for non-dysphagic) or intravenous/sublingual routes of labetalol or lisinopril respectively with a target SBP of 145-155 mmHg or a SBP fall of ≥ 15 mmHg. Additional doses were administered at 4 and 8 hours post randomisation if targets were not met. Controls were administered matching placebo, and the regimen continued for 14 days post randomisation. Dysphagic patients underwent similar titrated dosing but with sublingual lisinopril 5 mg, intravenous labetalol 50 mg or matching placebo for 72 hours, then oral therapy (if possible), or via nasogastric tube until day 14. Subsequently all patients followed local guidelines as regards antihypertensive therapy . At day 14 and 3 months post randomisation, mRS was completed.Baseline and two week assessments were performed by research staff at the local centres. Three month follow-up was by telephone administered from the trial coordinating centre. Where participants were not able to recall date of discharge at the three month follow-up, the local research staff were contacted to obtain the date from hospital records.The primary outcomes were incremental cost per incremental survivor and incremental cost per incremental QALY gained at 3 months post randomisation with active treatment versus placebo. Secondary analyses comprised incremental cost per incremental: patient with death or severe disability (defined as mRS score < 4) at 14 days and 3 months, and survivor and QALY gained at 14 days.Utilities were mapped to mRS scores estimated from a study of 459 individuals eliciting utilities from mRS scores using the time trade-off (TTO) approach .The analysis was conducted from the perspective of the acute hospital. Hence resource use data comprised patient length of stay and study drug consumption. The price year of the study was 2006. Length of stay (LoS) was calculated as the difference between date of death or discharge and date of randomisation. The bulk of hospitalisation costs tend to be skewed towards the first few days of admission and the National Schedule of Reference Costs 2006 estimatePer patient cost of study drugs was estimated as number of tablets or vials multiplied by unit cost . PlacebWe present results as quantities of resource use and total cost, and outcomes by treatment group (active treatment vs placebo). The incremental cost-effectiveness ratio (ICER) was calculated asUncertainty in the point estimate ICER was investigated by means of a non-parametric bootstrap with 1000 replications. This was used to estimate confidence intervals around incremental cost and outcomes, and to generate the cost-effectiveness acceptability curve (CEAC). The CEAC shows the treatment (active or placebo) with the highest probability of being cost-effective at varying thresholds of willingness to pay for a unit of outcome, and is a means of expressing uncertainty around point estimates .Results are presented as cost of each arm and increment, outcome from each arm and increment, and incremental cost-effectiveness Table . The figOf 179 patients randomised to the trial, eight were withdrawn post randomisation . We estimate a 96.5% probability of the incremental cost per QALY gained being below £30,000 .This was a trial for which data collection proved to be problematic, particularly in terms of disability status at three month follow-up. The primary objective of the study was to assess whether disability and death at two weeks post stroke was affected by drug induced reduction of BP . Study rThe economic evaluation component of this study was added following commencement of the trial via a protocol amendment, with research resources permitting only limited data collection. Therefore the analysis relied almost exclusively on patient-reported length of stay to determine the cost of active and placebo treatments , and the perspective of the analysis was thus restricted to the acute hospital admitting the stroke patient.The use of self-reported length of stay is a common method for data collection in economic evaluations alongside trials. However, this is subject to recall bias. Studies of the reliability of self-reported data have reported mixed results ,32. The Costing based on length of stay with drug costs added to this may risk double counting if the unit cost used factors in an allowance for drugs. This is an issue common to many economic evaluations, and care must be taken to be sure of what is included in 'per episode' unit costs. In the context of this study, as drug costs were such a trivial component, the impact on the results would be negligible.We did not document readmissions within this study. However, for this to affect the conclusion of the study, we estimate that patients in the treatment arm would on average, need 2.3 to 2.5 additional readmissions per patient over the three months compared with placebo. We consider such a large difference to be unlikely, indeed a priori it may be expected for there to be fewer readmissions in the active treatment arm. (Please see Appendix 1 for details).The EQ-5D generic quality of life instrument was included within this study by protocol amendment. As this was after baseline measurements had been taken, and due to the small numbers of observations, it was decided to map the mRS scores to utilities and hence QALYs gained, rather than use the EQ-5D data . The anaWe only had relatively small numbers of observations for analyses 5 and 6 cost-effectiveness from the acute setting perspective, and b) the generalisability of this restricted analytic perspective to wider societal cost-effectiveness over a longer horizon. Length of stay has been shown to be the major determinant of acute care cost ,34 and tThis can only by answered either through long-term prospective studies, or through decision analytic modelling. Such a prospective study may be prohibitively expensive and time consuming to conduct. The modelling approach is therefore recommended as a means of generating an answer within a reasonable time frame, and the results of this study should be seen as a valuable input into such an exercise, rather than a definitive estimate of the cost-effectiveness of antihypertensive medication immediately post stroke. Once such a model has been developed, value of information analysis may be used to estimate the likely return from a larger scale (and longer term) trial .Future trials of treatments in this area wishing to incorporate an economic aspect to their investigations should include a) generic quality of life measurement alongside any disease specific or clinical endpoints and b) resource use data collection from the outset. Consideration should be given as to whether at the very least quality of life and place of residence could be relatively easily measured at, say, six months and one year post intervention to lengthen the time horizon of any such study at minimal additional research cost.post ictus. Further research, in particular decision analytic modelling, is required to confirm both efficacy and cost-effectiveness and whether benefits are maintained over a longer time horizon. The data from this study form a useful input into such a model.Antihypertensive therapy in hypertensive patients immediately post stroke may be effective and cost-effective compared with placebo from the acute hospital perspective at three months The authors declare that they have no competing interests.JFP was the principal investigator, developed the trial, sought and obtained funding. CJ oversaw the statistical analysis. AKM was the CHHIPS trial coordinator and responsible for data management. TGR & GAF were co-investigators responsible for developing the trial, applying for trial funding and were members of the trial steering committee. EW carried out the economic evaluation and drafted the manuscript. All authors read and reviewed manuscript drafts, and approved the final version.• At three months, point estimate results were that intervention was £5,324 less expensive than control, and resulted in 0.044 more QALYs, yielding an ICER of -£121,000 (intervention dominant).• For the ICER to be below £20,000, the cost in the intervention arm could rise by £6204 .• The mean cost of a stroke admission in the study price year of 2006 was £2642. Therefore the intervention is still cost-effective compared with control so long as there were less than 6204/2642 = 2.3 more admissions per patient, on average, in the intervention arm compared with control over the three month period. • for the ICER to be below £30,000, intervention arm patients must have no more than a average of 2.5 admissions per patient over the three month period.Table A2.1. Baseline characteristics of patients included in analysis 4.Click here for fileTable A2.2. Baseline characteristics of patients included in analyses 5 and 6.Click here for file

Homozygous nude rats (rnu/rnu) injected s.c. with 3 X 10(7) human pancreatic cancer cells from the GER cell line developed circulating antibody to GER cell surface, detected in a 125I binding assay against viable GER cells in vitro. Antibody titre rose with progressive xenograft growth. These antibodies showed no selectivity for GER cells when compared with a panel of other human cell lines. Heterozygous nude rats (rnu/+) immunised with serum from their GER xenograft-bearing nude relatives (rnu/rnu) also developed anti-GER cell surface antibodies. These antibodies showed some selectivity for GER and WAD (a second human pancreatic cancer cell line) when compared with other human cancer cells and lymphocytes. These findings show that some human pancreatic cancer cell surface components may persist independently in the circulation of xenograft bearing rnu/rnu rats despite the presence of antibody excess to other surface determinants from the same cells. It is suggested that differences in the relative immune competence of rnu/rnu and rnu/+ rats may offer a biological opportunity for enhancing the recognition of weak antigenic determinants which may have some useful selectivity for different types of human tumour cells.

Fusarium solani by the use of cultured immortalized human corneal epithelial cells (HCEC) and to determine whether inactive hyphal fragments can induce an antifungal response in these cells.To evaluate the role of toll-like receptors (TLRs) in host responses to Fusarium solani, and the effect on expression of TLRs was determined by real-time polymerase chain reaction (PCR), immunofluorescence, and western blot analysis. Cells were also cocultured with hyphal fragment and hydrocortisone to determine whether hydrocortisone modulates the transcription of TLRs. The release of interleukin-6 (IL-6) and IL-8 was also measured using enzyme-linked immunosorbent assays (ELISA) in the presence and absence of specific blocking antibodies to TLR2 and TLR4.Cultured HCEC cells were stimulated with inactive hyphal fragments from Incubation of HCECs with inactive hyphal fragments upregulated the expression of TLR2, 3, 4, and 6 mRNAs and increased the release of IL-6 and IL-8. Immunofluorescence staining and western blot analysis confirmed that expression of TLR2 and TLR4 was upregulated in response to hyphal fragments. This upregulation was further enhanced by cotreatment with hydrocortisone. Results from ELISA assays showed that the concentration of IL-6 was increased, and the concentration of IL-8 was decreased in supernatants of HCECs after treatment with both hydrocortisone and hyphal fragments. The release of IL-6 and IL-8 was also inhibited by incubation with anti-TLR2 and anti-TLR4 monoclonal antibodies.Fusarium hyphae in HCECs. Glucocorticoids such as hydrocortisone can enhance the expression of the TLRs on the epithelium and thus may enhance the resistance to fungal infections in the cornea. These findings may provide crucial information for understanding the immune mechanisms of fungal keratitis and promote the design of new immune therapeutical approaches to fungal keratitis.HCECs are involved in the cornea immune response to fungal infections. TLR2 and TLR4 may play a crucial signaling role in response to Fusarium are the most frequently isolated fungi in patients with fungal keratitis. Furthermore, Fusarium has increasingly been identified in deep tissues and disseminated infections [Mycotic keratitis is an opportunistic fungal infection of the cornea caused by either a reduction in the local defense mechanism or by injury to the corneal epithelium. If not correctly diagnosed and treated, mycotic keratitis can result in a marked loss of vision and eventually cause a complete perforation of the cornea. Members of the genus fections -3. DespiThe corneal epithelium is known to be an efficient physical barrier to infections and constitutes the first line of defense against microbial pathogens . This isCandida albicans [Aspergillus fumigates [Cryptococcus neoformans [Fusarium. To better understand the innate immune response of corneal epithelial cells to fungal infections, we investigated the role of TLRs in immortalized human corneal epithelial cells (HCEC) in response to inactive hyphal fragments from Fusarium solani.Recent studies indicate that recognition of pathogens is largely assigned to an evolutionarily conserved family of receptors known as toll-like receptors (TLRs). These receptors function in innate immunity via the recognition of pathogen-associated molecular patterns ,11. Prevalbicans -19, Aspeumigates -24, and oformans -27. HoweDulbecco's Modified Eagle Medium (DMEM), F12, fetal bovine serum (FBS), and phosphate-buffered saline (PBS) were obtained from Invitrogen-Gibco . All media and cytokines used for cell culture were endotoxin minimized. Tissue culture dishes and six-well chamber slides were from BD . Hydrocortisone was obtained from Calbiochem . Affinity purified, monoclonal, anti-human TLR2, TLR4, and normal mouse immunoglobulin G (IgG) were from eBioscience . CY3-conjugated secondary antibody was from Beyotime Biotechnology . 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI dihydrochloride) was used to dye nuclei and was purchased from Beyotime. Paired antibodies for human interleukin-6 (IL-6) and IL-8 enzyme-linked immunosorbent assays (ELISA) were from BD. RNeasy Mini kits were purchased from Qiagen for RNA extraction. RNA polymerase chain reaction (PCR) kits were from Promega , and ethidium bromide, DNA molecular size markers, and agarose were from Gene Tech . SYBR Green PCR kits were from Applied Biosystems .Fusarium solani strain was purchased from the China General Microbiological Culture Collection Center . Isolation and preparation of killed hyphal fragments was previously described [Fusarium solani, 0.05% Tween 80 was added to the PBS. To remove hyphae and debris, the conidial suspension was filtered through eight layers of cheesecloth. Conidia were cultured in YAPD . After 48 h, more than 95% of blastoconidia were grown to hyphae, which were checked by microscope. To get hyphal fragments of a uniform size, hyphal fragments were treated with Micro Tissue Grinders and an Ultrasonic Cell Cracker . Hyphal fragments were then filtered through 400 mesh grit (38 μm diameter). Hyphal fragments were heat-killed for 15 min at 100 °C.The sterilized hyphae were centrifuged and resuspended vigorously in PBS, containing 10 mg of RNase A per ml, and incubated for 30 min at 37 °C to remove intracellular RNA. Finally, the hyphal fragments were washed three times with Hank's Buffered Salt Solution (HBSS) and stored at −80 °C. Microscopically, the morphology of the killed hyphal fragments 40 immortalized human corneal epithelial cells (HCEC) were cultured in DMEM/F12, supplemented with 10% FBS, 5 μg/ml insulin, 0.1 mu g/ml cholera toxin, 5 ng/ml human epidermal growth factor, and 40 μg/ml gentamicin at 37 °C under 95% humidity and 5% COi et al. . The celThe HCECs were seeded onto Laboratory-Tek tissue culture chamber slides for 24 h and then subjected to one of the following treatments: (1) treated with hyphal fragments for 48 h at 37 °C; (2) treated with hydrocortisone (10 μg/ml) for 48 h at 37 °C; or (3) incubated with hydrocortisone (10 μg/ml) for 2 h at 37 °C followed by treatment with hyphal fragments for 48 h at 37 °C. Following treatment, supernatants were collected and stored at −80 °C to evaluate the release of IL-6 and IL-8. mRNA was also extracted from cells following treatment to evaluate the expression of TLRs.TLR blocking experiments were conducted by incubating HCECs with monoclonal antibodies (mAbs) against TLRs. HCECs were incubated at room temperature with anti-TLR4, anti-TLR2, both anti-TLR4 and anti-TLR2, or IgG control antibody for 1 h. Cells were then treated with hyphal fragments for 48 h at 37 °C, and the supernatants were collected to evaluate the releases of IL-6 and IL-8.2, 5 mM dithiothreitol, 20 U of RNase Inhibitor, 1 μl (1 μg) random primer, 0.5 mM each dNTP, and 200 U RNase H-free reverse transcriptase . The following primer pair was used for the analysis of GAPDH by reverse-transcription polymerase chain reaction (RT–PCR): 5′-CGG AGT CAA CGG ATT TGG TCG TAT-3′ and 5′-AGC CTT CTC CAT GGT TGG TGA AGA C-3′.The annealing temperature of the primers was 60 °C. Each PCR was performed in a 20 μl solution containing 1 μl RT reaction products, 10X PCR buffer 2 μl, 1.8 mM MgCl2, 0.1 mM each dNTP, 0.1 μM of upstream primer, 0.1 μM of downstream primer, and 0.5 U Taq DNA polymerase. A negative control (the PCR without a preceding RT step) for each sample was run to assess whether there was residual genomic DNA in the DNase-treated samples.Total RNA prepared from confluent monolayers of HCEC was used to evaluate the expression of TLR mRNA. Qiagen RNeasy Mini kits were used for RNA extraction. Total RNA samples were then reverse transcribed in a final volume of 20 μl containing 1 μg RNA, 50 mM Tris-HCl, 75 mM KCl, 3 mM MgClReal-time PCR was performed in an ABI PRISM 7500 Sequence Detection System Thermal Cycler (Applied Biosystems). Real-time PCR was performed on a volume of 15 μl containing 1.5 μl (50 ng) of cDNA and 13.5 μl of master mix containing 7.5 μl of mix , 0.75 μl of each primer (10 pmol/l), and 4.5 μl of diethyl pyrocarbonate-treated water. The primers are listed in T data were evaluated by Sequence Detection Software V1.3.1 (Applied Biosystems). For data analysis, we used the comparative CT method (ΔΔCT method) with the following formula: ΔCT=CT - CT . The comparative ΔΔCT calculation involved finding the difference between ΔCT of treated cells and the mean value of the ΔCT from the untreated cells. Fold increase in the expression of specific mRNA in treated cells compared to untreated cells was calculated as 2-(ΔΔCT). Data are expressed as RQ (relative quantity) and differences are shown in the figures as the expression ratio of the normalized target gene according to the software results.Samples were amplified in triplicate, averages were calculated, and differences in CHCECs were seeded onto Laboratory-Tek tissue culture chamber slides without FBS for 24 h. The cells were then washed with Hank's Balance Salt Solution (Invitrogen-Gibco) and stimulated with 10 μg/ml hydrocortisone for 48 h. The slides were then fixed in 4% paraformaldehyde for 15 min and washed with 10X Tris Buffered Saline (TBS) three times for 5 min. Fixed cells were incubated in blocking buffer of 5% BSA and 0.1% Triton X-100 in PBS for 30 min at room temperature. Cells were then incubated with the following dilutions of primary antibodies for 1 h at room temperature: primary mouse anti human TLR2 and four monoclonal antibodies (20 μg/ml in 5% BSA-PBS) or with mouse IgG (control). The secondary antibodies that were conjugated to Cy3 were diluted 1:200 in 5% BSA-PBS and incubated for 1 h at room temperature. Coverslips were washed three times in PBS for 5 min, mounted , and viewed with a fluorescence microscope . The DNA-intercalating dye, DAPI dihydrochloride, was used to stain nuclei. For the negative control, preimmune mouse serum was substituted for the primary antibody.Cells challenged with hyphal fragments were lysed in radioimmunoprecipitation (RIPA) buffer . Protein concentration was determined using the bicinchoninic acid (BCA) assay . Equal amounts of protein were mixed with SDS–PAGE protein loading buffer and boiled for 5 min. Proteins were separated by sodium dodecyl sulfate-PAGE in Tris/glycine/SDS buffer and electro-blotted onto nitrocellulose transfer membranes. After blocking with 5% nonfat milk for 1 h, membranes were washed three times with TBST for 5 min and incubated overnight with polyclonal antibodies against TLR2 and TLR4 (1:1000 dilution in 5% nonfat milk) in TBST. GAPDH was used as the control. After washing three times in TBST, membranes were incubated with secondary HRP-conjugated anti-mouse IgG for 1 h. The membranes were again washed with TBST three times and one time in TBS, 5 min each. Immune complexes were visualized with an enhanced chemiluminescence reagent (Pierce). Results were quantified by capturing the exposed X-ray film image and using area measurements from image analysis software.The concentrations of IL-6 and IL-8 in the cell culture supernatants were determined by ELISA. The assay was performed according to manufacturer's instructions. Results from two representative experiments are presented as the means±SEM of triplicate cytokine measurements.t test using SPSS (version 11.5). Differences were considered statistically significant at p<0.05.Data are expressed as mean±SEM of triplicates from experiments repeated three times that yielded similar results. Statistical significance of differences was determined with the nonparametric Wilcoxon test and Student's Preliminary studies using real time PCR revealed that HCEC expressed varying levels of mRNA for TLR1–10 . TLR1, 3The results of real time PCR indicated that inactive hyphal fragments treatment can increase the mRNA expression of TLR2, 3, 4, and 6 in cultured HCEC .The results of real time PCR showed that hydrocortisone treatment upregulated the expression of TLR2, 4, 6, and 10 mRNA in HCECs . The incThe results of immunofluorescence staining revealed moderate TLR2 and 4 reactivity in untreated HCECs. The staining intensity of these antigens was slightly enhanced after treatment with hyphal fragments .The expressions of TLR2 and TLR4 were also confirmed by western blot analysis. The results of this analysis demonstrated increased expressions of TLR2 and TLR4 following treatment with hyphal fragments . The expFusarium hyphae. In contrast, an isotype-matched control, Ab, had no effect on IL-6 or IL-8 production , and Pseudomonas aeruginosa and their products, respectively [Fusarium. The results of this study demonstrated that exposure of HCECs to inactive hyphal fragment resulted in the upregulation of TLR mRNA expression of TLR2, 3, 4, and 6.Corneal epithelial cells are constantly exposed to microbial pathogens and their products on the ocular surface. Although the cornea is highly resistant to infections under normal conditions, sight-threatening microbial infections may occur when the corneal integrity is breached by trauma or contact lens wear. Therefore, the underlying mechanisms that regulate corneal epithelial cell activation are important in the development of infectious keratitis. Previous reports showed that human corneal epithelial cells express functionally active TLR2, 3, and 5 and that these cells respond to ectively -16. The candidiasis, Aspergillus, and Cryptococcus neoformans [This study focused on TLR2 and TLR4 because TLR3 reportedly only responds to double-stranded (ds) RNA ,34 and Toformans -27.Fusarium in HCECs. Our results are in agreement with other reports investigating host response to other fungal pathogens. Netea [candidiasis in TLR4-defective mice. Experimental models of disseminated candidiasis infection in TLR2−/− mice have also shown modulatory effects of TLR2 on host defense [Aspergillus hyphae. However, other reports have demonstrated that both TLR2 and TLR4 are important for recognition of Aspergillus fumigatus [Aspergillus niger [Cryptococcus neoformans glucuronoxylomannan binds to TLR2 and TLR4, resulting in translocation of NF-κB caused by the binding of TLR4 but not of TLR2 [Cryptococcus neoformans infection [Results from this study indicated that both TLR2 and TLR4 are likely involved in the host response to s. Netea demonstr defense ,19. Wang defense proposedumigatus -24 and Aus niger . Other r of TLR2 . More renfection ,27.Hemophilus influenzae through activation of TLR2 itself [Glucocorticoids are widely recognized as regulators of adaptive immunity and inflammation. These compounds have been used extensively in clinical settings to suppress a large variety of inflammatory and immune responses. Topical corticosteroids have evolved into the standard treatment for nearly every inflammatory disease of the ocular anterior segment ,38 and c2 itself ,42. This2 itself and suggFusarium solani hyphal fragments resulted in the production of IL-8, the major chemokine that attracts polymorphonuclear leukocytes (PMNs) into the infected cornea, and IL-6, which activates PMNs. A similar study also reported poly (I:C) [Recognition of pathogen-associated molecular patterns (PAMPs) via TLRs can lead to translocation of the nuclear factor NF-κB, resulting in upregulation of proinflammatory cytokines, costimulatory molecules, and chemokines ,45 such ly (I:C) and lipoly (I:C) induced At the same time, we observed that hydrocortisone can enhance the release of IL-6. This enhancement apparently correlates with the increased levels of the TLR mRNA following hydrocortisone treatment. These results suggested that the action of hydrocortisone on the cornea may be partially mediated via TLRs.Fusarium hyphae while an isotype-matched control Ab was ineffective can affect the release of IL-6 and IL-8 in HCECs following treatment with hyphal fragments. The results of ELISA showed that pretreatment of HCEC with anti-TLR2 or anti-TLR4 inhibited the production of IL-6 and IL-8 induced by ffective . MaximalExtrapolation of results in HCECs to the in vivo corneal epithelium may be problematic due to inherent differences between the two systems. For example, transformation by SV40 may significantly affect the expression of TLRs. However, previous studies have shown that HCECs are an excellent cell line in which to study TLR function in the corneal epithelium. The functions of TLRs in response to pathogen-associated patterns such as flagellin, lipopeptides, and poly(I:C) in HCECs are similar to the functions of TLRs in cultured primary human corneal epithelial cells ,13,15,50Fusarium hyphae in HCECs. Glucocorticoids enhance the expression of the TLRs on the epithelium and may promote resistance to fungal infections in the epithelium. These findings may provide crucial information for understanding the immune mechanisms of fungal keratitis and help design new immune therapeutical approaches to fungal keratitis.In summary, our data suggest that TLRs are involved in the cornea response to invasive fungal infections. TLR2 and TLR4 may play crucial roles in signaling in response to

The dihedral angle between unique benzene and pyridine rings is 8.0 (1)°. An intra­molecular O—H⋯N hydrogen bond may influence the mol­ecular conformation. In the crystal structure, there are weak π–π stacking inter­actions with a centroid–centroid distance of 3.7838 (15) Å.The title mol­ecule, C Å b = 8.4485 (14) Å c = 13.012 (2) Å β = 121.980 (3)°V = 1959.8 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.09 mmT = 298 K 0.38 × 0.20 × 0.16 mm Bruker SMART CCD diffractometerSADABS; Sheldrick, 1996T min = 0.967, T max = 0.986Absorption correction: multi-scan (5242 measured reflections1913 independent reflectionsI > 2σ(I)1334 reflections with R int = 0.025 R[F 2 > 2σ(F 2)] = 0.055 wR(F 2) = 0.143 S = 1.02 1913 reflections137 parametersH-atom parameters constrainedmax = 0.17 e Å−3 Δρmin = −0.13 e Å−3 Δρ SMART used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536809032346/lh2878sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809032346/lh2878Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

To the Editor: A 38-year-old French man with a history of chronic juvenile arthritis was referred to the Necker-Enfants Malades University hospital with a dysenteric syndrome. The patient had returned the day before from a 1-month stay in Port-au-Prince, Haiti, where he spent most of his time in close contact with young children from an orphanage, most of whom had diarrhea. Clinical examination at admission showed fever (39°C), chills, diffuse abdominal pain, bloody diarrhea, and vomiting. The patient received ceftriaxone, which was stopped on day 4 because initial blood and stool cultures were negative for pathogens and clinical signs had completely resolved.Shigella sonnei. An extended-spectrum β-lactamase (ESBL) was detected by double-disk synergy test; the isolate was also resistant to aminoglycosides (except amikacin), tetracycline, and cotrimoxazole. The strain was susceptible to fluoroquinolones and fosfomycin. It also appeared susceptible to azithromycin (MIC 4 μg/mL), although azithromycin MIC for Shigella spp. should be interpreted with caution . Analysis of the deduced amino acid sequence allowed characterization of TEM-137, derived from TEM-1 with 2 substitutions, Arg-16→Ser and Glu-240→Arg. This ESBL (and resistance to aminoglycosides and tetracyclines) was easily transferred to Escherichia coli J53-2 by conjugation.To identify the molecular basis of this ESBL, a series of PCR primers were used for detection of TEM-, SHV-, or CTX-M–type ESBL . High-level resistance to ceftazidime (MIC 32 μg/mL) and intermediate resistance to cefotaxime (MIC 8 μg/mL) were observed; the strain remained susceptible to cefepime and imipenem . Clavulanic acid did not restore susceptibility to ceftazidime (MIC 4 μg/mL) but did restore susceptibility to cefotaxime (MIC 0.5 μg/mL). With clavulanic acid, the MIC of cefepime was 0.06 μg/mL.S. sonnei is rare worldwide. In Argentina, a CTX-M-2 was found in an isolate of S. sonnei resistant to cefotaxime but not to ceftazidime harbored by this imported S. sonnei isolate clearly demonstrates that ESBL-associated shigellosis has emerged in Haiti and that potentially large and severe shigellosis outbreaks could occur, for which the use of azithromycin could be beneficial, as illustrated in our patient. Because treating shigellosis is becoming problematic, it is essential to focus on prevention measures such as simple rules of personal hygiene that might drastically decrease the risk of transmission.In our case, little information on antimicrobial drug resistance could be obtained from Haiti because no systematic investigation on resistance in

Purpose. To explore the interactions between child and parents psychosocial factors and team integration variables that may explain improvements in physical dimensions of the PEDS QL quality of life of children with complex needs after 2 years. Methods. In this 2-year study, parents were identified by the Children's Treatment Network. Families were eligible if the child was aged 0–19 years, had physical limitations, resided in either Simcoe County or the Region of York, Ontario, and there were multiple other family needs. Regression analysis used to explore associations and interactions; n = 110. Results. A child's physical quality of life was affected by interacting factors including child's behavior, parenting, and integrated care. Statistically significant interactions between team integration, processes of care, and child/parent variables highlight the complexity of the rehabilitation approach in real-life situations. Conclusions. Rehabilitation providers working with children with complex needs and their families should also address child and parent problematic behaviors. When this was the case in high integrated teams, the child's physical quality of life improved after two years. Integrated health services hold the promise of improved efficiency, capacity, performance/quality, cost-effectiveness, and enhanced working environment with improved communication and cooperation , 2. The client” . In OntaIn a synthesis of reviews of effective, efficient human services for school-aged youth, Browne et al. concludeThe CTN model of team service provision consists of an “integrated package” with the following key elements.Single point of access, Service Navigation, and a comprehensive Child and Family Interview, Service Coordinator, development of the individual child and family team, and development of a single plan of care recorded in the shared electronic client record.assignment of a http://www.ctn-simcoeyork.ca/).This integrated network incorporates the key principles necessary for success as outlined by Suter et al. in theirTo date, evaluation of health service integration efforts has been largely cross-sectoral in nature with some reported benefits to the system. System-level positive outcomes include reduction in nonemergency cases using the emergency room; reduction in the average length of stay in hospital; better financial performance; a flatter organizational structure (fewer management tiers). Some of the positive program/provider-level outcomes include increased job satisfaction; increased cooperation with other agencies; a blending of professional cultures into one shared culture . There hOur team took the bioecological and biopWe hypothesized that the effects of current integrated child and family team function would be more pronounced or stronger among families with fewer parent and child risk characteristics , 8 becauThis descriptive study is part of a prospective cohort study examining the effects and expense of the CTN. Ethics approval was obtained for the study by the Research Ethics Board of McMaster University.The depth of integration of CTN service providers on each child and family team was also measured at the 2-year followup. Completed integration measures were obtained from service providers on 110 CTN child and family teams. This was a 2-year longitudinal survey of families with a special needs child enrolled in the CTN from May to December 2007. Families were deemed eligible if the child was aged 0–19 years, were residents of Simcoe/York, and there were, in addition to the child's physical rehabilitation needs, multiple other needs within the family . The consenting parent/guardian most knowledgeable (PMK) returned a signed consent form to McMaster University indicating their willingness to participate. The PMK then completed a baseline telephone interview (1 hour) by one of three trained interviewers from McMaster University. A followup telephone interview was completed after 2 years by the same McMaster interviewer who was masked to the child and family receipt of integration care. observed integration score is the mean of the average group observed depth of integration scores. The total expected integration score is the mean of the average group expected depth of integration scores [Integration of the CTN teams among families enrolled in this research was measured using the Integration of Human Services Measure , 2. Thisn scores . Scores The team's functioning was assessed by the functioning of the service coordinator. Both observed and expected depth of integration scores about the service coordinator for each team were calculated by the average of individual members' inputs on a four-point scale from 0 (nonawareness) to 4 (collaboration). The number of team members who responded to the study and the corresponding response rate were also calculated.The PedsQL is a generic measurement system developed by Varni et al. . The shoBehavior was measured using the child behavior checklist (CBCL) questionnaire for children ages 2–19 also used in the Canadian Longitudinal Survey of Children and Youth (NLSCY) . This alThe Kessler scale (K10) , 14 meas Parents were asked to rate their mental, physical health and general life satisfaction on a five-point scale (1—“very satisfied” or “excellent” to 5—“very dissatisfied” or “poor”). These questions were taken from the Canadian Community Health Survey (CCHS 2.2) that allThe Impact on Family (IOF) Scale determines the effects of a chronic illness on parents and families. Parents respond on a four-point scale about the degree to which statements apply to their family (1—“strongly agree” to 4—“strongly disagree”) . The revThe NLSCY Parenting Scale was usedThe level of social support of the PMK was assessed using an eight-item shortened version of the Social Provisions Scale . DiffereThirteen items from the NLSCY population survey , based oThe Measure of Processes of Care (MPOC-20) is a 20-item, well-validated, and reliable self-report measure of parents' perceptions of the extent to which the services they and their child receive are family-centered , 23. ResThey include, child age, gender, grade and PMK report of the main medical and other important diagnosis.A standard form including spiritual or faith orientation, ethnicity, and languages was selected from the NLSCY that also includes community dwelling disabled children . SociodeDescriptive statistics were calculated for all child and family variables, team integration, and team functioning scores. The child and PMK variables had a changing number of participants for several reasons. The behavior subscale measures have different numbers of items applicable to different age groups. Specifically, prosocial, indirect aggression, and property offence behavior scale items are applicable for children and youth from 6 to 19 years old. The PedsQL is applicable only to children aged 2–19. The behavior scales for different age groups were transformed using the interpolation technique where the mean of the behavior scale scores for children from 2 to 5 years old with fewer items were multiplied times the number of items for older children. This transformed mean was used in the analysis. In 18 instances, there were reports of two or three children with complex needs in the same family and only one report of parent variables. In these instances, the PMK was counted multiple times to ensure a matched number of children and parents in the analysis. R2), as it measures the percentage of variation of the dependent variable explained by the model. In the final model, all possible 2-way interactions of variables were tested, and interactions that were not statically significant were removed using the Forward Stepwise Selection technique, where the inclusion significance level and exclusion significance level were chosen to be 0.05 and 0.10 respectively. The variables in the final model were centralized to adjust for possible multicolinearity. The normal probability plot for the residuals was used to check the normality assumptions for the models. A multiple linear regression model was used to study the interactions among the integrated team variables with other child/family/health services variables to explain the variation in the Child's Physical Quality of Life (QL) at followup. Variables consistent with the ecological conceptual framework that shoThe interactive effect between two continuous variables was illustrated by conditional regression lines. The association between one variable and the outcome was plotted as a regression line under three conditions of the other variable. The literature suggested applying one standard deviation from the mean to approximate scores of different conditions . In our In Observed levels of CTN team depth of integration indicate teams were currently functioning at a communication level while team members expect to be cooperating. The service coordinators were on average observed to be functioning at an awareness level and expected to be communicating. The average number of service providers on each child and family team was 6. The mean response rate per team was 67%. CTN teams were rated on their high (3.0 to 4.0) and low (<2.5) observed depth of team collaboration and expected team collaboration. Of 110 teams measured 43 were deemed high functioning (high observed and expected integration levels—bolded cells in A and B) was comprised of the main effects (A and B) and the cross effect (A∗B). Therefore, the regression coefficients of both components were included when interpreting a complete interaction effect. This could be easier to achieve by utilizing the plots of conditional regression lines. Figures Child physical QL at followup was positively associated with child psychosocial QL at baseline . The strMore hostile or ineffective parenting was not always positively associated with better child's physical QL . When thFor each additional unit in child emotional disorder at baseline, there was an average 1.6 score increase in child physical QL at followup when the family received good comprehensive and coordinated care . In famiThis study provides original information about the effect of integrative efforts of individual child and family service teams for children with complex needs and reaffirms the value of a bioecological perspective. The primary hypothesis was corroborated about the effect of integrated team function on the improvement in child physical function after 2 years being more pronounced among families with fewer parent/child risk factors. Teams with higher integration scores worked with children with higher levels of psychosocial function and parents with more positive and less hostile ineffective parenting style at baseline. The physical function of these children improved more with the higher integrated team compared to the improvement in a similar child with less integrated team function. Further, when highly integrated teams worked with parents endorsing hostile-ineffective parenting styles at baseline, there was greater improvement in the child's physical function and quality of life two years later. A less integrated team working with parents with similar hostile-ineffective parenting styles at baseline resulted in the child's physical functioning actually deteriorating after 2 years. This same improvement in the child's physical function after 2 years was observed when parents of children with high emotional disorder at baseline reported receiving a high level of comprehensive coordinated care at followup compared to similar children receiving less comprehensive coordinated care. Generally, CTN child and family teams rated themselves as functioning at a communication level of integration. This combined with the response rate of “moderate” among service providers reflects the complexity of integrating service providers from different agencies all at differing locations. The CTN network is also still in its infancy with respect to organization, planning, and system support. Higher expected integration scores reflect the recognition from service providers of improving integration efforts over time. This study also provides information about the physical quality of life of children with complex needs and the associations and interactions of system integration variables. The low QL scores in this sample compared to others , particuThis study supports previous findings and confirms that reports of simple associations between research outcomes do not give a comprehensive picture of the issues. Real-life problems are rarely caused by a single underlying issue. A multitude of factors and interactions among these factors are simultaneously present; therefore, care of these families requires a holistic approach that addresses all aspects of the child's environment. Finally, this study informs service planners of the positive characteristics of children and families more likely to be served by highly integrated teams, the risk variables at intake most likely to impair progress from children's rehabilitation services, and the need for teams to have behavioral mental health members.Results and findings are difficult to generalize outside of this study population because other contexts may differ. The PMK in this sample were predominantly married, educated, working mothers. This study may be missing important information from working, lower educated, single parents and their children—likely those with greater need. This study probably underestimates the effects. Highly integrated teams had already been working with a greater proportion of medically fragile children at intake into the study. While these families had less pronounced risk factors at intake into the study, this could have been due to the services of this team prior to the outset of the study.Due to the cross-sectional nature of the team integration measure in of this research, we do not understand the causation or directional influence of integration on child quality of life. Longitudinal followup is needed to determine whether documented improvements in integrative team function can improve the well-being of the child or if in fact providers need to engage actively those difficult to reach families . Of course randomized clinical trials would be the ideal design to address this question, but these are complex to undertake in circumstances like these . These qIn this study, quality of life data were parent-reported. Generally, parents underestimate their child's quality of life compared to child self-reports . TherefoRehabilitation providers working with children with complex needs need preparation to address child and parent problematic behaviors that limit progress in physical functioning. When this was the case in high integrated teams, the child's physical quality of life improved after two years.

