Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Anopheles gambiae complex is well documented in Africa, a continuous map of the spatial distribution of the chromosomal forms of An. gambiae s.s. is not yet available at country level to support control efforts.Maps of the distribution of malaria vectors are useful tools for stratification of malaria risk and for selective vector control strategies. Although the distribution of members of the An. gambiae s.s. based on their relative frequencies in relation to climatic and environmental factors in Mali.Bayesian geostatistical methods were used to produce continuous maps of the spatial distribution of the chromosomal forms of The maps clearly show that each chromosomal form favours a particular defined eco-climatic zone. The Mopti form prefers the dryer northern Savanna and Sahel and the flooded/irrigated areas of the inner delta of the Niger River. The Savanna form favours the Sudan savanna areas, particularly the South and South-Eastern parts of the country (Kayes and Sikasso regions). The Bamako form has a strong preference for specific environmental conditions and it is confined to the Sudan savanna areas around urban Bamako and the Western part of Sikasso region. The hybrids/recombinants favour the Western part of the country (Kayes region) bordering the Republic of Guinea Conakry.The maps provide valuable information for selective vector control in Mali (insecticide resistance management) and may serve as a decision support tool for the basis for future malaria control strategies including genetically manipulated mosquitoes. Malaria remains one of the main public health problems in Africa and researchers are developing new vector control methods focused on the genetic manipulation of mosquitoes. The principles of the genetic control methods are based on the propagation of sterility or other desirable genetic factors in successive generations of mosquitoes ,2. The mAn. gambiae s.s. occur sympatrically but are segregated environmentally [An. gambiae s.s chromosomal forms [The distributions of mosquito species are related to climate, and in West Africa, it appears that the different chromosomal forms of mentally -9. In Weal forms . Similaral forms and Nigeal forms . In addial forms .An. gambiae complex is composed of An. arabiensis, and An. gambiae s.s Three chromosomal and two molecular (M and S) forms of An. gambiae s.s. have been described and coexist [An gambiae s.s. in Mali was also observed [In Mali, the coexist ,14-16. T coexist . Analysi coexist . Variatiobserved .kdr) allele in the para sodium channel gene, which confers resistance to pyrethroid insecticides, is found in the S-molecular form, but could not be detected in the M-molecular form populations from the same localities [An. gambiae s.s. with climate and environmental factors, and to produce continuous maps of their spatial distribution.The ecological distribution of each chromosomal form seems to be related to a particular epidemiological pattern of the disease. The knock down resistance of 13,000,000 inhabitants. It is drained by two major rivers and has 4 distinct eco-climatic zones: i) Southern Sudan savanna with an annual rainfall of 1300–1500 mm from May to October and mean annual thermal amplitude (difference between the mean maximum and the mean minimum temperature) of 5 to 6°C; ii) Northern Sudan savanna with about 700–1300 mm annual rainfall distributed over 4 to 5 months; iii) Sahelian zones with 200–700 mm of annual rainfall distributed over three months and mean annual thermal amplitude of about 12°C; iv) Sub-Sahara zone with less than 200 mm of annual rain and 16°C of annual average thermal amplitude.An. gambiae s.l. and An. funestus. An. gambiae s.l. is composed of An. arabiensis and three chromosomal forms of An. gambiae s.s named Bamako, Mopti and Savanna [Mali is a relatively flat country, altitudinal variations are minimal, ranging from 200 to 350 m above sea level. There are two main seasons varying in length according to latitude: a dry season (November–April) and a rainy season (May–October) characterized by lower temperatures and an increase in humidity. Except for the Sahara desert, the country is entirely endemic for malaria (hyperendemic to hypoendemic from South to North). The main malaria vectors are Savanna .An. gambiae s.s. in Mali were collated from cross-sectional and longitudinal surveys carried out between 1981 and 2004 by the Malaria Research and Training Centre (MRTC), University of Bamako, Mali. Most surveys were conducted during the wet season (June–October). Survey sites were mainly small human settlements from 79 distinct rural sites representing various eco-climatic zones of Mali. Because of small distances separating some collection sites, data were aggregated resulting in a set of 71 locations. The database included data collected on i) the total number of An. gambiae s.s. specimens, ii) the count of chromosomal forms, and iii) the survey period (month and year). Mosquitoes were collected and processed across surveys following a standardized method to ensure data consistency. Identification of chromosomal forms was by cytogenetic method [All available published and unpuc method ,23.The climatic and environmental variables which were used in this study included temperature, rainfall, normalized difference vegetation index (NDVI), distance to water bodies, soil water storage (SWS), land use, agro-ecological zones (AEZ) and suitability for malaria transmission. The last one is a binary variable defined from environmental factors related to malaria transmission with cut-off values . The datFor each location, temperature and rainfall data were available as monthly long term averages. NDVI data were also summarized by monthly long term averages of the original decadal values during the period between 1985 and 1995. The agro-ecological zones (AEZ) were distinguished on the basis of the length of the crop growing period and were defined as follow: Equatorial Forest zone (> 270 days), Guinea savanna zone (165 – 270 days), Sudan savanna zone (90 – 165 days) and the Sahelian zone (< 90 days). In Mali only the last three AEZ are found.An. gambiae s.s with climatic and environmental factors. The multinomial outcome data represent the following four chromosomal forms: Mopti, Bamako, Savanna, and others (hybrids Bamako-Savanna and Savanna-Mopti). The Mopti form was considered as the baseline category. The mosquito data obtained at a specific location were linked to the environmental and climate data by drawing a buffer of 2 km around each location and calculating the environmental value by the average of environmental values of all pixels in this buffer.Bivariate multinomial regression models were fitted in STATA 9.0 to assess the association between the relative frequencies of chromosomal forms of To take into account the possible lag time between the rainfall and NDVI with the mosquito abundance , four suTwenty six thousand three hundred twenty eight mosquitoes (26328) were assigned to one of the 3 chromosomal forms: Mopti, Bamako, and Savanna that represented 57.1%, 19.0% and 18.6% of the chromosomally identified mosquitoes, respectively. The remaining 5.3% were hybrids of Mopti-Savanna or Savanna-Bamako and the recombinants . They may not reflect the exact situation – which is temporally dynamic – because (i) data were obtained from cross-sectional surveys carried out during a single point of time, and (ii) Long term averages of climatic and environmental factors were used because some of these factors were not available during the survey times. Despite the long duration of the data collection, standardized techniques were used for sampling and processing mosquitoes across surveys rendering the mosquito database consistent.The predicted maps of the different chromosomal forms of The analysis of the observed data showed that at least two of the chromosomal forms were sympatric in each of the three eco-climatic zones of Mali. The Mopti chromosomal form was prevalent in all eco-climatic zones indicating that this type can easily adapt to different environmental and climatic conditions. Its chromosomal arrangement bc/bc and u/u may play an important role in its adaptation to diverse environment . Indeed,The spatial distribution maps clearly show that, in spite of their sympatry, the spatial distribution of the different chromosomal forms is not random. Each chromosomal form favours a particular defined eco-climatic zone as reported by previous studies ,10,15,27The hybrids/recombinants Figs , 9 are oAn. gambiae s.s. chromosomal form distribution produced so far was for West Africa [An. gambiae s.s. chromosomal form spatially-continuous distribution for Mali. Based on current knowledge on vector resistance to pyrethroids in Mali [kdr gene – is more abundant in the southern part of the country, particularly in Sikasso and Kayes regions. Although any vector control by means of insecticides must be accompanied by a resistance monitoring system, particular attention must be paid to the southern part of the country.The only spatially-continuous map of t Africa . Our int in Mali , these mThe maps may also be useful for planning future implementation of malaria control by genetically manipulated mosquitoes. However, more bio-ecological and gene flow studies among the different chromosomal forms are needed before undertaking any field implementation of control by genetically manipulated mosquitoes. In addition, temporal distribution maps of the chromosomal forms would be useful to complete the stratification for targeted vector control. Indeed, in areas where the chromosomal forms occur sympatrically; their relative frequencies change seasonally, most likely in response to annual fluctuations in climate . HoweverAn. gambiae s.s. chromosomal form in Mali. The maps provide valuable information for selective vector control in Mali (insecticide resistance management) and may serve as a decision support tool for the basis for future malaria control strategies including genetically manipulated mosquitoes.Our study represents more finely resolved spatially-continuous distribution maps of The authors declare that they have no competing interests.NS, PV, and MMB conceived the study. PV, LG, and NS performed the statistical analysis. NS has written the ms with input from PV, TS, SD, and SFT. GD and YTT provided vector data. TS and YTT oversee the work. All authors read the final version and approved it.Geostatistical multinomial regression model. The data provided represent the formulation of the spatial statistical model and the model fit.Click here for file

Protected areas are the first, and often only, line of defense in efforts to conserve biodiversity. They might be detrimental or beneficial to rural communities depending on how they alter economic opportunities and access to natural resources. As such, protected areas may attract or repel human settlement. Disproportionate increases in population growth near protected area boundaries may threaten their ability to conserve biodiversity.Using decadal population datasets, we analyze population growth across 45 countries and 304 protected areas. We find no evidence for population growth near protected areas to be greater than growth of rural areas in the same country. Furthermore, we argue that what growth does occur near protected areas likely results from a general expansion of nearby population centers.et al., who claim overwhelming evidence for increased human population growth near protected areas. To understand the disagreement, we re-analyzed the protected areas in Wittemyer et al.'s paper. Their results are simply artifacts of mixing two incompatible datasets. Protected areas may experience unusual population pressures near their edges; indeed, individual case studies provide examples. There is no evidence, however, of a general pattern of disproportionate population growth near protected areas.Our results contradict those from a recent study by Wittemyer Protected areas are often the primary defense against species extinctions and habitat loss Many argue that protected areas are detrimental to rural development by excluding people from traditional lands and further marginalizing them by denying access to natural resources Others suggest that protected areas provide benefits for rural communities et al.Wittemyer et al. used to generate the study's results and this discrepancy is sufficient to explain their results.Using a more spatially explicit approach, we re-analyzed population growth around protected areas. There is no evidence to support disproportionate population growth near protected areas. There are systematic differences between the two independent datasets Wittemyer et al.) and calculate the population densities within these annuli. This technique is necessary to avoid inherent problems with creating a single buffer, as doing so ignores events immediately outside the buffer. et al. highlighted the area in their study and we have extensive experience working there.Using methods we employ elsewhere inside park boundaries (as in Kafue), but here data are very sparse and prone to measurement error. Our results for Kafue NP contradict those of Wittemyer et al.'s. We provide an explanation for this disagreement presently.It is difficult to convey results for all 304 protected areas in the same manner as et al., but match our previous results on land use changes near parks If one assumes that protected areas draw people to them, then population growth of the 0–10 km buffer minus that in the 10–20 km buffer should be greater than zero. As found for Kafue, and shown for all 304 protected areas in Although we find no evidence that population growth is disproportionate near protected area boundaries, populations are indeed growing. This is inevitable as human population continues to expand worldwide. Here it is the mechanism of the growth that matters, and again, Kafue NP provides an example . If ruraInstead, what one sees around Kafue NP follows well-understood features of human demography. What growth does occur in buffers is often from the growth of existing population centers incidentally expanding towards protected areas. et al. found spurious results, we repeated their analysis as best we could. Using their methodology, we closely matched their results and found 253 of 304 (83%) parks with higher growth in the buffers (obtained from one data set) compared to rural growth (from the other). This compares well with Wittemyer et al.'s 245 of 306 (80%) parks.To understand why Wittemyer et al. calculated population growth rates near protected areas using geographically explicit data et al.'s supplemental materials These results are artifacts of mixing two incompatible datasets. Wittemyer et al.'s results could have been no other way.Using a global map of urban and rural extents, it is possible to mask out areas identified as “urban” in the geographically explicit data et al. found a similar correspondence , and used this highly significant correlation to justify mixing the two datasets.As UN-supplied rural growth rates increase, so too did those from the country's synoptic data on rural growth et al.'s results.Unfortunately, what is needed here is not simply a strong correlation but a one-to-one correspondence. et al.'s analysis, calculating both rural and buffer growth rates from et al.'s main results. Using incompatible datasets, they found buffer growth to be higher than rural growth for 245 of 306 (80%) parks and 38 of 45 (84%) countries. In We then repeated Wittemyer et al.'s counter-result is methodologically flawed.Do protected areas, and their perceived benefits, attract people to them? The question is of utmost importance. Conservation efforts can draw both positive and negative actors to the scene. In a manner similar to locating the last remaining population of an endangered species, the creation and funding of a protected area could potentially cause more harm than ignoring the area altogether 2/census unit. Some countries, such as Chad and Angola, have much lower resolutions . While individual maps appear highly resolved, much of this cancels out when one divides the two datasets to calculate growth rates. Maps of growth collapse to the coarse level of census unit or lower, calling into question the suitability of these modeled population datasets for fine spatial-scale analyses. As these numbers show, the data are likely too sparse to draw fine-scale conclusions about population growth. In contrast, our analyses of land-use changes are consistently of 1 km2 resolution The geographically explicit data are not raw population counts, but predictions from a complex model that, in perhaps indirect and complex ways may include the proximity of a park boundary as a factor. Original population data comes from the level of census unit. The average resolution for all African countries (excluding South Africa) is 82 kmMore generally, the scarcity of suitable datasets poses a challenge for conservation When assessed using much finer-scale metrics such as land-cover, we find that protected areas perform admirably 2). We used ArcGIS 9.1 to harmonize projections, cell size, and extent across datasets. We carried out all further analyses in R 2.6.All datasets are global in scale, in raster (grid) format, and projected into Albers Equal Area projection at a resolution of 5km grid square or World Heritage Sites. They also excluded protected areas with no people in the 10 km buffer zone at the time of protected areas establishment, or with urban settlements greater than 1000 people.We obtained information on park location from the 2007 World Database on Protected Areas et al.'s results, we obtained country-specific rural growth rates from et al. provide further details of the analysis in their supplemental materials We calculated human population growth rates using decadal modeled population datasets for Africa et al.'s analysis, we followed their methodology of calculating population growth inside the 0–10 km buffer using the decadal datasets We then created 10 km wide annuli in and around each protected area, from 20 km inside the protected area to 50 km outside. Using the decadal datasets, we were able to calculate growth rates at ten-year intervals for each of the annuli. We obtained the annual growth rate by dividing the total growth rate by the number of years the analysis encompassed. In order to summarize these results, for each protected area we then divided the growth rate in the 0–10 km buffer by the growth rate in the 10–20 km buffer. Values greater than one indicate higher population growth near protected areas than away. When repeating Wittemyer

Systematic approaches for identifying proteins involved in different types of cancer are needed. Experimental techniques such as microarrays are being used to characterize cancer, but validating their results can be a laborious task. Computational approaches are used to prioritize between genes putatively involved in cancer, usually based on further analyzing experimental data.We implemented a systematic method using the PIANA software that predicts cancer involvement of genes by integrating heterogeneous datasets. Specifically, we produced lists of genes likely to be involved in cancer by relying on: (i) protein-protein interactions; (ii) differential expression data; and (iii) structural and functional properties of cancer genes. The integrative approach that combines multiple sources of data obtained positive predictive values ranging from 23% (on a list of 811 genes) to 73% (on a list of 22 genes), outperforming the use of any of the data sources alone. We analyze a list of 20 cancer gene predictions, finding that most of them have been recently linked to cancer in literature.Our approach to identifying and prioritizing candidate cancer genes can be used to produce lists of genes likely to be involved in cancer. Our results suggest that differential expression studies yielding high numbers of candidate cancer genes can be filtered using protein interaction networks. Tumor development results from a progressive sequence of genetic and epigenetic alterations that promote the malignant transformation of the cell by disrupting key processes involved in normal growth control and tissue homeostasis . Since cThe completion of the human genome project and the development of high-throughput experimental techniques have enabled new approaches for studying cancer. For example, gene-expression profiling using microarrays has improved the classification of some tumor types ,5. MoreoProtein interaction networks are a useful tool for better understanding the biology of the cell -15. MoreGene expression profiling with DNA microarrays is a powerful approach for identifying cancer genes. Numerous studies have presented analyses of human cancer samples in which they identify gene expression signatures for different cancer types and subtypes -24. In tet al. [In order to improve the candidate gene selection process, several works have combined gene expression with other types of genomic data ,33. One et al. , insteadet al. ,37.Here, we have implemented a systematic approach for identifying genes (and gene products) involved in cancer. Our method produces lists of reliable candidate cancer genes by combining (i) a list of known cancer genes ; (ii) prWe were interested in assessing different methodologies for identifying cancer genes. Specifically, we tested the use of (i) protein interaction networks; (ii) microarray differential expression data; (iii) structural, functional and evolutionary properties of genes; and (iv) an integration of the three previous type of data. For the evaluation, we relied on a cancer gene list compiled from a variety of curated lists, cancer and sarcoma reviews, and Entrez Gene queries, followed by additional curation (Materiathreshold to the percentage of cancer genes in 1000 random samples of N proteins with at least one interaction in PIANA (N being the number of proteins with CLD ≥ threshold).We assessed the use of protein interaction networks for predicting cancer genes. We hypothesized that proteins whose partners have been annotated as cancer genes are likely to be cancer genes as well: if a mutated gene is perturbing a pathway related to cancer (e.g. growth control), mutations to interaction partners are also likely to perturb the same pathway. As corollary, proteins with many interactions with cancer genes should be more likely to be involved in cancer than proteins with just one cancer gene partner. We used the PIANA tool to buildp-value < 2.2 × 10-16).Furthermore, we used the cancer linker degree of proteins to predict cancer genes (Methods), obtaining a positive predictive value of ~54% at sensitivity of ~10% Figure . We studp-value of 4.8 × 10-14 and p-value < 2.2 × 10-16, respectively), concluding that the literature bias does not invalidate our initial hypothesis. Besides, similarly to previous studies [The CLD of a protein depends on the number of interactions that have been reported for the protein and thus, it might be influenced by how much interest has been placed on a protein by the research community. To exclude this potential bias we calculated the cancer linker degree of proteins i) using only interactions from high-throughput studies (i.e yeast two hybrid and affinity purification systems); and ii) using all interactions in PIANA except for those in the Human Protein Reference Database , which i studies ,42, we oWe evaluated the use of differential expression data to predict cancer genes. We based our study on Oncomine lists ofMoreover, we studied the effect of looking at over- and under-expressed genes by their differential expression rank in a given experiment (Methods). For each differential expression study, we calculated the enrichment of cancer genes among i) the 100 most differentially expressed genes; and ii) all differentially expressed genes. None of the 24 experiments tested showed a significant increase in positive predictive value when restricting the predictions to the 100 most differentially expressed genes. These results suggest that the number of cancer types in which a gene is observed differentially expressed is a better strategy for predicting cancer genes than using its differential expression rank.p-value of 1.1 × 10-10).Cancer genes have been shown to have common structural, functional and evolutionary properties ,37 and t-16), but significantly lower than for proteins with CLD ≥ 20 . Furthermore, known cancer genes are found over- or under-expressed in an average of 2.8 cancer types.We were interested in examining the relationship between the cancer linker degree (CLD) of a protein and the number of cancer types in which its corresponding gene was differentially expressed. If proteins with high CLD tended to be differentially expressed in more cancer types than other proteins, that would suggest an involvement of high-CLD proteins in cancer. We observed that proteins with high CLD are significantly more likely to be found differentially expressed in multiple cancer types than the average protein in the dataset Figure . For exa-9) but significantly lower than for proteins with CLD ≥ 20 . The lower SF-Probability of proteins with very high CLDs is explained by the few cases found with multiple interactions to known cancer genes. These results suggest that proteins with interactions to cancer genes show structural, functional and evolutionary properties similar to cancer genes.We tested the correlation between the cancer linker degree (CLD) of proteins and their probabilities of being cancer genes according to their structural, functional and evolutionary properties (SF-Probabilities). We observed a significant difference between the SF-Probabilities of random proteins from the database (i.e. proteins with CLD ≥ 0) and the SF-Probabilities of proteins with interactions to cancer genes Figure . For exap-values of 0.003, 1.53 × 10-11 and 5.97 × 10-13, respectively).We evaluated the approach that predicts cancer genes by taking into account three different methodologies: 1) the cancer linker degree (CLD) of proteins; 2) the number of cancer types in which a gene appears differentially expressed with respect to normal tissue; and 3) the probability of being a cancer gene according to structural, functional and evolutionary properties (SF-Probability) . First, The procedure followed to predict cancer gene candidates consists of four steps , predicted by the method to be a cancer gene, has been recently added (in a date subsequent to the creation of our list of known cancer genes) to the Sanger Cancer Gene Census [Syk, with a cancer linker degree of 17, found differentially expressed in 4 types of cancer and with a SF-Probability of 0.99, is a positive effector of BCR-stimulated responses [mst1r, involved in breast cancer [srf is a nuclear repressor of Smad3-mediated TGF-beta signaling [surb7 and kin27 were not found to be involved in cancer according to the literature and thus we suggest future experimental studies to focus on evaluating their potential involvement in cancer. Literature references for each cancer gene candidate found to be involved in cancer are provided as Additional file We provide the complete list of human cancer gene candidates for which at least one type of data indicated a relationship to cancer or are ignaling , which iWe analyzed the use of three different criteria for predicting cancer gene candidates and concluded that: (i) the number of interaction partners of a protein that have been previously annotated as cancer gene (i.e. the cancer linker degree) is a good indicator of the likelihood of the protein to be involved in cancer; (ii) using differences in gene expression between normal tissue and cancer identifies many known cancer genes, but many non cancer genes as well; and (iii) probabilities based on structural, functional and evolutionary properties of known cancer genes (i.e. SF-Probabilities) are useful for filtering false positives from other cancer gene prediction methods. Moreover, we implemented and evaluated a method that integrates these criteria to produce reliable lists of cancer gene candidates, obtaining a positive predictive value of 73% when using very restrictive thresholds. Finally, we provided lists of cancer gene candidates and analyzed them using literature sources and information from public repositories, showing that our predictions are reliable.Most methods used for predicting or prioritizing cancer gene candidates are biased towards genes that are well annotated and/or familiar to the researcher. This leaves unexplored many potential cancer gene candidates. However, high throughput genomic and proteomic work has now yielded relatively unbiased, although noisy, genome- and proteome-wide data sets. For example, expression studies produce large lists of over- and under-expressed genes, which are then prioritized by their differential expression rank, usually with help of a limited number of literature searches. Our integrative approach to finding cancer gene candidates can be used to obtain unbiased lists of cancer gene candidates by using the cancer linker degree of proteins to filter expression studies. We observed that the low positive predictive value obtained when using differential expression data alone (around 15% for most cancer types in our study) shows a four-fold increase when combined with protein-protein interaction data. We expect that further experimental study of our proposed cancer gene candidates will find useful the methodology presented in this work.Separately, each of the criterion presented here for cancer gene candidate prediction has its limitations. First, methods based on protein interaction networks are limited by the fact that many cancers are the result of perturbations in the regulation of genes, which is not captured by protein-protein interaction data. Second, differential expression based methods have the drawback that many differentially expressed genes are not a cause for the cancer but rather a consequence of it. Besides, we are mapping expression levels of mRNA onto a network of protein interactions. However, it is known that the mRNA expression levels do not always match the protein expression levels . FinallyOur reported performance results on the use of SF-Probabilities differ markedly from the evaluation presented by Lopez-Bigas and coworkers . We attrThe methods presented here were evaluated by comparing their cancer gene predictions with a curated list of oncogenes, tumor suppressors and stability genes . This liWe showed that the integration of multiple sources of data is more reliable for predicting cancer genes than the use of one single criterion. For example, differential expression studies could benefit from the use of protein-protein interaction data to further validate their results: in the best case scenario, combining the cancer linker degree of a protein with differential expression data increased from 17% to 73% the fraction of known cancer genes within the cancer gene candidates. In conclusion, systems capable of integrating all available sources of data are fundamental to the discovery of proteins involved in cancer.We downloaded cancer genes from the Memorial Sloan Kettering computational biology website CancerGenes as of JaWe used PIANA to integj is named "partners of pj". PIANA builds the network by retrieving direct interaction partners for an initial set of seed proteins (i.e. the proteins of interest).PIANA represents the protein interaction data as a network where the nodes are proteins and the edges interactions between the proteins. In such a network, a set of proteins linked to protein pp-values calculated using Student's t-test for two-class differential expression analyses. A detailed description of the normalization process and statistical tests used in Oncomine can be found in [We manually searched for gene expression studies between normal tissue and cancer in Oncomine , a cancefound in ,39.We used the probabilities of being a cancer gene calculated in for humaWe used PIANA to map eN, positives are proteins with CLD ≥ N. True positives are known cancer genes among positives. False negatives are known cancer genes whose CLD is lower than N. The positive predictive value is defined as the ratio between true positives and positives. Sensitivity is the ratio between true positives and the sum of false negatives and true positives. Positive predictive values and sensitivities are shown in Figure The cancer protein interaction network was built using PIANA by settiWe calculated how many over- or under-expressed genes were known cancer genes for each cancer type described on Additional file At any given SF-Probability threshold, positives are proteins with a SF-Probability above or equal to that threshold. Among positives, true positives are those that are known cancer genes. False negatives are known cancer genes not found above the SF-Probability threshold. Genes used for training the model in were disWe manually analyzed cancer gene predictions from Table The assessment on whether two binomial samples of observations are significantly different was calculated using Fisher's exact test on a 2 × 2 contingency table comparing the number of cancer genes and non-cancer genes between two groups (e.g. CLD ≥ 10 versus CLD ≥ 1). The assessment on whether a distribution of averages on the number of cancer genes calculated on random samples is significantly different from a given ratio of cancer genes was calculated using the Wilcoxon signed rank test (e.g. ratio of cancer genes found on the 5537 proteins with CLD ≥ 1 versus 1000 averages extracted from random samples of size 5537). The assessment on whether two non-Gaussian samples of observations (SF-Probabilities or number of cancer types grouped by proteins with the same CLD) come from the same distribution was calculated using the Mann-Whitney U two-sided test. Differences in the observations were considered significant for p-values lower than 0.05. All tests were performed using the implementation provided by R ..We provide the complete list of human genes with the corresponding cancer gene prediction scores according to each type of data at RA conceived of the idea and performed research; BO and CS provided scientific guidance. RA drafted the manuscript. BO helped to draft the manuscript. All authors read and approved the final manuscript.Positive predictive value and Sensitivity obtained when predicting cancer genes based on cancer linker degree of proteins measured on the cancer protein interaction network built from all interactions in PIANA, where the cancer protein interaction network has been built from the cancer gene list obtained from randomly removing 10%, 25%, 50% and 75% of genes from the complete list of known cancer genes.Click here for filePositive predictive value and Sensitivity obtained when predicting cancer genes based on cancer linker degree of proteins measured on the cancer protein interaction network built from all interactions in PIANA, where the cancer protein interaction network has been built from the cancer gene list obtained from Aouacheria et al. .Click here for filePositive predictive value and Sensitivity obtained when predicting cancer genes based on cancer linker degree of proteins measured on the cancer protein interaction network built from high-throughput interactions in PIANA. High-throughput interactions were obtained by querying PIANA to retrieve all interactions detected by means of yeast two hybrid and affinitity purification systems.Click here for filePositive predictive value and Sensitivity obtained when predicting cancer genes based on cancer linker degree of proteins measured on the cancer protein interaction network built from all interactions in PIANA except for those coming from the Human Protein Reference Database (HPRD). HPRD is a manually curated database with interactions extracted from literature [terature . By exclClick here for filePositive predictive value and Sensitivity obtained when predicting cancer genes based on the total number of interaction partners of a protein. We observed a clear increase of involvement in cancer for proteins with many interaction partners with respect to those with just a few partners. However, the total number of partners of a protein is a worse indicator of being a cancer gene than the cancer linker degree of a protein , the number of cancer types in which it appears differentially expressed and its probability of being a cancer gene according to structural, functional and evolutionary properties (SF-Probability).Click here for fileSources of information for analysis of candidate cancer genes in Table 4of the article. For each cancer gene candidate in Table Click here for file

The mol­ecule inter­acts with the solvent water and dimethyl­formamide mol­ecules through N—H⋯O and O—H⋯O hydrogen bonds to form a three-dimensional supra­molecular network. The metal atom lies on a center of inversion.The title compound, [Ni(C H-benzimidazole-5,6-dicarboxyl­ate complexes, see: Gao et al. 2(H2O)4]·2C3H7NO·2H2O = 0.037 wR(F 2) = 0.137 S = 1.20 2737 reflections217 parameters9 restraintsH-atom parameters constrainedmax = 0.61 e Å−3 Δρmin = −0.32 e Å−3 Δρ RAPID-AUTO (Rigaku, 1998RAPID-AUTO; data reduction: CrystalStructure (Rigaku/MSC, 2002SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEPII (Johnson, 1976SHELXL9.Data collection: 10.1107/S1600536809038069/ng2646sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809038069/ng2646Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Adjacent Sn atoms are bridged by coordination to the two O atoms of each 1,1′-binaphthyl-2,2′-diyl phospho­nate ligand, forming a one-dimensional chain structure parallel to the b axis.In the title polymeric coordination compound, [Sn(CH DOI: 10.1107/S160053680905291X/sj2705Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Tetrodotoxin and saxitoxin are small, compact asymmetrical marine toxins that block voltage-gated Na channels with high affinity and specificity. They enter the channel pore’s outer vestibule and bind to multiple residues that control permeation. Radiolabeled toxins were key contributors to channel protein purification and subsequent cloning. They also helped identify critical structural elements called P loops. Spacial organization of their mutation-identified interaction sites in molecular models has generated a molecular image of the TTX binding site in the outer vestibule and the critical permeation and selectivity features of this region. One site in the channel’s domain I P loop determines affinity differences in mammalian isoforms. Tetrodotoxin (TTX) and saxitoxin (STX)—guanidinium toxins—are potent and potentially lethal marine toxins with features that have been of great value to ion channel research. The two toxins are small molecules with similar structural properties and they block voltage-gated Na channels competitively. Because of their specificity for Na channels they allow separation of Na currents from other ionic currents in native cells. They are so called because they both have guanidinium moieties and are consequently both positively charged at neutral pH. The early history and chemistry of these toxins has been amply described in a review by Kao and in aAfter Narahashi and colleagues ,4 had shGuanidinium ions are (slightly) permeable, implying that they can interact within the pore as deep as the selectivity filter. TTX and STX, although somewhat larger than guanidinium ions, have guanidinium moietie(s), plausibly allowing them to reach the narrowest part of the pore and interact with the selectivity filter, but block because they are too large to pass through .Protons and the guanidinium toxins both have positive charges. Protons reduce both Na permeation and TTX block . Their b+ with minimal energy exchange and to permit it to distinguish between that ion and K+. TTX block is antagonized irreversibly by treatment with carboxyl-modifying agents [The selectivity filter is presumed to contain carboxylates in order to facilitate dehydration of Nag agents –12.2+ competes with TTX/STX and it blocks within the membrane electric field at the same apparent depth as TTX/STX.TTX binding is antagonized by small cations, some of which are permeant ,14. For These arguments are all inferential, but they have been valuable guides to experimental study of the toxin binding site.2+, that it is genetically different from the Nav family, and that it is nevertheless blocked by TTX [The specificity of TTX for voltage-gated Na channels has been challenged by a suggestion that there is a cardiac Na channel with substantial permeability for Cad by TTX ,16. Thisd by TTX .The argument that TTX and STX achieve their block by occluding the outer pore was plausible but the evidence was circumstantial, and interference with channel gating is a logical alternative idea for the mechanism of block. TTX/STX block is somewhat use-dependent, which means that with repeated stimulation the block is enhanced about 3-fold . The preTTX carries one positive charge and STX carries two positive charges. To the extent that this charge enters the membrane electric field as it binds to its site in the pore , and th [et al. ,33. Subs [et al. has listCloning identified the ~2,000 amino acid residue primary sequence of the Na channel isoforms. Although only a few intrinsic membrane proteins had been structurally determined by that time, the patterns from them and from general rules of protein structure were helpful for predicting the Na channel secondary and tertiary structures . Three fet al. [The initial model of membrane topology of the Na channel by Noda et al. was confet al. . However+ selectivity, the characteristic that defines Na channels. Each domain contained a different SS2 sequence, but the domain’s sequence was shared between isoforms. The SS2 segments included multiple carboxylates, which met the requirements of Hille’s suggestion [During examination of the sequences of the S5-S6 regions, Guy and Seetharamulu proposedggestion for a reggestion ,39, whicggestion prescienet al. [Following the suggestion from modeling studies that the carboxylates in SS2 of the P loop were part of the narrow pore, Pusch et al. mutated et al. [et al. [4. Several of the adjacent uncharged residues were also changed, but with relatively little effect. Terlau et al. [et al. [et al. [et al. [The four P loops forming the pore’s outer vestibule contain multiple charged amino acids—six carboxylates and a lysine aligned into an inner ring and an outer ring (EE(M/D)D) . Noda etet al. demonstr [et al. showed tu et al. also mea [et al. , Chiamvi [et al. , Favre e [et al. . At this3 lower affinity for TTX than the three brain isoforms (Nav1.1–3) and the skeletal isoform (Nav1.4). In the domain 1 P loop sequence, where the toxins were thought to bind, there are two differences between these isoforms. The Nav1.5 sequence is DCWED, but Nav1.1–4 have an aromatic residue on place of the cysteine and an asparagine in place of the C-terminal aspartate. Several lines of evidence pointed to the aromatic residue as the basis of high TTX affinity for Nav1.1–4, as opposed to the aspartate, as the basis of Nav1.5 low affinity. The cardiac isoform is more sensitive to block by some divalent ions shows as much as 10s e.g., ,48), whi, whi3 los . Replacasing it . Comparaasing it , and comasing it . These set al. [50, kon and koff of TTX block are compared in on’s were primarily responsible for the decreases in affinity. However, E755A did show a small increase in koff. The relative importance of the domains was different for the outer ring. The rank order for neutralization of outer ring residues of the domains was I ≫ II> IV, suggesting that Glu-403 of domain I was of major importance to TTX affinity. E403Q showed a ΔΔG of 5.2 kcal/mol, with ΔΔG’s of E758Q and D1532N smaller at 3.3 and 2.4 kcal/mol . AlthougThe model of the S5-P-S6 Na channel pore-forming unit of Nav1.4 was baseN-terminal segments of the S6 helices, which were located on the basis of the KcsA M1 and M2 main chains. As a result, each P loop formed densely packed contacts with the α-helices of S5 and S6 segments of its own domain and S6 of the neighboring domain. Assembly of the four P loop αβ-hairpins then formed the guanidinium toxin binding pocket. The retained interactions with the guanidinium toxins include the following features:In our model of the Na channel outer vestibule, the P loops of domains I–IV were docked into the extracellular part of the inverted teepee formed by the C-terminal segments of S5 helices and the The 1,2,3 guanidinium group of TTX and the 7,8,9 guanidinium group of STX are directed into the pore, where they interact most strongly with Glu-755 of domain II and Asp-400 of domain I.The 1,2,3 guanidinium group of STX, which is located at right angles to the plane of the other guanidinium group in the rigid STX structure, interacts with Asp-1532 of domain IV.gem-diol, postulated to interact with Glu-758 of domain II.In the plane of the 1,2,3 guanidinium group on the opposite side of STX is a C-12 There is a strong nonbonded interaction between the aromatic ring of Tyr-401 of domain I and the nonpolar surface of TTX.3 instead of -CH2OH) have low binding Na channel affinity (about 0.01x) [2OH group.Kao and coworkers identifit 0.01x) ,63 that et al. [Yang et al. identifiet al. . Based oet al. [The optimal Tyr-401 - TTX interaction occurred with the nonpolar C4-C5-C7-C8 side of the toxin by van der Waals contacts. The calculated nonbonded interaction energy change with the Y401C mutation was 4.9 kcal/mol . This is compared to the 4.8 kcal/mol change measured experimentally with this mutation . The denet al. for bindThe calculated energies of interaction of Asp-400, Glu-755, Glu-758, and Asp-1532 with TTX were −4.0, −4.1, −3.6, and −2.2 kcal/mol. In this model the interactions with Asp-400 and Glu-755 are almost the same, while the experimental estimates show a noticeable difference: −3.3 and −5.4 kcal/mol . Howeveret al. [Santarelli et al. presenteet al. , ignoredet al. is an inet al. was not on, rather than increasing koff, implies that electrostatic orientation is a major part of the carboxylate contribution to binding orientation [Both the Lipkind-Fozzard and the Tikhonov-Zhorov models of TTX/STX binding assume that the outer vestibule is normally rigid. There are several pieces of experimental evidence that suggest that the outer vestibule is somewhat flexible. However, for purposes of interactions and site location, an induced fit between the toxin and the site is equally revealing. As already noted, any possible conformational change in the binding site has no significant effect on channel gating. Conformational changes during toxin binding would imply the existence of several stages in the binding process. Indeed, there are experimental results indicating that several stages in TTX/STX binding do occur ,68. Becaentation ,51, posientation and diffentation have proThe guanidinium toxins bind with high affinity deeply within the voltage-gated Na channel’s outer vestibule through multiple interactions to carboxylates and other residues. The binding is selective for voltage-gated Na channels, and this property has made radio labeled toxin crucial in the channel’s cloning. Binding produces complete block by interaction with the selectivity filter, while largely occluding the pore. Some isoforms have lower affinity. The best known example of this is the lower affinity for the cardiac Na channel, and this results from a cysteine just above the selectivity filter in that isoform, instead of an aromatic residue. The compact and rigid toxin structure has assisted molecular modeling of the channel’s outer vestibule, providing insight into the channel’s permeation and selectivity mechanisms. The toxins may eventually assist in direct structural studies of the voltage-gated Na channel.

Edinburgh Postnatal Depression Scale (EPDS) is an important screening instrument that is used routinely with mothers during the postpartum period for early identification of postnatal depression. The purpose of this study was to validate the Greek version of EPDS along with sensitivity, specificity and predictive values.120 mothers within 12 weeks postpartum were recruited from the perinatal care registers of the Maternity Departments of 4 Hospitals of Heraklion municipality, Greece. EPDS and Beck Depression Inventory-II (BDI-II) surveys were administered in random order to the mothers. Each mother was diagnosed with depression according to the validated Greek version of BDI-II. The psychometric measurements that were performed included: two independent samples t-tests, One-way analysis of variance (ANOVA), reliability coefficients, Explanatory factor analysis using a Varimax rotation and Principal Components Method. Confirmatory analysis -known as structural equation modelling- of principal components was conducted by LISREL . A receiver operating characteristic (ROC) analysis was carried out to evaluate the global functioning of the scale.8 (6.7%) of the mothers were diagnosed with major postnatal depression, 14 (11.7%) with moderate and 38 (31.7%) with mild depression on the basis of BDI-II scores. The internal consistency of the EPDS Greek version -using Chronbach's alpha coefficient- was found 0.804 and that of Guttman split-half coefficient 0.742. Our findings confirm the multidimensionality of EPDS, demonstrating a two-factor structure which contained subscales reflecting depressive symptoms and anxiety. The Confirmatory Factor analysis demonstrated that the two factor model offered a very good fit to our data. The area under ROC curve AUC was found 0.7470 and the logistic estimate for the threshold score of 8/9 fitted the model sensitivity at 76.7% and model specificity at 68.3%.Our data confirm the validity of the Greek version of the EPDS in identifying postnatal depression. The Greek EPDS scale could be used as a useful instrument in both clinical practice and research. The incidence of postpartum depression affects between 10% and 20% of new mothers and the clinical symptoms can appear as early as in the first weeks following delivery. However, postpartum depression often goes unrecognized with several consequences for the mother and the newborn .The Edinburgh Post Natal Depression Scale (EPDS) has been specifically developed in order to screen for postnatal depression . The EPDWith a cut-off score of 12/13 for screening English population it was reported sensitivity 86%, specificity 78%, Positive Predictive Value (PPV) 73% and alpha coefficient = 0.87 . AlthougIt has been observed through many validation studies that there is cultural variation in the expression of depressive symptoms during the postnatal period -10 that A recent study reported that Postnatal Depression in a Greek urban area had an overall prevalence of 19.8% and a point prevalence of 12.5% at the end of the first month after delivery . HoweverThe general aim of this study was to translate and validate this instrument into Greek. More specifically the study's objectives were to:1. Test a Greek version of the EPDS and assess its reliability and validity in identifying postpartum depression in a sample of new mothers.2. Examine the factor structure of Greek EPDS.3. Evaluate the sensitivity, specificity and predictive values of Greek EPDS over a range of cut-off scores.The 10 items of EPDS were translated by two independent bilingual translators. One other native English speaker who did not have knowledge of the original instrument then back translated the re-conciliated Greek version. The backward translation was sent to a group of English experts for comments . The translated questionnaire was culturally adapted through a cognitive debriefing process that was used to identify any language problems and to assess the degree of respondents understanding of the item's content that was meant to be elicited . During This study is part of a major project for translation and validation of screening instruments into the Greek language. After receiving ethical approval from the University of Crete, validation activities were initiated from June 2007 until February 2008. Following previous correspondence by mail and subsequent written informed consent, the mothers completed the EPDS and BDI-II questionnaires in the presence of a midwife (VV) at their homes or during their stay at the postnatal ward. The order of completion of the two questionnaires was counterbalanced; BDI-II was used in order to quantify the severity of any depressive symptoms. Along with the questionnaires there was a cover letter explaining the purpose of the study, providing the researchers' affiliation and contact information, and clearly stating that answers would be confidential and anonymity would be guaranteed in the final data reports.130 women were recruited from the perinatal care registers of the Maternity Departments of 4 Hospitals of Heraklion municipality (2 public and 2 private). Inclusion criteria were fluency in spoken and written Greek language between 4 days till 16 weeks postpartum delivery of a live healthy infant and written informed consent. In total 120 mothers agreed to participate (rate of attendance 92.3%).This is a 10-item self- report scale consisting of statements describing depressive symptoms. The 10 symptoms of depression included are: inability to laugh and look forward to things with enjoyment, blaming oneself unnecessarily, anxious or worried, scared or panicky, inability to cope, difficulty to sleep, sad or miserable, crying and thoughts of harming oneself. Each question has four possible answers, graded depending on the severity or duration of each symptom.The recent revision of the BDI was used . The BDIDescriptive characteristics were calculated for the sociodemographic variables. The assumptions of normality, homogeneity and independent cases of the sample were checked. Two independent samples t-tests were carried out to compare the EPDS scores in the groups of depressed and not depressed women according to BDI-II. Women were divided into four groups: no depressive symptoms (0-9) and those with mild (10-15), moderate (16-23) and severe (>24) depression symptoms. One-way analysis of variance (ANOVA) was used to compare the mean depression symptom levels - according to BDI-II scores- between the four groups of women.Reliability coefficients as measured by Cronbach's alpha were calculated for the EPDS and BDI-II in order to assess reproducibility and consistency of the instrument; the internal consistency of the Greek EPDS was also tested using Guttman split-half coefficients.The underlying dimensions of the scale were checked with an explanatory factor analysis using a Varimax rotation and Principal Components Method as a usual descriptive method for analyzing grouped data . Factor The meaning and acceptability of the items by the mothers were investigated by a community midwife during the administration of the scale.Finally, the validity of the EPDS in its Greek version - as a screening tool- was investigated considering the BDI-II diagnostic cut-off scores as a validated measure for classifying mother with depressive symptoms or with no depressive symptoms.Convergent validity requires that EPDS should correlate with related variables as BDI-II. Therefore, correlation coefficients (Pearsons and Spearman's rho) between global EPDS and BDI-II scores were estimated in order to determine the magnitude of the relationship between the two scales; correlation data for the two subscales -which have been revealed by factor analysis- were analysed in order to examine construct validity of the Greek EPDS.The sensitivity, specificity and positive and negative predictive values were calculated at several cut-off scores against BDI-II scale. A Receiver Operating Characteristic (ROC) analysis was carried out; this method allows display of all the pairs of sensitivity and specificity values achievable as the threshold is changed from low to high scores plotting the true-positive rate (sensitivity) on the vertical axis and the false - positive rate (one minus specificity) on the horizontal axis. The area under the ROC curve (AUC) is a quantitative indicator of the information content of a test and it may be interpreted as an estimate of the probability that a depressed mother chosen at random will, at each threshold, have a higher test score than a non-depressed mother.The response rate (99.7%) was very high. The sample demographic and obstetric characteristics are shown in Table Sixty (50%) mothers were considered to exhibit depressive symptoms on the basis of a BDI-II score more than 9; 8 (6.7%) of them were suffering from major depressive symptoms, 14 (11.7%) suffered from severe moderate depressive symptoms and 38 (31.7%) from mild depressive symptoms. The mean EPDS score was 10.42 (Std. Error 0.574 SD 4.447 CI 95% 10.994-9.846) in the depressed mothers and 5.9 (Std. Error 0.511 SD 3.956 CI 95% 4.88-6.92) in the non-depressed women. Levene's Test for equality of variances homogeneity (t = -5.878 df = 118 Sig.(2-tailed) = 0.0005).The group with depressive symptoms was divided in three subgroups according to their BDI-II scores. The mean EPDS score in mothers with mild depressive symptoms (n = 38) was 8.66 (Std. Error 0.601 SD 3.707 CI 95% 7.44-9.88), in those with moderate depressive symptoms (n = 14) was 12.21 (Std. Error 0.853 SD 3.191 CI 95% 10.37-14.06) and in those with severe depression symptoms (n = 8) was 15.62 (Std. Error 1.614 SD 4.565 CI 95% 11.81-19.44) . Since the number of comparisons is larger than 5, method Tukey Statistical Significant Difference was used in the following pairs:a. Non depressive symptoms - mild depressive symptoms, p < 0.004b. Non depressive symptoms - moderate depressive symptoms, p < 0.0005c. Non depressive symptoms - severe depressive symptoms, p < 0.0005d. Mild depressive symptoms - moderate depressive symptoms, p < 0.019e. Mild depressive symptoms - severe depressive symptoms, p < 0.0005f. Moderate depressive symptoms - severe depressive symptoms, p = 0.192The Greek EPDS showed a very high overall internal consistency . The internal consistency characteristics of Greek EPDS showed good reliability; Cronbach's alpha was 0.804 for the total scale (Items 1-10), Standardised alpha 0.805 and Guttman split-half 0.742.The exploratory factor analysis on the 10 items of the EPDS revealed two orthogonal factors . Communalities for Greek EPDS questions are presented in Table 2 for all the questions that consisted each latent variables are presented at Table Confirmatory factor analysis was conducted to determine whether data are consistent with the apriori specified model that has been suggested by exploratory factor analysis in order to evaluate whether the data fit the model adequately. The two factor-model was based on correlated factors that derived from the factor analysis using principal component analysis with varimax rotation by SPSS 16. The two latent variables Depress and Anxiety were strongly correlate with method Maximum Likelihood Figure . LISREL The Greek version of EPDS was well accepted by the mothers. It was easily and very quickly (approximately 5 minutes) completed. The questions appeared to be relevant, reasonable, unambiguous and clear. Therefore, face validity was considered to be very good. The content of Greek version of EPDS includes in a balanced way the full scope of the characteristics of postnatal depression -especially anxiety and depressive symptoms- that is intended to measure.The overall accuracy of Greek EPDS, as a screening instrument can be described as the area under its ROC curve. The curve was plotted considering, for the EPDS scores, a range between 1 and 23 (the maximum score reached by one depressed subject in our sample). The area under the minor depression ROC curve is = 0.794 . The area under the moderate and severe depression ROC curve is = 0.902 , which is considered excellent.Analyzing the scale sensitivity and PPV percentages in the detection of depressed women at the 8/9 cut off score the sensitivity is 76.66% specificity 68.33 and PPV is 70.76% and NPV is 74.54 was strongly correlated (Pearson r = 0.66 p < 0.0005) with the validated Greek version of BDI-II . Moreover, according to factor analysis two subscales have been revealed within EPDS. Cronbach's alpha was 0.741 for the first subscale and 0.718 for the second one.EPDS is the most used scale for screening depression in postnatal period worldwide. It has already been validated in many countries such as The Netherlands , PortugaCronbach standardised alpha and Guttman Split-half for the Greek EPDS were found similar to those reported by Cox in the first validation study (0.87) , by Pop A limitation of this validation study was that there was no test-retest, because it may have resulted in a low correlation due to an actual change in the depressive symptomatology. More over, the depressive symptomatology was assessed with only two paper-and pencil measures (i.e. EPDS and BDI-II) without further evaluation through clinical interviews which may have resulted in diagnosis or treatment of clinical postnatal depression. Despite the above limitation, -as in other previous international studies - this sSince Cox et al suggested that EPDS has one dimensional aspect , a numbeIt has been argued that factor stability is important for the explanatory value of a predictor sub-scale, as it demonstrates the ability to be explained in the criterion or target variable -32. HoweAlthough the first validation study suggesteA threshold of 11/12 was reported as more suitable for screening a French population ; a sensiThe ROC analysis confirmed the effectiveness of EPDS in detection of postnatal depression as well as its application in the range of cut-off scores proposed in previous studies. In our study, the high sensitivity (76.66) associated with a good PPV (70.76) to the 8/9 cut-off score allows the use of this score in the community screenings. Our choice of cut-off score has been mandated by the need to screen mothers to prevent postnatal depression rather than for diagnostic purposes. It is worthwhile to note that these cut-off values are at best guidelines for which cut-offs a health professional should consider for screening purposes. If a health professional would like to use the Greek EPDS for diagnosis, then different cut-offs -based on major depression scores according to BDI-II- should be used. Additionally, ROC analysis does not provide error estimates, so there is no guarantee of the accuracy of the sensitivity or specificity for a given cut-off.Moreover, the prevalence rate for major postnatal depression of 6.7% in this study is consistent with reported rates in the literature . This siThe Greek version of the EPDS has shown a satisfactory reliability and factor analysis indicated by two components similar to those of the original version. ROC analysis versus BDI-II provides the cut-off score of 8.5 as the best one for screening mother for minor, moderate and severe depression. We can therefore assert that it is a reliable and valid tool for identifying postnatal depression and it can be used by health professionals in their clinical practice to improve early detection, assessment and treatment for mothers with high scores.EPDS: Edinburgh Postnatal Depression Scale; BDI-II: Beck Depression Inventory- II; ANOVA: One way analysis of variance; LISREL: Linear Structural Relations; ROC: Receiver Operating Characteristic; PPV: Positive Predictive Value; NPV: Negative Predictive Value; AUC: Area Under Curve; KMO: Kaiser-Meyer-Olkin.The authors declare that they have no competing interests.VV participated in study design, translation, adaptation and validation of the questionnaire, carried out data collection and data entry, participated in the analysis and wrote the final draft of the manuscript. VD participated in study design, carried out the statistical analysis and co-wrote the final draft of the manuscript. MK and PB provided consultation during translation/adaptation/validation process and commented on the writing of the final draft of the manuscript. CL conceived the study design, was coordinator in the translation/adaptation/validation process and co-wrote the final draft of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

With the improvement of genotyping technologies and the exponentially growing number of available markers, case-control genome-wide association studies promise to be a key tool for investigation of complex diseases. However new analytical methods have to be developed to face the problems induced by this data scale-up, such as statistical multiple testing, data quality control and computational tractability.p-values are assigned to genomic regions termed bins, which are defined from a gene-biased partitioning of the genome, and the false-discovery rate is estimated. We have applied this algorithm to data coming from three genome-wide association studies of Multiple Sclerosis.We present a novel method to analyze genome-wide association studies results. The algorithm is based on a Bayesian model that integrates genotyping errors and genomic structure dependencies. The method practically overcomes the scale-up problems and permits to identify new putative regions statistically associated with the disease. The last years have shown a tremendous increase in the number of markers available for association studies. Previous studies were dealing either with the whole genome at a very low resolution (for instance 5 264 microsatellites in ) or withFirstly, the multiple testing problem seems to cause association studies ability to detect associations to decrease as the number of markers increases. The classical analysis strategy, based on an association test for each marker , encountMethods like False Discovery Rate (FDR) computatbins) on another basis, so as to limit the multiple-testing problem and make it independent of the number of markers. Combining these two arguments leads to choose one bin for each gene, and to create "desert" bins in large unannotated regions. It allows to associate a list of genes with a test, which simplifies the analysis of results. The drawbacks are (i) that it makes more difficult the study of these "deserts", however the goal is here to maximize, not the chance of finding an association, but the chance of elucidating a mechanism of a complex disease given the current knowledge (ii) that a bin might contain several haplotype blocks, resulting in a dilution of the association signal if only one block is associated. Reciprocally, neighbor bins are not independent because they may share a haplotype block. However, with the classical strategy, correlated neighbor SNPs would also be tested separately.Secondly, a genetic association of a given SNP is a statistical feature and does not explain by itself a phenotype. To biologically interpret an associated marker, its haplotype block should first be delimited. Then, the association can be refined by fine-scale genotyping technologies or ideally by full resequencing. This eventually allows to identify functional mutations. Most of the time, these mutations impact relatively close genes. This is a first argument to bias association analysis towards genes. Moreover, even if haplotype blocks are unreachable, DNA might be cut into distinct regions and the error rate (i.e. errors left in the data) is difficult to adjust. Obtaining unbiased statistical results is then conditioned to good pre-processing filters. Indeed spurious markers must be eliminated and missing data correctly managed.Thirdly, genome-wide genotyping data are obtained by high-throughput experiments which encompass limitations requiring careful statistical methodology. Especially, with i) is not enough for good asymptotic approximations and (ii) should be considered with care given possible high error rate.In addition, for most of SNPs used in this study, some genotypes are held by less than few percents of patients, which, given the usual collection size of a few hundreds, . It identifies putatively associated bins, containing genes previously described to be linked to MS .Three association studies dealing with Multiple Sclerosis (MS) in three independent collections have been realized. Around 600 patients have been recruited for each study, half of them as cases affected by the disease, half of them as controls Table . Genotypv). Indices are noted in lower case (k), ranging from 1 to the corresponding upper case letter (K). Unless needed, this range of indices is omitted. The number of different values is noted # is noted P , m ∈ , and a genotype value for each marker i is represented by this vector:Stochastic variables are noted with a round letter , errors on heterozygotic genotypes are more frequent. It can be detected through the deviation of a SNP from the Hardy-Weinberg equilibrium, which basically states that, noting P(a) = P(aa) + P(Aa)/2 and P(A) = P(AA) + P(Aa)/2:Due to i) if the number of missing genotypes is higher than 5% because the genotyping process quality was low for this SNP, (ii) if the minimum allele frequency in controls MAF = min(P(a), P(A)) is lower than 1%, because the SNP holds no information, or (iii) if the probability that the SNP follows the Hardy-Weinberg equilibrium in controls is lower than 0.02.Therefore, the following pre-processing filters are applied: SNPs are discarded each individual subset of the study is a realization of the conditional distributions On the contrary, due to the experimental design, estimations of A general way to assess the association of a bin b is to estimate whether However, as only We have chosen likelihood ratio LR as a statistic to estimate the "distance" between estimations of As all patients are considered to be independently chosen, the LR of the set of patients available is:p-value πb needs to be computed. This is theoretically achieved by enumerating all possible outcomes Db(σ) of the experiment that lead to the observed data Db(σ0) (σ is a enumeration parameter to be defined. The following notation simplification is done: Db(σ0) = Db). Then the probability p(Db (σ)) of each outcome assuming that p-value is:To assess estimation errors due to randomness and sample size, the probability that p-values is based on permutations: possible outcomes are obtained through patient phenotype permutations σ and σ0 is the identity permutation. The probability of each permutation is uniform. The denominator of equation (8) is constant with respect to such permutations, therefore it is omitted. Sampling this space is possible: random permutations of the phenotypes are drawn and used to compute a LR. This is a Monte-Carlo procedure, for which we propose an optimized implementation that guarantees the precision required for FDR estimation:In this article, estimation of b, compute LR for new permutations of phenotypes until the number of permutations realized Nb satisfies the following equation, noting p-value:For each bin θ and γ/δ control the quality of the method: θ is an upper bound of the threshold that is expected to be used to select bins. γ/δ controls the error due to the randomness of the process: Assuming that two consecutive p-values πb1 <πb2 ≈ θ are sufficiently spaced (probability ps = eδ-), c = cdf(γ) . In this article, B = 11 264, θ = 0.001, δ = 1 and γ = Nb = 507 003, ps = 0.37 and c = 0.92.To address multiple testing, the method uses an FDR estimation defined as in :πb ≤ θ. p-values below. The ratio is therefore an estimation of the proportion of false negatives in the set of bins with a p-value below θ. Because we want to analyze thoroughly the FDR for around the 10 bins with the lowest p-values, the FDR is not controlled at a specified threshold as in . Assuming that sharing of haplotype block by neighbor bins is the only source of correlation between tests, the positive correlation seems reasonable. Indeed, if the p-value of a not associated bin decreases, the p-values of bins sharing the same haplotype block are more than likely to decrease too. The uniform distribution is less obvious, because the number of possible contingency tables is finite so that even the null distribution is not uniform. However, the sample size is one to two order of magnitude higher than in other applications of FDR to discrete data in which the problem is acute [This estimation relies on two main hypothesis: p-is acute .Correlation between markers induced by LD is modelled with an inhomogeneous hidden Markov chain of order 1. Indeed, as a rough approximation, for each marker, most information is found on its first neighbor on each direction of DNA. In a directed graphical model, independence assumptions consist in:Finally, this assumptions also allow to obtain correct estimations because corresponding contingency tables are sufficiently filled. They implies that contingency tables are computed for 2 SNPs :An error model Figure is introSince ∅ is the number of patients with either m is the number of cells. To obtain more regular estimates, a constant is added to all cell counts. It is a Dirichlet prior on parameters. This constant is chosen to be C = α0α0 is the chosen error rate and Where nOn the other hand, given the previously developed structure of errors, the following model of β is estimated for each marker through the resolution of the non-linear system drawn from the preceding model. The maximum error rate α0 is estimated during external comparison of Affy. technology and other technologies. In this study, the error rate is chosen to be α0 = 0.05. The error rate is α = min/)~OJb. Some aa from its left neighbor and AA from its right neighbor, the merging of this two inferences would results in a contradiction and thus a low resulting likelihood. On the contrary, the approximated likelihood does not detect this contradiction and is falsely increased. This likelihood is named thereafter "two-marker" likelihood.This equation considers information coming from two neighbor markers together. Compared to the full model, information flow is limited to pair of markers. The likelihood could be falsely increased in this extreme situation: suppose that a missing genotype is inferred Simplifying further leads to consider markers one by one. There is no model of linkage disequilibrium anymore, but noise is reduced as cells are better filled. This likelihood is named thereafter "naive likelihood" because it corresponds to a naive Bayesian model:A, B, C (Table ABC), considering the collection of origins as a co-variable. The overall computation time is about 10 days on a single processor.The method has been applied to each of the three collections C Table as well A (resp. B and C), out of 112 463 SNP, 84 430 (resp. 93 548 and 86 652) SNP remains. If all SNP satisfied the Hardy-Weinberg equilibrium, 2 249 SNP are expected to be discarded. 9 422 were for collection A. It can be explained (i) by artifacts of DM calling algorithm which has a higher error rate on heterozygotic genotypes (ii) by deviations from the assumptions underlying this theoretical equilibrium. The bin partioning algorithm divides the genome into 19 556 gene bins and 1 993 desert bins. Out of these 21 549 bins, only 11 264 (52%) contain one SNP or more after pre-processing in at least one collection and are considered for further analysis. Before pre-processing, out of 12 512 SNP with one bin or more, 2 781 have only one SNP, and 2 188 bins 10 SNP or more. The maximum is 210.The pre-processing filters discard around 20% of SNP: for collection p-values computed using the two-marker L2 or the naive L3 likelihood for the three collection design. Two-marker FDR remains below naive FDR until a p-value level of 0.01 and both increase slowly towards 1. FDR against the number of selected SNP plots are detailed by collection in Figure p-value. The oscillations are less important for the three collection design, maybe because of the three time increase of sample size. With a FDR threshold of 5%, only between 2 and 6 bins are selected depending on the collections and likelihood considered , and handles the multiple testing problem through FDR estimation while staying computationally tractable. The method has been applied to analyze three association studies in Multiple Sclerosis.The FDR threshold is chosen according to the desired application. To conduct expensive further experiments with putatively associated genes, a very low rate of false-positives is required. A FDR threshold of 5% seems reasonable. On the contrary, if one wants to minimize the false-negative rate, a FDR of 50% is acceptable.i) to assess the algorithm and evaluate the different parameters and design and (ii) to identify genes potentially associated to Multiple Sclerosis. We have evidenced that the three collection design outperforms the one-study design in terms of expected number of true-positives, despite differences between the studied collections, especially on the severity of the disease. Furthermore, with this three collection design, the two-marker likelihood L2 seems to be more efficient thanks to the additional information used. With this configuration, a FDR threshold of 5% gives 6 associated bins. Four of them are located in the MHC region, known to be linked to Multiple Sclerosis [OR2T2 and OR4A47. The biological meaning of such association is unclear but the extended MHC regions contain many other olfactory genes [Applying the method to experimental genome-wide association data on three collections permits (clerosis . It is ary genes and olfary genes . At FDR The authors declare that they have no competing interests.NO, FK and JW conceived and designed the model. NO, KF, ML and GM wrote the analysis tool. NO, FK and JW wrote the manuscript.

Kuru is an acquired human prion disease that primarily affected the Fore linguistic group of the Eastern Highlands of Papua New Guinea. The central clinical feature of kuru is progressive cerebellar ataxia and, in sharp contrast to most cases of sporadic Creutzfeldt–Jakob disease (CJD), dementia is a less prominent and usually late clinical feature. In this regard, kuru is more similar to variant CJD, which also has similar prodromal symptoms of sensory disturbance and joint pains in the legs and psychiatric and behavioural changes. Since a significant part of the clinicopathological diversity seen in human prion disease is likely to relate to the propagation of distinct human prion strains, we have compared the transmission properties of kuru prions with those isolated from patients with sporadic, iatrogenic and variant CJD in both transgenic and wild-type mice. These data have established that kuru prions have prion strain properties equivalent to those of classical (sporadic and iatrogenic) CJD prions but distinct from variant CJD prions. Here, we review these findings and discuss how peripheral routes of infection and other factors may be critical modifiers of the kuru phenotype. C) to an abnormal isoform, designated PrPSc (PRNP), infection with prion-infected tissue or by rare sporadic events that generate PrPSc , Gerstmann–Sträussler–Scheinker disease, fatal familial insomnia, kuru and variant CJD and homozygosity confers genetic susceptibility to both sporadic and acquired forms of CJD . Codon 1PRNP genetic factors have also been revealed suggest that there are several different human PrPSc conformations, referred to as molecular strain types and these can be further classified by the ratio of the three PrP fragments seen after protease digestion. PrPSc types 1–3 are seen in classical (sporadic or iatrogenic) CJD brain, while type 4 PrPSc is uniquely seen in vCJD brain or methionine (M) at residue 129 and in wild-type mice , lack a transmission barrier to classical (sporadic and iatrogenic) CJD prions, regardless of the codon 129 genotype of the inoculum has been strongly supported by molecular and neuropathological analysis of human prion transmissions to conventional and transgenic mice. Transgenic mice expressing only human PrP have shown that residue 129 polymorphism constrains both the propagation of distinct human PrPent size . By content size and stroent size .Sc type and transmission rates of kuru prions and classical CJD prions, type 3 PrPSc from kuru or sporadic CJD brain propagated faithfully in 129VV Tg152 mice (Sc was also observed in 129VV Tg152 mice inoculated with the type 2 PrPSc kuru isolate (Sc and codon 129 methionine when crossing a PRNP codon 129 transmission barrier; however, further transmissions of CJD isolates with this molecular strain type will be required to investigate this directly (In agreement with the close similarities of both PrP152 mice . In thes isolate . This swSc in 129VV Tg152 mice contrasts sharply with that seen in vCJD-inoculated 129VV Tg152 mice propagating type 5 PrPSc. In both clinically affected and sub-clinically infected 129VV Tg152 mice, the propagation of type 5 PrPSc is only accompanied by the occurrence of large, non-florid, PrP plaques in the corpus callosum with an absence of PrP plaques or diffuse PrP deposition in other brain areas (Wadsworth et al. The pattern of neuropathology associated with the propagation of type 3 PrPet al. Molecular and biological strain typing studies have established that kuru prions have molecular strain types (Parchi et al. et al. et al. et al. PRNP mutation (Despite the close molecular and biological similarity of kuru prions and sporadic CJD prions, both the clinical presentation and the neuropathology of kuru are distinct from the majority of patients with sporadic CJD. While rapidly progressive dementia is the defining clinical feature of approximately 70 per cent of cases of sporadic CJD (mutation .PRNP genetic loci that exert a major influence on prion disease incubation time have been mapped in mice (In addition to the route of exposure, other factors may also influence the neuropathology and clinical features of kuru. Age is an important determinant of survival in sporadic and inherited prion diseases (

In silico analyses provide valuable insight into the biology of obligately intracellular pathogens and symbionts with small genomes. There is a particular opportunity to apply systems-level tools developed for the model bacterium Escherichia coli to study the evolution and function of symbiotic bacteria which are metabolically specialised to overproduce specific nutrients for their host and, remarkably, have a gene complement that is a subset of the E. coli genome.Buchnera aphidicola (symbiont of the pea aphid) as a model for using systems-level approaches to discover key traits of symbionts with small genomes. The metabolic network is extremely fragile with > 90% of the reactions essential for viability in silico; and it is structured so that the bacterium cannot grow without producing the essential amino acid, histidine, which is released to the insect host. Further, the amount of essential amino acid produced by the bacterium in silico can be controlled by host supply of carbon and nitrogen substrates.We have reconstructed and analysed the metabolic network of the γ-proteobacterium B. aphidicola to the host and, together with the impact of host-derived substrates on the profile of nutrients released from the bacteria, point to a dominant role of the host in controlling the symbiosis.This systems-level analysis predicts that the fragility of the bacterial metabolic network renders the symbiotic bacterium intolerant of drastic environmental fluctuations, whilst the coupling of histidine production to growth prevents the bacterium from exploiting host nutrients without reciprocating. These metabolic traits underpin the sustained nutritional contribution of In particular, insight into the metabolic capabilities of these bacteria can be obtained from the construction and analysis of metabolic models generated from the inventory of genes with function in metabolism. Of the various methods available, constraints-based modelling using flux balance analysis (FBA) has particular application because it reconstructs flux through metabolism without requiring kinetic or other detailed information on the function of individual metabolic enzymes . In E. coli iJR904 model. The limited number of metabolic pathways is small, comprising 196 gene products, 240 compounds and 263 reactions, only 39% of the compounds and 27% of the reactions in the E. coli. In the reaction graph, the modal path length between every pair of compounds, the maximal path length and %-unreachable nodes are all higher for APS than for E. coli to 50% (threonine) of the amount synthesised and E. coli K-12 (iJR904).We also analysed single gene deletions by the linear minimisation of metabolic adjustment (linearMOMA) method . This anB. aphidicola are close to those of the postulated minimal metabolic network [B. aphidicola is intolerant, first, of mutations that eliminate metabolic reactions unless that loss is compensated for by enhanced metabolic support from the host, and, second, of drastic changes in conditions, suggesting that the environmental conditions in the symbiosis may be relatively uniform. The condition of B. aphidicola in the symbiosis is consistent with this interpretation. The bacterial cells are restricted to a single insect cell type, the bacteriocyte, the sole function of which appears to be to house and maintain the bacteria; the cytoplasm of the bacteriocyte is packed with bacterial cells, each of which is enclosed by an insect membrane, known as the symbiosomal membrane [These data demonstrate that APS does not conform to the generality that metabolic networks are complex and robust , and sug network . The framembrane . The metB. aphidicola is predicted to vary because the amino acid composition of the aphid diet of plant phloem sap is influenced strongly by environmental conditions and plant age and species [B. aphidicola. One hypothesis is that EAA production is controlled by the supply of carbon and nitrogen substrates from the host. In iGT196, the principal carbon sources are glucose and mannitol, and the nitrogen sources are the amino acids aspartate, glutamate and glutamine. To test this hypothesis, carbon-limited and nitrogen-limited models were generated by increasing supply of either nitrogen or carbon sources, respectively. Consistent with prediction, these changes to the inputs to the APS network had substantial impacts on the output of EAAs could replicate the proximal truncation of the purine biosynthetic pathway and herein potentially limit the full interpretation of this experiment, it is clear that, unlike the evolutionary loss of various other metabolic genes, the truncation of the purine pathway was an improbable evolutionary step. To our knowledge, this type of host-symbiont linkage has not been described previously for any symbiosis. There is, however, evidence for coupling of the metabolism of nitrogen-fixing rhizobia and the surrounding plant cells in legume root nodules, such that rhizobial access to host amino acids is dependent on the release of the nitrogen-fixation product, ammonia [B. aphidicola and its host may reveal similar couplings between nutrient supply to B. aphidicola and bacterial overproduction of EAAs. Such couplings would preclude the evolution of bacteria with reduced export of EAAs, despite the evidence that EAA export is a costly trait for B. aphidicola . The metabolic coupling is in the selective interest of the B. aphidicola. Because B. aphidicola is an obligately vertically transmitted microbe with a small effective population size, any short-term growth advantage of reduced EAA export to the host would rapidly translate into depressed fitness of both the host and its bacterial complement.To assess whether we could model the evolution of the reduced network and applway Fig. . Whilst [et al. 06 could in silico analysis has shed light on the evolution and function of a symbiotic bacterium with a small genome. From the properties of the reconstructed metabolic network of B. aphidicola, adaptations for the symbiotic lifestyle can be identified. The fragile metabolic network suggests that the symbiotic environment is benign and not subject to drastic fluctuations, and host controls over bacterial metabolism are indicated by the responsiveness of the essential amino acid profile released from the bacteria to the host supply of carbon and nitrogen substrates. The coupling of purine synthesis to the overproduction of histidine transferred to the host is potentially one route by which this bacterium is bound to the cooperative lifestyle. Systems level analysis of other taxa will establish the generality of these key traits of metabolic fragility, flexibility and coupling among symbiotic bacteria with reduced genomes.Systems level E. coli K-12 iJR904 model [apaH, gloB, lig, gltX, suhB, mutT) or representing isolated enzymes in missing pathways . Other reactions supported by experimental evidence were added , which has been detected in isolated extracts of B. aphidicola APS ; the true 'orphan' ; and one spontaneous reaction (HCO3E). Pathways and reactions were checked using the EcoCyc Pathway/Genome database [BuchneraBASE [ with accession number MODEL7434234848. The reconstruction is also available in BuchneraCyc a BioCyc genome/pathway database created and adopted for this project using the Pathologic software [The iGT196 model comprised a subset of 04 model derived database . Mappingsoftware . The reaction HCOE. PathwaE. coli K-12[B. aphidicola to the aphid compared to E. coli K-12 (50.8%).The biomass reaction for the model was derived from that used in iJR904 which was based on experimental data for coli K-12. The coe. The 5.21 model provides glucose and mannitol as carbon sources and glutamine, glutamate and aspartate as nitrogen sources and precursors for biosynthesis was performed using the Fluxor toolkit, which uses linear optimization algorithms provided by the GLPK and OOQP toolkits. The Fluxor software is freeware available at software .Buchnera was represented as a directed bipartite graph G = , where C is a set of nodes representing compounds (metabolites), R is a set of nodes representing reactions and L is a set of directed links, i.e. an ordered pair of nodes from one C to one R. Compound ci is involved in reaction rj if and only if there is link between node ci and rj. This directed graph is referred to as the "reaction graph". The reaction graph can also be simplified by removing all reaction nodes and replacing them with links connecting each substrate with all its products [ and is available from the authors [email protected] upon request. The network diameter is the maximal length of the shortest path between two reachable nodes in the network. Calculation of the shortest path between two compounds using the reaction graph considers the two links that join two compounds to a reaction as a single link. We used a maximum likelihood approach [The metabolic network of products ,24. Thesproducts to fit tapproach to fit tgrowth of the resulting mutant and nitrogen-limited . Uptake of nitrogen sources in the nitrogen-limited model and of carbon sources in the carbon-limited model were maximal.et al., (2006) with the biomass reactions from iGT196 and iJR904, both with riboflavin included in the biomass reaction ). Initial FBA analysis using iJR904 modified to have the biomass reaction from iGT196 did not produce a feasible solution because the biosynthetic pathways to biotin and thiamine diphosphate were incomplete. Both of these cofactors were added to iGT196 as 'cofactor constraints' and were absent from the original iJR904 biomass reaction which lacked these additional criteria for growth. Therefore we added an efflux reaction for S-adenosyl-4-methylthio-2-oxobutanoate (amob) and for 4-hydroxy-benzyl alcohol (4 hba) which are produced but not consumed in the biotin and thiamine diphosphate biosynthesis pathways, respectively, and also an uptake reaction for pimeloyl-CoA (pmcoa) which is consumed but not produced during biotin biosynthesis. The analysis was performed as described previously [The evolution of minimal networks were simulated by the methods of Pal The construction and analysis of the model was performed by GHT, JZ, SJM, AS and IG. AED, GHT and JZ conceived the study and designed and coordinated it. All authors contributed towards the writing of the manuscript.Data deposition The model is available in BioModels database (MODEL7434234848), and the reconstruction is available at . The authors declare no competing financial interests. Correspondence and requests for materials should be addressed to GHT.Additional Methods. This file contains additional methods for the construction and validation of the model and the flux correlation method with references.Click here for fileB. aphidicola APS.Quantification of essential amino acid release from These data demonstrate the contribution of B. aphidicola APS-derived essential amino acids to protein growth of 2-to-7-day-old larval pea aphids (clone LL01) on chemically-defined diets.Click here for fileDescription of the iGH196 model and fluxes from the 5.21 model. The Excel sheet describes the gene/reaction relationships in the model and the fluxes in the 5.21 model.Click here for fileAnalysis of the FBA simulations for non-essential genes. The file summarises the results from our analysis of the FBA simulations for non-essential genes from iGT196 by our own method and also by using the linearMOMA method.Click here for fileFlux correlation of the histidine and purine biosynthesis pathways. Pairwise scatterplots showing correlation of fluxes in reactions of the histidine and purine biosynthetic pathways of Buchnera aphidicola.Click here for fileList of APS genes and the frequency of their retention in evolved symbionts. This file lists the APS genes and the frequency of their retention in evolved symbionts from Pal et al,. (2006) and this study.Click here for file

Octopus vulgaris, an invertebrate. Such an approach is novel for this taxon and of advantage in future experiments given the complexity of the behavioral repertoire of this species when compared with its relatively simple neural organization.Quantitative real-time polymerase chain reaction (RT-qPCR) is valuable for studying the molecular events underlying physiological and behavioral phenomena. Normalization of real-time PCR data is critical for a reliable mRNA quantification. Here we identify reference genes to be utilized in RT-qPCR experiments to normalize and monitor the expression of target genes in the brain of the cephalopod mollusc 16S, and 18S rRNA, actB, EEF1A, tubA and ubi as candidate reference genes . The expression of 16S and 18S was highly variable and did not meet the requirements of candidate HKG. The expression of the other genes was almost stable and uniform among samples. We analyzed the expression of HKG into two different set of animals using tissues taken from the central nervous system (brain parts) and mantle (here considered as control tissue) by BestKeeper, geNorm and NormFinder. We found that HKG expressions differed considerably with respect to brain area and octopus samples in an HKG-specific manner. However, when the mantle is treated as control tissue and the entire central nervous system is considered, NormFinder revealed tubA and ubi as the most suitable HKG pair. These two genes were utilized to evaluate the relative expression of the genes FoxP, creb, dat and TH in O. vulgaris.We chose O. vulgaris by applying RT-qPCR analysis for the first time in cephalopods. We validated candidate reference genes and found the expression of ubi and tubA to be the most appropriate to evaluate the expression of target genes in the brain of different octopuses. Our results also underline the importance of choosing a proper normalization strategy when analyzing gene expression by qPCR taking into appropriate account the experimental setting and variability of the sample of animals (and tissues), thus providing a set of HGK which expression appears to be unaffected by the experimental factor(s).We analyzed the expression profiles of some genes here identified for The normalization of the expression of target genes favors the elimination of unspecific variation caused by differences in starting material, RNA extraction, enzymatic efficiencies, transcriptional activity and presence of inhibitors in the samples. A suitable reference gene has to i. be adequately expressed in the tissue of interest, ii. not be co-regulated, and iii. show comparable expression levels with target genes. In addition, it should show reduced variability in expression levels among samples and experimental conditions did not have significantly different levels of expression in different tissues, similar to what resulted by analyzing the expression profile of dopamine transporter in the octopuses . On the contrary, tyrosine hydroxylase mRNAs reached expression levels in the optic lobes that were significantly higher when compared with those observed in other tissues is used as control to study the expression of different genes in the brain. We applied this reference gene pair to analyze the level of expression of our target genes in different regions of Octopus brain applying a geometric approach that take into account primer efficiencies for both reference and target genes.Our experiments showed that the expression of several so called housekeeping genes vary among different conditions and/or tissues (i.e. mantle vs brain), but also when the different parts in the brain of the octopus (masses) are considered. However, in such circumstances an algorithm that takes into account different conditions in a given experimental design (NormFinder ) results16S and 18S rRNAs, EEF1A and actB resulted not reliable as reference genes in terms of stability and relative levels of expression, in analogy to what is reported for other species .,20.16S a16S rRNA allowed to identify two discrete groups of animals in our sample. This did not correlate with sex, seasonality or the body size of the animals and was independent from the tissues considered. The fact that 16S rRNA is a mitochondrial gene suggests that this may be related with physiological (and/or metabolic) status of the animals. Similarly, we cannot exclude that 18S rRNA expression may be influenced by physiological conditions. Moreover, we found that actB reached higher levels of expression in the mantle when compared to the brain; it also resulted expressed with high interquartile ranges among samples, similarly to what resulted in other experimental settings [EEF1A as a suitable reference gene in our experimental conditions (except for Bestkeeper: mantle set a and SUB set b). However, its expression is comparable to the other putative reference genes and one more restricted to sub-adults of the summer season (set b). The expression levels detected for each animal group suggest a correlation between data set heterogeneity and gene expression variability as deduced by the elevated Ct value variability obtained from samples belonging to octopuses of set a.FoxP and creb vs dat and TH; data not shown). It is interesting to note that dopamine-related genes were abundantly expressed in the optic lobes of O. vulgaris, confirming previously published data [review in [Moreover, octopuses of our samples showed low expression levels for transcription factors when compared with mRNA coding for proteins highly utilized in the metabolic pathway were collected from different locations of the Bay of Napoli throughout the year (2006). Their weight ranged from 30 to 2100 g, spanning across a broad size/age range.The octopuses were caught in the Bay of Napoli in the same season ; their size ranged between 200–550 g.The octopuses according to the manufacturer's instructions. Contaminating DNA was degraded by treating each sample with Turbo DNase Kit (Ambion) according to the instruction manual.28S and 18S) were observed on the gel indicating minimal degradation of the RNA.For all RNA samples, the absence of DNA contamination was tested by performing PCR with β-actin primers. The quantity and purity of total RNA extracted was estimated monitoring both the absorbance at 260 nm and ratios 260/280 nm and 260/230 nm by Nanodrop . The quality of RNA was evaluated by gel electrophoresis. Intact rRNA subunits following the manufacturer's instructions. The cDNA was stored at -20°C until further use. cDNA was diluted 1:100 with HO. vulgaris using primers designed on conserved regions by means of bioinformatic analysis comparing homologous sequences available in Gene Bank for the different taxa on total RNA extracted from the brain of adult octopuses using TRIZOL® (Invitrogen) with inosinate degenerate primers . Primers WKNfw 5'-TGGAAGAATGCCGTGCGCCA CA-3' and WKNrev 5'-TGTGGCGCACGGCATTCTTCCA-3' were used to obtain the 5' and 3' ends respectively using GeneRacer™ (Invitrogen) following the manifacturer's protocol. At the same time a PCR screening of cDNA libraries from octopus brain were performed to confirm the transcripts obtained (1111 bp).To isolate 18S rRNA, ubi, dopamine transporter: dat, and tyrosine hydroxylase: TH) cDNAs were synthesized using SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen) from total RNA extracted from brains of adult octopuses using Eurozol (Invitrogen) according to the manufacturer's instructions. The cDNA obtained was used as template in PCR reactions to amplify genes of interest using primer pairs designed by Primer3 software [For all cases : 18Sfw 5'-CGTTTTCCTCGATCAAGAGC-3' and 18Srev 5'-CGAACTCGCGAAAGAAGAAG-3'.For ubi), a 324 bp cDNA sequence coding for ubi/ribosomal S27a protein was identified using the following primers: UBfw 5'-TGTCAAGGCAAAGATTCAAGA-3' and Ubrev 5'-GGCCATAAACACACCAGCTC-3'. These primers were designed on the basis of sequences present in Octopus eye EST library .For ubiquitin (dat) we analyzed the ortholog sequence alignment of vertebrates and invertebrates. Degenerated oligonucleotides were designed to amplify conserved regions. A 506 bp fragment coding for dat was amplified using the following primers: DATfor1 5'-TCKGGIAARGTDGTBTGGTT-3' and DATrev3 5'-ATIGCYCIGADCCNCCRAA-3'.For dopamine transporter (TH), the most conserved regions of vertebrate and invertebrate ortholog sequences were identified and degenerated oligos were designed for PCR reactions. The primers Thfor1 5'-RTSTTYCAGWSYACICAGTA-3' and Threv2 5'-AAYTCVACRGTGAACCAGTA-3' were used to amplify a fragment of 539 bp.For tyrosine hydroxylase (® Gel extraction kit (Qiagen) and cloned into pCRII-TOPO vector (Invitrogen) according to the instruction manual. The resulting plasmids were sequenced using M13 reverse primer and T7. Sequences of the PCR products obtained were analyzed by BLASTX and BLASTP programs.cDNA amplified fragments were purified from gel agarose using QIAquickcreb) cDNA sequence was found after screening O. vulgaris cDNA library constructed from mRNA of the supra-oesophageal mass. The cDNA sequence coding for Aplysia creb1α was used to screen the library (gift from Dr E.R. Kandel Laboratory). The sequence identified was 4313 bp long and coded for a protein of 296 amminoacids.The c-AMP response element binding protein . PCR amplifications were performed in a Chromo4™ Real-Time Detector (Biorad) thermal cycler using the following thermal profile: 95°C for 10 min, one cycle for cDNA denaturation; 95°C for 15 sec and 60°C for 1 min, 40 cycles for amplification; 72°C for 5 min, one cycle for final elongation; one cycle for melting curve analysis (from 60°C to 95°C) to verify the presence of a single product. Each assay included a no-template control for each primer pair. To capture intra-assay variability all RT-qPCR reactions were carried out in triplicate (set a) or duplicate (set b). Fluorescence was measured using Opticon Monitor 3.1 (Biorad).The distribution of the Ct was first calculated for each tissue considering all the samples and reported as box plot. The Ct values were obtained from the average of each animal tissue.Three different gene normalization algorithms were utilized in this work: BestKeeper , geNorm The expression of each target gene (relative to the most stable reference genes ) was calwere:ubi: ubitubA: tubulintrg: target geneRaw Ct data were exported to a worksheet for further analysis. SPSS 16 was used for statistical analysis (One-way ANOVA followed Dunnett post-hoc test). Significance level was set at 5%.OS and IZ participated in the design of the study, performed all the experiments and drafted the manuscript. FR and MB carried out data analysis and helped to draft the manuscript. MB participated in the design of the study and assisted in RT-qPCR experiments design and realization. MIA and EB participated in the design and coordination of the study and helped to draft the manuscript. GF conceived and supervised the study. All authors read and approved the final manuscript.O. vulgaris translated sequences with their invertebrate and vertebrate orthologousThe alignment of . For each gene alignment, identity matrix and cDNA sequence are provided.Click here for file

Chest pain with ST-segment elevation is a rare clinical problem during dobutamine stress testing. Although beta-agonists treatment prior to dobutamine stress testing has been shown to reduce the duration and amount of dobutamine infusion and atropine requirement, there is insufficient information about potential complications of this pharmacologic combination.We present a 67-year-old patient with dobutamine stress testing -induced chest pain and ST elevation who received albuterol for clinical treatment of bronchospastic disease prior to the test. She developed persistent chest pain and ST elevation despite medical management. Urgent cardiac catheterization showed no significant obstructive coronary artery disease. Thus coronary artery spasm was likely responsible for the chest pain and electrocardiogram abnormality in our patient as a result of β-agonist and dobutamine combination.Beta-agonists pre-treatment with dobutamine stress testing may induce coronary spasm in association with chest pain and ST elevation. Clinicians and nuclear cardiologist should be aware of this potential side effect of β-agonists treatment with dobutamine stress testing, particularly since dobutamine stress testing in nuclear cardiology is done in patient with chronic obstructive lung disease. Dobutamine infusion in combination with radionuclide myocardial perfusion imaging is an alternative pharmacological stress test for detection of myocardial ischemia in patient who is not able to tolerate dipyridamole or adenosine infusion. It is commonly used in patients with chronic obstructive pulmonary disease (COPD). As a catecholamine with predominant β1 receptor against, dobutamine increases heart rate, systolic blood pressure and myocardial contractility. Consequently, myocardial oxygen demand increases. Although its hemodynamic effect is similar to physical exercise, dobutamine stress test (DST) is not a substitute for exercise stress test. Serious side effects may occur during DST including myocardial infarction, ventricular arrhythmia, hypotension and prolonged ischemia . HoweverNumerous studies have demonstrated that DST in association with radionuclide or echocardiographic imaging is sensitive and specific diagnostic test for coronary artery disease. In order to maintain sensitivity of DST, it is important to reach target heart rate during the test. Atropine is usually combined with dobutamine infusion to increase heart rate. It has been demonstrated that β-agonists treatment shortly prior to DST reduced amounts and duration of dobutamine infusion as well as requirement of atropine . HoweverA 67-year-old Caucasian female with severe COPD who was receiving continuous oxygen treatment in addition to multiple bronchodilator and ant-inflammatory medications including fluticasone/salmeterol (Advair), tiotropium-bromide (Spiriva), ipratropium-bromide/albuterol-sulfate (DuoNeb) and budesonide (Pulmicort), presented to the hospital with sudden onset substernal chest pressure at rest which resolved spontaneously. She has no history of coronary artery disease, but limited cardiovascular risk factors including age and hypertension. Her physical examination was unremarkable with the exception of elevated blood pressure (158/92 mmHg). Serial electrocardiogram and cardiac enzymes during hospital course were within normal limits. For that reason, DST was scheduled. The patient received albuterol inhaler treatment 30 minutes prior to DST in addition to her scheduled bronchodilators as above. She underwent pharmacological stress test with dobutamine infusion at a maximum rate of 40 mcg/kg/min, a total dose of 28 mg, and atropine 0.2 mg. She reached to target heart rate with dobutamine/atropine combination. Blood pressure response was normal. During recovery the patient developed severe substernal chest pain that was similar to her prior pain and radiated to jaw. She appeared diaphoretic, pale and sick. Concurrent electrocardiogram showed 1.5 mm STSE in lead II, III, aVF, V3, V4 and V5 & B. ThePre-treatment with β-agonists in DST reduces the time of the test and the use of atropine in addition to requiring lesser amount of dobutamine infusion. However it is not known whether β-agonists may have additive effect on inducing coronary spasm and related STSE with angina during DST. Physiologic response to dobutamine and β-agonists on circulatory system are similar that may enhance overall effects of each other.STSE during stress test occurs in the presence of myocardial ischemia, coronary spasm or left ventricular dysfunction. It is rare clinical problem in patients without previous infract or coronary artery disease and associated with coronary spasm or non-occlusive coronary lesion ,5. TypicThe mechanism of dobutamine induced vasospasm with or without β-agonists is complex. Dobutamine primarily stimulates cardiomyocyte sarcolemma β1-adrenergic receptors, but also has effect on β2- and α1-receptors. Increase in myocardial oxygen demand and coronary flow causes α-adrenergic mediated vasoconstriction that has been observed during exercise. In fact exercise-induced coronary spasm is a result of α1 receptor stimulation. Higher doses of dobutamine, as in DST, generate more α1-adrenergic effect that may induce coronary spasm, particularly in the presence of endothelial dysfunction . Moreoveβ-agonists cause cardiovascular side effects including angina, tachyarrhythmias, hypertension and myocardial injury by increasing myocardial oxygen consumption. Albuterol activates β2-adrenergic receptors particularly in coronary resistant vessels that are partially mediated by the endothelium at the microcirculatory level. Endothelial function plays important role in β2-agonist effect on vascular tone. Intracoronary infusion of salbutamol induces vasoconstriction in stenotic coronary arteries without increase in heart rate and blood pressure . UnderlyAlbuterol pre-treatment with DST may induce coronary spasm in association with chest pain and STSE. This clinical condition may lead to invasive procedures like cardiac catheterization and possible complications. Although the true incidence of coronary vasospasm with STSE during DST with albuterol pre-treatment is not known, nuclear cardiologist must be aware of this potentially life threatening complication of this non-invasive diagnostic test. Coronary spasm should be considered in all patients with STSE and chest pain during DST, particularly following β-agonist treatment. The safety of this combination must be re-examined. Thus, the patients should not be subjected to the DST if they are treated with β-agonist before the test.

Simultaneous bilateral cerebrovascular infarction is relatively rare and its initial presentation as a space-occupying lesion is extremely uncommon. However, bilateral infarction can result from unilateral occlusion of anomalous cerebral vasculature.We report the case of a man presenting with lower limb weakness and aphasia of acute onset with initial computerised tomography suggesting bifrontal neoplasm. However, further investigation confirmed bilateral anterior cerebral artery territory infarction with a hypoplastic left anterior cerebral artery with the right anterior cerebral artery supplying both frontal lobes . We present the clinical and diagnostic features of this presentation and attempt to ascertain, by reviewing existent medical literature, the frequency and patterns of structural variations in cerebral vasculature.Simultaneous bilateral cerebral infarction can be the result of a unilateral cerebral artery occlusion and this can potentially mimic a space-occupying lesion. Anomalies of cerebral vasculature are not as rare as is usually believed and this should be borne in mind when investigating unusual presentations of cerebrovascular infarction. Cerebrovascular infarction is a well-recognised clinical disorder but simultaneous bilateral infarction is relatively rare and its initial presentation as a space-occupying lesion is extremely uncommon.Several morphological variations of the circle of Willis exist. In the Hodes et al. autopsy series, only 18% of specimens of the circle of Willis were found to be anatomically normal . Maurer Given this, bilateral cerebral infarction may be the result of unilateral cerebral artery occlusion and this can account for its unusual initial presentation as an intracranial tumour.A 71-year-old man was admitted to his local hospital with sudden onset aphasia and weakness in his lower limbs, which had occurred whilst playing golf. He reported no loss of consciousness, headache, nausea and/or vomiting, convulsions or incontinence. He had no significant past medical history and had no vascular risk factors. Routine full blood count and biochemical analysis were normal. Cranial computerised tomography (CT) and magnetic resonance imaging (MRI) performed in the original referring hospital were reported as demonstrating a bifrontal parasagittal space-occupying lesion crossing the head of the corpus callosum ; see Figure On examination post-transfer he was found to be conscious, alert and orientated. The patient had a degree of receptive dysphasia, mild bilateral lower limb weakness and altered behaviour and personality, suggestive of frontal lobe disruption. MRI was reported as in keeping with the initial suggestion of a space-occupying lesion Figure . Given tCT and MRI repeated 2 weeks after the onset of symptoms showed interval reduction in oedema within what appeared to be subacute bilateral anterior cerebral artery (ACA) territory infarcts. The infarction was attributed to thrombo-embolism in the right ACA. Cranial CT carried out at the 12-month follow-up appointment revealed cortical volume atrophy consistent with a bifrontal parafalcine infarction. Eighteen months after his initial presentation, the patient has made a good recovery and is continuing cognitive rehabilitation therapy.The ACA is a major vessel responsible for the blood supply to the interhemispheric region. Infarction of the ACA territory accounts for only 0.3% to 4.4% of cerebral infarctions reported . BilaterAccording to Bogousslavsky and Regli, 63% of ACA infarctions result from cardiogenic emboli or artery-to-artery emboli . BilaterAnomalies of the ACA are not quite as rare as was previously believed ,8. BaptiIn our patient, DSA demonstrated a hypoplastic left ACA and branches of the right ACA supplying part of the left frontal lobe whilst serial MRI excluded the possibility of a neoplasm. Serial CT scans confirmed that this was indeed a case of infarction. If investigations were not performed to confirm or exclude the clinical suspicion of cerebrovascular infarction despite the findings of the initial cranial CT, a diagnosis of bilateral ACA territory infarction would have been delayed or missed and the patient might have had to undergo an unnecessary surgical intervention. However, it should be noted that other imaging, for example CT angiography or CT perfusion studies, if performed nearer the time of presentation could have resulted in an accurate diagnosis more acutely.This case report highlights the finding that simultaneous bilateral cerebral infarction can be the result of a unilateral cerebral artery occlusion and that this can potentially mimic a space-occupying lesion. It also demonstrates that anomalies of cerebral vasculature are not as rare as is usually believed, and this should be borne in mind when investigating unusual presentations of cerebrovascular infarction.ACA: anterior cerebral artery; CT: computerised tomography; DSA: digital subtraction angiography; ICA: internal carotid artery; MRI: magnetic resonance imaging.The authors declare that they have no competing interests.BFM made substantial contributions to the design, acquisition of data, literature review and drafting of this manuscript, BC contributed to the acquisition of data and the radiological images, JK and DO were responsible for the conception, drafting and general supervision of this work. All authors have given final approval of the version to be published.Written informed consent was obtained from this patient for the publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Organohalogen compounds (OHCs) are known to have neurotoxic effects on the developing brain.We investigated the influence of prenatal exposure to OHCs, including brominated flame retardants, on motor, cognitive, and behavioral outcome in healthy children of school age.This study was part of the prospective Groningen infant COMPARE study. It included 62 children in whose mothers the following compounds had been determined in the 35th week of pregnancy: 2,2′-bis-(4 chlorophenyl)-1,1′-dichloroethene, pentachlorophenol (PCP), polychlorinated biphenyl congener 153 (PCB-153), 4-hydroxy-2,3,3′,4′,5-pentachlorobiphenyl (4OH-CB-107), 4OH-CB-146, 4OH-CB-187, 2,2′,4,4′-tetrabromodiphenyl ether (BDE-47), BDE-99, BDE-100, BDE-153, BDE-154, and hexabromocyclododecane. Thyroid hormones were determined in umbilical cord blood. When the children were 5–6 years of age, we assessed their neuropsychological functioning: motor performance , cognition , and behavior.Brominated flame retardants correlated with worse fine manipulative abilities, worse attention, better coordination, better visual perception, and better behavior. Chlorinated OHCs correlated with less choreiform dyskinesia. Hydroxylated polychlorinated biphenyls correlated with worse fine manipulative abilities, better attention, and better visual perception. The wood protective agent (PCP) correlated with worse coordination, less sensory integrity, worse attention, and worse visuomotor integration.Our results demonstrate for the first time that transplacental transfer of polybrominated flame retardants is associated with the development of children at school age. Because of the widespread use of these compounds, especially in the United States, where concentrations in the environment are four times higher than in Europe, these results cause serious concern. Organohalogen compounds (OHCs) are toxic environmental pollutants used extensively in pesticides, flame retardants, hydraulic fluids, and in other industrial applications . They arPrevious studies in humans on the effect of prenatal OHC exposure on outcome reported that polychlorinated biphenyls (PCBs) have adverse effects on neurologic performance and cognitive development at 6–11 years of age . KnowledBrominated flame retardants such as polybrominated biphenyls (PBBs) and polybrominated diphenyl ethers (PBDEs) were introduced as the new, allegedly harmless, successors of PCBs. However, the effect of prenatal exposure to brominated flame retardants on neurodevelopmental outcome at school age has never been investigated.The primary aim of this explorative study was to investigate the influence of prenatal OHC exposure, including OH-PCBs and PBDEs, on motor, cognitive, and behavioral outcomes in healthy Dutch children at 5–6 years of age.OHCs are also known to influence fetal thyroid hormone levels . BecauseThis prospective cohort study is part of the Groningen infant COMPARE (GIC) study launched within the European COMPARE study. The cohort of the GIC study consisted of 90 white, healthy pregnant women randomly selected from those who had given birth to a healthy, full-term, singleton infant and lived in the northern provinces of the Netherlands . All theTo determine the concentrations of the neutral and phenolic OHCs, blood (30 mL) was taken from the women at the 35th week of pregnancy. The blood was centrifuged at 3,600 rpm for 10 min, and the serum was collected and stored in acetone-prewashed glass tubes at −20°C until analysis.n = 2), BDE-99 (n = 3), or BDE-100 (n = 3) , OH-PCBs , and a wood protective agent, pentachlorophenol (PCP), were analyzed in 90 serum samples taken at the 35th week of pregnancy. Because of financial constraints, brominated flame retardants were analyzed in 69 randomly selected serum samples taken at the 35th week of pregnancy. Mean levels of BDEs 47, 99, and 100 measured in blank samples were subtracted from values measured in study samples to correct for background exposures . Samples that were below the limit of detection (LOD) for BDE-47 (/g serum ]were ass/g serum .4), free T4, reverse triiodothyronin (rT3), triiodothyronin (T3), thyroid-stimulating hormone (TSH), and thyroid-binding globulin levels were determined in the umbilical cord blood of the 90 women, provided that enough cord blood was available to perform the analyses.Thyroxin . This quTotal, Verbal, and Performance Intelligence levels were assessed using a short form of the Wechsler Preschool and Primary Scale of Intelligence, revised (WPPSI-R) . ExampleIn addition, we assessed several neuropsychological functions to investigate whether these were impaired by prenatal OHC exposure. They were assessed by subtests of the NEPSY-II , a neuropsychological battery for children . CentralWe assessed verbal memory using a standardized Dutch version of the Rey’s Auditory Verbal Learning Test (AVLT) . This teWe measured sustained attention and selective attention with the two subtests “Score!” and “Sky Search” of the Test of Everyday Attention for Children . SustainThe total duration of the follow-up was approximately 2.5 hr. Test scores obtained when a child was too tired and uncooperative, as assessed by the experimenter, were excluded.To obtain information on the children’s competencies and their behavioral and emotional problems, the parents completed the Child Behavior Checklist (CBCL) and the In addition, the parents filled out an attention deficit/hyperactivity disorder (ADHD) questionnaire that contains 18 items on inattention, hyperactivity, and impulsivity .To gain insight in the socioeconomic status (SES) and home environmental factors that may influence development, the highest level of maternal education and the Home Observation for Measurement of the Environment (HOME) questionnaire were assessed during the first year after birth during an earlier stage of the GIC study .U-test to relate the neurologic outcome to OHC concentrations.Chemical values are presented as medians with range because of the skewed distribution. Neutral compounds are expressed on lipid weight basis (nanograms per gram lipid) and phenolic compounds on fresh weight basis (picograms per gram serum). To compare the scores on the Movement ABC and cognitive tests with the reference values, we classified the scores into “normal” (> 15th percentile), “subclinical” (5th to 15th percentile), and “clinical” (≤ 5th percentile). We classified the questionnaires according to the instructions in the manual that provides the percentiles corresponding to the raw scores. The results on the neurologic examination are reported as percentage of children with nonoptimal function. We calculated intelligence quotient (IQ) scores by deriving the standard scores from the mean of the scores on the verbal and performance subtests. Because no Dutch norms are available for the NEPSY-II, we used the American norms to classify the scores of the children into percentiles. For the AVLT, we used the Dutch norms for children of 6 years of age. The Kolmogorov–Smirnov test was used to determine which neutral and phenolic OHC concentrations and outcome measures were distributed normally. We used the Pearson correlation for normally distributed variables and the Spearman’s rank correlation for nonnormally distributed variables, to relate the OHC concentrations to motor, cognitive, and behavioral outcome. The raw scores of the outcome variables were used for these calculations. Where appropriate, the test scores were inversely transformed so that for all tests higher scores indicated better outcomes. We used the Mann–Whitney U-test). If so, we corrected for sex on that outcome measure. The corrections were performed by means of partial correlations controlling for confounders.We corrected cognition and behavior of the children for SES and HOME, because these factors may exert an influence on the cognition and behavior of the children . We alsoWhen correlations between OHCs and outcome did not reach significance, we explored their relationship by means of scatterplots, to determine whether some other, nonlinear relationship existed.p < 0.05 was considered to be statistically significant. SPSS 14.0 software for Windows was used for all the analyses.In this article, negative correlations indicate that higher OHC concentrations were related to worse outcome and positive correlations indicate that higher OHC concentrations were related to better outcome. Throughout the analyses, Of the 69 children invited, 62 (90%) participated in the follow-up program. Six sets of parents declined the invitation to participate. One girl had to be excluded because she suffered severe cognitive impairment of unknown origin and therefore could not be tested. The OHC concentrations of the seven children not followed up were not different from those who did participate.The mean maternal age was 32 years . The highest level of maternal education was primary school for 4 mothers, secondary school for 30 mothers, and tertiary school for 28 mothers. The mean score on the HOME questionnaire was 33 .The cohort consisted of 38 boys and 24 girls. The mean age at follow-up was 5 years 10 months . The scores of the children were comparable to the reference values, except for selective attention, verbal memory, and internalizing and externalizing behavioral problems, on which the children obtained slightly worse scores compared with the reference values. The mean (± SD) for total IQ of the children was 103 ± 9 ; mean verbal IQ, 102 ± 9 ; and mean performance IQ, 103 ± 13 .According to the neurologic examination, we found that of the 62 children examined, 1 child (2%) had coordination problems, 2 children (3%) had mild tremors, 18 children (29%) had nonoptimal fine manipulative abilities, and 21 children (34%) had nonoptimal sensory integration.p = 0.044), we corrected selective attention for sex. After these corrections, we found additional correlations between OHCs and outcome. Some correlations before the correction were stronger after controlling for confounders, whereas others disappeared. p < 0.10).We corrected the cognitive and behavioral outcome for SES and HOME, and because boys and girls differed significantly for selective attention .3 correlated with better fine manipulative abilities. T3 correlated with better visuomotor integration and better behavior. T4 correlated with better sensory integrity and less ADHD.3 ; BDE-47 correlated with higher concentrations of T3 , as did BDE-99 and BDE-100 .We also found that OHC concentrations were related to thyroid hormones. PCP correlated with lower concentrations of TThe present explorative study indicated that prenatal background exposure to OHCs, including OH-PCBs and the more recently introduced PBDEs, correlated both positively and negatively with neurodevelopmental outcome in healthy Dutch children at 5–6 years of age. To the best of our knowledge, this study is the first to investigate the influence of background exposure to these toxic environmental pollutants on developmental outcome in healthy children at school age.With regard to PBDEs, animal studies have indicated that prenatal exposure to different PBDEs may cause long-lasting behavioral alterations, particularly in motor activity and cognitive behavior . We founHuman studies on the 1974 Michigan PBB incident showed that accidental exposure to high levels of PBBs may lead to perceptual and perceptual–motor problems and lower scores on subtests of the McCarthy Scales of Children’s Abilities in children 4–6 years of age . During With regard to PCBs, exposure can lead to subtle cognitive deficits, motor delay, and adverse effects on neurologic status in children at school age . These e4 (3 and T4), by contrast, correlated with better outcome. These findings, together with the negative correlations between OHCs and development, seem to confirm the hypothesis that thyroid hormone homeostasis may be involved.OHCs are known to exert their neurotoxic influence by affecting thyroid hormone homeostasis. It is hypothesized that OHCs affect thyroid hormone homeostasis by interfering with thyroid hormone signaling in the developing brain, by changing intracellular thyroid hormone availability, and by interacting directly at the level of the thyroid hormone receptors. On the one hand, OHCs have a high affinity for thyroid hormone receptors and lead to a decrease in thyroid hormone levels, whereas levels of TSH increase through hormonal feedback mechanisms. Previous studies on pregnant women and their infants found that PCBs are associated with higher levels of TSH and lower levels of T4 . We founBecause the threshold levels of toxicity for the different OHCs are unknown, we did not statistically test low versus high levels of OHCs in relation to outcome. The toxic equivalents of most of the OHCs investigated are also unknown. Research has shown that some compounds enhance each other, whereas others counteract each other. No data are available for all the compounds tested in our study. As a consequence, we explored relations between OHCs and outcome at school age by means of correlations. Because this study is, to the best of our knowledge, the first to investigate the association between background levels of OHCs and outcome at school age, it was difficult to hypothesize on the expected effect on the outcome measures. Our study might serve as a basis for power calculations for future studies, because it demonstrates the variability of various parameters and their mutual associations.It was striking that we found both positive and negative correlations between OHCs and outcome. It is difficult to determine the implications of these results for functioning in later life. The multiple statistical analyses that were performed might have played a role in this finding. Furthermore, it is difficult to determine how many of these effects can reliably be assigned to the specific contaminants, because some of them were likely to show some degree of collinearity. Other contaminants that were not measured, such as methyl mercury, might also have played a role.We did not compare postnatal OHC concentrations with outcome at 5–6 years of age because previous studies have pointed out that the most serious effects of neurotoxic OHCs are produced on developmental processes that occur prenatally .Concentrations of PBDEs in the environment are much higher in the United States than in Europe, Asia, or Australia . Levels Prenatal background exposure to OHCs not previously studied correlated with neuropsychological functioning in children at school age. PBDEs, used extensively worldwide, correlated with motor performance, attention, visual perception, and behavior, and we found the same results for OH-PCBs. We believe that unrelenting efforts should be made to find safe alternatives for these compounds.

