Datasets:

nickypro

/

minipile

like 0

Just Ask, Inc. Just Ask, Inc. is a Canadian children's science television series which aired on CBC Television in 1981. Premise David Suzuki hosted this science series geared towards children between ages eight and twelve. Topics included anatomy, astronomy, nature, snoring and the twinkling of stars. Neil McInnes provided animated segments. Scheduling This half-hour series was broadcast Wednesdays at 4:00 p.m. (Eastern) from 4 February to 25 March 1981, then another series run Mondays at 4:00 p.m. from 19 October to 28 December 1981. His co-host was a robot, Lustra (Joan Stuart voice) in the first season and Ami (Luba Goy voice) in the second series run. References External links Category:CBC Television shows Category:1981 Canadian television series debuts Category:1981 Canadian television series endings Category:1980s Canadian children's television series

Background ========== Congenital abnormalities involving coronary arteries are relatively rare \[[@b1-amjcaserep-19-992]\]. Among these abnormalities, anomalous origin of the right coronary artery from the pulmonary artery (ARCAPA) stands as an exceedingly rare anomaly with an incidence estimated to be 0.002% \[[@b2-amjcaserep-19-992]\]. Case Report =========== A 58-year-old morbidly obese African American female with a history of diabetes mellitus, hyperlipidemia, hypertension, chronic kidney disease, and smoking was referred for evaluation of shortness of breath and chest heaviness. She described her pain as "it feels like acid reflux". Her family history was of no relevance, with no record of premature coronary heart disease or sudden cardiac death. On physical examination, the patient was determined to be morbidly obese with a body mass index (BMI) of 51.8 kg/m^2^. Her blood pressure was 160/90 mmHg. There were no carotid bruits or jugular venous distension. Cardiac auscultation showed distant heart sounds with no audible murmurs or gallops. Lower extremity examination showed +1 edema with weak pedal pulses. Her current medications included nisoldipine 20 mg daily, losartan/hydrochlorothiazide 100/25 mg per day, atenolol 25 mg per day, and lansoprazole 30 mg per day. The patient's ECG showed non-specific ST segment and T-wave changes. Initial echocardiogram demonstrated left ventricular hypertrophy, left atrial enlargement, and diastolic dysfunction grade I with preserved ejection fraction. An adenosine nuclear study showed an area of reversible ischemia of the inferior wall. Subsequently, she underwent right and left cardiac catheterization. Selective left coronary angiography demonstrated short left main coronary artery (LCA) that originated appropriately from the left sinus of Valsalva. From the LCA, left anterior descending (LAD) and left circumflex (LCX) coronary arteries arose in a typical course ([Figures 1A](#f1-amjcaserep-19-992){ref-type="fig"}, [2A](#f2-amjcaserep-19-992){ref-type="fig"}). Both LAD and LCX were dilated and tortuous without significant stenosis. The right coronary artery (RCA) was visualized in a retrograde fashion almost instantaneously via collaterals originating from the left coronary system ([Figure 1B](#f1-amjcaserep-19-992){ref-type="fig"}, [Video 1](#f4-amjcaserep-19-992){ref-type="fig"}**)**. The RCA was markedly tortuous and dilated with no significant stenosis. It drained into the main pulmonary artery ([Figure 2B](#f2-amjcaserep-19-992){ref-type="fig"}, [Video 2](#f5-amjcaserep-19-992){ref-type="fig"}). On aortic root angiography, the origin of the RCA could not be determined ([Figure 3](#f3-amjcaserep-19-992){ref-type="fig"}, [Video 3](#f6-amjcaserep-19-992){ref-type="fig"}). To better assess the significance of this anomaly, O~2~ saturation run was obtained from her right cardiac chambers. All measurements are listed in [Table 1](#t1-amjcaserep-19-992){ref-type="table"}. Using the Fick principle, systemic cardiac output was calculated to be 5.98 L/min, and the pulmonary flow was 5.98 L/min. The pulmonary to systemic flow ratio was of 1: 1. No significant step-up in blood oxygen saturation was detected in the pulmonary artery. The patient was not considered a surgical candidate and her symptoms were controlled conservatively. Discussion ========== Anomalous coronary vessels are relatively rare congenital defects. The incidence of such anomalies has been reported in the medical literature to range from 0.3% to 0.9% \[[@b1-amjcaserep-19-992]\]. Among these abnormalities, anomalous origin of the RCA from the pulmonary artery (PA) (or ARCAPA) stands as an exceedingly rare anomaly with an incidence estimated to be 0.002%. In 1885, Brooks identified the first 2 cases of ARCAPA postmortem \[[@b3-amjcaserep-19-992]\]. Since then, just over 100 cases have been reported \[[@b4-amjcaserep-19-992]\]. In 1942, Soloff et al. described 4 anatomical variations for anomalous origin of the coronary arteries from the PA. Namely, anomalous origin of the left coronary artery (LCA) from the PA (ALCAPA), ARCAPA, both the LCA and the RCA originating from the PA, and an accessory coronary vessel originating from PA \[[@b5-amjcaserep-19-992]\]. Other congenital heart defects have been reported concurrently in 22% of cases of ARCAPA, such as aorto-pulmonary window (30% of associated defects) and tetralogy of Fallot (19%) \[[@b5-amjcaserep-19-992]\]. Investigations of the associated defects might lead to incidental identification of the anomalous vessels early in life. When isolated, however, many patients with ARCAPA remain asymptomatic, which suggests an under estimation of the true prevalence of this anomaly in the general population \[[@b6-amjcaserep-19-992]\]. The symptomatology of ARCAPA largely correlates with the underlying pathophysiology. Potential factors that can determine the age of onset and the nature of symptoms include the direction of filling in the anomalous vessel, the formation of collateral vessels with the left coronary system, and the significance of the resulting left to right shunt \[[@b2-amjcaserep-19-992]\]. In our case, retrograde filling of the RCA was demonstrated almost instantaneously on selective left coronary angiography. This was thought to be due to massive collateralization from the normally arising LCA. Additionally, the absence of notable step-up in blood oxygen saturation in samples drawn from the pulmonary trunk questions the significance of left to right shunt. This could explain the relatively late presentation in our patient. Of note, this pattern of semi-instantaneous retrograde filling into the RCA from the LCA, which was demonstrated in our case, has been reported in a few cases of single coronary artery (SCA) \[[@b6-amjcaserep-19-992]\]. However, in cases of SCA, direct communication between the RCA and the PA is extremely rare \[[@b7-amjcaserep-19-992]\]. In one case reported in 1963, Murray described a patient with SCA where a connection between the RCA and the PA did occur \[[@b8-amjcaserep-19-992]\]. Unlike our case, however, the communication was of a fistulous pattern and not a direct termination. In his review on SCA, Smith concluded that a coronary artery arising from the PA would make the diagnosis of SCA highly improbable \[[@b7-amjcaserep-19-992]\]. Consequently, the diagnosis of ARCAPA in our patient was considered much more likely compared to SCA. While patients with ALCAPA present in early childhood with congestive heart failure and myocardial ischemia, those with ARCAPA tend to follow a benign course and present later in life \[[@b9-amjcaserep-19-992]\]. Versatile clinical presentations have been described in the literature. In their review, Modi et al. reported angina as the most common symptom of ARCAPA, for which 18% of patients come to initial medical attention \[[@b5-amjcaserep-19-992]\]. Other manifestations included exertional dyspnea, congestive heart failure, and sudden cardiac death. Often, ARCAPA is diagnosed incidentally during angiography performed to evaluate other cardiac conditions \[[@b10-amjcaserep-19-992]\]. While conventional angiography is commonly performed to diagnose coronary anomalies, noninvasive imaging modalities including cardiac computed tomography angiography and/or cardiac magnetic resonance imaging can also be utilized to delineate the coronary anatomy and provide comprehensive anatomic information on the anomalous vessel \[[@b11-amjcaserep-19-992],[@b12-amjcaserep-19-992]\]. In our patient's case, this anomaly was diagnosed on selective left coronary angiography in the course of investigating atypical chest pain with abnormal nuclear stress test. Once ARCAPA is identified, surgical correction is advocated as the definitive treatment to reduce the risk of sudden cardiac death associated with having a single coronary system \[[@b13-amjcaserep-19-992]\]. The anomalous RCA can be either re-implanted to the aorta or ligated \[[@b14-amjcaserep-19-992]\]. However, long-term outcomes of such procedures were not well studied in the majority of cases, with a few patients reported to develop thrombosis in the implanted artery after surgical repair \[[@b2-amjcaserep-19-992],[@b14-amjcaserep-19-992],[@b15-amjcaserep-19-992]\]. Conservative medical management has also been described for this anomaly, especially when risk of surgery was deemed to outweigh benefits \[[@b16-amjcaserep-19-992]\]. Our patient was a morbidly obese woman with multiple comorbidities that significantly increase the risk of corrective surgery. In patients undergoing cardiac surgery, morbid obesity is associated with a 60% increase in mortality compared with normal weight patients \[[@b17-amjcaserep-19-992]\]. In addition, morbidly obese patients are at greater risk of postoperative complications, including renal failure, deep sternal wound infection, prolonged ventilatory support, and pneumonia \[[@b17-amjcaserep-19-992],[@b18-amjcaserep-19-992]\]. These complications were of particular concern in our patient given her medical history of chronic kidney disease, diabetes mellitus, and smoking. Therefore, she was not considered a surgical candidate and aggressive modification of risk factors including weight loss, smoking cessation, and adequate control of her diabetes mellitus was recommended. Once the surgical risk is deemed acceptable, corrective surgery should be considered for this patient to establish dual coronary system and reduce the risk of sudden cardiac death. In the meantime, the patient's symptoms are being satisfactorily controlled on conservative medical treatment. Conclusions =========== By reporting this case of ARCAPA, we shed some light on a rare congenital anomaly involving the coronary arteries. While variable presentations have been described for this anomaly, many patients remain asymptomatic. Diagnosis can be confirmed by conventional coronary angiography. Surgical correction by either re-implantation or ligation of the RCA is the definitive treatment. However, conservative management might be considered in patients with very high surgical risk. **Conflict of interest.** None. {#f1-amjcaserep-19-992} {#f2-amjcaserep-19-992} {#f3-amjcaserep-19-992} {#f4-amjcaserep-19-992} {#f5-amjcaserep-19-992} {#f6-amjcaserep-19-992} ###### Hemodynamic parameters and quantitative coronary angiography measurements in a patient with anomalous origin of the right coronary artery from the pulmonary trunk. **Chamber** **Pressure** **O~2~ saturation** --------------------------------------------------------- ----------------- --------------------- Right atrium (mean pressure) 16 65% Right ventricle 41/17 Pulmonary artery 38/24 67% Pulmonary wedge mean pressure 20 Left ventricle 131/18 Ascending aorta 126/72 94% **Flows** Systemic cardiac output 5.98 L/min Cardiac index 2.72 L/min/m^2^ Pulmonary blood flow 5.98 L/min Pulmonary/systemic flow ratio 1:1 Ejection fraction 75% **Quantitative coronary angiography measurements (mm)** LAD (mean luminal diameter) 7 mm RCA (mean luminal diameter) 8 mm LAD -- left anterior ascending artery; RCA -- right coronary artery. [^1]: Authors' Contribution: [^2]: Study Design [^3]: Data Collection [^4]: Statistical Analysis [^5]: Data Interpretation [^6]: Manuscript Preparation [^7]: Literature Search [^8]: Funds Collection [^9]: **Conflict of interest:** None declared

It is a private field in the foothills of southern california. It was the SoCal Kids's home field when we were team buddies, now its just the new SC. But anyways, the hand cutted up guy is Brandon Short, a member of the new wave of ironmen killers. Ft57: I think I saw you on the history channel on some program about the third reich? Is this true? Arg Todd Failed to Mention that at this pvtly owned feild it would be HK army timebomb etc. it woulda been cool to meet you guys, went to SC village instead, huge place Its like Any NYC area feild times 50 u ant just send in ur gun to get hk'd i think, u must be an hk affiliate... correct me if im wrong hk __________________ New Jersey Jesters d-2 X-Ball "Originally posted by HUSTLERS Great day at Atlas yesterday. I even enjoyed getting shot by many of the jesters many times. NJ Jesters Hate Club Fan #1962 "

One of the most beautiful, poignant and haunting short stories that one can find, so moving, so tender. Tagore packs so much into this short story than people would in bulky, obtuse novels. The spareness is so Zen like. At times he tried his hand at writing a verse or two. That the movement of the leaves and the clouds of the sky were enough to fill life with joy—such were the sentiments to which he sought to give expression. But God knows that the poor fellow would have felt it as the gift of a new life, if some genie of the Arabian Nights had in one night swept away the trees, leaves and all, and replaced them with a macadamised road, hiding the clouds from view with rows of tall houses. ———– In the loneliness of his exile, and in the gloom of the rains, his ailing body needed a little tender nursing. He longed to remember the touch on the forehead of soft hands with tinkling bracelets, to imagine the presence of loving womanhood, the nearness of mother and sister. ———— So the traveller, borne on the breast of the swift-flowing river, consoled himself with philosophical reflections on the numberless meetings and partings going on in the world—on death, the great parting, from which none returns. But Ratan had no philosophy. She was wandering about the post office in a flood of tears. It may be that she had still a lurking hope in some corner of her heart that her Dada would return, and that is why she could not tear herself away. Alas for our foolish human nature! Its fond mistakes are persistent. The dictates of reason take a long time to assert their own sway. The surest proofs meanwhile are disbelieved. False hope is clung to with all one’s might and main, till a day comes when it has sucked the heart dry and it forcibly breaks through its bonds and departs. After that comes the misery of awakening, and then once again the longing to get back into the maze of the same mistakes. I’ve lived in England, the United States, and India. Of all these countries India has been the best, and I would very much like to go back. People ask me why, and I tell them the many reasons to love India — its wealth of peoples, languages and cultures, the sincerity of its many devotees of many faiths, the omnipresence of its mythic narratives and their instantiations in daily life, its ethos of kindness to visitors, the industry of its small businesspeople, the freedom (in some contexts) to bend rules as one bends metal, the jugaad of all the jagged pieces and the all the jagged people into a thing that works. There are the dances, the songs, the colours, the clothes. There are the kebabs and curries and daal and sobji and ilish and misti doi and rasgulla. There are the biryanis and the dosas and the sambar and the fish fry. And there is the land itself: the fog-draped ghostliness of the North on a winter morning, the musty scent of damp leaves and rustling ferns in the cool air of Uttarakhand, the icy warmth of the still-faced Ganga at dawn, the black walls of cloud and the drenching massage of Kolkata’s kalboishakhi rains, the forests, the pebbly streambeds and the crystal-clear glacier melt of North Bengal, the waterfalls of the Western Ghats, the rocky moonscape of the Deccan plateau, the dusty red sunrises and sunsets, the long, sandy beaches of Kerala and Tamil Nadu. And of course there are the frustrations: the on-again off-again electricity, the missed water deliveries, the monsoon waterlogging laced with sewage and typhoid, the corrupt officials, the diffusion of responsibility, the intransigent bureaucrats, the inflexible peons, the confusion of equanimity with inaction, the confusion of story with fact, the lack of environmental awareness, the judicial paralyses, the parliamentary paralyses, the traffic paralyses, the hastily announced bandhs, the demagogic politics and politicians, the sexism, the racism, the compulsion to place one’s wealth on display, the practised lack of compassion for those outside one’s own community. I know about all of that. And you know what? On balance — on balance, mind you — I love it. Call me whatever you will, I don’t really like the IPL. I prefer watching Ranji, Vijay Hazare and Syed Mushtaq Ali trophies ( India’s regional first class, 50 overs and T20 competitions). Arundhati Sridhar travels around the country watching the IPL and blogs about it. She does write very beautifully. As I dug into the pulusu (the Telugu version of sambhar) in the thali, its bold coconut flavour painted a hundred memories of afternoons at my grandmother’s house, her wrinkled eyes watching as I took one helping after another with the deep steel ladle. The tamarind danced about my palette, instantly bringing back the low dining table that sprawled across into our drawing room, the prickliness of its jute-woven chairs. The Indian Railways may be all manners of wonderful, but they couldn’t have competed with the speed of a single morsel of anything on that plate in taking me home. On travelling sleeper class to Uttar Pradesh: As the train rolled through the simmering UP summer the next afternoon, gusts of suffocating loo filled the compartment, stifling every attempt at life and movement. As the afternoon got more pronounced, the heat seemed to come in uniform swathes, slowly mummifying every single person into the posture they held, lending the whole compartment an air of eeriness, as if it was occupied by the living dead. I too sat rooted to my berth, too afraid to move on what had become the equivalent of a hot tin roof, too afraid that any movement would unlock some new part of the surface that had not been made bearable by my body temperature working to tame it. Every few seconds I would feel a new droplet of sweat forming in a region I wasn’t even aware was capable of producing sweat. The question had, very conclusively, turned on its head : why would I ever consider a non-a/c sleeper in the middle of the Indian summer? Her lovely voice, her nuanced rendering of a complex art through uncluttered expression, her firm views on tradition and creativity which she found no need to publicly articulate — all these qualities made Ranjani Hebbar a very special musician, a very special person. Rarely has Carnatic music lost such a brilliant talent so young. The latest post on it is a review of Dave Zirin’s book: Brazil’s Dance With the Devil: The World Cup, the Olympics, and the Fight for Democracy. Zirin identifies a clear pattern in World Cups and Olympic games of recent years. Again and again, these events witness mass evictions, social cleansing (in which the poor, the homeless, drug addicts, and others are removed from sight), gentrification, the corporatization of public space, the erosion of civil liberties, and a massive increase in surveillance and “security.” Vast public subsidies pour into private hands as host cities are reshaped to the advantage of the rich. It’s always a boon for construction, real estate, security, and media interests, but often a tragedy for the communities left behind. As Zirin observes, these mega-events provide elites with “something that couldn’t be found at the end of a military-grade truncheon: the consent of the masses to neoliberal policy goals.” Amol Muzumdar, was one of the finest Ranji batsmen for Mumbai with the singular misfortune of his cricket career coinciding with SR Tendulkar and VG Kambli. He spent an entire cricketing career “waiting”. He had been at Shardashram Vidyamandir School in Dadar with the two and was the batsman waiting to come in when the pair amassed a record stand of 664 in a Harris Shield game in 1988, and it wouldn’t be too long before he made his name for Bombay by scoring 260 on debut in 1993-94, against the side he had seen beat his own in that final three years earlier. Once again, in the epic Ranji finals of 1992, he was a ball boy, patiently waiting for his turn. It would turn out that he would never play test cricket for India. In a different era, he might have walked into the Indian team. And so it goes. A humorous aside to this word is this: Street cricketers in Chennai grow up following and imitating Australian and other Western cricketers who usually use the word, “Wait in” as a communication during running between the wickets. This gets beautifully morphed, in the streets and gullies of Chennai to “Waiting, Waiting”.

India Defence League The India Defence League was a British pressure group founded in June 1933 dedicated to keeping India within the British Empire. It grew from the parliamentary India Defence Committee and was founded with the support of 10 Privy Councillors, 28 peers, 57 MPs, 2 former Governors and 3 former Lieutenant-Governors of Indian provinces and including members of the armed forces and the judiciary. Viscount Sumner was its Honorary President, with Lord Carson, Rudyard Kipling, Winston Churchill, Sir Henry Page-Croft, the Marquess of Hartington, and Viscount FitzAlan holding the Vice-Presidencies. It eventually had over 100 peers as members. The IDL also helped Admiral Keyes win the Portsmouth North by-election in 1934. See also Indian Empire Society Notes Category:1933 establishments in the United Kingdom Category:Organizations established in 1933 Category:Political organisations based in the United Kingdom Category:History of the British Empire Category:Indian independence movement

Pages Wednesday, November 16 Are you sitting comfortably? Then we'll begin! Story time at Flynn. Monday morning. All over the school, lessons stopped and children listened quietly and attentively to our volunteer parents reading picture books, and chapter books, and poetry, in Spanish and English.

Menu Progress for Killer Whale Habitat! “This is a beautiful planet and not at all fragile. Earth can withstand significant volcanic eruptions, tectonic cataclysms, and ice ages. But this canny, intelligent, prolific, and extremely self-centered human creature had proven himself capable of more destruction of life than Mother Nature herself…. We’ve got to be stopped.” -Michael L. Fischer- I received this update letter from the Wilderness Committee. It is such good news I just had to share it. The government has to be held responsible for the promises and legislation it claims to support and in this case they are on notice to do so. It is one thing to placate voters with plans however implementation is key. Today’s the day to spread the love, so it is with great pleasure that I write to share the good news about a wild creature that is near and dear to all of our hearts. Last week, we took another important step forward in the long effort to safeguard killer whales, one of our Pacific coast’s iconic species. I am writing to let you know what this latest court victory means, and to thank you – without supporters like you victories like this would not be possible! The federal Court of Appeal has upheld a precedent-setting ruling that confirmed the federal government is legally bound to protect killer whale habitat. This means that essentially all of the original ruling, which found that the Department of Fisheries and Oceans (DFO) had failed to legally protect killer whale critical habitat, has been upheld. The Wilderness Committee has been part of a coalition of nine environmental groups, represented by Ecojustice, who successfully argued in Federal Court last year that DFO had not met its legal obligation to protect killer whales. The court ruled that the Minister of Fisheries and Oceans must legally protect all aspects of killer whale critical habitat — including their food supply and the quality of their marine environment. DFO appealed one key aspect of that decision, claiming that discretionary provisions in the Fisheries Act adequately protect the critical habitat of aquatic species such as the killer whale. The Fisheries Act, however, does not make critical habitat protection mandatory, as is the case under the Species at Risk Act. Instead, the Fisheries Act gives Minister Keith Ashfield broad discretion to authorize activities that destroy habitat. Last week, the DFO appeal was defeated. And that’s great news for the two distinct populations of killer whales that traverse British Columbia’s coastal waters, the northern and southern residents. At last count there were 264 threatened northern residents and just 87 endangered southern residents. Killer whales are considered a “sentinel species,” which means their health is a bellwether for the overall health of the ocean environment in which they live. The victory was precedent-setting for the more than 90 endangered and threatened aquatic species listed under the Species at Risk Act, all of which depend on healthy habitats to survive. Today’s a good day to show your love for killer whales and all endangered species. Gwen Barlee | Policy DirectorWilderness Committee Thank you for supporting wilderness. The Wilderness Committee is Canada’s largest membership-based, citizen-funded wilderness preservation organization. We work for the preservation of Canadian and international wilderness through research and grass roots education. The Wilderness Committee works on the ground to achieve ecologically sustainable communities. As a Wilderness Committee member and supporter, you will be an important part of saving vital wilderness areas. You can also help us by volunteering. Find out how to become a member or call us at 604-683-8220.

Bulgarian New Democracy Bulgarian New Democracy (, БНД) is a political faction in the Bulgarian National Assembly formed on 2007-12-05 by fourteen dissenters of the National Movement for Stability and Progress who claim that their former party has lost its liberal roots. The faction may grow to about twenty MPs, but it is not expected to threaten the ruling government's majority. The leader of the faction is Borislav Ralchev. The faction did not immediately decide whether it will found its own party or whether it will join an existing party — most likely the Citizens for European Development of Bulgaria —, but it announced that the voters would have the final word on that before the next elections are held in 2009. In the end, the party was formally established as a separate party on 11 May 2008, positioning itself in the centre-right and hoping to establish alliances with other centre-right parties. Before the official announcement of the faction's foundation, European Liberal Initiative had been mentioned as a possible name. In January 2008, BND suggested it may ally with the United Democratic Forces to form a new, right-wing movement. References Category:Political parties in Bulgaria Category:Political parties established in 2007

When Joshua Safran was four years old, his mother--determined to protect him from the threats of nuclear war and Ronald Reagan--took to the open road with her young son, leaving the San Francisco countercultural scene behind. Together they embarked on a journey to find a utopia they could call home. In Free Spirit, Safran tells the harrowing, yet wryly funny story of his childhood chasing this perfect life off the grid--and how they survived the imperfect one they found instead. Encountering a cast of strange and humorous characters along the way, Joshua spends his early years living in a series of makeshift homes, including shacks, teepees, buses, and a lean-to on a stump. His colorful youth darkens, however, when his mother marries an alcoholic and abusive guerrilla/poet. Throughout it all, Joshua yearns for a "normal" life, but when he finally reenters society through school, he finds "America" a difficult and confusing place. Years spent living in the wilderness and discussing Marxism have not prepared him for the Darwinian world of teenagers, and he finds himself bullied and beaten by classmates who don't share his mother's belief about reveling in one's differences. Eventually, Joshua finds the strength to fight back against his tormentors, both in school and at home, and helps his mother find peace. But Free Spirit is more than just a coming-of-age story. It is also a journey of the spirit, as he reconnects with his Jewish roots; a tale of overcoming adversity; and a captivating read about a childhood unlike any other. Praise For Free Spirit… "Instantly captivating, heartbreaking, inspiring...[An] almost-too-crazy-to-be-true story. This book is nothing short of remarkable."—Elle Magazine, "Readers' Pick" "With engaging story after story and a healthy dose of narrative tension throughout, Safran all but turns the pages for you."—San Francisco Chronicle "An enthusiastic, bounding picaresque...Safran is funny, engaging and a great storyteller."—Jewish Daily Forward "Poetic, and compelling...In this important book, Safran offers up the wounds of a flower child, and every frayed petal is astonishingly beautiful."—Gulf Stream "A remarkable account of survival despite the odds."—Kirkus Reviews "Joshua Safran's Free Spirit provides a mesmerizing coming-of-age story for one of the next generation's most inspired spiritual progressives."—Rabbi Michael Lerner, Editor, Tikkun, and Chair, The Network of Spiritual Progressives "Free Spirit is a stranger-than-fiction look at an absolutely fascinating childhood."—Sam Apple, author of Schlepping Through the Alps "Haunting and beautifully written, Free Spirit draws you into the gritty, white-knuckle ride that was Joshua Safran's childhood. Spellbinding. A must-read."—Liz Murray, author of the New York Times bestseller Breaking Night "Rich in detail, humor, and compassion, Free Spirit is an eloquent coming-of-age story about a mother's well-intentioned, but flawed, search for utopia and the impact her chaotic journey had on her son. Thankfully, Joshua Safran emerges from his impoverished, rootless childhood resilient, resourceful, and wise. A transformative book."—Mira Bartók, author of National Book Critics Circle Award winner The Memory Palace "Some writers search everywhere for a great story, and others have a great story happen to them. Joshua Safran's tale of his upbringing among radicals, revolutionaries, and renegades is equal parts hilarious and touching. Strap yourself into the green bus for a whirlwind tour of the American underground through the eyes of an impressionable young storyteller-to-be."—Thomas Mullen, author of The Last Town on Earth

12-3316-cv Arrocha v. City University of New York UNITED STATES COURT OF APPEALS FOR THE SECOND CIRCUIT SUMMARY ORDER RULINGS BY SUMMARY ORDER DO NOT HAVE PRECEDENTIAL EFFECT. CITATION TO A SUMMARY ORDER FILED ON OR AFTER JANUARY 1, 2007, IS PERMITTED AND IS GOVERNED BY FEDERAL RULE OF APPELLATE PROCEDURE 32.1 AND THIS COURT’S LOCAL RULE 32.1.1. WHEN CITING A SUMMARY ORDER IN A DOCUMENT FILED WITH THIS COURT, A PARTY MUST CITE EITHER THE FEDERAL APPENDIX OR AN ELECTRONIC DATABASE (WITH THE NOTATION “SUMMARY ORDER”). A PARTY CITING TO A SUMMARY ORDER MUST SERVE A COPY OF IT ON ANY PARTY NOT REPRESENTED BY COUNSEL. 1 At a stated term of the United States Court of Appeals for the Second Circuit, held at the 2 Thurgood Marshall United States Courthouse, 40 Foley Square, in the City of New York, on the 1st 3 day of July, two thousand thirteen. 4 5 PRESENT: 6 DEBRA ANN LIVINGSTON, 7 GERARD E. LYNCH, 8 RAYMOND J. LOHIER, JR., 9 Circuit Judges. 10 _____________________________________ 11 12 JOSE LUIS ARROCHA, 13 14 Plaintiff-Appellant, 15 16 v. 12-3316-cv 17 18 CITY UNIVERSITY OF NEW YORK, et al., 19 20 21 Defendants-Appellees. 22 _____________________________________ 23 24 FOR PLAINTIFF-APPELLANT: Jose Luis Arrocha, pro se, Brooklyn, NY. 25 26 FOR DEFENDANTS-APPELLEES: Matthew W. Grieco, Assistant Solicitor General of 27 Counsel, Eric T. Schneiderman, Attorney General 28 of the State of New York, Barbara D. Underwood, 29 Solicitor General, Michael S. Belohlavek, Senior 30 Counsel, Albany, NY. 31  1 Appeal from a judgment of the United States District Court for the Eastern District of New 2 York (Vitaliano, J.). 3 UPON DUE CONSIDERATION, IT IS HEREBY ORDERED, ADJUDGED, AND 4 DECREED that the judgment of the district court is AFFIRMED. 5 Plaintiff-Appellant Jose Luis Arrocha, proceeding pro se, appeals from the district court’s 6 judgment granting the defendants’ motion to dismiss his civil rights and employment discrimination 7 action pursuant to Federal Rule of Civil Procedure 12(b)(6). We assume the parties’ familiarity with 8 the underlying facts, the procedural history of the case, and the issues on appeal. 9 We review a district court’s Rule 12(b)(6) dismissal of a complaint de novo. See Famous 10 Horse Inc. v. 5th Ave. Photo Inc., 624 F.3d 106, 108 (2d Cir. 2010). The complaint must plead 11 “enough facts to state a claim to relief that is plausible on its face.” Bell Atl. Corp. v. Twombly, 550 12 U.S. 544, 570 (2007). Although all allegations contained in the complaint are assumed to be true, 13 this tenet is “inapplicable to legal conclusions.” Ashcroft v. Iqbal, 556 U.S. 662, 678 (2009). “A 14 claim has facial plausibility when the plaintiff pleads factual content that allows the court to draw 15 the reasonable inference that the defendant is liable for the misconduct alleged.” Id. We remain 16 obligated, however, to construe pro se complaints liberally. See Harris v. Mills, 572 F.3d 66, 71-72 17 (2d Cir. 2009). Thus, while pro se complaints must contain sufficient factual allegations to meet the 18 plausibility standard, id., we should look for such allegations by reading pro se complaints with 19 “special solicitude” and interpreting them to raise the “strongest [claims] that they suggest.” 20 Triestman v. Fed. Bureau of Prisons, 470 F.3d 471, 474-75 (2d Cir. 2006) (per curiam) (emphasis 21 omitted). 22 2  1 Upon review, we conclude that the district court properly granted the defendants’ motion to 2 dismiss on the ground that the claims were implausible. We need not reach Arrocha’s argument that 3 his 2009 Title VII claims that the district court dismissed as time-barred were properly brought 4 because the district court should have treated his EEOC intake form as an EEOC charge (an 5 argument that, in any event, was not presented to the district court). Arrocha’s 2009 Title VII claims 6 rely on the same legal predicates and factual allegations as his 2009 § 1983 claims. Because we 7 conclude that the district court correctly dismissed the latter claims for failing to state a claim, his 8 Title VII claims were also properly dismissed, even assuming they were timely when filed. 9 For the foregoing reasons, the judgment of the district court is hereby AFFIRMED. 10 FOR THE COURT: 11 Catherine O’Hagan Wolfe, Clerk 3 