African-Americans remain underrepresented in clinical research despite experiencing a higher burden of disease compared to all other ethnic groups in the United States. The purpose of this article is to describe the study design and discuss strategies used to recruit and retain African-American smokers in a pharmacokinetic study.The parent study was designed to evaluate the differences in the steady-state concentrations of bupropion and its three principal metabolites between African-American menthol and non-menthol cigarette smokers. Study participation consisted of four visits at a General Clinical Research Center (GCRC) over six weeks. After meeting telephone eligibility requirements, phone-eligible participants underwent additional screening during the first two GCRC visits. The last two visits (pharmacokinetic study phase) required repeated blood draws using an intravenous catheter over the course of 12 hours.Five hundred and fifteen African-American smokers completed telephone screening; 187 were phone-eligible and 92 were scheduled for the first GCRC visit. Of the 81 who attended the first visit, 48 individuals were enrolled in the pharmacokinetic study, and a total of 40 individuals completed the study (83% retention rate).Although recruitment of African-American smokers into a non-treatment, pharmacokinetic study poses challenges, retention is feasible. The results provide valuable information for investigators embarking on non-treatment laboratory-based studies among minority populations. Although African-Americans experience a disproportionately high burden of disease ,2, they Tobacco-related morbidity and mortality is higher among African-Americans compared to other racial/ethnic groups in the United States . HoweverThe study protocol was reviewed and approved by the University of Kansas Medical Center Human Subjects Committee. This study was conducted within the General Clinical Research Center (GCRC) at the University of Kansas Medical Center.®, Glaxo SmithKline) by evaluating the effects of menthol in mentholated cigarettes on the pharmacokinetic (PK) profiles of bupropion and its three principal metabolites: hydroxybupropion, threohydrobupropion, and erythrohydrobupropion. The study aimed to recruit and enroll 20 African-American smokers of mentholated cigarettes (menthol smokers) matched 1:1 with 20 African-American smokers of non-mentholated cigarettes (non-menthol smokers) by gender, number of cigarettes per day smoked (CPD), and body mass index (BMI). Pharmacokinetic (PK) parameters of bupropion and its three principal metabolites were assessed at steady state under smoking and non-smoking conditions. During the smoking condition which lasted 10-15 days, subjects smoked their usual brand of cigarettes. This period was followed by a non-smoking condition lasting another 10-15 days. The PK parameters were then assessed between 1) menthol and non-menthol smokers, and 2) smoking and non-smoking conditions.Figure Participants were recruited using clinic-based and community-based strategies. Clinic-based strategies included informing medical center staff about the study through flyers, broadcast emails, departmental meetings, and employee newsletters. Posters and flyers were distributed at a community health center that serves a predominantly African-American patient population. Invitation letters were sent to former research participants who gave written consent to be contacted in the future. Community strategies included paid advertisements in neighborhood newspapers, the major city paper, and on two radio stations with large African-American audiences. Research staff provided flyers to African-American business owners and religious organizations. Those interested in the study were asked to call the study office and speak with a study coordinator who assessed their eligibility for the study.2. Additionally, each participant must have smoked either mentholated or non-mentholated cigarettes exclusively for the past year. Consistent with contraindications for bupropion use, exclusion criteria included predisposition to seizures, a diagnosis of bulimia or anorexia nervosa in the past year, an unstable medical or psychiatric illness, alcohol dependency within the last year, or a myocardial infarction in the last month. In addition, individuals who planned to move from the metropolitan area in the next month, or who had used other forms of tobacco in the past 30 days, or had used bupropion in the past 30 days were excluded from participation, as were those currently using any prescription or other medications contraindicated or with known interaction with bupropion, those reporting illicit drug use and women who were pregnant, breastfeeding, or contemplating pregnancy in the next month.Eligible individuals identified themselves as African-American or Black, aged 18 years or older. They smoked at least 10 cigarettes per day and had a BMI between 18 and 45 kg/mEligibility screening was multi-staged: telephone eligibility screening was followed by medical screening, and then, lastly, by screening for adverse events with medication and adherence to medication.Study staff specifically informed callers that this was a "non-treatment study to find out how the body breaks down a medication called Zyban". Research staff verified individuals' willingness to adhere to study instructions. Interested individuals were screened on the phone according to the eligibility criteria described above. Those eligible were informed that medical screening would include an additional medical history, a physical examination and laboratory tests to rule out contraindications to bupropion use. They were instructed to fast overnight prior to the medical screening visit. A written copy of these instructions was mailed to all individuals who had passed the telephone screening.Phone-eligible individuals came to the General Clinical Research Center (GCRC) after an overnight fast. The study staff discussed the details of the study with participants during the informed consent process. Individuals signed a written informed consent form. They provided a 20 ml blood sample for a complete blood count, a complete metabolic profile, and cotinine analysis. Women also gave a urine sample for a pregnancy test. The GCRC nurse took a medical history and examined the participants. Participants completed a baseline smoking history questionnaire and also completed a smoking topography using a CreSSmicro smoking topography device . The study staff and the study physician reviewed the results of the laboratory tests, medical history and physical examination findings to determine eligibility. Eligible participants were given a sterile container for collecting urine beginning 24 hours prior to the next visit to verify their menthol status. They were also given a special cigarette carrying container (Smartpak) to use during the study.Medically eligible participants were given a 7-10 day supply of placebo in a container with a Medication Event Monitoring System (MEMS) cap, an adherence verification device . On their second visit, participants were asked about adverse events using the Common Terminology Criteria for Adverse Events, version 3.0 . Unused study medication was collected and counted, and data were downloaded from the MEMS cap. Individuals who did not tolerate the placebo medication or used less than 75% of the prescribed dose were excluded from continued participation. Such individuals were excluded with the rationale that they were unlikely to take the active medication as prescribed during the entire study. Participants were enrolled in the pharmacokinetics phase of the study after they passed the medical adherence eligibility screening (Visit 2), and were scheduled for Visit 3. The participants continued to use the MEMS cap for the entire study to monitor bupropion use. The study staff instructed participants to bring their MEMS cap and all medications to each GCRC visit.ad lib for the first 10-15 days (smoking condition) and to quit smoking for the remaining 10-15 days of the study (non-smoking condition). Blood samples were drawn for pharmacokinetics (PK) analysis on two occasions, 10-15 days after the commencement of bupropion while participants were still smoking (PK 1), and again at days 20-25 (PK 2) when they were required not to smoke (non-smoking condition). The blood samples at Visit 3 (PK 1) provided PK parameters when participants were exposed to both bupropion and menthol in cigarettes. Samples at Visit 4 (PK 2) provided PK parameters when participants were exposed only to bupropion but not to menthol. At each PK visit, approximately 10 ml of blood specimens for PK were taken through an intravenous line inserted into the participant's arm prior to ingestion of 150 mg bupropion-SR and at 1, 2, 2.5, 3, 3.5, 4, 5, 6, 8, and 12 hours after ingestion of the first dose of 150 mg bupropion-SR. Use of the second dose of bupropion for the day was delayed until after all blood draws were completed.After a seven-day placebo run-in period and an initial three-day dosing period of 150 mg/day, participants were given 300 mg/day (150 mg 2×/day) sustained-release bupropion for 20-25 days. Participants were asked to smoke their usual brand of cigarettes Once participants were scheduled for visits, reminder letters were mailed one week before each visit, and reminder telephone calls were placed two days and one day before each visit. The study staff provided information about the procedures that participants would undergo in the upcoming visit and answered questions. Participants who missed an appointment were contacted by telephone to reschedule the appointment, provided they were still within the study visit window. The research team met weekly to review recruitment and retention progress and to provide feedback to the study staff.Monetary compensation was discussed with participants during the informed consent process. Participants were given $50 Visa gift cards for each screening visit and $150 Visa gift cards for each pharmacokinetic study visit. Fifty dollar Visa gift cards were given to the participants for the use of Smartpak and MEMS devices. Additional $50 Visa gift cards were given to participants who were able to abstain from smoking during the non-smoking phase (verified with Nic check).This is a descriptive summary and, as such, we summarized categorical variables by frequencies and percentages and continuous variables by means and standard deviations using SAS statistical package, version 9.1.Recruitment was conducted from February 2006 to February 2007, during which time a total of 515 African-American smokers were screened via telephone. Interested individuals learned about the study from newspapers (58.7%), word of mouth (14.6%), and flyers (8.5%) See Figure In total, 92 smokers were scheduled for Visit 1, and 81 kept their appointments. Figure Table This study demonstrated that African-American smokers can be successfully recruited to participate in an intensive GCRC-based non-treatment study. Given the intensity of participation required for the study, including 24-hour urine collection, the use of cigarette and pill monitoring devices, the number and duration of study visits, and multiple blood draws, achieving this recruitment level was considered a success. This outcome supports the feasibility of including African-Americans in laboratory-based research. Showing that African-Americans will volunteer to enroll in this type of research is important, given the persistent national problem of underrepresentation of African-Americans in clinical studies . The recMultiple factors contributed to recruitment success. Our research team has a track record of successfully engaging African-Americans in research studies, and we applied this experience to our recruitment efforts ,34,37-53The recruitment of African-American non-menthol smokers into our study was particularly challenging. Only about 20% of African-American smokers smoke non-menthol cigarettes -32,56. BThe majority of the participants who were excluded from this study after the informed consent process either did not adhere to medication regimen or did not keep the scheduled appointment. We do not know if failure to attend visit during the abstinence phase was due to the fact that some of the smokers could not stop smoking during this phase. While the exclusion criteria were carefully chosen to remove individuals who seemed unlikely to comply with our protocol, this study also provided insight into issues that warrant further investigation, such as adherence to medication among minority populations, and factors that influence minority participants to not keep the study appointments. Illicit drug use (primarily marijuana) accounted for 19.5% of those who were excluded from study after consenting to participate. Although use of illicit drugs was a clear exclusion criterion, we administered this question in person because of its sensitive nature and the need to get more accurate information along with a certificate of confidentiality on their behalf from the federal government agency for their protection.Our study demonstrates the feasibility of recruiting African-American smokers to a pharmacokinetic study, and identifies unique challenges to recruitment and retention. These challenges include intense eligibility criteria with multiple levels of eligibility, rigorous protocol, and invasive procedures. Despite these, we have demonstrated that recruiting African-Americans in non-treatment studies involving multiple blood draws and follow-up visits can be accomplished effectively. This paper provides valuable information for investigators embarking on non-treatment laboratory-based studies among minority populations.Dr. Ahluwalia is a consultant to Pfizer Inc.All authors have made substantial contributions to the intellectual content of the manuscript as follows: BF, CAB and IO participated in the acquisition of data; BF, LSC and CAB participated in drafting the manuscript; all authors participated in the concept and design of the study, interpretation of data, review and approval of the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/10/6/prepub

Bacillus thuringiensis phage 0305φ8-36 exhibited only limited detectable homology to known bacteriophages. The only known relative of this phage is a string of phage-like genes called BtI1 in the chromosome of B. thuringiensis israelensis. The high degree of divergence and novelty of phage genomes pose challenges in how to describe the phage from its genomic sequences.The recently sequenced 218 kb genome of morphologically atypical Phage 0305φ8-36 and BtI1 are estimated to have diverged 2.0 – 2.5 billion years ago. Positionally biased Blast searches aligned 30 homologous structure or morphogenesis genes between 0305φ8-36 and BtI1 that have maintained the same gene order. Functional clustering of the genes helped identify additional gene functions. A conserved long tape measure gene indicates that a long tail is an evolutionarily stable property of this phage lineage. An unusual form of the tail chaperonin system split to two genes was characterized, as was a hyperplastic homologue of the T4gp27 hub gene. Within this region some segments were best described as encoding a conservative array of structure domains fused with a variable component of exchangeable domains. Other segments were best described as multigene units engaged in modular horizontal exchange. The non-structure genes of 0305φ8-36 appear to include the remnants of two replicative systems leading to the hypothesis that the genome plan was created by fusion of two ancestral viruses. The case for a member of the RNAi RNA-directed RNA polymerase family residing in 0305φ8-36 was strengthened by extending the hidden Markov model of this family. Finally, it was noted that prospective transcriptional promoters were distributed in a gradient of small to large transcripts starting from a fixed end of the genome.Genomic organization at a level higher than individual gene sequence comparison can be analyzed to aid in understanding large phage genomes. Methods of analysis include 1) applying a time scale, 2) augmenting blast scores with positional information, 3) categorizing genomic rearrangements into one of several processes with characteristic rates and outcomes, and 4) correlating apparent transcript sizes with genomic position, gene content, and promoter motifs. Bacillus thuringiensis phage 0305φ8-36 from the draft sequence of B. thuringiensis israelensis. This phage-like chromosomal region is called BtI1. BtI1 contains the closest known homologues for 1) many 0305φ8-36 structure and morphogenesis genes, and 2) four non-structure genes on the left arm [The gene organization of phage 0305φ8-36 ,2 is shoThe few virion protein-encoding genes dispersed in the right arm have the appearance of morons – genes acquired relatively recently by single gene horizontal transfer and often transferred together with their own promoters and transcription terminators [E. coli made by Battistuzze et al. [et al. [To estimate the time to the common ancestor of the 0305φ8-36 left arm and BtI1, the divergence of its six most heavily conserved protein sequences was tabulated derived from an ancient duplication and then remaining in the same genome. The existence of paralogues implies both a functional relationship between the two genes, and some degree of functional specialization to enforce retention of both of them. To help clarify the comparison between the two genomes, 0305φ8-36 paralogous domains were detected by including all 0305φ8-36 gene products in the local version of the nr library used for all Psi-Blast searches. Paralogous domains are shown in Figure The order of homologues along the genome between 0305φ8-36 and BtI1 has been retained, despite numerous insertions and deletions of genes and domains among them. Hence, the gene order has remained intact over 2 Byr of vertical descent in each of the two lineages. The revisions presumably involve horizontal gene transfer, but these have not disrupted the overall genome plan for encoding virion proteins. Even more remarkably, most functionally assigned genes conform to the most common gene order found in tailed phages . Hence, In the region overlapping BtI1, 0305φ8-36 has 16 more virion protein-encoding genes (27 genes replacing 11) and 13% more coding sequence [a. Hence, the large modular differences between 0305φ8-36 and BtI1 reflect biologically selected additions or deletions of multiple virion proteins at a time.To interpret the indels missing from BtI1 as modules requires that these genes have not been lost by random deletion in a non-functional phage relic. Random deletion can be excluded based on the absence of fragmented genes at the indel junctions, since genomes under selection for function are expected to avoid or subsequently remove defects in their frame organization ,10. At aa, b, and c). Paralogue family a appeared in six orfs . This arrangement essentially recapitulates the relationship between λ gene products G and GT without using a frameshift.Many tailed phages have a tail chaperonin produced by a programmed translational frameshift within a pair of overlapping orfs upstream of the tape measure gene ,24. The Additional evidence of homology between λ GT and 0305φ8-36 gp143/144 include the following: 1) Comparison of predicted secondary structures within λ G and the conserved portion of 0305φ8-36 orfs 143/144 reveals that both are mainly composed of four alpha helixes Figure . Hence, The above observations are well precedented in comparative studies of less divergent phage genomes. These observations validate that pushing the limits of the comparative methods enables recovery of similar information in the context of a highly divergent comparison. We now apply these methods to seeking information about the 0305φ8-36 genome where there is less prior information to go on. Because the comparisons encompass so much evolutionary time, we envision observed genome rearrangements as representing an ongoing process rather than as singular events.f) with orf209 – a virion protein-encoding orf also of unknown function which is an apparent moron in the right arm of myoviral protein families starting with the virion proteins of bacteriophage P2 , found t the hub .Gp147 is a much larger and more complex protein than the T4 protein. T4 gp27 organizes the assembly of the tail lysozyme and the tape measure and then the subsequent assembly of additional base plate components ,28. The Curiously, paralogues for both of the 0305φ8-36 gp147 peptidase domains are found in BtI1 just downstream of the gp147 homologue Figure . Both ofBoth by the most common gene order and by eThe loss of similarity in between the blast matches in the orf 162–164 region has more to do with domain substitution than with divergence beyond recognition. This is apparent from the recognized folding domains marked as features in Figure The right arm lacks any sequence of genes to which it can be compared. There are, however, internal patterns of gene organization.Also shown in Figure -100 and aligned it from end to end. Segments of the Pfam sequence logo described as definitive of this family [A potential factor in the transcriptional organization of 0305φ8-36 is that orf99 appears to be a phage-encoded RNA polymerase. This gene was initially found as a weak Blast match to a portion of eucaryotic RNA-directed RNA polymerases involved in amplifying RNA during an RNAi response (Pfam05183). We expanded the Pfam domain model into a complete sequence alignment and HMM model using SAM. SAM then detected 0305φ8-36 orf99 with E = 10s family are shows family as havins family .B. thuringiensis israelensis genome. These phage-specific promoters candidates are marked on Figure We asked if there was either a novel promoter motif, such as used by T7 RNA polymerase , or recoThe orfs between 202 and 208 kb are all small, each apparently on a monocistronic transcript Figure . A preceDownstream from the host-takeover region, monocistronic frames are phased out in 0305φ8-36 between orf91 and orf80 with the inclusion of two apparent three-gene operons of about 1.5 total kb each. The virion protein-encoding gene, orf81, is organized like a moron with a downstream transcription terminator that would block read through from its own promoter and upstream promoters. Downstream of orf81, most operons are longer with several up to about 6 kb and encoding up to seven genes. However, these apparent transcripts are still only about half the size of those in the structure gene region. This results in 30 potential promoters on the remainder of the right arm. We propose that the abundance of promoters in this part of the right arm is to limit the delay in expression of these genes to the few minutes it takes to transcribe 6 kb. In essence the proposal is that gene organization throughout the genome, rather than just at the leading end, is influenced by time of injection. However, there is a complication introduced by the intermixing of the 21 bp promoter motif . This primase is found in bacteriophages and plasmids and is capable of functioning together with a variety of replicative helicases including DnaB [Phage 0305φ8-36 carries two primase genes, one in the left arm, and one in the right arm. The primase encoded on the left arm, orf181, belongs to a family normally found in ing DnaB . There iBacillus thuringiensis phage 0305φ8-36 exhibits many unusual features, including a long genome, a high degree of structural complexity as measured by total length of virion protein-encoding sequence, and a proteome that is highly divergent from known bacteria or bacteriophages [iophages . We havee.g. VpV262 versus SIO1 [The left and right arms of 0305φ8-36 have properties suggesting that two different viral ancestors were fused to make the 0305φ8-36 genome plan at some ancient time (see results). It is not unusual to see patterns of homology suggesting a bulk exchange of the non-structure genes (sus SIO1 ). The 03sus SIO1 ,11. IntrFusions that involved duplication and reassortment of multiple genes may have created the genome plans of other phages. But if some duplicated functions are not retained, it would be hard to distinguish this complex scenario from a one step modular exchange. The division of labor that favored the retention of two primases in 0305φ8-36 is not clear. Assuming that phage 0305φ8-36 starts replication from multiple origins of replication, as in T4 , there mThe relative isolation of the phage 0305φ8-36 genome from horizontal exchanges with phages of other known groups mirrors the findings of recent studies of the T4 superfamily ,16. ThesVibrio split from enterobacteria [A key problem in analyzing the rate at which recombination reorganizes a genome is that an observed recombination junction may be just the last step in a history of multiple exchanges. The total number of exchanges affecting the comparison of 0305φ8-36 and BtI1 in the hyperplastic region can be estimated if a similar exchange rate occurred as for the T4 family. There appear to be at least 23 horizontal exchanges mapped in a collection of T4-like tail fiber genes out to vibriophage KVP40 . The trebacteria produces12 generations characterized by organizationally conservative vertical descent. This is not to deny that horizontal exchanges can have disproportionate biological consequences, and can make conceptualization of the evolutionary history difficult [These observations raise the question of what keeps the genes in order. Conservative selection operating on the clustering of functions has been proposed, in particular on the genes that assemble the virion . Conservifficult . HoweverTo conduct a thorough domain by domain comparison of two divergent phage genomes from standard blast listings is taxing, as is generating a visual depiction of the results. Figure a to anchor multiple proteins of unknown function to the phage, 2) the fusion of virion proteins with cell wall binding, and peptidoglycan degrading domains postulated to come from previously acquired lysins, and 3) the fusion of structural anchoring domains with a putative stand-alone capsular polymer degrading enzyme. The proposal is that there is a class of domains frequently decorating virion proteins, but first arriving in the genome as morons encoding stand-alone proteins. This would have the accelerating effect described above for domains that can function in stand-alone proteins, and bias the evolutionary process to use these particular domains more often than others for elaboration of modified virion structure.Several patterns of domain reuse cited in the results can be interpreted in terms of a process by which intragenomic exchange modifies the vertically conserved genes. They are 1) the reuse of paralogue family Discriminating domains that tend to transfer laterally from those that tend to descend vertically is an aid in recognizing the relationship between genomes. An example is illustrated in the analysis of orf147 and RBTH_07687 in Figure The algorithm to detect and graph genes in order was also used to exclude relationship by vertical descent of the right arm to other known genomes. We have postulated that the right arm is derived from a separate and ancient ancestral virus. The right arm has interesting features we would like to subject to comparative analysis, such as the presence of the RNA polymerase gene, the degree of mosaicism, or the way the density of promoter-sized noncoding regions suggests a coordination of transcriptional control with injection (see results). So for each best blast match we computed a display like that in Figure Finally, the method of Figure Questions that may be addressed by the modular structure of 0305φ8-36 include: 1) whether the extra virion proteins have been added in several independent assemblies, and 2) whether this was done early in the 0305φ8-36/BtI1 lineage or later in 0305φ8-36 alone. As argued above, the presence of four extra 0305φ8-36 modules does not necessarily imply the addition of four separate structural assemblies. There is an indication of functional links among these modules in the repeated paralogous domains distributed in three of the modules. As described in the results, the repeated domains may represent a virion anchorage system used in common by the structures encoded in these modules. This would then further suggest the invention of both a novel anchorage system and its use to elaborate additional structure in 0305φ8-36 since the 0305φ8-36/BtI1 split. Consistent with this theory, 0305φ8-36 contains 70% more virion protein-encoding gene sequence than the set of structure genes homologous with BtI1. However, much of the difference between 0305φ8-36 and BtI1 is compensated by a 14 kb module of BtI1 genes substituted for 0305φ8-36 orfs 166–170 declare that they have no competing interests.SCH designed the study, performed informatic analysis with respect to genomic organization, and wrote the paper. JAT performed informatics analysis with respect to functional gene assignment and wrote portions of the paper. PS participated in the design and coordination of the study and helped draft the manuscript.