Previous studies indicate that the frequency distributions of HLA alleles and haplotypes vary from one ethnic group to another or between the members of the same ethnic group living in different geographic areas. It is necessary and meaningful to study the high-resolution allelic and haplotypic distributions of HLA loci in different groups.High-resolution HLA typing for the Uyghur ethnic minority group using polymerase chain reaction-sequence-based-typing method was first reported. HLA-A, -B and -DRB1 allelic distributions were determined in 104 unrelated healthy Uyghur individuals and haplotypic frequencies and linkage disequilibrium parameters for HLA loci were estimated using the maximum-likelihood method. A total of 35 HLA-A, 51 HLA-B and 33 HLA-DRB1 alleles were identified at the four-digit level in the population. High frequency alleles were HLA-A*1101 (13.46%), A*0201 (12.50%), A*0301 (10.10%); HLA-B*5101(8.17%), B*3501(6.73%), B*5001 (6.25%); HLA-DRB1*0701 (16.35%), DRB1*1501 (8.65%) and DRB1*0301 (7.69%). The two-locus haplotypes at the highest frequency were HLA-A*3001-B*1302 (2.88%), A*2402-B*5101 (2.86%); HLA-B*5001-DRB1*0701 (4.14%) and B*0702-DRB1*1501 (3.37%). The three-locus haplotype at the highest frequency was HLA-A*3001-B*1302-DRB1*0701(2.40%). Significantly high linkage disequilibrium was observed in six two-locus haplotypes, with their corresponding relative linkage disequilibrium parameters equal to 1. Neighbor-joining phylogenetic tree between the Uyghur group and other previously reported populations was constructed on the basis of standard genetic distances among the populations calculated using the four-digit sequence-level allelic frequencies at HLA-A, HLA-B and HLA-DRB1 loci. The phylogenetic analyses reveal that the Uyghur group belongs to the northwestern Chinese populations and is most closely related to the Xibe group, and then to Kirgiz, Hui, Mongolian and Northern Han.The present findings could be useful to elucidate the genetic background of the population and to provide valuable data for HLA matching in clinical bone marrow transplantation, HLA-linked disease-association studies, population genetics, human identification and paternity tests in forensic sciences. The Uyghur ethnic minority has its own language and alphabet. The Uyghur language, formerly known as Eastern Turki, belongs to the Uyghur Turkic branch of the Turkic language family, which is controversially a branch of the Altaic language family. The Uyghurs have two written languages, with one based on Arabian letters and the other on Latin letters Almost all the Uyghurs in China live in Xinjiang Uyghur Autonomous Region. The region, by far the biggest of the country's regions and provinces, covers more than 1,709,400 square kilometers or approximately one sixth of China's total landmass. Although Han, Kazak, Hui, Mongolian, Kirgiz, Tajik, Xibe, Ozbek, Manchu, Daur, Tatar and Russian people also live in Xinjiang, the Uyghur, who believe in Islam, are the largest ethnic group there , a total of 3391 alleles, including 1001 HLA-A, 1605 HLA-B and 785 HLA-DRB1 alleles, have been identified at HLA class I and class II loci in the world, which indicates that the HLA system constitutes the most complex and highly polymorphic genetic system in the human genome that has ever been discovered. The previously published population data The human major histocompatibility complex (MHC), also called human leukocyte antigen (HLA), is located at chromosome 6p21.31 Studies have been done on the genetic polymorphisms of HLA loci in the Uyghur population using low-middle resolution techniques. Yan CX et al. analyzed the HLA-A locus in Chinese Uyghur population by PCR amplification using sequence-specific oligonucleotide probe (PCR-SSOP) P values for Hardy-Weinberg equilibrium tests of HLA-A, -B and -DRB1 loci were 0.5785, 0.9696 and 0.4242, respectively, which indicate that the HLA genotypic frequency distributions in the Uyghur ethnic minority were consistent with the Hardy-Weinberg equilibrium at the three HLA loci.Polymorphisms of HLA-A, -B and -DRB1 loci in the Uyghur ethnic minority of Chinese Xinjiang Uyghur Autonomous Region were investigated using the SBT method. The The allelic frequencies at HLA-A, -B and -DRB1 loci obtained by high-resolution DNA typing of 104 unrelated healthy Uyghur individuals are summarized in HLA-B locus was extremely diverse, with a total of 51 alleles detected. The allelic frequencies of the HLA-B*35, B*51, B*15 and B*50 groups accounted for 12.49%, 9.61%, 8.16% and 6.73%, respectively. HLA-B*5101 had the highest frequency (8.17%) at the HLA-B locus, followed by B*3501 (6.73%), B*5001 (6.25%), B*1801 (4.81%), B*5801 (4.81%) and B*0702 (4.33%). The HLA-B*15 group was found to be the most diverse allelic family at HLA-B locus, consisting of eight alleles: B*1501, B *1502, B *1503, B *1505, B *1508, B *1517, B *1518 and B *1529.Thirty-three HLA-DRB1 alleles were identified. The allelic frequencies of the HLA-DRB1*7, DRB1*15, DRB1*13, DRB1*4 and DRB1*3 groups accounted for 16.35%, 13.94%, 13.46%, 12.01% and 11.53%, respectively. The six most common HLA-DRB1 alleles with a frequency higher than 5% were DRB1*0701 (16.35%), DRB1*1501 (8.65%), DRB1*0301 (7.69%), DRB1*1301(5.77%), DRB1*0401(5.29%) and DRB1*1502 (5.29%). The cumulative frequency of the six alleles was 49.04%.A total of 133 HLA A-B haplotypes, 118 HLA B-DRB1 haplotypes and 173 HLA A-B-DRB1 haplotypes were estimated using the expectation maximization (EM) algorithm. The estimated haplotypes were considered statistical significance only when their frequencies were greater than or equal to 2/3N (N: the sample size) The haplotypic frequencies of the estimated significant HLA haplotypes (the haplotypic frequencies ≥1.00%) are summarized in http://202.117.24.55:8001/xwlw/detail_xwlw.jsp?searchword_AUTHOR%3D%C9%F2%B4%BA%C3%B7&singlesearch_no&channelid_65004&record_2), Hong Kong Chinese populationThe phylogenetic tree in The values of the major forensic parameters for HLA-A, -B, and -DRB1 loci in the Uyghur population were listed in With the continuous development of economy and society and the progress in human culture, inter-ethnic intermarriages, especially the marriage between national minorities and the Han population have markedly increased, resulting in the assimilation and the decrease in ethnic minority populations. In addition, the ethnic minority populations previously isolated in remote areas are gradually migrating to the civilized areas in pursuit of a better life. These people may also marry other ethnic people. In view of these facts, the number of pure blooded ethnic minorities decrease rapidly. Therefore, preservation and study of genetic information resources of pure blooded ethnic minorities have been a priority on the research agenda. The authors have collected and stored blood samples from more than ten national minorities and have studied the population genetics of HLA loci and the short tandem repeats (STR) of Y chromosome and autosome in these national minorities, including the genetic polymorphisms of Y chromosome and autosome STR in the Uyghur ethnic minority in Xinjiang Uyghur Autonomous Region, China A total of 35 HLA-A, 51 HLA-B and 33 HLA-DRB1 alleles defined at the four-digit level were identified in the population. HLA-A*1101 was the most frequent allele at HLA-A locus in the Uyghur population, followed by A*0201, A*0301, A*3301 and A*2402. The five alleles accounted for 54.81% of the total HLA-A allelic frequency. HLA-A*1101 is also the most common HLA-A allele in other populations such as Chinese Wa (58.4%) The HLA-B locus exhibited the highest degree of polymorphisms in the Uyghur population. The three alleles with a frequency of more than 5% detected at the HLA-B locus were HLA-B*5101, B*3501 and B*5001. The HLA-B*5101 is also the most frequent allele in Asians, such as Kirgiz, Xibe, Tibetan, Dai, Mongolian, Hui, isolated Han population in southwest China, Beijing Han, Korean and Japanese. The HLA-B*3501 and B*5001 alleles detected in the Uyghur population are less common or never seen in other Asian populations. The HLA-B*4001, B*4601, B*1501 and B*1502 alleles, which have been found to have high frequencies in the Asian populations previously reported The HLA-DRB1 locus exhibited a high degree of polymorphism in the Uyghur population. The HLA-DRB1*0701, DRB1*1501, DRB1*0301, DRB1*1301, DRB1*0401 and DRB1*1502 were predominant alleles in the HLA-DRB1 locus in the population. The results were similar to frequency distributions of DRB1*0701 (16.7%) and DRB1*0301 (14.0%) in the Uygur population in the Silk Route of Northwest China Three HLA-A-B haplotypes, HLA-A*3001-B*1302, HLA-A*2402-B*5101 and HLA-A*3201- B*3501, occurred at a frequency greater than 2% in the Uyghur population. HLA-A*3001-B*1302 detected in the study population have commonly been observed in Kirgiz (2.72%), Hong Kong Chinese population (1.30%), Taiwanese (1.2%) and Xibe population (1.19%). HLA-A*2402-B*5101 in the Uyghur population has been found in Kirgiz (2.72%), Hong Kong Chinese population (1.30%) and Xibe population (1.19%). HLA-A*3201-B*3501 at a high frequency in the population is less frequent in other populations. HLA-A*1101-B*0702 and HLA-A*1101-B*5201 at a high frequency detected in the study population have been observed in the Yi population, at a respective frequency of 1.32% and 4.37%. HLA-A*0301-B*3501, HLA-A*0201-B*1801 at a high frequency in the population have been seen at a frequency of 2.01% and 2.05% in Eastern European American, respectively. HLA-B*5801-DRB1*0301 at a high frequency in studied population is also the most frequent two-locus haplotypes in other populations such as the Kinh population in Vietnam (4.10%), Han from Southern China (3.00%), Dai (4.40%) and Maonan (4.20%). The Uyghur population shared some haplotypes with other populations, namely, HLA-B*1302-DRB1*0701 (2.83%) with Korean population (2.89%) and Taiwanese (1.27%); HLA-B*3701-DRB1*1001 (1.92%) with Korean population (1.34%), Han from Southern China (3.00%); and HLA-B*5201-DRB1*1502 (2.40%) with Korean population (2.37%). HLA-A*3001-B*1302-DRB1*0701 (2.40%) in the population was also present at a high frequency in both Korean population (2.68%) and Taiwanese (3.02%). In all, the distributions of these haplotypes further suggest that the Uyghur population was a characteristic northwestern Chinese population. The haplotypes in this study were estimated using EM algorithm, but the haplotypes presented were not based on family data; therefore, we need to acknowledge the potential errors inherent to haplotype estimation methods The phylogenetic tree reveals that the Uyghur population belonged to the northwestern Chinese populations and was most closely related to Xibe group, and then to Kirgiz, Hui, Mongolian, and Northern Han. The reason that HLA-B locus was chosen for the phylogenetic tree construction was that HLA-B locus is highly polymorphic and that high-resolution HLA-B data can be obtained from a large number of comparable populations. The similar clustering results were obtained using the single HLA-A or HLA-DRB1 locus or HLA A-B-DRB1 haplotype. The close relationship of the Uyghur population with these groups may be partly explained by its history. The origin of the Uyghur population can be traced back to the Dingling nomads in the third century BC. The majority of the Uyghurs moved to the Western Region (present-day Xinjiang area) and some went to the Tufan principality in western Gansu Province after the mid-ninth century. The Uyghurs who settled in the Western Region intermarried with the Han people in Southern Xinjiang and Tibetan, Qidan and Mongol tribes, and evolved into the group now known as the Uyghurs.Genetic distance here refers to the genetic divergence between populations within a species. A small genetic distance indicates a close genetic relationship between two populations whereas a large genetic distance indicates a distant genetic relationship −6, respectively, which suggest that allelic frequencies at HLA loci were highly polymorphic in the study population and that HLA loci could be applied to personal identification and paternity testing in forensic science. Take a paternity testing case in forensic science for example. When one or two STR loci violate the genetic principle in paternity testing and exclude the alleged father or mother as biological father or mother, it is suspected that the alleged father or mother may not be the biological father or mother. However, we considered that gene mutation might occur at the STR loci excluded. In such a case, additional genetic markers are needed to further determine paternity. Nowadays, although a large number of new STR loci have been studied, they don't adopt quality and measurement attestation in the forensic application. Therefore, the highly polymorphic HLA loci may be the best option for further paternity testing. The results show that combinations of the HLA loci and STR loci may be a powerful tool for individual identification and paternity testing for the Chinese Uyghur population in the region.The polymorphisms of genetic markers can be evaluated by some forensic parameters such as HO, HE, PD, PIC and PPE. A higher heterozygosity means that more allele diversity exists and therefore, there is less chance of a random sample matching. A locus is considered highly polymorphic when its PIC is higher than 0.5 This present study may provide basic and valuable data for anthropological analysis and studies of HLA-associated disease susceptibility, organ transplantation , population genetics, human identification and paternity testing in forensic sciences.This study was approved by the Ethics Committee of Xi'an Jiaotong University, China. All the participants provided their written informed consent for the collection of the samples and the subsequent analysis, and the investigation was conducted in accordance with humane and ethical research principles of Xi'an Jiaotong Univeristy, China.One hundred and four unrelated healthy Uyghur individuals were randomly chosen from Yining city, Xinjiang Uyghur Autonomous Region, China. All participants were interviewed to ensure that no individuals have common ancestry going back at least three generations.Whole blood samples were collected from the participants and stored at -20°C until DNA extraction. Genomic DNA was extracted from whole blood containing ethylenediaminetetraacetic acid (EDTA) using a standard salting out method which yielded good quality high molecular weight DNA suitable for sequencing All individuals were typed for HLA-A, -B and HLA-DRB1 loci. Sequencing-based-typing (SBT) of exons 2 and 3 at HLA-A and -B loci were performed according to Kurz et al. PCR amplification was performed using a GeneAmp PCR system 9700 . PCR-amplified DNA fragments were purified and sequenced with ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits using an ABI 3730XL DNA sequencer , according to the manufacturer's instructions. Sequencing was processed always in the forward and reverse directions using software Sequencing Analysis, MatchTools and Navigator . The software was used to detect the heterozygous position within each electropherogram and to assess the typing, based on an alignment of the processed sequence with a library of HLA sequences and alleles updated to October 2007. Ambiguous types were resolved to four digits according to the updated database (IMGT release 2.19.0).Allelic frequencies of HLA-A, -B and -DRB1 loci were estimated using SPSS 11.0 software . Haplotypic frequencies were calculated from genotype data by expectation maximization (EM) algorithm using Arlequin software package version 3.0 Forensic parameters, including heterozygosity observed, expected heterozygosity, power of discrimination, polymorphism information contents, and probability of paternity exclusion, computed using the PowerStat version 1.2 spreadsheet , as described by Tereba

In this study, we investigate the efficacy of repairing an osteochondral defect in rabbit knee joints by administering bevacizumab, a humanized monoclonal anti-vascular endothelial growth factor (VEGF) antibody.An osteochondral defect was created on the patellar groove of 20 Japanese white rabbits that were classified into two recipient groups: group B, administration of bevacizumab (100-mg intravenous injection on the day of surgery and 2 weeks later), and a control group (defect only). Rabbits were killed 1 and 3 months postoperatively. Sections were stained with safranin O. Repair sites were evaluated using the modified O'Driscoll International Cartilage Repair Society grading system. The expression of chondromodulin (ChM)-I and VEGF was evaluated using immunohistochemical analyses.At 1 month postoperatively, the repair site in group B was filled with cartilaginous tissue. At 3 months, the repair site retained this cartilage phenotype. At 1 month in the controls, the defects were mainly filled with fibrous tissue. At 3 months, the defect was replaced by fibrous tissue and bone. Over the 3-month period, histological scores were significantly higher in group B than in the controls. At 1 month, group B showed intense positive results for ChM-I in the bottom of the repair tissue. VEGF was also identified in the same area. In the controls, no ChM-I was observed in the repair tissue. Conversely, the remodeling hypertrophic chondrocyte layer stained intensely for VEGF.Intravenous administration of bevacizumab contributes to better repair of articular cartilage in an osteochondral defect model. We suggest the possibility of facilitating articular cartilage repair with anti-VEGF antibody rather than using cultured cells or artificial scaffolds. Mature articular cartilage shows limited capacity for regeneration after degeneration or injury . For thiSuccessful regeneration of any tissue requires the presence of reparative cells with the potential to differentiate into the phenotypes required to restore the damaged site, but a microenvironment that supports the proliferation and differentiation of those cells is also needed ,29. In aThe objective of this study is to investigate the efficacy of repair in an osteochondral defect model of the rabbit knee joint following administration of bevacizumab, a humanized monoclonal anti-VEGF antibody, without using cultured cells or artificial scaffolds.Animal experiments were approved by the ethics review board of Tokai University and were performed in accordance with the guidelines on animal use of Tokai University.2 gas. After receiving a medial parapatellar incision to both legs, each patella was dislocated laterally and an osteochondral defect was created on the patellar groove of the femur in both legs using a drill and a biopsy punch . The bottom of the subchondral bone was shaved to a plane using the biopsy punch until bleeding was seen from the marrow. Rabbits were classified into two recipient groups: Group B, with administration of bevacizumab ; and controls . After recovery from surgery, all animals were allowed to walk freely in their cages without any splints.Twenty Japanese white rabbits were used in this study. The rabbits were anesthetized by exposure to sevoflurane and ORabbits were killed 1 and 3 months postoperatively by an overdose of intravenous anesthetic. The distal part of the femur was excised and fixed with 4% paraformaldehyde for 7 days. Each specimen was decalcified in a solution of 10% ethylenediaminetetraacetic acid (EDTA) in distilled water (pH 7.4) for 2-3 weeks, then embedded in paraffin wax and sectioned perpendicularly (4.5-m sections) through the center of the defect. Each section was stained with safranin O for glycosaminoglycans.Immunohistochemistry was performed as described previously ,33. BrieU test. Values of P < 0.05 were considered statistically significant for any differences.Results are presented as the means ± standard deviation (SD). Histological score was analyzed by the Mann-Whitney Operations were uneventful, and all rabbits immediately resumed normal cage activity. In Group B, major infection was identified in one knee at 1 month after surgery and in three knees at 3 months. These infected knees were omitted from the study. As a result, nine knees at 1 month and seven knees at 3 months were assessed from Group B, compared to 10 knees in controls at both 1 and 3 months.At 1 month after surgery, defects in both Group B and the controls were filled with reparative cells. In Group B, the repair site appeared to be filled with cartilaginous tissue, which was stained with safranin O Figures and 1b. At 1 month, Group B showed intense positive results for ChM-I at the bottom of the repair tissue in the remodeling hypertrophic chondrocyte layer, representing the border between cartilage and bone Figure . ChM-I hWe evaluated the repair site using a modified version of the grading system developed by O'Driscoll, Keeley and Salter . In thisAt 1 month, inside the repair tissue in Group B, Ti was mostly hyaline cartilage in seven of nine cases, with high cellularity of rounded chondrocytes and mostly fibrocartilage in two of nine cases. Conversely, in the controls, 4 of 10 cases showed mostly hyaline cartilage, 4 of 10 cases were mostly fibrocartilage and 2 of 10 cases were mostly noncartilage. For Matx in Group B, six of nine cases were strong, two of nine cases were moderate and one case showed slight staining. In the controls, 5 of 10 cases were strong, 3 of 10 cases were moderate and 2 of 10 cases showed slight staining. In Group B, Stru of the defect filling revealed the beginning of columnar organization of chondrocytes in six of nine cases and no organization of chondrocytes in three of nine cases. In the controls, 3 of 10 cases showed the beginning of columnar organization, 4 of 10 cases showed no organization and 3 of 10 cases showed cysts or disruptions. In both groups, Clus was not observed except in one instance. In one instance, there was a small amount of Clus in both groups. Also, in both groups, Tide was opened in all instances. In Group B, subchondral Bform was not recognized in four of nine cases, slightly recognized in four of nine cases and strongly recognized in one of nine cases. In the control group, subchondral Bform was not recognized in 8 of 10 cases and was slightly recognized in 2 of 10 cases. SurfH in Group B was normal in five of nine cases and showed slight fibrillation or irregularity in four of nine cases; in the control group, 1 of 10 cases was normal, 6 of 10 cases showed slight fibrillation or irregularity, 2 of 10 cases showed moderate fibrillation or irregularity and 1 of 10 cases showed severe fibrillation or disruption. FilH in Group B was complete in six of nine cases and nearly complete in three of nine cases. In controls, FilH was complete in 2 of 10 cases, nearly complete in 4 of 10 cases, moderate in 2 of 10 cases and nearly empty in 2 of 10 cases. Latl in Group B was bonded on both sides in seven of nine cases and bonded at one end or partially at both ends in two of nine cases. In controls, Latl was bonded on both sides in 1 of 10 cases, bonded at one end or partially at both ends in 6 of 10 cases and not bonded in 3 of 10 cases. Basl was good in all cases for both groups. In Group B, no inflammation was observed in all cases for InfH. The control group showed no inflammation in 5 of 10 cases, slight inflammation in 4 of 10 cases and strong inflammation in 1 of 10 cases. As a result, at 1 month, the total score was significantly higher for Group B than for the controls. In terms of individual scores, SurfH, FilH and Latl for Group B were significantly higher than in controls.In Group B, Ti at 3 months showed mostly hyaline cartilage in six of seven cases. In one of seven cases, tissue was mostly fibrocartilage. Conversely, in the controls, 3 of 10 cases were mostly hyaline cartilage, with mostly fibrocartilage in 1 of 10 cases and exclusively noncartilage in 6 of 10 cases. For Matx, six of seven cases in Group B showed strong staining and one of seven cases showed moderate staining; in the controls, 3 of 10 cases were strong, one instance was moderate and 6 of 10 cases were nonstaining. In Group B, Stru of the defect filling revealed tissue similar to healthy mature cartilage in three of seven cases, beginning columnar organization of chondrocytes in three of seven cases and no organization of the chondrocytes in one of seven cases. In the controls, only one instance was similar to healthy mature cartilage, 2 of 10 cases were beginning columnar organization, 1 of 10 cases had no organization and 6 of 10 cases showed severe disintegration. In Group B, Clus was not observed. In controls, 2 of 10 cases showed no clusters, 2 of 10 cases showed some clusters and 6 of 10 cases showed abundant cluster cells or nonchondrocytes. Tide in Group B was complete in three of seven cases, nearly complete in two of seven cases, half degree in one of seven cases and nearly absent in one of seven cases; in the controls, 1 of 10 cases was complete, 2 of 10 cases were nearly complete, 1 of 10 cases was half degree and 6 of 10 cases were not recognized as containing a calcified cartilage layer. Bform was recognized in both groups, except for one instance in each. In one instance, there was a slightly Bform in both groups. SurfH in Group B was normal in five of seven cases and showed slight fibrillation or irregularity in two of seven cases; in the controls, 1 of 10 cases was normal, 1 of 10 cases showed slight fibrillation or irregularity, 2 of 10 cases showed moderate fibrillation or irregularity and 6 of 10 cases showed severe fibrillation or disruption. FilH in Group B was complete in all instances. In the controls, FilH was complete in 4 of 10 cases, moderate in 1 of 10 cases, nearly empty in 1 of 10 cases and almost empty in 4 of 10 cases. Latl in Group B were bonded at both sides in six of seven cases and bonded at one end in one of seven cases. In the controls, Latl was bonded both sides in 1 of 10 cases, bonded at one end or partially both ends in 2 of 10 cases and not bonded in 6 of 10 cases. Basl was good in all cases in both groups. For InfH, no inflammation was observed in any cases in either group. At 3 months, the total score for Group B was significantly higher than that for the controls. In terms of individual scores, Ti, Matx, Stru, Clus, SurfH, FilH and Latl were significantly higher for Group B than for the control group in Group B, a result of blocking VEGF, whereas in the controls, the defects were repaired with that of various tissues, including hyaline cartilage (4 of 10 cases), fibrocartilage (4 of 10 cases) and noncartilage (2 of 10 cases). There was no delay in subchondral bone formation in Group B when blocking VEGF. For autologous reparative cells, basal integration was good and most inflammatory signs were absent from both groups. On the other hand, FilH, Latl and SurfH were significantly higher for Group B than for the controls. Actually, at 1 month after surgery, six of nine cases in Group B showed convex surfaces of these repaired tissues in surrounding articular cartilage, compared to only 2 of 10 cases in the controls. These results indicate that blocking VEGF preserves the accumulation of reparative cells in the defect. This is supported by studies showing that VEGF treatment prevents condensation of chondrogenic mesenchyme during early limb bud development through abnormal vascularization . As a suDefects had been repaired by the formation of various tissues in the controls at 3 months after surgery, which included hyaline cartilage (3 of 10 cases), fibrocartilage (1 of 10 cases) and exclusively noncartilage (6 of 10 cases). On the other hand, when blocking VEGF, defects were repaired mostly with hyaline cartilage (six of seven cases), with only one case being mostly fibrocartilage. To emphasize this, no cases showed replacement by fibrous tissue or bone. Similarly, 1 month after surgery, the controls showed repair without consistent tissue morphology, while Group B showed repair with consistency of tissue morphology. At 3 months postoperatively, Ti, Matx, Stru and Clus were significantly higher for Group B than for the controls. In both Group B and the controls, Tide was generally closed and bone formation was gradually observed. Continuous basal integration was also good and most signs of inflammation were not apparent in either group. Tissue that was repaired in the form of fibrous tissue and bone tended to show moderate or severe fibrillation of surface architecture and low defect filling. Therefore, SurfH and FilH were significantly higher for Group B than for the controls. As mentioned before, a sufficient number of reparative cells were in contact with the surrounding cartilage layer, and lateral integration was considered to be good. As a result, at 3 months, the total score was significantly higher for Group B than for the controls.et al. [et al. [Interestingly, ChM-I was expressed in the early stage of tissue repair after bevacizumab administration. ChM-I reportedly stimulates chondrocyte proliferation and proteoglycan synthesis in vitro and inhibits proliferation of vascular endothelial cells in vitro and in vivo ,53. Kita [et al. reportedIn this study, ChM-I was expressed at the bottom of the repair site invaded near the vasculature. ChM-I accumulated in the interterritorial space of the repaired matrix and was surrounding the cells that expressed VEGF. ChM-I is thought to form a barrier to inhibit vascular invasion from subchondral bone, indicating that it facilitates the acquisition of articular cartilage through the process of MSC differentiation in endochondral ossification. However, the shift from angiogenesis to antiangiogenesis is not determined entirely by ChM-I and VEGF. Inducers of endogenous angiogenic molecules also exist in the process of endochondral ossification, and these include VEGF , fibroblet al. [In other studies, VEGF has been reported to be necessary for chondrocyte survival during cartilage development. In VEGF-deficient mouse models, massive cell death is observed in the joint and epiphyseal regions of cartilage during cartilage development ,58. In tet al. reportedThe half-life of bevacizumab in the circulation of humans is reportedly 17-21 days. The approved dose of bevacizumab in humans is 5 mg/kg, and the clinical administration interval is more than 2 weeks . BevacizTemporary intravenous administration of the humanized monoclonal anti-VEGF antibody bevacizumab in an osteochondral defect model results in positive restorative effects. We suggest that this approach would be useful to achieve repair of articular cartilage without the need for cells or tissue transplantation.BASL: basal integration of defect-filling tissue; BFORM: bone formation; BMP: bone morphogenetic protein; BSA: bovine serum albumin; CHM-I: chondromodulin-I; CLUS: cluster formation; EDTA: ethylenediaminetetraacetic acid; FILH: histologic appraisal of the degree of defect filling; ICRS: International Cartilage Repair Society; INFH: histologic signs of inflammation; LATL: lateral integration of defect-filling tissue; MATX: matrix staining; PBS: phosphate-buffered saline; SD: standard deviation; STRU: structural integrity; SURFH: histologic appraisal of surface architecture; TI: tissue morphology; TIDE: tidemark opening; VEGF: vascular endothelial growth factor.The authors declare that they applied for a patent relating to the content of the manuscript in Japan, but did not receive any reimbursements, fees, funding or salary from an organization. The competitive companies developing or selling anti-VEGF drugs may keep them in check.TN and MS performed most of the experiments and MK performed the immunohistochemistry. TK, GE and NO helped with in vivo experiments. TN performed statistical analyses. MS and JM designed and coordinated the study and helped draft the manuscript. All authors approved the final manuscript.

The interaction was found to be dependent on the sialic acid binding capacity of sialoadhesin and on the presence of sialic acids on GP5. These findings not only contribute to a better understanding of PRRSV biology, but the knowledge and tools generated in this study also hold the key to the development of a new generation of PRRSV vaccines.The porcine reproductive and respiratory syndrome virus (PRRSV) is a major threat to swine health worldwide and is considered the most significant viral disease in the swine industry today. In past years, studies on the entry of the virus into its host cell have led to the identification of a number of essential virus receptors and entry mediators. However, viral counterparts for these molecules have remained elusive and this has made rational development of new generation vaccines impossible. The main objective of this study was to identify the viral counterparts for sialoadhesin, a crucial PRRSV receptor on macrophages. For this purpose, a soluble form of sialoadhesin was constructed and validated. The soluble sialoadhesin could bind PRRSV in a sialic acid-dependent manner and could neutralize PRRSV infection of macrophages, thereby confirming the role of sialoadhesin as an essential PRRSV receptor on macrophages. Although sialic acids are present on the GP 5 glycoprotein complex of PRRSV as the ligand for sialoadhesin and found this ligand-receptor interaction to be critically dependent on the lectin activity of sialoadhesin and on sialic acids on the GP5 glycoprotein. These data represent a major breakthrough in the understanding of the role of PRRSV proteins in viral entry and pave the way for the development of a new generation of PRRSV vaccines capable of inducing an immunity that specifically blocks the interaction between viral M/GP5 and sialoadhesin.The porcine reproductive and respiratory syndrome virus (PRRSV) is a major threat to swine health worldwide. The virus specifically targets subpopulations of macrophages, central players in the immune system, and can persist in animals for extended periods of time due to a hampered immunity. At present, no vaccines are available that are both safe and effective and it is clear that a more rational vaccine design is needed to solve this problem. Therefore, advancing our fundamental understanding of PRRSV biology is crucial. The macrophage-specific lectin sialoadhesin is a crucial viral receptor on macrophages and although its role in PRRSV infection is well documented, its viral counterparts have remained unknown. Using a soluble form of sialoadhesin, we identified the M/GP Nidovirales, family Arteriviridae, and is referred to as the PRRS virus (PRRSV) et al. assessing the economic impact of PRRS on swine production in the US reported an annual loss of approximately 560.32 million US dollars due to this syndrome At the end of the 1980s, a new syndrome was described affecting pig herds in North America and Canada Availability of safe and effective vaccines is essential for PRRSV control. Currently, there are two types of PRRSV vaccines on the market: attenuated and inactivated vaccines. However, these have specific drawbacks concerning safety 2, GP3, GP4 and GP53 as a structural membrane protein, in contrast to European and other North American isolates 5 have been shown to form disulfide-linked heterodimers 2, GP3 and GP4 form non-covalent heterotrimers in the virion and there are indications that also the E protein may be associated with the minor glycoprotein trimer The PRRSV virion consists of a nucleocapsid that is surrounded by a lipid envelope. The capsid structure consists of nucleocapsid proteins (N) and contains the viral genome: a single, positive RNA strand of approximately 15 kb in vivo tropism for cells of the monocyte/macrophage lineage: the virus infects specific subsets of porcine macrophages ex vivo virus propagation. In addition, a limited number of cell lines support in vitro virus replication upon adaptation of the virus. One such cell line, the African green monkey kidney cell line MARC-145 As has been shown for other arteriviruses, PRRSV shows a marked et al. pointed out that α2-3 linked sialic acids and to a lesser extent α2-6 linked sialic acids, most likely present on complex N-linked glycans attached to viral envelope glycoproteins, are involved in this interaction Over the past years, various studies have focussed on the entry of PRRSV into its host cell. These efforts have resulted in the identification of a number of macrophage molecules involved in PRRSV entry. As for many other viruses, initial binding of the virus to its host cell occurs via interactions with heparan sulphate glycosaminoglycans present on the cell surface 5 glycoprotein complex as a ligand for pSn and showed the sialic acid-dependency of the pSn-M/GP5 interaction.Although pSn has been shown to be a critical entry receptor for PRRSV on macrophages, viral envelope glycoproteins that act as ligands for this receptor have remained elusive. In the light of vaccine development, knowledge on this is particularly interesting, since it allows targeting of the immune response to a specific, critical step in virus infection. Vaccination with a functional viral pSn-binding epitope can elicit a protective immune response that specifically blocks the crucial, pSn-dependent internalization of the virus into its host cell. By construction and use of soluble recombinant porcine sialoadhesins, we identified the viral M/GPThe experimental procedure for the collection of porcine alveolar macrophages was authorized and supervised by the Ethical and Animal Welfare Committee of the Faculty of Veterinary Medicine of Ghent University. The use of human red blood cells was approved by the Medical Ethical Committee of the Ghent University Hospital and informed written consent was obtained from the donors of red blood cells.3, GP4 and GP5, respectively. Detection of the M protein was performed using mAb 126.3 (IgG2a) Detection of pSn was performed using the mouse monoclonal antibody (mAb) 41D3 et al.et al.2 atmosphere at 37°C.Porcine alveolar macrophages (PAM) were obtained from 4- to 6-week-old conventional Belgian Landrace pigs from a PRRSV-negative herd as described by Wensvoort Human red blood cells (RBCs) were obtained from healthy donors and stored at 4°C in Alsever's solution for up to 7 days.et al.The European prototype PRRSV strain Lelystad Virus 5′-CCTTCACCATGGACTTCCTG-3′ and reverse primer 5′-ACTAGATCTACTTACCTGTGCTGACCACCACGCTGACAG-3′. The pEE14-3C-Fc vector was cut with HindIII, treated with Klenow DNA polymerase to obtain blunt ends and subsequently cut with BamHI. The PCR product was digested with BglII and cloned into the cut pEE14-3C-Fc vector, yielding pEE14-pSn4D-3C-Fc. To obtain a non-sialic acid-binding pSn4D-Fc protein, a point-mutation (R116E) was introduced in the sialic acid-binding domain in pEE14-pSn4D-3C-Fc using the Quickchange site directed mutagenesis kit (Stratagene) with forward primer 5′-TCGGGCTCCTATAACTTCgaaTTTGAGATCAGCGAGGGC-3′ and reverse primer 5′-GCCCTCGCTGATCTCAAAttcGAAGTTATAGGAGCCCGA-3′, resulting in pEE14-pSn4DRE-3C-Fc.The pSn cDNA had been cloned previously into the pcDNA3.1/D vector (Invitrogen) 2 atmosphere at 37°C, after which the culture supernatant was collected. The pSn-Fc fusion proteins were purified from the supernatant using standard protein A sepharose chromatography following the manufacturer's instructions . Fractions of the eluate containing the purified protein were pooled and the buffer was exchanged to phosphate-buffered saline (PBS) by dialysis. Purified protein was stored at −70°C until use.For production of the pSn-Fc chimeras, HEK-293T cells were transiently transfected using calcium phosphate. Transfected cells were cultured for 3 days in DMEM supplemented with 3% IgG-depleted low IgG FBS (Gibco), 2 mM L-glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids and a mixture of antibiotics in a humidified 5% COVibrio cholerae sialidase and incubated for 1 h at 37°C. The RBCs were subsequently washed with PBA to remove the enzyme, resuspended in PBA at 0.25% (v/v) and used in the solid phase binding assay as described.Each well of an Immulon 4HBX 96-well flat-bottomed microtiter plate (Dynax Technologies Inc.) was coated with 50 µl of 8 µg/ml goat anti-human IgG in 0.05 M carbonate-bicarbonate buffer . Plates were washed with PBS containing 0.25% bovine serum albumin (PBA), after which 2-fold dilution series of the purified siglec-Fc chimera were added to the wells and incubated for 2 h at ambient temperature. Unbound siglec-Fc protein was removed by washing with PBA. RBCs were washed twice in PBA and resuspended in PBA at 0.25% (v/v) immediately before use. 100 µl of the RBC suspension was added to each well and the plate was incubated for 30 min at 37°C. The wells were gently washed with PBA to remove unbound RBCs and RBC binding was evaluated using an Olympus CK40-F200 inverted light microscope (Opelco). To quantify RBC binding, the plate was dried, fixed with methanol and dried again, after which a peroxidase substrate assay was performed . The result was evaluated measuring the optical density at 450 nm (OD450) using a Multiskan RC (Thermo Labsystems). As a positive control, an identical assay was performed in parallel for mSiglecE-Fc Samples of purified pSn-Fc protein were mixed with (non-) reducing Laemmli buffer, boiled for 5 min and subjected to SDS-PAGE (8% gel) using a BioRad Mini Protean 3 system. For Coomassie Blue staining, the SDS-PAGE gel was incubated successively in Coomassie Blue staining solution , destaining solution I and destaining solution II . Alternatively, for Western Blot analysis, proteins were transferred from the SDS-PAGE gel to a PVDF membrane via Western Blotting (BioRad Mini Trans Blot). The membrane was blocked overnight in PBS +0.1% Tween 20+5% skimmed milk. Detection of pSn-Fc protein was performed by subsequent incubation of the blot with the pSn-specific mAb 41D3 and peroxidase-labeled polyclonal goat anti-mouse antibodies (Dako), followed by visualization using enhanced chemiluminiscence . Alternatively, pSn-Fc protein was detected using peroxidase-labeled goat anti-human IgG antibodies and subsequent ECL.RE-Fc protein were either left untreated or were treated with endoglycosidase H or PNGase F . Also, samples of both proteins were incubated with 100 mU/ml Vibrio cholerae sialidase for 3 h at 37°C. After addition of reducing Laemmli buffer, samples were boiled for 5 min and analyzed via SDS-PAGE and Western Blot using peroxidase-labeled goat anti-human IgG antibodies as described above.Samples of purified pSn4D-Fc and pSn4D5-specific or an isotype-matched irrelevant control mAb in combination with peroxidase-labeled polyclonal goat anti-mouse antibodies. The detected protein bands were visualized using ECL. To confirm that the beads were efficiently coated with pSn-Fc protein, a sample of the bound fraction was subjected to SDS-PAGE and Western Blot analysis using the pSn-specific mAb 41D3. As a control, identical experiments were performed using uncoated beads and beads coated with the non-sialic acid-binding mutant pSn4DRE-Fc.100 µl of Dynabeads protein A (Invitrogen) were coated with 25 µg of pSn4D-Fc protein and incubated with semipurified, MARC-145-grown PRRSV LV at 37°C. After 90 min of incubation, the unbound virus fraction was collected, beads were washed 4 times with PBS and bound material was eluted with 0.1 M citrate buffer (pH 3.1). Samples of the semipurified virus, the bound and the unbound fraction were mixed with non-reducing Laemmli buffer, boiled for 5 min and resolved on a 12% SDS-PAGE gel. Subsequently, resolved proteins were transferred to a PVDF membrane via Western Blotting. The membrane was blocked overnight in PBS +0.1% Tween 20+5% skimmed milk and probed with a nucleocapsid-specific, a GP5 cells/well in 96-well plates and kept in culture for 48 h. 50 µl of a 3-fold dilution series of pSn4D-Fc or pSn4DRE-Fc (starting concentration 50 µg/ml) was mixed with a constant amount of virus (5 µl of a 2×105 TCID50/ml virus suspension) and incubated for 1 h at 37°C to allow binding. The mixtures were transferred to the PAM and cells were incubated for 1 h at 37°C. Soluble receptor-virus mixtures were then removed, fresh medium was added and cells were further incubated for 9 h at 37°C, after which they were fixed. Infected cells were then visualized via a nucleocapsid-specific immunoperoxidase staining PAM were seeded at a concentration of 10RE-Fc. Alternatively, sialidase-treated virus was used in the precipitations. Semi-purified virus was incubated with 100 mU/ml sialidase from Vibrio cholerae in RPMI-1640 for 3 h at 37°C. In parallel, virus was incubated with the buffer in which the sialidase was supplied. Titration on alveolar macrophages revealed a 90% decrease in infectivity of sialidase-treated virus when compared to control-treated virus, indicating that sialidase treatment removed sialic acids implicated in viral entry. To evaluate the effect of the treatment on different envelope glycoproteins, samples of sialidase- and control-treated virus were subjected to SDS-PAGE and Western Blot analysis using specific mAbs. The remaining virus was lysed and subjected to immunoprecipitation using pSn4D-Fc as described above.Viral proteins were solubilized from semipurified MARC-145-grown PRRSV LV by a 1 h incubation in TNE buffer (50 mM Tris-HCl (pH 7.4), 200 mM NaCl, 1 mM EDTA) containing 1% NP-40 (Roche Applied Science) and insoluble material was pelleted by centrifugation at 10,000×g for 45 min. Subsequently, the virus lysate was incubated with pSn4D-Fc-coated beads. The precipitation experiment, sample preparation and subsequent SDS-PAGE and Western Blotting were performed as described above. Membranes were blocked overnight in PBS +0.1% Tween 20+5% skimmed milk and probed with mAbs directed against the structural proteins of PRRSV LV and isotype-matched irrelevant control mAbs in combination with peroxidase-labeled polyclonal goat anti-mouse antibodies. Detected protein bands were visualized using ECL. Coating of the beads with pSn-Fc protein was checked as described above. To assess the sialic acid-dependency of the interaction, an identical experiment was performed using the non-sialic acid-binding mutant pSn4DRE-Fc-coated beads. The bound and unbound fractions as well as the original virus lysates were analyzed via SDS-PAGE and Western Blotting as described above.Similar precipitation reactions were performed using macrophage-grown virus. Lysates of semipurified macrophage-grown virus were applied to pSn4D-Fc- and pSn4Dhttp://www.ncbi.nlm.nih.gov/Genbank):GenBank accession numbers : M96262PRRSV Lelystad virus, individual structural proteins (protein): AAA46275 (GP2); AAA46276 (GP3); AAA46277 (GP4); AAA46278 (GP5); AAA46279 (M); AAA46280 (N); P0C6Y6 (E)Porcine sialoadhesin: AF509585 , AAP47136 (protein)Porcine CD163: EU016226 , ABV80230 (protein)Murine siglec E: AY371487 , AAQ72479 (protein)RE-Fc) was generated as a control. This protein was obtained by changing the amino acid R116, which is essential for sialic acid binding, to an E residue. PSn- and Fc-specific immunofluorescence cell stainings . This recombinant protein consists of the 4 N-terminal domains of pSn, coupled with the Fc- and hinge region of human IgG1 and allows study of PRRSV-pSn interactions in a cell-free context. The sialic acid-binding activity of pSn has been shown before to be essential for PRRSV binding tainings and ELIStainings revealedRE-Fc protein. Presence of a reducing agent resulted in single bands at about 80 kDa. These results indicate that the purified pSn-Fc proteins are present as disulfide-linked dimers under non-reducing conditions. The fact that single bands were obtained under each condition shows that the bulk of the protein in the purified fractions was pSn-Fc protein.After optimization of production and purification, all further tests and experiments were performed using purified pSn-Fc proteins. To check the purity of the proteins, samples were resolved on SDS-PAGE under reducing and non-reducing conditions and Coomassie Blue staining was performed . Under nRE-Fc were recognized by pSn-specific mAb 41D3. When SDS-PAGE was performed in the presence of a reducing agent, binding of mAb 41D3 to the blotted proteins was lost, which is in line with earlier observations for wild type pSn. Both the pSn4D-Fc and the pSn4DRE-Fc proteins could be detected on the blot membrane using polyclonal antibodies specific for the Fc-part of human IgG. Using the Fc-specific polyclonal antibodies for detection, additional bands could be observed with varying intensity in between batches. These bands most likely represent pSn-Fc protein that is partially degraded. Nevertheless, Coomassie Blue analysis of the same samples clearly indicated that the bulk of the protein was present in one specific band, which correlates with conformationally correct pSn-Fc protein.Purified proteins were also subjected to SDS-PAGE and Western Blot analysis . Under nRE-Fc proteins were treated with different glycosidases and analyzed via reducing SDS-PAGE and Western Blotting and Golgi before being displayed at the cell membrane. During its passage through these compartments, the protein does not only obtain intramolecular disulfide bridges, but also N-linked glycans, which are often essential for proper protein folding. To check intracellular processing of the recombinant proteins, purified pSn4D-Fc and pSn4DBlotting . TreatmeRE-Fc protein did not show RBC-binding activity. These results indicate that pSn4D-Fc has the capacity to bind sialic acids. As for full length pSn, the sialic acid-binding activity is critically dependent on the R116 residue within the N-terminal domain of pSn.Since the sialic acid-binding activity of pSn is essential for PRRSV binding, we first evaluated the sialic acid-binding capacity of the purified pSn4D-Fc protein. This was done via a solid phase red blood cell binding assay, a test routinely used to analyze the sialic acid-binding capacity of sialoadhesin-Fc and other siglec-Fc chimeras 5 envelope glycoprotein and the nucleocapsid protein N Click here for additional data file.Protocol S2Fc- and pSn-specific ELISA assays(0.06 MB PDF)Click here for additional data file.

There is now a large body of evidence linking inflammation to Alzheimer's disease (AD). This association manifests itself neuropathologically in the presence of activated microglia and astrocytes around neuritic plaques and increased levels of inflammatory mediators in the brains of AD patients. It is considered that amyloid-β peptide (Aβ), which is derived from the processing of the longer amyloid precursor protein (APP), could be the most important stimulator of this response, and therefore determining the role of the different secretases involved in its generation is essential for a better understanding of the regulation of inflammation in AD. The finding that certain non-steroidal anti-inflammatory drugs (NSAIDs) can affect the processing of APP by inhibiting β- and γ-secretases, together with recent revelations that these enzymes may be regulated by inflammation, suggest that they could be an interesting target for anti-inflammatory drugs. In this review we will discuss some of these issues and the role of the secretases in inflammation, independent of their effect on Aβ formation. Alzheimer's disease (AD) is a devastating neurological disease affecting more than 26 million people around the world, and there are indications that this number will quadruple by 2050. Age is the most significant risk factor and it is estimated that 50% of people over 85 have either AD or Mild Cognitive Impairment (MCI). Brains of individuals with AD manifest massive neuronal and synaptic loss in certain areas which result in the memory impairment and disorientation associated with this disease. The neuroanatomical study of a typical AD brain reveals the presence of two characteristic lesions: extracellular amyloid (or senile plaques) and intracellular neurofibrillary tangles composed primarily of hyperphosphorylated tau protein . AmyloidAlois Alzheimer described unique structures in the cerebral cortex of a 55 year old woman with progressive dementia that are now referred to as senile plaques [In 1907 plaques . Histolo plaques . Aβ is f plaques -6, suggeAβ deposition is considered a major pathogenic step in the development of AD. Evidence supporting the amyloid hypothesis has been extensively reviewed . On the APP is a type I integral membrane protein that resProteolysis of APP by α-secretase or β-secretase leads to the secretion of soluble α-APPs or β-APPs. This generates C-terminal fragments of 10 kDa and 12 kDa respectively, which are inserted in the membrane. These fragments can be cut by γ-secretase to release the peptides P3 and Aβ and a cyThere is strong evidence that Aβ toxicity could be mediated through the induction of inflammatory events in the brain. Over the past decade it has been speculated that the inflammatory response associated with the presence of neuritic plaques could be involved in neuronal damage and contribute to the progression of the disease ,22. A coThe first evidence for an excessive inflammatory process in AD came from a study carried out in AD and Down syndrome brains that showed increased levels of S100 and IL-1 . Since tClinical investigation and studies in AD animal models have reinforced the suggestion that inflammatory changes in the AD brain are an early and prominent feature. In support of this hypothesis, imaging studies have detected microglial activation in patients at very early clinical stages of the disease . MoreoveFurther evidence for a link between inflammation and AD comes from observations in head-injured patients. A number of large epidemiological studies (e.g. the MIRAGE study) have ideConversely, it has to be noted that inflammation is not only contributing to the disease progression, but could have beneficial effects. This may depend on the inflammatory elements activated, the time in the disease development and also whether the response is acute or chronic. Activated microglia can reduce Aβ accumulation by increasing its phagocytosis or extracellular degradation -45. MicrFurther support for the involvement of inflammation with the pathogenesis of AD came from the finding in epidemiological studies that treatment with non-steroidal anti-inflammatory drugs (NSAIDs) was associated with a reduced risk of developing AD. A meta-analysis of nine studies revealed that the benefit was greater with long-term use than with intermediate use . RecentlThe finding that NSAIDs could affect APP processing and that certain NSAIDs can inhibit β and γ-secretases with the recent revelation that secretases may be influenced by inflammation indicates that they could be an interesting target for anti-inflammatory drugs .in vivo evidence for a proteinase of the ADAM family as an α-secretase of APP, revealed activation of ADAM10 as a promising therapeutic target, and supported the hypothesis that a decrease in α-secretase activity contributes to the development of AD [APP is cleaved by α-secretase in the centre of the Aβ domain. Three related metalloproteases of the ADAM family, ADAM-9, ADAM-10 and ADAM-17, also termed TACE (tumor necrosis factor converting enzyme), appear to exert α-secretase activity ,57. A cont of AD . AnotherIn vivo studies have shown that many, but not all, of the inflammatory effects of TNF-α require cleavage and shedding from the cell surface. Besides TNF-α, ADAM17 cleaves ectodomains of other receptors and ligands, such as TNFR2 and L-selectin [ADAM proteinases have emerged as the major protein family that mediates ectodomain shedding, the proteolytic release of extracellular domains from their membrane-bound precursors. Proteolytic cleavage or ectodomain shedding is an additional mechanism whereby cells can regulate the proteins expressed on their cell surface. In many cases, soluble ectodomains are biologically active as mediators of functions ascribed to their transmembrane counterparts . ADAM-liselectin . In addiselectin . IL-1R2 That α-secretase is involved in inflammation is supported by the observation that ADAM-10 is expressed constitutively by astrocytes in the normal and inflamed human CNS . ADAM10 On the other hand, it has been also reported that various NSAIDs stimulate the non-amyloidogenic secretion of sAPPα from neuroblastoma cells . Sheddinβ-Secretase (BACE1 for β-site APP cleaving enzyme) was cloned and identified as a type I transmembrane aspartyl protease . BACE1 cBACE1 is primarily expressed in neurons ,75,76, bin vitro and also in APP transgenic mice [NFκB sites are present in the promoters of APP , preseninic mice ,55,88. Anic mice .The effect of NFκB on BACE1 promoter could be direct or through changes in PPARγ, because PPARγ agonists can antagonize the activity of transcription factors such as NFκB .PPARγ is a transcription factor that is involved in the regulation of the metabolism of glucose and lipids, in cellular differentiation as well as in the control of transcription of a wide range of inflammatory genes. A consensus binding site for PPARγ was found in the BACE1 promoter. PPARγ activation by agonists such as thiazolidinediones (TZD) and certain NSAIDs such as ibuprofen, indomethacin and naproxen results in a decrease of BACE1 transcription, expression and activity . Furtherin vitro experiments have shown that inflammatory cytokines and oxidative stress decrease PPARγ levels. Therefore, these findings suggest the existence of a down-regulation of PPARγ under inflammatory conditions, which would result in an increase in BACE1 transcription and Aβ generation. This effect could be prevented by modulation of PPARγ activity by NSAIDs, which have been shown to increase the levels of PPARγ in adipocytes and neurons [PPARγ levels are decreased in AD brain, indicating that inflammatory events may decrease PPARγ transcription. Furthermore, neurons ,53.STAT-1 can bind directly to a putative STAT1 binding sequence in the BACE1 promoter. A recent study showed that when STAT1 becomes phosphorylated by IFNγ-mediated activation of JAK2 and ERK1/2, STAT1 binds to BACE1 promoter region to increase BACE1 protein expression in astrocytes . On the Zacchetti et al., who described that the 5'-UTR-dependent translational repression of BACE1 may be alleviated in activated astrocytes [Evidence has been presented for regulation of BACE1 expression at the translational level. The untranslated 5'-BACE1 transcript leader contains upstream open reading frames (uORF) that can reduce the translation of the main open reading frame ,93. It rtrocytes . Therefoγ-Secretase is a protein complex of four essential membrane proteins called aph-1, pen-2, nicastrin and presenilin (PS). While aph-1, pen-2 and nicastrin function in the assembly and subcellular transport of γ-secretase and in the recognition of protein substrates -97. PS pIt was recently published that activated microglia and astrocytes have enhanced expression of PS and nicastrin following brain damage . AlthougAdditional evidence for an Aβ independent role of PS proteins in inflammation comes from studies with conditional knockout mice lacking both PS genes in the postnatal forebrain. These mice display strong age-dependent neurodegeneration and impairment of cognitive function . Gene prAs described above several NSAIDs decrease the risk for development of AD. Although the molecular mechanism(s) underlying this protective activity remain to be identified, certain NSAID could directly modulate γ-secretase activity . Thus, b50 values of 25 – 500 μM) at which they could also affect biophysical properties of biological membranes, the modulation of γ-secretase specificity might also involve interference with membrane fluidity and/or accessibility of substrate to the enzyme [Surprisingly, the PPARα antagonist fenofibrate and some COX-2 specific inhibitors could even increase Aβ42 production ,111,112.e enzyme . NonetheIn preclinical studies, long-term treatment of APP transgenic Tg2576 mice with ibuprofen and indomethacin were effective in reducing the plaque pathology ,117. AlsIn summary, in this review we have tried to give a perspective on the wide variety of interactions between inflammatory mediators and APP secretases. On the one hand, pro-inflammatory cytokines are able to increase the levels and/or activity of some secretases, such as α-secretase and BACE1. On the other hand, NSAIDs are able to modulate the activity of the secretases by regulating their levels in the case of BACE1, or by directly shifting the cleavage site of γ-secretase (see Table ADAM: a disintegrin and metalloprotease; ApoE: Apolipoprotein E; COX: cyclooxygenase; EOAD: Early Onset Alzheimer's Disease; FAD: Familiar Alzheimer's Disease; IL: Interleukin; iNOS: inducible nitric oxide synthase; MCI: mild cognitive impairment; NFκB: nuclear factor kappa B; NSAIDs: Non-steroidal anti-inflammatory drugs; PPAR: Peroxisome Proliferator-activated receptor; PS: presenilin; STAT: Signal transducers and activators of transcription; TNFα: Transforming Necrosis Factor-α; TZD: thiazolidinedioneThe authors declare that they have no competing interests.MS wrote most of the first draft, JW wrote the part of γ-secretase and SMG wrote the section on trauma. All authors were involved in the design of the figures and editing of the manuscript.

Over the past several years, great advances have been made towards novel drug delivery systems. The phenomena of interpolymer interactions and formation of polyelectrolyte complexes have been the focus of intensive fundamental and applied research. Interpolyelectrolyte complexes combine unique physicochemical properties with high biocompatibility. Studies have been carried out on many different polymer blends and types. Such combinations may possess unique properties that are different from those of individual component. The present review emphasizes on the applicability of polyelectrolyte complexes in drug delivery technology. Current state of art is witnessing a revolution in new techniques for drug delivery. These techniques are capable of controlling the rate of drug delivery, sustaining the duration of therapeutic activity and/or targeting the drug to specific tissues. These advancements led to the development of several novel drug delivery systems, revolutionizing the medication with several advantages.Recent decades witnessed the appearance of polymers that respond in some desired way to changes in temperature, pH, electric or magnetic field. The driving force behind these transitions include stimuli like neutralization of charged groups by either a pH shift or the addition of an oppositely charged polymer, changes in the efficiency of hydrogen bonding with an increase in temperature or ionic strength and collapse of hydrogels and interpenetration of polymer network. These types of polymers not only convert the active substances into a non-deleterious form which can be administered, but also have specific effect on the biodistribution, bioavailability or absorption of the active substances and hence increasingly gaining importance in modern pharmaceutical technology. The interaction between two oppositely charged polymers results in the formation of a complex, termed as polyelectrolyte complex. These pPolyelectrolyte complexes (PECs) are the association complexes formed between oppositely charged particles . These are formed due to electrostatic interaction between oppositely charged polyions. This avoids the use of chemical cross linking agents, thereby reducing the possible toxicity and other undesirable effects of the reagents. The polyelectrolyte complexes formed between a poly acid and poly base are little affected by the pH variation of the dissolution medium. This concept of complexation, between DNA and chitosan, has extThe occurrences of charge-charge interactions between ionic polymers and drugs were considered to be a negative event when the ionic polymers are used as excipients in pharmaceutical formulations. In these systems release of drugs may be strongly affected by the occurrence of charge-charge interactions. However, in recent years these negative events of polymer-drug and polymer-polymer interactions have been exploited positively for controlled drug release4.The polymers that contain a net negative or positive charge at near neutral pH are called polyelectrolytes. They arThe polyelectrolytes are classified into various types. Based on origin they are classified as natural polyelectrolytes, synthetic polyelectrolytes and chemically modified biopolymers. Based on composition they are homopolymers and copolymers. Based on molecular architecture linear, branched and cross linked. Based on electrochemistry they are classified as polyacids/polyanions, polybases/polycations and polyampholytes. Some of the important polyelectrolytes are exemplified in Many researchers extensively investigated the properties of the polyelectrolytes7 and theThis process involves mainly 3 steps as shown in A number of parameters are known to influence the formation of PECs. These a1721a and powder X-ray diffraction[Various methods have been used to investigate interactions between polymers. Measure2428ffraction were empPECs have gained much attention in the past few years because of their potential applications. These can be used as membranes–33, for 3542The concept of PECs in the design of drug delivery systems may be useful due to the advancements made during the last two decades–47. The et al.[There are several reports on different methods of preparation and applications of PECs in pharmacy. Kawashima et al. developeet al.[in-vivo/in-vitro evaluation studies. They prepared the PEC of indomethacin by using complexation of sodium tripolyphosphate and chitosan. Here the effects of the molecular weights of chitosan hydrolysates on the release and absorption rates of indomethacin from gel beads were examined. The release rates of indomethacin decreased with increasing of molecular weight and indomethacin content. A negative correlation was observed between the molecular weight and release rate constant (r=−0.983).Shiraishi et al. studied et al.[et al.[Jimenez-Kairuz et al. developel.[et al. preparedet al.[Tapia et al. evaluateet al.[et al.[Paloma et al. preparedl.[et al. developeet al.[Albeno et al. obtainedet al.[et al.[et al.[Rolfes et al. reportedl.[et al. employedl.[et al. developel.[et al. preparedThe review summarized emerging popularity and valuable potential offered by the polyelectrolyte complexes in the field of drug delivery. They represent an attractive class of polymer-based materials finding an irreplaceable role in many areas of the everyday life used for the preparation of biodegradable and biocompatible three-dimensional membranes, microcapsules, nano-sized formulations and various types of controlled release drug delivery systems.An extensive research is going on in the area of polyelectrolytes and polyelectrolyte complexes. There is a great potential in utilizing these PECs in ecology, biotechnology, medicine and pharmaceutical technology. However these techniques are not effectively applied for the development of drug delivery systems. They may efficiently modify the release; improve the stability and character of the drug substances due to their capacity to entrap the drug at molecular level. Hence the polyelectrolyte complexes have great potential in the design of novel drug delivery systems.

SOD1 in a subset of familial amyotrophic lateral sclerosis (ALS) cases confer dominant but clinically variable toxicity, thought to be mediated by misfolding and aggregation of mutant SOD1 protein. While the mechanism of toxicity remains unknown, both the nature of the SOD1 mutation and the genetic background in which it is expressed appear important. To address this, we established a Caenorhabditis elegans model to systematically examine the aggregation behavior and genetic interactions of mutant forms of SOD1. Expression of three structurally distinct SOD1 mutants in C. elegans muscle cells resulted in the appearance of heterogeneous populations of aggregates and was associated with only mild cellular dysfunction. However, introduction of destabilizing temperature-sensitive mutations into the genetic background strongly enhanced the toxicity of SOD1 mutants, resulting in exposure of several deleterious phenotypes at permissive conditions in a manner dependent on the specific SOD1 mutation. The nature of the observed phenotype was dependent on the temperature-sensitive mutation present, while its penetrance reflected the specific combination of temperature-sensitive and SOD1 mutations. Thus, the specific toxic phenotypes of conformational disease may not be simply due to misfolding/aggregation toxicity of the causative mutant proteins, but may be defined by their genetic interactions with cellular pathways harboring mildly destabilizing missense alleles.Genetic background exerts a strong modulatory effect on the toxicity of aggregation-prone proteins in conformational diseases. In addition to influencing the misfolding and aggregation behavior of the mutant proteins, polymorphisms in putative modifier genes may affect the molecular processes leading to the disease phenotype. Mutations in C. elegans model of misfolding and aggregation of several distinct ALS-related mutants of superoxide dismutase 1 (SOD1). In one wild type genetic background (N2), these proteins exhibited only mild cellular toxicity despite strong, mutant-specific aggregation phenotypes. However, when SOD1 mutants were expressed in the background of mildly destabilized protein polymorphisms, their toxicity was enhanced and a number of distinct phenotypes were exposed. These synthetic phenotypes reflected the loss-of-function of the destabilized polymorphic proteins. Furthermore, the degree to which each of these phenotypes was exposed depended on the nature of the SOD1 mutation. These data suggest that the presence of mildly destabilizing polymorphisms in the genetic background may modulate and direct the specific toxic phenotypes in protein aggregation diseases.Correct folding and stability are essential for protein function. In cells, a network of molecular chaperones and degradative enzymes facilitate folding, prevent aggregation and ensure degradation of the misfolded proteins, thus maintaining protein homeostasis. In many diseases, including Amyotrophic Lateral Sclerosis (ALS), expression of a single mutant protein that misfolds and aggregates causes cellular toxicity that is strongly dependent on the genetic background. To address the influence of genetic background on the toxicity of aggregation-prone proteins, we established a Up to 10% of cases have a dominant familial inheritance pattern with mutations in SOD1 (OMIM *14750 http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?cmd=entry&id=147450) contributing about 20% of those ALS and C-terminal YFP-tagging scheme , pUnc-54::SOD1-G85R::YFP (G85R), pUnc-54::SOD1-G93A::YFP (G93A) and pUnc-54::SOD1- G127insTGGGstop::YFP (127X) were established. We verified that SOD1 proteins expressed in the muscle cells were of the expected molecular sizes . This is in agreement with the known native-like properties of G93A C. elegans. 127X extracts also contained a heterogeneous population of electrophoretic states , but was readily dissociated by 5% SDS at room temperature D.C. elegans appears to form a molecularly heterogeneous mixture of SDS-labile aggregates and soluble protein, which for G85R and 127X does not attain a stably folded, native conformation.Thus, mutant SOD1 in in vivo, supporting the possibility of distinct interactions with cellular components.The observed biochemical heterogeneity paralleled a striking heterogeneity in aggregate morphology and distribution in SOD1-transgenic strains. While all three mutant SOD1 strains had some cells devoid of visible aggregates, most contained aggregates that exhibited a wide range of shapes, sizes, and cellular distribution . The majWe next asked whether expression of these aggregation-prone proteins caused toxicity. We assessed several phenotypes as indicators of dysfunction of muscle cells expressing the transgenes, such as decrease in motility of animals, disturbance of ultrastructural organization of myofilaments, developmental defects, and egg-laying defects. The motility of WT SOD1 animals grown at 15°C was similar to that of wild type (N2) strain on the second day of adulthood, as measured by number of body bends per minute A. In coAVII and AVIII).To assess the ultrastructural organization of myofilaments, we visualized actin filaments with Rhodamine-labeled phalloidin. We found no major disruptions of the organization of actin filaments in cells containing aggregates in either of three mutant strains B, S4A.C. elegans and to embryonic lethality (emb) or hatching of deformed, growth arrested larvae (lva). Although SOD1 mutant proteins aggregate already in embryos, neither of the mutant SOD1 strains exhibited substantially elevated emb+lva phenotype relative to the WT SOD1 strain , UNC-45(ts) and Ras(ts) proteins, respectively, destabilized the cellular folding environment and modulated the toxicity of polyQ expansions The relatively mild toxicity, despite misfolding and aggregation of mutant SOD1, indicates that the putative toxic species are either transient or suppressed by the cellular folding/quality control machinery. We had previously found that metastable temperature-sensitive (ts) mutations in various unrelated genes, such as emb+lva phenotype emb+lva at 15°C, 127X had 33% of emb+lva phenotype, and G93A had intermediate toxicity. The surviving animals had very few progeny. To ask whether this toxic interaction is specific to paramyosin, we crossed SOD1 strains to a strain harboring a ts mutation in unc-45 gene. Expression of SOD1 mutant proteins in unc-45(ts) genetic background resulted in exposure of egg laying and reproductive phenotype (egl+rep) at the permissive temperature (unc-45(ts) mutant animals at the restrictive temperature. Here, G93A exhibited over 80% toxicity at 15°C, compared with less than 5% for either G93A or UNC-45(ts) expressed alone. Furthermore, the surviving animals expressing both G93A and UNC-45(ts) developed into severely uncoordinated background did not have strong effects on embryonic lethality at 25°C. Instead, Ras(ts) animals raised at the restrictive temperature had a fluid-filled appearance with degenerated gonads, and produced few embryos . Note that egl+rep phenotype. Ras is ubiquitously expressed, and pleiotropic phenotypes that are exposed at the restrictive temperature reflect its dysfunction in different cell types. The egl phenotype exposed by SOD1mutants in ras(ts) background is likely due to the genetic interaction between the two mutations specifically in the in vulva muscles or gonad sheath cells, where the Unc-54 promoter driving SOD1 expression is active.Paramyosin and UNC-45 both affect the formation of myofilaments: paramyosin is a structural component and UNC-45 regulates myosin assembly. To assess whether SOD1 mutants were toxic towards a metastable mutant in a different cellular pathway, we crossed SOD1 strains to a strain expressing a temperature-sensitive Ras variant. Expression of G85R and G93A in ethality , while 1ethality , with 72C. elegans leads to mild toxicity, their expression in the genetic backgrounds harboring diverse temperature-sensitive mutations uncovers toxic phenotypes, with each SOD1 mutant affecting the activity of a given metastable protein to different extents.These data show that while expression of the three distinct SOD1 mutants in the wild-type N2 strain of C. elegans modulates the toxicity of three mutant SOD1 proteins, leading to the development of specific toxic phenotypes. While either SOD1 aggregation or loss-of-function of metastable ts proteins can each be viewed as a separate consequence of failure of protein folding homeostasis, the toxic phenotypes observed here resulted from their genetic interaction and thus were directed by the nature of the ts mutation present. Similar to ts mutations in C. elegans, the phenotypic expression of mildly destabilizing protein polymorphisms in higher organisms is thought to depend on the robustness of the protein folding environment We show here that introduction of mildly destabilized protein polymorphisms into the defined genetic background of C. elegans model in which aggregation, toxicity, and cellular interactions can be directly compared between different SOD1 mutants. Furthermore, as models of other aggregation-prone proteins, such as polyglutamine expansions C. elegans models could be instrumental in deciphering both common and protein-specific regulation of aggregation or toxicity. Expression of three different ALS-related mutants of SOD1 in body-wall muscle cells of C. elegans lead to mild cellular disfunction and appearance of protein aggregates with distinct morphological characteristics. We also observed an unexpected variability of aggregate morphology in neighboring cells of the same animal, which could indicate that factors other than genetically encoded interactions also affect the fate of SOD1 in the cell. Similar stochastic variability between muscle cells of the same animal was previously reported with respect to onset of sarcopenia in wild type C. elegansWe established a SOD1 (corresponding to G85R in human SOD1), with complete suppression of toxicity up to 2.5 years in one genetic background, but a rapid onset of paralysis by 90–120 days in a different genetic background We find that ALS-related SOD1 variants exert a potent destabilizing influence on the functionality of metastable temperature-sensitive proteins at permissive conditions, exposing a range of phenotypes that are not present in strains expressing SOD1 mutants alone. Moreover, the most toxic of the SOD1 mutants (127X) in the Ras(ts) background was the least toxic in the paramyosin(ts) background, whereas the G85R mutation was most toxic with paramyosin(ts). Strain-dependent differences in SOD1 toxicity were previously observed in a mouse model carrying G86R mutation in murine The nature of the toxicity of aggregation-prone proteins remains one of the central questions for diseases of protein conformation. We have previously showed that unrelated ts mutations caused premature aggregation of polyQ-expanded proteins in vitroC. elegans. It is thus possible that SOD1 mutant proteins form different intermediate folding states in vivo depending on the nature of the mutation, and as such may possess different functional interactions with the folding machinery of the cell. Indeed, G85R and G93A proteins were recently shown to have different interactions with HSP70 in cultured cells Drosophila also rescue the generic toxicity of protein misfolding due to the reduced function of HSP70 C. elegansEach of the SOD1 mutant proteins used in this study exhibits distinct biophysical properties C. elegans by specific ts mutations suggest that the presence of mildly destabilizing protein polymorphisms in the genetically diverse human population could direct such specific phenotypes: because each cell type contains characteristic complement of expressed proteins, the genetic interactions of aggregation-prone proteins with destabilizing polymorphisms are expected to manifest in a cell type-specific manner. The disease variability across the population suggests that such protein polymorphisms may be specific to individuals or families, and missed in the population-based linkage analyses. A recent study found that up to 70% of rare missense alleles are mildly deleterious in humans This hypothesis could offer an explanation for the apparent paradox of cell-type-specific toxicity caused by ubiquitously expressed toxic proteins in conformational diseases. Indeed, in SOD1-related ALS, Huntington's disease, and Alzheimer's disease, specific neuronal subtypes are affected despite ubiquitous expression of SOD1, huntingtin and APP, respectively. The differential modulation of mutant SOD1 toxicity in C. elegans strains were obtained from the Caenorhabditis Genetic Center. Ts mutants were: paramyosin(ts) - CB1402[unc-159(e1402)], UNC-45(ts) - CB286[unc-45(e286)] and Ras(ts) - SD551[let-60(ga89)].Nematodes were grown on NGM plates seeded with E. coli OP50 strain. Animals were synchronized by picking L4 larva or pre-comma stage embryos onto fresh plates. Assays were performed with young adult animals, at the second day of reproductive adulthood at either 15°C (3.5 days after L4 stage) or 25°C (2 day after L4 stage). The SOD1 transgenic strains were created by injection and integration of complex arrays, allowing for uniform expression of transgenes. Human SOD1 sequences were obtained by PCR amplification from plQL01 or plQL03 , and cloned into a Fire Lab pPD30.38 plasmid. DNA mixture for injection contained 1 ng of linearized plasmid DNA and 100 ng of worm genomic DNA digested with PvuII (NEB).muv phenotype was picked directly from a pool of F2 progeny. We could not generate a WT SOD+Ras(ts) animals, presumably due to close genetic location of respective loci.Crosses between SOD1 transgenic and ts strains were performed by first mating N2 males with SOD1 hermaphrodites, and subsequently mating SOD1 heterozygous fluorescent males with ts hermaphrodites. 3–5 fluorescent F1 hermaphrodite progeny from these crosses were allowed to self, and 15–20 F2 fluorescent progeny were singled onto individual plates. Plates containing 100% temperature-sensitive progeny were used for generation of double-homozygous strains. To generate a strain double homozygous for G85R and Ras(ts), a singe fluorescent F2 hermaphrodite exhibiting a strong We noted that strains co-expressing SOD1 and ts mutant proteins tended to accumulate suppressors, similar to what was observed with polyQ expansions Fluorescence recovery after photobleaching (FRAP) analysis was performed as previously described 2, 0.5% Triton-X 100, 0.2 mM PMSF, 1 ug/ml Leupeptin, 1 ug/ml Pepstatin A, Complete protease inhibitor (Roche)) and centrifuged for 1 min at 30×g (Eppendorf 5417C centrifuge). All reagents were from Sigma, unless indicated otherwise. This protocol is optimized for the removal of debris and large fragments of cuticle while preserving the majority of aggregates in the supernatant, verified by examination of supernatant under fluorescent microscope. For detergent solubility, native extracts were incubated in the indicated detergent for 15 min at room temperature prior to resolving by native PAGE. 20 or 30 micrograms total protein was run on a 5% or 7.5% continuous native gels. Gels were imaged on Storm 860 scanner (Molecular Dynamics) with ImageQuant software to detect YFP fluorescence, or processed for the in-gel enzymatic assay.For native extracts, nematode pellets were mechanically disrupted, lysed in native lysis buffer , as described previously To measure motility, nematodes at indicated age were placed individually in a drop of M9 buffer and acclimated for 1 min; the completed body bends were counted for 1 min. At least15 animals were used per experiment. Similar decrease in motility was found by this method and by measuring rate of movement of animals raised at 20°C on a plate seeded with OP50 bacteria (not shown).emb+lva at 15°C, freshly laid pre-comma stage embryos were picked onto new plates. Unhatched embryos and larvae that hatched but did not crawl or were severely deformed were scored after 2 days. Alternatively, young adults were acclimated to 25°C for 1 day prior to egg laying, transferred onto new plates and allowed to lay embryos. Embryos were picked and scored one day later at 25°C. About one hundred embryos was used per experiment and experiments were repeated at least three times.For egl+rep and severe uncoordination, 30 L4 larvae grown at 15°C were picked to a fresh plate and incubated for 3 days at 15°C or 1.5 days at 25°C. Animals retaining eggs or containing three-fold embryos (detected with Nomarski optics) were scored as egg laying defective (egl). Animals with degenerated gonads, sterile, and those accumulating oocytes were scored as having a reproductive defect (rep). Animals that did not move on their own or did not exhibit sinusoidal movement pattern after being prodded were scored as severely uncoordinated. Experiments were repeated at least three times.To score Figure S1Unc-54 promoter/enhancer and 3′UTR direct expression of the fusion protein in body wall, intestinal, anal depressor, and sphincter muscles, as well as sex-specific muscles that develop postembryonically (WormBase). (B) Steady-state protein levels of SOD1 WT and mutant proteins. G85R and 127X proteins are expressed at level similar to the WT SOD1, while G93A is expressed at lower steady-state level. The level of YFP protein in the control strain is more than 2 fold higher than in any of the SOD1-YFP strains. The upper panel shows immunoblot with anti-YFP antibody, the bottom panel - with anti-tubulin antibody. 10 individual young adult animals were picked from indicated strains, boiled (15 min) in SDS sample buffer and resolved on 10% SDS gel. Immunoblots were scanned and quantified using Odyssey Infrared Imaging System (LI-COR Biosciences). The numbers below the gel represent quantitation of YFP signal normalized to tubulin.(A) Schematic representation of the SOD1-YFP expression constructs. The (0.53 MB TIF)Click here for additional data file.Figure S2Only soluble species of WT SOD1 and G93A proteins possess specific dismutase activity. G93A extract contains one main population of similar electrophoretic mobility (A) and enzymatic activity (B) to the WT SOD1 . The aggregated G93A protein is inactive (arrowhead), as is G85R and 127X protein . Native extracts were resolved by 5% native PAGE (same gel as in (1.34 MB TIF)Click here for additional data file.Figure S3The aggregation pattern and morphological variability of aggregates in G85R strain. (A) Aggregation pattern of G85R mutant protein at 20°C is similar to that observed at 15°C shown in . Shown a(3.56 MB TIF)Click here for additional data file.Figure S4SOD1 aggregates do not disrupt myofilaments and localize to the muscle belly. (A) Phalloidin-stained myofilaments (red) appear intact in the cells containing SOD1 aggregates . In contrast, polyQ40 aggregates (panel VII) intercalate into myofilaments and disrupts their continuity (panel VIII). Arrows in each panel point to the location of selected aggregates. Panels I, III and V, showing SOD1 aggregates, and II, IV and VI, showing myofilaments in corresponding cells, are in different confocal planes. The scale bar in I is 10 micrometers. (B) G93A aggregates are localized to the cytoplasmic area beneath the myofilaments - muscle belly. Confocal image through the middle plane of individual nematode, the muscle cells on the ventral side (towards the bottom of the image) are seen edge-on. Short arrows indicate positions of the muscle quadrants, arrowheads outline an oocyte. Several G93A aggregates (green) are seen in close apposition to each other (long arrow), adjacent to myofilaments (red). The scale bar is 10 micrometers.(3.06 MB TIF)Click here for additional data file.Figure S5unc-45(ts) background leads to defect in cellular protein folding and exposure of severe uncoordination phenotype. (A) Double homozygous animals were scored on day 2 of adulthood. Animals that did not move on their own or did not exhibit sinusoidal movement pattern after being prodded were scored as severely uncoordinated. The hatched bar represents unc-45(ts) animals at 25°C. (B) Overexpression of heat-shock transcription factor HSF-1 rescues the synergistic toxicity between G93A and UNC-45(ts) mutant proteins. HSF-1 is expressed from ubiquitous promoter let-858, as described in Expression of SOD1 mutants in (0.35 MB TIF)Click here for additional data file.

Journal of the National Cancer Institute suggested that consuming more dairy products and calcium may reduce colorectal cancer risk, but epidemiologic studies on this link have yielded inconsistent results. One explanation for this inconsistency may be the timing of exposure: cancer develops over decades, and early-life exposures to carcinogens and growth factors could be a critical factor. A new study designed to address this possibility has found that adults who consumed more dairy during childhood may have a greater risk of developing colorectal cancer in adulthood. The results appear in the December 2007 issue of the American Journal of Clinical Nutrition.The etiology of colorectal disease revolves around genetic and environmental factors, particularly diet. A meta-analysis in the 7 July 2004 issue of the Gastroenterology Clinics of North America. The main culprits appear to be excessive caloric intake, as well as frequent consumption of red meat, processed meats, alcohol, and refined carbohydrates.Colorectal cancer is among the leading causes of mortality in developed countries; according to the National Cancer Institute, about 630,000 deaths were expected to occur worldwide in 2007. Even moderate changes in diet and lifestyle could prevent at least 70% of all colorectal cancer cases, according to a review in the December 2002 The historical cohort study employed data from the Carnegie Survey, conceptualized by Sir John Boyd Orr, which recorded food consumption patterns in 1,343 English and Scottish families from 1937 to 1939. The survey was designed to investigate the long-range impact of children’s diet, growth, living conditions, and health on adult cardiovascular disease.Dietary data were obtained using a 7-day household inventory; also, weighed inventories of all foods in the household were conducted at the start and end of the survey period. The average follow-up time for adults included in this study was 65 years; 4,374 individuals were available for follow-up between 1948 and 2005. Daily intake of dairy products ranged from less than 0.5 cup at the lowest level to nearly 2 cups at the highest; liquid milk constituted 94% of the dairy intake.Those individuals who grew up in families reporting the highest levels of dairy consumption showed a nearly threefold increase in the risk of colorectal cancer compared with those from families reporting the lowest intake. The elevated risk remained even after the researchers adjusted the data for potential confounders such as socioeconomic status and meat, fruit, and vegetable intake. No other cancers were significantly affected by higher dairy intakes.“The mechanisms underlying these associations remain unknown, but there is increasing evidence that nutrition early in life can have long-lasting programming effects,” says lead author Jolieke C. van der Pols, an epidemiologist at the University of Queensland. For example, childhood dairy intake appears to be inversely associated with adulthood concentrations of insulin-like growth factor 1 (IGF-1), a key player in the development and progression of colorectal cancer. But it’s the effect of early dairy intake on childhood (rather than on adult) concentrations of IGF-1 that may be the important mediator of colorectal cancer risk.The findings seem perplexing given previous research showing an association between high dairy/calcium consumption and lower risk of colorectal cancer in adulthood. “In adults, this protection occurs despite the increase in growth factors, which would be expected to increase risk,” says epidemiologist Edward Giovannucci of the Harvard School of Public Health. “It is possible, though not proven, that the increase in growth factors early in life may be more important for colorectal cancer risk.” Giovannucci asserts that the new findings are biologically plausible and warrant efforts to replicate these findings in other populations and settings.Andrew Szilagyi, a gastroenterologist and assistant professor of medicine at McGill University School of Medicine, points out the lack of data on adult dietary intakes in the Boyd Orr cohort. “We do not know any aspects of dietary intake in adulthood,” Szilagyi says. “Nor do we know that the adults who developed colorectal cancer were also the very children in the families that indeed had higher dairy intakes.” In light of the fact that most studies have reported a protective effect of dairy products, it is important to determine the extent to which the former diet was continued into adulthood, he notes.The milk consumption levels identified as posing a significant cancer risk in the Boyd Orr cohort are similar to current average intakes for U.S. children. Nonetheless, the researchers assert that it would be premature to consider altering current guidelines for children’s nutrition. “Dairy products are important contributors to children’s intake of protein, vitamins, and minerals,” says van der Pols. “Because this is only the first study to show associations between childhood dairy consumption and risk of cancer in adulthood, more evidence is needed before any firm conclusions can be drawn.”

The anterior face of the mouse lens is covered by a layer of epithelial cells. The epithelial cells serve a barrier function at the lens surface and as a progenitor population from which lens fiber cells, the predominant cell type of the lens, are derived. Decreased epithelial cell density is commonly observed during aging and cataract formation in humans and animal models and may contribute directly to tissue opacification. However, the loss of cells from the epithelium is often not easy to quantify, in part because the cells are arrayed across a near-spherical surface and, as a consequence, are difficult to image and count. Here, we describe a technique for determining epithelial cell number in the undisturbed lens of the mouse, a popular cataract model. The method utilizes orthographic projections of confocal images collected from the anterior and equatorial regions of the lens. The overlapping projections are brought into register using the unique distribution of proliferating cells as fiduciary points. Cell counts are performed using a computer-assisted method. This approach offers several advantages over flat-mount methods employed previously. The lens epithelium serves a barrier function and also provides progenitor cells from which lens fibers, the predominant cell type of the lens, are derived. In the lenses of many species, marked decreases in epithelial cell density are observed during normal aging or accomThe adult mouse lens approximates an oblate spheroid with an equatorial diameter of 2–3 mm. Accurately counting epithelial cells on the large, curved anterior surface of the lens is technically challenging. Previous studies on rodent lenses -8 circumAlthough technically straightforward, the flat-mount approach has several shortcomings. First, manual dissection of the epithelium excludes or damages cells located near the periphery of the epithelium. Second, a curved surface cannot be flattened without distortion. Thus, during preparation of epithelial flat-mounts the epithelium must either be cut or stretched (or both) to pin it flat in the dish. Third, cell density is not uniform across the epithelium. Any estimate based on a regional cell count will, therefore, be erroneous.In our approach, cells are visualized and counted in situ in the intact lens epithelium. This strategy has the further advantage that the spatial relationships between neighboring epithelial cells and between epithelial cells and the underlying fiber cells are retained.2 inhalation and lenses were dissected from the eye, fixed for 1 h in 3.7% formaldehyde/PBS, and permeabilized in 0.5% Triton X-100. EdU-positive cell nuclei were visualized using Click-iT™ (Invitrogen) chemistry, which features a copper-catalyzed, covalent reaction between an alkyne group in the EdU and an azide group in an Alexa 488 fluorochrome. Lenses were incubated in 1× Click-iT reaction cocktail for 30 min. Lenses were also counterstained with the far red fluorescence DNA dye, Draq5. Lenses were stained for 30 min at room temperature in a 1:1,000 dilution of Draq5 in PBS. These procedures were approved by the Washington University Animal Studies Committee.Nuclei were counted as surrogates for the epithelial cells. Nuclei were visualized following labeling with 5-ethynyl-2´-deoxyuridine and/or Draq5 . EdU is a thymidine analog and incorporated into newly-synthesized DNA during S-phase of the cell cycle. For EdU labeling, 8-week-old C57/Bl6 mice were given an intra-peritoneal injection of EdU (10 µg/g bodyweight), as described . One houLenses were viewed in glass-bottomed microwell dishes . The chambers were prefilled with a shallow layer of molten agarose (4% in tissue culture medium). Once the agarose had cooled and set, a wedge-shaped piece was removed using a scalpel, to provide a viewing chamber . The chaThe lenses were viewed using a confocal microscope in the inverted configuration. A plan-apochromat 10× objective lens (0.45 NA) or a 40× C-apochromat objective (1.2 NA) were used to collect the image stacks. EdU-labeled nuclei were detected using the 488 nm line of an argon laser and a 505–550 nm band-pass emission filter. Draq5-stained nuclei were imaged using the 633 nm laser line and a 650 nm long-pass emission filter.Image stacks of the lens anterior surface and equatorial region were collapsed to two-dimensional, maximum intensity projections. Such projections are equivalent to orthographic azimuthal projections used by cartographers to depict the earth as seen from a great distance. Orthographic projections have the following features: in the polar aspect , lines oFor our analysis, we divided the lens epithelium into two regions: a spherical cap and an epithelial band , visualized following EdU labeling, as fiduciary points to align the projections. Estimates of epithelial population number derived using our method are significantly higher than published values, perhaps as a result of more accurate counting of the densely-packed cells near the lens equator. The methodology should be applicable to any analysis of epithelial cell number or mitotic activity and could readily be extended to the lenses of other species, including humans.

Hyperactivation of immune cells results in a perilous, Th1-driven cytokine storm. We set out to explore the regulation of cytokines in an FHL patient who was clinically stable on low-dose immunosuppressive therapy after bone marrow transplantation over a six-month period. During this period, chimerism analyses showed that the fraction of host cells was between 1 and 10%. Both parents of the patient as well as healthy volunteers were studied for comparison.Familial hemophagocytosis (FHL) is a rare disease associated with defects in proteins involved in CD8Using ELISA, quantitative real-time PCR, and clinical laboratory methods, we investigated constitutive and inducible cytokines, polymorphisms, and clinical parameters in whole blood and whole blood cultures. Although routine laboratory tests were within the normal range, the chemokines IP-10 and IL-8 as well as the cytokine IL-27p28 were increased up to 10-fold under constitutive and stimulated conditions compared to healthy controls. Moreover, high levels of IFNγ and TNFα were produced upon stimulation. Unexpectedly, IFNγ induction of IL-18 binding protein (IL-18BP) was markedly reduced (1.6-fold vs 5-fold in controls). The patient's mother featured intermediately increased cytokine levels, whereas levels in the father were similar to those in the controls.Since IL-18 plays a major role in perpetuating hemophagocytosis, the failure of IFNγ to induce IL-18BP may constitute a fundamental pathogenetic mechanism. Furthermore, increased production of IL-8 and IL-27 appears to be associated with this disease. Such dysregulation of cytokines was also found in the heterozygous parents, providing a novel insight into genotype-phenotype correlation of FHL which may encourage future research of this rare disease. Hemophagocytic lymphohistiocytosis (HLH), also called hemophagocytic or macrophage activation syndrome, is the name of a group of rare diseases characterized by a dysregulation of the immune system. HLH can be inherited, but occurs more commonly secondary to causes such as viral (including H5N1) or bacterial infections or cancer. The group of inherited HLH comprises familial HLH (FHL) and the Chédiak-Higashi and Griscelli syndromes, which are associated with various gene defects, but are nearly identical in clinical presentation. Clinical features, which are shared by the inherited and the acquired forms, include nonremitting high fever, hepatosplenomegaly, cytopenia of at least two lineages, and/or elevations in pro-inflammatory cytokines and soluble CD25. In severe cases, multi-organ failure may ensue. Phagocytosis of hematopoetic cells in the bone marrow, spleen, or lymph nodes caused by dysregulation of T-cells, NK cells, and macrophages is characteristic of HLH. FHL usually is manifest in infancy with fulminant failure of several organs and, without chemo- and immunotherapy followed by bone marrow transplantation (BMT), is almost always fatal.Since FHL is rare with 240 reported cases between the first description by Farquhar and Claireaux in 1952 We therefore investigated parameters of Th1- and general immune activation in an FHL patient with a perforin mutation. She was studied for 6 months starting 7 months after BMT during which a mixed chimerism (1–10% host) was present. We compared the data to the patient's heterozygous parents and a collective of healthy individuals (HC). In addition to demonstrating dysregulation of several cytokines, we observed that the induction of IL-18 binding protein (IL-18BP), the only known natural inhibitor of IFNγ and Th1 responses in humans Informed written consent was obtained from the patient's mother and father as well as from all HC. The experiments were approved by the Ethikkomission of the J.W.Goethe University and conducted in compliance with the Helsinki Declaration.At 3 months of age, the female infant was admitted to the pediatric intensive care unit of the J. W. Goethe University Hospital at Frankfurt am Main with the classic presentation of FHL characterized by a sepsis-like clinical picture with hepatosplenomegaly, pancytopenia, and impaired liver function. FHL was confirmed by bone marrow histology and FACS analysis . The consanguineous parents (first degree cousins) are heterozygotes.Chemotherapy according to HLH94 The patient was in good overall condition and chimerisms were between 1 and 10% host cells during study period. Informed written consent was obtained from the patient's mother and father as well as from all HC. All experiments were conducted in compliance with the Helsinki Declaration.Chemicals, reagents and kits were obtained from the following companies: E. coli-LPS (O127∶B8): Sigma, Munich; IFNγ: Peprotech, Frankfurt; RPMI 1640 medium and FCS: Life Technologies GibcoBRL, Karlsruhe; IL-8 and IP-10 ELISA kits: BD Pharmingen, Heidelberg; all Germany. PCR reagents and devices: Applied Biosystems, Foster City, CA, USA.2 for 20 h.Equal volumes of freshly obtained heparinized blood were mixed with RPMI1640 plus 25 mM Hepes, 100 U/ml penicillin, and 100 µg/ml streptomycin. 1 ml aliquots were then transferred into round-bottom polypropylene tubes which were incubated at 37°C and 5% COWB cultures were mixed, then one aliquot was lysed with Triton X-100 for determination of IL-8. The other aliquot was centrifuged at 350 g and the cell-free supernatant was removed and assayed for IP-10. ELISAs were performed according to the manufacturer's instructions.Total RNA from WB cultures was obtained using the QIAamp RNA Blood Mini Kit from Qiagen . Primers and probe for IL-18BPa real-time PCR were as follows: primers, 5′-acctcccaggccgactg-3′ and 5′-ccttgcacagctgcgtacc-3′; probe, 5′-caccagccgggaacgtggga-3′ (exon/intron spanning). For GAPDH, pre-developed assay reagents (Applied Biosystems) were used. Specificity of PCR products was tested by classic PCR using the aforementioned primers. mRNA copy numbers for IL-18BPa and GAPDH were determined using cloned cDNA standards. For analysis of IL-27p28, 35 cycles of a PCR with the primers 5′-gcggaatctcacctgccag-3′ and 5′-cgggaggttgaatcctgca-3′ were run.Variant alleles of the cytokine promoters IL-6 (G-174-C), IL-8 (A252T), and TNFα (G-308A) were performed as described in detail previously Data were analyzed by Student's t-test.Chimerism studies indicated that during the time of these investigations, 1 to 10% of blood cells were of host origin. The ability of the patient's whole blood to produce Th1 and effector cyto-/chemokines under steady-state as well as stimulated conditions was compared to that in phenotypically healthy heterozygotes, namely both parents, as well as to that in HC.C and D).As shown in D).Upon stimulation with LPS, WB cultures from mother, father, and HC secreted comparable amounts of IP-10, TNFα, and IFNγ protein Figure 2In family members and in HC, constitutive levels of IL-6 were below detection limits (5 pg/ml) and measurements of CRP, white blood count including differential IgG, IgA, and IgM, LDH, and kidney function were each within normal limits throughout the study period. Only parameters of liver function, namely ALT, AST, and γGT, were slightly elevated in the patient.Identical genotypes of the promoters of the IL-8 and TNFα genes were found in the mother, father, and the patient . The same was the case for FcγRIIa and IIIb. For IL-6, the father was heterozygous, whereas both patient and mother were homozygous for allele G, which is associated with a higher production of the cytokine B). Whereas IL-18BP expression in the father's cells was nearly identical to that of the controls, the cells of the mother exhibited intermediate steady-state and IFNγ-induction patterns. In contrast to IL-18BP, steady-state expression as well as IFNγ-induction of IL-27p28 was markedly higher in the patient than in the parents and in HC may result from the persistent stimulation delivered by the host's own, perforin-deficient cells. Interestingly, a similar mechanism appears to be involved in the pathogenesis of influenza caused by the H5N1 virus, as the H5 hemagglutinin suppresses perforin expression An association of IL-8 with HLH has been described for the secondary Presently, there is no link of IL-27 to HLH. This cytokine can promote a Th1 response in its early stages Our data are obtained from a single patient and her parents; thus, any conclusion needs to be drawn with reasonable caution. We anticipate that this limitation may encourage future research to corroborate our findings and elaborate on several aspects, especially on a possible therapeutic role of IL-18BP in HLH. Summarizing our data, we suggest that assessing IL-18BP, IP-10, and/or IL-8 may assist in identifying latent disease activity in transplanted FHL patients whose clinical condition and laboratory status is still normal. IL-8 and IL-27 are introduced as possible new players in FHL. Furthermore, different degrees of abnormalities of cytokine regulation in the heterozygous parents shed light on genotype-phenotype correlations in FHL. Most importantly, we assert that the capacity of IL-18BP to counterbalance excessive production of Th1 cytokines was defective in the patient. This may constitute a novel mechanism of disease perpetuation which, given the pathogenetic similarities, may also be relevant in SLE, WG, and H5N1 infections.

Tube thoracostomy (TT) is the most commonly performed surgical procedure in thoracic surgery clinics. The procedure might have to be repeated due to ineffective drainage in patients with tube malposition (TM), in whom the drain is not directed to the apex or located in the fissure. Trocar technique, which is used to prevent TM, is not recommended because of its potential for severe complications.The study involved 180 patients who required TT application for any etiology within one year. The patients were divided into two groups as Group A, who had undergone classical surgical technique (n = 90) and Group B, who had undergone a combination of surgery and trocar techniques (n = 90). The groups were compared for TM, the effect of TM on the drain removal, and other insertion related complications.In Group A, 23 patients had TM, 4 of whom developed associated ineffective drainage, while the patients in Group B had no insertion related complications (p = 0.001). The mean drain removal time of the patients with TM was 5 ± 2.25 days. In the patients who did not develop TM, it was 3.39 ± 1.18 days (p = 0.001).The modified combination technique is a reliable method in preventing TM and its potential complications. TT is a standard and generally reliable method in the management of pathologies responsible for accumulation in the pleural space . The twoThis randomized, prospective study involved 180 patients who required TT for various etiologies between 2006 and 2007. The detection of the type of method to be used for the allocated patients were determined by using the prepared bloc randomization lists before the study. After receiving the statement of patient consent from all patients, the patients were evaluated in two groups as those who were applied surgical technique (Group A) and those who were applied combined modified technique (Group B). The presence of severe pleural adhesion was considered a contraindication for modified technique and these patients were applied surgical technique. On the chest computer tomography (CT), fissural, parenchymal, and extrathoracic location of the drain and angulation of the drain in the interpleural space were considered TM. The cases confirmed as TM depending on poorly air and fluid drainage, and because of that the pulmonary expansion could not be possible adopted as ineffective drainage. The groups were compared for TM occurrence, the effect of TM on the time of drain removal, and other tube thoracostomy complications.The patients who were scheduled for TT application for various indications were evaluated through AP and lateral radiographs before and after the procedure. The patients with suspected TM or severe complications were evaluated through thorax CT.th, 6th, or 7th intercostal space, or at the anterior or mid-axillary level depending on the etiology. In this technique, the stages of TT application are as follows: after sterilization of the area with betadine solution, an incision of nearly 2 cm is made on the proper location where it is parallel to the upper margin of the lower rib. Following blunt dissection with dissection clamp, the pleural space is penetrated. Any parenchymal adhesions, if present, are eliminated through finger exploration. A thorax drain of proper size (28 or 32F) for the indication is placed into the pleural space with the help of a macro clamp and connected to an underwater drainage system. Finally, a U-suture is made for use in drain fixation and removal.Surgical TT was performed in all the patients. After local anesthesia was achieved with lidocaine HCl, TT was performed through 5®) was advanced towards the pleural space and directed to the apex. After the combination was advanced about 15 cm, the trocar was withdrawn about 10 cm, and thus, the free end of the drain was advanced until it reached and was placed in the apex. Then, the trocar was withdrawn until the end of the drain that was outside the thorax. Upon clamping the drain on its proximal, the trocar was completely withdrawn and the drain was connected to the underwater drainage system. After the drain was fixed, the procedure was completed.The patients were prepared as in the surgical technique and were performed local anesthesia. An incision of nearly 2 cm was made at the proper location. In trocar technique, after penetrating into the pleural space, the trocar and drain together are advanced towards the apex by using force. This technique was modified and started as in the surgical technique. After penetrating the pleural space with blunt dissection, the adhesions in the pleural space were explored using a finger. Then, thoracic trocar and 28-32F XRO translucent PVC drain and 3 female patients. The mean age of the patients in Group A was 34.70 years. Group B comprised 81 male patients (90%) and 9 female patients. The mean age of the patients in Group B was 35.75 years.The most common etiology in both groups was stab wound injuries Table .The most common late-stage complication associated with TT was prolonged air leak Table .In Group A, 23 (25.5%) patients developed TM, and in 4 (4.4%) of these patients, TM led to ineffective drainage .TT is the most commonly performed surgical procedure in thoracic surgery clinics ,2. In exWhen the drain is not directed towards the apex in the pleural space, it is termed as TM. This complication occurs in 4 locations: intraparenchymal, fissural, extrathoracic locations, and angulation of the drain in the pleural space. Although TM usually occurs in urgent TT procedures, it may also be associated with the method of TT used. In a study where TM was defined in fissural or parenchymal location, trocar technique was shown to increase the risk of TM .On the other hand, angulation of the drain in surgical technique is not a rare occasion. In such cases, poor drainage may be associated with the angulation point and the degree of angulation of the drain because angulation often reduces the diameter of the lumen. This may result in failure in effective drainage depending on the diameter of the parenchymal defect particularly in pneumothorax. Some authors recommend the withdrawal and reinsertion of the drain in case of TM, while others suggest keeping the drain in its place if effective drainage is achieved . AlthougWith the use of the method described here, which consists of a combination of modified trocar and surgical TT techniques, we aimed to reduce the incidence of intrapleural angulations, which are commonly observed in surgical technique, and intraparenchymal-fissural locations, which are common with trocar technique, as well as pulmonary and cardiovascular injury. None of the patients involved in the study was performed trocar technique TT due to high complication rates. The comparison of the patients who were performed classical surgical technique and the patients who were performed modified combined technique revealed significant differences in favor of the group that was applied modified combined technique with respect to TM and air leak.The results of this study have shown that modified combined technique can be used safely in thoracic surgery clinics because it reduces the incidence rates of complications and TM, is easy to perform, and has positive effects on air leak and hospitalization time.The authors declare that they have no competing interests.This report reflects the opinion of the authors and does not represent the official position of any institution or sponsor. The contributions of each of the authors were as follows:KD and GG were responsible for reviewing previous research, journal handsearching, drafting report. BK was responsible for provision of published trial bibliographies, preparing photographs. GG was responsible for quality checking, coding and classification, data processing. US was responsible for project coordination.All authors have read and approved the final manuscript.

Nalidixic acid resistance was greater for C. coli (21.3%) than for C. jejuni . C. jejuni resistance to ciprofloxacin in broilers decreased from 31.7% in 2002 to 9.0% in 2004 (p = 0.02). The patterns of resistance to quinolones and fluoroquinolones were similar between 1999 and 2004 in human and broiler isolates for C. jejuni. These results suggest a potential benefit of a regulation policy limiting use of antimicrobial drugs in food animals.We describe isolates from human Campylobacter infection in the French population and the isolates' antimicrobial drug resistance patterns since 1986 and compare the trends with those of isolates from broiler chickens and pigs from 1999 to 2004. Among 5,685 human Campylobacter isolates, 76.2% were C. jejuni, 17.2% C. coli, and 5.0% C. fetus. Resistance to nalidixic acid increased from 8.2% in 1990 to 26.3% in 2004 (p<10 The network of participating laboratories, limited to hospital laboratories from 1986 to 2001, was complemented by private and additional hospital laboratories in 2002 to be more representative of the whole French territory by the agar diffusion method on Mueller-Hinton agar enriched with 5% sheep blood by using antibiotic disks, according to recommendations for Campylobacter of the Antibiogram Committee of the French Society for Microbiology (CA-SFM) and zoonotic bacteria in animal products for human consumption. Thus, data collection began just after the ban of 4 antimicrobial growth promoters by the European Community (EC) Council Regulation . Conventional broiler flocks are characterized by an indoor rearing period of 6 weeks, and free-range broiler flocks have an indoor rearing period of 6 weeks followed by 6 additional weeks with access to an open-air area.From 200 to 600 broiler cecal samples or pig fecal samples were collected each year in 10 broiler and 10 pig slaughterhouses representative of French production of these animals for human consumption viable isolates, 3,896 (76.2%) were C. jejuni, 878 (17.2%) C. coli, 257 (5.0%) C. fetus, 21 (0.4%) C. lari, 40 (0.8%) Arcobacter butzleri, and 13 (0.25%) other species of Campylobacter. Seven strains (0.1%) were Helicobacter spp. A seasonal increase during the warmer months was noted and was more pronounced for C. jejuni.-3). The ratio of C. jejuni to C. coli varied between 4.5 and 7.2 in those <30 years of age and decreased thereafter. C. fetus was isolated among adults >30 years of age and peaked in the elderly . Thirteen (0.2%) were newborns (5–30 days), 258 (4.5%) infants (1–11 months), 1,907 (33.5%) children (1–10 years), 2,555 (44.9%) ages 11–65 years, and 767 (13.5%) >65 years . Isolati p<10-3, .-3).Among the 5,620 isolates with a known clinical source, 5,253 (93.4%) were isolated from stools, 308 (5.5%) from blood, and 50 (0.9%) from other sites presumably seeded as a result of bacteremic infections. Both C. jejuni and C. coli were isolated essentially from stools, whereas 158 (63.5%) of 249 C. fetus isolates were from blood. Patients with blood isolates were older than those with stool isolates case-patients; 184 (3.2%) reported traveling outside France during the 2 weeks before onset of illness. The country of travel was specified for 169 (91.8%) case-patients .-3, -3). Resistance to erythromycin remained low, and no isolate was resistant to gentamicin.Resistance to nalidixic acid and tetracycline/doxycycline increased from 1986–1989 to 2002–2004 p<10-3, . Resista-3). Resistance was greater for C. coli (21.3%) than C. jejuni in 1990 to 26.3% (115/438) in 2004 patterns included resistance to nalidixic acid or ciprofloxacin, to doxycycline, and to ampicillin.Fifty-eight percent of Campylobacter isolates were resistant to -3). The proportion of resistance to ciprofloxacin did not vary according to age (27.3% of case-patients £15 years and 27.9% >15 years). For ampicillin, 41.9% of case-patients £15 years had a resistant strain compared with 37.3% of the case-patients >15 years (p = 0.001).Among the case-patients £15 years of age, 28.0% had a Campylobacter strain resistant to nalidixic acid compared with 37.6% of the case-patients >15 years of age (p<10-3). For nalidixic acid, 42% (70/166) of case-patients who traveled abroad compared with 34.7% of case-patients who did not had a resistant strain (p = 0.06). Resistance to ampicillin was present for 28.3% (47/166) who had traveled abroad compared with 31.1% for those who had not (p = 0.01).Of the case-patients who traveled abroad, for which strain resistance was available, 40.3% (67/166) had a strain resistant to ciprofloxacin, compared with 27.0% of case-patients who did not travel abroad (p<10-3), while the proportion of C. jejuni decreased from 32% (18/57) to 10% (4/40) in the free-range production facilities (p = 0.01).Between 1999 and 2004, a total of 544 C. jejuni and 374 C. coli isolates were recovered from poultry, and 871 C. coli were recovered from pigs by the antibiotic resistance surveillance system. Among the broiler isolates, the proportion of C. jejuni from animals raised in standard and export production facilities gradually decreased from 83.5% (279/334) in 1999 to 43% (28/65) in 2004 (p<10-3).Campylobacter isolates were inconstantly sensitive to ampicillin, and a high proportion of isolates resistant to tetracycline was recorded in poultry and pigs, but all strains remained sensitive to gentamicin . Isolate-3) than were C. jejuni strains , p<10-3) . C. coli-3) . Similar-3) .Our surveillance of Campylobacter isolates in France indicates some differences with findings from other western countries, i.e., a greater proportion of C. coli (17.0%). The epidemiologic characteristics of Campylobacter infections were, however, similar. Campylobacter is predominant in the summer than in the United States (<1%) or Belgium (11%) to 2004 (26.3%), consistent with trends observed in other countries . Comparison of human and animal data was not based on a continuum between human isolates and contaminated food consumption (isolates from retail chicken). However, broiler chicken and pig data were representative of French livestock and were consistent with those of another recent survey done in France (The extension of the surveillance of human Campylobacter allowed the epidemiologic characteristics of Campylobacter infections that occurred in the general French population to be better understood. Campylobacter resistance to antimicrobial agentss increased to a high level among humans in France from 1990 through 2004. Comparison of antimicrobial resistance patterns in humans, broilers, and pigs from 1999 to 2004 showed similar patterns of quinolone and fluoroquinolone resistance for C. jejuni isolates from broilers and humans. These results suggest that a limitation of the use of fluoroquinolones in broilers may reduce fluoroquinolone resistance of Campylobacter in humans. Other studies, however, are needed to further quantify the effect of restricted use of antimicrobial drugs in animals on bacterial resistance in human isolates. Ongoing national surveillance of Campylobacter in humans, livestock, and animal feeds at the retail level and antimicrobial susceptibility testing are necessary to evaluate the effects of implementing European policies. Further research is also needed to better understand the relationship between antimicrobial use in animals and humans and bacterial resistance in humans.

Yeast transcription factors that are more central in the transcription network tend to evolve more quickly. Transcription factors play a fundamental role in regulating physiological responses and developmental processes. Here we examine the evolution of the yeast transcription factors in the context of the structure of the gene regulatory network.In contrast to previous results for the protein-protein interaction and metabolic networks, we find that the position of a gene within the transcription network affects the rate of protein evolution such that more central transcription factors tend to evolve faster. Centrality is also positively correlated with expression variability, suggesting that the higher rate of divergence among central transcription factors may be due to their role in controlling information flow and may be the result of adaptation to changing environmental conditions. Alternatively, more central transcription factors could be more buffered against environmental perturbations and, therefore, less subject to strong purifying selection. Importantly, the relationship between centrality and evolutionary rates is independent of expression level, expression variability and gene essentiality.Our analysis of the transcription network highlights the role of network structure on protein evolutionary rate. Further, the effect of network centrality on nucleotide divergence is different among the metabolic, protein-protein and transcriptional networks, suggesting that the effect of gene position is dependant on the function of the specific network under study. A better understanding of how these three cellular networks interact with one another may be needed to fully examine the impact of network structure on the function and evolution of biological systems. Understanding of the function and evolution of any specific gene or protein requires knowledge of the context in which that gene operates, because change in any single component of a complex system can have ramifications for all other components. This system-orientated view, largely enabled by the omics revolution, has sparked increasing interest in the investigation of biological networks and has yielded promising results in the understanding of cellular , developThe premise that biological systems are more than the sum of their parts implies that such systems possess emergent properties that cannot be captured by a purely reductionist approach. For a network, one such emergent property is its topology. Comparisons of entirely different types of networks, including social, technological and biological networks, have revealed intriguing shared topological properties, such as an overall hierarchical organization, similar node-degree distributions, and a tendency toward a small-world structure in which most nodes are connected by only a few other intervening nodes . The obsIn this study we examine the evolution of the yeast transcription factors and ask whether fine differences in network structure and function lead to different evolutionary impacts on the elements of those networks. Gene regulatory networks are of particular interest because they allow the cell to modify its physiology, cycle and shape in response to environmental or developmental demands . MetabolOverall, we show that network structure does indeed lead to different evolutionary dynamics that depends more specifically on the overall function of the network. Therefore, understanding the relationship between network structure and the evolution of network components will depend on a deeper knowledge of gene function.kin), the number of target genes , and betweenness, measuring the centrality of a gene in the network, from two separately derived representations of the yeast transcriptional network. The first dataset (YTN1) [Saccharomyces Genome Database (SGD)) were retained for analysis of evolutionary rates, leading to the retention of a set of 256 genes for YTN1 and a set of 138 genes for YTN2. Because the first network contains 85% more transcription factors than the second, we have much more power to detect significant effects using the first network and therefore focus most of our discussion on that dataset. Nevertheless, both datasets yield qualitatively similar results for each of our major conclusions.We obtained node statistics, specifically the number of regulatory inputs includest (YTN1) includesLarge-scale analyses have shown that multiple genomic variables have an effect on the rate of protein evolution ,17. AmondN/dS: t249 = 3.62, P < 0.001; Wilcoxon two-sample P < 0.0001). Similarly, we find a correlation between protein evolutionary rates and genes' essentiality estimated by the growth rate of deletion strains [As noted in previous studies, expression level has a strong effect on transcription factor sequence evolution Figure , with mo strains , indicating that pleiotropy has direct fitness consequences. Accordingly, transcription factors with more GO terms tend to evolve more slowly terms ,31 as a Finally, the position of a gene within the network, or its centrality, has a significant influence on its evolutionary rate Figure . PreviouInterpretation of these simple correlation patterns is complicated by the fact that different genetic properties are correlated with one another and so any single correlation between two characteristics might actually be generated by a shared correlation with a third causal element. To correct for this, we examined the relative contribution of function, network and expression-associated constraints on transcription factor evolution using multivariate analysis.We first used multiple regression analysis with network connectivity and network centrality separately with function and expression-related predictor variables in order to estimate the contribution of each of these elements to variation in evolutionary rates among transcription factors. Consistent with the univariate patterns, our analysis reveals that transcription factors having larger effects on organismal fitness when deleted tend to evolve more slowly than those with lesser fitness effects Table . In the kin: YTN1: Spearman's ρ = -0.082, P = 0.2; YTN2: ρ = 0.033, P = 0.7), although the relationship between out-degree and essentiality differs between the two datasets . However, when growth rate is measured under different conditions, transcription factors with numerous target genes in YTN2 are not enriched in essential genes [We find no significant correlation between in-degree and essentiality , but centrality is not correlated with expression level and essentiality .Importantly, this analysis also shows that the contribution of network centrality to protein divergence is independent of expression and function-related variables Table . Thus, aThe high degree of correlation among predictor variables has led some to question the use of multiple regression for these types of analyses . We therTo get around these issues, we defined a new set of variables composed of principal components derived separately from the expression, network and function-related variables. Multiple regression analysis on these composite variables shows that each of these causal components has independent effects on the rate of nonsynonymous changes Table . ResultsIn summary, our results on the yeast transcription network and previous work on the yeast metabolic and PPI networks -6 show tGenomic information generated in recent years has not only offered new insights into biological processes at various levels of organization -3,32, buA second consequence of this systems molecular evolution perspective is that it yields novel insights into how cellular networks and their components evolve. Previous studies have noted that metabolic enzymes with high degree are no more essential than those with low degree, perhaps because rerouting of metabolic fluxes in highly connected regions circumvents loss of function mutations at a given node . The absWe obtain qualitatively similar results from our analysis of both representations of the transcriptional network ,15. ThisOur results on the yeast transcription network and previous work on the yeast metabolic and PPI networks -6 show tEscherichia coli to regulate transcript and protein levels to maximize growth rate and maintain stable metabolite levels, whereas when enzymes of the carbon metabolism network are disrupted, system stability is achieved through redundancy and flux rerouting [per se, seems to correlate better with protein divergence [In contrast, transcription networks play fundamental roles in regulating cell state during developmental processes and during physiological adjustment to changing environmental conditions . For inserouting . In eukavergence . Here, tvergence . HoweverDrosophila [Although the relationship between centrality and evolutionary rate is somewhat unexpected, examination of the fine scale structure of other networks indicates that this may be a general property of control systems. For example, although highly connected proteins (hubs) in the yeast PPI network evolve slowly ,7, interosophila . Thus, pThe system-level pattern of evolutionary rates is different from that observed in the protein-protein interaction and metabolic networks: central transcription factors tend to evolve faster. This suggests that the higher nucleotide rate divergence in central transcription factors may result from the role that these proteins play in controlling the flow of information and may be the result of adaptation to changing environmental conditions. The conclusions derived from network level analyses of molecular evolution can clearly vary depending on the functional role played by the components of that network. In the same way that we have shown that the particular function of a network can influence how one interprets the impact of its structure on protein evolution, it is clear that we must begin to link all of these networks together so that the complete nature and consequences of network structure on the function and evolution of biological systems can be examined.kin), out-degree (kout) and betweenness, were obtained for each dataset using the tYNA platform [We used two distinct datasets of the yeast transcriptional network. The first dataset , YTN1, iplatform .Saccharomyces cerevisiae [S. paradoxus, the most closely related species [dN) and synonymous changes (dS) were computed in CODEML [dS') [dN and dS by using the residuals of the regression between dN with dS in our analyses.Protein sequences of orthologous genes from revisiae and S. p species having i species , were re species , aligned species , and subn CODEML . In addiML [dS') . We alsodN/dS: Wilcoxon two-sample P = 0.004; mRNA abundance: dN/dS: Wilcoxon two-sample P = 0.04; YTN2: protein abundance: dN: Wilcoxon two-sample P = 0.03; mRNA abundance: dN/dS: Wilcoxon two-sample P = 0.06). Nevertheless, the translational robustness hypothesis suggests that the frequency of translation events is a better indicator of evolutionary rate than the number of proteins per cell [et al. [Essentiality was defined by a lethal phenotype in deletion strains . For a qper cell . Therefoper cell , which mper cell , as wellper cell using th [et al. . Express [et al. . Express [et al. .kout were natural-logarithmic transformed to approximate a normal distribution. One unit was added to betweenness and kin, as well as kout in YTN2, prior to the natural logarithmic transformation because of null values for these variables. All variables, including predictor and response variables, were standardized to a mean of 0 and 1 standard deviation unit. In addition to Spearman's rank correlations and multiple regression analysis, we also performed principal component regression analysis, first using single predictor variables together and then by defining a new set of principal components separately from the expression, network and function-related variables. These composite variables were obtained from the first principal component of expression , network and function related variables. Principal component analyses were performed on correlations.Statistical analyses were performed using JMP 4.0.4 . The number of GO terms and dN: rate of nonsynonymous changes; dS: rate of synonymous changes; dS': rate of synonymous changes corrected for selection at silent sites; GO: Gene Ontology; kin: in-degree; kout: out-degree; PPI: protein-protein interaction; SGD: Saccharomyces Genome Database.CAI: codon adaptation index; RJ designed the study and collected the data. RJ and PCP analyzed the data and wrote the paper.