Introduction {#Sec1} ============ Fusion proteins with the features of chimeric transcription factors are frequently created by chromosomal translocations in acute leukemia^[@CR1]^. Generation of these diverse factors is typically an early, initiating event in acute leukemogenesis with important patho-biological and clinical implications. Although the complete mechanisms underlying their oncogenic effects are not fully understood, one emerging theme is their ability to self-associate into higher-order molecular complexes^[@CR2]--[@CR4]^, reminiscent of the role of constitutive self-association in the oncogenic activation of chimeric kinases^[@CR5]^. However, the specific roles, if any, for oligomerization in activating the transcriptional and leukemogenic properties of most chimeric transcription factors remain poorly defined. The PBX1 proto-oncoprotein is a TALE (three amino acid loop extension) class homeodomain protein, which is a component of hetero-oligomeric transcriptional complexes that regulate developmental gene expression^[@CR6]--[@CR8]^. Lack of PBX1 results in embryonic lethality and several embryonic defects partially phenocopy loss of various HOX, MEINOX, or orphan homeodomain proteins^[@CR9],[@CR10]^, consistent with the *in vitro* properties of PBX1 as a DNA binding cofactor for a large subset of homeodomain transcription factors with roles in multiple developmental programs^[@CR11]--[@CR13]^. PBX1 is converted into a chimeric transcription factor by t(1;19) chromosomal translocations in about 5% of pediatric and adult acute lymphoblastic leukemia and (rarely) myeloid leukemia^[@CR14],[@CR15]^. It is oncogenically activated by in-frame fusions with E2A (also known as TCF3) proteins, which are transcriptional regulators of the bHLH family with critical roles in the development and differentiation of several cellular lineages^[@CR16],[@CR17]^. Fusion with E2A dramatically alters the biochemical and transcriptional properties of PBX1, with likely impacts on both the E2A and PBX1 subordinate pathways. The E2A moiety confers strong transcriptional activator and constitutive nuclear localization properties on E2A-PBX1^[@CR18]^, which retains the PBX1 homeodomain DNA binding motif. This gain of function, which is critical for oncogenic activity, abrogates interactions with and dependence on MEINOX homeodomain proteins, which conditionally regulate the stability, nuclear import and cooperative DNA binding of wild type PBX1^[@CR19]--[@CR21]^. Chimeric E2A-PBX1 oncoproteins retain an ability to bind DNA in association with HOX transcription factors^[@CR22],[@CR23]^, and co-expression with HOXA9 accelerates E2A-PBX1 mediated leukemogenesis^[@CR24]^, suggesting that E2A-PBX1 directly impacts the HOX transcriptional regulatory pathway in acute leukemia pathogenesis. A provisional molecular model proposes that E2A-PBX1 perturbs the expression of critical subordinate genes as a simple heterodimeric complex with HOX DNA binding partners^[@CR22],[@CR24]^. However, HOX gene expression profiles in E2A-PBX1^+^ ALL cells are highly variable^[@CR25],[@CR26]^ and most of the supporting experiments employed forced expression of HOX genes^[@CR24],[@CR27]^, raising the possibility that undefined pathways may contribute to E2A-PBX1 leukemogenesis. We report here that E2A-PBX1 self-associates through the PBC-B domain of the chimeric protein to form higher-order oligomers in t(1;19) human leukemia cells. Self- association is required for oncogenic activity and facilitates the binding of E2A-PBX1 to DNA. These studies suggest a revised model for E2A-PBX1 leukemogenesis in which self-association compensates for its inability to stably bind DNA or dimerize with heterologous MEINOX protein partners that otherwise regulate PBX1 DNA binding and transcriptional activity. Results {#Sec2} ======= Identification of E2A-PBX1 interacting proteins using LAP-tag purification {#Sec3} -------------------------------------------------------------------------- To assess potential protein interactions of E2A-PBX1, gel filtration chromatography was performed using a whole cell extract prepared from the human lymphoblastic leukemia cell line RCH-ACV, which contains a t(1;19) chromosomal translocation^[@CR28]^. E2A-PBX1 eluted at approximately 400 kD (Fig. [1a](#Fig1){ref-type="fig"}), much larger than its predicted monomeric mass of 90 kD, suggesting that it forms a higher-order complex. To identify candidate interacting proteins, we applied LAP (localization and tandem affinity purification) technology (Fig. [1b](#Fig1){ref-type="fig"})^[@CR29]^. LAP-tagged E2A-PBX1 was stably expressed in RCH-ACV cells and purified with GFP and Flag antibodies (Fig. [1b](#Fig1){ref-type="fig"}). Sixty co-purified proteins were identified by mass spectrometry in at least two of three independent experiments (Supplementary Fig. [S1a](#MOESM1){ref-type="media"}). Among the identified spectra, the majority signals derived from E2A and PBX family proteins, including wild type PBX1, PBX2 and PBX3 (Supplementary Fig. [S1a](#MOESM1){ref-type="media"} and Fig. [1c](#Fig1){ref-type="fig"}). Interaction of E2A-PBX1 with PBX family proteins was confirmed by co-immunoprecipitation (co-IP) assays (Fig. [1d](#Fig1){ref-type="fig"}). Although other proteins co-purified with E2A-PBX1 at lower abundance, we were unable to demonstrate their association with E2A-PBX1 under our co-IP conditions, including TCF12 and LMNB1, suggesting that they may be weak interactors of E2A-PBX1 or need other associating proteins to maintain stable interactions that otherwise may be disrupted during the co-IP process.Figure 1Identification of E2A-PBX1 interacting proteins using LAP purification. (**a**) Superose-6 gel filtration analysis was performed on a protein extract of the RCH-ACV E2A-PBX1^+^ leukemia cell line. Each column elution fraction was fractionated in SDS-PAGE and immunoblotted with an anti-PBX1 antibody. Full-length blots are included in Supplementary Fig. [S5](#MOESM1){ref-type="media"}. (**b**) Diagram shows LAP-tagged E2A-PBX1 and the tandem affinity LAP purification scheme. (**c**) Eluates from LAP purifications using RCH-ACV cells stably expressing vector or LAP-tagged E2A-PBX1 were resolved by SDS-PAGE and silver stained. The three bands of E2A-PBX1 were from E2A-PBX1 degradation. (**d**) Co-immunoprecipitation assays show E2A-PBX1 interaction with PBX1, PBX2, and PBX3. His-tagged PBX1, PBX2, or PBX3 were co-transfected with vector only or Flag-tagged E2A-PBX1 into 293T cells. Cell lysates were immuno-precipitated with an anti-Flag antibody before western blotting with Flag and His antibodies. Full-length blots are included in Supplementary Fig. [S5](#MOESM1){ref-type="media"}. (**e**) Results of cell proliferation assays are shown for RCH-ACV cells after control (shLuc) shRNA or shRNA-mediated knockdown of E2A-PBX1, PBX1, PBX2, or PBX3. Cell numbers were enumerated after 4 days and expressed relative to the numbers obtained with control shRNA-transduced cells. Data indicate means ± SEM (n = 3 independent experiments). Statistical analysis was performed by Student *t* test. \*\*\*p \< 0.001; n.s., not significant. To gain insight into the molecular function of PBX homeodomain family proteins in E2A-PBX1 leukemogenesis, the respective wild type proteins were individually depleted in RCH-ACV cells. E2A-PBX1 depletion by PBX1 shRNA, which targets both E2A-PBX1 and wild type PBX1, significantly reduced and impaired cell growth whereas wild type PBX1 specific depletion (shPBX1-N) had very limited impact on cell growth (Fig. [1e](#Fig1){ref-type="fig"} and Supplementary Fig. [S1b](#MOESM1){ref-type="media"}), consistent with the fact that PBX1 is expressed at very low levels (if at all) in B cell lineages^[@CR30]^. Similarly, cell growth was not significantly affected following depletion of PBX2 or PBX3 alone or in combination (Fig. [1e](#Fig1){ref-type="fig"} and Supplementary Fig. [S1b](#MOESM1){ref-type="media"}). Thus, despite the fact that E2A-PBX1 was capable of stably interacting with wild type endogenous PBX family proteins, their knockdown had no effect on cell growth in E2A-PBX1^+^ ALL cells. These findings raised the possibility that E2A-PBX1 may self-associate through the PBX1 portion of the chimera to form a tetramer (\~400 kD) or higher-order oligomer in t(1;19) lymphoblastic leukemia cells. E2A-PBX1 self-associates through the PBX1 PBC-B domain of the chimeric protein {#Sec4} ------------------------------------------------------------------------------ To investigate the oligomerization potential of E2A-PBX1, co-immunoprecipitation analyses were performed in 293T cells transiently co-expressing E2A-PBX1 proteins differentially tagged with either the Flag or His epitopes. Immunoprecipitation of Flag-tagged E2A-PBX1 with an anti-Flag antibody resulted in the co-precipitation of His-tagged E2A-PBX1 (Fig. [2a](#Fig2){ref-type="fig"}), demonstrating that E2A-PBX1 self-associates. Further analyses to localize the interaction site within E2A-PBX1 showed that mutants containing only the E2A portion did not interact with E2A-PBX1 (Fig. [2b,c](#Fig2){ref-type="fig"}), indicating that self-association occurs exclusively through the PBX1 portion of the chimeric protein consistent with the finding that E2A-PBX1 interacted with PBX family proteins in LAP purification. To further define regions of PBX1 responsible for self-association, a series of E2A-PBX1 deletion mutants was examined by co-immunoprecipitation analysis. These results showed that mutants with deletion of the PBC-B domain of PBX1 (ΔPBC-B) were unable to co-immunoprecipitate with E2A-PBX1 (Fig. [2b,c](#Fig2){ref-type="fig"}). All E2A-PBX1 mutant proteins localized to the nucleus excluding the possibility of localization changes (Supplementary Fig. [S2](#MOESM1){ref-type="media"}). Direct protein-protein interaction assays using GST-pull down further confirmed that the PBC-B domain mediates E2A-PBX1 self-association (Fig. [2d](#Fig2){ref-type="fig"}).Figure 2E2A-PBX1 self-associates through the PBX1 PBC-B domain of the chimeric protein. (**a**) Results are shown for co-immunoprecipitation assay in 293T cells co-transfected with His-tagged E2A-PBX1 and Flag-tagged E2A-PBX1. Cell lysates were immuno-precipitated with an anti-Flag antibody to demonstrate self-association of E2A-PBX1. (**b**) Schematic summary of E2A-PBX1 mutant constructs and their self-association abilities. HD, homeodomain; HCM, HOX cooperativity motif. (**c**) Flag-tagged mutant E2A-PBX1 proteins were co-transfected into 293T cells with His-tagged E2A-PBX1. Cell lysates were immuno-precipitated with an anti-Flag antibody to demonstrate that self-association of E2A-PBX1 requires the PBC-B domain of PBX1 in the chimeric protein. (**d**) GST-pull down assay shows that E2A-PBX1 self-associates directly through the PBC-B domain of PBX1. Full-length blots are included in Supplementary Fig. [S5](#MOESM1){ref-type="media"}. Self-association of E2A-PBX1 correlates with its oncogenic potential {#Sec5} -------------------------------------------------------------------- The role of self-association in E2A-PBX1 mediated oncogenic transformation was assessed using a methylcellulose serial replating assay that has previously been shown to reliably read out the transformative potential of E2A-PBX^[@CR31]^. In contrast to intact E2A-PBX1, deletion mutants without the homeodomain (HD) were not able to sustain the clonogenic potential of myeloid progenitors in methycellulose cultures (Fig. [3a](#Fig3){ref-type="fig"}) suggesting that homeodomain-mediated DNA binding is indispensable for E2A-PBX1 oncogenic activity in this assay. Of note, mutants with PBC-B domain depletion (ΔPBC-B), even with intact homeodomain, lacked transformation ability, correlating completely with their inabilities to self-associate (Fig. [3a](#Fig3){ref-type="fig"}). This suggested that oligomerization may be a prerequisite for E2A-PBX1 oncogenesis. By contrast, the previously demonstrated abilities of these mutant proteins to bind DNA with the cooperation of HOX partners^[@CR22],[@CR32]^, which depended on the extended PBX1 homeodomain containing the HOX cooperativity motif (HCM), did not correlate with transformation potential in this assay (Fig. [3a](#Fig3){ref-type="fig"}), suggesting that association of E2A-PBX1 with HOX partners alone is not sufficient for transformation.Figure 3Immortalization of myeloid progenitors by E2A-PBX1 is dependent on its self-association. (**a**) Primary myeloid progenitors (c-kit^+^) were transduced with various E2A-PBX1 deletion constructs and assessed for their clonogenic potential through four rounds of serial plating in methylcellulose culture. Data indicate means ± SEM (n = 3 independent experiments). (**b**) Schematic illustration of conditional FKBP-mediated dimerization. (**c**) Primary myeloid progenitors (c-kit^+^) were transduced with various E2A-PBX1-FKBP fusion constructs and assessed for their clonogenic potential as in panel A. Data indicate means ± SEM (n = 3 independent experiments). To further assess the role of self-association, a set of E2A-PBX1 fusion proteins was constructed using a modified FK506-binding protein (FKBP) dimerization module^[@CR33]^, which provides for conditional dimerization that can be disrupted using the synthetic agent D/D solubilizer (Fig. [3b](#Fig3){ref-type="fig"}). Two tandem copies of FKBP were fused in-frame to the carboxy termini of the various E2A-PBX1 deletion mutants (Fig. [3c](#Fig3){ref-type="fig"}). Fusion of full-length E2A-PBX1 to FKBP did not alter its ability to immortalize hematopoietic progenitors (Fig. [3c](#Fig3){ref-type="fig"}). However, the oncogenic potentials of several otherwise non-transforming E2A-PBX1 mutants were activated following fusion with FKBP as evidenced by their abilities to induce clonogenic growth of progenitors in the fourth round of methylcellulose culture (Fig. [3c](#Fig3){ref-type="fig"}) and establish cell lines in liquid culture (data not shown). The constructs that were not activated by FKBP lacked the PBX1 homeodomain, suggesting that forced oligomerization did not bypass a requirement for DNA binding in oncogenic transformation. In fact, the homeodomain was the minimal PBX1 requirement sufficient for transformation under these conditions as demonstrated by the robust ability of HD only-FKBP (Fig. [3c](#Fig3){ref-type="fig"}) to enhance clonogenic potential. One of the non-transforming constructs lacked all PBX1 sequences (E2A only) demonstrating that forced dimerization of only the E2A portion of the chimera was not oncogenic in the myeloid transformation assay (Fig. [3c](#Fig3){ref-type="fig"}). Taken together, these results suggest that oligomerization is required for transformation initiated by E2A-PBX1. Self-association is required for maintenance of E2A-PBX1-mediated transformation {#Sec6} -------------------------------------------------------------------------------- We next investigated the role for self-association in continued maintenance of E2A-PBX1-mediated transformation. The D/D solubilizer was added to methylcellulose culture medium to disrupt the artificial dimerization mediated by FKBP in the E2A-PBX1 mutants (Fig. [3b](#Fig3){ref-type="fig"}). When cells stably transformed by mutant E2A-PBX1-FKBP fusions were plated in methylcellulose culture in the presence of D/D solubilizer, their clonogenic potential was substantially impaired resulting in small colonies with diffuse morphology that failed to replate (Fig. [4a](#Fig4){ref-type="fig"}). This contrasted with the large blast-type colonies in the absence of drug, thus demonstrating a dependence upon FKBP-mediated oligomerization for maintaining enhanced self-renewal. By comparison, the clonogenic potential of cells transformed by full-length E2A-PBX1-FKBP was unaffected by D/D solubilizer presumably because self-association was mediated through the intact PBX1 moiety and not dependent on FKBP (Fig. [4a](#Fig4){ref-type="fig"}). In the absence of drug, the cultures initiated by PBC-B deleted mutant of E2A-PBX1-FKBP were comprised predominantly of Gr-1 low cells with the morphologic features of blasts (Fig. [4b,c](#Fig4){ref-type="fig"}). However, within 7 days of drug addition, the proportion of blasts was markedly reduced and the cultures contained mostly Gr-1 high cells with mature or maturing cytologic features (Fig. [4b,c](#Fig4){ref-type="fig"}). Taken together, these data demonstrate that the enhanced self-renewal, impaired differentiation, and sustained proliferation imposed by E2A-PBX1 are dependent on its ability to self-associate.Figure 4Self-association is required to maintain the oncogenic properties of E2A-PBX1 transformed cells. (**a**) Primary myeloid progenitors (c-kit^+^) were transduced with various E2A-PBX1-FKBP fusion constructs and assessed for their clonogenic potential through three rounds of serial plating in methylcellulose culture with or without D/D solubilizer. Representative colony morphologies are shown below the histogram. Data indicate means ± SEM (n = 3 independent experiments). Scale bar defines 200 μm. (**b**) FACS profiles show Gr-1 expression on E2A-PBX1-FKBP transformed cells cultured in medium with or without D/D solubilizer. (**c**) Cyto-preparations stained with May Grunwald-Giemsa solution show cells transformed with E2A-PBX1-FKBP fusions cultured in medium with or without D/D solubilizer. Representative images are shown. Scale bar defines 20 μm. Self-association of E2A-PBX1 confers its DNA binding ability {#Sec7} ------------------------------------------------------------ We hypothesized that the dependence on self-association in E2A-PBX1 transformation may be due to effects on DNA binding allowing E2A-PBX1 to cooperatively bind DNA with itself as a homo-dimer or oligomer. This may compensate for the inability of chimeric E2A-PBX1 to bind DNA as a monomer or hetero-dimerize with Meinox homeodomain protein partners, which otherwise cooperatively enhance wild type PBX1 DNA binding^[@CR34]^. Consistent with this hypothesis, electrophoretic mobility shift assays using an oligonucleotide containing the consensus PBX1 site showed that the PBC-B deletion mutant of E2A-PBX1 lacked DNA binding ability but was rescued by fusion with FKBP (Fig. [5a,b](#Fig5){ref-type="fig"}). These data demonstrate that self-association activates E2A-PBX1 DNA binding, which correlates with its conditional transformation properties (Figs [3c](#Fig3){ref-type="fig"} and [4a](#Fig4){ref-type="fig"}).Figure 5Self-association of E2A-PBX1 confers its DNA binding ability. (**a**) Coomassie blue stained SDS-PAGE gel shows purified MBP-tagged E2A-PBX1 recombinant proteins. MBP: maltose binding protein. \*Intact protein. (**b**) Electrophoretic mobility shift assay was performed using a PBX1 consensus site with various recombinant E2A-PBX1 or E2A-PBX1-FKBP fusion proteins indicated at the top. E2A-PBX1 self-association contributes to growth and maintenance of human E2A-PBX1^+^ preB-ALL {#Sec8} --------------------------------------------------------------------------------------------- To functionally delineate the role of E2A-PBX1 self-association in human E2A-PBX1^+^ leukemia cells, its potential oncogenic requirement was assessed using *in-vitro* and *in-vivo* transformation model systems. Various E2A-PBX1 mutant constructs that were resistant to shRNA-mediated PBX1 knockdown were expressed in RCH-ACV cells, which were then depleted of endogenous E2A-PBX1 by shRNA knockdown (Fig. [6a,b](#Fig6){ref-type="fig"}). Endogenous E2A-PBX1 depletion significantly reduced or impaired *in-vitro* growth of RCH-ACV cells in liquid culture or colony formation in methylcellulose medium (Fig. [6c--e](#Fig6){ref-type="fig"}). RCH-ACV cells expressing exogenous E2A-PBX1 full length (FLsi) and C-terminal deletion (ΔCsi) constructs resistant to shRNA knockdown continued to grow normally, despite the loss of endogenous E2A-PBX1 (Fig. [6c--e](#Fig6){ref-type="fig"}). In contrast, deletion mutants lacking the PBC-B domain (ΔPBC-B) or homeodomain (ΔHDsi) were unable to rescue growth of E2A-PBX1 depleted cells. However, fusion of the FKBP dimerization motif with the ΔPBC-B mutant, but not the ΔHD mutant, rescued cell growth and colony formation indicating that E2A-PBX1 self-association mediated by the PBC-B domain is required for RCH-ACV cell growth (Fig. [6c--e](#Fig6){ref-type="fig"}).Figure 6RCH-ACV cells are dependent on E2A-PBX1 self-association for growth and maintenance. (**a**) Experimental scheme for generating cells stably expressing shRNA-resistant exogenous E2A-PBX1 constructs for use in rescue experiments. (**b**) Western blot shows the levels of indicated proteins after E2A-PBX1 shRNA treatment of RCH-ACV cells expressing various shRNA-resistant E2A-PBX1 mutants. Endogenous E2A-PBX1 was efficiently depleted after shRNA treatment. "si" denotes E2A-PBX1 shRNA resistant constructs. Full-length blots are included in Supplementary Fig. [S5](#MOESM1){ref-type="media"}. (**c**,**d**) Histograms show results of cell proliferation and colony-forming assays after shRNA-mediated knockdown of endogenous E2A-PBX1. Cell numbers (**c**) and colony numbers (**d**) were enumerated after 4 and 5 days, respectively, and expressed relative to the numbers obtained with control shRNA-transduced cells. Data indicate means ± SEM (n = 3 independent experiments). Statistical analysis was performed by Student *t* test. \*\*p \< 0.01; \*\*\*p \< 0.001; n.s., not significant. (**e**) Representative colony morphologies are shown for experiment in (d). Scale bars define 400 μm. (**f**) Survival curves are shown for cohorts of mice transplanted with RCH-ACV cells stably expressing various E2A-PBX1 mutants and treated with control or E2A-PBX1 shRNAs (n = 4 in each cohort). Statistical analysis was performed by the Log-rank (Mantel-Cox) test. \*p \< 0.05; \*\*\*p \< 0.001; n.s., not significant. (**g**) E2A-PBX1 transcript levels are shown for bone marrow cells isolated from diseased mice transplanted with RCH-ACV cells treated with control (shLuc) or E2A-PBX1 shRNAs. Data indicate mean ± SEM (n = 3). Statistical analysis was performed by Student *t* test. n.s., not significant. The requirement for E2A-PBX1 self-association in leukemogenesis was assessed *in vivo*. NOD-SCID mice were transplanted with RCH-ACV leukemia cells depleted of endogenous E2A-PBX1 and expressing various exogenous E2A-PBX1 constructs (Fig. [6f](#Fig6){ref-type="fig"}). Mice transplanted with E2A-PBX1-depleted cells survived longer than control mice and were not converted to shorter latency by expression of the exogenous PBC-B domain mutant (Fig. [6f](#Fig6){ref-type="fig"}). In contrast, mice transplanted with cells expressing the PBC-B domain deletion mutant fused with FKBP developed leukemia with a shortened latency comparable to control mice rescued by expression of full-length E2A-PBX1. Although leukemia eventually developed in mice transplanted with E2A-PBX1-depleted cells, this was caused by loss of E2A-PBX1 suppression by an unknown mechanism (Fig. [6g](#Fig6){ref-type="fig"}). Thus, self-association mediated by the PBC-B domain contributes to the leukemogenic properties of E2A-PBX1. The critical requirement of self-association for growth and maintenance of E2A-PBX1^+^ preB-ALL was also assessed in a conditional E2A-PBX1 transgenic mouse model^[@CR35]^. Mouse E2A-PBX1^+^ leukemia cells were first transduced with various E2A-PBX1 constructs resistant to shRNA-mediated knockdown and then depleted of endogenous E2A-PBX1 by shRNA knockdown. Transduced cells were then assessed in colony forming assays to evaluate the ability of exogenous constructs to rescue depletion of endogenous E2A-PBX1 (Supplementary Fig. [S3a](#MOESM1){ref-type="media"}). The results were consistent with the foregoing studies using human RCH-ACV cells and confirmed that E2A-PBX1 self-association contributes to E2A-PBX1-induced preB-ALL (Supplementary Fig. [S3b,c](#MOESM1){ref-type="media"}). Delineation of the self-association motif of E2A-PBX1 {#Sec9} ----------------------------------------------------- To further define the oligomerization motif in E2A-PBX1, additional PBC-B domain deletion mutants were generated based on its predicted secondary structure (Fig. [7a](#Fig7){ref-type="fig"}). Flag-tagged PBC-B domain mutants of E2A-PBX1 were co-transfected with His-tagged full-length E2A-PBX1 into 293T cells and co-immunoprecipitation was performed with an anti-Flag-antibody to evaluate self-association potential. A deletion mutant lacking amino acids 189--231 of PBX1 (ΔPBC-B 189--231) was unable to precipitate with His-tagged E2A-PBX1 (Fig. [7b](#Fig7){ref-type="fig"}), indicating that a small motif within the deleted region of PBC-B domain plays a key role mediating self-association of E2A-PBX1. Colony forming assays also showed that the ΔPBC-B 189--231 mutant of E2A-PBX1, similar to the ΔPBC-B mutant lacking amino acids 89--231, was unable to transform mouse myeloid progenitors (Fig. [7c](#Fig7){ref-type="fig"}) thereby defining a helical-rich motif in E2A-PBX1 required for self-association and oncogenesis.Figure 7Delineation of the E2A-PBX1 dimerization motif. (**a**) Schematic illustration of PBC-B domain deletion mutants of E2A-PBX1. (**b**) Flag-tagged PBC-B domain mutants of E2A-PBX1 were co-transfected into 293T cells with His-tagged E2A-PBX1. Cell lysates were immuno-precipitated with an anti-Flag antibody to demonstrate that self-association of E2A-PBX1 requires the NC domain (aa 189--231) of PBX1. Full-length blots are included in Supplementary Fig. [S5](#MOESM1){ref-type="media"}. (**c**) Primary myeloid progenitors (c-kit^+^) were transduced with various PBC-B domain deletion constructs and assessed for their clonogenic potential through four rounds of serial plating in methylcellulose culture. Data indicate means ± SEM (n = 3 independent experiments). (**d**) RCH-ACV cells were transduced with GFP only, GFP fusion E2A-PBX1-N (89--231 aa) or E2A-PBX1-N (ΔNC) (89--188 aa). GFP^+^ cells were sorted after 4 days, mixed 50/50 with non-treated RCH-ACV cells, and monitored every 2 days. Diagram shows mean ± SEM (n = 3 independent experiments). Statistical analysis was performed by F test. \*p \< 0.05; \*\*\*p \< 0.001. We further tested whether the PBC-B domain may have dominant-negative effects on inhibiting cell growth when over-expressed in RCH-ACV cells. Indeed, RCH-ACV cells over-expressing the E2A-PBX1-PBC-B 89--231 mutant showed a 30% reduction of growth in liquid culture compared to control cells, while cells overexpressing the E2A-PBX1-PBC-B 89--189 mutant showed 10% reduction of growth (Fig. [7d](#Fig7){ref-type="fig"}), confirming that E2A-PBX1-PBC-B can associate with E2A-PBX1 but fail to bind DNA since HD domain is absent. Discussion {#Sec10} ========== In this study, we demonstrate that self-association of the E2A-PBX1 chimeric transcription factor is indispensable for its oncogenic activity in human and mouse B-cell precursor leukemia cells, and primary myeloid progenitors. E2A-PBX1 self-associates through the PBX1 PBC-B domain to form a higher-order complex in t(1;19) lymphoblastic leukemia cells. A detailed structure/function analysis demonstrated the complete concordance of self-association with DNA binding, self-renewal, impaired differentiation, and sustained proliferation (Supplementary Fig. [S4](#MOESM1){ref-type="media"}). Thus, our results from multiple experimental systems consistently support that self-association is crucial but not sufficient for E2A-PBX1 leukemia pathogenesis. An oncogenic requirement for oligomeric self-association is a feature that E2A-PBX1 shares with several other chimeric transcription factors associated with acute leukemia pathogenesis^[@CR2]^. For example, dimerization-induced co-repressor binding and relaxed DNA binding specificity are critical for PML-RARα-induced immortalization^[@CR36]^, and forced RARα homodimers prime mice for leukemia^[@CR37]^. Dimerization also activates the oncogenic properties of a subset of MLL fusion proteins (e.g. MLL-AF6) by promoting association with gene expression modulators^[@CR4],[@CR38]--[@CR40]^. In the case of AML1-ETO, the NHR2 domain, which mediates oligomerization and interactions with co-repressor molecules, is critical for AML1-ETO's transcriptional and *in vitro* effects on myeloid differentiation and clonogenic potential^[@CR3],[@CR41]^. Thus, a recurring scenario for oncogenic activation of chimeric transcription factors involves self-association, which serves to alter their transcriptional properties. The mechanistic basis for the role of self-association in E2A-PBX1 oncogenesis appears to be operative at the level of DNA binding. This was demonstrated by the DNA binding ability and oncogenic activity of PBC-B domain deletion mutants artificially fused to FKBP. Intact E2A-PBX1 typically binds DNA poorly, if at all, as a monomer^[@CR32]^. Furthermore, previous unbiased site selection screens for optimal PBX1 recognition sequences yielded tandem dimeric PBX1 core sequences (TGATTGAT) suggesting that the PBX1 homeodomain does not stably bind DNA as a monomer^[@CR42]--[@CR44]^. Thus, self-association may stabilize binding to PBX consensus sites by providing two or more homeodomains in trans. Indeed, forcing dimerization of E2A-PBX1 overrides the requirement of PBC-B domain and rescues the oncogenic activity of PBC-B deletion mutant of E2A-PBX1. However, we cannot rule out the possibility that self-association may also enhance or modulate the transcriptional effector properties of E2A-PBX1 mediated through the E2A moiety in addition to facilitating DNA binding. Our results also do not exclude potential heterologous protein interactions by E2A-PBX1, but suggest that they are likely too weak, unstable, or sub-stoichiometric to be identified using our approach. Consistent with our results, previous studies have shown that the PBX1 DNA binding homeodomain is required for E2A-PBX1 oncogenic activity, underscoring the PBX1 target gene dependent character of E2A-PBX1-mediated transformation^[@CR22],[@CR45]^. However, our results diverge from those of previous studies regarding the requirement for hetero-dimerization with HOX proteins. Some studies have suggested that it is necessary since the HCM domain of PBX1, which mediates HOX protein interaction, is required for fibroblast transformation *in vitro*, blocked differentiation of cultured murine myeloid progenitors, and acute myeloid leukemia in mice^[@CR22],[@CR24],[@CR27]^. Although E2A-PBX1 oncogenicity in some of these assays is strongly enhanced by forced hyper-expression of HOXA9, HOX family genes are not consistently expressed in ALL cells^[@CR25],[@CR26]^. Our studies suggest that hetero-dimerization with HOX proteins may be dispensable since the HCM deletion mutant retains oncogenic potential, and the homeodomain constitutes the minimum required portion of PBX1 for transformation induced by FKBP-mediated dimerization. Other studies differ from ours in not supporting a role for homo-dimerization of E2A-PBX1 in oncogenic activity^[@CR32],[@CR46]^. Calvo *et al*. identified a 39 amino acid self-association motif (corresponding to PBX1 amino acids 168--206) within the PBC-B domain that partially overlaps with the motif identified in our study (189--231). However, the 39 amino acid motif was not required for myeloid immortalization *in vitro* by E2A-PBX1. Conversely, our studies demonstrate a requirement for self-association for E2A-PBX1 oncogenic activity in human and mouse B-cell precursor leukemia cell assays in addition to mouse myeloid transduction/transplantation assays. The observed divergence with previous studies may reflect differences in biological assays, or expression levels or compositions of constructs employed. Nevertheless, our results clearly indicate that self-association through the PBC-B domain and DNA binding through the homeodomain of PBX1 are the basic requirements for E2A-PBX1 oncogenic activity in B-lineage ALL cells and myeloid progenitors. Our studies support a revised model for E2A-PBX1 mediated transformation. Fusion with E2A results in both gain- and loss-of-function effects on PBX1 transcriptional activity. The E2A moiety confers strong transcriptional activation and constitutive nuclear localization properties on E2A-PBX1, both of which are necessary for transformation. Conversely, as a consequence of PBC-A domain disruption, E2A-PBX1 lacks the ability to bind DNA or heterodimerize with Meinox homeodomain proteins^[@CR19],[@CR34]^, which otherwise modulate PBX1 stability, nuclear localization, DNA binding, and transcriptional activity^[@CR7],[@CR20],[@CR21],[@CR47]^. Nevertheless, E2A-PBX1 retains an ability to cooperatively bind DNA with HOX proteins as a simple heterodimer, which has led to suggestions that it may function with HOX partners to mis-regulate subordinate genes containing PBX/HOX binding sites. However, our current studies indicate that although HOX association ability of E2A-PBX1 is retained, it is not sufficient (Fig. [3](#Fig3){ref-type="fig"}). Rather, E2A-PBX1 must self-associate for transformation, which may compensate for the inability of monomeric E2A-PBX1 to bind DNA or heterodimerize with MEINOX homeodomain proteins. Despite its key role in leukemia pathogenesis, E2A-PBX1 has not yet proven to be a "druggable" transcription factor for therapeutic targeting. Dependence of PBC-B domain mediated self-association for E2A-PBX1 oncogenic activity provides a rationale for its consideration as a therapeutic target for E2A-PBX1^+^ preB-ALL. A potential strategy is to disrupt E2A-PBX1 self-association. We further defined a minimum region in PBC-B domain required for E2A-PBX1 self-association. Small molecules designed to target this region to disrupt self-association merit further investigation. Materials and Methods {#Sec11} ===================== Cell culture {#Sec12} ------------ 293T and Phoenix cells were cultured in DMEM medium supplemented with 10% FBS, 100 U/mL penicillin/streptomycin, and 0.29 mg/mL L-glutamine. Human leukemia cell line RCH-ACV was cultured in RPMI1640 medium supplemented with 10% FBS, 100 U/mL penicillin/streptomycin, and 0.29 mg/mL L-glutamine. Mouse E2A-PBX1 leukemia cells were cultured as previously described^[@CR35]^. Expression vector construction and retrovirus preparation {#Sec13} --------------------------------------------------------- Plasmids encoding mutant forms of E2A-PBX1 have been reported previously^[@CR22]^ or were constructed by PCR and standard cloning techniques in MSCV (for retroviral transductions, Clontech), pGEX-4T-1 (GE Healthcare), and pMAL-c2X (New England BioLabs) vectors. Two copies of the FKBP dimerization module were released by XbaI/BamHI digestion of Pc4-FM2E (Ariad Pharmaceuticals, Inc.) and fused in-frame to the carboxyl termini of various E2A-PBX1 constructs. For construction of PBX1 shRNA resistant constructs, a 5′ primer (GACAACTCAGTGGAGCAcagcGAcTAtAGgGCCAAACTCTCACAGATCAG, lower cases indicate mismatch nucleotides) with seven nucleotides mismatch to PBX1 shRNA targeted sequence and 3′ primer (CTCCACTGAGTTGTCTGAACC) were used for PCR amplification followed by InFusion cloning using InFusion Cloning Kit (Clontech laboratories Inc.). All constructs were confirmed by Sanger sequencing. Retrovirus generation and transduction of human leukemia cells are described elsewhere^[@CR48]^. Briefly, retrovirus was packaged in Phoenix-Eco cells and RCH-ACV cells expressing ecotropic receptor were used for transduction by spinoculation (2,500 rpm, 32 °C for 2.5 hr). shRNA design, lentivirus generation and cell transduction {#Sec14} --------------------------------------------------------- shRNAs were designed using a commercial web tool (Invitrogen). Individual shRNA sequences (shPBX1 (5′ GGAGCATTCAGATTACAGA 3′), shPBX1-N (5′ AGCCGAGGAGCAGAAGA GGAAG 3′), shPBX2 (5′ GGTATCCCAGGTCTCGGTTCA 3′), and shPBX3 (5′ GCAGCCTC TGGAGGTTCTTCA 3′)), were cloned into p309-mCherry lentiviral vector^[@CR49]^. Lentivirus generation and transduction of human leukemia cells are described elsewhere^[@CR48]^. The sorted mCherry^+^ cells were cultured for 4 days for cell proliferation assay or used in bone marrow transplantation experiments. Myeloid progenitor cell transformation assay {#Sec15} -------------------------------------------- Myeloid progenitors were transduced using retroviral constructs essentially as described previously^[@CR50]^ with minor modifications^[@CR38]^. In brief, c-kit^+^ cells were selected from the bone marrow of 4--8 weeks old C57BL/6 mice using an auto-MACS and anti-c-kit magnetic beads (Miltenyi Biotech). Purified c-kit^+^ cells were transduced with retrovirus and plated in methylcellulose medium supplemented with cytokines (20 ng/ml SCF, and 10 ng/ml of IL-3, IL-6, and GM-CSF) (PeproTech) with appropriate drug selection. Colonies were counted 7 days after plating, after which cells were harvested, washed, and replated (10,000 cells per assay). After the fourth round of serial replating, transformed cells were cultured in R20/20 medium (RPMI1640 medium containing 20% WEHI conditioned medium and 20% FBS) to establish continuous cell lines. For experiments with FKBP fused constructs, D/D solubilizer (Clontech) was added where indicated to methylcellulose at a concentration of 4 µM. Flow cytometry {#Sec16} -------------- Cells were washed once with PBS, and then suspended in PBS containing 5% BSA. Antibody against Gr-1 (RB6-8C5 clone, BD Bioscience) was added to the cell suspension at 1:100 dilutions. After 20 min incubation on ice, cells were washed once, suspended in PBS with 5% BSA and analyzed using an LSR Model 1a flow cytometer (BD Biosciences). Gel filtration chromatography {#Sec17} ----------------------------- Crude extract or elution fractions from Q Sepharose (250 mM KCl) or heparin Sepharose (200 mM KCl) were applied to a Superose 6 (3.2/30) column (Amersham Pharmacia Biotech) at a flow rate of 40 µl/min in buffer A (25 mM Tris-HCl, pH 8.5, 1 mM EDTA, 0.2% NP-40, 10% glycerol) containing 5 mM dithiothreitol, protease inhibitors and 200 mM KCl. Column fractions (50 µl) were collected and subjected to western blot analysis. Protein markers (Sigma) were eluted under the same condition to estimate molecular weights. Co-immunoprecipitation and immunoblot analysis {#Sec18} ---------------------------------------------- Two days after transfection of 293T cells with various plasmids, cells were harvested, washed with PBS, and suspended in Buffer A. Cells were lysed by passing 10 times through 26-G pestle before centrifugation (15,000 × g) for 10 minutes at 4 °C. Clarified protein extract was used either for immunoblot analysis or immunoprecipitation. Primary antibodies for western blot analyses consisted of anti-Flag (M2, Sigma), anti-His (sc-805, Genescript), anti-MBP (NEB), and anti-GAPDH (Sigma) antibodies. Monoclonal antibodies specific for PBX1 and E2A have been reported previously^[@CR19],[@CR51]^. The blots were reacted with primary antibodies followed by peroxidase-conjugated secondary antibodies. Membranes were then incubated with ECL western blot detection kits (GE Healthcare) and images were detected by exposure to X-ray film. Transplantation assays {#Sec19} ---------------------- Transplantation assays were performed as previously described^[@CR48]^. RCH-ACV human leukemia cells, stably expressing various E2A-PBX1 mutant constructs that are resistant to shRNA-mediated PBX1 knockdown, were transduced with control (shLuc) or E2A-PBX1 shRNA lentivirus with mCherry fluorescence reporter by spinoculation. After 72 hours, sorted mCherry^+^ cells in 0.2 mL PBS containing 0.5% FBS were transplanted into sublethally irradiated (200 rad) NOD.Cg-*Prkdc*^*scid*^ *Il2rg*^*tm1Wjl*^/SzJ (NSG) mice (8--10 weeks old). Electrophoretic mobility shift assays {#Sec20} ------------------------------------- Proteins used for DNA binding assays were purified using amylose resin according to users' manual (New England BioLabs). DNA binding reactions were performed according to manufacturer's instructions (LightShift Chemiluminescent EMSA kit, Thermo Scientific). Double-stranded oligonucleotides (TGATTGATTGATTGAT) used for DNA binding were end-labeled with biotin. Briefly, DNA binding reactions were carried out at room temperature for 20 min and the reaction mixtures were then subjected to electrophoresis using 5% TBE gels in 0.5X TBE buffer. After transferring to nylon membrane, the blots were reacted with streptavidin-horseradish peroxidase conjugate. Membranes were then incubated with ECL western blot detection solution and images were detected by exposure to X-ray film. LAP purification and mass spectrometry {#Sec21} -------------------------------------- Purification of LAP-E2A-PBX1 complexes was performed as described previously^[@CR29],[@CR52]^ with some modifications. RCH-ACV cells expressing LAP-tagged fusion proteins were harvested and lysed in LAP150 buffer (50 mM HEPES, pH 7.4, 150 mM KCl, 1 mM EGTA, 1 mM MgCl~2~ 0.3% NP-40, 10% glycerol) containing protease inhibitors, followed by centrifugation at 100,000 × g for 1 hr. The resulting extract was incubated with protein A-coupled GFP antibody beads. After extensive wash, the beads were incubated with PreScission protease. The eluate was then incubated with anti-Flag M2 affinity gel (Sigma) and LAP-E2A-PBX1 complexes were eluted with Flag peptides (Sigma) and subjected to mass spectrometry analysis. Mass spectrometry, peptide identification, data processing and analysis were performed by the Vincent Coates Foundation Mass Spectrometry Laboratory at Stanford University Mass Spectrometry as described elsewhere^[@CR53]^. Quantitative real-time PCR {#Sec22} -------------------------- RNA was isolated using TRIZOL Reagent and cDNA was synthesized using iScript Reverse Transcription Supermix (Bio-Rad) following the manufacturer's recommendations. Quantitative PCR analysis was performed using a CFX384 real-time PCR system (Bio-Rad) with TaqMan Master Mix and primers (Applied Biosystems). All signals were quantified using ΔCt method and were normalized to the level of *Actb*. TaqMan probes from Life Technologies used in real-time PCR are Hs00231228_m1 (PBX1, detects E2A-PBX1 and wild type PBX1), Hs01114333_m1 (PBX1-N, detects wild type PBX1), Hs01901345_g1 (PBX2), and Hs00608415_m1 (PBX3). Study approval {#Sec23} -------------- All experiments on mice were performed with the approval of and in accordance with Stanford's Administrative Panel on Laboratory Animal Care (APLAC, Protocol 9839). Supplementary information ========================= {#Sec24} Supplementary Information **Publisher's note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Supplementary information ========================= **Supplementary information** accompanies this paper at 10.1038/s41598-019-41393-w. We thank Cita Nicolas and Maria Ambrus for technical assistance, Dr. Michael C. Bassik for providing p309-mCherry vector, members of the Cleary laboratory for helpful discussions, and the Vincent Coates Foundation Mass Spectrometry Laboratory, Stanford University Mass Spectrometry for helping mass spectrometry analysis. This work was supported in part by grants from the NIH (CA214888), the William Lawrence and Blanche Hughes Foundation (M.L.C.), the Hyundai Hope On Wheels Foundation (M.L.C.), Alex's Lemonade Stand Foundation for Childhood Cancer (S.H.-K.W.), the Lucile Packard Foundation for Children's Health, Child Health Research Institute, and the Stanford NIH-NCATS-CTSA grant \#UL1 TR001085 (M.L.C., C.-H.L., J.D.-A.), the German Research Foundation (Deutsche Forschungsgemeinschaft, ref. DU 1287/2-1 and 1287/3-1) (J.D.-A.), the senior clinical fellowship from Bloodwise (formerly Leukaemia and Lymphoma Research) (T.C.P.S.), and NIH P30 CA124435 utilizing the Stanford Cancer Institute Proteomics/Mass Spectrometry Shared Resource. C.-H.L., Z.W. and M.L.C. developed the hypothesis and wrote the manuscript. C.-H.L., Z.W., J.D.-A., S.H.-K.W. and T.C.P.S. designed and performed experiments and analyzed data. J.D. conducted mass spectrometry data analyses. A.V.L. and P.K.J. provided purified GFP antibody and advised on experimental design. Competing Interests {#FPar1} =================== The authors declare no competing interests.

Exposure of prepubertal female rats to inhaled di(2-ethylhexyl)phthalate affects the onset of puberty and postpubertal reproductive functions. We evaluated the effects of inhaled di(2-ethylhexyl)phthalate (DEHP) on the onset of puberty and on postpubertal reproductive functions in prepubertal female rats. DEHP was administered by inhalation at doses of 0, 5, and 25 mg/m3 to groups of female rats for 6 h/day, 5 contiguous days/week from postnatal days (PNDs) 22 to 41 and to PND 84. The onset of puberty was determined by daily examination for vaginal opening (VO) and first estrous cycle. Reproductive function was evaluated by observing estrous cyclicity from PNDs 49 to 84. Upon completion of exposure, the rats were sacrificed at PND 42 and PNDs 85-88 during the diestrous stage. DEHP exposure advanced the age of VO and first estrous cycle, and serum cholesterol, luteinizing hormone, and estradiol levels were significantly elevated in the 25-mg/m3 DEHP group. Irregular estrous cycles were observed more frequently in DEHP-exposed rats, and serum cholesterol decreased in DEHP-exposed rats in adulthood; RT-PCR showed that the expression of aromatase mRNA, encoding a rate-limiting enzyme that catalyzes the conversion of testosterone to estradiol, was elevated in the 25-mg/m3 DEHP group. These data suggest that inhaled DEHP may advance the onset of puberty and alter postpubertal reproductive functions.

PepsiCo Inc. is introducing a version of Gatorade that's certified organic by the U.S. Department of Agriculture, testing whether a product created in a lab with artificial flavors and colors can adapt to America's growing natural-food movement. After two years of research, the company is now selling strawberry, lemon and mixed berry G Organic in some Kroger Co. supermarkets, said Brett O'Brien, Gatorade's senior vice president and general manager. It plans to expand the rollout to select grocery, natural and convenience stores over the next few weeks. The suggested retail price for the new drinks is $1.69 for a 16.9-ounce bottle, 50 cents more than for Gatorade Thirst Quencher, the nonorganic equivalent. Gatorade, which controls 70 percent of the sports-drink market, is facing increasing pressure from new challengers like coconut water as consumers are focused more than ever on ingredients. Organic food industry sales in the U.S. reached $43.3 billion in 2015, up 11 percent from the year before, while broader food sales gained 3 percent, according to the Organic Trade Association. "We heard pretty loud through the locker rooms, through our work with nutritionists, that there is an interest and a desire among athletes to go organic," O'Brien said in an interview. "Somewhere around 10 to 12 percent of athletes are saying they're interested in purchasing organic products." To be considered organic, the new Gatorade had to shed artificial ingredients and PepsiCo needed to refine its manufacturing. Every step of the process was approved by the USDA, which aims to ensure organic products are more natural and less harmful to the environment. But the introduction of G Organic isn't without risk. PepsiCo recently faced a backlash after switching sweeteners in Diet Pepsi, forcing the company to reintroduce a version with aspartame less than a year after removing it. A brand extension of Gatorade — which already includes zero-calorie G2 — could confuse consumers. "In as much as they can focus on the potential to change ingredients without changing the taste, that's sort of a win-win," said Adam Fleck, a beverage analyst at Morningstar Inc. "But you have to be very careful about alienating your current customers in a bid to attract lapsed customers or new customers." G Organic, which has seven ingredients, is the first major sports drink to cater to food and beverage customers looking for fewer and more natural components. Other types of consumer products have already shifted in that direction: — Kraft Heinz Co. released an organic version of Capri Sun juice last year and took artificial colors and flavors out of its macaroni and cheese. — General Mills Inc. has removed artificial ingredients from some cereals. — Campbell Soup Co. has pledged to make all of its North American products without artificial colors or flavors by the end of fiscal 2018. Gatorade is contending with a growing list of all-natural competitors that are taking aim at the brand's market dominance. "While sports drinks are still the Michael Phelps of mass hydration, young upstarts like coconut water are taking advantage of health and wellness trends to make a run at the champion," Duane Stanford, editor-in-chief of Beverage Digest, said in an email. Gatorade was developed in a lab at the University of Florida in 1965 after an assistant coach there asked researchers to look into why his football players — the Gators — were suffering from heat-related illnesses like dehydration. A single-ingredient product like coconut water benefits from a lack of such engineering. The most difficult part of creating G Organic was getting the amount of electrolytes and carbohydrates to the levels of other Gatorade products without boosting calories, O'Brien said. PepsiCo has previously dealt with pressure to change ingredients in Gatorade. It removed brominated vegetable oil from the sports drink after criticism on social media and online forums such as Change.org. Coca-Cola Co. made a similar move with Powerade. But listening to consumer criticism doesn't always pay off. Purchase, New York-based PepsiCo removed aspartame from Diet Pepsi in August 2015 only to reintroduce the original formula — now called Diet Pepsi Classic Sweetener Blend — in June. Diet Pepsi's sales volume fell 5.8 percent in 2015 and dropped about 11 percent at retail during the first quarter of 2016, according to Beverage Digest. The problem: Customers didn't like the taste of the sucralose-sweetened version. G Organic will be sold at first only in single-serve bottles to give people a chance to taste the product and to avoid the problem that befell Diet Pepsi, O'Brien said. It has 120 calories per single serving, about the same as in the flagship brand. "There's that misnomer that if it's organic it can't taste good, and that's not the case," he said. "We're just trying to get people familiar with the product, what it means, what it does and try it. Once we've checked those boxes, we've got a big opportunity here."