The trial was closed in 1993 with only 95 eligible patients randomized. There were no toxic deaths, and no patient failed to complete the treatment for reasons of toxicity. 6 months' treatment with low-dose interferon-α resulted in a statistically significant improved disease-free survival for up to 24 months after randomization (P< 0.05). However, at a median follow-up of over 6 years, although there was an apparent improvement in disease-free survival (from 9 to 22 months), and overall survival (from 27 to 39 months), consistent with larger studies powered to detect such differences, these differences were not statistically significant. The data therefore suggest that 6 months of low-dose interferon is active, and confirm the importance of the large randomized studies, such as the UKCCCR AIM-High and EORTC trials, that seek to confirm a possible survival advantage for low or intermediate dose interferon. © 2001 Cancer Research Campaign http://www.bjcancer.comIn 1989, the Scottish melanoma group initiated a randomized trial, comparing observation alone with 6 months' therapy with low dose interferon α (given subcutaneously 3 MU day

The aim of our study was to examine the effect of leptin on the catabolic and anabolic pathways regulating muscle mass. Gastrocnemius, extensor digitorum longus and soleus muscle mass as well as fiber size were significantly lower in ob/ob mice compared to wild type littermates, being significantly increased by leptin administration (P<0.001). This effect was associated with an inactivation of the muscle atrophy-related transcription factor forkhead box class O3 (FoxO3a) (P<0.05), and with a decrease in the protein expression levels of the E3 ubiquitin-ligases muscle atrophy F-box (MAFbx) (P<0.05) and muscle RING finger 1 (MuRF1) (P<0.05). Moreover, leptin increased (P<0.01) protein expression levels of peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), a regulator of muscle fiber type, and decreased (P<0.05) myostatin protein, a negative regulator of muscle growth. Leptin administration also activated (P<0.01) the regulators of cell cycle progression proliferating cell nuclear antigen (PCNA) and cyclin D1, and increased (P<0.01) myofibrillar protein troponin T. The present study provides evidence that leptin treatment may increase muscle mass of ob/ob mice by inhibiting myofibrillar protein degradation as well as enhancing muscle cell proliferation.Absence of leptin has been associated with reduced skeletal muscle mass in leptin-deficient Although the underlying mechanisms involved in the development of muscle atrophy are poorly understood, an imbalance between protein breakdown and synthesis, in favour of the former, plays an important role in this process ob/ob mice ob/ob mice, and whether leptin administration normalizes the reduced skeletal muscle mass of leptin-deficient animals through FoxO-dependent mechanisms. Data of our study provide evidence that leptin treatment may increase muscle mass of ob/ob mice by inhibiting muscular atrophy markers as well as enhancing positive regulators of muscle cell proliferation.Obesity and insulin resistance exhibit a derangement in muscle mass regulation ob/ob mice. Leptin administration increased leptin levels in wild type and ob/ob mice. Importantly, the determination of leptin was performed 20 hours after the last exogenous administration of the hormone and measured values were whitin the nanomolar range observed under physiological circumstances. In addition, ob/ob mice used in our study were obese, hyperinsulinemic, hyperglycemic and hyperlipidemic. Leptin treatment corrected the obese phenotype and improved glucose and lipid metabolism of ob/ob mice, independently of the inhibitory effect of leptin on food intake, as compared to the pair-fed ob/ob group. Moreover, leptin also decreased body weight and fat mass of wild type mice independently of appetite reduction , extensor digitorum longus (EDL) (P<0.0001) and soleus (SOL) (P<0.001) muscles were significantly lower in ob/ob mice as compared with wild type, showing a strong effect of leptin deficiency on muscle mass (P<0.05) and ob/ob (P<0.01) mice. Leptin treatment significantly increased GAS and EDL mass compared to control (P<0.05) and pair-fed (P<0.01) obese animals and prevented the SOL mass loss induced by pair-feeding in ob/ob mice (P<0.05). Leptin administration also increased the weight of GAS muscle in wild type mice as compared to pair-fed animals (P<0.01). Curiously, the hormone reduced the weight of EDL in wild type mice (P<0.05). The cross-sectional area (CSA) of GAS, EDL and SOL muscle fibers was also decreased in ob/ob compared to wild type animals (P<0.0001), a condition that was completely reverted by leptin treatment (P<0.0001). Surprisingly, pair-feeding increased CSA of EDL and SOL muscle fibers in wild type mice (P<0.0001), which was not observed in leptin-treated wild type mice. Therefore, our data show that leptin administration increases muscle mass and muscle fiber size of ob/ob mice.The weights of gastrocnemius (GAS) , 1,546 genes for leptin administration , and 1,960 for appetite inhibiting-independent effects of leptin . The set of genes with altered expression levels induced by leptin deficiency and administration represents a broad spectrum of biological processes involved in muscle growth and atrophy, such as cell cycle progression, ubiquitin-proteolysis and apoptosis , and myoblast differentiation , whereas negative regulators of cell cycle progression, such as Cdkn1a/p21, CKip1dkn1b/p27 or Rbl2, were down-regulated by leptin administration in ob/ob mice. Moreover, leptin treatment down-regulated the expression levels of positive regulators of ubiquitin proteolysis , apoptosis and autophagy and up-regulated inhibitory factors of apoptosis and decreased the mRNA expression of inhibitors of protein synthesis . Increased gene expression levels codifying for the contractile and sarcomeric proteins myosin , troponin , tropomyosin (Tpm3), nebulin (Neb) and titin (Ttn) were normalized by leptin treatment in ob/ob mice and autophagy (Gabarap11) induced by pair-feeding in ob/ob mice and S2. /ob mice and S2. /ob mice . Microar/ob mice .Foxo1 and Foxo3a in GAS muscle were detected between wild type and ob/ob mice, but a tendency towards a down-regulation of both transcription factors was found after leptin treatment (No differences in the transcript levels of reatment .P = 0.012) in ob/ob mice, with the phosphorylated-FoxO3a (inactive form) being increased by leptin administration (P = 0.023) in wild type and ob/ob mice (ob/ob mice. No effect of genotype (P = 0.833) or leptin treatment (P = 0.279) was observed on the activity of Akt in GAS muscle of experimental animals (ob/ob mice (P = 0.033) (P<0.001) in Pgc-1α mRNA levels in GAS muscle of ob/ob mice (ob/ob mice compared to wild type mice (P = 0.010). However, protein expression levels of PGC-1α were significantly increased (P = 0.005) by leptin administration in skeletal muscle of wild type and ob/ob mice . Gene ex/ob mice . The eff/ob mice .P = 0.006) and tended to decrease MuRF1 in ob/ob mice, although no significant differences were found for the global effect of treatment (P = 0.014) and MuRF1 (P = 0.021) was also reduced by leptin treatment in GAS muscle of wild type and ob/ob mice and pair-fed ob/ob mice (P = 0.015) (ob/ob mice.DNA microarray screening showed that leptin administration in S muscle . We exam= 0.015) , suggestob/ob mice showed an increase in the proliferating cell nuclear antigen (PCNA) (P = 0.010), a marker molecule for proliferating satellite cells P = 0.0001) proteins (ob/ob (P = 0.021) and pair-fed ob/ob (P = 0.003) groups and tended to increase cyclin D1 protein in ob/ob mice (P = 0.055). No significant differences were found in the protein expression of the CDK inhibitor p27Kip1 (P = 0.002) (P = 0.005) , which was reduced by leptin treatment as compared to ob/ob (P = 0.004) and pair-fed ob/ob (P = 0.015) mice and cycl= 0.005) in wild 15) mice . These dob/ob mice, which was normalized by leptin administration leptin induces changes in the expression of transcription factors involved in muscle growth (reduced FoxO3a and increased PGC-1α); 2) leptin down-regulates the atrophy markers, MAFbx and MuRF1, as well as the negative regulator of muscle growth myostatin; and 3) leptin increases the positive cell cycle markers cyclin D1 and PCNA.Muscle loss is the result of a reduced protein synthesis and increased myofibrillar degradation in response to inactivity, food deprivation or catabolic diseases ob/ob mice as well as decreases the protein expression of FoxO3a and the mRNA and protein expression of MAFbx and MuRF1 in wild type and ob/ob mice. These data suggest that leptin treatment inhibits the catabolic pathway of proteins mediated by the AMPK. Overexpression of FoxO3a is sufficient to cause skeletal muscle atrophy by increasing the UPS activity in vivo and in vitro studies have shown that FoxO3a also activates the autophagic/lysosomal pathway ob/ob mice presented an upregulation of proteolytic , apoptotic , and autophagic genes, which were down-regulated by leptin treatment.Animal and human studies have shown that caloric restriction enhances catabolic pathways in skeletal muscle through the activation of the energy sensor AMPK, which activates FoxO transcription factors leading to the up-regulation of MAFbx and MuRF1 The activation of PI3K/Akt signaling by insulin and growth factors regulates muscular mass by reducing FoxO3a activity and, hence, by blocking the expression of MAFbx and MuRF1 ob/ob mice show a markedly reduced expression of Pgc-1α in brown adipose tissue, which is reverted by leptin treatment ob/ob mice, which may be mediated by AMPK. In fact, AMPK reportedly enhances Pgc-1α up-regulation in muscle ob/ob mice.PGC-1α protects skeletal muscle from atrophy by blocking FoxO3a action and atrophy-specific gene transcription Kip1Kip1. These findings are in accordance with the mitogenic effects described for leptin in vascular endothelial cells in vivo. The work published by Ruth Harris db/db mice suggesting that leptin is able to increase the growth of db/db mice via a mechanism that is dependent on the short isoform of the leptin receptor.Muscle growth is related to a muscle fiber size increase, which involves a higher content of myofibrillar proteins as well as number of myonuclei to maintain a constant ratio between myonuclei per fiber and fiber size ob/ob mice. It is possible that changes observed in the leptin-treated mice are related to the overall hormonal changes elicited by the administration of leptin rather than due to the direct effects of leptin on muscle mass. In addition, physical activity is a key regulator for muscle mass and leptin reportedly increases the reduced spontaneous locomotor activity of ob/ob mice ob/ob mice may be affected by physical activity can not be ruled out. Unfortunately, physical activity was not assessed in the present study.In order to explore other potential hormonal effects, circulating concentrations of testosterone were assessed taking into account that androgenic hormones affect muscle mass. However, no significant differences were observed following leptin administration. These data seem to indicate that the leptin effects on muscle mass observed in the present study are not related to the changes in testosterone levels. Our findings do not rule out the possibility that other hormones may be involved in the regulation of muscle mass of ob/ob mice in the present study. Importantly, our data show that leptin decreases the high myostatin protein expression related to leptin deficiency in ob/ob mice, suggesting that leptin enhances muscle growth. These data are consistent with the inhibitory effect of leptin on the high mRNA myostatin levels in adipose tissue and skeletal muscle of ob/ob mice previously observed It has been suggested that myostatin plays a direct role in the deterioration of the skeletal muscle in states of obesity and insulin resistance ob/ob mice. Therefore, the increase of the Mhc1 and Mhc2a and slow TnT mRNA levels in ob/ob mice in the absence of an increase in their protein levels may represent a compensatory adaptation to increase levels of lost myofibrillar proteins in ob/ob mice.Fiber size augmentation requires an increase of the myofibrillar protein content. FoxO1 down-regulates genes implicated in muscle growth and differentiation ob/ob mice. The reduced skeletal muscle mass associated to leptin deficiency was prevented by leptin, on the one hand, reducing the negative regulator of muscle growth, myostatin, at the same time as by enhancing muscle cell proliferation through an increase in cyclin D1 and PCNA as well as the myofibrillar protein content of TnT, while decreasing p27Kip1.The control of muscle mass is regulated by a dynamic balance between the anabolic and catabolic processes. Data from our study indicate, for the first time, that leptin treatment prevents muscular atrophy by decreasing FoxO3a, MAFbx and MuRF1 protein expression in relation to an increase in the PGC-1α protein in the GAS muscle of wild type and Unfortunately, except in the rare cases of leptin deficiency, the clinical application of leptin in humans has not proved to be worthwhile in common obesity, since most obese patients exhibit hyperleptinemia pointing to the existence of leptin resistance. Therefore, no therapeutic benefit as regards improving body composition in obese humans might be foreseen. Furthermore, the sexual dimorphism relating to the fact that women have smaller muscles in spite of increased circulating leptin concentrations and higher leptin receptors expression should be also contemplated ob/ob mice (C57BL/6J) (n = 30) supplied by Harlan were housed in a room with controlled temperature (22±2°C), and a 12∶12 light-dark cycle (lights on at 08:00 am). Wild type and ob/ob mice were divided in control, leptin-treated (1 mg/kg/d) and pair-fed groups (n = 10 per group). A pilot study with different leptin doses and routes of administration was carried out in order to select the appropriate dose to ensure that its concentration would fell within the physiological range (nanomolar range) in both the wild type and ob/ob groups. The control and pair-fed groups received vehicle (PBS), while leptin-treated groups were intraperitoneally administered with leptin twice a day at 08:00 and 20:00 for 28 days. Control and leptin-treated groups were provided with water and food ad libitum with a standard rodent chow , while the daily food intake of the pair-fed groups was matched to the amount eaten by the leptin-treated groups the day before to discriminate the inhibitory effect of leptin on appetite. All experimental procedures conformed to the European Guidelines for the Care and Use of Laboratory Animals (directive 86/609) and were approved by the Ethical Committee for Animal Experimentation of the University of Navarra (080/05). Animals were sacrificed on the 28th day of treatment by CO2 inhalation 20 h after the last PBS or leptin administration (in order to avoid picking up effects reflecting an acute response) and after 8 h of fasting. Serum samples were obtained and stored at −80°C. Representative muscles of each muscle fiber type were excised: the SOL muscle is predominantly composed by oxidative, red fibers; the EDL contains mainly glycolytic, white fibers; while the GAS represents a mixed muscle type composed by both red and white fibers. Muscles of one leg were rapidly dissected out, weighed, frozen in liquid nitrogen, and stored at −80°C until mRNA and protein extraction, while the contralateral leg muscles were formalin-fixed for immunohistochemical analyses. Epididymal, perirrenal and subcutaneous adipose tissue depots were also excised.Ten-week-old male wild type (C57BL/6J) (n = 30) and genetically obese Serum glucose concentrations were measured using a sensitive-automatic glucose sensor . Serum triglycerides were spectrophotometrically determined using a commercial kit . Serum free fatty acid (FFA) concentrations were measured by a colorimetric determination using the NEFA C kit . Serum glycerol concentrations were evaluated by enzymatic methods Total RNA was extracted from 20–30 mg of GAS muscle samples by homogenization with an ULTRA-TURRAX® T 25 basic using TRIzol™ reagent . Samples were purified using the RNeasy Mini kit and treated with DNase I in order to remove any trace of genomic DNA.http://babelomics.bioinfo.cipf.es) and the KEGG website (http://www.genome.ad.jp/kegg/pathway) were used in conjunction with GeneSpring (http://www.agilent.com/chem/genespring) to identify pathways and functional groups of genes. All microarray data reported are described in accordance with MIAME guidelines. More information regarding the microarray experiments can be found at the EMBL-European Bioinformatics Institute (http://www.ebi.ac.uk/aerep/login. ArrayExpress accession number: E-MEXP-1831).Gene expression analyses were conducted using the Agilent Whole Mouse Genome array , containing 41,000 mouse genes and transcripts. Briefly, 1 µg of total RNA from each sample was amino-allyl labeled and amplified using the Amino Allyl MessageAmp II aRNA Amplification Kit . Aliquots (1.2 µg) of amplified aRNA were fluorescently labeled using Cy3/Cy5 and then appropriately combined and hybridized to Agilent oligomicroarrays. Hybridizations were performed following a reference design, where control samples were pools of RNA from all individual samples. Two hybridizations with fluor reversal (Dye swap) were performed for each sample and 5 animals were used per group. After washing, microarray slides were scanned using a Gene Pix 4100A scanner and image quantization was performed using the software GenePiX Pro 6.0. Gene expression data for all replicate experiments were analyzed using the GeneSpring GX software v 7.3.1 (Agilent Technologies). Clustering was accomplished with the Gene and Condition Tree algorithms. In addition, Gene Ontology groupings (18S rRNA (Applied Biosystems) and relative quantification was calculated using the ΔΔCt formula To validate the microarray data, a number of representative differentially expressed genes were selected to be individually studied by Real-Time PCR (n = 5–10 per group). For first strand cDNA synthesis, constant amounts of 1.5 µg of total RNA isolated from GAS muscle were reverse transcribed using random hexamers as primers and 300 units of M-MLV reverse transcriptase (Invitrogen) as previously described 2O 5 mM, 1% deoxycolate) supplemented with protease inhibitors . Soluble proteins were recovered after centrifugation at 16,000 g for 15 min at 4°C. Protein concentration was determined according to the method of Bradford Kip1 , mouse polyclonal anti-MHC I, anti-MHC II, goat polyclonal anti-PGC-1α, anti-slow TnT, anti-fast TnT, anti-MAFbx, and rabbit polyclonal anti-MuRF1 , rabbit polyclonal anti-Akt1/PKB (phospho Thr 308) and anti-Akt1/PKB antibodies in blocking buffer overnight at 4°C. After washing with TBS-Tween 0.5% (5×5 min), membranes were incubated with horseradish peroxidase-conjugated anti-goat IgG , anti-rabbit IgG, or anti-mouse IgG (Amersham Biosciences) for 1 h at RT. Mouse monoclonal anti-β-actin (Sigma) was used for normalization of density values. The chemiluminescence ECL reactive was used to develop the bands, which were analyzed by densitometric analysis using the Gel Doc-Quantity One 4.5.0. software (Bio-Rad).Muscle samples (20 mg) were homogenized in RIPA buffer in absolute methanol for 20 min at RT, and washed 3 times with ethanol. Sections were immersed in 10 mM citrate buffer (pH 6.0) and heated using a microwave oven at 800 W for 10 min to enhance antigen retrieval. After cooling, sections were blocked for 30 min at RT in a humidified chamber with 5% murine or goat serum (Sigma) in TBS. Polyclonal antibodies against MAFbx, MuRF1, PCNA, cyclin D1, p27Kip1, fast TnT and slow TnT, used for immunohistochemistry were the same than those used for western blot studies. In addition, the dystrophin protein was also immunolocalized with a monoclonal antibody (Abcam). Sections were subsequently incubated with the appropriate dilutions of primary antibodies in TBS with 5% mouse or goat serum (Sigma) (1∶50–100) in a humidified chamber overnight at 4°C. After washing with TBS (3×5 min), sections were incubated with horseradish peroxidase-conjugated secondary antibodies diluted in TBS with 5% BSA (1∶100) for 1 h at RT. After washing with TBS (3×5 min), localization of the antigen-antibody binding antibodies was performed by adding diaminobenzidine (DAB) (Sigma) or DAB with glucose oxidase (Sigma) as developing system kip1 in cross-sections of GAS muscles were quantified from 4 microscope fields (400X) randomly selected. Mean value was expressed as positive myonuclei number per 100 cells.Sections (5 µm) of formalin-fixed paraffin-embedded muscles were dewaxed with xylene and hydrated in decreasing concentrations of ethanol. Endogen peroxidase activity was quenched using 3% HU-Mann Whitney tests. As previously outlined, Gene Ontology groupings were used to identify pathways significantly affected by leptin deficiency and administration. Furthermore, statistical comparisons for microarray data to identify differentially expressed genes across different groups were performed using one-way ANOVA and Student's t-tests as appropriate. All statistical analyses were performed by using the SPSS statistical program version 15.0 for Windows and statistical significance was defined as P<0.05.Data are expressed as mean±standard error of the mean (SEM). Global effects of genotype and treatment were determined using a two-way analysis of the variance (ANOVA). When interaction between both factors was detected, comparisons between groups were subsequently analyzed by Kruskal-Wallis followed by Table S1Biochemical Characteristics of Wild Type and ob/ob Mice(0.03 MB XLS)Click here for additional data file.Table S2Genes Differentially Regulated by Leptin Treatment in ob/ob Mice(0.10 MB XLS)Click here for additional data file.Table S3Genes Differentially Regulated by Leptin Treatment as Compared to Pair-Feeding in ob/ob Mice(0.38 MB XLS)Click here for additional data file.Table S4Sequences of the Primers and Taqman Probes Used in the Real-Time PCR(0.03 MB XLS)Click here for additional data file.Figure S1ob/ob Mice. (A) Body weight curves of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and ob/ob mice . **P<0.01 and ***P<0.001 for PBS ob/ob vs PBS wild type and leptin-treated ob/ob mice. +P<0.05, ++P<0.01 and +++P<0.001 for pair-fed ob/ob vs leptin-treated ob/ob. #P<0.05 and ##P<0.001 for PBS wild type vs leptin-treated wild type. (B) Daily food intake curves of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and ob/ob mice . ***P<0.001 for PBS ob/ob vs PBS wild type and leptin-treated ob/ob. #P<0.05 and # #P<0.001 for PBS wild type vs leptin-treated wild type. (C) Epididymal (EWAT), perirrenal (PWAT) and subcutaneous (SWAT) depots relative to body weight of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and ob/ob mice . *P<0.05, **P<0.01 and ***P<0.001. Data are presented as mean±SEM. G: genotype, T: treatment. The striped line indicates the beginning of the pair-feeding treatment.Leptin Treatment Decreases Body Weight and Body Fat in Wild Type and (9.73 MB TIF)Click here for additional data file.Figure S2ob/ob and Leptin-Treated ob/ob Mice. Red represents up-regulated expression, green shows down-regulation, and yellow indicates a similar gene expression pattern as compared to reference. White boxes highlight that leptin treatment was able to reduce the mRNA expression of 732 up-regulated genes in ob/ob mice and to increase the expression of 846 down-regulated genes.Hierarchical Clustering of the Gene Expression Profile of the Gastrocnemius Muscle of Wild Type, (10.13 MB TIF)Click here for additional data file.Figure S3ob/ob mice (n = 5 per group). (B) Real-Time PCR analysis of muscle atrophy F box (MAFbx) and muscle RING finger 1 (MuRF1) in gastrocnemius muscle of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and ob/ob mice (n = 5 per group). (C) Real-Time PCR analysis of myosin heavy chain type I (Mhc1), myosin heavy chain type IIa (Mhc2a), myosin heavy chain type IIb (Mhc2b) and slow troponin T (slow TnT), in gastrocnemius muscle of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and ob/ob mice (n = 5 per group). Data are presented as mean±SEM of the ratio between gene expression and 18S rRNA. G: genotype, T: treatment.Analyses by Real-Time PCR of Key Genes Involved in Muscular Atrophy and Muscle Growth. (A) Real-Time PCR analysis of forkhead box class O3a (Foxo3a) and Foxo1, and peroxisome proliferator-activated receptor coactivator 1α (Pgc-1α) in gastrocnemius muscle of PBS (open), pair-fed (gray) and leptin-treated (closed) wild type and (0.39 MB TIF)Click here for additional data file.

Snake mitochondrial genomes are of great interest in understanding mitogenomic evolution because of gene duplications and rearrangements and the fast evolutionary rate of their genes compared to other vertebrates. Mitochondrial gene sequences have also played an important role in attempts to resolve the contentious phylogenetic relationships of especially the early divergences among alethinophidian snakes. Two recent innovative studies found dramatic gene- and branch-specific relative acceleration in snake protein-coding gene evolution, particularly along internal branches leading to Serpentes and Alethinophidia. It has been hypothesized that some of these rate shifts are temporally associated with control region duplication and/or major changes in ecology and anatomy.Anilius scytale, Rhinophis philippinus, and Charina trivirgata. All three genomes share a duplicated control region and translocated tRNALEU, derived features found in all alethinophidian snakes studied to date. The new sequence data were aligned with mt genome data for 21 other species of snakes and used in phylogenetic analyses. Phylogenetic results agreed with many other studies in recovering several robust clades, including Colubroidea, Caenophidia, and Cylindrophiidae+Uropeltidae. Nodes within Henophidia that have been difficult to resolve robustly in previous analyses remained uncompellingly resolved here. Comparisons of relative rates of evolution of rRNA vs. protein-coding genes were conducted by estimating branch lengths across the tree. Our expanded sampling revealed dramatic acceleration along the branch leading to Typhlopidae, particularly long rRNA terminal branches within Scolecophidia, and that most of the dramatic acceleration in protein-coding gene rate along Serpentes and Alethinophidia branches occurred before Anilius diverged from other alethinophidians.The near-complete mitochondrial (mt) genomes of three henophidian snakes were sequenced: Mitochondrial gene sequence data alone may not be able to robustly resolve basal divergences among alethinophidian snakes. Taxon sampling plays an important role in identifying mitogenomic evolutionary events within snakes, and in testing hypotheses explaining their origin. Dramatic rate shifts in mitogenomic evolution occur within Scolecophidia as well as Alethinophidia, thus falsifying the hypothesis that these shifts in snakes are associated exclusively with evolution of a non-burrowing lifestyle, macrostomatan feeding ecology and/or duplication of the control region, both restricted to alethinophidians among living snakes. Vertebrate mitochondrial (mt) genomes have been the subject of many studies of phylogeny and evolutionary genetics and genomics, by virtue of characteristics such as their manageable size and generally conserved gene content and order. Interest in snake mitogenomics has focused on topics as diverse as gene duplications, truncations and order rearrangements -4 Fig. 1The most basal split within extant snakes is between Scolecophidia (blind- and wormsnakes) and Alethinophidia. There is a large asymmetry in the number of extant species in these two clades with only 15% of species belonging to Scolecophidia. Within Alethinophidia, most species belong to the 'advanced' snake clade Caenophidia, while the remaining (c. 180) species comprise the paraphyletic Henophidia, whose phylogenetic intrarelationships are contentious .Complete or near-complete mt genome sequences have been published for over 20 snake species -6,8-10. Anilius scytale, Rhinophis philippinus and Charina trivirgata gene in C. trivirgata was found translocated from its typical vertebrate position between the genes 16S and ND1 to downstream of CRII. The same can be assumed for A. scytale and R. philippinus because this gene was not found between 16S and ND1. As in other alethinophidian snakes, the origin of light strand replication is present in all three newly sequenced mt genomes, with the stem being 12 bp long.As in other alethinophidian mt genomes, the tRNAA. scytale and R. philippinus is much shorter than that of C. trivirgata . This difference in length is attributable to gaps of variable size occurring at the 3' end of COI (data not shown). The length of ND4 sequences also differs among major snake lineages: 1338 nucleotides for all colubroids except Achalinus meiguensis (1353 sites) but 1356 for Acrochordus granulatus and henophidians. This difference in length is due to a single gap 130-150 nucleotides into the sequence.The lengths and GC content of ribosomal and protein-coding genes of the three mt genomes are shown in Table Python + Xenopeltis + Cylindrophis + Rhinophis , with 3442 amino acid sites. The maximum likelihood (ML) and Bayesian phylogenetic analyses performed in this study yielded trees with unequivocal support for major snake taxa regardless of the method or model used. As we explain below, many of the differences in analytical results were relatively minor and did not conflict strongly in that the contentious nodes were weakly supported. The only strongly conflicting results are shown in Fig. 1) against the 4-partition model (H0) was B10 = 0.989 (2lnB10 = -0.02), indicating that there was no significant difference between the two models.The maximum likelihood (ML) GTR+I+Γ tree based on the 4-partition nucleotide model is shown in Fig. Anilius and Tropidophis , Rhinophis + Cylindrophis (node F), Boidae (node G), Caenophidia (node H), Colubroids except Achalinus meiguensis (node J), Viperidae (node K), 'colubrids' + Elapidae (node L). The clade uniting Python + Xenopeltis (node E) received very high support in all trees except the CAT-GTR+Γ tree alethinophidians - was only weakly supported (0.5 BPP). A clade comprising Rhinophis + Cylindrophis and Python + Xenopeltis (node D) was recovered in all trees and received strong support in Bayesian analyses but only weak to moderate support in ML analyses received very high to maximal support in nucleotide analyses but low support in amino acid analyses with the exception of the mtREV+I+Γ analysis run with the program PhyloBayes (Table A. meiguensis joins with Acrochordus granulatus with weak support (data not shown). Enhydris plumbea is the sister to Elapidae (node M) in nucleotide analyses and the PhyloBayes mtREV+I+Γ analysis , relationships between es Table . Achalines Table . In the is Table but thisOnly node C Fig. is stronL. humilis show especially accelerated amino acid change relative to rRNA nucleotide branch lengths . However, as with previous molecular studies, most deeper henophidian nodes could not be resolved robustly in this study. Low node support is often associated with short internal branches that can result from incongruence within data and/or too few character changes . As . As PythXenopeltis, and Loxocemus, the non-monophyly of macrostomatan alethinophidians and the non-monophyly of dwarf boas Gekko gecThe branch lengths of rRNA and protein-coding genes were compared by firstly estimating branch lengths separately for rRNAs and all protein-coding genes using both nucleotide and amino acid data. Because of the erosion of signal at 3rd codon positions (see section 2.3) 1st, 2nd and 3rd codon positions were weighted 2, 1 and 5, respectively. ND6 was analysed as a separate partition because of its aberrant base composition. The amino acid analysis was run without partitioning. Secondly, rRNA branch lengths were compared with those for individual protein-coding genes in bivariate plots. Following Jiang et al. [DD partly conceived the project, generated new sequence data, performed the analyses and co-wrote the manuscript. DJG partly conceived and designed the project, collected material in the field and co-wrote the manuscript. All authors read and approved the final manuscript.Anilius scytale) and JL Gower, GLK Kariyawasam, H Lokugamage, Y Mapatuna, F Naggs, I & W Perera, D Raheem, SRMS Samaradiwakara, M Wilkinson, and KASR Wickramanaike (Rhinophis philippinus). The Director of the Department of National Museums, Colombo, Sri Lanka is thanked for granting loan of material. We thank Tropikhuset in Malmö for supplying the C. trivirgata specimen, and PG Foster and B Hallström for help with running some of the analyses. R Crozier and J Brown on their input in running Bayesian analyses and Bayes Factor analysis. D San Mauro provided constructive criticism of an earlier draft. This work was supported by the Jörgen Lindström stipendium, Nilsson-Ehle (Kungliga Fysiografiska Sällskapet I Lund) Fund, Leverhulme Trust Grant F/00696/F and Darwin Initiative Grant 162/08/214.Assistance was provided to DJG during fieldwork to collect samples used in this study by O Ballou, J-A Cerda, P Gaucher, A Kupfer, and M Wilkinson (The ML tree based on amino acid data under the mtREV+I+Γ model. The support values are LR-ELW. In this tree, and in most amino acid phylogenetic analyses, Enhydris plumbea is the sister-group of elapids and colubrids, in contrast to nucleotide analyses, in which E. plumbea is the sister-group of elapids.Click here for fileThe Bayesian MTR+I+Γ tree produced using the program PhyloBayes. The support values are BPP. This analysis gives weak support to the CAT topology (Fig. Anilius and Tropidophis, in conflict with node C (Fig. ogy Fig. , i.e. boe C Fig. . This isClick here for file

Louise Degenhardt and colleagues discuss the evidence and the debate about whether Global Burden of Disease estimates should include cannabis use as a risk factor for psychosis. Comparative risk assessments estimate the proportion of a disease that can be attributed to a particular risk exposure and are important guides for health planning.In observational studies, there has been consistent evidence that cannabis use is associated with an increased risk of schizophrenia and more generally, psychosis.There is debate about whether such observational evidence is sufficient to infer that cannabis use is a contributory cause of psychosis.Given the controversy, should the comparative risk assessment in the current revision of the Global Burden of Disease (GBD) include an attribution of psychosis to cannabis use?We argue that the risk assessment should be included because the evidence is as good as that for many other risk factors included in the GBD, psychotic disorders are associated with substantial unavertable disability, and cannabis use is a potentially preventable exposure.Evidence has accumulated suggesting that regular cannabis use is associated with psychotic symptoms and disorders in the general population Governments, policymakers, and funders need information on the comparative population health impact of different diseases and risk factors when making decisions about where to focus policy, services, and research. This field was revolutionised when the World Bank provided estimates using the disability-adjusted life year (DALY) The GBD defines risks according to the following considerations:Risk factors should be potentially modifiable;Risks should be assessed irrespective of place in a causal chain or scientific discipline that has traditionally analysed the risk factor, as long as evidence of causal effect can be established;Risks are defined to be not too broad or too narrow with a relatively specific definition of risk factor exposure;Protective as well as hazardous factors are considered. However, the absence of a specific intervention should not be assessed as a risk factor, but rather in measurement of intervention coverage and effectiveness; andThere exist sufficient data on risk factor exposure and risk-factor disease relationships.In the previous global CRA, cannabis use was not included as a risk factor for any disease because of concerns about the quality of the evidence It is useful to distinguish two primary ways in which cannabis use could be a “cause” of psychosis The evidence suggests that it is more likely that cannabis use precipitates psychosis in vulnerable persons, which is consistent with other lines of evidence suggesting that there is a complex constellation of factors leading to the development of psychosis (the stress-diathesis model of schizophrenia) and with studies suggesting that gene-environment interactions may provide some explanation of the association There is also some evidence that cannabis use is associated with increased likelihood of relapse to psychosis among those who have developed a psychotic disorder 1) in the brain The principal psychoactive ingredient of cannabis is delta-9-tetrahydrocannabinol (THC), which acts upon a specific cannabinoid receptor distinct from a psychotic disorder such as schizophrenia.Other drugs such as amphetamine have also been shown to have the potential to trigger psychotic symptoms among some users Several cross-sectional studies have examined the relationship between cannabis use and self-reported psychotic experiences or psychotic symptoms in the general population. All have found that cannabis use (or cannabis use disorders) were more common among people reporting such experiences; and these associations persisted after controlling for other variables It is not always clear whether the psychotic symptoms endorsed in studies assessing the relationship between cannabis use and “psychosis” occurred only in the context of cannabis intoxication, or whether the symptoms were a more distal outcome of previous cannabis use. For example, the Fergusson et al. study In case-control studies Cross-sectional community surveys of psychiatric disorders have also documented higher rates of substance use disorders among persons with schizophrenia The first evidence that cannabis use may precipitate schizophrenia came from a 15-y prospective study of cannabis use and schizophrenia in 50,465 Swedish conscripts A number of longitudinal studies have since been reported that have all supported the findings of the Andreassen et al. study. Zammit et al. reported a follow up of the Swedish cohort study, reporting on risk over a 27-y follow up that covers most of the risk period for the onset of psychotic disorders in a cohort that was first studied when 18–20 y old Zammit et al. Zammit et al.'s findings were consistent with those of a study conducted by Van Os and colleagues Van Os et al. replicated and extended the findings of the Swedish cohort in a number of important ways. First, cannabis use at baseline predicted an increased risk of psychotic symptoms during the follow-up period in individuals who had not reported psychiatric symptoms at baseline. Second, there was a dose-response relationship between frequency of cannabis use at baseline and risk of psychotic symptoms during the follow-up period. Third, the relationship between cannabis use and psychotic symptoms persisted when they statistically controlled for the effects of other drug use. Fourth, the relationship between cannabis use and psychotic symptoms was stronger for cases with more severe psychotic symptoms that were adjudged to need psychiatric care. Fifth, those who reported any psychotic symptoms at baseline were more likely to develop schizophrenia if they used cannabis than were individuals who were not so vulnerable.A study by Henquet et al. n = 759). Participants were assessed intensively on risk factors for psychotic symptoms and disorders since birth Arseneault et al. reported a prospective study of the relationship between adolescent cannabis use and psychosis in young adults in a New Zealand birth cohort , although this was more likely to work against finding relationships.There was also specificity in the effects of cannabis on schizophreniform disorder: there was no relationship between other drug use and psychotic disorders, and no relationship between cannabis use and depression. There was also an interaction between psychosis risk and age of onset of cannabis use, with earlier onset being more strongly related to psychosis. There was also the suggestion of an interaction between cannabis use and vulnerability, with a higher risk of psychosis among cannabis users who reported psychotic symptoms at age 11 y.COMT gene that codes for dopamine in their effects on the risk of psychosis Caspi and colleagues subsequently used the cohort to examine an interaction between cannabis use and a functional polymorphism of the Apart from clinical diagnoses, several longitudinal studies have also examined the relationship between cannabis use and subclinical (or isolated) psychotic symptoms. Fergusson, Horwood, and Swain-Campbell have reported a longitudinal study of the relationship between cannabis dependence at age 18 y and the number of psychotic symptoms reported at age 21 y in the Christchurch birth cohort in New Zealand One study of high risk young people has failed to report an association between cannabis use and psychosis risk. This study identified 100 young people at “ultra high” risk for psychosis Increasingly, researchers in the field of psychosis are examining the concept of psychotic spectrum features as risk factors for psychosis There are several major criticisms of the above evidence. The first concerns the varying outcome measures that different studies have used. These include “psychosis,” psychotic symptoms, and schizophreniform disorders diagnosed using psychiatric interviews and psychiatric case registers.How should this affect confidence in the study findings? We suggest that they are less of an issue than they first appear. First, as noted above, there is a growing recognition that psychotic-like experiences can provide valuable clues with respect to underlying neurobiological mechanisms and shared risk factors for psychotic disorders. Categorical diagnostic criteria do not provide the final word on these disorders. The exploration of psychotic symptoms (or psychotic-like experiences) has become a very fertile area of research Second, most studies of the association have very low statistical power for detecting any effect that cannabis use has on the risk of diagnosed psychotic disorders. More prevalent outcomes, such as subclinical psychotic symptoms, have provided greater power to examine associations.Third, we would also argue that the persistence of a correlation between cannabis use and these variously measured outcomes is more suggestive of a robust relationship than the contrary. This is because the use of differing measures of varying predictive validity may be expected to attenuate rather than positively bias measures of association between cannabis use and psychosis. Finally, the Swedish and Dutch studies that have investigated diagnosed psychotic disorders have found the same associations as studies of psychotic symptoms.Many prospective studies share the weakness that they cannot precisely specify the timing of first cannabis use and the onset of psychotic symptoms. Participants have usually been assessed once a year or less often and asked to retrospectively report their cannabis use during the past year(s). This assessment has often been in terms of the total number of times cannabis was used, or the number of times on average that cannabis was used each week or month. Nonetheless, there are multiple prospective studies of representative samples of the general population, all of which show that cannabis use at one point in time is associated with psychotic symptoms at a later one, even after using a range of controls for confounding and various statistical approaches to analysis.Studies undertaking more temporally fine-grained measurements have provided results consistent with these cruder measurements. A French study using an experience sampling method Another study, involving monthly assessment of psychotic symptoms and cannabis use over 10 mo among persons with psychotic disorders, similarly found that more frequent cannabis use in one month was related to increases in psychotic symptoms a month later Publication bias is a potentially more serious concern: If negative results have been withheld from publication then the consistent positive results would be far less impressive than they seem from the published systematic reviews The most difficult task in drawing causal inferences from observational studies is excluding the possibility that the relationship between cannabis use and psychosis is due to other uncontrolled factors . This has led some to object to calculation of estimates of population attributable risk (PAR) because the adjusted estimates are modest , and so open to the alternative explanation of uncontrolled confounding. For example, some have suggested that the propensity to take risks and engage in socially disapproved behaviour may be a common cause of cannabis use and psychotic symptoms Some may argue that a causal inference demands evidence that the cessation of cannabis use reduces these risks, as the evidence of risk reversal on cessation in the British doctors' study strengthened the case for a causal relationship between cigarette smoking and lung cancer and other diseases It is difficult to see more conclusive evidence being produced for cannabis as a contributory cause of psychosis, or for the results of such studies to be as convincing as the evidence from cigarette smoking. This is because: the relationship between cannabis and psychosis is not as strong as that between smoking and lung cancer; the prevalence of cannabis use is so much lower than that for smoking; and the outcomes of psychosis are not as easy to study as mortality was in the Doll and Hill follow up of the British doctors. How then can we resolve the uncertainty that remains?Epidemiology is an imprecise science, and recent experience has taught us to be cautious in making causal inferences from observational studies Calculation of a PAR is important to place the magnitude of the cannabis and psychosis association in a population health context. Arsenault et al. Nonetheless, these PAR estimates must be heavily qualified. Risk models related to complex and heterogeneous syndromes like schizophrenia will never be fully specified. Further, standard PAR estimates cannot account for the possibility that cannabis has brought forward the age of onset in an individual who would have otherwise developed the illness at a later age without exposure to cannabis Some commentators may well argue that it is premature to conclude that the relationships between cannabis use and psychosis are causal, which raises the question of what the standard of proof should be causal inference. Some may argue for “proof beyond reasonable doubt,” the standard implicitly used in the last iteration of the GBD If we had treatments that resulted in complete, immediate, and sustained remission for all individuals who develop psychosis, then the role of cannabis as an aetiological agent may attract less attention. But schizophrenia remains a poorly understood group of disorders. Even our best treatments are suboptimal Making estimates of the proportion of psychoses attributable to cannabis will in effect provide worst case estimates of the burden of disease (BoD) attributable to cannabis if the critics are correct that uncontrolled confounding explains the relationships between cannabis use and psychosis. In Australia, for example, cannabis use was included as a risk factor in the Australian BoD study, assuming causal relationships for cannabis dependence, psychosis, suicide, and car crashes In the GBD project, we are considering several possible ways in which cannabis and psychosis may be linked. A range of estimates will be made as follows: (1) a model that will assume greater disorder severity among those using cannabis regularly who have already developed the disorder; (2) a model that will assume the association reflects earlier onset of the disorder among those who would have developed it anyway; (3) a model that will assume reduced remission from schizophrenia once it has developed; and (4) a model that assumes increased incidence of schizophrenia.It is important to consider the consequences of not estimating this risk. There will be a reduced public health, policy, or research imperative, since there will be no estimated burden. If we do attempt to estimate burden, future work will examine the accuracy of our estimates and refine them as evidence accumulates. Debates may emerge and (hopefully) improvements made as new evidence supports or challenges the assumptions made. Estimates made in GBD 2005 should be seen as a first step in a process that can and should be improved with new data and new insights, including work for future estimates of country and global disease burden.