Automated image analysis, measurements of virtual slides, and open access electronic measurement user systems require standardized image quality assessment in tissue-based diagnosis.To describe the theoretical background and the practical experiences in automated image quality estimation of colour images acquired from histological slides.Digital images acquired from histological slides should present with textures and objects that permit automated image information analysis. The quality of digitized images can be estimated by spatial independent and local filter operations that investigate in homogenous brightness, low peak to noise ratio , maximum gradients, equalized grey value distribution, and existence of grey value thresholds. Transformation of the red-green-blue (RGB) space into the hue-saturation-intensity (HSI) space permits the detection of colour and intensity maxima/minima. The feature distance of the original image to its standardized counterpart is an appropriate measure to quantify the actual image quality. These measures have been applied to a series of H&E stained, fluorescent , and immunohistochemically stained slides. More than 5,000 slides have been measured and partly analyzed in a time series.Analysis of H&E stained slides revealed low shading corrections (10%) and moderate grey value standardization (10 – 20%) in the majority of cases. Immunohistochemically stained slides displayed greater shading and grey value correction. Fluorescent stained slides are often revealed to high brightness. Images requiring only low standardization corrections possess at least 5 different statistically significant thresholds, which are useful for object segmentation. Fluorescent images of good quality only posses one singular intensity maximum in contrast to good images obtained from H&E stained slides that present with 2 – 3 intensity maxima.Evaluation of image quality and creation of formally standardized images should be performed prior to automatic analysis of digital images acquired from histological slides. Spatial dependent and local filter operations as well as analysis of the RGB and HSI spaces are appropriate methods to reproduce evaluated formal image quality. The technological progress in image acquisition, transfer, and display prompted surgical pathologists to investigate and implement new image viewing techniques in their daily work. Telepathology, which is the transfer and viewing of macroscopic and microscopic images at a distance, was fully established at the beginning of the 1990s followed by the construction of specific telemedicine systems such as the iPATH or UICC-TPCC at the beginning of this century . Only a This scenario requires a formal and reproducible analysis of the image quality to be viewed electronically due to practical and also legal reasons. The definition of image quality is, however, not simple. The viewing of images induces, in addition to their optical properties, emotions that are not completely associated with the physical components: Quite independent from clearly defined terms, such as contrast, resolution and focus, pathologists often state that some images are easy to view at and others are not . Thus, tOn the other hand, formal parameters of image quality contribute to recognition of image information too. Especially the application of automated texture and object analysis requires formally standardized images prior to the image examination -4,11.In this article we describe the theoretical background and our experiences in applying formal standardization in microscopic images prior to automated information analysis. Digitized images obtained from H&E stains, performed immunohistochemistry, and applied fluorescent dyes served for this investigation.The preparation of histological glass slides is subject to quality influences that are induced by tissue fixation, embedding, and cutting procedures, followed by influences of stains and coverglass fixation, to name some of them. Adjustment of the microscope, illumination or brightness of light transmission, selection of fields of view at different magnifications, quality of mounted camera and its position play an additional role that influence the quality of the acquired image. How to measure and correct these parameters?Computerized tissue-based diagnosis uses at least two different image information sources which are called a) texture and b) object. Analysis of spatial distribution of grey values per pixel reveals texture information, and that of grey values per biological object, object information -4,11. GrIn aggregate, the minimum of image transformations to obtain a standardized image includes a) shading, b) grey value interval, and c) grey value level correction. Correction of shading results in equal distributed illumination and brightness, that of grey value interval in equal distributed grey value histogram, and that of grey value level in expanding grey values adjusted to the maximum possible one. These standardized images might not be of sufficient quality permitting efficient object detection. Thus, the same standardization procedures should be applied to the derived differentiated images (gradient procedures). The obtained distance of the original from the standardized image is obviously a reproducible and objective measure of image quality of grey value image or colour channel.Microscopic images usually consist of three colour spaces, most frequently displayed in the red-green-blue (RGB) space . AnalysiMicroscopic images should contain objects to be measured. Objects are related to grey value threshold in general, thus the number and areas covered by automated threshold procedures can serve as monitor for image quality related to biological information. We applied the algorithm described by Otsu for these purposes .A series of digital images acquired from H&E stained slides in the Institutes of Pathology, Research Center Borstel, Charite, Berlin, University of Campinas, Campinas, Brasil, University of Freiburg, Freiburg, University of Kerman, Kerman, and University of Novi Sad, Novi Sad, Serbia were subject to the described algorithm. In addition, images acquired from fluorescent and immunohistochemically stained slides which have been submitted to the Electronic Automated Measurement User System (EAMUS™) have been included in this study. All in all, more than 5000 images have been analyzed and included in the statistical analysis.A survey of the applied measurements is depicted in table The results are partly accumulated in serial order, as demonstrated in figure A reliable and standardized quality of digitized images obtained from histological slides is a necessity to further extract information and correlate this information with external data such as diagnosis, prognosis, etc. . For exaAcknowledged limits of image quality parameters to classifying images of good or less good quality do not exist, to our knowledge. Therefore, a serial analysis of "distances" between original and standardized images seems an adequate procedure in estimating image quality. The results demonstrated in figure The correlation of hue and saturation spaces with the intensity space is closer than that between the different RGB spaces. Images of good quality display only one and strictly closed space in the corresponding figures (see figure The image measurements reported herein are performed on images of (.bmp) format without any compression mode. The influence of compression on image and tissue based diagnosis quality had been already extensively analyzed by several authors ,22-25. AImage quality analysis and implementation of standardized images for further image processing can be easily implemented into Grid technology allowing

I have enjoyed guest editing this special symposium on Pediatric Urology. Pediatric urology has always been very close to my heart. It is one of my dreams to see this speciality become established superspeciality in India like in United States of America. With the establishment of American Academy of Pediatrics – Urology section (AAP Uro) and European Society of Pediatric Urology this speciality has firmly established its role as superspeciality in the developed world. ESPU has an exit examination at the end two years of specialized training and the AAP is planning a similar exit exam in future. Situation in the developing world and in India continues to be significantly different. The pediatric urological diseases are managed both by the pediatric surgeons and the urologists. This turf war continues because pediatric surgeons usually treat children below age of 12 years in all government and teaching medical colleges in India. This has had an adverse effect on the growth of pediatric urology as subspeciality. Pediatric surgeons have given up long ago cardiac and neurosurgery because of extensive technical and scientific development in this field. Urology today is no exception. Development of endourology, urodynamics and renal transplantation work requires specialized training and skills which cannot be learnt during a pediatric general surgical training. In this issue, Dr. Oak, Professor of pediatric surgery from Mumbai and Prof. Paddy Dewan, a pediatric urologist from Melbourne, Australia have deliberated on the issue of "Training of pediatric urologist". It is obvious that it would require a multidisciplinary approach requiring support of Pediatricians, Endocrinologists, Nephrologists, Pediatric Anaesthetists and supporting nursing and paramedical staff. A pediatric surgeon who intends to pursue his career as pediatric urologist would need an additional training in the field of Endourology, urodynamics and renal transplantation. While, an urologist would need training regarding basic principles of pediatric general surgery. Instead of fighting a turf war, it would be better if the respective surgical societies of pediatrics and urology can come together and device a syllabus for a structured training programme. These societies would then need to identify units / institutions which can undertake such training.This issue concentrates on some of the important advances which have been made in the field of pediatric urology. The treatment of VUR is better standardized today and the role of surgery is clearly defined. Drs. Dave and Khoury from Torronto Hospital for Sick Children provide evidence based approach for management of VUR. Dr. Atul Thakre elaborates the evolving role of laparoscopy in antireflux surgery. Dr. Pramod Reddy from Cincinnati have discussed very lucidly the advances in the field of Uroradiology.Urolithiasis in children is not an uncommon problem in our part of the world and Prof. Rizwi etal from SIUT Karachi and Dr. Mahesh Desai etal from MPUH, Nadiad discuss the issues of aetiopathogenesis and management of Urolithiasis. The important point highlighted by the Karachi group is the significance of ammonium urate stones secondary to dehydration and malnutrition which can easily be prevented by providing better primary healthcare. Dr. Divyesh Desai from Hospital for Sick Children, has provided an update on the role of bladder function assessment in the management of posterior urethral valve. I feel it will be very useful for urology post graduates and the practicing urologists. The management of Wilm's tumour is a success story of oncology and today the emphasis is on curing these children with minimal morbidity. Dr. Hemant Tongaonkar, the urooncologist from TATA cancer hospital has provided a review of Wilm's tumour treatment with special emphasis on cytogenetics and various treatment modalities. Prof. E. Duardo Ruiz a famous renal transplant surgeon from Buenos Aires shares his experience of last 25 years of pediatric renal transplantation and many units who are developing the programme of pediatric transplantation would immensely benefit from this experience.I sincerely thank all my contributors for their hard work and hope that this issue would help generate interest in this wonderful subspeciality. I take this opportunity to thank the Editorial team of IJU for having given me this opportunity.

Anous minutus), during two breeding seasons. The first season had anomalously high sea-surface temperatures and ‘low’ prey availability, while the second was a season of below average sea-surface temperatures and ‘normal’ food availability. During the second season, supplementary feeding of chicks was used to manipulate offspring nutritional status in order to mimic conditions of high prey availability. When sea-surface temperatures were hotter than average, provisioning rates were significantly and negatively impacted at the day-to-day scale. Adults fed chicks during this low-food season smaller meals but at the same rate as chicks in the unfed treatment the following season. Supplementary feeding of chicks during the second season also resulted in delivery of smaller meals by adults, but did not influence feeding rate. Chick begging and parental responses to cessation of food supplementation suggested smaller meals fed to artificially supplemented chicks resulted from a decrease in chick demands associated with satiation, rather than adult behavioral responses to chick condition. During periods of low prey abundance, chicks maintained structural growth while sacrificing body condition and were unable to take advantage of periods of high prey abundance by increasing growth rates. These results suggest that this species expresses limited plasticity in provisioning behavior and offspring development. Consequently, responses to future changes in sea-surface temperature and other environmental variation may be limited.Behavioral and/or developmental plasticity is crucial for resisting the impacts of environmental stressors. We investigated the plasticity of adult foraging behavior and chick development in an offshore foraging seabird, the black noddy ( Contemporary climate change has led to organisms encountering more extreme and variable environmental conditions Offspring developmental plasticity may also buffer species against environmental variation and extremes Anous minutus). Anecdotal evidence suggests that food available to this species is related to sea-surface temperatures (SST), and that noddies fare poorly during extreme warm water events Therefore, in many long-lived species such as seabirds, it remains unclear how either adult provisioning behavior or chick developmental patterns respond to environmental variation. Here we report the results of a study designed to address this uncertainty by simultaneously evaluating flexibility in adult foraging behavior and chick development in a long-lived species of seabird characterized by a relatively low rate of adult mortality and reproduction, a single-egg clutch, and slow chick maturation, the black noddy , in the Capricorn Section of the GBR Marine Park, Australia, over two consecutive austral summer breeding seasons (2005/06 and 2006/07). Approximately 30,000–70,000 black noddies nest on Heron Island each season Four treatment groups of chicks were exposed to differences in prey availability over the two years; one treatment group was strictly observational and three were experimental and involved supplemental feeding. During the 2005/06 breeding season (December 2005 and January 2006) chick rearing coincided with an anomalous warm-water event and low At least one adult from each study nest was captured by hand and colour-banded for individual identification. Hatching dates of chicks were determined either by checking the status of each nest daily, or estimated from linear regressions of culmen length against chick age In 2005, adult provisioning rates at nests were also assessed during 12-hr nest watches between ∼06:30–18:30 hrs on 20 out of the 26 days on which chicks were weighed and measured. In 2006/07, and based on observations from 2005 that feeding was negligible during the middle of the day, adult provisioning rates were assessed during twice-daily 4–5 hour nest watches during the morning and afternoon (∼06:30–11:00 hrs & 14:30–19:00 hrs) on 26 out of 39 days on which chicks were weighed and measured. Observers were positioned so that all nests (n = 18 in 2005/06 and n = 21 in 2006/07) were monitored simultaneously each day. Frequencies of feeding by individual parents were recorded and chicks were weighed before and after feeding events. Meal sizes were then calculated from changes in chick body mass that were corrected for mass lost through digestion, respiration and excretion between weighings, using equations based on natural rates of mass loss for this species (as per Sardinops neopilchardus), a member of the family Clupeidae and prey of black noddies n = 182) daily by a single meal at 06:00 hrs over a total of 24 days, ranging between the average ages of 5.3±0.3 and 36.3±0.3 days . Chicks in the high food supplementation treatment were fed the equivalent of ∼two-thirds of the total food provisioned by both its parents per day via two supplementary meals provided daily, one at 06:00 hrs and another at 14:00 hrs. The amount of food provisioned by adults increased as chick mass increased. Therefore, in order to supplement food at these predetermined levels, the mass of food to be supplemented was determined from previous measurements of provisioning for that chick. Chicks in the control group in 2006/07 were subjected to the same degree of handling, but received no supplementary food.Chicks in the medium-high and high food treatments in 2006/07 were hand-fed supplemental food consisting of freshly thawed white pilchards .Sea-surface temperature (SST) data were obtained from seven Seabird Temperature Recorders (SBE39) deployed by the Australian Institute of Marine Science (AIMS) within a 7 km radius of the Heron Island lagoon. For each monitoring station, daily average SSTs were computed from the SST measurements recorded every hour at depths from 0.3–1.6 m. Temperature data from each monitoring site were compared with data collected during the same period at each of the other monitoring sites. All temperatures from in situ loggers and more distant SSTs remotely sensed by satellite, local temperature data obtained from loggers were compared with daily average SST data derived from between one or two daily ‘snapshot’ images from an Advanced Very High Resolution Radiometer (Ver. 3) flown onboard a NOAA 18 series satellite in situ loggers were significantly correlated with satellite-derived values averaged for the 50×50 km grid square centred on Heron Island . We used the local in situ SST data in preference to the remotely sensed SSTs in our assessments because in situ data were available for more days of the study as logger data are unaffected by cloud cover.In general, black noddies forage between 15 and 80 km from nesting or roosting islands 10 transformed. Student's t-test, ANOVA and linear regression were used for further analysis where these assumptions were met. Group differences were assessed using Tukey's tests.All data were tested for normality and homogeneity of variance; data that did not conform to these assumptions were logWe used residuals from least squares regressions of mass, and wing and tarsus lengths versus age to test whether growth between 5 and 21 days was linear. Linear growth was assumed where the residuals of such regressions were approximately normally distributed around zero. Similar periods of linear chick growth have been documented in a number of other seabird species Two-way repeated-measures ANOVA was used to test for changes in meal sizes and begging frequency between periods with and without supplementation (2006/07 only). These comparisons were made between treatment groups and supplementation periods. To measure plasticity of adult foraging behavior in daily meal mass provided to chicks and feeding frequency, a single average value for each of these variables was derived for each nest. In this way, independence of the samples was maintained and the effect of flexibility of the pair of adults was sampled. These values were then compared for group differences using one-way ANOVA.In order to assess the response of a parent to an individual chick's condition over time, estimates of a chick's condition at any point should be statistically independent of its condition on other days in the comparison . Time series analysis of estimates of chick condition revealed significant autocorrelation between condition estimates taken at two-, but not four-day intervals in both sampling years. Thus, estimates of chick condition were compared to meal sizes provided by parents at four-day intervals.Results below are presented as averages±1 standard error (SE), unless otherwise stated. All statistical analyses were performed using SPSS for Windows Version 17.0. Work was authorised under Queensland Parks and Wildlife Service Permit WITK02654804, Australian Bird and Band Banding Scheme Authority numbers 1386 and 2665 and James Cook University Ethics Approval A954_04.10 daily feeding frequency , daily SSTs on the southern GBR exceeded long-term averages by 1–1.5°C . ForaginF3,35 = 116.32, P<0.001). The mean number of meals fed to chicks each day over the study period was not the same among the four treatment groups in 2006/07 demonstrated that immediately upon cessation of supplementation, chicks from the supplemented treatment groups were fed daily meal sizes equal in size to that of unsupplemented chicks , with medium-high food supplementation resulting in the fastest mass accumulation .The rate at which chicks increased in mass differed among treatments . The total amount of food brought to chicks each day by their parents was positively related to chick condition with chicks in the normal food treatment being in significantly better condition compared to low food treatment chicks at any given meal size.When the condition of unsupplemented chicks , normal food treatment (2006/07)) was compared against the total amount of food brought to these chicks each day, there were no statistical differences in the slopes of the lines between years breeding on the northern GBR Puffinus pacificus) breeding on the southern GBR This study further supports within-season variation in SST as a robust descriptor of foraging success across a range of tropical seabird taxa During 2005/06 total food delivered to chicks per unit time was lower than in 2006/07 . BreedinThe reduction in total meal sizes brought to chicks each day in the medium-high and high food treatments closely matched the rate at which chicks in the experimental group were artificially supplemented , supportHowever, our results also suggest that feeding rates by parents of this species are not absolutely fixed. During 2005/06, adults fed at higher rates during an interval of slightly higher than normal sea-surface temperature . This inIn both years of this study, body condition and daily meal sizes were positively correlated in naturally fed chicks . Adults In 2006/07, chicks in the medium-high food supplementation treatment accumulated mass at a faster rate than controls . DespiteWhen food availability was low during 2005/06, the rate of structural growth increased despite the poorer condition of chicks . The reaThe chick growth responses to low, normal, medium-high and high prey availability observed here suggest that growth rate reaction norms in black noddy chicks may have resulted from selection imposed by consistently low or highly variable food availability typical of tropical oceans

They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed A major goal of HIV-1 vaccine research is to design novel candidates capable of neutralizing the vast array of viruses circulating in the human population. One approach is to base the vaccine upon the HIV-1 outer surface envelope glycoproteins to generate antibodies. However, during persistent infection in humans, the HIV-1 envelope glycoproteins have evolved structural features that limit the elicitation of broadly neutralizing antibodies. These immune “decoys” divert the antibody response resulting in virus subpopulations that can escape the host response. A potential means by which the virus elicits these decoy responses comes as a by-product of the entry process. Binding of the HIV-1 envelope glycoproteins to the primary receptor, human CD4, induces the formation of a second co-receptor binding site on the envelope glycoproteins, which then binds to another protein required for viral entry. Antibodies to the co-receptor binding site are generally ineffective at neutralizing HIV-1 patient isolates. Here, we demonstrate the mechanism by which antibodies to the HIV-1 co-receptor binding site are elicited in animals and humans injected with HIV-1 envelope glycoproteins and describe the implications of their formation regarding natural HIV-1 infection and vaccine design. The human immunodeficiency virus (HIV-1) exterior envelope glycoprotein, gp120, and the transmembrane glycoprotein, gp41, are non-covalently associated to comprise the trimeric, functional viral spike. These glycoproteins mediate entry and represent the sole virally encoded targets for neutralizing antibodies (nAbs) on the surface of the virus. The HIV-1 envelope glycoproteins, and those from related immunodeficiency viruses, are somewhat unusual in that they mediate target-to-membrane fusion by receptor-triggered conformational changes rather than by low pH-mediated fusion events typified by the influenza virus type 1 viral membrane protein, hemagglutinin (HA) As was previously shown, antibodies against this induced co-receptor binding site are abundantly generated during natural HIV infection As an immunogen, monomeric gp120 does not elicit broadly nAbs in vivo, abundant cell-surface CD4 is a potential source for high-affinity binding of Env, we sought to confirm that the YU2 trimers could bind to CD4-positive cells derived from non-human primates before initiating immunogenicity studies. We co-incubated primate peripheral blood mononuclear cells (PBMCs) with 2 µg/ml, 10 µg/ml or 20 µg/ml gp140-F trimers and stained the cells for CD3, CD4, CD8 and a marker for dead cells. Trimer binding to cell-surface-expressed CD4 was detected with the V3-directed antibody 447-52D on live, CD3+/CD4+/CD8− cells by flow cytometry /FT ytometry . SimilarTo confirm that the highly purified trimers used in this study were competent for recognition by 17b, as well as competent for induction of the CD4i epitope by CD4, we performed both ELISA-based and surface plasmon resonance (SPR) binding assays. First, we incubated 3.2 ng/ml to 10 µg/ml of the YU2 gp140-F trimers in solution, without or with an excess of sCD4, after which gp140-F was captured by 17b on a plate . Consist+ lymphocyte. By this means, we determined that the avidity of the trimers for 17b was nanomolar to subnanomolar regardless if the trimers were in complex or not with CD4 . While this virus is relatively insensitive to antibodies raised against HIV-1 Env it becomes highly sensitive to anti-HIV-1 CD4i-antibodies in the presence of sub-inhibitory concentrations of sCD4, facilitating the specific detection of such antibodies in-vivo presence of CD4 with affinity for the YU2 trimers in the non-human primates. Alternatively, it might be that rabbits lack B cell receptors (BCR) in their naïve repertoire with the ability to recognize the HIV-1 co-receptor binding site while the monkeys possess such a capacity.In stark contrast, CD4i-antibodies could not be detected in the serum from any of the WT rabbits , suggestWhile the HIV-2 assay detects antibodies specific for the co-receptor binding site, we wanted to confirm these results by performing an ELISA based assay where serum from immunized animals were tested for their ability to compete with a biotinylated 17b antibody for binding to gp120. It is known that antibodies not directly directed against the co-receptor site are capable of competing with 17b for binding to gp120 Direct interaction of the trimers with primate CD4 might be expected to expose as well V3, the other element of gp120 involved in co-receptor interaction in vivo presence of primate CD4 allows for BCR recognition of the YU2 gp140-F co-receptor site and subsequent elicitation of CD4-induced antibodies in rabbits. Before initiating the immunogenicity experiment, we confirmed that the huCD4 transgenic animals, ranging from 2 to 5 years of age, still expressed human CD4 on their PBMCs as follows. Incubation of 20 µg/ml gp140-F trimers with PBMCs from WT and huCD4 rabbits and analysis by flow cytometry using species-specific cellular makers in vitro HIV-2 assay. CD4-induced antibodies could be detected in the sera from four out of five huCD4 rabbits after three immunizations with gp140-F trimers formulated with alum were assessed for gp120 binding antibodies by ELISA. All sera exhibited detectable binding titers to the unmatched YU2 gp120 ranging from 5000 to 100,000 endpoint titers (not shown). We assessed the ability of the sera to inhibit the entry of MN and, in the presence of CD4, the HIV-2 virus 7312. As shown in in vitro neutralization against the viruses tested. However, cross neutralization of HIV-2 in presence of sCD4, an assay that is diagnostic for the detection of CD4i antibodies, was observed initially in sera derived from monkeys inoculated with the YU2 trimers but not in WT rabbits. Taken together, these data strongly suggest that Env-CD4 complexes generated in vivo upon inoculation are the source for elicitation of the CD4-induced antibodies following vaccination. This observation was confirmed by the inoculation of Env trimers into rabbits transgenic for human CD4 and the detection of CD4i antibodies in the sera of these animals, in contrast to WT rabbits, revealing conclusively the mechanism of their generation is associated with more rapid viral clearance following SHIV162P3 challenge The induction of co-receptor site directed antibodies in non-human primates and humans is consistent with previous reports that detected the presence of CD4i, co-receptor directed antibodies in gp140-immunized humans , as well as in naturally infected humans in vivo source for presentation of the CD4i region to the humoral immune system is by direct interaction of the trimers with cell-surface CD4 displayed on CD4-expressing T cells or other CD4-positive cells of the hematopoetic lineage. It is also possible that low levels of CD4 are shed from CD4+ cells into interstitial spaces and soluble complexes are formed. Detection of low levels of sCD4 has been previously reported in humans In the present study, the most likely The implications of inducing the co-receptor binding site has been discussed extensively at the level of entry, but less so at the level of antibody elicitation. That the CD4i antibodies are not elicited by trimers in the absence of CD4, even though the gp140-F molecules are well recognized by 17b, and that CD4 induction of the epitope in the trimer context is not a requirement for 17b binding, may seem to be a bit of a paradox. However, we interpret these data to indicate that the conformational fixation imparted by CD4 binding to gp120 is a critical requirement for the naïve, germline B cell repertoire to efficiently recognize the site as opposed to the affinity-matured 17b antibody, which can likely induce the fit of its epitope in the absence of CD4 . After extensive washing with PBS the protein was eluted and captured in the second step via the His-tag by nickel-chelation chromatography. then washed and eluted with a 300 mM Imidazole containing PBS buffer. In some cases the YU2gp140-F trimers were separated from lower molecular weight forms by the third step of gel filtration chromatography using a superdex200 26/60 prep grade column by the ÄKTA Fast protein liquid chromatography system . In contrast, the YU2gp120 and HXBc2 gp120 core proteins were purified by capturing the molecules on an IgG17b affinity column. After extensive washing with PBS, the proteins were eluted from the column with 100 mM glycine/Tris HCl/150 mM NaCl. pH 2.8 and immediately neutralized with Tris base, pH 8.5.2SO4. OD was read at 450 nm.Env protein was co-incubated at concentrations of 0.4 to 46 nM in PBS with 2, 4 or 9 nM sCD4 at room temperature for 1 h, allowing for CD4-Env trimer complexes to form. Non-Env bound sCD4 was captured on a plate pre-adsorbed with 200 ng/well of the anti-CD4 antibody RPA-T4 . RPA-T4 binds to domain 1 of CD4 and competes with HIV-1 gp120 for binding. RPA-T4 bound sCD4 was probed with a biotin-conjugated, non-competitive anti-CD4 antibody, OKT-4 (Ebioscience). Horseradish peroxidase (HRP) conjugated streptavidin (Sigma) followed by the colorimetric peroxide enzyme immunoassay substrate was added to induce a colorimetric change and the reaction was stopped by adding 1 M H2SO4. OD was read at 450 nm. The 17b binding competition assay was performed by coating the ELISA plate with 200 ng/well of lectin from Galanthus nivalis (Sigma), followed by 200 ng/well of HXBc2 core protein. After blocking with 2% fat-free milk, serum was incubated for 45 minutes at dilutions between 25 and 6400 in a total volume of 100 ul after which 25 ul of biotin conjugated 17b antibody was added to a final dilution of 2500 and incubated for an additional 45 minutes. The plate was probed with HRP conjugated streptavidin and developed as above.High-protein-binding MaxiSorp plates (Nunc) plates were coated with 200 ng/well of mAb 17b in 100 µl of PBS at 4°C overnight after which the wells were blocked for 2 h at room temperature (RT) with PBS-2% fat-free milk. The gp140-F trimers, at concentrations between 3.2 ng/ml to 10 µg/ml, were pre-incubated with 20 µg/ml sCD4 for 1 h at RT and then added to the wells. The wells were then probed for 17b bound gp140-F trimer with rabbit anti-gp140-F polyclonal sera. Addition of HRP conjugated anti-rabbit-Ig (Fc region) followed by the colorimetric peroxide enzyme immunoassay substrate was used to induce a colorimetric change and the reaction was stopped by adding 1 M HTo determine the kinetic constants of YU2gp140-F interaction with 17b IgG, we performed binding analysis were in two different formats on a Biacore3000 surface plasmon resonance spectrometer. In one format , YU2gp14To prepare binding surfaces, ligands were immobilized on CM5 chip by the amine coupling method following manufacturer's protocol. One flow cell receiving only NaOAc buffer was used as reference control for correction of background binding. For binding experiments, analytes were serially diluted at concentrations ranging from 4.6 nM to 600 nM in the HEPES-EP reaction buffer. To determine the rate of association, each analyte was allowed to flow over the activated surfaces at a rate of 30 µl/min for 3 minutes. Dissociation was determined by washing off bound analyte for the next 5 min. Likely due to avidity of the oligomeric analytes, especially in +/CD4+/CD8− cells from primates is described in Monkey, human and rabbit PBMCs were analyzed by flow cytometry using a modified LSR I system (BD Biosciences). Data analysis was performed using FlowJo software . Staining and gating strategies to detect YU2 trimer binding to live, CD3Macaca fascicularis) of Chinese origin, 5–6 years old, were housed in the Astrid Fagraeus laboratory at the Swedish Institute for Infectious Disease Control. Housing and care procedures were in compliance with the provisions and general guidelines of the Swedish Animal Welfare Agency. The animals were housed in pairs in 4 m3 cages, enriched to give them possibility to express their physiological and behavioural needs. They were habituated to the housing conditions for more than 6 weeks before the start of the experiment, and subjected to positive reinforcement training in order to reduce the stress associated with experimental procedures. All immunizations and blood sampling were performed under sedation with ketamine 10 mg/kg intramuscularly (i.m.). The macaques were weighed and examined for swelling of lymphnodes and spleen at each immunization or sampling occasion. Before entering the study, all monkeys were confirmed negative for simian immunodeficiency virus (SIV), simian T-cell lymphotropic virus and simian retrovirus type D. Female New Zealand White Rabbits and male huCD4 New Zealand White transgenic rabbits were housed at BioCon, Inc or at an animal facility at the National Institutes of Health according to current regulations. Cynomolgus macaques were injected once with 200 ug followed by three injections with 100 µg YU2gp140-F trimer. Rabbits were injected four times with 50 ug YU2 trimer. All proteins were formulated in the GSK-AS01B adjuvant system prior to injection unless otherwise stated and all injections were administered i.m. at an interval of one month. Sera were collected before the first injection as well as two weeks after each injection. All procedures were approved by the Local Ethical Committee on Animal Experiments.Five female cynomolgus macaques (env-deficient HIV-1 backbone vector (pSG3 Env). For screening, a single dilution of sera or plasma was used and the percent neutralization was calculated compared to controls with no sera added. To determine the dilution of the sera that resulted in a 50% reduction in RLU against selected viruses, serial dilution assays were performed and the neutralization dose-response curves were fit by non-linear regression using a 4-paremeter hill slope equation programmed into JMP statistical software . The results are reported as the serum neutralization ID50, which is the reciprocal value of the serum dilution resulting in a 50% reduction in viral entry. Dana Gabuzda (Dana Farber Cancer Institute) provided the Env plasmid for YU2. Env plasmids for SF162 and JRFL were provided by Leonidas Stamatatos and James Binley (Torrey Pines Institute), respectively. The Clade A Env-pseudovirus DJ263.8 was cloned from the original PBMC derived virus provided by Francine McCutchan and Vicky Polonis (U.S. Military HIV Research Program). Env plasmids BaL.01 was recently described by our laboratory Analysis for HIV-1 and HIV-2 neutralization in serum samples were performed as previously described MN or HIV-1GNE8 derived gp120 in Alum adjuvant Twenty randomly chosen serum samples were obtained via an MTA with the Global Solutions for Infectious Diseases. These sera were derived from volunteers from the VaxGen Inc phase III clinical trial. At the time of sampling (month 12.5) the participants had received four injections with the AIDSVAX B/B vaccine containing 300 ug each of recombinant HIV-1Figure S1Biochemical analysis of the YU2 gp140-F trimers.(3.17 MB TIF)Click here for additional data file.Figure S2FACS gating strategy for cynomolgus macaque and human PBMCs.(2.29 MB TIF)Click here for additional data file.Figure S37312/V434M (+9 nM sCD4) and HIV-1MN neutralization by sera from monkeys immunized 2 times with gp140-F trimers formulated in the GSK Adjuvant System AS01B or in Ribi adjuvant.HIV-2(1.12 MB TIF)Click here for additional data file.Figure S4V3 peptide or gp120 binding reactivity in serum samples from cynomolgus macaques, WT rabbits or huCD4 rabbits after immunization with gp140-F trimers.(2.12 MB TIF)Click here for additional data file.Figure S5Staining and gating strategy for flow cytometry analysis of rabbit PBMCs.(2.12 MB TIF)Click here for additional data file.

Background and purpose Many investigations on biodegradable materials acting as an antibiotic carrier for local drug delivery are based on poly(lactide). However, the use of poly(lactide) implants in bone has been disputed because of poor bone regeneration at the site of implantation. Poly(trimethylene carbonate) (PTMC) is an enzymatically degradable polymer that does not produce acidic degradation products. We explored the suitability of PTMC as an antibiotic releasing polymer for the local treatment of osteomyelitis.Methods This study addressed 2 separate attributes of PTMC: (1) the release kinetics of gentamicin-loaded PTMC and (2) its behavior in inhibiting biofilm formation. Both of these characteristics were compared with those of commercially available gentamicin-loaded poly(methylmethacrylate) (PMMA) beads, which are commonly used in the local treatment of osteomyelitis.Results In a lipase solution that mimics the in vivo situation, PTMC discs with gentamicin incorporated were degraded by surface erosion and released 60% of the gentamicin within 14 days. This is similar to the gentamicin release from clinically used PMMA beads. Moreover, biofilm formation by Staphylococcus aureus was inhibited by approximately 80% over at least 14 days in the presence of gentamicin-loaded PTMC discs. This is similar to the effect of gentamicin-loaded PMMA beads. In the absence of the lipase, surface erosion of PTMC discs did not occur and gentamicin release and biofilm inhibition were limited.Interpretation Since gentamicin-loaded PTMC discs show antibiotic release characteristics and biofilm inhibition characteristics similar to those of gentamicin-loaded PMMA beads, PTMC appears to be a promising biodegradable carrier in the local treatment of osteomyelitis. Osteomyelitis is characterized by progressive inflammatory bone destruction . In geneSustained high local antibiotic concentrations are currently achieved by the implantation of gentamicin-loaded poly(methylmethacrylate) (PMMA) beads. Although these beads have been used to treat osteomyelitis for many years , their mCurrently, the biodegradable carrier materials most often investigated have been based on poly(lactide) (PLA) and/or poly(glycolide) (PGA) . BiodegrThe use of PLA and PGA implants has been disputed . An impoOne possible candidate material is poly(trimethylene carbonate) (PTMC), a biodegradable polymer that is relatively new in biomedical applications.In contrast to PLA/PGA, the degradation products of PTMC are not acidic . InteresThe objective of this in vitro study was to explore the suitability of PTMC as a biodegradable, antibiotic-releasing carrier, and to compare it with commercially available gentamicin-loaded PMMA beads. The study investigated 2 related issues regarding gentamicin-loaded PTMC: (1) the release kinetics and (2) its ability to inhibit biofilm formation.Polymer-grade 1,3-trimethylene carbonate (TMC) was purchased from Boehringer Ingelheim . Gentamicin sulfate was purchased from Sigma-Aldrich , and analytical-grade chloroform and diethyl ether were purchased from Merck BV . A lipase solution from Thermomyces lanuginosus was purchased from Sigma-Aldrich and used as received. Antibiotic-loaded poly(methylmethacrylate) (PMMA) beads are commercially available under the name Septopal . Each Septopal bead (diameter: 7 mm) contains 7.5 mg of gentamicin sulfate (corresponding to 4.5 mg of gentamicin base). Staphylococcus aureus 0734 is one of the most commonly involved bacterial strains in osteomyelitis and was High-molecular-weight PTMC (Mn = 388 × 103 g/mol) was synthesized, purified, and characterized as previously described . 2 solutPTMC precipitates with and without gentamicin were compression-molded at 50°C into films of 500 μm thickness using a laboratory press. Finally, discs with a diameter of 5 mm were punched out of the films.The surface erosion of gentamicin-loaded PTMC was visualized using SEM. A series of SEM micrographs of PTMC discs were taken after immersion in phosphate-buffered saline (PBS), pH 7.0, or in the lipase solution. After 3, 7, and 10 days, discs were taken out of the solutions for SEM evaluation. Discs were sputter-coated with gold/palladium and examined at 2.0 kV in a JEOL field emission scanning electron microscope type 6301F.Gentamicin release was determined at 37°C in PBS (in the absence of lipase) and in a lipase solution, which induces surface erosion of PTMC . 3 gentaGentamicin concentrations were measured using a procedure described by Gentamicin concentrations in lipase solutions could not be determined spectrophotometrically due to interference of the enzyme. An indirect bacterial inhibition assay, described and validated by The extent to which the released amount of antibiotics inhibits the formation of a biofilm is an index of the efficacy of the antibiotic-loaded carrier. To study biofilm formation, 2 types of bacterial growth media were prepared: TSB and a 4:1 mixture of TSB and lipase solution to allow enzymatic degradation of PTMC. 3 non-loaded PTMC discs and 3 gentamicin-loaded PTMC discs were immersed in 10 mL TSB or 10 mL TSB/lipase medium for 2 weeks at 37°C. In addition, 3 gentamicin-loaded PMMA beads were immersed in 10 mL of TSB. Medium was collected and replaced with new medium after 24, 48, 72, 144, 168, 312, and 336 h to obtain samples containing the antibiotic released during the first, second, third, seventh, and fourteenth day.S. aureus biofilms in 96-well plates under stationary conditions. 2 μL of bacterial inoculum (approximately 1 × 106 CFU/μL) was added to wells containing 198 μL of TSB. After 24 h of incubation at 37°C, the medium was removed and the plates were washed 3 times with 220 μL of PBS. Subsequently, each well was stained with 200 μL of 1% (w/v) crystal violet in water for 30 min. After staining, the plates were gently rinsed 3 times with demineralized water. Quantitative analysis of biofilm formation was performed by adding 200 μL of ethanol/acetone (80:20) to solubilize the crystal violet. The absorbance of this crystal violet solution was measured using a FLUOstar Optima plate reader at a wavelength of 575 nm. The absorbance (A) is proportional to the amount of crystal violet, which is directly proportional to the amount of biofilm grown in each well.These elution media were used for the formation of The maximal amount of biofilm formation was defined as the amount grown in elution media collected from non-loaded PTMC discs, and the percentage of biofilm inhibition was calculated according to the following equation:For gentamicin-loaded PMMA beads, the maximal amount of biofilm formation was defined as the amount grown in freshly inoculated TSB medium, as non-loaded PMMA beads are not commercially available. All experiments included 6 replicate wells and were performed in triplicate with separately cultured bacteria.In evaluating gentamicin release characteristics and inhibition of biofilm formation, Student's t-test for independent samples was used. A 95% confidence interval was applied for statistical significance.The surface topographies of PTMC immersed for 3, 7, or 10 days in PBS and in lipase solution were visualized with SEM. Examples of micrographs after immersion for 7 days are shown in The cumulative release of gentamicin from PTMC discs in PBS, PTMC discs in lipase solution, and PMMA beads in PBS is shown graphically in The biofilm inhibition after 24 h in growth medium containing gentamicin released from gentamicin-loaded PTMC discs and PMMA beads during the first, second, third, seventh, and fourteenth day is graphically presented in The inhibition obtained from gentamicin-loaded PTMC discs incubated in lipase-containing growth medium was, however, better than that obtained with similar discs incubated in growth medium only (p < 0.05). After surface erosion in the lipase enzyme solution, gentamicin-loaded PTMC showed continuous, effective inhibition of biofilm formation similar Gentamicin-loaded PMMA beads constitute an effective drug delivery system for local antibiotic therapy in bone infections. However, after high initial gentamicin concentrations at the site of the infection, the gentamicin concentrations drop considerably . The maiPTMC is such a surface-eroding polymer. It is an aliphatic polycarbonate, and upon degradation of the carbonate linkages by hydrolysis, carbon dioxide and 1,3-propanediol will be formed. Thus, PTMC degrades without the formation of acidic degradation products and has good compatibility with bone tissue. Subcutaneous implantation of PTMC discs in rats showed a mild-to-moderate tissue reaction around the implant . Within PTMC degrades very slowly by hydrolysis in vitro: the polymer is stable in water and in buffered solutions . HoweverInterestingly, the degradation of PTMC showed characteristics of a surface erosion process—as the loss of mass could be correlated to the decrease in thickness of the specimen, and the decrease in molecular weight was limited . This inA crucial point in the treatment of chronic osteomyelitis is the handling of the dead space and gentamicin-loaded PMMA beads can be used to treat the dead space problem. In addition to providing local delivery of antibiotics, these beads will fill the dead space. After the infection is cured, the beads can be removed and the dead space can be filled either with a bone graft or a muscle flap. A specific dead space problem is related to two-stage revision of infected joint prostheses. In these cases, PMMA beads have been used to fill the dead space, i.e. to facilitate the implantation of a new prosthesis. In the examples above, the surgeon uses PMMA beads as non-biodegradable carriers of antibiotics. Accordingly, the use of biodegradable carriers is confined to cases where the dead space problem is considered to be small.The aim of our study was to explore the suitability of biodegradable antibiotic-loaded PTMC discs in the local treatment of osteomyelitis, especially for cases where the volume of dead space is low. In buffer, PTMC released only small amounts of antibiotics during the first 2 weeks, but in a lipase solution (where PTMC degrades by surface erosion), this was accompanied by a high rate of release of antibiotics similar to that observed for non-biodegradable Septopal beads made from PMMA. In line with this, gentamicin-loaded PTMC showed less inhibition of biofilm formation for 2 weeks under non-surface eroding conditions in buffer than under surface-eroding conditions in lipase solution. Moreover, the inhibitory effect of gentamicin-loaded PTMC in the lipase enzyme solution was similar to that of clinically used Septopal beads. This indicates that under conditions that favor surface degradation of the PTMC discs, the polymer could be a suitable biodegradable carrier of antibiotics in the treatment of osteomyelitis. It should be emphasized, however, that a strict comparison of the antibiotic release behavior of Septopal beads and of our PTMC specimens is not possible due to their different geometries, masses, and degrees of gentamicin loading.In this study, macroscopic examination showed that the PTMC discs were completely resorbed within 2 weeks upon immersion in the lipase solution. As PTMC degrades by a surface erosion process, it is possible to extend the degradation time by increasing the thickness of the specimens and by reducing the surface-to-volume ratio. It has also been shown that reducing the initial molecular weight of PTMC polymer has the effect of reducing the rate of degradation . After iA next step would be to initiate animal experiments to confirm the release characteristics and antimicrobial efficacy of gentamicin-loaded PTMC discs as seen in this study. Animal experiments should also be carried out to study the long-term effects of gentamicin-loaded PTMC implants on the regeneration of bone. This is necessary to ensure that PTMC is safe during its degradation in bone, and that it can be used as a drug delivery device in orthopedic applications.In summary, gentamicin-loaded PTMC discs degrading in lipase solution showed antibiotic release kinetics and biofilm inhibition properties that are comparable to those of non-biodegradable gentamicin-loaded PMMA beads. The use of antibiotic-loaded PTMC discs does not require a second surgery for the removal of the beads after therapy; therefore, PTMC-based materials appear to be promising alternative antibiotic carriers for the local treatment of osteomyelitis.

We are all connected to life. Every choice we make and every belief we hold exerts influence upon the whole of life. And we live with the consequences of our choice. As part of our biological health, this unique truth has physical expressions in honor, loyalty, family and group bonds. Probably this forms the basis of marriage, one of the most vital and powerful of our relationships. The human population has seen modern civilization and is still within family boundaries. One such familial-social bond in consanguineous marriage.The word consanguineous comes from the two Latin words “con” meaning shared and “sanguis” meaning blood. Consanguinity describes a relationship between two people who share an ancestor, or share blood. Such marriages are favoured by different populations usually bound to traditional customs, beliefs and to keep property in united form within the family. In Arab Muslim communities, first cousin unions between a man and his father's brother's daughter are preferred. However, in population of Dravidian Hindus of South India, marriage of a boy with his mother's brother's daughter, is opposed. But, uncle-niece unions (but not aunt-nephew) are permitted in Judaism. Many studies indicated that consanguineous marriages are strongly favoured in human populations. The highest consanguineous marriages (20% to over 50%) are reported in North of Africa, Asia etc, usually associated with low socioeconomic status, illiteracy, and rural residence.2 In IndiConsanguineous marriages are major responsible risk factors for Bipolar disorders. This marriage system has been reported as an important factor in the appearance of autosomal recessive diseases and congenital anomalies, including hydrocephalus, postaxial hand polydactyly and bilateral cleft lip cleft palate, bipolar disorders, depression, dysferlinopathy, reproductive disorders, sterility, infant mortality, child deaths, spontaneous abortions and stillbirths etc. Also there are reports indicating positive association between consanguinity and Down syndrome, and also ventricular septal defect (VSD), atrial septal defect (ASD), atrioventricular septal defect (AVSD), pulmonary stenosis (PS) and pulmonary atresia (PA). The risk for birth defects in the offspring of first cousin matings has been increased to 5-8% compared to 2-3% in non-consanguineous marriages.[et al,[Recently Nalini and Gayathri reportedet al, reportedRedefining conventional medical ethics in the light of new moral issues arising out of advances in medical science and technology has resulted in the emergence of Applied Ethics.Genetic counseling is the process by which clients or their relatives, at risk of an inherited disorder, are advised of the consequences and nature of the disorder, the probabilities of developing or transmitting it, and the choices open to them in management and planning of their families, in an attempt to prevent, avoid or ameliorate the disorder. This has preventive, diagnostic, therapeutic and supportive value. Genetic counselors function as members of health care team and act as patient advocates, protecting their best interests in addition to working as a genetic resource to physicians. Genetic counselors provide useful information and support to families who may be at risk of an array of inherited disorders. They are involved in identification of families at risk, investigation of problems presented by the family, interpretation of information about the disorder, analysis of inheritance patterns and evaluation of risks of recurrence while reviewing testing options available to the family.It is important to look for inborn errors of metabolism in children of consanguineous parents, since many of these conditions are inherited in an autosomal recessive manner. While individually sparse, collectively they represent a significant burden of disease. Nevertheless, a ray of hope here is, some conditions are treatable if diagnosed at an early stage. Consanguineous couples with a child having an undiagnosed medical condition are at a risk of higher chance than their unrelated counterparts, of future children being affected, due to the possibility of an unrecognized autosomal recessive condition.When an abnormality or illness is identified in a child of a consanguineous couple, it is imperative that investigations and referrals should proceed in a systematic way, as clinically indicated for the presenting symptoms but with an emphasis on autosomal recessive conditions in the diagnosis. Nevertheless, it is important to remember that autosomal recessive conditions can arise by chance, with the child having two different mutations, not necessarily because of consanguineous marriage alone. This can go a long way in eliminating shame and guilt in the parents, that, somehow they were responsible for the condition of their child or in erasing the misconception that they are being punished by God for their sin of marrying within the close family.Apart from autosomal recessive conditions leading to learning difficulties, consanguinity has not been reported to have any significant effect on intelligence.Presence of family history of possible autosomal recessive condition may considerably increase the risk of offspring over the background risks of consanguinity. In such cases, the consanguineous couple can be tested for their carrier status and prenatal diagnosis when necessary. When the diagnosis or mutation is not known, investigation of an affected relative may provide valuable clues. If this is not possible, an estimation of risks involved and detailed, systematic fetal scans are the only choice open. However, this may leave many couples disconcerted at the residual uncertainty.In the case of death of the affected child, or termination of affected pregnancy, a postmortem exam may throw light on the causal factors. This presents the best chance under the circumstances to make the diagnosis and identify the causal mutation. While being distressful to the grieving parents, this examination may reveal information that may enable their doctors to predict the health status of the next child/children. It is important to remember that, it could be extremely frustrating for a couple if, in a future pregnancy, the lack of relevant genetic information about their first child makes it impossible to provide accurate advice and testing.The general risk for any couple of begetting a child with a serious or lethal medical condition is around 2%. The higher risk for a couple who are related as first cousins, in the absence of a known genetic disease in the family, is 3%. This statistical estimation often comes as a relief for the genetic counselees who anticipate a significantly higher figure. This is one of the benefits of research in this field that provides authentic data based on which probabilities, close to reality could be predicted. The higher risk comes as a consequence of autosomal recessive conditions stemming from homozygosity by descent. In other words, it is the risk of a recessive mutation present in an ancestor being passed down two branches of the family and coming together in the consanginous marriage. It is assumed that all of us carry at least one mutated allele that would lead to an autosomal recessive condition if present in two copies (homozygosity). In case this mutant allele is inherited by both members of a consanguineous marriage from a common ancestor, they both will be carriers for this condition. Hence they will have a one in four chance of begetting an affected offspring.The possibility of both parents being carriers for a recessive condition is influenced by how closely they are related. This means that the offspring risk can be minimized while retaining the social and familial advantages of consanguinity, if weddings are consummated between distant relatives (third cousins rather than second cousins or second cousins rather than first cousins).An interesting angle is lent to this scenario by “Astrology”, an ancient practice prevalent in many communities the world over, especially in India. “Horoscope matching” to check “Marital compatibility” of the boy and girl before wedding, which is religiously and meticulously followed by elders on both the sides, may be viewed as an intelligent form of “Premarital consultation / counseling”.Genetic counseling yields best results when done premaritally or at least prior to conception. A non-judgmental attitude towards consanginous couples is essential on the part of the counselor, to establish good communication channels and to foster effective working relationships between the medical profession and communities where consanguineous marriages are prevalent.Refer well before conception occurs especially if they have a family history of a possible autosomal recessive condition.Remember to empathize and not to imply that a child's condition is the parents' fault, even if the couple are consanginous and the child has two identical copies of a mutant gene. Nobody chooses to deliberately pass on an illness to their offspring and no one is to blame.Ensure that the couple referred for premarital genetic counseling are made aware that there are no blood tests available that provide “General Genetic Compatibility” data. They need to be informed that some few basic carrier tests are there for a limited range of specific conditions.Adopt a non-judgmental attitude with a positive mindset to disseminate knowledge and information to the couple, empowering them with the various options available, enabling them to make intelligent decisions.Deal with the issue in a sensitive, caring and sensible manner.Some useful tips in counseling consanguineous couples:The young age of marriage in consanguineous couples further implicates a need to increase awareness programs among the young generation about the deleterious effects of consanguineous marriages. It is clear that the social benefits derived from such marriages are of paramount importance to consanguineous couples; however, the availability of preventive measures should be emphasized. Further genetic investigation conducted in this area to elucidate the mode of inheritance is required.India needs to take a big leap in this direction with consanguineous marriages being more prevalent. The need of the hour is setting up infrastructure with basic research and good medical facilities with genetic testing and counselling. Many hospitals in our country lack genetic testing facilities with few well trained genetic counsellors to handle the situation. Adopting better translational research concept and intervention strategies help consanguineous couples reach informed and intelligent reproductive decisions, with which they have to live throughout their lives.

Background/Purpose. Kimura's diamond-shaped-duodenoduodenostomy (DSD) is a known technique for the correction of congenital intrinsic duodenal obstruction. We present a modification of the technique and review the advantages of this new technique. Methods. From 1992 to 2006, 14 newborns were treated for duodenal atresia. We inverted the direction of the duodenal incisions: a longitudinal incision was made in the proximal duodenum while the distal was opened by transverse incision. Results. Our “inverted-diamond-shaped-duodenoduodenostomy” (i-DSD) allowed postoperative oral feeding to start on days 2 to 3, peripheral intravenous fluids discontinuity on days 3 to 8 ; time to achieve full oral feeds on days 8 to 12 ; the length of hospitalisation ranged from 10 and 14 days . No complications related to the anastomosis, by Viz leakage, dehiscence, biliary stasis, or stenosis were observed. Conclusions. The i-DSD provides a safe procedure to protect the ampulla of Vater from injury and avoids any formation of a blind loop. The results show that patients who have i-DSD achieve full oral feeds in a very short time period and, consequently, the length of hospitalisation is also significantly reduced. KIMURA, in 1977, introduced an anastomotic technique of side-to-side duodenoduodenostomy in two layers, arranging the bowel incisions to form a “diamond-shaped” (DSD) and created a larger stoma. In 1990, he refined his technique based on a transverse incision in the distal end of the proximal duodenum and a longitudinal incision in the distal duodenum. The double layer anastomosis was completed using 5–0 or 6–0 catgut or Vicryl continous inner and 6–0 silk interrupted outer layer sutures. No gastrostomy or transanastomotic tube was used. By this technique the anastomosis recovered its function in a significantly shorter time period and early postoperative feeding could be started. For the surgical treatment of congenital intrinsic duodenal obstruction In the same year, we adopted this new technique in 2 cases . In 1992, we modified the original Kimura's procedure in an inverted diamond-shaped duodenoduodenostomy (i-DSD). We present the technical points of the modification to the procedure and review the early advantages and the long-term bowel function in these patients.with atresia of the second portion of the duodenum (DA). Maternal polydramnios was present in 9/14 (64.3%), and prenatal ultrasonography scan diagnosis of duodenal obstruction was available in 12/14 (85.7%). Eleven associated anomalies were found in 8 patients. Patients with associated anomalies which might affect oral feeding have been excluded from the survey, so that the number of variables that might affect the outcome are reduced to a minimum. .From 1992 to 2006, 14 consecutives newborns were treated for total congenital intrinsic duodenal obstruction . The meahepatic flexure of the colon was mobilized by reflecting it downwards to expose the dilated duodenum. The duodenum was then adequately mobilized by Kocher's manoeuvre. A soft rubber tube was inserted either by orogastric or gastrostomy and advanced into the duodenum to assess the level and nature of obstruction. The redundant wall of the proximal duodenum was brought down to overlie the proximal portion of the distal duodenal segment. If this could not be done easily, more megaduodenum was mobilised . The ligament of Treitz was divided in two cases, for more mobilization of the distal duodenum. After proper preparation by nasogastric decompression and fluid and by electrolyte replacement the operation was carried out, under general endotracheal anesthesia, through a right transverse upper abdominal incision. The abdominal muscles were divided transversely with cutting diathermy and the peritoneal cavity was opened in the line of incision. The longitudinal incision was made on the proximal dilated duodenum until the end of the blind pouch . After compression of the gallbladder, the papilla of Vater was localized by observing bile flow.The distal duodenum was opened by transverse incision at its top (or just close to annular pancreas). A mixture of air and saline was injected into the distal bowel lumen to rule out a distal obstruction. The distal duodenum was easily distended to a larger size during this manoeuvre by occluding the proximal jejunum and to withdrawing the filled (5 mL) Foley's balloon (Wangeesten's manoeuvre). The “inverted” anastomosis (i-DSD) was accomplished in a single layer with interrupted 5–0 or 6–0 Vicryl sutures in an inverting fashion. In the first 2 patients, we used 5–0 silk sutures. It started on the posterior duodenal wall by approximating the distal corner of the proximal longitudinal incision with the posterior midpoint of the distal tranverse incision. Then, each midpoint of the longitudinal incision was joined with the corresponding corner of the distal incision. The posterior wall was completed with intermediate stitches. At last, the anterior wall of the anastomosis was performed by approximating the uppermost corner of the longitudinal incision with the anterior midpoint of the distal incision and completed by intermediate stiches on each side. Neither duodenal tapering or transanastomotic tube or gastrostomy was used. Reconstruction of the abdominal wall was performed in layers using 4–0 Dexon sutures. The skin was closed with continous intradermic suture using 5–0 Dexon. We modified the Kimura's procedure by inverIn the immediate postoperative period the stomach was continuously emptied by gravity drainage via a nasogastric tube; when the gastric residual was less than 20 mL by passive drainage oral feeding was started with 30 mL of regular formula, which was progressiveley increased as tolerated, with concurrent scaling down of the intravenous feeding.In the present study 4 patients with associated anomalies have been excluded from the survey. One patient died in the postoperative period due to associated cardiac anomaly. We analysed the most important parameters for the postoperative evaluation as day of starting of oral feeding, time to achieve full feeds, day of discontinuation of intravenous fluid, complications if any, and length of hospitalisation . In the postoperative period the gastric residual usually stopped on day 1 to 2. All of the nine patients with i-DSD started oral feeding on days 2 to 3 (mean 2.1). The volume and concentration of the feeding were progressively increased, and full alimentation was achieved on days 8 to 12 (mean 9.4). On day 3 to 8, peripheral intravenous fluids were discontinued. We never used total parenteral nutrition (TPN). The patients did not show complications related to the duodenal anastomosis as leakage, dehiscence, spillage or stenosis, blind loop, and biliary stasis. The lenght of hospitalisation ranged from 10 to 14 days (mean 11.2). In the late follow-up a detailed history of morbidity and growth development were taken in addition to performance of clinical examination. All patients were followed in accordance to a protocol evaluating the esophageal function, the form of and the mucosal patterns of the stomach and duodenum, gastroesophageal and duodenogastric reflux, the model and speed of emptying of the stomach and the duodenum, by using x-ray series and ultrasonographic study, gastroesophageal pH-metry and duodenogastric manometry. The patients were free from gastrointestinal symptoms with growth development and body weight in normal range for age. Upper gastrointestinal contrast study showed passage of contrast material through the duodenal stoma. Duodenal diameter was found to show some decrease in size postoperatively and a trend towards normalisation over time. Abnormal morphology of the duodenum at the anastomosis persisted, without clinical discomfort, in 4 patients 4-5 aged years. In the oldest children this anatomical discrepancy progressively decreased to a size consistent with the age. In all patients ultrasound showed normal transit time. Gastroesophageal pH-metry showed absence of duodenogastric reflux and presence of gastroesophageal reflux in 1 case (12 months aged). The duodenal manometry did not show a reduced or absent contractile activity in the distal duodenum; in 2 patients we founded reduced contractile activity in the preanastomotic duodenal segment.Congenital intrinsic duodenal obstruction may be caused by duodenal atresia, stenosis, membrane, or web and most frequently occurs in the second part of the duodenum at or below the ampulla of Vater. In the past, the transmesolic side-to-side duodenojejunostomy was the generally accepted procedure for the surgical treatment of the congenital intrinsic duodenal obstructions in the neonate . Mortali The direct duodenoduodenostomy achieved good results , 5. Neve. Barium studies in his series showed less deformed configuration of the duodenum [In 1977 Kimura performeduodenum . The supduodenum . Our technique is very similar to Kimura's DSD, except for the followed technically important changes.The longitudinal incision on the proximal duodenum is very far from the outlet of the ampulla; it represents a safer procedure to protect the ampulla of Vater from injury; furthermore, the longitudinal incision until the end of the blind pouch removes any obstacle to duodenal transit and, thus, avoids formation of a blind loop. The same type of incision can be prolonged proximally in case of total or extramucosal plication duodenoplasty or prolonged on the distal duodenum and can represent the only step of the duodenotomy for duodenal web or membrane excision . for inspection, irrigation, and dilatation of distal bowel enlarge its size and stimulate postoperative bowel motility and early recovery of bowel function [The transverse incision on the distal duodenum is sufficient for a large stoma because the manoeuvres function .The single layer interrupted sutures anastomosis gives best blood circulation of the local tissues. The greatest advantage is to avoid any obstacle (blind loop) to the intestinal transit and thus to achieve earlier recovery of anastomotic function and significantly less time to achieve full preanastomotic feeds (1-2 days) and shorter duration of hospital stay. All of the children have been followed to the present time, and so far none of them has experienced any problem related to our modified operative technique. The absence of anastomotic problems played a significant role to achieve the good result reported in this series. Kimura found very low rate of complications and good long-term results . In the In our series abnormal duodenal morphology persisted in half of patients for 4-5 years; in the oldest children this discrepancy decreased progressively, suggesting that, in accordance with Kimura's experience, the DSD preserves a more natural anatomical configuration to the reconstructed duodenum. For this reason the tapering by excising a portion of the redundant wall of the proximal dilated duodenum increases the risk bowel spillage and damage the bile duct . In conclusion, we believe that the “inverted diamond-shaped anastomosis” (i-DSD) can be applied to all types of intrinsic duodenal obstructions and achieves very satisfactory result. The shorter time of hospitalisation also provides an evident benefit on the hospital cost.

The disappearance rate (k) of i.v. glucose was measured in cachectic and non-cachectic cancer patients and tumour-free controls. The respective k values were found to be 1.06 +/- 0.27 (mean +/- s.d.), 1.64 +/- 0.34 and 1.63 +/- 0.23. Of the other parameters measured, only plasma albumin level was found to vary significantly amongst the 3 categories, the mean level being the lowest in cachectic cancer patients. The means of total plasma protein, fasting blood glucose and plasma liver enzyme concentrations were similar in the 3 groups. Glucagon, a potent insulin secretogogue, failed to augment the fasting insulin level in cachectic but did so in non-cachectic cancer patients. Taken together, the findings suggest that the reduced glucose tolerance in patients with neoplasia is due to impairment of insulin release exhibited predominantly by ill-nourished advanced cancer patients having a moderate to sever degree of hypoalbuminemia.

The dihedral angle between the eight-membered plane containing the malononitrile group and the aromatic system is 25.88 (4)°. The distance from the central C atom of the malononitrile group to the centroid of the n-glide-related distal aromatic ring is 3.66 Å, suggesting π–π inter­actions.In the title complex, C Å b = 16.190 (3) Å c = 10.4570 (13) Å β = 93.016 (7)°V = 1250.9 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.08 mmT = 293 K 0.5 × 0.2 × 0.2 mm Bruker P4 diffractometerAbsorption correction: none4319 measured reflections3151 independent reflectionsI > 2σ(I)1297 reflections with R int = 0.044 3 standard reflections every 97 reflections intensity decay: none R[F 2 > 2σ(F 2)] = 0.072 wR(F 2) = 0.176 S = 0.98 3151 reflections173 parametersH-atom parameters constrainedmax = 0.22 e Å−3 Δρmin = −0.21 e Å−3 Δρ XSCANS used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809023988/pv2168sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809023988/pv2168Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Strongylocentrotus droebachiensis), within and among spawnings of an individual, among individuals within a population, and among populations. We also examined population-level variation between two reproductive seasons for one population. We then compared among-population quantitative genetic divergence (QST) for sperm characters to divergence at neutral microsatellite markers (FST).Sperm morphology can be highly variable among species, but less is known about patterns of population differentiation within species. Most studies of sperm morphometric variation are done in species with internal fertilization, where sexual selection can be mediated by complex mating behavior and the environment of the female reproductive tract. Far less is known about patterns of sperm evolution in broadcast spawners, where reproductive dynamics are largely carried out at the gametic level. We investigated variation in sperm morphology of a broadcast spawner, the green sea urchin (QST-FST comparison.All sperm traits except total length showed strong patterns of high diversity among populations, as did overall sperm morphology quantified using multivariate analysis. We also found significant differences in almost all traits among individuals in all populations. Head length, axoneme length, and total length had high within-male repeatability across multiple spawnings. Only sperm head width had significant within-population variation across two reproductive seasons. We found signatures of directional selection on head length and head width, with strong selection possibly acting on head length between the Pacific and West Atlantic populations. We also discuss the strengths and limitations of the S. droebachiensis is highly variable, both among populations and among individuals within populations, and has low variation within an individual across multiple spawnings. Selective pressures acting among populations may differ from those acting within, with directional selection implicated in driving divergence among populations and balancing selection as a possible mechanism for producing variability among males. Sexual selection in broadcast spawners may be mediated by different processes from those acting on internal fertilizers. Selective divergence in sperm head length among populations is associated with ecological differences among populations that may play a large role in mediating sexual selection in this broadcast spawner.Sperm morphology in Spermatozoa are the most morphologically diverse cells, yet they all have the same basic function: to fertilize an egg. Variation in sperm shape among species can often be attributed to sexual selection mediated by sperm competition -8 , by examining variation in five sperm morphometrics within and among Pacific, West Atlantic and East Atlantic populations. We also assess the stability of sperm parameters over time within an individual across multiple spawnings and within a population across two reproductive seasons.A basic question is whether sperm morphology of a broadcast spawner varies substantially among males, as has been found in both internal and other external fertilizers ,11. AddiQST) with a neutral expectation of differentiation under genetic drift, estimated by divergence at neutral microsatellite loci . If sperm traits are under directional selection for different optima among populations, quantitative trait divergence should be higher than expected under neutrality (QST > FST). Finally, if sperm traits are evolving under homogenizing selection, population means should be more similar than expected under neutrality (QST <FST), though this conclusion is much more difficult to obtain with confidence. QST-FST analysis has been applied in a wide range of taxa to address diverse questions in evolutionary biology, e.g., [In order to determine if selection is driving population-level divergence in sperm morphology, we compare quantitative genetic divergence in sperm traits (oci FST -46). The. TheQST)dictions . If spery, e.g., -49.Here, we show that sperm traits have diverged strongly among populations as well as among individuals within populations. At the same time, sperm morphology exhibits low variation within individual males across multiple spawnings. We detect directional selection on sperm traits for different population means, especially in sperm head length between the Pacific and West Atlantic populations. Patterns of pairwise divergence among populations suggests that ecological variables may be playing a large role in sperm evolution of this broadcast spawner.QST for each trait.We tested sperm from multiple spawnings of males held in culture in 2006 and 2007. Among 15 males measured every two weeks two to five times (average = 3), head length, axoneme length and total length did not differ significantly among spawning events Table . HoweverF = 8.92; P < 0.0001). CV of head length among males within a population showed a clinal pattern with lowest among-male variability in the Pacific and highest in the East Atlantic. In all other traits, the West Atlantic had the highest variability among males, with the lowest in Norway. Head width was an exception, with the lowest variability among males in the Pacific. In general, patterns of variability within and among individuals were comparable for all traits and all populations, but midpiece area in the East Atlantic was an order of magnitude more variable within males than among males. In fact, midpiece area in all populations was much more variable than the other traits, with CV's within males of 47.8 in the Pacific, 62.1 in the West Atlantic and 31.7 in the East Atlantic. Among-male CV's for midpiece area were 33.1 in the Pacific, 42.5 in the West Atlantic, and 5.6 in the East Atlantic.Within-male variability in sperm morphometry as measured by within-male CV did not differ for the three populations for any trait except head width . Significant correlations among males were also found between head length and width , head length and axoneme length , axoneme length and total length , and head width and midpiece area , including head length, head width, axoneme length and midpiece area . CAN1 accounted for 75.7% of the variation and had highest raw canonical coefficients for head length, axoneme length, and total length [Evolutionary processes responsible for the observed sperm morphological variation among males may be illuminated by examining similar patterns in other male reproductive traits. In particular, the gamete recognition protein bindin shows strong differences between species as well as between some populations (-68 but aiscanus) ,70, and iscanus) . If balaS. droebachiensis. Determination that intraspecific variation is under selection will require further comparisons with other species that occur at higher abundances and an understanding of the dynamics of sperm precedence in males with different sperm head sizes.Alternatively, sperm morphological traits may be evolving neutrally among males within populations of FST was 0.159, with pairwise FST's of 0.014 between the Pacific and West Atlantic, 0.318 between the Pacific and East Atlantic, and 0.203 between the two Atlantic populations.Heterozygosities and tests of Hardy-Weinberg equilibrium for the East Atlantic and Pacific populations are as reported in for the QST for the sperm traits was 0.41, with a standard error of 0.10, as compared with FST of 0.159. ANOVAs of trait divergence from which variance components were obtained for calculating QST were significant for all traits except total length. QST's for head length , head width , and midpiece area were significantly higher than FST, based on tail probabilities of QST on a chi-squared FST distribution , axoneme length and midpiece area , are most divergent, in comparison with a pairwise FST of 0.0136 from three populations, from the eastern Pacific , West Atlantic and East Atlantic . Individuals were obtained from the Pacific and West Atlantic from January to April 2006 and from the West Atlantic from February to April 2007. Sperm samples from the East Atlantic population were kindly provided by Nils Hagen in March 2006.We examined sperm morphology in green sea urchins ad libitum. These individuals were reproductively active until late April. In 2007, a different cohort of adults was kept in an indoor seawater facility maintained at 8°C under a daily cycle of 13 hours of light and 11 hours of darkness. These individuals were also fed kelp ad libitum and were reproductively active through mid-June. Comparison of sample means between the different treatment conditions of 2006 and 2007 were done for the West Atlantic population using a t-test .In 2006, adult Sea urchins were induced to spawn by injecting 0.55 M KCl. Most individuals were spawning on arrival after shipment, allowing a baseline measurement of sperm morphology before placement in common tanks. Dry sperm was collected off gonopores using a pipettor with a wide-bore tip, diluted 1:50 or 1:100 in filtered sea water (FSW), and fixed in a final concentration of 1% paraformaldehyde and 9.25% FSW.http://rsb.info.nih.gov/ij/) and converted from units of pixels to microns based on a scale specific to the focal length of the camera and the ocular magnification. Scales were calculated using a stage micrometer .Ten μl of fixed sperm were pipetted on a slide, and a cover slip was applied and sealed with nail polish. Individual spermatozoa were visualized using differential interference light (DIC) microscopy with a Zeiss Axioplan DIC microscope at 250× to 1000× magnification. Digital micrographs were taken using an Olympus E330, E995 or E4500 digital camera. Measurements on images were obtained using ImageJ software , and only midpiece area data were log-transformed. All statistical analyses described below were performed in SAS, and Bonferroni correction was applied for each analysis. Repeatability of sperm measurements across two separate measurement events was determined for five males (ten spermatozoa each) from all three populations, using repeated measures ANOVA. We also spawned 15 males from the west Atlantic population (from both 2006 and 2007) every two weeks a total of two to five times and measured ten to 25 sperm from each spawning event to evaluate individual variation through time. These data were also analyzed using repeated measures ANOVA. We estimated correlations between pairwise individual trait means across the entire dataset using Pearson correlation coefficients. We also estimated coefficients of variation (CV) within and among males for all populations.We examined the 2006 and 2007 spawning seasons in the west Atlantic population for differences in sperm morphology using a two-sample t-test and determined that only head width was significantly smaller in 2007 than in 2006 Table . For thiQST with FST at neutral microsatellite markers. QST was estimated from descriptive components of variance obtained by analysis of variance, computed using RANDOM in PROC GLM in SAS and Type III sums of squares accounting for unbalanced design. QST was calculated as VGB is the among-population variance for quantitative traits, and VGW is the average within-population genetic variance.VGW, in turn, was computed as the product of the trait heritability (h2) and the within-population component of variance (VW): VGW = h2VW.We tested the hypothesis that the amount of divergence in sperm traits among populations was significantly higher than we would expect for neutral variation, indicating directional selection for different trait means among populations. This test of selection was performed for each sperm trait by comparing quantitative genetic divergence or BVGB+2VGW, where VQST due to its position in the denominator of the QST equation. As a result, the estimates of QST calculated using repeatability are very conservative and represent a lower limit on possible QST's over the range of heritability from 0 to 1, given the observed among-population trait divergence.We derived our estimates of heritability for each sperm trait from our measurements of repeatability, calculated using morphometric data from multiple spawnings of the same male . RepeataFST at four neutral microsatellite markers was estimated using AMOVA in Arlequin v. 2.000 [n = 41); Isle of Shoals, New Hampshire, USA (n = 144); and Vestfjorden, Norway (n = 79). All of these sites are geographically identical or proximate to those from which adults were obtained for the sperm variation data. While FST was not estimated from the same individuals from which sperm measurements were taken, both the sperm morphometric and microsatellite datasets were derived from the same geographic populations. The West Atlantic population had the largest distance between sampling localities of the two datasets, but previous research has shown that the West Atlantic region experiences high levels of gene flow [FST, because jackknifing cannot be done over only three populations. Mitochondrial DNA has also been used to estimate FST [v. 2.000 from pubv. 2.000 and unpuene flow . Therefomate FST ,85, but mate FST and so wQST were significantly different from the neutral model represented by FST. Because FST estimates can be highly variable among neutral loci, it is best to compare QST not to a mean FST but to a distribution of possible FST's [FST and QST have been shown to follow a chi-squared distribution under a wide range of demographic scenarios [QST-to-FST ratio to a chi-squared distribution with (ndemes - 1) degrees of freedom, according to the statistic (ndemes - 1)QST/FST [ndemes is the number of demes. The p-value associated with this statistic gives the probability that the observed QST falls within the distribution of FST. A significant p-value for a sperm trait would indicate that it has a low probability of being selectively neutral and a high probability of evolving under directional selection.We tested the hypothesis that our estimates of le FST's . The discenarios . As a re)QST/FST , where nTo test for an effect of low sample size in the East Atlantic population, we performed a Bartlett's test for homogeneity of variances among all populations for each sperm trait. None of the sperm traits examined showed significant differences in variance among the populations, suggesting that although the East Atlantic sample size is small, there was no associated increase in variance. Most of the statistical tests performed in this study are based on ANOVA, which assumes equal variance among samples. Thus, we do not feel that the small sample size of the East Atlantic population has compromised our results in any way.MM collected and analyzed data and drafted the manuscript. SP provided input on data analysis and the manuscript. Both authors read and approved the final manuscript.Table of sperm trait correlations (r) above diagonal and P-values below diagonal.Click here for fileTable of raw canonical coefficients of sperm traits for both canonical variables from canonical discriminant analysis.Click here for fileTable of squared Mahalanobis distances from canonical discriminant analysis of overall sperm morphology between population pairsClick here for fileGreen sea urchin sperm (A) components and (B) traits measured.Click here for file

In this study, we evaluated the changes which occurred in the epiligament, an enveloping tissue of the ligament, during the ligament healing. We assessed the association of epiligament elements that could be involved in ligament healing.Thirty-two 8-month old male Wistar rats were used in this study. In twenty-four of them the lateral collateral ligament of the knee joint was surgically transected and was allowed to heal spontaneously. The evaluation of the epiligament healing included light microscopy and transmission electron microscopy.At the eight, sixteenth and thirtieth day after injury, the animals were sacrificed and the ligaments were examined. Our results revealed that on the eight and sixteenth day post-injury the epiligament tissue is not completely regenerated. Till the thirtieth day after injury the epiligament is similar to normal, but not fully restored.Our study offered a more complete description of the epiligament healing process and defined its important role in ligament healing. Thus, we provided a base for new strategies in ligament treatment. The incidence of knee ligament injuries has increased in recent years due to the general public's increase in sports activities -4. LigamThirty-two 8-month old male Wistar rats, with weight ranges of 350 - 400 g at the time of surgery, were used for this study after approval was obtained from the University Committee on Animal Resources. These rats were divided in four groups, each group including eight animals. The last group of animals underwent no transection and served as intact controls.Twenty-four rats were anesthetized by intraperitoneal injection using a mixture of 5 mg/kg b.w. Xylasine and 45 mg/kg b.w. Calypsol . Their hind limbs were then shaven and washed with betadine solution. Under sterile conditions a small incision (10 mm) was made in their skin on the "femoro-fibular joint" (knee joint) of the left hind limb over the site of LCL. After skin incision, the overlying connective tissue was dissected to expose the knee's LCL. Then, a 1-mm gap in the mid-substance was surgically created and the gap was left without suturing. The transected ends were marked with 9-0 nylon monofilament suture. The skin incision was closed using 5-0 Ethibond suture. The right knee of other animals remained intact. The remaining eight rats were used as unoperated normal controls. After operation, the rats were allowed free cage activities. No infections or complications were observed in the twenty-four injury-induced animals. On the eight, sixteenth and thirtieth day after surgery, the animals were sacrificed with intracardiac injection of Thiopental . The unoperated controls were anesthetized, sacrificed as operated ones and then the same surgical approach was used. The injured ligaments were carefully removed without disturbing the scar region and were immediately fixed in 3% glutaraldehyde for 2 hours. The normal controls of the EL tissue were taken from the midsubstance of the LCL and were fixed as injured ligaments. Then both the controls and injured EL tissues were rinsed several times with 0.1% phosphate buffer to remove the fixative solution with subsequent incubation in a 1% osmium tetroxide for two hours was made. After that the pieces were dehydrated in EtOH . Next, the LCL scars were treated for 30 minutes with a 2:1 mixture of propylene oxide and epon. The pieces were embedded in Durcupan . Afterward all slices were processed with disectional microscope and cut with ultramicrotome . The scar regions were identified on semi-thin sections (for light microscopy) stained with 1% metilene blue, azure II and basic fuchsin. The EL tissue of the LCL was identified on semi-thin sections from the midsubstance in controls and gap region of the transacted ligament for operated animals (for light microscopy). The ultrathin sections (60 nm thick) were taken only from the EL gap region and from the midsubstance of the LCL epiligament tissue (for transmission electron microscopy) and both were contrasted with 2.5% uranyl acetate, lead nitrate, and sodium citrate.Normal rats' EL structure has been previously described by us . HistoloThe histological results demonstrated at the eight day after injury Fig. ; Fig. 3aTEM analysis at the eight day post-injury Fig. ; Fig. 3bOn the sixteenth day after injury Fig. ; Fig. 5aUltrastructurally, at the sixteenth day post-injury Fig. ; Fig. 5bOn the thirtieth day after injury Fig. ; Fig. 7aTEM at this period Fig. revealedLigaments' healing involves a complex, coordinated series of events that form a neo-ligament which is more scar-like in character than the native tissue . NumerouThe EL structure is quitе different from the ligament substance ,15,18. TDue to the characteristics of the EL tissue Lo et al. supposedOur light microscopic study on the eight day after injury revealed that the scar regions were characterized with hyper-cellularity and intensive angiogenesis. Numerous cells in the deep part of the EL substance migrated in the endoligament enveloping the collagen fibres of the ligament. This was in contrast to relatively small number of cells in the EL presented near the ligament substance in unoperated animals. TEM observations revealed active fibroblasts with short plasma membrane processes. Their large nucleuses had an enormous prominent nucleolus, typical characteristic of cells that were actively synthesizing proteins. The cytoplasm contained considerable amount of free ribosomes, polysomes, expanded rough endoplasmic reticulum also a sigh for active protein synthesis. High incidence of lysosomes in fibroblasts of injured animals, in contrast to controls exhibited their higher phagocytic activity. The detected high amounts of spherical mitochondria opposed to uninjured animals were a characteristic of a more intense metabolic activity. Intensive angiogenesis was presented with increasing number of blood vessels in the EL substance indicating late inflammation and early proliferative phase. Chaotically arranged single or rarely small groups of collagen fibres did not reveal a well-presented restoration of the EL. On the sixteenth day after injury the light microscopy research presented similar characteristics as in previous period, but the granulation margins in the EL were less distinct and the scar region appeared to be more organized. Deep part of the EL was also hypercellular, differently to controls and these cells also migrated in the endoligament enveloping the collagen fibres of the ligament. The fibroblasts in the scar region also had large nuclei and abundant rough endoplasmic reticulum as in previous period. The number of lysosomes and mitochondria decreased, but was higher than controls. All these characteristics indicated less phagocytic activity and less activation of fibroblasts. In the regenerative zone of the EL there was single or clusters of adipocytes representing a new packing material for EL tissue. However, they had irregular form and varied in size compared to unoperated animals consisted single adipose cells with spherical or polyhedral form when they are closely packed. The number of blood vessels in the EL tissue decreased presenting the remodeling phase. The collagen fibers in this period were also organized in bundles with different orientations and damaged collagen fibers, between and included in them, but more regular than in the previous period. On the thirtieth day after injury the healing process advanced and cells of the EL infiltrate most of the LCL scar, while collagen disorganization subsided. The EL tissue was similar to controls and was composed of fibroblasts, adipocytes, mast cells and reduced number of vascular network, but not fully restored. The cells in the deep part of the EL decreased in numbers as in controls. TEM presented mostly single lysosomes in the EL's fibroblasts, similar to controls. However, incidentally fibroblast with numerous lysosomes and single fibers with damaged characteristics were discovered, presented not completely restoration of the EL tissue.Light microscopic investigations revealed that the general cellular morphology of EL was similar to that seen in synovium . This isLimitations of the current animal model existed and should be noted. First, all injuries were induced by scalpel transaction, a method that is not an ideal simulation of common clinical injuries ,11. SecoIn conclusion, this study illustrates for the first time the ultrastructural changes of the early reparation of the EL tissue during first month of ligament healing. As described, the EL is the main source of fibroblasts, progenitor cells and blood vessels that proliferated and infiltrated within the ligament body via the endoligament during ligament healing. Therefore, detailed knowledge of the EL as well as its normal morphology and its restoration during ligament healing is essential to get a better understanding of the normal healing process and thus propose optimal treatment regimes.The authors declare that they have no competing interests.GPG and NKV conceived the study. GPG wrote the manuscript, design the study, prepared the light and transmission microscopy and analyzed the results. NKV and PSK helped in analyzing the result section and preparing the manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2474/11/117/prepub

La maladie cœliaque (MC) de l’adulte est une pathologie fréquente dont la présentation clinique est polymorphe. Les manifestations extradigestives sont multiples et rendent le diagnostic difficile lorsqu’elles sont isolées. Nous rapportons le cas d’un patient de 52 ans qui présentait un accident vasculaire cérébral ischémique (AVCI). Le bilan étiologique objectivait une hyperhomocystéinémie avec une carence en vitamine B12. La biopsie duodénale était en faveur d’une maladie coeliaque. Les anticorps antigliadines étaient positifs. Le patient fût mis sous régime sans gluten, antiaggrégant plaquettaire et hydroxocobalamine avec une évolution favorable. La maladie coeliaque est une entéropathie inflammatoire chronique auto-immune provoquée par un antigène alimentaire la gliadine du gluten. Les aspects neuropathologiques sont hétérogènes, les mécanismes impliqués sont mal connus . Des accPatient de 52 ans, sans antécédent pathologique notable, qui présenta le 20/04/09, de façon brutale un trouble de la parole et de la déglutition sans signes d’hypertension intracrânienne ni trouble de la vigilance dans un contexte d’apyrexie et de conservation de l’état général. L’examen général trouva un patient conscient, apyrétique à 37° C, une TA à 150/80 mmHg. L’examen neurologique objectiva un un syndrome pseudobulbaire fait de pleurers et rires spasmodiques, un trouble de la sensibilité profonde vibratoire et du sens de position du gros orteil des 2 membres inférieures, des réflexes ostéo-tendineux et cutanés conservés, sans autre déficit moteur ni trouble de la coordination ni trouble des fonctions supérieures. L’examen des autres appareils était sans particularité.Le scanner cérébral montra des images lacunaires siégeant au niveau des 2 hémisphères cérébraux en sous cortical. L’imagerie par résonance magnétique cérébrale objectiva, à l’étage sus tentoriel, des anomalies de signal de la substance blanche périventriculaire diffuse en plages en hypersignal T2 et FLAIR et en séquence de diffusion ne prenant pas le produit de contraste signant la nature ischémique. A l’étage sous tentoriel, on retrouve des anomalies de signal au niveau bulbaire et de l’hémisphère cérébelleux gauche en hyper T2 et FLAIR non visible en diffusion et non modifiées après injection du gadolinium dont l’origine pourrait être ischémique ou inflammatoire , 2. L’IRLe patient fût mis sous régime sans gluten, hydroxocobalamine injectable et anti-aggrégant plaquettaire pour prévention secondaire de son AVC ischémique. L’évolution était favorable avec un recul de 6 mois.La MC est une pathologie fréquente, dont la prévalence est estimée à 1% en Europe. La sex-ratio est de deux femmes pour un homme. La maladie est généralement découverte lors de la quatrième ou cinquième décennie .La physiopathologie de la MC fait intervenir plusieurs éléments. Les deux antigènes principaux sont la gliadine, fraction protéique des céréales et surtout la transglutaminase tissulaire (tTG) qui permet notamment la transformation des résidus glutamines de la gliadine en glutamates . Celles-Les manifestations cliniques de la MC rendent compte de plusieurs phénomènes: atteinte digestive, atteintes extradigestives, complications ou pathologies associées à la MC. En effet, la MC est associée à de nombreuses endocrinopathies , à des manifestations cutanées (dermatite herpétiforme), à des syndromes malformatifs, notamment la trisomie 21, au déficit en IgA et à diverses manifestations neurologiques [Les atteintes neurologiques seraient présentes dans 10% des cas. La survenue d’AVCI au cours de la MC est rare.L’hyperhomocystéinémie, secondaire à une carence en vitamine B12 et en acide folique, est un facteur de risque reconnu dans la survenue d’accidents ischémiques cérébraux. Plusieurs études contrôlées ont démontré un risque d’AVC ischémique multiplié par deux lorsqu’il existe une hyperhomocystéinémie pathologique . RécemmeDevant l’âge jeune de notre patient, l’absence de facteur de risque vasculaire, l’absence de cause cardiaque, la négativité du reste du bilan inflammatoire et immunologique plaident en faveur de l’existence d’un lien de causalité entre l’accident vasculaire cérébral ischémique (AVCI) et la maladie coeliaque (MC). Concernant l’implication des antiphospholipides : une étude cas témoin récente n’a pas montré de différence significative dans la prévalence des anticorps anticardiolipines et anti-ß2GPI, hormis pour les anticorps anticardiolipines d’isotype IgA, dont la fréquence semble plus élevée au cours de la MC . CependaLa maladie coeliaque est une affection à symptomatologie polymorphe dont le diagnostic doit êrtre évoqué devant de nombreuses manifestations cliniques extradigestives parmi lesquelles l’accident vasculaire cérébral ischémique de l’adulte jeune d’où l’intérêt de rechercher une MC devant les cas d’AVC ischémiques inexpliqués de l’adulte jeune.Les auteurs ne déclarent aucun conflits d’intérêts.

The dihedral angle between the two benzene ring mean planes is 65.69 (10)°. In the crystal structure, mol­ecules are linked through N—H⋯O hydrogen bonds and stack along the b axis.In the crystal structure of the title compound, C Å b = 5.2618 (6) Å c = 15.892 (2) Å β = 93.519 (3)°V = 2307.3 (5) Å3 Z = 8 Kα radiationMo −1 μ = 0.09 mmT = 223 (1) K 0.40 × 0.35 × 0.18 mm Rigaku R-AXIS RAPIDII diffractometerABSCOR; Higashi, 1999T min = 0.968, T max = 0.983Absorption correction: numerical (13860 measured reflections3357 independent reflectionsI > 2σ(I)1779 reflections with R int = 0.055 R[F 2 > 2σ(F 2)] = 0.073 wR(F 2) = 0.240 S = 1.01 3357 reflections158 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.32 e Å−3 Δρmin = −0.21 e Å−3 Δρ PROCESS-AUTO (Rigaku/MSC, 2004PROCESS-AUTO; data reduction: CrystalStructure (Rigaku/MSC, 2004SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997CrystalStructure and PLATON (Spek, 2003Data collection: 10.1107/S160053680803225X/su2064sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680803225X/su2064Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Three groups of rats were constituted by combiningsimultaneous infusion during 48 h either of glucoseand/or insulin, or glucose+diazoxide: Hyperglycemic-Hyperinsulinemic (HGHI), euglycemic-Hyperinsulinemic(eGHI), Hyperglycemic-euinsulinemic (HGeI). Control ratswere infused with 0,9% NaCl. In HGHI and HGeI ratsplasma glucose levels were maintained at 20-22 mmol/l. IneGHI rats, plasma glucose was not different from that ofcontrols, whereas plasma insulin was much higher thanin controls. In HGHI rats, IRS-2 mRNA expression, totalprotein and phosphorylated protein amounts were increasedcompared to controls. In HGeI rats, only IRS-2mRNA expression was increased. No change was observedin eGHI rats whatever the parameter considered. In allgroups, mRNA concentration of IRS-1 was similar to thatof controls. The quantity of total and phosphorylated IRS-1 protein was dramatically increased in HGHI rats andto a lesser extent in eGHI rats. Neither mRNA nor IRS-1protein expression were modified in HGeI rats. The datasuggest that glucose and insulin play at once a specificand a complementary role in islet IRSs signaling. Especially,glucose stimulates IRS-2 mRNA expression whateverthe insulin status and independently of the secretoryprocess. The differential regulation of IRS-1 andIRS-2 expressions is in agreement with their supposed different involvement in the control of β-cell growth andfunction.We investigated the possible interplay between insulinand glucose signaling pathways in rat pancreatic

These infections are likely prevalent among persons who live or work near nonhuman primates. In Asia, contact between persons and nonhuman primates is widespread in multiple occupational and nonoccupational contexts. Simian foamy viruses (SFVs) are retroviruses that are prevalent in all species of nonhuman primates. To determine SFV prevalence in humans, we tested 305 persons who lived or worked around nonhuman primates in several South and Southeast Asian countries; 8 (2.6%) were confirmed SFV positive by Western blot and, for some, by PCR. The interspecies interactions that likely resulted in virus transmission were diverse; 5 macaque taxa were implicated as a potential source of infection. Phylogenetic analysis showed that SFV from 3 infected persons was similar to that from the nonhuman primate populations with which the infected persons reported contact. Thus, SFV infections are likely to be prevalent among persons who live or work near nonhuman primates in Asia. Human society critically influences the ecologic contexts in which the transmission of infectious agents between species occurs are woven into the fabric of everyday life comprise a subfamily of simian retroviruses that are ubiquitous in nonhuman primates. Ancient and well adapted, SFVs have coevolved with their nonhuman primate hosts for >30 million years . Study sites, selected for their known human–nonhuman primate contact, were located in 4 countries in South and Southeast Asia: Thailand, Indonesia, Nepal, and Bangladesh. The seroprevalence of SFV among the nonhuman primates at these sites has been reported (Macaca mulatta). In Bangladesh, where for decades ≈200 rhesus monkeys have ranged freely in the village of DH, northeast of Dhaka, 11 villagers were sampled and interviewed in 2007.In Thailand, 211 persons were interviewed and sampled: 8 workers from a zoo in northern Thailand in 2002 and 203 persons at temples, nonhuman primate pet owners, bushmeat hunters, and urban residents from 9 sites in 2004–05. In Indonesia, biological samples and demographic and exposure data were collected from 74 temple workers at 2 sites in Bali: AK in 2000 (n = 56) and UB in 2003 (n = 18). In Nepal in 2003, 9 persons who lived and/or worked at the Swoyambhu Temple in Kathmandu were sampled; this World Heritage site is home to >400 free-ranging rhesus . This assay has been previously described . For each clone, 3–6 colonies were picked and purified-DNA sequenced. Sequences were analyzed by using Sequencher 4.7 . For pol, 425 bp were compared; for gag, 1,125 bp were compared. Trimmed sequences were analyzed by using BLAST (www.ncbi.nlm.nih.gov/blast/Blast.cgi) and aligned, and neighbor-joining trees according to the manufacturer’s instructions. For PCRs, the primers and conditions described by Schweizer and Neumann-Haefelin were used for gag and pol gene sequences reported here were deposited in GenBank under the following accession nos.: AK04gag EU448349, AK04pol EU448363, AK19gag EU448350, AK19pol EU448364, AK23gag EU448351, AK23pol EU448365, BGH4 gag EU450664, HAD3 gag EU450665, HAD38pol EU448341, HAD3pol EU448342, MBG11gag EU448344, MBG13gag EU448345, MBG14gag EU448346, MBG4gag EU448343, MBG7gag EU448347, MBG8gag EU448348, SFVfasWgag EU448357, SM44gag EU448353, SM44pol EU448358, SM46pol EU448359, SM49gag EU448354, SM49pol EU448360, SM61gag EU448355, SM61pol EU448361, SM62gag EU448356, SM62pol EU448362, UB1pol EU448366, UB3gag EU448352, and UB3pol EU448367. SFVmulO is listed under accession no. DQ120937.The Persons ranged from 18 to 80 years of age. Their context of contact with nonhuman primates was defined as the predominant form of contact at the time of the study. Some persons reported other past contexts of contact. For example, several of the 23 bushmeat hunters, all from the same village in Thailand, had previously worked at a park where free-ranging nonhuman primates were the main attraction, and a few of the temple workers in Bali and Thailand reported having previously owned pet nonhuman primates.Of 305 serum samples analyzed, 211 samples from Thailand were initially screened with bioplex at the Washington National Primate Research Center or among age groups . Bites were less common among bushmeat hunters (0%) and persons who lived and/or worked at monkey temples (25.6%) than among those who were exposed to urban (57.9%) and pet monkeys (52.4%). Splashes of body fluids onto mucosa were reported by nearly one fourth (24.9%) of the study population and scratches by 38.4%. Overall, 63.6% of the total population reported being exposed to nonhuman primate body fluids through a bite, scratch, or splash onto mucosa.No statistical differences in bite exposures were detected between men and women (χM. nemestrina) to harvest coconuts. At the time of data collection, he had 3 working M. nemestrina that he kept in his compound and transported to the fields on his motorbike. He reported having received several scratches and 2 bleeding bites (hand and arm) over the years. The bites were treated with traditional medicines.At the time of sampling, HCM2, a farmer from central Thailand, was 56 years of age. Since 23 years of age, he had trained 8 pig-tailed macaques (M. assamensis) ranged freely through the temple grounds, commonly entered nearby homes in search of food, and frequently received food from monks and visitors to the temple. HMS14 reported that M. assamensis came into her home daily to raid food bins. In 1999, a pet female stump-tailed macaque (M. arctoides) was brought to the temple and released. HMS14 had repeated physical contact (but no bites or scratches) with this released pet macaque, which was often present at her food stall. HMS14 reported that on 3 separate occasions in 2004 she was scratched by free-ranging M. assamensis and that the scratches were deep enough to bleed.At the time of sampling, HMS14 was 44 years of age. She sold food at a Buddhist temple in northern Thailand and had worked and lived in the area for 30 years. Wild assamese macaques were an attraction for domestic and international tourists. He also reported that he had previously owned 2 pet M. fascicularis. He reported having received >5 bleeding bites to his hands from his pet macaques and 1 bleeding bite and multiple scratches from macaques at the temple site. He did not seek medical treatment for the bites or scratches.HAD3, a 58-year-old man, worked at a Hindu temple site in central Bali, where free-ranging long-tailed macaques . The wound was washed with water, and she was treated with a rabies vaccination and antimicrobial drugs at a local clinic. She denied having ever been scratched.NH2, a 36-year-old woman, lived immediately adjacent to the Swoyambhu Temple in Kathmandu and occasionally worked there as a cleaner. She had been bitten 1 time on her middle finger by one of the temple’s free-ranging rhesus macaques M. mulatta that ranged freely through the village. She did not recall whether she had received any medical treatment. She did not report any other physical contact with nonhuman primates, though she did comment that the local macaques often entered her house in search of food, leaving urine and feces.BGH4, a 19-year-old housewife, was born in the central Bangladeshi village in which she was sampled. When she was 4 years old, she was severely bitten on her left calf by one of the gag sequences from BGH4 (A), gag and pol sequences from HAD3 , and pol sequences from HAD38 (C). SFV sequences from humans were compared with those from macaques of the group with which the person had been in contact and with those from other macaques of the same species but different geographic origin .We derived SFV sequences from the peripheral blood DNA of 3 SFV-infected persons: BGH4, HAD3, and HAD38. We were able to amplify mitochondrial DNA from the DNA sample of another person (HCM2) from which no SFV sequences could be obtained. We have no evidence that DNA obtained from the other 4 human blood samples was of good quality (data not shown). We obtained rom BGH4 , panel Aom HAD38 , panel CM. mulatta from her village in central Bangladesh and more distantly with 2 performing M. mulatta (origin unknown) sampled near her village (MBG7 and MBG8). The virus sequence of BGH4 is equidistant from that of MBG7 and MBG8 and from that obtained from an M. mulatta (SFVmulO of unknown origin) housed at the Oregon National Regional Primate Center. SFV pol and gag sequences from HAD3 clustered most closely with SFV from AK M. fascicularis at the Bali temple site where HAD3 worked, as did HAD38 pol sequences. In contrast, the virus sequences from these 2 humans were more distantly related to those from the UB animals, which were also M. fascicularis but from another temple site in Bali (≈15 km away). The SFV sequences from HAD3 and HAD38 were even less similar to SFV isolated from M. fascicularis from Singapore (SM isolates).SFV from BGH4 clustered most closely with SFV from 4 These data suggest that SFV sequences are stable in nonhuman primates and can be used for several macaque species to mark an individual’s geographic origin. Correlation between the SFV sequences isolated from humans and those from the corresponding nonhuman primate populations with which they reported contact was excellent.We found prevalence of SFV infection in the heterogeneous populations studied to be 2.6%. In contrast with previous studies of persons who had occupational exposure to nonhuman primates, the exposure of some of the SFV-infected persons in our study was only through their normal daily routines. Previous research on nonhuman primate–human interaction in South and Southeast Asia describes interspecies contact as a frequent phenomenon in this part of the world .Bites from nonhuman primates are thought to be the most likely route of SFV transmission because viral RNA is found at high concentrations in the oral mucosa and saliva of infected animals (A). The 3 persons from whom SFV sequences were obtained each interacted with a single species of macaque; we did not detect any recombinant viruses, which are more likely to be encountered in persons who come into contact with multiple nonhuman primate species.Other studies have shown SFV sequences to be highly stable , panel AHomo sapiens, the more likely it is that transmission to humans can occur. The second factor is interspecies contact, which can be conceived as having 2 dimensions: the duration of contact and the intensity of contact. In general, contacts such as bites, scratches, or mucosal splashing with body fluids have the highest potential for transmitting infectious agents. In this light, the human–nonhuman primate interface in South and Southeast Asia ranks among the most likely contexts for zoonotic transmission.A recent review article recapitulates arguments that 2 factors influence the likelihood that disease can be transmitted from an animal reservoir to humans nonhuman primates are increasing rapidly. For example, during the 1990s, population levels of the 3 species of macaques in the Kowloon Hills of Hong Kong increased 100% (Our data suggest that the number of persons at risk for infection with SFV is much larger in South and Southeast Asia than elsewhere. This finding presents both a challenge and an opportunity for future research. The challenge is to find infected persons and follow the course of infection in addition to taking action to prevent future transmission. The opportunity lies in assembling a large cohort of infected persons, which will enable the use of epidemiologic techniques to learn about the natural course of SFV infection in humans.