Cardiac imaging has emerged as an important tool for assessing the diagnosis and prognosis of patients with coronary artery disease. The extent and severity of coronary arterial obstruction (provided by coronary arteriography), along with the degree of myocardial hypoperfusion (provided by perfusion tomography) and the extent of myocardial dysfunction (provided for instance with the measurement of myocardial thickening by magnetic resonance imaging (MRI) together, have long been recognized to be directly related to morbidity and mortality in patients with coronary artery disease. Yet, in clinical practice these imaging studies are most often viewed independently of each other and conventionally displayed in only 2 dimensions, severely limiting the clinicians ability to synthesize the true extent of the abnormalities. Accurate assessment of the extent and severity of coronary artery disease requires the multidimensional (equal to or greater than 3) integration of anatomic and physiologic information obtained independently from these cardiac imaging modalities. However, this integration has traditionally been subjective, time consuming, lacking standardization and difficult to conceptualize multidimensionally. The long term objectives of the proposed research in this competing continuation application are to overcome these limitations by continuing to develop and validate computer-based methods to multidimensionally quantify, unify and visualize the coronary arterial tree and the distributions of myocardial perfusion and thickening. During this next funding period, collaborators from Emory University and the Georgia Institute of Technology propose to continue to focus their efforts in fully completing the development and validation of each of the following methodologies: 1) complete automation of multidimensional reconstruction of the coronary vasculature from arbitrary, non-orthogonal biplane angiographic projections using non-parallel geometry, 2) multidimensional sampling and rendering of myocardial perfusion distributions, 3) multidimensional count based quantification of the amplitude and phase of the onset of myocardial thickening from multigated perfusion tomographic studies, and 4) complete automation of the unification of the multidimensional coronary vasculature with myocardial distributions. In addition, the unification concept will be extended to include myocardial thickening distributions from MRI. The extensive progress thus far achieved in these aims during the initial funding period is strong evidence to support further research, development, and clinical implementation of this multidimensional unified approach.

Junk Bonds Keep Cruising: Up 1% In May, 4.75% In 2014 To Date By Michael Aneiro Junk bonds turned in yet another improbably strong month in May, with the market gaining 1.007%, per a benchmark Bank of America Merrill Lynch index. The high-yield market has now returned 4.754% already in 2014 to date, even though the average junk bond’s annual yield stood at just 6.2% at the start of the year and the year is only 5 months old. I’ve written at great, fatigue-inducing length about how overvalued the junk-bond market looks right now, but as long as the Federal Reserve keeps buying bonds and holding down interest rates and encouraging investors to buy riskier, higher-yielding investments, there really might not be any such thing as overvaluation anymore. Whenever the Fed starts pulling up stakes, watch out. Checking on some other current market metrics: the average junk bond now yields a mere 5.067%, within a whisker of the 4.96% all-time low seen in May 2013, at an average spread of 367 basis points over comparable Treasury bond yields, which is still a decent distance from the 240 record low seen in June 2007 when Treasury yields were much higher. The average junk bond trades at 105.4 cents on the dollar, not far from the 107-cent record level seen in May 2013. Checking in on the big high-yield bond exchange-traded funds, the iShares iBoxx $ High Yield Corporate Bond Fund (HYG) is currently trading down 16 cents Monday at $94.46, and is up 2.16% year to date. The SPDR Barclays Capital High Yield Bond ETF (JNK) is down 3 cents at $41.30 and is up 2.47% year to date. Copyright 2015 Dow Jones & Company, Inc. All Rights Reserved This copy is for your personal, non-commercial use only. Distribution and use of this material are governed by our Subscriber Agreement and by copyright law. For non-personal use or to order multiple copies, please contact Dow Jones Reprints at 1-800-843-0008 or visit

Q: Conditioning Expectated Value on Independent Random Variables Let $X_1$ and $X_2$ be independent random variables. Let $Y$ be a random variable such that $E(Y\mid X_1)=0$ and $E(Y\mid X_2)=0$. Under what conditions is it true that $E(Y\mid X_1,X_2)=0$? A: The condition is on the joint distribution of $\left(X_{1},X_{2}\right)$. Let $f$ be the probability density function. Let $h\left(x_{1},x_{2}\right)$ be a function. Assume for $i=1$ or $i=2$: $\int_{x_{i}} h\left(x_{1},x_{2}\right) f\left(x_{1},x_{2}\right) dx_{i} = 0 \implies h\left(x_{1},x_{2}\right) = 0$. (The assumption is called "completeness" in the nonparametric instrumental variables literature in econometrics.) Let $x_{-i}$ be the $x$ that is not $x_{i}$. Then, because $\mathbb{E}\left[Y | X_{i}\right] = \mathbb{E}\left[\mathbb{E}\left[Y | X_{1},X_{2}\right] | X_{i}\right] = 0$, we have: $\int_{x_{i}} \mathbb{E}\left[Y | X_{1}=x_{1},X_{2}=x_{2}\right] \frac{f\left(x_{1},x_{2}\right)}{f_{i}\left(x_{i}\right)} dx_{-i} = 0 \iff \int_{x_{i}} \mathbb{E}\left[Y | X_{1}=x_{1},X_{2}=x_{2}\right] f\left(x_{1},x_{2}\right) dx_{-i} = 0$. Which, by assumption, implies $\mathbb{E}\left[Y|X_{1},X_{2}\right] = 0$.

Myristyl and palmityl acylation of the insulin receptor. The presence of covalently bound fatty acids in the insulin receptor has been explored in cultured human (IM-9) lymphocytes. Both alpha (Mr = 135,000) and beta (Mr = 95,000) subunits of the receptor incorporate [3H]myristic and [3H]palmitic acids in a covalent form. The effects of alkali and hydroxylamine on the labeled subunits indicate the existence of two different kinds of fatty acid linkage to the protein with chemical stabilities compatible with amide and ester bonds. The alpha subunit contains only amide-linked fatty acid while the beta subunit has both amide- and ester-linked fatty acids. Analysis by high performance liquid chromatography after acid hydrolysis of the [3H]myristate- and [3H]palmitate-labeled subunits demonstrates the fatty acid nature of the label. Furthermore, both [3H]myristic and [3H]palmitic acids are found attached to the receptor subunits regardless of which fatty acid was used for labeling. The incorporation of fatty acids into the insulin receptor is dependent on protein synthesis and is also detectable in the Mr = 190,000 proreceptor form. Fatty acylation is a newly identified post-translational modification of the insulin receptor which may have an important role in its interaction with the membrane and/or its biological function.

You are to write a letter to a smoker. You do not have to give it to this person. However many students have given their letter. Your letter must contain the health risks about tobacco, the costs to them and you. How it makes you feel when they smoke. You must also tell them how to quit and what they can expect when they quit. A page long.

Amyloid in cytologic specimens. Differential diagnosis and diagnostic pitfalls. To describe and illustrate the characteristic features of amyloid in cytologic preparations and point out its diagnostic pitfalls. Five fine needle aspirates and one bronchial washing that contained amyloid were retrospectively reviewed. The aspirates were obtained from each of the five following sites: lung, occipital lymph node, thyroid gland, proximal humerus and subcutaneous soft tissue. Smears of all of the aspirates were stained with Papanicolaou stain, and in two cases they were also stained with Diff-Quik. Cell block sections were stained with hematoxylin and eosin. Congo red, CD45 and CD20 were used on selected cases. Amyloid appears as either flocculent material or irregularly shaped fragments with scalloped and pointed edges. The amorphous fragments are acellular and frequently associated with connective tissue cells. They stain eosinophilic to cyanophilic with Papanicolaou stain and deep blue with Diff-Quik. In two cases an exuberant giant cell reaction almost obscured the amyloid. In the thyroid aspirate, the amyloid was misinterpreted as colloid. In bronchial washings and lung aspirates, amyloid has to be distinguished from mucus, alveolar proteinosis, chondroid material and corpora amylacea. When circumferentially surrounded by lymphocytes or plasma cells, flocculent amyloid deposits may simulate adenoid cystic carcinoma. Amyloid can be easily overlooked or mistaken for other entities with similar staining qualities. Congo red staining can help to confirm the diagnosis.

{#F1}

Ultrathin Colloidal Quantum Dot Films for Optical Amplification: The Role of Modal Confinement and Heat Dissipation. We demonstrate optical pumping lasers based on colloidal quantum dots, with a very thin geometry consisting of a ≈20 nm thick film. Obstacles in ultrasmall laser devices come from the limitation of gain materials and the size of cavities for lasing modes, which requires a minimum thickness of the gain media (typically greater than 50-100 nm). Here we introduce dielectric waveguide structures with a high refractive index, in order to reduce the thickness of quantum dot gain media as well as their threshold energy (≈39 % compared to the original gain medium). Finite-difference time-domain simulations show that the modal confinement factor of thinner quantum dot films can be improved by the presence of an adjacent waveguide layer. We also discuss the possible role of dielectric waveguide layers for efficient heat dissipation during optical pumping. Integrating an extremely thin colloidal quantum dot gain medium into optical waveguides is a promising platform for downscaling on-chip photonic integrated devices, as well as investigating extreme interactions between light and matter such as surface plasmon-photon coupling.

Custom Commissions Hi, welcome to TMC Graf’x custom commissions. Fancy owning your own custom fan-art illustration? We specialise in commissions of characters from Film, TV, Cartoons, Sci-Fi, comics and games. You can even request yourself as your favourite character or create your own character and we can illustrate that for you too. Perfect for a unique birthday or christmas gift. Please browse the galleries or have a look at some of the samples below for inspiration. Every so often we attend conventions and expos throughout the UK selling artwork, but our commission form is always open for requests and all enquiries are always welcome. A handy price guide is provided below to give you a ballpark figure depending on your illustration requirements. Just message us with the details of what you want and we’ll get straight on to it once our quote has been accepted. Price Guide Prices vary depending on the specific request but you can use the following common requests as a base guide. These prices are for one character only with no/minimal background and do not include shipping costs. Extra characters, detailed backgrounds etc. will increase costs. A4 pencil headshot £15 A4 inked headshot £25 A4 colour headshot £30 A3 pencil headshot £20 A3 inked headshot £30 A3 colour headshot £40 A4 pencil full body £20 A4 inked full body £30 A4 colour full body £40 A3 pencil full body £30 A3 inked full body £40 A3 colour full body £50 Sketchcards £15 A specific price will be quoted before any work begins on commission requests. These prices are for private commissioned work only and the images cannot be published or used in any other media form. If you wish to hire me for commercial material please contact me here. Commission request Fill out the form below to commission your own custom character illustration. Choose a character(s) * Type the name of the character(s) here Choose a view * Headshot Full body Choose a size * A4 A3 Sketchcard Other Choose a style * pencil inked colour Extra information or questions. Feel free to provide us with additional information, request an unlisted size or just ask us a question

In case you guys didn't receive anything from the house, Pig is on April 13 this year. They must have gotten around to scheduling it late though, because the actual dinner is at the Holiday Inn rather than the Ramada. However, there's a block of rooms reserved at both hotels. If you tell the Ramada you need a room reserved by the house you can get it for $68 per night, which is almost $20 less than their normal rip-off rate... or you're more than welcome to crash in my room and sleep next to Kalberg. (I'd go with your own room)

CooRie CooRie is a self-produced Japanese music unit by singer-songwriter Rino that performs songs for anime and games. CooRie used to be a two-person unit when it debuted in 2003, with Rino doing the lyrics and vocals and doing the music compositions and arrangements. After Osada left by the end of 2003 Rino maintained the name CooRie and composed the music by herself, although she sometimes sings under her own name, especially if the song is for adult games. CooRie's records are released under Lantis and Mellow Head (On the Run). Discography Singles 大切な願い / Taisetsu na Negai (Released February 26, 2003) 大切な願い / Taisetsu na Negai – anime television Nanaka 6/17 ending theme 君とナキムシ / Kimi to Nakimushi 大切な願い / Taisetsu na Negai (off vocal) 君とナキムシ / Kimi to Nakimushi (off vocal) 流れ星☆ / Nagareboshi☆ (Released April 23, 2003) 流れ星☆ / Nagareboshi☆ — anime television Narue no Sekai opening theme ステレオ / Stereo – Radio show Narue no Sekai TV ending theme 流れ星☆ / Nagareboshi☆ (off vocal) ステレオ / Stereo (off vocal) サクラサクミライコイユメ／未来へのMelody / Sakura Saku Mirai Koi Yume/Mirai e no Melody (Released July 24, 2003) <li>未来へのMelody / Mirai e no Melody – anime television D.C.: Da Capo 1st ending theme <li>未来へのMelody / Mirai e no Melody (off vocal) あなたと言う時間 / Anata to Iu Jikan (Released March 24, 2004) あなたと言う時間 / Anata to Iu Jikan – anime television Hikari to Mizu no Daphne ending theme <li>あなたと言う時間 / Anata to Iu Jikan (off vocal) センチメンタル / Sentimental (Released April 21, 2004) センチメンタル / Sentimental – anime television Midori no Hibi opening theme 戻らない日々 / Modoranai Hibi センチメンタル / Sentimental (Off vocal) 戻らない日々 / Modoranai Hibi (Off vocal) 光のシルエット / Hikari no Silhouette (Released June 8, 2005) 光のシルエット / Hikari no Silhouette – anime television Zettai Shōnen opening theme メロトロン / Mellotron 光のシルエット / Hikari no Silhouette (off vocal) メロトロン / Mellotron (off vocal) 暁に咲く詩 / Akatsuki ni Saku Uta (Released August 24, 2005) 暁に咲く詩 / Akatsuki ni Saku Uta – anime television D.C.S.S.: Da Capo Second Season ending theme かくれんぼ同盟 / Kakurenbo Doumei 暁に咲く詩 / Akatsuki ni Saku Uta (Off Vocal) かくれんぼ同盟 / Kakurenbo Doumei (Off Vocal) 風～スタートライン～ / Kaze: startline (Released December 21, 2005) 風～スタートライン～ / Kaze: startline — PC game Joukyou Kaishi! opening theme 月明かりセレナード / Tsukiakari Serenade — PC game Joukyou Kaishi! ending theme 風～スタートライン～ / Kaze: startline (off vocal) 月明かりセレナード / Tsukiakari Serenade (off vocal) いろは / Iroha (Released February 8, 2006) いろは / Iroha — anime television Binchou-tan opening theme 君にヘッドフォン / Kimi ni Headphone いろは / Iroha (off vocal) 君にヘッドフォン / Kimi ni Headphone (off vocal) クロス＊ハート / Cross*Heart (Released January 24, 2007) クロス＊ハート / Cross*Heart – anime television Kyoushirou to Towa no Sora opening theme 水玉 / Mizutama クロス＊ハート / Cross*Heart <instrumental> 水玉 / Mizutama <instrumental> 優しさは雨のように / Yasashisa wa Ame no you ni (Released October 24, 2007) 優しさは雨のように / Yasashisa wa Ame no you ni – anime television D.C. II: Da Capo II ending theme 恋想モジュレーター / Rensou Modulator 優しさは雨のように / Yasashisa wa Ame no you ni (off vocal) 恋想モジュレーター / Rensou Modulator (off vocal) 僕たちの行方 / Bokutachi no Yukue (Released April 23, 2008) 僕たちの行方 / Bokutachi no Yukue – anime television D.C.II S.S. ~Da Capo II Second Season~ ending theme シンプルになれ。 / Simple ni Nare. 僕たちの行方 / Bokutachi no Yukue (off vocal) シンプルになれ。 / Simple ni Nare. (off vocal) パルトネール / Partenaire (Released November 27, 2008) パルトネール / Partenaire (Partner in French) Thank you for the Music パルトネール / Partenaire (off vocal) Thank you for the Music (off vocal) IF：この世界で / IF: Kono Sekai de (Released April 29, 2009) IF：この世界で / IF: Kono Sekai de — PS2 game D.C.I.F. ~Da Capo~ Innocent Finale opening theme ALIVE IF：この世界で / IF: Kono Sekai de (off vocal) ALIVE (off vocal) 星屑のサラウンド / Hoshikuzu no Surround (Released August 26, 2009) 星屑のサラウンド / Hoshikuzu no Surround — anime television Sora no Manimani ending theme 闇に咲く星のように / Yami ni Saku Hoshi no You ni – anime television Sora no Manimani Ep. 4 ending song 星屑のサラウンド / Hoshikuzu no Surround (OFF VOCAL) 闇に咲く星のように / Yami ni Saku Hoshi no You ni (OFF VOCAL) 愛永久 ～Fortune favors the brave～／めぐり愛逢い / Ai Eikyuu ~Fortune favors the brave~/Meguri Ai Ai (Released January 27, 2010) <li>めぐり愛逢い / Meguri Ai Ai – Online game Ai Sp@ce theme song <li>めぐり愛逢い / Meguri Ai Ai (off vocal) 夢想庭園 / Musō Teien (Released July 7, 2010) 夢想庭園 / Musō Teien – OVA Book Girl opening theme Like A Music 夢想庭園 / Musō Teien (instrumental) Like A Music (instrumental) ダ・カーポⅢ ～キミにささげる あいのマホウ～ (Released April 27, 2012) <li> All is love for you <li> All is love for you （Off Vocal） 会いたいよ／メグル／REFLECTION (Released February 13, 2013) <li> メグル <li> メグル （Off Vocal） 『BON-BON』 (Released May 11, 2016) LACM-14477 BON-BON – anime television Tanaka-kun is Always Listless ending theme Melodic Future BON-BON （Off Vocal） Melodic Future （Off Vocal） Albums 1st album: 秋やすみ / Aki Yasumi (Released September 29, 2004) LHCA-5001 はじめに / Hajime ni センチメンタル / Sentimental 大切な願い / Taisetsu na Negai あなたと言う時間 / Anata to Iu Jikan 秋やすみ / Aki Yasumi ステレオ / Stereo 流れ星☆ / Nagareboshi☆ 未来へのMelody / Mirai e no Melody 存在 / Sonzai – anime television D.C.: Da Capo 2nd ending theme 想い出トランク / Omoide Trunk 小さな手紙 / Chiisana Tegami – anime television Midori no Hibi insert song えんぴつ / Enpitsu Self-cover album: 木漏れ日カレンダー / Komorebi Calendar (Released March 24, 2005) LHCA-5005 そよ風のハーモニー / Soyokaze no Harmony – anime television D.C.: Da Capo insert song 空のリフレイン / Sora no Refrain – PS2 game SAKURA: setsugetsuka theme song Parade — My-HiME Radio: Fuuka Gakuen Housoubu theme song 記憶のゆりかご / Kioku no Yurikago — anime television D.C.: Da Capo Sakura Yoshino song 幸せレシピ / Shiawase Recipe — Radio show Da Capo Hatsunejima Housoukyoku 1st opening theme 小さな傘 / Chiisana Kasa — from Mai Nakahara's mini album Homework Precious time – PS2 game Tentama 2wins theme song 君が望む永遠 / Kimi ga Nozomu Eien – PC game Kimi ga Nozomu Eien ending theme Eternal Love～眩しい季節～ / Eternal Love: mabushii kisetsu — PS2 game D.C.P.S.: Da Capo~ Plus Situation ending theme Dream～The ally of～ — PC game D.C.: Da Capo ending theme 2nd album: トレモロ / Tremolo (Released June 21, 2006) LHCA-5040 光のシルエット / Hikari no Silhouette 暁に咲く詩 / Akatsuki ni Saku Uta いたずらな雨 / Itazura na Ame 天空の花 / Tenkuu no Hana – PS2 game Mabino x Style ending theme 月明かりセレナード / Tsukiakari Serenade バスタブブルーズ / Bathtub Blues 記憶ラブレター / Kioku Love Letter – anime television D.C.S.S.: Da Capo Second Season episodes 24 & 25 ending theme 風～スタートライン～ / Kaze: startline 心編み / Kokoroami メロトロン / Mellotron いろは / Iroha トレモロ～夢の続き～ / Tremolo: yume no tsuzuki 3rd album: 旋律のフレア / Senritsu no Flare (Released January 23, 2008) LHCA-5075 旋律のフレア / Senritsu no Flare クロス＊ハート / Cross*Heart Spring has come – PC game D.C.II: Da Capo II ending theme ウソツキ / Usotsuki — anime television School Days ending theme SWEETEST – PS2 game Strawberry Panic! opening theme 君DK / Kimi DK 探し物 / Sagashimono 桜の羽根～Endless memory～ / Sakura no Hane: Endless memory — PC game D.C.II Spring Celebration grand ending theme 水玉 / Mizutama リトル・モア / Little More — PC game Muv-Luv (all-age version) Miki Tamase ending theme 優しさは雨のように / Yasashisa wa Ame no you ni 想い / Omoi 4th album: Imagination Market (Released October 21, 2009) LHCA-5111 Listen Imagination Market パルトネール / Partenaire ALIVE 僕たちの行方 / Bokutachi no Yukue 雨上がりの君のもとへ / Ame Agari no Kimi no Moto e キミナシノセカイ / Kimi Nashi no Sekai Thank you for the Music 想い出に変わるまで / Omoide ni Kawaru Made 君にヘッドフォン / Kimi ni Headphone IF：この世界で / IF: Kono Sekai de 幸せになるために / Shiawase ni Naru Tame ni 5th album: Heavenly Days (Released October 20, 2010) LHCA-5121 ノスタルジアに愛を込めて / Nostalgia ni Ai wo Komete 夢想庭園 / Musō Teien 煌めきHarmonics / Kirameki Harmonics – anime television Sora no Manimani insert song 闇に咲く星のように / Yami ni Saku Hoshi no Yō ni 星屑のサラウンド / Hoshikuzu no Surround 音速タイムマシンに乗って / Onsoku Time Machine ni Notte 金色の風景 / Kin-iro no Fuukei — Bungaku Shōjo to Yumeutsutsu no Melody image song 風をあつめて 〜CooRie Bossa Mix Version〜 / Kaze wo Atsumete ~CooRie Bossa Mix Version~ Like A Music My Dearest – PC game Kotori Love Ex P theme song めぐり愛逢い / Meguri Ai Ai 桜風 / Sakura Kaze – PC game D.C.II Fall in Love ~Da Capo II~Fall in Love grand ending theme Heavenly Days — Maria-sama ga Miteru movie theme Compilation album: Brillant (Released April 4, 2013) LACA-9279 ～ LACA-9280 disc – 1 大切な願い / Taisetsu na Negai 流れ星☆ / Nagareboshi Dream～the ally of～ 存在 / Sonzai 未来へのMelody / Mirai he no Melody センチメンタル / Sentimental いろは / Iroha あなたと言う時間 / Anata to Iu Jikan 旋律のフレア / Senritsu no Flare 君DK / Kimi DK ウソツキ / Usotuski Spring has come 優しさは雨のように / Yasahisa ha Ame no Youni 君が望む永遠 / Kimi ga Nozomu Eien disc – 2 クロス＊ハート / Cross Heart 光のシルエット / Hikari no Silhouette 暁に咲く詩 / Akatsuki ni Saku Uta 僕たちの行方 / Bokutachi no Yukue 雨上がり君のもとへ / Ameagari Kimi no Moto he パルトネール / Partenaire 星屑のサラウンド / Hoshikuzu no Surround Thank you for the Music IF：この世界で / IF – Kono Sekai de 夢想庭園 / Musou Teien Heavenly Days 水性メロディ / Suisei Melody All is Love for you 秘密 / Himitsu Self Cover album: Melodium (Released December 18, 2013) LACA-15363 DreamRiser Super Noisy Nova いじわるな恋 / Ijiwaru na Koi 残酷な願いの中で / Zankoku na Negai no Naka de ナミダで咲く花 / Namida de Saku Hana 宿題 / Shukudai 陽だまりドライブ / Hidamari Drive 心の窓辺にて / Kokoro no Madobe Nite 君と愛になる / Kimi to Ai ni Naru Brand-new Season 透明な羽根で / Toumei no Hana de PIANOTE Self Cover album: Melodium2 (Released December 9, 2015) LACA-15532 Planet Freedom Sentimental Venus REFLECTION ひだまり笑顔 / Hida mari egao ハルモニア/ Harumonia Melodium 6th Album セツナポップに焦がされて / Setsuna Pop ni Kogasarete ''' (Released December 20, 2017) LACA-15668 エクレア / Ekurea セツナポップに焦がされて / Setsuna Pop ni Kogasarete Rearhythm -Album ver- 愛しさの雫 / Itoshisa no shizuku 終わらないPrelude / Owaranai Prelude HAPPY CRESCENDO フラクタル / Furakutaru (Fractal) 春風とクリシェ / Harukaze to kurishe MISTY LOVE キミとMUSIC -Album ver- / Kimi to MUSIC -Album ver- VOICE SONG BON-BON Other 2003-12-26: Onegai Twins Image Vocal Album: Esquisse — episode 6 image song "Kiss no Meiro" (キスの迷路) 2006-09-21: PlayStation 2 Game Strawberry Panic! Original Sound Track — opening theme "Sweetest" 2006-10-25: "MUV-LUV" collection of Standard Edition songs: divergence — Muv-Luv Extra Miki Tamase ending theme "Little More" (リトル・モア) 2007-05-23: D.C.II Spring Celebration Vocal Mini Album: Songs from D.C.II Spring Celebration — grand ending theme "Sakura no Hane: Endless memory" (桜の羽根～Endless memory～) 2007-08-22: School Days Ending Theme+'' — anime television ending theme "Usotsuki" (ウソツキ) References External links CooRie Official Blog CooRie Official Web Site (Unupdated) CooRie Lantis website Category:Anime musicians Category:Japanese female singer-songwriters Category:Lantis (company) artists Category:21st-century Japanese singers Category:Living people Category:Year of birth missing (living people) Category:21st-century women singers

Use of combined conventional and real-time PCR to determine the epidemiology of feline haemoplasma infections in northern Italy. Although knowledge of feline haemotropic mycoplasmas (haemoplasmas) has dramatically improved in recent years, some issues still remain to be elucidated. The aim of the current study was to evaluate the prevalence of feline haemoplasma infections in blood samples collected from cats in northern Italy. A convenience-sample of 307 cats (40 anaemic; 258 non-anaemic; nine with unknown haematocrit [HCT]) was investigated using polymerase chain reaction assays. Furthermore, the date of blood collection, signalment and clinicopathological data were retrospectively evaluated to assess predictors and risk factors for infection. Haemoplasma infections were highly prevalent in the sample investigated with an overall prevalence of 18.9% (95% confidence interval: 14.5-23.3%). The prevalence for the three feline haemoplasmas was 17.3% for 'Candidatus Mycoplasma haemominutum' (CMhm), 5.9% for Mycoplasma haemofelis (Mhf) and 1.3% for 'Candidatus Mycoplasma turicensis' (CMt). Feline immunodeficiency virus-positive status represented a risk factor for infection with an odds ratio of 4.19 (P=0.02). Moreover, a higher prevalence was observed in summer (odds ratio 1.78; P=0.04) which may be consistent with arthropod-borne disease transmission. Cats infected with Mhf showed significantly lower HCT (P=0.03), haemoglobin values (P=0.02) and red blood cell counts (P=0.04), lower mean corpuscular haemoglobin concentration (P<0.01) and higher white blood cell counts (P<0.01) when compared with non-infected cats.

Have you seen the new entries to the Online Oxford English Dictionary? They are only online and not in the OED per se. I enter them here because to me they are slang and largely geek slang from electronics. Most are not in most Agora denizens vocabulary, but I bet some will creep in. As I mentioned elsewhere, I.ve started to use "dongle." Nice catch. But I could argue with several of them, since app to me is not synonymous with applet. App refers to the program, whereas applet refers to the icon to call up the program. The latter comes from Apple, while app is short for application. Or so I have used it.

[Impact of Vitamin D in Sports: Does Vitamin D Insufficiency Compromise Athletic Performance?] Introduction Vitamin D is essential for calcium homeostasis and regulates the expression of over 900 genes. It thereby influences musculoskeletal health and function. Additionally, multiple other effects were observed through the detection of vitamin D receptors (VDR) in numerous tissues of the human body. Material and Methods We reviewed the literature regarding evidence of the impact of vitamin D on musculoskeletal health and peak athletic performance. Results and Discussion It is well known that there is a high prevalence of vitamin D deficiency in the average European population. This article confirmed the same for athletes in different disciplines. Therefore, vitamin D deficiency and its effects are relevant for competitive sports. The surprisingly high prevalence of inadequate vitamin D levels depends on the geographic location, the time of day and year, local climate conditions, and sports disciplines (indoor vs. outdoor). Based on the analysed literature, we found several correlations between 25-OH-D3 serum levels and different aspects of competitive sports. A serum level ≥ 30 ng/ml provides sufficient mineralisation of non-mineralised bone matrix and is therefore crucial for skeletal health. Furthermore, this concentration was positively correlated with an accelerated regeneration of muscular force. Levels above 40 ng/ml provided a protective effect on the development of stress fractures. Researchers suspect that levels above 50 ng/ml are required for athletes to achieve maximal physical performance. While there is an ongoing discussion amongst researchers regarding beneficial effects of such high levels, it is well known that blood levels lower than 30 ng/ml lead to mineralisation defects in bone (rickets, osteomalacia) and muscular function (reversible myopathy). Conclusion This review suggests that athletes should have an evaluation of vitamin D-dependent calcium homeostasis based on laboratory tests of 25-OH-D3, calcium, creatinine, and parathyroid hormone. In case of vitamin D insufficiency, normal blood levels of ≥ 30 ng/ml may be restored by optimising the athlete's lifestyle and, if appropriate, oral substitution of cholecalciferol. This concentration is associated with a protective effect and enhancement of physical performance. Consequently, it is a requirement for restoring and maintaining musculoskeletal health and athletic performance.

Percutaneous distal osteotomy of the first metatarsal (PDO) for the surgical treatment of hallux valgus. The authors report their experience in the treatment of hallux valgus by percutaneous distal osteotomy (PDO) of the first metatarsal. Surgery is performed under truncular anaesthesia, in day-surgery, and weight-bearing is allowed immediately. Between January 2001 and December 2002 this procedure was used to treat 83 patients (90 feet). Long-term clinical and radiographic follow-up revealed the percentage of excellent results, in line with open surgery. Post-surgical complications are also considerably reduced, with better patient compliance.

In order to increase optical signal bandwidth, optical communications are sent over fiber optic communication lines as wavelength multiplexed signals. For example, a 100G LR4 optical transceiver signal consists of 4 wavelengths separated by 800 GHz traveling on a single fiber. Each wavelength signal is modulated at 25 Gbps so that when they are combined they provide a composite 100 Gbps signal. When received at its intended destination, the optical signal is demultiplexed into its individual wavelengths and then converted to respective electrical signals using photodiodes. A typical optical transceiver demultiplexes the combined signal using thin film filters with pass bands that are separated by 800 GHz. Once demultiplexed, the different wavelengths that were combined to form the composite signal are steered to a wavelength specific photodiode using actively aligned mirrors. Other demultiplexers utilize Indium Phosphate semiconductor devices which can double as both a demultiplexer and a photodetector. Unfortunately, the Indium Phosphate devices experience high insertion loss, and must be kept at high temperatures due the high temperature dependence of the Indium Phosphate semiconductor material.