N-methyl-N-nitrosourea (MNU) and lambda carrageenan (λCgN) associate with aberrant crypt foci (ACF) in mouse colon. Undegraded λCgN and MNU were tested alone and in combination against MTCRII and ACF in Balb/c mice, at 20 weeks after the start of treatment. MTCRII were unaffected by λCgN alone. Combined λCgN/MNU treatments induced greater MTCRII (P<0.01) as well as greater number (P<0.001) and crypt multiplicity (P<0.01) of ACF than MNU alone. MTCRII were approximately 10-fold more numerous than ACF, although linear correlations were observed between these parameters . MTCRII are induced by λCgN/MNU interactions in sufficient numbers to provide statistical power from relatively small sample sizes and correlate with ACF formation. MTCRII could thus provide the basis for a novel medium-term murine bioassay relevant to early-stage colorectal tumorigenesis.Metallothionein (MT) crypt-restricted immunopositivity indices (MTCRII) are colonic crypt stem cell mutation markers that may be induced early and in abundance after mutagen treatment. Metallothionein is the endogenous reporter gene for MTCRII, but is not typically implicated in the classical pathway of colorectal tumorigenesis. Hence, the oncological relevance of MTCRII is unclear. This study tests the hypothesis that MTCRII induced by Humans are exposed to mixtures of genotoxic and nongenotoxic environmental chemicals that may be linked to cancer (N-methyl-N-nitrosourea (MNU) and undegraded lambda carrageenan (λCgN), have interactive effects upon MT crypt-restricted immunopositivity indices (MTCRII), including frequency and size of MT-immunopositive foci and total number of MT-immunopositive crypts ) alone or in combination with 1 or 4% λCgN as follows:n=5):Group 1 (Drinking water only for 20 weeks (water only control).n=5):Group 2 injection of vehicle (DMSO), then drinking water for 20 weeks (vehicle control).n=5):Group 3 (λCgN only for 20 weeks.Continuous 1% n=5):Group 4 (λCgN only for 20 weeks.Continuous 4% n=10):Group 5 :Group 6 :Group 7 :Group 8 :Group 9 :Group 10 (−1 i.p. and continuous 1% λCgN treatment until 20 weeks.MNU 62.5 mg kgn=10):Group 11 : Crypt multiplicity was determined as the number of aberrant crypts per ACF.All assays of ACF were blinded to treatment and carried out after colonic retrieval at 20 weeks after the initiation of treatment. Colons were carefully pinned flat on a cork mat, painted with 0.1% methylene blue and left at room temperature for 10 min. Assay of ACF was performed using a dissecting microscope at × 40 magnification and the following parameters were recorded:Colons were then ‘Swiss-rolled’ on the cork mat, with the ileocaecal junction at the centre of the roll, fixed in neutral formal saline for 48 h, and embedded in paraffin wax blocks.μm thickness) were cut at 10 levels (L1–L10), 100 μm apart through the ‘Swiss-rolled’ colon. One section from each level was stained using a standard indirect immunoperoxidase technique for MT, while endogenous peroxidase activity was blocked using 3% hydrogen peroxide in methanol. Slides were incubated with an anti-MT primary antibody . The secondary antibody used was horseradish peroxidase-conjugated rabbit anti-mouse immunoglobulin . Negative control sections were incubated either in the absence of antibody, in normal mouse serum (1 : 1000), or with an irrelevant antibody of the same IgG subclass (1 : 1000) . These were consistently negative. Positive control sections included mouse colon previously treated by N-ethyl-N-nitrosourea , which induces MT-immunopositive crypts .The size of each MT-immunopositive patch was assessed by the number of contiguous MT-immunopositive crypts within the patch. Patches were recorded as doubles, triples or greater frequency of MT-immunopositive foci (ii) number of MT-immunopositive patches and (iii) the total number of MT-immunopositive crypts were expressed as the number per 10post hoc tests were applied to assess differences between specific treatment regimens. Differences of MT-immunopositive patch formation between MNU alone and all combinations of λCgN/MNU were assessed by Student's t-test. Correlations between MTCRII and ACF data were investigated by Pearson's product moment coefficient. SPSS for Windows (version 11) was used for statistical analysis .Serial weight data were available in individual mice. The weight index was calculated as the weight at study completion relative to weight at study start, expressed as a percentage. Between-group differences of weight index were assessed by one-way ANOVA. Descriptive statistics applied to weight index were expressed as mean±standard deviation (mean±s.d.). Group data were available for consumption of food and fluid, which were assessed in grams or ml per kg body weight, respectively. Descriptive statistics were expressed as mean±s.d. To achieve a normal distribution, MTCRII and ACF data from each treatment group were log transformed to ensure a normal distribution and assessed by a probability plot of residuals. Transformed data were analysed by univariate ANOVA. Duncan n=90 total) received water- or vehicle-only controls, high- or low-dose λCgN alone or in combination with MNU (62.5 mg kg−1 i.p.). λCgN was given in single or recurrent short- or long-term patterns of exposure. Group values for fluid, food intake and weight index are shown in In all, 11 treatment groups of mice (−1) treatment, but was unaffected by λCgN treatment alone. Data analysis by one-way between-group ANOVA with the Duncan post hoc test allowed division of results into statistically different subsets. Combined λCgN/MNU regimens induced significantly greater total number of MT-immunopositive crypts compared to MNU alone or treatments lacking MNU . Significant incremental differences were observed between three treatment subsets (A–C), where A represents treatment groups 1–4, B represents group 5 and C represents groups 7 and 9. Treatment groups 6, 8, 10 and 11 overlapped subsets B and C vs 1.12±1.01 per 104 total crypts for all MNU/λCgN treatment groups (P=0.002). All patches of ⩾4 MT-immunopositive crypts were observed in combined λCgN/MNU treatment groups.Significant between-group differences in the frequency of patches of ⩾2 contiguous MT-immunopositive crypts were also observed . Post hoc analysis demonstrated significant incremental differences in ACF number between five homogeneous treatment subsets (A–E), where A represents treatment groups 1–4, B represents treatment group 5, C represents groups 6 and 7, D represents group 8 and E represents groups 9 and 11. Group 10 overlapped subsets C and D . Linear correlations were observed between total MT-immunopositive crypt number and ACF number per 10 P<0.01) and ACF P< 0.01) .λCgN and MNU.Colonic tumorigenesis involves acquisition of mutations or heritable epigenetic events, affecting growth control or differentiation genes within crypt stem cells, progression to premalignant stages including ACF and ulti−1) together with single, repeated or continuous exposures to low- (1%) or high- (4%) dose λCgN, to that of our previous study (λCgN treatment were continued for longer term (20 weeks). The present study supports our earlier work and shows that λCgN alone does not significantly affect MTCRII, but enhances MNU effects upon this end point (λCgN exposure to 20 weeks was associated with the development of larger MT-immunopositive (mutant) patches than observed at 10 weeks, in our previous study.The present study uses a similar combinatorial design, involving a single MNU treatment (62.5 mg kgλCgN exposure may have cumulative effects upon mutant patch size. These effects could be related to λCgN-induced tissue injury in mouse colon (Hence, prolonged While biomarkers of rate-limiting steps of tumorigenesis are informative, validation against tumour-associated end points is important. Aberrant crypt foci comprise a contiguous collection of crypts that have thickened epithelia, altered luminal openings and are clearly circumscribed from adjacent normal crypts . Gene mu

Experimental screening of large sets of peptides with respect to their MHC binding capabilities is still very demanding due to the large number of possible peptide sequences and the extensive polymorphism of the MHC proteins. Therefore, there is significant interest in the development of computational methods for predicting the binding capability of peptides to MHC molecules, as a first step towards selecting peptides for actual screening.50 cutoff criteria used to select the binders and non-binders. The best performance was achieved when predictions were performed on the dataset consisting only of strong binders (IC50 less than 10 nM) and clear non-binders . In addition, robustness of the predictions was only achieved for alleles that were represented with a sufficiently large (greater than 200), balanced set of binders and non-binders.We have examined the performance of four diverse MHC Class I prediction methods on comparatively large HLA-A and HLA-B allele peptide binding datasets extracted from the Immune Epitope Database and Analysis resource (IEDB). The chosen methods span a representative cross-section of available methodology for MHC binding predictions. Until the development of IEDB, such an analysis was not possible, as the available peptide sequence datasets were small and spread out over many separate efforts. We tested three datasets which differ in the ICAll four methods show good to excellent performance on the comprehensive datasets, with the artificial neural networks based method outperforming the other methods. However, all methods show pronounced difficulties in correctly categorizing intermediate binders. A precise understanding of host immune responses is crucial for basic immunological studies as well as for designing effective disease prevention strategies. Epitope-based analysis methods are effective approaches at assessing immune response, allowing for the quantification of the interaction between a host and pathogen, of vaccine effectiveness or other prevention strategies.As part of the adaptive immune response, antigens are recognized by two different types of receptor molecules: immunoglobulins which act as antigen receptors on B cells and antigen-specific T-cell receptors (TCRs) ,2. The l+ T cells. The binding of antigenic peptides from pathogens to MHC class I molecules is one of the crucial steps in the immunological response against an infectious pathogen [MHC class I molecules deliver peptides from the cytosol and are recognized by CD8pathogen . While nThe Immune Epitope Database and Analysis Resource (IEDB) ,5 is a cIEDB is not the first database to store such information, as there are a number of databases which include similar information. However, although most of the components of IEDB can be found in other resources, none contains them all. For example, SYFPEITHI containsWhile IEDB is the first epitope database of significant size, the experimental screening of large sets of peptides with respect to their MHC binding capabilities is still very demanding due to the large number of possible peptide sequences and the extensive polymorphism of the MHC proteins. Therefore, there is significant interest in the development of computational methods for predicting the binding capability of peptides to MHC molecules, as a first step towards selecting peptides for actual screening.et al. [Sequence- and structure-based methods, as well as combinations thereof, have been developed and were used for both classification and regression. Classification models aim to distinguish binding from non-binding peptides, whereas regression methods attempt to predict the binding affinity of peptides to MHC molecules. As the quantity of publicly available binding data has been limited until recently, most methods focus on classification. A review of previous methods can be found in Tong et al. .Sequence-based methods are computationally more efficient than structure-based methods. However, they are hampered by the need for sufficient experimental data and therefore only achieve high performance on already intensively investigated MHC alleles. Additionally, sequence-based methods do not provide a structural interpretation of their results, which is of importance for designing peptidic vaccines and drug-like molecules. Structure-based methods have the advantage of being independent of the amount of available experimental binding data, but are computationally intensive and therefore not suited for the screening of large datasets.et al. [NetMHC which has shown to be among the best predictors in recent comparison tests [A recent approach performset al. and wereon tests .SVMHC) to rather sophisticated encoding (DynaPredPOS). The chosen methods include advanced learning strategies such as support vector machines (SVM) (DynaPredPOS and SVMHC) and artificial neural networks (ANN) (NetMHC), as well as the more straightforward quantitative matrix based prediction (YKW).A major focus of this study is on testing the dependency in performance of well established methods on the use of different training and testing datasets. The four methods we have chosen span a representative cross section of available methodology for MHC-peptide binding predictions, from simple binary where included in the analysis (Table 50 or in rare cases EC50), but including only those with a binding affinity between 50 nM and 1000 nM, i.e. including only weak binders and non-binders (the intermediate dataset or Dataset I) and all peptides with an IC50, but excluding those with a binding affinity between 10 nM and 10,000 nM, i.e. including only very strong binders and very clear non-binders (the strong dataset or Dataset S). Alleles with less than 200 peptides in total (binders and non-binders) were excluded from the analysis in all datasets. IC50 measures the half maximal (50%) inhibitory concentration (IC) of a radioactive isotope labeled standard peptide to MHC molecules, whereas EC50 measures the half maximal effective concentration (EC) of such a reference peptide [50 values greater than 500 nM, and peptides annotated as non-binders with IC50 values less than 500 nM were discarded. We have made the three datasets available: http://www.mpi-inf.mpg.de/~roomp/benchmarks/list.htm.Three datasets were generated for each allele: all peptides available in IEDB (the full dataset or Dataset F), all peptides with an available quantitative laboratory test result was developed in our laboratory [The first prediction method used (boratory . The genboratory . SubsequDynaPredPOS).The BFESM is used to generate a feature vector for each given peptide in the training dataset; all vectors together produce a feature matrix for model generation and prediction. A local feature matrix is constructed from the BFESM which uses all residue and binding pocket positional information from the scoring matrix. This matrix provides a basis for logistic regression and SVM training of the fDynaPredPOS is the ability to construct bound peptide conformations for all predicted sequences. The bound conformations are generated by connecting the saved residue conformations for the simulation runs and performing a short energy minimization. In a detailed analysis [One feature unique to analysis , the conSVMHC from Dönnes et al. [YKW from Yu et al. [Additionally, we evaluated two sequence-based prediction methods from the literature. The first method is s et al. , which is et al. . For this et al. , which wu et al. , which iNetMHC has recently been shown to be among the best predictors in an extensive comparison of prediction servers whose performance was evaluated with 176 peptides derived from the tumor antigen survivin and the cytomegalovirus internal matrix protein pp65 [NetMHC is available via http://www.cbs.dtu.dk/services/NetMHC/. NetMHC could not be trained for this study as it was only accessible via with web interface, and was therefore used for testing purposes only. Also, it is probable, that at least some of the data used to train the NetMHC server was the same data which was retrieved from IEDB for this study.The fourth and final method we evaluated is an artificial neural network based approach ,28, whicein pp65 . NetMHC SVMHC, YKW, and DynaPredPOS was performed for each HLA-A and HLA-B allele separately. In the case of DynaPredPOS, the same BFESM generated from the molecular simulations on A*0201 was used to generate each new feature matrix for each allele separately. For NetMHC, the peptide sequences from Dataset F, I and S were submitted to the prediction server and the prediction results were recorded.For Datasets F, I and S, training and testing of the prediction models for The accuracy of the methods was assessed by generating areas under the curve , which We used 10-fold cross validation to assess the accuracy of the predictions.YKW, SVMHC and DynaPredPOS are on the size of the available allele datasets , we tested the methods' performance with randomly selected balanced datasets of different sizes, selected from all peptides available in IEDB for a particular allele (Dataset F). NetMHC was not included in this analysis, because we were unable to retrain the statistical model.In order to determine how dependent the reproducibility of the results of the prediction methods The alleles examined were A*0201, A*3101 and B*0702. The training was performed on each allele separately, followed by testing using 10-fold cross validation. The smallest balanced dataset for each allele consisted of 50 randomly selected binders and 50 randomly selected non-binders and the size of the largest dataset depended on the overall number of binders or non-binders available for the allele. All prediction methods were run on four randomly selected balanced datasets in each size category for each allele.YKW, SVMHC and DynaPredPOS), trained for the allele A*0201, to generalize to other alleles. NetMHC was again not included in this analysis, because we were unable to retrain the statistical model. Training was performed on Dataset F of A*0201, followed by testing on Datasets F of all other alleles. This generalization ability is essential for epitope prediction models as there are many alleles with insufficient data for training an allele-specific model.By this test, we assess the ability of the statistical models and no statistically significant difference between the other three methods could be detected. Therefore, the ranking of the methods can be described as NetMHC > .If all available peptides for an allele are used for the prediction , an allele's dataset generally has to contain more than 100 binders and more than 100 non-binders (preferably more than 200 binders and more than 200 non-binders). Also, datasets for which the number of binders and non-binders are relatively balanced produced larger AUCs (i.e. better performance). Unbalanced datasets in IEDB generally have a substantially lower number of binders than non-binders. For NetMHC had the best performance for 10 out of 11 alleles. However, all methods showed at best marginal prediction performance (the largest achieved AUC was 0.79) and in most cases the predictions were poor.Intermediate binders . Despite a substantially lower number of data points in Dataset S, a higher accuracy was found for the best method for all alleles when compared with the Datasets F. A typical ROC plot comparing the performance of the four prediction methods for Dataset S is shown in Figure Restricting the datasets to peptides which were either very strong binders or clear non-binders substantially improved the results in most cases , the dataset was relatively well balanced, the NetMHC was the best method for five of the seven alleles tested there was no significant difference in the performance of the methods. For all alleles, with the exception of A*1101, at least one method had excellent predictive performance (AUC greater than 0.90); generally at least two methods showed excellent predictive performance.For the independent dataset of 176 peptides Table , while NYKW, SVMHC and DynaPredPOS) on the size of the training sets used. NetMHC was not included in this analysis as the predictor is only available online and therefore could not be trained by the authors. We found that in most cases the AUCs stabilized at or close to their maximum level, when the size of the randomly selected balanced dataset consisted of more than 200 binders and 200 non-binders improved the performance of the methods (results not shown), as did using a subset of data containing only the very strongest binders and clearest non-binders. Due to the error involved in experimental binding affinity analysis , we suggNetMHC, on Dataset S in particular where it performs with an AUC of 1 for many alleles, may be in part due to the fact that this method could not be trained for the purposes of this study as NetMHC was only accessible via a web interface. It should also be noted that some of the data used to train NetMHC was probably identical to that extracted from IEDB for this study. This conjecture is also supported by the prediction results of the methods on the independent, novel dataset, which showed no statistically significant results between the methods showed that all methods require a sufficient number of data points for reproducible results Figure . OverallThe analysis of the methods' generalizability showed that the prediction capabilities are good to marginal for some alleles, implying that cross-allele prediction is feasible in some cases. In other cases, the AUCs were very low. Having trained with A*0201 and then tested for generalizability on HLA-A and HLA-B alleles in Dataset F, a possible reason for certain alleles to give rise to such low AUCs may be that a particular subset of binders that bind well to A*0201 may be very clear non-binders for the alleles in question. Conversely, clear non-binders for A*0201 may be binders for the other alleles leading to low AUCs.In contrast to the former study , which iKR contributed to the design of the study, computed and interpreted the results and drafted the manuscript. IA conceived the study, participated in its design and the interpretation of the results, and helped draft the manuscript. TL contributed to the design of the study and to the interpretation of results and helped draft the manuscript. All authors contributed to the writing of the manuscript and read and approved the final version.

Small dense LDL is reported to be associated with increased coronary artery disease risk by various epidemiological studies. The gold standard for separation and identification of LDL subtypes in plasma is ultracentrifugation which is a lengthy procedure and difficult to perform. Various other methods like NMR, HPLC, gradient gel electrophoresis (GGE) have been reported for LDL sub fractionation all of which require specialized equipments and expertise. We report here a high throughput 3% polyacrylamide slab gel electrophoresis method (PASGE) for sub fractionation of LDL which was compared with GGE, a commonly used method for LDL sub fractionation.The 3% PASGE method compared well with the GGE method There was a good correlation between LDL particle diameter identified by the PASGE and GGE (Pearson correlation coefficient = 0.950). A 100% concordance was found when samples were classified as per LDL phenotypes in subjects with A and B phenotype by the two methods with the concordance being 66% in subjects with intermediate (I) phenotype. The electrophoresis apparatus was optimized and designed for running twenty eight samples at a time compared to twelve to fourteen by the conventional PASGE and eight to twelve by disc electrophoresis.The rapid 3% polyacrylamide slab gel electrphoresis method developed is simple to perform, cost-effective and can be used for the identification LDL sub fractionation and phenotyping in large epidemiological studies. Cardiovascular disease (CVD) is the major public health problem in developing countries like India ,2. More Serum LDL has been the subject of numerous epidemiological studies because of their unequivocal association with coronary artery disease . HoweverSeveral methods are available for sub fractionation of LDL. These methods include density gradient ultracentrifugation , non-denTwenty samples were analyzed by both 3% PASGE method and GGE. Gel pictures of LDL fractionation of 12 samples by 2–8% GGE and 3% PASGE is depicted in Fig Different methods have been reported for separation of LDL fractions and include NMR, HPLC, ultracentrifugation and GGE. The first three require sophisticated instruments which may not be available in all clinical chemistry laboratories. LDL sub-fractionation by GGE has been widely used by clinical laboratories -9 howeveThe 3% slab gel electrophoresis method described is simple, cost effective, takes shorter time and allows measurement of larger number of samples compared to other reported methods for LDL subfractionation.Blood samples were drawn after overnight fast from 20 individuals in Na2 EDTA vacutainers (Becton Dickson) and plasma was separated by centrifugation at 2000 rpm. Samples were aliquoted and stored at -70°C until LDL sub fraction analysis by 3% PASGE and Gradient gel electrophoresis (GGE).A 3% PASGE method was developed by modification of existing electrophoresis methods for LDL sub fractionation ,15,22. AElectrophoresis was performed in cold (4–8°C) using TBE buffer . The gel was pre run for 10 minutes at 50 V. Samples were run initially at 70 V for 30 min, followed by 125 V for 1 hr and 200 V for 1.5 hrs. Gel was allowed to remain in dark for 1 hour. Densitometry was performed in a Helena EDC system (Helena laboratories).The migration of LDL and HDL was arrived at by measuring the distance between absorbance maxima of VLDL and LDL and that of VLDL and HDL respectively. Migration of predominant LDL fraction in relation to HDL was derived as followsParticle diameter corresponding to LDL peaks was calculated from a calibration curve prepared from standards of known diameters which were incorporated in every run.For comparison, samples were run on non denaturing 2–8% polyacrylamide gradient gel. LDL subfractionation by GGE was carrAgreement between PASGE and GGE method was evaluated by applying Pearson correlation. Bland Altman plot was generated to assess the deviation of PASGE method from GGE. Weighted Kappa statistics was applied to evaluate concordance between LDL phenotypes obtained by the two methods.CVD: Cardiovascular Disease; PASGE: Polyacrylamide Slab Gel Electrophoresis; GGE: Gradient Gel Electrophoresis; NMR: Nuclear Magnetic Resonance; LDL: Low: density lipoprotein; VLDL: Very low: density lipoprotein; TEMED: N, N, N', N': tetramethylene diamineAPS: Ammonium persulphate.The authors declare that they have no competing interests.YS was responsible for analyses of blood samples and initial drafting of the manuscript. RL was responsible for design, planning, execution and drafting of the manuscript, RG and VK were involved in drafting the manuscript and revising it critically for intellectual content.

This manuscript presents an initial description of doctoral level core competencies for health services research (HSR). The competencies were developed by a review of the literature, text analysis of institutional accreditation self-studies submitted to the Council on Education for Public Health, and a consensus conference of HSR educators from US educational institutions. The competencies are described in broad terms which reflect the unique expertise, interests, and preferred learning methods of academic HSR programs. This initial set of core competencies is published to generate further dialogue within and outside of the US about the most important learning objectives and methods for HSR training and to clarify the unique skills of HSR training program graduates. Health services research (HSR) is a scientific field that examines the structures, functions, policies, and outcomes of health services delivered to individuals and populations. Its purIn the 1995 Institute of Medicine report, Health Services Research: Training and Workforce Issues , four elHSR incorporates a wide range of disciplines, notably biomedicine, economics, epidemiology, informatics, management sciences, political science, psychology, sociology, and statistics. Application of these disciplines to problems confronting health systems requires a workforce with a diverse skill set. The field has specific journals, professional societies, employers, sponsors, and training programs; however, the competencies common to all doctoral-trained HSR professionals have not been well-defined.Graduates of HSR training programs pursue a wide variety of careers in academia, research, healthcare delivery, and policy analysis. Despite the success of these graduates, they complete their respective training programs unsure what it means to be a health services researcher, how they are distinguished from other professionals, and what professional roles their advanced training has prepared them to undertake. Our inability to clearly articulate the skill set that is unique to health services research is an unsatisfactory response to these talented students, and highlights the need to develop a common set of HSR competencies.This manuscript describes an initial set of core competencies ("Version 1") for individuals trained at the doctoral level in HSR. The goal was to define the essential knowledge- and skills-based competencies expected of all HSR trainees, irrespective of areas of content specialization, method or disciplinary focus. Defining HSR doctoral competencies will (1) assist educators with developing and identifying the most important learning objectives for HSR training, (2) clarify for employers the skills and abilities of graduates of HSR training programs, and (3) give HSR trainees a unique professional identity.Ideally, designing a training program begins with defining its competencies, delineating learning objectives specific to each competency, and then developing a structure for delivering educational experiences that fulfills the objectives . The aimEach competency has a set of learning objectives, which describe the approach for achieving the competency. Although the end-results of training programs may be similar, the approaches used to attain them may differ. This manuscript does not propose specific learning objectives, curricula, or methods that could be used for each competency.We developed the core competencies by reviewing the literature and conducting a text analysis of accreditation self-studies submitted to the Council on Education for Public Health. Based on common themes identified in the self-studies, an initial draft of core competencies was developed and subsequently discussed at a conference of HSR educators. The Version 1 competencies presented in this manuscript are the result of this consensus conference. It should be emphasized that the methods used to generate these competencies were based on review of US training programs.A search of the peer- and non-peer reviewed literature was conducted for all articles and reports that describe competencies or learning objectives in health services research . LiteratBecause the focus of this project was on health services researchers, programs designed to train managers of health systems were considered outside the project scope -8, as weThe project team obtained accreditation self-studies of all schools of public health doctoral and master's level programs in health services research from the Council on Education for Public Health (CEPH) – a total of 27 schools and 55 programs. Masters programs were included in this review, because many programs did not distinguish in the accreditation self-study between doctoral and masters level training. Approximately 650 learning objectives were extracted from the self-studies, and then sorted into learning objective clusters using text analysis software that may be used to derive themes from text-heavy data . The intBased on this categorization of learning objectives, the project team drafted an initial set of core competencies that summarized the learning objective clusters. For example, scientific method and theory, literature review methods, and proposal development were three clusters that were ultimately associated with a single core competency: "pose innovative and important research questions, informed by systematic reviews of the literature, stakeholder needs, and relevant theoretical and conceptual models."The draft version of the core competencies and their associated learning objective clusters were reviewed by the health services research faculties from the University of Washington and the Johns Hopkins Schools of Public Health. Their comments were used to produce a revised version. These materials were submitted to a geographically diverse batch of leaders of HSR training programs from across the United States in order to obtain the input of their faculty. These leaders and their programs were selected in consultation with staff responsible for HSR training programs funded by the Agency for Healthcare Research and Quality. The specific programs were selected to represent the major census divisions in the US, programs with and without CEPH-accreditation, and others that were or were not funded by the Agency for Healthcare Research and Quality.The conference was held in the fall of 2005 and included 10 directors of HSR training programs, doctoral students, and representatives from AcademyHealth, AHRQ, CEPH, and public and private sector stakeholder organizations that are employers of HSR trainees. The group used a consensus conference process to revise the specific knowledge- and skills-based competencies that are common to all health services research professionals. A final version of competencies resulted from this consensus process, and is presented in this manuscript.The specific wording of each competency was intended to reflect the level of mastery and to identify the specific asset that HSR doctoral training should develop among its trainees. Table The list of 14 core competencies should be viewed in its entirety as a reflection of values and teaching goals of the HSR doctoral training programs, professional societies, and stakeholder organizations that contributed to this project. While some academic programs may emphasize specific core competencies more than others, it is the totality of the core competencies that makes the list unique to HSR. Individual core competencies are written in broad terms to allow individual variation and interpretation among programs. Some are expressed in such general language that they may be relevant to disciplines other than HSR. This is appropriate since some competencies are central to conducting research in all fields, but this should not minimize the relevance of their inclusion in the core competencies for HSR.The competencies presented in this manuscript are a first step towards explicating the common knowledge and skill sets of health services researchers. They are presented to generate dialogue and debate both in the US and globally on the essential competencies for HSR. It is possible that non-US programs would view other competencies as core to the educational experience, such as comparative health systems research. Lack of inclusion of these international programs should be seen as a limitation of this work.Further work is necessary to clearly identify the field's unique conceptual and methodological contributions to scientific inquiry. These efforts will undoubtedly help refine the HSR core competencies. Within the past two years, these competencies have been discussed and debated at a supplemental meeting to the 2007 Annual Research Meeting of AcademyHealth. At a 2008 conference sponsored by the Agency for Healthcare Research and Quality, approaches to how a particular program would deliver and evaluate them were examined by a group of HSR training program directors. They are published now to extend this dialogue to the global audience of health services research programs, employers of HSR trainees, and students.Competencies can be an effective tool to guide the design of health services doctoral training programs and can contribute to the definition of the field of health services research. Stakeholder debates can elucidate HSR strengths and identify areas for further development – e.g. development of theories of organizational change to improve quality or better methods to take selection bias into account. To maximize the utility of core competencies, they should be embedded in experiential training as well as courses. Didactic course work is only a small part of doctoral education and much learning takes place during seminars, independent studies with faculty, research assistantships, and research field experiences. One of the next steps in thinking about curriculum development with the competencies will include suggestions for implementing experiential learning in doctoral training. This first foray into competency development should not indicate that HSR is ready for an accreditation process, as accreditation may have the unintended effect of stifling innovation in HSR training. However, this emerging framework could serve as a possible template for continuing education of HSR professionals as the specificity of HSR competence increases with further work.The application of these competencies should not result in a set of "cookie cutter" training programs. In implementing the competencies, we expect that programs will consider the characteristics of their students, the expertise and interests of their faculty, and the opportunities presented by their research partners for field experiences. Programs should continue to offer training with emphasis in specific methods or topic areas. For example, one program may specialize in qualitative methods such as community-based participatory research, while another may concentrate on health economics.The 14 core competencies provide an overview of the breadth of expertise that can be expected of all graduates of US-based HSR doctoral training programs and a minimum level of depth . The specific level of competence in each educational domain, however, is a topic for each training program to grapple with. For example, we did not find unanimity that all HSR trainees should acquire an independent mastery level for primary and secondary data gathering studies. Instead, these competencies were worded to reflect an expectation of an intermediate level of competence – i.e., know how to apply or do something in a supervised setting. It would be expected that individual trainees would choose one of the two types of methodological approaches to gain independent expertise during their doctoral training.The Version 1 core competencies presented in this paper are a product of work done in 2005 and should be considered a first draft. The competencies should be dynamic, changing as the field of health services research changes. For this reason it is likely that the core competencies will need to be revised on a periodic basis. We are publishing Version 1 of the HSR core competencies to generate discussion among a wider group of health services research professionals.The pre-publication history for this paper can be accessed here:

VEGF-A). VEGF-A functions in the development of embryonic structures, during tissue remodelling and for the growth of tumour-induced vasculature. The study of the role of VEGF-A during normal development has been significantly complicated by the dominant, haplo-insufficient nature of VEGF-A-targeted mutations in mice. We have used morpholino-based targeted gene knock-down technology to generate a zebrafish VEGF-A morphant loss of function model. Zebrafish VEGF-A morphant embryos develop with an enlarged pericardium and with major blood vessel deficiencies. Morphological assessment at 2 days of development indicates a nearly complete absence of both axial and intersegmental vasculature, with no or reduced numbers of circulating red blood cells. Molecular analysis using the endothelial markers fli-1 and flk-1 at 1 day of development demonstrates a fundamental distinction between VEGF-A requirements for axial and intersegmental vascular structure specification. VEGF-A is not required for the initial establishment of axial vasculature patterning, whereas all development of intersegmental vasculature is dependent on VEGF-A signalling. The zebrafish thus serves as a quality model for the study of conserved vertebrate angiogenesis processes during embryonic development.Angiogenesis is a fundamental vertebrate developmental process that requires signalling by the secreted protein vascular endothelial growth factor-A (

A 66 yrs old gentleman presented with severe mood changes following application of very potent topical corticosteroid cream, clobetasol propionate, which was prescribed for his recalcitrant eczema. The symptoms disappeared within 24 hours of discontinuation of the cream and he remained mentally well when reviewed after 2 weeks. This case report highlights the rare manifestation of psychiatric problems secondary to topical corticosteroids. Having performed thorough literature search I would like to discuss in this report the evidence for this relation and stress the importance of appropriate usage of topical corticosteroids.A 66 yrs old gentleman was referred for urgent psychiatric assessment as he complained of severe mood swings, which ranged from anger to tearfulness. He had no previous psychiatric history. When seen he gave a 2-week history of exaggerated egosyntonic unipolar affective reactions with symptoms of overwhelming tiredness and sadness, and difficulty in concentrating. A few months earlier, he was diagnosed with eczema in a dermatology clinic and was prescribed fucibet cream (betamethasone with fusidic acid), which is classed as potent corticosteroid. His skin condition did not improve satisfactorily and was considered to have recalcitrant eczema. He was then prescribed clobetasol propionate cream, which is classed as a very potent corticosteroid. As advised, he applied the cream twice daily and to the areas affected i.e. forehead, neck, arms, and chest. Ever since he commenced clobetasol cream, he began to experience severe mood swings. He described these experiences to immediately follow the application of the cream to his body and the episodes lasted upto couple of hours each time. Despite these experiences, he continued to apply the cream, as he has seen an improvement with his skin condition. His medication history suggests that he has drug sensitivity as he reacted badly to local anesthetic for a nasal surgery and he is also allergic to penicillin.He is not known to drink alcohol, smoke cigarettes or take illicit substances. He was not on any other medications at the time of contact and had no significant medical history. He denied any other difficulties in his life and there were no other symptoms of depression, mania, anxiety, psychosis, or cognitive impairment. There is no family history of psychiatric illness.From the assessment, given the clear relation between the commencement of the corticosteroid cream and the affective reactions and the absence of any other significant contributors to the presentation, it was concluded that the psychiatric manifestation was secondary to the topical corticosteroid preparation, clobetasol propionate. He was advised to withhold it with a plan to review him in few days time. When reviewed he reported a dramatic improvement within 24 hours of discontinuing the cream and he no longer experienced the symptoms described. He was reviewed again in 2 weeks time when he remained mentally well.Clobetasol is indicated in the British National Formulary for treatment of severe resistant inflammatory skin disorders such as recalcitrant eczema unresponsive to less potent corticosteroids. Topical Patients with Cushing's syndrome may suffer with psychiatric disturbance including emotional lability, euphoria, depression, psychosis, or mania. Behavioret al. also suggest that using less than 50 g of clobetasol propionate ointment a week may result in transient suppression of HPA function, which apparently recovers as the skin heals. This is probably because less ointment is applied and the epidermal barrier is restored, thereby reducing corticosteroid absorption.[Inhibition of the HPA axis by an excessive application of moderately potent or relatively modest doses of stronger steroids is well documented. Hence, isorption. It is alsorption.

Popular predictive models for estimating morbidity probability after heart surgery are compared critically in a unitary framework. The study is divided into two parts. In the first part modelling techniques and intrinsic strengths and weaknesses of different approaches were discussed from a theoretical point of view. In this second part the performances of the same models are evaluated in an illustrative example.k-nearest neighbour model, logistic regression model, Higgins and direct scoring systems and two feed-forward artificial neural networks with one and two layers. Cardiovascular, respiratory, neurological, renal, infectious and hemorrhagic complications were defined as morbidity. Training and testing sets each of 545 cases were used. The optimal set of predictors was chosen among a collection of 78 preoperative, intraoperative and postoperative variables by a stepwise procedure. Discrimination and calibration were evaluated by the area under the receiver operating characteristic curve and Hosmer-Lemeshow goodness-of-fit test, respectively.Eight models were developed: Bayes linear and quadratic models, k-nearest neighbour models were much more parsimonious. In testing data, all models showed acceptable discrimination capacities, however the Bayes quadratic model, using only three predictors, provided the best performance. All models showed satisfactory generalization ability: again the Bayes quadratic model exhibited the best generalization, while artificial neural networks and scoring systems gave the worst results. Finally, poor calibration was obtained when using scoring systems, k-nearest neighbour model and artificial neural networks, while Bayes and logistic regression models gave adequate results.Scoring systems and the logistic regression model required the largest set of predictors, while Bayesian and Although all the predictive models showed acceptable discrimination performance in the example considered, the Bayes and logistic regression models seemed better than the others, because they also had good generalization and calibration. The Bayes quadratic model seemed to be a convincing alternative to the much more usual Bayes linear and logistic regression models. It showed its capacity to identify a minimum core of predictors generally recognized as essential to pragmatically evaluate the risk of developing morbidity after heart surgery. The increasing number of diagnostic and therapeutic choices and the demand for quality and cost control have contributed to a proliferation of techniques of pattern recognition and decision making in all biomedical fields. In recent years, many different models have been proposed for the prediction of adverse outcome in heart surgery patients -6. This k-nearest neighbour for BL versus [0.721–0.830] for LR) and the generalization power was similar. They both showed good calibration performances. This seems to confirm previous experimental findings indicating that in many practical situations the two approaches give generally similar results ,18. Thei22–0.831 kNN model required only five features to predict morbidity in ICU patients after heart surgery. In general, this non parametric approach did not overfit training data, so that good generalization could also be obtained using different dimensions of the feature set . AŨC calculated by means of the bootstrap resampling method was almost the same for training and testing data (percentage difference less than 1%). The quality of the results in the scenario considered may also be due to the small number of parameter estimates required by the model. In fact, with three predictor variables and two classes, the BQ model required the estimation of eighteen parameters (mean vectors and covariance matrices of the two classes). This model parameter number is about the same as that of the LR model (fifteen model parameters), but much less than that of BL (fifty-two model parameters). Like the BL model, the BQ model can be recursively updated whenever a new case has to be included in the training set. Finally, after recalibration, Hosmer-Lemeshov goodness-of-fit test using Ĉ-statistics indicated adequate model calibration. These considerations make the BQ model a convincing alternative to the BL and LR approaches for the present application.It can be noted that two of the three predictors selected by the Bayes quadratic model (oxygen extraction and need for cardiac inotropic drugs after the operation) were chosen by all models. This means that these two variables were essential features for predicting morbidity in the scenario considered. Of course, the need for inotropic drugs after the operation is strongly correlated with poor cardiac function, while the key role played by oxygen extraction confirms the results of a previous study, in which increased oxygen extraction immediately after heart surgery has been indicated as an independent predictor of prolonged ICU stay . The thiStatistical predictive models and artificial neural networks are black-box systems allowing cases to be allocated to different classes, but they do not lend themselves to interpretation of the underlying causes. However, when the number of the selected predictor variables is sufficiently small it may be interesting to seek an explanatory interpretation of the predictive model results a posteriori. In everyday life we are accustomed to considering phenomena in three dimensions. It is therefore difficult to expound the meaning of systems (such as predictive models) working in more than three dimensions. However, when the predictive model uses two or three features, a rational interpretation of its results may be attempted. The BQ model developed on our ICU data used only three features to predict morbidity outcomes, so that an interpretation of the result obtained was sought. First of all it is useful to recall that oxygen extraction is the ratio of oxygen consumption to oxygen delivery. A recent paper showed that the relationship of oxygen consumption to oxygen delivery is an important concept, even if its practical application is not simple and decisions regarding the need for strategies to increase and maintain oxygen delivery require the interpretation of many measurements . The BQ As a conclusion, the Bayes quadratic model seemed to identify a minimum core of predictor variables generally recognized as essential for a pragmatic evaluation of the risk of morbidity after heart surgery. When this set of predictors was used on test data, it gave good discrimination, generalization and calibration, which were similar or better than those obtained with the Bayes linear or logistic regression models. Because of the small number of predictors to be monitored, clinicians may also more easily track and rationally interpret time courses of patient status, and consequently make prompt decisions about optimal therapeutic strategies. Of course, this does not mean that the Bayes quadratic approach is always the best model for predicting morbidity in ICU patients. However it provided a good compromise between system complexity and predictive performance in our example.The purpose of the present study was to analyse and compare different predictive models for estimating patient morbidity in the ICU after heart surgery. In this second part of the study we developed and tested eight popular predictive models with preoperative, intraoperative and postoperative data acquired in adult patients who underwent coronary artery bypass grafting. This part of the study supplements Part I in which different approaches for developing predictive morbidity models were reviewed in a unitary framework from a theoretical point of view.k-nearest neighbour model and artificial neural networks, while Bayes and logistic regression models gave satisfactory results. Most of models selected more than ten features to predict morbidity. Scoring systems and logistic regression model required the largest set of predictors, while Bayesian and kNN models were much more parsimonious, requiring less than ten features.The experimental results indicated that all models provided acceptable discrimination in test data and satisfactory generalization in our illustrative example. On the contrary poor calibration was obtained with scoring systems, the The Bayes quadratic model required the smallest set of predictor variables and provided very interesting results, which were similar or better than those obtained with the Bayes linear or logistic regression models. Unlike logistic regression models, an additional intrinsic strength of Bayesian models is that they can be updated in a straightforward manner, including new correctly classified cases into the training set, since this just involves the updating of mean vector and covariance matrix estimates by means of simple recursive relationships.Because of the small number of predictors needed, the Bayes quadratic linear model also enabled an explanatory interpretation of the results obtained in our example. In particular, the BQ model seemed to confirm previous experimental findings proving that the relationship between oxygen consumption and oxygen delivery is a key issue for guiding therapy.In conclusion, both theoretical and experimental findings indicate that the Bayes quadratic model offers a good compromise between complexity and predictive performances and can therefore be a convincing alternative to other much more extensively used predictive models (such as scoring systems or even Bayes linear and logistic regression models) in many clinical applications.Note: This paper is accompanied by Part I, which gives a comprehensive review of several methods used to plan predictive models [e models .kNN = k-nearest neighbour; LR = logistic regression; MSE = mean squared error; ROC = receiver operating characteristic.ANN = artificial neural network; AUC = area under the ROC curve; AŨC = median value of AUC, BL = Bayes linear; BQ = Bayes quadratic; CI = confidence interval; DS = direct score; HL = Hosmer-Lemeshow; HS = Higgins score; ICU = intensive care unit; The author(s) declare that they have no competing interests.All authors participated in the study plan and coordination. GC and PB were concerned with medical informatics and biostatistical aspects of the study. EB was concerned with epidemiology and biostatistical aspects of the study. SS, BB and PG were involved in clinical aspects. SS collected clinical data. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Neuregulin-1 proteins are related to physiological correlates of Type A in terms of cardiac reactivity. Furthermore, neuregulin-1 gene (NRG1) may play a role in cardiovascular disease such as atherosclerosis and coronary heart disease i.e. the suggested "outcomes" of Type A behavior. Therefore, NRG1 is hypothesized to be associated with Type A behavior.The study examined whether Type A behavior pattern is associated with the single nucleotide polymorphism (SNP) SNP8NRG221533 of the NRG1. The subjects were 631 men and women participating in the population-based Cardiovascular Risk in Young Finns study in 1992 and 2001. Type A was self-assessed with the Framingham Type A Scale and reassessed nine years later.Type A was associated with NRG1 genotype. Carriers of genotype CC scored lower on Type A compared to the others.Our study has pinpointed a SNP in NRG1 that predicts Type A behavior. As previous evidence suggests an association for NRG1 with beta-adrenergic stimulation, its role underlying Type A is discussed. Type A behavior, originally described as a behavioral pattern comprising impatience, hard driving and a sense of hurry , was conIn the 1980's, however, most studies failed to confirm an association between Type A behavior and CHD . In 1999Vagueness of the Type A concept may at least partly, explain these conflicting findings. There is a disagreement whether Type A mainly refers to emotions, attitudes, behavioral styles, or innate dispositions, and what is the contribution of those dimensions to the final concept. If Type A behavior, or any dimension of it, could be anchored to genetic background, this might establish its content. More important, identifying functional genes related to Type A behavior might increase our knowledge about mechanisms through which Type A could be associated with health outcomes. This study was taken with these purposes. As far as we know, there are no previous studies that have associated Type A behavior with molecular genetics. For two reasons, neuregulin-1 (NRG1) might belong to candidate genes to start with. First, neuregulin-1 proteins are related to physiological correlates of Type A in terms of cardiac reactivity. They seem to reduce excessive beta-adrenergic stimulation, and help to produce counterbalancing parasympathetic activity ,7, and TThe subjects were derived from the ongoing prospective population based study, called Cardiovascular Risk in Young Finns. The Young Finns study has followed a random sample of 3596 healthy Finnish children and adolescents (3–18 years old at baseline) since 1980 .Genetic data was acquired from a sub-sample of 1600 subjects (missing n = 62). Psychological data on adult Type A behavior was obtained first in 1992, and again in 2001 when participants were 15–30 and 24–39 years old, respectively.Participants under the age of twenty at the first Type A assessment were excluded, as questions concerning job-related Type A behavior were not age-appropriate for them. After this exclusion, psychological data was received from 631 genotyped participants who had complete Type A measures from both follow-ups. Of them 276 (43.7%) were men and 355 (56.3%) women. Participants gave written informed consent, and the study was approved by local ethics committees.AF491780). The PCR reaction mixture consisted of genomic DNA, 1 × Universal PCR Master Mix, 900 nM of each primer and 200 nM of each probe. Amplification was performed using the TaqMan Universal Thermal Cycling Protocol. After PCR, end-point fluorescence intensity was measured by the ABI Prism 7900HT Sequence Detection System and allelic discrimination performed. All genotyping was performed blinded to participant outcome. Negative controls (water) and random duplicates were used as quality control.Genomic DNA was extracted from peripheral blood leukocytes using a commercially available kit and DNA samples were then genotyped by employing the 5'exonuclease assay . For theType A behavior was self-assessed with the Framingham Type A Scale . The sca2). Genotypes TT and TC were combined as mean values of Type A in these genotypes were almost identical . However, women were somewhat overrepresented in the data . Included participants were naturally also older than excluded participants, because of our age criterion.The group with data from all used variables was compared to the excluded cases with t- and χThe percentages of subjects carrying genotypes TT, CT and CC in the whole genotyped sub-sample , were 33.7%, 49.7% and 16.6%, respectively. The genotype frequencies followed Hardy-Weinberg equilibrium (p = .83). Table 2 = .010) and overall Type A behavior on first assessment in 1992, genotype CC carriers having lower Type A than others. These associations were replicated on second assessment in 2001 and when Type A was calculated as the mean of the two assessments in1992 and 2001 . Again genotype CC carriers showed lower Type A compared to others. Job related Type A was not associated with NRG1 genotype on either assessment or in mean of the two assessments .NRG1 genotype was significantly associated with trait-related Type A behavior (p = .01, ηOur findings showed that when compared with other genotypes, individuals carrying the genotype CC of NRG1 had lower Type A behavior. This was true with total Type A and its trait-related subscale.The trait-related subscale differentiated the genotypes whereas the job-related subscale did not. This would be in line with an assumption that trait-related Type A behavior is more innate and job-related behavior more circumstantial. It should be noted that calculating the total Type A behavior in the way used, also emphasizes the portion of trait-related Type A compared to job-related Type A behavior.As the etiology of Type A is still unclear, an association between NRG1 and Type A behavior might provide hints of the physiological basis of this personality type and imply a mechanism through which Type A behavior may have its effect on health. NRG1 plays a part in the survival, growth and repair of adult cardiomyocytes as a response to increased workload . It is aNeuregulin proteins, on their part, appear to have the ability to control excessive beta-adrenergic activation. This is, incidentally, likely to be a key factor in neuregulin's protective role in heart failure ,7. In anIt has primarily been through responses to stressors that Type A has been thought to be pathogenic, even when considered as risk factor for atherosclerosis and not Neuregulin has been found to be overexpressed in coronary atherosclerotic lesions in the intima of human blood vessels, primarily in macrophages . Type A,Cronbach's alpha reliabilities of Type A measures were moderate in size varying mostly between 0.6 – 0.7. Previously reported reliabilities for overall Type A correspond to these values . In the It is important to note that the association between NRG1 genotype and Type A behavior was found in Framingham Type A. It is known that different Type A measures do not correlate very strongly as they emphasize different aspects of the multidimensional concept. The current results suggest an association for NRG1 with Framingham Type A but not necessarily with Type A behavior defined by other measures.To our knowledge, our study is the first to examine molecular genetics and Type A. A genetic component has previously been suggested on the basis of quantitative genetics . A folloSNP: single nucleotide polymorphism; CHD: coronary heart disease; NRG1: neuregulin-1; DNA: deoxyribonucleic acid; PCR: polymerase chain reactionThe authors declare that they have no competing interests.HMS participated in the design of the manuscript, performed the statistical analyses and drafted the manuscript. MH participated in the design of the manuscript, performed the statistical analyses and drafted the manuscript. TH helped to perform the statistical analyses and helped to draft the manuscript. TL was responsible for the molecular genetic studies, and helped to draft the manuscript. OTR participated in collection of data, and helped to draft the manuscript. JSV participated in the collection of data, helped to draft the manuscript. LKJ conceived of the study and participated in its design and coordination and collection of data, and drafted the manuscript. All authors read and approved the final manuscript.

Escherichia coli gene mqsR (b3022) was identified as the gene most highly upregulated in persisters. Here, we report multiple individual and complex three-dimensional structures of MqsR and its antitoxin MqsA (B3021), which reveal that MqsR:MqsA form a novel toxin:antitoxin (TA) pair. MqsR adopts an α/β fold that is homologous with the RelE/YoeB family of bacterial ribonuclease toxins. MqsA is an elongated dimer that neutralizes MqsR toxicity. As expected for a TA pair, MqsA binds its own promoter. Unexpectedly, it also binds the promoters of genes important for E. coli physiology . Unlike canonical antitoxins, MqsA is also structured throughout its entire sequence, binds zinc and coordinates DNA via its C- and not N-terminal domain. These studies reveal that TA systems, especially the antitoxins, are significantly more diverse than previously recognized and provide new insights into the role of toxins in maintaining the persister state.One mechanism by which bacteria survive environmental stress is through the formation of bacterial persisters, a sub-population of genetically identical quiescent cells that exhibit multidrug tolerance and are highly enriched in bacterial toxins. Recently, the mqsR, the gene most highly upregulated in persisters, together with mqsA, function: they are the founding members of a new family of toxin:antitoxin (TA) systems. Unexpectedly, the structure of MqsR reveals that it is a ribonuclease, a protein that controls the production of other essential proteins. Moreover, we identified multiple features of this TA system that are so unique that each is a starting point for drug development. Unlike other antitoxins, MqsA is structured throughout its entire sequence, its structure is unchanged between the free and toxin-bound states and it binds zinc. It also binds DNA via its C- and not N-terminal domain. Finally, MqsA binds both its own promoter and additional genes important for E. coli physiology. Taken together, our data provide fundamental new insights into the role of MqsR and MqsA in bacterial persistence and biofilms.Most bacteria live in biofilms, microbial communities that cause more than 80% of human infections. Biofilms have a genetically identical sub-population of dormant cells, named persister cells, which are the well-recognized source of antibiotic resistance. Recently, it was demonstrated that toxins are highly upregulated in persisters and have therefore been postulated to play a role in the persister state. Using an inter-disciplinary approach, we reveal how E. coli, the frequency of persisters in planktonic cultures is only about one in a million The emergence of increasing numbers of bacteria that are resistant to antibiotics portends a major public health crisis. One well-recognized but poorly understood mechanism used by bacteria to survive environmental stress is through the formation of persisters, a subpopulation of cells that survive prolonged exposure to antibiotics Recent studies have demonstrated that the persister state is correlated with the increased expression of chromosomal toxins from toxin:antitoxin (TA) genes E. colirelBEmazEFdinJ-yafQhipBAhicAByefM-yoeBrelE, mazF and yoeBmqsR (ygiU/b3022), a gene originally identified as one that encodes a regulator of motility, curli and quorum sensing and that influences biofilm development by mediating the response of the cell to autoinducer-2 To date, more than ten TA loci have been identified in mqsA (ygiT/b3021), the second gene in the two-gene mqsRA operon, is lethal mqsRA constitutes a novel TA module mqsRA has many characteristics that differ from canonical TA systems. First, in the mqsRA operon, mqsR precedes, instead of follows, mqsA. This unusual genetic organization has only been observed in two other recently characterized TA systems, that of higBAhicABhicABDeletion of bona fide TA pair that, because of the unique features of MqsA, define a novel family of TA modules. We show that MqsR is toxic and forms a tight complex with its antitoxin, MqsA, an interaction that mitigates MqsR toxicity. MqsA and the MqsR:MqsA complex also bind the promoters of the mqsRA operon and, unexpectedly, genes critical for E. coli physiology, including mcbR and spy. To the best of our knowledge, this is the first time a TA pair has been shown to bind and regulate promoters other than its own. The structure of MqsR reveals that it is a member of the RelE/YoeB family of bacterial RNase toxins. Based on its similarity with RelE, MqsR likely functions as a ribosome-dependent RNase. This suggests that MqsR is important for bacterial persistence via its ability to inhibit translation and, in turn, cell growth. MqsA itself is a two-domain protein with a novel fold that, unlike every other antitoxin, is well-ordered throughout its entire sequence and whose structure does not change upon toxin binding. It is also the first antitoxin known that binds metal, in this case zinc. These studies reveal the molecular mechanisms by which MqsR and MqsA mediate the cessation of cell growth and provide novel targets for the development of a new class of antibiotics that target TA pairs.In this paper, we employed a combination of biochemical and structural studies to show that MqsR, along with MqsA, are a 2:MqsR), as determined using size exclusion chromatography and cell viability. Expression of MqsR alone leads to cell growth arrest in multiple bacterial strains (BW25113 and MG1655), while co-expression of MqsR with full-length MqsA (referred to hereafter as MqsA-F) rescues the cell growth arrest phenotype . In additography and confr PmqsR; . It was classes . Taken t and spy .1, with two molecules in the asymmetric unit. The two monomers are identical in terms of the overall fold with well-ordered electron density throughout both chains. The final model contains 262 residues, and includes all 131 residues for each MqsA-F molecule.The structure of full-length MqsA of the 76 residues for MqsA-N and 97 residues (1–97) of the 98 residues for MqsR in the first complex and 59 residues of MqsA-N and 90 residues for MqsR in the second complex. X-ray diffraction data quality and refinement statistics are reported in The structure of the MqsR:MqsA-N complex was solvThe structure of the MqsA-F dimer is shown in MqsA-N binds zinc and adopts a novel, elongated fold . It is cThe interaction between the two, long twisted β-strands and the five turn α-helix of the MqsA zinc binding domain is stabilized by an extended hydrophobic core composed of 11 residues: Ile18, Tyr20, Phe22, Leu29, Ile32, Tyr36, Met45, Phe53, Val57, Phe60 and Val64 , they arMqsA-C, the helix-turn-helix (HTH) domain, is composed of five tightly packed α-helices , which b2 of solvent accessible surface area binds MqsR, we carried out two co-expression toxicity experiments using the same protocol as that used to produce the proteins for structural studies: 1) MqsR co-expressed with MqsA-N and 2) MqsR co-expressed with MqsA-C. When MqsR and MqsA-C are co-expressed, bacterial cell growth is arrested , and conmqsR promoter (PmqsR), as incubation of PmqsR with MqsA-C results in a shift in the electrophoretic mobility of the DNA and three α-helices, with α-helix 2 adjacent to and α-helices 1 and 3 abutting the backside of the β-sheet , both ofThe RelE-like fold is characterized by a central, antiparallel β-sheet and adjacent α-helix, which is conserved among the MqsR, YoeB and RelE bacterial toxins were K56A, Q68A, Y81A and K96A , S7B. Th2 of SASA while the secondary interface buries 479 Å2 of SASA. A total of 2016 Å2 of SASA is buried upon complex formation, or 17.7% of the total SASA, well within the range expected for biological interfaces. The primary interface is centered on MqsA β-strand 3 (Ser43-Met45), which interacts with MqsR β-strand 2 to form a single continuous β-sheet . Since the structure of the MqsA-N is invariant among all structures determined , we used the MqsA-F and MqsR:MqsA-N structures to generate an accurate model of the full MqsR:MqsA2:MqsR complex. As can be seen in 2:MqsR complex forms a highly extended structure with the MqsA-C domains located at the center of the complex and the MqsR toxins (magenta) bound at the periphery. In overall shape, the MqsR:MqsA2:MqsR complex is most similar to the MazF:MazE complex The MqsR:MqsA2:MqsR complex bind directly to the mqsR promoter , bind DNA via the same helix, the HTH-XRE DNA binding helix. In MqsA, the HTH-XRE DNA binding helix corresponds to α-helix 4 2:MqsR complex , and thus may be able to adopt a slightly different conformation when bound to DNA, it is highly unlikely that it could shift sufficiently to permit binding to unbent DNA.We generated a model of the MqsR:MqsA complex . As can promoter . Notably another may helpE. coli persister cells gamma- delta- and epsilon proteobacterial classes. This work has provided the first steps for understanding this novel, unique TA system at a molecular level and provides a basis for developing novel antibacterial therapies that target TA pairs.Taken together, the crystal structures of full-length MqsA and the MqsR:MqsA-N complex reveal that the MqsR:MqsA TA complex is the founding member of a novel family of TA pairs. It forms a dimer of dimers, in which DNA binding and MqsR recognition by MqsA are mediated via distinct, structured domains. Because MqsR is the gene most highly upregulated in E. coli strain BW25113 were conducted in LB medium at 37°C. Growth experiments were monitored using pBS(Kan)-based plasmids lac promoter, the fragments from genomic DNA were amplified by PCR . For the MqsR:MqsA-N complex, MqsR was subcloned into the pET28a vector (Novagen) which contains an N-terminal his6-tag with a thrombin cleavage site. MqsA-N was subcloned into the untagged pCA21a vector . The complex was co-expressed and purified by sequential his6-tag, thrombin cleavage, second subtraction his6-tag and SEC.Full-length MqsA , the MqsA N-terminal domain and the MqsA C-terminal domain were subcloned into a modified pET28a vector which contained an N-terminal his2, and 19% (w/v) PEG3350). Crystals of MqsR:MqsA-N were obtained using the sitting drop vapor diffusion method at 4°C. Crystals were grown by mixing 0.2 µL MqsR:MqsA-N protein complex with 0.4 µL of precipitant (0.1 M Bis-Tris pH 5.5 and 25% (w/v) PEG3350). MqsA-F and MqsR:MqsA-N crystals were cryoprotected in precipitant containing 20% glycerol and frozen in liquid nitrogen for data collection.Crystals of MqsA-F were obtained using the sitting drop vapor diffusion method at 4°C. Crystals were grown by mixing 0.2 µL of MqsA-F protein ethanol) with 0.2 µL of precipitant and sequence verified. Growth experiments were conducted in LB at 18°C and all mutants were tested in parallel. Briefly, 10 ml of an overnight culture was used to inoculate 1 L of LB and then incubated at 37°C with rigorous shaking. Once a mutant culture reached an ODThe P22 C2 repressor protein (PDBID 2R1J) The genes/proteins mentioned in the text include (UniProtKB/Swiss-prot ID unless stated otherwise): MqsR/YgiU (Q46865), MqsA/YgiT (Q46864), McbR (P76114), Spy (P77754), RelE (P0C077), RelB (P0C079), MazE (P0AE72), MazF (P0AE70), DinJ (Q8X7Q6), YaFQ (Q47149), HipA (P23874), HipB (P23873), HicA (P76106), HicB (P67697), YefM (P69346), YoeB (P69348), HigA (Q9KMG4/Q9KMA5), HigB (Q9KMG5/Q9KMA6). The PDB files mentioned in the text are RelE (PDBID 2KC8), YoeB (PDBID 2A6Q) and RNase Sa (PDBID 1RSN).The structure factors and coordinates for MqsA-F and the MqsR:MqsA-N complex have been deposited with the Protein Databank with accession numbers 3GN5 and 3HI2, respectively.Figure S1E. coli strain MG1655 (A–C) and BW25113 containing pBS(Kan) , pBS(Kan)-mqsA-F (open circle), pBS(Kan)-mqsR (black triangle) and pBS(Kan)-mqsR-mqsA-F (open triangle) at 37°C in LB with 1 mM IPTG induction upon inoculation (incubation time  = 0 min). Electrophoretic mobility shift assay controls that show both MqsR:MqsA-F (F) and MqsA-F (G) do not bind the PtomB DNA probe, which was used as a non-specific competitive control for the EMSA assays shown in MqsR and MqsA are a Toxin:Antitoxin Pair. The effect of MqsR, MqsA-F and the MqsR:MqsA-F complex on cell growth , cell viability (CFU/ml) and colony formation (C) for (1.25 MB TIF)Click here for additional data file.Figure S21–131 (14.9 kDa), while the proteolytic fragments are denoted with *. The trypsin digested samples analyzed by MALDI-TOF MS and LC-MS/MS are boxed. Proteolytic digestion of a stable, folded domain (SPAR PDZ domain) and an intrinsically unstructured protein (DARPP-32) are shown on the right for comparison.MqsA is Susceptible to Proteolytic Degradation. SDS-PAGE analysis of MqsA-F incubated with chymotrypsin, trypsin or proteinase K for 5, 15, 30 and 60 minutes at 30°C. The upper band indicated with an arrow corresponds to undigested MqsA(0.82 MB TIF)Click here for additional data file.Figure S3MqsR and MqsA are conserved among multiple bacterial species. Sequence alignment of MqsR (A) and MqsA (B). Secondary structural elements for MqsR and MqsA are represented as cylinders (α-helices) or arrows (β-strands) and shaded according to the protein/domain to which they belong . Identical residues are highlighted in cyan whereas similar residues are shaded in gray; symbols below the sequence: ‘*’ identical residues; ‘:’ highly similar residues; ‘.’ similar residues.(1.59 MB TIF)Click here for additional data file.Figure S4Constructs used in this study. MqsA residues 62–76 represent the ‘linker’ between the two domains of MqsA. Subsequent structure determination demonstrates that the physical linker between the MqsA N- and C-terminal domains is short, centered on residue T68.(0.20 MB TIF)Click here for additional data file.Figure S5Crystal Structures of the Individual MqsA Domains and their Independent Rotation in the MqsA dimer.(A) Ribbon model of MqsA-N. Bound zinc is illustrated as a teal sphere. (B) Ribbon model of MqsA-C. α-helix 4, which is predicted to mediate DNA binding, is shaded in green. (C) The N- and C-terminal domains of MqsA rotate independently via the short flexible linker. Both monomers of MqsA were superimposed on the MqsA-C domains to illustrate the relative rotation of the MqsA-N domains , resulting in a shift of the bound zinc ions by 18 Å.(1.46 MB TIF)Click here for additional data file.Figure S6oF-dcF map at 1.5 σ. MqsA in green, zinc ion in teal. (B) Stick representation of a portion of the MqsR:MqsA secondary interface (MqsR residues T59-Q68 in blue and MqsA residues K2-H7 in green) with σA-weighted 2moF-dcF map at 1.5 σ.Stereoimages of MqsA and MqsR. (A) Stick representation of the MqsA zinc binding pocket (residues K2-M11 and C37-E42) with σA-weighted 2m(2.08 MB TIF)Click here for additional data file.Figure S7Semi-log plots of MqsR toxicity assays illustrated in (0.39 MB TIF)Click here for additional data file.Protocol S1Supporting Protocols and References.(0.07 MB PDF)Click here for additional data file.Table S1Bacterial strains and plasmids used in this study.(0.05 MB PDF)Click here for additional data file.Table S2Oligonucleotides used for this study.(0.02 MB PDF)Click here for additional data file.Table S3Data collection and refinement statistics for MqsA-N.(0.05 MB PDF)Click here for additional data file.Table S4Data collection and refinement statistics for MqsA-C.(0.05 MB PDF)Click here for additional data file.