Pecten maximus, catalyzes the NADH dependent, reductive condensation of L-arginine and pyruvate to octopine, NAD+, and water during escape swimming and/or subsequent recovery. The structure of OcDH was recently solved and a reaction mechanism was proposed which implied an ordered binding of NADH, L-arginine and finally pyruvate. Here, the order of substrate binding as well as the underlying conformational changes were investigated by NMR confirming the model derived from the crystal structures. Furthermore, the crystal structure of the OcDH/NADH/agmatine complex was determined which suggests a key role of the side chain of L-arginine in protein cataylsis. Thus, the order of substrate binding to OcDH as well as the molecular signals involved in octopine formation can now be described in molecular detail.Octopine dehydrogenase (OcDH) from the adductor muscle of the great scallop, Several molluscan species, in particular cephalopods are known for their vivid swimming performances. Also among the usually slow moving or even sedentary bivalves, active species are known such as the Pectinid scallops which exhibit jumping and swimming movements when attacked by predatory starfish 2-(D-1-carboxyethyl)-L-arginine:NAD+-oxidoreductase, EC 1.5.1.11) catalyzes the reductive condensation of L-arginine and pyruvate in the presence of NADH to yield D-octopine [(R)-N2-(1-carboxyethyl)-L-arginine], NAD+, and water (Pecten maximus (P. maximus)Octopine dehydrogenase proposed, based on kinetic and fluorometric data, that the apo enzyme forms a binary complex in the presence of NADH to which the other two substrates bind in a compulsory ordered sequential mechanism Despite the physiological, biochemical and structural information available for OcDH from Pecten maximus was solved Recently, the crystal structure of OcDH from We like to stress that in the crystal, domain I and domain II are stabilized in the presence of NADH by two different sets of interactions. First, Arg324 located in domain II binds the pyrophosphate moiety of NADH bound to domain I thereby acting as a “NADH-sensor”. This already closes the protein. Second, the His-tag located in the cleft of both domains clues together these two parts. Through this sort of artificial arrangement, the pyruvate binding site is generated that would not be present in solution P. maximus, which indicates that pyruvate binding to OcDH does not occur spontaneously.Thus the formation of the OcDH/NADH complex should precede the binding of L-arginine, which then induces a rotational movement (via the helix-kink-helix motif) of the two domains towards each other. This movement coordinates the placement of the α-ketogroup of pyruvate and the α-amino group of L-arginine in close proximity to each other resulting in the subsequent formation of a Schiff base which is immediately reduced to D-octopine and thus prevents the reduction of pyruvate to lactate. The formation of the latter has never been observed in Saccharomyces cerevisiae, which catalyzes the reversible pyridine nucleotide-dependent oxidative deamination of saccharopine to yield L-lysine and α-ketoglutarate (α-KG) Such a conformational change has also been proposed for the Saccharopine Dehydrogenase from In solution, however, no activity can be observed when pyruvate is added as a substrate to OcDH in the presence of NADH. Such a reaction could possibly generate lactate in analogy to lactate dehydrogenase. However, the crystal structures of OcDH revealed that the conformational change observed by L-arginine binding is a prerequisite to form the pyruvate binding site Here, we have applied two different methods, nuclear magnetic resonance (NMR) and X-ray crystallography to address these questions.+ were obtained from Roche, pyruvate L-arginine and agmatine from Sigma.All chemicals used were of analytical grade and were used without further purification. NADH and NADCloning of the OcDH gene, heterologous, large scale expression and determination of enzymatic activity of OcDH, were performed as described previously .5: For the expression of U-[15N] labeled OcDH M9 Minimal media (0.6% (w/v) Na2HPO4, 0.3% (w/v) KH2PO4, 0,05% (w/v) NaCl, 0.4% (w/v) Glucose, 1 mM MgSO4, 0.3 mM CaCl2, 1 µg mL−1 Biotin, 1 µg mL−1 Thiamin, 50 µg mL−1 EDTA 8,3 µg mL−1 FeCl3, 0.84 µg mL−1 ZnCl2, 0.13 µg mL−1 CuCl2, 0.1 µg mL−1 CoCl2, 0.1 µg mL−1 H3BO3, 16 ng mL−1 MnCl2, pH 7.0) supplemented with 0.1% (w/v) 15N-ammoniumchlorid as only nitrogen source was used. Five liter minimal media were inoculated with an over night culture and cells were grown for 12 h at 37°C. Cells were then induced by the addition of 0.35 mM IPTG and the expression temperature was lowered to 18°C for another 36 hours. Purification was performed as described before Expression and purification of isotope labeled OcDH-His15N] labeled OcDH was carried out as described above. NMR samples for titration experiments contained 0.25 mM U- [15N] labeled OcDH in aqueous solution 2D2O). All NMR experiments were carried out at 298 K on a Varian UnityINOVA spectrometer, equipped with a 5 mm cryogenic Z-axis PFG-1H triple resonance probe at a proton frequency of 800 MHz. For each concentration of ligands a 2D TROSY-type 1H-15N correlation experiment was recorded with 69 ms maximum 15N evolution time and 16 accumulated scans t1 per time increment. The concentration of NADH was increased from 75 µM to 3 mM in 6 steps, NAD+ from 75 µM to 5 mM in 7 steps and L-arginine from 75 µM to 8 mM in 6 steps with 3 mM NADH present in all steps.Expression and purification of U-[Spectra were processed using the Varian VNMRJ 1.1D software and analyzed with the program CARA Δδ  =  (Δδmax · [L])/(Kd + [L]).Here, Kd is the dissociation constant, [L] the ligand concentration, Δδ is the change of the chemical shift, Δδmax the maximal change of the chemical shift of an individual resonance.5 were grown as described previously −1) with reservoir solution, (100 mM MES pH 6.0–7.0) and Na-citrate ranging from 1.0 to 1.2 M, in a 1∶1 ratio. Crystals appeared after approximately 5 days. Prior to crystallization, 0.8 mM NADH was added to the protein solution. Agmatine-bound crystals were obtained by soaking NADH-bound OcDH crystals in 100 mM MES pH 7.0, 1.15 M Na-citrate, 0.8 mM NADH containing 20 mM agmatine for at least 8 hours. Suitable crystals were washed in 100 mM MES pH 7.0, 30% (v/v) ethylene glycol, 1.15 M Na-citrate and directly frozen in liquid nitrogen.As it was not possible to obtain crystals of the OcDH/NADH-agmitine complex we used soaking to obtain the agmatine bound OcDH structure. This means that OcDH protein crystals were transferred into a solution containing agmatine, which diffuses into the crystal and is specifically bound. Therefor crystals of OcDH-HisA dataset of OcDH/NADH/agmatine at 2.8 Å was collected at beamline BW7A, EMBL, DESY, Hamburg (Germany). Detailed information on data collection statistics are shown in http://pymol.sourceforge.net/).Structure figures were prepared using PyMol . We used this spectrum as a reference for the detection of chemical shift perturbations caused by binding of NADH, L-arginine and/or pyruvate.To perform HSQC-titrations, OcDH was uniformly isotope labeled by using 13C-15N-labelled OcDH NMR sample. About 25% of the backbone amides did not exchange with H2O even under denaturing conditions. Here, suitable refolding procedures for OcDH after full deuterium to proton back-exchange under denaturating conditions could not be established.Unfortunately, we were not able to establish full assignments due to poor deuterium to proton back-exchange of the per-deuterated and 15N-labeled OcDH with increasing concentrations of NADH ranging from 0.075 mM to 3 mM for NADH . This suggests that NADH is the first substrate to bind to OcDH.Nevertheless, for binding studies, NADH was first titrated to to 3 mM and 2D-Tfor NADH . Applyinobtained and 3b. DK value of 4.1±0.31 mM for the binding of L-arginine to the binary OcDH/NADH complex . However, when the OcDH/NADH complex was titrated with L-arginine in concentrations ranging from 0.075 mM up to 8 mM, superposition of the spectra revealed a large number of resonance peaks being shifted. The dependence of the respective chemical shift differences of the L-arginine enabled us to calculate a complex and 2c. complex are in gWhat induces the conformational change of OcDH upon L-arginine binding?In addition, chemical shift changes in general indicate different chemical environment of the respective nuclei. The chemical environment can change due to direct interaction with the substrate or due to substrate binding induced conformational changes, even minor ones. The sheer number of chemical shift changes in the finger print region upon L-arginine binding indicates that much more residues are affected upon substrate binding as could be explained by a sole and physical interaction of the protein with the substrate. Thus, L-arginine binding obviously induced conformational changes in OcDH. i of 40±2 mM. This implicates that agmatine and L-arginine bind to the same binding site in OcDH.Agmatine is the decarboxylation product of arginine and X-ray studies 5-tag of OcDH is crucial for crystallization 5-tag is positioned differently as in the OcDH/NADH complex Arg324 forms a salt bridge with the pyrophosphate moiety of NADH. As a consequence of the domain movement, the distance of this salt bridge is reduced from 4.3 Å (NADH complex) to 3.8 Å (L-arginine and agmatine complex), which of course will strengthen this interaction.5-tag was never detected in the crystals of the OcDH/NADH complex. Furthermore, data sets of unsuccessful soaking of agmatine into the crystals revealed structures identical to the OcDH/NADH complex with no reorientation of the his5-tag or domain closure and these data sets had no significant change in the unit cell axis. This suggests, that a significant reorientation of the two domains occurs during the process of binding of agmatine into the crystals. Obviously the conformational change is tolerated by the crystal lattice and not dictated by packing forces. Further support for this interpretation comes from a closer inspection of the his5-tag that protrudes in both structures (OcDH/NADH and OcDH/NADH-agmatine complex) in the cleft between both domains. In the OcDH/NADH complex water molecules establish a network of interactions between the protein and the his5-tag 5-tag and OcDH are observed in the OcDH/NADH-agmatine complex similar to the ones observed in the OcDH/NADH-L-arginine complex. This demonstrates that the substrate induced conformational change in the protein generates a new set of interactions that are only possible in the ternary complex. Due to this rearrangement, the diffraction quality of these crystals decreased due to the ligand-induced rotation, which is reflected in a lower resolution .As stated above, the conformational change observed here as well as the reorientation of the hisSeveral studies have been undertaken to gain insights into the kinetic mechanism of the reductive condensation of octopine and its reversible oxidation. The results of spectrometric and fluorometric studies indicated that NADH binds initially to the apo enzyme, followed by L-arginine forming the OcDH/NADH-L-arginine complex + must bind first to OcDH which has already been shown for some other dehydrogenases + are in good agreement with the binding constants reported for octopine formation by Doublet and Olomucki who used fluorometric studies obtaining values of 0.02 mM and 0.38 mM for NADH and NAD+ respectively P. maximus the L-arginine concentrations are in the mM range in this organism. Therefore the measured Kd of 4.1±0.3 mM for L-arginine to OcDH is in accordance with the in vivo levels of L-arginine The NMR titrations demonstrated that neither addition of L-arginine nor of pyruvate to the apo enzyme did induce any differences in amide cross peaks in the absence of NADH. Obviously, NADH respectively NADThe results of the NMR-spectroscopic investigations not only suggest a clear order and seuqnece of substrate binding, but also show that L-arginine binding is associated with a conformational change in solution. This confirms the conformational change substantiated in the X-ray structure of the substrate bound complex NADH binding introduces a small conformational change, as it is known for most dehydrogenases in vivo as well as in vitro experiments. As mentioned before, this leads to the conclusion that L-arginine binds prior to pyruvate and is the second substrate that binds in a sequentially ordered mechanism. L-arginine binding is associated with a conformational change, which generates the binding site for pyruvate N-(1-D-carboxylethyl)-L-norvaline dehydrogenase (CENDH) from Athrobacter spec. by Britton et al. Pecten jacobaeusPyruvate binding to the OcDH/NADH binary complex could not be detected through a shift of amide cross peaks in the NMR experiments. The binding site of pyruvate is in proximity to the NADH allowing hydride transfer. This however would lead to the formation of lactate, which cannot be detected 5-tag as well as the coenzyme NADH has been essential for the crystalisation of OcDH 5-tag binds in between both domains and is localized near the L-arginine as well as the pyruvate binding site. By soaking of the substrates into preformed crystals the structures of both OcDH/NADH-substrate complexes were solved and the binding sites revealed. Not only the binding sites were verified by an extensive mutational analysis 5 in solution never appeared to form a dimeric or higher oligomeric species, as analysed by size exclusion chromatography or native gel electrophoresis (data not shown). Furthermore a his-tag induced oligomerisation and a subsequent conformational change would have been detected in the solution NMR experiments. In all cases the T2 relaxation rate did not change. The determined T2 relaxation rate is in agreement with a monomeric OcDH under the condition of the experiments, indicating that even at the concentrations required for the NMR experiments OcDH remains monomeric (data not shown). This suggests that the conformational change observed is not induced by the his5-tag but rather via the addition of the inhibitor agmatine.Since we were not able to perform a sequence specific assignment of the amide cross peaks of OcDH via NMR we investigated the conformational change further by an inhibitor, namely agmatine, which is a L-arginine analog lacking the carboxyl group. We crystallized and solved the structure of the OcDH/NADH-agmatine complex. The hisHere a similar conformational change was observed as in the recently reported OcDH/NADH-L-arginine complex. This implies that the carboxyl group of the L-arginine amino acid is not responsible for the domain closure. OcDH has been shown to be specific for L-arginine and any other amino acid reduces the activity of OcDH by almost a factor of 100 Saccharomyces cerevisiae the ternary complex model does not represent the catalytically competent conformation of the enzyme as the substrate and cofactor are too far apart for catalysis to occur (5.7 Å) Saccharomyces cerevisiae, also the alanine dehydrogenase from Phormidium lapideum undergoes a conformational change upon substrate binding which is a perquisite for its activity In the structure of the saccharopine dehydrogenase from In summary, substrates of OcDH bind in an ordered sequential manner. First NADH binds to OcDH followed by L-arginine. The binding of the guanidinium headgroup of L-arginine induces a conformational change, resulting in the formation of the pyruvate binding site. This implies that the reduction of pyruvate can only occur in the presence of L-arginine, which than forms octopine and prevents lactate formation as earlier already observed

Microbicide candidates delivered via gel vehicles are intended to coat the vaginal epithelium after application. The coating process depends on intrinsic biophysical properties of the gel texture, which restricts the potential choices for an effective product: the gel first must be physically synthesizable, then acceptable to the user, and finally applied in a manner promoting timely adequate coating, so that the user adherence is optimized. We present a conceptual framework anchoring microbicide behavioral acceptability within the fulfillment of the product biophysical requirements.We conducted a semi-qualitative/quantitative study targeting women aged 18–55 in Northern California to assess user preferences for microbicide gel attributes. Attributes included: (i) the wait time between application and intercourse, (ii) the gel texture and (iii) the trade-off between wait time and gel texture. Wait times were assessed using a mathematical model determining coating rates depending upon the gel's physical attributes.71 women participated. Results suggest that women would independently prefer a gel spreading rapidly, in 2 to 15 minutes (P<0.0001), as well as one that is thick or slippery (P<0.02). Clearly, thick gels do not spread rapidly; hence the motivation to study the trade-off. When asked the same question ‘constrained’ by the biophysical reality, women indicated no significant preference for a particular gel thickness (and therefore waiting time) (P>0.10) for use with a steady partner, a preference for a watery gel spreading rapidly rather than one having intermediate properties for use with a casual partner (P = 0.024).Biophysical constraints alter women's preferences regarding acceptable microbicide attributes. Product developers should offer a range of formulations in order to address all preferences. We designed a conceptual framework to rethink behavioral acceptability in terms of biophysical requirements that can help improve adherence in microbicide use ultimately enhancing microbicide effectiveness. As women now account for 60% were administered by a trained interviewer and audio-recorded and then transcribed. The discussions lasted approximately 60 minutes and were conducted in English. Transcripts were analyzed and coded to ascertain common themes using the qualitative data analysis software program ATLAS.ti . Because of the responsive nature of the discussions, each focus group was unique, thus the actual coding list was refined as the coding took place. Upon completion of the coding, a second researcher examined both the final coding list and the actual coding of each transcript. Any coding discrepancies were discussed between the two researchers and coding was modified according to their agreement. The discussions focused on women's attitudes towards existing sexual and reproductive health products, including HIV/STI and pregnancy prevention methods and lubricants, attitudes towards using a new STI prevention product, self-reported risk factors for HIV, STIs, and pregnancy. We also explored inferred microbicide preferences and how women would make trade-offs in terms of their preference among products with different biophysical characteristics. Participants were presented with a 5-minute description of microbicides, and information of how microbicides might be formulated and used. To help women visualize the distinction between a ‘highly viscous’ gel and a ‘less viscous’ gel, the interviewer showed participants several different over the counter (OTC) products currently available and applied the products to her own hand to illustrate viscosity. To illustrate a highly viscous gel, Vagisil Regular Strength Anti-Itch cream was demonstrated and to illustrate a less viscous gel, KY Jelly Personal lubricant was demonstrated. Next, the women completed a brief questionnaire. The questionnaire had three main components. The first component assessed self-reported HIV/STI risk status and use of preventive methods. The second section explored microbicide preferences and how women would make trade offs in terms of their preferences among products with different biophysical characteristics. The third survey component recorded socio-demographic variables. The survey was administered by a trained interviewer and was self-administered following the focus group discussions.This present work focuses on the second component of the questionnaire, in which we asked women three sets of questions to explore the relationship between product acceptability and biophysical properties of potential microbicide products. The questions of this section were driven by the mathematical model η, where η is a representative viscosity of the gel. The thickness of the gels was expressed into sensations of ‘watery’, ‘slippery’ and ‘thick’ from physical experiences with commercial gels and was linked to three different viscosity scales coming from the common physical sense that a watery gel has a low viscosity, that a thick gel has a high viscosity etc. Lastly, the ‘constrained’ series of questions was simply revealing the links among attributes of gels that derive from biophysical constraints .The time of spread of the gels was translated from viscosity data from gels such as KY Jelly , Carraguard , and HEC .Analysis of the questionnaire data was accomplished using R statistical package R 2.10.1 , leading to three answers 1,jX, 2,jX and 3,jX. We then estimated the 3 differences a, b and c for each pair of scores: a,jD = 1,j−X2,jX, b,jD = 1,j−X3,jX and c,jD = 2,j−X3,jX and calculated their population means: k = a, b, or c and n is the number of answers. The t-test statistic was then given by p-values were then derived. The distributions of the answers (scores) corresponding to the series of questions ‘time’, ‘thickness’ and ‘constrained’ for use with a steady partner and a casual partner are presented on Results indicate that users, whether with a steady or casual partner, would prefer a gel that spreads very fast of the order of 2 to 15 minutes as compared with 1 hour or 10 hours (p<0.0001). Likewise, they prefer a gel that is thick or slippery, as compared to watery (p<0.02). Consistent with the quantitative findings, the qualitative data indicates that regardless of relationship status, women would prefer a product they can use spontaneously and one that is highly viscous, or thick and not messy. However, when asked to make a trade-off between a product they could use shortly after application but was less viscous, similar to KY Jelly, compared to a thicker, more viscous product with less leakage that would require application several hours ahead of use to be effective, we saw differences according to relationship status consistent with the quantitative data. The findings suggest that among women in casual relationships, if asked to make a trade-off between viscosity and wait time, the priority for such women overall is to have a product which could be effective quickly (little wait time), regardless of viscosity. Indeed, when probed further, many women reported that a less viscous microbicide could even be appealing if it could enhance pleasure, such as a ‘warming’ gel or lubricant. Women in steady relationships were more concerned about the effectiveness of the product for prevention of pregnancy or STIs/HIV as it would be easier for them to plan ahead compared to women being in a casual relationship.We designed a conceptual study where for the first time the behavioral acceptability of microbicide gels is realistically constrained and interpreted through the biophysical reality of the gels themselves. Specifically, we conclude that at the population level there is a fairly uniform spectrum of preferences for gels of different thicknesses (and so wait times) for women in a steady relationship, and a preference for a gel that spreads very fast as compared with a gel having intermediate properties for women in a casual relationship. In that sense, developers should offer a range of formulations in order to address the preferences of all users and therefore increase adherence. Though our results are not exhaustive due to the limitations of the sample size (N = 71), and although we would do well to incorporate a number of other attributes, the work here still introduces a new approach in the field. One could now use the latter approach to broaden the conversation and include questions with more characteristics that can govern gel coating such as pH, temperature The approach is novel as it presents for the first time a critical biophysical framework in which to rethink the acceptability of microbicide gel vehicles. The latter framework would ensure that end users like the gels' features offered by market developers, identifying individualized prevention strategies and generating the highest usage rates. It will help refine and tailor the microbicide gels' application instructions given to participants of clinical trials, and will help design future products that can achieve greater compliance rates. This is important, as poor adherence can contribute to the lack of effectiveness or reduced effectiveness observed in the clinical trials This work fits well into the new era of conceptualizing a mechanistic model to guide microbicide development

The second author's name is incorrect. The correct name is: Borbála Győri. The correct citation is: Gácsi M, Győri B, Virányi Z, Kubinyi E, Range F, et al. (2009) Explaining Dog Wolf Differences in Utilizing Human Pointing Gestures: Selection for Synergistic Shifts in the Development of Some Social Skills. PLoS ONE 4(8): e6584. doi:10.1371/journal.pone.0006584

The pyrrolidine ring adopts a twist conformation. An intra­molecular O—H⋯O hydrogen bond generates an S(6) ring motif. A weak intra­molecular C3—H3⋯O3 inter­action is also observed. In the crystal, mol­ecules are linked by two sets of N—H⋯O hydrogen bonds, forming centrosymmetric dimers containing two R 2 2(8) ring motifs. The dimers are linked via C—H⋯π inter­actions.In the title compound, C Å b = 11.0258 (3) Å c = 12.9663 (4) Å α = 69.111 (1)°β = 72.044 (2)°γ = 66.410 (1)°V = 1163.93 (6) Å3 Z = 2 Kα radiationMo −1 μ = 0.09 mmT = 293 K 0.20 × 0.20 × 0.20 mm Bruker SMART APEXII area-detector diffractometerSADABS; Bruker, 2008T min = 0.982, T max = 0.982Absorption correction: multi-scan (21655 measured reflections5795 independent reflectionsI > 2σ(I)4635 reflections with R int = 0.023 R[F 2 > 2σ(F 2)] = 0.040 wR(F 2) = 0.119 S = 1.03 5795 reflections329 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.22 e Å−3 Δρmin = −0.19 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997SHELXL97 and PLATON (Spek, 2009Data collection: 10.1107/S1600536810010500/ci5061sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810010500/ci5061Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The serum/plasma proteome was explored for biomarkers to improve the diagnostic ability of CA19-9 in pancreatic adenocarcinoma (PC).A Training Set of serum samples from 20 resectable and 18 stage IV PC patients, 54 disease controls (DCs) and 68 healthy volunteers (HVs) were analysed by surface-enhanced laser desorption and ionisation time-of-flight mass spectrometry (SELDI-TOF MS). The resulting protein panel was validated on 40 resectable PC, 21 DC and 19 HV plasma samples and further by ELISA on 33 resectable PC, 28 DC and 18 HV serum samples . Diagnostic panels were derived using binary logistic regression incorporating internal cross-validation followed by receiver operating characteristic (ROC) analysis.vs DC and from PC vs HV samples gave the ROC area under the curve (AUC) of 0.90 and 0.90 compared with 0.87 and 0.91 for CA19-9. The AUC was greater when CA19-9 was added to the panels and confirmed on the validation-1 samples. A simplified panel of apolipoprotein C-I (ApoC-I), apolipoprotein A-II (ApoA-II) and CA19-9 was tested on the validation-2 set by ELISA, in which the ROC AUC was greater than that of CA19-9 alone for PC vs DC (0.90 vs 0.84) and for PC vs HV (0.96 vs 0.90).A seven-protein panel from the training set PC A simplified diagnostic panel of CA19-9, ApoC-I and ApoA-II improves the diagnostic ability of CA19-9 alone and may have clinical utility. Diagnostic serum biomarkers for pancreatic cancer are unsatisfactory . CA19-9,The low-molecular-weight proteome (<10 kDa) is a rich source of new potential biomarkers, but these do not resolve easily with 2D gel electrophoresis . Consequently, this paper describes an international study using SELDI-TOF MS to identify biomarkers that are followed by the use of ELISA to validate these on a further set of samples in which the disease controls (DCs) had severe pancreatic pathology. This work therefore aims to develop improved biomarkers that would be useful in the diagnosis of patients at an increased risk of pancreatic cancer.A total of 319 samples were obtained with patient consent. Training serum samples were obtained from 160 patients (the Training Set) managed at Centre-1 and their protein panels were validated against 80 plasma samples collected from subjects treated at Centre-2 classifiThe study was approved by the ethics committees of the Northern Sydney Health Human Research, Sydney, Australia and the University of Verona, Verona, Italy.M urea/1% CHAPS), and then centrifuged at 12 000 r.p.m. for 5 min). The supernatant was diluted 1 : 25 with trifluoroacetic acid (TFA), added to 50% acetonitrile/0.5% TFA, spotted on a hydrophobic (H50) protein chip array and processed as previously described (Serum or plasma was diluted 1 : 1 with denaturing buffer (8 m/z range 2500–75 000 with a laser intensity setting of 220 (arbitrary units) and detector sensitivity set at 8. The laser was optimised for 4000–20 000 m/z peaks, whereas peaks <1000 m/z were deflected from the detector. Mean values from duplicate samples were used in subsequent analyses. The m/z value for each of the peaks was determined using external calibration with known standards : bovine insulin (5734.51 +1H), equine cytochrome c (12 361.96 +1H), equine apomyoglobin (16 952.27 +1H) and rabbit muscle aldolase (39 212.28 +1H). Spectra were analysed using the Ciphergen Protein Chip Software Version 3.1 (Bio-Rad).Mass spectra were generated in the M acetic acid/0.1 M NaCl (pH 3.0) and fractions were monitored on SELDI using normal phase NP20 chips. Pooled fractions containing maximum activity were subjected to reverse-phase high-performance liquid chromatography (HPLC) on a 4.6 × 250 mm Jupiter 5 μm, 300Å C18 column after 30 min of gradient elution (15–60% acetonitrile in 0.1% TFA), and fractions were again monitored by SELDI-TOF MS on NP20 chips. The fraction containing the peaks of interest was lyophilised and then sent to the Bioanalytical Mass Spectrometry Facility for identification by tryptic peptide mass fingerprinting and MS sequencing. To confirm the protein identities, a SELDI immunoadsorption approach was performed. In this instance, a rabbit polyclonal Apolipoprotein C-I (ApoC-I) antibody was bound to an RS100 protein chip array and analysed on the SELDI-TOF MS.The proteins of interest were size fractionated on a Superose 12 HR 10/300 GL column , equilibrated and eluted with 0.1 m/z 16 989, 17 132 and 17 247 were identified by a different strategy from above, following the report of m/z 17 270 and 17 390 in human serum SELDI profiles as apolipoprotein A-II (ApoA-II) homodimers. The serum of patients suffering from PC and the purified human plasma ApoA-II were directly submitted to an RS100 preactivated chip coupled with ApoA-II antibody .The three protein peaks at μM dithiothreitol (DTT) from 0 to 4 h, respectively, and subjected to western blotting analysis with anti-ApoA-II antibody (AbCam) as described in a previous study . Sample group statistics were performed on peak intensity values for profiles of PCs vs DCs and HVs. Univariate analysis of individual peaks was performed using the non-parametric Mann–Whitney U-test with significance considered at P<0.05. The discriminatory power for each marker was characterised by receiver operating characteristic (ROC) area under the curve (AUC) analysis and the AUCs were compared using the Hanley and McNeil method using the multivariate binary logistic regression with ten-fold cross-validation technique previously described . Likelihood ratios (LRs) were calculated for each model to estimate the ratio of the likelihood of the test result in patients with disease to the likelihood of the same test result in patients without disease. Results with an LR of >10 or <0.1 effect a substantial change on disease likelihood over a broad range of pre-test estimates, whereas an LR of 1.0 leaves the likelihood of disease unchanged , respectively. Absorbance was measured at 450 nm on a microplate reader within 10 min.Having developed the protein biomarker panel with SELDI, further confirmation was sought using ELISA as follows. Duplicate serum or plasma levels of CA19-9 were measured by ELISA kit for which normal values were set at <37 U mlThree separate groups of subjects were studied. The initial training set from centre-1 consisted of 160 samples: 38 from PC patients , 54 DC samples from patients with other pancreatico-biliary disorders and 68 samples from HVs . Althougχ2=2.1, NS), but the median values were marginally different (P=0.047). The HVs had normal liver function values.Validation-2 samples were from a further 79 patients from centre-1: 33 PC samples (21 from patients who underwent resection), 28 DC subjects (18 underwent pancreatic resection whereas 10 had therapeutic endoscopic retrograde cholangiopancreatography (ERCP)) and 18 HV subjects. The DCs and HVs had similar age and sex distribution . In the –1 (±2.1), respectively; P<0.001). Mean CA19-9 values were also higher in the stage IIb and IV patients (2212±1354 U ml–1) compared with the early stage I and IIa patients (163±19 U ml–1), but this was not statistically significant using the Mann–Whitney test.Blood CA19-9 levels were elevated in 63 of 78 PCs, 20 of 75 DCs and 15 of 85 HVs with greater mean (± s.e.m.) values in PC compared with DC and HV patients (CA19-9=1192.2 (±477.0), 34.3 (±5.0) and 19.7 U mlm/z range 3000–20 000 were analysed. In the training set samples, 21 peaks were found to be differentially expressed between PCs and DCs. These individual putative tumour markers had ROC AUC values ranging from 0.62 to 0.81, with 14 upregulated in PC patients that correctly classified 74% of PC and 87% of DC serum samples (ROC AUC: 0.90 (0.85–0.96), Differences in SELDI profiles were observed between PC, DC and HV subjects using the H50 protein chip array . In all,patients . Logistianalysis . This seP<0.05) and were significantly greater than that for CA19-9 alone , -9 alone .P-value ⩽0.01, using logistic regression analysis that correctly classified 71% of PC and 96% of HV serum samples (ROC AUC: 0.90 (0.84–0.96), P<0.05) than for the protein panel or CA-19-9 alone – 92% of PC and 97% of HV samples were correctly classified (ROC AUC: 0.99 (0.98–1.00)).In all, 18 peaks were found to be differentially expressed between PCs and HVs, 13 with a analysis . The tenP<0.05) the classification, identifying 93% of PC and 84% of HV samples (ROC AUC: 0.96 (0.91–1.00)), which was greater than that for CA19-9 alone (ROC AUC: 0.81 (0.61–0.92), but this did not reach significance.When the logistic regression equation from the training set was applied to the validation-1 sample set, 90% of PC and 74% of HV serum samples were correctly classified (ROC AUC: 0.90 (0.81–0.98), m/z 6420 peak and the others were closely correlated with the m/z 17 247 peak. Subsequent analysis of the identities of these peaks clarified this correlation.Spearman's correlation coefficients for the variables selected in the above protein panels indicatem/z 6420 and 6618 peak intensities were purified for identification of the apparent 6.6 kDa proteins. The protein fractions were monitored on SELDI using NP20 chips and for ApoC-I were 107 (4), 101 (6) and 124 g l–1 (12). For ApoC-1 the difference between DCs and PCs indicated a trend to significance at P=0.07 and the mean ApoA-II values were different between HVs and PCs (P=0.001), whereas the mean differences between DCs and PCs were not significant. Although there were significant differences between the PC and DC patients in the values of bilirubin and other liver function tests, these were less significant than those from the training sets (vs HV and 0.68 (0.55–0.81) for PC vs DC patients. The addition of these proteins to CA19-9 improved the ROC AUC compared with CA19-9 alone to 0.96 (0.90–1.0) vs 0.90 (0.80–0.99) for HV samples and 0.90 (0.82–0.98) vs 0.84 (0.74–0.95) for DC samples (ELISA mean (s.e.m.) measurements on the HV, DC and PC validation-2 set for ApoA-II were 55 (2), 47 (1) and 44 g ling sets . ROC ana samples . MultivaThis international collaborative study shows the utility of SELDI-TOF MS for identification of potential diagnostic biomarker panels that have been confirmed on two independent sample sets. The significant proteins in the diagnostic panel were identified as ApoA-II and ApoC-I. This allowed for a simplified panel, the efficacy of which was confirmed on validation-2 samples by ELISA. Although this study has similar motives to previous studies using SELDI-TOF MS on 24 subjects, and developed training models using a support vector machine algorithm that selected four peaks, three from the CM10 protein chip and one from the H50, which when combined could distinguish pancreatic cancer from healthy controls with high sensitivity and specificity. The SELDI-derived panel was superior to that of CA19-9 alone, but was further improved in combination with CA19-9. A fifth recent study compared serum from cancer patients and healthy volunteers and showed that a panel of three proteins had a sensitivity of 83% and a specificity of 96% when tested in an independent validation set of samples. Interestingly, ApoA-II was identified, along with ApoA-I and transthyretin and a truncated isoform that lacks N-terminal Thr-Pro- (6432 Da) (This study found that the 6432 Da) . ApoC-I α-2 macroglobulin, ceruloplasmin and complement 3C. The inflammatory process associated with cancer may have important prognostic implications (This international collaborative study confirms the usefulness of SELDI-TOF MS for exploration of low-mass proteome (

Mlo gene confer durable broad-spectrum resistance against the powdery mildew pathogen, Blumeria graminis f.sp. hordei. Mlo codes for a member of a plant-specific family of polytopic integral membrane proteins with unknown biochemical activity. Resistant barley mlo mutant alleles identify amino acid residues that are critical for Mlo function in the context of powdery mildew susceptibility.Recessively inherited natural and induced mutations in the barley mlo mutants and used site-directed mutagenesis in combination with transient gene expression to unravel novel amino acid residues of functional significance. We integrate these results with previous findings to map functionally important regions of the heptahelical Mlo protein. Our data reveal the second and third cytoplasmic loop as being particularly sensitive to functional impediment by mutational perturbation, suggesting that these regions are critical for the susceptibility-conferring activity of the Mlo protein. In contrast, only mutations in the second but not the third cytoplasmic loop appear to trigger the Endoplasmic Reticulum-localized quality control machinery that ensures the biogenesis of properly folded membrane proteins.We molecularly analyzed a novel set of induced barley Our findings identify functionally important regions of the polytopic barley Mlo protein and reveal the differential sensitivity of individual protein domains to cellular quality control. Hordeum vulgare), polygenic resistance, dominantly inherited resistance (R) genes or recessively inherited mutants of the Mildew resistance locus o (Mlo) confer protection against the fungal disease [R genes usually provide isolate-specific resistance that is of little constancy under field conditions, mlo resistance is broad-spectrum and durable [Mlo locus, which can be obtained by mutagenesis of any susceptible wild type line, were first described in the 1940s [mlo mutants [mlo allele has been reported to date. This allele (mlo-11) originates from an Ethiopian landrace and represents the major source of mlo resistance introgressed into cultivated European spring barleys [Mlo gene encodes the founder of a family of plant-specific integral membrane proteins with heptahelical topology and yet unknown biochemical activity [Mlo genes are organized in small- to medium-sized families per higher plant species [Mlo locus have for a long time thought to represent a unique feature of the monocot barley. Recently, however, mlo resistance was also discovered in the dicot species Arabidopsis thaliana and Solanum lycopersicum (tomato), either caused by induced mutant alleles or as a consequence of a naturally occurring deletion in the coding region, respectively [The powdery mildew disease, caused by obligate biotrophic ascomycete fungi of the order Erysiphales, is a major impediment for cereal (e.g. wheat and barley) agriculture in temperate climates. In barley barley lines, but clearly distinct from the near complete penetration resistance seen in mlo null alleles. We reasoned that this landrace either expresses a type of powdery mildew resistance that is different from mlo-conditioned resistance, or that it may contain a weak natural mlo allele with residual susceptibility-conferring activity. To differentiate between these two possibilities, we extracted RNA from accession CGN0524 and performed reverse transcription-polymerase chain reaction (RT-PCR) to amplify and sequence the Mlo cDNA sequence of this line. Compared to the reference sequence substitution at the amino acid level. The predicted amino acid exchange is located in the second transmembrane domain of the heptahelical Mlo protein. The respective polymorphism is neither present in the Mlo sequence of a selection of European barley cultivars nor in the Mlo sequence of 40 analyzed barley Hordeum spontaneum accessions of broad haplotype diversity [mlo allele.We previously identified the Z83834; ) we deteBgh entry rates) of the partial penetration resistance in this accession upon overexpression of a wild type Mlo cDNA. This experiment resulted in the reinstatement of a Bgh entry rate that is typical for the complementation of mlo resistance in this assay and mlo28 (T222I); [mlo-typical recessive inheritance and allelism with known mlo mutants need to be formally proven by future test crosses of the accession with barley Mlo and mlo genotypes.To further assess this hypothesis we used the previously described transient gene expression assay in single barley leaf epidermal cells to analy(T222I); ) Howevermlo allele. Indeed, first leaves of selfed progeny of these two lines (5589-1-1 and 5590-1-1) showed no visible signs of infection except for an occasional infection type 4 (compatible), resulting in few mildew colonies. These colonies were about half the size compared to colonies on the susceptible barley cultivar Manchurian. Such a reaction has been previously designated as 0/(4) and is characteristic of mlo resistance [Next we analyzed powdery mildew infection types of two barley landrace accessions (lines 5589 and 5590) collected in Yemen. Based on an inoculation survey with a broad range of powdery mildew isolates , these two accessions, which originate from the Al Bayda' province of Yemen, were suspected to harbor a sistance .mlo-11 allele. PCR analysis using genomic DNA and two specific primer pairs (one diagnostic for the presence of the mlo-11 repeat structure and the other indicating presence/absence of a Miniature inverted repeat transposable element (MITE) associated with the terminal repeat in the majority of mlo-11 genotypes) revealed that both 5589-1-1 and 5590-1-1 harbor the mlo-11-typical repeat units showed resistance to a set of 19 tested Bgh isolates. Resistance of these lines was thus suspected to be based on a mutation at the Mlo locus [mlo-11 allele at the protein level. This sequence polymorphism is identical to the mlo-1 mutant allele, which was originally induced in cultivar Haisa by X-ray mutagenesis [mlo-1 allele, which are typically characterized by light seed coats. To resolve whether line RAH4124 harbors an independent and possibly natural version of the mlo-1 mutant allele we performed molecular fingerprint analysis at the Mlo locus. We employed previously described simple sequence repeat (SSR) markers that are located few kb upstream of the Mlo gene and that were found suitable, owing to their highly polymorphic character, to display the haplotype diversity of cultivated and wild barleys [mlo-1 mutant in cultivar Haisa as well to a mlo-1-containing backcross line (7 times backcrossed) in cultivar Ingrid infection phenotype, suggesting that they are affected at the Mlo locus. Moreover, for two of the mutant plants (mlo-2 and mlo-6) an allelic relationship with other mlo mutants has been shown [Given the limited success to identify new natural agenesis ,20,23. Tterature . The resen shown .Mlo coding sequence. Amplified Mlo cDNA sequences were subjected to sequence analysis. In most cases we identified single nucleotide polymorphisms that either lead to a single amino acid substitution or a premature stop codon revealed evidence for aberrant Mlo transcript splicing, owing either to the presence of multiple aberrant transcript versions or the presence of one aberrant transcript type harboring the entire Mlo intron 3 (mlo-44).We extracted total RNA from first leaves of the respective powdery mildew resistant mutant plants and used it as template for RT-PCR-based amplification of the mlo-6, pooled cDNAs were cloned into vector pCR-BluntII-Topo and seven individual recombinant clones subjected to sequence analysis. This revealed a G to A mutation in the AG consensus 3' splice site of intron 4, resulting in four distinct versions of the Mlo cDNA, including a wild-type-like cDNA and three incorrectly spliced variants (data not shown). All anomalous splicing variants give rise to frame shifts and premature stop codons. Occurrence of a low level of correctly spliced cDNAs in the mlo-6 mutant indicates that the defective 3' consensus splice site is still being used, though seemingly with a lower efficiency. In case of mlo-44, a G to A mutation in the GT consensus 5' splice site sequence of intron 3 results in a complete lack of splicing of this intron. Consequently, the respective cDNA harbors the entire intron 3 sequence, leading to an aberrant coding sequence and a premature stop codon (data not shown).In case of mlo alleles , of which two harbor mutations in splice junctions (mlo-6 and -44), while four result in a premature stop codon and seven give rise to single amino acid substitutions in various regions of the Mlo protein (mlo-2 (A349T), -35 (H231L), -37 (S71F), -38 (G318R), -40 (G264D), -41 (R209K), and -42 (S187L); additional file Mlo cDNAs of cultivars Bonus and Kristina prevents discrimination of these two scenarios. Interestingly, the same amino acid residue (glycine 318) is affected in the previously described fully independent mlo-27 allele in the genetic background of cultivar Plena; however, in the latter mutant the glycine residue is replaced by glutamic acid , -35 H1L, -37 (mlo-33 (A306T) and mlo-29 (P334L) and focused on amino acid residues in this part of the protein that are conserved with respect to their biochemical characteristics between the barley Mlo and Arabidopsis thaliana AtMLO2 co-orthologs [Mlo coding sequence were modified by PCR to encode alanine instead of the respective authentic amino acid (see Methods for details). This resulted in a set of twelve site-directed mlo mutants. Additionally, we generated barley Mlo cDNA analogs of three mutants originally discovered in AtMLO2 [Atmlo2-9, Atmlo2-10 and Atmlo2-11, which are each characterized by a single amino acid substitution in the AtMLO2 coding region and affect the second cytoplasmic loop of the AtMLO2 protein . We identified the corresponding residues in the barley Mlo protein by comparative amino acid sequence alignment protein accumulation , mlo-27 (G318E), mlo-29 (P334L) and mlo-33 (A306T)) are affected in amino acids that are located in cytoplasmic regions of the Mlo protein. Since information about the in planta protein accumulation of Mlo variants encoded by mutant alleles mlo-35 (H231L), mlo-41 (R209K) and mlo-42 (S187L) is lacking to date, this figure might be even higher. Moreover, the three single amino substitution variants that were engineered in the barley Mlo protein based on the data of powdery mildew resistant Arabidopsis Atmlo2 mutant alleles also localize to a cytoplasmic loop. It is noteworthy that with the exception of site-directed mutants in cysteine residues [mlo mutant was identified that codes for a mutation in an extracellularly localized amino acid. It thus appears that the cytoplasmic regions are of particular importance for Mlo function in the context of powdery mildew susceptibility. Cytoplasmic loop-loop interplay was previously suggested to be crucial for Mlo activity [mlo mutants that is thought to reflect a genuine Mlo activity [In this study we molecularly characterized a variety of novel natural and induced S187F, D9N, D251N S187F, D9N, D251Nactivity ,33. Altemlo-29 P3L and mlo mlo-35 H1L, mlo-4mlo mutants encode protein variants that show reduced Mlo accumulation , mlo-7 (G226D), mlo-12 (F240L), mlo-28 (T222I) and Mlo D219N), while the nine tested mutant variants of the small third cytoplasmic loop (encoded by mlo-27 (G318E), mlo-29 (P334L), mlo-33 (A306T), Mlo P320A, P324A, F329A, W330, F331A, R33A) are all stable in planta. We hypothesize that the larger second cytoplasmic loop is a major quality determinant of the Mlo protein, while mutations in the smaller third cytoplasmic loop appear to escape the ERAD machinery. This effect could be related to the size difference and/or the topology of the two cytoplasmic regions, which may result in a more prominent exposure of amino acid residues from the bulky second loop. Based on consensus secondary structure prediction of the second and third cytoplasmic loop , mlo-12 (F240L) and mlo-13 (V30E) require Hrd1p for ERAD-based degradation in yeast [Besides the second cytoplasmic loop, the transmembrane regions also seem to be sites that are particularly sensitive to mutational perturbations that result in reduced Mlo accumulation. This appears plausible since, in the case of integral membrane proteins, the delay or failure of mutant variants to co-translationally integrate into the ER lipid bilayer is known to lead to recognition by components of the ERAD-M pathway, relocation from the ER membrane and subsequent protein degradation. It is assumed that misfolded transmembrane domains expose hydrophobic amino acid side chains to the lipid bilayer, which are sensed by the transmembrane domain of the ERAD component Hrd1p, an ER-localized integral membrane protein with a C-terminal RING domain and E3 ubiquitin ligase function . Notablyin yeast .mlo alleles. Besides one presumptive mlo variant with a single amino acid polymorphism, we found the well-known mlo-11 allele in a set of additional powdery mildew resistant landraces and in two accessions from Yemen. The latter result challenges the proposed origin of the mlo-11 mutant in the Ethiopian highlands. Based on our new findings it remains at present unclear whether the mlo-11 mutant was introduced from Ethiopia to Yemen or vice versa. In principle, the mlo-11 allele may have originated even from another country of this geographical area. This example highlights the difficulties in tracing the roots and authentic population structure of wild plant communities in the context of anthropogenic perturbations such as agriculture, trading and, more recently, tourism. This problem is also exemplified by the mlo-1 mutation that was found to be introgressed into a presumed Turkish "landrace". Descriptive analyses of natural accessions should thus be accompanied by supporting molecular analyses whenever possible.In the context of the present study we also aimed to identify novel natural mlo mutants and their molecular defects that might be useful for plant breeding purposes and future research on Mlo protein function. Our data identifies the second and third cytoplasmic loop as functionally relevant sites of the polytopic barley Mlo protein. In contrast, only mutant variants with defects in the bulky second cytoplasmic loop serve as substrates for the cellular ERAD quality control system. The findings suggest the presence of molecular "hot spots" for the recognition of malformed protein variants by the ERAD machinery.We provide a comprehensive compilation of http://www.cgn.wur.nl/UK/).Barley accessions CGN0519 1013, CGN0520 1014, CGN0521 1015, CGN0523 1016, CGN0524 1017, CGN0526 1018 and CGN0527 1019 were obtained from the Centre for Genetic Resources in Wageningen , while lines backcross Ingrid (BCI) mlo-1, mlo-2, mlo-3 and mlo-6 were a gift from J. McKay . Accessions 5589 and 5590 were collected in Yemen and kindly provided by J. Valkoun, J. Konopka and S. Ceccarelli , while accession RAH4124, collected in Turkey, was previously described [Blumeria graminis f.sp. hordei isolate K1 was used for all experiments in this study. Fungal inoculum was regularly propagated on a susceptible barley line in a controlled growth chamber.Candidate barley escribed and kindescribed . BlumeriEco RV or Hin dIII and fragments separated by agarose gel electrophoresis. Upon transfer to a nylon membrane, the blot was probed with radiolabelled Mlo full-length cDNA in standard conditions.Genomic DNA of barley was digested with either mlo-11 repeat units was determined by PCR using oligonucleotide primers ADUP7 (5' CTC AAG CTT GCC ACC ATG TCG GAC AAA AAA GGG G 3') and Mlo6 (5'-CAT CTA CTA CTA GCA TGT ACC-3'). This combination amplifies a ~1.2 kb mlo-11 repeat-specific fragment from genomic template DNA. Additionally, PCR reactions using oligonucleotide primers Mlo6 and Mlo10 (5' GTC CTG CCA CCT AAG TAG CAG 3') were used. This combination amplifies a ~380 bp fragment from Mlo genotypes and a ~440 bp fragment from most mlo-11 genotypes [Presence of enotypes .Mlo, previously described microsatellite and MITE markers (7646) were used. Oligonucleotide sequences for amplification of the markers from barley genomic DNA were reported in [For haplotype analysis at orted in . AmplicoMlo cDNA was amplified by RT-PCR using oligonucleotides Mlo38 and Mlo40 as forward and reverse primers, respectively. Sequences of Mlo cDNAs were determined using primers Mlo4 (5'-AAG GCG GAG CTC ATG CTG GTG GGC-3'), Mlo5 (5'-ACG CGT TAG AGC TAT GGA GAT GAC-3'), Mlo34 (5'-CGA TGG AGG ACG ACT TCA AGG-3') and Mlo1 (5' TGG TGG GGC TAG CTC TCC AG 3'). Sequencing was performed by the MPIZ DNA core facility on Applied Biosystems Abi Prism 377, 3100 and 3730 sequencers using BigDye-terminator v3.1 chemistry. Premixed reagents were from Applied Biosystems. Oligonucleotides were purchased from Invitrogen . Partial Mlo cDNAs of mutant mlo-6 were cloned into vector pCR-BluntII-Topo using the Zero Blunt TOPO PCR cloning kit and DNA sequencing in this vector performed with the T7 primer.Total RNA was extracted from seven-day-old barley leaves using the Trizol reagent according to the instructions of the manufacturer. cDNA synthesis was carried out with Superscript II Reverse Transcriptase based on oligo-dT priming. Mlo wild-type coding sequence by PCR-based site-directed mutagenesis . The two resulting PCR products were mixed, annealed and extended by few PCR cycles. The resulting full-length fragments were cloned into appropriate vectors and confirmed by DNA sequencing as described above.Mutations were introduced into the ension"; ). BrieflBlumeria graminis f.sp. hordei isolate K1) conidiospores. Histochemical staining for β-glucoronidase (GUS) activity was performed at 48 hours post inoculation [Ballistic transformation of detached barley leaves was carried out as previously described ,38 usingAY436765) that contains two separate expression cassettes: one consisting of a doubled cauliflower mosaic virus 35S promoter, an in frame fusion of Mlo and Renilla luciferase cDNAs and 35S terminator, the second comprising of 35S promoter, firefly luciferase and 35S terminator. Derivatives of this plasmid expressing Mlo variants as translational fusions with Renilla luciferase were generated by placement of suitable restriction fragments. Arabidopsis thaliana cells were propagated as reported in [2, harvested by centrifugation (15.000 g), shock-frozen in liquid nitrogen and extracted in the lysis buffer supplied with the dual luciferase kit. Measurements of enzyme activities were performed according to the manufacturer's instructions. Renilla luciferase activity was set in relation to firefly luciferase activity and the ratio obtained with wild-type Mlo set as 100%.Dual luciferase assays were performed as previously described ,25. We uorted in . Protoplorted in using a http://www.compbio.dundee.ac.uk/www-jpred/ was used to calculate consensus secondary structures of the second and third loop of monocot and dicot Mlo orthologs . Multiphordei; ER: Endoplasmic Reticulum; ERAD: Endoplasmic Reticulum-Associated Protein Degradation; GUS: β-glucoronidase; RT-PCR: reverse transcription-polymerase chain reaction.Bgh: Blumeria graminis, f.sp. mlo alleles, generated plasmid constructs and performed the transient gene expression assays in barley; JM carried out the dual luciferase assays; JHC screened barley accessions; PP performed the Southern blot analysis shown in Figure AR conducted the molecular analysis of mlo allelesCompilation of molecularly characterized . This file provides an overview about the 36 mlo alleles characterized at the molecular level to date. It lists the mother variety, mutant ID, the mutagen, the mutational event at the DNA and protein level as well as references for each of the mutants.Click here for file

For the applications of hindered phenol-based anti­oxidants, see: Kim & Lee 2003; Um & Le21H27NO3SCM r = 373.50 Triclinic, a = 5.6305 (1) Å b = 9.3489 (2) Å c = 18.8749 (3) Å α = 85.505 (1)°β = 89.453 (1)°γ = 87.834 (1)°V = 989.77 (3) Å3 Z = 2 Kα radiationMo −1 μ = 0.18 mmT = 100 (2) K 0.25 × 0.15 × 0.05 mm Bruker SMART APEX diffractometerSADABS; Sheldrick, 1996T min = 0.956, T max = 0.991Absorption correction: multi-scan (12688 measured reflections4507 independent reflectionsI > 2σ(I)3746 reflections with R int = 0.028 R[F 2 > 2σ(F 2)] = 0.042 wR(F 2) = 0.127 S = 1.18 4507 reflections239 parameters1 restraintH atoms treated by a mixture of independent and constrained refinementmax = 0.75 e Å−3 Δρmin = −0.71 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008X-SEED (Barbour, 2001publCIF (Westrip, 2008Data collection: 10.1107/S1600536808026056/tk2295sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808026056/tk2295Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Many cell lines derived from tumors as well as transformed cell lines are far more sensitive to V-ATPase inhibitors than normal counterparts. The molecular mechanisms underlying these differences in sensitivity are not known. Using global gene expression data, we show that the most sensitive responses to HeLa cells to low doses of V-ATPase inhibitors involve genes responsive to decreasing intracellular iron or decreasing cholesterol and that sensitivity to iron uptake is an important determinant of V-ATPase sensitivity in several cancer cell lines. One of the most sensitive cell lines, melanoma derived SK-Mel-5, over-expresses the iron efflux transporter ferroportin and has decreased expression of proteins involved in iron uptake, suggesting that it actively suppresses cytoplasmic iron. SK-Mel-5 cells have increased production of reactive oxygen species and may be seeking to limit additional production of ROS by iron. Inhibitors of the vacuolar-type (H+)-ATPase (V-ATPase) have been investigated as potential therapeutics for cancer 1, that is joined by several linkages to an integral membrane complex, V0. Hydrolysis of ATP by subunits of V1 is converted into mechanical rotation in V0 that moves protons from the cytosolic to the lumenal side of the membrane in which V0 resides. The activity of the V-ATPase is controlled by multiple mechanisms so that when disassembled, V1 does not hydrolyze ATP and V0 does not rotate and transport protons The V-ATPase is a large, protein complex that can transport protons across membranes against a pH gradient and thus generate the acidic environment found in endocytic organelles, the Golgi apparatus and the Trans-Golgi Network In both the secretory and the endocytic pathways pH gradients are critical for many functions. The lumen of the endoplasmic reticulum is neutral and that of the Golgi complex is acidic and this difference is used to regulate the binding of escaped ER chaperones in the acidic Golgi by the KDEL receptor, which recycles to release them at the neutral ER To investigate the basis for the differential sensitivity of cancer cells to inhibitors of the V-ATPase, we have made use of the observation that cells often respond to stress by up-regulating critical components of pathways that are sensed to be failing, as for example the response to the failure of protein folding in the endoplasmic reticulum To determine which metabolic pathways were stressed by low doses of V-ATPase inhibitors, we first determined the dose response to two different inhibitors of the V-ATPase on several cell lines. We wished to find a concentration of each inhibitor that would show an effect on growth, indicating that cells were responding to the stimulus, but which was not so toxic that the response would be prevented or complicated by cells dying during the experiment. The cell lines we tested had IC50s to bafilomycin A that ranged from 10 nM to greater than 10 µM and we chose the moderately sensitive cell line HeLa (IC50 = 150 nM) for our experiments because its relatively shallow dose response made for more uniform growth inhibition experiments, suggesting that the gene expression experiments would also be more reproducible. We also chose to compare two inhibitors of the V-ATPase that act through distinct mechanisms Two major pathways for uptake of nutrients into cells depend upon the acidity in endosomes supplied by the V-ATPase. Inhibiting the V-ATPase will interfere with the delivery of iron into the cell by preventing the release of iron from transferrin and also prevents uptake of cholesterol by inhibiting the release of LDL from its receptor. Therefore we treated HeLa cells for 6 or 12 hours with deferoxamine (DFO) to chelate iron and separately with medium lacking LDL to mimic inhibiting uptake of exogenous cholesterol through the LDL receptor. Controls were matched samples cultured in normal culture medium. These samples were processed for microarrays exactly as samples treated with V-ATPase inhibitors. In this way we could identify all genes responding by increased transcription when iron was deficient or LDL uptake was blocked. Data was processed by the UT Southwestern DNA Micro Array Core Facility using GCOS software with MAS5 normalization and experimental samples were compared to the DMSO treated samples, or, for DFO or low LDL conditions, samples cultured in normal medium run at the same time to calculate the magnitude of change.Genes were considered to show significantly increased expression if both samples at one time point with either Baf or LX1077 had a change P value of less than 0.002 and the average of the two samples increased more than 2-fold. In most cases, Baf induced transcription more than LX1077, although the genes responding to Baf also responded to LX1077. The genes that increased transcription earliest are shown in After longer intervals of treatment with V-ATPase inhibitors, 52 genes that had increased in response to 12 hours culture in low LDL medium also showed increased expression in cells treated for 24 hours with V-ATPase inhibitors . Eight oAs one would expect, if both increases and decreases in gene expression are considered, after 24 hours in Baf there is a complicated response involving a number of pathways that control growth and response to stress . The mosOur original intent in pursuing these studies was to investigate the causes of differential response to V-ATPase inhibitors seen in cancer cells. Because the major immediate responses to inhibition of the V-ATPase were to the lack of iron or cholesterol, we investigated if these were responsible for the hypersensitivity of some cancer cells to V-ATPase inhibitors . We measTo investigate the mechanism of cytotoxicity induced by Baf in SK-Mel-5 and HeLa cells, we treated cells of each line with 0 to 1000 nM Baf for 24 hours and then investigated the cleavage of PARP or caspase 3 as signs for the induction of apoptosis . In bothBoth SK-Mel-5 cells and MCF7 cells were more sensitive to Baf than HeLa cells and this difference in sensitivity was abolished by supplementing the culture medium with iron . Thus weThe differences in expression of transferrin receptor and ferroportin in SK-Mel-5 cells were not due to an inability to regulate these proteins in response to iron. When SK-Mel-5 cells or HeLa cells were treated with DFO to chelate iron, both upregulated expression of transferrin receptor . In respA possible reason for a cell to actively depress cytoplasmic iron levels would be to protect against the generation of reactive oxygen species (ROS) by iron. To investigate if SK-Mel-5 cells might be producing more ROS, we labeled SK-Mel-5 and HeLa cells with dyes that increase fluorescence in the presence of ROS. Cells were photographed with identical camera settings and fluorescence intensities of cells were measured using Image J software. SK-Mel-5 cells produced significantly more ROS than HeLa cells, measured with both dyes .Since SK-Mel-5 cells appeared to have low levels of intracellular iron and were hypersensitive to Baf, which would further decrease iron uptake, we investigated the sensitivity of SK-Mel-5 cells to the iron chelator DFO . As expeThree observations suggested that ferroportin expression might be induced by ROS in SK-Mel-5 cells. SK-Mel-5 cells had both increased ROS production and increased ferroportin expression. One of the major pathways induced by Baf treatment of HeLa cells for 24 hr was the antioxidant response mediated by NRF2, suggesting that Baf treatment could increase ROS. Baf induced rather than repressed ferroportin expression in SK-Mel-5 cells, whereas lowering iron levels with DFO decreased ferroportin expression. If ferroportin expression was induced by ROS, then treating SK-Mel-5 cells with the anti-oxidant N-acetylcysteine (NAC) would be expected to decrease ferroportin expression. When SK-Mel-5 cells were treated for 48 hrs with increasing concentrations of NAC, ferroportin expression was decreased . Taken tAlthough a number of cell lines derived from tumors or cell lines transformed by oncogenes are highly sensitive to V-ATPase inhibitors, problems of toxicity in animals, particularly neurotoxicity, have prevented development of these inhibitors as anti-cancer agents. The obvious problem is that the V-ATPase is an important enzyme responsible for many fundamental cellular processes and inhibiting it will have many effects in many cell types. This in turn suggests that the hypersensitivity of cancer cells to V-ATPase inhibitors should be due to a vulnerability in one or more of the many processes requiring the V-ATPase and that identifying these vulnerabilities might reveal therapeutic targets that can be exploited with fewer toxic effects on normal tissues. Our data show that inhibition of iron uptake by V-ATPase inhibitors is an important determinant of differential sensitivity of cancer cell lines to these inhibitors, suggesting that mechanisms that control intracellular iron levels might be useful therapeutic targets for certain tumors. Analysis of gene networks upregulated in response to low doses of V-ATPase inhibitors revealed that pathways responsive to decrease in intracellular iron and decrease in exogenous cholesterol were by far the dominant responses, but only iron was related to the hypersensitivity of several cancer cell lines to V-ATPase inhibitors. Our results also indicate that there are multiple mechanisms by which cancer cells are hypersensitive to V-ATPase inhibitors and suggest that measuring the levels of proteins involved in iron uptake, storage and efflux may be useful for identifying tumors that might respond to therapeutics that target iron. Although as rapidly growing cells, one might expect that cancer cells in general might need more iron than normal cells, SK-Mel-5 cells are an example of a cancer-derived cell that appears to be actively limiting intracellular iron through the expression of the efflux transporter, ferroportin. The vulnerability of SK-Mel-5 cells to Baf and the iron chelator DFO is likely to be due to higher than normal production of ROS. Future studies will determine if this is the case and if these higher ROS levels can be manipulated therapeutically. Ferroportin expression might be a particularly good diagnostic for tumors that would be hypersensitive to iron chelators, or to other means of therapeutically increasing ROS.The following antibody were used in the study: mouse monoclonal anti – transferrin receptor, cat. # 612124 from BD Biosciences , rabbit polyclonal to metal transporter protein , rabbit polyclonal to divalent cation transporter 1/DMT1/NRAMP2/Slc11a2, cat.# LS-C16687 from LifeSpan Biosciences , rabbit polyclonal anti – ferritin FTH1, cat.# 3998, rabbit polyclonal to cleaved PARP (Asp214) cat.# 9541, rabbit polyclonal to cleaved caspase-3 (Asp175), cat.#9661 from Cell Signaling Technology, Inc , mouse monoclonal anti-actin, cat.# 69100 from MP Biomedicals .HeLa, SK-MEL-5, SK-MEL-28, and MCF-7 cells were obtained from the American Type Culture Collection. MH were obtained from Ralph Mason (UT Southwestern) and H1993 from John Minna (UT Southwestern). Cells were cultured in DMEM with 10% fetal calf serum in 5% CO2 atmosphere at 37°C.4 cells were added to wells in 96 well plates and the next day a series of concentration of V-ATPase inhibitors or DMSO was added to the wells. After 48 hours the ATP concentration in the wells was measured with CelTiter Glo (Promega). For iron or cholesterol rescue experiments either 150 µM iron citrate (Fe3+) or 30 µg/ml cholesterol with 2.5 mM methyl-β-cyclodextrin were included in the medium with the V-ATPase inhibitors.1×10Actively growing HeLa cells were plated in 10 cm diameter dishes in DMEM containing 10% fetal calf serum and grown overnight to just reach confluency. Samples were treated with the following conditions, 15 nM bafilomycin A (Sigma), 2001 nM phenylsalicylihalamide (LX1077), 100 µM deferoxamine mesylate , or DME containing 10% LDL deficient serum . All samples except the low LDL and matched controls received 0.1% DMSO. Cells were cultured in these conditions for 6, 12, or 24 h and total RNA was isolated with RNEasy Mini Kit (Invitrogen) and at least 2 µg RNA was delivered to the UT Southwestern Microarray Core Facility. Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 2 ug total RNA. Hybridizations to Affymetriz Human Genome U133 Plus 2.0 Arrays and scanning of the arrays with an Affy GeneChip 3000 7G, was conducted according to the manufacturer's instructions. Data was processed with GCOS using MAS5.0 normalization to produce CHP files. The microarray primary data, as CHP and CEL files, has been uploaded to GEO under accession number GSE16870.www.ingenuity.com). The software calculates the significance of the association between the data set, in this case all genes with a P change value less than 0.00025, and genes assigned to canonical pathways in the Ingenuity Knowledge Base. This significance is based upon two factors, (1) the fraction of genes in the data set assigned to a pathway compared to all genes assigned to that pathway and (2) a p-value calculated by Fisher's exact test that determines the probability that this association arose by chance alone.The functional analysis of pathways enriched in genes which changed expression after 6 or 24 hr treatment with Baf were generated by Ingenuity Pathways Analysis . Protein concentrations were determined using DC Protein Assay and 30 µg of total protein for each sample was diluted with SDS sample buffer , boiled immediately for 15 minutes, and resolved by SDS/PAGE. Proteins were electrotransferred to nitrocellulose membrane and probed with indicated primary antibody at 4°C, overnight. All antibodies were diluted with 5% Milk in 1x PBS plus 0.5% TWEEN 20. All primary antibodies were used at a dilution of 1∶1,000, with the exception of actin, used at 1∶10,000. Secondary HRP-conjugated goat anti-rabbit and goat anti-mouse antibody were used at 1∶3,000 dilution. Protein bands were visualized using the ECL reagent . To measure protein levels, actively growing HeLa, SKMEL5 and MCF7 cells were lysed in RIPA buffer and 30 µg of protein was probed for the protein expression.To measure apoptosis, HeLa and SK-Mel-5 cells were treated with indicated concentrations of Baf for 24 hrs, then collected, lysed in RIPA buffer and 30 µg of total protein was analyzed by immunoblotting with antibodies to cleaved PARP or cleaved caspase-3.To measure the effect of N-acetyl-L-cysteine (NAC) on protein expression, SKMEL5 cells were grown in the absence or presence of 5 mM and 10 mM NAC, for 48 hrs. Medium containing NAC was changed every 8 hrs, with freshly dissolved NAC. After 48 hrs treatment, cells were lysed in RIPA buffer and 30 µg of total protein was analyzed by immunoblotting with the antibodies shown. All Western blots shown are representatives of two independent experiments performed on different days with two independent sample sets.5-(and-6)-chloromethyl-2′, 7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA), cat# C6827 and dihydroethidium (DHE) cat# D23107 are cell permeable ROS-sensitive dyes, that become fluorescent upon oxidation by ROS present in the cytoplasm. The CM-H2DCFDA acts as an H2O2 –sensitive probe, and DHE reacts mainly with superoxide anions To measure sensitivity to DFO, approximately 250,000 HeLa or SK-Mel-5 cells were plated per well in 12-well tissue culture plates. The next day, cells were treated with indicated dosages of DFO, and 72 hrs later cell numbers were determined by using a Beckman Cell Counter . Two wells for each concentration were counted, and the average numbers of two independent experiments were graphed +/− SEM, n = 2.Table S1Genes Increasing Expression Early with V-ATPase Inhibitors and with Low LDL. Genes upregulated 2-fold or more after 12 hours in cells treated with V-ATPase inhibitors and in cells incubated in medium lacking LDL are listed. Baf, 15 nM bafilomycin A; LX, 200 nM LX1077; DFO, 100 µM deferoxamine; low LDL, cells incubated in medium containing LDL depleted serum.(0.12 MB DOC)Click here for additional data file.Table S2Genes Increasing Expression Early with V-ATPase Inhibitors and with DFO. Genes upregulated 2-fold or more after 12 hours in cells treated with V-ATPase inhibitors and in cells treated with 100 µM deferoxamine are listed. Baf, 15 nM bafilomycin A; LX, 200 nM LX1077; DFO, 100 µM deferoxamine; low LDL, cells incubated in medium containing LDL depleted serum.(0.13 MB DOC)Click here for additional data file.Table S3Genes Increasing Expression Late with V-ATPase Inhibitors and with Low LDL. Genes upregulated 2-fold or more after 24 hours in cells treated with V-ATPase inhibitors and in cells incubated in medium lacking LDL are listed. Baf, 15 nM bafilomycin A; LX, 200 nM LX1077; DFO, 100 µM deferoxamine; low LDL, cells incubated in medium containing LDL depleted serum.(0.12 MB DOC)Click here for additional data file.Table S4Genes Increasing Expression Late with V-ATPase Inhibitors and with DFO. Genes upregulated 2-fold or more after 24 hours in cells treated with V-ATPase inhibitors and in cells treated with 100 µM deferoxamine are listed in order of increase with Baf for 24 hours. Baf, 15 nM bafilomycin A; LX, 200 nM LX1077; DFO, 100 µM deferoxamine; low LDL, cells incubated in medium containing LDL depleted serum.(0.19 MB DOC)Click here for additional data file.Table S5Genes Increasing Expression Late with V-ATPase Inhibitors and not with DFO or Low LDL. Genes upregulated 2-fold or more after 24 hours in cells treated with V-ATPase inhibitors and in cells treated with 100 µM deferoxamine are listed in order of increase with Baf at 24 hours. Baf, 15 nM bafilomycin A; LX, 200 nM LX1077; DFO, 100 µM deferoxamine; low LDL, cells incubated in medium containing LDL depleted serum.(0.12 MB DOC)Click here for additional data file.Table S6Pathways significantly enriched in genes changing expression after 24 h treatment with 15 nM bafilomycin. Genes changing significantly in duplicate experiments were analyzed with Ingenuity Pathways Analysis software to identify pathways in which a statistically significant number of genes were changed. Only pathways with a -log p value greater than 2 by Fisher's exact T-test are shown. The “ratio” is the fraction of total genes assigned to the pathway that changed expression.(0.09 MB DOC)Click here for additional data file.

Plasmodium gametocytes is hard to evaluate even in vitro. This is because visual examination of stained smears, which is commonly used, is not totally convenient. In the current study, flow cytometry has been used to study the effect of established anti-malarial drugs against sexual stages obtained from W2 strain of Plasmodium falciparum. Gametocytes were treated for 48 h with different drug concentrations and the gametocytaemia was then determined by flow cytometry and compared with visual estimation by microscopy.The activity of promising anti-malarial drugs against 2 = 0.9986) was obtained. Two distinct peaks were observed on cytometry histograms and were attributed to gametocyte populations. The activities of established anti-malarial compounds were then measured by flow cytometry and the results were equivalent to those obtained using light microscopy. Primaquine and artemisinin had IC50 of 17.6 μM and 1.0 μM, respectively.Initially gametocytaemia was evaluated either using light microscopy or flow cytometry. A direct correlation (rGametocyte sex was apparently distinguishable by flow cytometry as evaluated after induction of exflagellation by xanthurenic acid. These data form the basis of further studies for developing new methods in drug discovery to decrease malaria transmission. Plasmodium falciparum to anti-malarial drugs in vitro. The most used methods are light microscopy, which enables visual quantification of parasitized red blood cells, and radioactive methods that evaluate the viability of parasites by tracking the incorporation of 3H-hypoxanthine into their nucleic acids. However, only the first method allows the quantification of gametocytes, since these cells do not multiply. Given that light microscopy is labour-intensive, subjective, and suffers from inter-operator variations, alternative methods for the counting of gametocytes are needed to increase the efficiency of drug-screening on this stage of the parasite's life-cycle.Many different approaches have been used to measure the susceptibility of asexual stages of Plasmodium using DNA fluorescent stains [® [Plasmodium takes up and metabolizes HE into ethidium, a nucleic acid-binding fluorochrome [P. falciparum.In earlier studies, flow cytometry has been proposed to assess the viability of intra-erythrocytic stages of t stains ,2. Many t stains , acridint stains and YOYOt stains require t stains ,7 and Pitains [® , while hrochrome . Some aurochrome or with rochrome to stainP. falciparum asexual and sexual forms stained with HE was performed in order to validate a method for the screening of gametocytocidal drugs. First, the relative distribution of fluorescence in parasite subpopulations according to their maturity and sex was analyzed and then the gametocytocidal activity of drugs was determined. Finally, particular gametocyte preparations were treated with xanthurenic acid to follow the exflagellation process.In the present study, the discrimination, by flow cytometry, of in vitro gametocytocidal activities of potentially anti-plasmodial drugs. Moreover, this method enables to discriminate the male and female gametocyte subpopulations.Flow cytometry was demonstrated to be usable to evaluate the different stages of sexual and asexual parasite populations and to assess the Red blood cells and human serum were obtained from EFS, Toulouse (France); PBS, RPMI and additives were from Lonza (Belgium). All other reagents were from Sigma-Aldrich, l'Isle d'Abeau (France).2 incubator.Parasites were cultured according to Trager and Jensen , and synGametocyte cultures were initiated with W2-Indochina strain as described elsewhere , with moVisual counting of schizonts and gametocytes was carried out on Giemsa-stained smears before and after concentration. Images were digitally recorded with a digital camera mounted on an optical microscope .® columns were filled with warmed (37°C) RPMI. The experimentation was performed under sterile conditions [Magnetic purification was carried out by using the haemozoin paramagnetic complex property. Prior to purification, MACSnditions ,17. The Primaquine and artemisinin (the latter being kindly provided by Pierre Fabre Laboratories) were dissolved in DMSO, while chloroquine was dissolved in RPMI. Twelve day-old gametocyte cultures were transferred to 24-well or 96-well plates, and increasing dilutions of each drug were added. All experiments were performed in triplicate. After 48 h of incubation at 37°C, thin blood smears were prepared and stained with Giemsa. The number of gametocytes per 10,000 erythrocytes was visually estimated by optical microscopy. In parallel, parasitaemia was evaluated by flow cytometry.5 cells were analysed with a FACScalibur cytometer (Becton Dickinson®) using the CellQuestPro® program for data analysis.Cultures were washed with PBS. Pellets were resuspended in hydroethidine solution (50 μg/mL) for 20 minutes at 37°C in the dark. After washing in PBS, 10In order to obtain an homogenous film, glass cover-slips were coated overnight at room temperature with poly-L-lysine (1:100 in PBS). Parasite cultures were washed twice in PBS and the pellets were resuspended in 50 μg/mL hydroethidine (HE) for 20 minutes at 37°C in the dark. Samples were then washed twice in PBS and resuspended in 1 mL of PBS. Cells were distributed on the poly-L-lysine-coated cover-slips and incubated for 20 minutes at 37°C in the dark. After cell adhesion, the cover-slips were washed with PBS and analysed with a fluorescence microscope .et al [® columns and immediately resuspended at 5% final haematocrit in 100 μM xanthurenic acid (XA) for 20 min at room temperature [The exflagellation of gametocytes was quantified according to Kawamoto et al . Gametocperature ,20. PrioIn vitro cultures were incubated with HE, which is converted to ethidium by metabolically active cells [Plasmodium falciparum W2 strain cultures were synchronized by 5% D-sorbitol lysis to obtain ring-enriched cultures [Plasmodium berghei gametocytes [ve cells . The intcultures , and by cultures in ordercultures ,22. Flowetocytes .® and 83.04% after was obtained between gametocytaemia determined by the two methods. More, the M2 population was, most of the times, lower than M3 in cultured P. falciparum NF54 strain was 2 μM. In the current study, after enrichment by MACS®, a fraction of the purified gametocytes (strain W2) was treated with 100 μM XA, a concentration that triggers the highest stimulatory effect on in vitro exflagellation [et al [P. falciparum that have showed that female gametocytes were generally more numerous than males. Generally, one male was observed for four females, though large fluctuations in the gametocyte sex ratio have been observed [The repartition of gametocytes in each population M2 and M3) could be due to the sex of the gametocytes, which modifies their amount of DNA, and/or to their stage of maturation. To determine whether the M2 and M3 peaks corresponded to the difference between male and female gametocytes, we compared gametocyte cultures before and after male gametogenesis. Exflagellation has been achieved by decreasing drastically the culture temperature (from 37°C to 23°C) and submitting the gametocytes to xanthurenic acid (XA), a gametocyte-activating factor (GAF) . The senin vitro and the ellation . This XA could ben [et al . These an [et al . On the observed .in vitro gametocytocidal activity of drugs, the efficiency of primaquine, artemisinin and chloroquine against gametocytes were compared both by the classic optical microscopy (OM) method and by FCA. After 12 days of maturation and treatment with N-acetyl-D-glucosamine (5 days before testing) to remove most of asexual stages, gametocytes obtained from chloroquine-resistant W2 strain were exposed to these established anti-malarial compounds at increasing dilutions for 48 h. The results are summarized in Table 50 against gametocytes was 1,000 nM by FCA and 690 nM by OM). As expected, chloroquine was inactive . Primaquine, which had an IC50 against gametocytes of 17,600 nM by FCA and 11,200 nM by OM could be compared with gametocytaemia evaluated by OM by Sall et al . IntereP. falciparum gametocytes and hence should be useful to evaluate promising anti-gametocyte drugs. Moreover, HE-labelled viable parasites, which were the only labelled cells, while Giemsa staining did not allow the differentiation between living and dead parasites. Although these results were obtained on P. falciparum, they are close to those of other authors [P. berghei. They showed that the fluorescence intensity of gametocytes was comparable to that of late trophozoites, as showed in the present report. Using flow cytometry, other researchers have identified P. falciparum gametocytes well before they were morphologically distinguishable from asexual stage parasites, thanks to the use of the chimeric Pfs 16-GFP [FCA, in combination with magnetic enrichment, has here been shown to be useful to estimate the inhibitory concentrations of known drugs against authors ,27 who hs 16-GFP . This FAThe authors declare that they have no competing interests.SC conceived and carried out the studies, drafted the manuscript. AC conceived the study, interpreted cytometry studies, redaction and correction of the manuscript. AL master degree student in the laboratory, participated to in vitro culture and cytometry studies. BP interpreted cytometry studies, drafted and corrected the manuscript. AV conceived the study and participated in its design and coordination, redaction and correction of the manuscript.All authors read and approved the final manuscript.

This condition worsens with age and at the age of 30 years, men and women with Marfan's syndrome have an annual death risk of 2% and 1%, respectively – 20–40 times higher than normal population of the same age.[P/dt) and reduction in heart rate, which reduces the number of systolic impulses in a given period.[A review of clinical studies of medical treatment for Marfan's syndrome reveals that only three classes of drugs have been investigated – beta-blockers, angiotensin converting enzyme (ACE) inhibitors, and calcium channel blockers with primary focus being on beta-blockers. The propn period. To date,Bicuspid aortic valve is perhaps the most common congenital heart disease occurring at a frequency of 1–2/1000 live births. Several 6This meta-analysis and e-mail survey of expert opinion attempts to clarify the issues involved in medical management of patients with Marfan's syndrome and bicuspid aortic valve with beta-blockers including effects on slowing aortic root dilatation and cardiovascular effects – death, aortic dissection, and surgery – and when to initiate therapy in patients who may potentially benefit from it.et al., from Johns Hopkins university.[et al., in 1994.[et al., in children reported that beta-blocker therapy does not significantly alter the rate of aortic root dilatation in children with Marfan's syndrome.[The first report describing a beneficial effect of beta-blockers in patients with Marfan's syndrome was published by Halpern iversity. This sma in 1994. This stusyndrome. A recentsyndrome. There iset al., showed that the rate of enlargement of aorta in patients receiving treatment was less than one-third the rate of patients receiving no treatment (P < 0.001).[et al.,[et al., reported no significant change in progression of aortic root dilatation between patients treated with beta-blockers versus controls, despite the fact that heart rate was significantly slower in those treated with beta-blockers.[The randomized control study conducted by Shores < 0.001). Also, cl.[et al., though tblockers. A recentblockers. The diffMost studies had left this decision to the discretion of the treating physician. Most of these decisions were made empirically. There is no clear consensus on whether treatment should be initiated as soon as the diagnosis of Marfan's syndrome is made or one can wait till significant aortic root dilatation has set in. No clear cut-off values of aortic root measurements have been suggested as an indication for starting the therapy. In one study, a greater proportion of treated patients had positive family history of Marfan's syndrome. Some of Atenolol was the most commonly used agent in most studies.–12 In moet al., reported a slower rate of enlargement of the aorta in patients receiving treatment compared with placebo.[These drugs are sometimes prescribed to patients in whom beta-blockers are contraindicated. In a small study, Rossi-Foulkes placebo.The potential benefit of these drugs in Marfan's syndrome maybe mediated through angiotensin-II type-2 receptor blockade, thereby, reducing apoptosis of vascular smooth muscle cells and cystic medial necrosis. A recent randomized controlled trial in children reported increased aortic distensibility and reduced stiffness index in patients treated with enalapril compared with beta-blockers.et al., demonstrated that losartan therapy in the mouse model of Marfan's syndrome resulted in complete correction of the phenotypic abnormalities in the aortic wall.[The postulated mechanism of benefit of these agents is mediated through their transforming growth factor (TGF)-beta receptor antagonism. In a pretic wall. These reOther drugs with theoretical rationale in patients with Marfan's syndrome include matrix metalloproteinase inhibitors , advanced glycation end-product (AGE) receptor blockers, aldosterone receptor antagonists, and drugs to reduce homocystenemia.The e-mail survey was carried out using the following questionnaire. All the experts were requested to respond to the the following questions and a summary of the consensus is presented.Survey opinion: Most of the respondents felt that beta-blockers are useful in patients with Marfan's syndrome. Regarding bicuspid aortic valve, most were of opinion that beta-blockers are not of much value, especially if there is no aortic root dilatation. Dr Wilson and Dr Saxena felt that beta-blockers may have a role in bicuspid aortic valve if there is aortic root dilatation. Dr Teirney and Dr Shrivatsava, however, were of opinion that beta-blockers are not effective in both Marfan's syndrome and bicuspid aortic valve.Reducing the rate of progression of aortic root dilatation.Delaying need for aortic root surgery.Reducing mortality and cardiovascular events.Survey opinion: Most of the respondents were of opinion that beta-blockers were useful for all the three endpoints in patients with Marfan's syndrome.At time of diagnosis itself.Once aortic root dilatation has set in.Any cut-off value for aortic root dimension.Survey opinion: Most of the experts preferred to start beta-blockers only after aortic root dilatation has set in. None offered any cut-off values for aortic root dilatation in children. Prof. Jondeau, however, was of opinion that beta-blockers should be started right from the time of diagnosis itself.Survey opinion: The overall opinion was that the choice of beta-blocker really does not matter, though most respondents preferred cardioselective beta-blockers like atenolol. Atenolol was recommended in standard tolerated doses (1–2 mg/kg/day). Most of the experts recommended monitoring of resting heart rate and tolerance before increasing the dose. Yearly monitoring of the aortic root dimension by echo was also recommended.Survey opinion: Most of the experts were not in favor of alternative drugs till more evidence is available. Dr. Wilson suggested use of ACE inhibitors in patients who cannot tolerate beta-blockers and use of calcium channel blockers in those who are intolerant to both beta-blockers and ACE inhibitors. Most of the experts felt that losartan is still in a trial phase for the medical treatment of patients with Marfan's syndrome.It will be a reasonable practice to recommend beta-blockers in patients with Marfan's syndrome with aortic root dilatation, though there is some recent evidence suggesting that such therapy may not be beneficial. Based on available data, beta-blockers may be of value in delaying the progression of aortic root dilatation, while harder clinical endpoints like mortality and vascular complications may not be altered much. The role of newer drugs like losartan in Marfan's syndrome needs further evaluation. In patients with bicuspid aortic valve, there is no evidence base to support the use of any of these drugs at present.

Breast-cancer incidence and mortality rates in different countries were found to be correlated with height, weight and age at menarche, all of which have been identified as risk factors in cohort or case-control studies of breast cancer. There were, however, correlations with total fat and animal protein consumption per capita even after controlling for the 3 anthropometric variables. This suggests that, while some of the effects of diet on breast-cancer rates may be mediated through effects on these known risk factors, there may be more direct effects as well.

Metric systems for semantics, or semantic cognitive maps, are allocations of words or other representations in a metric space based on their meaning. Existing methods for semantic mapping, such as Latent Semantic Analysis and Latent Dirichlet Allocation, are based on paradigms involving dissimilarity metrics. They typically do not take into account relations of antonymy and yield a large number of domain-specific semantic dimensions. Here, using a novel self-organization approach, we construct a low-dimensional, context-independent semantic map of natural language that represents simultaneously synonymy and antonymy. Emergent semantics of the map principal components are clearly identifiable: the first three correspond to the meanings of “good/bad” , “calm/excited” , and “open/closed” (freedom), respectively. The semantic map is sufficiently robust to allow the automated extraction of synonyms and antonyms not originally in the dictionaries used to construct the map and to predict connotation from their coordinates. The map geometric characteristics include a limited number (∼4) of statistically significant dimensions, a bimodal distribution of the first component, increasing kurtosis of subsequent components, and a U-shaped maximum-spread planar projection. Both the semantic content and the main geometric features of the map are consistent between dictionaries (Microsoft Word and Princeton's WordNet), among Western languages , and with previously established psychometric measures. By defining the semantics of its dimensions, the constructed map provides a foundational metric system for the quantitative analysis of word meaning. Language can be viewed as a cumulative product of human experiences. Therefore, the extracted principal semantic dimensions may be useful to characterize the general semantic dimensions of the content of mental states. This is a fundamental step toward a universal metric system for semantics of human experiences, which is necessary for developing a rigorous science of the mind. Words of natural language along with idioms and phrases are used in speech and writing to communicate conscious experiences, such as thoughts, feelings, and intentions. Each meaningful word, considered without any context, is characterized by a set of semantic connotations To build a metric system for the semantics of words means to allocate words in a metric space based on their semantics, i.e., to create a semantic map of words. There are multiple ways to generate such maps based on the representation of semantic dissimilarity as geometrical distance onym). This aspect of word semantics, when expressed parsimoniously, is in many cases domain-independent, as may be illustrated with the following example. The term short-term memory belongs to the domains of cognitive, computational and neuro-sciences, together with its antonym: long-term memoryHere we develop an alternative approach based on the separate aspect of word semantics that determines whether two words are synonyms or antonyms of main semantic dimensions that are in a definite sense orthogonal to each other. We found that these main semantic dimensions can be approximately characterized as (1) “good” vs. “bad”, (2) “calming” vs. “exciting”, (3) “open” vs. “closed”, and (4) “basic” vs. “elaborate”.This semantic aspect relates to the basic “flavor” of experience captured by generally applicable antonym pairs This study was conducted using the dictionaries of synonyms and antonyms extracted from the thesaurus of Microsoft Office 2003 and 2007 Professional Enterprise Editions, further referred to as MS, in English, French, Spanish, and German, as well as the dictionary of English synonym and antonyms available as part of the Princeton WordNet 3.0 resource The MS corpora have independent origin for different languages . These MS dictionaries of synonyms and antonyms were acquired automatically with the following recursive procedure (see below for hardware and software details).first”, or its translation in other languages. Alteration of the initial word never changed the resultant core dictionary by more than a few words.Step 1. Start in the thesaurus with the seed word “Step 2. Add all synonyms and antonyms of the word to the dictionary, avoiding duplicates; repeat step 2 using each of these onyms sequentially as a new word.Step 3. Take the next word from the thesaurus in alphabetical order, and repeat steps 2 and 3. After the last alphabetical word, resume with the first one and continue until the entire thesaurus is processed.http://wordnet.princeton.edu on 3/29/07), were further processed in the following ways.Next, we extracted the subset of the dictionary corresponding to the largest component of the graph of synonym and antonym links truncated to nodes (words) with a minimum of two links, including at least one antonym link, per node A is a synonym of word B, then B is synonym of A. This symmetrization is necessary to define the energy function.Step 4. Symmetrize the onym relation by making all synonym and antonym links bi-directional. In other words, if word A is listed at the same time as synonym and antonym of word B, both onym relations between A and B are removed.Step 5. Eliminate onym inconsistencies: if word Step 6. Identify the largest connected cluster in the graph of onym relations. Remove all words that do not belong to this main cluster.Step 7. Eliminate all words with no antonyms or fewer than two synonym/antonym links. The remaining dictionary of synonym and antonyms is referred to as the “core” dictionary.The different core dictionaries had widely differing characteristics. The MS English core has 15,783 words, with an average of 11 synonyms and 2.7 antonyms per word. The WN English core has 20,477 words, with an average of 3.8 synonyms and 4.2 antonyms per word. The MS French core has 65,721 words, with an average of 6.5 synonyms and 10 antonyms per word. The MS German and Spanish cores have 93,887 and 259,436 words, respectively. The total size of each corpus is above 200,000 words, and in all cases, the extracted cores were a small part of the entire thesaurus. However, the next largest connected cluster was typically several orders of magnitude smaller than the core. For example, in WN the second largest connected cluster only contained 34 words.N words of a given core dictionary as points in a high-dimensional unit ball, i.e. as vectors with length ≤1. The specific results described here were obtained with a dimension of 26, but they remained essentially identical when using the lower and higher dimension values of 10 and 100, respectively. Next, we minimize an “energy” or cost function H of the distribution, thereby finding a minimum or “ground state” of the system. The energy function of the word configuration x, was defined precisely as follows:Our approach to constructing a cognitive map by self-organization of a distribution of words in a multidimensional vector space is inspired by statistical physics. At the beginning, we randomly allocate all xi is the 26-dimensional vector representing the ith word (out of N) in the configuration x. The ijW entries of the symmetric relation matrix equal +1 for pairs of synonyms, −1 for pairs of antonyms, and zero for all non-onym pairs. Intuitively, maximizing the first sum moves synonyms towards the same hemispaces, while minimizing the second tends to align antonym pairs on opposite sides of the origin, reflecting their semantic relations. The fourth-power norm provides a soft limit to the absolute distance from the center. More specifically, the first term of the equation is the simplest analytical expression that captures the intent of aligning synonym vectors in parallel and antonym vectors in opposite directions. The last term is the lowest symmetric power term that is necessary to keep the distribution compact. This general approach and specific selection were empirically validated by their successful reconstruction of a map whose meaning was known a priori, that of color space, as illustrated at the end of the Here right/wrong, 63°; excited/hectic, 71°; right/excited, 91°. During the optimization process, words move from the initial random allocation based on their synonym/antonym relations, such that synonyms would “attract” each other and antonyms would “repel” each other. After the optimization is completed, the angles between the same word vectors become: right/wrong, 178° ; excited/hectic, 12° ; right/excited, 95° . These final angles do not depend on the initial angles.This process may be illustrated with an example. In the initial random distribution of all words, before minimizing the energy function (*), the angles between word vectors in multi-dimensional space tend to be close to 90°. For instance, one specific simulation run using MS Word English data started from the following angles for a sample of word pairs: −6 , which was achieved in all cases in less than 106 steps.The adopted optimization procedures included a second-order Newton algorithm using analytic expressions for derivatives of the energy function, and a zero-order steepest-descent algorithm with time-dependent “thermal noise” or simulated annealing. Convergence of the optimization was assessed by measuring the norm of the gradient of the energy function, as well as the relative change of the energy function itself and word coordinates in one iteration (see below for hardware and software details). In particular, the process was terminated whenever any of these monitored parameters fell below the threshold of 2·10When the optimization is completed, we rotate the resultant distribution to its principal components (PCs) by single value decomposition. Since the cost function and optimization procedure are symmetric with respect to the origin, the final sign of any PC coordinate is not meaningful by itself and can be considered a random outcome. Thus, upon completion of optimization, we flip each axis as needed to standardize its semantics for consistency among simulation runs. We selected the axes orientation arbitrarily once and for all maps, pointing the positive ends toward “good”, “exciting”, “open” and “elaborate”, respectively. Moreover, we normalized word coordinates by the average square length of all word vectors, effectively scaling the entire distribution to the unit variance. These post-processing operations of rotation, selective axis inversion, and rescaling, do not change the intrinsic shape of the optimized distribution, but are convenient and necessary for quantitative comparison of corpora.H (*) was reached in each case.The final distribution appeared to be systematically invariant with respect to the choice of initial random coordinates over multiple trials, suggesting that the global minimum of pleasure, arousal, and dominance. Each rating scale in ANEW runs from 1 to 9, with a rating of 1 indicating a low value and 9 indicating a high value on each dimension.The Affective Norms for English Words ANEW databasehttp://www.natcorp.ox.ac.uk/corpus. The raw dataset distilled so to exclude those items occurring five or fewer times http://www2.psy.uq.edu.au/CogPsych/Noetica/OpenForumIssue4/SMH.html. The curator's filtering to exclude items that occur in only one article yield 97,031 words Two word frequency databases were used. The first is the demographic set from the British National Corpus (BNC), a 100 million word collection of language samples from a wide range of sources, representative of contemporary English. The XML Edition (2007 release), maintained by the University of Oxford (United Kingdom), was downloaded from The algorithm to acquire the MS dictionaries of synonym and antonyms (Steps 1–3 above) was based on COM (Component Object Model) automation, and implemented in MathWorks Matlab following published examples Starting from the synonym/antonym matrix extracted from the widely-employed English thesaurus of Microsoft Word (MS English), optimization converges to a definite stable state that is macroscopically independent of the initial random conditions (details in the 10–R100).The maximum spread planar projection exhibitsQualitatively similar features emerge when adopting an independent dictionary of synonyms and antonyms, Princeton's WordNet happy (1.96), confident (1.50), merry (0.99), and untroubled (0.78), to bored (−0.57), helpless (−1.01), hurt (−1.33), depressed (−1.59), and sad (−1.89). These words follow the exact same order in the map derived from WordNet (WN), and the quantitative values between the two are tightly correlated . This characterization of the first component generalizes to all words of the dictionary, demonstrating a highly significant correlation both between corpora (MS and WN) and with the ANEW ‘pleasure’ scale . More precisely, the sign of this coordinate robustly predicts the “positive-negative” content of each word, and the numerical value along this axis accurately orders words according to that aspect of their meaning. To illustrate this feature with an example, we ranked words describing mood (from best to worst) based on an independent psychometric measure of “pleasure” derived from a large number of human raters, namely the first of the Affective Norms for English Words (ANEW) e’ scale .relax , troubling , and excite . Since principal components are by construction orthogonal on the map, the values of word coordinates in these first two dimensions (PC#1 and PC#2) are mutually independent. In particular, words with negative ‘arousal’ value can be either good or bad, as in soothing and boring , and the same holds for positive arousal terms such as thrilling and shocked . More generally, while the positions of words in the maximum spread projection (first two components) are highly consistent among MS English, WordNet, and the map derived from MS French thesaurus all have positive valence, while the bottom ones all have negative valence. Similarly, the sorted antonym pairs have opposite meaning relative to valence.A similar process can be applied to antonym pairs. In particular, antonym pairs can be sorted by dividing the difference of the two words in the given coordinate by the square root of their vector distance. The top antonym pairs in the sorted list are also taken to represent the meaning of that component. Both approaches based on individual words and antonym pairs reveal definitive and consistent semantics for all four significant PC's in MS English . For exahttp://translate.google.com). In particular, a large number of terms repeated in the same components across corpora and languages, reflecting general semantic agreement in matching PCs always involve PC4, except one word (smooth) occurring in PC2 and PC3. Moreover, PC4 has no within-column cross-corpora repetitions, and in general shows lower consistency compared to the first 3 PCs.The semantics of the third and fourth orthogonal dimensions can be summarized as “open/closed” (‘dominance’) and “copious/essential”, respectively. The first three components, but not the fourth, are also consistent with the corresponding semantics of both the WN English corpus and the MS French corpus, after automatic translation into English with the Google translator tool , a major “calm” term (−1.08 on component 2), and a sense of “closure” (−0.21 on component 3). In this case, there is a clearly dominant component (the second). On average, by construction, the first components tend to have higher amplitudes than later components. This means that, broadly, the most informative element of a word is how “good” or “bad” it is, followed by how “calming/exciting”, etc. It is also interesting to compare the principal semantic components of a given word on a relative scale after filtering this general trend. This renormalization can be achieved by dividing each coordinate by the average amplitude of the corresponding component. In the serenity case, the third component becomes nearly as prominent as the first one on this relative scale have similar proportions on the principal components of the map, i.e. small angles between their vectors the assignment as synonym in the source dictionary may still be appropriate in specific contexts . As an alternative example, hot and cool are typically antonyms (referring e.g. to weather or beverages), except when used idiomatically to describe an idea, a videogame, or a classmate.As expected based on the form of the energy function vectors . In contOverall, given a pair of synonyms or antonyms in the dictionary, their dot product identifies the correct “onyms” relation with 99% accuracy. In particular, four real numbers associated with each word contain all essential information to identify antonyms among related terms: all semantic flavors of antonymy are reducible to four principal semantic dimensions. In contrast, random pairs have an average angle of 90°, with less than 3% of values below 13° or above 170°.related terms, synonyms will be concentrated in the neighborhood and antonyms in the antipodes. Nevertheless, unrelated words will still constitute the majority of terms even close to 0° and 180°. These unrelated words randomly end up in the proximity of a given term by virtue of their large number in the self-organizing reduction of the high number of initial dimensions into the low-dimensional principal component space. Therefore, the constructed semantic map of words differs from the high-dimensional semantic spaces typically obtained with other existing approaches It is tempting to extrapolate these considerations and assume that proximity of two words in the map is sufficient to ensure a similarity of their meanings. However, this is not the case. Unrelated word pairs vastly outnumber synonyms (∼1500∶1) and antonyms (∼7400∶1). The majority of unrelated words pertains to separate semantic domains, and could not possibly be considered synonyms or antonyms. Even the tail ends of their angle distribution constitute a disruptive confounder of the semantic relations. Stated differently, given a particular word, it is fair to assume that, among all A pool of terms likely related to a given word is constituted by all synonyms of synonyms or, more generally, “onyms of onyms” of that word. In particular, words which are onyms of onyms are usually in overlapping semantic domains, but not all words in overlapping domains are onyms of onyms. Having a synonym or antonym in common does not guarantee, but strongly indicates, that two words pertain to overlapping semantic domains. Thus, within the pool of onyms of onyms, one could expect angular information to be a powerful predictor of semantic content. To test this hypothesis, we sampled 20 words from MS English and WN English, and computed the cosines of their angle with each of their onyms of onyms. We then assigned the binary values of +1 and −1 to the onyms of onyms that were also reported as synonyms or antonyms, respectively. The correlation between the cosines and binary values was statistically significant in all 40 cases .antonym has 22 onyms of onyms. Among these, the two terms with the largest positive dot products are the only listed synonyms, namely opposite_word (1.000) and opposite. Similarly, the words with the largest negative dot products are the only two listed antonyms, namely equivalent word (−0.999) and synonym (−0.998). The two onyms of onyms with the positive and negative dot products closest to zero lack any synonym/antonym content: cyclic (0.190) and secondary (−0.066). These qualitative observations are reflected in an R value of 1.00 and a P value of 3.3·10−8.In addition to finding systematically significant numerical values in all 40 cases examined, this compilation reveals the consistent ability of the map to identify, based on the dot products, “new” synonyms and antonyms not explicitly listed as such in the dictionary. A specific example may constitute a useful illustration. In WN, the term antonym is not part of the MS English core, but the word opposite is, and has 306 onyms of onyms. In this case, however, the same analysis returns relatively weaker R and P values of 0.44 and 0.025, respectively. A closer inspection to the list of onyms of onyms explains this apparent inconsistency and further corroborates the predictive value of the semantic map. The top ranking positive dot products correspond to terms listed as synonyms, namely dissimilarity (1.00), the other extreme, and contra (both 0.98). Next in the list, while not reported as synonyms, are nonetheless correct predictions: heretical, heterodox, competing, and contrary to accepted belief , followed by contending and hotheaded (both 0.97). Interestingly, the next terms at similar values are again listed as synonyms: inverse, opposing (both 0.97), deviating, and contrary (both 0.96).The term opposite in MS is due to a few outliers, such as harmonizing . As discussed above (see footnote 1), even in these cases the map intuitively appears to be robust enough to actually “correct” mistaken assignments . To quantify this impression, we computed the correlation for the subset of the onyms of onyms that are listed as synonyms or antonyms of the word opposite in the independent WN dictionary, but not in MS. In other words, we “tested” the predicted assignment of the MS semantic map based on the available data in the WN dictionary. The resulting R and P values (0.99 and 0.005) were statistically significant, and the identified terms were consistent both among the new synonym and new antonyms . Furthermore, the words with even more extreme negative dot products, although not explicitly listed in either dictionary, were all consistent with antonym meanings: resemblance, congruence (both −0.96), analogy (−0.97), equivalence, and similarity (both −0.99).The lower correlation value for control and delicate) are plotted in the plane of the first two principal components. In general, terms are located in the proper octant according to the connotation of their meaning . For instance, the term control can be substituted with a “good” connotation by organize, or with a “bad” connotation as curb. Likewise, delicate can connote a “calming” semantic as soft or an “exciting” semantic as personal.A potential practical application of the described semantic map consists of specifying the connotation as well as the general meaning (denotation) of words. An illustration of considering connotation is provided in okay and good lie in the same quadrant of the map with an angle of 10° between them and can be considered “absolute” synonyms. In particular, they both have a positive value in the first component . However, with respect to the position of fine, these two terms lie on opposite sides . Relative to fine , the term okay has actually a negative valence (−0.34), whereas the term good has a positive one (0.43).Moreover, the vector representation of words in this map has both absolute and relative meanings. For example, the terms relevant has greater vector length (1.33) than the term pertinent (1.15), but smaller than the term important (1.90). The word closest to the center is emigrant (vector length 0.36). Despite its definite meaning, this word is relatively neutral with respect to the main semantic dimensions of the map. The distribution of lengths over the whole dictionary is 26 times more common than the term professor. It is thus possible to compute an overall “concept mean”, as the frequency-weighted average position of all words in the semantic map. Such measure captures the most representative meaning composed across a particular language (P<10−18), while there is no significant preference in the other semantic dimensions .However, words have different usage frequency in language . For exalanguage . In EnglThe semantic characterization of the map principal components also enables a direct comparison across corpora, languages, and data types. As mentioned earlier, the first three components, but not the fourth, demonstrate high consistency across independent corpora (MS English vs. WN English) and languages based on the norms of the covariant matrices, which are the natural generalization to higher dimensions of the concept of the variance of a scalar-valued random variable. The covariance matrix or dispersion matrix is a matrix of covariances between elements of a vector, and naturally generalizes to higher dimensions the concept of the variance of a scalar variable. The correlation coefficient for a pair of scalar variables is the ratio of their covariance to the product of their standard deviations. Our formulation (**) is a natural extension to variables in multiple dimensions. The formula is analogous to that of the Pearson correlation coefficient, and coincides with it in one dimension:Finally, as an additional method of quantifying the linear relationships between pairs of corpora , we defined an “overall correlation” This measure characterizes the alignment of two distributions of points, each independently rotated to their internal principal components, throughout all of their dimensions. The overall correlation coefficient consistently assumed high values (between 0.68 and 0.80), always intermediate between the first canonical correlation and the correlation between first principal components.This result of the cross-corpus comparison, as well as the qualitative assessment of the semantic content of the significant principal components, also proved to be generally robust with respect to alterations of the cost function parameters and/or the initial conditions in optimization. These findings indicate overall consistency and reliability across languages, datasets, and variations of the technique.colorX was defined as a sphere 2S, in which each point was associated with a unique color, using the three Cartesian coordinates as RGB values. A number n of points were randomly sampled from colorX. For each sampled point, a list of “synonyms” and “antonyms” was generated by stochastically selecting neighbors within a certain ‘threshold angle’ as synonyms and neighbors within that threshold angle from the antipode as antonyms. The initial values for the threshold angles and the average number of onyms per point (the ‘degree’ of the graph) were set to 20° and 3.5, respectively, consistently with the parameters of the available linguistic corpora, and later allowed to vary as described below.To verify the general applicability and robustness of our approach, we designed a simple simulation of color mapping. The model semantic space d-dimensional space with random initial coordinates. Their coordinates were optimized by minimizing the above-described energy function H of locations and synonym-antonym connections, using the same convergence criteria adopted for the main language study , the threshold angle between “onyms”, as well as the number of color nodes, did not affect the quality of the reconstruction in a wide range of parameters. In other words, the results of this approach are robust with respect to alteration of the corpus parameters: the dimension of the embedding of the first three PCs are each close to 1, while the remaining 7 are negligible , resemblmbedding , the nummbedding , the nummbedding , and thembedding .In his 1946 “Man's Search for Meaning”, neurologist and psychiatrist Viktor Frankl maintained that life has meaning under any imaginable circumstance, that the search for this meaning is the core human drive, and that personal freedom consists of the individual choice of such meaning This study demonstrates the possibility to derive a precise metric system for semantics of human experiences objectively from data collected without using human subjects. More generally, the new technical approach we presented may have practical implications for multiple fields. Previous studies that resulted in semantic maps either relied on subjective human judgments are consistent with earlier psychometric, cognitive, and linguistic theories and findings, including Osgood's semantic differential The possibility to objectively define a quantitative scale for the major categories of general semantic content, capturing both synonym and antonym relations, has practical applications to linguistic data mining Low-dimensional vector-space representations of word meaning were constructed previously at least in two fields, namely computational linguistics and experimental psychology. In the former case e.g. LSA the purpThe semantic similarity of our map with ANEW in the first two dimensions was quantitatively confirmed by canonical correlation analysis, based on the map locations of words that are common for the two maps. However, the two maps are not equivalent to each other. The map constructed in the present study contains more dimensions and more words, including words that do not belong to affective stimuli. Most importantly, this map differs qualitatively from previous data as it was not constructed based on given semantic dimensions. Instead, semantics of our map dimensions are emergent and defined by the locations of all words together.king and queen could be synonyms, as in head of the royal family, or antonyms, as in gender . Our choice of energy function (*) departs from the current paradigm. The principal components of the resulting map uniquely capture the general aspects of antonymy, i.e. those that apply to most contexts. Accordingly, the notions of synonymy and antonymy used in our analysis differ from the concepts of similarity and dissimilarity as defined by co-occurrence, as illustrated by the king/queen or hot/cool examples mentioned above. Many definitions of antonymy were proposed over the years The constructed semantic cognitive map provides one geometrical representation for two relations: synonymy and antonymy. Most existing automated methods infer synonymy from word co-occurrence Unlike with LSA and related techniques, were the low-dimensionality of the map results from manual truncation of higher dimensions Unlike most previous studies, our model was not tailored for a special practical purpose, but was constructed starting from basic principles. Our energy function was selected as the most parsimonious analytical expression corresponding to the concept of synonym and antonym vector alignment. The first term is the simplest analytical expression that attempts to align synonym vectors in parallel and antonym vectors in opposite directions. The last term is the lowest symmetric power term that is necessary to keep the distribution compact. This conceptual framework significantly differs from the frameworks mentioned above, including LSA Although the constructed semantic map reveals definitive semantics in each of its significant principal components, the vector associated with every word in the map should be interpreted as a “noisy” measure rather than an exact set of numerical values. This cautious interpretation is motivated by two considerations. First, the positions of individual words on the map depend on the selection of available synonym-antonym links, which only constitute a small subset of all possible synonym-antonym links. Adding or deleting a link changes map coordinates of the corresponding words. Stated differently, any dictionary of synonyms and antonyms only provides sparse sampling of the onym graph.The quantitative extent of this sparse sampling can be estimated by comparing two independent thesauri, such as MS English and WN English. Limiting the respective dictionaries of synonyms to the pool of their 5,926 words in common leaves 30,922 links for MS and 12,188 for WN, with 6,576 overlaps. Assuming that synonyms in each of the two dictionaries are sampled randomly and independently from the “comprehensive” set of all true synonyms, the cardinality of the true synonym set can be computed as  = 57,311. Thus, the MS and WN English dictionaries only represent at most ∼54% and 21%, respectively, of all synonyms. However, the assumption of independent random sampling is unlikely to be realistic, because more usual synonyms may have a greater chance to be listed in both dictionaries, thus increasing the number of overlaps. Therefore, these values should be considered coarse overestimates, and the real representation is likely to be even sparser.mean can assume the distinct meanings of “average”, “nasty”, and “indicate”. Therefore, the word vector may be forced to find a compromise orientation that does not match precisely any of the word meanings. From this perspective, the constructed map crudely approximates meanings with words. Semantics of individual words may not match precisely semantics of their map locations, and therefore should not be taken as literal definitions of the latter. Although the map was constructed based on relations among individual words, precise numerical definitions of its semantics only apply to large subsets of words, as in the analyses involving word frequency data do not have a significant measure of the “semantic flavor” that this map represents. This is also why finding unrelated words next to each other on the map does not indicate an inconsistency.X of all meanings, by assumption can be mapped into a high-dimensional Euclidean space (X (colored arrows). These relations have each their own domain of applicability in X. Dashed lines of corresponding colors show the domain boundaries. For example, the word hot can be viewed as a label for the relation among two meanings represented by points in X, one of which can be considered hot as compared to the other: the red color is hot compared to the blue color, the weather in Mexico is hot compared to Canada, the housing market in Manhattan is hot compared to that in Detroit. The relation hot, however, has a limited domain of applicability. For instance, this concept does not make sense in general when referred to pairs of elementary geometrical shapes. As a particular example, a triangle can be said to be sharp, but not hot, compared to a circle.Semantic space, or the set an space , left. Shot and sharp overlap, e.g. in the food domain, while the domains of applicability of differentiable, a mathematical term, and charismatic appear to be disjoint. Two relations labeled by words within an overlap of their domains are synonyms, if their vectors point in the same or similar directions . They are antonyms, if their vectors point in the opposite or nearly opposite directions . These notions of synonymy and antonymy have a clear geometrical interpretation in X locally. However, they may or may not be globally consistent. For instance, good and bad are in general globally consistent antonyms, i.e. they point in nearly opposite directions in all of their overlapping domains of applicability. In contrast, hot and cool are often antonyms but occasionally point in similar directions, i.e. are synonyms, as in the example of “a hot videogame” and “a cool videogame” (cf. footnote 1).Domains of applicability of two relations labeled by words may be overlapping or disjoint. For example, domains of applicability of V. Here they can be further rotated to reduce the dimension of V, respecting the following rule: global synonyms should remain nearly parallel and global antonyms nearly anti-parallel. However, the converse may not be true. For example, if red and brown arrows , therefore, they have to keep this property in V. However, brown and purple arrows cannot be antonyms, because their domains are disjoint. Red and green arrows have overlapping domains in X and are orthogonal in their common domain in X: they are neither synonyms nor antonyms. While in principle according to the above rule they can be oriented at any angle in V, our numerical experiments show that they are more likely to be nearly orthogonal to each other in V, if other angular relations within the overlap of their domains are satisfied.The vectors representing relations labeled by words, when translated to a common origin, span a vector space n arrows have oveX to V is captured by the energy function described in V can be smaller than the dimension of the Euclidean space into which X is mapped. However, because metrics in V respect consistent synonym and antonym relations among all vectors defined at any given location in X, the dimension of V is unlikely to be smaller than the dimension of X itself. Therefore, the dimension of V, which in our analysis is ∼4 provides an approximate upper bound on the dimension of X and a lower bound on the dimension of the Euclidean space into which X is mapped.The above rule to translate and rotate vectors from According to this interpretation, the results of our work can be restated as the following. There are only a small number (∼4) of independent semantic relations that generally apply in a consistent manner to almost all possible domains of applicability. In order of importance, or of the amount of meaning they express, as measured by the captured variance, they can be identified as good/bad , calm/excited , open/closed (freedom), and copious/essential. The first three of these dimensions are consistent across corpora and languages.X is a connected graph G and antonymy (colored). Because each meaning of a word, and in most cases each word, typically has at most one antonym in the dictionary, words again can be associated with directions of their antonym links and therefore can be embedded as vectors in V, as described above. The above analysis suggests that equivalent semantic properties of V will result from interpretation of either individual words or pairs of antonyms as vectors in V.An alternative, simplistic view of the semantic space graph G , right,

MCAO-induced focal cerebral ischemia was associated with increases in hypoxia-inducible factor (HIF)-1α, inducible nitric oxide synthase (iNOS), tumor necrosis factor (TNF)-α, and active caspase-3 expressions in ischemic regions. These expressions were obviously inhibited by 0.7 g kg−1day−1 THSWT treatment. In addition, THSWT inhibited platelet aggregation stimulated by collagen in washed platelets. In an in vivo study, THSWT (16 g kg−1) significantly prolonged platelet plug formation in mice. However, THSWT (20 and 40 μg mL−1) did not significantly reduce the electron spin resonance (ESR) signal intensity of hydroxyl radical (OH•) formation. In conclusion, the most important findings of this study demonstrate for the first time that THSWT possesses potent neuroprotective activity against MCAO-induced focal cerebral ischemia in vivo. This effect may be mediated, at least in part, by the inhibition of both HIF-1α and TNF-α activation, followed by the inhibition of inflammatory responses , apoptosis formation (active caspase-3), and platelet activation, resulting in a reduction in the infarct volume in ischemia-reperfusion brain injury.Tao-Hong-Si-Wu-Tang (THSWT) is a famous traditional Chinese medicine (TMC). In the present study, oral administration of THSWT (0.7 and 1.4 g kg The other experiments were assessed by the method of analysis of variance (ANOVA). If this analysis indicated significant differences among the group means, then each group was compared using the Newman-Keuls method. A P value of <.05 was considered statistically significant.Experimental results are expressed as the means ± S.E.M. and are accompanied by the number of observations. Paired Student's −1day−1) prior to the ischemic insult. Administration of THSWT at 0.7 and 1.4 g kg−1day−1 showed dose-dependent reductions in infarct volume (white area) compared to the solvent-treated group (−1day−1) treated groups at various distances from the frontal pole. The infarct area was largest between the 3rd and 4th sections in both groups. Oral administration of THSWT (0.7 g kg−1day−1) markedly reduced the infarct area in all regions, especially in sections three to five (−1day−1) treated rats at 24 h after MCAO than that of solvent-treated group .All animals in this study showed similar physiological values before, during, and after MCAO among the groups (data not shown). Neither abnormal behavior, depression of respiration, nor hypothermia was observed in the solvent- or THSWT-treated groups. The cerebral infarction was examined using 2-mm-thick slices of the cerebrum 24 h after MCAO reperfusion in rats through TTC staining. , n = 7) . Figure to five . In addiα, detected as a major band of approximately 120 kDa 24 h after MCAO-reperfusion injury (lane 2), was more pronounced than that of levels obtained in the corresponding area of the sham-operated group (lane 1). THSWT (0.7 g kg−1day−1) treatment significantly (P < .05) suppressed the expression of HIF-1α in ischemic cerebral tissues (−1day−1), iNOS expression was markedly reduced in MCAO-reperfused rats compared to levels obtained in the corresponding area of the sham-operated group (lane 1). Again, THSWT (0.7 g kg−1day−1) obviously abolished the elevation of TNF-α (−1day−1) treatment markedly reduced this reaction triggers a more-pronounced platelet aggregation in washed platelet suspensions (μg mL−1) concentration-dependently inhibited platelet aggregation stimulated by collagen (1 μg mL−1). At 40 μg mL−1, THSWT almost inhibited platelet aggregation stimulated by collagen (1 μg mL−1) in washed human platelets (μg kg−1)-pretreated mice, the time to occlusion was approximately 140 s. When THSWT was administered at 16 g kg−1 after pretreatment with fluorescein sodium, occlusion times were markedly prolonged compared to the solvent controls (Collagen (1 pensions . THSWT (latelets . The solP < .01) .●) were observed as shown in μg mL−1) did not significantly suppress hydroxyl radical formation compared to the solvent-treated group. This observation provides direct evidence suggesting that the neuroprotective effect of THSWT was not mediated by free radical-scavenging activity.In this study, typical ESR signals of hydroxyl radicals [α expression after ischemic injury, and these expressions could be significantly suppressed by THSWT . Bax is family) . In the by THSWT . In addiischemia . Adminisdeficits . In addipoptosis . In thisn injury .in vitro and thrombosis in vivo. In the thrombotic study, the mesenteric venules were continuously irradiated by fluorescein sodium throughout the entire experimental period, thus leading to strong damage to endothelial cells as previously described [−1) of THSWT employed in this model was relatively higher than that (0.7 g kg−1day−1) in MCAO-induced cerebral ischemia. Furthermore, we also examined whether THSWT has direct free radical-scavenging activity in a cell-free system. In this study, the mechanisms of free radical formation in the H2O2/NaOH/DMSO system were assumed to be from superoxide anions and hydroxyl radicals being generated from the degradation of hydrogen peroxide [in vitro. Thus, the neuroprotection of THSWT might not involve, at least partly, the inhibition of free radical formation.Platelet aggregation plays a pathophysiological role in cerebrovascular disorders. Inhibition of platelet aggregation by drugs may represent an increased therapeutic possibility for such diseases. We previously demonstrated that endothelial cell injury induces platelet aggregation and adhesion to vessel walls . In the escribed . Therefoperoxide . The supα and TNF-α, followed by the inhibition of inflammatory responses , apoptosis (active caspase-3), and platelet activation. The rationale for the use of THSWT is based on the fact that multiple deleterious processes in different cell types of organelles are initiated during ischemia-reperfusion injury which ultimately synergistically moves toward irreversible injury. Therefore, treatment with THSWT is not limited to one factor but involves many mechanisms, most of which may be interrelated. For example, THSWT-induced neuroprotection is related to inflammation, NO, and apoptosis, and many of those factors are related to HIF-1α. We speculate that the suppression of these molecules and morphological changes may lead to improvements in patients with ischemic stroke. Thus, these results provide scientific validation of a better understanding of the effectiveness of THSWT in ischemia-reperfusion brain injury and related diseases.In conclusion, the most important findings of this study suggest that the neuroprotective effect of THSWT on cerebral ischemic damage in MCAO-reperfusion rats is probably mediated by the inhibition of HIF-1This work was supported by Grants from the National Science Council of Taiwan (nos. NSC97-2320-B-038-016-MY3 and NSC 95-2320-B-195-003-MY2) the Committee on Chinese Medicine and Pharmacy (no. CCMP97-RD-008) Mackay Memorial Hospital Medical Research Fund (no. MMH9828) and Wan-Fang Hospital-Taipei Medical University(no. 97TMU-WFH-01). Chih-Jen Wu, Jui-Tai Chen contributed equally to this work.

The cyclo­heptene ring adopts a slightly distorted boat conformation. In the crystal structure, inter­molecular N—H⋯O hydrogen bonds form centrosymmetric dimers. A C—H⋯π inter­action, involving the benzene ring, is also found in the structure.In the title mol­ecule, C Å b = 8.0883 (2) Å c = 9.2503 (3) Å β = 108.937 (3)°V = 997.24 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.08 mmT = 200 (2) K 0.56 × 0.38 × 0.31 mm Oxford Diffraction Gemini R diffractometerCrysAlis RED; Oxford Diffraction, 2008T min = 0.985, T max = 1.000 (expected range = 0.960–0.974)Absorption correction: multi-scan (15925 measured reflections4127 independent reflectionsI > 2σ(I)3036 reflections with R int = 0.023 R[F 2 > 2σ(F 2)] = 0.052 wR(F 2) = 0.145 S = 1.01 4127 reflections140 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.31 e Å−3 Δρmin = −0.35 e Å−3 Δρ CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997PLATON (Spek, 2003Data collection: 10.1107/S160053680802463X/wn2274sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680802463X/wn2274Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Alzheimer's disease (AD) is an age-associated progressive neurodegenerative disorder with dementia, the exact pathogenic mechanisms of which remain unknown. We previously reported that homocysteic acid (HA) may be one of the pathological biomarkers in the brain with AD and that the increased levels of HA may induce the accumulation of intraneuronal amyloid-beta (Aβ) peptides. In this study, we further investigated the pathological role of HA in a mouse model of AD. Four-month-old prepathological 3xTg-AD mice exhibited higher levels of HA in the hippocampus than did age-matched nontransgenic mice, suggesting that HA accumulation may precede both Aβ and tau pathologies. We then fed 3-month-old 3xTg-AD mice with vitamin B6-deficient food for 3 weeks to increase the HA levels in the brain. Concomitantly, mice received either saline or anti-HA antibody intraventricularly via a guide cannula every 3 days during the course of the B6-deficient diet. We found that mice that received anti-HA antibody significantly resisted cognitive impairment induced by vitamin B6 deficiency and that AD-related pathological changes in their brains was attenuated compared with the saline-injected control group. A similar neuroprotective effect was observed in 12-month-old 3xTg-AD mice that received anti-HA antibody injections while receiving the regular diet. We conclude that increased brain HA triggers memory impairment and that this condition deteriorates with amyloid and leads to subsequent neurodegeneration in mouse models of AD. Amyloid plaques and neurofibrillary tangles are the two pathophysiological hallmarks of Alzheimer's disease (AD). Intracellular amyloid-beta 42 (Aβ42) is increasingly being recognized as an early pathological trigger that can lead to amyloid plaques and may even induce neurofibrillary tangles. We previously reported that homocysteic acid (HA) induces intracellular accumulation of Aβ42 and that the production of α-synuclein in the presence of methionine results in cell death HA affects the two pathophysiological hallmarks of AD and may be involved in its etiology. HA is also known as an NMDA (N-methyl-D-glutamate) receptor agonist On the basis of these HA toxicities, few researchers have studied the possibility of HA pathogenicity in the onset of AD The 3xTg-AD mouse model showed memory impairment at an early age because of Aβ accumulation in neuronal cells The mouse germline used in this study was a kind gift from Professor F. M. Laferla . The housing environment (12 h/12 h light/dark cycle) was a germ-free clean room. Seven 3xTg-AD hemizygous male mice (3 and 7 months old) were studied. Also, four nontransgenic (non-Tg) mice were studied. The 3xTg-AD mice developed both plaque and tangle pathology in AD-relevant brain regions. Despite an equivalent overexpression of the human sAPP and human tau transgenes, the 3xTg-AD mice developed extracellular As deposits before tangle formation, consistent with the amyloid cascade hypothesis. In addition, these mice exhibited deficits in synaptic plasticity, including long-term potentiation, which occurs before extracellular As deposition and tau pathology but is associated with intracellular As immunoreactivity. These results support the view that synaptic dysfunction is a proximal defect in the pathobiology of AD and precede extracellular plaque formation and neurofibrillary pathology. As these 3xTg-AD mice phenocopy critical aspects of AD neuropathology, this model will be useful in preclinical intervention trials, particularly because the efficacy of anti-AD compounds in mitigating the neurodegenerative effects mediated by both signature lesions can be evaluated.Vitamin B6-deficient food was purchased from Kyudo Ltd.Nutrient composition will be described further.Anti-HA antibodies were purchased from MoBiTec Co. (Germany). Polyclonal antisera were raised in rabbits after immunization with a glutaraldehyde-containing HA conjugate, following which antibody specificity was determined by performing ELISA with competition experiments involving HA-G-BSA, cysteine-G-BSA, and homocysteine-G-BSA .We synthesized a glutaraldehyde-containing HA conjugate KLH (Keyhole limpet hemocyanin) compound, and mice were immunized twice by IP route with this compound and BCG. Two weeks later KLH and BCG immunized mice again. Immunization volume was 20 µL.The apparatus used for Morris water maze task comprised a circular aluminum tank (1.5 m in diameter) painted white and filled with water maintained at 26–29°C. The maze was located in a room containing several simple, visual extramaze cues. To reduce stress, mice were placed on a platform in both the hidden and cued versions of the task for 10 s before the first training trial.Mice were trained to swim to a 14-cm circular clear Plexiglas platform placed 1.5 cm below the water surface that was invisible to the mice while swimming. Platform location was randomly selected for each mouse but was kept constant for that mouse throughout the training period. In each trial, mouse was placed in the tank at one of the four designated starting points in a pseudorandom order. Mice were allowed to search for and escape to the submerged platform. If a mouse failed to find the platform within 60 s, it was manually guided towards it and allowed to remain there for 10 s. Then, each mouse was placed in a holding cage under a warming lamp for 25 s until the start of the next trial. To ensure that memory differences were not due to the lack of task learning, the mice underwent four trials a day for as many days as required to meet the criterion, which was defined as a <20-s mean escape latency before the first probe trial was run. To prevent overtraining, probe trials were run for each group as soon as they met the group criterion and stopped after all the groups met the criterion. Retention of spatial training was assessed 1.5 and 24 h after the last training trial. Both probe trials consisted of a 60-s free swim in the pool without the platform. Mice were monitored by a camera mounted on the ceiling directly above the pool and all trials were stored on videotape (burnt onto a DVD) for subsequent analysis. Parameters measured during the probe trial comprised initial latency time to reach the platform (1).2 asphyxiation, and the brains were rapidly removed and fixed for 48 h in 4% paraformaldehyde. Sections (50-µm thick) were processed for free-floating immunohistochemistry as previously described Mice were sacrificed by COg for 25 min. The supernatant was washed five times with an equal volume of diethyl ether and the aqueous phase was maintained. Residual ether was evaporated under nitrogen at room temperature for 5 min. Immediately thereafter, 20 µL was injected into the HPLC system.HA was extracted from mouse brain (hippocampus and cortex) with trichloroacetic acid. Brains (1.50−2.00 g) were isolated from 4-month-old 3xTg-AD homozygous male mice. Mice were killed by rapid decapitation and their brains were quickly excised and placed on an ice-cold petri dish. For the gradient high-performance liquid chromatography (HPLC) method, tissue samples were weighed and homogenized using a sonicator for 10 s in ice in 4 mL of ice-cold 10% (w/v) trichloroacetic acid per 100 mg tissue (wet weight). HA (4 µg) was added as an internal standard. For isocratic HPLC, tissue samples were divided into six aliquots. The samples were homogenized as described above. The homogenates for isocratic or gradient HPLC were left on ice for 1 h and centrifuged at 20,000×Urine of the 3xTg-AD male mice (15-month-old) was collected for 24 h. The urinary HA level was measured according to the method of the HPLC system.Mice were anesthetized as follows: 2-mm-wide incisions were made in the left hemisphere and a guide cannula was inserted into the left ventricular space using a Teflon tube (1 mm in diameter). This operation did not impair learning and memory performance, and the abilities of the operated mice were similar to those of mice that did not undergo surgery.t-test and P-values (p<0.05).Statistical significance was estimated with Student's All animals experiments have been done according to the accepted international guideline methods and Saga Woman Junior College approved this work according to animal experimental guideline.P<0.05) higher than those in age-matched control mice. This finding indicates that HA may contribute to the pathology of AD.We measured HA levels in the brains of 4-month-old 3xTg-AD-homozygous mice. At this age, mice display an intracellular accumulation of Aβ in the brain regions affected by AD. This accumulation also appears to be associated with the early memory deficit exhibited by these mice We then fed 3-month-old 3xTg-AD mice vitamin B6-deficient food for 3 weeks to increase HA levels in the brain. The brain HA levels were significantly increased following the 3-week vitamin B6-deficient diet . ConsistTo further examine the role of HA in the pathogenesis of AD, we administered anti-HA antibody intracranially through guide cannula during the course of the vitamin B6-deficient diet. Anti-HA antibody significantly decreased the HA level in 3xTg-AD mice and HA vWe next evaluated the hippocampus-dependent memory with the Morris water maze task. Three-month old 3xTg-AD mice given a vitamin B6-deficient diet exhibited significant memory impairment compared with 3-month-old control mice induced neurogenesis. We are interested in the finding that the anti-pain effect induced the neurogenesis of hippocampus In conclusion, (i) HA accelerates pathological changes in AD; and (ii) HA toxicity decreases with anti-HA antibody, which induces strong neurogenesis in the hippocampus, resulting in marked recovery of memory performance. Our hypothesis is also supported by the observation that anti-HA antibodies induced marked recovery in 7-month-old hemizygous mice However, recovery was observed on the second trial day and not the third trial day. This observation could be probably induced by the fact that the control hemizygous mice did not impair partially their memory ability at 7 months old and that control mice exhibited partial good memory performance on the third trial day. We should note the cure effect of anti-HA antibody or HA vaccine on memory impairment of 3xTg-AD mice. Homozygous 3xTg-AD mice exhibited complete memory impairment at 12 months old with normal food intake . HA vaccThis is the first study, to our knowledge, to demonstrate marked recovery from AD induced by treatment with anti-HA antibody or HA vaccine. Our findings prove the strong curative effect of anti-HA antibody treatment and HA vaccine and support the idea that HA is a true etiological agent and an accelerator in the pathogenesis of AD. However, one may think that vitamin B6-deficient burden 3xTg-AD mice to have HA pathogen artificially. We thus needed to investigate whether the effect of anti-HA antibody or HA vaccine could be observed in the normal feeding of 3xTg-AD mice. The result shows clearly the strong cure effect of anti-HA antibody and HA vaccine in the normal feeding of 3xTg-AD mice (12-month-old; But how does HA induce neurodegeneration? HA affects the two pathophysiological hallmarks of AD and may be involved in its etiology. Moreover, HA itself can induce neurodegeneration at a higher level with no amyloid

Almost 20 years after the development of models of malaria pathogenesis began, we are beyond the ‘proof-of-concept’ phase and these models are no longer abstract mathematical exercises. They have refined our knowledge of within-host processes, and have brought insights that could not easily have been obtained from experimentation alone. There is much potential that remains to be realized, however, both in terms of informing the design of interventions and health policy, and in terms of addressing lingering questions about the basic biology of malaria. Recent research has begun to iterate theory and data in a much more comprehensive way, and the use of statistical techniques for model fitting and comparison offers a promising approach for providing a quantitative understanding of the pathogenesis of such a complex disease. Identifying factors that are involved in pathogenesis is important, but it is really only the first step towards a complete understanding of infectious disease. In the words of Ronald Ross, ‘To say that a disease depends upon certain factors is not to say much, until we can also form an estimate as to how largely each factor influences the whole result’ cited by . Ross waPlasmodium parasite causes disease), the relative significance of different factors in the development of disease is still debated ubiquitous in studies of malaria epidemiology have the capacity to be equally informative when applied to questions of malaria pathogenesis. Yet modelling the within-host dynamics of malaria is a comparatively new practice, beginning just 20 years ago e.g. .The types of mathematical models of malaria pathogenesis we discuss in this review are based on a mechanistic description of the underlying biology of the system. This contrasts with purely statistical (i.e. curve-fitting models), although our exclusion of this class of models is not a value judgement. Indeed, such statistical models have also provided important insights of the kinds of cells and/or molecules thought to be important in pathogenesis. For example, it might track the density of asexual and sexual parasite forms, red blood cells, and various types of immune effectors. As factors are identified as being potentially important in regulating these variables, they are translated into a mathematical formulation that can be incorporated into the basic model structure.The ultimate aim when building models of malaria pathogenesis is to simplify the highly complex biological processes occurring during an infection into a comprehensible mathematical system from which inferences and predictions can be drawn. Critical in this process is the recognition that not all details of the biological system are relevant for understanding and predicting pathogenesis. Models need not (in fact should not) incorporate everything that we know about the biological system: we seek to understand the important components of reality, not to replicate the reality we do not understand. Indeed, the true power of a good model lies in its ability to expose the central agents responsible for the biological patterns under investigation by dispensing with the irrelevant details. Models help us to determine what is irrelevant.M), gametocytes (G), and red blood cells (R), change from one day to the next;t + 1) is some function of their densities on the present day (time t). Notice that two of these functions do not depend on the gametocyte density, G(t), reflecting an assumption that gametocytes play no role in determining the merozoite or RBC counts on the next day. Other assumptions about how various biological processes work are captured by the specific forms of the functions fM, fM and fR to denote the density of specific T cells on day t then the model might be extended asfM, fG, fR and fT are specified to account for the relevant assumptions about how these processes work , models have helped elucidate some of their general characteristics. Models of malaria have repeatedly demonstrated that immune responses are more effective if directed towards infected RBCs rather than free-living merozoites over successive parasite peaks, finding, for example, that innate immune responses are almost entirely responsible for controlling the primary peak but are completely absent after the sixth peak.Also, as we would expect, innate immune responses are predicted to be most important during initial parasite peaks and progressively less important throughout the course of infection or older RBCs towards mathematical descriptions that more closely accord with the qualitative picture emerging from experimental immunology e.g. . Indeed,quantitative description of observed dynamics requires further assessment. This kind of ‘goodness-of-fit’ analysis is still relatively uncommon in mathematical treatments of malaria, but recent research has begun to take this approach have an advantage in immunized hosts. Theory offers an easier and powerful approach for teasing apart mechanisms.Some of the potential evolutionary effects of interventions have been studied with model organisms and while their results are important they are not always well understood. Why, for example, does passaging malaria parasites through immunized mice result in selection for more virulent parasites ? In partThe fundamental goal of any study of malaria pathogenesis is to bring new insights towards developing successful treatment and control measures for this disease. Given the lack of progress in the past, our best hope for tackling the problem of malaria is through a more comprehensive understanding of the mechanisms that determine its pathogenesis. Unless these processes can be translated into mathematical models that accurately capture the dynamics of pathogenesis, this understanding will remain out of reach. In the process of striving for a mathematical account of malaria pathogenesis, we will likely discover the existence of new regulatory factors and that some regulatory factors are largely unimportant. By determining the relative importance of what does matter, and how those factors interact, we will be able to predict the likely consequences of clinical interventions, such as vaccines and chemotherapeutic agents targeted at particular parasite stages, and novel interventions aimed at host factors which determine disease (immunopathology). Achieving this promise requires the careful interactions between experimental biologists who appreciate that useful models need not include every last detail of every pathway, and biomathematicians who are prepared to tackle the jargon, the huge experimental literature and the fuzzy uncertainties of real experimental data.