Filed 12/9/15 L.G. v. M.M. CA4/1 NOT TO BE PUBLISHED IN OFFICIAL REPORTS California Rules of Court, rule 8.1115(a), prohibits courts and parties from citing or relying on opinions not certified for publication or ordered published, except as specified by rule 8.1115(b). This opinion has not been certified for publication or ordered published for purposes of rule 8.1115. COURT OF APPEAL, FOURTH APPELLATE DISTRICT DIVISION ONE STATE OF CALIFORNIA L.G., D067027 Respondent, v. (Super. Ct. No. D551515) M.M., Appellant. APPEAL from an order of the Superior Court of San Diego County, David B. Oberholtzer, Judge. Reversed and remanded for further proceedings. Law Offices of Martin N. Buchanan, Martin N. Buchanan; Law Office of Neale B. Gold and Neale Bachmann Gold for Appellant. Yale & Baumgarten and David W. Baumgarten for Respondent. M.M. (Mother) appeals a trial court order granting the petition of L.G. (Father) requiring her to return to Mexico with their two children pursuant to the Hague Convention on the Civil Aspects of International Child Abduction, October 25, 1980, T.I.A.S. No. 11670 (the Hague Convention), as implemented by the International Child Abduction Remedies Act (ICARA) (22 U.S.C.A. § 9001 et seq.).1 Mother contends the trial court erred by finding there was a grave risk of harm to the children if they were returned to Mexico in the custody of Father, but then granting Father's petition for a return order subject to unauthorized and unenforceable conditions (e.g., requiring her to return to Mexico with the children). She argues the court should have denied Father's petition based on its finding of a grave risk of harm to the children. We conclude the trial court erred by making its return to Mexico order subject to certain unauthorized and/or unenforceable conditions and remand the matter for further proceedings as discussed below. FACTUAL AND PROCEDURAL BACKGROUND In 2001, Father and Mother were married. They are both Mexican citizens. Until October 2013, they both resided in Tijuana, Mexico, while working at their family hardware store in Chula Vista, California. Father and Mother had two daughters, M., born August 2002, and Me., born May 2004, both born in the United States. Their daughters have dual citizenship in Mexico and the United States. They resided and attended school in Tijuana. Prior to and during April 2013, Father physically and verbally abused Mother. In July 2013, Father and Mother filed a voluntary divorce petition in Mexico that apparently was not thereafter finalized. 1 ICARA was originally found at former title 42 United States Code section 11601 et seq. 2  On or about October 12, 2013, Mother, without Father's knowledge or consent, moved with their children from their home in Mexico to the United States, where they apparently have since been staying at domestic violence shelters in San Diego County. Mother thereafter refused to inform Father of the location of, or allow him to visit with, their children. In April 2014, Father filed a petition for divorce in the Tijuana family court. On October 10, 2014, Father filed the instant Hague Convention petition seeking an order requiring the return of the children to Mexico so that custody and visitation rights could be adjudicated in the pending divorce action in Mexico. During a four-day trial, the trial court heard the testimony of nine witnesses, including Father, Mother, and the children's therapists. Mother testified regarding past incidents of physical and verbal abuse committed by Father against her, some of which were committed in the presence of one or both of their children. The court also spoke with both children in chambers. On the record, the trial court stated its findings of fact and orders. The court found Father had committed substantial domestic violence against Mother. It found Father's denials of that domestic violence were not believable and concluded he "plainly lied to the Court about important things." Based on the evidence, the court concluded there would be a grave risk of emotional harm to the children were they returned to Mexico in Father's custody, but there would be no grave risk of harm were they otherwise returned to Mexico. To protect the children, it ordered they remain in Mother's custody, ordered her to seek a restraining order against Father from the Mexican court within 10 days, and ordered that Mother would, on her return to Mexico, have exclusive use of the family 3 home. It further ordered that, on the issuance of a protective order from the Mexican court, Mother was to return to Tijuana with the children. The court stated: "Let me be absolutely clear about that. The children are going back to Mexico with the [M]other [¶] . . . [¶] [I]f Mother refuses to cross the border, I'll make further orders." On November 13, 2014, the trial court issued its written order granting Father's petition (Order). The Order states in part: "1. The children's country of habitual residence is Mexico. [¶] . . . [¶] "4. Mother's removal of the children from Mexico to the United States was wrongful under the Hague Convention, Article 2, and was an attempt by Mother to impose custody by fait accompli through crossing an international border. "5. Consequently, this Court is bound by Hague Convention Article 12 and [former] 42 U.S.C. § 11601(a)(4) to order the return of the children to Mexico forthwith, unless there is a cognizable defense. "6. Due to a history of domestic violence, the court finds by clear and convincing evidence there would be a grave risk of emotional harm to the children if they were returned immediately to the Father's custody. [Citation.] "7. Nevertheless, the Court finds no grave risk of emotional harm to the children if they are returned to Mexico. The court then set forth its orders for the return of the children to Mexico, stating: "8. Therefore, the court orders the return of the children to Mexico, the country of habitual residence, and the jurisdiction of the Tijuana, Baja, California, Family Court, which has a pending case involving custody of the children. "9. Pursuant to [former] 42 U.S.C. § 11604(a), the court orders Mother to accompany the children in their return to Mexico. This is a temporary order, pending a custody order from Tijuana, Baja California, Family Court. 4  "10. To further protect the children from a grave risk of emotional harm, the court further orders Mother to request a restraining order or other protective order for herself and the children from the Tijuana, Baja California, Family Court on or before November 16, 2014, to allow the children's safe return. "11. Until such time as the Mother obtains a restraining order or other protective order from the Tijuana, Baja California, Family Court, and/or until such time as this order is superseded or cancelled by a Tijuana, Baja California Family Court order, [Father] shall never be intentionally or knowingly within 100 meters of [Mother] or the children, while in the U.S. or Mexico, except for purposes of attending court hearings or other events at which the attendance of one or both parents is required. "12. Unless the Tijuana, Baja California Family Court orders otherwise, on or before November 16, 2014, Father shall vacate the [family] premises [in Tijuana] to allow the Mother and children to occupy the residence. "13. Upon receiving the protective order the minor children shall immediately return to Tijuana, Mexico and to the family home . . . in the Mother's custody pending orders from the Tijuana, Baja California, Family Court or the parties agree to a different arrangement." The court reserved jurisdiction in the event the Tijuana family court denied Mother's request for a protective order, subject to superseding or different orders by that court. The trial court denied Mother's request for a stay of the Order pending an appeal. Mother timely filed a notice of appeal challenging the Order. On December 18, 2014, we granted Mother's petition for writ of supersedeas and request for stay, and stayed the Order pending further order of this court. 5  DISCUSSION I The Hague Convention Generally "The [Hague] Convention . . . was adopted in an effort 'to protect children internationally from the harmful effects of their wrongful removal or retention and to establish procedures to ensure their prompt return to the State of their habitual residence, as well as to secure protection for rights of access.' [Citations.] To deter parents from crossing international boundaries to secure a more favorable forum for the adjudication of custody rights, the [Hague] Convention provides for the prompt return of a child who is 'wrongfully removed to or retained in' any country that has signed on to the [Hague] Convention. [Citations.] It thus provides a means by which to restore the status quo when one parent unilaterally removes the child from the child's country of habitual residence and/or retains the child in a new jurisdiction. [Citation.] [¶] The only function of a proceeding under the [Hague] Convention is to decide whether a child should be returned to the country of the complaining parent; it does not govern the merits of parental custody disputes, but leaves those issues to be determined by appropriate proceedings in the child's country of habitual residence." (In re Marriage of Forrest & Eaddy (2006) 144 Cal.App.4th 1202, 1210 (Forrest).) A petitioner under the Hague Convention "bears the burden of proving the child's wrongful removal or retention by a preponderance of the evidence." (Forrest, supra, 144 Cal.App.4th at p. 1211.) "If the petitioner succeeds in showing a wrongful removal, the [Hague Convention] requires repatriation of the abducted child to its country of habitual 6 residence in all but a few exceptional circumstances. [Citations.] Exceptions to the Hague Convention must be narrowly interpreted 'lest they swallow the rule of return.' " (Maurizio R. v. L.C. (2011) 201 Cal.App.4th 616, 633 (Maurizio R.).) The primary exception at issue in this appeal is the "grave risk" exception, which provides that return of a child to his or her country of habitual residence need not be ordered if "there is a grave risk that his or her return would expose the child to physical or psychological harm or otherwise place the child in an intolerable situation." (Hague Convention, art. 13, par. b; 22 U.S.C.A. § 9003(e)(2)(A).) The grave risk exception is narrow and must be proved by clear and convincing evidence. (22 U.S.C.A. § 9003(e)(2)(A); Maurizio R., at p. 633; In re Marriage of Witherspoon (2007) 155 Cal.App.4th 963, 974 (Witherspoon).) Another exception to return may apply when a child of sufficient age and degree of maturity objects to return. (Hague Convention, art. 13; Witherspoon, supra, 155 Cal.App.4th at p. 975.) The Hague Convention provides: "The judicial or administrative authority may also refuse to order the return of the child if it finds that the child objects to being returned and has attained an age and degree of maturity at which it is appropriate to take account of [his or her] views." (Hague Convention, art. 13; Witherspoon, at p. 975; Escobar v. Flores (2010) 183 Cal.App.4th 737, 746 (Escobar).) Elisa Perez-Vera, the official reporter for the Hague Convention, explained in her report that the Hague Convention provides that a child's views on his or her return may be conclusive if the child has attained an age and degree of maturity sufficient for his or her views to be taken into account by the court. (Escobar, at pp. 746-747 & fn. 4; Witherspoon, at pp. 972, fn. 7 7, & 975-976; De Silva v. Pitts (10th Cir. 2007) 481 F.3d 1279, 1286; Blondin v. Dubois (2d Cir. 2001) 238 F.3d 153, 166 ["[A] court may refuse repatriation solely on the basis of a considered objection to returning by a sufficiently mature child."].) The Hague Convention does not set forth a minimum age at which a child is old enough and mature enough to trigger that provision. (Blondin, at p. 166.) On appeal from an order granting or denying a Hague Convention petition, "we review the trial court's determination of the historical facts for substantial evidence but conduct a de novo review of the questions of law." (Forrest, supra, 144 Cal.App.4th at p. 1213.) We review independently a trial court's interpretation of the Hague Convention and its application of the Hague Convention to the facts in a particular case. (Maurizio R., supra, 201 Cal.App.4th at pp. 633-634.) II Unauthorized and Unenforceable Conditions of Return Order Mother contends the trial court erred as a matter of law by making the Order requiring the return of the children to Mexico subject to certain conditions that are unauthorized and/or unenforceable. She does not dispute the trial court's findings that the children's habitual residence was in Mexico and that she wrongfully removed them from Mexico to the United States. More importantly, she does not dispute the court's finding that there would be no grave risk of emotional harm to the children were they returned to Mexico, unless they are returned immediately to Father's custody (in which case there 8 would be a grave risk of emotional harm).2 Rather, Mother only challenges certain conditions of the Order and requests that we reverse the order and remand the matter to the trial court. A Mother asserts the trial court erred as a matter of law by requiring her to return to Mexico with the children. In the Order, the court ordered "Mother to accompany the children in their return to Mexico." In so doing, as in another case involving a similar return order, the trial court "admirably attempted to balance the broad purposes of the [Hague] Convention with the safety of the children by fashioning undertakings that attempted to protect the children from their father during the pendency of custody proceedings [in Mexico]." (Simcox v. Simcox (6th Cir. 2007) 511 F.3d 594, 610 (Simcox).) However, the Hague Convention requires the return of only children, and not their parents, to the country of their habitual residence. (Maurizio R., supra, 201 2 Although Father's respondent's brief disputes the trial court's finding that there would be a grave risk of emotional harm to the children were they returned immediately to his custody, he has not filed a notice of cross-appeal and therefore cannot contest the trial court's factual finding on that issue. (California State Employees' Assn. v. State Personnel Bd. (1986) 178 Cal.App.3d 372, 382, fn. 7 ["[I]t is the general rule that a respondent who has not appealed from the judgment may not urge error on appeal."].) Accordingly, we need not address, and do not decide, whether there is substantial evidence in the record on appeal to support the trial court's findings regarding the absence or presence of a grave risk of harm to the children were they to be returned to Mexico in the custody of Father or another person (e.g., Mother or court-appointed guardian). (Cf. Forrest, supra, 144 Cal.App.4th at p. 1213 [substantial evidence standard applies in reviewing trial court's factual findings].) In any event, were we to address that issue, it is likely we would conclude there is substantial evidence in the record to support the trial court's finding there would be a grave risk of emotional harm to the children were they returned to Mexico immediately in Father's custody. 9 Cal.App.4th at p. 633; Forrest, supra, 144 Cal.App.4th at p. 1210.) A trial court has no authority under the Hague Convention or ICARA to order a parent to return to the children's country of habitual residence, whether with or without the children. (Maurizio R., at p. 641 ["Mother cannot be compelled to return to Italy."]; Simcox, at p. 598 [reversing return order, finding particularly problematic the "command that Mrs. Simcox herself return to Mexico"].) By ordering Mother to return to Mexico with her children, the trial court erred. It lacked the authority under the Hague Convention and ICARA (or otherwise) to require her to return to Mexico. Father does not cite any authority showing, or otherwise persuade us, the trial court had that authority. Furthermore, contrary to Father's assertion and the trial court's apparent belief, the court did not have the authority under the Hague Convention or ICARA to order Mother to return to Mexico with the children as a provisional remedy. (22 U.S.C.A. § 9004(a).) A court exercising jurisdiction under the Hague Convention and ICARA "may take . . . measures . . . to protect the well-being of the child . . . before the final disposition of the [Hague Convention] petition." (22 U.S.C.A. § 9004(a), italics added.) Accordingly, those provisional measures may be taken only during the pendency of a Hague Convention petition and not as part of a final order deciding the merits of that petition. Because the trial court's order that Mother return to Mexico with the children is part of the Order that finally disposes of Father's petition, it is not a provisional measure under ICARA. Nevertheless, we note the trial court's objective of protecting the children from the grave risk of emotional harm by Father on their return to Mexico could have been carried 10 out in a differently constructed return order. (See, e.g., Maurizio R., supra, 201 Cal.App.4th at pp. 641-642.) Mother "cannot be permitted to defeat the Hague Convention" by refusing to return to Mexico with the children. (Id. at p. 641.) Assuming on remand of this matter the trial court does not alter its conclusion the children must be returned to Mexico (i.e., based on the children's views as discussed below), the court should craft conditions and undertakings that do not require Mother's cooperation in their return to Mexico. (Id. at pp. 641-642.) For example, the court may give Mother the choice to return to Mexico with the children, but if she chooses not to do so, it may appoint a guardian, child welfare escort, or other responsible third party to escort the children back to Mexico for further custody proceedings there. (Id. at p. 641; cf. Simcox, supra, 511 F.3d at p. 610 ["[T]he court must provide for a contingency to assure the children's safety and care should Mrs. Simcox choose to remain in the United States."].) There is nothing in the record indicating the courts in Mexico are unable to issue orders to protect the children's physical and emotional health pending the outcome of the custody proceedings there. (Maurizio R., at pp. 641-642 [regarding courts in Italy].) In the unlikely and rare circumstance that the trial court finds it impossible to craft conditions or undertakings that would protect the children from emotional harm by Father on their immediate return to Mexico, it may be necessary that it deny Father's petition. (Cf. Simcox, at pp. 610-611.) B Mother also asserts the trial court erred as a matter of law by conditioning the children's return to Mexico on Mother's application for, and the issuance of, a protective 11 order from the Tijuana family court. The Order states: "To further protect the children from a grave risk of emotional harm, the court further orders Mother to request a restraining order or other protective order for herself and the children from the Tijuana, Baja California, Family Court on or before November 16, 2014, to allow the children's safe return." The Order further stated: "Upon receiving the protective order the minor children shall immediately return to Tijuana, Mexico and to the family home . . . in the Mother's custody . . . ." The record shows that Mother apparently applied for such a protective order before the November 13, 2014, hearing on the terms of the Order, but it does not show whether such an order had been issued by that date or whether one has since been issued by the Tijuana family court. "[C]onditioning a return order on a foreign court's entry of an order . . . raises serious comity concerns." (Danaipour v. McLarey (1st Cir. 2002) 286 F.3d 1, 23; Maurizio R., supra, 201 Cal.App.4th at p. 644.) Nevertheless, we generally agree with the trial court's attempt to guide the parties in obtaining an order from the Tijuana family court to protect the children from the risk of emotional harm by Father. However, similar to our reasoning above that precludes the court from requiring Mother to return to Mexico with the children, the court also has no authority to require Mother to apply for a protective order from the Tijuana family court. Absent evidence in the record showing otherwise, we presume there may be alternative means by which a protective order may be obtained from a court in Mexico to protect the children in the event Mother does not voluntarily apply for, and obtain, such an order. Furthermore, absent a finding by the trial court that there would be a grave risk of emotional harm to the children by Father 12 were they returned to Mexico in the immediate custody of Mother, a guardian, a child welfare escort, or other responsible third party (other than Father), it should not have conditioned their return on the issuance of a protective order by the Tijuana family court. We cannot presume the courts in Mexico are unable to promptly issue orders to protect the children's emotional health pending the outcome of the custody proceedings there. (Maurizio R., supra, 201 Cal.App.4th at pp. 641-642 [regarding courts in Italy].) C Mother also asserts the trial court erred by including in the Order conditions or undertakings that it could not enforce. For example, she cites the order that Father vacate the family home in Tijuana. She correctly argues the trial court could not enforce that order, nor is there anything in the record showing the Tijuana family court would enforce that order. By so ordering, the court erred. However, we disagree with Mother's assertion that the trial court must deny Father's petition if it cannot enforce that or other conditions. (Cf. Danaipour v. McLarey, supra, 286 F.3d at p. 25-26 [if grave risk or other exception applies, a court should not exercise its discretion to return the child unless enforcement of its undertakings can be guaranteed]; Simcox, supra, 511 F.3d at p. 606.) As a general rule, a court should only issue orders that it has the ability to enforce. Nevertheless, it should not be dissuaded from issuing appropriate orders if their enforcement is not "guaranteed." D Mother also asserts the trial court erred by ordering the return of the children to Mexico because Father did not carry his burden to present evidence showing the 13 conditions or undertakings ordered by the court would alleviate the risk of emotional harm to the children. Citing Baran v. Beaty (11th Cir. 2008) 526 F.3d 1340, she argues that because the trial court found there would be a grave risk of harm to the children were they returned to Mexico immediately in Father's custody, it was his burden to then present evidence that specific undertakings would alleviate that risk. (Id. at pp. 1349, 1352-1353.) She further argues that because Father did not propose any specific undertakings or present any evidence that the undertakings would alleviate the grave risk to the children were they to be in his immediate custody, the trial court should have denied his petition for their return under the Hague Convention. We disagree. Although it would be helpful for the petitioning parent to propose specific undertakings to the court and present evidence showing that those undertakings would alleviate any grave risk to the children on their return to the country of their habitual residence, we cannot conclude a court must deny a petition absent such proposed undertakings and evidence in support thereof. Rather, we believe it is incumbent on the trial court, with or without the assistance of either parent, to determine, based on the evidence before it, whether sufficient conditions or undertakings can be crafted that would avoid harm, or at least reduce it to a level less than a grave risk of harm, to the children were they to be returned to the country of their habitual residence. We conclude the trial court did not err by not denying Father's petition as asserted by Mother. E Mother also asserts the trial court erred by granting Father's petition and should have denied it simply because the court found there would be a grave risk of emotional 14 harm to the children were they returned to Mexico in the immediate custody of Father. However, the court also found there would be, in general, no grave risk of emotional harm to the children were they otherwise returned to Mexico (i.e., not in Father's immediate custody). Furthermore, the trial court presumably believed a return order subject to certain conditions and undertakings would be sufficient to protect the children from the risk of any emotional harm on their return to Mexico. Although there are errors in certain conditions and undertakings of the Order, as discussed above, we believe the court was correct that conditions and undertakings could be crafted that would be sufficient to protect the children from the risk of any emotional harm on their return to Mexico. On remand, absent another ground to deny the petition as discussed below, the court should attempt to craft appropriate conditions and undertakings that would alleviate that risk. III Proceedings on Remand Mother requests that on remand of this matter we direct the trial court to enter a new order denying Father's petition. We decline to do so. Rather, on remand the court should instead first determine, as Mother alternatively suggests, whether either or both of the children are of sufficient age and degree of maturity and object to their return to Mexico.3 (Hague Convention, art. 13; Witherspoon, supra, 155 Cal.App.4th at p. 975.) 3 Although the trial court spoke with the children, the record does not show whether it considered the potential application of this exception to the Hague Convention's general rule requiring the return of children to the country of their habitual residence. 15 If so, the court may, in the reasonable exercise of its discretion, deny the petition for their return to Mexico. (Hague Convention, art. 13; Witherspoon, at p. 975; Escobar, supra, 183 Cal.App.4th at p. 746; Blondin v. Dubois, supra, 238 F.3d at p. 166 ["[A] court may refuse repatriation solely on the basis of a considered objection to returning by a sufficiently mature child."].) The Hague Convention does not set forth a minimum age at which a child is old enough and mature enough to trigger that provision. (Blondin, at p. 166.) However, in other cases children as young as 13, 11, and eight years old have been found, in the circumstances of those cases, to be of sufficient age and degree of maturity to make it appropriate for the court to consider their views on their return to the country of their habitual residence. (See, e.g., Witherspoon, at p. 976 [13- and 11-year- old children]; Escobar, at pp. 740, 745, 752 [eight-year-old child]; Blondin, at p. 158 [eight-year-old child].) If the trial court does not deny Father's petition on that ground (i.e., the children are of sufficient age and degree of maturity and object to their return to Mexico), it shall craft new conditions and undertakings that are appropriate to protect the children from the grave risk of emotional harm on their immediate return to Mexico. In so doing, the court should not order any unauthorized or unenforceable conditions or undertakings and should consider alternative means to return the children to Mexico other than in Mother's custody should she decline to voluntarily return to Mexico with them. In the event appropriate conditions and undertakings cannot be crafted to protect the children from the grave risk of emotional harm from their Father on their immediate return to Mexico, the court may deny the petition. 16  DISPOSITION The Order is reversed and the matter is remanded for further proceedings in accordance with this opinion. Because we reverse the Order, our stay of that Order pending further order of this court automatically dissolves. Each party shall bear his or her own costs on appeal. McDONALD, J. WE CONCUR: HUFFMAN, Acting P. J. NARES, J. 17 

looks fine Eric Gillaspie 04/05/2001 07:24 AM To: Richard B Sanders/HOU/ECT@ECT cc: Ann Elizabeth White/HOU/ECT@ECT, Karl E Atkins/NA/Enron@ENRON Subject: Easement encroachment demand letter Richard, We plan on sending this demand letter (and an identical one to the other co-owner) out today. Ann Elizabeth wanted me to run it by you before we send it out. Please let me know if you have any questions or comments. Thanks, Eric Gillaspie 713-345-7667 Enron Building 3886

# Vultr+SS+Firewall(fail2ban+iptables)+ss-bash 网络加速教程，适用于Linux0基础的同学 **教程见** https://github.com/ugukkylbklaom/Vultr-SS-Firewall/wiki

Design Ideas Use visual tools to create the home design of your dreams March 14, 2014 The reason why many homeowners procrastinate about re-decorating comes down to heavy lifting and the drudgery that precedes the fun part of selecting accessories, soft furnishings and beautiful wood floors like those in Anderson's Vintage Walnut 5-inch collection. But there's one handy tool - a storyboard - that can help people pull together home design plans and get a real-life sense of what the end result of a makeover will be, reported the Virginian-Pilot. Storyboards are often used by professional designers to create a room's visual image from colored drawings, swatches of wallpaper, upholstery and samples of wood stains. As a decorating project progresses, it has both a decorative and a record-keeping purpose. Laying out the plan Before gathering their materials, home decorators should collect pictures from magazines and catalogs that may serve as inspiration for their color schemes and design style. Narrow down the choices to a particular style and color combination. Next, come up with some adjectives that describe how the room will look and the atmosphere that you want to create. It may be classic and elegant in a bedroom or cozy and comfortable in a family-friendly den. This is also a good time to address functional issues, including the right finishes for floors and architectural features that will become major elements of a room design. Focusing on details For homeowners who like to hone in on details, a scaled plan drawn on graph paper will show precise furniture placement in relation to doors, windows and other permanent features. Cut-outs of furniture can be arranged on the board. For a 3-D effect, miniature versions of furniture can be constructed from foam core or craft materials. People can simulate moving heavy furnishings, installing wallpaper and choosing paint colors all with the ease of this illustrative tool. It helps to note how much paint, fabric or other materials are needed to decorate the room and keep this list with the storyboard to take along during shopping. In this way, it becomes not only a decorative aid, but one that assists homeowners in record-keeping for their projects. "[A storyboard] is another tool not only to present [ideas], but also to record them so it's the formal record of what's going to be done. It's part of the design process," Susan Pniewski, director of interior design with H&A Architects & Engineers in Virginia Beach, told the Virginian-Pilot.

Q: Parallel.For System.OutOfMemoryException We have a fairly simple program that's used for creating backups. I'm attempting to parallelize it but am getting an OutOfMemoryException within an AggregateException. Some of the source folders are quite large, and the program doesn't crash for about 40 minutes after it starts. I don't know where to start looking so the below code is a near exact dump of all code the code sans directory structure and Exception logging code. Any advice as to where to start looking? using System; using System.Diagnostics; using System.IO; using System.Threading.Tasks; namespace SelfBackup { class Program { static readonly string[] saSrc = { "\\src\\dir1\\", //... "\\src\\dirN\\", //this folder is over 6 GB }; static readonly string[] saDest = { "\\dest\\dir1\\", //... "\\dest\\dirN\\", }; static void Main(string[] args) { Parallel.For(0, saDest.Length, i => { try { if (Directory.Exists(sDest)) { //Delete directory first so old stuff gets cleaned up Directory.Delete(sDest, true); } //recursive function clsCopyDirectory.copyDirectory(saSrc[i], sDest); } catch (Exception e) { //standard error logging CL.EmailError(); } }); } } /////////////////////////////////////// using System.IO; using System.Threading.Tasks; namespace SelfBackup { static class clsCopyDirectory { static public void copyDirectory(string Src, string Dst) { Directory.CreateDirectory(Dst); /* Copy all the files in the folder If and when .NET 4.0 is installed, change Directory.GetFiles to Directory.Enumerate files for slightly better performance.*/ Parallel.ForEach<string>(Directory.GetFiles(Src), file => { /* An exception thrown here may be arbitrarily deep into this recursive function there's also a good chance that if one copy fails here, so too will other files in the same directory, so we don't want to spam out hundreds of error e-mails but we don't want to abort all together. Instead, the best solution is probably to throw back up to the original caller of copy directory an move on to the next Src/Dst pair by not catching any possible exception here.*/ File.Copy(file, //src Path.Combine(Dst, Path.GetFileName(file)), //dest true);//bool overwrite }); //Call this function again for every directory in the folder. Parallel.ForEach(Directory.GetDirectories(Src), dir => { copyDirectory(dir, Path.Combine(Dst, Path.GetFileName(dir))); }); } } The Threads debug window shows 417 Worker threads at the time of the exception. EDIT: The copying is from one server to another. I'm now trying to run the code with the last Paralell.ForEach changed to a regular foreach. A: Making a few guesses here as I haven't yet had feedback from the comment to your question. I am guessing that the large amount of worker threads is happening here as actions (an action being the unit of work carried out on the parallel foreach) are taking longer than a specified amount of time, so the underlying ThreadPool is growing the number of threads. This will happen as the ThreadPool follows an algorithm of growing the pool so that new tasks are not blocked by existing long running tasks e.g. if all my current threads have been busy for half a second, I'll start adding more threads to the pool. However, you are going to get into trouble if all tasks are long-running and new tasks that you add are going to make existing tasks run even longer. This is why you are probably seeing a large number of worker threads - possibly because of disk thrashing or slow network IO (if networked drives are involved). I am also guessing that files are being copied from one disk to another, or they are being copied from one location to another on the same disk. In this case, adding threads to the problem is not going to help out much. The source and destination disks only have one set of heads, so trying to make them do multiple things at once is likely to actually slow things down: The disk heads will be lurching all over the place. Your disk\OS caches may be frequently invalidated. This may not be a great problem for parallelization. Update In answer to your comment, if you are getting a speed-up using multiple threads on smaller datasets, then you could experiment with lowering the maximum number of threads used in your parallel foreach, e.g. ParallelOptions options = new ParallelOptions { MaxDegreeOfParallelism = 2 }; Parallel.ForEach(Directory.GetFiles(Src), options, file => { //Do stuff }); But please do bear in mind that disk thrashing may negate any benefits from parallelization in the general case. Play about with it and measure your results.

Structure and permeability to ferritin of the choriocapillary endothelium of the rat eye. The choriocapillaris is the fenestrated capillary network that supplies a large portion of the nutrients required by the retinal pigment epithelium, photoreceptor cells, and other cells of the outer neural retina. The permeability of these capillaries was investigated in the rat by the use of ferritin (mol. wt. approx. 480,000; mol. diam. 110A) as a tracer. Ninety minutes after intravascular ferritin administration, a high concentration of tracer particles was distributed uniformly in the capillary lumina but few particles were present in Bruch's membrane, the multilayered basement membrane that separates the choriocapillary endothelium from the retinal pigment epithelium. The bulk of the tracer remained in the capillary lumina with a definate blockage seen at fenestral, channel, and vesicle diaphragms. These results indicate that the ratchoriocapillary endothelium, unlike the fenestrated endothelia lining other capillary beds, constitutes an important barrier to the passage of ferritin and presumably of circulating native molecules of similar size.

Passive harmonic hybrid mode-locked fiber laser with extremely broad spectrum. We demonstrate a harmonic mode-locking Erbium-doped fiber laser which is cooperatively mode-locked by nonlinear polarization evolution (NPE) and semiconductor saturable absorber mirror (SESAM). Via effective dispersion and nonlinearity optimization, 8th harmonic at a repetition rate of 666.7 MHz is obtained. The output pulses has a full spectrum width at half maximum (FWHM) of 181 nm and duration of 218 fs. The pulses are compressed to 91 fs by external chirp compensation. The average power of the direct output pulse at an available pump power of 1.5 W is 136 mW, which exhibits a single-pulse energy of 0.2 nJ. The cavity super-mode suppression is up to 60 dB and the signal-to-noise ratio of the 8th harmonic is over 75 dB.

Q: Create Dynamic Controls using retrieved data [Asp - Vb .Net] I'm trying to create multiple controls by using retrieved data from query, but preventing them from dissapearing on postback, allowing me to get and mantain their values, the problem I have is that I cannot create them on Init because the number of controls, their IDs, and other properties are only known after user selects an item on menu. Page loads a Menu with all its items and values (Data dependent), plus, a button is loaded too User clicks a item on menu. Selected value is used to perform a query by using a Dataset (This happens inside a function which is called from Menu_ItemClick event). Retrieved data from query is used to determine how many controls must be created (2, 4, 6, etc.). Each control has its unique ID, which is given according to data. Controls are created and placed into a Panel (named p). Now controls are visible and available for editing (RadioButtons, TextAreas) User clicks on button to save information from dynamic controls into a Database Problems I'm facing Controls dissapear on postback when clicking button, because they weren't created on Init. Placing button on UpdatePanel to prevent whole page postback, makes dynamic controls not accesible when trying this: For Each c In p.Controls ... Next The only control it gets is a single Literal control (Controls count is 1), as if other controls didn't exist. Thank you in advance. A: When you wrote "Controls dissapear on postback when clicking button, because they weren't created on Init", did you mean to say that "Controls dissapear on postback when clicking button, because they weren't re-created on Init"? If not, then that is likely a root cause of your problem - dynamically-created controls must always be recreated in response to a PostBack (cf. ASP.NET dynamically created controls and Postback). There may be other issues as well, as dynamic controls in Web Forms can provide a lot of challenges as your scenario gets more involved - here's one article that lays out many of them under various scenarios http://www.singingeels.com/Articles/Dynamically_Created_Controls_in_ASPNET.aspx (e.g., if the user can re-select from the DropDownList to generate a different set of dynamic controls). The canonical reference on all of this is http://msdn.microsoft.com/en-us/library/ms178472.aspx. Now, on PostBack you'll need some way to ascertain which controls were dynamically created so they can be dynamically re-created. As such, you'll need to store somewhere whatever information allowed you to dynamically create the controls. Since ViewState isn't available in Page_Init and there can be other issues introduced when using sessions, my suggestion is to simply declare a HiddenField that contains that state information. In Page_Init, you'll then need to get the HiddenField's value from Request.Form (since the value of your HiddenField won't be loaded until after Page_Init from ViewState) and go from there to re-create your controls. My final suggestion: try getting everything working with a regular Panel first and then try and introduce the UpdatePanel - no need to over-complicate the problem at first.

1. Darren McFadden, Arkansas running backThe numbers: 30 carries, 181 yards, two TDs; 1-for-1 passing, 12 yards, TD; two receptions, 23 yards The result: Arkansas 31, Tennessee 14 Watching McFadden these last few weeks makes one wonder what might have been had the star sophomore been healthy for the opener against USC. Nonetheless, McFadden has surprising Arkansas poised to play in the SEC Championship Game - and who knows, maybe the national title game. He has been at his finest in Arkansas' biggest SEC games. Against Auburn, South Carolina and Tennessee, McFadden has a combined 545 rushing yards and six total touchdowns. 2. Jarvis Moss, Florida defensive endThe numbers: Eight tackles, blocked field goal, blocked extra point, pass break-up The result: Florida 17, South Carolina 16 The standout pass rusher was a force on special teams, saving Florida's season and keeping the Gators in the national title hunt. Moss' blocks kept four South Carolina points off the scoreboard in a 1-point win. He blocked Ryan Succop's 48-yard field-goal attempt on South Carolina's final play of the game to make sure Florida wouldn't be among the one-loss teams to fall on Saturday. 3. Tra Battle, Georgia safetyThe numbers: Three interceptions, one touchdown, four tackles, pass break-up The result: Georgia 37, Auburn 15 Remember the Bulldogs? For the first time this season, Georgia looked like the team that won two SEC titles in the last four years. Against Auburn last season, Battle was burned by Devin Aromashodu on a 62-yard pass play that set up the Tigers' game-winning field goal. This year, he found redemption by tying a Georgia record with three interceptions – all in the first half. Highlighted by a 30-yard interception return for a touchdown in a 23-point second quarter, his career day salvaged the Bulldogs' season. UGA's record was tarnished by four losses in a five-game span, including defeats at the hands of Vanderbilt and Kentucky. 4. Ray Rice, Rutgers running backThe numbers: 22 carries, 131 yards, two TDs The result: Rutgers 28, Louisville 25 on Thursday When Rutgers fell behind Louisville 25-7 in the second quarter, the Scarlet Knights got back to basics. Their strategy reverted to what made them undefeated in the first place – handing the ball to Rice. The sophomore ran 17 times for 114 yards and two touchdowns - including 74 yards in the fourth quarter - after the Cardinals took their 18-point lead. 5. Yamon Figurs, Kansas State wide receiverThe numbers: Six receptions, 123 yards, two TDs, one punt return, 52 yards The result: Kansas State 45, Texas 42 Teams have targeted Texas' ailing secondary in recent weeks, but none has been able to translate that into an upset of the defending national champion - until Saturday. The senior Figurs turned in his third career 100-yard receiving day, helping true freshman Josh Freeman to his first big win as the Wildcats' quarterback. Figurs had two touchdown catches and also set up a Kansas State field goal with a 52-yard punt return. 1. One-loss teams The number of teams in the race for the national championship whittled on Saturday with Texas, Cal and Auburn all losing their second game of the season. Another one-loss team, Florida, was shaky in its 17-16 loss to South Carolina. The remaining undefeated teams are Ohio State, Michigan, Rutgers and Boise State. The remaining one-loss teams are Florida, Arkansas, Notre Dame, USC, Louisville, West Virginia, Wisconsin and Wake Forest. 2. Dennis Franchione The embattled Texas A&M coach faced an uphill battle going into the season. An 8-1 start helped his cause, but difficult losses to Oklahoma and Nebraska in the last two weeks have sent him back to square one. 3. Louisville defensive end William Gay Rutgers kicker Jeremy Ito missed a 33-yard field-goal attempt at the end of Thursday's game against Louisville, but Gay was offside on the kick. Ito made the ensuing 28-yard kick to give Rutgers the 28-25 win. 4. Washington The Huskies have fallen apart since the season-ending injury to Isaiah Stanback. But a loss at home to winless Stanford? Surely, Washington can do better. 5. Jim Tressel and Lloyd Carr Anyone else catch them downplaying the importance of the Ohio State-Michigan game next week? That kind of talk is fine for Weeks 1-11 or in any other year, but not now. Tressel and Carr have a week to at least acknowledge this is a biggie - even for this storied rivalry.

Cataract surgery in relative anterior microphthalmos. To determine the prevalence of relative anterior microphthalmos (RAM) and evaluate intraoperative performance and surgical outcome in eyes with RAM undergoing cataract surgery. Nested case-control series. One thousand four hundred consecutive patients undergoing cataract surgery were evaluated to determine the prevalence of RAM. Relative anterior microphthalmos is defined as horizontal corneal diameter (HCD) < or =11 mm, anterior chamber depth (ACD) < or =2.2 mm, and axial length (AL) >20 mm, with no other morphologic malformation. Patients were examined preoperatively for HCD, ACD, and AL. Horizontal corneal diameter was measured with calipers. Anterior chamber depth and AL were measured with immersion shell with water. Associated ocular pathologic conditions were recorded. Two control groups were identified. Group I (normal eyes; n = 84) had HCD >11 mm, ACD >2.2 mm, and AL >20 mm. Group II (eyes with small corneal diameter; n = 84) had HCD < or =11 mm, ACD >2.2 mm, and AL >20 mm. Patients with RAM and controls were evaluated for intraoperative performance and postoperative outcome. The 2-tailed Fisher exact test was applied to compare the performance of RAM with each of the control groups. The odds ratio (OR) with 95% confidence intervals (95% CI) was determined. The prevalence of RAM was 6% (84 of 1400 eyes; 95%CI, 0.048-0.074). Relative anterior microphthalmos was associated with the presence of small pupil, 34 (40.48%); corneal guttae, 31 (36.9%); glaucoma, 29 (34.5%); and pseudoexfoliation, 6 (7.14%). Intraoperatively, RAM was associated with overall surgical difficulty because of less working space in 59 eyes (70.24%; OR, 63.7; 95% CI, 18.3-221; P<0.001) compared with control groups I and II; uveal trauma in 12 (14.28%); Descemet's detachment in 5 (5.95%); and posterior capsule rupture in 2 (2.38%). Postoperatively, RAM was associated with transient corneal edema in 63 eyes (75%; OR, 9.0; 95% CI, 4.4-18.0; P<0.001; OR, 5.4; 95% CI, 2.7-10.5; P<0.001) on the first postoperative day. The prevalence of RAM was 6%. Relative anterior microphthalmos with its associations posed significant intraoperative difficulties. The occurrence of transient corneal edema was frequent.

Super Adventure Of Smash Bros for windows 10 Super Adventure Of Smash Bros For PC / Super Adventure Of Smash Bros APK Download On Windows 10, 7, 8, MAC – Here we are going to share how to Download Super Adventure Of Smash Bros App and how to use Super Adventure Of Smash Bros For PC. You can also download Super Adventure Of Smash Bros APK free […]

As a community, everyone always asks us about the next time we will be playing Golf with your Friends and the videos are always a real treat. What sets this video apart from the others? Well! This was the first time we got to try out the new Pirate themed map. Do not worry, we were all just stellar at it. Do not be fooled by the picture from the meetup…7 strokes is a very reasonable amount. For the second part of the video we had more people join in as we played the Haunted map with crazy settings. This video is full of funny innuendos, bad humour and all the SoSa members you just love to spy on playing video games. Join us and play some Dirty Bomb with us this Sunday. It is a free FPS available on Steam! RSVP here to let us know if you will be joining us, so we can send you a reminder a few hours before the event. Do not forget to check out the meetups part of the website where we have already planned the weekly game nights for the next few weeks. Also our two upcoming real life meets can be found here as well. As always, here is the list of members who joined us for the meetup for your stalking pleasures:

Ask HN: What maths should I learn to have a solid basis for Machine Learning? - Jmoir I&#x27;m very interested in Machine Learning, especially when related to Natural Language Processing, such as comprehending stories.<p>I&#x27;m a complete beginner following along with dive into machine learning (http:&#x2F;&#x2F;hangtwenty.github.io&#x2F;dive-into-machine-learning&#x2F;) and listening to machine learning podcasts etc.<p>It is clearly very maths-heavy. My question is, if I want to have a deep understanding of Machine Learning, with the goal of one day researching in that area, what should I learn (maths-wise and more)and are there any good resources you know of? ====== nostrademons Linear algebra. Things like constraint solvers, automata, Bayesian reasoning & other probability/stats topics, etc. may also come in handy, but the core is mostly applied linear algebra. Also, math will help you understand machine learning _algorithms_ , but if you want to be a practitioner, most of the hard work is in feature selection, data cleaning, backtesting, etc. These don't need a deep understanding of math so much as a deep understanding of _your data_ \- key skills there include graphing data; having an intuition for different statistical distributions; being able to build a webapp that lets you easily graph a candidate feature, drill into examples, and share the results with the rest of your team, and other very mundane tasks that are pretty basic software engineering with a stats focus. ~~~ Jmoir I see, thanks. Bayesian is a word that keeps popping up time after time. I'll definitely start learning Linear algebra then. Feature selection, data cleaning and backtesting. I see, well you are trying to get a computer to understand and learn from data, so it's only natural that you would have to have a good command over it to design a system like that. ------ kafkaesq This textbook is a classic, and downloadable as a PDF: [http://statweb.stanford.edu/~tibs/ElemStatLearn/](http://statweb.stanford.edu/~tibs/ElemStatLearn/) Don't be put off by what you don't (yet) understand. Even someone with a math PhD, but not specifically in the areas covered, wouldn't recognize much of the terminology they're introducing. But feel free to jump around, and look for concepts that seem more approachable -- particularly where case studies are presented, often with very nice charts and diagrams -- and you can get a feel as to whether it's something for you. Learning math is like learning a language -- it takes a lot of time, and not a lot seems to happen right away. But in the long run, it can be very rewarding. ~~~ Jmoir Thank you, I'll take a look at that. Also, thanks for the solid advice! I enjoy maths, recently I've been going through all the maths I've learnt previously to refresh my memory of it. Maths suits a Computer Science student's brain (Y) ------ mindcrime Definitely linear algebra, but also some calculus and some probability theory / statistics. By way of illustration, if you were to go through the Andrew Ng course on Machine Learning, you'll encounter mathematical explanations involving partial derivatives from differential calculus As it is, he gives you the derivations you need, so you can complete the class without needing to find partial derivatives. But the point is, a certain level of understanding of calculus will help with understanding exactly what is happening. As for probability / stats, you'll find more than a few uses of probability notation and basic ideas from statistics scattered throughout machine learning. ------ jayajay I'm from a physics background, and I am pretty confident that Linear Algebra is sufficient. Please know variational calculus, as well. You'd think you need a bunch of statistics, but I think highly specific statistics is unnecessary as long as you have a decent understanding. ~~~ jayajay Actually, I would recommend focusing on Linear Algebra before you delve into Matrix Algebra. Some universities offer courses on Matrix manipulation, which is too superficial. Learn vector spaces, basis, orthogonality, operators, transformations, inner products, tensors, etc. and you'll have a leg up on many machine learning scientists lmao. ------ orionblastar Khan Academy is a good place to start to learn Linear Algebra [https://www.khanacademy.org/math/linear- algebra](https://www.khanacademy.org/math/linear-algebra) ~~~ Jmoir Thanks, I'll give it a gander. I've used Khan Academy before, but I didn't take a liking to it really. I'll give it another go! ~~~ RogerL If you like videos, but not Khan, give Gilbert Strang's videos at MIT a look. His teaching is fantastic, and he wrote several of the core texts. Or you can just work directly from his books if you prefer that approach. ~~~ Jmoir Thanks, I'll take a look at his videos and books! ~~~ mindcrime There are several freely available LinAlg books on the 'net as well. Well, counting pirate books, there are _lots_ of them. But even limiting it to the legally available ones, there's quite a bit of learning material out there. For example: [https://www.math.ucdavis.edu/~linear/](https://www.math.ucdavis.edu/~linear/) or [http://joshua.smcvt.edu/linearalgebra/](http://joshua.smcvt.edu/linearalgebra/) This is also a handy resource to keep around: [https://people.math.gatech.edu/~cain/textbooks/onlinebooks.h...](https://people.math.gatech.edu/~cain/textbooks/onlinebooks.html) ~~~ Jmoir Wow fantastic, I'll definitely take a look at these. Thank you very much.

Enhanced sulfate reduction accompanied with electrically-conductive pili production in graphene oxide modified biocathodes. This study aimed to investigate the graphene oxide (GO) conversion by the sulfate-reducing biocathode and its modified effects on performance of the microbial electrolysis cell (MEC). Biocathodes were acclimated with autotrophic sulfate-reducing cultures using medium containing 500 mg L-1 sulfate. Sulfate reductive rate in the MEC was 230 and 135 g m-3 d-1, respectively, with and without 30 mg L-1 GO addition. Raman measurements showed that GO was efficiently reduced to graphene by the biocathode within 24 h. Higher electrochemical activity and smaller charge transfer resistance were detected on biofilm with GO affected. With high electrical conductivity of 307 ± 36 μS cm-1, pili substance were observed on GO affected biofilm. As dominated by Desulfovibrio sp., the biocathode could use GO as the sole electron acceptor and maintained high activity. The results from this study should provide useful information for applications of nanomaterials in the biocathode MEC.