All hospital-treated cases of Burkitt's lymphoma (BL), with onset of symptoms in the period 1963-68 and resident in the Lango and Acholi districts of Uganda, were identified. The average annual incidence of BL in the 6-year period was 1-87 X 10(-5), similar to that in the adjacent West Nile district. Contrary to findings in other areas of Uganda, there was no evidence of seasonal variation in the onset of cases, nor of space-time clustering, nor of a decline in the incidence of BL in the study period. An inverse relationship was noted between the median age at onset of BL and the incidence of the disease in different areas of Uganda, a finding consistent with intense malarial infection being a precipitating factor for BL. The variable observations with respect to space-time clustering of BL and seasonal variation in incidence in different areas remains unexplained, but it is suggested that a closer study of the patterns of malarial infection in these areas may help to account for the findings.

RPGR) ORF15 in a large Chinese family with X-linked recessive retinitis pigmentosa and describe the phenotype in affected male and female carriers.To screen the mutation in the retinitis pigmentosa GTPase regulator phenotype in male-affected individuals, with some variability in the age of onset of night blindness and visual acuity, but was recessive in female carriers without an RP phenotype. However, the state associated with the carrier was moderate to high myopia with the refractive error ranging from −5.00 D to 22.00 D in 14 female carriers.Mutation screening demonstrated a novel mutation RPGR ORF15 causes a serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing X-linked RP and expands phenotypic spectrum of the disease in a Chinese family. This finding will be useful for further genetic consultations and genetic diagnosis.This novel mutation in The prevalence of RP was estimated to be one out of 4,000–5,000 individuals in Western countries [Retinitis pigmentosa and the RP2 (OMIM 312600) genes [RPGR and up to 20% in RP2 [Inheritance can be autosomal dominant, autosomal recessive, X linked, or in the rare cases taken as a digenic trait. However, in the majority of cases (about 50%–60% in Caucasians) it is impossible to establish the pattern of inheritance, and these cases are defined as “sporadic” . The X-l0) genes . In totaRPGR gene is located on chromosome Xp21.1 with 23 exons, including the tissue-specific alternatively spliced exons 9a, open reading frame 15 (ORF15), 15a, and 15b [RPGR gene has 23 exons, reports have indicated that pathogenic mutations cluster in exon ORF15 [RPGR can lead to significantly different clinical phenotypes.The and 15b –13. The and 15b . Althougon ORF15 . These mon ORF15 –23. It rORF15 mutation analysis, as proposed by Neidhardt and coworkers [The aim of this study was to screen the mutation in a large Chinese family with a possible XL inheritance pattern and to characterize the phenotypic manifestation associated with the mutation. The screening strategy for molecular genetics testing of XLRP cases is by direct sequencing and beginning with the screening of an XLRP male patient by oworkers .A family with a possible XL inheritance pattern was recruited at the Department of Ophthalmology in the People’s Hospital of the Ningxia Hui Autonomous Region from August 2007 to February 2009. There are 82 family members in the pedigree, and 77 members were successfully recruited. There were 41 males and 36 females and the age ranged from 4.5 to 76 years. All of them were healthy without other disease except three with hypertension. They received complete ophthalmic examinations, including routine ophthalmic examinations, Octopus perimetry, electroretinography (ERG), and color fundus photography. The individuals were diagnosed with nonsyndromic RP if they had a typical clinical history and features of RP, such as night blindness, decreased visual fields, and bone spicule pigmentation on fundus examinations. Syndromic RP, such as Usher’s syndrome, Leber congenital amaurosis, and Bardet–Biedl syndrome, were excluded. Control subjects included 80 healthy subjects who had undergone detailed ocular examinations and were confirmed to be free of RP and other major eye diseases.Written informed consents were obtained from all subjects and controls. The study protocol was approved by the Ethics Committee on Human Research, the People Hospital of Ningxia Hui Autonomous Region. All procedures in this study were performed in accordance with the Declaration of Helsinki.Peripheral blood was obtained from 77 family members and 80 normal subjects. The blood were drawn with EDTA tubes and then stored at −20 °C in refrigerator for 1 to 7 days before processing. Genomic DNA was extracted using the QIAamp DNA Blood kit , according to the manufacturer’s instructions.ORF15 of the RPGR gene sequence from GenBank sequences in the Ensembl database. Detected sequence variants in the DNA sample were confirmed by bidirectional sequencing on another stock DNA sample.From the 200 µl input volume of EDTA-whole blood sample, a final 200 µl extracted volume was obtained. The steps were as follows: Samples were lysed and heated in the orbital shaker. Each lysate was transferred to a spin column in a rotor adaptor and if the lysate needed to be homogenized or cleared, it was transferred to the middle position of the rotor adaptor. Nucleic acids were bound to the silica membranes or purification resins of the spin column and washed to remove contaminants. The spin column was transferred to a collection tube for elution of purified nucleic acids. Four pairs of primers were designed according to the published exon There are 82 family members in the pedigree, including five individuals who have passed away. Eight affected males were diagnosed by ophthalmic exam. A six-generation pedigree was compiled and revealed X-linked recessive inheritance . Eight aThe clinical data of eight affected males are summarized in The clinical data of 14 female carriers are summarized in The proband’s uncle (IV:8), who had severe RP and mild myopia, has three daughters, all of whom were heterozygotous carriers and exhibited moderate to high myopia. One daughter, aged 23 wearing glasses right (R) −18.00 D, left (L) −22.00 D, had 20/30 and 20/60 central vision in both eyes. Deteriorated central visual acuity was noted at age 9 due to high myopia. A fundus examination revealed the retinal and optic disc changes that were consistent with high myopia. No spicule formations were observed in the peripheral fundi. ERG scotopic amplitudes were 75% of the normal, and photopic amplitudes were 90% of the normal. One of her older carrier sisters, wearing glasses R −15.00 D, L −12.00 D, had 20/50 and 20/40 central vision with the same retinal change as mentioned above. The other older carrier sister, wearing R −5.50 D, L −6.75 D, showed normal central vision and a normal retinal appearance. Among 22 females without the mutation, 20 had a median of refractive error of –2.50 D and two were found to have high myopia with a refractive error ranging from −6.25 D to 8.75 D.RPGR ORF15 were identified, including one novel deletion change (rs12687163) and I559V (rs12688514) are common single nucleotide polymorphisms (SNPs) registered in the dbSNP database.Among the 77 family members and 80 control subjects, a total of three sequence changes in the n change . One varORF15 SNPs were found not only in patients but also in normal family members and control individuals and could be excluded as disease-causing mutations.Among the ORF15+577_578delAG, in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa and documented the clinical manifestations. Our review of the phenotypes by genotype analysis showed that there is significant intrafamilial variability in the XLRP phenotype. Moderate to high myopia is a particular feature for female carriers in this pedigree. This feature may be the most reliable guide to the female carrier status in XLRP, its presence implying a mutation in the RPGR gene. Our finding expands the spectrum of RPGR mutations causing XLRP and the phenotypic spectrum of the disease in a Chinese family, and will be useful for additional genetic consultation and genetic diagnosis. Further investigations will identify and characterize the possible genetic modifiers that determine the clinical outcome of RPGR mutations in female carriers.In conclusion, we identified a novel mutation,

The imidazolium ring is rotated by 48.81 (17)° with respect to the benzene ring. The packing is dominated by layers established by O—H⋯I, C—H⋯I and C—H⋯O contacts and propagating along the bc plane.In the title compound, [Fe(C DOI: 10.1107/S1600536809051216/ng2694Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

To replicate, lentiviruses such as HIV must integrate DNA copies of their RNA genomes into host cell chromosomes. Lentiviral integration is favored in active transcription units, which allows efficient viral gene expression after integration, but the mechanisms directing integration targeting are incompletely understood. A cellular protein, PSIP1/LEDGF/p75, binds tightly to the lentiviral-encoded integrase protein (IN), and has been reported to be important for HIV infectivity and integration targeting.PSIP1/LEDGF/p75 locus. Infections with vectors derived from equine infections anemia virus (EIAV) and HIV were compared. Integration acceptor sites were analyzed by DNA bar coding and pyrosequencing.Here we report studies of lentiviral integration targeting in 1) human cells with intensified RNAi knockdowns of PSIP1/LEDGF/p75, and 2) murine cells with homozygous gene trap mutations in the PSIP1/LEDGF/p75 expression.In both PSIP1/LEDGF/p75-depleted cell lines, reductions were seen in lentiviral infectivity compared to controls. For the human cells, integration was reduced in transcription units in the knockdowns, and this reduction was greater than in our previous studies of human cells less completely depleted for PSIP1/LEDGF/p75. For the homozygous mutant mouse cells, similar reductions in integration in transcription units were seen, paralleling a previous study of a different mutant mouse line. Integration did not become random, however–integration in transcription units in both cell types was still favored, though to a reduced degree. New trends also appeared, including favored integration near CpG islands. In addition, we carried out a bioinformatic study of 15 HIV integration site data sets in different cell types, which showed that the frequency of integration in transcription units was correlated with the cell-type specific levels of Early steps of retroviral replication involve reverse transcription to generate a DNA copy of the viral RNA genome, and integration, which results in the covalent connection of the viral DNA to host cell DNA cells, amplification of correct LEDGF/p75 message was sporadically detected at high PCR cycle numbers, suggesting that rare correctly spliced messages were formed. However, quantification of correct message formation using SyberGreen quantitative PCR showed expression of LEDGF/p75 to be below the limit of detection in the −/− cells, corresponding to a reduction of at least 32-fold compared to the wild type (+/+) cells (unpublished data). Sutherland and coworkers reported LEDGF/p75 protein to be undetectable We also compared lentiviral infection in murine cells containing the gene trap disruption of LEDGF/p75 −/− MEFs isolated from embryos of +/+ and homozygous mutant −/− mice after infection with HIV and EIAV. Integration was measured by infecting cells, maintaining the cells in culture for two weeks to allow loss of unintegrated DNA −/− MEFs , and EIALEDGF/p75.Below we first describe studies of EIAV integration targeting in the SupT1 cells with intensified RNAi knockdowns, then HIV and EIAV targeting in the mouse cells disrupted at For each of our studies, we used the pyrosequencing technology commercialized by 454 Life Sciences Use of DNA bar coding allowed multiple integration site populations to be studied in parallel in vitroThe EIAV vector was used to infect SupT1 cells with intensified RNAi against LEDGF/p75 and compared to controls consisting of either SupT1 cells with a scrambled shRNA (SCRAM) or untreated SupT1 cells. Integration sites were sequenced and placed on the hg18 draft human genome sequence. As a first step in the analysis, the favored target DNA sequences at the point of integration were compared in the presence and absence of LEDGF/p75. Alignment of target DNA sequences at integration sites has revealed weak inverted repeat consensus sequences EIAV has been reported to favor integration in an A/T rich palindromic consensus sequence The genomic distribution of EIAV integration sites was then compared in the presence and absence of LEDGF/p75 . IntegraThree catalogs of human gene annotation were used to analyze EIAV integration site distributions, since LEDGF/p75 had previously been implicated in directing HIV integration to transcription units. From 60 to 69% of EIAV integration sites were in genes , while aIn some data sets integration by lentiviruses has been found to be disfavored near CpG islands CpG islands are often associated with transcription start sites. Analysis of integration frequency showed a trend toward more frequent integration near transcription start sites in the knockdown (6% in pooled SupT1 controls versus 10% in the knockdown) though the trend did not achieve significance with this sample size (P = 0.083 by the Fisher's exact test).In the previous study of weaker LEDGF/p75-knockdowns One of the main questions at the start of this study was whether a stronger knockdown of LEDGF/p75 would result in stronger effects on lentivirus integration targeting. Integration frequency at some of the genomic features studied was not detectably affected by the LEDGF/p75 knockdown. For example, when integration frequency was assessed relative to gene density, no strong effect was seen . SimilarLEDGF/p75 homozygous gene trap (−/−) and control (+/+) mice We analyzed integration sites in murine embryonic fibroblasts (MEFs) derived from the Integration site sequences were aligned to determine the consensus palindromic sequence at the point of integration, and results were compared for the +/+ and −/− MEFs for each virus . In bothGenome-wide studies of EIAV integration targeting in murine cells are presented in this section and analysis of HIV integration in murine cells is described in the next section. Extensive further analysis of EIAV and HIV integration in MEFs is presented in Statistical LEDGF/p75 gene trap cells compared with wild-type. In wild-type cells, 58.6% of experimental integration sites were in RefSeq genes . We analyzed data from 15 HIV integration site data sets for which we also had transcriptional profiling data on gene activity for that cell type. For each microarray data set, the expression level of ell type . This anLEDGF/p75 mRNA levels (P = 0.044). These data indicate that natural variation in LEDGF/p75 expression levels is a significant determinant of integration frequency in transcription units in human primary cells.Some of the data in LEDGF/p75 locus LEDGF/p75 mutant Here we report studies of lentiviral integration in two cell types with strong depletions of LEDGF/p75. In the first, we studied the SupT1 human T-cell line with intensified RNAi against LEDGF/p75 described in LEDGF/p75 expression correlated with higher frequencies of integration in transcription units. The trend achieved significance even when the analysis was restricted to human primary cells only. Thus the study of natural variation in LEDGF/p75 expression allowed us to extend the idea that LEDGF/p75 directs HIV integration to transcription units in human primary cells without artificially reduced LEDGF/p75 levels.Published studies of integration targeting by LEDGF/p75 have relied on analysis of cells where the LEDGF/p75 levels were artificially reduced—thus there is interest in obtaining data on the effects of LEDGF/p75 in cells naturally expressing different levels of the protein. We took advantage of the observation that different cell types differ reproducibly in their frequency of integration in transcription units in vitro with fusions of the LEDGF/p75 IBD to a sequence-specific binding domain support this model A simple model holds that LEDGF/p75 directs favored integration into transcription units by tethering. According to this model, one domain of LEDGF/p75 binds to HIV preintegration complexes and the other binds chromatin at active transcription units. Data from artificial tethering studies Curiously, both this study and Shun et al. Finally, data presented here and in 4 cells/ml MEFs were extracted from wild-type and knockout embryos at 13.5 dpc TC2 and TL2 are control (“scramble” sequence) and active shRNA-expressing SupT1 cell lines derived in parallel by intensified RNAi. They were established simultaneously from the same parental population, using equivalent MOI transduction with lentiviral vectors that differed only in the 19 nt of the shRNA VSV-G pseudotyped HIV vector particles were produced by Lipofectamine transfection of 293T cells with p156RRLsin-PPTCMVGFPWPRE 5 cells per well of a 24-well plate, infected with between 25–100 µl concentrated DNase I treated virus stock, and all wells were brought to 200 µl final volume with fresh RPMI containing 10% heat-inactivated FBS, 10 units/ml penicillin, 10 µg/ml streptomycin and 50 µg/ml gentamycin (R-10). At 5 hours all well contents were transferred to a 1.5 ml Eppendorf and spun for 10 min at 1000RPMs to pellet cells. Cells were resuspended in 1 ml R-10 and cultured for an additional 76 hrs for integration site cloning or 2 weeks for QPCR analysis. Upon collection, 30–50% of cells expressed GFP as analyzed by fluorescence microscopy.For EIAV infection of SupT1 cells, cells were plated at 1×105 cells per well and each well infected with 1 µg p24. For EIAV, cells were plated into 24-well plates at a density of 4×104 cells per well, and each well infected with 100 µl concentrated virus. Infections were performed overnight in the presence of 10 µg/ml DEAE-dextran. 10 independent HIV infections and 5 EIAV infections were performed per genotype. 48 hours after infection, 90% of cells were harvested for integration site cloning and the remainder passaged for an additional 2 weeks to dilute unintegrated products of reverse transcription and used for QPCR analysis of integration efficiency.For HIV infection of MEFs, cells were plated onto 6-well plates at a density of 3×10For quantitative PCR analysis, infected cells were passaged for 2 weeks following infection to dilute unintegrated products of reverse transcription, then genomic DNA was extracted using the Qiagen DNeasy tissue extraction kit. QPCR using HIV late-RT primers and probe was carried out as described in 5 cells per well of a 24-well plate were infected with various amounts of concentrated DNase treated virus stock. All wells were brought to 1 ml final volume with fresh R-10. Three days later, cells were lysed in 0.5% Triton-X 100 in PBS and luciferase levels were determined using Luciferase Assay System and a Thermo Luminoskan Ascent luminescence counter. All infections were performed in triplicate.For luciferase assays, HIV luciferase reporter virus stock was prepared by transfection of pLai3_envLuc2 Integration sites were isolated and sequenced by linker-mediated PCR essentially as described previously Integration sites were judged to be authentic if the sequences had a best unique hit when aligned to the murine or human genome as appropriate (mm8 and hg18 respectively) using BLAT, and the alignment began within 3bp of the viral LTR end and had >98% sequence identity. Detailed statistical methods are described in To control for possible biases in isolating integration sites due to restriction enzyme sequence distribution, three-ten matched random controls were computationally generated for each experimental integration site that were the same distance from the closest MseI restriction site as the experimental site.Integration site counts in various genomic annotations were compared with matched random controls by the Fisher's exact test. Additionally, multiple regression models for integration intensity were applied, as described in For analysis of correlations with gene activity in murine integration sites and 8, tLEDGF/p75 but not p52 were available on each chip . To account for differences in the sensitivities arising from the different chip designs and probe sets, the values for each cell type were first ranked for each probe set and chip combination, then the ranked values pooled in the final data set.For the analysis of relative gene activity in Table S1Oligonucleotides used in this study(0.01 MB XLS)Click here for additional data file.Statistical Report S1EIAV integration in human cells(0.35 MB PDF)Click here for additional data file.Statistical Report S2EIAV and HIV integration in murine cells(1.44 MB PDF)Click here for additional data file.

This report reviews 48 patients who from 1979 to 1994 were treated at the Norwegian Radium Hospital for newly diagnosed noncerebral extragonadal malignant germ cell tumour (EGGCT). Based on histology and/or serum tumour markers, 12 patients had a seminoma and 36 a non-seminoma. At diagnosis, 33 and 15 patients were classified as having abdominal and mediastinal EGGCT respectively. At the time of diagnosis 13 patients, all with non-seminomatous tumours, had metastases to bone, liver or brain. One patient with abdominal seminoma was cured by radiotherapy alone, whereas cisplatin-based chemotherapy (with or without surgery) was planned in the 47 remaining patients. Twenty-seven out of 42 patients receiving four or more chemotherapy cycles were rendered tumour free by induction chemotherapy, including 5 of the 13 patients with extralymphatic non-pulmonal disease. An additional tumour-free patient died of septicaemia after only two cycles of chemotherapy. Late relapses (after > 2 years) were observed in three patients, and a testicular primary was diagnosed during follow-up in three cases. Seven patients died of treatment-related complications, five of these because of neutropenic septicaemia. The median age of these patients was 52 years compared with 35 years in the remaining 41 patients (P < 0.05). The 5-year overall survival for all 48 patients was 60% (95% CI 46-74%) [cancer-specific 5-year survival 71% (95% CI 50-92%)]. EGGCT is a potentially curable disease, even in patients with very advanced disease. Special attention should, however, be devoted to patients above the age of 40 years because of an increased risk of treatment-related side-effects. Late relapses and the subsequent development of testicular tumours indicate the need for long-term follow-up.

Following the publication of our article we noticThe table should therefore appear as shown in Table

Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE).We studied 2164 clinically stable COPD patients, 337 smokers with normal lung function and 245 never smokers. In these individuals, we measured clinical parameters, nutritional status, spirometry, exercise tolerance, and amount of emphysema by computed tomography.COPD patients were slightly older than controls and had more pack years of smoking than smokers with normal lung function. Co-morbidities were more prevalent in COPD patients than in controls, and occurred to the same extent irrespective of the GOLD stage. The severity of airflow limitation in COPD patients was poorly related to the degree of breathlessness, health status, presence of co-morbidity, exercise capacity and number of exacerbations reported in the year before the study. The distribution of these variables within each GOLD stage was wide. Even in subjects with severe airflow obstruction, a substantial proportion did not report symptoms, exacerbations or exercise limitation. The amount of emphysema increased with GOLD severity. The prevalence of bronchiectasis was low (4%) but also increased with GOLD stage. Some gender differences were also identified.The clinical manifestations of COPD are highly variable and the degree of airflow limitation does not capture the heterogeneity of the disease. Chronic obstructive pulmonary disease (COPD) is defined by the presence of poorly reversible airflow limitation . Yet, CO(1) to characterise the heterogeneity of COPD as a whole (vs. controls); (2) to explore the relationships (or lack of them) of the main clinical, functional and radiological characteristics of the disease; (3) to investigate the level of heterogeneity within each stage of disease severity, using either the classification proposed by Global initiative for chronic Obstructive Lung Disease (GOLD), which is based upon the degree of airflow limitation [1 at predicting the risk of death from any cause and from respiratory causes among COPD patients [(4) because the prevalence of COPD in women is increasing [Evaluation of COPD Longitudinally to Identify Predictive Surrogate Endpoints (ECLIPSE) is a large observational study of COPD patients and controls conducted at 46 centres in 12 countries aimed at defining COPD phenotypes and identifying biomarkers and/or genetic parameters that help to predict disease progression [patients ; and, fiThe study design of ECLIPSE has been published previously [1 over 3 years . The sizes of the control groups were based on both the ability to detect a difference of at least 16.5 mL/year rate of decline in FEV1 between COPD patients and controls, and to detect a 50% increase in exposure (required 5-7 COPD patients per control) for any diagnostic test. Based upon these calculations, we studied 2164 patients with COPD (GOLD stage 2-4), 337 smoking controls and 245 non-smoking controls Male/female subjects aged 40-75 years; (2) Baseline post-bronchodilator FEV1 < 80% of the reference value and FEV1/FVC ≤0.7; and, (3) Current or ex-smokers with a smoking history of ≥10 pack-years. Smoker controls: (1) Male/female subjects aged 40-75 years, who are free from significant disease as determined by history, physical examination and screening investigations; (2) Baseline post-bronchodilator FEV1 > 85% of the reference value and FEV1/FVC > 0.7; and, (3) Current or ex-smokers with a smoking history ≥10 pack-years. Non smoking controls: (1) Male/female subjects aged 40-75 years, who are free from significant disease as determined by history, physical examination and screening investigations; (2) Baseline post-bronchodilator FEV1 > 85% of the reference value and FEV1/FVC > 0.7; and, (3) Smoking history of <1 pack-year. Besides, all participants: (4) signed and dated their written informed consent prior to participation ; and, (5) had to have the ability to comply with the requirements of the protocol and be available for study visits over 3 years. Key exclusion criteria were the presence of a respiratory disorder other than COPD, other significant inflammatory diseases or a reported COPD exacerbation within 4 weeks of enrolment [1 (panel D) in the three groups of individuals recruited into ECLIPSE by each of the 46 participating centres.Power calculation was based on precision of effect estimates in COPD subgroups for rate of decline in FEVThe American Thoracic Society (ATS) respiratory questionnaire, the modified Medical Research Questionnaire (mMRC) and the COPD-specific version of the St. George's Respiratory Questionnaire (SGRQ-C) were useAll subjects underwent a low-dose computed tomography (CT) scan of the chest acquired using multi-detector-row CT scanners with a minimum of 4 rows, obtained in supine position at suspended full inspiration without administration of intravenous contrast. Exposure settings were 120 kVp and 40 mAs and images were reconstructed using 1.0 mm (Siemens) or 1.25 mm (GE) contiguous slices and a low spatial frequency reconstruction algorithm . CT scanners were calibrated regularly using industry and institutional standards. All of the CT scans were evaluated at the central imaging unit at the University of British Columbia, Vancouver, Canada. Quantitative assessment of lung volumes and the percentage of lung CT voxels below a threshold of -950 Hounsfield Units as a representative of the presence of emphysema, was performed using the software Pulmonary Workstation 2.0 . Two radResults are shown as mean ± SD, frequency distribution or proportion, as appropriate. Because none of the continuous variables were normally distributed (Kolmogorov-Smirnov test), Kruskal-Wallis tests were used to analyze the statistical significance of differences between groups. Differences in categorical variables were assessed using Cochran-Mantel-Haenszel tests. Correlations between variables of interest were explored using Spearman's Rho; p values less than 0.05 (two sided) were considered significant.The study was sponsored by GlaxoSmithKline. A Steering Committee and a Scientific Committee comprising in total ten academics and six representatives of the sponsor developed the original study design and concept, the plan for the current analyses, approved the statistical plan, had full access to the data, and was responsible for decisions with regard to publication. The study sponsor did not place any restrictions with regard to statements made in the final paper.COPD patients were older than controls and had more pack years of smoking than smokers with normal lung function Table . BMI was1 reversibility decreased in more severe disease. By contrast, co-morbidities appeared to be independent of the degree of airflow limitation included, as well as their careful clinical and functional characterisation thus allowing the study of relationships between clinical, functional, and radiological variables. The size of ECLIPSE permits more accurate estimates of the variance observed in a number of key parameters used to assess COPD patients. While ECLIPSE is not a population-based sample, recruitment was very similar to that in other clinical trials and variability between centres was minor Figure . Thus, tet al using principal component analysis and cluster analysis in a cohort of COPD subjects recruited in a French multicentre study [In summary, our results help to better delineate the heterogeneity and complexity of COPD by describing the relationships (or lack thereof) between a number of important clinical, functional, and radiological domains of the disease. Of potential particular relevance is our finding that the current GOLD classification of disease severity, based upon the degree of airflow limitation, is a poor predictor of other features of COPD. This observation is in keeping with recent observations by Burgel re study . The clire study . The lonAA has received reimbursements, fees, or funding from GlaxoSmithKline, Almirall, AstraZeneca, Boheringer-Ingelheim, Roche, Nycomed, Novartis and Procter & Gamble; PMAC has received consulting fees from AstraZeneca, GlaxoSmithKline, Nycomed and Pfizer, speaking fees from GlaxoSmithKline and Nycomed; and grant support from Boehringer-Ingelheim and GlaxoSmithKline; BC has received grants to the pulmonary division he works in to complete research studies. From GlaxoSmithKline, Boehringer-Ingelheim, Forrest Medical, Astra Zeneca and Aeris; has served on advisory boards for GlaxoSmithKline, Boehringer-Ingelheim, Almirall, Astra Zeneca, Aeris and Deep Breeze; has received speaker fees from GlaxoSmithKline, Boehringer-Ingelheim, Astra Zeneca, Almirall and Esteve; Does not have shares or interest in any company. Neither does the family; Has not received tobacco money nor has stocks in any tobacco related companies; HOC has received an honorarium for serving on the steering committee for the ECLIPSE project for GlaxoSmithKline. In addition HC was the co-investigator on two multi-centre studies sponsored by GlaxoSmithKline and has received travel expenses to attend meetings related to the project. HC has three contract service agreements with GlaxoSmithKline to quantify the CT scans in subjects with COPD and a service agreement with Spiration Inc to measure changes in lung volume in subjects with severe emphysema HC is the co-investigator (D Sin PI) on a Canadian Institutes of Health - Industry (Wyeth) partnership grant. HC has received a fee for speaking at a conference and related travel expenses from AstraZeneca ; LDE is an employee of GlaxoSmithKline and hold stocks and stock options in GlaxoSmithKline; DAL has received grant funding, honoraria and travel expenses from GlaxoSmithKline and serves on the Respiratory CEDD Board of GlaxoSmithKline; WM has been reimbursed for travel by GlaxoSmithKline, Zambon, Astra Zeneca, Boehringer-Ingelheim, Pfizer and Micromet for attending conferences; has received honoraria from GlaxoSmithKline and AstraZeneca for participating as a speaker in scientific meetings; serves on advisory boards for GlaxoSmithKline, Pfizer, Almirall, Amgen, Bayer and Micromet; serves as a consultant for Pfizer and SMB Pharmaceuticals; BEM is an employee and shareholder of GlaxoSmithKline, the sponsor of ECLIPSE; SR has consulted or participated in advisory boards for: Able Associates, Adelphia Research, Almirall/Prescott, APT Pharma/Britnall, Aradigm, AstraZeneca, Boehringer-Ingelheim, Chiesi, CommonHealth, Consult Complete, COP Forum, DataMonitor, Decision Resources, Defined Health, Dey, Dunn Group, Eaton Associates, Equinox, Gerson, GlaxoSmithKline, Infomed, KOL Connection, M. Pankove, MedaCorp, MDRx Financial, Mpex, Novartis, Nycomed, Oriel Therapeutics, Otsuka, Pennside Partners, Pfizer (Varenicline), PharmaVentures, Pharmaxis, Price Waterhouse, Propagate, Pulmatrix, Reckner Associates, Recruiting Resources, Roche, Schlesinger Medical, Scimed, Sudler and Hennessey, TargeGen, Theravance, UBC, Uptake Medical, VantagePoint Management. SR has given lectures for: American Thoracic Society, Astra Zeneca, Boehringer-Ingelheim, California Allergy Society, Creative Educational Concept, France Foundation, Information TV, Network for Continuing Ed, Novartis, Pfizer, SOMA. SR has received industry-sponsored grants from: Astra Zeneca, Biomarck, Centocor, Mpex, Nabi, Novartis, Otsuka; EKS has received grant support and consulting fees from GlaxoSmithKline for studies of COPD genetics and honoraria and consulting fees from Astra Zeneca; RT-S is an employee and shareholder of GlaxoSmithKline, the sponsor of ECLIPSE; EW serves on an advisory board for Nycomed; has received lecture fees from GlaxoSmithKline, Astra Zeneca and Novartis; has received research grants from GlaxoSmithKline and Astra Zeneca; JCY is an employee and shareholder of GlaxoSmithKline, the sponsor of ECLIPSE; JV has received fees for advising and/or presenting from GlaxoSmithKline, Astra Zeneca, Pfizer, Boehringer-Ingelheim, Nycomed, Hofmann - la Roche, Talecris, Kamada and Sounds Biotech; has received research support from GlaxoSmithKline.The authors developed the design and concept of the study, approved the statistical plan, had full access to and interpreted the data, wrote the article, read and approved the final manuscript and were responsible for decisions with regard to publication.AA was a study investigator, developed the study protocol, served on the scientific committee, interpreted study data, developed the first draft of the manuscript, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; PMAC developed the study protocol, served on the scientific committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; BC was a study investigator, developed the study protocol, served on the scientific committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; HOC developed the study protocol, served on the steering committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; LDE developed the study protocol, served on the steering committee, performed statistical analysis and interpreted data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; DAL developed the study protocol, served on the steering committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript. WM was a study investigator, developed the study protocol, served on the steering and scientific (Chair) committees, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; BEM interpreted data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; SR was a study investigator, developed the study protocol, served on the scientific committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; EKS was a study investigator, developed the study protocol, served on the steering committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; RTS developed the study protocol, served on the steering and scientific committees, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; EW served on the scientific committee, developed the study protocol interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript; JCY developed the study protocol, served on the steering and scientific committees, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript. JV was a study investigator, developed the study protocol, served on the steering committee, interpreted study data, contributed to and reviewed drafts of the manuscript, and approved the final version of the manuscript.The study sponsor (GlaxoSmithKline) did not place any restrictions with regard to statements made in the final version of the article.PRINCIPAL INVESTIGATORS AND CENTRES PARTICIPATING IN ECLIPSE Bulgaria: Y Ivanov, Pleven; K Kostov, Sofia. Canada: J Bourbeau, Montreal; M Fitzgerald, Vancouver; P Hernández, Halifax; K Killian, Hamilton; R Levy, Vancouver; F Maltais, Montreal; D O'Donnell, Kingston. Czech Republic: J Krepelka, Praha. Denmark: J Vestbo, Hvidovre. The Netherlands: E Wouters, Horn. New Zealand: D Quinn, Wellington. Norway: P Bakke, Bergen, Slovenia: M Kosnik, Golnik. Spain: A Agusti, Jaume Sauleda, Palma de Mallorca. Ukraine: Y Feschenko, Kiev; V Gavrisyuk, Kiev; L Yashina, W MacNee, Edinburgh; D Singh, Manchester; J Wedzicha, London. USA: A Anzueto, San Antonio, TX; S Braman, Providence. RI; R Casaburi, Torrance CA; B Celli, Boston, MA; G Giessel, Richmond, VA; M Gotfried, Phoenix, AZ; G Greenwald, Rancho Mirage, CA; N Hanania, Houston, TX; D Mahler, Lebanon, NH; B Make, Denver, CO; S Rennard, Omaha, NE; C Rochester, New Haven, CT; P Scanlon, Rochester, MN; D Schuller, Omaha, NE; F Sciurba, Pittsburg, PA; A Sharafkhaneh, Houston, TX; T Siler, St Charles, MO; E Silverman, Boston, MA; A Wanner, Miami, FL; R Wise, Baltimore, MD; R ZuWallack, Hartford, CT.Steering Committee: H Coxson (Canada), C Crim , L Edwards , D Lomas (UK), W MacNee (UK), E Silverman (USA), R Tal-Singer , J Vestbo , J Yates .Scientific Committee: A Agusti (Spain), P Calverley (UK), B Celli (USA), C Crim , B Miller, W MacNee , S Rennard (USA), R Tal-Singer , E Wouters (The Netherlands), J Yates .