The NiII atom is coordinated by four N atoms and two O atoms of two deprotonated Schiff base ligands, forming a slightly distorted octa­hedral coordination configuration, in which the tertiary N atoms occupy the axial positions.The centrosymmetric title complex, [Ni(C DOI: 10.1107/S1600536808020497/at2571Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Cholesterol is known to be essential for fetal development.Statins, which inhibit cholesterol production, have therefore been considered as potential teratogens and are contraindicated in pregnancy.Data available thus far on the risks of congenital anomalies associated with statin therapy have come from non-analytic postmarketing surveillance studies.Given the increasing use of statins in women of childbearing age, there is a need for a population-based study on the risks of congenital anomalies associated with gestational statin use.In this pharmacoepidemiological study, we determined the risk of congenital anomalies in women who filled prescriptions for statins during the first trimester of pregnancy, compared with women who had stopped statins before pregnancy or those who used fibrates during pregnancy.We found no evidence of an increased risk of fetal anomalies among first-trimester statin users, or any discernable pattern of congenital anomalies among live births.However, in the absence of outcome data on nonlive births, conclusions remain uncertain.Evidence from animal studies suggests that statin medications should not be taken during pregnancy. Our aim was to examine the association between the use of statins in early pregnancy and the incidence of congenital anomalies.A population-based pregnancy registry was built. Three study groups were assembled: women prescribed statins in the first trimester (group A), fibrate/nicotinic acid in the first trimester (group B) and statins between 1 year and 1 month before conception, but not during pregnancy (group C). Among live-born infants, we selected as cases infants with any congenital anomaly diagnosed in the first year of life. Controls were defined as infants with no congenital anomalies. The rate of congenital anomalies in the respective groups was calculated. Adjusted odds ratios (OR) and 95% confidence intervals (CI) were also calculated.Our study group consisted of 288 pregnant women. Among women with a live birth, the rate of congenital anomalies was 3/64 in group A, 3/14 in group B and 7/67 in group C . The adjusted OR for congenital anomalies in group A compared with group C was 0.36 .We did not detect a pattern in fetal congenital anomalies or evidence of an increased risk in the live-born infants of women filling prescriptions for statins in the first trimester of pregnancy. Conclusions, however, remain uncertain in the absence of data from nonlive births. High blood cholesterol has been shown to be a risk factor for coronary heart disease (CHD) and cardiovascular death . The risPregnant women or those likely to become pregnant clearly fall within the populations that might become targets for antilipaemic drug therapy. During normal pregnancy, there is a steady physiological increase in serum lipid concentrations, so that by the third trimester triglyceride levels are 300–400% higher and cholesterol levels 25–90% higher than in the nonpregnant state . NeverthNo controlled studies have assessed the teratogenic potential of any statins in humans. However, case-series and postmarketing surveillance data are available. A recent notable report was on a case series . The RAMQ covers all Quebec residents for the cost of physician visits, hospitalizations and procedures, but covers only a proportion of residents for the cost of prescribed medications. The RAMQ drug plan covers individuals ≥65 years old, recipients of social assistance (welfare beneficiaries) and workers and their families (adherents) who do not have access to a private insurance programme, accounting for approximately 43% of the overall Quebec population at any time before or during pregnancy; the diagnosis of diabetes in the year before pregnancy or gestational diabetes diagnosed at ≥26 weeks of pregnancy , or the filling of prescriptions for medications for diabetes in the 12 months before and during pregnancy, including insulins and oral hypoglycemics ; the diagnosis of chronic hypertension in the year before and during pregnancy , or the filling of prescriptions for any antihypertensive drugs (AHFS class 24 : 08), or gestational hypertension defined as a diagnosis made at ≥20 weeks of pregnancy and identified with ICD-9 codes 642.0–642.9. Both diabetes and hypothyroidism are causes of secondary hyperlipidaemia and, togWe also considered the number of different medications prescribed other than statins or fibrates/nicotinic acid during pregnancy. Where such prescribed medications were considered, we took into account those prescriptions filled before pregnancy but whose duration overlapped into the period of pregnancy. The data collected on the babies included birth weight and gender (ISQ database). As there is an increased risk of prematurity in fetuses with a congenital anomaly , we alsoWe investigated the presence of major and minor congenital anomalies in live-born babies. Cases were defined as infants born with any congenital anomaly. These were identified by searching the RAMQ and Med-Echo databases for ICD-9 codes 740.0–759.9 among those women with live births. The index date for case definition was considered as the end of pregnancy. However, we also searched for records of congenital anomalies made within the first 12 months of each infant's life, to allow for delayed detections or registrations and enhance the detection of anomalies. Controls were defined as infants with no (neither major nor minor) congenital anomaly documented in the first 12 months of life.Pregnancy outcomes in the three study groups are described. Further descriptive statistics were performed only for those women with live births. Descriptive statistics were also used to describe the population by case status. The congenital anomalies detected, stratified by study group, are also listed.et al. [P > 0.25. Maternal age at end of pregnancy and the following measures of socioeconomic status were retained in the model: place of residence, insurance status, marital status and years of education achieved. To test for a curvilinear relationship between age and congenital anomaly, a quadratic term (age squared) was added to the linear term in a separate model. There were missing data in two variables, marital status (7.6%) and years of education achieved (8.3%). This was dealt with by assuming cohabitation for marital status and secondary education completed (11 years' education), where data were missing. We examined the effect on our model of reversing these assumptions and adopting living alone as the default for marital status, and for education assuming either secondary education not completed (≤10 years) or university education (≥16 years' education).The incidence of congenital anomalies for each study group was calculated using the number of reported anomalies in mother–baby-linked live births as the numerator and the total number of mother–baby-linked live births for each group as the denominator. Confidence intervals (CIs) were calculated using the method of Haenszel et al. for PoisDescriptive and statistical analyses were performed using the SAS System for Windows V8.0 . Ethics approval was obtained from the Research Ethics Board of CHU Sainte-Justine and from the Commission for access to information of Quebec.The Medication and Pregnancy registry included 110 313 women. Of these, 153 women received a statin during the first trimester of pregnancy (group A), 29 received a fibrate or nicotinic acid in the first trimester of pregnancy (group B) and 106 women received a statin in the period between 1 year before conception and 1 month before conception (group C). The pregnancy outcomes for these three groups are described in We were able to perform a link of mother–baby data for 64 of the 69 known live births for group A. In group B mother–baby linkage was possible in 14 out of the 15 known live births, whereas in group C all mothers were successfully linked to babies (67/67). Further results refer to these groups.The patterns of antilipaemic medications used are presented in The rate of congenital anomalies in group A was 3/64 . The ratThe first multivariate analysis of the entire study cohort, stratified by study group (using group B as the reference group), included the variables; maternal age at end of pregnancy (as a continuous variable), all the socioeconomic variables as previously described, and the following categorical indicators of co-morbid diseases: diabetes, hypertension, hypothyroidism, comedications and medical visits before pregnancy and history of pregnancy in previous year. The adjusted OR for congenital anomalies for group A was 0.79 and for group C 1.74 , when compared with group B. In the second multivariate analysis, which included groups A and C, using group C as the reference group, the final model was adjusted for age at end of pregnancy (as a continuous variable), socioeconomic variables as previously described, and the following categorical indicators of co-morbid diseases: diabetes, hypothyroidism, comedications, medical visits before pregnancy, low birth weight and baby's gender. The adjusted OR for groupA was 0.36 , when compared with group C.P for the quadratic term in the first multivariate analysis = 0.22; P for the quadratic term in second multivariate analysis = 0.50). Under the alternative assumptions for missing data, i.e. living alone by default and education ≤10 years, the point estimates for groups A and C in the first multivariate analysis of the entire study cohort stratified by study group were adjusted OR = 0.72 and adjusted OR = 1.51 , respectively. If ≥16 years of education was assumed, then the adjusted OR estimates were 0.73 and 1.54 for groups A and C, respectively. The adjusted ORs in the second multivariate analysis (comparing group A with C) under these various assumptions remained unchanged.There was no evidence of a nonlinear trend with the quadratic term for maternal age entered into the model . In grouIn this study, we found that the overall incidence of congenital anomalies in pregnancies where prescriptions for statins had been filled in the first trimester of pregnancy was not statistically greater than the incidence in those pregnancies where prescriptions for fibrates only had been filled in the first trimester , or where the statins had been stopped at least 1 month before conception . There was no evident pattern in the types of congenital anomalies among the live births. However, the sample size of our study was small and lacked sufficient power to detect small increases in overall risk among those taking statins during pregnancy. Furthermore, the number of cases ascertained was also very small. We acknowledge that this is a limitation in drawing inferences from the statistical tests of significance. Nevertheless, this is an issue common to many such studies published so far.The congenital anomalies detected in the three cases where statin prescriptions had been filled in the first trimester involved lovastatin, simvastatin and atorvastatin. No malformations were detected among the 11 infants exposed to pravastatin. One prevailing theory is that statins with high affinity for lipid environments more readily enter extrahepatic tissues, including the embryo during pregnancy, and thus have a greater potential to downregulate cholesterol biosynthesis [n = 2), cleft palate (n = 1), cleft lip (n = 2), oesophageal atresia (n = 1), spina bifida (n = 1), duodenal atresia (n = 1), polydactyly (n = 1), hypospadias (n = 1), constriction of pyelourethral junction (n = 1), clubbed foot (1), vertebral, anal, tracheo-oesophageal, renal (VATER) (n = 1), aqueductal stenosis (n = 1), ‘severe deformity’ (n = 1), microtia (n = 1), ‘cardiovascular defect’ (n = 1) and an atrial/ventricular septal defect/aortic hypoplasia . The stMost studies of associations of human birth defects, such as ours, are undertaken in live births. However, live births represent only part of the population in which such adverse outcomes may be detected . AlthougTo our knowledge, there is no extensive evidence suggesting that the indication for antilipaemic treatment could itself be a cause of adverse fetal outcome other than a case report of possible intrauterine growth restriction . HoweverIn this database study we were able to assemble a cohort of all women known to have been prescribed statins or fibrates within a population, and ascertain pregnancy status. This method allowed us to ascertain a denominator from which the cases (the numerator) are drawn. Controlled epidemiological studies are considered to be more appropriate than uncontrolled case reports in establishing a relationship between gestational drug exposure and pregnancy outcomes in humans . NeverthPharmacoepidemiolgical studies based on administrative databases are important and may yield valuable information despite limitations of the incompleteness of information on potential confounders or on certain clinical variables of interest. In this study, we did not have access to information such as the reasons for the termination of a pregnancy. Information on other potential confounding variables such as smoking and folic acid intake were not available. We also acknowledge that an assumption of our study was that those who filled a prescription were also sufficiently exposed to the medicines, but absolute noncompliance with medications obtained by pregnant women is known to be low, at about 8% .An advantage of database studies that include the routine collection of information on dispensed drugs, including name, dose and amount dispensed, is the avoidance of limitations associated with the need for long-term recall by study subjects . They allow the rapid assembly of cohorts that would otherwise be costly and time consuming if done prospectively. Such database research provides valuable information in the investigation of associations that might have an important public health impact.The prevention of severe hypercholesterolaemia during pregnancy remains desirable. However, for the majority of women discontinuation of antilipaemic drugs such as statins should have little impact on them or their babies. Given the continuing uncertainty over the safety of statins for the fetus, the avoidance of their use during pregnancy remains the best advice; consequently, women on statins should plan their pregnancies to guarantee the best outcome.In conclusion, we did not detect a pattern in congenital anomalies or find evidence of an increased risk of fetal congenital anomalies in the live-born infants of women filling prescriptions for statins in the first trimester of pregnancy, compared with women on fibrates or those who stopped statins before pregnancy. However, studies of larger populations that include more information on nonlive births are necessary before confirming or refuting an association between statins and fetal congenital anomalies.

Pulmonary fibrosis is a progressive and lethal disorder. Although the precise mechanisms of pulmonary fibrosis are not fully understood, oxidant/antioxidant and Th1/Th2 balances may play an important role in many of the processes of inflammation and fibrosis. The transcription factor Nrf2 acts as a critical regulator for various inflammatory and immune responses by controlling oxidative stress. We therefore investigated the protective role of Nrf2 against the development of pulmonary fibrosis.To generate pulmonary fibrosis, both wild-type C57BL/6 mice and Nrf2-deficient mice of the same background were administered bleomycin intratracheally.The survival of Nrf2-deficient mice after bleomycin administration was significantly lower than that of wild-type mice. The degree of bleomycin-induced initial pulmonary inflammation and pulmonary fibrosis was much more severe in Nrf2-deficient mice than in wild-type mice. The expression of antioxidant enzymes and phase II detoxifying enzymes was significantly reduced in the lungs of Nrf2-deficient mice, concomitant with an elevation of lung 8-isoprostane level, compared with wild-type mice. The expression of Th2 cytokines, such as interleukin-4 and interleukin-13, was significantly elevated in the lungs of Nrf2-deficient mice with an increase in the number of Th2 cells that express GATA-binding protein 3.The results indicated that Nrf2 protects against the development of pulmonary fibrosis by regulating the cellular redox level and lung Th1/Th2 balance. Thus, Nrf2 might be an important genetic factor in the determination of susceptibility to pulmonary fibrosis. Pulmonary fibrosis is a chronic progressive disorder in which excessive deposition of extracellular matrix as a result of tissue injury leads to irreversible scarring of interstitial lung tissue ,2. AlthoOxidative stress may play an important role in this process because excessive levels of reactive oxygen species (ROS) may damage cellular macromolecules such as DNAs, lipids, and proteins, leading to oxidative stress-induced tissue injury ,5. To liThere are several factors that modify wound healing and the degree of fibrosis. Among them, an inflammatory phenotype (Th1 or Th2) is thought to be important as a host factor to modulate tissue injury and fibrosis. In idiopathic pulmonary fibrosis, the inflammatory response closely resembles a Th2-type immune response, with increases in the number of eosinophils and mast cells, and increased amounts of Th2 cytokines such as interleukin (IL)-4 and IL-13 ,11. In mNrf2 is a member of the family of cap'n'collar basic leucine zipper transcription factors and has been identified as a pivotal factor in the coordinated induction of antioxidant and phase II detoxifying enzymes under the regulatory influence of the antioxidant response element (ARE) ,14. IndeNrf2-/-) mice with an ICR/129sv background were backcrossed with C57BL/6 mice for eight generations. C57BL/6 WT mice were purchased from Charles River Japan . All the mice used in this study were 6 to 8 weeks old and maintained in our animal facilities under specific pathogen-free conditions. All animal studies were approved by the Institutional Review Board. Mice were administered bleomycin or saline intratracheally.Nrf2-deficient activity using standard NADH-linked enzymatic assay procedures as previously described . Cells wThe concentrations of tumor necrosis factor (TNF)-α and macrophage inflammatory protein-2 (MIP-2) in the supernatant of the first BAL fluid were determined by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions . The concentrations of IL-4, IL-13, and interferon-γ (IFN-γ) in the lung homogenates were also determined by ELISA (R&D systems).Seven days after bleomycin or saline administration, total RNA was extracted from lung tissues, and real-time quantitative RT-PCR was performed using an ABI7700 sequence detector . The ready-made PCR primers of GST-P1, GCLS, NQO1, Prx-I, HO-1, T-bet, and GATA-binding protein 3 were used in this study. The results were normalized by GAPDH gene expression.The concentration of 8-isoprostane in the lung homogenates was determined by ELISA .Seven days after bleomycin or saline administration, the lungs were removed, minced, and incubated with RPMI 1640 containing 10% fetal bovine serum and 75 U/ml collagenase at 37°C for 90 minutes. The cells were then filtered through 20-μm nylon mesh. The cell suspensions were stained with anti-CD4, anti-CD8, anti-CXCR3, and anti-CCR3 antibodies , respectively. After staining, the cells were analyzed by flow cytometry using a FACSCaliber flow cytometer with CellQuest software .Levels of IFN-γ and IL-4 production in T cells were determined by flow cytometric intracellular cytokine analysis as previously described . BrieflyOne day after bleomycin or saline administration, the lungs were removed and nuclear fractions were prepared using a Nuclear Extraction Kit according to the manufacturer's protocol. The nuclear proteins were separated on 5-15% gradient SDS-polyacrylamide gels and transferred onto a polyvinylidene difluoride membrane. The membrane was stained immunochemically using an antibody against nuclear factor-κB (NF-kB) p65 subunit . Immunoreactive bands were detected using ECL Western blotting detection reagents . Lamin B was used as an internal control.p < 0.05 were considered to be statistically significant.Data were expressed as the mean ± SEM. Comparisons of data among the experimental groups were performed using ANOVA and Scheffe's test. The survival curves were analyzed using the log-rank test. Values of Nrf2-/- mice died within 28 days after bleomycin administration and is maintained at a reduced level by the Keap1-dependent ubiquitination and proteosomal degradation systems,31. Uponand NQO1 . The puland NQO1 .Nrf2-/- mice after bleomycin administration. These cytokines enhance the fibrotic process by augmenting fibroblast proliferation and collagen production, and are required for the initiation and maintenance of pulmonary fibrosis [Nrf2-/- mice after bleomycin administration. The measurement of intracellular cytokine levels also revealed that the proportion of IL-4-producing T cells was increased whereas the proportion of IFN-γ-producing T cells was decreased in the lungs of Nrf2-/- mice after bleomycin administration. These findings suggest that the Th1/Th2 balance is shifted toward Th2 in the lungs of Nrf2-/- mice by exposure to bleomycin. Nrf2 may affect the differentiation and cytokine production of T cells rather than baseline homing of Th1/Th2 cells in the lungs, since the level of Th1 and Th2 cells was not different between the lungs of WT mice and Nrf2-/- mice under the unstimulated condition.Although the pathogenesis of pulmonary fibrosis is not fully understood, a newer hypothesis suggests that pulmonary fibrosis is the culmination of the wound-healing responses to sequential acute lung injury . The fibfibrosis -37. BothNrf2-/- mice, whereas the GATA3 level was not altered in the lymphocytes from WT mice after bleomycin administration. Thus, GATA3-mediated Th2 cell differentiation and Th2 cytokine induction are an additional mechanism for aggravation of bleomycin-induced pulmonary fibrosis in mice lacking Nrf2. The relationship between Nrf2 and Th2 bias has been reported previously. Genetic deletion of Nrf2 renders mice more susceptible to Th2-driven allergic airway inflammation [Nrf2-/- dendritic cells with ambient particulate matter augmented oxidative stress and Th2 cytokine production as compared with Nrf2 wild-type dendritic cells [The differentiation of Th1/Th2 cells is regulated by the transcription factors T-bet and GATA3, respectively. GATA3, a member of the GATA family of zinc-finger transcription factors, is known to be a key regulator of Th2 development. It has been demonstrated that antisense GATA3 inhibits the expression of all Th2 cytokine genes in the Th2 clone D10 . In tranammation . Furtheric cells .Nrf2-/- mice after bleomycin exposure, it has been demonstrated that oxidative stress favors a Th2-polarizing condition. King et al. have demonstrated that exposure of T cells to 2,3-dimethoxy-1,4-naphthoquinone, which generates a low level of superoxide anion, resulted in the growth of cells expressing CCR4, and a decrease in cells expressing CXCR3, indicating phenotypic conversion to Th2 cells by activation of signal transducer and activator of transcription 6 (STAT6), leading to the induction of GATA3 [Nrf2-/- mice after bleomycin exposure (data not shown). These findings suggest that enhanced oxidative stress promotes Th2 cell differentiation and Th2 cytokine production by activating STAT6, followed by activation of GATA3. Thus, Nrf2 may be a critical regulator for Th1/Th2 balance in the lungs exposed to oxidants or electrophiles.Although it is unclear why Th2 bias occurs in of GATA3 . In the Nrf2-/- mice after bleomycin administration. NF-κB plays a cardinal role in the development of pulmonary inflammation through transcriptional activation of many proinflammatory genes, including the genes of cytokines and chemokines [Nrf2-/- mice. NF-κB is known as a redox-sensitive transcription factor that is activated by ROS [Nrf2-/- macrophages may cause an overwhelming inflammatory response and thus evoke pulmonary fibrosis.In the present study, the activation of NF-κB was enhanced in the lungs of emokines . In the d by ROS ,46. It id by ROS ,48. It iThe present study showed that Nrf2 protects against the development of bleomycin-induced pulmonary inflammation and fibrosis by regulating the cellular redox level and Th1/Th2 balance. Nrf2 has an advantage over a single antioxidant molecule for the treatment of acute lung injury and pulmonary fibrosis, since Nrf2 coordinately induces a variety of self-defense genes, including antioxidant and phase II enzymes. In addition, Nrf2 is expressed abundantly in macrophages, cells which are easily collected by BAL. Acute respiratory distress syndrome and idiopathic pulmonary fibrosis are lethal disorders for which effective therapeutic approaches are not readily available. Although transcription factor regulation therapy cannot currently be used for the treatment of these diseases, we believe that the present results may lead to new therapeutic options.Nrf2: NF-E2 related factor-2; Keap1: Kelch-like ECH-associated protein-1; ROS: reactive oxygen species; GST: glutathione-S-transferase; NQO1: NADP(H): quinine oxidoreductase; GCLC: glutamate-cysteine ligase catalytic; HO-1: heme oxygenase-1; Prx-I: peroxiredoxin I; ARE: antioxidant response element; TNF-α: tumor necrosis factor-α; MIP-2: macrophage inflammatory protein-2; STAT6: signal transducer and activator of transcription 6; GATA3: GATA binding protein-3; NF-κB: nuclear factor-kappaB.The authors declare that they have no competing interests.in vitro and in vivo experiments and drafted the initial version of the manuscript. YM carried out flow cytometry. YY and NH contributed to the in vivo and in vitro experiments. KI and MY generated the knockout mouse. YI and NH participated in the design and coordination of the study and drafted the final manuscript. All authors have read and approved the final manuscript.NK performed the

Candida albicans in the immunocompetent host is a benign member of the human microbiota. Though, when host physiology is disrupted, this commensal-host interaction can degenerate and lead to an opportunistic infection. Relatively little is known regarding the dynamics of C. albicans colonization and pathogenesis. We developed a C. albicans cell surface protein microarray to profile the immunoglobulin G response during commensal colonization and candidemia. The antibody response from the sera of patients with candidemia and our negative control groups indicate that the immunocompetent host exists in permanent host-pathogen interplay with commensal C. albicans. This report also identifies cell surface antigens that are specific to different phases of candidemia. We identified a set of thirteen cell surface antigens capable of distinguishing acute candidemia from healthy individuals and uninfected hospital patients with commensal colonization. Interestingly, a large proportion of these cell surface antigens are involved in either oxidative stress or drug resistance. In addition, we identified 33 antigenic proteins that are enriched in convalescent sera of the candidemia patients. Intriguingly, we found within this subset an increase in antigens associated with heme-associated iron acquisition. These findings have important implications for the mechanisms of C. albicans colonization as well as the development of systemic infection. Candida albicans has both a benign and pathogenic association with the human host. Previous to this study, little was known in regard to how the host humoral system responds to the commensal colonization of C. albicans, as well as the development of hematogenously disseminated candidiasis. We show using a C. albicans cell surface protein microarray that the immunocompetent host exists in permanent host-pathogen interplay with commensal C. albicans, and undergoes stage-specific antibody responses as the yeast transitions from a benign microbe to an opportunistic fungal pathogen. Also identified were serological signatures specific for acute and convalescent stages of candidemia. Our findings provide new insight in the characterization of potential serodiagnostic antigens and vaccine candidates to the opportunistic pathogen C. albicans. Candida albicans exists in a dichotomist relationship with the human host. C. albicans is frequently found as a commensal organism on the human skin, gastrointestinal (GI) tract and the vulvovaginal tract C. albicans as a commensal in the oral cavity. Colonic and rectal colonization is even higher, ranging from 45% to 75% among patient groups. Alterations in the host immunity, physiology, or normal microflora rather than the acquisition of novel or hypervirulent factors associated with C. albicans, are suggested to lead to the development of candidiasis C. albicans into the bloodstream from initial commensal GI colonization or the shedding from developing biofilms on indwelling catheters The yeast in vivo gene expression would provide insight into how C. albicans interacts with host cells during the transition from commensal colonization to an opportunistic pathogen in the immunocompromised host. However, in vivo transcription profiling of C. albicans during commensal colonization or candidemia is technically challenging C. albicans responses to host cells have been performed using ex vivo and in vivo infection models. These include phagocytosis of C. albicans cells by neutrophils C. albicans to host cells identified in these studies. The changes in gene expression identified in these in vitro model systems possibly reflect tissue- or stage-specific expression during an infection in patients. Profiling of antibody responses during infection in patients offers an alternative approach that can overcome technical challenges of in vivo transcription profiling. An antibody-based approach has been used to identify C. albicans gene expression during thrush in individuals with HIV Information on C. albicans from blood cultures is the standard method for the diagnosis of candidemia. Nevertheless, blood cultures may only become positive late in infection, and in one study up to 50% of all autopsy-proven cases of candidemia were reported as negative in blood cultures C. albicans infection is serological diagnosis. An immunoproteomic approach using two-dimensional electrophoresis followed by quantitative Western blotting and mass spectrometry has been used to profile serologic response to peptides from cell surface extracts in candidemia Currently the isolation of C. albicans cell surface protein microarray. Our rationale in developing a cell surface protein microarray is that the cell surface of C. albicans is the immediate target of the human immune system when C. albicans cells enter the bloodstream. Cell surface proteins play important roles in host interaction, and many of them are known virulence factors. In addition, a recent study showed that there is a significant expansion of cell wall, secreted and transporter gene families in pathogenic Candida species in comparison to non-pathogenic yeasts C. albicans invasion of epithelial and endothelial cells is observed in both candidemia patients and non-candidemia controls, including all healthy individuals. Our findings provide new insights into commensal colonization and pathogenesis of C. albicans, as well as the characterization of potential serodiagnostic antigens and vaccine candidates.To investigate the establishment of the humoral immunity during commensal sensitization, as well as the adaptive immune response to candidemia, we have developed a C. albicans. The median time from the date of positive culture to serum collection was two days. The study population was classified by age, gender, underlying disease, portal of entry, antifungal received, and outcome of stay (SH-UF) from January 2004 to December 2006. We collected sera from 21 patients with candidemia where the etiological agent was of stay . A subseC. albicans cell surface proteins were chosen for the protein microarray because they interact directly with the host and thus are likely important for colonization and infection, as well as likely targets for the host immune system. Furthermore, many of their protein expression levels are regulated in response to extracelluar signals, such as stress, nutrients, host factors, or changes in environment. Known antigenic proteins are also included as controls C. albicans cell surface microarray to evaluate the antibody profile of patients with candidemia against healthy individuals and uninfected hospital patients to determine relevant cell surface antigens that correlate with infection. Arrays were probed with a collection of sera consisting of different stages of candidemia: acute, early convalescent (approximately 4 weeks after onset of infection) and mid convalescent (approximately 12 weeks after onset of infection), as well as uninfected hospital patients and healthy individuals. C. albicans cell surface protein microarray showed that the mean global signal intensity was similar among different groups (data not shown), although antigenic profiles are not identical between individuals.We have used the in vitro transcription/translation reaction mixture containing no vector. The top-forty serodominant antigens in the candidemia patients consisted of many previously characterized antigenic peptides such as Bgl2 We were interested in determining the most seroprevalent antibodies in the acute candidemia patients and how their humoral response compared against the negative control groups. Antigens to the most seroprevalent antibodies were defined as serodominant antigens and characterized as having mean antigen reactivity 2-fold greater than the C. albicansCDR4, RAS2, and ALS9 are up-regulated during oxidative stress To determine stage-specific biomarkers of acute candidemia, the normalized serological expression of acute candidemia patients were compared against the humoral reactivity of the uninfected hospital patients and healthy individuals. Serodiagnostic antigens were defined as having an IgG response significantly greater in acute candidemia patients (days 0–14) as compared to the negative control groups with Benjamini and Hochberg (BH) adjusted Cyber-T p-values <0.05. Thirteen antigens met this requirement . MoreoveThe 13-serodiagnostic antigens were also evaluated with a two-way hierarchical cluster analysis on candidemia positive and negative sera. Interestingly, the sera clustered into two distinct groups based on their responses to the 13 antigens . Clusterth antigen has an AUC of 0.630, which still exceeds the upper 95% confidence interval for random expectations for the AUC. To extend the analysis to combinations of antigens, we used kernel methods and support vector machines to build linear and nonlinear classifiers. As inputs to the classifier, we used the highest-ranking AUC antigens in combinations of 2, 5, 10, 11, 12 and 13 proteins and the results were validated with 10 runs of three-fold cross-validation and the negative control groups. The convalescent patient sera consisted of three patients whose serum was drawn under all three disease phases , 4 patients who had blood drawn at the acute and early convalescent phases, and 3 patients whose blood was drawn only at the early convalescent phase. Using BH adjusted Cyber-T p-values <0.05, we identified 33 antigens, 11 of which are from the 13 diagnostic antigens for the acute phase of infection . Among tC. albicans that is different from commensal sensitization. Again, PCA was used to further confirm that the antigenic signatures identified during the convalescent phase of candidemia differed from the negative control groups , to early convalescent (EC), and mid convalescent (MC). A two-way hierarchical cluster analyses was performed on differential IgG responses to the 33 antigens in 3 patients with AI, EC and MC sera, and 4 patients with only AI and EC sera . A one tC. albicans cell surface protein microarray and profiled host humoral responses during conmmensal colonization and during the progression of candidemia. Thirteen novel serodiagnostic antigens were identified for differentiating acute candidemia from commensal sensitization and 33 antigens were found to discriminate convalescent candidemia from non-candidemia controls. The sensitivity and specificity for the identification of acute candidemia determined by the top 10 antigens from the set of 13 serodiagnostic markers are comparable to that obtained using the method of 2D-PAGE and immunoblots et al. reported that the anti-Bgl2p IgG antibody levels mainly define the proteomic signature for candidemia patients in vitro without any glycosylation, its antigenicity is likely different from the Bgl2 produced by C. albicans used in the 2D-PAGE immunoblots. The previously identified immunogenic heat shock protein 90 (Hsp90) is also one of 33 biomarkers for convalescent candidemia identified from this study. Hsp90 has been shown to elicit a protective humoral response C. albicans cell surface protein microarray helped us overcome many of the technical difficulties found with traditional proteomics, since the expression level of recombinant-derived proteins vary by only a single log and the use of fluorescent-labeled antibodies allows for greater linearity, precision, and sensitivity in the quantitative measurement of the humoral response to C. albicans. One of the most beneficial aspects in the use of the protein microarray assay is its ability to detect significant differences in the IgG response that under traditional immunoblot conditions would be below the detectable threshold. However, a potential limitation to our study is that the microarray is based on recombinant peptides. Because of the cell free nature of our in vitro translated peptides, potential epitopes may have been lost due to miss folding and a lack of glycosylation, both of which may affect the conformational structure of the native protein. On the other hand, the removal of posttranslational modifications, such as glycosylation, from the peptides may have revealed hidden peptide epitopes only seen during a strong host immune response. A large collection of peptide epitopes may increase the specificity in diagnosis of infection. In support of this, our study has identified many new clinical biomarkers that are associated with differing states of interactions with the host as well as the characterization of potential new targets for therapeutics and vaccine candidates. To our knowledge, this is the first study using a protein microarray to analyze the serological response to an organism that is capable of existing as both commensal flora and an opportunistic pathogen in the human population.In this study, we have developed a C. albicans is common in humans and attenuated host immunity is a perquisite for the transition from commensal colonization to infection. Historically, it was believed that C. albicans switched from a commensal to a pathogen using distinct pathogen-associated genetic programs when the host immune status was altered. An intriguing review challenges this notion, Hube postulates that C. albicans exists in a permanent host-pathogen interplay where overgrowth and invasion is only observed under immunocompromising conditionsC. albicans or (2) a variable transcriptional profile where C. albicans expression is dependent on the stage- and tissue-specific interactions with the host. Our study indicates the existence of permanent host-pathogen interplay with variable gene expression over the course of infection. The serological response to the entire C. albicans cell surface protein microarray detected considerable homogeneity as well as differences in the patterns of antigens recognized among patients and healthy individuals. The majority of healthy individuals and uninfected hospital patients have moderate to strong IgG responses to many C. albicans cell surface proteins that have long been associated with virulence or hyphal-regulation . In agreement with our protein microarray data, Naglik et al. observed similar levels of IgG titers to the hyphal wall protein Hwp1 in patients with oral candidiasis and asymptomatic mucosal infections as well as healthy culture-negative controls ECE1 transcription is highly expressed during GI colonization and invasion of host tissue Commensal colonization of The microenvironmental conditions during commensal colonization of the host may also play a role in the induction of the IgG response to certain cell surface proteins. Previous studies have evaluated characteristics common to the GI and/or vulvovaginal tract such as blood, hypoxia, iron restriction and weak acid as modifiers of gene expression C. albicans is the identification of discriminating peptides that can differentiate between commensal colonization and candidemia with high sensitivity and specificity. By profiling antibody response from patients with varying stages of candidemia against healthy individuals and candidemia-negative hospital patients, we have identified 13 diagnostic antigens for acute phase of candidemia and 33 for the early/mid convalescent candidemia. The serologic signature in candidemia patients likely reflects an alteration in the level of those proteins due to a change either in transcription and/or protein stability. Stage- and tissue-specific gene expression during the course of systemic infection is expected as C. albicans cells transition through differing microenvironments of the host. Among the 13 diagnostic antigens for acute candidemia, three are associated with drug resistance C. albicansC. albicans overgrowth and infection. Furthermore, a study of global transcriptional responses to oxidative stress observed an increase in the transcriptional expression of CDR4 (4.1-fold), RAS2 (2.5-fold) and ALS9 (1.5-fold) C. albicans is initially exposed to human blood or following phagocytosis by neutrophils and granulocytes C. albicans. Circulating iron in serum is bound to transferrin and ferric reductases are required in the acquisition of iron from transferrin. Interestingly, Cfl91 is found as a biomarker for both acute and convalescent candidemia patients. Of particular interest is the increase antibody response to hemoglobin and heme-related proteins as these molecules are normally sequestered in erythrocytes One of the most challenging tasks in characterizing serodiagnostic antigens from C. albicans. Even though previous sensitization to commensal colonization does not limit mortality or even morbidity in patients, experimental studies have identified protective antibodies against hematogenously disseminated candidiasis, such as heat shock protein 90 (Hsp90) or β-mannan The development of the antigenic profiles over the course of candidiasis may also provide insight into a protective humoral response against Human sera from candidemia patients and hospitalized patients were collected from SH-UF under protocols approved and created by the UF Institutional Review Board. Sera from healthy individuals were obtained from volunteers at the General Clinical Research Center at the University of California, Irvine. Written, informed consent was obtained from participants.C. albicans from blood cultures. Sera from candidemia patients and hospitalized patients were collected from SH-UF as previously published C. albicans. The Infectious Diseases Consultation Service at SH-UF identified controls. Sera were collected and stored at −70°C in the repository at the UF Mycology Research Unit. For patients with candidemia, sera were obtained from the earliest possible date on or after the date that the first positive cultures were drawn. In all cases, this was within 7 days of the first positive culture (acute-phase sera). For ten patients with candidemia, sera were also recovered 4 to 12 weeks after the date on which the first positive cultures were drawn .Candidemia was defined as the recovery of Candida Genome Database (CGD) using keywords such as “cell surface”, “plasma membrane”, and “cell wall”. The CGD annotation of cell surface proteins is based on published experiments C. albicans with primers listed in E. coli as described E. coli based cell-free in vitro transcription/translation system . The protein microarray was made by printing the peptides onto nitrocellulose-coated FAST glass slides (Schleicher & Schuell) using the OmniGrid 100 (GeneMachines) in the UCI Microarray Facility. Each peptide was printed in duplicate and showed homogenous spot morphology as well as low background. Internal controls consisting of buffer alone and a reaction mixture with no DNA were also printed onto the FAST slides. After the addition of the plasma samples the microarray was incubated with a biotin-conjugated donkey anti-human IgG Fcγ fragment specific secondary antibody (Jackson Immunoresearch). The secondary antibody was then removed and the microarray was incubated with Streptavidin: SureLight ® P-3 (Columbia Biosciences). Details concerning microarray construction and controls, antibody profiling, data normalization, as well as the reproducibility and validity of the microarray are given in the Cell surface proteins were selected from the http://www.r-project.org). It has been noted in the literature that data derived from microarray platforms is heteroskedatic www.bioconductor.org) was applied to the quantified array intensities. In addition to removing heteroskedacity, this procedure corrects for non-specific noise effects by finding maximum likelihood shifting and scaling parameters for each array such that the variances of a large number (default setting used: 85%) of the spots on the array are minimized. In other words, the method assumes that variance in binding for the vast majority of the proteins on the array are due to noise rather than true differential immunological response. In essence, 85% of the spots on the array are used as controls for sample-by-sample normalization. This calibration method has been shown to be effective on a number of platforms All analysis was performed using the R statistical environment (www.r-project.org) and STATA . Multiple antigen classifiers were constructed using linear and non-linear Support Vector Machines (SVMs) using the “e1071” R package. To prevent overfitting and show the generalization of the classification method, 10 repeats of three-fold cross-validation were performed. In this methodology, the data is split into 3 class-stratified subsets. For each subset, a classifier is trained using the remaining two-thirds of the data. The classifier is then evaluated on the one-third of the data not used for training. This process is repeated for each split and for 10 different splits, yielding 30 evaluation measures. The ROCR package was used to construct receiver-operating-characteristic curves and perform sensitivity and specificity analyses. Blast2Go (www.blast2go.org) was used for gene ontology annotation and enrichment analysis. To confirm that the identified antigens were accurate, their vectors were resequenced. The Diagnostic biomarkers between groups were determined using a Bayes regularized t-test adapted from Cyber-T for protein arrays http://www.candidagenome.org. The gene names and ORF numbers are listed here: INT1 (19.4257), CWH41 (19.4421), PGA13 (19.6420), RBT5 (19.5636), HWP1 (19.1321), SLK19 (19.6763), YPS7 (19.6481), ALS3 (19.1816), CHS2 (19.7298), EFT2 (19.5788), IPF9655 (19.3988), GNP3 (19.7565), PHR3 (19.5632), ECE1 (19.3374), BGL2 (19.4565), PAN1 (19.19.886), OSH2 (19.5095), CRP1 (19.4784), PRY1 (19.2787), PGA60 (19.5588), UTR2 (19.1671), HNM1 (19.2003), HYR1 (19.4975), WSC4 (19.7251), CDC24 (19.3174), HYR3 (19.575), DNF2 (19.932), MEP2 (19.5672), GCA1 (19.4899), CWH43 (19.3225), FRE10 (19.1415), ALS5 (19.5736), ALS1 (19.5741), SLN1 (19.3256), FCY21 (19.1357), TOS1 (19.1690), FET34 (19.4215), TKL1 (19.5112), CDR1 (19.6000), CFL91 (19.1844), CDR4 (19.5079), ALS9 (19.5742), CDC19 (19.3575), NIK1 (19.5181), CHS8 (19.5384), RTA4 (19.6595), TRK1 (19.600), YOR1 (19.1783), CSC25 (19.6926), RAS2 (19.5902), DRS23 (19.323), IPF25023 (19.2296), ALS6 (19.7414), VPS62 (19.1800), SNQ2 (19.5759), IPF885 (19.7214), CAG1 (19.4015), HNM4 (19.2946), APC5 (19.6861), HSP90 (19.6515), CSA1 (19.7114), GSL2 (19.3269), PGA4 (19.4035), FLC1 (19.2501), CHS1 (19.7298), IPF22247 (19.4940), YCK22 (19.2222), SSU1 (19.7313), RAD50 (19.1648), and CYR1 (19.5148).Detailed information for the genes/proteins from this study can be found at the Candida Genome Database Text S1Supplemental Experimental Procedures and Supplemental References(0.08 MB DOC)Click here for additional data file.Figure S1C. albicans cell surface protein microarray. Representative image of the cell surface protein microarray of C. albicans hybridized with the sera of an acute candidemia patient. The array consisted of sixteen subsets. Each of the C. albicans cell surface peptides were printed in duplicate. The yellow box indicates a duplicated print of buffer alone and the red box shows a duplicate print of reaction mixture with no DNA.(0.13 MB PDF)Click here for additional data file.Figure S2C. albicans cell surface antigens. Heatmap of the entire C. albicans cell surface protein microarray probed with a collection of acute candidemia patients (n = 18), early and mid convalescent candidemia patients (n = 10), uninfected hospital patients (n = 12) and healthy individuals (n = 50). The antigens are in columns and are sorted by normalized mean intensity. The colorized scale ranks the antigens with red being the strongest, bright green the weakest, and black in between.Global expression profile of (0.22 MB PDF)Click here for additional data file.Figure S3Development of the antigenic profile overtime in candidiasis patients. Two-way hierarchical cluster analyses of differential IgG response to the 33 convalescent serodiagnostic antigens (rows) and serum specimens (columns) from candidemia patients. The patients are ordered from left to right starting with the acute infection (AI) phase, early convalescent (EC), and mid convalescent (MC). The colorized scale ranks the antigens with red being the strongest, bright green the weakest, and black in between. Cell surface proteins that showed a significant increase in IgG response from AI to EC are labeled red .(0.17 MB PDF)Click here for additional data file.Table S1Study population characteristics(0.03 MB PDF)Click here for additional data file.Table S2List of proteins and primer sequences on microarray(0.22 MB XLS)Click here for additional data file.Table S3Statistical data of acute candidemia patients(0.24 MB XLS)Click here for additional data file.Table S4Statistical data of convalescent candidemia patients(0.28 MB XLS)Click here for additional data file.

A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands) in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs) is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required.The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0), AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs) within a defined distance (20 bp to 200 bp) to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented.This study develops a database-assisted system, PlantPAN , for recognizing combinatorial .In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at However, defining all functional binding sites within an identified promoter is difficult, and the existence of some additional binding sites should be assumed [cis-regulatory elements in co-regulated genes are identified by exporting sets of genes to AthaMap. The study describes an effective resource, PlantPAN , for identifying the co-occurrence of transcription factor binding sites (TFBSs) in a group of gene promoters with distance constraint between two TFBSs, and presents graphically the transcription factor binding sites in specific gene promoter regions of interest. With the advent of microarray technology, Arabidopsis co-expression tool (ACT) [cis-regulatory elements in the 200 bp region upstream of the transcription start site. Recently, Chawade et al. proposed putative cold acclimation networks by combining data from microarrays, promoter sequences and known promoter binding sites [The appropriate regulation of gene expression is essential for all cellular processes, in which transcriptional control is primarily concerned with improved survival. In animals and plants, transcription factors are key regulators of gene expression and play a critical role in the life cycle . Investi assumed . Further assumed . Some co assumed . Accordi assumed ,6 identi assumed web toolol (ACT) was deveol (ACT) providesng sites . AccordiArabidopsis promoter sequences and consensus sequences for 105 previously characterized transcription factor binding sites (TFBSs) and provides analysis on over-represented TFBSs occurring in multiple promoters. PlnTFDB [cis- and trans- acting regulatory DNA elements, described in earlier studies[Arabidopsis thaliana transcription factor database (AtTFDB) consisting of approximately 1,770 Arabidopsis TFs and their sequences (protein and DNA) grouped into around 50 families with information on available mutants in the corresponding genes. AGRIS [Arabidopsis. JASPAR [Arabidopsis transcription factors. PlantCARE [cis-acting regulatory elements and a portal to tools for the in silico analysis of promoter sequences. AthaMap [cis-regulatory elements in Arabidopsis. Notwithstanding the recent development of the above resources, advances in plant science require a more detailed analysis of plant promoters. For example, CpG islands in the genome are important because of their strong correlation with gene regulation. CpG-rich regions are methylated and are associated with inactive DNA often linked to heterochromatin, gene silencing, and pathogen control [Oryza sativa [Arabidopsis, gene expression is up-regulated when gene promoters were enriched in GGCCCAWW and AAACCCTA repeat sequence; gene expression is down regulated when gene promoters were enriched with TTATCC motif repeat [Many databases harbor collections of numerous transcription factors and are useful for the prediction of transcription factor binding sites in the promoter regions of plants. For instance, TRANSFAC -13 is a PlnTFDB is an in PlnTFDB is a datr studies. AGRIS [r studies containss. AGRIS integrat. JASPAR ,19 is an. JASPAR stores ilantCARE is a dat control -25. In p control -28. Ther control -28. Rece control and CpG control were dev control -33. For a sativa . Moreovef repeat was devecis-regulatory elements within the conserved regions of homologous genes. Moreover, the combinatorial transcription factor binding sites with distance constraint can be identified in a group of gene promoter sequences. The detailed methods are illustrated as follows.PlantPAN is a web-based system which is running on an Apache web server on a Linux operation system. The content of the integrated databases including gene information, gene ontology (GO), gene sequence, promoter sequence, transcription factor binding sites, CpNpG islands and tandem repeat regions are stored in a MySQL relational database system, and all tables are connected by means of Gene ID , Oryza (O. sativa) and maize (Z. mays) was obtained from TAIR (TAIR6_genome_release) [Arabidopsis, Oryza, and Zea are 35,351, 62,827 and 29,759, respectively. Users are allowed to input the gene IDs [Gene information of release) , TIGR (orelease) and ZmGDrelease) , respectrelease) . The numgene IDs , locus nAfter the promoter region had been determined, the regulatory elements, such as transcription factor binding sites (TFBSs), CpG/CpNpG islands, and tandem repeats were annotated. Table Arabidopsis or locus name for Oryza) or a group of promoter sequences is allowed for input to the system. In the second step, the system calculates the GO terms related to the input genes. The genes involved in different GO terms are tabulated. Users can choose all genes or genes in a particular GO term for further analysis. In the third step, the promoter sequence is extracted from the PlantPAN promoter database. However, if users input a group of promoter sequences in step one, then the system will skip steps two and three. In the fourth step, users can select transcription factors binding profiles from different species and scan TFBSs in the promoter regions. The thresholds of the core similarity and the matrix similarity should be set in this step; the default values are 1.0 and 0.75, respectively.The "Gene group analysis" function of PlantPAN system, which comprises seven analytic steps Fig. , is utilApriori is a program that is implemented to mine association rules for a group of input data [Apriori was used to discover the co-occurrence of transcription factor binding sites (TFBSs) and combinatorial TFBSs in a group of gene promoters [In step five, a figure depicts all detected TFBSs in every promoter. Consequently, put data ,44. A seK is the number of background gene promoters used and T is the number of observed gene promoters that are input by users, k is the number of promoters have the combination in the background gene set and t is the number of promoters have the combination in the observed gene set. P-value is calculated for each combination based on the hypermetric equation; smaller the p-value is, more statistically significant the combination is. A smaller p-value of a combination corresponds to greater statistical significance.where et al. found that 75% of the interacting transcription factors were occurred within the characteristic distances which are smaller than 166 bp in yeast [One TFBS which co-occur in a group of gene promoters could be identified in sixth step. Additionally, the fact that target genes with characteristic distances show significantly higher co-expression than those without preferred distances provides evidence for the biological relevance of the observed characteristic distances . Yu et ain yeast . In thisArabidopsis and Oryza in the cross-species analysis of promoter sequences of homologous genes, were extracted from Gramene [The paralogous and orthologous genes among Gramene . Followi Gramene , was app Gramene program.cis-regulatory elements are also revealed graphically to improve presentation.The regulatory features discovered in the promoters are presented graphically or tabulated. A graphical interface is implemented using the GD library of a PHP programming language. Once the analysis has been completed, numerous regulatory characteristics, including transcription factor binding sites, CpG/CpNpG islands, and repeat regions, are shown in an overview. The regulatory features are then presented in more detail if users click the regulatory elements figured in the graph or the label, "View in Table." Moreover, the regulatory elements in the conserved regions and the co-occurrence of PlantPAN has two main functions. Firstly, it applies "Gene group analysis" to identify the co-occurrence of transcription factor binding sites in a group of gene promoters. Combinatorial regulation by transcription factor complexes is an important characteristic of eukaryotic gene regulation ,4,45. Twet al. [et al. predicted that DOF and AP2 could co-regulate At4g37150.1 and At1g20440.1 in this cold regulatory network [In a previous study, Chawade et al. construcet al. . Moreove network , LFY (At5g61850.1), FUL (At5g60910.1), AGL24 (At4g24540.1), and PI (At5g20240.1), which participated importantly in flower development Fig. , and theze) Fig. . SeveralArabidopsis thaliana rbcS-1A (At1g67090.1) promoter has been defined from -320 bp to -125 bp; a binding site is present for the GBF (G-box binding factor) transcription factor binding[Arabidopsis rbcS-1A gene ID for a search, one GBF binding site was identified between -241 bp and -230 bp is one of the putative genes whose promoter contains Up1 and Up2 [Previous investigations have revealed that the gene expression can be up-regulated when the promoter that contains Up1 (GGCCCAWW) or Up2 (AAACCCTA) repeats . Arabido and Up2 . These r and Up2 , which cNevertheless, users can input a novel promoter sequence to analyze the above four regulatory features. After the annotation tools were employed, the selected features, such as TFBSs, CpG/CpNpG islands and tandem repeats, were represented in the graph and table , as predicted in the conserved regions between -58 bp and -48 bp and between -78 bp and -88 bp in Arabidopsis (AT1G48990) and Oryza (LOC_Os05g50110), respectively . Additionally, the transcription factors will be enlarged by taking into account more experimental matrices from different plants. The authors will in the near future be energetically connecting transcription factors to other proteins using protein-protein interaction databases. Furthermore, the plant microarray data will be integrated into "Gene group analysis" of PlantPAN.The number of sequenced and annotated plant genomes is rapidly increasing. The PlantPAN database is currently being expanded to cover species other than PlantPAN provides a "Gene group analysis" function for analyzing the co-occurrence of combinatorial TFBSs with a distance constraint in sets of plant genes. This function extends a good platform to examine the co-expression genes of microarray data in transcriptional regulation networks. Furthermore, the PlantPAN web server not only provides a user-friendly input/output interface, but also offers numerous advantages in plant promoter analysis over currently available tools for annotating plant promoters and table (S1). The data provided represent six supplementary figures and one supplementary table in this study.Click here for file

C-reactive protein (CRP) levels>3 mg/L and>10 mg/L are associated with high and very high cardiovascular risk, respectively, in the general population. Because rheumatoid arthritis (RA) confers excess cardiovascular mortality, we determined the prevalence of these CRP levels among RA patients stratified on the basis of their RA disease activity.We evaluated physician and patient global assessments of disease activity, tender and swollen 28 joint counts, erythrocyte sedimentation rate (ESR), and CRP measured in a single clinic visit for 151 RA patients. Disease activity was calculated using the Clinical Disease Activity Index (CDAI) and the Disease Activity Score 28 Joints (DAS28-ESR and DAS28-CRP).Median CRP level was 5.3 mg/L. 68% of patients had CRP>3 mg/L, and 25% had CRP>10 mg/L. Of those with 0–1 swollen joints (n = 56), or 0–1 tender joints (n = 81), 64% and 67%, respectively, had CRP>3 mg/L, and 23% and 20%, respectively, had CRP>10 mg/L. Of those with remission or mildly active disease by CDAI (n = 58), DAS28-ESR (n = 39), or DAS28-CRP (n = 70), 49–66% had CRP>3 mg/L, and 10–14% had CRP>10 mg/L. Of patients with moderate disease activity by CDAI (n = 51), DAS28-ESR (n = 78), or DAS28-CRP (n = 66), 67–73% had CRP>3 mg/L, and 25–33% had CRP>10 mg/L.Even among RA patients whose disease is judged to be controlled by joint counts or standardized disease scores, a substantial proportion have CRP levels that are associated high or very high risk for future cardiovascular events in the general population. Rheumatoid arthritis (RA) is a chronic inflammatory disease whose predominant clinical manifestations are synovitis and progressive articular damage. Patients with RA, however, experience excess cardiovascular morbidity and mortality that are not explained by Framingham cardiac risk factors but that have been linked to chronic systemic inflammation A substantial body of evidence also implicates systemic inflammation in the pathogenesis of atherosclerosis and CVD in the general population Serum CRP levels in RA patients frequently are above the 3 mg/L and 10 mg/L cutoffs associated with high and very high risk for CVD in the general population. For example, cross-sectional data from a recent observational cohort of 767 RA patients showed the median CRP level to be 11 mg/L, indicating that>50% of those RA patients had CRP levels associated with very high cardiovascular risk Current therapeutic regimens can improve or suppress articular manifestations in many RA patients The 151 patients in this study were enrolled from the RA clinic at San Francisco General Hospital and are part of the University of California San Francisco (UCSF) RA cohort. All patients met ACR 1987 classification criteria for RA and had their therapeutic regimens determined by a UCSF-affiliated rheumatologist. For this study, we included all enrollees who had tender and swollen 28 joint counts, a patient global assessment of disease activity, erythrocyte sedimentation rate (ESR), and CRP determined during a single clinic visit between October, 2006 and April, 2008. Data were extracted from the most recent clinical encounter in which these criteria were met. 145 patients also had a physician's global assessment recorded at that encounter. This study was approved by the UCSF Committee on Human Research, and all patients signed consent documents allowing their clinical information to be gathered and analyzed for research purposes.Data regarding patient age, gender, self-reported ethnicity, disease duration, seropositivity, medication use, and radiographic changes were extracted from each patient's clinical record. Four UCSF faculty rheumatologists trained in the DAS evaluation performed the tender and swollen joint counts and physician global assessment. Swollen and tender joint counts were analyzed categorically as: 0 joint, 1 joint, 2–4 joints, and 5+ joints. Patient and physician global assessments of disease activity were recorded independently using a standard 100 mm horizontal visual analog scale in which 0 = no activity and 100 = maximal activity All laboratory specimens were collected at the time of the clinic visit, with testing conducted in the San Francisco General Hospital clinical laboratories. ESR was measured according to standard Westergren techniques. High sensitivity CRP was measured in serum that had been frozen and stored at −20°C for less than 4 days. CRP assays were performed with a Beckman Coulter IMMAGE Nephelometry System , using a near-infrared particle immunoassay, with a laser diode at 940 nm, a detection limit of 0.20 mg/L, and a measuring range of 0.20–1440 mg/Liter.Spearman correlation coefficients were calculated to examine the associations of clinical characteristics, joint counts and CRP, since many measures were found to be non-normally distributed. The prevalence of elevated CRP was compared across ordered joint, DAS28, and CDAI categories using the Cochran-Armitage test for trend The mean age of the patients was 52.4 years old, and the mean duration of RA was 9.9 years . 89% of The median physician global assessment of disease activity was 27, and the median patient global assessment was 47 . The medSixty-eight percent of study patients had CRP levels>3 mg/L . BecauseLikewise, a substantial majority of those patients with self-rated low disease activity (scores of less than 30 out of 100), had CRP>3 mg/L (29 out of 41 = 71%) which was similar to those with a patient global assessment of≥30 . The patient global assessment of disease activity had a weak, although still statistically significant, overall correlation with CRP and 70% of those with 1 tender joint (n = 23) had CRP levels>3 mg/L . The medOnly 7 patients were in remission by CDAI, and, of these, 4 had CRP levels>3 mg/L . Of the In our cohort of patients, those classified by DAS28-ESR as in remission or with mildly active disease had median CRP levels of 2.8 and 2.9 mg/L, respectively - lower than the levels of CRP found in patients similarly classified by CDAI . HoweverOverall, 25% of our RA patients had CRP levels>10 mg/L . Of patiAmong patients who met criteria for remission, the prevalence of CRP>10 mg/L ranged for 0% for CDAI to 5% for DAS28-ESR and DAS28-CRP . HoweverOur data demonstrate that a substantial proportion of RA patients thought to have suppressed disease nonetheless have CRP levels that are associated with high (>3 mg/L) and very high (>10 mg/L) risk of cardiovascular events in the general population. Our findings should be viewed in the context of currently recommended therapeutic targets in RA. For example, the American College of Rheumatology (ACR) recommends a therapeutic goal of remission or mild disease activity by CDAI or DAS28 The basis for the high prevalence of elevated CRP levels in RA patients with mild to moderate disease activity is not certain but likely is multifactorial. First, the clinical joint exam lacks sensitivity to detect subtle synovitis and may underestimate the extent of active rheumatoid disease. Indeed, magnetic resonance imaging can detect inflammation in rheumatoid joints clinically thought to be free of synovitis Several studies suggest that treatment of RA with methotrexate or TNF inhibitors may reduce cardiovascular events and mortality due to CVD The great majority of patients with moderate disease activity or better in our study were on methotrexate or other synthetic disease-modifying anti-rheumatic drugs. Among the patients receiving TNF inhibitors in our study, the median CRP level (6.0 mg/L) and the prevalence of CRP>3 mg/L (76%) or>10 mg/L (27% ) did not differ significantly from those of patients not using TNF inhibitors, but the patients receiving these agents appeared to have more severe disease (data not shown).While therapies may reduce some of the overall cardiovascular risk of a population of RA patients, there are limited data on the extent of residual cardiovascular risk in individual treated RA patients. For example, it remains to be seen whether treating RA patients to levels of mild disease activity or remission, as assessed by the best available clinical metrics, normalizes cardiovascular risk relative to that of the general population. However, our finding that a majority of patients who achieve these ACR-recommended targets nonetheless have elevated CRP levels suggests that excess cardiovascular risk persists. Consistent with this possibility, endothelial dysfunction was reported in a study of young to middle aged patients with RA who were in remission or had mild disease activity by DAS28-ESR and who were free from other cardiovascular risk factors. In that study, endothelial dysfunction correlated with average CRP levels and disease duration Our study has several limitations. First, it is cross-sectional. However, studies demonstrating CRP to be an independent predictor of cardiovascular risk, including those involving RA patients, often used a single, baseline measurement of CRP Our study indicates that systemic inflammation, as reflected in an elevated CRP, persists in a sizable number of RA patients with minimal or no clinically detectable joint disease and thus may confer increased cardiovascular risk upon these patients. Future studies should examine the relation of subclinical joint inflammation detected by sensitive imaging techniques to markers of cardiovascular risk. If this risk predicted here is confirmed by future studies, then recognition of these at-risk RA patients may have important implications for therapy. One option might be to base treatment decisions on disease assessment scores more heavily weighted towards markers of inflammation or to treat subclinical joint inflammation. Given the efficacy, toxicity, and expense of current RA therapies, however, an alternative strategy might be to aggressively modify traditional cardiovascular risk factors in those with persistent systemic inflammation. Even in the absence of elevated low density lipoprotein, the use of statins might reduce cardiovascular risk in RA patients with elevated CRP. Of note in this regard, the recently published JUPITER trial of apparently healthy individuals without hyperlipidemia but with CRP≥2 mg/L demonstrated that statin therapy significantly reduced major cardiovascular events, with a hazard reduction of 0.56 (p<0.00001)

Bilateral rectus femoris haematoma following a simultaneous strain of the quadriceps muscles is a very rare condition.We report the case of a 21-year-old Greek Caucasian female rowing athlete who was injured on both thighs. She complained of pain and inability to walk. Physical examination revealed tenderness over the thighs and restriction of knee movement. The result of a roentgenogram was normal, and there was no evidence of fracture or patella displacement. Magnetic resonance imaging revealed haematoma formation in both the rectus femoris muscles. The diameters of the left and right haematomas within the muscles were 6 cm and 5 cm, respectively. Therapeutic approaches included compression bandages, ice application, rest, elevation, and administration of muscle relaxant drugs. Active stretching and isometric exercises were performed after three days. The patient was able to walk using crutches two days after the initiation of treatment. On the seventh day, she had regained her full ability to walk without crutches. Non-steroidal anti-inflammatory drugs were administered on the fifth day and continued for one week. Six weeks later, she had pain-free function and the result of magnetic resonance imaging was normal. She was able to resume her training programme and two weeks later, she returned to her previous sport activities and competitions.There are references in the literature regarding the occurrence of unilateral quadriceps haematomas following strain and bilateral quadriceps tendon rupture in athletes. Simultaneous bilateral rectus femoris haematomas after a muscle strain is a rare condition. It must be diagnosed early. The three phases of treatment are rest, knee mobilization, and restoration of quadriceps function. Traumatic musculoskeletal pathology is frequent in athletes. Muscle strains are the most common injuries, especially in sports involving running. They are defined as an indirect injury to a muscle that produces tension overload in a passive muscle or eccentric overload in an actively contracting muscle . They vaThe classification of strains is based on their severity. A mild (first degree) strain describes a rupture of a few fibres with minor loss of strength or restriction of movement. Active movement or passive stretching produces a mild aching discomfort. Meanwhile, a moderate (second degree) strain involves greater damage of muscle. The pain is aggravated by any attempt to move the muscle and there is clear loss of strength. Lastly, a severe (third degree) strain involves a complete disruption of the muscle, thus resulting in total lack of muscle function . The teaA 21-year-old Greek Caucasian female rowing athlete was injured on both thighs during field training. She had to train in sprint as part of her field training program. Upon acceleration, she experienced severe pain on both thighs and fell down. She continued to suffer from severe pain on the anterior surface of her thighs and tenderness with any attempt of movement. She was also unable to stand up and walk. Her trainer observed swelling and loss of function immediately after the trauma and he tried to control the pain with compression dressing and ice packs while they were in the field. She was later brought to our clinic by an ambulance.On physical examination, an oedema was found on the anterior surface of her thighs. The pain was continuous and aggravated on palpation of the quadriceps muscle and any knee movement. There was no gap in quadriceps continuity. Her active and passive knee flexion and extension were restricted and painful. She was not able to perform an isometric quadriceps contraction with her knee in full extension. The active knee's range of movement was 40° for the right and 55° for the left. The passive range of movement was the same because of the pain. We checked the pulse of her periphery arteries with a Doppler ultrasound machine and we found it normal. After the physical examination a roentgenogram was performed. The roentgenogram result was negative for fracture and the patella was not displaced.Ultrasonography revealed haematoma formation on both her rectus femoris muscles, and magnetic resonance imaging (MRI) was then performed to estimate the size of the haematomas and to evaluate the surrounding soft tissues Figure . The diaBased on physical and MRI examinations the strains were classified as second grade or moderate. We examined the athlete to exclude the occurrence of compartment syndrome and we checked her coagulation profile by blood laboratory examination. We did not find any bleeding diathesis. She did not report any connective tissue disorder in her family and any use of anabolic steroids. Our patient was treated conservatively.th day to reduce the pain and to avoid the development of myositis ossificans. Afterwards, we applied isometric exercises and active stretching of the muscle within our patient's pain limits. She was instructed to perform active, pain-free quadriceps stretching 15 times a day and pain-free isometric quadriceps strengthening exercises. Two days later she started to walk using crutches.The treatment included compression bandage, ice application, and rest and elevation for the first 48 hours. Muscle relaxant drugs were administered for 1 week in maximum doses. We administered non-steroidal anti-inflamatory drugs (NSAID) on the 5On the 7th day our patient started stretching exercises, and she was able to walk without crutches. The active and the passive ranges of movement of her knees were bilaterally the same. The active range of movement was 110° and the passive was 120°. The three phases of treatment were rest, knee mobilization, and restoration of quadriceps function. The goals included pain-free knee flexion and extension and rapid, unrestricted return to her full athletic activities.Six weeks later MRI result was normal and she had regained a full pain-free range of movement Figure . She staQuadriceps strains frequently occur in athletes while training or participating on a race. The rectus femoris at the myotendinous junction is the most susceptible to injury because of its superficial location, biarticular course, most oftenly eccentric action, and higher content of type II fibres ,3. OtherMedical imaging can define the precise location and severity of muscle traumas and detect critical elements that will delay complete repair. Ultrasonography is an efficacious and inexpensive imaging technique for analyzing muscular trauma . It provHaematoma formation in the quadriceps muscle rarely leads to increased pressure (41 mmHg to 80 mmHg) within the muscle compartment, and thus to the development of compartment syndrome . Compartet al., it was demonstrated that changes in tissue temperature are depth dependent after the application of ice packs [Quadriceps haematoma predisposes to the development of myositis ossificans. Myositis ossificans occurs after a strain in deep muscles. In traumatic myositis ossificans, the bone is deposited within a muscle as a result of haematoma . King idce packs . Passivece packs ,7.There are many treatment protocols and the most known is the one reported by Jackson and Feagin . Other aOlder athletes require prolonged missed playing time . The higQuadriceps strain often occurs in athletes. It usually develops in the quadriceps muscles, and the rectus femoris is the most susceptible. Unilateral quadriceps haematomas following strain in athletes and bilateral quadriceps tendon rupture have been reported in the literature. The team physician must be informed about the possibility of simultaneously bilateral rectus femoris hematoma after a muscle strain in order to stress the importance of diagnosing this condition early. The three phases of its treatment are rest, knee mobilization, and restoration of quadriceps function.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.KN performed the patient's treatment and gave the final approval for submitting the manuscript. CL participated in designing the study and conceived and drafted the manuscript. GN participated in the literature research. EP participated in the study design and literature research. NA participated in the literature research. TT participated in the literature research. All authors read and approved the final manuscript.

High seroprevalence of dengue was found on both sides of the border. <$100 was a significant predictor . Risk factors that predicted past dengue infection were presence of larval habitat, absence of air-conditioning and street drainage, and weekly family income <$100. Mosquito larvae were present in 30% of households in both cities. Our results show that dengue fever is endemic in this area of the southern Texas–Mexico border.Reported autochthonous dengue fever transmission in the United States has been limited to 5 south Texas border counties since 1980. We conducted a cross-sectional serosurvey in Brownsville, Texas, and Matamoros, Tamaulipas, Mexico (n = 600), in 2004 to assess dengue seroprevalence. Recent dengue infection was detected in 2% and 7.3% (95% CI 4.3%–10.3%) of residents in Brownsville and Matamoros, respectively. Past infection was detected in 40% (95% CI 34%–45%) of Brownsville residents and 78% (95% CI 74%–83%) of Matamoros residents. For recent infection, only weekly family income Dengue fever is the most prevalent mosquitoborne viral disease in the world, causing an estimated 50 million infections and 25,000 deaths annually, with at least 2.5 billion persons at risk for transmission suggest that dengue is substantially underreported on both sides of the border and prompted us to conduct an epidemiologic investigation in the neighboring cities of Brownsville, Texas, USA, and Matamoros, Tamaulipas, Mexico. Our primary objectives were to assess population seroprevalence of dengue and to identify the most important risk factors for regional transmission. Public health agencies from both countries at the local, state, and national levels collaborated on the project. To our knowledge, this is the first dengue seroprevalence study conducted in the lower Rio Grande Valley since 1980 , conducted larval inspections in and around the house, and interviewed participants by using a household survey that measured risk factors for dengue and public perception about the disease. Two survey teams consisting of 2 interviewers, a medical professional, and an entomologist worked concurrently in both cities to control for seasonal and temporal variance. The survey was timed to coincide with the height of the traditional dengue season (August–December), with most cases occurring in September and October. The survey ran for 5 weeks in October and November 2004. We recorded age, sex, and length of residence in the area for all participants. We attempted to include only those residents who had lived in the region for >10 years, so that our seroprevalence measure would more accurately reflect regional transmission.We collected a blood sample (5 mL intravenously) from 1 volunteer per household , including an additional consent form for the Health Insurance Portability and Accountability Act from US survey participants. Participants <18 years of age (n = 6) were required to obtain a parent’s signed consent before giving their own. Participation in the survey was voluntary, and no gifts or financial incentives were offered. Survey participants were notified in person or by mail if they tested positive for recent dengue infection.Serum samples were analyzed at the Laboratorio Estatal de Salud Pública Tamaulipas by using DUO immunoglobulin (Ig) M/IgG capture ELISA to identify recent primary and secondary infections and an indirect IgG ELISA for past dengue infection (Panbio). The Dengue Branch of the Centers for Disease Control and Prevention (CDC) conducted confirmatory testing on all samples that tested positive or equivocal for recent infection with capture IgM and IgG ELISAs (Panbio). CDC provided dengue-positive and -negative control serum samples to test on the ELISA kits (Panbio) before testing the serum specimens. CDC also tested a random subsample (n = 12) of serum samples that were negative for recent dengue infection.Only samples confirmed by CDC were classified as recent infections. CDC criteria included samples with presence of IgM antibodies >0.2 optical density (OD) or presence of IgG antibodies with titers >40,960 (90), as previously described for all survey design-adjusted descriptive and inferential analyses. We used binomial survey–adjusted Wald tests or Wilcoxon-Mann-Whitney rank sum tests to determine significant differences in frequencies or distributions of key variables, respectively, between Matamoros and Brownsville. We conducted survey design–corrected, multivariate logistic regression based on a multivariate a priori hypothesis. We used the outcomes of recent and past dengue infection as dependent variables in separate models.Ae. aegypti and Ae. albopictus mosquito habitat (number of water-holding containers in and around the house), presence of air-conditioning and intact screens, household density, storage of water, street drainage, weekly family income, presence of immature Ae. aegypti on the premises, and history of crossing the border within the past 3 months. We constructed 3 models: separate models for recent and past dengue infection and a third model adding a dummy variable for city, which allowed us to identify the independent variables in the model most responsible for the different prevalence in past dengue infection in the 2 cities. Twenty-two exclusions were made because of missing data in the independent variables; all models contained 578 observations. We conducted Fisher exact tests to determine the effect of missing data on the dependent variables. All variables were entered into the model as a block without regard for significance level.Independent variables in all models included >65 years) in Matamoros. Seroprevalence was slightly higher in female participants in both cities, but differences were not statistically significant of Brownsville residents and 78% (95% CI 74%–83%) of Matamoros residents. An additional 3% of residents in both cities tested equivocal for prior dengue infection. Seroprevalence of IgG dengue antibodies was remarkably consistent with citywide averages across all age groups within both cities except for younger persons (ages 15–24 years) in Brownsville and older persons of Brownsville residents and 7.3% (95% CI 4.3%–10.3%) of Matamoros residents. Most appeared to be secondary infections. Results from the PRNT90 assay (n = 3) indicated that dengue serotypes 1 and 2 were circulating in the population calculates a positive result based in units. This test determines the sample absorbance compared to a calibrant absorbance. Based on the kit, the interpretation of a positive result is >22 units and the interpretation of this result is suggestive of a recent secondary dengue infection. The CDC IgG ELISA is based on the titration of the antibody present in the serum sample. This titration can be correlated with an HI value to determine a diagnosis of recent secondary dengue infection. When the 2 tests are compared based on the definition of recent secondary dengue infection, the Panbio test is 87.5% sensitive and 100% specific when using the CDC IgG ELISA as the accepted standard. All samples that tested positive for IgG antibodies by Panbio test kits were confirmed by CDC . Most participants were female: 67% in Brownsville and 75% in Matamoros. Based on interviewer observations, we believe that the dominant reason for unequal representation of men in the survey was their reluctance to give blood. There was little difference in mean length of residence in the 2 cities . A large percentage of the survey participants had lived in their respective cities their entire lives: 25.3% in Brownsville and 41.7% in Matamoros; 83% of survey participants in Brownsville and 99% in Matamoros had lived in their city Many population characteristics were similar between the 2 cities: water and sewerage provision, household size, level of intact screens, and mosquito habitat and density. Key differences (p<0.01) included water storage practices, presence of air-conditioning, street drainage, income, presence of discarded tires, percentage of the population buying drinking water, and travel across the border .Ae. aegypti, and Ae. albopictus larval habitat in the neighborhood, and weekly family income <$100 US of 3.2 (95% CI 1.3–8.0), p = 0.01. All other variables were not significant . Design <$100 US .<1.82, mean VIF = 1.26, far lower than the accepted VIF >10 value for significant collinearity . We added a city variable to the past infection model to determine its influence in explaining dengue prevalence in our model. In the model, city was highly significant , and the model F improved from F = 5.42, p<0.0001 to F = 7.14, p<0.0001 with the addition of city to the model. Several variables that predicted past dengue infection changed significantly with the addition of the city variable to the model including stored water, street drainage, air-conditioning, and income, indicating that the influence of these factors on past infection differed by city. We tested for collinearity among all independent variables and found none; variance inflation factors (VIF) for all tests were Ae. aegypti differed substantially between the 2 cities . Ae. albopictus, an exotic species first detected in Texas in the 1980s, was more abundant in Brownsville (13%) than in Matamoros (4%), while Culex quinquefasciatus was present at the same level in both cities. Breteau indices for all species were the same as house indices in both cities or differed by <1%.We found mosquito larvae in 30% of households in both cities, but the relative abundance of the species differed between the 2 cities . The houBrownsville and Matamoros are contiguous cities separated by the Rio Grande . Of the Based on our seroprevalence results for past infection, dengue infections are clearly not being identified by passive surveillance. This result was found in the outbreak of dengue in 1980 in which passive surveillance failed to detect any dengue infections, while Hafkin et al. (Several factors may mask the region’s endemic dengue transmission. One possibility is that the dengue strains circulating in the region result in mostly subclinical infections and mild diseases that do not require hospitalization and are managed through outpatient self-medication such as acetaminophen. Another reason dengue is underreported on the US side of the border may be that a large percentage of these residents cross the border into Mexico for medical diagnoses and treatments. According to our surveys, 59% of Brownsville residents regularly cross the border for medical purposes; however, only 2% of Matamoros residents went to Brownsville for their medical needs. Lack of laboratory resources to confirm dengue infection is another possible explanation. During our survey, physicians in Matamoros reported seeing a large number of patients with suspected dengue, but they were treated with acetaminophen and bed rest because resources were insufficient to conduct laboratory confirmation tests for dengue infection. The most commonly reported illness in the region is the flu.Low income across both cities was the dominant risk factor for both recent and past dengue infection. Poverty is a proxy for many risk factors that make people vulnerable to infectious diseases; some poverty-related factors were measured in this study while others were not. Our specific finding of the protective effect of air-conditioning has been found in another area of the US-Mexico border (Recent seroepidemiologic studies conducted in dengue-endemic countries have found high dengue seroprevalence: 29.5% in the Brazilian state of Goiás (90, and cases of dengue hemorrhagic fever have increased in Mexico in the past 2 decades (Demographic factors that could facilitate regional dengue transmission include immigration, which potentially introduces new strains of dengue from dengue-endemic regions in Latin America, and a high local birth rate, which introduces a steady stream of newly susceptible persons. Cocirculation of multiple dengue serotypes has been previously documented in the region (This study was motivated in part by the climate–dengue debate. While the role of climate change on future dengue transmission is unclear, we find that dengue is already a problem in this area of the US–Mexico border. Because dengue infections are not being identified through local surveillance efforts, we recommend proactive physician outreach emphasizing the potential for dengue infections and increased access to dengue diagnostic tests, especially on the Mexican side of the border, where a large proportion of US and Mexican border residents seek their primary medical care. Improved systems of active binational surveillance for dengue infections are needed, and sentinel sites should include the network of high-volume private clinicians practicing at the border. Ultimately, investments in local infrastructure, improvements in household screening, economic assistance for air-conditioning in dengue-endemic areas, and sustained community education about the importance of reducing larval habitat around the home will be necessary to reduce dengue transmission in this region.

Congenital syphilis is a preventable disease and its presence reflects a failure of prenatal care delivery systems, as well as syphilis control programmes. The procedure to prevent congenital syphilis through antenatal screening and treatment is well established. But implementation of effective programmes has proved very difficult especially in resource constrained countries. We report here a case of late congenital syphilis who presented at the age of 13 years with palatal perforation.Congenital syphilis is a rare and serious disease that although preventable continues to be a major health care problem . AlthougA 13 year old boy presented to the ENT OPD, at LN Hospital, New Delhi, India, with complaints of a hole in the hard palate which had been slowly enlarging, since its appearance 2–3 months back along with difficulty in eating and nasal speech.Except for the presence of a perforation approximately 1 cm in diameter in the anterior hard palate, the physical examination of the child was otherwise unremarkable was reactive at 16 dilutions and Treponema pallidum haemagglutination test (TPHA) was positive . The X-ray of the chest was normal and Mantoux test was negative. Cerebrospinal fluid examination was normal. Skeletal survey revealed no radiological evidence of periosteal lesions or perichondritis. Ultrasound examination of the abdomen and pelvis showed no abnormality. No other orofacio-dental stigmata of congenital syphilis like Hutchinsons teeth were detected. Ophthalmic examination including fundoscopy was normal. No symptoms suggestive of nervous system involvement were observed. All the investigations were carried out before starting the treatment. Following these reports, the mother, father and three other younger siblings were investigated. The mother and the father were weakly reactive for VDRL and their TPHA was positive.The routine investigations revealed Hemoglobin 12.4%, Total leukocyte count 11700/mmThe younger siblings were all non reactive for VDRL as well as TPHA. All the family members including the patient were non reactive for HIV. The mother gave a history of taking some treatment for a genital lesion two years prior to the birth of the patient, The records of the above-mentioned condition or any treatment taken were not available. The obstetric history of the mother was uneventful. The patient was a product of unbooked full term normal vaginal delivery at home by traditional birth attendants. Our patient had three younger siblings who were also full term normal vaginal delivery and all are alive and well. Except for the development of some rash in the diaper area as a neonate there was no other history of characteristic bullous lesions elsewhere on the body. The developmental milestones of the patient were normal as told by the mother. The patient gave no history of any trauma, sexual assault or child abuse or drug abuse.The child and his parents were started on a 3-week course of i/v aqueous crystalline Penicillin G 50,000 U/kg . He was informed of the risk of further enlargement of the defect and was asked to come back for palatal repair on completion of the medical treatment. He tolerated treatment well without any complications and showed a fall in VDRL titers to 2 dilutions when last seen after 6 months of his first visit.Congenital syphilis represents a significant financial and emotional burden in developing countries. Even one case of congenital syphilis is a sentinel public health event, since timely diagnosis and treatment of syphilis infected pregnant woman should prevent transmission almost entirely . The risDifferential diagnosis of a lesion presenting as palatal perforation should include tertiary syphilis, leprosy, tuberculosis, mucormycosis, mechanical trauma, intranasal cocaine abuse, malignancies, especially nasal T cell lymphomas, Wegener's granulumatosis, sarcoidosis and midline non-healing granuloma . A positA recent data from WHO states that only 68% of women in developing countries receive antenatal care and of these about half do not attend ANC clinics until after the first trimester. A studyst trimester supported by treatment and partner notification with adequate follow up. ANC must be strengthened to ensure that there is no reinfection by treating all sexual partners, promoting condom use during pregnancy and counseling all women on how to prevent sexually transmitted infection.It is difficult to discuss such a socially stigmatized disease, but if congenital syphilis is to be targeted for elimination, new approaches are required. The true incidence must be determined, diagnostic measures improved and risk factors controlled. Countries need to reexamine their current policies related to antenatal care and steps must be taken to overcome all administrative and cultural barriers. Control measures must be based on mandatory antenatal screening in 1A study from rural Haiti has shown that decentralizing screening for syphilis can drastically reduce the incidence of congenital syphilis even with limited infrastructure in peripheral areas . With thThe author(s) declare that they have no competing interests.MC carried out the detailed case study, collected references and review material, planned the study and drafted the manuscript. BK carried out the serological assays and participated in the design of study. PB conceived the study, and participated in its design, coordination and value addition and final approval of the manuscript. All authors read and approved the final manuscript.

Sir,et al.[I read with great interest the article tilted, “Congenital fibrosis of the extraocular muscles (CFEOM)” by Cooymans et al. AlthoughCurrent scientific thought is that these clinical entities have an underlying genetic cause. Regardless of clinical variations, they are being grouped first by genetic etiology and then by clinical differences. A major dilemma lies in its pathogenesis, but recent genetic studies support the hypothesis of aberrant development of motor nuclei in midbrain and pons. Despite the fact that diagnosis can be defined by clinical characteristics as well as genetic study, this is not an easy task to apply all the time. Dynamic MRI imaging is a valuable adjunct in the clinical evaluation of CFEOM. Orbital KIF21A in the formation of oculomotor axis.[ARIX (PHOX2A) in four CFEOM2 pedigrees have been identified. ARIX required for CN III and CN IV development in mouse and zebrafish, confirms the hypothesis that CFEOM2 results from abnormal CN III and IV development.[TUBB3 has been described as the gene responsible for CFEOM3.[To date, four CFEOM genotypes have been described. They include CFEOM1, CFEOM2, CFEOM3, and Tukel syndrome. The locus of CFEOM 1 is located at the centromere of chromosome 12. The transmission is usually autosomal dominant (AD) with complete penetrance. It is associated with the absence of superior division of cranial nerve III and corresponding midbrain motor neurons as well as profound atrophy of levator and superior rectus muscles. The mutator axis. CFEOM2 ielopment. CFEOM3 ielopment. Recentlyr CFEOM3. Tukel syr CFEOM3.

In the crystal structure, all except one of the NH2 groups participate in N—H⋯O hydrogen bonding. The identified hydrogen bonds furnish a three-dimensional network. N—H⋯π contacts are observed with H⋯π distances ranging from 2.516 (17) to 2.815 (16) Å. No π-stacking of the aromatic rings is observed.In the title compound, C Å b = 12.0080 (6) Å c = 23.9003 (16) Å β = 90.818 (5)°V = 2334.5 (2) Å3 Z = 16 Kα radiationMo −1 μ = 0.08 mmT = 200 (2) K 0.32 × 0.26 × 0.22 mm Nonius KappaCCD diffractometerCrysAlis RED; Oxford Diffraction, 2005T min = 0.976, T max = 0.983Absorption correction: multi-scan (13102 measured reflections4681 independent reflectionsI > 2σ(I)2852 reflections with R int = 0.031 R[F 2 > 2σ(F 2)] = 0.036 wR(F 2) = 0.088 S = 0.96 4681 reflections354 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.14 e Å−3 Δρmin = −0.20 e Å−3 Δρ CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997SHELXL97 and PLATON (Spek, 2003Data collection: 10.1107/S1600536808039950/ez2150sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808039950/ez2150Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Members of the TRIP-Br/SERTAD family of mammalian transcriptional coregulators have recently been implicated in E2F-mediated cell cycle progression and tumorigenesis. We, herein, focus on the detailed functional characterization of the least understood member of the TRIP-Br/SERTAD protein family, TRIP-Br2 (SERTAD2).TRIP-Br2 expression in HCT-116 colorectal carcinoma cells was performed to determine the potential of TRIP-Br2 as a novel chemotherapeutic drug target.Oncogenic potential of TRIP-Br2 was demonstrated by (1) inoculation of NIH3T3 fibroblasts, which were engineered to stably overexpress ectopic TRIP-Br2, into athymic nude mice for tumor induction and (2) comprehensive immunohistochemical high-throughput screening of TRIP-Br2 protein expression in multiple human tumor cell lines and human tumor tissue microarrays (TMAs). Clinicopathologic analysis was conducted to assess the potential of TRIP-Br2 as a novel prognostic marker of human cancer. RNA interference of CYCLIN E, CYCLIN A2, CDC6 and DHFR. TRIP-Br2 is frequently overexpressed in both cancer cell lines and multiple human tumors. Clinicopathologic correlation indicates that overexpression of TRIP-Br2 in hepatocellular carcinoma is associated with a worse clinical outcome by Kaplan-Meier survival analysis. Small interfering RNA-mediated (siRNA) knockdown of TRIP-Br2 was sufficient to inhibit cell-autonomous growth of HCT-116 cells in vitro.Overexpression of TRIP-Br2 is sufficient to transform murine fibroblasts and promotes tumorigenesis in nude mice. The transformed phenotype is characterized by deregulation of the E2F/DP-transcriptional pathway through upregulation of the key E2F-responsive genes TRIP-Br2 as a bona-fide protooncogene and supports the potential for TRIP-Br2 as a novel prognostic marker and a chemotherapeutic drug target in human cancer.This study identifies INK4a/cyclin D/RB pathway is a hallmark of many human cancers and more than half of all NCI-60 cell lines [SEI-1/SERTAD1/SEI-1 (henceforth referred to as TRIP-Br1), TRIP-Br2/SERTAD2/SEI-2 (henceforth referred to as TRIP-Br2), TRIP-Br3/HEPP/CDCA4/SEI-3 (henceforth referred to as TRIP-Br3), RBT1 (Replication Protein A Binding Transactivator 1)/SERTAD3 (henceforth referred to as RBT1) and the recently-identified SERTAD4 [Drosophila, TARANIS (TARA), was identified in a screen for functional partners of the homeotic loci and was shown to represent a novel member of the trithorax group (trxG) of regulatory proteins [Deregulation of E2F transcriptional activity due to alterations in the p16ll lines -7. Famil SERTAD4 . In addiproteins .SEI-1, RBT1 and TARA) domain [Members of the TRIP-Br protein family possess three key regions that we have previously coined TRIP-homology domains (THD) . THD1 co) domain . It has ) domain ,11.TRIP-Br1 and RBT1 have recently been shown to be localized in tandem within a 19q13 amplicon frequently found in human tumors, consistent with their putative role as oncogenes that promote tumor growth [TRIP-Br1 has been further demonstrated to be amplified and overexpressed in several ovarian cancer cell lines as well as in ovarian carcinomas [RBT1 amplification to human cancers remains elusive. As a proof-of-principle that at least a subset of the TRIP-Br gene family consists of novel protooncogenes that play important roles in cellular proliferation and human cancer, the knockdown of TRIP-Br1 or RBT1 in cultured cell lines has been shown to reduce cell growth and colony formation [TRIP-Br3 has been recently identified as a novel E2F-responsive gene and as a repressor of E2F-dependent transcriptional activation [r growth . Indeed,r growth ,13 as wer growth and lungr growth . Althougrcinomas , the assormation ,17,18. Ativation .TRIP-Br2 in primary cell lines, achieved through DNA enzyme knockdown or global knockout strategies, results in cellular proliferation arrest [While most of the TRIP-Br family members have recently been extensively characterized and shown to be involved in a variety of important cellular processes including E2F-mediated cell cycle progression, p53-dependent stress response and cancer pathogenesis ,18,20-22n arrest . In the TRIP-Br2 was analyzed by NCBI Entrez Gene, NCBI AceView and BLAST/ClustalW . The PSORT II analysis software was used to predict the subcellular localization of TRIP-Br2 proteins. The GNF SymAtlas v 1.2.4 human microarray database was interrogated to determine the in silico gene expression profiling of TRIP-Br2 across all human tissues. The NCBI symbol SERTAD2 was used in the query of the GNF SymAtlas database. The median (med) was calculated based on expression of TRIP-Br2 across all human tissues; med × 3: 3-fold more than the median; med × 10: 10-fold more than the median. In silico TRIP-Br2 expression, (χ), across all human tissues was scored via the following scheme: +: (χ) ≤ median; ++: median < (χ) ≤ med × 3, +++: med × 3 < (χ) ≤ med × 10, ++++: med × 10 < (χ).The gene structural organization of human 2 environment. Rabbit anti-TRIP-Br2 polyclonal antibodies were generated as previously described [TRIP-Br1-HA have been previously described [TRIP-Br2 (hTRIP-Br2) was obtained from NCBI PubMed (GenBank™ accession no. BC101639) and used as the template in the design of hTRIP-Br2-specific primers for the construction of C-terminal HA-tagged hTRIP-Br2 expression plasmid . All cell lines were cultured in DMEM supplemented with 10% FBS and maintained at 37°C in a 5% COescribed and usedTRIP-Br1-HA or pcDNA3.1-TRIP-Br2-HA using FuGENE 6 Transfection Reagent in accordance with the manufacturer's instructions. Stable clones were selected using Geneticin at a concentration of 750 μg/ml. Expression levels of the carboxyl terminal HA-tagged TRIP-Br1 and TRIP-Br2 in each respective clone were determined by Western blot analysis.NIH3T3 fibroblasts were transfected with the empty vector pcDNA3.1 as a control or with the expression vectors pcDNA3.1-vector-only, NIH3T3TRIP-Br1-HA and NIH3T3TRIP-Br2-HA fibroblasts were cultured in 96-well plates (for BrdU) or 100 mm culture dishes (for flow cytometry) in DMEM supplemented with 0.2% FBS and were maintained for 72 h at 37°C in a 5% CO2 environment. BrdU incorporation was monitored using a cell proliferation/colorimetric ELISA assay according to the manufacturer's instructions . Flow cytometry was performed using a FACScan flow cytometer at a wavelength of 488 nm.NIH3T36 NIH3T3vector-only or NIH3T3TRIP-Br2-HA fibroblasts were injected subcutaneously into 6-week-old athymic nude mice (n = 4 for each group). On day 13 post-injection, the mice were examined for tumor formation. Tumor dimensions were measured every 2 days from day 13 until day 25 post-injection, at the end of which time both groups were sacrificed and all tumors were harvested for histological, immunohistochemical and Western blot analyses. The experiment was repeated by injection of new NIH3T3vector-only or NIH3T3TRIP-Br2-HA clones into new groups of 6-week-old athymic nude mice (n = 4). The penetrance of tumor induction from subcutaneous injection of NIH3T3vector-only or NIH3T3TRIP-Br2-HA into these athymic nude mice was 0% and 100%, respectively. Tumor ellipsoid volume was estimated using the formulae previously described [Soft agar assays were used to assess anchorage-independent growth of NIH3T3 cells as previously described . For tumvector-only, NIH3T3TRIP-Br1-HA and NIH3T3TRIP-Br2-HA fibroblasts using the TRIZOL® Reagent . Total RNA (3 μg) was reverse transcribed using the ABI High Capacity cDNA Archive Kit according to the manufacturer's instructions. Polymerase Chain Reactions (PCR) were performed on 1 μl cDNA samples in the presence of 10 mM deoxyribonucleotide triphosphates (dNTPs) and 10 μM of specific primer pairs in a total reaction volume of 20 μl. PCR was performed as follows: 20 cycles of denaturation , annealing and extension with a 2-minute initial denaturation step at 94°C and a 3-minute terminal polishing step at 72°C. The primer sequences used for RT-PCR are available upon request.Total RNA was isolated from serum-deprived NIH3T3Subcellular fractionation of the cells was performed using the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit according to the manufacturer's instructions. Proteins from whole-cell lysates were resolved using standard denaturing polyacrylamide gel electrophoresis and immunostained as described previously .Multiple TMA slides were obtained from the Department of Pathology TMA Program at the National University of Singapore, in compliance with Institutional Review Board approval (IRB 05-017). These tumor TMAs were constructed as previously described -29 and r4 HCT-116 cells were plated in 12-well plates and transfected with Cy3-labeled oligomer, scrambled siRNA (negative control) or three different TRIP-Br2-specific siRNAs at the dose of 4 picomoles (pmol) or 40 pmol (in 1 ml of DMEM supplemented with 10% FBS) respectively using Lipofactamine™ Transfection Reagent , in accordance with the manufacturer's instructions. Twenty-four hours post-transfection, these cells were cultured in serum-free DMEM and maintained at 37°C in a 5% CO2 environment for 72 h. HCT-116 cells that were not subjected to transfection reagent treatment were included as controls. Cells in colony forming assays were stained with 0.4% Giemsa stain as previously described [5 × 10escribed . The dyeSurvival curves for various patient cohorts were estimated according to the method of Kaplan and Meier, and curves were compared using the generalized Wilcoxon's test. The log-rank test was used to assess the strength of association between survival time and single variables corresponding to factors thought to be prognostic for survival.TRIP-Br2 gene locus is approximately 22.3 kb long and is localized at the poorly-characterized chromosome 2p14 region of the human genome , rhesus monkey (97%), rat (86.9%), mouse (88.3%), chicken (81.4%) and zebrafish (67.1%) Figure . The pren Figure . The int) Figure . Furtherin silico gene expression profiling of TRIP-Br2 using a comprehensive web-based human microarray database, GNF SymAtlas v 1.2.4 . As compared to other tissues/cell types, TRIP-Br2 is highly expressed in bone marrow, the thymus, the tonsil and smooth muscle. It is also highly expressed in lymphohematopoietic cell lineages, particularly in BDCA4+ dendritic cells, CD34+ cells (bone marrow hematopoietic stem cells), CD71+ early erythroid cells, B lymphoblasts, CD4+ T cells, CD8+ T cells, CD19+ B cells, CD56+ NK cells and CD33+ myeloid cells and investigated the mechanism(s) by which TRIP-Br1 and TRIP-Br2 facilitate cellular transformation. Overexpression of TRIP-Br1-HA or TRIP-Br2-HA in NIH3T3 fibroblasts conferred the ability to proliferate under low serum concentrations, possibly by enhancing DNA synthesis , CYCLIN A2 (CCNA2), CDC6 and DHFR, were found in serum-deprived fibroblasts that stably overexpress TRIP-Br proteins . Notably, in serum-deprived NIH3T3 cells that stably overexpress TRIP-Br1-HA or TRIP-Br2-HA, we observed a concomitant increase in cyclin E expression . This is consistent with our previous observation that cyclin E was downregulated following ablation of TRIP-Br1 or TRIP-Br2. Hence, our data suggest that CYCLIN E may be a TRIP-Br1- and TRIP-Br2-coregulated gene.To validate the protooncogenic role of TRIP-Br2 in cell cycle regulation and tumorigenesis, we stably overexpressed C-terminal HA-tagged-TRIP-Br2 in NIH3T3 fibroblasts of either NIH3T3vector-only or NIH3T3TRIP-Br2-HA fibroblasts (from one representative clone each) was injected subcutaneously into the lower flanks of athymic nude mice (n = 4). This experiment was repeated at least twice by subcutaneous injection of a different clone of either NIH3T3vector-only or NIH3T3TRIP-Br2-HA fibroblasts into other groups of four athymic nude mice. Data from two mice from a representative experiment are shown in Figure Upper panel). All sites injected with NIH3T3TRIP-Br2-HA fibroblasts developed a tumor, which was typically ~0.7 cm3 at day 25 post-injection . Tumors derived from NIH3T3TRIP-Br2-HA fibroblasts were histologically fibrosarcomas as well as HA-immunostaining of paraffin-embedded tumor sections indicated the presence of the transgene product TRIP-Br2-HA.In addition, we validated the tumorigenic potential of TRIP-Br2 by an s Figure . WesternGiven that overexpression of TRIP-Br2 alone was sufficient to transform NIH3T3 fibroblasts, we hypothesized that expression of TRIP-Br2 may be dysregulated and contribute to oncogenesis in human cancer. We screened normal and cancer cell lines for TRIP-Br2 expression using rabbit anti-TRIP-Br2 polyclonal antibodies and found that TRIP-Br2 was overexpressed in human cancer cell lines U2OS, PC3, 769-P, HCT-116, HepG and MCF-7 cells, but not in WI38 diploid fibroblasts Figure . The higWe next sought to identify the cellular role(s) of TRIP-Br2 by investigating its localization in WI38 and U2OS cells. Using rabbit anti-TRIP-Br2 polyclonal antibodies, we first demonstrated by immunocytochemistry that TRIP-Br2 was predominantly localized to the nuclei of WI38 and U2OS cells Figure , with scIn order to address an oncogenic role for TRIP-Br2 in human cancers, we assessed the immunohistochemical expression of TRIP-Br2 by comparing normal and cancer tissue sections on microarrays that were constructed from patient specimens of 10 different human tumor types. Tissue microarray (TMA) is a high-throughput method for the analysis of large numbers of formalin-fixed, paraffin-embedded (FFPE) materials with minimum cost and effort . We founNext, we investigated the effect of TRIP-Br2 overexpression on the survival of hepatocellular carcinoma (HCC) patients to determine whether TRIP-Br2 overexpression is associated with poor prognosis. A patient cohort (n = 12) with full survival data was divided into two groups, survival ≤ 1 year (n = 8) and survival > 1 year (n = 4). These two groups were subsequently scored as "TRIP-Br2 overexpressors" versus "TRIP-Br2 non-overexpressors" in the corresponding tumor tissue biopsies represented on TMAs Figure . A patieTRIP-Br2 as a novel transcription-based chemotherapeutic target for human cancers, we performed siRNA knockdown of TRIP-Br2 expression in HCT-116 cells. Cy3-labeled oligomer transfection control (Cy3-O), scrambled siRNA non-specific control (Scr) or TRIP-Br2-specific siRNAs were transiently transfected into HCT-116 cells, respectively, at a low dose of 4 pmol or a high dose of 40 pmol (in one ml of DMEM supplemented with 10% FBS). Twenty-four hours post-transfection, these cells were serum-deprived for 72 h to investigate the role of TRIP-Br2 in cell-autonomous growth of HCT-116 cells. As shown in Figure Left panel), specific knockdown of TRIP-Br2 expression in HCT-116 cells (12-well plate) was only achieved by TRIP-Br2-specific siRNAs, DS1 and DS2, at the higher dose of 40 pmol. There were no changes in the transcript levels of other TRIP-Br gene family members upon treatment with TRIP-Br2-specific siRNAs, DS1 and DS2, as assessed by semi-quantitative RT-PCR .Western blot analyses further revealed that TRIP-Br2 protein expression was significantly knocked down by TRIP-Br2-specific siRNAs, DS1 and DS2 motif of TRIP-Br2 led to the nuclear entrapment of TRIP-Br2 and abolished it protein turnover [In summary, we have identified TRIP-Br2 as a novel protooncogene that is aberrantly overexpressed in human cancers. By making use of a comprehensive and high-throughput tissue microarray technology, we were able to advance rapidly from experimental validation of the protooncogenic role of TRIP-Br2 to identifying its value in translational medicine for the potential treatment of a wide variety of human cancers.The authors declare that they have no competing interests.All authors have read and approval the final manuscript. JKC participated in study design, data acquisition, interpretation and manuscript writing. LG participated in study design and data interpretation. ZZ, CY, SLN, KGS, JVB participated in data interpretation. XMS participated in tissue culture-related work. SAR and BKP participated in tissue microarray-related work. MST and SIH designed the study and led the data interpretation and manuscript writing.Additional Materials. This file contains additional materials entitled 1) "Construction of C-terminal HA-tagged hTRIP-Br2 expression plasmid" ; 2) "Frequency of TRIP-Br2 overexpression in 10 different human cancers" ; 3) "TRIP-Br2 expression in multiple normal human tissues and benign tumors" .Click here for fileTRIP-Br2 expression in multiple normal human tissues and benign tumors. The data presents the results of immunostaining of multiple normal or benign human tumor tissue arrays with rabbit anti-TRIP-Br2 polyclonal antibodies.Click here for file

The studies on in vitro effects allow to understand the action mechanisms of mycotoxins and, sometime, to explain the in vivo symptoms. The impairment of semen quality and female reproductive function induced by zearalenone could be a factor responsible for the reproductive failure in farm animals.Farm animals are exposed to zearalenone through the feed because of the widespread occurrence of this mycotoxin in cereals and clinical reproductive disorders due to mycotoxin effects are often reported in farm animal species. This review describes the metabolism, the mechanistic aspects, the clinical reproductive symptoms and the Fusarium graminearum, F. culmorum, F. crookwellense, F. equiseti and F. semitectum, frequent contaminants of maize, wheat, oats and barley [F. graminearum or F. culmorum, may produce both compounds [et al. [Fusarium. Variations in the incidence of ZEA occur with different crop years, cereal crop and geographical areas. The worldwide contamination of grain and feed with ZEA ranges from 0.004 to 8 mg/Kg, with the highest levels found in wheat (from Germany) and corn samples (from Argentina) [Zearalenone (ZEA) is a mycotoxin produced by d barley . This myompounds . In mamm [et al. in corn gentina) . Considegentina) .Zearalenone is rapidly absorbed after oral administration. Its uptake is estimated to be 80-85% and the mycotoxin and its derivatives are detected in blood about 30 min after oral administration bound toHydroxylation resulting in the formation of α- and β-ZOL, catalyzed by 3α- and 3β- hydroxysteroid dehydrogenase (HSDs);Conjugation of ZEA and its reduced metabolites with glucuronic acid, catalyzed by uridine diphosphate glucuronyl transferase (UDPGT).The liver is the main organ responsible for metabolism of steroids, but a variety of other tissues, such as kidneys, testis, prostate, hypothalamus, ovary, intestine, contain 3α(β)-HSD activity. The adverse effects of ZEA are partly determined by the processes of elimination, because the biliary excretion and entero-hepatic cycling are important processes affecting the fate of ZEA and explet al. [2) at oestrous but they are bound to glucuronic acid, which inactivates the compound and facilitates the excretion [Malekinejad et al. demonstret al. . In the et al. . The gluet al. . The entet al. . After aet al. . The maxxcretion . The urixcretion . Higher xcretion respect xcretion .et al. [The ovine metabolism of ZEA includes the synthesis of five metabolites, such as ZAN, α- and β-ZOL, α- and β-ZAL and high levels of some of these forms may be excreted in the urine as glucuronides by grazing sheep . As repoet al. , the sheet al. in urineet al. [It has been reported that bovine hepatocytes and granulosa cells (GCs) produce predominantly β-ZOL , 9, 10 tet al. , high amet al.[The main excretion of ZEA in the horse come through faeces, followed by urine . The maiet al. reported2 for the specific binding sites of the oestrogen receptors (ERs) occurring in different organs. Two subtypes of ER exist, ER- alpha and ER-beta that are differently distributed in the body. Several investigations have demonstrated that binding of ZEA and its derivatives initiate a sequence of events known to follow estrogen stimulation of target organs [2) and the following events, typifying early estrogen response, occur: an increase in uterine RNA synthesis as well as an increase in RNA polymerase activity, synthesis of uterine estrogen-induced protein [2, whereas α-ZOL shows somewhat stronger binding and β-ZOL much less binding [in vitro systems. The proliferation of ER-positive (MCF-7) and ER-negative (MDA-MB-231) human breast cancer cells lines, which respond to physiological concentrations of E2 (1nM) was used to characterize the oestrogenic activity of ZEA and derivatives through oestrogenic parameters such as proliferative effect (PE), relative proliferative effect (RPE) and relative proliferative potency (RPP) [−2 to 10−3) than E2 [50 value (5.2 × 10−3 μM) than those of other ZEA-related compounds [2. Both intracellular ER and plasma membrane receptors could be involved in this effect [2 membrane binding proteins, structurally related to the intracellular ER, has been previously described in rabbit [2. An antiestrogenic effect is found for α-ZOL, which can be based on the fact that α-ZOL blocks ER on cell membrane following no biochemical response [Zearalenone and its derivatives compete effectively with 17 β-Et organs . In the protein . The bincy (RPP) . On MCF- than E2 . β-ZOL sompounds . ZEA ands effect . In factn rabbit . The invresponse .2 and testosterone. Consequently, ZEA is also a substrate for 3α-HSD and 3β-HSD present in many steroidogenic tissues, such as liver, kidney, testis, prostate, hypothalamus, pituitary, ovary, intestine [2 and testosterone) fall into two major classes of proteins: the cytochrome p450 heme-contaning proteins and the hydroxysteroid dehydrogenases (HSD) [scc) found in the ovary (theca interna and GCs) and testis (Leydig cells). The CYP17 is expressed exclusively in the Leydig and in thecal cells where there is the site of androgen production. Cytochrome p450 aromatase catalyses the conversion of androgen to estrogens in two different major pathways: first, the aromatase pathway (transformation of testosterone into E2 and of androstenedione into estrone) and secondly, the 5α-reductase pathway (transformation of testosterone into dihydrotestosterone). The major sites in human and rats are in the preovulatory follicle, the corpus luteum, placenta and Leydig cells. 3α-HSD shows high affinity for 5α-dihydrotestosterone. The seven human isoenzymes of 17β-HSD play an important role in the biosynthesis of mainly androgens and oestrogens, testosterone and estradiol and their weaker precursor androstenedione and estrone which are expressed in GCs of developing follicles and in testes (Leydig cells). The 3 β-HSD catalyses the conversion of pregnenolone into progesterone. The isoforms of 3 β-HSD are expressed in a cell- and tissue-specific manner, particularly in ovary and testis (Leydig cells).The structure of the ZEA resembles many characteristics of steroids and binds to ER as an agonist. The ZEA conversion to α-ZOL and β-ZOL shows similarities to processes in steroid metabolism where HSDs play a pivotal role in synthesis of various steroid hormones including Entestine . As obsees (HSD) ,21,22. TThe conversions of testosterone and progesterone by these tissues are important components of the mechanisms by which these hormones exert their effect on both gonadotropin regulation and sexual behavior. By competitively inhibiting the 3α-reduction of these hormones, ZEA could cause an accumulation of the active components, because 3α-HSD is an important factor in ovarian follicular development . ZearaleIn vitro studies on mouse Leydig cell function demonstrated that ZEA and α-ZOL exposure (from 10−8 to 10−4 M) can interfere with the process of spermatogenesis reducing the hCG-stimulated testosterone synthesis owing to the down-regulation of P450scc, 3β-HSD-1 and steroidogenic acute regulatory protein (StAR) transcription [cription .The effect of ZEA and its metabolites depends upon the reproductive status of the affect animals.in vivo-derived porcine granulosa cell cultures [in vitro maturation [The specific manifestations are dependent upon the relative dose of ZEA and the stage of estrous cycle or pregnancy during which ZEA was consumed. The oestrogenic syndrome in swine affects primarily the reproductive tract and mammary gland, and in more sensitive young gilts 1–5 ppm of ZEA induce clinical signs such as hyperemia, edematous swelling of the vulva, sometime vaginal prolapse and even rectal prolapse . This hycultures . Oocyte turation .2 in inhibiting the release and secretion of follicle stimulating hormone (FSH), thus depressing the maturation of ovarian follicles during the preovulatory stage. The changes induced by ZEA depend on time of administration in relation to oestrous cycle as well as on the dose administered [In cyclic animals, nymphomania, pseudopregnancy, ovarian atrophy and changes in the endometrium are reported . Zearalenistered . This innistered .2. During pregnancy, ZEA reduces embryonic survival, when administered a threshold level (200 μg/Kg b.w.), and sometimes decreases fetal weight [During pregnancy, the timing of the exposure is critical, because at threshold level of ZEA (1 mg/Kg b.w.), administered on days 7 to 10 after mating, does not disrupt pregnancy, when administered on days 2 to lead to degenerative changes in embryos that begin to be well advanced by day 13 after mating . These el weight . Placentl weight .Fusarium cultures per os on male swine showed a 30% of weight reduction of testes, decrease of fertility related to reduction of sperm quality and viability [The effect of iability . In boariability . No adveiability .In cow, infertility, reduced milk production and hyperoestrogenism have been associated with ZEA . HeifersHigh dietary levels (12 mg/Kg of diet) of ZEA feeding for extended periods of time (10 days) may affect reproductive performance of sheep negatively by reducing fertility and ovulation rates . A dailyA field outbreak of ZEA mycotoxicosis in horses was associated with corn screenings containing approximately 2.6 mg/Kg of ZEA . The conin vivo investigations which provide information about net effects in whole animals, where pollutant may act at multiple sites and organs but these studies reveal little about the involved underlying mechanisms [in vivo systems, however these systems not always provide an accurate prediction of toxicity in whole animals [As reported in chanisms . Therefochanisms . In fact animals .In vitro maturation of porcine oocytes is negatively affected by α- and β-ZOL in a dose-dependent manner [in vivo-produced porcine zygotes to blastocysts was influenced by α-ZOL. At concentration of 7.5 μM, the percentage of zygotes developing to blastocysts tended to be reduced. Increasing concentrations of mycotoxins in the culture medium increased the degeneration of embryos [2, ZEA and its derivatives (α- and β-ZOL) at levels ranging from 0.3 to 31.2 μM, reduced the percentage of oocytes that reached the MII stage, induced nuclear malformation in a concentration-dependent manner, with ZEA and α-ZOL being the most effective at lower concentrations. All mycotoxins reduced the fertility by altering spindle formation during meiosis and leading to less fertile oocytes and mixoploid embryos [2 production at lower levels and inhibiting at larger doses (9.36 μM), as reported by Ranzenigo et al. [t manner . Culturet manner . The dev embryos . Similar embryos . Alpha a embryos . On porco et al. . At higho et al. .in vitro maturation of oocytes to the M II stage and increase the rates of oocytes showing chromatin abnormalities at levels of 94 μM [in vitro exposure of mural GC cultures with 94 μM of α-ZOL for 24 h, an increase of 17β-E2 levels was found in culture medium supernatants, probably related to the inhibitory effects of mycotoxins in the pathway of steroidogenesis [Zearalenone and its derivatives (α-ZOL and ZAN) inhibit of 94 μM . This efof 94 μM . After iogenesis .in vitro exposure of GCs collected from the ovaries of cycling mares with ZEA and its derivatives α- and β-ZOL, at levels of 1 and 0.1 nM, induced a simultaneous increase in cell proliferation and an apoptotic process [The process . The con process .in vitro exposure at concentrations ranging from 125 to 250 μM [−7 to 20 μM of ZEA and its derivatives (α- and β-ZOL) for 24 and 48 h [in vitro exposure to mycotoxins: in particular β-ZOL significantly increases the curvilinear velocity (VCL parameter) at μM levels, 100-fold lower than those active for α-ZOL, after short (5 h) time incubation and no modifications are observed at longer times [et al.[Zearalenone and α-ZOL affect the fertilization ability of boar sperm because of their negative effect on viability, motility and acrosome reaction in a time and dose-dependent manner after o 250 μM . After 4o 250 μM . Mycotoxand 48 h . Zearaleer times . Rajkovis [et al., is modis [et al..in vitro exposure of equine spermatozoa with some urine samples containing low levels (ng/mL) of ZEA and its derivatives measured by ELISA [Zearalenone and its derivatives , added to Tyrode’s medium at concentrations ranging from 0.025 to 250 nM induce instability of sperm chromatin structure of frozen-thawed spermatozoa at lower levels. β-ZOL, ZEA, α-ZOL and α-ZAL induce chromatin damage at 0.025 nM instead of ZAN and β-ZAL that are toxic at 0.25 nM [by ELISA . This efby ELISA and earlby ELISA , was meain vivo rather than in vitro, especially in sensitive animal species, such as swine. The in vivo investigations provide information on the net effects in whole animals, whereas cell-specific responses emerge from in vitro investigation. The summarized results of in vitro studies with cell cultures of the reproductive tract indicate that there is only partial agreement with those of in vivo studies, because multiple interactions occur in whole organisms during mycotoxin exposure. In vitro experiments may contribute to risk assessments and to define the action mechanism induced by mycotoxins on germ cells. In vitro effect of ZEA and its derivatives was more investigated in cells of ovaries compared to those of testis. Complications in pharmaco-kinetic distribution and secondary effects attributed to other unidentified factors may make it difficult to ascertain the direct mechanistic toxicities of mycotoxins to the cells To our knowledge, innovative methodologies, such as the Computer Assisted Sperm Analysis (CASA) or flow cytometry, have not been used to assess sperm cell functional parameters during mycotoxicosis outbreaks. Therefore, it is necessary to increase the use of cell models in order to determine the direct biological effects of mycotoxins in order to validate the in vivo findings [The effects of ZEA have been widely investigated findings .