[Low-dose aspirin in patients with diabete melitus: risks and benefits regarding macro and microvascular complications]. Aspirin is recommended as cardiovascular disease prevention in patients with diabetes mellitus. Due to the increased risk of bleeding and because of the hypothesis that there could be a worsening of microvascular complications related to aspirin, there has been observed an important underutilization of the drug. However, it is now known that aspirin is not associated with a deleterious effect on diabetic retinopathy and there is evidence indicating that it also does not affect renal function with usual doses (150 mg/d). On the other hand, higher doses may prove necessary, since recent data suggest that diabetic patients present the so called "aspirin resistance". The mechanisms of this resistance are not yet fully understood, being probably related to an abnormal intrinsic platelet activity. The employment of alternative antiplatelet strategies or the administration of higher aspirin doses (150-300 mg/d) should be better evaluated regarding effective cardiovascular disease prevention in diabetes as well as the possible effects on microvascular complications.

i - 6*i + 3*i as d*i + j and give d. 11 Express (-m**3 - 4*m**3 + 3*m**3)*(m - 3*m + m)*(5 - 37 + 2 + (-3 - 3 + 4)*(-2 + 3 - 3)) as t*m + f*m**2 + l*m**4 + z + h*m**3 and give l. -52 Rearrange 3 - 1 - 9*x - 2 to the form z + w*x and give w. -9 Express (-k + 4*k - k)*(3*k - k - k) - k + 49 - 25 - 27*k**2 - 25 as o + p*k**2 + b*k and give b. -1 Rearrange 0*x + 11*x - x to r*x + c and give r. 10 Express 130*c**2 - 2204*c + 2204*c in the form b*c**2 + p + x*c and give b. 130 Express -4 - 2*l**2 - 7 + 8 + 3*l + 12 as v*l**2 + n + c*l and give c. 3 Express (3*p - 10*p - p)*(-4*p**3 + p**3 + 2*p**3) as x*p**3 + a*p**2 + s*p**4 + d*p + v and give s. 8 Rearrange (3*r - 6*r + 2*r)*(6 - 20 - 13) to the form z*r + k and give z. 27 Express 3*l**2 - l**2 + l**2 + (3*l - 2*l + l)*(-2*l - l + 4*l) - l**2 - 3*l + 3*l + (0*l + l**2 + 0*l)*(2 + 1 - 4) in the form z + y*l**2 + m*l and give y. 3 Rearrange (-1 - 1091*x - x**2 + 3 + 1089*x)*(2*x**2 + 1 - 1) to g*x**4 + s*x**2 + d*x + h + a*x**3 and give a. -4 Rearrange -442*i - 3*i**4 + 440*i - 2 - 2*i**3 + i**3 to the form l*i**3 + x*i**4 + y*i**2 + j + s*i and give j. -2 Rearrange -6*r**3 + 3*r**2 + 2 - r**4 + 4*r**3 + 2*r**4 - r to a*r**4 + t + s*r**3 + v*r + o*r**2 and give o. 3 Express 2 - 3*t**4 - t**3 + 2*t**4 - 3 as z*t + h*t**3 + k + c*t**2 + s*t**4 and give s. -1 Rearrange -307 + 20*t + 307 to the form w + l*t and give l. 20 Rearrange (-3 - 21 + 6)*(-4 - 1 + 4)*(-5*n + 3*n + n) to the form p + y*n and give y. -18 Express 0 + 0 + p**3 + (-2*p - 2*p + 2*p)*(-4*p**2 - p**2 + 4*p**2) + 2 - 4*p**3 - 2 - 14*p + 14*p - 4*p**3 in the form t + n*p**2 + w*p + u*p**3 and give u. -5 Rearrange 3 - 3*h**2 - 3 - 3 - h**2 to the form l*h**2 + x + v*h and give l. -4 Express -17*v + 5 + 33*v + 2 - 12*v in the form h + a*v and give a. 4 Express (141*w**2 - 137*w**2 - 2 - 3)*(12 + 0 - 9) in the form o + j*w + u*w**2 and give u. 12 Rearrange -2*s**4 + s**3 - 4*s**4 + 2*s**4 + 4 + 2*s**4 to j*s**4 + f*s**2 + c*s + r + t*s**3 and give j. -2 Express 17*m**3 - 7*m**3 - 2*m**2 - 6*m**3 - 2 in the form d*m**2 + g + i*m + l*m**3 and give d. -2 Rearrange 9*b - 656 + 656 to the form o + s*b and give s. 9 Express 0*g**3 - g - 11 - 1 - 2*g**2 + 3*g**2 - 2*g**3 as v*g**3 + b*g + i*g**2 + u and give i. 1 Express -7*a + 3*a + 8*a + 12*a as q*a + k and give q. 16 Express -f**4 - 18*f**3 - 1 - 2*f - 4*f**2 + f**2 + 18*f**3 as i*f**2 + q + o*f**3 + l*f + t*f**4 and give l. -2 Express -5*k**2 + 4*k**2 - k**3 + 2*k**2 - 2*k**4 as o*k**4 + f*k + m*k**2 + b*k**3 + u and give m. 1 Rearrange (1 + 5 - 1)*(-2 + 0 + 1)*(1 + 4 + 1)*(1 + 2 - 2)*(3 - 3 - i**2) to y*i + j + l*i**2 and give l. 30 Rearrange 24*n - 2 - 22*n + 4 - 5*n**3 to m*n**2 + y + b*n**3 + f*n and give y. 2 Express v + 3*v - 2*v + (0*v + 2*v - 3*v)*(35 + 30 - 16) as p + c*v and give c. -47 Express d - d + d**3 + (-d + d + 2*d**3)*(-15 - 4 + 3) as b*d + i + z*d**2 + q*d**3 and give q. -31 Rearrange 0*y - 13*y + y to s*y + f and give s. -12 Express -47*q**2 - 75 + 75 in the form b + s*q + o*q**2 and give s. 0 Express -13*s**2 + 9*s**2 - 98*s**2 - 2*s**2 in the form m*s**2 + c*s + j and give c. 0 Rearrange i**4 + 0*i - i**3 + 2*i**3 - 3*i**3 + 2*i**2 - i to s*i**2 + c*i + b*i**3 + f*i**4 + z and give c. -1 Rearrange (-2*a - 3*a**2 + 5*a**2 - a**2)*(-38*a + 38*a + 10*a**2 + (-4*a + 0*a + 3*a)*(0 + 0 - a)) to the form s*a**4 + x*a**3 + i*a**2 + v*a + h and give s. 11 Rearrange 38*y - 1 - 38*y + 4*y**2 + (-y - 3*y + 2*y)*(-y + 6*y - 3*y) + 3*y**2 - 4*y + 4*y to the form s + c*y + o*y**2 and give s. -1 Express (2 + 2*b - 2)*(0*b**3 + 0*b**3 + b**3) + (27 + 10 - 3)*(-b**4 - b**4 + b**4) as x*b + w + c*b**3 + z*b**2 + t*b**4 and give t. -32 Express (-2 + 2 - 5*b)*(11*b**3 + 17*b - 17*b) as y*b + h*b**3 + x + i*b**4 + j*b**2 and give i. -55 Rearrange 3 - 4*j**4 + j**3 + 2 + j - 3*j**4 - 4 to z*j**3 + x*j**2 + s*j**4 + t + m*j and give z. 1 Rearrange -5*u - 3*u**3 - 19*u**2 + 13*u**2 + 8*u**2 + 0 + 2 to x*u**3 + i*u + g + a*u**2 and give i. -5 Rearrange -16*a**2 + 6 + 8*a**2 - 1 - 2*a**4 + 3*a**2 to j*a**4 + d*a + u + s*a**2 + m*a**3 and give u. 5 Express 2644 - 2644 + 7*f**2 + f + 2*f in the form c + a*f**2 + r*f and give a. 7 Express -59*d - 56*d + 52*d - 54*d as u + q*d and give q. -117 Express (8 - 2 - 2)*(-3 - 4 + 1)*(j**2 + 4*j**2 - 4*j**2) as n + v*j**2 + a*j and give v. -24 Express -4*y**2 - y**3 + 20*y - 43*y + 22*y as r + i*y**2 + j*y**3 + f*y and give f. -1 Rearrange 5*c - 5*c + 0*c + 2*c - c**2 + c**4 - 7*c**3 to n*c**2 + u*c**4 + o*c + d*c**3 + a and give d. -7 Express (1 + 1 - 4)*(4 - 6 + 1)*(5 - 5 - 3*k + (-k + 0*k + 0*k)*(3 + 1 - 2) + 0 - 2*k + 0) in the form s + u*k and give u. -14 Rearrange 47*z + 4*z**2 - 1 - 47*z + 0 to q*z + f + x*z**2 and give q. 0 Rearrange 2*m**3 + 3*m**4 + m**4 - 4*m**3 + 1 - 5*m**4 to the form u*m**2 + i*m**4 + o*m + l + b*m**3 and give i. -1 Rearrange -8*l**3 - l**4 + 0*l**3 - 7*l**2 + 6*l**3 to the form m*l + y*l**3 + w*l**2 + z*l**4 + u and give w. -7 Express (43 + 7*m - 43)*(-4*m**2 + 6*m**2 + 0*m**2) in the form h*m**3 + x*m**2 + w + q*m and give h. 14 Rearrange (-r + 4*r - 5*r)*(5*r**2 - 5*r**2 + 5*r**3) + 2*r**3 - 2*r**3 + 2*r**4 to f*r**2 + b + y*r**4 + t*r**3 + k*r and give y. -8 Express -10*p**2 + 5*p**3 - 2*p**3 + 25*p**2 - p**3 in the form d*p + g*p**3 + h + r*p**2 and give r. 15 Rearrange -7 + 3 - 43*a + 5 - 2 to h + t*a and give h. -1 Rearrange (3 + 1 + 25)*(-5 + 3 + n + 0) to f + q*n and give q. 29 Express -y - y**2 + 0*y**2 + 0*y**2 + 6*y**2 in the form t*y**2 + c*y + o and give t. 5 Express (2 - 3 + 2)*(a**4 - 3*a**4 + 4*a**4) - 16*a**4 + 0*a**4 + 3*a**4 - 5*a**4 + 4*a**4 + 0*a**4 as o + j*a**3 + k*a + s*a**4 + h*a**2 and give s. -12 Express 4 - 4 - 8*b in the form r + o*b and give o. -8 Rearrange -7*x - 2*x**4 - x**4 - 3 + x**4 + 4*x**4 to the form o*x**3 + p*x + z*x**4 + c*x**2 + w and give p. -7 Rearrange -14*u + 11*u - 2*u - 1 to the form g + c*u and give g. -1 Express (29 + 27 + 13)*(-j - j + 3*j) in the form y + r*j and give r. 69 Rearrange ((-6*z + 3*z - 4*z)*(2 - 1 - 3) - z - 3*z + 5*z + 4*z - 3*z - 2*z)*(3*z**2 - z**2 + z - z**2) to the form m*z**2 + f*z**3 + l + h*z and give m. 14 Express (4*q**2 - q**2 - 4*q**2)*(-4*q + 4*q + q) + (4*q + 2*q**2 - 4*q)*(-1 + 1 - 2*q) - 4*q + 4*q - 3*q**3 in the form l*q + f + n*q**3 + i*q**2 and give n. -8 Express -11 + 11 + 6*n - n**2 as b + q*n**2 + f*n and give q. -1 Express -1 + 2*r**2 + 6 - r**2 as j*r + v + i*r**2 and give v. 5 Rearrange -3 - 2 + 0*w + 0*w + 7*w + 2*w**3 to the form i + v*w + l*w**2 + m*w**3 and give v. 7 Rearrange -1 - 25*a**3 + 201*a**2 + 0 - 199*a**2 to d*a + y + z*a**3 + j*a**2 and give y. -1 Rearrange (m + 0*m - 4*m)*(1 - 3 + 6) to the form n + o*m and give o. -12 Rearrange 0*x**3 + 0*x**2 + x**2 - 4*x**2 - 2 + 3*x**3 to the form k*x + q*x**2 + c*x**3 + v and give c. 3 Express 231 - 229 - n + n**2 - n**3 + n**2 + 2*n**4 in the form t*n**3 + s + u*n + b*n**4 + v*n**2 and give t. -1 Express (h + h - h)*((67*h - 119*h + 0*h)*(0 + 0 - 1) + (-4*h - h + 6*h)*(1 - 1 + 2)) + (2 - 2 + h)*(-h - h + 3*h) as x*h**2 + w*h + y and give x. 55 Express 57*p**2 - 2 + 49*p**2 - 2*p - 90*p**2 as d*p + l*p**2 + k and give k. -2 Rearrange (4 - 1 - 1)*(-3*v**2 + 3*v**2 - v**2)*(-4 + 4 - 13*v) to a*v**3 + s + b*v**2 + j*v and give b. 0 Express (1 + 0 + 0)*(-1051 + 1051 + 149*q) in the form j*q + l and give j. 149 Rearrange r**3 - 100*r + 12*r**2 - 38*r**2 + 102*r to h*r + j*r**3 + i*r**2 + m and give h. 2 Rearrange -w - 14*w - 13*w to the form y + g*w and give g. -28 Rearrange -21*s - 12*s + 2*s to l*s + i and give l. -31 Rearrange 37*g**2 + 3 - 78*g**2 + 42*g**2 to the form c*g + t*g**2 + q and give q. 3 Rearrange 45*f**2 - 10*f**2 - 17*f**2 to the form x*f + z*f**2 + b and give z. 18 Express a**4 + a**4 + 3*a - a**3 - 1 + 2*a - 4*a as m*a**2 + d*a**3 + y + k*a + c*a**4 and give k. 1 Rearrange -12*o + 38*o + 11*o to the form c*o + h and give c. 37 Express 2*b + 0*b**2 - 8*b - b**2 + 2 + (0*b - b + 2*b)*(-3*b - 4*b + 5*b) - 2*b - 2*b**2 + 2*b in the form s + y*b**2 + r*b and give r. -6 Express 2*o**2 - 3 + o**2 + 8 in the form q*o**2 + t + p*o and give t. 5 Rearrange (0 + 0 + 26*l)*(-5 + 1 + 5) to j*l + i and give j. 26 Rearrange 9*j**2 + 0*j**2 - 6*j**2 + (3 - 3 - 2*j)*(3 - 3 - j) + (0*

Q: Text goes off screen after using .aspectRatio(contentMode: .fill) I am trying to make an app with a background image using SwiftUI. However, the image is not the same aspect ratio as the screen, making me use .aspectRatio(contentMode: .fill) to fill the entire screen with it. This works completely fine until I start adding text. When adding text, it now goes off the screen instead of wrapping like it normally should do. Here's my code: struct FeaturesView: View { var body: some View { ZStack { Image("background") .resizable() .aspectRatio(contentMode: .fill) .edgesIgnoringSafeArea(.all) VStack(alignment: .leading) { Text("Hello this is some sample text that i am writing to show that this text goes off the screen.") } .foregroundColor(.white) } } } And this is the preview: As you can see, the text goes off the screen. I have tried using ´.frame()´ and specifying a width and height to fix it, but that causes issues when using the view inside other views. I am using the Xcode 12 beta. I'm new to Swift and SwiftUI, so all help is appreciated :) A: Of course it goes, because image expands frame of container, ie ZStack, wider than screen width. Here is a solution - make image to live own life in real background and do not affect others. Tested with Xcode 12 / iOS 14. var body: some View { ZStack { // ... other content VStack(alignment: .leading) { Text("Hello this is some sample text that i am writing to show that this text goes off the screen.") } .foregroundColor(.white) } .frame(maxWidth: .infinity, maxHeight: .infinity) .background( Image("background") .resizable() .aspectRatio(contentMode: .fill) .edgesIgnoringSafeArea(.all) ) }

Home Choosing the right family medical practice for your needs can be a hard choice. At Family Practice Centre of Livonia and Canton, we have been serving the medical needs of the metro Detroit area since 1965. With the experience of our skilled physicians helping to solve your medical needs, you will be putting your entire family's health and well-being in good hands. The Patient – Doctor Partnership The health and wellness of our patients is a top concern of this office. Providing the best possible care to every patient is our primary goal. The only way we can meet this goal is if doctors and patients work together. This concept is called the Patient Centered Medical Home. Patient Responsibilities: Ask questions, share your feelings and be a part of your care. Be honest about your history, symptoms and other important information about your health. Tell your doctor about any changes in your health and well-being. Take your medicine as prescribed and follow your doctor's advice. Make healthy decisions about your daily habits and lifestyle. Prepare for and keep scheduled visits or reschedule visits in advance whenever possible. Call your doctor first with all problems, unless it is a medical emergency. End every visit with a clear understanding of your doctor's expectations, treatment goals and future plans. Doctor Responsibilities: Explain diseases, treatments and results in an easy-to-understand way Listen to our patients' feelings and questions; help them make decisions about their care

Q: Get the POST data back on Web API I have a Web API server that runs in c#. The httpget methods works perfectly, but I am too new to Web Api to get the post to work, and my searches that I've done is a bit fruitless. This is my HttpPost in the ApiController [HttpPost] public bool UploadLogs(UploadLogsIn logs) { return true; } This is the model public class UploadLogsIn { public byte[] logData { get; set; } public int aLogs { get; set; } } In a c++ Application I try to post data to this method. I'm using Curl to do the post CURL *curl; CURLcode res; curl = curl_easy_init(); if (curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://192.168.56.109:9615/api/WebApiService/UploadLogs"); curl_easy_setopt(curl, CURLOPT_POSTFIELDS, R"({"UploadLogsIn": [{"aLogs: 10}]})"); curl_easy_setopt(curl, CURLOPT_POST, 1L); curl_easy_setopt(curl, CURLOPT_TIMEOUT, 20); curl_easy_perform(curl); } curl_easy_cleanup(curl); When I debug the Web Api, the method gets hit, but the parameter does not contain any data. UPDATE With wireshark, this is the information that is sent POST /api/WebApiService/UploadLogs HTTP/1.1 Host: 192.168.56.109:9615 Accept: */* Content-Length: 32 Content-Type: application/x-www-form-urlencoded Form item: "{"UploadLogsIn": [{"aLogs: 10}]}" = "" END UPDATE If I add a header struct curl_slist *headers = NULL; headers = curl_slist_append(headers, "Accept: application/json"); headers = curl_slist_append(headers, "Content-Type: application/json"); headers = curl_slist_append(headers, "charsets: utf-8"); then my parameter is null. The Wireshark dump for this is POST /api/WebApiService/UploadLogs HTTP/1.1 Host: 192.168.56.109:9615 Accept: application/json Content-Type: application/json charsets: utf-8 Content-Length: 32 Line-based text data: application/json {"UploadLogsIn": [{"aLogs: 10}]} I'm sure there is something dumb that I do not do right. Any help will be appreciated A: There is a mismatch between the class you want and the data being sent. Your desired class looks like this public class UploadLogsIn { public byte[] logData { get; set; } public int aLogs { get; set; } } But the data being sent looks like this {"UploadLogsIn": [{"aLogs": 10}]} Which when deserialized looks like this public class UploadLogsIn { public int aLogs { get; set; } } public class RootObject { public IList<UploadLogsIn> UploadLogsIn { get; set; } } See the difference? To get the model to bind to this action [HttpPost] public bool UploadLogs([FromBody]UploadLogsIn logs) { return true; } The data sent would have to look like this {"aLogs": 10}

Introduction ============ Prosthetic joint infection (PJI) is a relatively uncommon but devastating complication following total joint arthroplasty. The average reported incidence of PJI is 0.5-2%. [@B1]-[@B3] PJI has a large negative impact on the patient and it causes significant morbidity, mortality, and leads to tremendously increased health care costs. [@B1],[@B4]-[@B6] The Workgroup of the American Musculoskeletal Infection Society (MSIS) (2011) classified PJI in 3 groups, based on duration of symptoms and time after surgery. Acute infections manifest within 3 months after primary arthroplasty. Delayed (low-grade) infections usually become manifest 3-14 months after primary arthroplasty. Late (hematogenous) infections become manifest more than 2 years after primary arthroplasty. [@B1],[@B2],[@B7] Nowadays, debridement, antibiotics, irrigation and retention (DAIR) is the most widely performed treatment for acute PJI. [@B3],[@B4],[@B6] Success after DAIR treatment can be defined as eradication of infection with retention of the prosthesis and no occurrence of PJI-related mortality. A wide range of success rates (26-95%) associated with patients who undergo debridement with implant retention has been reported in the literature. [@B3],[@B4],[@B6],[@B8],[@B9] Staphylococcus aureus (12-23%) and coagulase-negative staphylococci (30-43%) are the most commonly cultured microorganisms associated with acute PJI, followed by mixed flora (10-11%), streptococci (9-10%), gram-negative bacilli (3-6%), enterococci (3-7%), and anaerobes (2-4%). [@B1],[@B3],[@B10] Several attempts have been made to create treatment protocols for acute PJI. \[e.g. 1,2,11,12\] However, a recent survey showed that in approximately 25-30% of the Dutch Hospitals there is no protocol available for the treatment of cases suspected of acute PJI. [@B13] Furthermore, a lot of variety exists in the available protocols. [@B13],[@B14] As national (Dutch) registries are not developed for the registration of PJI but rather focus on implant survival, not all DAIR procedures -even if exchange of modular components took place- are reported in these registries. [@B13],[@B15] This contributes to the underestimation of the rate of implant-related infections [@B16],[@B17]. In 2013, delegates from nine hospitals in the South-East Netherlands composed one combined diagnostic and treatment protocol for acute PJI based on the definition of acute PJI, according to MSIS and the principles of DAIR. With the aim to diminish unwanted variation and improve the quality of care around acute PJI of hip and knee arthroplasty. In order to evaluate the adherence to the treatment protocol and treatment outcome, the participating centers registered relevant aspects of treatment and outcome in a specially developed online registration system. The purpose of this study was to give an overview of the first findings of this regional collaboration. We focus on PJI incidence rate, patient, clinical and microbiological characteristics of PJI, and outcome of the DAIR treatment. Furthermore, we evaluate the adherence to the regional protocol and describe our initiatives on how to improve this adherence. Methods ======= Regional treatment protocol and infection database -------------------------------------------------- In 2013, delegates from nine orthopedic departments of hospitals in the South-East Netherlands composed one combined diagnostic and treatment protocol for acute PJI. **Figure [1](#F1){ref-type="fig"}.** The applied definition of PJI follows the MSIS criteria for PJI. [@B2],[@B4],[@B11],[@B18] A PJI is present in case of a sinus tract communicating with the prosthesis. Or if a pathogen is isolated by culture from at least two separate tissue or fluid samples obtained from the affected prosthetic joint. Or if at least four of the minor criteria are present. Minor criteria are elevated serum erythrocyte sedimentation rate (ESR) and serum C-reactive protein (CRP) concentration; elevated synovial leukocyte count; elevated synovial polymorphonuclear neutrophil percentage (PMN%); presence of purulence in the affected joint; isolation of microorganism in one culture or periprosthetic tissue or fluid; and more than five neutrophils per high-power field at x 400 magnification. [@B2],[@B11],[@B18] Within the regional treatment protocol early infections are defined as presentation of PJI within 3 months after placement of the prosthesis or as a result of a hematogenous seeding. According to the regional treatment protocol all (acute) PJIs were treated following the regimen of DAIR. The procedure consists of incising the old scar or wound, obtaining tissue samples for multiple cultures (at least 6) from synovium, capsule, and interface. This is followed by the removal of old stiches and exchangeable components (e.g. polyethylene insert) of the prosthesis. Meticulous debridement and thorough irrigation by means of pulse lavage with at least 6L NaCL is performed before exchangeable components are replaced. [@B1],[@B3],[@B6] In case of a high purulent infection at first debridement leaving behind gentamicin beads may be considered**.** Debridement and irrigation may be performed twice in the attempt to eradicate the PJI. Postoperatively, antibiotic treatment is based on bacterial susceptibility and determined in consultation with the medical microbiologist [@B8]. Patients with a total hip arthroplasty (THA), unipolar hip hemiarthroplasty, total knee arthroplasty (TKA) or revision THA/TKA, treated following DAIR are included in the regional PJI database. Data are acquired from the patients\' electronic medical records and prospectively collected in the online regional PJI database. The data registered by each hospital in the online database include: specific operation information (e.g. type of prosthesis, operation side, operation technique), patient characteristics (e.g. sex, age, body mass index), risk factors (e.g. diabetes mellitus, malignancy, rheumatoid arthritis, smoking), clinical features (e.g. erythema, persistent wound leakage / dehiscence), date of debridement, cultured microorganisms and outcome after 3 and 12 months. Each participating hospital has one or two contact persons (researcher / orthopedic surgeon) who is responsible for data registration, who can be contacted in case of questions by fellow surgeons and who participates in regular meetings with the other delegates. During these meetings uncertainties within the treatment protocol, challenging PJI cases and results of the registered data are discussed. Study design ------------ An analysis of prospectively registered data on patients diagnosed with an acute THA or TKA PJI, between 2014 and 2016, in nine hospitals in the South-East of the Netherlands was performed. **Figure [1](#F1){ref-type="fig"}.** The nine hospitals comprises a variety of academic, peripheral and private clinics. Data entry was reviewed (M.K., M.vd.S.) and controversies or contradictions were double-checked and if necessary corrected by the contact person at each hospital. Participants ------------ For the current analyses we included acute PJI, classified as appearance of the first signs and symptoms of infection within 90 days after primary implantation between January 2014 and December 2016. [@B1],[@B2] In addition, we excluded cases of revision arthroplasty, unipolar hip hemiarthroplasty, delayed or late infection (first signs and symptoms of infection \>90 days after implantation) and cases were less than two perioperative tissue cultures were obtained to analyze. Outcome measures ---------------- Patient characteristics, type of surgery and microbiology cultures were evaluated. Furthermore, we looked at mortality and treatment success. Treatment failure was defined as any further surgical procedure e.g. one/two-stage revision or Girdlestone situation at a follow-up of one year. Adherence to the protocol was investigated by analyzing the following key components; exchange of modular components (yes), number of cultures taken (≥6) and number of DAIR treatments performed (≤2). Statistical analysis -------------------- The incidence was defined as the number of prosthetic joint infections between January 2014 and December 2016 in the South-East Netherlands per 100 primary total arthroplasty procedures. This was calculated as the ratio between the number of prosthetic joint infections from January 2014 to December 2016 and the number of primary total arthroplasties in the same period. Descriptive statistics were used to describe data in terms of incidence, totals and outcome. All continuous variables are reported as means and standard deviations, categorical data as totals and percentage. Difference over the years in adherence to the protocol and outcome were tested by means of χ2 tests. Statistical analyses were performed using SPSS (version 21.0 RES Workspace Manager statistical software). Results ======= General ------- Based on data from the Dutch Arthroplasty Register, 23.353 (approximately 14% of all primary hip or knee arthroplasty in the Netherlands) [@B19] prosthetic hip or knee replacement procedures were performed between January 2014 and December 2016 in the nine participating hospitals. In the regional database a total of 426 suspicions of prosthetic joint infection were registered. We excluded 116 cases because of revision arthroplasty or unipolar prosthesis, leaving 310 primary TKA and THA with a suspected PJI. A total of 236 cases met the definition of acute PJI, representing an overall incidence of 1.12 %. **Figure [2](#F2){ref-type="fig"}.** Patient characteristics ----------------------- Patient demographics of acute PJI and prosthetic characteristics are presented in **Table [1](#T1){ref-type="table"}**. PJI occurred in 148 (63%) cases of primary hip arthroplasty and in 88 (37%) cases of primary knee arthroplasty. Patients\' mean age at time of infection was 68 years (SD 11.5 years), 147 cases (62%) were male and 89 cases (38%) were female. Prosthetic Joint Infection characteristics ------------------------------------------ The median interval between index procedure and diagnosis of infection was 20 days. On admission, 73% of the PJI patients had persistent wound leakage and 50% erythema at the affected joint. Of all PJI patients 49% had 2 or more clinical features at presentation. The predominant pathogens cultured from intraoperative samples during the first debridement were staphylococcus aureus (N= 107, 45%), coagulase negative staphylococcus (N=99, 42%), streptococcus sp. (N=32, 14%) and corynebacterium sp. (N=30, 13%). **Table [2](#T2){ref-type="table"}.** Adherence to the protocol ------------------------- Following the DAIR treatment, at the first debridement replacement of exchangeable parts significantly increased (p\<0.01) from 24/53 cases (45%) in 2014, to 42/79 cases (53%) in 2015 and 73/104 cases (70%) in 2016. Over the years in less cases more than two times a debridement was performed (p\<0.01) and an increase in the number of cultures obtained (≥6) from the affected prosthetic joint (p\<0.001) **Table [3](#T3){ref-type="table"}.** Outcome ------- Outcome following DAIR is detailed in **Table [4](#T4){ref-type="table"}**. After 3 months follow-up, prosthesis retention was achieved in 215 (91%) cases and after 12 months follow-up in 205 (87%) cases. This latter percentage remained stable over the years (p\>0.05). At the 12 months follow-up 24 (10%) of the patients required some form of surgery post-DAIR, for example a Girdlestone situation, amputation or one/two stage revision. Of our patients with PJI, 3% (N=7) died within one year after the primary surgery. Discussion ========== With this unique collaboration of nine hospitals in the South-East Netherlands we created a first regional registry, based on one combined treatment protocol for acute PJI of THA and TKA. We evaluated adherence to the treatment protocol. Moreover, this is the first study on diagnosis and treatment of PJI, which includes a large number of cases from different hospitals in the Netherlands using such a well-defined protocol. The PJI incidence within the regional cohort was 1.12%, which is comparable to the range of 0.5-2% in literature. [@B2],[@B3],[@B20] The risk factors that are associated with developing PJI following total joint arthroplasty include male sex, age, higher body mass index (BMI), and the presence of comorbidities such as diabetes, cardiac history. These factors are also associated with a higher mortality risk, suggesting there would be an association between PJI and mortality. [@B21] Moreover, the mortality rate was 3% within one year after total joint arthroplasty infection, in line with literature (3-4%). [@B22],[@B23] For comparison, the relative five-year survival rate for the most common cancers are 99% for prostate cancer, 89% for breast cancer, 64% for colorectal cancer 16% for lung and bronchial cancer and 91% for melanoma. [@B24] The high mortality rates related to PJI support the notion of a devastating complication and should be part of counseling of the patients [@B21],[@B23]. Several guidelines have been developed to aid the challenging of diagnosis and treatment of PJIs. \[e.g. 2,11\] The regional protocol was based on these evidence-based statements in order to standardize PJI management. In line with our results, Armstrong et al. (2018) recently demonstrated that adherence to specific aspects of a PJI guideline varies considerably. They suggested that lack of awareness or not recognizing the importance of these aspects might be underlying issues for a not optimal protocol adherence. [@B12] The implementation of our regional treatment protocol for PJI involved regular discussion between the participating hospitals to get everybody on board, to clarify used definitions and to present analyses of the registered data. Over the course of the collaboration we found an increase in adherence to key-components of the treatment protocol. The better adherence was not yet reflected in better outcome. Limitations ----------- The diagnosis of PJI is complex; multiple diagnostic tools are used in the attempt to correctly diagnose PJI. [@B20] Nowadays, the MSIS criteria are generally accepted worldwide and its use in research allowed for consistency in definition between studies. For the current analyses we used one of the major diagnostic criteria of MSIS; at least two phenotypically identical pathogens isolated from at least two separate tissues to identify true PJI cases. [@B2],[@B4],[@B18] In recent years, also numerous markers have been evaluated and described as minor criteria for PJI. However, as Parvizi et al. (2018) mentioned, while major criteria for infection are identical between the different definitions, the minor criteria differ and are less agreed upon. Publications in recent years have shown different weights (sensitivity and specificity) for the various tests (minor criteria) used. [@B18] Furthermore, PJI might be present if fewer criteria are met and even if all perioperative obtained cultures were negative [@B10]. Unfortunately, as not all minor criteria were integrated in the online database, these data were not available to take into account to identify true PJI. In the current analyses, the definition of PJI was created using the most objective unbiased criteria that identified the strongest major diagnostic criteria. As a result there is no doubt about the accuracy of the PJI diagnosis in the identified cases. Furthermore, the multicenter design of the study with incorporation of data from multiple centers in the regional PJI database may be caused variation in data interpretation. During the regional meetings we discussed this and reached consensus to minimize missing data. Such comparative data sharing improves the quality of care of PJI. The great variability of the way surgeons diagnose PJI, e.g. the interpretation of subjective assessments of tissue inflammation, is a major reason for underestimating the prosthetic joint infection. [@B17],[@B18] Although the total number of primary THAs and TKAs performed in the participating hospitals only increased minimally, we noticed an increase in PJIs in our cohort over the three years evaluated. We believe this is rather a sign of better adherence to the protocol and better registration instead of a real increase of PJIs. Conclusion ========== Results of the regional cohort are in line with the available literature. Regional collaboration and regular feedback on registered data resulted in better adherence to the combined treatment protocol. Despite our attempts to improve PJI care, PJI remains a serious complication of THA and TKA with a significant mortality rate and great impact on the patients and health care. Since it is still not possible to determine a reliable incidence of PJI from the (Dutch) arthroplasty register, a specified PJI register is necessary to evaluate incidences and follow-up results. Such a register will enhance the collaboration between hospitals where experience and treatment results are routinely evaluated and discussed, to improve the quality of care around acute PJI of hip and knee arthroplasty. The authors would like to thank scientific board of the Regional Prosthetic Joint Infection working group for their valuable input on the manuscript. Regional Prosthetic Joint Infection working group ================================================= The Regional Prosthetic Joint Infection working group includes: W.H.C. Rijnen, J.H.M. Goossen, J.G.E. Hendriks, R. Roerdink, T. Weernink, W. van der Weegen, Y. Pronk, A.M.J. Burgers, S. de Boer. {#F1} {#F2} ###### Patient demographics, baseline clinical characteristics and prosthetic characteristics. ---------------------------------------------------- Variables N (%) -------------------------------- ------- ----------- Joints\ 148\ (63%)\ Hip arthroplasty\ 88\ (37%)\ Knee arthroplasty\ 147\ (62%)\ Sex\ 89 (38%) Male\ Female Age (years)\*\ 68\ (± 11.5)\ Body mass index (kg/m^2^)\*\ 29.9\ (± 5.2)\ Normal \[18.5-24.9\]\ 35\ (15%)\ Overweight \[25-29.9\]\ 99\ (42%)\ Obesity \[30-34.9\]\ 66\ (28%)\ Morbid obesity \[≥ 35\] 36 (15%) Risk factors\ 15\ (6%)\ Diabetes mellitus\ 15\ (6%)\ Malignancy\ 55\ (23%)\ Others (e.g. cardiac history)\ 14\ (6%)\ Rheumatoid arthritis\ 30 (13%) Smoking ---------------------------------------------------- \*presented as mean (±SD) ###### Predominant organisms cultured from intraoperative samples during the first debridement. -------------------------------------------------- Organism N (N%) ----------------------------------- ----- -------- *Staphylococcus aureus* 107 (45%) Coagulase negative staphylococcus 99 (42%) *Corynebacterium* species 30 (13%) *Streptococcus* species\ 32\ (14%)\ Haemolyticus group A\ 2\ (1%)\ Haemolyticus Group B\ 3\ (1%)\ Haemolyticus Group C\ 2\ (1%)\ Haemolyticus Group G\ 8\ (3%)\ *Enterococcus* species 33 (14%) -------------------------------------------------- ###### Adherence to the regional protocol. 2014 2015 2016 Total -------------------------------- ------ ------- ------ ------- ---- ------- ----- ------- **No. of debridements** 1 30 (57%) 57 (72%) 63 (60%) 150 (64%) 2 13 (24%) 15 (19%) 38 (37%) 66 (28%) ≥3^\*\*^ 10 (19%) 7 (9%) 3 (3%) 20 (8%) **^\*^Exchange of components** Yes^\*\*^ 24 (45%) 42 (53%) 73 (70%) 139 (59%) **No. of cultures** ≥6^\*\*^ 22 (42%) 58 (73%) 73 (70%) 153 (65%) \*Results of \'Exchange of components\' and \'No. of cultures\' are based on the first debridement.\*\* Significant difference across the years. ###### Outcome following DAIR and complications. --------------------------------------------------------------------- 3 months (%) 12 months (%) -------------------------- ---------- --------- ----------- --------- **Prosthesis retention** 215 (91%) 205 (87%) **Reoperation**\ 17\ (7%)\ 24\ (10%)\ One-stage revision\ 6\ (2.5%)\ 4\ (1.7%)\ Two-stage revision\ 3\ (1.3%)\ 14\ (5.9%)\ Girdlestone\ 4 1\ (1.7%)\ 4\ (1.7%)\ Amputation\ 3 (0.4%)\ 1\ (0.4%)\ Unknown**^\*^** (1.3%) 0 (0%) **Mortality** 4 (2%) 7 (3%) --------------------------------------------------------------------- \* In three cases the type of reoperation at three months was not defined. [^1]: Competing Interests: The authors have declared that no competing interest exists.

using System; using Robust.Client.Animations; using Robust.Client.GameObjects.Components.Animations; using Robust.Client.Interfaces.GameObjects.Components; using Robust.Shared.Animations; using Robust.Shared.GameObjects; using Robust.Shared.Interfaces.GameObjects.Components; using Robust.Shared.Maths; namespace Content.Client.GameObjects.Components { [RegisterComponent] public sealed class AnimationsTestComponent : Component { public override string Name => "AnimationsTest"; public override void Initialize() { base.Initialize(); var animations = Owner.GetComponent<AnimationPlayerComponent>(); animations.Play(new Animation { Length = TimeSpan.FromSeconds(20), AnimationTracks = { new AnimationTrackComponentProperty { ComponentType = typeof(ITransformComponent), Property = nameof(ITransformComponent.LocalRotation), InterpolationMode = AnimationInterpolationMode.Linear, KeyFrames = { new AnimationTrackProperty.KeyFrame(Angle.Zero, 0), new AnimationTrackProperty.KeyFrame(Angle.FromDegrees(1440), 20) } }, new AnimationTrackComponentProperty { ComponentType = typeof(ISpriteComponent), Property = "layer/0/texture", KeyFrames = { new AnimationTrackProperty.KeyFrame("Objects/toolbox_r.png", 0), new AnimationTrackProperty.KeyFrame("Objects/Toolbox_b.png", 5), new AnimationTrackProperty.KeyFrame("Objects/Toolbox_y.png", 5), new AnimationTrackProperty.KeyFrame("Objects/toolbox_r.png", 5), } } } }, "yes"); } } }

Genetic variability of the coding region for the prion protein gene (PRNP) in gayal (Bos frontalis). The gayal (Bos frontalis) is a rare semi-wild bovid species in which bovine spongiform encephalopathy (BSE) has not been reported. Polymorphisms of the prion protein gene (PRNP) have been correlated significantly with resistance to BSE. In this study, the coding region of PRNP was cloned and characterized in samples from 125 gayal. A total of ten single nucleotide polymorphisms (SNPs), including six silent mutations (C60T, G75A, A108T, G126A, C357T and C678T) and four mis-sense mutations (C8A, G145A, G461A and C756G), corresponding to amino acids T3K, G49S9, N154S and I252M were identified, revealing high genetic diversity. Three novel SNPs including C60T, G145A and C756G, which have not been reported previously in bovid species, were retrieved. There also was one insertion-deletion (187Del24) at the N-terminal octapeptide repeat region. Alignment of nucleotide and amino acid sequences showed a high degree of similarity with other bovid species. Using phylogenetic analyses it was revealed that gayal has a close genetic relationship with Zebu cattle. In short, preliminary information is provided about genotypes of the PRNP in gayal. This could assist with the study of the pathogenesis of transmissible spongiform encephalopathies and cross species transmission as well as a molecular breeding project for gayal in China.