Currently, 3D cone-beam CT image reconstruction speed is still a severe limitation for clinical application. The computational power of modern graphics processing units (GPUs) has been harnessed to provide impressive acceleration of 3D volume image reconstruction. For extra large data volume exceeding the physical graphic memory of GPU, a straightforward compromise is to divide data volume into blocks. Different from the conventional Octree partition method, a new partition scheme is proposed in this paper. This method divides both projection data and reconstructed image volume into subsets according to geometric symmetries in circular cone-beam projection layout, and a fast reconstruction for large data volume can be implemented by packing the subsets of projection data into the RGBA channels of GPU, performing the reconstruction chunk by chunk and combining the individual results in the end. The method is evaluated by reconstructing 3D images from computer-simulation data and real micro-CT data. Our results indicate that the GPU implementation can maintain original precision and speed up the reconstruction process by 110–120 times for circular cone-beam scan, as compared to traditional CPU implementation. The gigabyte data size is huge even for a graphic workstation. Currently, image reconstruction speed is still a bottleneck for the development of 3D cone-beam CT. The study of fast and efficient reconstruction algorithms for large volume image and their implementation on hardware or software will have important significance both theoretically and practically [Computed Tomography (CT) has become one of the most popular diagnostic modalities since its invention thirty years ago. Compared with 2D parallel-beam and fan-beam CT, 3D cone-beam CT system is able to achieve higher special resolution and better utilization of photons . With th The Graphics Processing Unit (GPU) can process volume data in parallel when working in single instruction multiple data (SIMD) mode . Because3. Muller and Xu have studied the CT image reconstruction for large volume data [ Back to 1990s, only high-end workstations, such as the SGI Octane or Onyx, had the level of graphics hardware necessary for CT image reconstruction. Cabral et al. were the first to employ this hardware for the acceleration of CT reconstruction . With thume data . They di This paper is organized as follows. In O(N4) in the spatial domain and constitutes the bottleneck for all software solutions [The filtered back-projection algorithm proposed by Feldkamp, Davis and Kress (FDK) for 3D volume reconstruction from circular cone-beam projections still remains one of the most widely used approach . In thisolutions . So hereYv perpendicularly aligned along Yv axis. The key for the GPU-accelerated backward-projection is to calculate the projection positions of the vertices of every slice on the X-ray detector of cone-beam CT system. If the projection positions of the four vertices of a slice on the X-ray detector are produced, we can generate the projection coordinate of each voxel of the slice by interpolating the coordinates of the vertices in GPU rasterizer, and achieve the backward-projection from a projection image to the slice in GPU fragment shader. v1, v2, v3, and v4, whose projection positions in detector space are p1, p2, p3, and p4, respectively. According to projective-texture mapping theory [ Here is our detailed algorithm for backward-projecting a projection image to a volume slice based on GPU. As shown in g theory , 15, we g theory , formulav = T. A 4 × 4 rotation matrix R rotates the volume coordinate system by φ degrees in counter-clockwise direction. Another 4 × 4 translation matrix T translates the volume coordinate system a distance of d along the negative axis. The two matrices R and T jointly map the vertex coordinate v from volume coordinate system (Xv − Yv − Zv) into source coordinate system (Xs − Ys − Zs). A 4 × 4 perspective projection matrix P, determined by the source location and the detector dimensions w and h, defines a frustum for cone-beam projection. The parameters n and f of the matrix P denote the distances from x-ray source to the near and far clipping planes of the frustum, respectively. The matrix P implements the subsequent perspective projection that maps the frustum into a cube clip space, whose Cartesian coordinates are between −1 and 1. Then a texture coordinate conversion matrix E, defined by the horizontal and vertical numbers of detector units, produces the homogeneous coordinates vp in detector space for the vertex v. In formula , the coop1, p2, p3, and p4 in detector space are obtained. Then the fragments corresponding to the voxels of slice are generated in orthographic viewing mode in GPU rasterizer, and the texture homogeneous coordinate of each fragment is produced by the linear interpolation of the texture homogeneous coordinates of p1, p2, p3, and p4. To compensate for the perspective distortion effects, the texture coordinate of each fragment is divided by its 4th component pw to derive correct coordinate in the fragment shader of GPU. At last, these texture coordinates are used to sample the projection image of this projection view, and the obtained sample values are accumulated into the corresponding voxels of the output texture representing the slice. These calculations finish the backward-projection to the slice from one projection view. Note that the sample positions usually do not coincide with the detector units, the final values of the sample positions are produced by nearest-neighbor interpolation or bilinear interpolation. By implementing the calculation of formula in SIMD The above procedure is executed repeatedly until every volume slice is processed from every projection view, thus the entire reconstructed volume is updated.S1 and the voxel position v1 can be replicated by rotating it across 90°, 180°, and 270° intervals respectively to produce the other three pairs of , , and . This means that they share the same geometric relation in projection layout. The backward-projection can be significantly speeded up by the utilization of rotational symmetry, since the geometry transform matrix described in formula of a 2D-texture ProjTex, one projection image per channel.Arrange the projection images in the four rotational symmetric views of SliceTex1, SliceTex2, SliceTex3 and SliceTex4 to save the backward-projected values for four slices, respectively. Each of the four textures has individual four color channels, and each channel is used to save the backward-projected values from one projection view.Employ four textures θ for each slice by using the algorithm presented at In GPU vertex shader, the computation described in formula is only In GPU fragment shader, the projection images in the four symmetric views are backward-projected and accumulated to the four slice textures, respectively, according to the projection texture coordinates produced by the vertex shader and the succeeding rasterizer of GPU. The four slice textures are then rendered to GPU frame buffer in the same pass by the Multiple Render Targets (MRT) technique of OpenGL.The above procedures are repeated with Ping-Pong technique, until the projection images of all views are backward-projected and accumulated to the four slices. The effort of backward-projection from full 360° arc is reduced to one 90° arc by using the rotational symmetry.G, B and A channels of the four slice textures are rotated by 90°,180°, and 270°, respectively, and the data in the RGBA channels of each slice texture are respectively accumulated and packed into an output texture with four channels, one slice per channel, which is then downloaded to system memory. Now the four slices have been updated by the projection data from all the views on circular trajectory. The method increases the speed of downloading data by taking advantage of the 4-channel RGBA parallelism, and avoids the calculation of slices accumulating in CPU.A new rendering pass is appended in the end. In this pass, as shown in The above processes are repeated for every volume slice from every projection view, and then the entire reconstructed volume is updated.v1 and v2 of the reconstructed volume are vertical symmetric with respect to the central scanning plane , that means when the coordinate of v1 is , the coordinate of v2 is . According to formula , then that of v2 is in the circular cone-beam scanning case. That is, their Xd coordinates stay the same, while their Yd coordinates are opposite. Another type of symmetry is known as vertical symmetry in circular cone-beam projection layout. As shown in Yd axis, but read the data in the lower half in the opposite order of Yd axis, that is, fold the projection image. Then we pack the two halves of the projection image into two color channels of a 2D-texture, respectively. Thus the projection positions of the vertices of two vertical symmetrical slices in the projection image are identical, consequently only half of projection positions are needed to calculate for backward-projecting a projection image to the reconstructed volume. We use the property of vertical symmetry to decrease the amount of backward-projection positions calculation. When loading a projection image into GPU memory, we read the data in the upper half of the projection image along As for GPU-accelerated algorithms, the projection data should be firstly loaded into graphic card memory so as to be called by GPU, which required expensive data transfers between graphic card memory and system memory due to bandwidth limit. Since the reconstruction of each slice needs the projection images from all projection views, we try to load all the projection images into graphics card memory at one time for saving data transfer time. Currently, graphics cards have typically 512 MB or 768 MB of RAM. If the amount of projection data exceeds the graphic card memory capacity, the projection data have to be partitioned into blocks to fit into the graphic card. A new partitioning scheme is employed in our program. As shown in d be source-to-rotation center distance, D be source-to-detector distance, and DH be detector height, then we can get the maximum height of the reconstructed volume:Let N chunks, then the height of each chunk is VH/N, and the top coordinate and bottom coordinate of the nth chunk along the Yv axis can be calculated according to the formula is set to 1660.0 mm, the source-to-detector distance (SDD) is 1900.0 mm, and the size of each detector bin is 0.127 mm × 0.127 mm. These parameters are set according to a real industry CT system in our laboratory. The micro-CT source-to-detector distance is 570.0 mm and source-to-rotation center is 390.0 mm. Its detector bin is 0.049 mm × 0.049 mm. 3 and 10243 voxels by use of the FDK algorithm with a GPU-based backward-projection. In this reconstruction, the detector array sizes are 5122 and 10242, and the numbers of projection views are 360 and 720, respectively. The programmable pipeline of FX4600 GPU supports 32-bit float precision calculation, and our GPU-based reconstructions show the equivalent image quality as our CPU-based implementations, as shown in We have performed reconstructions for Shepp-Logan phantom volumes with 5123 voxels can be uploaded into graphics card memory at one time, and the backward-projection takes 7.2–7.7 seconds. While the projections in 32-bit float precision for reconstructing the volume with 10243 voxels are too large to be transferred to graphics card memory at one time. The projections need to be partitioned to fit into the graphics card memory on the basis of our partitioning scheme presented in DH is 1024 × 0.127 mm = 130.038 mm. According to formulas /1024 ≈ 1.045 times projection data are needed to transfer from system memory to graphics card memory for reconstructing the whole volume. Hence, as compared to the methods presented in papers [Since our graphics card memory is 768 MB, the projections for reconstructing the volume with 5123. Again, this system is too large for one shot reconstruction, and the projection data needs to be partitioned. The backward-projection time is about 14.5–15.2 seconds given by 3 partitions of the projection data. We have also applied the GPU-accelerated FDK algorithm to the real mouse data acquired with a microcone-beam CT scanner. The projection size for each projection view is 1600 × 980, and data were collected at a total number of 360 views. The reconstructed image array is 512In the work, we have investigated and implemented a GPU-based 3D cone-beam CT image reconstruction algorithm for large data volume, and evaluated the GPU-based implementations by use of computer-simulation data and real micro-CT data. The GPU-based implementation using geometric symmetries has speeded up the backward-projection process by about 110–120 times for a circular cone-beam scan, as compared to the CPU-based implementation on the same PC. The volumes reconstructed by GPU and CPU have virtually identical image quality. Further work is in progress to apply our algorithms to the iterative image reconstruction methods of cone-beam CT.

Most focal nodular hyperplasia (FNH) cases are diagnosed by chance. We studied a case of pre-FNH. We used glutamine synthase as an immunohistochemical marker for perivenous zones.Neither fibrotic scars nor hepatocytic nodules surrounded by fibrosis with a ductular reaction were observed in the sections studied. Most sections generally displayed preserved architecture. The glutamine synthase-positive hepatocyte areas were wider than those observed in non-tumoural surrounding liver, and they tended to extend outwards. Portal tracts bordering the nodule were more fibrotic, with an absence of portal veins and ducts and with arterial proliferation often in proximity with large draining veins; isolated arteries were present and hepatic veins were rare in the nodule. These features appeared prior to the identification of other major criteria characteristics of FNH, thus supporting the "hypothesis of Wanless".The findings confirm that in FNH there is a portal tract injury leading to local portal vein injury. This leads to a cascade of events, including arterial venous shunts, ductular reaction, and scar formation. The estimated prevalence of focal nodular hyperplasia(FNH) is 0.4 to 3% in a non-selected autopsy series and 0.3% in a clinical series. Most FNH cases are diagnosed by chance, but some are symptomatic. In contrast to hepatocellular adenomas, imaging techniques are sufficient for diagnosis in 70% of FNH cases. Histopathological examination is required for diagnosis in the few cases that have non-diagnostic imaging features ,2. In abet al. hypothesized that the primary lesion of FNH is the result of a portal tract injury leading to injury of the local portal vein (PV) with secondary large arterial-PV shunts [Recently, Wanless V shunts . We studV shunts , taking V shunts .A white female patient born in 1950 was reported to have vesicular polyps for several years. In 2000, she presented with biliary colic, and a stone was detected in her gallbladder. A hypoechoic nodule was also identified in the left lobe 7 and 19, α-smooth muscle actin (SMA), and GS. Additional immunostaining included CD34 for characterising capillarised sinusoids, CRBP1 (cellular retinol binding protein-1) for hepatic stellate cells, CD3 and CD20 for T- and B-lymphocytes, respectively, and CD68 for histiocytes.The non-tumoural liver was steatotic 30%), and the nodule was less steatotic in comparison. Early stage FNH formation was diagnosed due to frank ductular reaction, observed around the arteries in two small areas at the border, there were abnormal portal tracts, which were more fibrotic, and there was also an absence of portal veins and ducts and arterial proliferation, often in proximity with large draining veins; b) isolated arteries in the lesion; c) an absence or rarefaction of hepatic veins. All these features appeared prior the identification of other major characteristics of FNH, i.e., nodules circled by fibrous bands, ductular reaction, abnormal vessels and several arteries in fibrotic bands.These observations support suggestions by Wanless et al. and confIt is not possible to fully understand the pathogenesis of FNH from a single case. It is possible, however, from our current understanding of the role of the hepatic artery in the normal liver to propoIn normal livers, the artery within the portal tract supplies three compartments: the peribiliary vascular plexus, the portal tract interstitium, and the portal vein wall. However, the artery outside the portal tract (termed isolated artery) supplies two compartments: the hepatic capsule and the hepatic vein wall .The prime cause of FNH may be arterial, due to the lack of branches to various tributaries . This lack of branches may lead to conditions that are either primary or secondary to inflammation ; this in turn leads to the disappearance of portal vein, bile ducts, and hepatic veins, subsequently resulting in the enlargement and proliferation of arteries, in venous shunts and in all other features described by Wanless et al. . DisappeThe aim of this study was not to confirm the presence of arterio-venous shunts . The existence of these shunts proposed by Wanless' group is however very likely .The suggestion of an arterial malformation is consistent with the possibility of discovering FNH during foetal life and in infancy, the stability of the lesions over time, the association with other vascular malformations, and the singular or multiple nature of nodules .Our observations confirm that in FNH there is a portal tract injury defined by the disappearance of portal vein, bile ducts, and hepatic veins, subsequently leading to the enlargement and proliferation of arteries, and to venous shunts . The prime cause of FNH may be arterial.The author(s) declare that they have no competing interests.PB-S and CB designed the study and wrote the paper. HL performed the imaging technique. GC performed the immunohistochemistry. JS was in charge of the patient and performed the surgery. All authors read and approved the final manuscript.Informed consent was obtained from the patient for publication of this case report.

CDC25B phosphatase is a cell cycle regulator that plays a critical role in checkpoint control. Up-regulation of CDC25B expression has been documented in a variety of human cancers, however, the relationships with the alteration of the molecular mechanisms that lead to oncogenesis still remain unclear. To address this issue we have investigated, in model cell lines, the consequences of unscheduled and elevated CDC25B levels.We report that increased CDC25B expression leads to DNA damage in the absence of genotoxic treatment. H2AX phosphorylation is detected in S-phase cells and requires active replication. We also report that CDC25B expression impairs DNA replication and results in an increased recruitment of the CDC45 replication factor onto chromatin. Finally, we observed chromosomal aberrations that are also enhanced upon CDC25B expression.Overall, our results demonstrate that a moderate and unscheduled increase in CDC25B level, as observed in a number of human tumours, is sufficient to overcome the S-phase checkpoint efficiency thus leading to replicative stress and genomic instability. Members of the CDC25 phosphatase family regulate cell cycle transitions through dephosphorylation of their substrates the CDK-Cyclin complexes. As ultimate targets of the DNA damage activated pathway, they also play a critical role in the fate of the cells in response to injury ,2. The cElevated expression of CDC25B has been documented in a growing list of human cancers ,7, transVery little is known about the mechanisms by which increased CDC25B expression contributes to the oncogenesis process. It has been shown that overexpression of CDC25B results in checkpoint bypasss and premature entry into mitosis ,12. We aHowever, as mentioned above all three CDC25 phosphatases have been shown to be involved in the control of CDK-cyclin activities at the G1-S transition and in S-phase -17. It iIn this study we have investigated cell cycle progression in response to unscheduled expression of CDC25B and found dramatic effects during DNA replication leading to replicative stress and genomic instability. These results emphasize the relevance of the study of its expression in human tumours and shed light on its potential role in oncogenesis.To examine the impact of unscheduled CDC25B expression on cell cycle progression during S-phase we used a U2OS cell line conditionally expressing an Ha epitope-tagged CDC25B protein under the control of the tetracycline promoter . We firsWe thus examined the duration of S-phase in cells expressing Ha-CDC25B or not. These cells were BrdU labeled then chased with thymidine and collected at various times for flow cytometry analysis of BrdU positivity. Nocodazole treatment was used during the experiment to stop progression into mitosis. As shown in figure S1, Additional file We next examined the possible consequences of unscheduled CDC25B expression on the occurrence of replication-linked DNA damage. With this aim, we used immunofluorescence microscopy to monitor γ-H2AX staining, a sensitive and early marker of DNA injury. As shown in figure In order to confirm this observation in a cellular context in which the unscheduled expression of CDC25B is limited to a level frequently observed in many tumour cell lines, we made use of HCT116 cells that were engineered to stably express a moderate level of Ha-CDC25B. As shown in Figure These observations were specific for CDC25B, as they were not observed in U2OS cells conditionally expressing CDC25C and fluorescence microscopy was used to visualize, in each of the replication foci, the corresponding labeling detected with antibodies to CldU (green) and IdU (red) Figure and in HTo confirm that this observation in HCT116 CDC25B+ cells was totally dependent on CDC25B expression, we invalidated its expression by RNA interference using siRNA against CDC25B that has already been validated [The ability of abnormal and unscheduled increased levels of CDC25B to promote replication stress resulting from a decrease of fork progression, prompted us to analyze this chromosome feature.We examined chromosomal aberrations in metaphase spreads that were prepared using U2OS cells expressing CDC25B after colcemid treatment. The frequencies of chromatid and chromosome aberrations such as gaps and breaks were respectively 1.2% and 0.6% in U2OS cells whereas they rose to 2.7% and 1.6% in U2OS cells expressing CDC25B Figure . As illuIn this study, we show that a moderate and unscheduled increase in CDC25B protein level, comparable to the increased level that has been reported to be observed in human tumours, has a critical incidence during S phase through the generation of replication defects. We first demonstrate that abnormal level of CDC25B expression results in DNA damage essentially occurring in replicating cells. This observation is reminiscent of the premature activation of cyclin E- and cyclin A-dependent kinase observed upon CDC25A overexpression . It alsoAlthough S-phase duration was not changed, we also observed a decrease in the replication rate upon expression of CDC25B and we demonstrated that depletion of its expression was sufficient to rescue a normal progression. As the replication rate is inversely correlated with the density of active origins ,35, an ain vitro transforming potential [We also report an increase in numbers of chromosomal aberrations such as gaps, breaks and joined chromosomes that illustrates the deleterious consequences of elevated CDC25B expression during S-phase and its potential role in genomic instability. In line with this observation, we previously reported that HCT116 cells, expressing elevated levels of CDC25B, displayed an elevated mutation rate compared to the parental cell line . In the otential and its otential ).Our findings indicate that unscheduled and moderate expression of CDC25B during S-phase is sufficient to induce replicative stress and genomic instability. Since abnormal expression of CDC25B has been found in numerous cancers (reviewed in ) our resU2OS conditionally expressing Ha-CDC25B3 (B3 isoform) cells were grown as previously described . Cells wA previously validated siRNA for CDC25B with the following sequence 5'AGACUGCAGAUACCCCUAU-3' was used. Human CDC45 siRNA pool was purchased from Santa Cruz (CA). Cells were electrotransfected using AMAXA nucleofector following the manufacturer's instructions for HCT116 and U2OS cells.Mouse anti-phospho Ser139 γ-H2AX , rabbit anti-phospho Ser139 γ-H2AX (Upstate Biotechnology), mouse anti-Ha tag (clone Ha.11 Covance), rabbit anti-phospho H3-Ser210 (Upstate Biotechnology), rat anti-BrdU (clone BU1/75 Serotec), mouse anti-BrdU (Becton Dickinson), rabbit CDC25B antibody , mouse anti-actin , rabbit anti-CDC45 (ref. 20685. Santa Cruz). Mouse rabbit and rat anti-IgG Alexa 488 and 594 for immunofluorescence , rabbit and mouse anti-HRP antibodies .Cells cultured on glass coverslips were processed as previously described then incubated with rabbit anti-γ-H2AX and mouse anti-Ha tag or rabbit anti-phospho H3 Ser210 and mouse anti-phospho γ-H2AX followed by rabbit and mouse Alexa secondary antibody staining . Cells wReplication focus detection with CldU and IdU was performed on U2OS or HCT116 cells blocked by thymidine (2.5 mM) for 17 h then released in DMEM for two hours. Cells were incubated in medium containing 100 μM CldU for 30 min then 100 μM IdU for the last 30 minutes after washing with hot medium. IdU incorporation was stopped with medium containing thymidine (1 mM) then cells were fixed with cold 70% ethanol. They were treated with 100% methanol at -20°C for 5 min, washed twice with PBS then incubated in 1.5 M HCl for 20 min. After two washes with PBS, they were incubated in 0.5% Tween20/0.25%BSA/5% fetal veal serum/PBS/(TBS) for 30 min in a humid box. Incubation in the primary antibody rat anti-BrdU against CldU and mouse anti-BrdU against IdU in TBS for 2 hours was followed by anti-rat IgG Alexa 594 and anti-mouse IgG Alexa 488 in TBS respectively. Cells were washed twice in 0.5% Tween/PBS then mounted in Vectashield solution and visualized using a DM 6000 microscope. Pictures were acquired with MetaMorph software, keeping the same intensities for each fluorescent dye for all the pictures of the same assay and the signals were measured using ImageJ software. IdU-CldU colocalization was quantified from the merge picture by dividing the colocalization area by the total area for each nucleus and the non-parametric Welch T corrected test was used to analyse the data.Cells were processed as previously described with mouse anti-phospho Ser139 γ-H2AX, followed by mouse anti-IgG Alexa 488 . DNA was2, 10 mM KCl, 10% glycerol, 0.34 M sucrose, protease inhibitors , 10 min on ice. EDTA 10 mM was added for 30 min and this chromatin fraction obtained after centrifugation represented the soluble fraction. The pellets were washed twice in buffer A and incubated 30 min at RT with 2000 U/ml DNaseI (Roche) and a further 30 min at 4°C with 0.5 M NaCl. The DNase solubilized chromatin fraction was obtained after centrifugation .U2OS cells were synchronized and induced for CDC25B expression at the G1-S transition by a simple thymidine block . After 3 h of thymidine release, the cells were harvested and resuspended in buffer A and analysed by Western Blotting. For protein quantification, pictures were acquired with a Bioimaging Systems, Syngene Camera and the signals measured using ImageJ software.U2OS cells were induced for CDC25B or not for 24 hrs at which point Colcemid was added for the last 3 h to accumulate mitotic cells prior to trypsinisation, centrifugation, resuspension in PBS, centrifugation and swelling in hypotonic (50 mM) KCl solution for 25 min at RT. A fixation solution of 100% ethanol/acetic acid (3:1) was added and the cells were centrifuged, rinsed twice in ethanol/acetic acid before spreading on slides and being left to dry. Chromosomes were stained with 0.05 μg/ml DAPI/PBS (Sigma) for 10 min then washed with several changes of PBS and mounted with mounting medium (Dakocytomation) prior to microscopy. About 30 spreads were scored for statistical data.The authors declare that they have no competing interests.BB designed, carried out the experiments and drafted the manuscript. ES performed the double block thymidine synchronisation experiment. BA constructed the HCT116 CDC25B+ cell line. BD supervised the project and finalised the manuscript. All authors have read and approved the final manuscript.Analysis of S phase duration. Asynchronous cells overexpressing CDC25B (U2OS CDC25B) or not (U20S) were treated with nocodazole (200 nM) all along the assay. The cells were pulse labeled with BrdU then BrdU was replaced by thymidine (1 mM). The cells were collected at the indicated times and immunostained with anti BrdU antibodies. The percentage of BrdU positive cells in S phase was determined by flow cytometry analysis. 100% correspond to the cell population before chase. As an example, the percentages of cells in S phase at 0 h and 10 h after thymidine chase were measured as shown in the two lower plots.Click here for fileAnalysis of γ-H2AX staining in overexpressing CDC25C U2OS cells. Asynchronous U2OS cells conditionally overexpressing Ha-CDC25B or Ha-CDC25C by tertracycline removal (+) [oval (+) for 17 hClick here for fileAnalysis of γ-H2AX staining during the cell cycle. U2OS cells conditionally expressing Ha-CDC25B were synchronized in mitosis by nocodazole treatment as in figure Click here for file