Clostridium botulinum neurotoxins, the causative agents of botulism, block the neurotransmitter release by specifically cleaving one of the three SNARE proteins and induce flaccid paralysis. The Centers for Disease Control and Prevention (CDC) has declared them as Category A biowarfare agents. The most potent among them, botulinum neurotoxin type A (BoNT/A), cleaves its substrate synaptosome-associated protein of 25 kDa (SNAP-25). An efficient drug for botulism can be developed only with the knowledge of interactions between the substrate and enzyme at the active site. Here, we report the crystal structures of the catalytic domain of BoNT/A with its uncleavable SNAP-25 peptide 197QRATKM202 and its variant 197RRATKM202 to 1.5 Å and 1.6 Å, respectively. This is the first time the structure of an uncleavable substrate bound to an active botulinum neurotoxin is reported and it has helped in unequivocally defining S1 to S5′ sites. These substrate peptides make interactions with the enzyme predominantly by the residues from 160, 200, 250 and 370 loops. Most notably, the amino nitrogen and carbonyl oxygen of P1 residue (Gln197) chelate the zinc ion and replace the nucleophilic water. The P1′-Arg198, occupies the S1′ site formed by Arg363, Thr220, Asp370, Thr215, Ile161, Phe163 and Phe194. The S2′ subsite is formed by Arg363, Asn368 and Asp370, while S3′ subsite is formed by Tyr251, Leu256, Val258, Tyr366, Phe369 and Asn388. P4′-Lys201 makes hydrogen bond with Gln162. P5′-Met202 binds in the hydrophobic pocket formed by the residues from the 250 and 200 loop. Knowledge of interactions between the enzyme and substrate peptide from these complex structures should form the basis for design of potent inhibitors for this neurotoxin.The seven antigenically distinct serotypes of Botulinum neurotoxins are the most poisonous substance to humans. The ease with which the bacteria can be grown, its potency and persistence have made it a potential bioterrorism agent, and accordingly, botulinum neurotoxin has been declared as Category A agent by the Centers of Disease Control and Prevention. Since it is both a potential bioweapon and a bioterrorism agent, it is imperative to develop counter measures and therapeutics for these neurotoxins, as none are available so far except experimental vaccines and an FDA-approved equine antitoxin. Our work presented here is an important milestone towards achieving this goal. The best antidote can be developed by blocking the active site of any enzyme. The crystal structures of substrate peptide–enzyme complex presented here map the interactions between the two and provide critical information for designing effective drugs against this toxin. Clostridium botulinum and they share considerable sequence homology, and structural and functional similarity attachment protein receptors) required for docking and fusion of vesicles containing neurotransmitters to target cells Clostridium botulinum neurotoxins (CNTs) are the most potent toxins known to humans since even one billionth of an ounce is fatal. Seven antigenically distinct botulinum neurotoxins are produced by the bacterium viz SNAP-25 and syntaxin Catalytic domains of BoNTs are zinc proteases and cleave SNARE proteins with stringent substrate specificity though they share significant sequence similarity. BoNT/A and BoNT/E cleave the synaptosomal-associated 25 kDa protein (SNAP-25) while BoNT/B, /D, /F, and /G cleave the vesicle-associated membrane protein (VAMP). BoNT/C is the only one that has dual substrate specificity, The potency and the ease with which these toxins can be produced make them potential bioweapons and bioterrorism agents. The Centers for Disease Control and Prevention (CDC) has declared them as Category A biowarfare agents. Currently, while experimental vaccines are available, only an equine trivalent antitoxin is available for post-exposure therapeutics with a limited therapeutic window Clostridium botulinum neurotoxin serotype A truncated light chain (residues 1 to 424), Balc424, was expressed in E. coli and purified to homogeneity using size exclusion chromatography, as described previously P21 space group with one molecule in the asymmetric unit . Both QRATKM and RRATKM complex crystals were grown by sitting drop vapor diffusion at room temperature. Briefly, 3 µl of the protein solution (15 mg/ml) was mixed with an equal volume of a reservoir solution containing 20% PEG 8000, 100 mM sodium cacodylate, pH 6.5, 5% ethylene glycol and 200 mM ammonium sulfate. Thick plate-like crystals were obtained in five days and were flash frozen with liquid nitrogen using 20% ethylene glycol as cryoprotectant. The X-ray intensity data for both complex crystals were collected at X29 beamline of National Synchrotron Light Source (NSLS) using ADSC QUANTUM 315 detector. Balc424-QRATKM and Balc424-RRATKM complex crystals diffracted to 1.5 Å and 1.6 Å, respectively and belonged to the ric unit . All datThe structures of the complexes were determined by Fourier Synthesis using the acetate bound Balc424 (Protein Data Bank id 3BWI) as model followed by rigid-body refinement and simulated annealing. The composite omit map and the difference Fourier showed interpretable electron density for these hexapeptides. The best results were obtained with data collected from crystals grown with 1∶25 (protein/peptide) molar ratio. The peptide models were built with O 2, 5.0 mM DTT, pH 7.2). 50IC values were determined by varying the concentration of inhibitors. The experimental data were analyzed using equation 1, where I is the inhibitor concentration, y is the percent inhibition, with a slope factor (s) of 1.0.The proteolytic activity of balc424 was determined by HPLC using P[187–203] synthetic peptide as reported previously Coordinates and structure factors have been deposited to the Protein Data Bank. BALC424-QRATKM (3DDA) and BALC424-RRATKM (3DDB). The SwissProt accession number for BoNT/A is P10845.The crystal structure has been determined to 1.5Å resolution. The model refined with R and R free of 18.4 and 20.1%, respectively. The final refined model contains 423 protease residues, 6 substrate residues, one sulfate and one zinc ions and 375 waters. More than 91% of residues are within the most allowed region of the Ramachandran plot. The electron density in the residual map (Fo-Fc) was well defined for the hexapeptide and QRATKM could be modeled unambiguously except for the side chains of K and M . It appeThe crystal structure of Balc424 with a substrate analog RRATKM has been determined to 1.6Å resolution. The R and R free for the final refined model are 20.1 and 21.2%, respectively. The final refined model contains 423 residues of protease, 6 residues of substrate analog peptide, two sulfate ions, one zinc ion and 375 waters. More than 90% of residues are within the most allowed region of the Ramachandran plot. The substrate analog could be modeled unambiguously in the residual map (Fo-Fc) . Except 50IC of QRATKM and RRATKM are 133 and 95 µM, respectively are good inhibitors (nM range), the hexapeptides are weak inhibitors ectively .The side chain of P1-Q197 is exposed to the solvent region but makes a hydrogen bond with Glu164 OE1 and 4. HP1′-Arg198 occupies the S1′ site formed by Arg363, Thr220, Asp370, Thr215, Ile161 and Phe194. Phe163, though slightly farther, also forms part of this subsite. The amino nitrogen and carbonyl oxygen of P1′ are hydrogen bonded to Phe163 O and Arg363 NH2 and 4. TS2′ site is formed by Arg363, Asn368 and Asp370, while S3′ subsite is formed by Tyr251, Leu256, Val258, Tyr366, Phe369 and Asn388. P3′-Thr200 OG makes a hydrogen bond with Tyr251 OH. P4′-Lys201 is exposed to the solvent region. In the present crystal structure the side chain density for this residue is weak probably due to high thermal factors . HoweverThe crystal structure of SNAP-25 (146–206) peptide with an inactive double mutant (Pdb id = 1XTG) had identified the exosites as recognition sites distant from the active site Though the overall conformation of the enzyme in 1XTG and the current structure is very similar (RMSD is ∼1 Å for 400 Cα atoms), loops 200 and 250 vary significantly . This coRecently, the structure of a complex between the BoNT/A-LC and an inhibitory peptide N-Ac-CRATKML has been reported Kι 1.9 µM) Ki improved to 300nM. Keeping this as a control various truncations were done N-Ac-CRATKML is a fairly good inhibitor (193EANQRATK201 (SN/A1) and A195NQRATK201 (SN/A2) (the numbers correspond to our numbering scheme). While SN/A1 was cleavable by BoNT/A, SN/A2 was not, suggesting that the N terminal DEAN is required for cleavage. This probably explains why QRATKM which lacks DEAN was not cleaved in our case even though we used up to 1∶30 ratio of Balc424 to peptide. However, the major reason for the peptide not being cleaved is the amino group chelating zinc. Any extension beyond in the N terminal direction would change the character of this amino group and may not be able to chelate zinc. However, the earlier study used GST fusion protein to express the short peptide and might have some effect in binding to the enzyme. This is supported by the facts that I192DEANQRATKKMLGSG207 had 1/5th the activity compared to wild type mK and catk.Saturation mutation studies based on the crystal structure of BoNT/A with SNAP-25 (146–206) has been used to define two regions, active site (AS) domain and binding site (B) domain in SNAP-25 The current structure confirms our earlier model for catalytic mechanism Even though botulinum neurotoxins are declared category A biowarfare agents, effective drugs are yet to be developed. Antibody therapeutics is emerging but more than one antibody may be needed to contain the effect of a single serotype

Matrix metalloproteinase-28 (MMP-28) is a poorly understood member of the matrix metalloproteinase family. Metalloproteinases are important mediators in the development of the nervous system and can contribute to the maturation of the neural micro-environment.MMP-28 added to myelinating rat dorsal root ganglion (DRG) co-cultures reduces myelination and two antibodies targeted to MMP-28 (pAb180 and pAb183) are capable of binding MMP-28 and inhibiting its activity in a dose-dependent manner. Addition of 30 nM pAb180 or pAb183 to rat DRG cultures resulted in the 2.6 and 4.8 fold enhancement of myelination respectively while addition of MMP-28 to DRG co-cultures resulted in enhanced MAPK, ErbB2 and ErbB3 phosphorylation. MMP-28 protein expression was increased within demyelinated lesions of mouse experimental autoimmune encephalitis (EAE) and human multiple sclerosis lesions compared to surrounding normal tissue.MMP-28 is upregulated in conditions of demyelination in vivo, induces signaling in vitro consistent with myelination inhibition and, neutralization of MMP-28 activity can enhance myelination in vitro. These results suggest inhibition of MMP-28 may be beneficial under conditions of dysmyelination. Additionally, MMP-28 treatment enhances MAPK phosphorylation, induces rapid phosphorylation of ErbB2 and ErbB3, and reduces phosphorylation of PI3K in myelinating rat DRG co-cultures, changes likely to be inhibitory to the development of myelin. Finally, we demonstrate for the first time that MMP-28 protein levels can be found at increased levels in both mouse experimental autoimmune encephalitis (EAE) spinal cord and in human cerebellar multiple sclerosis lesions. Together, these results suggest that MMP-28 may be a suppressor of myelination and that inhibition of MMP-28 may be beneficial in promotion of myelin repair.The generation of myelin during development or repair in the peripheral and central nervous systems involves complex signaling between the neuron and the surrounding glial cells . AlthougPrevious data from our laboratory suggested that down-regulation of MMP-28 expression in the neuron was permissive for the development of myelin but it iPeptides from regions N- and C-terminal to the active site of human MMP-28 were used to immunize rabbits for the generation of the polyclonal anti-MMP-28 antibodies Ab 180 and pAb 183. Antisera were purified by peptide affinity chromatography followed by Protein G purification. One of the peptides was found to have the closest amino-acid homology to MMP-10 (23%) while no homology was found in the other peptide to any MMPs or other proteins. In binding and activity assays, MMP-10 was used as an MMP containing a related protein sequence and MMP-2 was used as a non-related MMP. To determine antibody specificity, 100 ng of purified human MMP-28, MMP-2, and MMP-10 were loaded on nitrocellulose membranes by SDSPAGE followed by Western blotting. Both antibodies pAb180 and pAb183 were found to recognize the mature form of human MMP-28 (approximately 45 kDa) in samples of purified human MMP-28 protein but did not recognize MMP-2 (72 kDa), or MMP-10 (58 kDa pro-form or 48 kDa mature-form) receptors but is nTo determine if MMP-28 is expressed in demyelinating tissues in vivo, MMP-28 expression in two states of demyelination was analyzed. First, demyelination in mice was induced using experimental autoimmune encephalitis (EAE) by immunizing mice with a peptide fragment of myelin oligodendrocyte glycoprotein (MOG). This model of demyelination is a commonly used model for the human demyelinating disease multiple sclerosis (MS). ExpressXenopus laevis nerve regeneration and in myelinating rat DRG cultures. These data suggested the possibility that MMP-28 may play a role in the development of myelin during normal development and in neural regeneration. Here we show that exogenously added MMP-28 reduces myelination, that activity in vitro can be inhibited by antibodies to MMP-28, and that such inhibition results in enhanced formation of myelin. Specific inhibitors of MMP-28 are not known; therefore, we generated antibodies to two distinct regions of MMP-28 with the goal of developing inhibitory antibodies. The peptides used were unique to MMP-28 and not expected to cross react with other MMPs. In addition, the locations of the epitopes were expected to be near the active site based on the known sequence of MMP-28. Both antibodies were shown to bind and inhibit MMP-28 activity but did not bind or inhibit MMP-2 or MMP-10. MMP-28 is expressed by DRG neurons within the first 14 days after initiation of myelination by ascorbic acid [in vitro as well as in vivo during nerve regeneration, it is possible that MMP-28 activity is antagonistic to myelination. If so, blocking its proteolytic activity may result in enhancement of the myelination program. Addition of either of the two neutralizing anti-MMP-28 antibodies (pAb 180 or pAb 183) to myelinating DRG cultures resulted in an increase in axon associated MAG staining. This strengthens the hypothesis that neuronal MMP-28 expression after the onset of myelination acts as an inhibitor of the development of myelin. It is not known if MMP-28 acts on the matrix of the neural micro-environment or cleaves cell surface molecules involved in signaling. Illman et al. [in vitro, at much higher doses than used in these experiments, MAG may be a substrate for MMP-28 [We have shown previously that MMP-28 is expressed in the developing nervous system in a temporally regulated manner . This exbic acid . As MMP-n et al. have shon et al. ,23 and dn et al. ,13,25. An et al. ,27 and Nin vitro demonstrate a role for MMP-28 in regulating PNS myelination, we were curious if a similar role might be involved in the development or maintenance of CNS myelin. We report in this study for the first time that increased MMP-28 expression can be detected within demyelinated lesions of mouse EAE and human MS nervous system tissue. The increase in MMP-28 detected in both cases lends further support to the hypothesis that MMP-28 activity is involved in the regulation of myelin. It can not be determined from these experiments if MMP-28 activity in these tissues is responsible for the demyelination or if it expressed prior to or during any remyelination, however, the timing of the EAE progression in the tissue (21 days after induction) and the increased nuclei (presumably infiltrating immune cells) in both tissues, suggest that these lesions may be actively demyelinating rather than undergoing the process of remyelination. While these experiments represent a small sample size and need to be followed up to determine the specific lesion types that demonstrate this altered expression, the results suggest that MMP-28 may be a relevant target for therapeutic intervention in MS. It is important to note that while there is consistency in MMP-28 expression during development in the CNS and PNS, and between dysmyelination states the functional implications of altered MMP-28 expression in the CNS may not be the same as in the PNS. Also remaining to be characterized is the role of activation of MMP-28. MMP function is carefully controlled by cleavage of the pro- form to generate the active form of the protein. The sequence of proMMP-28 contains a putative furin recognition sequence but the details of activation for this enzyme in vivo are unknown.While the experiments performed in vivo, inhibition of this protease may represent a therapeutic mechanism for enhancing remyelination in demyelinating diseases.Validation of the functional role of MMP-28 in the CNS remains to be carried out. Although the specific mechanism is unknown, MMP-28 appears to play a role in the development of myelin. We suggest that in the nervous system, signaling pathways such as activation of the ErbB-MAPK cascade can be altered in response to MMP-28-induced proteolysis and that continued expression of this protease results in inhibition of robust myelination. If MMP-28 activity plays a similar role in modulating myelination in vivo, inhibition of this protease may represent a therapeutic mechanism for enhancing remyelination in demyelinating diseases.Although the specific mechanism is unknown, MMP-28 appears to play a role in the development of myelin. We suggest that in the nervous system, signaling pathways such as activation of the ErbB-MAPK cascade can be altered in response to MMP-28-induced proteolysis and that continued expression of this protease results in inhibition of robust myelination. If MMP-28 activity plays a similar role in modulating myelination Rabbit polyclonal antibodies were generated to two distinct peptides of human MMP-28 from regions N-terminal or C-terminal to the active site. These epitopes were chosen as they are near the active site of MMP-28 and expected to be accessible to antibodies based on computer modeled predictions of MMP-28 structure. In addition, they are unique to MMP-28 and not expected to bind to other MMPs. Antibodies were affinity-purified from antisera using the corresponding antigen peptides. Antisera were subsequently further purified using protein G spin columns according to the manufacturer's protocol. These purified antibodies, pAb180 and pAb183, were quantified by absorbance at 260 nM and characterized for their ability to bind and modify activity of MMP-28 protein.100 ng of purified recombinant human MMP-28, MMP-2, and MMP-10 were loaded onto a 4–12% bis-tris gel and electrophoresed at 125 V for 90 minutes under non-reducing conditions. For detection of rat MMP-28, 14 day myelinating rat DRG co-cultures grown in 24 well plates were lysed directly in the well with 200 ul of lysis buffer added just before use to final concentrations of 10 μM, 0.01%, and 1× respectively). LDS sample buffer (Invitrogen) was added to a final 1× concentration. One tenth of the total protein prepared from one well was analyzed by Western blot. The proteins were transferred to nitrocellulose membrane at 30 volts for 90 minutes. The membranes with recombinant MMPs or rat protein extract were blocked overnight in 5% non-fat dry milk/TBST at 4°C followed by incubation in 0.5% NFDM/TBST with either pAb180 or pAb183 at 50 ng/ml. Blots were washed 3 times in TBST and incubated in 0.5% NFDM/TBST with an anti-rabbit HRP-conjugated secondary antibody (10 ng/ml) for 1 hour. The blots were then washed 6 times for ten minutes in what in TBST. Chemiluminescent detection was carried out using SuperSignal West-Femto . Radiographic film was exposed to the blots to detect the presence of MMP-28.MMP-28 protein activity was measured using a fluorescently labeled substrate. The fluorescently labeled and quenched peptide, Omni-MMP , a pan-MMP substrate, was dissolved in DMSO to a concentration of 20 mM. MMP protein was diluted in PBS. MMP-28, 10× protease assay buffer and substrate were added to a final concentration of 1× assay buffer, 10 μM substrate in 100 μl final volume. Reactions were carried out in black 96 well plates covered with aluminum foil at 37°C. Fluorescence was measured using a Victor3 plate reader for 1 second/well.DRG cultures were established as described by Svenningsen et. al. (2003). Embryos were isolated at day 17 of gestation from pregnant Long-Evans rats (Harlan) and DRGs removed. Cells were washed in L15 + 10% FBS 3 times and resuspended in Neuralbasal media (Invitrogen) with 100 ng/ml NGF (BD) and 2% B27 supplement (Invitrogen). Cells were grown on plates coated with Matrigel (1:20 L15) for 4 days after plating at which point fresh media was added with 50 μg/ml ascorbic acid (myelination media) to initiate myelination. Identification of cell type was carried out by immunofluorescent detection of antibodies to S-100 (Dako), Neurofilament (Chemicon), O4 (Millipore), and Claudin-11 (Santa Cruz). Percentage of Schwann cells or neurons was determined by counting nuclei and S-100 or Neurofilament positive cells from three random fields. A minimum of 149 cells were counted per field. Determination of myelination was carried out by immunofluorescent detection of MAG (Chemicon), a marker for the early stages of myelination. Experiments were performed in early myelinating cultures (14 days or less under myelination permissive conditions). To determine the extent of early myelination, cultures were stained by immunocytochemistry for MMP-28 (Cederlane), present in axons to detect axon bundles, DAPI to detect associated Schwann cell nuclei and MAG to detect myelin formation as described previously using fluorescently labeled secondary antibodies. Images were captured of MMP-28, DAPI, and MAG staining from three random fields in each well. Identified axon bundles were determined to be MAG positive or MAG negative. Scoring was performed blinded to treatment group. A minimum of 100 axon bundles per well were counted and myelination represented as MAG positive axon bundles compared to total axon bundle number. Three wells per group were counted. MMP-28 protein was expressed and purified as described previously and diluted into myelination media. For the 0 nM MMP-28 treatment, a volume of MMP-28 negative elution fraction equal to the volume used for the 20 nM MMP-28 sample was added to the myelination media.DRG co-cultures grown in 24 well plates were induced to myelinate for 14 days and then treated with fresh media containing NGF with or without 10 nM MMP-28 . MMP-28 added in the presence of IgG or pAb 180 and pAb 183 was pre-incubated at room temperature for 1 hour prior to addition to cultures. Antibodies added alone to cultures for analysis of myelination were diluted directly in myelination media. Media was aspirated at 0, 1, 5, 10, 15, and 20 minutes after treatment, cells were lysed directly in the wells and subjected to one freeze/thaw cycle at -80°C to disassociate Matrigel. LDS sample buffer (Invitrogen) was added to a final 1× concentration and samples analyzed by Western blot as described earlier. Antibodies were obtained from Cell Signaling Technologies, catalogue numbers as follows: pErbB2 2249S, pErbB3 4784P, pMAPK 4377S, pPI3K 4228P, or LabVision: PCNA Ab-1, PC10. Equal protein loading was confirmed by Coomassie staining of protein in the gel after transfer and Ponceau-S staining of the membrane prior to blocking. For immunoflourescence of phosphoErbB3, cultures were fixed in methanol for 10 minutes followed by three washes in 0.1%Tween 20-PBS (PBST). Nonspecific binding sites were blocked with PBST/5% non-fat dry milk at 37°C for 1 hour followed by incubation with primary antibody for 90 minutes at 37°C. Secondary antibodies used were AlexaFluor-488 goat antimouse and Alexa Fluora-555 goat anti-rabbit (Invitrogen). Nuclei are counterstained with DAPI . To evaluate proliferation in DRG co-cultures, changes in DNA content was measured using the CyQuant NF Cell Proliferation Assay kit (Invitrogen) according to the manufacturers protocol. Briefly, equal number of DRG cells were plated in wells of a 48 well plate and grown under myelination permissive conditions for 14 days at which time, 10 nM MMP-28 or an equal volume of MMP-28 negative column eluate (n = 3 wells per group) was added to the media. After 24 hours, media was removed and 100 μl of 1× dye binding solution was added to the wells and incubated for 60 minutes. Fluorescence was measured on a fluorescent microplate reader (excitation at 485 nm and emission at 535 nm). Proliferation in DRG co-cultures prior to the development of myelin was measured by detection of PCNA by immunofluorescence as described above. Cells were plated at equal number and grown for 2 days at which time 10 MMP-28 or an equal volume of MMP-28 negative column eluate was added for 24 hours. Increases in Schwann cell proliferation have been detected after 24 hours . Images of three random fields within each well were captured (minimum of 100 cells per field) and total cell number (DAPI stained nuclei) and PCNA positive nuclei were determined.staining was performed on 2 sections from spinal cords of three mice with a score of 2 or greater and three normal control spinal cords. For determination of myelination in human MS, frozen 5 μm cerebellar tissue sections from a human MS patient were obtained . Myelination was detected by Luxol fast blue staining or MAG immunohistochemistry. Paraffin sections were deparaffinized through two changes of xylenes followed by a graded series of methanol and a final wash in PBS while frozen sections were thawed to room temperature before processing. Sections were placed in 0.1% Luxol fast blue solution (0.1 g Luxol fast blue (Acros), 0.5 ml acetic acid, in 95% ethanol to 100 ml) for 16 hours at 56°C. The slides are then removed from Luxol fast blue, washed in 95% ethanol, rinsed in distilled, deionized water (ddH2O) and differentiated in 0.05% lithium carbonate (Acros) for 30 seconds. Following differentiation, slides were then rinsed in ddH2O and examined microscopically to verify differentiation of white matter. The slides were then incubated in 0.1% Cresyl echt violet (American Master Tech Scientific) for 40 seconds to counterstain nuclei and gray matter. Excess Cresyl echt violet was rinsed off the slides with ddH2O. The slides were differentiated in 95% ethanol for 5 minutes followed by sequential dehydration in 100% ethanol and Xylenes. The sections were permanently mounted under coverslips using Permount (Sigma). The tissue was analyzed by light microscopy using an upright microscope. To identify changes in protein expression within MS and EAE lesions, immunohistochemistry was performed using standard techniques with antibodies to MMP-28 (Cedarlane) and MAG (Chemicon). Nuclei were counterstained with DAPI. For Western blot analysis of MMP-28 levels in normal or multiple sclerosis patients, frozen brain tissue samples from multiple sclerosis patients were obtained from the Rocky Mountain Multiple Sclerosis Center and normal brain samples were obtained from in house tissue banks (Eli Lilly). Approximately 5 mg of tissue was cut from the frozen samples and lysed in 500 μl 1× LDS buffer (Invitrogen) containing 1× reducing agent (Invitrogen). 5 μl of each sample was loaded onto a 4–12% Bis-Tris gel and electrophoresed under 100 V for 1 hour. The gel was removed and stained with SimplyBlue (Invitrogen) to verify approximately equivalent protein concentrations. Electrophoresis was repeated and proteins were transferred to nitrocellulose. Western blot detection of MMP-28 was carried out as described above using anti-MMP-28 (Cedarlane). Blots were stripped using Restore western blot stripping buffer (Pierce) according to manufacturers instructions and detection of acetylated tubulin (Sigma) was carried out for normalization of protein levels. All animal use protocols were approved by the Eli Lilly Animal Care and Use Committee.EAE was established in 6–8 week old C57BL6 mice by immunization to MOG as follows. MOG35-55 and heat inactivated M. Tuberculosis were diluted to a final concentration of 1.5 mg/ml and 2.5 mg/ml respectively in CFA and emulsified by sonication on ice. Mice were immunized in the right flank by subcutaneous injection of 200 μl of MOG emulsion at day 0 and day 7 followed at t = 0 and t = 48 hours with 200 μl of 2.5 μg/ml Pertussis toxin in PBS. Development of EAE clinical signs was monitored daily according to the following scale: 0 = No clinical EAE symptoms, 0.5 = Distal limp or spastic tail, 1 = Limp tail, 1.5 = Limp tail and hind limb weakness, 2 = Unilateral partial hind limb paralysis, 2.5 = Bilateral partial-hind-limb paralysis, 3.0 = Complete bilateral hind-limb paralysis, 3.5 = Complete hind-limb and unilateral partial-forelimb paralysis, 4.0 = Total paralysis of fore and hind-limbs, 5.0 = Moribund or death. After 21 days, the clinical signs score for treated animals was determined to be at 2 or higher. Immunofluorescence SRW contributed to the design of experiments, the execution of experiments, the collection and analysis of data and preparation of the manuscript. JED contributed to the design, generation, and analysis of the antibodies and review of the manuscript. RCS contributed to the design and analysis of experiments and contributed to the preparation and review of the manuscript.

In the crystal structure, inter­molecular N—H⋯N hydrogen bonds link the mol­ecules into centrosymmetric dimers.In the mol­ecule of the title compound, [Fe(C DOI: 10.1107/S1600536808008714/hk2443Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Genomic instability in the tumor tissue has been correlated with tumor progression. In the present study, chromosomal aberrations (CAs) in peripheral blood lymphocytes (PBLs) of breast tumor patients were studied to assess whether chromosomal instability (CIN) in PBLs correlates with aggressiveness of breast tumor and has any prognostic utility. Cultured blood lymphocyte metaphases were scored for aberrations in 31 breast cancer patients and 20 healthy age and sex-matched controls. A variety of CAs, including aneuploidy, polyploidy, terminal deletions, acentric fragments, double minutes, chromatid separations, ring chromosome, marker chromosome, chromatid gaps, and breaks were seen in PBLs of the patients. The CAs in patients were higher than in controls. A comparison of the frequency of metaphases with aberrations by grouping the patients according to the stage of advancement of disease did not reveal any consistent pattern of variation in lymphocytic CIN. Neither was any specific chromosomal abnormality found to be associated with the stage of cancer. This might be indicative of the fact that cancer patients have constitutional CIN, which predisposes them to the disease, and this inherent difference in the level of genomic instability might play a role in disease progression and response to treatment. Cancer is a complex disease in which cells with altered gene expression grow abnormally, invade other tissues, and disrupt their normal function. A crucial early event in carcinogenesis is the induction of the genomic instability phenotype, which enables an initiated cell to evolve into a cancer cell by achieving greater proliferative capacity and genetic plasticity to overcome host immunological resistance, localized toxic environment, and suboptimal micronutrient supply.Genomic instability in cancer can be of two types: microsatellite instability (MIN) and chromosomal instability (CIN). MIN tumors exhibit an apparently normal karyotype and have mutations in DNA mismatch repair genes. But, a majority of the tumors exhibit abnormal karyotypes involving either chromosomal rearrangement and/or aneuploidy and are classified as CIN tumors.–3Various reports indicate a significant increase in the chromosomal aberrations (CAs) in peripheral blood lymphocytes (PBLs) of cancer patients with solid tumors.–7 PBLs oBreast cancer is a major global health problem and the incidence of the disease continues to increase steadily. The frequency of sporadic breast cancer is higher in areas adjoining Amritsar city of Punjab, India . In the present study, CAs in PBLs of sporadic breast tumor patients were studied to assess whether CIN in PBLs correlates with aggressiveness of breast tumor, i.e. disease stage, and has any prognostic utility.t-test was used to compare the frequency of aberrant metaphases among patients and controls.Five milliliters of blood sample from 31 cancer patients, 28 with sporadic malignant breast cancer and three with benign breast disease, were collected before surgery from the surgical wards of Sri Guru Ram Das Institute of Medical Sciences and Research, Amritsar (Punjab), after informed consent was obtained. Institutional ethical committee approval was obtained for the study. Relevant information regarding age, symptoms, duration and stage of the disease (TNM classification), habits, habitat, menstrual and reproductive history, occupation, and exposure of the patients to mutagens was recorded on a predesigned questionnaire. Age and sex-matched controls were randomly selected from the general population of Amritsar. Blood samples of 31 breast cancer patients and 20 healthy age and sex-matched controls were cultured in RPMI 1640 medium according to the standard culturing technique, with somn = 24) consumed vegetarian diet and only 22.5% (n = 7) consumed nonvegetarian food occasionally. All of them had first full-term pregnancy before the age of 30 years. 87.1% (n = 27) of the patients were housewives. Twelve patients (38.7%) belonged to urban area, six (19.3%) of them had suburban habitat, and 13 (42%) belonged to rural areas surrounding Amritsar [n = 11) of the controls belonged to urban areas, 20% (n = 4) of them were from suburban areas, and 25% (n = 5) belonged to rural area. Most (90%) (n = 18) of them consumed vegetarian diet [Among the patients, one patient had stage IV disease, 13 had stage III disease, eight were diagnosed at stage II, six had stage I, and three patients had benign disease. The cancer patients were in the age group of 28–65 years. None of the patients had history of early menarche (before the age of 12 years) or late menopause (after 55 years) in postmenopausal patients. 77.4% of the patients .The frequency of aberrant metaphases varied from 3.3 to 60.1% in cultured lymphocytes of patients and from 1.5 to 5.7% in controls . Stage Iin situ hybridization study of numerical alterations of chromosomes 7, 8, 16, and 17 in 28 ductal carcinoma in situ (DCIS), it was shown that the patterns of aneuploidy in breast tumor tissue may differ according to the tumor grade.[Genetic instability is a defining feature of human cancer. In the present study, breast cancer patients had a significantly higher percentage of aberrant metaphases as compared with controls. There was a high frequency of numerical as well as structural abnormalities in the cultured lymphocytes of patients, but enormous variation was seen in the level of lymphocytic CIN among the breast cancer patients. The mean of percentage of metaphases with aberrations was 20.2% in patients with benign disease, 40.4% in stage I patients, 33.9% in stage II patients, 30.8% in stage III patients, and 27.3% in stage IV patients. However, the percentage of aberrant metaphases ranged from 15.7 to 23.3% in patients with benign disease, 21.4 to 60% in stage I patients, 20.1 to 50.2% in stage II patients, and 3.3 to 60.1% in stage III patients, suggestive of variability in the underlying genomic composition of these patients. Grouping of patients according to the stage of advancement of disease did not reveal any consistent pattern of variation in lymphocytic CIN , in contHigh frequency of aberrations in PBLs of breast cancer patients similar to that seen in tumor tissue has already been reported in several studies.18–20 AlsAberrations involving specific chromosomes in the lymphocytes of breast cancer patients have been reported in a previous study. Various www.punjabenvironment.com).Another interesting observation from the analysis of epidemiological data of the patients was that many of the well-established epidemiological risk factors reported in previous studies on western data did nIn the present study, the patients had much higher CIN than controls. Even patients with benign disease or at stage I had higher CIN than controls. But, the patients had variation in the level of CIN in PBLs with no apparent correlation with disease stage, as a stage I patient had up to 60% aberrant metaphases while a stage II patient had only 3.3% aberrant metaphases. The present study is in agreement with the previous reports on validity of cytogenetic assay for determination of frequency of CAs as a biomarker for cancer risk.–11 Such

Virus-Induced Chaperone-Enriched (VICE) domains form adjacent to nuclear viral replication compartments (RC) during the early stages of HSV-1 infection. Between 2 and 3 hours post infection at a MOI of 10, host protein quality control machinery such as molecular chaperones (e.g. Hsc70), the 20S proteasome and ubiquitin are reorganized from a diffuse nuclear distribution pattern to sequestration in VICE domains. The observation that VICE domains contain putative misfolded proteins suggests that they may be similar to nuclear inclusion bodies that form under conditions in which the protein quality control machinery is overwhelmed by the presence of misfolded proteins. The detection of Hsc70 in VICE domains, but not in nuclear inclusion bodies, indicates that Hsc70 is specifically reorganized by HSV-1 infection. We hypothesize that HSV-1 infection induces the formation of nuclear protein quality control centers to remodel or degrade aberrant nuclear proteins that would otherwise interfere with productive infection. Detection of proteolytic activity in VICE domains suggests that substrates may be degraded by the 20S proteasome in VICE domains. FRAP analysis reveals that GFP-Hsc70 is dynamically associated with VICE domains, suggesting a role for Hsc70 in scanning the infected nucleus for misfolded proteins. During 42°C heat shock, Hsc70 is redistributed from VICE domains into RC perhaps to remodel viral replication and regulatory proteins that have become insoluble in these compartments. The experiments presented in this paper suggest that VICE domains are nuclear protein quality control centers that are modified by HSV-1 to promote productive infection. Protein quality control is a protective cellular mechanism by which damaged proteins are refolded or degraded so that they cannot interfere with essential cellular processes. In the event that protein quality control machinery cannot refold or degrade damaged proteins, sequestration of misfolded protein is an alternative protective mechanism for reducing the toxic effects of misfolded protein. Several neurological diseases result from the accumulation of toxic misfolded proteins that cannot be efficiently refolded or degraded. In neurons from patients afflicted with Huntington's disease, misfolded huntingtin protein is sequestered in large aggregates in the nucleus called inclusion bodies. Inclusion bodies also contain protein quality control machinery including molecular chaperones, the proteasome and ubiquitin. Here we report that analogous structures called Virus-Induced Chaperone-Enriched (VICE) domains form in the nucleus of cells infected with Herpes Simplex Virus type 1 (HSV-1). VICE domains contain misfolded protein, chaperones and protein degradation activity. VICE domain formation is efficient in infected cells taxed with high levels of viral protein production. We hypothesize that misfolded proteins that arise in HSV-1-infected cells are sequestered in VICE domains to promote remodeling of misfolded proteins. Protein quality control (PQC) is essential for maintaining active and properly folded proteins and for degrading aberrantly folded proteins that would otherwise interfere with vital cellular processes. PQC systems consist of a balance between protein refolding machinery (molecular chaperones) and protein degradation machinery (reviewed in Herpes Simplex Virus type 1 (HSV-1) gene expression occurs in three stages beginning with immediate-early proteins, followed by early replication proteins and finally late structural proteins E. coli DnaK (Hsc70 homologue) and DnaJ (DnaK cochaperone) for the release of λP protein from the preprimosomal complex at the origin to initiate phage λ DNA replication It is well established that viruses depend on host molecular chaperones for many aspects of their life cycles to relatively high (10 pfu/cell). Using ICP4 as a marker for viral infection and Hsc70 as a marker for VICE domains, we determined the percentage of infected cells that contained VICE domains. Next we asked if the defect seen at low MOI reflects an inability to form VICE domains or a delay in their formation. When cells were harvested at 9 hpi, we observed that 17% of cells infected at an MOI of 0.1 contained VICE domains. At an MOI of 1, the percentage of infected cells that contain VICE domains at 9 hpi increased to 62%. Thus it appears that VICE domain formation is delayed at low MOI compared to high MOI perhaps reflecting a slower establishment of gene expression.We showed above that VICE domain formation correlated with the expression of viral early genes. Next we asked whether VICE domain formation requires the presence of particular early proteins that are essential for HSV-1 DNA replication. Vero cells were infected with viral DNA replication mutants at an MO7 plaque forming units (PFU) were concentrated, subjected to SDS-PAGE and immunoblotted with antibody against the major capsid protein VP5 to detect viral capsids (9 pfu) was also included to ensure that VP5 can be detected in a concentrated KOS stock. The stocks that resulted in the highest proportion of infected cells with VICE domains also had the highest particle-to-pfu ratios. Infection with stocks that contain an intermediate particle-to-pfu ratio, HD2 and Hr94, resulted in inefficient VICE domain formation that is comparable to KOS infection in the presence of PAA (compared with KOS infection). This may reflect their defect in DNA replication despite the fact that these stocks have a higher particle-to-PFU ratio than KOS. This is consistent with our previous observations that DNA synthesis is required for efficient VICE domain formation To explain this discrepancy we considered the possibility that stocks of Hr114 and Hp66 contain a high number of defective particles resulting in a higher than normal particle-to-PFU ratio. In this scenario, infection of cells at an MOI of 2 based on the infectious viral titer would not reflect the presence of noninfectious particles that may also still stimulate gene expression. In order to estimate the number of viral particles in mutant and wild type stocks, 1×10 capsids . Intereset al have reported that nuclear inclusions in normal cells contain ubiquitin, the 20S proteosome, Hsp70 and misfolded proteins Fu et al showed that although Hsp70 was observed in nuclear inclusions that contain misfolded proteins, these nuclear inclusions did not appear to contain Hsc70 We have previously reported that both Hsp70 and Hsc70 are found in VICE domains Nucleosolic and cytosolic proteins can be extracted from cells with a TX-100 detergent buffer leaving behind proteins that are bound to matrix or insoluble proteins. A defining feature of nuclear inclusions is that they are resistant to detergent extraction, probably because they contain insoluble misfolded proteins We previously reported that the 20S subunit of the 26S proteasome is localized to VICE domains during productive infection In the experiment shown in Next, we asked whether proteolytic activity can be detected in VICE domains. HFF-1 cells were infected at an MOI of 2 and nuclei were microinjected with DQ-OVA and TX red dextran (data not shown) at 5–6 hpi. At 20–30 minutes post injection cells were fixed, permeabilized and treated with antibodies against Hsc70. In Polyubiquitin chains are formed by the linkage of each ubiquitin monomer to one of 7 lysine residues of another ubiquitin monomer. The best-characterized polyubiquitin chains are those that utilize lysines 48 and 63. Specific lysine linkages are one determinant in the fate of the target protein In the experiment shown in We next hypothesized that atypical ubiquitin chains linked via K6, K11, K27, K29 or K33 may be localized to VICE domains. We obtained a construct encoding ubiquitin that can only polymerize using the K33 linkage, and we generated mutants that can only polymerize using K6, K11, K27 or K29 linkages. Cells expressing each construct were infected with KOS at an MOI of 10 for 6 hours. In each case, we did not observe significant colocalization of ubiquitin foci and Hsc70 foci . MonomerFRAP analysis has been used to demonstrate that chaperones and misfolded proteins are dynamically associated with nuclear inclusion bodies One aspect of the cellular response to heat stress at 42°C includes the translocation of Hsc70 to the nucleolus The relocalization of Hsc70 to VICE domains during infection suggests that HSV-1 may disrupt the normal cellular response to stress by reorganizing cellular protein remodeling machinery such as Hsc70 to VICE domains. We next asked whether Hsc70 in infected cells can translocate to nucleoli during heat shock at 42°C. Previous electron microscopy studies have shown that nucleolar components aggregate and become more compact and electron dense at late times post infection Previous reports have indicated that nuclear proteins are particularly sensitive to heat shock 8 pfu/mL. Interestingly, infected cells that were heat shocked at 42°C as early as 2 hours post infection exhibited serious declines in virus production suggesting that 42°C heat shock irreversibly affects viral productivity.To determine the effect of 42°C heat shock on HSV-1 productivity, we performed a heat shock time course experiment and assayed for viral productivity . InfecteSeveral observations are made in this paper concerning the reorganization of the cellular heat shock protein Hsc70 and the formation and function of Virus-Induced Chaperone-Enriched (VICE) domains during HSV-1 infection. The formation of VICE domains correlates with early gene expression and is most efficient at high multiplicities of infection or during infection with virus stocks that contain a high number of particles relative to plaque-forming-units. Thus VICE domain formation appears to correlate with robust viral gene expression. Furthermore, VICE domains are dynamic structures that contain a model misfolded protein, molecular chaperones, active proteolytic machinery and are resistant to detergent extraction. These properties suggest that VICE domains are similar to nuclear inclusions that are formed in cells expressing misfolded proteins such as mutant huntingtin or ataxin-1 protein VICE domain formation may be a mechanism to sequester and process misfolded proteins that arise as a result of robust HSV-1 gene expression. Several studies have demonstrated that sequestration of misfolded proteins into cytosolic or nuclear inclusions reduces their toxicity to the cell, and disruption of inclusion formation induces cell death VICE domains may also serve as storage compartments for chaperone machinery that can be released as needed during HSV-1 infection. The sequestration of Hsc70 in VICE domains provides a dynamic pool of protein remodeling machinery that can be used for protein folding and for the assembly of multimeric viral complexes. For instance, monomeric protein subunits that make up larger structures such as the HSV-1 heterotrimeric helicase/primase complex (UL5/UL8/UL52), the portal complex (UL6 dodecameric ring) or capsids themselves may require the assistance of host molecular chaperones. Indeed we previously reported that individual members of the UL5/8/52 helicase/primase complex aggregated in uninfected cells when expressed without their protein partners During heat stress, the ability to recruit Hsc70 into RC may be especially important given that 42°C heat shock reduces the solubility of viral proteins . InteresThe observation that Hsp70, but not Hsc70, is associated with GFP170* nuclear inclusions We report in this paper that wt ubiquitin can be detected in VICE domains. On the other hand, HA-tagged ubiquitin mutants that can only polymerize using one of the possible 7 lysines are not detected in VICE domains. This result suggests that polyubiquitinated substrates in VICE domains are not conjugated via homotypic ubiquitin linkages . Thus itThe Gardner laboratory has described a nuclear PQC system in yeast consisting of a nuclear ubiquitin ligase (San1p) that targets four mutant misfolded proteins, but not their native counterparts, for proteolytic degradation It has been observed that some HSV-1 mutants are growth restricted in some cell types but not others. It is possible that the ability to tolerate misfolded proteins by some cells may provide the basis for this pattern of permissivity. For instance the immediate-early protein ICP22 is dispensable for productive infection in Vero cells; however, it is required for efficient infection of HEL fibroblasts Another alphaherpesvirus, VZV, does not reorganize Hsc70 into VICE domains, and has thus apparently evolved a different strategy to mediate protein quality control In this paper we have demonstrated that nuclear PQC machinery is reorganized during infection by HSV-1. We and others have previously shown that functional Hsc70 is required for RC formation and efficient virus production, and formation of VICE domains occurs during the earliest stages of infection (Livingston and Weller unpublished data Vero (African Green Monkey kidney fibroblast) cells were obtained from the American Type Culture Collection (ATCC) and maintained at 37°C in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen). For FRAP analysis, Vero cells were maintained in phenol red-free DMEM (Invitrogen). Limited passage primary human foreskin fibroblast (HFF-1) cells were purchased from the ATCC and were cultured in DMEM supplemented with 10% FBS, 1× sodium pyruvate (Invitrogen) and 1% penicillin/streptomycin (Invitrogen) at 37°C. HFF-1 cells were cultured and used for experiments prior to reaching passage 20.Strain KOS served as wt HSV-1. The phosphonoacetic acid (PAA)-resistant virus, PAAr5, was provided by Dr. Donald Coen 5′-CCATGCAGATCTTCGTCAAAACGTTAACCGGTAGAAC-3′; R6K reverse 5′-GTTCTACCGGTTAACGTTTTGACGAAGATCTGCATGG-3′; R11K forward 5′-CGTCAGAACGTTAACCGGTAAAACCATAACTCTAGAAGT-3′; R11K reverse 5′-ACTTCTAGAGTTATGGTTTTACCGGTTAACGTTCTGACG-3′; R27K forward 5′-CCATCCGATACCATCGAAAACGTTAAAGCTAGAATTCAAGAC-3′; R27K reverse 5′-GTCTTGAATTCTAGCTTTAAGTTTTCGATGGTATCGGATGG-3′; R29K forward 5′-CATCGAAAACGTTAGAGCTAAAATTCAAGACAGAGAAGGCA-3′; R29K reverse 5′-TGCCTTCTCTGTCTTGAATTTTAGCTCTAACGTTTTCGATG-3′. Mutations were confirmed by sequencing analysis.The GFP170* expression vector was provided by Dr. Elizabeth Sztul Vero cells were transfected with the indicated amount of plasmid DNA using the Lipofectamine/Plus Reagent method (Invitrogen) as recommended by the manufacturer. Following 16–18 hours of protein expression, transfected cells were either prepared for IF as described below or superinfected for an additional 6 hours before fixation.Preparation of cells cultured on glass slides for IF analysis was previously described Imaging was performed using a 63× planapochromat objective lens and a Zeiss LSM 510 Meta confocal microscope equipped with argon and helium lasers. The data shown in Vero cells attached to glass coverslips were washed in 1× PBS and then treated for 2 min with cytoskeletal extraction buffer containing 0.5% Triton X-100 on ice followed by another PBS washing step. Cytoskeletal extraction buffer was described previously The fluorescent self-quenching protease substrate DQ-OVA was purchased from Molecular Probes . Dextran (MW 70 kDa) conjugated to the Texas-red dye was purchased from Invitrogen. Lactacystin was purchased from Sigma Chemical Company .HFF-1 cells were plated in a 35 mm glass coverslip-bottom dish purchased from MatTek . HFF-1 cells were chosen for this experiment because microinjection of Vero cells resulted in clogging of the microinjection needle. No differences in VICE domain formation between HFF-1 and Vero cells have been observed. Before microinjection, serum-containing media was changed to serum-free DMEM to prevent clogging of the needle. DQ-OVA was diluted in 1× PBS to 0.25 mg/mL, a concentration tolerated by uninfected HFF-1 cells over the course of an hour (data not shown). HFF-1 cells were then co-microinjected with DQ-OVA and 70 kDa Texas Red Dextran (injection control). DQ-OVA was predigested by diluting DQ-OVA in 0.5% trypsin and incubating at 37 degrees for 1–2 hours followed by inactivation of trypsin at 65 degrees C for 20 min. To inhibit 20S proteasomal activity, HFF-1 cells were co-injected with 0.25 mg/mL DQ-OVA, TX Red Dextran (70 kDa) and 15 uM lactacystin. For microinjection of infected cells, HFF-1 cells were co-injected with 0.25 mg/mL DQ-OVA and TX Red Dextran following 5 hours of KOS infection at an MOI of 2. Microinjected cells were incubated for 20–30 min at RT and/or 37 degrees to allow cleavage of the DQ-OVA substrate before fixation and preparation for IF as described above. Hsc70 was detected using rat-anti-Hsc70 and Alexafluor goat-anti-rat 647 (Molecular Probes 1∶200). Imaging was performed on a LSM 510 Confocor microscope. No overlap in fluorescence detection between red, green and far-red channels was observed in control experiments.Infected Vero cells in 60 mm dishes were lysed in 2× SDS sample buffer containing DTT at a final concentration of 33 mM. Samples were boiled for 5 min and each sample was loaded to a 10% SDS-PAGE gel. Proteins were transferred to Millipore PVDF membranes followed by blocking in 5% milk/TBST. Membranes were blotted with mouse-anti-ICP4 (Abcam 1∶1000 ab6514), mouse-anti-ICP8 (Abcam 1∶1000 ab20194), mouse-anti-gC (Abcam 1∶1000 ab6509), rat-anti-Hsc70 and mouse-anti-γ tubulin for 1 hour. Following extensive washing in 1× TBST, membranes were treated with HRP-conjugated sheep-anti-mouse or HRP-conjugated goat-anti-rat antibody for 30 min. Blots were developed using Amersham Plus ECL detection reagents.∧7 pfu/mL by dilution in 1×PBS. Viral particles were pelleted at 10,000 rpm for 40 min followed by resuspension in 1 mL 1×PBS and microfuged again 10,000 rpm for 40 min. Pellets were resuspended in 60 ul 1×PBS followed by addition of DTT-containing SDS sample buffer to a final concentration of 2×. Samples were boiled for 5 min, resolved on 8% SDS-PAGE gels, transferred to Millipore PVDF membranes and reacted with mouse-anti-VP5 (courtesy of Dr. Jay Brown) diluted 1∶1000 for 1 hour. Membranes were incubated with HRP-conjugated sheep-anti-mouse antibody (Amersham Biosciences) for 40 min and chemiluminescent signal was detected using Amersham Biosciences ECL developing solutions.The titer of each viral stock indicated in Vero cells attached to a coverslip-embedded 35 mm dish were transiently transfected to express wt Hsc70-GFP for 16–18 hours prior to infection with KOS at an MOI of 2. At 5–6 hours post infection, media was changed to phenol red-free DMEM and infected cells were imaged using a Zeiss LSM 510 Meta confocal microscope. Total fluorescence Hsc70-GFP in VICE domains was bleached using the argon 488 nm laser at 100% laser power for 60 iterations in widefield. 120 frames were collected over the course of 190 sec at 2.5× zoom using a planapochromat 63× objective with the pinhole at maximum width to collect fluorescence from the entire depth of the specimen. Data were analyzed using Metamorph imaging software. Average fluorescence intensity in regions of interest of equal size that contained photobleached VICE domains, unbleached VICE domains, and nucleoplasm and average cell-free background was subtracted. Values were normalized to the average of 5 prebleach images, and corrected for bleaching during monitoring by normalizing to average intensity of the entire cell. Images were arranged using Adobe Photoshop and Adobe Illustrator; images shown in Vero cells were infected with KOS at a MOI of 10. Cells and media were collected at 12 hours post infection and frozen overnight at −70°C. Samples were freeze-thawed for a total of 3 times and clarified by centrifugation at 1500 rpm for 10 min. Supernatants were diluted serially, adsorbed to Vero cells for 1 hour and infected cells were overlayed with methylcellulose containing bicarbonate and penicillin/streptomycin until fixation in formaldehyde . Methylcellulose was washed from the cell monolayer and cells were stained with 0.2% crystal violet.

Guidelines recommend inhaled corticosteroids (ICS) for patients with severe chronic obstructive pulmonary disease (COPD). Most COPD patients are managed in primary care and receive ICS long-term and irrespective of severity. The effect of withdrawing ICS from COPD patients in primary care is unknown.In a pragmatic randomised, double-blind, placebo-controlled trial in 31 practices, 260 COPD patients stopped their usual ICS (median duration of use 8 years) and were allocated to 500 mcg fluticasone propionate twice daily (n = 128), or placebo (n = 132). Follow-up assessments took place at three monthly intervals for a year at the patients' practice. Our primary outcome was COPD exacerbation frequency. Secondary outcomes were time to first COPD exacerbation, reported symptoms, peak expiratory flow rate and reliever inhaler use, and lung function and health related quality of life.In patients randomised to placebo, COPD exacerbation risk over one year was RR: 1.11 (CI: 0.91–1.36). Patients taking placebo were more likely to return to their usual ICS following exacerbation, placebo: 61/128 (48%); fluticasone: 34/132 (26%), OR: 2.35 (CI: 1.38–4.05). Exacerbation risk whilst taking randomised treatment was significantly raised in the placebo group 1.48 (CI: 1.17–1.86). Patients taking placebo exacerbated earlier (median time to first exacerbation: placebo (days): 44 (CI: 29–59); fluticasone: 63 (CI: 53–74), log rank 3.81, P = 0.05) and reported increased wheeze. In a post-hoc analysis, patients with mild COPD taking placebo had increased exacerbation risk RR: 1.94 (CI: 1.20–3.14).Withdrawal of long-term ICS in COPD patients in primary care increases risk of exacerbation shortens time to exacerbation and causes symptom deterioration. Patients with mild COPD may be at increased risk of exacerbation after withdrawal.ClinicalTrials.gov NCT00440687 Exacerbations in patients with chronic obstructive pulmonary disease (COPD) worsen health status ,2 and ar1 of less than 50% predicted and a history of frequent exacerbations 1 percentage ≤ 50 or antibiotic/oral steroid courses in last year > 1 for COPD) with those who would not currently be prescribed ICS according to GOLD guidelines . Time to first exacerbation was analysed using the unadjusted log rank test. Potential confounders were the same as for analyses of exacerbation frequency. Symptoms of shortness of breath, cough, wheeze and sputum production, reliever inhaler use and peak expiratory flow rate were analysed. We tested for differences between the fluticasone and placebo groups using generalised estimating equations with an autoregressive correlation structure to allow for within-patient correlation between outcomes on consecutive days. Symptoms were controlled for baseline level of symptom at randomisation and at first exacerbation (percentage of time with symptom between days -14 and -8 prior to onset of exacerbation) as well as smoking status, season and oral steroid and antibiotic use. Lung function and quality of life were analysed for each consecutive three-month period after randomisation using analysis of covariance adjusting for baseline levels of these outcomes.Intervention and control group allocation were concealed during analyses. Analyses were carried out separately for total one-year duration of study (intention to treat) and time on randomised study inhaler (per protocol). We analysed our primary outcome in patients prescribed ICS in the non-mild group (predicted FEVThirty-one of 36 (86%) general practices invited took part. Three practices declined, as they were involved in other trials. Two practices were excluded as information on ICS prescribing was poorly recorded.1, mean difference -8.8% (CI -13.3 to -4.2), more courses of antibiotics or steroids, mean difference 0.67 (CI 0.22 to 1.12) and the prescription of long acting beta 2 agonists, OR 4.0 (2.3 to 7.0).Participant flow is shown in figure 47,460 days of diary card records (days with data) were returned by patients after randomisation, equivalent to a completion rate of 88.2% of total study days. The proportion of completed diary cards was similar in both groups: fluticasone 87.7%, placebo 88.8%. The completion of diary card days in patients returning to their usual steroid inhaler was 63.2% in the fluticasone group and 57.3% in the placebo group.When data for all 260 patients for the one year duration of the study were included in the analysis, irrespective of whether patients had returned to their usual ICS inhaler, the mean exacerbation frequency was 2.92 (CI 2.47 to 3.37) for the fluticasone group and 3.13 (CI 2.61 to 3.65) for placebo, adjusted RR 1.11 (0.91 to 1.36), P = 0.298. The mean exacerbation frequency for reported (moderate and severe) exacerbations was 1.91 (CI 1.55 to 2.28) for fluticasone and 2.24 (CI 1.82 to 2.66) for placebo, adjusted RR 1.25 (0.95 to 1.58), P = 0.067.The mean duration of exposure to randomised treatment was 235 days for fluticasone group and 179 days for placebo group (table 1/FVC ratio mean difference 14.9% (CI 11.6 to 18.3), were prescribed a lower dose of ICS: mean difference 337 mcg (CI 186 to 489) and reported less shortness of breath OR 0.13 (CI 0.01 to 0.22) than in the more severe group . The risk of exacerbating after withdrawal of ICS whilst randomised to treatment in patients with mild COPD disease was significantly increased: RR 1.94 (CI 1.20 to 3.14). For the remaining 158 (60.8%) of COPD patients, the risk of exacerbation after withdrawal was non-significantly raised . However, the exacerbation risk in this group was not significantly different to the exacerbation risk in the group not fulfilling GOLD criteria for ICS prescription .One-hundred and two (39.2%) of patients did not meet GOLD guidelines for prescription of ICS in COPD . Before randomisation, patients in this mild group had less severe airflow obstruction: FEV190 (73.1%) of the 260 patients had at least one exacerbation whilst randomised to the study inhaler. The median time to first exacerbation was 19 days shorter for patients randomised to placebo: 63 days (CI 53 to 74) for the fluticasone group, and 44 days (CI 29 to 59) for the placebo group, . Early exacerbation was more common in the placebo group with 56 (42%) of patients in the placebo group exacerbating in the first month after randomisation compared to only 30 (23%) in the fluticasone group. A Cox regression analysis adjusted for variables controlled for in exacerbation frequency analyses showed an increased hazard ratio for first exacerbation in the placebo group, OR 1.43 (CI 1.08 to 1.96) compared to fluticasone. Cumulative survival for time to first exacerbation is shown in figure Patients recorded a significant increase in wheeze whilst randomised to placebo for the whole year, OR 1.83, (CI 1.06 to 3.18). Reporting of shortness of breath, OR 2.11, (CI 1.25 to 3.57) and cough OR 1.95 (CI 1.16 to 3.29) was significantly greater in the placebo group for the first 3 months of the study only and wheeze, OR 1.85, (CI 1.35 to 2.53), was significantly greater in the placebo group during exacerbation. Sixty-two percent of patients in the placebo group reported wheeze on the first day of exacerbation compared to 36% in the fluticasone group at 12 months: fluticasone -41 mls, placebo -64 mls .A decrease in FEVl figure . The decSGRQ total scores showed a small but non-significant decrease in both groups after one year. There were no significant differences found at 6 or 12 months for SGRQ total score and sub-scores between fluticasone and placebo. EuroQol 5-D total and visual analogue scale showed no significant difference at 12 months for fluticasone and placebo. All scores were adjusted for baseline score, smoking status and season table .1 were more likely to return to their usual inhaler, mean difference 5.08%, (CI 0.73 to 9.44). Patients were exposed to randomised treatment for 179 days (CI 153 to 206) in the placebo group and 235 days (CI 209 to 262) in the fluticasone group.Of the 260 patients in the study, 126 (48.5%) completed the study on the randomised inhaler, with 134 returning to their usual ICS inhaler. Sixty-one (46%) patients in the placebo group returned to their usual inhaler as a direct result of an exacerbation or self-reported respiratory symptom deterioration compared to 34 (26%) in the fluticasone group . Patients with a lower percentage predicted FEVThere were three COPD related deaths, all occurring in the fluticasone group. These patients all had severe COPD on spirometric criteria and had frequent exacerbations requiring recurrent hospital admissions prior to entry into trial. There was no significant difference in reporting of skin bruising, thinning of skin, sore throat, oral thrush or hoarseness of voice between fluticasone and placebo groups during the study.We report the first randomised placebo-controlled study of withdrawal of long-term inhaled corticosteroids in patients with COPD recruited in primary care. Risk of COPD exacerbation was increased in patients withdrawn from ICS, significantly so in the per protocol analysis of patients on randomised treatment. Withdrawal also led to earlier exacerbation, with a rapid deterioration in symptoms. In the year following withdrawal, patients reported more wheeze and a significant increase in the use of their reliever inhaler in the first month. Patients were more likely to return to their usual ICS following an exacerbation in the withdrawal group. Patients with mild COPD, for whom current guidelines do not recommend ICS, also had an increased risk of exacerbation after withdrawal.1 13 to 80%). The majority of our patients were managed entirely in primary care, with only 13% seen in a respiratory clinic and 14% admitted to hospital with a COPD exacerbation in the year before the study, exactly matching national estimates [1 percent predicted (55%) was marginally higher, as might be expected in COPD patients recruited in primary care. Third, using diary cards with a high completion rate, and examining medical records, allowed us to capture a near complete picture of all exacerbations, including those unreported to health care. Up to 50% of COPD exacerbations pass unreported to a clinician [Our study had a number of strengths. First, we systematically screened general practice patients prescribed long-term inhaled steroids to identify a representative sample of primary care COPD patients with a wide range of exacerbation frequencies (0 to 10 per year) and severity consistent with favourable effect of ICS on other outcomes in our study. However, differential cessation rates made it important to reduce potential bias in the analysis by detailed follow up of all patients for the duration of the study, and by reporting separate analyses for exacerbations occurring whilst patients were taking study medication (per protocol) and for the duration of the study (intention to treat).All previous randomised controlled studies on this topic have reported the effects of withdrawing ICS in patients with COPD in secondary care ,22,24,25Our study did not detect any significant difference in quality of life after withdrawing inhaled corticosteroids. This was unexpected given the effect on exacerbations in our study and the known relationship between COPD exacerbations and quality of life . Our finWithdrawal of ICS caused a sustained significant increase in wheeze throughout the year. Cough and shortness of breath was significantly increased for the first three months. Patients describing these changes did so early after randomisation, by day three for shortness of breath, and day four for cough and wheeze. These findings were similar to the COSMIC study that also reported an acute deterioration in symptoms. However, we only found a difference for shortness of breath for the first three months of the study and found no significant difference in the reporting of sputum production. Wheeze was not recorded in their study. There was a notable effect on lung function on withdrawal. An immediate and sustained drop in peak expiratory flow rate throughout the study was noticed from day two of study. It is likely that the effects on symptoms, reliever inhaler use and peak expiratory flow rate on withdrawal may have been significant but for patients returning to their usual inhaler during the study.1 > 50%, and 158 (60%) had less than two COPD exacerbations per year. 102 (39%) of patients had both a predicted FEV1 > 50% and exacerbation rate of less than two a year. Withdrawing ICS in these 102 patients exposed them to an increased risk of exacerbation comparable with patients with moderate and severe COPD. Why patients with mild COPD faired no better is unclear. All patients lacked reversibility of FEV1 after high-dose nebulised salbutamol at study entry. We examined percentage change in FEV1 before and after bronchodilator challenge as a confounder to risk of exacerbation and time to first exacerbation and found that greater bronchodilator reversibility did not predict earlier exacerbation. Milder COPD patients in our subgroup had reported significantly less pre-trial shortness of breath and had less airflow obstruction. The milder COPD patients are therefore likely to represent a subgroup with less chronic airways inflammation than in the severe group [Our findings of a consistent range of adverse effects of ICS withdrawal from COPD patients drawn from primary care provide useful confirmation of, but also extend analyses from secondary care populations ,22,24,25re group . Despitere group ,22.1 severity and pre-trial exacerbation frequency, ICS dose no longer significantly affects outcome, the relative risk has fallen to 1.1 (95% CI 0.78 to 1.56). The likely interpretation is that pre-trial ICS dose is a marker of severity which affects exacerbation rate, but is linked to all the other markers of severity as well. Our finding that the risk of exacerbation was also raised in patients with mild COPD after ICS withdrawal raises the question of whether these patients should be recommended these drugs. Our findings come from a sub-group analysis in a withdrawal study and therefore may be treated with caution, but are strengthened by using diary cards and examination of patient medical records.Secondly, it is noted that the milder group had been prescribed significantly lower doses of pre-trial ICS. There has been no dose-response relationship established for ICS in patients with COPD. In our study, patients in the severe group may have had a greater step-down of ICS when randomised to placebo. Conversely patients in the mild group may have had an increase in their ICS dose when randomised to fluticasone. The dose of pre-trial ICS does have an effect on our primary outcome. Patients with ICS dose higher than 800 mcg had 1.52 (95% CI 1.19 to 1.95) times more exacerbations than those on a lower dose of ICS (< 800 mcg). However, the effect of the study intervention when adjusted for pre-trial ICS remains virtually unchanged. When we repeat the analysis but with adjustment for all the covariates including FEV1 or exacerbation frequency.In summary, withdrawal of long term ICS in patients with COPD from primary care increases the risk of exacerbation, shortens the time to first exacerbation and leads to worsening wheeze. The reversion of larger numbers of patients on placebo to pre-randomisation ICS following exacerbations ameliorated this risk over the one year period of the trial. Careful consideration of the risks and benefits of withdrawal of ICS should be made. Patients with COPD stopping long-term ICS should be monitored closely for deterioration, irrespective of their baseline FEVAuthor 1: Aklak B. Choudhury. No conflicts of interest declaredAuthor 2: Carolyn M. Dawson. No conflicts of interest declaredAuthor 3: Hazel E. Kilvington. No conflicts of interest declaredAuthor 4: Sandra Eldridge. No conflicts of interest declaredAuthor 5: Wai-Yee James. No conflicts of interest declaredAuthor 6: Jadwiga A. Wedzicha Yes.JAW has received honoraria for lectures at meetings and/or attendance at advisory boards from GSK, Boehringer Ingelheim, Astra Zeneca, Bayer, Roche, Vitalaire, Aventis Pasteur and Aventis Pharma and she has received research grants in the last 3 years totalling $450,000 from Glaxo Smith Kline, $550,000 from Boehringer Ingelheim, £25,000 from Astra Zeneca and $300,000 from Aventis Pateur.Author 7: Gene S. Feder. No conflicts of interest declaredAuthor 8: Chris J. Griffiths YesCG received £80,000 from Pfizer for a study of the relationship between ethnicity and response to antihypertensive medication .AC, JW, CG and GF conceived and designed study. AC, CD, HK and WJ conducted participant interviews, collected exacerbation data from practices, analysed symptoms on diary cards. SE performed statistical analysis. AC and CG helped coordinate the study. AC, JW, CG and GF helped to draft the final manuscript. All authors read and approved the final manuscript.

In the absence of overt stimuli, the brain shows correlated fluctuations in functionally related brain regions. Approximately ten largely independent resting state networks (RSNs) showing this behaviour have been documented to date. Recent studies have reported the existence of an RSN in the basal ganglia - albeit inconsistently and without the means to interpret its function. Using two large study groups with different resting state conditions and MR protocols, the reproducibility of the network across subjects, behavioural conditions and acquisition parameters is assessed. Independent Component Analysis (ICA), combined with novel analyses of temporal features, is applied to establish the basis of signal fluctuations in the network and its relation to other RSNs. Reference to prior probabilistic diffusion tractography work is used to identify the basal ganglia circuit to which these fluctuations correspond.An RSN is identified in the basal ganglia and thalamus, comprising the pallidum, putamen, subthalamic nucleus and substantia nigra, with a projection also to the supplementary motor area. Participating nuclei and thalamo-cortical connection probabilities allow this network to be identified as the motor control circuit of the basal ganglia. The network was reproducibly identified across subjects, behavioural conditions , field strength and echo-planar imaging parameters. It shows a frequency peak at 0.025 ± 0.007 Hz and is most similar in spectral composition to the Default Mode (DM), a network of regions that is more active at rest than during task processing. Frequency features allow the network to be classified as an RSN rather than a physiological artefact. Fluctuations in this RSN are correlated with those in the task-positive fronto-parietal network and anticorrelated with those in the DM, whose hemodynamic response it anticipates.Although the basal ganglia RSN has not been reported in most ICA-based studies using a similar methodology, we demonstrate that it is reproducible across subjects, common resting state conditions and imaging parameters, and show that it corresponds with the motor control circuit. This characterisation of the basal ganglia network opens a potential means to investigate the motor-related neuropathologies in which the basal ganglia are involved. A number of studies dating back to 1995 have shown that when subjects are not engaged in processing externally directed tasks or time-varying stimuli - when they are, from a behavioural perspective, at rest - MR images of the brain show correlated, low frequency fluctuations in functionally related areas. This has been interpreted as indicating functional connectivity between regions [It has recently been shown that RSN fluctuations explain not only inter-trial variation in the BOLD response but alsoThe first RSNs were discovered using functional connectivity analysis, in which correlation is performed between the time course in a seed voxel or region and that in other voxels, in order to reveal areas whose activity is coupled. The discovery that functional connectivity could be observed between ipsilateral and contralateral sensorimotor regions was rapiThere is no a priori model in functional connectivity analysis, but a seed voxel (or ROI) time-course is selected by the experimenter. This process leaves the approach prone to omission unless correlations are computed between a large number of regions , and alMost RSN findings to date relate to the cerebral cortex. There are reports, mostly restricted to the functional connectivity literature, of correlated fluctuations between isolated subcortical structures, including the amygdala and the These scant and inconsistent reports leave the consistency and role of this network open to question. A recent dispute indicates that apparently subtle variations in behavioural condition can give rise to the appearance of spontaneous activation . Both thThe basal ganglia consist of four nuclei; the striatum (which is subdivided into the caudate nucleus and putamen), the globus pallidus or pallidum, the substantia nigra and the subthalamic nucleus . OriginaWe examine resting-state fluctuations in the thalamus and basal ganglia using two common resting state conditions, two large, independent study groups and a fast EPI protocol optimised for structures with a short T2* ,39, combWe find a resting state network involving the thalamus and a large portion of the basal ganglia in groups studied under both the eyes open and fixation conditions, and a temporally coherent network focussed on the caudate in the fixation study only.2 image (right panel). The entirety of the network is shown in Additional File The distributed basal ganglia network is symmetric and incorporates the pallidum, putamen, subthalamic nucleus and substantia nigra, as well as the thalamus, with weaker extensions to the transverse temporal gyrus and the supplementary motor area (SMA). The network is illustrated as it appears in the MELODIC analysis of the fixation study group of 26 subjects in Figure The basal ganglia network is also present in the analyses of the two subgroups of 13 subjects in the fixation study and positively correlated, to a similar degree, with both the right and left lateral fronto-parietal networks . These values may be compared with those obtained in this analysis between the Default Mode and the lateral fronto-parietal networks; -0.19 ± 0.34, p = 0.011 (right) and -0.19 ± 0.21, p = 1.6 × 10-4 (left). That is, the correlations between the basal ganglia RSN and the Default Mode, and the basal ganglia RSN and lateral parietal networks are consistent with those between the Default Mode and the lateral parietal networks but are stronger and more significant. Functional network connectivity analysis [To investigate the possibility of causal relationships existing between the basal ganglia and other RSNs as being of physiological origin based on their spatial distribution. These included components of vascular origin located in the Circle of Willis, distributed grey matter components arising from respiration rate variation of the type reported by Birn et al. , and CSFThe "Dynamic Range" feature afforded 93% accuracy in distinguishing resting state networks and physiological components, with 0 false negatives and 1 false positive . The basal ganglia component was classified as an RSN.We detail the structures contributing to a recently reported resting state network in the thalamus and basal ganglia. By using a high field, high BOLD sensitivity experiment design and high resolution analysis, we show that it encompasses not only the thalamus, pallidum, putamen and transverse temporal gyrus - as has been previously noted - but also the substantia nigra and subthalamic nucleus, allowing the basal ganglia circuit to which it corresponds to be identified. Despite its non-observation in most resting-state studies to date ,21-23 itBecause of their historical significance as motor structures, the best studied basal ganglia network is the motor circuit. Cortical input from precentral motor areas, postcentral somatosensory areas, the arcuate premotor area and the supplementary motor areas projects dominantly to the putamen. The putamen sends projections to the interior segment of the pallidum and on to particular thalamic nuclei (the direct pathway) as well as the internal segment of the globus pallidus via the caudolateral substantia nigra to the thalamus (the indirect pathway). Outputs from the thalamus project to the supplementary motor area, the motor cortex and arcuate premotor area, probably in distinct subcircuits . The obsAs well as there being good agreement between the areas observed in this RSN and the motor circuit, there is disparity between the principle sites of input to the striatum and the other circuits. The caudate provides input to the oculomotor, dorsolateral prefrontal and lateral orbitofrontal circuits and the ventral striatum provides input to the anterior cingulate circuit. The cortical regions to which the circuits send output are the frontal eye fields for the oculomotor circuit and the dorsolateral prefrontal cortex, the lateral orbitofrontal cortex and the anterior cingulate area for those circuits respectively.No components were identified corresponding to the associative and limbic thalamo-cortical loops . The queOur hybrid simulations suggest that ICA is capable of separating circuits which overlap to some extent, but which also have non-overlapping elements and different temporal behaviour ) of 4 mm thickness with a 1 mm nominal gap. Other imaging parameters were as follows: TE/TR = 28/1000 ms, a matrix size of 64 × 64 and a field of view of 21 × 25 cm2 yielding 3.3 × 3.9 × 4 mm3 voxels, NR = 300, TA = 5 min. Imaging was prefaced by 10 s of dummy scans to ensure a steady state of longitudinal magnetisation.Twenty-six female right-handed subjects with no history of neurological or psychiatric disease and aged between 22 and 41 years (mean 26 ± 5 years) participated in the study, which was approved by the Ethics Committee of the Medical University of Vienna, with informed written consent. Magnetic resonance images were acquired with a 3 T Bruker Medspec S300 scanner using a birdcage head coil. T1-weighted structural images were obtained using a 3D MPRAGE sequence with TE = 4 ms; flip angle = 7°; iPAT factor 2, TA = 5 min optimized for maximal contrast to noise ratio between grey and white matter at 4 T [A second group of subjects was studied in the eyes closed condition. Fifteen subjects with no history of neurological or psychiatric disease and aged between 19 and 56 years, mean 36 ± 12 years, participated in the study, which was approved by the Ethics Committee of the University of Trento, with informed written consent. Magnetic resonance images were acquired with a 4 T Bruker Medspec scanner using a birdcage-transmit, eight-channel receive head coil . Tr at 4 T . Subjectr at 4 T , which hr at 4 T .In the eyes closed study, distortion correction of EPI data was performed online using the point-spread function method as implemented in Siemens Distortion Correction WIP Version 2.5 . Functiohttp://www.fmrib.ox.ac.uk/connect/ based on the results of a study by Behrens et al. [Anatomical connectivity determines function . The liks et al. .Data in the fixation study were additionally analysed with GIFT . GIFT emFrequency spectra were calculated from component time courses using Welch's averaged, modified periodogram spectral estimation method, using a Hamming window over periods of 64 s, with 50% overlap between segments. The peak frequency was calculated as the mean frequency over subjects at which the spectral power was a maximum.To investigate correlations between component time courses the http://mialab.mrn.org/ was applied to GIFT results. In keeping with the identification of the peak in spectral power at 0.025 ± 0.007 Hz, correlations were assessed in the frequency range 0.01 to 0.4 Hz. Only lags between components reflecting the Default Mode and the basal ganglia resting state network were assessed, in view of the hypothesised connection between the two networks. A significance threshold of P < 0.05 was set for correlations. As an additional means to assess the reliability of calculated correlations and lags, the analysis was performed for each of 20 randomly-composed groups of 13 subjects from the population of 26 subjects.An extension of the approach of correlating RSN time courses, termed Functional Network Connectivity , has beeth iteration isGiven differences in the frequency composition of RSN and physiological components . This image is of the independent component for the basal ganglia identified in the MELODIC analysis, thresholded at P > 0.5 (downsampled data).Click here for fileIndependent component for the basal ganglia RSN (GIFT). This image is of the independent component for the basal ganglia identified in the GIFT analysis (downsampled data).Click here for fileHybrid simulations, ICA separation of spatially overlapping components. This document contains text and images describing hybrid simulation showing that ICA is capable of separating circuits which overlap to some extent, but which also have non-overlapping elements and different temporal behaviour.Click here for fileAnalysis flow chart. This image shows the most important details relating to the two study groups and the analysis methods applied to each, presented as a flowchart.Click here for file

Our objective was to systematically assess the differences in features, results, and usability of currently available meta-analysis programs.Systematic review of software. We did an extensive search on the internet for specialized meta-analysis software. We included six programs in our review: Comprehensive Meta-analysis (CMA), MetAnalysis, MetaWin, MIX, RevMan, and WEasyMA. Two investigators compared the features of the software and their results. Thirty independent researchers evaluated the programs on their usability while analyzing one data set.The programs differed substantially in features, ease-of-use, and price. Although most results from the programs were identical, we did find some minor numerical inconsistencies. CMA and MIX scored highest on usability and these programs also have the most complete set of analytical features.In consideration of differences in numerical results, we believe the user community would benefit from openly available and systematically updated information about the procedures and results of each program's validation. The most suitable program for a meta-analysis will depend on the user's needs and preferences and this report provides an overview that should be helpful in making a substantiated choice. Meta-analysis has been characterized in various ways, from "making order of scientific chaos" to "megaComputer software has become indispensable in meta-analysis and in the last decennia many programs have been developed. To aid potential users in choosing the software that fits their needs, there are a number of reviews and comparisons available -7. The mWe decided, a priori, to focus on software that was solely dedicated to meta-analysis of randomized therapeutic or observational causal studies. General statistics packages were excluded. Furthermore, the software had to be actively maintained and supported, which was judged by either the time of the last software update (less than 5 years), bug report (less than 5 years), or website update (less than 3 years). We also decided to select only software with a graphical interface and mouse-click compatibility, which essentially excluded the DOS programs.Searches for software and publications related to their development and usage were done by two authors with combinations of the following keywords in Internet search engines of Google, Yahoo, AltaVista, and MSN: "meta-analysis", "meta-analyses", "systematic review", "software", "program", "package", "macro", "add-in", and "add-on". The first search was done mid 2005 and the last search in June 2006. The software was purchased or downloaded if it appeared to fulfill the inclusion criteria.The assessment of the numerical and graphical features in the included meta-analysis programs was handled independently by two investigators and reviewed by all authors until there was consensus on all items. The programs were installed and tested on Windows XP and Windows 2000 systems in English and Japanese. Details of the documented features are provided in the tables of the results section.We searched the internet and literature databases of medical and social sciences for articles that reported validations of meta-analysis software. We also checked the website of each included program and made inquiries with its authors about their validation procedures.In addition to the search for validation reports, two reviewers actively investigated the comparability of the numerical results with data sets from three previously published -10 meta-For each data set, we compared the combined association measures, tests for heterogeneity, and tests for small study effects (publication bias) derived from each of the studied meta-analysis programs. We focused on the most common association measures such as the risk difference, risk ratio, odds ratio, mean difference, Hedges' g, and Cohen's d, including their 95% confidence intervals. We used the metan (version 1.81) , metabiaFinally, we performed a usability assessment amongst 30 researchers from various institutes and countries: Kitasato University (Japan), Tokai University (Japan), Utrecht University (The Netherlands), University of Amsterdam (The Netherlands), the Dutch Cochrane Center (The Netherlands), the University of Leuven (Belgium), and the Centre for Statistics in Medicine (UK). There were no specific inclusion criteria and the sample consisted of individuals from various departments and with various levels of experience with meta-analysis.During the assessment sessions, participants were asked to install each of the studied meta-analysis programs and to analyze one small data set of a meta-analysis with a dichotomous outcome . As theWe found 10 meta-analysis packages that were available for download or purchase via the internet Table . Many weBelow is a short summary of the numerical and graphical features in each of the reviewed programs; details are available in Tables Comprehensive Meta-Analysis has the highest profile in the Internet search engines of all included programs. It distinguishes itself from other programs by the option to enter effect sizes of different formats and the comprehensiveness of the numerical options and output. Data can be entered manually or via copy-and-paste in the CMA spreadsheet; direct import of text or other data files is not possible. The program features all major graphical presentations. The tutorial and manual are to-the-point and extensive. The program is actively maintained and the website is modern and regularly updated.MetAnalysis 1.0 is not sold separately, but comes as a bonus feature of a book . It is lMetaWin 2.1 is accompanied by a comprehensive manual in the form of a book and, in this respect, resembles the MetAnalysis package described above. Distinctive features are the effect size calculator, some graphs that are relatively uncommon in meta-analysis , and the option to use bootstrap confidence intervals. The interface resembles a spreadsheet program and various data files can be imported. For some changes in the analysis, data range selections have to be repeated, which is somewhat more time-consuming compared to methods used by other programs. In contrary to most other software, all calculations are based on t-distributions and boot-strap methods are also available. The help files and the book are extensive and detailed.MIX 1.5 (free software) is the most recently developed program. Its most prominent features are the comprehensive graphical output, detailed numerical options, and educational features like built-in data sets corresponding to those in a number of books, and extensive tutor functions. MIX is the only program that will not function by itself and it requires Microsoft Excel 2000 or later to run. Another limitation is the maximum number of data sets, which is currently 100. Data sets can be created by manual input as well as by importing text delimited data files or Excel workbooks. The numerical and graphical options are diverse and comprehensive.RevMan 4.2.8 (free for private and academic use) was developed by and for the Cochrane Collaboration. It stands out due to its extensive features for collaborative management of systematic reviews. The analytical functions of the program cannot be accessed without first creating a review structure and because import and copy-and-paste functionality are also limited, getting started requires more preparation than with most other software. Once data are in the analysis module, analysis is straightforward. Output is detailed, though without tests for publication bias and no other graphs than the forest and funnel plot. The help resources in RevMan are extremely thorough. A new version is to be released in the near future.WEasyMA 2.5 stands out by the speed with which results become available after data set creation. Data cannot be imported or pasted and need to be entered manually, cell by cell. Another limitation of this program is that it can only handle data from clinical trials with dichotomous outcomes, e.g. two-by-two table data. Although limited to these types of data, the program produces a wide variety of numerical and graphical output. The original author has indicated that the software is currently unsupported by a development team and may soon no longer be available.Our internet and database search did not yield any publications on the validity or validation of any of the programs, except for MIX ,25. AuthWe found no discrepancies in meta-analysis results between STATA, MIX and RevMan. In CMA, we found a small inconsistency in results of publication bias tests, but this was corrected via an update while we were writing this article.MetaWin's results were different from STATA's results because MetaWin mostly uses a t-distribution where the aforementioned programs use a z-distribution . We did find what seemed to be a terminological inconsistency, as the Mantel-Haenszel labeled method used in MetaWin for odds ratio analyses gave results that were identical to those from Peto's method in the other programs .Since MetAnalysis and WEasyMA can only analyze data from two-by-two tables, the comparability assessments were limited to one data set . AnalyseIn WEasyMA, we found results that could not be reproduced if a data set with zero events in one study arm was used. Even when using the same continuity correction as reported in the 'Calculation options' dialog in WEasyMA, the results remained different in STATA. The WEasyMA authors did not respond to our inquiry into reasons for the discrepancies.Of the 30 participating researchers, 26 provided quantitative data that were suitable for analysis Table . TroubleRevMan was most familiar to the participating researchers. MIX had not been used by any of the participants but the name was familiar to some as they were affiliated to the same institutions as the makers of the MIX software. Stratifying the results in analogous subgroups did not reveal any specific trends in the ratings. Experienced users appeared to be more critical than less experienced users, but relative scores were identical. Installation of WEasyMA and CMA was troublesome for some researchers. Qualitative statements mostly concerned problems with the installation , error messages in French (WEasyMA), and difficulties with data set creation . Favorable comments included praise for the user interfaces , help system (RevMan), speed of analysis (WEasyMA), and within-program tutoring .Meta-analysis is an indispensable tool in current-day synthesis of research data from multiple studies, and systematic reviews with meta-analyses occupy the top position in the hierarchy of evidence. Software for meta-analysis has evolved over the years and available reviews are relatively outdated. We therefore considered it timely to provide a systematic overview of the features, criterion validity, and usability of the currently available software that is dedicated to meta-analysis of causal (therapeutic and etiologic) studies. It has some overlaps with existing reviews -7, but iWe studied four commercial programs and two free programs (RevMan and MIX). The features of the commercial programs were not necessarily more extensive than those of the free ones. In particular MIX stood out in terms of numerical options and graphical output. CMA was generally most versatile, in particular in options for analysis of various types of data. With regard to the comparability of results, MIX, RevMan, and CMA produced numerical results that were identical to results from STATA's metan, metabias, and metatrim. MetaWin's results are different and slightly more conservative, since the confidence intervals are based on a t-distribution or bootstraps. WEasyMA produces results that can be disparate from the other programs, especially in data sets with studies with zero events in one or both of the comparison groups. Although most differences were small in the data sets we used, we have reservations on how this will reflect on data sets with more extreme data. The MetAnalysis program should also be used with care as data have to be entered manually and in the correct columns. Exchanging the columns is currently not prevented by warning or error messages and can lead to invalid results.The usability study shows that preparing data for analysis is the hardest part in each program. MIX and CMA are identified as the most user-friendly programs. WEasyMA scored least favorable. Stratifying user evaluations based on experience with meta-analysis and previous experience or knowledge of the software did not reveal any trends in the ratings.Our comparison has been limited to software dedicated to meta-analysis only and does not include general statistics packages. The primary reason to leave them out was because they are structurally very different, making direct comparisons inappropriate. Central to this issue is software syntax: most general packages require thorough knowledge of their syntax in order to produce and alter graphs that are common in meta-analysis; the dedicated packages, however, produce such graphs with a few or sometimes even a single click. In addition, the syntax knowledge required to do more advanced meta-analyses with the general packages means that in a usability survey all participants would have to be expert statisticians, capable of writing and adapting syntax for meta-analysis in all major general software packages. This is not only not feasible in the current setting, it would also make the participating individuals no longer representative of the (sometimes relatively inexperienced) users of the software in the scientific and academic community. Although a different approach would be necessary, we believe the user community of meta-analysis software would benefit from an additional review of meta-analysis options in general statistics software.metan, metabias and metatrim as reference. Our choice for STATA was based on its versatility and use in two major books on meta-analysis [Due to the lack of a 'gold' standard, we resorted to between-program comparisons and a criterion validation with STATA's user-written commands analysis ,12. We rThe results of our usability survey should be regarded as exploratory and serve as a rough indication. First, the number of participants was relatively small. Second, it is not unlikely that there may be some bias in favor of RevMan and MIX because some users were already familiar with these programs. Subgroup analyses, however, did not reveal such trends. MetAnalysis could unfortunately not be included as it was included after the start of the usability assessment. A further point regarding MIX is that it was created following a development focus list that wasAnother point to which we would like to draw attention is the lack of accessible public information about the manner in which meta-analysis programs have been validated. Only the website of the MIX program includes specific references to this and MIX is the only program with a peer-reviewed and published validation report . WithoutFinally, we are fully aware that the world of information technology changes constantly and by the time this manuscript is published, it is possible that some updates have become available or that new products have been launched. We apologize beforehand for our lack of timing. Like a traditional review, we intend to update this investigation in due time.In conclusion, the most suitable meta-analysis software for a user depends on his or her demands; no single program may be best for everybody. The information provided in this article, in particular the data in Tables None of the authors have financial conflicts of interest, although the first author is also primary developer of one of the free programs (MIX) studied in this review. The other authors have been co-authors in an introductory article about MIX. To reduce personal biases, all tasks were handled by multiple investigators and the subjective usability assessments were assigned (by study design) to individuals other than the authors.LB and KGM developed the study concept and designed the study. LB and LMY handled the primary data acquisition and drafted the manuscript. All authors double checked the data tables and analyses, and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:Software usability scoring list. The scoring list that was used to evaluate the usability of the meta-analysis software.Click here for file

Although pyrethroids are less acutely toxic to humans than to insects, We assessed pubertal effects by orally administering 0.5, 1.0, and 5.0 mg/kg/day of the type II pyrethroid esfenvalerate (ESF) to female rats beginning on postnatal day (PND) 22 until vaginal opening. ESF administration suppresses serum estradiol and delays pubertal onset.N-methyl-d,l-aspartic acid , and then we drew two more samples. We performed a second experiment as above except that animals received luteinizing hormone–releasing hormone to test pituitary responsiveness.To assess possible hypothalamic and/or pituitary effects, animals received 0.5 or 1.0 mg/kg ESF or corn oil on PNDs 22–29. On PND30, we drew three blood samples (200 μL) from each rat at 15-min intervals beginning at 1000 hours, and again at 1500 hours. To test hypothalamic responsiveness, after the third afternoon sample, all animals received an intravenous injection of p < 0.05). Furthermore, NMA- and LHRH-stimulated LH release was similar in control and ESF-treated animals, indicating that both hypothalamic and pituitary responsiveness, respectively, were unaffected.Basal levels of luteinizing hormone (LH) in the afternoon hours were higher in control animals than in animals treated with 1.0 mg/kg ESF (Although the hypothalamus is able to respond to exogenous stimuli, absence of a normal afternoon rise in LH would indicate a hypothalamic deficit in ESF-treated animals. Pesticides are used worldwide to control both agricultural and household pests. In 2001, the United States alone used approximately 122 million pounds of insecticides, and 12% of those compounds were for home and garden use . One of Chrysanthemum cinerariaefolium. Pyrethroids exert their toxic action by binding to the voltage-dependent sodium channel in nervous tissue and prolonging the open phase 2005). Additionally, permethrin, cyfluthrin, cypermethrin, and deltamethrin have been detected in human breast milk in women living in an area of South Africa in which pyrethroids were used for malaria control. . PyrethrOnly a few published reports of dietary intake levels of the different pyrethroids are available. The average daily intake for permethrin for a man weighing 70 kg was estimated at 3.2 μg/day, which is less than the acceptable daily intake of 50 μg/kg/day , but no in vitro studies have indicated that pyrethroids may have estrogenic activity, causing them to be placed on the U.S. EPA’s list of possible endocrine disruptors (2)-inducible gene pS2 and the proto-oncogene Wnt10B in MCF-7 breast cancer cells -, cyano(3-phenoxyphenyl)methyl ester] because it is used both in the home and on a wide variety of crops, including fruits, vegetables, and nuts .ad libitum access to food and water. All procedures used were approved by the University Animal Care and Use Committee and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and temperature (23°C), with Animals . AnimalsWe purchased ESF from Chem Service, Inc. and dissolved it in corn oil for the dosing studies. We mixed dosing solution every other day and stored it at room temperature protected from light. Control animals received an equal volume of corn oil.2.For the first experiment, we administered 0.5, 1.0, or 5.0 mg/kg/day ESF by gastric gavage to female pups beginning on PND22 and continuing until vaginal opening (VO) occurred. We used a random-block experimental design. We randomly assigned pups from multiple litters to either a control or treatment group, so that each ESF treatment group had its own control group. Dosing occurred in the morning, and dosing volume was 10.0 mL/kg (0.1 mL/ 10.0 g) body weight. Once VO occurred, we performed vaginal lavage daily and observed cytology until first diestrus (D1), which indicates sexual maturity . In the Animals were dosed with 0, 0.5, or 1.0 mg/kg ESF from PND22 to PND29. The 29-day-old female rats were then anesthetized with 2.5% tribromoethanol and Silastic cannulas were inserted into the right external jugular vein of each rat . The nexWe treated a separate group of animals as described for the NMA stimulation experiment except after the third afternoon sample, we intravenously administered LHRH (25 ng). Again, two samples were collected at 15-min intervals after LHRH treatment; samples were stored as described above.2 using an RIA kit purchased from Diagnostic Products Corp. as previously described (2 assay sensitivity was 8.0 pg/mL. All assays had inter- and intra-assay coefficients of variation of < 10%.We measured rat LH and FSH using radioimmunoassay (RIA) procedures as previously described . Rat LH escribed . The E2 t-test; hormone levels were analyzed by analysis of variance (ANOVA) followed by post hoc testing using Student-Newman-Keuls multiple-range test. We analyzed differences in LH serum levels among treatment groups comparing morning, afternoon, and poststimulation values by the Kruskal-Wallis test (nonparamteric ANOVA) followed by Dunn’s multiple comparisons test. We considered probability values of p < 0.05 to be statistically significant. We used INSTAT and PRISM software, version 3.0, for personal computer to calculate and graph results.Values are expressed as the mean ± SE. We analyzed differences between treatment groups in timing of puberty using the Student’s paired p < 0.01 and p < 0.05, respectively) the age at VO compared with corn oil controls daily weight gain at any dose administered. Controls gained 4.2 ± 0.11 g, whereas animals receiving 5.0, 1.0, and 0.5 mg/kg gained 4.07 ± 0.15, 4.11 ± 0.15, and 4.25 ± 0.22 g, respectively. However, the 5.0 mg/kg and 1.0 mg/kg doses of the pesticide delayed .2 from PND29 pesticide-treated and control animals. Animals exposed to the two highest doses of ESF (1.0 and 5.0 mg/kg) exhibited a 1.3- and 2-fold decrease in serum E2, respectively, compared with controls . The mean afternoon LH levels in control animals were higher (p < 0.05) than those of animals treated with 1.0 mg/kg ESF , but we noted no differences between either ESF treatment group compared with controls. These data demonstrate that hypothalamic responsiveness to NMA stimulation was not altered by the pesticide stimulated LH release over afternoon basal levels in control and both ESF treatment groups, demonstrating that pituitary responsiveness was not affected by the pesticide (data not shown).We conducted a final experiment to assess pituitary responsiveness after ESF exposure. We dosed animals with ESF and collected serial blood samples as described above, except that instead of NMA administration, we challenged these animals with LHRH (25 ng) . LHRH maThis is the first study to show an inhibitory action of a type II pyrethroid pesticide, ESF, on the hypothalamic control of prepubertal gonadotropin secretion. This study is also the first to show that short-term administration of ESF to juvenile animals significantly delays the onset of female puberty. The dose of 1.0 mg/kg used for our short-term puberty studies was two times lower than the stated no observable effect level (NOEL) of 2.0 mg/kg/day used for the dietary developmental study in rats .in vivo study that evaluated puberty in female animals exposed to a type II pyrethroid. We found only one 2. Females dosed with 5.0 and 1.0 mg/kg ESF had significantly suppressed E2 levels.In the present study, we dosed immature animals 1 day postweaning until just before the onset of puberty, at which time we measured morning serum levels of LH, FSH, and E2 levels, a compensatory increase in LH would be expected because of the removal of the negative feedback effect at the hypothalamus. However, the morning LH levels in the pesticide-treated animals were the same as those in controls. This atypical response to the low E2 suggested a hypothalamic deficit.Interestingly, in our study, ESF did not affect the morning basal secretion of FSH or LH. If ESF were acting only at the ovarian level to suppress serum EHowever, our results for afternoon LH levels showed an inhibition in the afternoon hormonal rise in animals treated with even the lowest dose (0.5 mg/kg) of pesticide. The physiologic pattern of both LH and FSH secretion is periodic and intermittent, although more so for LH. Before the onset of puberty, the amplitude of LH release is low; however, once puberty begins, the release of LH becomes more prominent in the afternoon. Both rats and humans exhibit a similar release pattern , which i2 resulting from either hypothalamic and/or pituitary dysfunction or from a direct effect on the ovary. Many toxicants can perturb multiple systems, and ESF may also be interfering with ovarian steroid hormone biosynthesis as well. However, if ESF acted solely on the ovary to suppress E2 synthesis or release, the expected response would be a compensatory increase in LH levels because of the feedback mechanism from the ovary to the hypothalamus and pituitary. Morning LH levels in the pesticide-treated animals were the same as those in control animals, indicating an abnormal feedback response.Delayed puberty most commonly occurs because of decreased E2 and low afternoon LH, we expected the ESF-treated animals to release less LH than controls after NMA stimulation. However, the ESF-treated animals responded to NMA stimulation as well as the controls.When we measured LH in serial morning and afternoon blood samples, the afternoon rise in LH was suppressed in females dosed at even the lowest ESF concentration. Based on the findings of low serum EThe toxic effects of pyrethroids are caused by the prolongation of the open state of voltage-dependent sodium channels, resulting in repetitive firing of the neurons. If the delay in puberty was due to the action of the pesticide on the sodium channels of the LHRH neurons, the expected result would be an initial increase in LH due to the rapid release of LHRH, followed by a decrease in LH levels after the releasable pool of LHRH was exhausted.One possible site of pyrethroid action that could potentially cause the delay in puberty is the NMDA receptor; activation of the NMDA receptor has been suggested as a mediator of pyrethroid neurotoxicity . FurtherAny or all of the EAAs, such as glutamate or aspartate, may not be present in high enough levels to fully activate the NMDA receptor. Thus, when we administered the NMDA receptor agonist, more unoccupied receptor sites were available for binding and subsequent stimulation of LHRH release. Other neurotransmitters, such as norepinephrine, may also be adversely affected by the pesticide.Although the exact mechanism of action is unknown at this time, we observed the effects at dosage levels below the NOEL established through chronic dietary exposure studies in rats. The This could potentially affect current established exposure levels for humans, because the reference dose for ESF of 0.02 mg/kg/day is based directly on the rodent NOEL of 2.0 mg/kg/day. Obviously, more basic research is needed in this area; because of the worldwide use of this class of pesticide, further studies are warranted.