Ethusa Ethusa is a genus of crabs in the family Ethusidae. Species Ethusa americana A. Milne-Edwards, 1880 Ethusa mascarone (Herbst, 1785) Ethusa microphthalma S. I. Smith, 1881 - Broadback Sumo Crab Ethusa tenuipes M. J. Rathbun, 1897 Ethusa truncata A. Milne-Edwards & Bouvier, 1899 - Truncate Sumo Crab References Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284–292 Category:Crabs

Huynh D.T.T., Estorninos E., Capeding R.Z., Oliver J.S., Low Y.L. & Rosales F.J. (2015) Longitudinal growth and health outcomes in nutritionally at‐risk children who received long‐term nutritional intervention. J Hum Nutr Diet. 28, 623--635 doi:10.1111/jhn.12306 25808062 Introduction {#jhn12306-sec-0005} ============ Poor growth among Filipino children remains a concern despite a decrease in undernutrition among children over the past two decades [1](#jhn12306-bib-0001){ref-type="ref"}. The causes of undernutrition in this child population are seen to be similar to those reported in other developing countries, including inappropriate feeding practices leading to an inadequate diet, low socioeconomic status and an unhealthy household environment [2](#jhn12306-bib-0002){ref-type="ref"}, [3](#jhn12306-bib-0003){ref-type="ref"}. Poor nutrition in early childhood has been associated with reduced human capital, such as shorter adult height, less schooling and reduced economic productivity, as well as increased risks of chronic diseases [4](#jhn12306-bib-0004){ref-type="ref"}. In addition, an analysis of Filipino children aged 0--5 years using nationally representative data showed that the total population‐attributable risk for child deaths as a result of undernutrition was 46%, of which 93% was related to mild‐to‐moderate undernutrition [5](#jhn12306-bib-0005){ref-type="ref"}. Recently, a pooled data analysis involving 53 809 children aged 1 week to 59 months of age from 10 prospective studies in Africa, Asia and South America, including the data from the Philippines, has also demonstrated that even mild anthropometric deficits (−2 ≤ *Z*‐scores \< −1 or 2.3rd ≤ percentile \< 15th for various growth parameters including weight‐for‐age, height‐for‐age and weight‐for‐height) were associated with a significantly higher risk of mortality in childhood, especially from infectious diseases [6](#jhn12306-bib-0006){ref-type="ref"}. These findings stressed the importance of identifying effective intervention models to remedy the health consequences and economic impacts of childhood undernutrition. The treatment of undernutrition in children aims to improve energy and nutrient intake for promoting catch‐up growth [7](#jhn12306-bib-0007){ref-type="ref"}. Dietary counselling using family foods is considered an integral part of treating undernutrition in children [8](#jhn12306-bib-0008){ref-type="ref"}. However, the effects of dietary counselling on children\'s health and nutrition outcomes were shown to vary from little to significant success [9](#jhn12306-bib-0009){ref-type="ref"}, [10](#jhn12306-bib-0010){ref-type="ref"}. There are a number of limiting factors that may impede the success of nutrition counselling, such as the intensity of the intervention, the complexity of the behaviours to be changed, timing constraints and the existence of other external constraints such as low food availability [10](#jhn12306-bib-0010){ref-type="ref"}. By contrast, oral nutritional supplementation (ONS) of macro‐ and micronutrients plus dietary counselling has been shown to be a more effective method for treating and preventing undernutrition in young children compared to dietary counselling alone. In a group of pre‐school‐aged children with evidence of growth faltering (defined as weight‐for‐height percentile below the 25th percentile) and picky eating behaviour, ONS plus dietary counselling over a 3‐month period led to significantly greater improvement in different growth indicators including weight‐for‐age (WAP), height‐for‐age (HAP) and weight‐for‐height percentiles (WHP) compared to dietary counselling alone [11](#jhn12306-bib-0011){ref-type="ref"}. However, although the short‐term benefits of oral nutritional supplementation in promoting catch‐up growth in undernourished children are well‐established, the effects of long‐term nutritional supplementation are less certain, especially in children who are only mildly undernourished or at the lower end of the normal growth range. Whether the long‐term use of oral nutritional supplements in such children may result in excessive weight gain is also unknown. The present study aimed to assess the effects of the intervention model consisting of initial dietary counselling and long‐term oral nutritional supplementation of macro‐ and micronutrients over 48 weeks on ponderal and linear growth patterns and related health aspects in 36--48‐month‐old children at risk of undernutrition. Because a preventive approach of treating children at risk of undernutrition has been suggested to be more effective in combating undernutrition in children younger than 5 years of age in populations with a high burden of child undernutrition [12](#jhn12306-bib-0012){ref-type="ref"}, we chose to investigate a preventive approach of intervening in nutritionally at‐risk children including both mildly undernourished children (WHP percentile between 5 and \<15) and those at the lower end of the normal growth range (WHP percentile between 15 and 25). Materials and methods {#jhn12306-sec-0006} ===================== Study design and participants {#jhn12306-sec-0007} ----------------------------- The present study was a prospective, multicentre, single‐arm study that was conducted in the city of Manila, Philippines between October 2011 and October 2012. Children were recruited from children health clinics from the Asian Hospital and Medical Centre and the Medical City. Clinically healthy children were eligible for inclusion if they were 36--48 months of age and at risk of undernutrition defined as WHP from the 5th to the 25th based on the WHO Growth Standards. Excluded from the study were children who had a history of preterm delivery, birth weight \<2500 g or \>4000 g, or current or chronic infections (except for intestinal parasites infection), diarrhoea, acute and chronic hepatitis B or C, HIV or tuberculosis, or a diagnosis of neoplastic diseases, renal, hepatic and cardiovascular diseases, or a diagnosis of congenital or genetic disorder or infantile anorexia nervosa. Because parental obesity is an important risk factor that contributes both genetic and family environmental influences for being overweight in childhood [13](#jhn12306-bib-0013){ref-type="ref"}, children having an obese parent defined as measured or self‐reported body mass index ≥ 27.5 kg m^--2^ were also excluded. The study was approved by the Institutional Review Board and the Food and Drug Administration of the Philippines. Written informed consent was obtained from each child\'s parents or legal guardian. The study was performed in accordance with the ethical principles that had their origin in the Declaration of Helsinki (clinicaltrials.gov number NCT01658267). Intervention {#jhn12306-sec-0008} ------------ Eligible children received three sessions of dietary counselling administered at baseline and weeks 4 and 8 post‐baseline plus two servings of ONS per day for 48 weeks. The dietary counselling was conducted by the study physicians who were trained on a standardised method. The Recommended Energy and Nutrient Intakes for Filipino children aged 4--6 years [14](#jhn12306-bib-0014){ref-type="ref"} and materials on good feeding practice from WHO were used as guidelines for preparing the content of the dietary counselling. During the dietary session, parents were advised on food group selection, for which they were provided a list of foods with good protein quality from animal and vegetable sources, foods containing vegetable fat and locally available fatty fishes, staple foods, and also foods with dietary fibres such as beans, lentils and peas. In addition, some portion sizes of cooked foods from different food groups were given to aid parents or caregivers in estimating the adequate amounts to be consumed by the child. Based on WHO guidelines, techniques to enhance the child\'s eating behaviour with respect to mealtime and feeding environment, meal frequency, limiting consumption of sweetened foods and beverages were also given during the session [15](#jhn12306-bib-0015){ref-type="ref"}. Children from 3--4 years of age should be given family foods at three meals each day and twice daily nutritious snacks such as a nutritional supplement, banana or bread [15](#jhn12306-bib-0015){ref-type="ref"}. The ONS was to be consumed at snack time at mid‐morning and mid‐afternoon or before bedtime. The ONS, commercially available (PediaSure; Abbott Laboratories, Taguig City, Philippines), was used as a tool for improving the overall diet quality. When given twice daily, the ONS provided 450 kcal, 13.5 g of high quality protein, 17.7 g of easily‐digested fat and 59.4 g of carbohydrate and 28 minerals and vitamins (450 mL in total) to meet approximately 30% and 50% of the energy and micronutrient requirements, respectively (Table [1](#jhn12306-tbl-0001){ref-type="table"}). It also contained *Lactobacillus acidophilus, Bifidobacterium* spp. and fructo‐oligosaccharides. ###### Nutrient composition of nutritional supplement and percentage of recommended intakes for Filipino children aged 4--6 years Nutrients Nutritional supplement (450 mL) Percentage of recommended intakes for Filipino children aged 4--6 years (Barba & Cabrera [14](#jhn12306-bib-0014){ref-type="ref"}) (%) --------------------------------- --------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------- Energy, kcal 450 32 Protein (g) 13.5 48 Vitamin A (μg) 270 35.5 Vitamin C (mg) 45 150 Vitamin B~1~ (mg) 1.4 230 Vitamin B~2~ (mg) 0.9 150 Niacin (mg) 6.8 97.1 Vitamin B~6~ (mg) 1.2 200 Vitamin B~12~ (μg) 1.4 120 Vitamin D (μg) 9.0 180 Vitamin E (mg) 7.2 144 Folate (μg) 112.5 56 Calcium (mg) 432 78.5 Iron (mg) 6.3 70 Iodine (μg) 43.7 49 Magnesium (mg) 89.1 117 Phosphorus (mg) 373.5 75 Zinc (mg) 3.0 56 Selenium (μg) 14.4 65 Manganese (mg) 0.7 47 Lactobacillus acidophilus (cfu) 3.9 × 10^7^ *Bifidobacterium* spp. (cfu) 2.45 × 10^6^ Fructo‐oligosaccharides (g) 1.98 John Wiley & Sons, Ltd Outcome assessments {#jhn12306-sec-0009} ------------------- The compliance of long‐term ONS was assessed and its impact on nutritional status was measured by the changes in weight‐for‐age, weight‐for‐height and height‐for‐age over the study period relative to the degree of compliance with the ONS. Other outcomes include the number of sick days over the study period, parental assessment of child\'s appetite and physical activity level. Compliance assessment {#jhn12306-sec-0010} --------------------- Compliance with the study product was assessed from the product intake records for which parents or caregivers were asked to complete on a daily basis. The compliance was categorised into high, medium and low using the percentage of actual study product intake over the study period with the cut‐offs: 85--115%, 65% to \<85% and \<65% respectively. Anthropometric assessment {#jhn12306-sec-0011} ------------------------- Anthropometric measurements were performed by study staff who trained on standardised methods of conducting the measurements. Weight was measured with light clothes and shoes and jackets removed, using electronic weighing scales (Tanita HD380; Tanita, Manila, Philippines) and recorded to the nearest 0.1 kg. Standing height was measured without shoes or hat, using a height measuring gauge (Seca 217; Seca, Hamburg, Germany) and recorded to the nearest 0.1 cm. Weight and height were measured at baseline and all post‐baseline visits at weeks 4, 8, 16, 24, 32, 40 and 48. Assessment of growth and nutritional status {#jhn12306-sec-0012} ------------------------------------------- Weight‐for‐age, weight‐for‐height and height‐for‐age were expressed as sex‐age‐specific percentiles and *Z*‐scores using the WHO Child Growth Standards. Wasting and being overweight were defined as weight‐for‐height percentiles \<2.3rd and \>97.7th respectively. In addition, being at risk of wasting and being overweight was assessed as weight‐for‐height between 2.3rd and \<25th and between the 85th and 97.7th percentiles, respectively. The rate of weight‐for‐height *Z*‐score gain from baseline to each post‐baseline time point was also calculated. Dietary assessment {#jhn12306-sec-0013} ------------------ Dietary intake was collected using 24‐h food recall method by the trained nutritionists from the Food and Nutrition Research Institute in the Philippines (FNRI). At baseline, one 24‐h food recall was completed. Two 24‐h food recalls for two nonconsecutive days were performed at all post‐baseline visits. The first recall was conducted in the weekend prior to the scheduled visit via a telephone interview and the second recall was completed at the visit. After conducting the quality control checks for data accuracy and completeness, dietary intake data were analysed using the Individual Dietary Evaluation Software ([ides]{.smallcaps}) developed by the FNRI. For assessing an increase in energy intake from baseline to post‐baseline visits, the mean energy intake was calculated from two recalls for all post‐baseline visits. Physical activity and appetite {#jhn12306-sec-0014} ------------------------------ Parents were asked to rate their child\'s physical activity and appetite over the last 24 h using the Visual Analogue Scales, scoring 1--10 at baseline and all post‐baseline visits. Sick days {#jhn12306-sec-0015} --------- From the adverse event (AE) and serious adverse event (SAE) reports collected over the study period as part of normal clinical trial surveillance, we extracted information on the incidences and the number of sick days of common acute illnesses that are associated with childhood morbidities and mortalities, including diarrhoeal and upper and lower respiratory tract infections [6](#jhn12306-bib-0006){ref-type="ref"}. The total number of sick days for the subject was calculated from the date of onset to the date resolved for each event, as recorded in the AE page. If more than one event occurred on the same date, the date was only counted once in the determination of number of sick days. In the analysis examining the trend in number of sick days over 48 weeks, the number of sick days at both weeks 4 and 8 was combined for equally spaced data points at each 8‐week interval. Statistical analysis {#jhn12306-sec-0016} -------------------- All statistical analyses were performed on an intent‐to‐treat basis, using [sas]{.smallcaps}, version 9.1.3 (SAS Institute Inc., Cary, NC, USA). Descriptive results, including anthropometric measurements, energy intake, number of sick days, physical activity and appetite scores, were summarised by the mean, median and SD. Categorical variables were summarised by number of subjects (*n*) and as a percentage (%). All continuous variables were checked for normality using the Shapiro--Wilk test. If the Shapiro--Wilk test was significant (*P* \< 0.05), the variable was declared to be non‐normal. The nonparametric tests, including the Mann--Whitney *U*‐test and the signed rank test with stepdown Bonferroni adjustment, were used to examine the differences between two groups for continuous outcome variables with non‐normal distribution. The association between repeated measures of WHP and HAP over the study period with sociodemographic factors, including age (months), sex and parental education level, baseline nutritional status such as mild wasting (WHP \< 15) versus normal (WHP ≥ 15), study site, study visits and the compliance with ONS consumption, expressed as a percentage of ONS consumption, was assessed using repeated measures analysis of covariance ([ancova]{.smallcaps}). In addition, [ancova]{.smallcaps} was used to assess whether these factors have an impact on the number of sick days or parent‐reported appetite and physical activity scores over the study period. Results {#jhn12306-sec-0017} ======= Baseline characteristics of subjects {#jhn12306-sec-0018} ------------------------------------ Two hundred and twenty‐four subjects were screened, of whom 200 were enrolled. Of the 200 enrolled subjects, one subject did not meet the eligibility criteria for age group and never consumed the study product. This results in the intent‐to‐treat population of 199 subjects. Baseline characteristics of children and their parents are shown in Table [2](#jhn12306-tbl-0002){ref-type="table"}. The mean age was 41.2 months and 50% were male. In general, children had ponderal growth faltering rather than linear growth faltering problem because the mean weight‐for‐age percentile was the lowest among growth indicators. Males were heavier than females at baseline (*P* \< 0.0001), whereas mean height was comparable between the two sexes. In addition, males had significantly greater mean percentiles of weight‐for‐height at baseline than females. In terms of parental characteristics, there were more than 90% of children whose mothers attended high school and/or college or university. ###### Baseline characteristics of children participated in the present study Baseline characteristics[a](#jhn12306-note-0002){ref-type="fn"} Study group (*n* = 199) *P*‐value ----------------------------------------------------------------- ------------------------- ------------------------------------------------- Age (months) 41.2 (3.59) Sex Male 99 (49.7) Maternal age (years) 30.0 (6.19) Maternal education level College/University or Higher 84 (42.2) High School 114 (57.3) Secondary School 0 Primary School 1 (0.5) Weight (kg) 12.4 (0.98) Male 12.7 (0.90) \<0.0001[b](#jhn12306-note-0003){ref-type="fn"} Female 12.2 (0.98) Height (cm) 93.3 (3.94) Male 93.7 (4.06) 0.1049[b](#jhn12306-note-0003){ref-type="fn"} Female 92.8 (3.79) Weight‐for‐height percentiles 15.9 (7.29) Male 17.0 (7.64) 0.0228[c](#jhn12306-note-0004){ref-type="fn"} Female 14.8 (6.79) Weight‐for‐age percentiles 8.9 (8.54) Male 9.8 (8.60) 0.0712[c](#jhn12306-note-0004){ref-type="fn"} Female 8.1 (8.46) Height‐for‐age percentiles 14.2 (17.0) Male 15.3 (18.5) 0.7083[c](#jhn12306-note-0004){ref-type="fn"} Female 13.1 (15.4) Data are presented as the means (SD), except for sex, which is presented as a percentage. *P*‐value is from a *t*‐test. *P*‐value is from the Mann--Whitney *U*‐test. John Wiley & Sons, Ltd Compliance {#jhn12306-sec-0019} ---------- There was high compliance because 100% of children were reported to consume at the recommended dose of ONS with at least 85% of two servings on a daily basis. In accordance with a high compliance with ONS consumption, there were improving trends in total energy intake over the study period (*P* \< 0.0001) (Fig. [1](#jhn12306-fig-0001){ref-type="fig"}). {#jhn12306-fig-0001} Changes in growth indicators over time {#jhn12306-sec-0020} -------------------------------------- Because of the lack of diversity in compliance categories, data were analysed and presented as a single group. In terms of weight change, children had more weight gain for the first 8 weeks of the study (0.5 and 0.3 kg on average in the first and second 4 weeks, respectively) than for the remaining period (0.2--0.3 kg per 8 weeks) (Fig. [2](#jhn12306-fig-0002){ref-type="fig"}a). By contrast, height steadily increased over the study period, with a mean rate of 0.5 cm every 4 weeks (Fig. [2](#jhn12306-fig-0002){ref-type="fig"}b). {#jhn12306-fig-0002} Various anthropometric indices were used to assess longitudinal growth that includes both ponderal and linear growth. The patterns observed for these growth indices were similar and characterised by two phases, including catch‐up growth and maintenance of growth. Children had the greatest increases in mean WHP and WAP in the first 4 weeks of the study compared to the changes between consecutive visits. At least 70% of children had an increase in WHP and WAP during this period (data not shown). The rates of percentiles gain slowed down after week 4 and were relatively stable for the rest of the study (Fig. [3](#jhn12306-fig-0003){ref-type="fig"}). Percentiles at all post‐baseline visits were significantly higher than baseline (*P* \< 0.0001). In terms of linear growth, children steadily increased HAP over time, except for the period of week 40 to week 48, and this reached statistical significance from week 16 onwards compared to baseline (Fig. [4](#jhn12306-fig-0004){ref-type="fig"}). At week 48, using WHO definitions for assessing undernutrition and overnutrition, four (2.1%) children and one child (0.5%) were categorised as wasting and being overweight, respectively (data not shown). Although these wasting children were good compliers with ONS consumption (85--100%) and had an improved energy intake at most of post‐baseline visits, a further decrease in WHP was possibly the result of acute illnesses in two children (total number of sick days of 8--10 day over the study period), whereas there was a greater increase in HAP and a further decrease in WAP compared to baseline in the other children leading to smaller WHP. In terms of growth velocity, the mean increase in WH *Z*‐scores at all post‐baseline time points was below 0.67, which is the recommended cut‐off point for defining rapid weight gain (Fig. [5](#jhn12306-fig-0005){ref-type="fig"}) [16](#jhn12306-bib-0016){ref-type="ref"}. {#jhn12306-fig-0003} {#jhn12306-fig-0004} {#jhn12306-fig-0005} Figures [6](#jhn12306-fig-0006){ref-type="fig"} and [7](#jhn12306-fig-0007){ref-type="fig"} show the weight‐for‐age and height‐for‐age *Z*‐score distributions at baseline and week 48. Both *Z*‐score distributions at week 48 were shifted to the right and towards the normal distribution, representing the distribution of the reference population of WHO Child Growth Standards [17](#jhn12306-bib-0017){ref-type="ref"}. There was a further shift toward the central value (0 *Z*‐score) or greater improvement in *Z*‐score for weight‐for‐age than for height‐for‐age. A similar *Z*‐score distribution was seen for weight‐for‐height (data not shown). {#jhn12306-fig-0006} {#jhn12306-fig-0007} Sick days, physical activity and appetite scores {#jhn12306-sec-0021} ------------------------------------------------ The trend in number of sick days over the 48‐week period was examined. When the first 8 weeks of intervention were used as a reference, the number of sick days of each post‐week 8 visit was significantly reduced compared to the reference (*P* \< 0.0001) (Fig. [8](#jhn12306-fig-0008){ref-type="fig"}). In addition, parents reported an improvement in appetite and physical activity levels from baseline to each post‐baseline visit (*P* \< 0.0001 for each post‐baseline visit) (Fig. [9](#jhn12306-fig-0009){ref-type="fig"}). {#jhn12306-fig-0008} {#jhn12306-fig-0009} Factors associated with ponderal and linear growth over time {#jhn12306-sec-0022} ------------------------------------------------------------ Several factors were investigated to determine their association with ponderal and linear growth. Several factors were shown to have significant positive associations with an increase in WHP over the study period, including lower WHP in the normal range at baseline (*P* \< 0.0001), being male (*P* = 0.0006), highest parental education of college or university or higher (*P* = 0.0002) and better compliance with ONS consumption (*P* = 0.0021) (Table [3](#jhn12306-tbl-0003){ref-type="table"}). Similarly, these are also significant positive predictors for the development of HAP over time, except for the overall ONS compliance (Table [4](#jhn12306-tbl-0004){ref-type="table"}). By contrast, there are no associations between the examined factors and the reduced number of sick days or improved appetite or physical activity scores (data not shown). ###### Relationship between weight for height percentile and sociodemographic factors over time Effect Least squares mean Standard error *P*‐value ------------------------------------ -------------------- ---------------- ----------- Baseline nutritional status Mildly wasting (WHP \< 15) 19.75 0.91 \<0.0001 Normal (WHP ≥ 15) 35.83 0.85 Weeks 4 25.68 1.40 0.5812 8 28.13 1.40 16 29.06 1.40 24 28.54 1.40 32 26.89 1.40 40 28.43 1.40 48 27.78 1.40 Sex Female 26.07 0.88 0.0006 Male 29.51 0.87 Baseline age (months) 0.1670 Study site Asian Hospital and Medical Center 28.93 0.55 0.1221 The Medical City 26.65 1.35 Highest parental education High school 25.91 0.88 0.0002 College/University or Higher 29.66 0.88 Compliance with ONS consumption Overall percentage of ONS consumed 0.0021 *P*‐value is from repeated measures [ancova. ons,]{.smallcaps} oral nutritional supplementation[; whp,]{.smallcaps} weight‐for‐height percentile[.]{.smallcaps} John Wiley & Sons, Ltd ###### Relationship between height for age and sociodemographic factors over time Effect Least squares mean Standard error *P*‐value ------------------------------------ -------------------- ---------------- ----------- Baseline nutritional status Mildly wasting (WHP \< 15) 4.65 0.54 \<0.0001 Normal (WHP ≥ 15) 32.08 0.68 Weeks 4 16.61 0.95 0.1473 8 17.23 0.95 16 18.03 0.95 24 18.75 0.95 32 19.19 0.95 40 19.36 0.95 48 19.39 0.95 Sex Female 16.95 0.61 \<0.0001 Male 19.78 0.60 Baseline age (months) 0.1187 Study site Asian Hospital and Medical Center 20.76 0.38 \<0.0001 The Medical City 16.0 0.92 Highest parental education High school 17.28 0.61 0.0015 College/University or Higher 19.45 0.60 Compliance with ONS consumption Overall percentage of ONS consumed 0.9240 *P*‐value is from repeated measures [ancova. ons,]{.smallcaps} oral nutritional supplementation[; whp,]{.smallcaps} weight‐for‐height percentile[.]{.smallcaps} John Wiley & Sons, Ltd Discussion {#jhn12306-sec-0023} ========== Conventionally, nutritional intervention targets children with moderate and severe undernutrition rather than those with mild undernutrition because of its significant impact on health and growth, both short and longer term [18](#jhn12306-bib-0018){ref-type="ref"}, [19](#jhn12306-bib-0019){ref-type="ref"}. On the other hand, children at the lower end of the normal growth are considered normally nourished and therefore are not the focus for nutritional intervention. The present study shows that, in these nutritionally at‐risk children with low anthropometric values, the intervention model consisting of initial dietary counselling and long‐term use of an oral nutritional supplement promoted ponderal growth in the catch‐up growth phase and linear growth during the maintenance growth phase, thereby promoting and sustaining proportional growth. In addition, we observed health benefits on the number of sick days, appetite, physical activity levels and thus overall health in pre‐school‐aged children in a developing country. These benefits have been achieved with a low risk of excessive weight gain. This confirms the hypothesis that the preventive approach of targeting children at risk of undernutrition using an intervention model consisting of initial dietary counselling and continued ONS is safe and effective with respect to improving nutritional status and health in children under 5 years of age. This study showed a gain in weight (WAP) during the catch‐up phase, followed by a gain in height (HAP). This growth pattern has been observed in studies of catch‐up growth in severely undernourished children who demonstrated weight gain preceding height gain with the onset of supplementation [20](#jhn12306-bib-0020){ref-type="ref"}, [21](#jhn12306-bib-0021){ref-type="ref"}. In the present study, however, none of children were moderately or severely undernourished. Thus, their growth represents a pattern of saltation and stasis as characterised by Lampl [23](#jhn12306-bib-0023){ref-type="ref"}, indicating a robust adaptive strategy, by which populations adjust growth patterns accordingly to environmental factors such as available diet. In this regard, it demonstrates the adequacy of the diet in providing the energy and nutrients necessary for growth. Golden [7](#jhn12306-bib-0007){ref-type="ref"} has noted that a gain in height is a better indicator of the effectiveness of the nutritional intervention than weight gain alone. This is because weight gain is frequently simply a result of a positive energy balance, whereas height gain only occurs when diets contain necessary nutrients to support syntheses of skeletal tissue and accompanying lean tissue [7](#jhn12306-bib-0007){ref-type="ref"}. According to Golden [7](#jhn12306-bib-0007){ref-type="ref"}, these nutrients are classified as the growth nutrients comprising the building blocks of tissues and are necessary for almost all biochemical pathways in which a lack of any of these nutrients will stop the child from growing. Among the available nutrition intervention methods, dietary counselling using family foods for treating undernutrition in children is considered the first line of treatment, although its shortcomings have also been recognised when applied in the setting of developing countries. In addition to the challenges in procuring dietary diversity and in consuming adequate amounts to meet nutrient intake recommendations, plant‐based diets are known to contain relatively high anti‐nutrients, a low nutrient bioavailability for some nutrients such as iron, zinc and vitamin A, and a limited source of active compounds that are available in animal source foods [12](#jhn12306-bib-0012){ref-type="ref"}. These challenges have contributed to the limited success of relying on dietary counselling using family foods alone to achieve adequate weight and height growth in children at nutritional risk [12](#jhn12306-bib-0012){ref-type="ref"}, [18](#jhn12306-bib-0018){ref-type="ref"}. Growth of children in the present study as measured by WHP demonstrated a healthy gain in body weight because it consists of initial catch‐up growth followed by growth maintenance phase. Although children who were at the lower end of the normal growth range at baseline had greater increases in WHP compared to those with mild wasting, time was not significant in the model of factors associated with WHP over time, especially when the least squares means were comparable from week 8 onwards, suggesting that the increased WHP is stable after week 8. In addition, there was only one child (0.5%) who was categorised as overweight by the end of the study. Because rapid weight gain during childhood was shown to be associated with obesity development in later life, it is recommended that the 0.67 *Z*‐score variation should be used to evaluate rapid growth as a risk factor of later obesity [17](#jhn12306-bib-0017){ref-type="ref"}. The score variation is based on the difference between the 25th, 50th and 75th percentiles of a growth chart [17](#jhn12306-bib-0017){ref-type="ref"}. Using this definition, the amount of weight gain in these children within the first 4 weeks of intervention (0.26 *Z*‐scores or 5.5 percentiles and 0.39 *Z*‐scores or 12.2 percentiles, respectively) was considered safe at the same time as helping nutritionally at‐risk children regain growth normality. In addition to being at the lower end of the normal range, which was associated with the improved growth over time as discussed above, other factors were shown to have an impact on ponderal and linear growth over time, including a higher parental educational level and being male. The findings in the present study were in accordance with the existing literature on the importance of parental education in child\'s health. Higher parental education levels were shown to be associated with protective caregiving behaviours and a lower risk of child malnutrition in the Philippines, Bangladesh and Indonesia [3](#jhn12306-bib-0003){ref-type="ref"}, [23](#jhn12306-bib-0023){ref-type="ref"}. In the present study, males were better nourished than females at baseline and also had significantly greater increase in weight‐for‐height and height‐for‐age percentiles over the study period. This sex difference in growth was previously reported in a longitudinal cohort study from birth to 24 months in Filipino children [24](#jhn12306-bib-0024){ref-type="ref"}. Although an individual\'s sex may modulate the responses of growth to nutritional intervention as shown in young infants during the first 6 months of life [25](#jhn12306-bib-0025){ref-type="ref"}, a male sex preference that appears to be common in Asian countries may have an impact on growth response to the intervention because they may receive better family\'s resources compared to females. In the present study, we observed a significant reduction in the number of sick days and a significant increase in the appetite and physical activity scores over the study period. Sociodemographic factors were shown not to be associated with these improved outcomes in the repeated measures [ancova]{.smallcaps} analysis. The absence of a control group limited our ability to establish a definitive causal relationship between the intervention and these improved outcomes. Nonetheless, the ONS provided at least 50% of the requirements for nutrients known to be critical for improvement and maintenance of the immune system, such as zinc, vitamin E, vitamin A and selenium, especially when high compliance with ONS consumption was reported in 100% of children [7](#jhn12306-bib-0007){ref-type="ref"}, [26](#jhn12306-bib-0026){ref-type="ref"}, [27](#jhn12306-bib-0027){ref-type="ref"}. This may have preventive implications in providing protection against common infections of respiratory and gastrointestinal tracts in children from developing countries. Compared to those children who live in a clean environment or are not under stress, children who live in crowded or flooded areas such as the children in the present study are advised to consume a diet containing higher protective nutrients [7](#jhn12306-bib-0007){ref-type="ref"}. In addition, as reported by parents, children in the present study also had a significant increase in appetite and physical activity scores. It is possible that adequate intake of certain micronutrients such as zinc and iron may have a positive impact on appetite because they have been shown to be involved in appetite regulation [28](#jhn12306-bib-0028){ref-type="ref"}, [29](#jhn12306-bib-0029){ref-type="ref"} and improvement of appetite in young children who have evidence of growth faltering [30](#jhn12306-bib-0030){ref-type="ref"}, [31](#jhn12306-bib-0031){ref-type="ref"}. It is noteworthy that the present study was carried out in children aged 3--48 months, which is beyond the 'first 1000 days window'. It is well‐accepted that nutritional intervention should be implemented during the 'first 1000 days window' for better outcomes on child growth and development, whereas less emphasis is placed on nutritional intervention after this window of opportunity because of a modest impact on growth, functionality and health outcomes [32](#jhn12306-bib-0032){ref-type="ref"}, [33](#jhn12306-bib-0033){ref-type="ref"}, [34](#jhn12306-bib-0034){ref-type="ref"}. However, our intervention beyond 1000 days has demonstrated significant benefits on growth, functionality and health outcomes, providing some evidence on the merit of extending the window of intervention beyond 1000 days. Indeed, analyses on longitudinal data on growth from birth cohorts in Brazil, Guatemala, India, the Philippines and South Africa have shown that catch‐up growth may still occur after age of 2 years [35](#jhn12306-bib-0035){ref-type="ref"}. This is also supported by analysis using the absolute height‐for‐age difference over time, which showed that 70% of height deficit at 60 months was a result of faltering from conception to 24 months, whereas 30% was a result of continued increases in deficit from age 2--5 years [33](#jhn12306-bib-0033){ref-type="ref"}. Thus, our results add to the body of evidence supporting the proposal that appropriate nutritional intervention in children beyond 2 years old could still be effective and important for minimising the negative impact of growth retardation on both short‐ and long‐term health consequences [7](#jhn12306-bib-0007){ref-type="ref"}. The present study had some limitations. First, this is a single‐arm clinical trial with no control group. We expected that there would have been a relative distribution in compliance among the enrolled subjects from low, medium to high compliance. However, the compliance with ONS was 100% in this population, which did not allow for a comparison of growth across compliance levels. We acknowledge that this is a major study limitation and the inclusion of an active control group should be more advantageous for illustrating the causal effects of the intervention on the benefits observed. Nonetheless, given the clear causal link between poor nutrition and faltering growth [36](#jhn12306-bib-0036){ref-type="ref"}, as well as previously proven benefits between ONS in improving growth among nutritionally at‐risk children [11](#jhn12306-bib-0011){ref-type="ref"}, [37](#jhn12306-bib-0037){ref-type="ref"}, the probability that the ONS resulted in the health benefits observed in the present study is high. Additionally, the availability of the well‐established WHO growth standards enables us to compare the growth of children in the present study against the standards and determine the positive effect of the intervention. Second, the high compliance with ONS may be subject to biases because it was measured using parental self‐reporting. However, the high compliance observed in the present study is supported by the increased energy intake through dietary assessment and the increase in both ponderal and linear growth. In conclusion, the present study shows that nutritional intervention combining initial dietary counselling and long‐term oral nutritional supplementation promoted an initial catch‐up growth in weight and also improved linear growth during the growth maintenance phase, thereby helping to sustain proportional growth in children at risk of undernutrition. Given the positive results of the present study showing that ONS in the form of energy, macro‐ and micronutrients can be a useful tool in the management of child undernutrition, further research is warranted to evaluate the effectiveness of including ONS in the prevention intervention models on promoting growth and health in nutritionally at‐risk children using more robust study designs, such as those including an active control group receiving a placebo supplement. Evaluation of the cost‐effectiveness of such interventions in improving human capital for the society will also provide useful insights into potential public health implications. {#jhn12306-sec-0025} Conflict of interests, source of funding and authorshipDTTH, JSO, YLL and FJR are employees of Abbott.Abbott Nutrition provided funding for the study.DTTH and FJR conceived and designed the study. EE and RZC were responsible for subject recruitment and data collection. DTTH, JSO, YLL, EE, RZC and FJR participated in data analysis and interpretation. DTTH, EE, RZC, JSO, YLL and FJR drafted the manuscript. All authors critically reviewed the manuscript and approved the final version submitted for publication. Abott Nutrition was responsible for the study design, monitoring, data analysis and manuscript preparation and submission. We thank Mr Yatin Berde for his assistance in constructing the graphs. We would also like to thank Dr Florianne Valdes, the Medical City Philippines, for help with execution of the study and data collection. Special thanks are extended to the Food and Nutrition Research Institute for their help in collecting dietary intake data and conducting dietary data analysis.