Stroke victims are at relatively high risk for injurious falls. The purpose of this study was to document longitudinal fall patterns following inpatient rehabilitation for first-time stroke survivors.Participants (n = 231) were recruited at the end of their rehab stay and interviewed monthly via telephone for 1 to 32 months regarding fall incidents. Analyses were conducted on: total reports of falls by month over time for first-time and repeat fallers, the incidence of falling in any given month; and factors differing between fallers and non fallers.The largest percentage of participants (14%) reported falling in the first month post-discharge. After month five, less than 10% of the sample reported falling, bar months 15 (10.4%) and 23 (13.2%). From months one to nine, the percentage of those reporting one fall with and without a prior fall were similar. After month nine, the number of individuals who reported a single fall with a fall history was twice as high compared to those without a prior fall who reported falling. In both cases the percentages were small. A very small subset of the population emerged who fell multiple times each month, most of whom had a prior fall history. At least a third of the sample reported a loss of balance each month. Few factors differed significantly between fallers and non-fallers in months one to six.Longitudinal data suggest that falls most likely linked to first time strokes occur in the first six months post discharge, particularly month one. Data routinely available at discharge does not distinguish fallers from non-fallers. Once a fall incident has occurred however, preventive intervention is warranted. Stroke survivors are at high risk for developing a wide range of complications . Common Falls are the most frequently reported accident among older adults and someThe literature on falls in community-dwelling stroke survivors is generally cross-sectional. In identified stroke populations, studies ask about falls over some time interval. In these studies the time intervals differ from the stroke event often differ and other comorbidities affecting the population are seldom identified. The longer the interval from stroke to survey the less likely it is that the fall can be definitely attributed to the stroke. Recall issues also become important. Available studies on stroke survivors in community-based populations have examined: falls only in women , long-teUnderstanding fall patterns and predictors of falls is important, particularly as the stroke recovery trajectory is long and unpredictable. Falls can increase a stroke victim's risk of morbidity and mortality. The risk of fall-related fractures is especially of concern in stroke survivors given their impaired mobility and high risk for developing osteoporosis ,27. LongThis study had two objectives: 1) to document the frequency and monthly pattern of reported falls in community residing stroke survivors over a period of up to 32 months and 2) to identify differential characteristics among fallers and non fallers.Data were obtained from a multi-center prospective cohort study documenting the patterns of secondary conditions, including falls, following a first-time stroke. Recruitment began in October 2000 and ended in June 2003. The study was approved by the Institutional Review Board (IRB) of Emory University and by each hospital's IRB.Participants were recruited from urban, not-for-profit inpatient acute care (with a specific stroke unit) and rehabilitation hospitals in the southeastern and southwestern United States. The sites were located in low-income to upper-middle class neighborhoods and were either privately owned or university affiliated. Inclusion criteria were general to recruit as large a sample as possible. Eligible were all first-time stroke patients age 18 years or older, who were diagnosed with either hemorrhagic or ischemic stroke, had a telephone, had a caregiver who could act as a proxy respondent if speech impaired, and who were likely to be discharged to the community. The majority of subjects (94.3%) were living at home following the stroke, while the remainder had been discharged to either an assisted living or nursing home facility (n = 14). Eleven percent of those discharged to the community came from a hospital with a dedicated stroke unit.A hospital case manager referred patients that were appropriate for the study to the project site coordinator. A site coordinator then visited the patient during their acute or rehabilitation stay to describe the project and obtain consent. All subjects voluntarily signed an approved consent form. A separate consent was available for patient family members if subjects were unable to sign or deemed unable to understand the requirements of the study. Researchers believed that caregiver reports of falls and fall-related health care utilization would be reliable for those who could not self-report. Subjects were called the first week post-discharge to review the study and contacted monthly thereafter via telephone.Data were collected from two sources. We gathered information from discharge inpatient hospital medical records as well as from monthly interviews conducted with the participants. Our goal in this approach was to identify whether information routinely available at discharge could predict future outcomes following discharge.Following consent, baseline data on demographics, past medical history, and discharge Functional Independence Measure (FIM) scores were collected from inpatient medical records. The FIM is the most widely accepted instrument to assess progress during inpatient rehabilitation and has been used to predict stroke rehabilitation outcomes ,28. ThisSubjects were followed monthly post discharge and completed detailed telephone interviews regarding secondary conditions experienced in the previous month. All interviewers were trained at the Emory University Rollins School of Public Health by the study's principal investigator (VLP) and project coordinator (AEH). Given rolling recruitment, subjects entered the study as they were affected by strokes and discharged over time. They participated in the study for intervals varying from six to thirty-two months. If a subject completed two years and agreed to continue, their interview schedule changed to quarterly interviews.Subjects were mailed a notebook to be used for the study. The notebook included laminated sheets of the questions that would be covered and calendar pages that noted the weeks when they would be called. Subjects were also encouraged to use the calendar to mark days when a fall occurred. If the subject was not available in a particular month, then they were asked through a prompting process during the interview to recall the previous month and to refer to their calendar.Falls were defined as a fall to the ground and were only self-reported. Subjects were first asked to report whether they had a fall in the past month. If the subject reported a fall they were then asked the date of occurrence. Subjects were then asked whether they had experienced any more falls and questioned about each subsequent fall. Episodes of near-falls were notAll statistical analyses were undertaken with SPSS package for Windows, version 11.5 . Statistical significance was defined at p < 0.05 unless otherwise specified. Standard descriptive statistics were used to describe the sample, while Chi-square tests for categorical variables; t-tests (non-skewed) and Mann-Whitney U tests (skewed) for continuous variables were used to compare significant differences between those who did and did not fall. Hazard rate regression was used to identify the likelihood of a respondent falling in a given month, based on their individual reporting times .A total of 290 subjects were referred for recruitment and 245 subjects consented and completed at least one interview. Ultimately, 14 subjects were discharged to nursing homes and were not included in the analyses. Those discharged to a long term care setting had significantly lower FIM scores (74.54 vs. 97.63) and were significantly older (64.13 vs. 72.78 years) compared to those who were discharged home after their rehabilitation stay. Thus, our results include data from 231 participants. The mean follow-up period was 13.50 months . Thirty-nine subjects (16.8% of the sample) dropped out of the study during the two-year follow-up period. Reasons for drop out included loss to follow-up (48.7%), death (28.2%), or they no longer wanted to participate (15.4%).Table The most common discharge diagnoses following the stroke included hypertension (54.5%); diabetes (21.2%), communication disorder (22.1%); lipid disorders (19.9%); and hemiparesis or hemiplegia (16.5%). Ischemic strokes accounted for 85.3% and strokes occurred in both the right hemisphere (39%) and left hemisphere (39%).The mean length of stay in rehabilitation was 20.25 days . The mean total FIM score was 97.63 . The group was relatively highly functional physically and moderately functional cognitively compared to other acute rehabilitation stroke survivors ,36.As part of the subjects' discharge plan, over two-thirds (68.8%) of the subjects were receiving some type of therapy in the first three months following discharge. Half of these subjects (n = 116) were receiving two or more therapies. The most common therapies received were outpatient physical therapy (45.5%), outpatient occupational therapy (39.4%), and outpatient speech therapy (21.6%).The sample reported 335 total fall incidents (259.83 person-years observation) . These dNote, again due to rolling enrollment, the larger number of respondents with data in early months (i.e. one to six) reflects the fact that subjects were recruited over time and those recruited late in the study were followed for a shorter period of time. Participants who missed an interview month were prompted to during the call to report fall incidents in the prior month through anchoring questions, such as a holiday, birthday or a health care visit reported in the prior month.Table Table Two very small groups emerged in relation to reports of multiple falls. The percentage of the population reporting multiple falls was extremely small. Three of the four reports of multiple falls (in those without a prior history) occurred in the first three months following discharge. Also, a very small subset of the population emerged who fell multiple times each month; most of whom had a prior fall history.Table Preventing falls in people affected by stroke is an important healthcare goal . UnderstAt least a third of the sample reported a loss of balance over the observation period, while a much smaller percentage reported a fall to the ground - in month one 18% reported a fall, 56% a loss of balance. These findings are in concert with recent data on people age 65 and older reported by the CDC, although the comorbidities of the population surveyed were not described. Here, the majority of falls are concentrated in the first six months post discharge and after that period those with a single falls begin to develop a fall history, with multiple falls being less common than single falls. Of note is that the percentage of the sample reporting falls, multiple or single in a given period, was extremely small - less than 10% in four out of 15 months of observation from month 6 on.Data here suggest that information routinely available at discharge does little to assist in helping to identify first-time fallers. This finding is consistent with the work of Ray et al. who throuBased on demographics, our sample is generalizable to the community-dwelling stroke survivor population. The sample is similar to national samples in gender and racial mix ,41, whilThis study documents that falls, clearly linked to strokes, occur in the first several months following discharge from acute rehabilitation. The frequency of falls in this sample in the first six months is lower than the percentages in many cross-sectional studies in which other comordities may have influenced the fall rate -25. The These data suggest that predicting falls post-discharge based solely on the medical record data routinely available at dischThere were a few additional limitations to this study. Fall incidents were self-reported and while this methodology in commonly used in cross-sectional studies, the effect of this reporting mechanism on reports is unknown. Furthermore, the definition here of "fall to the ground" leads to a conservative estimate of fall incidents. Other definitions, such as likely falls or falls prevented by participant response, such as a nearby object or a caregiver intervening, may lead to different results. We also had no way to assess the severity of the fall. We also did not collect data on participants' "fear of falling", nor on In conclusion, falls in community-dwelling stroke survivors are a frequent occurrence following in patient rehabilitation. Further analysis of the key characteristics that increased length of rehabilitation stay as well as the occurrence of near-fall events such as loss of balance may increase our understanding of predictive factors for falls among stroke survivors following discharge to the community. Longitudinal data are useful to supplement cross-sectional data available on stroke populations in the continuing effort to design effective interventions to prevent falls among people affected by strokes.The authors declare that they have no competing interests.LMW was the primary author. She conducted data analysis, and oversaw preparation of the manuscript. VLP was the Principal Investigator. She also drafted parts of the manuscript, mentored the primary author in the research process, and edited the manuscript. AEH: implemented the study, conducted data analysis, and assisted with preparation of the manuscript. PGF contributed to the initial study design, recruited subjects, collected data and reviewed drafts of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Dermochelys coriacea) has undergone a dramatic decline over the last 25 years, and this is believed to be primarily the result of mortality associated with fisheries bycatch followed by egg and nesting female harvest. Atlantic leatherback turtles undertake long migrations across ocean basins from subtropical and tropical nesting beaches to productive frontal areas. Migration between two nesting seasons can last 2 or 3 years, a time period termed the remigration interval (RI). Recent satellite transmitter data revealed that Atlantic leatherbacks follow two major dispersion patterns after nesting season, through the North Gulf Stream area or more eastward across the North Equatorial Current. However, information on the whole RI is lacking, precluding the accurate identification of feeding areas where conservation measures may need to be applied.The leatherback turtle and foraging latitude . Egg-yolk and blood isotope values are correlated in nesting females, indicating that egg analysis is a useful tool for assessing isotope values in these turtles, including adults when not available.Using stable isotopes as dietary tracers we determined the characteristics of feeding grounds of leatherback females nesting in French Guiana. During migration, 3-year RI females differed from 2-year RI females in their isotope values, implying differences in their choice of feeding habitats (offshore Our results complement previous data on turtle movements during the first year following the nesting season, integrating the diet consumed during the year before nesting. We suggest that the French Guiana leatherback population segregates into two distinct isotopic groupings, and highlight the urgent need to determine the feeding habitats of the turtle in the Atlantic in order to protect this species from incidental take by commercial fisheries. Our results also emphasize the use of eggs, a less-invasive sampling material than blood, to assess isotopic data and feeding habits for adult female leatherbacks. Dermochelys coriacea), visited by up to 30–40% of the world's population of nesting females Yalimapo beach in French Guiana, South America, is one of the main nesting grounds for the largest of the sea turtles, the leatherback . The RI for leatherback turtles is variable, but is most commonly 2 or 3 years Recent satellite transmitter data has revealed that Atlantic leatherbacks follow two major dispersion patterns after nesting, either through the North Atlantic area or more easterly at low latitudes across the North Equatorial Current 15N/14N, noted δ15N) and carbon in the consumer tissues reflect those in their resources in a predictable manner due to selectivity for lighter isotopes during a consumer's metabolic processes 13C, and 3–4‰ for δ15N 15N relative to their food and consequently δ15N measurements serve as indicators of a consumer's trophic position 13C values vary little along the food chain and are mainly used to determine primary sources in a trophic network 13C values can also indicate inshore versus offshore, or pelagic versus benthic contribution to food intake 13C values to decrease from low to high latitudes, due to oceanographic factors such as CO2 concentration effects on carbon fixation by phytoplankton Individuals that exploit geochemically different habitats, or feed on different resources, can be differentiated using stable isotope measurements, as the isotope profile of consumers reflects that of their prey. This approach is based on the fact that stable isotope ratios of nitrogen and/or origin of carbon source . We also tried to investigate whether females forage in the breeding areas. Finally, we examined the relationship between stable isotope values of eggs and female tissues to assess egg analysis as a less-invasive method of sample collection for isotope measurements in this endangered marine turtle.In this paper we present the first isotopic analysis of leatherback turtle nesting in French Guiana and inferred from isotopic leatherback data collected several times on the same females during a nesting season. We hypothesized that females with different RIs forage at different locations, and differ in the isotopic values of the tissues subject to a low turnover (Red Blood Cells-RBC). Our hypothesis predicted that females with 3 and 2 year RI exploit geochemically different habitats varying in latitude , 7 females for 4 clutches , 1 female for 3 clutches (40 d), 14 females for 2 clutches (9–43 d) and 29 females for 1 clutch. The different clutches were not necessarily consecutive; For example, a female that was sampled for 4 clutches during 49 days laid 6 clutches during this period, but 2 were not sampled. Among the turtles 23 had been tagged and recorded in a passive integrated transponder tags (PIT) database, which showed that 7 had a 3-year RI and 16 had a 2-year RI.13C and δ15N in any tissue (P>0.5).The curved carapace length (CCL) of sampled females ranged from 142–172 cm . A preliminary analysis showed that CCL had no effect on δ13C and 0.07–0.15‰ for δ15N. Despite the small sample size, we assumed that a single egg-yolk reflected the δ13C and δ15N of the whole clutch.Two eggs were sampled from each of three clutches to assess intra-clutch variability in isotope values. Differences between the values for the 2 eggs within a clutch were of the same order as the measurement error, ranging from 0.10–0.15‰ for δ13C and δ15N for each tissue in relation to the time (in days) of each clutch after the first clutch was observed. The number of eggs in each clutch was included as a covariable, but had no effect on δ13C and δ15N for any tissues . The time of each laying event had no effect on δ15N values for any tissue compared with the values for blood and for egg-yolk .The mean (±SD) isotope values of the whole body of the jellyfish sampled at the beach during the breeding season were very high for carbon and similar for nitrogen of egg-yolk were not different between females with 2-year and 3-year RIs at 371 and 614 days in a captivity study, and found that turnover was at least 371 days. However they did not show the dynamic of the turnover. Seminoff et al.Trachemys scripta, was 142 d increasing linearly, with a half-life of 35.6 days. Based on these unique data on turtles and knowing that the longest nesting season observed during our study for a leatherback female was 49 days, we can suppose that isotopic turnover of plasma in the leatherback turtles sampled may have not been completed, but that a change in isotopic values could have been detected. However, no significant variation in plasma δ13C and δ15N throughout the breeding season was detected.The use of stable isotope ratios has become a powerful tool to estimate and clarify the feeding ecology of many vertebrate, especially when species are particularly difficult to study by traditional methods Rhizostoma and Aurelia) are regularly observed on Yalimapo beach, and they are known to be a common prey of leatherback turtles Parallel measures of isotope values in jellyfish sampled on the nesting beach did not indicate food intake near the beach. Massive strandings of two jellyfish genera . Williams et al.Fratercula cirrhata) nestlings were significantly depleted in 15N compared to well-fed conspecifics. Thus, the effect of nutritional restriction could be dependent of species-specific differences in physiological response A further complicating factor to interpret isotopic data is the nutritional stress While past experiments on mammals, birds, fishes, and insects have shown changes in stable isotope ratios due to nutritional stress, there has been no research on this topic in reptiles. The detection of nutritional stress in wild population is very difficult compared to experimental studies. Indeed, the short timeframe of our samples in relation to the slow turnover rate of turtle blood, the particular physiological characteristic of the endothermic capacity of leatherbacks 15N and δ13C Leatherback turtles undertake long migrations between nesting sites and foraging grounds. The causes of variation in the RI of female leatherbacks are unknown, but may be linked to the availability of food sources and thus the ability to store enough energy resources to undertake migration to breeding areas 15N values. Wallace et al.15N in leatherback turtles indicates oceanographic differences, as the distinct nitrogen cycling regimes among oceans influences the baseline δ15N signatures of marine food webs 15N values of egg yolk and RBC were significantly different between an Atlantic population (St Croix) and a Pacific population . In this sense the δ15N values for French Guiana turtles were more similar to the St Croix population , which probably reflects different feeding strategies on gelatinous zooplankton: leatherbacks are known to feed on planktivorous jellyfish or jellyfish that forage on fish or crustaceans Leatherback females in French Guiana (2-year and 3-year RI) did not differ in their δpulation . The tur13C values in the tissue of marine animals have been shown to vary with latitude , and the high values of the 3-year RI turtles indicate a more southern and/or coastal foraging area (West African and Iberian coasts). Confirming these conclusions, maps of gelatinous organism distribution provide information on prey location and indicate that these foraging areas support several appreciable aggregations of potential prey, especially due to the presence of upwelling and frontal areas Although individual females may show a degree of subregional fidelity to areas such as northward to the Gulf Stream area or eastward to tropical waters ude e.g. , reflect15N values in egg yolks were not significantly different among serial clutches from one turtle, but the δ13C values were significantly different and tended to decrease from one clutch to another. No explanation for these different trends is apparent. If females had fed on jellyfish at Yalimapo beach and incorporated this C source into egg yolk, the trend of egg yolk δ13C values should have been reversed. Hatase et al.Chelonia mydas), with δ13C not significantly different and a significant enrichment in δ15N egg yolk values among five serial clutches from one turtle. This enrichment could not be attributed to nutritional stress from fasting et al.13C and δ15N in egg yolks among four serial clutches of a single loggerhead turtle.Stable isotope ratios in the diet become incorporated into egg yolk in 8–15 days in birds 13C and δ15N) of the blood of females and their egg yolks. This indicates that stable isotope analysis of egg components is a viable method for assessing foraging ecological questions in marine turtles. Thus, to study the diet of adult sea turtles, stomach lavage or blood sampling during laying could be replaced by a procedure less-invasive, sampling the yolk of a single egg.We found a positive relationship between isotope values , which provides a taxonomic resolution of resources, and satellite telemetry, which provides migration travels Establishing patterns of movements of free-ranging animals is crucial for a better understanding of their feeding ecology and life history traits, and is a prerequisite for their conservation. Tracking animal movements can be done directly using remote-sensing techniques or indirectly using biochemical markers like naturally occurring stable isotopes. This method is less-invasive, repeatable and can be applied over different time scales to investigate migration or feeding ecology, and is very appropriate to the study of endangered species such as sea turtles. Stable isotope analysis in sea turtle can also be used to assess the feeding ecology and habits in inaccessible locations. For example, Reich We underline two important points for the conservation of leatherback turtles. Firstly, two foraging area dichotomy for Atlantic leatherback turtles are used by 2-year and 3-year RI females. Foraging in the more southern and coastal area of West Africa seems to delay the return of females to breeding areas by one year. More research is needed to understand whether females always select the same foraging areas, and if so what the evolutionary benefits are in choosing a particular foraging site . Fisheries bycatch is believed to be among the primary causes of leatherback turtle decline followed by egg and female harvest Research was carried out within the Amana Nature Reserve at Yalimapo beach in French Guiana , on the inshore plain of the coastline between the Mana and Maroni Rivers . LeatherEggs and blood were sampled nightly from turtles on Yalimapo nesting beaches, from 4 h before until 4 h after the high tide from the 16th March to 14th May, 2006. Nesting females were scanned for PIT tags. At the beginning of the nesting season all females were sampled. Sampling then focused on females that had already been captured one or more times. The curved carapace length (CCL) was measured to the nearest cm as an index of size. The number of eggs in each clutch was recorded and one fertile egg was collected. For three females we collected two eggs laid successively, in order to examine intra-clutch variation in stable isotope ratios of the egg yolk. Blood was sampled in the venous sine of the rear flipper MicroMass, Service Central d'Analyse, Solaize, France) coupled to a EuroEA 3024 analyzer. Stable C and N isotope ratio are expressed as:R is 13C/12C or 15N/14N for δ13C and δ15N, respectively. The standard for the C isotopic ratio is IAEA-NBS 21 (graphite −28.13‰), and for the N isotopic ratio is IAEA-N1 (+0.4‰) and IAEA-N2 (+20.3‰). Ten replicate assays of internal laboratory standards indicated measurement maximum errors (SD) of ±0.15‰ and ±0.2‰ for stable carbon and nitrogen isotope measurements, respectively.Samples of egg yolk and turtle blood , and whole specimens of jellyfish were used for isotope analyses. Lipids were previously removed from egg yolk with a dichloromethane-methanol (2∶1) solution. All samples were dried at 60°C for 48 h, ground to a fine powder, weighed in tin capsules and stored in a dessicator until isotope measurement. Isotope analyses were performed using an IsoPrime spectrometer (13C and δ15N), and the main independent variable was the time in days of each clutch since the first clutch was observed . We added a covariable that was the number of eggs in each clutch. Repeated measurements enabled comparison of data from the same female at different laying events. The normality of the dependent variables was confirmed prior to the analyses.We firstly examined variation in isotope ratios in the plasma, RBCs and egg yolk of each female throughout the nesting season (between different laying events) in order to establish whether females forage during the breeding season. We carried out general linear models with repeated measures (repeated measures GLM) in which the dependent variable was each isotope ratio . We used mixed models because values for the same female at different times (representing different laying events) were correlated; this covariance structure was handled by introducing the individual females as a random effect into the GLMM.We secondly searched for differences in RBC and plasma isotope values between 2-year and 3-year RI females. We carried out a general linear mixed model (GLMM) for each tissue and each isotopic ratio (δ13C or δ15N for egg yolk and the independent variables were δ13C and δ15N of RBC or plasma. Individual females were introduced in the model as a random effect, as explained above. Because one of the goals of this analysis was to establish a method to obtain isotope ratios of females when female tissue samples are not available, we determined regression equations between egg yolk isotope ratios and those for RBC and plasma, through simple regression models when GLMM were significant.Finally, to assess if female isotope ratios could be estimated from egg samples only, we tested the relationship between isotope ratios of egg yolk, and RBC and plasma from the same female. We performed independent GLMM in which the dependent variable was δAll analyses were performed with the STATISTICA package, version 6.0

The mammalian Natriuretic Peptide (NP) system consists of neuro-hormones, such as atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), c-type natriuretic peptide (CNP), and the N-Terminal fragment of BNP (NT-pro-BNP). In response to some cardiovascular derangement the heart (acting as an endocrine organ), brain and other structures secretes natriuretic peptides in an attempt to restore normal circulatory conditions. Their actions are modulated through membrane-bound guanylyl cyclased (GC) receptors. They induce diuresis, natriuresis and vasodilation in the presence of congestive heart failure. These neuro-hormones also play a role in the suppression of neointimal formation after vascular injury. In addition, they act as antifibrotic and antihypertrophic agents preventing cardiac remodeling after myocardial infarction. Further, NP have diagnostic and prognostic role in heart failure, vasoconstriction, left ventricular late remodeling after MI and others. At present, some drugs such as Nesiritide, NEP inhibitors and vasopeptidase inhibitors were synthetized from NP, to antagonize these cardiovascular derengements. In future, it will be possibile to elaborate some drugs similar to petidase inhibitors and some CNP-like drugs able to reduce many symptoms of cardiovascular derangements without significant side effects. Natriuretic Peptide (NP) System is composed of neurohormones synthesized by the heart, brain and other organsAtrial Natriuretic Peptide (ANP); Brain Natriuretic Peptide (BNP); C-type Natriuretic Peptide (CNP)N Terminal fragment of pro BNP (NT-pro-BNP) must be also considered. This last derives from the proteolysis of proform BNP.At present, the mammalian natriuretic peptide system consists of some substances: ANP is the first discovered member of this family. The major site of synthesis in normal heart is the atrium, and secretion is stimulated by stretch. In normal adult heart, ventricular tissue produces only minor amounts of ANP, but major amounts are found in ventricles of fetuses and in patients with LV hypertrophy. ANP is a 28-amino acid peptide stored and released by atrial myocytes in response to atrial distension and stretch. In addition, it also increases angiotensin II and/or endothelin rise-concentrations as a consequence of sympathetic stimulation.Elevated levels of ANP generally are found in hypervolemic states inducing a condition of congestive heart failure. It is present in patients with heart failure and chronic atrial fibrillation (AF). In this connection, ANP levels were higher among those with AF of longer duration than in decompensated patients with AF of shorter lengthBNP was primarily discovered in porcine brain, but the highest concentration of peptide is found in the heart. It is a 32 amino-acid peptide, synthesized within the ventricles in response to myocyte stretch and/or pressure overload8. It is released both as an active hormone and an inactive N-terminal fragment (NT pro-BNP). Recently, Elnomany and Abdelhameed found that BNP levels are elevated in patients with symptomatic LV dysfunction. The reduction of Mitral Annulus Posterior Excursion (MAPSE), as the index of left ventricular dysfunction, appears strongly correlated with plasma BNP levels. This correlation provides a simple, accurate and reproducible tool for early diagnosis of LV dysfunctionIn addition, BNP levels are higher in patients with dyspnea (shortness of breath) due to heart failure than in patients with dyspnea induced by other causes. Consequently, BNP measurement in the emergency room helps in to discriminate two types of dyspnea. Besides, BNP appears to be a useful marker of cardiovascular risk, even in persons without clinical evidence of cardiovascular disease. Finally, BNP levels were employed to predict the risk of heart failure atrial fibrillation and stroke or transient ischemic attack. Conclusively, the hemodynamic effects of BNP are largely similar to those of ANP.C-type Natriuretic Peptide was originally isolated from porcine brain extracts but, the major site of synthesis are the vessel walls. The peptide plays a role in the suppression of neo-intima formation after injuryNumerous compounds limiting ventricular remodeling after MI heve been reported. These include angiotensin-converting enzyme inhibitors, angiotensin II type 1 receptor blockers, aldosterone antagonists, and matrix metalloproteinase inhibitors. Although almost all these agents have been given orally contrary to CNP, this last has the advantage concerning short period of treatment and fewer side effects.N-terminal fragment of Brain Natriuretic Peptide (NT pro-BNP) derives from the proteolysis of pro-BNP (composed of 108 amino-acids). It consists of 76 amino-acids and recently caused great interest for its possible role in monitoring cardiac insufficiencyThe NP serum levels are important not only as indicators of numerous cardiovascular derangements, but also as markers of their severity. ANP are found elevated in patients suffering from MI and having congestive heart failureThis diagnostic value was recently confirmed by Coutance et al. Although elevated BNP levels have a high sensitivity to detect patients at risk of death, the specificity of this neuro-hormone is lowThe beneficial effects of NP on cardiovascular disease stimulated the development of new compounds able to prolong and enhance these positive effects. Of these:Nesiritide is a recombinant form of human BNP, approved for use in the acute treatment of congestive heart failure caused by systolic dysfunctionThe agent is indicated for intravenous treatment and has advantageous, pluripotent properties in ADHF including hemodynamic, neurohormonal, lusitropic, and reverse remodeling effects. In addition, it was satisfactorily compared with other vasodilating agents and did not promotes arrhythmogenesisSubsequently, a number of other drugs deriving from CNP have been prepared30More recently, a new class of drugs similar to NEP inhibitors have been shown to be efficacious in animal models with heart failure. Treatment with NEP-inhibitor, Candoxantril, increases urinary sodium and significantly elevates filtration fraction with no significant effect on glomerular filtration rate, renal plasma flow or lithium clearance. A reduction in aldosterone concentration is also evident in these patients34There are, however, complex interactions between ACE and NEP inhibition. Both ACE and NEP metabolize the kinin peptides bradykinin and kallidin, whereas NEP converts angiotensin I to angiotensin and metabolizes Angiotensin II and endothelin. Addition of NEP inhibition to ACE inhibition potentiates the ACE-inhibitor-induced increase in kinin levels. But, the combined ACE/NEP inhibition increases the risk of angioedema and may counteract any benefit of ACE inhibitionConclusively, NP is an endogenous system able to induce most common circulatory derangements, such as water retention, vasoconstriction in response to CHF. In addition, the system causes endothelial dysfunction and left ventricular late remodeling. To avoid these negative effects, new derived drugs are recently prepared to reduce, eliminate or delay the symptoms of cardiac and vascular impairments. They act by performing some cardiovascular and renal actions such as: natriuresis; increase of glomerular filtration; systemic vasodilation; inhibition of renin release; reduction of left ventricular remodeling; reduction of venous and “wedge” pressure.These drugs must be able to attain, extend, and stabilize neuro-hormonal, hemodynamic and clinical improvements of symptoms of some cardiovascular disease, such as chronic heart failure, myocardial infarction or systemic hypertension. In future, these drugs will become more and more important, because they act by addressing common cardiovascular symptoms through endogenous principles, which allows resolution of symptoms or retard progression of symptoms without adverse side effects.

Diverticular disease of the colon is a common benign condition. The majority of patients with diverticular disease are asymptomatic and are managed non-operatively, however complications such as perforation, bleeding, fistulation and stricture formation can necessitate surgical intervention. A giant colonic diverticulum is defined as a diverticulum larger than 4 cm in diameter. Despite the increasing incidence of colonic diverticular disease, giant colonic diverticula remain a rare clinical entity.This is the first reported case of laparoscopic-assisted resection of a giant colonic diverticulum. We discuss the symptoms and signs of this rare complication of diverticular disease and suggest investigations and management. Reflecting on this case and those reported in the literature to date, we highlight potential diagnostic difficulties and consider the differential diagnosis of intra-abdominal gas-filled cysts.The presence of a giant colonic diverticulum carries substantial risk of complications. Diagnosis is based on history and examination supported by abdominal X-ray and computed tomography findings. In view of the chronic course of symptoms and potential for complications, elective surgical removal is recommended. Colonic resection is the treatment of choice for this condition and, where possible, should be performed laparoscopically. Diverticular disease of the colon is a common benign condition that occurs in excess of 60% in those aged over 70 years ,2. It isAbout 5% of patients who have symptomatic diverticula experience complications such as perforation, bleeding, fistulation and stricture formation which can necessitate surgical intervention.A giant colonic diverticulum (GCD) is defined as a diverticulum larger than 4 cm in diameter . The meaThe presentation of GCD is variable, ranging from the asymptomatic patient 4%) to a host of non-specific gastrointestinal (GI) symptoms with only 10% of patients presenting with an abdominal mass % to a ho.Despite the increasing incidence of colonic diverticular disease, GCD remains a rare clinical entity . We repoA 53-year-old white Italian man initially presented to gastroenterologists with a 5-week history of dyspepsia, epigastric pain and a palpable mass in the left hypochrondrium. There was no history of anorexia, dysphagia, weight loss, change in bowel habit or gastrointestinal blood loss. His past medical history included early Alzheimer’s disease and discoid lupus.Examination revealed a well circumscribed, mobile mass in the left hypochrondrium extending above the level of the ribs raising the possibility of an enlarged spleen. There was no palpable lymphadenopathy.A blood film showed atypical myelomonocytic cells but a subsequent bone marrow aspiration was normal. All other routine blood tests were within normal limits. An abdominal ultrasound scan demonstrated a normal spleen and a separate gas-filled cyst in the left hypochondrium.Over the next few weeks, the patient developed diarrhoea and lost 3 kg in weight. He reported that the mass appeared to be fluctuating in size.An abdomen computed tomography (CT) scan demonstrHe was referred to colorectal surgeons and a barium enema was performed to further assess the extent of the diverticular disease. This confirmed moderate sigmoid diverticulosis but did not demonstrate direct communication between the colon and the giant cyst . The diaA laparoscopic-assisted sigmoid colectomy was performed 6 weeks later. Four 12 mm ports were inserted and pneumoperitoneum achieved. Three of the ports were positioned along the lateral edge of the right rectus abdominus muscle and triangulated to provide optimum access to the left colon. The fourth port was in the left iliac fossa. The large cystic structure was clearly visible in the left hypochondrium at the apex of a long mobile loop of sigmoid colon on the anti-mesenteric border . The remThe patient made an excellent postoperative recovery and was discharged on the fourth postoperative day.et al. [Macroscopic assessment of the segmental colonic resection confirmed the presence of diverticular disease with an associated giant cyst measuring 11 cm in maximal diameter. The wall of the cyst measured 0.6 to 1 cm in thickness. Microscopically, it did not contain any elements of bowel wall and instead was composed of reactive scar tissue with foreign body type giant cell reaction. The presence of plant material admixed with inflammatory debris was thought to be indicative of faecal matter and suggested a direct communication between the cyst and bowel lumen. However, this was not identified histologically. There was no evidence of dysplasia or malignancy. In accordance with the classification suggested by Steenvoorde et al. , the histh century [Diverticular disease of the colon is a significant cause of morbidity and mortality in the western world and its frequency increased throughout the whole of the 20 century ,8. Since century ,8.GCDs are defined as those that are larger than 4 cm in diameter and withAs in our patient, it is not unusual for these patients to undergo multiple investigations before making the correct diagnosis. Plain supine abdominal X-ray is the simplest and most readily available investigation and should be used as the first line in suspected cases. If a large air filled structure with or without fluid levels is visualised then an abdominal CT scan would be indicated. Barium enema failed to demonstrate a communication between the giant diverticulum and the colon in approximately one-third of reported cases ,4. It isThe use of abdominal ultrasound has been reported to be helpful in only 25% of cases . Early cThe role of colonoscopy in diagnosing GCD is limited. The ostium between the diverticulum and the colon is frequently too small to be detected ,2,4 and et al. suggested a histological classification of GCD based on three subtypes to a host of gastrointestinal symptoms including abdominal pain (68%), constipation (18%), rectal bleeding (13%), vomiting (12%), abdominal distension (11%), diarrhoea (11%) and abdominal mass (10%) [% to a hoThe presence of a GCD carries substantial risk of complications 12% to 19%) including inflammation, perforation, abscess formation, fistula formation, urinary obstruction , volvulu2% to 19%In view of the chronic course of symptoms and potential for complications, elective surgical removal is recommended . Colonic