The aim of the present study is to examine: (1) whether a specific respiratory substrate, dicholine salt of succinic acid (CS), can enhance insulin-stimulated insulin receptor autophosphorylation in neurons, and (2) whether CS can ameliorate cognitive deficits of various origins in animal models.Accumulated evidence suggests that insulin resistance and impairments in cerebral insulin receptor signaling may contribute to age-related cognitive deficits and Alzheimer's disease. The enhancement of insulin receptor signaling is, therefore, a promising strategy for the treatment of age-related cognitive disorders. The mitochondrial respiratory chain, being involved in insulin-stimulated HIn a primary culture of cerebellar granule neurons, CS significantly enhanced insulin-stimulated insulin receptor autophosphorylation. In animal models, CS significantly ameliorated cognitive deficits, when administered intraperitoneally for 7 days. In 16-month-old middle-aged C57Bl/6 mice , CS enhanced spatial learning in the Morris water maze, spontaneous locomotor activity, passive avoidance performance, and increased brain N-acetylaspartate/creatine levels, as compared to the age-matched control . In rats with chronic cerebral hypoperfusion, CS enhanced spatial learning, passive avoidance performance, and increased brain N-acetylaspartate/creatine levels, as compared to control rats . In rats with beta-amyloid peptide-(25–35)-induced amnesia, CS enhanced passive avoidance performance and increased activity of brain choline acetyltransferase, as compared to control rats . In all used models, CS effects lasted beyond the seven-day treatment period and were found to be significant about two weeks following the treatment.The results of the present study suggest that dicholine salt of succinic acid, a novel neuronal insulin sensitizer, ameliorates cognitive deficits and neuronal dysfunctions in animal models relevant to age-related cognitive impairments, vascular dementia, and Alzheimer's disease. PhosphoDetect™ Insulin Receptor (pTyr1162/1163) ELISA kit and Insulin Receptor (β-Subunit) ELISA Kit were from Calbiochem. Other materials were purchased from Sigma, ICN, Gibco, Biosource, Molecular Probes, or Acros.Dicholine succinate salt (2:1), formula [. Animals were housed in groups of 4 per cage at a constant temperature 21°C in a light-controlled room at 14/10 light-dark cycle. Food and water were freely available. All animal studies were carried out in accordance with the requirements of our institutional committees for the keeping and use of laboratory animals and in accordance with the "Principles of Laboratory Animal Care" formulated by the National Institutes of Health. All animals were allocated to experimental groups randomly, using computer-generated random numbers.2+/Mg2+-free Hanks' buffered saline (HBSS) without Phenol Red (Gibco). After mincing the tissue with fine scissors, the tissue was placed in Ca2+/Mg2+-free HBSS with Phenol Red and 0.1% trypsin for 15 min at 36°C. Trypsin was inactivated by washing with normal HBSS. Cells were dissociated by trituration and pelleted in HBSS. Then, the cells were resuspended in Neurobasal Medium (Gibco) supplemented with B-27 Supplement (Gibco), 20 mmol/L KCl, GlutaMax (Gibco) and penicillin/streptomycin and plated with density 5 × 106 cells/ml onto 35 mm × 10 mm sterile cell culture dishes which had been previously coated with poly-D-lysine. The cultures were maintained at 36°C in a humidified atmosphere of 5% CO2 and 95% air and fed with supplemented Neurobasal Medium. Cultures were treated on day 3 with 10 μmol/L cytosine arabinoside (Sigma) for 24 h to prevent glial proliferation. CGN at 7 to 8 days were used for experiments.Cerebellar granule neurons (CGN) were prepared from 7- to 8-day-old Wistar rats as described ,62. Cere2, 1 mmol/L MgCl2, 20 mmol/L HEPES, and 5 mmol/L glucose) at pH 7.4 for 30 min, followed by exposure to vehicle, insulin, CS, or combinations of insulin with CS for 20 min. The experiment was terminated by removing the medium, washing with ice-cold PBS, and adding 120 μL per dish cell lysis buffer (Biosource) supplemented with 1 mmol/L PMSF, 50 mmol/L protease inhibitor set III (Sigma), and 2 mmol/L sodium ortovanadate as the inhibitor of tyrosine phosphatases at 4°C for 20 min. Lysates were centrifuged at 12,000 rpm at 4°C for 12 min. In each CGN lysate, pYpY-IR amounts were measured as described by the manufacturer's manual. Obtained values were normalized to total amounts of insulin receptor β-subunit (IR) measured by insulin receptor (β-subunit) ELISA kit . The results are expressed as a percentage of the response produced to 100 nmol/L insulin.Amounts of double phosphorylated β-subunit of insulin receptor (pYpY-IR) were measured by PhosphoDetect™ insulin receptor (pTyr1162/1163) ELISA kit suitable for studies with rat insulin receptor. CGN cultures were incubated in Hepes-buffered salt solution as described . The ratnucleus basalis magnocellularis of rat brain as a sterile solution of 2 μg per 1 μL of saline per side through the guide cannula with Hamilton microsyringe according to stereotaxic coordinates: AP -1.5, DL ± 2.7, and H 8.1 [β-Amyloid peptide-(25–35)-induced amnesia in rats was induced as described previously . The ratnd H 8.1 . Sham-opSpontaneous locomotor activity of mice was evaluated in open field tests in an automated mode using the Opto-Varimex-3 photocell-based activity monitor. The Opto-Varimex-3 animal activity monitor employs a photocell beam grid. Animals were placed individually into the activity monitor and spontaneous locomotor activity was collected for a 3-min period.via grid floor. Each mouse was placed again on the platform, and step-down latency was recorded until 180 s had elapsed.The apparatus for step-down passive avoidance test consisted of a box (22 × 24 × 27 cm) with a stainless-steel grid floor. A circular Plexiglas platform was fixed at the center of the box. During the training, each mouse was placed individually on the platform. When the mouse stepped down from the platform and placed its four paws on the grid floor, an electric shock 1.0 mA was delivered for 3 s. The retention trial was carried out twenty-four hours after the training session in a manner similar to the training except that no electric shock was delivered via the grid floor. After receiving the footshock, the rat was returned to a home cage. The retention trial was carried out twenty-four hours after the acquisition trial. In the retention trial, each animal was placed into the light compartment, and the step-through latency was recorded until 180 s had elapsed.A step-through box for passive avoidance test consisted of a light compartment connected to a dark compartment by a controllable door. This test consisted of two trials. In the acquisition trial, the rats were individually placed into the light compartment, the door to a dark compartment was opened, and the latency until the rat entered the dark compartment was recorded. After the rat had stepped through the door, the door was closed and an electric shock 0.8 mA was delivered for 1 s The water maze test was performed as described by Morris . The expAll behavioral experiments were carried out by investigators blinded to treatment groups.1H frequency 400 MHz using the Bruker AM-400 WB spectrometer with a vertical magnet equipped with a home-build probe of outer diameter 70 mm. An animal under pentobarbital sodium anesthesia was fixed in the probe head, the surface coil (6 mm in diameter for mice or 14 mm in diameter for rats) being positioned directly onto the skull at animal's sinciput. Magnetic field homogeneity was optimized by the water signal. Line widths of 40 to 90 Hz were routinely obtained. The 1H-MRS spectra were accumulated and processed as described [1H-MRS measurements were carried out by investigator blinded to treatment groups.Spectra were recorded at escribed ,66. MetaRats were decapitated under sodium pentobarbital anesthesia. Brains were quickly removed and homogenized. ChAT activity in cerebral cortex homogenates was measured by the method described by Fonnum . All ChAData were analyzed for statistical significance by one-way analysis of variance (ANOVA). Data of the water maze test were analyzed for statistical significance by two-way ANOVA. Values are given as means ± SEM. Differences were considered significant at P < 0.05.1H-MRS, proton magnetic resonance spectroscopy; i.p., intraperitoneal; NAA, N-acetylaspartate; NBM, nucleus basalis magnocellularis; PBS, phosphate-buffered saline; PMSF, phenylmethylsulfonyl fluoride; SEM, standard error of mean; 2VO, two-vessel occlusion.AD, Alzheimer's disease; ANOVA, analysis of variance; ChAT, choline acetyltransferase; CGN, cerebellar granule neurons; Cr, creatine; CH, choline chloride; CS, dicholine salt of succinic acid; HBSS, Hanks' buffered salt solution; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; The author(s) declare that they have no competing interests.in vitro studies with CGN cultures and data analysis. YES carried out the in vitro studies with CGN cultures and data analysis. NAP carried out the in vitro studies with CGN cultures and data analysis. VGP participated in the design of the in vitro studies with CGN cultures, critical intellectual discussion, and manuscript evaluation/critique. NAS carried out the 1H NMR study in vivo and the data analysis. EIZ carried out the measurement of ChAT activity and the data analysis. IAP conceived, designed and coordinated the study, and drafted the manuscript. All authors read and approved the final manuscript.ZIS carried out surgical operations, behavioral tests, and the data analysis in animal studies. ATP carried out surgical operations and behavioral tests in animal studies. VVS participated in the design of behavioral studies, critical intellectual discussion, and manuscript evaluation/critique. TPS carried out the

In the eukaryotic cell the cAMP-dependent protein kinase (PKA) is a key enzyme in signal transduction and represents the main target of the second messenger cAMP. Here we describe the design, synthesis and characterisation of specifically tailored cAMP analogs which can be utilised as a tool for affinity enrichment and purification as well as for proteomics based analyses of cAMP binding proteins.Two sets of chemical binders were developed based on the phosphorothioate derivatives of cAMP, Sp-cAMPS and Rp-cAMPS acting as cAMP-agonists and -antagonists, respectively. These compounds were tested via direct surface plasmon resonance (SPR) analyses for their binding properties to PKA R-subunits and holoenzyme. Furthermore, these analogs were used in an affinity purification approach to analyse their binding and elution properties for the enrichment and improvement of cAMP binding proteins exemplified by the PKA R-subunits. As determined by SPR, all tested Sp-analogs provide valuable tools for affinity chromatography. However, Sp-8-AEA-cAMPS displayed (i) superior enrichment properties while maintaining low unspecific binding to other proteins in crude cell lysates, (ii) allowing mild elution conditions and (iii) providing the capability to efficiently purify all four isoforms of active PKA R-subunit in milligram quantities within 8 h. In a chemical proteomics approach both sets of binders, Rp- and Sp-cAMPS derivatives, can be employed. Whereas Sp-8-AEA-cAMPS preferentially binds free R-subunit, Rp-AHDAA-cAMPS, displaying antagonist properties, not only binds to the free PKA R-subunits but also to the intact PKA holoenzyme both from recombinant and endogenous sources.In summary, all tested cAMP analogs were useful for their respective application as an affinity reagent which can enhance purification of cAMP binding proteins. Sp-8-AEA-cAMPS was considered the most efficient analog since Sp-8-AHA-cAMPS and Sp-2-AHA-cAMPS, demonstrated incomplete elution from the matrix, as well as retaining notable amounts of bound protein contaminants. Furthermore it could be demonstrated that an affinity resin based on Rp-8-AHDAA-cAMPS provides a valuable tool for chemical proteomics approaches. The PKA holoenzyme is activated upon cooperative binding of four molecules of the second messenger cAMP to the R-subunits, thus releasing the now active C-subunits [The cAMP-dependent protein kinase (PKA) is a key regulator protein in eukaryotic signal transduction and is involved in several cellular processes during growth and development. Via phosphorylation of its substrate proteins PKA controls metabolic processes, cAMP mediated gene expression, cell differentiation and/or apoptosis . The enzsubunits .Historically, purification of PKA holoenzyme from biological material was performed via anion exchange chromatography ; later,1. Purify high quantities of selected protein of interest;2. yield functionally active protein;3. provide a purification procedure with mild but efficient elution conditions while retaining high yields of protein;4. obtain nucleotide-free proteins which can easily be used for further interaction studies and biochemical assays;5. provide an easy-to-use procedure applicable in chemical proteomics.In addition to cAMP's role as a general activator of all holoenzyme isoforms, with PKA representing the main intracellular effector of cAMP, there are still other targets of cAMP like nucleotide-gated ion channels , cAMP de2C2), including proteins interacting with the C-subunits.PKA R-subunits and specific components of the cAMP signalling network can be precisely targeted from complex protein mixtures using highly specific cAMP analogs covalently coupled to agarose beads. Generally, two groups of chemical tools are used for the affinity purification of functional complexes: agonist and antagonist binders Fig. . AgonistIn the present study several cyclic nucleotide analogs were synthesised and optimised for their binding properties to the respective components of the PKA system using an iterative approach based on direct SPR binding studies. Subsequently, these cAMP analogs were coupled to a solid support and tested for binding and elution in a one step purification procedure probing all four recombinantly expressed R-subunit isoforms. Furthermore, we tested optimised cyclic nucleotides analogs for their application in a chemical proteomics approach addressing either the R-subunits or the intact PKA holoenzyme complex along with physiological interaction partners derived from animal tissue.In previous studies, hundreds of cyclic nucleotides were developed and characterised regarding their binding ability to proteins containing cyclic nucleotide binding (CNB) domains -14.For our developments we used optimised binders based on Sp-cAMPS Fig. , a cAMP 8-AEA-cAMP, 8-AHA-cAMP, Sp-8-AEA-cAMPS, Sp-8-AHA-cAMPS and Sp-2-AHA-cAMPS were covalently coupled to a sensor surface using NHS/EDC chemistry and the association and dissociation patterns of the four different R-subunit isoforms were analysed using a Biacore 2000 instrument Fig. . When adGenerally, fast binding to the affinity matrix as well as rapid and complete dissociation under elution conditions are preferred for purification, without the dissociation of protein from the affinity matrix under washing conditions. From the observed elution patterns, Sp-8-AEA-cAMPS was considered the best candidate for efficient elution of hRIα Fig. , especiaAs a consequence of the high surface ligand density the association and dissociation patterns of the R-subunits to the immobilised cAMP analogs were severely affected by mass transfer limitations. These limitations are due to depletion of the analyte (here the R-subunits) being in close proximity to the sensor surface during association, thus prohibiting the quantitative analyses of association and dissociation kinetics. Furthermore, rebinding effects in the dissociation phase are intensified by the presence of four cAMP binding sites per R-subunit dimer -32. StilThe analogs tested in SPR were coupled to agarose beads using NHS chemistry Fig. . BacteriE. coli Chloramphenicol Acetyltransferase which is abundant in the BL21 (DE3) Codon Plus RIL strain resulted in half the amount of purified PKA R-subunit . The purification of RIα and RIIα isoforms resulted in 12 mg protein per liter expression media. For RIβ and RIIβ isoforms 5 mg and 3 mg protein were purified respectively. All affinity purified proteins were verified by MS (data not shown). The entire purification procedure of each R-subunit isoform was completed within 8 h.2C2) complex and target physiological interaction partners via a chemical proteomics approach. Only cAMP analogs derived from the lead structure Rp-cAMPS , free R-subunit and C-subunit were injected to both sensor surfaces. Fig. 2C2) and the free R-subunit (R2). A control experiment was performed, injecting free R-subunit over both surfaces and similar binding signals of approximately 5,300 RU each were obtained for the agonist as well for the antagonist surface , free R-subunit and C-subunit were injected and after a 4 min wash, the sensor surface was incubated with 0.2% SDS. Proteins bound to the nucleotide surface were eluted using the microrecovery function (Biacore 3000 Control Software 4.1) and the content of 15 subsequent elutions was subjected to SDS-PAGE was bound to the antagonist surface and subsequently eluted. For a control the same amount of holoenzyme was also injected to the agonist surface and analysed as described above. Only R-subunit, but no C-subunit, could be detected by SDS-PAGE and antagonist agarose (Rp-8-AHDAA-cAMPS) were incubated with pig brain lysate in order to investigate, if endogenously expressed R-subunit and PKA holoenzyme can be pulled out of biological material. After incubation of the soluble protein fraction with the affinity resins, the beads were washed six times and the bound proteins were subsequently eluted with 20 mM cAMP and analysed by SDS-PAGE Fig. .et al. in preparation). This indicates, that functional complexes of cAMP interactome can be pulled out of tissue lysates with these new chemical tools, proving the opportunity for the discovery of additional components of the cAMP signalling pathway.Using the agonist as affinity reagent, all four R-subunit isoforms were pulled from pig brain lysate. When using the antagonist, additionally all major C-subunit isoforms and characterised the binding to all four R-subunit isoforms in direct interactions studies using SPR. Subsequently these agonists were coupled to solid supports and used for affinity purification of recombinantly expressed R-subunits. All three analogs displayed superior purification strategies when compared to conventional cAMP analogs .Using Sp-8-AEA-cAMPS agarose it is now possible to obtain large yields of active and nucleotide-free R-subunit without the use of denaturants. This is especially important since remaining nucleotide in the CNB domain would interfere with subsequent studies. Furthermore decreased stability of Urea unfolded and refolded protein occurs .et al. in preparation). Here we can demonstrate that components of cAMP signalling pathways were selectively complexed with their physiological interaction partners thus demonstrating that phosphorothioate cAMP analog agaroses are extremely valuable for comparable chemical proteomics studies. Furthermore, phosphorothioate cAMP analogs provide an additional advantage as they were shown to be highly stable against phosphodiesterase activity [In general, affinity reagents, addressing a specific subset of proteins or protein complexes, are of growing importance for many applications in proteomics. This includes enrichment of proteins or subcellular components as well as removal of unwanted cell debris subcellular components, proteins and metabolites. Therefore, our described cAMP analogs not only provide a highly selective tool as an affinity material for purification of PKA R-subunits, but can also serve as a tool that particularly targets the cAMP sub-proteome , Roth (Karlsruhe) or Applichem (Darmstadt). The following cAMP-analogs were synthesised by Biolog LSI (Bremen): 8-AHA-cAMP, 8-AEA-cAMP, Sp-cAMPS, Sp-8-AHA-cAMPS, Sp-2-AHA-cAMPS, Sp-8-AEA-cAMPS, Rp-cAMPS, Rp-8-AHA-cAMPS, Rp-8-AHDAA-cAMPS. A representative scheme with synthesis and coupling of Sp-8-AEA-cAMPS to agarose beads is provided in Fig. 2PO4, pH 7, followed by water. Each cAMP(S) analog was eluted with a gradient from 100% water to 100% acetonitrile. The product containing fractions were collected and evaporated under reduced pressure to obtain 8-AHA-cAMP, 8-AEA-cAMP, Sp-8-AHA-cAMPS, Sp-8-AEA-cAMPS, Sp-2-AHA-cAMPS and Rp-8-AHDAA-cAMPS in yields of 60–80% with purities > 99% (by HPLC). The structure of each cAMP(S) analog was confirmed by UV/VIS spectrometry and FAB/MS or ESI/MS analysis.All cAMP- and ω-aminoalkyl-substituted Sp-cAMPS analogs according to the manufacturer's instructions analogs were coupled to NHS-activated agarose beads containing 0.005% (v/v) surfactant P20, using a Biacore 2000 instrument (Biacore AB). Binding analyses were performed by injection of 100 nM hRIα, hRIβ, hRIIα and rRIIβ at a flg for 30 min at 4 C. Three different Sp-cAMPS agaroses were tested side by side in a one step purification strategy. 1.2 μmoles of coupled analog were used for each purification, corresponding to approximately 400 μL of agarose slurry. 12 mL supernatant from 500 mL bacterial culture were incubated with the respective affinity matrices. Binding was carried out in a batch format by gently rotating over night at 4°C. After washing the agarose seven times with 1.25 mL lysis buffer each, the protein was eluted with 1.25 mL of 10 mM cGMP in buffer B (buffer A plus 1 mM β-mercaptoethanol) by gentle rotation at 4°C for 1 h followed by an elution using 10 mM cAMP in buffer B instead of cGMP. Excess of nucleotide was removed using a PD10 gel filtration column (Amersham Pharmacia). cGMP bound to the cyclic nucleotide binding pockets was removed by extensive dialysis against buffer B.Bacterial cells overexpressing R-subunit were lysed using a French Pressure Cell (Thermo Electron) in lysis buffer containing 20 mM MOPS pH 7, 100 mM NaCl, 1 mM β-mercaptoethanol, 2 mM EDTA and 2 mM EGTA (buffer A). The crude lysate was centrifuged at 27,000 The purification strategy of RIβ with Sp-8-AEA-cAMPS follows in principle the procedure described for RIα.The purification strategy of RII isoforms follows the procedure described for hRIα except cell lysis was performed in buffer containing 20 mM MES pH 6.5, 100 mM NaCl, 5 mM EDTA, 5 mM EGTA and 5 mM β-mercaptoethanol (buffer C) including the protease inhibitors Leupeptin , TPCK and TLCK . After cell lysis, the soluble protein fraction was incubated in a batch format with Sp-8-AEA-cAMPS agarose . The agarose was washed twice with 10 mL buffer D and subsequently with buffer C containing protease inhibitors. Two elution steps were performed with 1 mL 25 mM cGMP in buffer C and exchanged to 20 mM MES pH 6.5, 150 mM NaCl, 2 mM EDTA, 2 mM EGTA and 1 mM β-mercaptoethanol using a PD10 column (Amersham).The side by side comparison of Sp-8-AEA-cAMPS, 8-AHA-cAMP and 8-AEA-cAMP for purification was performed as described for the RI and RII purification. Crude lysate from one litre expression culture was divided into three equal aliquots and incubated in a small scale experiment with 100 μL of the respective agaroses. The cGMP elution was followed by a second elution step with 40 mM cAMP at room temperature for 30 minutes according to .2, 1 mM ATP with 0.005% (v/v) surfactant P20 on a Biacore 3000 instrument. 250 nM PKA type I holoenzyme (R2C2), free RIα subunit or C-subunit were injected over the analog sensor surfaces in separate experiments. The association phase was monitored for 5 min followed by a 4 min washing step with running buffer. Bound protein was eluted by incubating the sensor surface with 0.2% SDS for 90 s and the eluted material was recovered in a capped vial. The sensor surfaces were regenerated by three subsequent injections of 3 M guanidinium HCl.Rp-8-AHDAA-cAMPS . Protein was eluted with 1 mL 20 mM cAMP in buffer E by gentle rotation at room temperature for 1 h. The entire supernatant of each step was precipitated with TCA and applied to SDS-PAGE , 2 mM NADH and 20 mM sucrose). After centrifugation at 13,700 g for 25 min, the supernatant was filtered and incubated with 150 μL agarose (corresponding to 1 μmole of Sp-8-AEA-cAMPS or Rp-8-AHDAA-cAMPS) over night at 4°C. The beads were washed six times with 1.5 mL buffer F. Elution was carried out with 1 mL of buffer E containing 20 mM cAMP by gentle rotation at room temperature for 1 h. All samples were precipitated with TCA for SDS-PAGE were added directly to the gel slurry and incubated at 50°C for a minimum 1 h [Protein bands were excised from one-dimensional SDS-PAGE and digeimum 1 h . After aimum 1 h ,57. The DB, SS and SEH performed the expression and purification of the recombinant proteins as well as the biochemical characterisation and the chemical proteomics experiments. FS and HGG synthesised and purified the cyclic nucleotide analogs and performed coupling to the agarose. SD carried out the SPR measurements, OB the mass spectrometry analyses, SS the BIA-MS experiments and DB, SS and FWH wrote the manuscript and prepared the figures.

Plasmodium parasites must control cysteine protease activity that is critical for hepatocyte invasion by sporozoites, liver stage development, host cell survival and merozoite liberation. Here we show that exoerythrocytic P. berghei parasites express a potent cysteine protease inhibitor . We provide evidence that it has an important function in sporozoite invasion and is capable of blocking hepatocyte cell death. Pre-incubation with specific anti-PbICP antiserum significantly decreased the ability of sporozoites to infect hepatocytes and expression of PbICP in mammalian cells protects them against peroxide- and camptothecin-induced cell death. PbICP is secreted by sporozoites prior to and after hepatocyte invasion, localizes to the parasitophorous vacuole as well as to the parasite cytoplasm in the schizont stage and is released into the host cell cytoplasm at the end of the liver stage. Like its homolog falstatin/PfICP in P. falciparum, PbICP consists of a classical N-terminal signal peptide, a long N-terminal extension region and a chagasin-like C-terminal domain. In exoerythrocytic parasites, PbICP is posttranslationally processed, leading to liberation of the C-terminal chagasin-like domain. Biochemical analysis has revealed that both full-length PbICP and the truncated C-terminal domain are very potent inhibitors of cathepsin L-like host and parasite cysteine proteases. The results presented in this study suggest that the inhibitor plays an important role in sporozoite invasion of host cells and in parasite survival during liver stage development by inhibiting host cell proteases involved in programmed cell death. Plasmodium sporozoites are transmitted by Anopheles mosquitoes to the vertebrate host. They migrate through the skin before entering blood vessels and being transported with the bloodstream to liver sinusoids. There the sporozoites transmigrate through Kupffer cells and several hepatocytes before they invade a final hepatocyte and develop into thousands of merozoites. These daughter parasites are transported inside host cell-derived vesicles (merosomes) back to the bloodstream where they are finally released and infect red blood cells. Most of these processes depend on the activity of proteases, which must be tightly controlled to avoid proteolytic destruction of the parasite. We have identified a potent cysteine protease inhibitor of the rodent parasite Plasmodium berghei, which is expressed throughout the life cycle of the parasite. The inhibitor appears to play a role in sporozoite invasion of host cells and in parasite survival during liver stage development by inhibiting host cell proteases involved in programmed cell death. Plasmodium. The infection of the vertebrate host begins with the inoculation of sporozoites into the dermis during blood feeding of an infected Anopheles mosquito Plasmodium species, they develop inside a parasitophorous vacuole to several thousand red blood cell-infective merozoites P. berghei, it was shown that infected hepatocytes are protected against apoptosis throughout liver stage development Malaria is caused by apicomplexan parasites of the genus Plasmodium sporozoites Plasmodium parasites are exposed to host cell proteases and it is likely that they have evolved mechanisms to counteract proteolytic digestion.As in the blood stage and mosquito stage Host cell proteases are often involved in pathogen defense mechanisms and a number of other parasites have already been shown to express cysteine protease inhibitors that block these proteases. These include host cell proteases involved in antigen presentation, cytokine responses and host cell apoptosis and proteases that are stored in potentially fusogenic organelles like lysosomes and are liberated upon pathogen recognition Trypanosoma cruzi and was the first identified member of a new superfamily of reversible, tight-binding cysteine protease inhibitors Trypanosoma brucei, Pseudomonas aeruginosa, Leishmania mexicana, Leishmania major, Entamoeba histolytica, P. falciparum and Toxoplasma gondiiT. brucei, T. cruzi, P. falciparum, E. histolytica) and/or host cell proteases Short-term regulation of parasite as well as host proteases can be mediated by specific parasite-derived inhibitors. A prominent example is chagasin, which is expressed by P. falciparum ICP (PfICP), termed falstatin, has been described previously for the blood stage of the human malaria parasite The P. berghei, which we name PbICP for Plasmodium berghei inhibitor of cysteine proteases, following the common nomenclature for the entire inhibitor family. PbICP appears to play a critical role at least during the parasite liver and blood stages in the vertebrate host. We analyzed specifically the exoerythrocytic parasite stages and suggest a function of PbICP in sporozoite invasion and host cell survival.Here we report on the falstatin homolog of the rodent malaria parasite Animals were obtained from Charles River Laboratories. All animal work was conducted in compliance with regulations created and approved by the ethical committee of Hamburg state authorities (Nr. FI 28/06).Homology searches, multiple alignments and secondary structure predictions were performed with public BLAST search tools (PlasmoDB), the Clustal W program (EMBL-EBI) and structure prediction programs .pbicp gene , pbicp-n and pbicp-c were amplified from cDNA of P. berghei ANKA wildtype mixed blood stage parasites using the following primer pairs: PbICP-fw (5′-GG GAATTCGAAGATAACGACATATACTCTTTTGATATC-3′) / PbICP-rv (5′- CCCAAGCTT TTATTGGACAGTCACGTATATAAT-3′) to clone MBP-PbICP full length, PbICP-C-fw1 (5′-TTGAATTCGGAGATGAAAAATGTGGTAAATCA-3′) / PbICP-C-rv1 (5′-TTGGATCC TTATTGGACAGTCACGTATATAAT-3′) to clone MBP-PbICP-C, PbICP-C-fw2 (5′- TTCATATG GGAGATGAAAAATGTGGTAAATCA-3′) / PbICP-C-rv2 (5′-TTGAATTC TTATTGGACAGTCACGTATATAAT-3′) to clone His-PbICP-C and PbICP-C without tag, PbICP-N-fw1 (5′-GGGAATTCGAAGATAACGACATATACTCTTTTGATATC-3′) / PbICP-N-rv1 (5′-TT GGATCC TGGTTAAATGAGTTGTATGAAGTAGTTGGG -3′) to clone MBP-PbICP-N for antibody production, PbICP-N-fw2 (5′-GGGAATTCGAAGATAACGACATATACTCTTTTGATATC-3′) / PbICP-N-rv2 (5′-TTGGATCC AGTCAATTCATATTTACTATCAACTTTACCA -3′) to clone MBP-PbICP-N for protease assays.The 10-tagged PbICP-C E. coli strain E. coli strain (Stratagene) and purified using amylose resin (New England Biolabs). The MBP-tag of PbICP (full length) was removed by factor Xa (New England Biolabs) and untagged PbICP was purified by using a MonoQ column (Pharmacia).The PCR products were cloned into the bacterial expression vectors was measured every 10 seconds and activity was calculated from the linear part of the graph (ΔE/Δt). Protease activity in the presence of the control protein MBP was set to 100% and residual activity in the presence of recombinant PbICP constructs was calculated.Cathepsin L 6 wildtype oocyst sporozoites, 6×105 wildtype salivary gland sporozoites, infected HepG2 cells at different time points after infection or from saponin-treated blood stage parasites using the RNA Extract Kit II (Macherey and Nagel). First strand cDNA synthesis was performed with the Superscript™ First-Strand Synthesis System for RT-PCR (Invitrogen).Total RNA was isolated from 105′-ATGCTCCATCCTAGCCCTTT-3′) / PbICP-rev (5′-CCACTTTCATTCATTGTGTTGTT-3′) and Pbtubulin-fw (5′- TGGAGCAGGAAATAACTGGG-3′) / Pbtubulin-rev (5′-ACCTGACATAGCGGCTGAAA-3′). All RNA preparations were free of genomic DNA (gDNA) contamination as no PCR product was obtained when reverse transcriptase had been omitted from the RT-PCR (negative control).Duplex-PCR was performed with the two primer pairs PbICP-fw and MBP-PbICP-N in PBS buffer were mixed with one volume Freund's adjuvant complete (Sigma) and intraperitoneally injected into BALB/c or NMRI mice. After two weeks, the mice were boosted with the same amount of protein mixed with Freund's adjuvant incomplete (Sigma) followed by a second boost two weeks later. Immunized mice were killed after confirming the antibody response in preliminary experiments, and blood was collected by cardiac puncture. Antisera were obtained after centrifugation and diluted with one volume glycerol (Roth) for long term storage at −20°C.Rabbit antisera against His-PbICP-C, rabbit antisera against a peptide within the PbICP-N sequence and the appropriate preimmune sera were obtained from Eurogentec S.A.2 in EMEM (PAA) containing 10% fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin . For infection, 5×104 cells were seeded per coverslip in a 24-well plate. P. berghei (ANKA) sporozoites were prepared from salivary glands of infected Anopheles stephensi mosquitoes and incubated with HepG2 cells in EMEM (PAA) containing 3% bovine serum albumin (Sigma), 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin at 37°C and 5% CO2. After 2 hours, cells were washed and incubated in fresh culture medium for the indicated times.Human hepatoma cells (HepG2) were obtained from the European cell culture collection. Cells were cultivated at 37°C and 5% COParasite proteins were separated on 12% to 14% SDS-PAGE gels under reducing conditions and transferred to nitrocellulose membranes. Membranes were probed with rabbit antisera directed against His-PbICP-C or a peptide of PbICP-N, anti-GFP mouse monoclonal antibodies (Roche) or rabbit antisera (Molecular Probes) and mouse anti-tubulin monoclonal antibody (Sigma). Horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG (Pierce or Rockland) and enhancing chemiluminescence substrate detection kits (Pierce and Bio-Rad) were used for detection.A. stephensi mosquitoes and incubated on glass coverslips with or without HepG2 cells in EMEM (PAA) containing 3% bovine serum albumin (Sigma), 2 mM L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C and 5% CO2. After 2 hours, medium was carefully removed and sporozoites were fixed with 4% formaldehyde in PBS , permeabilized with ice-cold methanol (10 min) and incubated with primary antisera and subsequently with fluorescently labeled secondary antibodies . DNA was visualized by staining with 10 µg/ml DAPI (Sigma). Labeled cells were analyzed by widefield or confocal microscopy using the Leica DM RB or Olympus FV1000.Sporozoites were isolated from salivary glands of A. stephensi mosquitoes and incubated for 40 minutes on ice in PBS with a 1∶100 dilution of rabbit antiserum directed against His-PbICP-C, the appropriate preimmune serum or mouse antiserum directed against CSP. Sporozoites were washed twice with cold PBS and subsequently incubated with a 1∶200 dilution of the Cy2-labeled anti-rabbit or anti-mouse secondary antibody (Dianova) and Hoechst 33258 (Molecular Probes) for 30 min on ice. Sporozoites were washed twice, settled on coverslips with DAKO Fluorescent Mounting Medium (DAKO) and immediately analyzed by widefield fluorescence microscopy using the Leica DM RB.Sporozoites expressing cytosolic mCherry HepG2 cells were infected as described above. After the indicated time periods, cells were fixed with 4% formaldehyde in PBS , permeabilized with ice-cold methanol (10 min) and incubated with primary antibody and subsequently with fluorescently labeled secondary antibodies . DNA was visualized by staining with 10 µg/ml DAPI (Sigma). Labeled cells were analyzed by widefield or confocal microscopy using the Leica DM RB or Olympus FV1000.P. berghei infected A. stephensi mosquitoes were isolated, fixed in 2% paraformaldehyde and 0.025% glutaraldehyde and slowly embedded in LR WhiteTM Resin (London Resin Company) after dehydration. Briefly, ultrathin sections were incubated with rabbit antiserum directed against His-PbICP-C and subsequently with gold (10 nm)-labeled Protein A.Midguts and salivary glands of For double staining, ultrathin sections were first incubated with anti-TRAP mouse antiserum and subsequently with gold (10 nm)-labeled anti-mouse IgG and afterwards with rabbit antiserum directed against His-PbICP-C and with gold (25 nm)-labeled Protein A.Sections were stained with 2% uranyl acetate and 1∶10 diluted Reynold's lead citrate solution in 0.01 N NaOH. Sections were analyzed using the FEI Tecnai TEM.P. berghei ANKA wildtype mixed blood stage parasites using the primer pair PbICPpL17-fw (GGATCCATGAAAAGTATAACTTTTTTCGTGTTTAAT-3′5′-CTG) / PbICPpL17-rev (GGATCCTTGGACAGTCACGTATATAATTTTAGTGTT-3′5′-CTG). The resulting fragment was cloned into the P. berghei GFP transfection plasmid pL0017 (MR4) using the BamHI site in front of the gfp gene. The plasmid was linearized for transfection using the restriction sites of SacII and ApaI in the ssu integration site sequence. Schizont-stage parasites were transfected with 2.5 and 7.5 µg purified plasmid DNA as described by Janse et al. DNA was amplified from cDNA of To monitor parasite growth over the course of development, parasite size was measured by the density slice module of the OpenLab software version 5.0.2. Briefly, at different time points after infection (24 hpi (hours post infection), 48 hpi, 63 hpi), transgenic parasites over-expressing PbICP-GFP and control parasites were photographed. Images from each time point were merged and OpenLab software version 5.0.2 was used to produce a density slice of the image and to calculate the parasite areas.5 HepG2 cells were seeded per coverslip in a 24-well plate. The following day, transgenic PbICP-GFP sporozoites and GFPcon sporozoites as control were prepared from salivary glands of infected A. stephensi mosquitoes and counted in a Neubauer chamber. 2×104 sporozoites per sample were added to the HepG2 cells. After 1 h incubation at 37°C and 5% CO2, cells were fixed for 2 min with 2% formaldehyde in PBS (no permeabilization) and incubated with rabbit or mouse anti-CSP antiserum and subsequently with fluorescently labeled secondary antibody . DNA was visualized by staining with 10 µg/ml DAPI (Sigma). Sporozoites that have invaded cells are protected against CSP staining and are visualized just by the GFP fluorescence. In contrast, free GFP-positive sporozoites are stained by the CSP antibodies. Free and intracellular sporozoites were counted and their percentages were calculated.An inside/outside assay to investigate infection efficiency was performed as follows: 1×105 HepG2 cells were seeded per coverslip in a 24-well plate. The following day, P. berghei (ANKA) sporozoites were prepared from salivary glands of infected A. stephensi mosquitoes and counted in a Neubauer chamber. For the inside/outside assay, red fluorescent sporozoites expressing cytosolic mCherry protein were used 4 sporozoites per sample were incubated in 30 µl of the anti-His-PbICP-C rabbit antiserum, the appropriate preimmune serum or anti-CSP rabbit antiserum for 40 min on ice. Afterwards, pre-warmed medium containing 3% bovine serum albumin (Sigma), 2 mM L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin was added to the samples. The sporozoite suspension was then added to HepG2 cells. Analysis of the neutralization assays was performed by different established methods ).The neutralization assay was mainly performed as described by Kumar et al. 2, cells were washed three times in PBS, fixed with 4% formaldehyde in PBS and permeabilized with ice-cold methanol (10 minutes). To visualize the sporozoites, CSP-staining was performed . DNA was stained with 10 µg/ml DAPI (Sigma). The number of transmigrated cells was determined by calculating the percentage of dextran-fluorescein-positive cells as a percentage of all cells. HepG2 cells without sporozoites served as control .The suspension of sporozoites was mixed with 1 mg/ml dextran-fluorescein prior being added to the HepG2 cells. 1 h after incubation at 37°C and 5% CO2, cells were fixed for 2 min with 2% formaldehyde in PBS (no permeabilization) and incubated with rabbit or mouse anti-CSP antiserum and subsequently with fluorescently labeled secondary antibody . DNA was visualized by staining with 10 µg/ml DAPI (Sigma). Sporozoites that have invaded cells are protected against the CSP-staining and were visualized only by the mCherry expression. Free mCherry sporozoites were additionally stained by the CSP antibodies. Sporozoites were counted and the percentage of free and intracellular sporozoites was calculated.1 h after incubation at 37°C and 5% CO2, cells were washed and fresh culture medium was added. 24 to 30 hours after infection, cells were used for IFA and the numbers of infected HepG2 cells per coverslip were determined. More than 200 infected cells were counted in the preimmune controls and set to 100% for each of the three independent experiments.After 2 h incubation at 37°C and 5% COP. berghei ANKA wildtype mixed blood stage parasites using the primer pair PbICP-CpEGFP-fw (5′-TTGAATTCGGAGATGAAAAATGTGGTAAATCA-3′) / PbICP-C pEGFP -rev (5′-TTGGATCCTTATTGGACAGTCACGTATATAAT-3′).DNA was amplified from cDNA of The resulting fragment was cloned into the pEGFP-C2 vector (Clontech) to generate a GFP-PbICP-C-fusion protein. The vector pEGFP-C2 alone was used as the GFP control.2.HepG2 cells were grown in single wells of a 6-well plate at 70–80% confluence and transfected using MATra technology (IBA) as recommended by the manufacturer. Briefly, cells were washed with PBS and reduced-serum OptiMEM media (PAA) was added. 5 µg of the appropriate plasmid DNA was pre-incubated with 5 µl of MATra-A reagent in OptiMEM media for 20 min at room temperature and then added to the cells. The cells were incubated with the DNA-MATra complex on a universal magnetic plate (IBA) for 30 min at 37°C and 5% CO2 for 30 min. Live imaging was performed using an inverse microscope and the Openlab 5 software (Improvision).The next day transfected cells were treated with 70 nM tBHP for 4 hours or 1 µM CAM for 48 hours. Cells were washed with PBS and stained with 25 nM TMRE and 16 µM Hoechst 33258 (Molecular Probes) at 37°C and 5% COP. berghei parasites, we analyzed the structural and biochemical properties of the P. berghei homolog of falstatin/PfICP, PbICP. It belongs to the chagasin-like inhibitor family . ICPs are so far the only cysteine protease inhibitors known to exist in protozoan parasites. Typically, ICPs are small proteins with a low sequence similarity to each other but a characteristic β-sheet-rich secondary structure similar to immunoglobulins Plasmodium and Toxoplasma gondii are unusual chagasin family members Plasmodium ICPs contain an additional N-terminal extension region resulting in an overall molecular weight of about 40 kDa. PbICP shares approximately 40% amino acid sequence identity with falstatin/PfICP but only about 21% with chagasin of Trypanosoma cruzi, the first described member of the inhibitor family. Secondary-structure prediction programs propose that PbICP contains the characteristic β-sheet-rich structure with two additional β-strands (β5′and β5″) between the elongated L3 and L4 and an intron of 519 bp. The first exon codes for a classical signal peptide while the second exon codes for the mature protein.The E. coli, purified the protein by affinity chromatography and removed the MBP tag by factor Xa digestion and subsequent ion exchange chromatography and the ICP of T. brucei (TbICP) E. histolytica (EhICP1) and PbICP in their capacity to inhibit cathepsin B and found that EhICP1 blocked this protease but PbICP did not (data not shown).To confirm that PbICP acts as a cysteine protease inhibitor, we produced recombinant PbICP as an MBP fusion protein in tography . PAGE anhepsin-L , Table 1P. berghei. First, we investigated pbicp mRNA expression. RNA was isolated from P. berghei insect stages , red blood cells from infected NMRI mice and infected hepatoma cells. Duplex RT-PCR assays suggested that pbicp, like tubulin, is constitutively transcribed throughout the life cycle stages analyzed , immunoelectron microscopy (IEM) and western blot analysis. An overview is provided of the different antisera generated against the full-length PbICP, PbICP domains (PbICP-N and PbICP-C) and PbICP peptides , as wellpbicp gene, the PbICP protein could be detected in all exoerythrocytic parasite stages . PbICP o(eef1aa) . Overexp(eef1aa) -E. Inter(eef1aa) . To prov(eef1aa) .We then investigated whether the C-terminal domain of PbICP on its own has inhibitory potential. PbICP-C, the region homologous to chagasin, was expressed as an MBP fusion protein and usedin vitro and according to its different localizations it can potentially control parasite as well as host cell-derived proteases.In this study, we report the identification of the potent cysteine protease inhibitor PbICP, the falstatin/PfICP homolog of the rodent malaria parasite P. berghei sporozoites to support host cell invasion. First, the inhibitor was detected in typical CSP-positive sporozoite trails We provide several lines of evidence that PbICP is secreted by ToxoplasmaPbICP does not contain an obvious micronemal targeting motif but since these motifs are rather heterogenous as a bait to trap structurally different proteases Plasmodium ICPs indeed function similarly to serpins, this would explain why falstatin/PfICP is an efficient inhibitor of structurally different proteases.Upon sporozoite invasion of hepatocytes and transformation into trophozoites, PbICP is still secreted by the parasite, entering the PV and apparently reaching the host cell cytoplasm. Since a PEXEL export motif is absent in PbICP, it is so far unknown how the inhibitor crosses the PVM. It has been shown previously that At the end of the liver stage, the situation changes completely and an ordered parasite-mediated cell death is induced. This form of cell death clearly differs from apoptosis since caspases are not involved, there is no switch in phosphatidylserine residues to the outer leaflet of the host cell membrane and the dying cell does not shrink or form apoptotic bodies but rather expands in size P. aeruginosa, which expresses a functional chagasin homolog but no potential target proteases of the C1 protease family To further analyze the function of PbICP translocated into the host cell cytoplasm, it will be necessary to identify its target protease. We suggest that PbICP acts on both parasite and host cell proteases. An effect on host cell proteases has already been shown for a number of ICPs of other pathogens. A good example is the prokaryote Plasmodium ICPs show a complete loss of cathepsin B inhibition Plasmodium ICPs contain sequence insertions in the chagasin-like C-terminal domain, which might, in principle, interfere with cathepsin B binding. A recent publication reports that T. gondii-derived toxostatins, two other members of the chagasin family, contain similar extensions as found in the chagasin-like domain of PbICP. Remarkably, toxostatin-1 was already shown to retain the capability of inhibiting cathepsin B Plasmodium ICPs is not caused by an interference of the extension loops with the occluding loop of the protease but must be due to other structural motifs.All so-far characterized chagasin-like inhibitors have shown a significantly lower affinity to cathepsin B than to cathepsin L-like C1 cysteine proteases P. berghei parasites constitutively over-expressing a GFP-tagged version of the inhibitor. Although these parasites were very helpful for analyzing PbICP localization and processing during the liver stage, the genetic manipulation did not provoke a pronounced phenotype apart from a slightly better invasion rate. The best genetic manipulation to analyze the biological function of PbICP would be to knock out the pbicp gene. This approach has been tried several times without success, strongly suggesting that PbICP expression is essential during the blood stage because transfection and the selection of transgenic parasites is performed at this stage.To characterize the function of PbICP, we generated transgenic P. berghei that seems to play different roles during the life cycle of the malaria parasite. In the exo-erythrocytic stage, PbICP is important for the invasion of sporozoites and is able to protect the host cell from apoptosis, which is essential for the completion of liver stage development.In conclusion, we identified a potent cysteine protease inhibitor of Figure S1P. yoelii (PyICP) and P. falciparum in comparison with the ICPs of T. gondii (toxostatins), T. cruzi (chagasin), T. brucei, L. mexicana and the two ICPs of E. histolytica. Conserved amino acid residues of the chagasin inhibitor family are highlighted in grey, the wedge forming loops that bind the active-site cleft of proteases are highlighted in yellow. The amino acid residues of chagasin highlighted in purple form the β-sheet strands. The N-terminal residues of PbICP highlighted in pink represent the classic signal sequence.Multiple sequence alignment of ICPs. Multiple sequence alignment of PbICP and the ICPs of (0.56 MB PDF)Click here for additional data file.Figure S2T. gondii (toxostatins), T. cruzi (chagasin), T. brucei, L. mexicana and the two ICPs of E. histolytica. Conserved residues of the chagasin inhibitor family are highlighted in grey, the wedge forming loops that bind the active-site cleft of proteases are highlighted in yellow. At the top of the alignment the β-strands of chagasin are displayed in purple. The amino acid sequences of chagasin that form β-strands are additionally indicated in purple. (B) Known β-strands of chagasin and predicted β-strands of PbICP are depicted by arrows. In contrast to chagasin (purple), the inhibitor domain of PbICP (green) is predicted to have two additional β-strands (β5′ and β5′′) and elongated loop-structures L3 and L4 as well as a N-terminal extension region with a classic N-terminal signal sequence (grey). The wedge-forming loops that bind into the active site cleft of the proteases are highlighted in yellow. Like the toxostatins of T. gondii, but in contrast to the non-apicomplexan chagasin-like inhibitors of other protozoa and bacteria, the Plasmodium ICPs do not contain the NPTTG motif in L2 .Multiple sequence alignment of the ICP chagasin domains. (A) Multiple sequence alignment of the C-terminal chagasin-like domain of PbICP, PyICP and falstatin/PfICP in comparison with the ICPs of (0.31 MB PDF)Click here for additional data file.Figure S3GDEK was used for immunization to produce PbICP-C domain-specific antisera. Anti-PbICP-N domain-specific antisera were obtained from mice using recombinant MBP-PbICP-NSFNH for immunization and from rabbits using the peptide EDIEDNQKYPTTSYN. Panels (B and C) show a specificity control of the anti-PbICP-C antiserum (rabbit) in IEM.Schematic overview of PbICP constructs and epitopes used for the generation of antisera and examples of specificity controls. (A) To generate a specific antisera different regions of PbICP were used to immunize mice and rabbits. A mouse anti-PbICP antiserum was generated using MBP-tagged full-length PbICP. Recombinant His-PbICP-C(7.94 MB PDF)Click here for additional data file.Figure S4GDEK. Confocal images of HepG2 cells infected with P. berghei wildtype parasites 55 hpi. Preimmune control (A) and anti-PbICP-C (B). Infected cells were fixed, incubated with a chicken anti-ExpI antiserum (secondary antibody: anti-chicken Alexa 594) and a rabbit antiserum against PbICP-C (secondary antibody: anti-rabbit Cy2) (B) or preimmune serum (secondary antibody: anti-rabbit Cy2) (A). DNA was stained with DAPI (blue).Specificity test of anti-PbICP-antiserum directed against His-PbICP-C(1.67 MB PDF)Click here for additional data file.Figure S5Staining of unfixed sporozoites shows PbICP localization at the apical pole of the sporozoite. Salivary gland sporozoites expressing mCherry were incubated on ice with rabbit anti-PbICP-C antiserum (A), rabbit anti-CSP antiserum (B) or rabbit preimmune serum (C), washed, subsequently stained with Cy2-conjugated secondary anti-rabbit antibody (green) and Hoechst 33258 (blue), again washed and immediately analyzed by fluorescence microscopy.(0.48 MB PDF)Click here for additional data file.Figure S6P. berghei. Infected cells were fixed 4 hpi, incubated with polyclonal antisera against PbICP-C (rabbit) and against GFP (mouse) and subsequently stained with fluorescently labeled secondary antibodies . DNA was stained with DAPI (blue). Partial co-localization of PbICP and GFP confirmed secretion of the inhibitor in the host cell cytoplasm. (B) Quantitative analysis of PbICP secretion. IFA of a HepG2 cell infected with P. berghei. Infected cells were fixed 4 hpi, incubated with polyclonal antiserum against PbICP-C (rabbit) and against CSP (mouse) and subsequently stained with fluorescently labeled secondary antibody . DNA was stained with DAPI (blue). Parasites associated with HepG2 cells and found in the same focal plane as the host cell nucleus were considered intracellular . Intracellular parasites were counted and the absolute numbers of parasites secreting either PbICP and CSP or CSP alone are shown in the graph.PbICP is secreted by intracellular trophozoites . (A) IFA of a GFP-expressing HepG2 cell infected with (1.76 MB PDF)Click here for additional data file.Figure S7P. berghei 2 hours after infection. Infected cells were fixed, incubated with polyclonal antiserum against PbICP-C (rabbit) and subsequently stained with fluorescently labeled secondary antibody . DNA was stained with DAPI (blue).PbICP is secreted by intracellular sporozoites (widefield IFA). IFA of HepG2 cells infected with (1.61 MB PDF)Click here for additional data file.Figure S8P. berghei-infected HepG2 cells. Cells were fixed 30 hpi and stained with polyclonal antisera against PbICP-C and ExpI . DNA was stained with DAPI (blue).PbICP partially co-localizes with the PVM marker ExpI at the schizont stage . Confocal IFA of (0.35 MB PDF)Click here for additional data file.Figure S9P. berghei at 48 hpi. Infected cells were fixed and stained with anti-ExpI antiserum and polyclonal antiserum against PbICP-C . DNA was stained with DAPI (blue). Representative images are presented in A-D.PbICP localizes to vesicular structures in the PV of liver stage schizonts. IFA of HepG2 cells infected with (2.00 MB PDF)Click here for additional data file.Figure S10P. berghei at the end of the liver stage (63 hpi) prior to and after visible destruction of the PVM. Infected cells were fixed, stained with DAPI (A) and with anti-ExpI antiserum and polyclonal antiserum against PbICP-C (B). Different phenotypes are presented as a cartoon (C). Late schizont/merozoite stages were counted and the percentage of each different phenotype was calculated. Presented on top of the images are the means and standard deviations of three independent experiments (frequency of phenotypes). Main phenotypes are parasites with intact PVM and PbICP restricted to the parasite and the PV, and parasites with disrupted PVM visible by Exp1 staining and PbICP release into host cell cytoplasm. hc: host cell.PbICP is released into the host cell cytoplasm at the end of the liver stage. IFA of HepG2 cells infected with (3.02 MB PDF)Click here for additional data file.Figure S11P. berghei parasites and analyzed at different time points after infection. The sporozoite shown in panel (A) revealed an apical accumulation of the GFP fluorescence (marked with an asterisk). Early liver stage parasites (B) released GFP-positive structures (marked with arrows). In schizont stages , GFP fluorescence was found in the PV and the parasite cytosol. At the end of the liver stage, after detachment of the infected HepG2 cell (E), GFP fluorescence was found in the host cell cytoplasm and in the merozoites.Characterization of the PbICP-GFP-expressing liver stage parasites. (A-E) Live imaging of PbICP-GFP-expressing liver stage parasites confirmed the PbICP localization determined by the antisera-based analysis. HepG2 cells were incubated with PbICP-GFP-expressing (3.78 MB PDF)Click here for additional data file.Figure S12P. berghei show slightly enhanced infection efficiency. HepG2 cells were infected with transgenic PbICP-GFP sporozoites or GFPcon sporozoites as a control, incubated for 1 h, subsequently fixed without permeabilization and stained with an anti-CSP antiserum (inside/outside assay). Extracellular but not intracellular sporozoites were labeled by the anti-CSP antiserum. Intracellular sporozoites are only positive for GFP expression. Sporozoites were counted and the percentages of free and intracellular sporozoites were calculated. Presented are the means and standard deviations of three independent experiments.PbICP-GFP-expressing (0.09 MB PDF)Click here for additional data file.Figure S13PbICP-GFP expressing parasites do not differ in their intrahepatic development from mCherry-expressing parasites. HepG2 cells were infected with transgenic PbICP-GFP sporozoites or mCherry-expressing sporozoites. Parasite size was determined over the course of development in HepG2 cells using the density slice module of the OpenLab 5.03 software. Size was measured at 24, 48 and 63 hpi by live imaging. Since mCherry expression is restricted to the parasite cytosol but PbICP-GFP is also translocated into the PV, PbICP-GFP-expressing parasites appear slightly bigger (upper panel). To analyze this observation in more detail, infected cells were fixed and stained with an anti-Exp1 antiserum, which labels the PVM of both parasite strains (lower panel). In contrast to the live imaging, this experiment revealed that mCherry parasites are slightly bigger confirming that PbICP-GFP is secreted into the PV.(0.38 MB PDF)Click here for additional data file.Figure S14PbICP-C expression protects HepG2 cells against host cell death (camptothecin treatment). (A) HepG2 cells were transiently transfected with a plasmid leading to cytosolic expression of GFP-tagged PbICP-C (upper panel) or with a GFP control plasmid (lower panel). Subsequently host cell death was induced by camptothecin treatment for 24 h and analyzed by live imaging of intact mitochondria by TMRE (red) and DNA by Hoechst (blue). Dying cells exhibited condensed chromatin in the nucleus and a loss of mitochondrial membrane potential. (B) Fluorescent cells were counted and the percentages of dead and viable cells were calculated. Cells expressing GFP-PbICP-C showed significantly better survival upon camptothecin-induced cell death in comparison to GFP-expressing cells.(1.28 MB PDF)Click here for additional data file.

The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population.The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses.env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification.18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic. Human immunodeficiency virus type 1 (HIV-1) shows an extensive genetic variability and can be classified into 9 phylogenetic subtypes (A-K), which are approximately equidistant from one another, and several circulating recombinant forms (CRFs), resulting from recombination events occurring between different HIV-1 subtypes co-circulating in a specific geographic region .-37.35-37The p17 region of the B clade isolates shows a low amino-acidic variability and the consensus derived from the alignment shows an overall rate of amino acid conservation of 44.44% (36 of 81 residues). None of the observed amino acid changes is found in gag residues conferring drug resistance Figure . Similarenv and gag gene have been amplified from uncultured PBMCs of Italian samples by the standardized nested PCR conditions.A molecular and phylogenetic characterization was performed on HIV-1 variants identified in individuals residing in Italy and infected in the 1995–2005 period. The groups at high risk of HIV-1 infection were equally represented in the present study. The C2-V5 and p17 regions of the gag and env genes have been studied in parallel, to have an immediate picture of the evolution pattern in viral regions under different immune pressure and to identify possible intra-genomic recombinants. In fact, considering the worldwide represented CRFs described until now, the p17 gag and the C2-V3 env regions show a different subtype designation in most of cases and are highly diagnostic for the identification of novel recombinants.Informative regions of the 2 structural env gene compared to gag.The average nucleotide divergences versus standard sequences of different subtypes suggest the presence of B and non-B subtypes among the Italian sequences identified in the present study. Moreover, within the B subtype sequences, the average divergence in the env C2-V3 region is 18.08%, with values ranging from 7.1 to 29.9%. On the contrary, the average divergence in the gag p17 region is 11.13%, with values ranging from 7.79 to 16.86%. These observed divergence values are compatible with samples identified in a geographical area characterized by a long-lasting HIV epidemic and confirm the more pronounced genetic evolution of gag and env sub-genomic regions, suggesting the absence of intra-genomic recombination events.The phylogenetic analysis confirmed the nucleotide divergence subtype prediction for both B and non-B-subtype classification; in particular, of the 3 non-B isolates, 2 cluster with CRF02-AG (NA05.05 and PR06.07), 1 with the C subtype (PR06.03). Moreover, for all the B- and non-B-subtype sequences, the phylogenetic classification matches in the The phenetic analysis of the V3 region shows a significant amino acid stability in 9 residues of the V3 loop, for B-subtype isolates, confirming the strong selection for specific sequences involved in strategic functions regarding the immune response as well as cellular tropism and transmission. The different HIV-1 isolates identified in the current study show the subtype-specific tetrameric sequence at the apex of the V3 loop , which is considered the target for the anti-V3 neutralizing antibodies. However, less-represented sequences have been identified at the tip of the B clade isolates , suggesting a constant diversification in this clade.The overall results suggest that the B subtype is still largely predominant in the HIV-1 epidemic in Italy and is circulating among all risk groups. On the contrary, HIV-1 non-B subtypes in Italy are strictly associated with the heterosexual transmission and are identified in infections acquired in the last period (2001–2005). The three non-B-subtype HIV-1 isolates are strictly associated with heterosexual transmission. The samples PR06.03 and PR06.07, corresponding to an Ethiopian and a Nigerian subject respectively, belong to the subtype/CRF predominant in their respective Country of origin, suggesting an infection either prior to the immigration to Italy or subsequent but through heterosexual contacts with HIV-infected subjects from those Countries. The sample NA05.05, on the contrary, corresponds to an Italian-born subject with a possible partner/s from Regions with high endemicity for HIV infections.These results confirm that in Italy, as in other Western European countries, non-B subtypes or recombinant forms are introduced by immigrants/migrants and transmitted at a low rate to the indigenous population. This would also explain the lower prevalence of non-B subtypes in Italy compared with other European countries with an older tradition of immigration waves and much tighter historic and economic links with African countries.The presented data are representative of a nationwide molecular survey and, regardless the small sample size, are part of recurrent studies giving a constant updated picture of the genetic evolution of the HIV-1 epidemics in different risk groups in Italy.The authors declare that they have no competing interests.LB supervised the molecular and phylogenetic analysis and wrote the paper; AP and MT conducted molecular and phylogenetic analysis; FV and MCR enrolled patients and collected samples in Bologna; EP and CC enrolled patients and collected samples in Parma; CS and OP enrolled patients and collected samples in Naples; MLT contributed to the phylogenetic analysis and to writing the paper; FMB supervised the whole project. All authors read and approved the final manuscript.

Stylophora pistillata were lopped of three different genets, their skeletons marked with alizarin red-S, and divided haphazardly into three morphometric treatment groups: (I) upright position; (II) horizontal position, intact tip; and (III) horizontal position, cut tip. After 1 y of in-situ growth, the 45 surviving ramets were brought to the laboratory, their tissues removed and their architectures analyzed by 22 morphological parameters (MPs). We found that within 1 y, isolated branches developed into small coral colonies by growing new branches from all branch termini, in all directions. No architectural dissimilarity was assigned among the three studied genets of treatment I colonies. However, a major architectural disparity between treatment I colonies and colonies of treatments II and III was documented as the development of mirror structures from both sides of treatments II and III settings as compared to tip-borne architectures in treatment I colonies. We did not observe apical dominance since fragments grew equally from all branch sides without documented dominant polarity along branch axis. In treatment II colonies, no MP for new branches originating either from tips or from branch bases differed significantly. In treatment III colonies, growth from the cut tip areas was significantly lower compared to the base, again, suggesting lack of apical dominance in this species. Changes in branch polarity revealed genet associated plasticity, which in one of the studied genets, led to enhanced growth. Different genets exhibited canalization flexibility of growth patterns towards either lateral growth, or branch axis extension . This study revealed that colony astogeny in S. pistillata is a regulated process expressed through programmed events and not directly related to simple energy trade-off principles or to environmental conditions, and that branch polarity and apical dominance do not dictate colony astogeny. Therefore, plasticity and astogenic disparities encompass a diversity of genetic (fixed and flexible) induced responses.The high morphological resemblance between branching corals and trees, can lead to comparative studies on pattern formation traits, best exemplified in plants and in some cnidarians. Here, 81 branches of similar size of the hermatypic coral In multicellular organisms, the level of integration among bodily components dictates the final functional performance of the entire organism A further challenging topic is the study of organisms' architectures, made of multiple genetically identical modules, at several levels of organization, which are physiologically and structurally integrated Pseudopterogorgia bipinnata, Sànchez and Lasker In various modular organisms, including plants In branching corals, architectural characteristics can be deduced from traits at three hierarchical levels of organization, the individual polyps Stylophora pistillataS. pistillata, characterized by a continuum of architectural design with several distinct stages. Each stage was marked by its own characteristic morphometric parameters. We presupposed S. pistillata. Special attention is given to whether apical dominance and branch orientation are important in ruling colonial architectures of branching-corals'.To elucidate further the rules that govern colony development in branching forms, we studied plasticity of colony astogeny and branch to colony trajectories in the Indo-Pacific branching coral in situ growth, 45 of the 81 fragments (55.6%) survived and developed into colonies of various shapes. These included 15 colonies from treatment I , 14 colonies from treatment II and 16 colonies from treatment III . Upon collection, each colony was dried, measured, and photographed from all angles and 22 morphometric parameters (MPs) were taken , treatment II (42±14%) and treatment III (23±3%) differed significantly from each other as compare to genotype H (6.01±1.04gr) and J between tips or bases of the two polarity manipulated treatments (II compared to III); and (2) between tip (either intact or cut-off) and base of the same branch. Five most relevant MPs for this comparisons were chosen: (1) nB ; (2) %nB (percentage of branches developed from tip (TBB) or from base (BBB) of the total number of branches in the colony); (3) TBL ; (4) EV ; and (5) %Nx, the number of branches from orders 2 to 4 as part of the total number of branches .Comparisons between the treatments revealed no significant differences in any tested MPs between treatments II and III for all the genets.3) compared to the base revealed no significant differences between all five MPs studied in genets H and I to coral colony astogeny and to address the possible existence of apical dominance, a well-documented phenomenon in the plant world, in shaping coral architectures. Results of this, and earlier studies on the branching coral Stylophora pistillata ramets, grown from similar size branches, and sub-cloned from three different coral genets. Ramets were haphazardly divided into three morphometric settings or treatment II colonies , genotype-based differences emerged in treatments III . We found that altering branch orientation, in addition of trimming the branch tip (upper 0.5 cm), triggered species-specific and colony-specific architectural reactions. Genotype H exhibited an increase in percentage of down-facing branches (%DGB) as compared to the other two genotypes, genotype I gained more weight (W1) as compared to the other genotypes and genotype J showed an increase in percentage of branch order 2 (%N2) as compared to the other two genotypes. Other MPs, where differences were not yet resulted in significant values (because of high variation in the results) and were noticeable to the eye, were the developed total number of branches (nB) and ecological volume (EV). Genotype H showed 19% and 15% increase in total number of branches when comparing treatment I to II and I to III, respectively, and 45% and 7% in ecological volume, respectively. Genotype I exhibited increases of 115% and 143% in total number of branches when comparing treatment I to II and I to III, respectively, and 123% and 186% in ecological volume, respectively. Genotype J displayed 44% and 17% increase in nB, respectively, 27 and 32% and 39% in EV, respectively. As stated, these values however, were not significantly different from each other's.S. pistillata mode of astogeny S. pistillata branching system, as in the case of the soft coral Nephthea sp., where cutting the terminal polyps in young colonies did not change the way the colony developed While the traditional test for apical dominance in plants entails removal of the apical bud and measuring the effects on the dormant buds lower on the branch Stylophora settings II and III in the present study, Acropora branches developed terminal polyps at both sides of the branch. However, while in the Acropora treatment Stylophora treatment did not show any phototropism impact as new branches initiated up and down trajectories, without obvious preference for light.The impacts of branch orientation and polarity on morphometric parameters regulating colonial astogeny was revealed earlier by Kawaguti Stylophora species-specific colonial astogeny from vertical oriented branches, most new branch initiations developed along the branch.Changing branch orientation affected the way morphology developed, the complexity of the branching system (represented by numbers of branch generations), and the growth of new branches from branch tip or along the branch. When the initial branch orientation changed from horizontal to vertical, the percentage of high order of branches (N2 compare to N3 or N4) was higher than that of the horizontal branch. Altering the orientation of the branch from vertical to horizontal might result in shifting energy (evident by developing of new branches) from the original branch tip area (intact or cut-tip branch) to the opposite branch end, the base. It is of major interest to note that new branches developed from both tip ends rather than from the whole length of the branch, resembling induced positional information Stylophora pistillata is highly regulated as in whole colony scenarios Acropora millepora and Pocillopora damicornisAstogeny of cut branch in Stylophora pistillata, Meroz et al. It is evident that coral colonies, isolated branches, and spat not only ‘sense’ environmental cues but also ‘discern’ their special position. Working on two branching coral species, including Stylophora pistillata , were carefully detached from the substrates by chisel and hammer. Each colony represented only a single genet, as colonial fragments of this species in Eilat do not resume development in situ in clear plastic bags with alizarin Red S solution sinTwenty-two morphometric parameters MPs; were meaFirst step in the analysis carried out “Pearson Correlation”, in order to remove parameters that are related (p>0.9), therefore do not add information to the analysis. The second step of the analysis was to elucidate those MPs that provide the best discrimination between the groups, using Discriminant Analysis test. This analysis was preformed initially within each genotype between treatments and than, on each treatment between genotypes and for each test, three to four most discriminating MPs were chosen. Following that, an ANOVA was performed on the selected MPs checking for significance of differences, first in each genotype between treatments and than, in each treatment between genotypes. The level of significant was calculated using Bonferoni correction to avoid type I error. In the ANOVA tests, the preliminary assumption was the existence of homogeneity of variance and not normal distribution

Carbohydrates are considered the third class of information-encoding biological macromolecules. “Glycomics,” the scientific attempt to characterize and study carbohydrates, is a rapidly emerging branch of science, for which informatics is just beginning. Glycomics requires sophisticated algorithmic approaches. Several algorithms and models have been developed for glycobiology research in the past several years. This tutorial will provide a brief introduction to the field of glycome informatics, which will include a primer on glycobiology as well as descriptions of the algorithms and models that have been developed in this field.The four essential molecular building blocks of cells are nucleic acids, proteins, lipids, and carbohydrates, often referred to as glycans. Nucleotide and protein sequences are at the heart of nearly all bioinformatics applications and research, whereas glycan and lipid structures have been widely neglected in bioinformatics. However, glycans are the most abundant and structurally diverse biopolymers formed in nature. Bound to proteins, as glycoproteins, they are known to affect the functions of proteins. More than half of all protein sequences deposited in the SWISS-PROT databank include potential glycosylation sites and thus may be glycoproteins. Based on an analysis of well-annotated and characterized glycoproteins in SWISS-PROT, it was concluded that more than half of all proteins are glycosylated The development and use of informatics tools and databases for glycobiology and glycomics research has increased considerably in recent years. However, the general development in this field can still be considered as being in its infancy when compared to the genomics and proteomics areas. In terms of bioinformatics in glycobiology, there are several paths of research that are currently in progress. The development of algorithms to reliably support the characterization of glycan structures for high-throughput applications is the most immediate demand of the glycomics community. Additionally, several major glyco-related projects and lipids . Glycoproteins are usually on the cell surface, where they are recognized by bacteria, viruses, and other proteins, such as lectins, in order to facilitate various crucial functions. It is also known that glycans are involved in a variety of biological processes including protein folding and signalling events.The complex structure of glycans has been a bottleneck in the structure determination and thus data accumulation of glycan structures. This is confounded by the complex biosynthetic pathways of glycans. It is known that glycan-specific diseases called CDGs are caused by defects in these pathways Complex carbohydrates are composed of monosaccharides that are covalently linked by glycosidic bonds, either in the α or β form. Unlike DNA and proteins, however, monosaccharides may be linked to one or more other monosaccharides, such that they form a branched tree structure. In order to formulate a standardized notation for glycans, the Consortium for Functional Glycomics (CFG) proposed a standard symbolic representation for those monosaccharides that are found most in nature, which has been employed in Carbohydrates are most classically drawn as a tree in a two-dimensional plane, with the root monosaccharide placed at the right-most position and children branching out toward the left. Each node represents a monosaccharide, and each edge represents a glycosidic linkage, which includes the carbon numbers that are bound and the conformation. An example of an N-linked glycan is given in f for furanose or p for pyranose. The carbon numbers that link the two monosaccharide units are given in parentheses between the symbols separated by an arrow. For example, the structure in pNAc-(1→4)-[β-D-GlcpNAc-(1→2)-α-D-Manp-(1→3)][α-D-Manp-(1→3)-[α-D-Manp-(1→6)]-α-D-Man-(1→6)]-β-D-Manp-(1→4)-β-D-GlcpNAc-(1→4)-β-D-GlcpNAc. In such a way, long carbohydrate sequences can be adequately described in abbreviated form using a sequence of letters.Although the two-dimensional notation is nice and pretty, it is not suitable for storage in a database, let alone for bioinformatic analysis. The IUPAC–IUBMB has specified the “Nomenclature of Carbohydrates” to uniquely describe complex oligosaccharides based on a three-letter code to represent monosaccharides . Each monosaccharide code is preceded by the anomeric descriptor and the configuration symbol. The ring size is indicated by an italic However, as we discuss in the next section, it is not always possible to obtain a full and exact representation of carbohydrates due to the difficulties in sequencing them. Currently, the most popular method for complex carbohydrate sequencing is mass spectroscopy (MS). However, this process is often incomplete and error-prone. For example, unless one uses MS in tandem it is nearly impossible to distinguish between isomeric monosaccharides . As any spectrometrist will state, MS in tandem is a rather tedious process, even for one carbohydrate structure. Thus, for those developing databases, the notation for carbohydrates must be flexible enough to capture all the data at hand but also be able to account for ambiguities.There are currently in use several different notations for carbohydrates, which developed out of the construction of some major databases during a time when no standard notation for carbohydrates existed. Briefly, these notations are KEGG Chemical Function (KCF) format, which represents glycans using a connected graph, LINUCS (Linear Notation for Unique Description of Carbohydrate Sequences), which provides a unique and linear notation for glycans, and Linear Code by GlycoMinds, which provides a commercial complex carbohydrate database As of the time of this writing, there are three major databases for complex carbohydrates, Glycosciences.de, KEGG GLYCAN, and the database developed by the Consortium for Functional Glycomics (CFG). All three databases are based on the CarbBank database developed in the 1990s by the Complex Carbohydrate Research Center (CCRC) at the University of Georgia The major issue that was facing the glyco-informatics community was the fact that each of these databases represented their glycan structures in different formats. Glycosciencse.de uses the LINUCS format, KEGG the KEGG Chemical Function (KCF) format, and CFG the IUPAC format. In September 2006, a workshop was held at the National Institutes of Health (NIH), United States, where glycobiologists and glyco-informaticians gathered to discuss a standard exchange format for carbohydrate structures. At this meeting, the GLYDE-II XML format for glycans and glycoconjugates, developed by the CCRC, was agreed upon as the standard format for exchanging carbohydrate data Along with the development of these glycan databases over the past few years, bioinformatic methods for analyzing glycan structures have also appeared. In general, these can be classified into the following six categories: glycosylation analysis, glycomics, glycan biomarker prediction, glycan structure analysis, glyco-gene expression analysis, and glycan structure mining.In the area of research in the first three categories of glycosylation analysis, glycomics and glycan biomarker prediction may be of most interest to biologists, whereas the latter are (currently) active areas of research in the informatics community. Thus, the literature is rich in research in the former areas, and it is hoped that the latter areas will be able to develop and produce more interesting results as these technologies advance. In any case, these areas are all covered equally in this section.Since the methods in this section have been summarized nicely in two previous reviews As one form of post-translational modification, glycosylation affects the function of the modified protein. Thus, many methods have been developed to predict glycosylation sites based on the amino acid sequence. These methods have been summarized in The statistical analysis of amino acids surrounding glycosylation binding sites has been an active area of research by the German Cancer Research Center. One of their tools called GlySeq In addition to analyzing the surround sequence, a tool called GlyVicinity performs a statistical analysis of a PDB entry by computing the frequency of amino acids within a user-definable distance up to 10 Å of carbohydrate residues. This tool performs on top of the data in GlyVicinityDB, which contains distance information of the amino acids in the spatial vicinity of carbohydrate residues in PDB entries In other work at Johns Hopkins University, a model to mathematically formulate N-glycosylation was developed The field of glycomics can be defined as the technology to determine carbohydrate sequences (structures) using mass spectral data. This area of research has been the most desired by the glycobiology community due to the tedious process traditionally being used to characterize glycans and glycoproteins. In particular, each mass peak was manually annotated by experts, resulting in months of analysis for one mass spectrum.This problem was conventionally solved by developing a database of theoretical mass spectra corresponding to known glycan structures. Thus newly produced MS data could be compared with the theoretical spectra to find the most similar one, thus providing a clue as to the structures behind the new spectra More recently, as a result of the large volumes of MS data being produced by the CFG, the Cartoonist program was developed to automatically annotate N-glycans in MALDI-MS data In an attempt to predict any type of glycan structure from mass spectra, the GLYCH method was developed to use a dynamic programming method and a listing of all possible fragment types of glycans Learning with Kernels by Scholkopf and Smola Many glycan motifs are known to be involved in a variety of diseases including cancer q-gram distribution kernel In glycome informatics, the layered-trimer kernel was first developed and used to verify the utility of using kernels for glycan biomarker prediction Taking advantage of the fact that the glycan substructures at the leaves are more prone to be recognized compared to the root structures attached to proteins, a weighting scheme was employed that differentiated substructures based on their “depth” or the “layer” of the substructure, the number of glycosidic linkages between the substructure and the root. Furthermore, it is known that glycosyltransferases interact with three monosaccharides on average. Thus, glycan structures were decomposed into trimers. This produced a feature vector of trimers distinguished by layer, which was tested using a dataset of glycans related to different blood components as well as to leukemic cells. These annotations were retrieved from the original CarbBank database.X and Y, their inner product is calculated as Σkxkykw, where k is a feature, and so the summation is taken over all features. The weighting parameter kw is set to 1 when the layer of feature k is 1. Otherwise, kw = 1−exp(−αh), where α is a positive constant to weight h, the layer of the matching substructures.The kernel was defined using a weighting parameter for the layer of each glycan substructure, according to the following equation. Given the feature vectors for two glycans Using this kernel on the leukemia dataset described above, the model was able to extract a feature that was highly characteristic of leukemia, which was corroborated by experimental evidence.q-gram distribution kernel could predict leukemia markers as equally well as the previous model, and, in addition, it found that sulfation was a major marker for cystic fibrosis, which is smaller than a trimer. Thus, a more flexible kernel was developed.This method extended the layered-trimer kernel in order to account for potential glycan biomarkers that were smaller or larger than trimers, without the use of layers, since it was assumed that layer information could be subsumed by the wider distribution of features. As a result, the q-gram distribution kernel, a hierarchical model was developed, where a kernel for each q was first developed, upon which another kernel was trained to extract the best feature from the best kernel. This model was again shown to produce similar results to the original layered-trimer kernel.Finally, to more efficiently handle the large number of features required by the The tree structure of glycans has been a topic of interest especially for bioinformaticians interested in trees. Traditionally, RNA structures and phylogenetic analyses have been the focus of tree-based algorithms. However, these structures result in trees with information at the leaves, with internal nodes representing relationships between the leaves. Thus, glycans have provided a structure where internal and external nodes all represent the same type of object: monosaccharides. As a result, glycan structure alignment using tree alignment algorithms and glycosidic linkage score matrices has been developed and analyzed.M is the mapping between the children of u and v, and sons(x) is the set of children of node x, and w is the similarity score between nodes u and v, which can be defined by a weighting between the matches of the monosaccharide type and the glycosidic linkage between the monosaccharide and its parent (which is null at the root). Considering the fact that gaps really are not expected to appear often in meaningful glycan structure alignments, the gap penalty d may be set to a very large value to penalize gaps more heavily.The first application of tree-structure alignment using dynamic programming applied to glycans was the algorithm called KEGG Carbohydrate Matcher, or KCaM This algorithm may now be used to analyze monosaccharide similarity, as in amino acid similarity, as represented by amino acid substitution matrices such as PAM Once the appropriate classes of glycans are defined, the KCaM alignment results can be used to calculate the frequency of alignment of glycosidic linkages, which includes the full linkage information (carbon numbers and conformation), as well as the two monosaccharide names which are linked . This score matrix of links is thus the log odds score of the expected frequency of alignment of link pairs In an attempt to overcome one of the major issues in glycomics, glycan structure characterization through MS, a bioinformatic method to predict glycan structures in a particular cell through the gene expression profiles was developed This method was further improved such that (i) the database of glycans were augmented with new glycans that should exist and (ii) the prediction score for glycans used the expression values directly as opposed to using binary values. The first step was performed by analyzing the database of glycans and finding those that differed by more than one link. That is, considering the fact that glycosyltransferases typically catalyze only one link at a time, if two similar glycans in the database existed, but differed by say two to four links, then “intermediate” glycans that should be catalyzed in the process of synthesizing the larger structure should also exist, and these “intermediate” glycans are added to the database. Lectins are known to recognize specific glycan structures, whose binding events trigger signalling processes to occur. However, oftentimes the specific structures being recognized are unknown. For example, siglecs are suspected to recognize patterns not only at the leaves of glycans but also further deeper in the chain In order to retrieve the learned patterns directly from the model, a profile version of these models, called ProfilePSTMM, was subsequently developed to add insertion and deletion states in addition to the original match state. This model was tested on binding affinity data of galectins, which are known to recognize galactose residues, but had not been analyzed for longer patterns. In this experiment, a dimer structure was found to appear highly in the data, which was corroborated by experimental results This tutorial briefly described several different bioinformatic methods for glycome research. With the further development of data resources and standards for data exchange, we hope that even better and newer methods to help understand the functioning of the glycome can be developed.

Although a recently introduced live attenuated vaccine has proven to be effective, AHF remains a potentially lethal infection. Like in other viral hemorrhagic fevers (VHF), AHF patients present with fever and hemorrhagic complications. Although the causes of the bleeding are poorly understood, impaired hemostasis, endothelial cell dysfunction and low platelet counts have been described. Thrombocytopenia is a common feature in VHF syndromes, and it is a major sign for its diagnosis. However, the underlying pathogenic mechanism has not yet been elucidated. We hypothesized that thrombocytopenia results from a viral-triggered alteration of the megakaryo/thrombopoiesis process. Therefore, we evaluated the impact of JUNV on megakaryopoiesis using an in vitro model of human CD34+ cells stimulated with thrombopoietin. Our results showed that CD34+ cells are infected with JUNV in a restricted fashion. Infection was transferrin receptor 1 (TfR1)-dependent and the surface expression of TfR1 was higher in infected cultures, suggesting a novel arenaviral dissemination strategy in hematopoietic progenitor cells. Although proliferation, survival, and commitment in JUNV-infected cultures were normal, viral infection impaired thrombopoiesis by decreasing in vitro proplatelet formation, platelet release, and P-selectin externalization via a bystander effect. The decrease in platelet release was also TfR1-dependent, mimicked by poly(I:C), and type I interferon (IFN α/β) was implicated as a key paracrine mediator. Among the relevant molecules studied, only the transcription factor NF-E2 showed a moderate decrease in expression in megakaryocytes from either infected cultures or after type I IFN treatment. Moreover, type I IFN-treated megakaryocytes presented ultrastructural abnormalities resembling the reported thrombocytopenic NF-E2−/− mouse phenotype. Our study introduces a potential mechanism for thrombocytopenia in VHF and other diseases associated with increased bone marrow type I IFN levels.Argentine hemorrhagic fever (AHF) is an endemo-epidemic disease caused by Junín virus (JUNV), a member of the in vitro model of platelet production. We found that neither infection of hematopoietic progenitors with JUNV nor poly(I:C) affected cell survival or megakaryocyte generation. However, these treatments triggered the main anti-viral cytokines produced by host type I IFN (IFN α/β), which acted in a paracrine fashion and led to abnormal platelet formation. Thus, this study identifies type I IFN as a new regulator that selectively affects the last steps of megakaryocyte lifespan, and it suggests a potential mechanism for thrombocytopenia in AHF and other diseases associated with increased bone marrow type I IFN levels.Argentine hemorrhagic fever (AHF) is an endemo-epidemic disease caused by Junín virus (JUNV). Although a recently introduced live attenuated vaccine has proven to be effective, AHF remains a potentially lethal infection and JUNV is considered to be a potential biological weapon. Like other viral hemorrhagic fevers (VHF), AHF patients present fever with a combination of neurological and bleeding complications. Although the causes of the bleeding are poorly understood, impaired hemostasis and endothelial cell function as well as low platelet counts have been described. In this study, we have examined the impact of JUNV on an Arenaviridae, Bunyaviridae, Filoviridae, and Flaviviridae viral families Viral hemorrhagic fever (VHF) is an acute systemic febrile syndrome caused by a diverse group of RNA viruses from the Callithrix jacchusRhesus macaquesWe hypothesized that the thrombocytopenia observed in VHF is the result of a viral-triggered alteration of the megakaryo/thrombopoiesis process. Support for this hypothesis comes from studies of experimental murine lymphocytic choriomeningitis virus (LCMV) infection showing an association between thrombocytopenia and reduced megakaryocyte number at the bone marrow level Arenaviridae family. Although a recently introduced live attenuated vaccine has proven to be effective, AHF remains a potentially lethal infection and JUNV is considered to be a potential biological weapon AHF is an endemo-epidemic disease caused by JUNV, a member of the + cells are infected by JUNV. Furthermore, we have identified selective inhibition of platelet release involving transferrin receptor 1 (TfR1) and type I IFN (IFN α/β) as paracrine mediators.In this study, we evaluated whether the different megakaryopoiesi/thrombopoiesis stages are affected by JUNV infection of hematopoietic progenitor cells. Our results showed that human CD34in vitro model of human CD34+ cells stimulated with thrombopoietin (TPO). Under our culture conditions, TPO stimulation promoted proliferation, an increase in cell size and CD41 expression and a decrease in CD34 expression , megakaryocyte differentiation (CD41+) nor the clonogenic ability of megakaryocyte progenitors. Surprisingly, JUNV infection induced a significant decrease in both proplatelet formation . In contrast, P-selectin externalization was significantly reduced in platelets derived from JUNV-infected cultures .+ cells were susceptible to JUNV infection. At ten days post-infection (p.i.), RNA from JUNV-inoculated CD34+ cells displayed a fragment of the viral genome, while RNA from cultures exposed to the UV-irradiated JUNV strain did not. Immunofluorescence and flow cytometric studies revealed that 4.1±0.2 and 4.9±0.5% of the cells were infected, respectively against TfR1, neither viral antigens nor the inhibitory effect of JUNV on the number of platelets generated were observed . These results suggest that the reduction in platelet release could be a more generalized effect and may not be restricted to JUNV infection.Because the number of infected cells was low and only a few were positively identified as megakaryocytes, it was reasonable to consider that the decrease in platelet release was most likely the result of a bystander cell effect rather than a direct effect of JUNV on megakaryocytes. Thus, to further study the biological effects of viral infection on platelet release, we analyzed the effect of poly(I:C), which mimics the double-stranded RNA (dsRNA) product from the replicative cycle of most viruses in vitro and in vivoin vitro system. While UV-irradiated JUNV-infected-CD34+ cell cultures stimulated by TPO did not express IFN β mRNA, increasing expression over time was observed in JUNV-infected cultures (Because poly(I:C) is a potent inducer of IFN β release cultures . Accordicultures . Howevercultures without cultures . To the cultures .+ cells with IFN α mimicked the results obtained with IFN β (data not shown). These results were not surprising bearing in mind that both IFNs are ligands for the same receptor in vitro.Because another general feature of the cells' response to viral infection is an increase in IFN α production, as a downstream product of the IFN β pathway, this molecule was also studied. Stimulation of CD34in vivo studies showed that megakaryocytes from type I IFN receptor knockout mice are more susceptible to LCMV infection Considering that Although the signaling pathways regulating thrombopoiesis are still under study, Src kinases and several transcription factors have been shown to be involved as regulators of this process To examine the levels of relevant factors involved in megakaryo/thrombopoiesis, we performed a semi-quantitative RT-PCR assay. We found that the mRNAs of SOCS-1, SOCS-3 and GATA-1, three molecules involved in the initial steps of megakaryocyte development Having demonstrated that JUNV infection triggers the production of type I IFN and impairs platelet formation, in the next experiments we examined whether type I IFN was capable of regulating the expression of NF-E2. The results showed that like viral infection, the exposure of purified megakaryocytes to IFN β or α , human herpesvirus 6 and human cytomegalovirus negatively affected the survival, differentiation and/or maturation of megakaryocyte progenitors Previous studies of the effect of viral infection on megakaryocytes derived from CD34+ cells significantly reduced both JUNV replication as well as the decrease in platelet formation induced by JUNV infection, indicating that viral infection is a necessary event for the inhibition of platelet formation. Moreover, the fact that UV-irradiated virus had no effect on proplatelet production and platelet release indicates that viral replication is also necessary to hinder thrombopoiesis. These data also implicate TfR1 as the main route of viral entry into hematopoietic progenitor cells. This is particularly relevant considering that it has recently been shown that pathogenic strains can use TfR1-dependent or independent pathways + cells could represent a viral dissemination strategy at least in hematopoietic bone marrow cells. However, in vivo experiments will be required to determine its relevance.It has recently been demonstrated that TfR1 is the receptor for some new world arenaviruses, including JUNV Remarkably, we found that only 5% of total cells were infected, therefore the observed 50% reduction in platelet production appeared to be due to a selective bystander effect from infected cells rather than a direct effect of viral replication on megakaryocyte biology. Moreover, poly(I:C), a synthetic analogue of the dsRNA associated with the replicative cycle of most viruses Surprisingly, despite the low number of infected cells, only few were megakaryocytes. Although we have not yet determined the identity of the vWF negative-infected cells, they could be megakaryocytes with low vWF content because it has been recently shown that treatment of megakaryocytes with IFN α inhibited 70% of vWF RNA expression In vivo, JUNV may infect other cells in the bone marrow environment, and CD34+ progenitor cells may be exposed to higher levels of type I IFN than produced in our in vitro system. Interestingly, we found that while low IFN β concentrations selectively impaired thrombopoiesis, treatment of CD34+ cells with higher concentrations also reduced megakaryocyte numbers without modifying the apoptosis rate, suggesting an IFN β-mediated cell cycle arrest. Remarkably, both phenomena were independently described by different groups using recombinant IFN α: while Wang et al. demonstrated that IFN α hinders mouse megakaryopoiesis altering proliferation and ploidy et al. found that IFN α decreases platelet production without altering megakaryocyte growth −/− mice have no circulating platelets and their megakaryocytes present ultrastructural abnormalities that are quite similar to those of our type I IFN-exposed megakaryocytes Our analysis of the signaling pathways involved in the JUNV-mediated inhibition of platelet production indicated that SOCS-1, SOCS-3, GATA-1, and Src, which are involved in the processes of proliferation, differentiation, and proplatelet formation, respectively et al. revealed that mice infected with LCMV exhibit a type I IFN-dependent platelet dysfunction that, if associated with thrombocytopenia below a critical threshold, results in severe bleeding and acute anemia As regarding type I IFN's effect on platelet function, elegant studies from Iannacone in vivo data support our hypothesis regarding the critical role of IFN I in the thrombocytopenia present in VHF patients? High levels of circulating IFN a that correlate with virulence and prognosis has been described in different VHF Do the In conclusion, we provide the first evidence linking viral infection of human hematopoietic progenitors with selective inhibition of thrombopoiesis through the type I IFN pathway. Our studies highlight a potential mechanism that leads to thrombocytopenia and bleeding in AHF and other diseases as a result of an increase in the levels of type I IFN in the bone marrow milieu. These data should be of use in the effort to find new therapeutic strategies for the thrombocytopenia that is associated with VHF.This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the Institutional Review Board of the National Academy of Medicine, Buenos Aires, Argentina. All patients provided written informed consent for the collection of samples and subsequent analysis.2b and rabbit polyclonal anti-human IFN β neutralizing Ab were obtained from Pestka Biomedical Laboratories . Rabbit polyclonal IgG anti-NF-E2 Ab was purchased from Santa Cruz Biotechnology .Fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies (mAbs) against CD34, glycoprotein (GP) IIb (CD41), GP Ib (CD42b), P-selectin (CD62p), phycoerytrin (PE)-conjugated anti-GP IIIa (CD41), unconjugated anti-human HLA-ABC, anti-CD71 Abs, and a fixation/permeabilization kit (BD Cytofix/Cytoperm™) were purchased from BD Biosciences . FITC-conjugated anti-rabbit immunoglobulins (Igs) and anti-von Willebrand factor (vWF) Abs were obtained from Dako A/S . Cy3-conjugated anti-mouse Ig was obtained from Zymed . Recombinant human IFN αTrizol were from Invitrogen. The synthetic analog of dsRNA polyriboinosinic polyribocytidylic acid, poly(I:C) and recombinant human IFN β1a were obtained from InvivoGen . The Src family kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolopyrimidine (PP2) was obtained from Biomol International LP . Thrombopoietin (TPO) was obtained from Peprotech . All of the other reagents were obtained from Sigma Chemical Co. .Random hexamers, SuperScript III reverse transcriptase and + cells was performed as previously described + cells were purified using a magnetic cell-sorting system in accordance with the manufacturer's recommendations. After two Mini-MACS column separations, the purity of the cell suspension was determined by flow cytometry and typically ranged between 95 and 99%. Cell viability was greater than 90%. Fresh CD34+ cells were used for each experiment.Isolation of CD34+ cultures on day 12 using anti-CD41 magnetic beads (Miltenyi Biotec) following the manufacturer's instructions. The purity of the final cell suspension was ≥95% and cell viability was greater than 80%.Mature megakaryocytes were purified by immunomagnetic positive selection from TPO-stimulated CD34Monolayers of Vero-76 cells , Manassas, VA) were grown in minimum essential medium (MEM) containing 10% fetal calf serum (FCS) and antibiotics.Instituto Nacional de Enfermedades Virales Humanas “Dr. Julio I. Maiztegui”, Pergamino, Argentina. Virus stocks were grown, identified, and quantified as described previously by using the JUNV-susceptible Vero-76 cell line. Virulence was tested in three-week-old guinea pigs and the median lethal dose, (LD50), assayed between 11 and 14 days p.i., was ≤10 PFU. When required, virus was subjected to UV inactivation for 20 min using a 365 nm UV bulb positioned 5 cm over the stock A virulent strain of JUNV originally isolated from an AHF patient (P3441) was kindly provided by Dr. A. Ambrosio of the + cells (1×104) or a monolayer of Vero-76 cells were inoculated with JUNV at a multiplicity of infection (MOI) of one or the equivalent volume of UV-irradiated virus for 1 hr at 37°C. Mock-infected controls contained supernatants of Vero cells instead of JUNV. After washing, UV-irradiated JUNV-, JUNV- or mock-infected CD34+ cells were cultured in Iscove's Modified Dulbecco's Medium containing 2 mM glutamine, 5% human serum , 25 ng/ml TPO and antibiotics (growth medium) at 37°C in a humidified atmosphere with 5% CO2CD342+- and Mg2+-free), cytocentrifuged on silanized glasses, fixed with 1% paraformaldehyde (PFA) for 20 min and permeabilized with 0.1% Tween for 10 min. The slides were incubated overnight at 4°C with a pool of specific mAbs against JUNV Cells were washed with PBS .Negative controls were performed using uninfected cells or omitting primary Abs. JUNV-susceptible Vero cells were used as a positive control.+ cell cultures were measured by immunostaining with saturating concentrations of specific FITC-labeled mAbs or an isotype-matched control after varying numbers of days. After 30 min of incubation, the samples were fixed with 1% PFA and analyzed by flow cytometry.The levels of CD34, CD41 and CD42b in the TPO-stimulated CD34g, washed and fixed in 70% ethanol at −20°C overnight. Cells were then washed, resuspended in PBS, and incubated for 30 min at RT with saturating concentrations of FITC-conjugated anti-CD41 (or isotype control), 1 µg/ml propidium iodide, and 10 U/ml RNaseA. Cell ploidy was analyzed by flow cytometry.To evaluate megakaryocyte ploidy, cells were centrifuged for 10 min at 220×3 CD34+ cells were resuspended in collagen-based, serum-free medium containing 50 ng/ml TPO and seeded in double-chamber culture slides. After 12 days, megakaryocyte colonies were detected using an anti-CD41 antibody and an alkaline phosphatase detection system and were then counterstained with Evan's Blue. Two categories of colonies were identified: pure megakaryocyte colonies and mixed megakaryocyte colonies (distinguished by the presence of non-megakaryocyte cells within the same colony). Pure megakaryocyte colonies were scored according to their size: small CFU-megakaryocytes (3–20 cells), medium CFU- megakaryocytes (20–50 cells), and large CFU-megakaryocytes (>50 cells).Aliquots of 5×105 cells per well) and allowed to adhere for 4 hr at 37°C and 5% CO2. PPF was then evaluated by fluorescence microscopy by staining cells with TRITC-conjugated phalloidin. DAPI was used as a counterstain. Proplatelet-forming megakaryocytes were identified as large cells exhibiting long filamentous structures. The extent of PPF was calculated as the percentage of proplatelet-bearing cells by counting 500 cells per treatment.PPF was analyzed as previously described with some modifications + events with the same scatter properties as blood platelets.Platelets were counted using flow cytometry as previously described 2 to avoid platelet preactivation. The pellet was resuspended in modified Tyrode buffer and left to rest for 30 min at 37°C. The suspension was stimulated with 1 U/ml thrombin for 10 min at 37°C. After fixation, cells were stained with anti–P-selectin (CD62p)–FITC and anti-CD41-PE mAbs for 30 min and P-selectin expression was measured by flow cytometry using the characteristic forward and side scatter pattern of normal blood platelets treated similarly.P-selectin expression on platelets was determined as previously described with minor modifications + cell membranes, cells were incubated with a FITC-conjugated anti-CD71 or an isotype-matched control mAb at the indicated days p.i. Samples were washed, fixed, and analyzed by flow cytometry.To determine the level of TfR1 expression on TPO-stimulated CD34CD34-derived megakaryocytes were tested for NF-E2 expression using a double-labeling technique (NF-E2/CD41). Cells were immunostained with a PE-conjugated anti-CD41 mAb or an isotype-matched control and fixed with 1% PFA at 4°C. After washing with PBS containing 0.1% saponin, cells were incubated first for 30 min in the same buffer with anti-NF-E2 polyclonal Ab at 4°C and then with FITC-conjugated swine anti-rabbit Igs. Cells were analyzed by flow cytometry. Non-specific fluorescence was assessed using rabbit serum instead of primary Ab. In selected experiments, NF-E2 expression was determined in purified mature megakaryocytes treated with type I IFN using the anti-NF-E2 polyclonal Ab (or rabbit serum) followed by FITC-conjugated swine anti-rabbit Igs.Trizol as recommended by the manufacturer. cDNA was synthesized from 20 ng of total RNA using 15 mM of random hexamers and SuperScript III reverse transcriptase according to the manufacturer's instructions. The cDNA samples were diluted 10-fold, and the PCR reaction was conducted at the annealing temperature of 55°C. All reactions were confirmed to be within the linear range of amplification. The primer sequences and sizes of the amplified fragments are included in Total RNA was isolated from cell pellets using Megakaryocytes were fixed with 1.5% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, for eight hr. Cells were dehydrated through a series of alcohols, infiltrated with propylene oxide, and embedded in epoxy resin in an inverted beam capsule. Ultrathin sections were stained with uranyl acetate and lead citrate and examined with a Tecnai G2 Spirit BioTWIN transmission electron microscope at an accelerating voltage of 80 kV, and images were recorded with an AMT 2k CCD camera .t test was used to determine the significance of differences between means, and p values lower than 0.05 were considered to be statistically significant. When multiple groups were compared, one-way analysis of variance (ANOVA) followed by the Newman-Keuls procedure was used to determine significant differences between groups.All results are expressed as the means ± SEM. Student's paired

Substance-using women who exchange sex for money, drugs or shelter as a means of basic subsistence have remained largely at the periphery of HIV and harm reduction policies and services across Canadian cities. This is notwithstanding global evidence of the multiple harms faced by this population, including high rates of violence and poverty, and enhanced vulnerabilities to HIV transmission among women who smoke or inject drugs. In response, a participatory-action research project was developed in partnership with a local sex work agency to examine the HIV-related vulnerabilities, barriers to accessing care, and impact of current prevention and harm reduction strategies among women in survival sex work. This paper provides a brief background of the health and drug-related harms among substance-using women in survival sex work, and outlines the development and methodology of a community-based HIV prevention research project partnership. In doing so, we discuss some of the strengths and challenges of community-based HIV prevention research, as well as some key ethical considerations, in the context of street-level sex work in an urban setting. Substance-using women working in open street-level sex work markets face a myriad of health risks, including pervasive violence and assault, high rates of poverty and homelessness, drug-related harms, stigma, and social isolation -3. MortaOf particular concern, women who exchange sex for money, drugs, shelter, or other commodities as a means of basic subsistence have been shown to face an elevated risk of HIV transmission , increasIn Vancouver, Canada, a city drug policy response, known as the Four Pillars strategy, and several innovative harm reduction efforts have been shown to be highly successful in reducing the harms of drug users, including primary and secondary prevention, extensive fixed and mobile syringe exchange programs, a heroin maintenance trial and two supervised injection facilities ,25. Yet In an effort to respond to existing gaps in prevention and policy, a community-based HIV prevention research project was developed to investigate the health-related harms, service barriers, and impact of current harm reduction and prevention strategies among women working in survival sex work in Vancouver, Canada. This paper outlines the development and methodology of the Maka Project Partnership, and discusses some of the strengths and challenges of community-based HIV prevention research, as well as ethical considerations, in the context of survival sex work in an urban setting.An initial gap in service access, HIV prevention and harm reduction for survival sex workers was identified as a key issue through informal conversations between health providers, staff, and sex workers at an inner city drop-in centre. In operation since 1987, Women's Information Safe Haven (WISH) Drop-In Centre Society connects with an estimated 200 women engaged in survival sex work per night. While the mandate is not exclusive to Aboriginal women, over half of the women that come through its doors are of First Nations, Metis and Inuit ancestry. The project works closely with WISH's well-established Aboriginal Health and Safety Project for Women in the Sex Trade (AHIP), as well as other key Aboriginal and sex work collaborators.In 2004, researchers were approached to collaborate on an initial needs assessment of women attending the drop-in. The results led to the conception and design of both a research and a service arm . The serA key component of the project is capacity-building among a team of women in survival sex work, supported by an open Community Advisory Board (CAB), that inform all stages of the project. Initial CAB tasks were to identify the working role of the CAB and develop a hiring process for peer team of women. The hiring process aimed to ensure a transparent process, including extensive and flexible options for informing and inviting women to contact the project and the creation of a community-peer hiring panel (CAB members). Through this process, a team of women with a lived experience of survival sex work were hired, trained and support to play an active role in guiding, developing and conducting the research. These positions are low-threshold employment positions that work from a harm reduction perspective, similar to models of other sex work and drug-user groups. There is considerable focus on capacity building and training, as well as ongoing support and referral for addictions counselling, drug treatment, supportive housing, and child care. Extensive training modules were conducted in collaboration with local community agencies and sex work groups, including sex work specific training created and conducted by PACE Society on lateral oppression, vicarious trauma, debriefing and conflict resolution; participatory-action research principles, methodologies, ethics, and informed consent; and health, HIV/HCV prevention, and harm reduction conducted by community health providers, sex work groups, and Aboriginal agencies.In keeping with community-based research principles, this project adopts multiple research methodologies, including ongoing qualitative focus group discussions, social mapping, and a prospective cohort (6 monthly interview questionnaires and HIV screening) over a three-year period. All focus group discussions are facilitated or co-facilitated by a member of the peer team and inform the 'lived experiences' of survival sex work and barriers to and facilitators for prevention and harm reduction efforts. Individual informed consent is obtained prior to the discussion group and verbal rather than written consent is provided at the time of the interview, due to participant concerns of confidentiality. Discussion groups last approximately two hours and all participants receive Can$25 compensation for their expertise and time.A particularly novel component of the project is the social mapping, a participatory-action research tool that facilitates community access to hidden populations and highlights local expertise. Initial piloting of the maps with over 60 women facilitated by the Maka peer team has informed subsequent recruitment and outreach efforts for both research and service arms of this project. In particular, women are provided with a map of Vancouver's Downtown Eastside and surrounding communities and asked to mark 1) strolls where they work and live; 2) current working conditions ; 3) high and low risk areas for violence and bad dates; 4) working areas impacted by police presence and harassment; 5) areas of health and syringe availability and disposal.Given the difficulty in accessing a representative sample of sex workers due to the illegal and clandestine nature of sex work and unknown boundaries of this population , mappingThrough time-space sampling, a total of 205 women were initially invited and agreed to participate in a baseline visit over a six month period in 2006 (response rate of 93%), with ongoing 6 monthly follow-up visits scheduled to continue through 2008. Baseline and follow-up include detailed interview questionnaires administered by the peer interviewers and HIV screening by the project nurse, supported by extensive pre and post-test counselling. Women 14 years of age and older who have used illicit substances (not including marijuana) within the last month and are actively engaged in street-level sex work are eligible to participate. Semi-structured interview questionnaires elicit responses related to current and past experiences of sex work, violence and trauma, health and addition service access, working conditions, and sexual and drug-related harms. HIV screening is completed by the project nurse using the INSTI rapid HIV test , and new reactive tests are confirmed by western blot. A pre-test counseling questionnaire is completed by the project nurse on detailed questions relating to overall health, experiences with HIV and Hepatitic C testing, and current and past abuse experiences in order to facilitate counselling and referral to support services. Participants receive Can$25 compensation at baseline and each follow-up visit.Sex work researchers have described some of the key ethical issues and challenges in conducting non-exploitative research in this population both in Canada and internationally ,35,38-40The concern of ensuring privacy and confidentiality of participants requires particular consideration in the sex work context, in addition to raising some key ethical issues related to HIV prevention research. Given the historically oppressive nature of research of sex work, significant concern from the onset by both the community partner and sex work activists was that the research did not further stigmatize a highly marginalized population of women, or falsely precipitate sex workers as "vectors of disease". A concern similarly voiced in other settings across the globe ,41. As sTwo key ethical issues emerged of important relevance in HIV related research with sex work populations. First, while HIV is a reportable illness using the standard ELISA test, the new rapid point of care test provides women with the opportunity to receive anonymous HIV screening. Women are advised during extensive pre-test counselling that the INSTI test is not a diagnostic test, and a reactive test needs to be confirmed by a western blot, as per standard of care. Women have the choice of being referred to a physician for follow-up testing, or completing the follow-up testing at the Maka Project office. Early findings suggest increased acceptability and utilization of point of care testing among a highly marginalised population of women, with 96% of women agreeing to HIV screening at first visit. Within this context, the role of HIV reportability and disclosure in survival sex work needs to be explored , particuSecondly, reporting of violence experienced by youth less than 18 years of age is a major limitation to research with legal minors , and hasConsistent with recent literature on public health partnerships , the CBRHowever, a particular challenge to the CBR process in this community has been the balancing of interests of academic and community partners, as well as survival sex workers themselves. Three sets of partners are represented in the research: a service agency for sex workers, survival sex workers, and the researchers. Emerging discussions in community-based HIV prevention research have focused on the challenges of defining a "community" in the CBR process . In healIn addition to the many strengths of ensuring active involvement of those currently involved in survival sex work for both sex workers and researchers ,39,49, tHigh rates of health and drug-related harms, including violence and victimization, persist among women in open street-level sex worker markets in cities across Canada, and globally ,28,50,51KS conceptualized the manuscript, wrote the original draft, and incorporated suggestions from authors into the final version of the manuscript. VB, SA, DA, KG and MWT were involved in conception of the methodology and provided critical feedback on content and revisions to the original draft. All authors read and approved the final version of the manuscript.

ANGPTL 3,4,5 and 6 genes. A number of novel associations were identified, including the associations of high density lipoprotein and very low density lipoprotein with ANGPTL4. The KBAC method is implemented in a user-friendly R package.There is solid evidence that rare variants contribute to complex disease etiology. Next-generation sequencing technologies make it possible to uncover rare variants within candidate genes, exomes, and genomes. Working in a novel framework, the kernel-based adaptive cluster (KBAC) was developed to perform powerful gene/locus based rare variant association testing. The KBAC combines variant classification and association testing in a coherent framework. Covariates can also be incorporated in the analysis to control for potential confounders including age, sex, and population substructure. To evaluate the power of KBAC: 1) variant data was simulated using rigorous population genetic models for both Europeans and Africans, with parameters estimated from sequence data, and 2) phenotypes were generated using models motivated by complex diseases including breast cancer and Hirschsprung's disease. It is demonstrated that the KBAC has superior power compared to other rare variant analysis methods, such as the combined multivariate and collapsing and weight sum statistic. In the presence of variant misclassification and gene interaction, association testing using KBAC is particularly advantageous. The KBAC method was also applied to test for associations, using sequence data from the Dallas Heart Study, between energy metabolism traits and rare variants in ANGPTL 3,4,5 and 6 genes. A number of novel associations were identified. The KBAC method is implemented in a user-friendly R package.It has been demonstrated that both rare and common variants are involved in complex disease etiology. Until recently it was only possible to perform large scale analysis of common variants. With the development of next-generation sequencing technologies, detection and mapping of rare variants have been made possible. However, methods used to analyze common variants are not powerful for the analysis of rare variants. To address the problems of rare variant analysis working in a novel framework, the kernel-based adaptive cluster (KBAC) method was developed to perform gene/locus based analysis. The KBAC combines variant classification and association testing in a coherent framework. Through simulations motivated by population genetic and disease data, it is demonstrated that the KBAC has superior power to other rare variant analysis methods, especially in the presence of variant misclassification and gene interaction. Using data from the Dallas Heart Study, the KBAC method was applied to test for associations between energy metabolism traits and rare variants in Currently there is great interest in investigating the etiology of complex disease due to rare variants Gene interactions are believed to be involved in a broad spectrum of complex disease etiologies Ideally, when carrying out direct mapping, only causal variants should be tested for associations. When DNA samples are sequenced, both causal and non-causal variants are uncovered. Bioinformatics tools Driven by the advancement of sequencing technologies and availability of data, statistical and computational methods are needed for analyzing sequence data. It has been demonstrated that methods used to analyze common variants are low powered when applied to the analysis of rare variants The Kernel Based Adaptive Cluster (KBAC) was developed to overcome the problems of detecting rare variant associations in the presence of misclassification and gene interaction. Under the KBAC framework, data-based adaptive variant classification and testing of association are unified. The sample risk of a multi-site genotype is modeled using a mixture distribution with two components, where one component represents the distribution of sample risk of genotype if it is non-causal and the other component represents distribution of sample risks of causal genotypes. Ideally, if distributions for causal components were known, classification could first be performed and only the causal genotypes would be used in association studies. However, when searching for genotype-phenotype associations, it is usually unknown which variants are causal. Instead of performing an unrealistic two-step procedure, variant classification and association testing are unified in the KBAC framework. Continuous adaptive weighting which is implemented in the KBAC is preferable, particularly for low frequency alleles, than classifying variants and carrying out a stratified analysis, because increasing classification and shrinking size of strata can increase both type I and II error. For the KBAC, adaptive weighting procedure is implemented using the cumulative distribution functions for the multi-site genotype counts. Distributions of multi-site genotype counts are compared between cases and controls. Those multi-site genotypes that are enriched in cases will be up-weighted. Under the null hypothesis, the assigned weights asymptotically follow a uniform distribution. While under the alternative hypothesis, disease causal multi-site genotypes tend to be more frequent in cases than in controls. Therefore they are more likely to be adaptively up-weighted. The weighted multi-site genotype frequencies are aggregated and contrasted between cases and controls. In order to evaluate whether there is an association, significance of the KBAC can be assessed using either permutation or Monte Carlo approximation See .rare variants found exclusively in cases to those found only in controls (RVE) ANGPTL3, 4, 5, and 6 genes.The performance of the KBAC was compared to the weighted sum statistic (WSS) For the simulated population data phenotypes were generated separately and motivated by epidemiological disease studies. Two types of main effects phenotypic model are considered: 1.) constant genetic effects for each causal variant and 2.) genetic effects inversely correlated with minor allele frequencies (MAF) of causal genetic variants. In order to evaluate the impact of variant misclassification, a variety of scenarios were examined where 1.) different proportions of non-causal variants were included in the analysis and 2.) different proportions of causal variants were excluded from the analysis.RET gene is hypothesized CHEK2 gene increase risk of breast cancer in the absence of BRCA1 and BRCA2 mutations, but because of a shared pathway, the same CHEK2 variants in the presence of high risk BRCA variants do not further increase risk Two disease models of gene interactions were also evaluated. The example of with-in gene interaction was motivated by Hirschsprung's disease Under each of the above scenarios, phenotype-genotype association testing is performed for rare NS variants. It is demonstrated that the KBAC has a clear advantage in power and robustness over other existing methods and this benefit is especially strong, when rare variant data is analyzed where there is either variant misclassification or gene interactions.ANGPTL 3, 4, 5 and 6 genes obtained from sequence data were analyzed. In addition to identifying the originally reported association between triglyceride levels and ANGPTL 4, KBAC identified associations for a.) body mass index and ANGPTL 5, b.) diastolic blood pressure with ANGPTL 6, c.) high density lipoprotein with ANGPTL 4, d.) triglyceride levels with ANGPTL 3 e.) very low density lipoprotein with ANGPTL 3 and ANGPTL 4.In order to further illustrate applications of the KBAC and other statistical methods, i.e., WSS, CMC, and RVE to carry-out association studies, energy metabolism traits and rare variants in The results presented focus on simulations using simulated SFS from AA sequence data. Similar results are found for simulations using simulated SFS for EA and estimated SFS for AA and EA , S7, S8.Rare NS variants carrier information is summarized for replANGPTL3, 4, 5, and 6 genes.For the within gene interaction model , similarWhen permutation was used to evaluate significance for the KBAC, type I error was well controlled, because p-values were obtained empirically. Additionally, in order to ensure that the type I error for RVE is well controlled permutation is also used to obtain empirical p-values. For the WSS For main effects model with fixed genetic effects and no misclassification , the pow effects , the powUnder both models , the powfound in for fixefound in for varifound in for fixefound in variablefound in for fixefound in for variUnder the within gene interaction model, KBAC is consistently the most powerful method for all scenarios with different proportions of causal variants . The advIn the between gene interaction model, power comparisons between the four methods remain similar . KBAC isANGTPL 3,4,5 and 6 genes were analyzed to determine whether they are associated with energy metabolism traits , low density lipoprotein (LDL), very low density lipoprotein (VLDL), high density lipoprotein (HDL), cholesterol, glucose, body mass index (BMI), systolic (SysBP) and diastolic blood pressure (DiasBP) were investigated. In the original DHS study, NS variants were analyzed using RVE, and significant associations were found between ANGPTL3, ANGPTL 4 and TG as well as between ANGPTL 6 and cholesterol ANGPTL 6 and DiaBP ANGPTL 3 and TG levels ANGPTL4 and VLDL ANGPTL5 and BMI ANGPTL4 and HDL ANGPTL4 compared to those individuals with HDL levels in the upper quartile, while those individuals with TG levels in the upper quartile had an excess of rare variants in ANGPTL4 compared to those with TG levels in the lower quartile. The association detected by KBAC between ANGPTL4 and VLDL and between ANGPTL5 and BMI remains significant after correcting for multiple testing. RVE, on the other hand, detected associations between ANGPTL 5, 6 and glucose while the other three methods did not. We further investigated this association by applying a more stringent MAF cutoff 0.1% for the NS variants analyzed in ANGPTL 5 and 6. Using this new criterion both associations were detected by all methods , rare variants in the m traits . As in tThe KBAC method developed for association mapping of rare variants combines genotype classification and hypothesis testing in a coherent framework. The risk of each multi-site genotype is modeled as a mixture distribution with two components, among which only the component representing a non-causal genotype is known and is used in the adaptive weighting. Each multi-site genotype is continuously weighted using the non-causal component. The power of the KBAC as well as the other methods investigated can be affected by inclusion of non-causal mutations or exclusion of causal variants in the sample, to a varying degree. When non-causal variants are included in the analysis, the difference in rare variant carrier frequencies observed between cases and controls is mitigated. On the other hand, when causal variants are excluded from the association analysis, the marginal effect size of existing variants can vary considerably depending on whether missing causal variants exist on the same multi-site genotype. As a result, treating each variant (or multi-site genotype) interchangeably will incur loss of power, the severity of which will depend on the proportion of misclassified variants in the data. The performance of the KBAC is superior to the other approaches that were examined.Bioinformatics tools It is of great interest to evaluate gene×gene interactions in the study of complex diseases. The KBAC analyzes multi-site genotypes (or multi-locus genotype), which can be beneficial in detecting gene interactions The RVE method which compares the occurrence of variants which are exclusively observed in cases to those which are only observed in controls has the lowest power among all tests evaluated. The RVE method possesses undesired statistical properties by excluding those variants which are observed in both cases and controls. For all variants that are not fully penetrant, when sample size is large, they tend to appear in both case and control samples and would thus be excluded from the analysis using RVE. As a result, the RVE method is not asymptotically consistent; with increasing sample size power may be even lower than for smaller sample sizes Forward time simulations of locus genetic data incorporated both population demographic change and purifying selection. Both factors are known to impact SFS for observed rare variants . Only NS variants were analyzed for comparing different methods, as it has been suggested that using NS variants will concentrate variations on functionally significant class of alleles, and increase signal to noise ratio Whether or not phenotypic effects of causal rare variants are inversely correlated with their MAF is unknown. Deleterious functional variants tend to have low frequencies The KBAC test statistic does not have a closed form distribution; therefore it is necessary to evaluate significance either through permutation or using Monte Carlo approximation. For small sample sizes i.e. ∼≤400 cases and 400 controls, permutation is recommended, because it can be more reliable than Monte Carlo approximation. For larger sample sizes, Monte Carlo approximation not only controls type I error, but also the estimates of power do not differ from those obtained using permutations (data not shown). Permutation can be computationally intensive for large samples and/or genome-wide data where a large number of genetic regions are analyzed; therefore Monte Carlo approximation can be particularly advantageous to evaluate significance due to its computational efficiency.A well known problem of genetic association studies is spurious findings due to population substructure and/or population admixture. For rare variant association analysis this problem can occur when study subjects are sampled from different populations and the distribution of non-causal variant sites and/or aggregate frequencies of non-causal variants differ between the sampled populations. To control for population stratifications, KBAC can be coupled with principal components analysis (PCA) ANGPTL family. In the analyses, all individuals with potentially confounding factors i.e. diabetics, alcoholics, and individuals treated with lipid lowering drug were excluded. In the original studies individuals were excluded based upon both their quantitative trait values and the confounding factors. For example, only individuals treated with lipids lowering drugs in the lower quartile of TGs were removed, but those in the upper quartile were included in the analysis. We believe excluding individuals based upon their quantitative trait values should not be done instead all individuals meeting the exclusion criteria should be removed from the analysis. KBAC performs consistently well, and identifies the most phenotype-genotype associations among all the approaches compared. The effects of mutant ANGPTL genes on lipoprotein lipase (LPL) have been studied through in vitro functional studies and in vivo mice studies. LPL has been known to affect glucose metabolism ANGPTL4 gene and triglyceride levels were successfully replicated using an independent dataset The application of KBAC as well as WSS, CMC and RVE were further illustrated by the analyses of genes in Although the examples given are for the analysis of single regions and interaction between two regions, the KBAC can also be used to analyze entire exomes (or genomes). In order to control for family-wise error rate (FWER), it is sufficient to use a Bonferroni correction, since there will be little or no linkage disequilibrium between rare variants in different genes. It is thus not necessary to control the FWER using permutations. If exome sequencing is carried out and analysis is implemented gene by gene, given that human genome contains ∼20,000 genes, a significance level The KBAC is a powerful tool to detect main association effects and gene interactions in large sequence data sets of candidate genes, exomes and in the future entire genomes. The KBAC is implemented in a user friendly R package and is available from the authors.Total sample size is denoted as The ratio increases with disease penetrance of The sample risk If the mixture distribution under the alternative were known, then each genotype could be classified and only the causal genotypes would be used in the analysis. However, in disease gene mapping, the causality of variants is unknown. Instead of trying to ‘estimate’ Thereby, under the null hypothesis, the weights are uniformly distributed and under the alternative, greater weights can be placed on the multi-site genotypes that are enriched in cases. The genotypes with high sample risks will be given higher weights which can potentially separate causal from non-causal genotypes. Instead of classifying genotypes in a rigid manner with unknown likelihoods, this method weighs each genotype in a continuous fashion using only the known component Three types of kernels can be used to assign weights to each rare genotype; they are asymptotically equivalent. For small to moderate sample sizes, binomial and hyper-geometric likelihoods tend to work best, while for large sample sizes the asymptotic normal kernel is computationally efficient. All examples shown in this article were carried out using the hyper-geometric kernel.Under the null hypothesis of no disease/gene associations, conditioning on the genotype counts Under the null hypothesis of no disease/gene association, conditioning on the genotype counts The weight as above is obtained through summations, i.e.Under the null distribution, the sample risk for genotype Each “individual” with multi-site genotype The KBAC statistic is defined as Standard permutation procedure is used to obtain empirical p-values for small sample sizes and for large sample sizes significance can be obtained through the Monte Carlo approximation. A graphical illustration of the KBAC statistic can be found in .In order to control for sample heterogeneities such as population stratification/admixture, it is desirable to be able to incorporate covariates in the association analysis. The kernel weights computed for the KBAC statistic can be used with logistic regression. For an individual A score statistic to test Although using permutation can provide an exact empirical distribution under the null hypothesis, it can be computationally prohibitive for large sample sizes and genome-wide association studies. A Monte Carlo method was developed which enables fast computation of p-values efficiently. Under the null hypothesis, conditioning on the genotype counts, Algorithm 1:Step 1: Simulate a Step 2: Compute Step 3: Repeat step 1 and step 2 In this article power calculations were carried out empirically; haplotypes were generated using forward time simulations and case-control status was assigned via a linear log odds model. Power calculations can also be carried out using Monte Carlo approximation. Under the alternative hypothesis of disease-gene associations, it is assumed that the disease model is known from DHS. The SFS of rare variants was estimated using a method of moments approach . Fifty-percent of the rare NS variant nucleotide sites were selected to be causal, where the rare mutant allele has an effect on the disease odds and the remaining rare variant sites are non-causal with no phenotypic effect. Two types of penetrance models were evaluated. In the first type of model, the genetic effects of causal variants are constant (OR = 3) regardless of their allele frequencies. For the second class of models, the genetic effects are inversely correlated with the MAFs. Disease odds of individual rare variants varies in the range of 2∼20. As a majority of rare variants are of extremely low frequencies, most of the uncovered rare variants in a case control sample have ORs between 2 and 4. This is compatible with surveys for multi-factorial diseases To evaluate the within gene interaction and between gene interaction models, 1000 cases/1000 controls and 300 cases/300 controls were generated for each replicate, respectively. For each model, 25% to 100% of the simulated rare variant sites are causal while the remaining rare variant sites are non-causal. For the within gene interaction model, one site with a common variant [MAF>20%] is randomly selected. The disease status of each “individual” is assigned based upon their multi-site genotype using a linear log odds model. The genetic effects of causal rare variants are modulated by the alleles at the chosen common variant site. Each causal rare variant increases disease risk with an OR of 3 only if the rare variant is on the same haplotype as the minor allele from the common variant site, otherwise the OR = 1. For the between gene interaction model, two unlinked genes are simulated for each “individual”. The disease status of each “individual” is assigned based upon their joint multi-site genotype at high risk gene 1 and low risk gene 2 using a linear log odds model. Each causal rare variant in gene 2 increases disease risk with an OR of 2.0 if there are no causal rare variants in gene 1; however, if there are rare causal variants in gene 1, the causal variants in gene 2 do not increase risk and each causal variant in gene 1 increases disease risk with an OR of 4.0 regardless of the genotype at gene 2. Mathematical illustrations of these two models are shown in ANGTPL3, 4, 5 and 6 influence energy metabolism in humans, coding regions of the four gene were sequenced using DNA samples obtained from 3551 participants in DHS The DHS dataset is a multi-ethnic population based probability sample from Dallas County residents whose lipids and glucose metabolism have been characterized and recorded Figure S1Schematic illustration of the permutation procedure used for evaluating statistical significance empirically.(0.19 MB TIF)Click here for additional data file.Figure S2Impact of misclassifications under main effects model with fixed genetic effects using simulated SFS for EA.(0.18 MB TIF)Click here for additional data file.Figure S3Impact of misclassifications under main effects model with variable genetic effects using simulated SFS for EA.(0.18 MB TIF)Click here for additional data file.Figure S4ANGPTL family.Impact of misclassifications under main effects model with fixed genetic effects using estimated SFS for AA from genes in (0.18 MB TIF)Click here for additional data file.Figure S5ANGPTL family.Impact of misclassifications under main effects model with variable genetic effects using estimated SFS for AA from genes in (0.18 MB TIF)Click here for additional data file.Figure S6ANGPTL family.Impact of misclassifications under main effects model with fixed genetic effects using estimated SFS for EA from genes in (0.18 MB TIF)Click here for additional data file.Figure S7ANGPTL family.Impact of misclassifications under main effects model with variable genetic effects using estimated SFS for EA from genes in (0.18 MB TIF)Click here for additional data file.Figure S8Power comparisons for within gene (left panel) and between gene interaction model (right panel) with simulated SFS for EA.(0.19 MB TIF)Click here for additional data file.Figure S9Graphical Illustrations for KBAC Statistic. In the KBAC framework, variants adaptive weighting and testing of associations are simultaneously performed. The statistical significance can be evaluated using either permutations or Monte Carlo approximations. For information on nomenclature used please refer to the Materials and (0.25 MB TIF)Click here for additional data file.Figure S10Demographic History of AA with Two-Epoch Change.(0.06 MB TIF)Click here for additional data file.Figure S11Complex Demographic History of EA.(0.09 MB TIF)Click here for additional data file.Table S1Rare variant summary statistics. The summary statistics are displayed for the generated replicates under main effects model with fixed and variable genetic effects using simulated SFS from EA population. Scenarios with different proportions of causal variants excluded and scenarios with different proportions of non-causal variants included were considered. The table displays for a given sample, the information on a) the average proportion of rare NS variant carriers among cases and controls; b) the mean number of rare NS variant sites; c) the mean number of rare NS variant sites that are exclusive to cases or controls; d) the average proportion of case and control rare NS variant carriers with more than one rare variant. For each scenario, a sample size of 1,000 cases and 1,000 controls were used. 2,000 replicates were generated for each scenario.(0.05 MB DOC)Click here for additional data file.Table S2Rare variant summary statistics. The summary statistics are displayed for the generated replicates under within gene interaction model and between gene interaction model using simulated SFS from EA population. Scenarios with different proportions of causal variants were considered. The table displays for a given sample, the information on a) the average proportion of rare NS variant carriers among cases and controls; b) the mean number of rare NS variant sites; c) the mean number of rare NS variant sites that are exclusive to cases or controls; d) the average proportion of case and control rare NS variant carriers with more than one rare variant. For within gene interaction model, a sample size of 1,000 cases and 1,000 controls were used, and for between gene interaction model, a sample size of 300 cases and 300 controls were used. 2,000 replicates were generated for each scenario.(0.04 MB DOC)Click here for additional data file.Table S3ANGPTL dataset was used. Scenarios with different proportions of causal variants excluded and scenarios with different proportions of non-causal variants included were considered. The table displays for a given sample, the information on a) the average proportion of rare NS variant carriers among cases and controls; b) the mean number of rare NS variant sites; c) the mean number of rare NS variant sites that are exclusive to cases or controls; d) the average proportion of case and control rare NS variant carriers with more than one rare variant. For each scenario, a sample size of 1,000 cases and 1,000 controls were used. 2,000 replicates were generated for each scenario.Rare variant summary statistics. The summary statistics are displayed for the generated replicates under main effects model with fixed and variable genetic effects. Estimated SFS from AA population with (0.04 MB DOC)Click here for additional data file.Table S4ANGPTL dataset was used. Scenarios with different proportions of causal variants excluded and scenarios with different proportions of non-causal variants included were considered. The table displays for a given sample, the information on a) the average proportion of rare NS variant carriers among cases and controls; b) the mean number of rare NS variant sites; c) the mean number of rare NS variant sites that are exclusive to cases or controls; d) the average proportion of case and control rare NS variant carriers with more than one rare variant. For each scenario, a sample size of 1,000 cases and 1,000 controls were used. 2,000 replicates were generated for each scenario.Rare variant summary statistics. The summary statistics are displayed for the generated replicates under main effects model with fixed and variable genetic effects. Estimated SFS from EA population with (0.04 MB DOC)Click here for additional data file.Text S1Supplementary Material.(0.25 MB DOC)Click here for additional data file.