FOR PUBLICATION UNITED STATES COURT OF APPEALS FOR THE NINTH CIRCUIT MILTON LEWIS,  No. 11-15309 Petitioner-Appellant, D.C. No. v.  2:02-cv-00013- ROBERT L. AYERS, KJM-GGH Respondent-Appellee.  OPINION Appeal from the United States District Court for the Eastern District of California Frank C. Damrell, Jr., District Judge, and Kimberly J. Mueller, District Judge, Presiding Argued and Submitted January 18, 2012—San Francisco, California Filed May 30, 2012 Before: M. Margaret McKeown, Richard R. Clifton, and Jay S. Bybee, Circuit Judges. Opinion by Judge Clifton 5973  LEWIS v. AYERS 5975 COUNSEL Gary D. Sowards (argued), David A. Senior, Ann K. Tria, McBreen & Senior, Los Angeles, California, for the petitioner-appellant. Barton Bowers (argued), Michael P. Farrell, Michael A. Can- zoneri, Office of the Attorney General, Sacramento, Califor- nia, for the respondent-appellee. OPINION CLIFTON, Circuit Judge: Milton Otis Lewis was sentenced to death following Cali- fornia convictions for first-degree murder and other crimes. 5976 LEWIS v. AYERS While seeking federal habeas relief, Lewis requested a stay of the proceedings on the ground that he was not competent at the time to assist counsel. We have previously held that a habeas petitioner in a capital case is entitled to such a stay if he is not presently competent and is raising a claim as to which he could potentially benefit if he could communicate rationally with his attorney. Rohan ex rel. Gates v. Woodford, 334 F.3d 803, 819 (9th Cir.), cert. denied, 540 U.S. 1069 (2003).1 Following an evidentiary hearing on Lewis’s competency, the district court denied the requested stay based on its determina- tion that Lewis was competent to proceed. Lewis seeks an immediate appeal of the competency deter- mination or, in the alternative, mandamus relief. We conclude that we lack jurisdiction to review the competency determina- tion at this time because it is not an immediately appealable order. We also conclude that mandamus relief is not appropri- ate. We thus dismiss the appeal and deny the petition for writ of mandamus. I. Background Lewis was convicted in 1990 of one count of first-degree murder, two counts of robbery, one count of burglary, and one count of attempted murder. As to the first-degree murder con- viction, the jury also found the special circumstances of rob- 1 We note that the Supreme Court recently granted certiorari to review our decision in In re Gonzales, 623 F.3d 1242 (9th Cir. 2010). Ryan v. Gonzales, 132 S. Ct. 1738 (2012). Our decision in Gonzales applied Rohan (and our subsequent decision in Nash v. Ryan, 581 F.3d 1048 (9th Cir. 2009)) and held that the petitioner was entitled to a stay pending a competency determination because he had raised a claim that could benefit from rational communication with counsel. 623 F.3d at 1246. Even if the Court reversed Gonzales in a way that effectively overrules Rohan, the result in this case would be the same because we hold here only that the district court’s denial of a stay after a determination that petitioner is com- petent is not subject to immediate appeal and not deserving in this case of mandamus relief.  LEWIS v. AYERS 5977 bery murder and burglary murder, and, at the penalty phase, returned a verdict of death. The California Supreme Court affirmed on direct appeal the convictions and death sentence. People v. Lewis, 22 P.3d 392 (Cal. 2001). Lewis sought post- conviction relief in state court, but his petitions were denied. Lewis filed a habeas petition under 28 U.S.C. § 2254 in the Eastern District of California on March 31, 2003, followed by an amended petition on December 13, 2004, which asserted 103 claims. The district court granted summary judgment in favor of the State on 74 of the claims in 2008. Other claims remain pending. In a declaration filed in August 2007, Dr. Pablo Stewart, a psychiatrist retained on behalf of Lewis, declared that, in his expert opinion, Lewis was mentally incompetent at the time of the offense, at the time of the police interview, at the time of trial, and at the time of the declaration. This declaration was filed in response to a query by the magistrate judge, made during a hearing regarding a motion for an evidentiary hear- ing on some of the habeas claims, about whether Lewis was presently competent. After Dr. Stewart’s declaration was filed, the magistrate judge, in order to clarify the assertion of present incompetency, issued an order requiring Lewis to either file a motion to stay the proceedings based on current incompetency or abandon the assertion that he was at that time incompetent. Lewis filed a motion to stay proceedings because of incompetency. The magistrate judge held an evidentiary hearing on Lewis’s competency. Dr. Stewart testified at the hearing, as did an expert for the State, Dr. Roderick Ponath, and Lewis’s counsel for post-conviction proceedings, David Senior. Dr. Ponath examined Lewis during two full interviews in 2009 and a handful of other brief exchanges around that time. In a declaration filed prior to the evidentiary hearing, Dr. Ponath stated that Lewis suffered from a mental disorder, but 5978 LEWIS v. AYERS he later testified that the disorder “was really minimal effect, minimal impairment.” Dr. Ponath described how Lewis, with- out assistance, could describe his appeal process and the issues he and counsel had discussed pursuing, and Dr. Ponath expressed the view that Lewis was able to communicate suffi- ciently with counsel. Thus, Dr. Ponath concluded that Lewis had, at the time of his examination, the “sufficient present ability to consult with his attorney with a reasonable degree of rational understanding.” At the evidentiary hearing, Dr. Ponath gave further testi- mony that Lewis’s disorder was possibly influenced by Lewis’s past methamphetamine use. Dr. Ponath did not believe Lewis had an impairment that required treatment, however. On cross-examination, Dr. Ponath stated that, at least at the time of his testimony, San Quentin Prison had a procedure in place to identify individuals with major mental disorders, but that Lewis was never identified as a potential candidate for monitoring or treatment. Dr. Stewart, Lewis’s expert, first examined Lewis in two interviews in 2003. At that time, Dr. Stewart reported that Lewis “demonstrated paranoid delusions, ideas of reference, loose associations, pressured speech, clanging associations, and inappropriate affect . . . .” Dr. Stewart reported that dur- ing his third examination of Lewis in July 2007, Lewis “pre- sent[ed] as much improved from the previous examinations.” Despite the improvement, however, Dr. Stewart stated that Lewis appeared to be “guarding against appearing mentally ill, but [was still] marked by evident indications of psychotic ideation.” As part of his examinations of Lewis, Dr. Stewart adminis- tered the MacArthur Competence Assessment Tool for Crimi- nal Adjudication (“MacCAT”), a standardized test for determining competency of criminal defendants. In the last administration of the MacCAT in 2007, Lewis had “improved measurably,” particularly in two of the three sections, where  LEWIS v. AYERS 5979 his score placed him in the “minimal to no impairment” range for the “Understanding” portion, and the “mild impairment” range for the “Reasoning” portion. In the third category, how- ever, Lewis showed no improvement from 2003 and remained in the “significantly impaired” range for the “Appreciation” portion. Ultimately, Dr. Stewart, while recognizing in his declara- tion the “waxing and waning of Mr. Lewis’s functioning,” concluded in his testimony at the evidentiary hearing that “Lewis does not have the capacity to rationally communicate with counsel.” On January 26, 2010, the magistrate judge issued findings and recommendations which concluded that the motion to stay should be denied because Lewis was “currently compe- tent enough to proceed in his habeas action.” On September 2, 2010, the district judge adopted in full the findings and rec- ommendations and denied Lewis’s motion for a stay of pro- ceedings. Lewis seeks to appeal the competency determination, asserting that we have jurisdiction to review that determina- tion as an immediately appealable collateral order. Alterna- tively, Lewis petitions for a writ of mandamus to stay the habeas proceedings because of his present incompetency. We address each argument in turn. II. The Collateral Order Doctrine and the Competency Determination [1] We have jurisdiction pursuant to 28 U.S.C. § 1291 to consider appeals in habeas cases from interlocutory decisions of the district court that fall under the collateral order doc- trine. Bittaker v. Woodford, 331 F.3d 715, 717-18 (9th Cir. 2003); see Cohen v. Beneficial Indus. Loan Corp., 337 U.S. 541, 546 (1949) (setting forth the collateral order doctrine). “[T]o be appealable an interlocutory order must satisfy three 5980 LEWIS v. AYERS requirements: (1) it must be ‘conclusive’; (2) it must ‘resolve an important question separate from the merits’; and (3) it must be ‘effectively unreviewable on appeal from a final judgment.’ ” Osband v. Woodford, 290 F.3d 1036, 1039 (9th Cir. 2002) (quoting Wharton v. Calderon, 127 F.3d 1201, 1203 (9th Cir. 1997)). All three requirements must be satis- fied to qualify as a collateral order for the purpose of appeal. Cordoza v. Pac. States Steel Corp., 320 F.3d 989, 997 (9th Cir. 2003). The competency determination fails all three requirements. We considered a similar question in the context of a federal criminal prosecution in United States v. No Runner, 590 F.3d 962, 964 (9th Cir. 2009). In that case the defendant, claiming amnesia due to brain injury, was found mentally competent to stand trial by the district court after a competency hearing. The defendant immediately sought to appeal that determina- tion. Id. at 963-64. We held that a pretrial competency deter- mination failed to satisfy both the first and third requirements of the collateral order doctrine. [2] Regarding the first requirement, we held that “[a] pre- trial competency order does not conclusively determine the question of competency.” Id. at 964. We noted that “the ques- tion of competency remains open throughout the trial, and may be raised by the defendant, or by the court, at any time.” Id. (emphasis added); cf. Panetti v. Quarterman, 551 U.S. 930, 934 (2007) (“Prior findings of competency do not fore- close a prisoner from proving he is incompetent to be exe- cuted because of his present mental condition.”). [3] So, too, may Lewis raise his competency at any time in his capital habeas proceedings. See Nash, 581 F.3d at 1058-59 (holding that a capital habeas petitioner may assert incompe- tency for the first time on appeal and granting a limited remand for a competency determination prior to any further adjudication of the appeal). Though the district court deter- mined that Lewis was currently competent to proceed, if cir-  LEWIS v. AYERS 5981 cumstances change such that Lewis subsequently becomes incompetent during the course of his habeas proceedings, those proceedings may not continue.2 See Rohan, 334 F.3d at 819 (“[W]here an incompetent capital habeas petitioner raises claims that could potentially benefit from his ability to com- municate rationally, refusing to stay proceedings pending res- toration of competence denies him his statutory right to assistance of counsel, whether or not counsel can identify with precision the information sought.”).3 Accordingly, a competency determination in habeas proceedings is not a “conclusive” order, and the competency determination here does not satisfy the first requirement of an appealable collat- eral order. [4] As for the third requirement of the collateral order doc- trine, we concluded in No Runner that “[the] right [to compe- tency] can be protected adequately by post-conviction appellate review.” 590 F.3d at 966. We expressly rejected the 2 Consistent with our holding here, in a subsequent order the magistrate judge discussed the unfixed nature of the competency determination, clari- fying that “[i]f petitioner in this case were to later make a colorable show- ing of changed circumstances, e.g., that petitioner had reverted to the condition observed by Dr. Stewart when the doctor first met petitioner, the undersigned would be mandated by Ninth Circuit precedent to once again halt proceedings and consider the changed circumstances in a motion to stay proceedings.” 3 The State contends that Rohan should be reevaluated in light of the Supreme Court’s decision in Cullen v. Pinholster, 131 S. Ct. 1388 (2011). “ ‘[W]e may overrule prior circuit authority without taking the case en banc when an intervening Supreme Court decision undermines an existing precedent of the Ninth Circuit, and both cases are closely on point.’ ” Mil- ler v. Gammie, 335 F.3d 889, 899 (9th Cir. 2003) (en banc) (quoting Gal- braith v. Cnty. of Santa Clara, 307 F.3d 1119, 1123 (9th Cir. 2002)). We decline to reevaulate Rohan because Pinholster is not closely on point and does not undermine the holding in Rohan. Pinholster’s limitation on the evidence that can be reviewed in a federal habeas proceeding, 131 S. Ct. at 1398, does not undermine the rule from Rohan that a capital habeas petitioner is entitled to be able to communicate rationally with counsel where necessary to assist in making his case. 5982 LEWIS v. AYERS defendant’s argument that the right to competency is akin to the rights afforded by the Double Jeopardy Clause: “The Supreme Court . . . has never held that incompetency includes an absolute right not to be tried, or that a competency determi- nation cannot be reviewed effectively on appeal after convic- tion.” Id. The same reasoning applies to capital habeas proceedings. [5] We also conclude that Lewis’s current claim does not satisfy the second collateral order requirement, that it must resolve an important question separate from the merits. One of Lewis’s surviving habeas claims before the district court “alleges that petitioner was at all relevant times incompetent to waive rights, assist trial counsel, and stand trial.” Although this claim asserts incompetency at all times, not just that Lewis is currently incompetent, a determination of Lewis’s present competency is of the “nature as to affect, or to be affected by, [a] decision of the merits” on that claim. Cohen, 337 U.S. at 546. Consequently, we conclude that the sub- stance of the competency determination “substantially over- lap[s] [with the] factual and legal issues of the underlying dispute, making such determinations unsuited for immediate appeal as of right under § 1291.” Van Cauwenberghe v. Biard, 486 U.S. 517, 529 (1988). [6] Because Lewis’s attempt to appeal the district court’s denial of a stay does not satisfy any of the three requirements for an appealable collateral order, we lack jurisdiction to review that order. III. Mandamus Relief [7] “ ‘To issue the writ, the court must be firmly convinced that the district court has erred, and that the petitioner’s right to the writ is clear and indisputable.’ ” United States v. Austin, 416 F.3d 1016, 1024 (9th Cir. 2005) (quoting Special Invs., Inc. v. Aero Air, Inc., 360 F.3d 989, 993 (9th Cir. 2004)). “Whether a writ of mandamus should be granted is deter-  LEWIS v. AYERS 5983 mined case-by-case, weighing the factors outlined in Bauman v. United States Dist. Court, 557 F.2d 650 (9th Cir. 1977).” Cole v. U.S. Dist. Court, 366 F.3d 813, 816-17 (9th Cir. 2004). In Bauman, we established five guidelines to determine whether mandamus is appropriate in a given case: (1) whether the petitioner has no other means, such as a direct appeal, to obtain the desired relief; (2) whether the petitioner will be damaged or prejudiced in any way not correctable on appeal; (3) whether the district court’s order is clearly erroneous as a matter of law; (4) whether the district court’s order is an oft repeated error or manifests a persistent disregard of the fed- eral rules; and (5) whether the district court’s order raises new and important problems or issues of first impression. 557 F.2d at 654-55. Lewis does not contend that the fourth or fifth fac- tors are applicable here, and we agree. We further conclude that the first three factors do not counsel in favor of manda- mus relief. As to the first and second factors, we have already con- cluded, in our discussion of the collateral order requirements, that Lewis is entitled to full review of the competency deter- mination after final judgment on his habeas petition and that any error in the competency determination is correctable at that time. No Runner, 590 F.3d at 965-66. As to the third Bauman factor, we conclude that the district court’s determination that Lewis was competent at that time was not clearly erroneous. Clear error is found when a reviewing court has a “ ‘definite and firm conviction that a mistake has been committed.’ ” See Easley v. Cromartie, 532 U.S. 234, 242 (2001) (quoting United States v. U.S. Gypsum Co., 333 U.S. 364, 395 (1948)). If the district court’s findings are plausible in light of the entire record, we may not reverse, even if we would have weighed the evidence differently. See Husain v. Olympic Airways, 316 F.3d 829, 835 (9th Cir. 2002), aff’d, 540 U.S. 644 (2004); see also Katie A. ex rel. 5984 LEWIS v. AYERS Ludin v. L.A. Cnty., 481 F.3d 1150, 1155 (9th Cir. 2007). “ ‘Where there are two permissible views of the evidence, the factfinder’s choice between them cannot be clearly errone- ous.’ ” United States v. Elliott, 322 F.3d 710, 715 (9th Cir. 2003) (quoting United States v. Working, 224 F.3d 1093, 1102 (9th Cir. 2000)); see also United States v. Al Nasser, 555 F.3d 722, 727 (9th Cir. 2009) (district court’s choice of one of two plausible accounts was not clearly erroneous). Because there were two permissible views of the evidence that was presented to the magistrate judge, the competency determina- tion was not clearly erroneous. Reports from examinations of Lewis supported the finding that he was competent to proceed. The magistrate judge appeared to accept Dr. Stewart’s assessment that Lewis had a serious impairment that rendered him incompetent at the time of the 2003 examination. However, it was not clear error to concurrently give weight to Dr. Ponath’s later examinations of Lewis that evinced a sufficiently improved “ability to understand and communicate rationally with counsel when necessary.” Nash, 581 F.3d at 1057. Dr. Stewart did not dispute the behavior reported by Dr. Ponath in his later examinations of Lewis, but testified that he would still characterize Lewis as incompetent. Dr. Ponath, on the other hand, was skeptical of Dr. Stewart’s diagnosis, opin- ing that Lewis’s condition should not improve as dramatically as it did between 2003 and 2007 if Lewis in fact had the degenerative condition that Dr. Stewart diagnosed him as hav- ing. Faced with this conflicting expert testimony, it was not clearly erroneous for the district court to find that the evi- dence weighed in favor of a competency finding. The magis- trate judge noted that Lewis was directly responsive in his answers about his case to Dr. Ponath, and that this correlated with Lewis’s high score on the “Understanding” portion of the MacCAT in 2007. Such an ability to understand, coupled  LEWIS v. AYERS 5985 with only a “mild impairment” in reasoning capability, could plausibly indicate an ability to rationally communicate with counsel.4 Further, Lewis’s responsive and otherwise normal trial testimony illustrated the waxing and waning nature of Lewis’s mental condition. [8] The district court was thus presented with contrasting opinions that reasonably supported both sides of the compe- tency issue, and it was plausible to conclude that the State’s evidence was more persuasive. We do not have a definite and firm conviction that a mistake was made in the competency determination. Consequently, this final factor also counsels against granting mandamus relief. IV. Conclusion The appeal is dismissed for lack of jurisdiction to collater- ally review the competency determination. The petition for writ of mandamus is denied. APPEAL DISMISSED FOR LACK OF JURISDIC- TION; PETITION FOR WRIT OF MANDAMUS DENIED. 4 Lewis contends that his consistent poor performance on the “Apprecia- tion” portion of the MacCAT precludes a finding of competence. The magistrate judge considered the declarations and testimony on the admin- istration of this test, and it was not clearly erroneous to place more weight in the areas of Lewis’s improved test scores (and the interview with Dr. Ponath consistent with those improvements) over Lewis’s repeatedly lower scores on the “Appreciation” portion. 

/* NUGET: BEGIN LICENSE TEXT * * Microsoft grants you the right to use these script files for the sole * purpose of either: (i) interacting through your browser with the Microsoft * website or online service, subject to the applicable licensing or use * terms; or (ii) using the files as included with a Microsoft product subject * to that product's license terms. Microsoft reserves all other rights to the * files not expressly granted by Microsoft, whether by implication, estoppel * or otherwise. Insofar as a script file is dual licensed under GPL, * Microsoft neither took the code under GPL nor distributes it thereunder but * under the terms set out in this paragraph. All notices and licenses * below are for informational purposes only. * * Copyright (c) Faruk Ates, Paul Irish, Alex Sexton; http://www.modernizr.com/license/ * * Includes matchMedia polyfill; Copyright (c) 2010 Filament Group, Inc; http://opensource.org/licenses/MIT * * Includes material adapted from ES5-shim https://github.com/kriskowal/es5-shim/blob/master/es5-shim.js; Copyright 2009-2012 by contributors; http://opensource.org/licenses/MIT * * Includes material from css-support; Copyright (c) 2005-2012 Diego Perini; https://github.com/dperini/css-support/blob/master/LICENSE * * NUGET: END LICENSE TEXT */ /*! * Modernizr v2.6.2 * www.modernizr.com * * Copyright (c) Faruk Ates, Paul Irish, Alex Sexton * Available under the BSD and MIT licenses: www.modernizr.com/license/ */ /* * Modernizr tests which native CSS3 and HTML5 features are available in * the current UA and makes the results available to you in two ways: * as properties on a global Modernizr object, and as classes on the * <html> element. This information allows you to progressively enhance * your pages with a granular level of control over the experience. * * Modernizr has an optional (not included) conditional resource loader * called Modernizr.load(), based on Yepnope.js (yepnopejs.com). * To get a build that includes Modernizr.load(), as well as choosing * which tests to include, go to www.modernizr.com/download/ * * Authors Faruk Ates, Paul Irish, Alex Sexton * Contributors Ryan Seddon, Ben Alman */ window.Modernizr = (function( window, document, undefined ) { var version = '2.6.2', Modernizr = {}, /*>>cssclasses*/ // option for enabling the HTML classes to be added enableClasses = true, /*>>cssclasses*/ docElement = document.documentElement, /** * Create our "modernizr" element that we do most feature tests on. */ mod = 'modernizr', modElem = document.createElement(mod), mStyle = modElem.style, /** * Create the input element for various Web Forms feature tests. */ inputElem /*>>inputelem*/ = document.createElement('input') /*>>inputelem*/ , /*>>smile*/ smile = ':)', /*>>smile*/ toString = {}.toString, // TODO :: make the prefixes more granular /*>>prefixes*/ // List of property values to set for css tests. See ticket #21 prefixes = ' -webkit- -moz- -o- -ms- '.split(' '), /*>>prefixes*/ /*>>domprefixes*/ // Following spec is to expose vendor-specific style properties as: // elem.style.WebkitBorderRadius // and the following would be incorrect: // elem.style.webkitBorderRadius // Webkit ghosts their properties in lowercase but Opera & Moz do not. // Microsoft uses a lowercase `ms` instead of the correct `Ms` in IE8+ // erik.eae.net/archives/2008/03/10/21.48.10/ // More here: github.com/Modernizr/Modernizr/issues/issue/21 omPrefixes = 'Webkit Moz O ms', cssomPrefixes = omPrefixes.split(' '), domPrefixes = omPrefixes.toLowerCase().split(' '), /*>>domprefixes*/ /*>>ns*/ ns = {'svg': 'http://www.w3.org/2000/svg'}, /*>>ns*/ tests = {}, inputs = {}, attrs = {}, classes = [], slice = classes.slice, featureName, // used in testing loop /*>>teststyles*/ // Inject element with style element and some CSS rules injectElementWithStyles = function( rule, callback, nodes, testnames ) { var style, ret, node, docOverflow, div = document.createElement('div'), // After page load injecting a fake body doesn't work so check if body exists body = document.body, // IE6 and 7 won't return offsetWidth or offsetHeight unless it's in the body element, so we fake it. fakeBody = body || document.createElement('body'); if ( parseInt(nodes, 10) ) { // In order not to give false positives we create a node for each test // This also allows the method to scale for unspecified uses while ( nodes-- ) { node = document.createElement('div'); node.id = testnames ? testnames[nodes] : mod + (nodes + 1); div.appendChild(node); } } // <style> elements in IE6-9 are considered 'NoScope' elements and therefore will be removed // when injected with innerHTML. To get around this you need to prepend the 'NoScope' element // with a 'scoped' element, in our case the soft-hyphen entity as it won't mess with our measurements. // msdn.microsoft.com/en-us/library/ms533897%28VS.85%29.aspx // Documents served as xml will throw if using &shy; so use xml friendly encoded version. See issue #277 style = ['&#173;','<style id="s', mod, '">', rule, '</style>'].join(''); div.id = mod; // IE6 will false positive on some tests due to the style element inside the test div somehow interfering offsetHeight, so insert it into body or fakebody. // Opera will act all quirky when injecting elements in documentElement when page is served as xml, needs fakebody too. #270 (body ? div : fakeBody).innerHTML += style; fakeBody.appendChild(div); if ( !body ) { //avoid crashing IE8, if background image is used fakeBody.style.background = ''; //Safari 5.13/5.1.4 OSX stops loading if ::-webkit-scrollbar is used and scrollbars are visible fakeBody.style.overflow = 'hidden'; docOverflow = docElement.style.overflow; docElement.style.overflow = 'hidden'; docElement.appendChild(fakeBody); } ret = callback(div, rule); // If this is done after page load we don't want to remove the body so check if body exists if ( !body ) { fakeBody.parentNode.removeChild(fakeBody); docElement.style.overflow = docOverflow; } else { div.parentNode.removeChild(div); } return !!ret; }, /*>>teststyles*/ /*>>mq*/ // adapted from matchMedia polyfill // by Scott Jehl and Paul Irish // gist.github.com/786768 testMediaQuery = function( mq ) { var matchMedia = window.matchMedia || window.msMatchMedia; if ( matchMedia ) { return matchMedia(mq).matches; } var bool; injectElementWithStyles('@media ' + mq + ' { #' + mod + ' { position: absolute; } }', function( node ) { bool = (window.getComputedStyle ? getComputedStyle(node, null) : node.currentStyle)['position'] == 'absolute'; }); return bool; }, /*>>mq*/ /*>>hasevent*/ // // isEventSupported determines if a given element supports the given event // kangax.github.com/iseventsupported/ // // The following results are known incorrects: // Modernizr.hasEvent("webkitTransitionEnd", elem) // false negative // Modernizr.hasEvent("textInput") // in Webkit. github.com/Modernizr/Modernizr/issues/333 // ... isEventSupported = (function() { var TAGNAMES = { 'select': 'input', 'change': 'input', 'submit': 'form', 'reset': 'form', 'error': 'img', 'load': 'img', 'abort': 'img' }; function isEventSupported( eventName, element ) { element = element || document.createElement(TAGNAMES[eventName] || 'div'); eventName = 'on' + eventName; // When using `setAttribute`, IE skips "unload", WebKit skips "unload" and "resize", whereas `in` "catches" those var isSupported = eventName in element; if ( !isSupported ) { // If it has no `setAttribute` (i.e. doesn't implement Node interface), try generic element if ( !element.setAttribute ) { element = document.createElement('div'); } if ( element.setAttribute && element.removeAttribute ) { element.setAttribute(eventName, ''); isSupported = is(element[eventName], 'function'); // If property was created, "remove it" (by setting value to `undefined`) if ( !is(element[eventName], 'undefined') ) { element[eventName] = undefined; } element.removeAttribute(eventName); } } element = null; return isSupported; } return isEventSupported; })(), /*>>hasevent*/ // TODO :: Add flag for hasownprop ? didn't last time // hasOwnProperty shim by kangax needed for Safari 2.0 support _hasOwnProperty = ({}).hasOwnProperty, hasOwnProp; if ( !is(_hasOwnProperty, 'undefined') && !is(_hasOwnProperty.call, 'undefined') ) { hasOwnProp = function (object, property) { return _hasOwnProperty.call(object, property); }; } else { hasOwnProp = function (object, property) { /* yes, this can give false positives/negatives, but most of the time we don't care about those */ return ((property in object) && is(object.constructor.prototype[property], 'undefined')); }; } // Adapted from ES5-shim https://github.com/kriskowal/es5-shim/blob/master/es5-shim.js // es5.github.com/#x15.3.4.5 if (!Function.prototype.bind) { Function.prototype.bind = function bind(that) { var target = this; if (typeof target != "function") { throw new TypeError(); } var args = slice.call(arguments, 1), bound = function () { if (this instanceof bound) { var F = function(){}; F.prototype = target.prototype; var self = new F(); var result = target.apply( self, args.concat(slice.call(arguments)) ); if (Object(result) === result) { return result; } return self; } else { return target.apply( that, args.concat(slice.call(arguments)) ); } }; return bound; }; } /** * setCss applies given styles to the Modernizr DOM node. */ function setCss( str ) { mStyle.cssText = str; } /** * setCssAll extrapolates all vendor-specific css strings. */ function setCssAll( str1, str2 ) { return setCss(prefixes.join(str1 + ';') + ( str2 || '' )); } /** * is returns a boolean for if typeof obj is exactly type. */ function is( obj, type ) { return typeof obj === type; } /** * contains returns a boolean for if substr is found within str. */ function contains( str, substr ) { return !!~('' + str).indexOf(substr); } /*>>testprop*/ // testProps is a generic CSS / DOM property test. // In testing support for a given CSS property, it's legit to test: // `elem.style[styleName] !== undefined` // If the property is supported it will return an empty string, // if unsupported it will return undefined. // We'll take advantage of this quick test and skip setting a style // on our modernizr element, but instead just testing undefined vs // empty string. // Because the testing of the CSS property names (with "-", as // opposed to the camelCase DOM properties) is non-portable and // non-standard but works in WebKit and IE (but not Gecko or Opera), // we explicitly reject properties with dashes so that authors // developing in WebKit or IE first don't end up with // browser-specific content by accident. function testProps( props, prefixed ) { for ( var i in props ) { var prop = props[i]; if ( !contains(prop, "-") && mStyle[prop] !== undefined ) { return prefixed == 'pfx' ? prop : true; } } return false; } /*>>testprop*/ // TODO :: add testDOMProps /** * testDOMProps is a generic DOM property test; if a browser supports * a certain property, it won't return undefined for it. */ function testDOMProps( props, obj, elem ) { for ( var i in props ) { var item = obj[props[i]]; if ( item !== undefined) { // return the property name as a string if (elem === false) return props[i]; // let's bind a function if (is(item, 'function')){ // default to autobind unless override return item.bind(elem || obj); } // return the unbound function or obj or value return item; } } return false; } /*>>testallprops*/ /** * testPropsAll tests a list of DOM properties we want to check against. * We specify literally ALL possible (known and/or likely) properties on * the element including the non-vendor prefixed one, for forward- * compatibility. */ function testPropsAll( prop, prefixed, elem ) { var ucProp = prop.charAt(0).toUpperCase() + prop.slice(1), props = (prop + ' ' + cssomPrefixes.join(ucProp + ' ') + ucProp).split(' '); // did they call .prefixed('boxSizing') or are we just testing a prop? if(is(prefixed, "string") || is(prefixed, "undefined")) { return testProps(props, prefixed); // otherwise, they called .prefixed('requestAnimationFrame', window[, elem]) } else { props = (prop + ' ' + (domPrefixes).join(ucProp + ' ') + ucProp).split(' '); return testDOMProps(props, prefixed, elem); } } /*>>testallprops*/ /** * Tests * ----- */ // The *new* flexbox // dev.w3.org/csswg/css3-flexbox tests['flexbox'] = function() { return testPropsAll('flexWrap'); }; // The *old* flexbox // www.w3.org/TR/2009/WD-css3-flexbox-20090723/ tests['flexboxlegacy'] = function() { return testPropsAll('boxDirection'); }; // On the S60 and BB Storm, getContext exists, but always returns undefined // so we actually have to call getContext() to verify // github.com/Modernizr/Modernizr/issues/issue/97/ tests['canvas'] = function() { var elem = document.createElement('canvas'); return !!(elem.getContext && elem.getContext('2d')); }; tests['canvastext'] = function() { return !!(Modernizr['canvas'] && is(document.createElement('canvas').getContext('2d').fillText, 'function')); }; // webk.it/70117 is tracking a legit WebGL feature detect proposal // We do a soft detect which may false positive in order to avoid // an expensive context creation: bugzil.la/732441 tests['webgl'] = function() { return !!window.WebGLRenderingContext; }; /* * The Modernizr.touch test only indicates if the browser supports * touch events, which does not necessarily reflect a touchscreen * device, as evidenced by tablets running Windows 7 or, alas, * the Palm Pre / WebOS (touch) phones. * * Additionally, Chrome (desktop) used to lie about its support on this, * but that has since been rectified: crbug.com/36415 * * We also test for Firefox 4 Multitouch Support. * * For more info, see: modernizr.github.com/Modernizr/touch.html */ tests['touch'] = function() { var bool; if(('ontouchstart' in window) || window.DocumentTouch && document instanceof DocumentTouch) { bool = true; } else { injectElementWithStyles(['@media (',prefixes.join('touch-enabled),('),mod,')','{#modernizr{top:9px;position:absolute}}'].join(''), function( node ) { bool = node.offsetTop === 9; }); } return bool; }; // geolocation is often considered a trivial feature detect... // Turns out, it's quite tricky to get right: // // Using !!navigator.geolocation does two things we don't want. It: // 1. Leaks memory in IE9: github.com/Modernizr/Modernizr/issues/513 // 2. Disables page caching in WebKit: webk.it/43956 // // Meanwhile, in Firefox < 8, an about:config setting could expose // a false positive that would throw an exception: bugzil.la/688158 tests['geolocation'] = function() { return 'geolocation' in navigator; }; tests['postmessage'] = function() { return !!window.postMessage; }; // Chrome incognito mode used to throw an exception when using openDatabase // It doesn't anymore. tests['websqldatabase'] = function() { return !!window.openDatabase; }; // Vendors had inconsistent prefixing with the experimental Indexed DB: // - Webkit's implementation is accessible through webkitIndexedDB // - Firefox shipped moz_indexedDB before FF4b9, but since then has been mozIndexedDB // For speed, we don't test the legacy (and beta-only) indexedDB tests['indexedDB'] = function() { return !!testPropsAll("indexedDB", window); }; // documentMode logic from YUI to filter out IE8 Compat Mode // which false positives. tests['hashchange'] = function() { return isEventSupported('hashchange', window) && (document.documentMode === undefined || document.documentMode > 7); }; // Per 1.6: // This used to be Modernizr.historymanagement but the longer // name has been deprecated in favor of a shorter and property-matching one. // The old API is still available in 1.6, but as of 2.0 will throw a warning, // and in the first release thereafter disappear entirely. tests['history'] = function() { return !!(window.history && history.pushState); }; tests['draganddrop'] = function() { var div = document.createElement('div'); return ('draggable' in div) || ('ondragstart' in div && 'ondrop' in div); }; // FF3.6 was EOL'ed on 4/24/12, but the ESR version of FF10 // will be supported until FF19 (2/12/13), at which time, ESR becomes FF17. // FF10 still uses prefixes, so check for it until then. // for more ESR info, see: mozilla.org/en-US/firefox/organizations/faq/ tests['websockets'] = function() { return 'WebSocket' in window || 'MozWebSocket' in window; }; // css-tricks.com/rgba-browser-support/ tests['rgba'] = function() { // Set an rgba() color and check the returned value setCss('background-color:rgba(150,255,150,.5)'); return contains(mStyle.backgroundColor, 'rgba'); }; tests['hsla'] = function() { // Same as rgba(), in fact, browsers re-map hsla() to rgba() internally, // except IE9 who retains it as hsla setCss('background-color:hsla(120,40%,100%,.5)'); return contains(mStyle.backgroundColor, 'rgba') || contains(mStyle.backgroundColor, 'hsla'); }; tests['multiplebgs'] = function() { // Setting multiple images AND a color on the background shorthand property // and then querying the style.background property value for the number of // occurrences of "url(" is a reliable method for detecting ACTUAL support for this! setCss('background:url(https://),url(https://),red url(https://)'); // If the UA supports multiple backgrounds, there should be three occurrences // of the string "url(" in the return value for elemStyle.background return (/(url\s*\(.*?){3}/).test(mStyle.background); }; // this will false positive in Opera Mini // github.com/Modernizr/Modernizr/issues/396 tests['backgroundsize'] = function() { return testPropsAll('backgroundSize'); }; tests['borderimage'] = function() { return testPropsAll('borderImage'); }; // Super comprehensive table about all the unique implementations of // border-radius: muddledramblings.com/table-of-css3-border-radius-compliance tests['borderradius'] = function() { return testPropsAll('borderRadius'); }; // WebOS unfortunately false positives on this test. tests['boxshadow'] = function() { return testPropsAll('boxShadow'); }; // FF3.0 will false positive on this test tests['textshadow'] = function() { return document.createElement('div').style.textShadow === ''; }; tests['opacity'] = function() { // Browsers that actually have CSS Opacity implemented have done so // according to spec, which means their return values are within the // range of [0.0,1.0] - including the leading zero. setCssAll('opacity:.55'); // The non-literal . in this regex is intentional: // German Chrome returns this value as 0,55 // github.com/Modernizr/Modernizr/issues/#issue/59/comment/516632 return (/^0.55$/).test(mStyle.opacity); }; // Note, Android < 4 will pass this test, but can only animate // a single property at a time // daneden.me/2011/12/putting-up-with-androids-bullshit/ tests['cssanimations'] = function() { return testPropsAll('animationName'); }; tests['csscolumns'] = function() { return testPropsAll('columnCount'); }; tests['cssgradients'] = function() { /** * For CSS Gradients syntax, please see: * webkit.org/blog/175/introducing-css-gradients/ * developer.mozilla.org/en/CSS/-moz-linear-gradient * developer.mozilla.org/en/CSS/-moz-radial-gradient * dev.w3.org/csswg/css3-images/#gradients- */ var str1 = 'background-image:', str2 = 'gradient(linear,left top,right bottom,from(#9f9),to(white));', str3 = 'linear-gradient(left top,#9f9, white);'; setCss( // legacy webkit syntax (FIXME: remove when syntax not in use anymore) (str1 + '-webkit- '.split(' ').join(str2 + str1) + // standard syntax // trailing 'background-image:' prefixes.join(str3 + str1)).slice(0, -str1.length) ); return contains(mStyle.backgroundImage, 'gradient'); }; tests['cssreflections'] = function() { return testPropsAll('boxReflect'); }; tests['csstransforms'] = function() { return !!testPropsAll('transform'); }; tests['csstransforms3d'] = function() { var ret = !!testPropsAll('perspective'); // Webkit's 3D transforms are passed off to the browser's own graphics renderer. // It works fine in Safari on Leopard and Snow Leopard, but not in Chrome in // some conditions. As a result, Webkit typically recognizes the syntax but // will sometimes throw a false positive, thus we must do a more thorough check: if ( ret && 'webkitPerspective' in docElement.style ) { // Webkit allows this media query to succeed only if the feature is enabled. // `@media (transform-3d),(-webkit-transform-3d){ ... }` injectElementWithStyles('@media (transform-3d),(-webkit-transform-3d){#modernizr{left:9px;position:absolute;height:3px;}}', function( node, rule ) { ret = node.offsetLeft === 9 && node.offsetHeight === 3; }); } return ret; }; tests['csstransitions'] = function() { return testPropsAll('transition'); }; /*>>fontface*/ // @font-face detection routine by Diego Perini // javascript.nwbox.com/CSSSupport/ // false positives: // WebOS github.com/Modernizr/Modernizr/issues/342 // WP7 github.com/Modernizr/Modernizr/issues/538 tests['fontface'] = function() { var bool; injectElementWithStyles('@font-face {font-family:"font";src:url("https://")}', function( node, rule ) { var style = document.getElementById('smodernizr'), sheet = style.sheet || style.styleSheet, cssText = sheet ? (sheet.cssRules && sheet.cssRules[0] ? sheet.cssRules[0].cssText : sheet.cssText || '') : ''; bool = /src/i.test(cssText) && cssText.indexOf(rule.split(' ')[0]) === 0; }); return bool; }; /*>>fontface*/ // CSS generated content detection tests['generatedcontent'] = function() { var bool; injectElementWithStyles(['#',mod,'{font:0/0 a}#',mod,':after{content:"',smile,'";visibility:hidden;font:3px/1 a}'].join(''), function( node ) { bool = node.offsetHeight >= 3; }); return bool; }; // These tests evaluate support of the video/audio elements, as well as // testing what types of content they support. // // We're using the Boolean constructor here, so that we can extend the value // e.g. Modernizr.video // true // Modernizr.video.ogg // 'probably' // // Codec values from : github.com/NielsLeenheer/html5test/blob/9106a8/index.html#L845 // thx to NielsLeenheer and zcorpan // Note: in some older browsers, "no" was a return value instead of empty string. // It was live in FF3.5.0 and 3.5.1, but fixed in 3.5.2 // It was also live in Safari 4.0.0 - 4.0.4, but fixed in 4.0.5 tests['video'] = function() { var elem = document.createElement('video'), bool = false; // IE9 Running on Windows Server SKU can cause an exception to be thrown, bug #224 try { if ( bool = !!elem.canPlayType ) { bool = new Boolean(bool); bool.ogg = elem.canPlayType('video/ogg; codecs="theora"') .replace(/^no$/,''); // Without QuickTime, this value will be `undefined`. github.com/Modernizr/Modernizr/issues/546 bool.h264 = elem.canPlayType('video/mp4; codecs="avc1.42E01E"') .replace(/^no$/,''); bool.webm = elem.canPlayType('video/webm; codecs="vp8, vorbis"').replace(/^no$/,''); } } catch(e) { } return bool; }; tests['audio'] = function() { var elem = document.createElement('audio'), bool = false; try { if ( bool = !!elem.canPlayType ) { bool = new Boolean(bool); bool.ogg = elem.canPlayType('audio/ogg; codecs="vorbis"').replace(/^no$/,''); bool.mp3 = elem.canPlayType('audio/mpeg;') .replace(/^no$/,''); // Mimetypes accepted: // developer.mozilla.org/En/Media_formats_supported_by_the_audio_and_video_elements // bit.ly/iphoneoscodecs bool.wav = elem.canPlayType('audio/wav; codecs="1"') .replace(/^no$/,''); bool.m4a = ( elem.canPlayType('audio/x-m4a;') || elem.canPlayType('audio/aac;')) .replace(/^no$/,''); } } catch(e) { } return bool; }; // In FF4, if disabled, window.localStorage should === null. // Normally, we could not test that directly and need to do a // `('localStorage' in window) && ` test first because otherwise Firefox will // throw bugzil.la/365772 if cookies are disabled // Also in iOS5 Private Browsing mode, attempting to use localStorage.setItem // will throw the exception: // QUOTA_EXCEEDED_ERRROR DOM Exception 22. // Peculiarly, getItem and removeItem calls do not throw. // Because we are forced to try/catch this, we'll go aggressive. // Just FWIW: IE8 Compat mode supports these features completely: // www.quirksmode.org/dom/html5.html // But IE8 doesn't support either with local files tests['localstorage'] = function() { try { localStorage.setItem(mod, mod); localStorage.removeItem(mod); return true; } catch(e) { return false; } }; tests['sessionstorage'] = function() { try { sessionStorage.setItem(mod, mod); sessionStorage.removeItem(mod); return true; } catch(e) { return false; } }; tests['webworkers'] = function() { return !!window.Worker; }; tests['applicationcache'] = function() { return !!window.applicationCache; }; // Thanks to Erik Dahlstrom tests['svg'] = function() { return !!document.createElementNS && !!document.createElementNS(ns.svg, 'svg').createSVGRect; }; // specifically for SVG inline in HTML, not within XHTML // test page: paulirish.com/demo/inline-svg tests['inlinesvg'] = function() { var div = document.createElement('div'); div.innerHTML = '<svg/>'; return (div.firstChild && div.firstChild.namespaceURI) == ns.svg; }; // SVG SMIL animation tests['smil'] = function() { return !!document.createElementNS && /SVGAnimate/.test(toString.call(document.createElementNS(ns.svg, 'animate'))); }; // This test is only for clip paths in SVG proper, not clip paths on HTML content // demo: srufaculty.sru.edu/david.dailey/svg/newstuff/clipPath4.svg // However read the comments to dig into applying SVG clippaths to HTML content here: // github.com/Modernizr/Modernizr/issues/213#issuecomment-1149491 tests['svgclippaths'] = function() { return !!document.createElementNS && /SVGClipPath/.test(toString.call(document.createElementNS(ns.svg, 'clipPath'))); }; /*>>webforms*/ // input features and input types go directly onto the ret object, bypassing the tests loop. // Hold this guy to execute in a moment. function webforms() { /*>>input*/ // Run through HTML5's new input attributes to see if the UA understands any. // We're using f which is the <input> element created early on // Mike Taylr has created a comprehensive resource for testing these attributes // when applied to all input types: // miketaylr.com/code/input-type-attr.html // spec: www.whatwg.org/specs/web-apps/current-work/multipage/the-input-element.html#input-type-attr-summary // Only input placeholder is tested while textarea's placeholder is not. // Currently Safari 4 and Opera 11 have support only for the input placeholder // Both tests are available in feature-detects/forms-placeholder.js Modernizr['input'] = (function( props ) { for ( var i = 0, len = props.length; i < len; i++ ) { attrs[ props[i] ] = !!(props[i] in inputElem); } if (attrs.list){ // safari false positive's on datalist: webk.it/74252 // see also github.com/Modernizr/Modernizr/issues/146 attrs.list = !!(document.createElement('datalist') && window.HTMLDataListElement); } return attrs; })('autocomplete autofocus list placeholder max min multiple pattern required step'.split(' ')); /*>>input*/ /*>>inputtypes*/ // Run through HTML5's new input types to see if the UA understands any. // This is put behind the tests runloop because it doesn't return a // true/false like all the other tests; instead, it returns an object // containing each input type with its corresponding true/false value // Big thanks to @miketaylr for the html5 forms expertise. miketaylr.com/ Modernizr['inputtypes'] = (function(props) { for ( var i = 0, bool, inputElemType, defaultView, len = props.length; i < len; i++ ) { inputElem.setAttribute('type', inputElemType = props[i]); bool = inputElem.type !== 'text'; // We first check to see if the type we give it sticks.. // If the type does, we feed it a textual value, which shouldn't be valid. // If the value doesn't stick, we know there's input sanitization which infers a custom UI if ( bool ) { inputElem.value = smile; inputElem.style.cssText = 'position:absolute;visibility:hidden;'; if ( /^range$/.test(inputElemType) && inputElem.style.WebkitAppearance !== undefined ) { docElement.appendChild(inputElem); defaultView = document.defaultView; // Safari 2-4 allows the smiley as a value, despite making a slider bool = defaultView.getComputedStyle && defaultView.getComputedStyle(inputElem, null).WebkitAppearance !== 'textfield' && // Mobile android web browser has false positive, so must // check the height to see if the widget is actually there. (inputElem.offsetHeight !== 0); docElement.removeChild(inputElem); } else if ( /^(search|tel)$/.test(inputElemType) ){ // Spec doesn't define any special parsing or detectable UI // behaviors so we pass these through as true // Interestingly, opera fails the earlier test, so it doesn't // even make it here. } else if ( /^(url|email)$/.test(inputElemType) ) { // Real url and email support comes with prebaked validation. bool = inputElem.checkValidity && inputElem.checkValidity() === false; } else { // If the upgraded input compontent rejects the :) text, we got a winner bool = inputElem.value != smile; } } inputs[ props[i] ] = !!bool; } return inputs; })('search tel url email datetime date month week time datetime-local number range color'.split(' ')); /*>>inputtypes*/ } /*>>webforms*/ // End of test definitions // ----------------------- // Run through all tests and detect their support in the current UA. // todo: hypothetically we could be doing an array of tests and use a basic loop here. for ( var feature in tests ) { if ( hasOwnProp(tests, feature) ) { // run the test, throw the return value into the Modernizr, // then based on that boolean, define an appropriate className // and push it into an array of classes we'll join later. featureName = feature.toLowerCase(); Modernizr[featureName] = tests[feature](); classes.push((Modernizr[featureName] ? '' : 'no-') + featureName); } } /*>>webforms*/ // input tests need to run. Modernizr.input || webforms(); /*>>webforms*/ /** * addTest allows the user to define their own feature tests * the result will be added onto the Modernizr object, * as well as an appropriate className set on the html element * * @param feature - String naming the feature * @param test - Function returning true if feature is supported, false if not */ Modernizr.addTest = function ( feature, test ) { if ( typeof feature == 'object' ) { for ( var key in feature ) { if ( hasOwnProp( feature, key ) ) { Modernizr.addTest( key, feature[ key ] ); } } } else { feature = feature.toLowerCase(); if ( Modernizr[feature] !== undefined ) { // we're going to quit if you're trying to overwrite an existing test // if we were to allow it, we'd do this: // var re = new RegExp("\\b(no-)?" + feature + "\\b"); // docElement.className = docElement.className.replace( re, '' ); // but, no rly, stuff 'em. return Modernizr; } test = typeof test == 'function' ? test() : test; if (typeof enableClasses !== "undefined" && enableClasses) { docElement.className += ' ' + (test ? '' : 'no-') + feature; } Modernizr[feature] = test; } return Modernizr; // allow chaining. }; // Reset modElem.cssText to nothing to reduce memory footprint. setCss(''); modElem = inputElem = null; /*>>shiv*/ /*! HTML5 Shiv v3.6.1 | @afarkas @jdalton @jon_neal @rem | MIT/GPL2 Licensed */ ;(function(window, document) { /*jshint evil:true */ /** Preset options */ var options = window.html5 || {}; /** Used to skip problem elements */ var reSkip = /^<|^(?:button|map|select|textarea|object|iframe|option|optgroup)$/i; /** Not all elements can be cloned in IE **/ var saveClones = /^(?:a|b|code|div|fieldset|h1|h2|h3|h4|h5|h6|i|label|li|ol|p|q|span|strong|style|table|tbody|td|th|tr|ul)$/i; /** Detect whether the browser supports default html5 styles */ var supportsHtml5Styles; /** Name of the expando, to work with multiple documents or to re-shiv one document */ var expando = '_html5shiv'; /** The id for the the documents expando */ var expanID = 0; /** Cached data for each document */ var expandoData = {}; /** Detect whether the browser supports unknown elements */ var supportsUnknownElements; (function() { try { var a = document.createElement('a'); a.innerHTML = '<xyz></xyz>'; //if the hidden property is implemented we can assume, that the browser supports basic HTML5 Styles supportsHtml5Styles = ('hidden' in a); supportsUnknownElements = a.childNodes.length == 1 || (function() { // assign a false positive if unable to shiv (document.createElement)('a'); var frag = document.createDocumentFragment(); return ( typeof frag.cloneNode == 'undefined' || typeof frag.createDocumentFragment == 'undefined' || typeof frag.createElement == 'undefined' ); }()); } catch(e) { supportsHtml5Styles = true; supportsUnknownElements = true; } }()); /*--------------------------------------------------------------------------*/ /** * Creates a style sheet with the given CSS text and adds it to the document. * @private * @param {Document} ownerDocument The document. * @param {String} cssText The CSS text. * @returns {StyleSheet} The style element. */ function addStyleSheet(ownerDocument, cssText) { var p = ownerDocument.createElement('p'), parent = ownerDocument.getElementsByTagName('head')[0] || ownerDocument.documentElement; p.innerHTML = 'x<style>' + cssText + '</style>'; return parent.insertBefore(p.lastChild, parent.firstChild); } /** * Returns the value of `html5.elements` as an array. * @private * @returns {Array} An array of shived element node names. */ function getElements() { var elements = html5.elements; return typeof elements == 'string' ? elements.split(' ') : elements; } /** * Returns the data associated to the given document * @private * @param {Document} ownerDocument The document. * @returns {Object} An object of data. */ function getExpandoData(ownerDocument) { var data = expandoData[ownerDocument[expando]]; if (!data) { data = {}; expanID++; ownerDocument[expando] = expanID; expandoData[expanID] = data; } return data; } /** * returns a shived element for the given nodeName and document * @memberOf html5 * @param {String} nodeName name of the element * @param {Document} ownerDocument The context document. * @returns {Object} The shived element. */ function createElement(nodeName, ownerDocument, data){ if (!ownerDocument) { ownerDocument = document; } if(supportsUnknownElements){ return ownerDocument.createElement(nodeName); } if (!data) { data = getExpandoData(ownerDocument); } var node; if (data.cache[nodeName]) { node = data.cache[nodeName].cloneNode(); } else if (saveClones.test(nodeName)) { node = (data.cache[nodeName] = data.createElem(nodeName)).cloneNode(); } else { node = data.createElem(nodeName); } // Avoid adding some elements to fragments in IE < 9 because // * Attributes like `name` or `type` cannot be set/changed once an element // is inserted into a document/fragment // * Link elements with `src` attributes that are inaccessible, as with // a 403 response, will cause the tab/window to crash // * Script elements appended to fragments will execute when their `src` // or `text` property is set return node.canHaveChildren && !reSkip.test(nodeName) ? data.frag.appendChild(node) : node; } /** * returns a shived DocumentFragment for the given document * @memberOf html5 * @param {Document} ownerDocument The context document. * @returns {Object} The shived DocumentFragment. */ function createDocumentFragment(ownerDocument, data){ if (!ownerDocument) { ownerDocument = document; } if(supportsUnknownElements){ return ownerDocument.createDocumentFragment(); } data = data || getExpandoData(ownerDocument); var clone = data.frag.cloneNode(), i = 0, elems = getElements(), l = elems.length; for(;i<l;i++){ clone.createElement(elems[i]); } return clone; } /** * Shivs the `createElement` and `createDocumentFragment` methods of the document. * @private * @param {Document|DocumentFragment} ownerDocument The document. * @param {Object} data of the document. */ function shivMethods(ownerDocument, data) { if (!data.cache) { data.cache = {}; data.createElem = ownerDocument.createElement; data.createFrag = ownerDocument.createDocumentFragment; data.frag = data.createFrag(); } ownerDocument.createElement = function(nodeName) { //abort shiv if (!html5.shivMethods) { return data.createElem(nodeName); } return createElement(nodeName, ownerDocument, data); }; ownerDocument.createDocumentFragment = Function('h,f', 'return function(){' + 'var n=f.cloneNode(),c=n.createElement;' + 'h.shivMethods&&(' + // unroll the `createElement` calls getElements().join().replace(/\w+/g, function(nodeName) { data.createElem(nodeName); data.frag.createElement(nodeName); return 'c("' + nodeName + '")'; }) + ');return n}' )(html5, data.frag); } /*--------------------------------------------------------------------------*/ /** * Shivs the given document. * @memberOf html5 * @param {Document} ownerDocument The document to shiv. * @returns {Document} The shived document. */ function shivDocument(ownerDocument) { if (!ownerDocument) { ownerDocument = document; } var data = getExpandoData(ownerDocument); if (html5.shivCSS && !supportsHtml5Styles && !data.hasCSS) { data.hasCSS = !!addStyleSheet(ownerDocument, // corrects block display not defined in IE6/7/8/9 'article,aside,figcaption,figure,footer,header,hgroup,nav,section{display:block}' + // adds styling not present in IE6/7/8/9 'mark{background:#FF0;color:#000}' ); } if (!supportsUnknownElements) { shivMethods(ownerDocument, data); } return ownerDocument; } /*--------------------------------------------------------------------------*/ /** * The `html5` object is exposed so that more elements can be shived and * existing shiving can be detected on iframes. * @type Object * @example * * // options can be changed before the script is included * html5 = { 'elements': 'mark section', 'shivCSS': false, 'shivMethods': false }; */ var html5 = { /** * An array or space separated string of node names of the elements to shiv. * @memberOf html5 * @type Array|String */ 'elements': options.elements || 'abbr article aside audio bdi canvas data datalist details figcaption figure footer header hgroup mark meter nav output progress section summary time video', /** * A flag to indicate that the HTML5 style sheet should be inserted. * @memberOf html5 * @type Boolean */ 'shivCSS': (options.shivCSS !== false), /** * Is equal to true if a browser supports creating unknown/HTML5 elements * @memberOf html5 * @type boolean */ 'supportsUnknownElements': supportsUnknownElements, /** * A flag to indicate that the document's `createElement` and `createDocumentFragment` * methods should be overwritten. * @memberOf html5 * @type Boolean */ 'shivMethods': (options.shivMethods !== false), /** * A string to describe the type of `html5` object ("default" or "default print"). * @memberOf html5 * @type String */ 'type': 'default', // shivs the document according to the specified `html5` object options 'shivDocument': shivDocument, //creates a shived element createElement: createElement, //creates a shived documentFragment createDocumentFragment: createDocumentFragment }; /*--------------------------------------------------------------------------*/ // expose html5 window.html5 = html5; // shiv the document shivDocument(document); }(this, document)); /*>>shiv*/ // Assign private properties to the return object with prefix Modernizr._version = version; // expose these for the plugin API. Look in the source for how to join() them against your input /*>>prefixes*/ Modernizr._prefixes = prefixes; /*>>prefixes*/ /*>>domprefixes*/ Modernizr._domPrefixes = domPrefixes; Modernizr._cssomPrefixes = cssomPrefixes; /*>>domprefixes*/ /*>>mq*/ // Modernizr.mq tests a given media query, live against the current state of the window // A few important notes: // * If a browser does not support media queries at all (eg. oldIE) the mq() will always return false // * A max-width or orientation query will be evaluated against the current state, which may change later. // * You must specify values. Eg. If you are testing support for the min-width media query use: // Modernizr.mq('(min-width:0)') // usage: // Modernizr.mq('only screen and (max-width:768)') Modernizr.mq = testMediaQuery; /*>>mq*/ /*>>hasevent*/ // Modernizr.hasEvent() detects support for a given event, with an optional element to test on // Modernizr.hasEvent('gesturestart', elem) Modernizr.hasEvent = isEventSupported; /*>>hasevent*/ /*>>testprop*/ // Modernizr.testProp() investigates whether a given style property is recognized // Note that the property names must be provided in the camelCase variant. // Modernizr.testProp('pointerEvents') Modernizr.testProp = function(prop){ return testProps([prop]); }; /*>>testprop*/ /*>>testallprops*/ // Modernizr.testAllProps() investigates whether a given style property, // or any of its vendor-prefixed variants, is recognized // Note that the property names must be provided in the camelCase variant. // Modernizr.testAllProps('boxSizing') Modernizr.testAllProps = testPropsAll; /*>>testallprops*/ /*>>teststyles*/ // Modernizr.testStyles() allows you to add custom styles to the document and test an element afterwards // Modernizr.testStyles('#modernizr { position:absolute }', function(elem, rule){ ... }) Modernizr.testStyles = injectElementWithStyles; /*>>teststyles*/ /*>>prefixed*/ // Modernizr.prefixed() returns the prefixed or nonprefixed property name variant of your input // Modernizr.prefixed('boxSizing') // 'MozBoxSizing' // Properties must be passed as dom-style camelcase, rather than `box-sizing` hypentated style. // Return values will also be the camelCase variant, if you need to translate that to hypenated style use: // // str.replace(/([A-Z])/g, function(str,m1){ return '-' + m1.toLowerCase(); }).replace(/^ms-/,'-ms-'); // If you're trying to ascertain which transition end event to bind to, you might do something like... // // var transEndEventNames = { // 'WebkitTransition' : 'webkitTransitionEnd', // 'MozTransition' : 'transitionend', // 'OTransition' : 'oTransitionEnd', // 'msTransition' : 'MSTransitionEnd', // 'transition' : 'transitionend' // }, // transEndEventName = transEndEventNames[ Modernizr.prefixed('transition') ]; Modernizr.prefixed = function(prop, obj, elem){ if(!obj) { return testPropsAll(prop, 'pfx'); } else { // Testing DOM property e.g. Modernizr.prefixed('requestAnimationFrame', window) // 'mozRequestAnimationFrame' return testPropsAll(prop, obj, elem); } }; /*>>prefixed*/ /*>>cssclasses*/ // Remove "no-js" class from <html> element, if it exists: docElement.className = docElement.className.replace(/(^|\s)no-js(\s|$)/, '$1$2') + // Add the new classes to the <html> element. (enableClasses ? ' js ' + classes.join(' ') : ''); /*>>cssclasses*/ return Modernizr; })(this, this.document);