The Estradiol-Dihydrotestosterone model of prostate cancer (PC) showed how the interaction of hormones with specific hormone receptors affected apoptosis. The same hormone can produce different effects, depending on which hormone receptor it interacts with.This model proposes that the first step in the development of most PC and breast cancer (BC) occurs when aromatase converts testosterone to estradiol (E2). A sufficiently high enough local level of E2 results in telomerase activity. The telomerase activity allows cell division and may lead to BC or PC, which will proliferate if the rate of cell division is greater than the rate of cell death. The effect of hormones on their hormone receptors will affect the rate of cell death and determine whether or not the cancer proliferates.By minimizing bcl-2 and maximizing apoptotic proteins, new systemic treatments for BC and PC can be developed that may be more effective than existing treatments. The Estradiol-Dihydrotestosterone (E-D) model of prostG) is greater than the rate of cell death (RD), then these cells will proliferate and cancer may result. Telomerase activity was sufficient to transform human cell lines that ordinarily have limited life spans into immortalized cell lines [Aromatase (Aro) is an enzyme which converts testosterone (T) to estradiol E2). If the Aro activity is high enough, a process is started that may result in BC or PC. High local levels of E2 result in human telomerase production and activity. If the rate of growth upregulated bcl-2 in the BC line T47D . All of Mifepristone (RU-486), a drug that is antagonistic to progesterone receptor A (PRA), decreased bcl-2 production in LNCaP , an andrG > RD if an initial cancer cell arises.The mutations BRCA1 and BRCA2 have a striking lack of PRB expression in normal breast cells . BRCA1 mD or increases RG in addition to the elimination of PRB. Further research is needed to clarify this point.The fact that men with BRCA1 mutations do not have an increased chance of developing BC can be explained by the decreased downregulation of bcl-2 that results from the loss of PRB being offset by men's high levels of T which results in both mAR and iAR significantly downregulating bcl-2. If a high enough level of T is present, it is possible that no net increase in bcl-2 would occur in spite of the absence of PRB. In PC, high levels of T end up with iAR downregulating bcl-2, but with mAR upregulating bcl-2, which results in more bcl-2 being present than is the case for BC. Since women have a much lower level of T than men do, the increase in bcl-2 that results from the loss of PRB would probably not be offset by the downregulation of bcl-2 by the androgen receptors. This is consistent with BRCA1 increasing the level of bcl-2 in the breast tissue of women but not of men. Since BRCA2 mutations increase the chance of developing BC for both men and women, this implies that there is another factor present in BRCA2 mutations which decreases RG > RD. The fact that RU-486 prevented BC development is consistent with mPR downregulating bcl-2. This is because in the presence of RU-486, there is no PRA or PRB available for P to bind to, and since this prevents BC, then RG < RD. If mPR upregulated bcl-2, then P would have caused an increase in bcl-2, which might have resulted in some of the mice developing BC if RD became low enough. Assuming mPR downregulates bcl-2, but not as strongly as PRA upregulates bcl-2, then in the absence of RU-486, P would have resulted in an increase in bcl-2 and therefore an increased incidence of BC due to the decrease in RD, whereas in the presence of RU-486, P would have resulted in a decrease in bcl-2 and therefore a decreased incidence of BC due to the increase in RD, which what was in fact observed. Also, it is likely that the combined BRCA1/p53 deficiency still resulted in the same number of initial BC cells arising in all of the mice, but since RG < RD in the presence of RU-486, the BC was unable to proliferate.Mice which were BRCA1/p53 deficient all developed BC, unless they were treated with RU-486, in which case none of the mice developed BC . This isThe inferences drawn by combining the above experiments are consistent with the conclusion of the extended E-D model that PRA upregulates bcl-2, whereas PRB and mPR downregulate bcl-2. However, further testing is needed to conclusively prove these points.By using T-BSA, which is known to bind to mAR but not to iAR, it was shown that mAR upregulates bcl-2 in5α-dihydrotestosterone (DHT) downregulated bcl-2 in the PC cell line LNCaP-FGC and in tAndrogens inhibited cell proliferation in the BC cell line MCF7-AR1 , which hThe PC cell line LNCaP-FGC has high levels of iAR . High ph++) influx increased when T-BSA was added to PC cells [++ influx is consistent with mAR upregulating Ca++ influx, since T-BSA binds to mAR but not to iAR. The fact that T-BSA caused Ca++ influx, whereas T does not, is consistent with iAR downregulating Ca++ influx. Ca++ influx also occurs during ADT [++ influx to occur, then it is likely that one or more proteins are responsible for preventing Ca++ influx. This is consistent with iAR upregulating proteins which are responsible for preventing Ca++ influx.Calcium ion is a protein that binds to Caoduction , which ioduction . This isD as much as possible, so that RG < RD for any early stage cancer cells that may already be present. This means that, for safety concerns, no drugs should be used which block hormone receptors, since, until proven otherwise, it must be assumed that every hormone receptor has some purpose in the overall health of the body. Also, hormone levels should be kept within their physiological limits until evidence is produced that shows that it is safe to go outside of those limits. Within these constraints, the goal is to maximize the production of apoptotic proteins upregulated by mAR and to minimize the production of bcl-2.In designing protocols for preventing BC and PC, every effort should be made to avoid potential long term side effects, while still increasing ROne way to minimize bcl-2 production would be to maximize the activity of PRB and mPR while minimizing the activity of PRA. However, since no hormone has yet been discovered that does this, then P has to be considered instead. P should be increased to the maximum safe physiological amount appropriate for the gender of the individual being treated, unless testing shows a genetic makeup that results in an increase in bcl-2 in the breast or prostate epithelial cells in response to P, such as in the case of BRCA1 or BRCA2 mutations.Another way to minimize Bcl-2 would be by using a hormone that binds preferentially to ER-β over ER-α and mER. Estriol (E3) has an affinity for ER-β which is 3.5 times greater than for ER-α, E2 has an equal affinity for ER-α and ER-β, and estrone has an affinity for ER-α which is 5 times greater than for ER-β. This is++ influx and decrease Cal production, all of which should increase RD.In order to maximize the production of apoptotic proteins upregulated by mAR, binding to mAR should be increased as much as possible and binding to iAR should be decreased as much as possible. Since T and DHT seem to have similar affinities to mAR, whereas DHT has an affinity to iAR which is five times greater than T, then high T and low DHT (HTLD) should create the desired imbalance. Therefore, the serum level of bioavailable T should be increased to the maximum safe physiological level appropriate for the gender of the individual being treated, while the serum level of DHT should be decreased to the minimum physiological level necessary for maintaining good health. Since T can be converted to E2 by Aro, the level of E2 should be monitored and kept within normal or low normal physiological levels. In addition to increasing the apoptotic proteins upregulated by mAR, this protocol should increase CaD occurring after full agonism of mAR along with no agonism of iAR. However, if there is a great amount of agonism of mAR along with a small amount of agonism of iAR, then there would still be an increase in RD for PC if the imbalance in the binding to the androgen receptors is great enough. Using F to prevent DHT creates such an imbalance, since T has an affinity which is five times less than that of DHT to iAR. This raises the possibility that HTLD would result in RG < RD for most early stage BC or PC cells.When LNCaP tumors were transplanted into nude mice, four weeks of T-BSA administration resulted in a 60% reduction in tumor volume when compared to BSA administration alone . Also, w2D3 . When calcitriol bound to the vitamin D receptor (VDR), it inhibited growth and upregulated AS3 in a number of PC cell lines [G in BC and PC, and if the level of bcl-2 is low enough, may increase RD.The active metabolite of vitamin D is 1,25(OH)ll lines and incrll lines and PC [ll lines . Calcitrll lines and in Pll lines . Also, bll lines and in Pll lines . In somell lines . This isHTLD will have different effects with regards to bcl-2 production for BC and PC. For BC, the increased amount of T binding to mAR will result in a decrease in bcl-2 due to increased downregulation. However, the decreased amount of DHT binding to iAR will result in less downregulation of bcl-2 production and therefore an increase in bcl-2. Therefore, there should not be a dramatic increase in bcl-2 for BC as a result of HTLD.For PC, however, the increased amount of T binding to mAR will result in an increase in bcl-2 due to increased upregulation and the decreased amount of DHT binding to iAR will also result in an increase in bcl-2 due to decreased downregulation. Therefore, for preventing PC, more care must be used to decrease bcl-2 in other ways, if possible. Also, large quantities of foods which contain components which bind to ER-β with less than full agonism should be avoided. This is because such components might interfere with E2 binding to ER-β and thus reduce the downregulation of bcl-2. For example, genistein, the main isoflavone found in soy, increased bcl-2 in the BC cell line MCF-7 .D more than the apoptotic proteins increase RD. This would be expressed by a more rapid population growth, which would account for the observed increase in PSA for those men taking 5AR2 inhibitors. Pharmacological amounts of genistein induced apoptosis in PC cell lines by a process independent of its binding to estrogen receptors [D to some extent. However, when 5AR2 inhibitors are used in conjunction with genistein, the overall increase in bcl-2 that results may more than offset the anticancer effects of genistein, if any PC cells are already present. If no PC cells are present, then ingesting phytoestrogens should help prevent PC, since the phytoestrogens should interfere to some degree with the ability of E2 to upregulate telomerase. Pharmacological levels of genistein did suppress telomerase activity in the PC cell lines LNCaP and DU-145 [Anecdotally, some men with PC who were taking 5AR2 inhibitors following ADT exhibited consistent increases in PSA values associated with the introduction of large doses of genistein, soy, tofu, modified citrus pectin, or flaxseed into a pre-existing diet. Often this change in PSA trajectory could be reversed by stopping that nutritional product . This iseceptors . Therefod DU-145 .in vitro [Although in using the HTLD protocol for preventing PC, the hormones would be kept within physiological levels, there is still the possibility that long term use of this protocol may have some health consequences unrelated to PC. Lean elderly men and women who have Alzheimer's disease (AD) had lower bioavailable levels of T than those without AD . This miin vitro , and β-ain vitro . This inIn a five year study for male veterans over 40 years of age, those with low levels of T had a mortality rate of 34.9% as compared to 20.1% for those with normal levels of T . Low levIn summary, the protocol for preventing both BC and PC involves obtaining gender appropriate maximum safe physiological levels of bioavailable T, maximum safe physiological level of calcitriol, minimum safe physiological level of DHT and normal level of E2. Maximum safe physiological levels of P should be added except for those individuals whose genetic makeup would not benefit from P. If further research should determine that E3 is helpful, then maximum safe physiological levels of E3 should be added. Also, ingesting large quantities of foods which are known to bind to ER-β with less than full agonism should be avoided. Other factors, such as nutritional supplements or lifestyle changes which are shown to reduce the incidence of BC and PC, can also be included. Table It is possible that the HTLD protocol might be ineffective or even harmful depending on the mutations that may be in some of the BC or PC already present. For example, if there is a mutation in PC that prevents mAR from upregulating apoptotic proteins but still allows it to upregulate bcl-2, then the HTLD protocol would be harmful. The earlier this protocol is started, the less likely that any such adverse mutations would be present.D. However, it would also eliminate the imbalance that should upregulate the apoptotic proteins associated with mAR, which should result in a decrease in RD. Further research is needed to determine whether HTLD or HTHD is more effective in preventing BC. For HTHD, there is no need to avoid ingesting phytoestrogens, since no 5AR2 inhibitors would be present and therefore no decrease in bcl-2. Table An alternative strategy for prevention would involve all of the steps listed above, but in place of maximizing the upregulation of apoptotic proteins by mAR through HTLD, instead minimize the amount of bcl-2 present and rely on the high serum level of calcitriol to maximize apoptosis. For BC, the gender appropriate maximum physiological level of bioavailable T and DHT or high T and high D (HTHD) would reduce the production of bcl-2 in comparison to HTLD, since DHT downregulates bcl-2. This decrease in bcl-2 should increase the likelihood that calcitriol would increase RFor PC, the minimum safe physiological level of bioavailable T and the maximum safe physiological level of DHT or low T and high D (LTHD) should reduce bcl-2 even more than HTHD does, assuming that maximum agonism of mAR is not achieved with the maximum safe physiological level of DHT alone. This is because reducing the level of T would reduce the overall amount of androgen available to bind to mAR and mAR upregulates bcl-2 in PC. Further research is needed to determine whether HTLD or LTHD is more effective in preventing PC. Also, for LTHD there is no need to avoid ingesting phytoestrogens. Table D. Ideally, if the initial treatment is successful, then treatment can eventually be changed to one of the preventative protocols described previously.When treating BC or PC systemically, the goal should be to minimize bcl-2 and to maximize apoptotic proteins, without regards to long term health risks. If the genetic makeup of the BC or PC were known, then treatments could be individually designed for optimal effectiveness. However, due to the heterogeneous nature of BC and PC, care must be taken to consider all possible mutations and, whenever possible, to avoid using any treatment that would ever decrease R++ influx may lead to apoptosis [++ influx [++ channel blockers. This is all consistent with Ca++ overload being the cause of apoptosis during ADT. When ADT is administered, typically nothing is done to maximize the upregulation of apoptotic proteins or to maximize the downregulation of bcl-2.Systemic hormonal manipulation is currently being used, to a limited extent, for both PC and BC. In PC, the form of systemic hormonal manipulation currently being used is ADT. During ADT, downregulation of Cal coupled with Capoptosis . For pro+ influx . In the For BC which has ER-α present, currently systemic hormonal manipulation is aimed at reducing the binding of E2 to ER-α. This is accomplished either by using tamoxifen, in order to block the binding to ER-α, or anastrozole, which is an antagonist to Aro, in order to reduce the amount of E2 present in the BC cells. In both cases, bcl-2 production should be reduced, since ER-α upregulates bcl-2. However, nothing is done to utilize any of the other hormone receptors to further reduce bcl-2 production and nothing is done to maximize the production of apoptotic proteins.G, then it would be more difficult to use systemic treatment to achieve RG < RD following surgery. If systemic hormonal treatment can be shown to be sufficiently effective in early stage treatment, it is possible that localized treatment may not be necessary. However, systemic hormonal treatment must be continued indefinitely in case any BC or PC cells remain, whereas surgery has the possibility of being curative. There is also the possibility that surgery might remove cancer cells that have already mutated to the point that systemic treatment would be ineffective on them, so that surgery followed by systemic treatment might be successful whereas systemic treatment without surgery might be a failure. More research is needed to clarify this point.There are a number of options available in searching for the optimum treatment protocol. One consideration is whether or not localized treatment, such as surgery, should be done initially for BC or PC. It is known that if surgery does not remove all cancer cells, the remaining cancer cell population doubles at a quicker rate than it did before the surgery . IncreasMen with stage T1–T2 PC, with a mean prostate specific antigen (PSA) of 13.5, whose initial treatment was radical prostatectomy (RP) had a PC specific death rate of 4.6% and a 10.1% rate of distant metastases after a median of 6.2 years . Men witD by killing mitochondria.While this systemic treatment compares quite favourably with RP, it is possible to make improvements during ADT based on the extended E-D model. Maximum antagonism of mAR and iAR should be used. In order to obtain the lowest level of bcl-2 from the non-androgen receptors (LBNAR), maximum antagonism of ER-α, mER, and PRA should be used, as well as maximum agonism of ER-β, PRB, and mPR. P should be used only in the presence of a drug that blocks the conversion of P to T, since P is able to be converted to T . Also, m++ influx coupled with the absence of Cal which is known to occur in ADT without LBNAR. It is possible that some of the non-androgen receptors are involved in the regulation of Ca++ influx and Cal. For example, there is evidence [++ influx in the PC cell line LNCaP. Table Incorporating these modifications should minimize the amount of bcl-2 present while maintaining the apoptotic forces of ADT. Further research is needed to verify that the LBNAR protocol maintains Caevidence that mER++ influx and decreased production of Cal. It is possible that AMNI will not result in the same level of apoptosis from Ca++ overload as what is seen in ADT, since other receptors besides iAR and mAR may be involved in Ca++ influx and Cal production. LBNAR should be added to minimize bcl-2 production. MAV should also be added to AMNI. This should increase RD if the overall level of bcl-2 is low enough, but should not increase AS3 due to the antagonism of iAR. The optimum length of time to maintain this treatment needs to be determined. Table Following ADT, there should be maximum agonism of mAR coupled with maximum antagonism of iAR, or all mAR no iAR (AMNI). AMNI should maximize the production of the apoptotic proteins upregulated by mAR, and should increase the level of bcl-2, since mAR upregulates bcl-2 and iAR downregulates bcl-2. There should also be increased CaG by increasing the production of AS3 and increase RD, since, as opposed to AMNI, NMAI should reduce bcl-2 production in PC. Table Since the AMNI treatment may fail against PC with mutated mAR that is unable to upregulate apoptotic proteins, it should be followed by a treatment of maximum antagonism of mAR along with maximum agonism of iAR, or no mAR all iAR (NMAI). NMAI should increase the production of AS3 upregulated by iAR to stop cell proliferation, and should lower bcl-2 levels. LBNAR and MAV should also be added to NMAI. In this case, MAV should decrease R++ influx as it does for PC. Next, the AMNI protocol along with LBNAR and MAV should be done. This would have similar benefits as was described for PC, although because mAR downregulates bcl-2 in BC, as opposed to upregulating it in PC, the RD would be expected to be greater, since the level of bcl-2 should be lower. Just as in PC, the NMAI protocol along with LBNAR and MAV should be done next. This should have an equivalent effectiveness against BC as it had against PC. An additional protocol to consider for BC would be to use maximum agonism of mAR and of iAR, or all mAR all iAR (AMAI). When LBNAR and MAV are added, this should have a bcl-2 level lower than for any of the other protocols, but it would then be dependent on calcitriol killing mitochondria to increase RD and upregulating AS3 to decrease RG. Table For BC, the initial treatment should also be maximum antagonism of mAR and iAR along with LBNAR and MAV. This should be effective assuming that iAR upregulates Cal and downregulates CaMore research is needed to determine the effectiveness of these treatments and the optimal time to maintain each treatment. For both PC and BC, if the treatments are successful then one of the preventative protocols can then be used.The protocols given for preventing and treating BC and PC are merely suggestions based on the properties of the extended E-D model. There are other possible alternatives that can be tried. In the case of prevention, it is possible that raising T to higher than physiological levels when using HTLD may have beneficial effects. Individuals with mutations in BRCA1 or BRCA2 may want to start a preventative protocol at an earlier age. A protocol for prevention may also be applied to patients after they initially receive localized treatment, such as surgery or radiation. Changes in lifestyle that are shown to be useful against BC and PC, such as diet and exercise, can be added to the protocols for prevention and treatment.BC and PC are complex diseases, and the properties of hormone receptors described in the extended E-D model represent a foundation which can be built on to better understand both diseases. Bcl-2 is chosen as the main antiapoptotic protein to focus on in this model because it has been shown to be extremely powerful. It prevented apoptosis caused by calcitriol in BC and in PD, whereas, in PC, bcl-2 will be upregulated. In PC, this creates a situation in which the same hormone receptor exhibits one property that increases the chance of apoptosis and another that decreases the chance of apoptosis. Ordinarily, apoptosis will occur if a sufficient quantity of androgen is present, as evidenced by the fact that T-BSA resulted in a 60% reduction in tumor size of LNCaP transplanted into nude mice after one month [If iAR is not functional, then apoptotic proteins will be upregulated by mAR in both BC and PC. In BC, bcl-2 will also be downregulated, helping to further increase Rne month . Since mne month in men wAlthough telomerase activity may immortalize cells, it is not sufficient by itself to produce cancer as evidenced by the fact that the tissue cultures with telomerase activity did not become cancerous . It is bD in both BC and PC. One experiment [++ influx along with lowered production of Cal, which might increase RD as well.A key prediction of the extended E-D model is that HTLD will increase Rperiment that higIf the observed apoptosis was totally due to the apoptotic proteins upregulated by mAR when initially unopposed by downregulation from iAR, then the amount of apoptosis should be about the same for T and DHT. However, when T alone was used to end androgen ablation, the result was an average increase of 128% in tumor volume. This was much worse than the average increase of 23% in tumor volume observed when T plus F was used to end androgen ablation. Also, considering that LNCaP is an ADPC cell line, the addition of T should have resulted in an increase in tumor volume much greater than that observed with continual androgen ablation. The fact that continual androgen ablation had an average increase of 114% in tumor volume means that using T alone after androgen ablation was only a little worse than continual androgen ablation. This difference suggests that the initial increase in apoptotic proteins that occurred when the faster acting mAR was active, but the slower acting iAR was not yet active, might be responsible for the better than expected results for T alone.G or an increase in RD. However, when androgen ablation plus F was used, the average increase in tumor volume was 91%, which was a bit better than continual androgen ablation, but still much worse than HTLD. As a result, the benefits observed from using T plus F are consistent with an initial surge followed by a slow continual release of apoptotic proteins due to the imbalance in the binding of T to both mAR and iAR as compared to the binding of T to mAR and DHT to iAR.Another possibility is that the effectiveness of HTLD was due to the low DHT caused by F, either because of a decrease in RD for BC and PC in animal studies as well as with various cell lines. Since it is assumed that some BC or PC cells may be present before treatment is started, it is important that the protocol used have the ability to cause apoptosis or inhibit the growth of existing BC or PC. Also, in addition to a protocol's effectiveness in preventing BC and PC, its impact on quality of life must be considered. Since the protocol will be used for long term, a significant improvement in quality of life might offset a slightly inferior effectiveness in preventing BC and PC. It is also possible that alternating between the preventative protocols might be more effective than maintaining just one. More research is needed to examine these possiblities.In order to determine the best protocol for preventing BC and PC, the HTLD, HTHD, and LTHD protocols should be examined for their efficacy in increasing RIn considering the best protocol for treating BC and PC, the theoretical ideals were given, with no consideration to the side effects of the treatment or whether the necessary drugs existed and were available for human use. In practice, both of these must be considered and modifications must be made, while trying to stay as close to the theoretical ideal as possible. For example, it is known that high levels of calcitriol cause hypercalcemia, but research is being done to develD typical of ADT. If T were used without E2, then telomerase activity would occur when Aro was activated, which would produce high local levels of E2 and telomerase activity. However, for prostate epithelial cells to express Aro activity requires either a mutation or presumably a failure to methylate the portion of DNA containing the Aro gene. Therefore, the fact that the percentage of Noble rats that develop PC when exposed just to exogenous T is much lower than the percentage that develop PC when exposed to exogenous T plus E2 is consistent with the extended E-D model.For a model to be an accurate reflection of reality, it should be able to explain all observed experimental results. The extended E-D model can explain some experimental findings in a straightforward manner. One example would be the fact that both exogenous T and E2 must be given to Noble rats in order to reproducibly induce PC . The higG and RD that result.Another example is that mammary epithelial proliferation in ovariectomized rhesus monkeys occurred after three days of treatment with tamoxifen . This isG < RD. For levels below this threshold, RG > RD and if BC or PC develops, then it can proliferate. As bioavailable levels of T decrease further, RD should also decrease. This should not increase the incidence of BC or PC, but should increase the aggressiveness of the disease. For BC, this is because lower agonism of mAR would result in less apoptotic proteins being upregulated, and lower agonism of iAR would result in less AS3 being upregulated. In addition, there should be higher levels of bcl-2, since both mAR and iAR downregulate bcl-2. The same factors would explain the increase in PC, except that in prostate epithelial cells mAR upregulates bcl-2 whereas iAR downregulates bcl-2. This would result in less of an increase in bcl-2 than occurs in breast epithelial cells. Lower levels of T were associated with worsening clinical staging, worsening histological staging, and more poorly differentiated adenocarcinomas for PC [One example that is more problematic for the extended E-D model to explain is the relationship between serum levels of T and incidence of BC and PC. The extended E-D model would predict that there is a separate threshold level of bioavailable T for BC and PC, above which Rs for PC .G, making it more likely that RG > RD for some individuals. Another possibility is that the higher level of free T results in higher local levels of DHT. This increase in DHT should result in increased agonism of iAR which should result in more downregulation of the apoptotic proteins upregulated by mAR. If ordinarily apoptosis is caused in part by the slow accumulation of these apoptotic proteins, then the increased downregulation by iAR should result in a decrease in RD, increasing the possibility that RG > RD. Also, if the level of free T becomes low enough, then even in the presence of Aro activity, the local level of E2 that results would be too low to upregulate telomerase activity, removing Aro activity as a cause for BC or PC.However, higher levels of free T are correlated with slightly increased incidences of BC and PC . The higMore research is needed to test the properties of the extended E-D model. Experiments concentrating on individual hormone receptors are essential. The extended E-D model can be expanded to include how hormone receptors upregulate or downregulate other proapoptotic and antiapoptotic proteins as they are discovered.BC and PC appear to be functionally identical, but there are slight differences in the way each disease achieves that functionality. The most striking difference between the two diseases is the difference in the properties of their mAR. In both BC and in PC, apoptosis occurs following the loss of functionality of their iAR. However, since women have much lower levels of T than men do, in order to maintain the identical functionality it is necessary for mAR to be more effective in inducing apoptosis in BC than in PC, which in fact appears to be the case. For both BC and PC, mAR upregulates apoptotic proteins, but for BC, mAR also downregulates bcl-2, whereas for PC, mAR upregulates bcl-2.BC and PC are complex diseases, but by focusing on the properties of the individual hormone receptors, it is possible to develop systemic protocols for prevention and treatment. Such protocols can be augmented by any lifestyle changes, such as diet and exercise, which may be shown to be helpful.The author(s) declare that they have no competing interests.

To assess the frequency of IMLN recurrence, its associated risk factors with disease-free interval (DFI) and its predicting factors on overall survival time.133 cases of breast cancer IMLN recurrence were identified via the computerized CT reporting system between February 2003 and June 2008, during which chest CT for patients with breast cancer (n = 8867) were performed consecutively at Cancer Hospital, Fudan University, Shanghai, China. Patients' charts were retrieved and patients' characteristics, disease characteristics, and treatments after recurrence were collected for analysis. The frequency was 1.5% (133/8867).p = 0.002), and positive ER/PR disease . The median survival time after IMLN recurrence was 42 months, with a 5-year survival rate of 30%. Univariate analysis showed four variables significantly influenced the survival time: DFI of IMLN recurrence (p = 0.001), no concurrent distant metastasis (p = 0.024), endocrine therapy for patients with positive ER/PR (p = 0.000), radiotherapy (p = 0.040). The independent factors that reduced the death risk were no concurrent distant metastases , endocrine therapy for patients with positive ER/PR status and palliative radiotherapy .IMLN recurrence was presented as the first metastatic site in 121 (91%) patients while 88 (66.2%) had other concurrent metastases. Typical chest CT images included swelling of the IMLN at the ipsilateral side with local lump and sternal erosion located mostly between the second and third intercostal space. The median disease-free interval (DFI) of IMLN recurrence was 38 months. The independent factors that could delay the IMLN recurrence were small tumor size (HR 0.5 95%CI: 0.4 - 0.8; The risk of IMLN recurrence is low and there are certain characteristics features on CT images. ER/PR status is both a risk factor for DFI of IMLN recurrence and a prognostic factor for overall survival after IMLN recurrence. Patients with only IMLN recurrence and/or local lesion have a good prognosis. The significance of internal mammary lymph node (IMLN) as a second lymph node basin in breast cancer where 8%~37% tumors drain to IMLN while 1%~5% of tumor exclusively drain to the IMLN had been recognized as a major prognostic factor historically . HoweverFollowing surgery, systemic adjuvant chemotherapy is indicated in selected cases of localized disease based upon prognostic risk factors. All patients with hormone receptor-positive tumors should be considered for adjuvant endocrine therapy lasting for at least 5 years. Radiation of the chest wall and regional lymph nodes is suggested following mastectomy in selected high-risk patients. However, the value of IMLN irradiation without ignoring the risk of cardiac morbidity in the subset of patients with positive IMLN remains unclear presently while the prognostic significance of IMLN recurrences were scarce and controversial. Therefore, we undertake the initiative to review all the patients presented with IMLN recurrence at our institution in order to understand the characteristics associated with IMLN and its predicting influence on the prognosis of breast cancer so that we might have a better understanding in decision making for the most appropriate management for patients who had undergone radical or modified radical mastectomy. The aim of this study was to assess the chance of IMLN recurrence in a single institution, its associated risk factors with disease-free interval (DFI) and its predicting factors on overall survival time. A statistical analysis of a series of 133 breast cancer patients with IMLN recurrences is presented.IMLN recurrence in our study was defined as a soft nodule with a diameter of 1 cm or larger adjacent to the internal mammary vessels within the first through sixth parasternal anterior intercostal space on spiral chest CT scan and/or confirmed by cytology. Surgical management usually performed at our center for patients with primary breast cancer included modified and radical mastectomy. Adjuvant chemotherapy for four to six cycles of cyclophosphamide, methotrexate, and 5-fluorouracil (CMF), cyclophosphamide, epirubicin, and 5-fluorouracil (CEF) and CEF followed by docetaxel are usually given for patients with node-positive disease or at high risk despite having node-negative disease. Adjuvant radiotherapy at a dose of 45-50 Gy delivered to fields including chest wall and supraclavicular area with a 10-Gy boost to tumor bed using targeted fields of electrons are recommended for postmastectomy patients with primary tumor size greater than 5 cm, 4 or more positive axillary lymph nodes, or positive pathologic margins. Adjuvant endocrine therapy was given for patients with ER/PR positive tumors while trastuzumab was not available for patients with HER-2 positive disease then. Patient was followed-up every 3 months after primary surgery with documented physical examination, every 6 months for ultrasonic examination, every 12 months for conventional CT-scan further spiral chest CT scan if indicated.To identify patients with IMLN recurrence, we reviewed all chest spiral CT (computed tomographic) reports covering a 5-year span from Feb 2003 through June 2008 when CT reports were recorded by computer at Cancer Hospital of Fudan University, Shanghai, China, which served a population of almost half million. All CT examinations were performed using a 40-row helical CT scanner operated at 120 kV and 100 mAs, with a maximized 45 × 45 cm field of view, a 512 × 512 matrix, and the table speed of 1.53 mm/0.5 seconds . CT images were obtained using consecutive 5 mm-thick CT scanning from the supraclavicular region to the top of diaphragm with breath holding. Each CT scan which reported internal mammary lymph node enlargement was reviewed again by two radiologists for the confirmation of clinically apparent IMLN recurrence.The frequency of IMLN recurrence in this series was 1.5% (133/8867) after radical (n = 59) or modified radical mastectomy (n = 74). The primary surgery time was between August 1988 and June 2007, the median surgery time was Mar 2003. Patients who received primary extended radical mastectomy were excluded from this study. IMLN status was not evaluated by sentinel LN biopsy.th AJCC staging manual, 17 (12.8%) patients had stage I, 89 (64.4%) had stage II, and 29 (21.8%) had stage III disease. 78 (58.6%) patients were ER/PR positive. 29 (21.8%) had HER-2 positive disease (HER-2 positive was defined as +++ by IHC method or FISH positive). The most common histological type was invasive ductal carcinoma, with 46% of the tumors located at the areola and inner quadrant area.The median age at surgery was 57 years, with 78 (58.6%) patients being postmenopausal. The median primary tumor size was 2.5 cm (range: 1-7 cm), among which 31.6% (n = 42) was ≤ 2 cm, 63.2% (n = 84) was between 2 cm to 5 cm, and 5.2% (n = 7) > 5 cm. Number of ALN involvement was negative in 46.6% (n = 62) patients, 1~3 in 32.3% patients (n = 43), and ≥4 in 21.1% patients (n = 28). According to 6After primary surgery, 124 (93.2%) patients received adjuvant chemotherapy. Only 15.8% (21/133) received adjuvant radiotherapy due to worrisome of the toxicity of radiotherapy. All patients with ER/PR positive tumors received adjuvant endocrine therapy . The median follow-up time was 52 months (range: 10-246 months). All patients' characteristics were listed in Table 90% patients were followed as planned while 10% present with recurrent disease at a more serious condition due to poor compliance. All 133 patients were evaluated for distant metastases using abdominal CT/MRI and bone scan after the diagnosis of IMLN recurrence. The types of therapy right after IMLN recurrence were recorded. Endocrine therapy was most commonly used for patients with ER/PR positive disease or at low risk of rapidly progressive disease. Patient with ER and PR negative, life-threaten condition or multiple metastatic sites often received chemotherapy. Radiotherapy was given either as initial or palliative treatment based on patients' disease presentation.DFI of IMLN recurrence was calculated from the primary surgery to IMLN recurrence. The overall survival time was calculated from the IMLN recurrence until death or last follow-up. Actuarial curves were compared by the two-tailed log-rank test and difference of p ≤ 0.05 was considered significant. The independent prognostic significance of variables on the events and survival, proved to be significant factor in univariate analysis, was tested in proportional hazards regression models described by Cox. Survival analysis was carried out using life-table and Kaplan-Meier method. The estimates of the models are given as hazard ratio (HR) with 95% confidence intervals (95% CI).Written informed consent was obtained from all patients at the time of admission. The study had been approved by the Fudan University Cancer Hospital Ethic Committee for Clinical Investigation. Patients' charts were retrieved and patients' characteristics, disease characteristics, and initial treatments after IMLN recurrence and patients' survival were collected for analysis.Among the 133 patients, IMLN recurrence was presented as the first metastatic site in 121 (91.0%) patients, only 12 had other sites of metastases prior to IMLN recurrence. 88 (66.2%) patients had other concurrent metastasis sites, 45 patients had isolated IMLN recurrence, of whom 23 developed distant metastases later. There were 48 cases (36.1%) with ipsilateral visible soft tissue mass beside the sternum, among which cytology examination had been presented for 33 patients, all confirmed recurrence. There were 20 (15.0%) cases with localized skin involvement with painful presentation.The typical CT-scan presentation was enlargement and swelling of IMLN located on the ipsilateral side with the formation of a local lump and sternal erosion Figure . Median The median DFI of IMLN recurrence was 38 months (range: 4-241 months). Tumor size, ER/PR status, adjuvant radiotherapy for T > 5 cm were variables that significantly influenced the DFI of IMLN recurrence , and ER/PR status Table .The median survival time after IMLN recurrence was 42 months, and the 5-year survival rate was 30% for all patients. The 5-year survival of patients without concurrent other sites metastasis was 43%. The results of univariate analysis of the tested prognostic variables are shown in Table p = 0.031), presence of endocrine therapy for patients with positive ER/PR , presence of sequential radiotherapy delivered to the IMLN area .The four factors proved to be significant in univariate analysis were tested by multivariate analysis , and Stage II disease (P = 0.017) were associated significantly with any regional lymph node recurrence . Bijker et al reported the significant independent factors were tumor size > 5 cm (measured by pathology) (p = 0.0002). Conflicting results have been reported regarding the influence of ALN status on regional recurrence [Recurrence in the IMLN is rare, despite the fact that these nodes are the second LN drainage basin of breast cancer and are left untreated after surgery in most patients. Tumor location, positive ALN, younger age, and larger tumor size (>5 cm) had been reported as high risk factors of tumor cells drainage to IMLN , but thecurrence ,20. SincSeveral studies reported that adjuvant treatment modalities did not influence the risk of local recurrence after breast-conserving surgery for early-stage disease -23. HoweThe 5-year survival rate of the 133 patients was 30% while that for those with isolated IMLN recurrence was 43%. The results is similar to the findings of other studies on isolated local recurrence (IRL) of breast cancer, ranging from 39-84%, IRL defined as new breast tumor, chest wall recurrence, overlying skin recurrence, supraclavicular recurrence ,26-29. STime to ILR, the most frequently reported prognostic factor for survival after local recurrence post breast-conserving surgery was also reported in our study for IMLN recurrence after radical or modified radical breast cancer surgery -30. EndoThe 2008 National Comprehensive Cancer Network Clinical Practice Guidelines recommend consideration of radiation therapy to internal mammary nodes for patients with node-positive breast cancer after mastectomy or breast-conserving surgery, noting "substantial controversy" on this topic. But as isolated IMLN recurrence is rare, it is unlikely that parasternal irradiation will result in a significant reduction of the risk of clinically apparent IMLN recurrence, based on the negligible risk of IMLN recurrence without adjuvant radiotherapy. Thus, we strongly advocate that if IMLN is clinical or pathological negative, it should be left untreated regardless of the status of axillary nodes.In conclusion, our data show that the risk of IMLN recurrence is low and there are certain characteristics features on CT images. ER/PR status is both a risk factor for DFI of IMLN recurrence and a prognostic factor for overall survival after IMLN recurrence. Patients with only IMLN recurrence and/or local lesion have a good prognosis.The authors, their immediate families of this paper have no potential conflict of interest to disclose.LC participated in acquisition of data, analysis and interpretation of data, and drafting of the manuscript. YG and PW confirmed chest spiral CT. SL revised the manuscript. XH, JC, JL and ZS participated in acquisition of data. ZW conceived of the study, participated in its design and coordination and revised the final manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/479/prepub

This review will briefly summarize recent advances in the pathophysiology of AD and focus on the pharmacological treatment of the cognitive and functional symptoms of AD. It will discuss the roles of vascular prevention, cholinesterase inhibitors and an NMDA-antagonist in the management of AD. It will address the issues thought to be related to the lack of persistence or discontinuation of therapy with cholinesterase inhibitors shown in recent studies and some of the solutions proposed. These include setting realistic expectations in light of a neurodegenerative condition and available symptomatic treatments, slowly titrating medications, and using alternate routes of administration. Finally, it will introduce future therapeutic options currently under study.Alzheimer’s disease (AD) is the most common neurodegenerative disorder. Worldwide prevalence of the disease is estimated at more than 24 million cases. With aging of populations, this number will likely increase to more than 80 million cases by the year 2040. The annual incidence worldwide is estimated at 4.6 million cases which is the equivalent of one new case every seven seconds! The pathophysiology of AD is complex and largely misunderstood. It is thought to start with the accumulation of beta-amyloid (Aβ) that leads to deposition of insoluble neuritic or senile plaques. Secondary events in this “amyloid cascade” include hyperphosphorylation of the protein The year 2006 marked the centennial of the description by Alois Alzheimer of the first case of the disease that will eventually hold his name. Alzheimer’s disease (AD) is the most common neurodegenerative disorder. Worldwide prevalence of dementia is estimated at more than 24 million cases . The anntau hypothesis, which are ardently supported by the so-called “baptists” and “tauists” respectively [1). Sequential cleavage of APP by α-secretase and γ-secretase leads to the production of a small, non-toxic, and soluble peptide, referred to as p3. The sequential cleavage of APP by β-secretase and γ-secretase leads to the production of the insoluble beta-amyloid protein that deposits into plaques. Beta-amyloid (Aβ) is neurotoxic in vitro [tau and generation of neurofibrillary tangles, inflammation, oxidation, and excitotoxicity [The pathophysiology of AD is complex and incompletely understood. Several hypotheses have been suggested to explain the series of events that eventually lead to the clinical manifestations of the disease. Presently, the two main competing hypotheses are the amyloid-cascade hypothesis and the hyperphosphorylation of protein ectively . These hectively , 17. In ectively , 131. Thectively , 67. Theectively . Neurofiectively , 112 and eventually NFTs [The main alternate hypothesis to the amyloid cascade lends a central role to hyperphosphorylation of the protein lly NFTs , 74, 125lly NFTs . This isRecent data suggest that cerebrovascular disease plays an important role in the pathophysiology of AD. There are epidemiological, clinical and pathological similarities between AD and vascular dementia. Also, regional brain hypoperfusion leading to hypometabolism, degenerative changes and cognitive impairment have been described in early stages of AD. These principles are known as the Critically Attained Threshold of Cerebral Hypoperfusion (CATCH) theory . AccordiCognitive outcome measures include the Alzheimer’s Disease Assessment Scale – cognitive subscale [Mini-Mental Status Examination [Severe Impairment Battery [Global measures include the Clinical Global Impression of Change [Clinician Interview-Based Impression of Change (CIBIC – scored from 1 to 7 similarly to the CGIC) [Functional measures include the Progressive Deterioration Scale [Alzheimer’s Disease Cooperative Study Activities of Daily Living inventory [Disability Assessment for Dementia scale [Alzheimer’s disease progressively impairs cognitive abilities and behaviour, leading to gradual functional decline. Outcome measures used in clinical trials are selected to mirror clinical hallmarks of the disease. Typically, these trials include a combination of measures evaluating cognition, clinicians’ and caregivers’ impression of change, functional abilities and behaviour. Pharmacological treatment of behavioural and psychological symptoms of dementia (BPSD) have been recently reviewed in this journal . We willormance) , the Minormance) , and theormance) . Global ectively), and thehe CGIC) . Functioormance) , the Alzormance) , and theormance) . Results of clinical trials in primary prevention of AD are contradictory. Three studies have shown that optimal use of antihypertensive agents in systolic and diastolic hypertension as well as after a cerebrovascular event is associated with a reduction in the incidence of cognitive impairment , 127. ThNeurochemical studies of neurons from the basal forebrain of individuals with AD have shown a deficit in choline acetyl-transferase leading to a decrease in the production of acetylcholine and cortical cholinergic dysfunction . These sDonepezil is a piperidine derivative that reversibly inhibits acetylcholinesterase . It is vA recently published Cochrane review evaluating donepezil in AD included 24 trials and 5796 participants in mild to severe stages of the disease . The res2, and the effective and maximal dose is 10 cm2.Rivastigmine is a carbamate derivative that reversibly inhibits both acetyl- (AChE) and butyryl- (BuChE) cholinesterase . It is tInvestigation of transDermal Exelon in Alzheimer’s disase (IDEAL) study compared two doses of transdermal rivastigmine with the oral form [2 dose was not associated with more clinical benefit and led to more side-effects. The smaller 10 cm2 dose which is the highest commercially available dose was associated with similar clinical benefit than the maximal oral dose, but with significantly less gastrointestinal side-effects. Neither dose of transdermal rivastigmine led to behavioural benefits compared to placebo. The authors of the Cochrane review conclude: “ Rivastigmine appears to be beneficial for people with mild to moderate Alzheimer’s disease…improvements were seen in the rate of decline of cognitive function, activities of daily living, and severity of dementia…”. A plasma and Cerebrospinal fluid (CSF) biomarker study evaluated the long-term ChEI inhibitory effect of rivastigmine in eleven patients with AD treated for 12 months. This uncontrolled study showed persistent inhibition of both AChE and BuChE in plasma as well as CSF [A Cochrane review evaluating rivastigmine in AD has recently been updated and includes 9 trials and 4775 patients . It showral form . The higl as CSF . This coGalantamine is a tertiary alkaloid agent that reversibly inhibits AChE . It alsoA recently published Cochrane review evaluating galantamine in mild to moderate AD and Mild Cognitive Impairment (prodrome of dementia) included 10 trials and a total of 6805 participants . The resConsolidated Standards of Reporting Trial (CONSORT) checklist concluded that 27% to 55% of these criteria per study were inadequately reported [Four clinical trials compared the ChEI’s in AD and led to conflicting results . A carefreported . Considereported . On thisreported . Studies have shown that enhancement of the excitatory effects of the neurotransmitter glutamate may play a role in the pathogenesis of AD (theory of “excitotoxicity”) . MemantiThe Cochrane review evaluating memantine included 3 clinical trials in moderate to severe AD and three unpublished studies in mild to moderate AD . In modeRelatively few clinical trials have evaluated cost-effectiveness of pharmacological treatment in AD. The Cochrane review on donepezil considered the results of the two trials allowing cost-benefit evaluation and concluded: “There is some evidence that use of donepezil is neither more nor less expensive compared with placebo when assessing total health care resource cost.”, 46. SevNumbers Needed to Treat (NNT) for clinical benefits and Numbers Needed to Harm (NNH) for side-effects of ChEI’s [Overall, the benefits of symptomatic treatments in AD are modest. Some authors argue that the magnitude of this benefit, though statistically significant, is marginal at best and may even be difficult to detect, measure and quantify clinically , 100. A f ChEI’s . This stf ChEI’s . How do American Academy of Neurology [British Association of Psychopharmacology [American Association for Geriatric Psychiatry [Recommendations for Best Practices in the Treatment of AD in Managed Care [Canadian Consensus Conference of Diagnosis and Treatment dementia [CCCDTD states that “all three cholinesterase inhibitors available in Canada are modestly efficacious for mild to moderate AD. They are all viable options for most patients with mild to moderate AD” . The AAN recommends that: “cholinesterase inhibitors should be considered in patients with mild to moderate AD (Standard), although studies suggest a small average degree of benefit.” The consensus statement from the British Association for Psychopharmacology states: “There is type 1a evidence for the efficacy of memantine in the treatment of moderate to severe Alzheimer’s disease”. Conversely, the National Institute for Health and Clinical Excellence (NICE) in the UK made the following recommendations based on a cost-effectiveness evaluation of ChEI’s in AD: “The three acethylcholinesterase inhibitors donepezil, galantamine, and rivastigmine are recommended as options in the management of patients with Alzheimer’s disease of moderate severity only.” [American College of Physicians and the American Academy of Family Physicians conclude : “Clinicians should base the decision to initiate a trial of therapy with a cholinesterase inhibitor or memantine on individualized assessment.” [Published guidelines on symptomatic treatment for AD vary in the strength of their recommendations. Certain consensus guidelines consider at least a trial of ChEI and/or memantine as a standard approach in the pharmacological treatment of AD. These include the recommendations from the eurology , the Brmacology , the Ameychiatry , Recommeged Care , and thedementia . For exay only.” . They adssment.” , 100. ThTwo observational administrative database studies evaluated persistence with the three available ChEI in two Canadian provinces , 85. TheIn vitro and in animal models of AD, it has been shown to have mitochondrial stabilizing properties leading to improvement in neuronal function and inhibition of cell death [Latrepirdine is a non-selective anti-histaminic agent that has been used as an anti-allergic medication in Eastern Europe. ll death . In a siAll currently available treatment options for AD are symptomatic and do not modify natural progression of the disease. Disease-modifying approaches are constantly being explored. Several agents under study target the amyloïd cascade. They can be divided into three general categories: agents aiming at decreasing the production of Aβ, at reducing its aggregation, or at increasing its clearance , 71. AgeInhibition of protein tau phosphorylation is also being explored in animal models and pilot human studies in AD. Agents in this category include glycogen synthase kinase 3-β (GSK3-β) inhibitors such as lithium and valpOther agents being tested target oxidative stress in AD, neuroinflammation, cholesterol metabolism and the neuroendocrine pathways , 71. Development of disease-modifying treatments in AD faces many challenges that will need to be considered in future research and clinical trials. Novel pharmacological agents will need to cross the blood-brain barrier and be readily bioavailable to the central nervous system. Several of the secretases being targeted have numerous substrates some of which are required for normal function. Hence, total inhibition rather than modulation may lead to unacceptable adverse events. Transferring results of animal model research to humans has been fraught with obstacles as demonstrated by the immunization trials. Finally, methodology in clinical trials will need to be adapted to detect disease-modifying effect, and this may lead to longer and more expensive studies. In conclusion, AD is a common and costly disease. Currently several symptomatic treatments are available that provide mild benefits that are nevertheless dose-dependent, clinically detectable, and reproducible across clinical trials. Sustained use of these medications needs to be improved for optimal benefit. This can be achieved by tailoring doses and titration to the individual patients to enhance tolerance, and mostly, setting realistic expectations in face of a neurodegenerative disease and symptomatic treatments. Several agents under study are potentially disease-modifying and may significantly alter the otherwise inexorable deterioration in AD. It is such treatments that will significantly improve clinical symptoms of the disease and lead to robust pharmacoeconomic benefits such as the reduction of resource utilisation. However, when expensive disease-modifying agents will become available, they will present the clinician with many clinical and ethical challenges as to their indications, decisions to combine or discontinue treatments. These challenges will need to be considered in future clinical trials.

P<0.0001) than in group II (69.6 months) but did not significantly differ in group II and III (69.6 months vs 65.0). Such 5-year follow-up data show that preoperative circulating prostate cells are an independent prognosis factor of recurrence. Moreover, tumour handling induces cancer-cell seeding but surgical blood dissemination does not accelerate cancer evolution.In clinically organ-confined prostate cancer patients, bloodstream tumour cell dissemination generally occurs, and may be enhanced by surgical prostate manipulation. To evaluate cancer-cell seeding impact upon patient recurrence-free survival, 155 patients were prospectively enrolled then followed. Here, 57 patients presented blood prostate cell shedding preoperatively and intraoperatively (group I). Of the 98 preoperatively negative patients, 53 (54%) remained negative (group II) and 45 (46%) became intraoperatively positive (group III). Median biological and clinical recurrence-free time was far shorter in group I (36.2 months, In cancer surgery, local and distant recurrences may be explained by incomplete resection, leaving behind residual cancer cells in the resected stump area, and/or presence of undetectable regional micrometastases. Highly frequent detection of tumour-surrounding tissue-derived cells in the bloodstream during surgical tumour handling has often been reported in case of liver, colon, breast, gastric, and lung adenocarcinomas (μl cDNA (25 PCR cycles with 1 min hybridisation at 60°C at each cycle). After the first amplification was done, 1 μl of the amplification product was poured into two distinct tubes to perform nested PCR using inner couples of primers for 25 additional cycles with 1 min hybridisation at 60°C at each cycle. As each forward primer was labelled at 5′-terminus by 6-FAM, fluorescent PCR products were analysed using Genescan technology on a 3100 genetic analyser . Robustness of the method was tested using LNCaP prostate cell line spiking experiments in normal blood. Limit of detection was found very low, detecting as few one prostate cell in 1 ml blood. Accuracy was also checked with intra- and inter-assay coefficients of variation of 8.9 and 10.5% respectively. No false positivity was observed in more than 100 healthy individuals who were tested as controls confirming the specificity of the method. Biochemical progression was defined as two consecutive serum PSA values of 0.2 ng ml−1 or greater . To determine if RT–PCR results correlated with progression-free survival, a Cox regression was performed, and included preoperative PSA, Gleason score, pathological stage and RT–PCR results. The recurrence-free results were also assessed by the product-limit method of Kaplan–Meier. Comparisons between groups were performed by the log-rank method .We enrolled prospectively 176 consecutive men presenting biopsy-established prostate adenocarcinoma clinically confined to the prostate gland according to standard criteria and undergoing RP. None of them received hormonal therapy before surgery. Among this group, 21 were lost and only 155 patients were analysed. Clinical and pathological staging was performed using the TNM92 system, and patient stages were either pT2N0M0 or pT3N0M0 (casuistic is summarised in n=53) and group III preoperatively negative/intraoperatively positive patients (n=45). Although some of the clinical/biological factors remained relevant in the multivariate analysis , the preoperative positivity of circulating prostate cells emerged as the strongest predictor of progression-free survival (P<0.001). The median biological and clinical recurrence-free time was two times as short for group I preoperatively positive patients as for groups II and III preoperatively negative patients (Blood dissemination of prostatic cells was preoperatively present in 57 patients (37%) (Group I) and absent in the 98 remaining patients (63%). Of these 98 preoperatively negative patients 45 (46%) became intraoperatively positive. Thus, regarding surgically induced blood prostatic cell shedding, two groups of patients can be differentiated: group II including preoperatively negative/intraoperatively negative (<0.0001) thus sho818, NS) , revealiRefinements in surgical treatments have reduced surgical mortality in patients with solid epithelial tumours. The fate of cancer patients is generally linked to early tumour cell dissemination initially undetectable by conventional means . These dNevertheless, surgical cure requires that the tumour should be removed without inadvertent spillage of cancer cells at the time of organ handling and surgical manipulations. It is now well established that surgical variations do exist together with measurable rates of both local recurrence and survival preoperatively and (ii) during manipulation of the tumour. The preoperative blood spillage of prostatic cells show a strong biological recurrence predictive power, which is independent of other classical markers such as blood PSA initial levels. Thus, preoperative circulating prostate cells detection can be used as an additional marker to better stadify patients. Prostate cell blood dissemination was also detected intraoperatively, nevertheless, such spillage has not been shown to have any statistically significant adverse effect on recurrence, which seems to exclude tumour surgical management as a major cause of metastatic development. Our results suggest that intrinsic factors linked to the tumour itself mainly contribute to cancer evolution and subsequent poorer prognosis.

Even though organic light-emitting device (OLED) technology has evolved to a point where it is now an important competitor to liquid crystal displays (LCDs), further scientific efforts devoted to the design, engineering and fabrication of OLEDs are required for complete commercialization of this technology. Along these lines, the present work reviews the essentials of OLED technology putting special focus on the general working principle of single and multilayer OLEDs, fluorescent and phosphorescent emitter materials as well as transfer processes in host materials doped with phosphorescent dyes. Moreover, as a prototypical example of phosphorescent emitter materials, a brief discussion of homo- and heteroleptic iridium(III) complexes is enclosed concentrating on their synthesis, photophysical properties and approaches for realizing iridium based phosphorescent polymers. Since the first observation of organic electroluminescence in the 1960s by applying hundreds of volts to an anthracene single crystal . BoostedAlthough OLEDs already meet the requirements for some practical applications in, e.g., portable electronics like cellular phones or digital cameras with opeet al. in 1987 immobilized on a transparent carrier material such as glass or a flexible polymer . Al. Al37·nHtris-cyclometalated iridium(III) compounds was published in the early 1980s being observed as a byproduct of the synthesis of di-μ-chlorotetrakis-2-phenyl-pyridine)diiridium(III) . Ho. Hotris-operties –63 and uoperties , therefotris-cyclometalated iridium complexes, an alternative synthesis approach is based on incorporating ancillary ligands such as acetylacetonates complexes has received considerable attention because of a series of practical applications such as flat-panel displays. Even though numerous organoiridium compounds have been reported giving efficient electroluminescence in the red , green and blueThe absorption and emission spectra of phosphorescent metal complexes are in general influenced by various parameters such as the valence electron configuration at the metal, the type of the electronic transitions or the correlation among lower lying electronic excited states . Similar6 and d8 transition metal complexes and play, therefore, a major role in the photophysics of iridium(III) compounds. Intraligand (IL) π–π* excited states originate from electronic transitions of the ligand. If the metal perturbation upon coordination is minimized, their spectral properties often closely resemble the free ligand states. Finally, ligand-to-metal charge transfer (LMCT) excited states are occasionally observed in complexes with metal atoms in high oxidation states or in d10 complexes [Among them, metal-centered (MC) excited states are typically present in metal complexes with partially filled d shells at the metal center. The corresponding d-d transitions are Laporte-forbidden and, consequently, exhibit very low transition probabilities. Metal-to-ligand charge-transfer (MLCT) states involve electronic transitions from metal based d orbitals to a ligand centered π* antibonding orbital. Emissive MLCT states are particularly observed in domplexes , 78, 79.All these transitions determine the photophysical properties of transition metal complexes and can be used for the interpretation of experimentally observed spectra or prediction of absorption and emission characteristics of novel compounds , 78, 79.−1 cm−1 complexes typically display absorption bands with extinction coefficients between approximately 50000 and 6000 L molvia changing the ligand structures luminophores applying the above described tuning procedures giving materials with a broad range of excited state lifetimes and quantum yields approaching 100% . As a coEven though many phosphorescent dyes are very promising candidates for realizing highly efficient OLEDs, for numerous phosphorescent small molecules serious problems such as the complexity of device fabrication or insufficient fine-dispersion of the dopant in the host material have been encountered. Especially phase separation is concerned as critical drawback, thus, covalent incorporation of the phosphorescent chromophores into polymers has received considerable attention.As a result, numerous concepts for the preparation of phosphorescent polymers have been proposed, among them utilization of ring-opening metathesis polymerization (ROMP), click-chemistry, the use of cross-linkable iridium complexes, grafting approaches or radical polymerization techniques –96. In aHerein the essentials of OLED technology have been reviewed putting special focus on the working principle of single and multilayer OLEDs as well as the use of fluorescent and phosphorescent emitter materials. After discussion of the advantages of phosphorescent dyes doped into suitable host materials and the corresponding energy transfer processes, the synthesis and photophysical properties of phosphorescent iridium(III) complexes have been enclosed. It has been shown that this class of materials exhibits photophysical characteristics readily tuned by changes of the cyclometalating and/or ancillary ligands, thus being ideal candidates for applications in, e.g., full color displays. Furthermore, different strategies for incorporating iridium complexes into polymers have been presented giving phosphorescent polymers with reduced phase separation in combination with facilitated device fabrication (e.g. solution processing).The development of OLEDs has undoubtedly been empowered by different applications in display technology. As a consequence, tremendous scientific efforts have been devoted to this topic concentrating on the design, engineering and fabrication of OLEDs. Nevertheless, the intrinsic limits of OLED technology have not been reached yet. Hence, further progress in device physics and materials science is necessary to provide a step forward to the complete commercialization of this highly promising technology.

In 2004, a major outbreak of hepatitis A among tourists returning from Egypt involved 351 case-patients from 9 European countries who were infected with a single strain (genotype 1b). The case-control study identified orange juice as the most likely infection vehicle. Vaccination against hepatitis A virus is strongly recommended before travel to disease-endemic areas. In Germany, approximately half of the 1,400–2,300 cases of laboratory-confirmed HA reported annually since 2001 were acquired abroad. In mid-August 2004, infectious disease surveillance in Germany showed a strong increase of HAV infections in tourists returning from Egypt, where HA is highly endemic (The line listing of HA patients included persons with laboratory evidence of recent HAV infection (anti-HAV immunoglobulin M [IgM]) who stayed at hotel X after June 1, 2004. Also listed were hotel guests with HA disease , without laboratory confirmation, who had traveled with persons with laboratory-confirmed cases.A case-control study was performed among hotel X guests >17 years of age residing in 3 German states. The time span between the earliest arriving case-patient's last day at hotel X and the latest arriving case-patient's first day there was defined as the "minimum period of transmission" (MPT). Case-patients came from the line listing. Healthy hotel guests who stayed at the hotel during the MPT who had neither been vaccinated against HAV nor previously infected with HAV were eligible as controls. Telephone interviews were conducted with a standardized questionnaire that elicited information on demographic factors, foods and drink consumption, and participation in recreational activities such as swimming, day trips, etc.2 tests) and multiple logistic regression were performed ; p<0.05 was considered statistically significant. The Egyptian authorities' investigation included testing all hotel employees for HAV antibodies , and scrutiny of food suppliers. Serum samples were obtained from German case-patients for testing by reverse transcription–PCR (RT-PCR) in the VP1–2A junction and sequencing of a 160-bp-long PCR fragment of the VP1 region.For statistical analysis, exposures were dichotomized into "ever" versus "never," and the "number of days exposed" was calculated. Univariate analysis persons. Case-patients were 2 to 67 years of age (median 34 years) and 54% were male. Overall, 47% of case-patients were hospitalized. Risk of hospitalization rose with increasing age (p for trend = 0.001). The MPT lasted from June 24 to July 23 . No moreSixty-nine HA case-patients (60% response among the 115 case-patients in the 3 states) and 36 controls were included in the statistical analysis. Eighty-seven percent of the case-patients reported absence from work for 3 to 56 days (median 26 days), and 54% of the case-patients were hospitalized for 2 to 25 days (median 9 days).Case-patients and controls did not differ significantly by age, sex, recreational activities, consumption of ice cream or salads, or other foods consumed or behavioral characteristics. Case-patients were significantly more likely to have drunk orange juice served at the breakfast buffet (82%) than were controls (64%) . In multivariate analysis, no other exposures were retained. A dose-response relationship became apparent between number of days of orange juice consumption and HA . Case-paThe on-site investigations in Egypt did not identify hotel staff positive for HAV IgM. Minimal fluctuation among hotel staff renders it unlikely that an HAV-positive employee was missed. Investigations at the orange juice producing plant found significant hygiene problems. In addition, the finished product did not undergo heat treatment. This producer did not cater to other hotel chains in Hurghada.This large outbreak demonstrates risk and clinical impact of HA for nonimmune travelers to HA-endemic countries. In Germany, the outbreak accounted for 12% of all HA case-patients notified in the year 2004.The results of the outbreak investigation strongly point to orange juice as the infection vehicle. In the case-control study, among a broad range of foodstuff, beverages, and recreational activities queried, the consumption of orange juice was the only exposure significantly associated with HA, with higher doses of juice significantly increasing HA risk. These findings are corroborated by the inspection of the hygienic conditions under which the juice was produced in Egypt. The juice was most likely contaminated during the manufacturing process, e.g., by an infected worker with imperfect hand hygiene or by contact of fruit or machinery with sewage-contaminated water.,–>15 days (Citrus fruit and citrus juices have only rarely been implicated as vehicles of HA outbreaks, with contamination typically described during preparation just before consumption (The fact that juice was consumed by 60% of healthy controls may be explained in part by fluctuating virus concentration within the juice, which resulted in varying degrees of infectiousness during the 4-week period. A contaminated lot may have been phased-in and out slowly by gradual mixture with other lots. Also, the study design did not allow the exclusion of controls who did not know they were immune.The Hurghada outbreak-strain clearly differs from strains that have caused nontravel-associated outbreaks in Germany in recent years. Two large autochthonous outbreaks were caused by HAV type 1a strains (Vaccination against HA is recommended for all nonimmune travelers to HA-endemic areas (

Members of the calcium-activated chloride channel (CLCA) gene family have been suggested to possess a variety of functions including cell adhesion and tumor suppression. Expression of CLCA family members has mostly been analyzed in non-neural tissues. Here we describe the expression of mouse and human CLCA genes in the nervous system.We show that from the six mouse CLCA family members only Clca1, Clca2 and Clca4 mRNAs are expressed in the adult brain, predominantly in olfactory ensheathing cells. During mouse nervous system development Clca1/2 is more widely expressed, particularly in cranial nerves, the diencephalon and in the cerebral cortex. While human CLCA2 and CLCA4 genes are widely expressed in brain, and at particularly high levels in the optic nerve, human CLCA3, the closest homologue of mouse Clca1, Clca2 and Clca4, is not expressed in the brain. Furthermore, we characterize the expression pattern of mouse Clca1/2 genes during embryonic development by in situ hybridization.The data published in this article indicate that within the nervous system mouse Clca1/2 genes are highly expressed in the cells ensheathing cranial nerves. Human CLCA2 and CLCA4 mRNAs are expressed at high level in optic nerve. High level expression of CLCA family members in mouse and human glial cells ensheathing nerves suggests a specific role for CLCA proteins in the development and homeostasis of these cells. Calcium activated chloride currents have been characterized in a number of cell types including smooth muscle, skeletal muscle and epithelium. Physiologically, it has been shown that activation of calcium-activated chloride current plays a prominent role in among others the maintenance of smooth muscle tone, epithelial secretion and vertebrate olfactory transduction. The precise molecular identities of the currents are still hotly debated. Proteins belonging to CLC, CLCA, bestrophin and tweety gene families have been proposed to function as calcium activated chloride channels [reviewed in ].The CLCA gene family includes 4 genes in humans, 5 genes in rat and 6 genes in mouse. The nomenclature of the CLCA genes in different organisms is somewhat confusing since the numbering of different genes does not reflect the actual homologies between the genes in different organisms but rather the time of characterization [reviewed in ].Although a lot of evidence shows the involvement of CLCA proteins in mediating chloride conductance, it is still unclear whether CLCA proteins are channels themselves. It has been shown that there are differences in endogenous chloride current characteristics in normal versus CLCA over-expressed cells . Also, aIn addition to their functions as chloride channels or channel modulators, some CLCA family members function as cell adhesion molecules ,8 and tuExpression analysis by RT-PCR of mouse Clca family members, has revealed that mClca1 is expressed at high levels in spleen and bone marrow and mClca2 in mammary gland. Moderate or low expression levels of both genes were found in most tissues with only mClca1 expressed in brain tissue . ExpressTo date, expression analysis has shown that only mClca1 is expressed in the mouse brain. However, in case of mClca3 and 4, brain tissue was not included in the expression analysis. In this study we describe the spatio-temporal expression of mClca1, 2 and 4 genes in the nervous system. We show that these genes are expressed in the olfactory ensheathing cells. In addition we also describe the expression pattern of human CLCA2 and 4 genes in the nervous system. Finally, we describe the expression pattern of mClca1/2 during embryonic development by in situ hybridization.Total RNA from NMRI mouse tissues and total RNA from postmortem adult human brain regions was extracted using RNAWiz (Ambion) according to the manufacturers instructions. Total RNA from human non-neural tissues was obtained from Clontech. First-strand cDNAs were synthesized with Superscript III (Invitrogen) reverse transcriptase using 5 μg RNA as recommended by the manufacturer.PCR reactions were performed in a volume of 25 μl, using 1/50 of the first-strand cDNA reaction. Annealing temperature for different sets of primers ranged from 55–60°C. The number of cycles used varied from 25–35 for different primer sets. Number of cycles for different primer sets was determined empirically and we always analysed the PCR product in the exponential phase of amplification. PCR with primers specific for housekeeping gene HPRT and GAPDH were used as a control to determine the variation of the amount of cDNA in different PCR reactions.Real-time quantitative (Q) RT-PCR analysis of CLCA mRNA levels in adult mouse and human brain regions and during mouse brain development was performed in triplicates using qPCR Core Kit for SYBR Green I (Eurogentec) with Lightcycler 2.0 (Roche) according to manufacturers instructions. Data was normalized with housekeeping gene HPRT and analyzed with Lightcycler 4.05 software (Roche). Data was not normalized with HPRT in case of mClca1, mClca2 and mClca4 PCRs using equal amounts of cDNAs from different mouse brain developmental stages, since the level of HPRT mRNA is increased during development .Primers used in the experiments are the following:hclca1 sense ACGAACAAGGACACCAGCAAAhclca1 antisense AAGAGATCAGGTATGGGAGCAThclca2 sense TGCATGTCAATCACTCTCCCAhclca2 antisense GAGTTCCTATCCATTGCTCGThclca3 sense GAAGGAGCTCAAACAGACGAChclca3 antisense ACTTTCTACTGAACCAGGCTChclca4 sense GCCACAGTTCATGAGGATAAGhclca4 antisense CACAGACAATACCAGCGTAGmclca1sense CACCAGGATCACTGGCACCAATmclca1 antisense GCATCGATAAGGCTGTTTAGGTCmclca2 sense CGCCAGCATCACAGGCAAGAAGmclca2 antisense GCGTCGATAAGGCTGCTTACATGmclca4 sense TTCAGCAGGACAGCATCTGGmclca4 antisense TGCCACTTGTGCGATGTTGgapdh sense TTCCTACCCCCAATGTGTCCGTCgapdh antisense ACCCTGTTGCTGTAGCCGTATTCAhprt sense GATGATGAACCAGGTTATGAChprt antisense GTCCTTTTCACCAGCAAGCTTGhclca2real sense AGCACCTGGAGAAGACTTTGAhclca2real asense CTTGCTGAGGATTTCGCTTTGAhclca4real sense AGACCTTGATGCCACAGTTCAThclca4real asense TGGTGACAGATCAGTAGTATTTAmclca1 realS CACTGATAACTTGCGTATCTACmclca1 realAS CACAGTTGTGAACCACATTGGmclca2 realS TCACTGATAACTTGCGTATCTATmclca2 realAS ACACTCGTGGACCACCTTCTmclca4 realS AATGACAGCTCCTACCTAGCmclca4 realAS GGCTCCACTGTGTTTGACCT35S]UTP for labeling. The hybridization specificity was confirmed using [α-35S]-labeled sense riboprobes synthesized from the same templates. All sense probes resulted in the hybridization signal equivalent to the background. This shows that cRNA labeling of different CLCAs was specific. Primers used to generate probes were the following:DNA fragments for riboprobe generation were subcloned into pCRII-TOPO vector (Invitrogen), sense and antisense cRNA probes were synthesized with the MAXIScript In Vitro Transcription Kit (Ambion) T7 or SP6 RNA polymerase, using [α-CLCA12 sense ATAGTATCTCTGCACTGGTGCLCA12 antisense GAATGGATATCTAATTTCCATAGCLCA4 sense CCTCCTGGTCTGGGTACCAACLCA4 antisense ATAGACGCAAATAGGAAATTTACSerial saggital and coronal sections (14 μm) from fresh-frozen NMRI mouse brain were analyzed by in situ hybridization analysis following the previously described protocol . EmulsioPrevious analyses have shown that out of six mouse Clca genes only mClca 1 is expressed in the brain and is expressed at relatively low levels compared to other tissues where the gene is expressed [Quantitative real-time PCR analysis of mClca1, 2 and 4 expression during mouse brain development showed that expression of mClca1 was increasing during postnatal brain development and reached maximum levels in the adult mouse brain. mClca2 expression did not change during mouse brain development and mClca4 expression was low during embryonic development, highest around birth of the animal and the level of respective mRNA was gradually decreasing during postnatal development Fig .In order to analyze the spatial distribution of mClca1, 2 and 4 mRNA expression in the adult brain we performed real-time PCR anaysis using cDNAs from various regions of mouse brain. Strikingly, all the mClca genes expressed in the nervous system, were highly enriched in olfactory bulb Fig . ExpressTo further analyze the cellular distribution of mClca1,2 and 4 expression in brain, we performed in-situ hybridization on adult brain sections. Since mClca1 and 2 genes share 95% identity, we were unable to design probes that distinguish between these genes. Therefore, we consider the expression pattern of mClca1 and 2 together (marked mClca1/2). It should be noted however, that mClca2 was expressed at very low levels in the adult mouse brain Fig and therWe performed in situ hybridization analysis in order to characterize mClca1/2 expression during mouse development. Our analysis showed that at embryonic day 13 (E13) mClca1/2 is expressed at high levels in the developing urethra, midgut, aorta and heart Fig . High maIn situ hybridization analysis on E17 mouse embryos showed that high levels of mClca1/2 mRNA expression were retained in the developing urethra Fig . ExpressSince three mouse Clca gene family members were expressed in brain, we were interested if any of the four human CLCA genes are expressed in the nervous system. As the numbering of CLCA family members in human and rodents is different, we performed bioinformatic analysis to reveal which rodent Clca genes have closest homology to which human family members. Schematic depiction of human, mouse and rat CLCA loci is shown in Fig Our bioinformatic analysis showed that human CLCA3 is the closest homologue of mouse Clca1, 2 and 4 genes Fig . It sharhCLCA2 and 4 were differentially expressed in the adult brain as revealed by quantitative RT-PCR analysis Fig . The higIn this study we show novel expression sites for mouse Clca1, Clca2 and Clca4 genes. All six mouse Clca genes are located in chromosome 3 and are clustered in the same locus. Our RT-PCR and in situ hybridization analyses reveal that in the murine nervous system, mClca1, 2 and 4 genes are preferentially expressed in the olfactory ensheathing cells. In contrast to our findings, it has been previously shown that mClca2 is not expressed in the mouse brain . Our anamClca 1, 2 and 4 genes share highest similarity with each other within the gene family. At amino acid level mClca1 and 2 share 95% identity and mClca4 shares 81% identity with mClca2 and 80% identity with mClca1. Moreover, these three genes lie next to each other and form a 3' gene cluster in the Clca gene locus. Given their similar expression pattern in the nervous system, it could be argued that either their olfactory ensheathing cell specific expression is driven by a common regulatory element or each of these mouse genes has retained an olfactory ensheathing cell specific promoter element following gene duplication. Other reports have shown that the rat Clca genes most homologous to mouse Clca1,2 and 4, i.e. rbClca and rbClca2 are expressed in rat brain ,21. TheiOur analysis of mClca1/2 expression in the nervous system at early postnatal development revealed that it is expressed also in the layer II-III of the cerebral cortex. Interestingly the expression was seen only in the frontal part of the developing cortex. At E17 mClca1/2 expression was more widespread in the brain, with prominent expression in diencephalon. During embryonic development mClca1/2 expression was seen in the developing nerves of the peripheral nervous system. We could detect expression at E13 in the developing olfactory nerve and spinal nerves and at E17 in the optic nerve, trigeminal nerve and olfactory nerve. It is possible that mClca1/2 expression marks the glial cells ensheathing peripheral nerves.In this study we have also analyzed the expression of human CLCA genes in the nervous system. Human CLCA locus contains 4 genes. The most 3' of the genes is hCLCA3, which is also most closely related to mClca1, 2 and 4. RT-PCR analysis showed that unlike its mouse homologues, hCLCA3 is not expressed in the nervous system. In contrast, our results show that two other members of the family, hCLCA 2 and 4 are expressed in various parts of human brain. It has previously been shown, using RNA dot-blot analysis, that hCLCA4 is expressed rather uniformly in the brain with striking absence in the cerebellum . HoweverIn this study we have shown that mClca1, mClca2 and mClca4 are expressed in the olfactory ensheathing cells of the adult mouse CNS. During mouse development mClca1/2 widely expressed in the CNS but at particularly high levels in cranial nerves. In addition, we found that mClca1/2 is expressed in layer II of the developing cerebral cortex at P9. Our analysis also reveals that hCLCA2 and hCLCA4 are expressed in the CNS of adult humans.TT and DM contributed to the design of the experiments and to the preparation of the manuscript. MP performed the experiments and contributed to the design of the experiments and to the preparation of the manuscript.

Bcl-2 has been demonstrated to inhibit apoptosis in breast cancer cells in vitro, and the ratio between Bcl-2 and its proapoptotic homologue Bax seems to be an important determinant of cellular sensitivity to induction of apoptosis. However, little information is available on the relationship between Bcl-2 and the rate of apoptotic and necrotic cell death in breast tumours. From a series of 441 premenopausal, lymphnode-negative breast cancer patients, a subset of 49 tumours was selected in which immunostaining for the 26-kDa isoform of Bcl-2 was either absent (n = 23) or very high (n = 26). High expression of Bcl-2 was found to be strongly associated with low rates of apoptotic (P < 0.001) and necrotic cell death (P < 0.001). The mean value of the apoptotic index was 2.69%+/-1.40% in Bcl-2-negative tumours and 0.68%+/-1.00% in Bcl-2-positive tumours. Expression of the proapoptotic protein Bax correlated neither with Bcl-2 nor with the frequency of apoptotic cells. Immunostaining for the antiapoptotic Bcl-2 homologue BcI-X(L) correlated with Bcl-2 expression (P < 0.001) but not with apoptosis. High proliferation rate and high tumour grade (Bloom-Richardson) were strongly associated with absence of Bcl-2 expression (P< 0.001). p53 accumulation was associated with absence of Bcl-2 expression and increased apoptotic activity. Loss of Bcl-2 expression was strongly correlated with increased apoptotic and necrotic cell death, high proliferation rate and high tumour grade, supporting a model in which Bcl-2 not only mediates cell death, but also cell division in breast cancer tissue, and in which regulation of cell division and cell death are tightly linked.

Although the medical outcomes of antiretroviral therapy (ART) for HIV/AIDS are well described, less is known about how ART affects patients' economic activities and quality of life, especially after the first year on ART. We assessed symptom prevalence, general health, ability to perform normal activities, and employment status among adult antiretroviral therapy patients in South Africa over three full years following ART initiation.A cohort of 855 adult pre-ART patients and patients on ART for <6 months was enrolled and interviewed an average of 4.4 times each during routine clinic visits for up to three years after treatment initiation using an instrument designed for the study. The probability of pain in the previous week fell from 74% before ART initiation to 32% after three years on ART, fatigue from 66% to 12%, nausea from 28% to 4%, and skin problems from 55% to 10%. The probability of not feeling well physically yesterday fell from 46% to 23%. Before starting ART, 39% of subjects reported not being able to perform their normal activities sometime during the previous week; after three years, this proportion fell to 10%. Employment rose from 27% to 42% of the cohort. Improvement in all outcomes was sustained over 3 years and for some outcomes increased in the second and third year.Improvements in adult ART patients' symptom prevalence, general health, ability to perform normal activities, and employment status were large and were sustained through the first three years on treatment. These results suggest that some of the positive economic and social externalities anticipated as a result of large-scale treatment provision, such as increases in workforce participation and productivity and the ability of patients to carry on normal lives, may indeed be accruing. By late 2008, some 2.9 million people in sub-Saharan Africa were receiving antiretroviral therapy for HIV/AIDSAlongside these studies of biomedical outcomes of treatment is a small body of literature investigating the impacts of ART on patients' economic activities, quality of life, and other non-biomedical outcomes during the first year on treatment. These studies, which have recently been reviewedWhat has been missing so far is evidence about the longer-term sustainability of these improvements beyond the initial year on treatment. Sustained improvements in economic and quality of life outcomes are likely to support long-term adherence and to mitigate some of the negative economic and social consequences of untreated HIV/AIDS in high-prevalence countries. In this paper, we report results of a longitudinal study of South African ART patients who have been followed for up to three years after starting treatment. Outcomes analyzed include self-reported ability to perform normal daily activities, prevalence of symptoms, and employment status in the first 1080 days after ART initiation.The study was approved by the Institutional Review Board of the Boston University Medical Campus and the Human Research Ethics Committee of the University of the Witwatersrand. Written informed consent was provided by all study subjects.The study was conducted at three ART clinics in South Africa. The cohort and study methods have been described previously3 or WHO Stage IV disease was diagnosed, though many patients first presented at the study clinics with CD4 counts far below 200 Most patients were initiated on the national first-line regimen of stavudine, lamivudine, and efavirenz or nevirapine. Patients not yet eligible for treatment were monitored and received counseling and vitamin supplements.All three sites followed the 2004 South African national guidelines for providing HIV/AIDS care and treatment. Under these guidelines, ART was initiated once a patient's CD4 count fell to less than 200 cells/mmAt each site, study subjects were identified each day from patients present at the clinic, either waiting in a queue or attending an adherence or wellness class or support group. We selected subjects from these groups using nth-name sampling and invited them to participate in the study. Adult patients who were HIV-positive but not yet medically eligible for ART or who had initiated ART less than six months before recruitment were eligible for enrollment. Those who provided written informed consent were enrolled in the cohort and administered a baseline questionnaire by a study interviewer. Enrollment took place between June 2005 and June 2006.Follow-up questionnaires were then administered as often as possible when subjects returned for consultations or to pick up medications. Because clinic visits were often unplanned and not all subjects had time to participate in an interview at every visit, interviews occurred at only a fraction of total visits and at irregular intervals, as is discussed further below. In addition, subjects' medical records were reviewed and information collected about date of ART initiation, dates of clinic visits, CD4 counts, and other indicators. For this analysis, data were censored on September 30, 2009.The questionnaire was designed for this study and focused on subjects' self-reported health conditions and engagement in economic activities. For this analysis, nine specific outcomes are investigated. Four are related to specific symptoms: pain or headache, nausea, tiredness or fatigue, and skin rash or other skin problems. Because these symptoms affect a person's ability to perform normal activities, these outcomes have economic as well as quality-of-life implications. Two outcomes are related to general health condition and asked whether the subject did not feel well physically at least part of the day yesterday or whether the subject felt sad, depressed, or stressed at least part of the day yesterday. Finally, three outcomes pertained to normal activities and employment status. Inability to perform normal activities was defined as reporting being unable to perform one's normal activities for at least part of a day in the previous five-day work week (Monday-Friday) due to physical or mental health. When subjects reported any inability to perform normal activities, the number of days to which this pertained in the same five-day period was elicited. The employment status variable was defined as holding a full time or part time wage or salary position, including domestic service but excluding informal sector piecework activities. Although many of our outcomes overlap with definitions in the World Health Organization's International Classification of Functioning, Disability and Health (ICF)Information from the nine outcomes was organized into 8 dichotomous variables and one continuous variable . For each interview for each study subject who initiated ART prior to June 2009, the interview date was compared to the date the subject initiated therapy to calculate the number of days on ART at each interview. The date of ART initiation was extracted from the subject's clinical records. Time on ART, from 90 days before initiation ART to 1080 days after, was stratified into thirteen 90-day increments. In recognition that changes in wellbeing may be more rapid immediately after initiating treatment, the first 90-day period was further subdivided into days 0–30 and 31–90 on ART, for a total of 14 separate time-on-ART dummy variables.A logistic regression framework was used to estimate the probability (absolute risk) that a subject reported yes for each dichotomous outcome, with data pooled across the three study sites. Linear regression was used for the number of days of unable to perform normal activities. A population-averaged model for all outcomes was used to account for multiple observations on a single subject (using xtlogit and xtreg in STATA 10 with the pa option). In each model, variables included three age categories , sex , and 13 time-on-ART dummy variables. The reference age category variable was 30–39 years of age and the reference time-on-ART variable was the initial 30 days on ART (days 0–30). Other than for the employment status outcome, significant site effects were not found, so site was not included as a variable in the models. For the employment status outcome, the site-specific estimates are discussed in the Using the logistic regression results, we computed the estimated probability for each outcome for the reference case representing the largest age/sex group in the sample during the first month on ART (0–30 days on ART). We then estimated marginal/partial effects for each covariate in the logistic model using the mfx post-estimation command in STATA 10. Odds ratios from the logistic regression model are not reported but available from the authors. Finally, we performed Wald tests for linear hypotheses about the parameters of the logistic regression model to investigate if the changes observed after 360 days on ART were sustained over the next two years (using the post-estimation test command in STATA 10.1).The cohort was enrolled between July 1, 2005 and June 30, 2006. Study recruitment and the construction of the analytic cohort are shown in In this paper, we report data collected between the baseline interview and September 30, 2009. During this period of observation, 855 subjects initiated or were already on ART and completed at least one interview after treatment initiation. The remaining 210 study subjects had not yet started ART by their final interview within this period or were not interviewed between 90 days before ART initiation and 1080 after and are not included in this analysis. For the 855 subjects included, the average number of interviews per subject was 4.4. Interviews were conducted primarily during visits for purposes of medical consultation (59%) or medication pickup (38%). The median [IQR] interval between interviews was 170 [115–266] days.3). As Most subjects initiated treatment at low CD4 counts over the 14 time categories are illustrated in Fatigue, nausea, and skin problems showed a similar pattern of ongoing improvement, with symptom probabilities falling by 80–85% between 0–90 days before ART initiation and three years after. Men were estimated to experience significantly less pain and fatigue than women, but no sex differences were estimated in the probability of nausea or skin problems.Subjects were also asked two general questions about how they felt on the day preceding the interview . The estimated probability that a subject reported feeling unwell physically yesterday fell sharply over the first year on ART, from 0.40 to 0.22, an improvement that was sustained over the next two years on therapy. The estimated probability of feeling sad, depressed, or stressed yesterday did not improve, however. While the probability of this outcome at baseline (0–30 days) is significantly lower than in the 90 days prior to treatment initiation, there are no further estimated improvements that are sustained for more than two time periods.Subjects were also asked about their ability to perform the primary normal daily activities reported in Although the estimated probability of any inability to perform normal activities in the previous week fell dramatically over the first year on ART, the estimated average duration of inability for those who reported any inability remained relatively long regardless of time on ART. Conditional on any inability, the estimated average number of days unable to perform normal activities for the reference case is 3.03 days in the previous five working days, or roughly 60% of the work week.Finally, the results for employment status are reported in Unlike for other outcomes, employment status did vary by study site. If Themba Lethu Clinic, the large urban public hospital in Johannesburg, is used as the reference case, subjects enrolled at the Witkoppen Health and Welfare Centre, which serves informal settlements on the edge of Johannesburg, were 8% more likely to report being employed, while those at the ACTS Clinic, a rural site in Mpumalanga Province, were 7% less likely to report being employed. For all sites, the basic trend over time on ART remained essentially the same as shown in In a cohort of 855 adult patients on ART at three treatment facilities in South Africa, indicators of well-being and economic activity improved significantly within one year of treatment initiation and either continued to improve or remained stable for a full three years after starting treatment. For those patients who remain on treatment, ART appears to offer long-term gains in ability to perform normal activities, symptom prevalence, and employment opportunities. The findings of this study suggest that some of the positive economic and social externalities anticipated as a result of large-scale treatment provision, such as increases in workforce participation and productivity and the ability of patients to carry on normal lives, may indeed be accruing.By the end of the three-year observation period, the probability of pain, fatigue, nausea, and skin problems reported by study subjects had fallen by 57–85%. While pain and fatigue at three years remained relatively common , these should be interpreted cautiously, as some residual level of pain and fatigue is likely to be reported even by a healthy, HIV-negative population. The probability of reporting any inability to perform normal activities for reasons of health during the preceding five-day work week fell to a stable level of 10% of the cohort. For this core indicator of wellbeing, a decline from almost 40% when initiating therapy to 10% represents an important gain.The study reported here has several limitations. First, it is an on-treatment analysis only. The enrollment refusal rate was low (8%), but post-enrollment loss to follow up from the cohort was high, for a number of reasons. The most common reason was that the patient had stopped attending the study clinic, due to program loss to follow up (22%), transfer to another site (7%), or death (5%). Study loss to follow up—patients who had made visits in the 12 months before data censoring but not been interviewed—was 8%. Discontinuation of treatment may well be correlated with our outcomes of interest, if patients who felt worse or better than average were more likely to drop out of treatment or avoid being interviewed. Our results should therefore be interpreted as conditional on staying alive and on treatment at the same site. As indicated by the CD4 counts shown in A second potential source of bias is the timing of interviews, which took place on days when patients presented voluntarily to the study clinics. It is likely that some visits during which interviews were conducted were due to patient condition, and not for routine monitoring or drug pickup. The study sites' records do not allow us to distinguish clearly between routine and non-routine medical consultations. If many interviews took place during visits for patient condition, then our results could understate the average benefits of treatment later in the study. Since study staff did not approach patients who appeared visibly ill and unable to participate in an interview, and because most interviews were conducted during routine visits, we believe that this potential bias is modest. On the other hand, decisions not to interview patients who appeared visibly ill, which were infrequent but did occur, could lead to a slight overestimate of the benefits of treatment.In addition, we frequently had long and irregular gaps between interviews, resulting in a very unbalanced data set and differing numbers of observations among subjects followed for the same overall length of time. This resulted largely from the irregularity of routine patient visits to the study clinics and the difficulty of locating and interviewing patients who present at unscheduled times. Finally, as with any study that relies on self-reported interview data, recall error is likely. We deliberately chose very short recall periods (≤ 7 days) to minimize this risk, but we could not eliminate entirely.Our results are roughly consistent with those of several studies that have reported only to 12 months after treatment initiation. In the study in Cape Town, South Africa, for example, the proportion of patients reporting no problems with usual activities rose from 76% at baseline to 94% at 12 months.We conclude that patients who remain on ART in South Africa experience large improvements in their ability to perform normal activities, symptom prevalence, and employment potential and that these improvements are sustained and for some outcomes continue to increase over the first three years on ART. While we have no way to know how our study subjects compare with HIV-negative South Africans of comparable socioeconomic status, the relatively low prevalence of self-reported inability to perform normal activities and of symptoms, and the relatively high employment rate after three years, suggest that ART patients, assuming that they remain on treatment, are able to lead relatively normal lives.

Intuitively, cardiac dyssynchrony is the inevitable result of myocardial injury. We hypothezised that radial dyssynchrony reflects left ventricular remodeling, myocardial scarring, QRS duration and impaired LV function and that, accordingly, it is detectable in all patients with heart failure.225 patients with heart failure, grouped according to QRS duration of <120 ms , between 120-149 ms or ≥150 ms , and 50 healthy controls underwent assessment of radial dyssynchrony using the cardiovascular magnetic resonance tissue synchronization index .(-0.033 LVEF) ms, p < 0.0001).Compared to 50 healthy controls (21.8 ± 6.3 ms [mean ± SD]), CMR-TSI was higher in A (74.8 ± 34.6 ms), B (92.4 ± 39.5 ms) and C (104.6 ± 45.6 ms) . Adopting a cut-off CMR-TSI of 34.4 ms (21.8 plus 2xSD for controls) for the definition of dyssynchrony, it was present in 91% in A, 95% in B and 99% in C. Amongst patients in NYHA class III or IV, with a LVEF<35% and a QRS>120 ms, 99% had dyssynchrony. Amongst those with a QRS<120 ms, 91% had dyssynchrony. Across the study sample, CMR-TSI was related positively to left ventricular volumes (p < 0.0001) and inversely to LVEF (CMR-TSI = 178.3 e Radial dyssynchrony is almost universal in patients with heart failure. This vies against the notion that a lack of response to CRT is related to a lack of dyssynchrony. Conversely, it is also assumed that lack of pre-implant dyssynchrony relates to a poor outcome from CRT.Central to the paradigm underpinning cardiac resynchronization therapy (CRT) is the concept that cardiac dyssynchrony contributes to the clinical syndrome of heart failure and that its correction translates to a clinical benefit. Accordingly, it is generally considered that pre-implant dyssynchrony is a In an attempt to identify patients who were most likely to have left ventricular (LV) dyssynchrony, the CArdiac REsynchronization in Heart Failure (CARE-HF) study adopted We have previously shown that a measure of radial dyssynchrony, derived from cardiovascular magnetic resonance (CMR) tissue synchronization imaging, is a powerful predictor of mortality and morbidity after CRT in patients with a QRS ≥ 120 ms. We hypotThe study group consisted of 225 patients with heart failure who were referred for a CMR study to a single centre . The diagnosis of heart failure was made if symptoms of the condition were associated with objective evidence of LV dysfunction on echocardiography, or if pulmonary oedema had been documented on chest radiography in the absence of primary valvular disease. The diagnosis of ICM was made if systolic dysfunction was associated with a history of myocardial infarction or if th3) were quantified using manual planimetry of all short-axis cine images with MASS analysis software .Patients were scanned using a 1.5 Tesla scanner and a phased array cardiac coil, during repeated 8-second breathholds. A short axis stack of LV images was acquired using a steady state in free precession sequence in sequential 8 mm slices (2 mm interslice gap) from the atrioventricular ring to apex. Left ventricular volumes, ejection fraction and mass has been described previously. Briefly,The septal-to-lateral wall motion delay (SLWMD) was defined as the time difference (in ms) between the time-to-peak inward wall motion of the septal and lateral segments, from base to apex. The observer was blinded to all other clinical details of the patients, including the outcome measures.The CMR technique described above permits visualization of radial wall motion throughout the entire LV. The phase of inward radial wall motion data derived from each short axis CMR slices were color-coded to construct bull's eye polar color maps of inward wall motion . The phase of inward radial wall motion were represented by colors of a spectrum ranging from blue , to green and to red . Accordingly, the bull's eye with a homogenous blue color throughout denotes complete synchrony, whereas a bull's eye with a homogenous red color throughout denotes complete synchrony. Inhomogenous color coding denotes dyssynchrony of radial motion, with blue representing early activation and red representing late inward radial wall motion. The spatial distribution of dyssynchrony was quantified by manually counting the number of distinct red patches (180° phase shits).3 by multiplying the planimetered area in each segment by the slice thickness. Scar volume was expressed as a % of left ventricular myocardial volume in the diastolic phase. Satisfactory images were obtained in 220/225 patients with heart failure (125/130 patients with ICM). The observer was blinded to other CMR, echocardiographic and clinical data.For scar imaging, gadolinium-diethylenetriamine pentaacetic acid (0.1 mmol/kg) was given intravenously and images were acquired after 10 minutes using a segmented inversion-recovery technique in identical short-axis slices. Inversion times were adjusted to null normal myocardium (260 to 400 ms). Quantification of myocardial scarring was carried out by planimetry of enhanced tissue on late-enhancement short-axis images. Infarct volume was calculated in cmt test, without correction for multiple comparisons. Categorical data were presented as frequencies and were compared using the Chi-squared test and Fisher's exact test. Linear and exponential regression as well as Pearson's correlation analyses were used to explore the relationship between continuous variables. For curve fitting, the fit with the greatest R2 were chosen for presentation. Statistical analyses were performed using the Statview and the 2007 NCSS statistical packages. A two-tailed p value of < 0.05 was considered statistically significant.Continuous variables are expressed as mean ± standard deviation (SD). Normality was tested using the Shapiro-Wilk test. Comparisons between continuous variables were made using the unpaired Student's Compared to patients with a QRS<120 ms, patients in the QRS 120-149 ms and the QRS ≥ 150 ms groups were older, had a higher NYHA class and had higher LV volumes and a worse LVEF , 4.2 times higher in the QRS 120-149 ms group (92.4 ± 39.4 ms) and 4.8 times higher in the QRS ≥ 150 ms group (104.6 ± 45.6 ms) . Compared to healthy controls, SLWMD was 2.1 higher in the QRS <120 ms group (109.0 ± 82.6 ms p = 0.0022), 2.9 times higher in the QRS 120-149 ms group and 3.3 times higher in the QRS ≥ 150 ms group . As shown in Figure As shown in Fig. (-0.033 LVEF) (p < 0.0001). Linear relationships were observed in relation to LVEDV and LVESV (p < 0.0001). When all patients with heart failure were classified according to quartiles of scar size, the most extreme dyssynchrony was observed in patients with scars>75%. patients with LVEF<35%. As shown in Figure For patients such as those included in the CARE-HF study, namely patients in NYHA class III or IV with an LVEF<35% and a QRS ≥ 120 ms, dyssynchrony was present in 132/133 (99%) patients.In a reanalysis of a data on 77 patients undergoing CRT, . With respect to LV volumes, they correlated positively with dyssynchrony. Together, these findings indicate that the extremes of dyssynchrony are observed in patients with the worst myocardial function.We have found that an LVEF<35%, the LVEF cut-off adopted by outcome studies ,15 and cAccording to the currently accepted paradigm underpinning CRT, increasing pre-implant dyssynchrony is required for clinical benefit. Our study, however, shows that the extremes of dyssynchrony are observed in patients with the worst LVEF and the largest myocardial scars. One might therefore expect to find that increasing dyssynchrony relates to a poor outcome. Our previous demonstration that increasing dyssynchrony, assessed using CMR-TSI, relates to a high mortality and morbidity after CRT is consiUsing tissue Doppler imaging and a 12-segment model, Yu et al demonstrProlonged QRS duration results in late myocardial activation, usually in the posterolateral LV segments. A correlation should therefore be expected between QRS duration and measures of LV dyssynchrony. Although a correlation between QRS duration and cardiac dyssynchrony has been shown using radionuclide phase analysis, studies Using colour-coded bull's eye maps of radial wall motion, we have shown that, in patients with heart failure, dyssynchrony is distributed unevenly throughout the LV. Moreover, the spatial heterogeneity of dyssynchrony, quantified in terms of the number of patches of late radial wall motion in bull's eye maps, correlates positively with QRS duration and scar volume, and negatively with LVEF. These findings are relevant to studies showing that CRT is more effective when LV leads are deployed in areas of delayed contraction. ,24 ImporWe have found significant differences in the SLWMD between healthy controls and patients with heart failure. Whilst only 56% of patients were classified as having dyssynchrony on the basis of the SLWMD (≥ 99.4 ms), 95% had dyssynchrony on the basis of the CMR-TSI (>34 ms). This suggests that CMR-TSI, which is based on wall motion data from the entire LV, is more sensitive at detecting dyssynchrony than SLWMD, which is based on wall motion data from the septal and lateral segments only. Importantly, the overlap between the values for healthy controls and patients with heart failure was less for CMR-TSI than for SLWMD. It would appear, therefore, that the ability to detect dyssychrony and to differentiate between healthy controls and patients with heart failure depends on the sensitivity of the method used to measure it.Dyssynchrony was demonstrated in virtually all patients with heart failure who satisfied the currently established indications for CRT. Our findings extend the current paradigm of CRT to patients with heart failure and a QRS ≤ 120 ms. Although the recently reported RethinQ study showed no symptomatic benefit from CRT in implantable cardioverter defibrillator recipients with a QRS <120 ms, Yu et alIn an attempt to identify the cut-off of dyssynchrony below which one should expect a reasonable response to CRT, we reanalysed data from a previous study of patients undergoing CRT. In this Further randomized studies are needed to determine whether the less severe dyssynchrony observed in these patients is an appropriate substrate for CRT. We should consider, however, that factors other than dyssynchrony, such as myocardial viability, also govern the response to CRT. Comparison of CMR-derived measures of dyssynchrony with respect to response after CRT is required. Prominent amongst other measures is the circumferential uniformity ratio estimate (CURE), which has recently been shown to predict symptomatic response to CRT. The CMR-We conclude that cardiac dyssynchrony is virtually synonymous with heart failure. The finding that dyssynchrony is present almost all patients with heart failure who satisfy the currently established indications for CRT casts doubt notion that a lack of response to CRT is related to a lack of dyssynchrony. Further studies are needed to determine what level of dyssynchrony translates to a clinical benefit from CRT, including those with a QRS <120 ms. The additional finding that dyssynchrony is distributed in a patchy fashion throughout the left ventricle provides a rational basis for multisite LV pacing.The authors declare that they have no competing interests.PWXF collected and analyzed data and drafted the manuscript. KK collected data. JW collected data. REAS recruited and carried out implantations and contributed intellectually to the manuscript. BS carried out image and data analyses and also contributed to statistical analysis and drafting of the manuscript. MP conceived part of the study and helped draft the final manuscript. FL conceived the hypothesis, designed the study, collected and analyzed data and contributed to drafts and final version of the manuscript. All authors read and approved the final manuscript.Table 1. Clinical, Electrocardiographic and CMR Characteristics for Patients Included in the Study, Grouped According to QRS DurationClick here for file

P<0.02).Overall survival at 4 years was 66%. The 4 years overall survival rate of T3/T4 patients, who underwent concomitant chemotherapy, was 72%, and that of T3/T4 patient who did not, was 34% (P<0.04). The patients who did not undergo chemotherapy were significantly older. The difference in cause-specific survival rates (72 vs 48%) was not significant. Relapse-free interval without local recurrence at 4 years was 70%. Relapse-free interval of T3/T4 patients was 78% with chemotherapy and 60% without chemotherapy (p=NS). Rates of treatment discontinuation and early toxicity were not statistically different. Late complications occurred in 33 patients, eight of whom had grade 2/3 tumours. At 2 years, complications occurred in 39% of patients who had undergone concomitant chemotherapy, and in 20% of patients who had not (p<0.02). Differences in grade 2/3 complications were not significant. In conclusion, although radiotherapy with concomitant chemotherapy is considered the current ‘gold-standard’ treatment for anal canal cancer, in our daily experience, only 55% of our T3/T4 patients have undergone this treatment. The remainder did not undergo chemotherapy mainly because they were deemed too old. In this series, no increase in local control and cause-specific survival was observed in patients who received concomitant chemotherapy; this may be due to the small number of patients included in the series. The increased rate of late complications observed in patients who received the combined treatment, however, provides evidence that this treatment should be restricted to younger patients without comorbidity and therefore justifies our position. Perhaps reduction of doses of chemotherapy must be discussed for older patients.This study is an analysis of the criteria considered when prescribing concomitant chemotherapy and radiotherapy, as a routine treatment for patients with anal canal cancer, and related complications. Between 1990 and 1996, 67 patients were treated at Institut Curie for invasive, nonmetastatic cancer of the anal canal. Median age was 65 years . TNM stage distribution was as follows: seven T1, 17 T2, 27 T3, 16 T4, and 22 N+ patients. A total of 29 patients received concurrent chemotherapy and radiotherapy. Radiotherapy volumes and dose and prescribed dose for chemotherapy were not statistically different from one group of patients to another. Only 55% of T3/T4 patients underwent standard chemoradiation treatment for anal canal cancer. Age was the one of main factor in determining if the patient would undergo concomitant chemotherapy or not. For the T3/T4 patients, concomitant chemotherapy was prescribed to 69% of patients <55 years, 90% of patients between 56 and 64 years, 45% of patients between 65 and 75 years, and 20% of patients over 75 years ( Carcinoma of the anal canal is a relatively uncommon tumour . The staIn our experience, patients with T3/T4 and N+ disease are not so frequent. For instance, in a series of 346 patients treated for anal canal cancer at our institution between 1967 and 1996, 33% had a T3/T4 tumour and 23% had an N+ tumour , the associated results, and complications. This study conducted at Institut Curie includes 67 patients treated for anal canal cancer with 5FU/cisplatin concurrent chemotherapy and radiotherapy, between 1990 and 1996.The sample consists of 67 patients with locally advanced nonmetastatic anal canal cancer who were treated at our institution between 1990 and 1996. The sample excluded patients with tumours of the anal margin, adenocarcinomas, and melanomas. Pretreatment evaluation included history, physical examination, chest radiography, tumour biopsies, standard laboratory tests, and ultrasound (US) or CT-based evaluation of the liver and lymph nodes. Endorectal ultrasound was performed on a small number of patients (the most recent cases only), therefore the results of this test will not be considered in this study. The median duration of follow-up was 48 (10–101) months.Tumour characteristics and treatments are summarised in Most patients underwent pelvic irradiation. A 4-field box technique was used. The top field was located at the L5–S1 interspace and the bottom field, 2 cm below the lowest margin of the tumour. The inguinal nodes were only covered by the anterior field. A complementary electron boost was delivered to the inguinal nodes.The prescribed dose at the ICRU point was 50 Gy for the pelvis and 45 Gy for N0 nodes. Doses were delivered in five fractions per week, and fraction doses ranged from 1.8 to 2 Gy.Evaluation was repeated 1 to 2 months following treatment. A boost of 15–20 Gy was delivered to responding patients using either direct perineal field, reduced 4-field, or brachytherapy. Based on clinical evaluation results, an additional 20 Gy was also delivered to all nodes involved.The low-dose rate procedure (with 192-iridium) was used for patients who underwent brachytherapy. The prescribed dose was applied to the 85% isodose. When combined with external beam radiotherapy, the sum of the 85% reference isodose and external dose was used. Median doses of 48 and 63 Gy were delivered to the pelvis and to the anal canal, respectively (36–75).Abdominoperineal (AP) resection was performed in patients who did not respond to a 50 Gy treatment, when residual tumour was detected after completion of the treatment, or in case of local recurrence. Colostomy alone was performed in patients with rectovaginal fistulae or severe radiation-induced complications.−2) and cisplatin (20 mg m−2) for 5 days of every 21-day cycle (J1=J21), was concomitant with radiotherapy. A total of two to three courses were given. The treatment is decided at our weekly meeting with participation of surgeons, radiation, and medical oncologists as a function of our protocols and patient's performance status, tumour and lymph node stage. Usually, we use concurrent chemotherapy and radiotherapy for T3/T4 or/and N+ patients.Chemotherapy, consisting of a continuous infusion of 5-FU delivered to patients with higher-grade tumours, that is, 55.8% of patients with a T3/T4 tumour and 67% of patients with a tumour >4 cm in size.Concomitant chemotherapy was mostly (P<0.03): 47% of patients under 56 years, 61% of patients between 56 and 65 years, 34% of patients between 66 and 75 years, and 16% patients over 75 years. For the T3/T4 patients alone . There was, however, no significant difference in cause-specific survival at 2 years (86 vs 81%) and at 4 years (72 vs 47%).The overall 4-year survival rate was 66%. The 4-year survival rate of T3/T4 patients was 70%. The 4-year RFS rates of T3/T4 patients, with or without concomitant chemotherapy, were 78 and 60%, respectively (NS) . No difference in the rates of cutaneous, digestive, and renal complications was noted between both the treatments.Increased incidence of haematological complications was observed with concurrent chemotherapy were given the combined treatment. Factors considered to determine the indication for this treatment included tumour size and T stage. The combined treatment was mostly given to patients with large-sized tumours, that is, 55.8% of T3/T4 patients and 67% of patients with a tumour ⩾4 cm in size. All of these patients should have normally had chemotherapy alone. Why were not the remainder given chemotherapy?P<0.03): nearly 50% of patients ⩽65 years vs nearly 20% of patients were over 75 years. In T3/T4 patient population, the rates were 69% of patients under 55 years, 90% of patients between 56 and 65 years, 45% of patients between 66 and 75 years, and 20% of patients over 75 years.The main reason was their age. A larger proportion of younger patients had concurrent chemotherapy and radiation , rectum haemorrhage, and anal fibrosis. Complications required medical treatment in eight patients; however, none of the patients had to undergo surgery.The authors of the two aforementioned studies apparently obtained different results , only seAnd the most important point is the difference of the chemotherapy used. In our series, the treatment was a 5FU/cisplatin combination, more frequently using in France for anal cancer (In another retrospective study, authors showed an increased complication rate after concurrent chemotherapy and radiotherapy (In conclusion, our decision not to treat older patients with comorbidity with concurrent chemotherapy and radiotherapy is supported by the fact that an increased late complications rate is associated to this combined treatment. Perhaps reduction of doses of chemotherapy must be discussed for this population of patients.

Projections from a theoretical model of concentration of methotrexate in liver are confirmed but projections of biliary excretion are not.Measurements of methotrexate have been made in the liver and plasma of 4 patients and in the bile and plasma of 1 patient receiving [