If, "Hindsight's 20/20," Is really true Where the hell did we go wrong? Because I keep looking In my rearview And all I see is miles of fog And the mirror's on my right And the mirror's on my left Warn the future's closing fast The miles are never far enough OH, NO! The miles are never far enough Still we try The road less traveled Filled with dead ends and broken bridges Yet we tred on Slowly, but surely And try to leave this town behind us OH, NO! The miles are never far enough OH, NO! The miles are never far enough We thought we'd found us a goldmine But this place is a ghost town We're just trying to get up But all they want is a breakdown We thought we'd found a goldmine But all they want is a breakdown All they want is a breakdown... We thought we'd found a goldmine But this place is a ghost town We're just trying to get up But all they want is a breakdown A break... down We thought we'd found a goldmine But this scene is a ghost town We're just trying to get up But all they want is a breakdown DOWN DOWN DOWN Still we'll try The road less traveled Filled with dead ends and broken bridges Yet we tred on Slowly but surely And try to leave this town behind us Please, let me know When narcissism goes Back out of style Because I'm sick and tired Of everyone Crying over their own spilled blood

Q: Planetary nitrification: could it work? Imagine an alien species arrived on Earth, to find that the nitrogen in the air was toxic to them. Imagine they wanted to terraform our planet, and decided to fix this problem by nitrifying a lot of our atmosphere. They wouldn't want to completely halt the nitrogen cycle; they'd just want to convert enough nitrogen into nitrates so that they wouldn't die the minute they left their spaceship. So my question is, if they took this course of action, and, say, the nitrogen concentration in the atmosphere was halved, would that create some kind of ecological crisis that would only make their living here more problematic? And if it is so that converting so much nitrogen into nitrates would be pointless because denitrifying bacteria will only return the nitrogen to the atmosphere, could they convert the nitrogen into another unreactive compound without effecting all the plants that need nitrates for growth and protein production? Note: I know that there are actually two steps to convert nitrogen into nitrates, but I've just used 'nitrification' as a shortcut. A: I'm going to have to argue against your selected answer. The problem is, just how are yon aliens going to get rid of the nitrogen? You referred to "converting so much nitrogen into nitrates" which suggests that this is what you had in mind. So the N2 molecules get converted to NO3 ions, right? Mmm, no. In fixing the nitrogen you deplete the atmosphere of much more oxygen than you do nitrogen, specifically 3 times as much. So, since the earth's atmosphere is (roughly) 80% nitrogen and 20% oxygen, when about 8.3% of the 80% has been converted to NO3, ALL of the oxygen will be used up. The other alternative, ammonia, is much worse. Ammonia, NH4, takes 4 times as much hydrogen as nitrogen, and since the total free hydrogen in the atmosphere is only 55 parts per million (by volume, not weight) there's just not a lot of leverage you can get. Of course, if the aliens are examples of Clarke's Law ("Any sufficiently advanced technology is indistinguishable from magic), They can get around this by transmuting about 3/8 of the nitrogen to oxygen, binding it to 1/8 of the nitrogen, and thereby nitrify 1/2 of the total nitrogen. Is this a good idea? I'd suggest not. Let's ignore the energy release caused by converting oxygen to nitrogen - those aliens are really good at the "indistinguishable from magic" part. If we're not willing to overlook this, the surface of the earth turns into crispy critters, and this is generally considered to be A Bad Thing. NO3 is the standard measure of nitrogen in fertilizers, and dumping this much nitrate into the soil would constitute (essentially) massive overfertilization and would quickly kill most plants. The NO3 produced accounts for about half of the total atmosphere, and atmospheric pressure is 15 lb/sq in, so the total NO3 will amount to about 7 pounds per square inch, which is far beyond anything we have experience with. For a somewhat specialized perspective, see http://www.growweedeasy.com/nitrogen-toxicity-cannabis. About 70% of this nitrate would be directly deposited in the oceans, and water runoff would contain extraordinarily high levels of nitrogen, and this would quickly produce algal blooms in the world's oceans which would deplete the oxygen levels and kill off all surface fish, followed more slowly by the deeper species as the oxygen depletion worked its way downwards. The local, surface version of this phenomenon is already seen in places like the Gulf of Mexico, where fertizer runoff from farms along the Mississippi River cause "dead zones". Of course, this assumes that the nitrate levels would not directly kill the existing algae (not a good assumption, IMO, but I'm not an expert in the field). With all due respect, this is a good example of the principle that you should wait at least 24 hours before selecting an answer. A: It's fine-ish. It happens already, the aliens have friends here on Earth. Rhizobia and other bacteria convert atmospheric nitrogen for us higher order species on a regular basis, since we can't use atmospheric nitrogen anyway. Atmospheric Nitrogen constitutes a large portion of the atmosphere, so you will have a few years of climactic effects, but on the ground, not a huge difference (other than effects of climate change), because the vast majority of atmosphere is in the 5km-16km location, not the 1% or so that we live in. So brace yourselves for weather issues and very fertile growth. I hope the Aliens come hungry.

1. Introduction {#sec1} =============== Dacryops is a rare clinical entity characterized by cyst formation in the lacrimal gland. Although it can arise in any location where lacrimal gland tissue is present, it usually presents as painless swelling under the lateral aspect of the upper eyelid. Although, in many cases, there is no a predisposing factor, in some cases, it may be preceded by local trauma or inflammation and also there is a reported case that occurred after chemical injury \[[@B1]\]. It is thought that trauma or inflammation causes ductal wall damage and weakened lacrimal ductal contractility, resulting in distention of the duct wall and consequent cyst formation \[[@B1]--[@B3]\]. To best of our knowledge, diplopia due to dacryops has not been reported previously. 2. Case Report {#sec2} ============== A 57-year-old man was referred to the ophthalmology department with binocular horizontal diplopia that was present for 2 weeks. The diplopia occurred in only left direction of gaze and had progressed over the past days. There was no associated pain, erythema, or discharge. And past medical history of the patient was negative for any orbital trauma or infection. During ophthalmological examination, corrected visual acuity was 20/20 OD and 20/20 OS. The external examination revealed no inflammation, mass, or proptosis. There was no difference between the right and left eye in the exophthalmometry evaluation and extraocular movements were full in both eyes. At eyelid eversion examination of the right eye, small cystic mass was identified on the anterior aspect of the palpebral lobe of the lacrimal gland. The cyst appeared smooth and translucent and was attached to the underlying conjunctiva. Magnetic resonance (MR) imaging revealed a 11 × 6.5 mm well-circumscribed cystic lesion adjacent to the lateral rectus and contiguous with the inferior palpebral lobe of the lacrimal gland ([Figure 1](#fig1){ref-type="fig"}). The globe and the remaining lacrimal gland tissue were normal and there was no associated periorbital or soft-tissue inflammation. A lateral orbitotomy was performed. During excision, the cyst was ruptured and thin, watery, clear fluid gushed out. Postoperatively, the patient\'s diplopia was resolved. Histopathological examination of the surgical specimen revealed a cystic space lined by columnar epithelial cells consistent with ductal origin and this finding was compatible with the diagnosis of dacryops. 3. Discussion {#sec3} ============= Dacryops, lacrimal ductal cyst, usually appears as a a slowly growing well-circumscribed translucent cyst in the palpebral lobe of the lacrimal gland and presents as painless swelling in the lateral portion of the upper eyelid. In the setting of superimposed infection, rapid growth can be observed. Mass effect of enlarging cyst can displace the globe, restrict motility, and cause proptosis \[[@B3], [@B4]\]. Etiopathogenesis of dacryops is not clearly known, but it is speculated that preceding trauma or inflammation results in ductal wall damage. Decreased contractility and lacrimal gland hypersecretion both cause dilatation of the ductal wall and subsequent cyst formation \[[@B1]--[@B3]\]. In differential diagnosis of dacryops, other benign and malign orbital tumours such as pleomorphic adenoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, pleomorphic adenocarcinoma, lymphoma, pseudolymphoma, and metastasis and developmental cysts such as dermoid and epidermoid cysts must be considered. MR imaging is a preferably used imaging modality to assess orbital tumours because of its advantage of better soft tissue evaluation than that of computerized tomography imaging. Dacryops can be easily diagnosed by MR imaging as a well-defined, small cystic lesion and appears to be hypointense on T1-weighted and hyperintense on T2-weighted imaging \[[@B5]\], but the definitive diagnosis is made by histopathological examination. Dacryops is histopathologically characterized by cystic spaces lined by ductal epithelium and surrounded by glandular tissue and dilated ducts \[[@B1], [@B2]\]. In our patient, both MR imaging findings and histopathological examination were compatible with dacryops. To the best of our knowledge, diplopia case due to dacryops has not been reported previously. In our patient, we thought that diplopia during left lateral gaze occurred due to dacryops because after detailed ophthalmological examination and MR imaging no other cause of diplopia was found and also diplopia was resolved after the operation. We suggested that diplopia in this case may be developed because of the mass effect of dacryops on lateral rectus muscle. In conclusion, although dacryops is a rare ophthalmological entity, it must be included in the differential diagnosis of orbital masses. And clinicians and radiologists should be aware of its variable presentations such as diplopia in our case. The authors have no conflict of interests to declare. The study was conducted at the Department of Ophthalmology, Ankara Oncology Hospital. {#fig1} [^1]: Academic Editors: C. Giusti, M. Luechtenberg, and C. J. MacEwen

1. Field of the Invention The present invention relates to a method for production of semiconductor devices which permits easy removal of native oxide with a minimum damage to the substrate. 2. Description of the Related Art Plasma treatment has been a common practice in the past technology. It alters the treated layer only slightly with very little adverse effect on reliability and working speed so long as it is performed on the wiring section of large area. However, this does not hold true any longer as the result of recent miniaturization of semiconductor devices, particularly in wiring. Reduced wiring width, increased current density, and multilayer structure require better reliability. An increase in current density is accomplished by employing a conducting film composed mainly of copper which has a low resistance as well as a thin interlayer insulating film with a low dielectric constant. The process for forming an interlayer insulting film on a conducting film composed mainly of copper involves a step of removing native oxide from the conducting film. This step is accomplished by plasma treatment in a reducing gas typified by hydrogen and ammonia. This technique is disclosed in Japanese Patent Laid-Open No. 2003-188254. Unfortunately, any interlayer insulating film with a low dielectric constant usually suffers from low density and poor mechanical strength. Consequently, plasma treatment with a reducing gas causes the interlayer insulating film to increase in dielectric constant or to recede. On the other hand, chemical treatment without plasma poses a problem with chemical solution remaining on or infiltrating into the insulating film. In order to address these problems, there has recently been proposed a process for annealing in a reducing gas. This process, however, still has many difficulties such as increase in heat amount to be overcome before it is put to practical use.

Placental inflammation and fetal hemodynamics in a rat model of chorioamnionitis. The relative contributions of inflammation and ischemia to the pathogenesis of periventricular leukomalacia (PVL) have not been elucidated. We hypothesized that fetal cardiovascular function and cerebral blood flow velocity (BFV) would be decreased in a rat model of chorioamnionitis. We also tested whether placental inflammation was related to proximity to the cervix in our model of chorioamnionitis [intracervical lipopolysaccharide (LPS) or vehicle (PBS) injection]. On embryonic d 15, Sprague-Dawley rats underwent baseline maternal and fetal echocardiography, followed by LPS or PBS injection, then serial echocardiographic evaluations until embryonic day (ED) 21. One hour after birth, pups had middle cerebral artery (MCA) BFV measured. Placentas of LPS-exposed pups exhibited uniform, higher inflammation grades (p < 0.001). All fetal BFVs increased with advancing GA (p < 0.001) whereas resistance index (RI) decreased (p < 0.001). There was no difference in fetal BFV between the groups other than a reduced gestation-related increase in descending aorta BFV in LPS-exposed rats (p < 0.05). Newborn pups exposed to LPS had lower heart rate (p = 0.006) and MCA BFV (p = 0.024) and higher RI (p = 0.003) and pulsatility index (PI; p = 0.004). In conclusion, intracervical LPS injection produces an inflammation independent of placental position, a blunted increase in gestation-related aortic BFV, and a decrease in MCA BFV in newborn pups.

A fresh look at NASH pathogenesis. Part 1: the metabolic movers. The strong relationship between over-nutrition, central obesity, insulin resistance/metabolic syndrome and non-alcoholic fatty liver disease (NAFLD) suggest pathogenic interactions, but key questions remain. NAFLD starts with over-nutrition, imbalance between energy input and output for which the roles of genetic predisposition and environmental factors (diet, physical activity) are being redefined. Regulation of energy balance operates at both central nervous system and peripheral sites, including adipose and liver. For example, the endocannabinoid system could potentially be modulated to provide effective pharmacotherapy of NAFLD. The more profound the metabolic abnormalities complicating over-nutrition (glucose intolerance, hypoadiponectinemia, metabolic syndrome), the more likely is NAFLD to take on its progressive guise of non-alcoholic steatohepatitis (NASH). Interactions between steatosis and insulin resistance, visceral adipose expansion and subcutaneous adipose failure (with insulin resistance, inflammation and hypoadiponectinemia) trigger amplifying mechanisms for liver disease. Thus, transition from simple steatosis to NASH could be explained by unmitigated hepatic lipid partitioning with failure of local adaptive mechanisms leading to lipotoxicity. In part one of this review, we discuss newer concepts of appetite and metabolic regulation, bodily lipid distribution, hepatic lipid turnover, insulin resistance and adipose failure affecting adiponectin secretion. We review evidence that NASH only occurs when over-nutrition is complicated by insulin resistance and a highly disordered metabolic milieu, the same 'metabolic movers' that promote type 2 diabetes and atheromatous cardiovascular disease. The net effect is accumulation of lipid molecules in the liver. Which lipids and how they cause injury, inflammation and fibrosis will be discussed in part two.

Ralph Lauren quietly shuttered its two-year-old 20,000-square-foot store last week. Other brands are expected to close boutiques in a city that has lost its luster for cash-rich mainland Chinese tourists. James Long kept his beloved boxing references, but transported his sporty hoods, sweatshirts and wraps to a bohemian island vacation, where the denim was sun-bleached and the colors vivid. Bright ribbon patches were stitched haphazardly onto frayed denim jeans, shorts and jackets, while kaftan shapes in sheer mesh had ribbons appliquéd into stripes, adding to the sport-meets-beach attitude. An abstracted, handwritten “James” was blown up and appliquéd onto sweats and a hooded kaftan, while silver leather looked great as a cropped biker jacket. WWD's Ultimate Holiday Gift Guide is brought to you by @styleontherise and is complete with the perfect presents for everyone on your list. Click the link in our bio to start shopping NOW. #WWDHoliday #Sponsored @rebeccaminkoff is bringing self-checkout to high fashion: The brand has partnered with @queuehop to bring its customers self-checkout options, beginning this holiday season at its SoHo store. (📷: @aurorarosephoto) It was a big night for Demna Gvasalia at the Fashion Awards 2016 in London: The designer took home the award for international ready-to-wear designer for his work at @balenciaga, while his brand @vetements_official scooped international urban luxury brand. (📷: @giovanni_giannoni_photo) Despite decades of enforcement, the plague of sweatshops still exists in America: "The sad reality is for workers in this industry there are still incredible problems and workers in this industry are subjected to inexcusable levels of violations of our basic labor standards." - David Weil, The Department of Labor Wage and Hour

Q: How can I save multiple images to a temporary folder to preview before confirming the upload? I have a site where I would like to let users select multiple images to upload to the site, show them a preview of the images they uploaded and then give them the option to either change any of the images or to go ahead and upload them. I would like for them to: Select the images Click a submit button and have the images save to a temporary location Reload the page showing the images they uploaded with a "Change Photo" button next each photo The user can click on the "Change Photo" button to have the page reload with an upload form so that the user can pick and upload a new photo to the temporary location and have it replace the photo in question Or the user can click on the "Upload Photos" button to confirm the upload and have it save it in a permanent location I am using php, but I don't mind a solution that involves javascript with php, as long as the above criteria is met. How can I save multiple images to a temporary folder to preview before confirming the upload? A: Just a suggestion, you can use jQuery uploadify to upload multiple images through ajax and save in some temp folder, and again display these uploaded image which when confirmed by user to be upload then you can move those images to your destination folder deleting it from temp folder.

Q: the 'select' call keep find client socket could be read It's hard for me to describe my question, though, the title above maybe somehow not clear. I have a ordinary tcp server which have a listen socket, and can accept up to 32 clients, I have created sockets for each client, and I use select system call to monitor which client could be read, following code is a snippet of my program. where, rset is a member variable of my class and its type is fd_set. I have zeroed it using FD_ZERO in the constructor. timeo is also a member variable, type is struct timeval initialized with 10 seconds. this->sock is again a member variable, used for listening and accepting new clients. I have called FD_SET(this->sock, &rset) before. print_trace is just a macro which print the message and append a '\n'. while(1) { int count = select(FD_SETSIZE, &rset, /*&wset*/ NULL, NULL, &timeo); printf("%d fds\n", count); if(count) { if(FD_ISSET(this->sock, &rset)) { // new connection comes and now this line will not blocked if((csocks[sock_count] = accept(this->sock, NULL, NULL))) { FD_SET(csocks[sock_count], &rset); ++sock_count; } } else { print_trace("there are clients can be read."); for(int i = 0 ; i < sock_count ; ++i) { if(FD_ISSET(csocks[i], &rset)) { char buffer[512] = {0}; recv(csocks[i], buffer, 512, 0); printf("here client socket number: %d, i=%d, message: %s\n", csocks[i], i, buffer); } } } } timeo.tv_sec = 10; timeo.tv_usec = 0; } I know I am not re-enable the this->sock using FD_SET, for select will clear all the bits when timeout, but it have no concern with my trouble. my trouble is, when I run the server program, and in 10 seconds, I run a client program to connect to this server, the select returns 1 normally, so that the client socket be created and be added to rset, and then, the server goes to next loop, caution! now, right now, terminate the client program immediately, don't wait for the select returns. Okay, now the trouble will reappear, the server program keep printing the following info: 1 fds there are clients can be read. here client socket number: 6, i=2, message: 1 fds there are clients can be read. here client socket number: 6, i=2, message: 1 fds there are clients can be read. here client socket number: 6, i=2, message: 1 fds there are clients can be read. here client socket number: 6, i=2, message: ... ... I have use tcpdump monitor the connection, when terminate the client, it just send an FIN packet, and the server program just send an ACK packet, there is no any other data flowing the connection. why the select keep finding the client socket can be read while it just read empty message(as the printing message showing)? Any help will be appreciated. update: I know the usage of select method clearly, I thought I don't use this method properly so I have had spent about one hour to study this method, in order to solve my problem, but found no result still. A: You're ignoring the result returned by recv(), which is itself an error, and specifically you're ignoring the possibility that it's zero, which is end of stream, on which you should close the socket, so you don't just select on EOS again.

Onlyanurse nursing topics. The place where we discuss all things nursing at the fastest growing nursing website. We have forums by specialty and lots of great nursing stories and articles. We also have a great store where you will find everything you need for your nursing needs. We sell wholesale nursing shirts and can print pretty much everything you need for nursing graduations. The smallest order we will print is 10 shirts. Contact us for details DAHO— A nurse at St. Luke Magic Valley Medical Center is facing a wrongful death suit filed by the family of a seven-month-old child who received an adult dose of saline mixed with potassium phosphate. Wisconsin-Labor Day Weekend, flight nurse Jon Hagen received a call that a vehicle had rolled over on the highway. Hagen immediately flew to the scene along with his partner. The victim was a critically injured man around the same age as Hagen. They rushed him to the closest trauma hospital. I've been a surgical nurse for longer than many people have been alive. Before I became a surgical nurse I worked in the ICU and the ED. But I found my calling when I began my orientation in the operating room. That was when I realized that I'd always be an operating room nurse because I fell in love with the OR. There are some really cool If you're trying to figure out what career path you want to take and your head is spinning as you try to decide whether to be a nurse, doctor, teacher, lawyer or fly by the seat of your pants and see what kind of hell you can raise, (the latter is just a joke, don't get any stupid ideas), but this article can help you out. Nursing is a great career and I love what I do. In my thirty years in this profession, I’ve worked in the emergency room, case management, and palliative care nursing. The latter is where I found my passion; what I was born to do. With the continuing rise in crime rates, forensic nursing is becoming a popular part of the American judicial system and one of the booming career options. This new form of nursing is one of the newest forms of forensic sciences recognized by the Nurse educators are very crucial to the field of nursing and are needed at just about every level of practice. They can teach nurses pursuing undergraduate studies as registered nurses (Rn's) and licensed practical nurses (LPNs) and also those at the advanced level, seeking to play the role of nurse educators, nurse researchers, practice nurses, future nurse leaders and nurse administrators. The RN specializing in Perioperative Nursing practice performs nursing activities in the preoperative, intraoperative, and postoperative phases of the patients' surgical experience. Based on the Standards and Recommended Practices for Perioperative Nursing -- A.O.R.N., Being a traveling nurse has many attractive benefits over regular nursing Firstly, nurses are in demand constantly not only in the US but worldwide. For a nurse that has the desire to travel and earn money, becoming a traveling nurse would be ideal. Of the hospitals and medical facilities rely on traveling nurses to fill roles when staffing levels are lower than normal, but further than that to bring a new level of expertise that may be lacking in the nursing in the If you've already decided that nursing job is what you want, you've made a fantastic decision. You should know that there are plenty of different nursing specialties, and that there's a tremendous nursing shortage in the U.S. Just like there are different types of doctors, there are different types of nurses. And that is why nursing is such an exciting field. If you get tired of one area, there's always another. It is more critical than any time before for agencies to hire, train and retained qualified hospice nurses. This has never been as challenging as it is today. Today's hospice is seeing more medically complex patients. This requires nurses to stay current with critical assessment skills. Increasing and changing regulations make documentation more important than ever before to ensure payment and long-term viability for agencies while the change to electronic medical records present a new challenge for some seasoned hospice nurses. Growth of the agency is critical to success yet the increasing number of hospice providers and mandatory reporting of quality measures makes this more challenging. A pending bill in the state Senate would lift Michigan's requirement that physicians must supervise nurse anesthetist while they administer anesthesia. The bill would allow nurses with advanced training as Certified Registered Nurse Anesthetists to order and administer anesthesia pre-operatively, perioperatively and postoperatively. Career in nursing is not only financially stable but prestigious too. This field has a lot to offer as there is more number of jobs along with security as compared to other healthcare occupation. According to the Bureau of Labor Statistics the demand for nurses will go on increasing with time as the number of healthcare units are increasing globally. Night shift nurses are a special breed. There are a few nurses who work nights, but they're only doing it because they have to. There's another kind that love working nights. These nurses are night owls by nature, and it doesn't bother them to be up all night, in fact, they prefer it to working days. If there's anything I hate more than call lights in nursing, I would have to say that IV pumps would rank right up there. If I met one in a dark alley I don't think I could be responsible for what I would do to it. Only A Nurse Nurses Helping Nurses Every Day! Onlyanurse.com is the fastest growing nursing community on the internet. The website has nursing jobs, nursing CEUs, nursing articles, nursing forums by specialty, nursing humor, a wide array of nursing products, we have nursing hoodies, nursing t shirts, nursing shoes, stethoscopes, gifts for nurses, games for nurses, mugs and cup for nurses, bags for nurses, jewelry for nurses, Onlyanurse nursing community

Extended Life Coolants (ELCs) for internal combustion engines are based on Organic Acid Technology (OAT) and include an organic acid and other ingredients such as potassium hydroxide, ethylene or propylene glycols, water, etc. Recently OAT based coolants have been replacing silicate based coolants because of the longer service life of the OAT corrosion inhibitors. Unlike silicate based inhibitors, OAT inhibitors typically do not deplete over the 150,000 mile/5 year service interval. Most manufacturers emphasize the low to no maintenance feature of OAT coolants. Over the life of the coolant, the organic acids in ELCs can become depleted or compromised due to “topping off” with water or conventional (silicate based) coolant, and for optimal ELC performance and engine protection, it is important to maintain the total organic acid content of the ELC within a particular performance range. Replacing an ELC when it is still in an acceptable performance range can result in unnecessary costs, and failing to replace an ELC that is no longer within an acceptable performance range can lead to engine damage and lost productivity. To avoid damage to engines and devices that results from contamination or dilution of an ELC, it is useful to be able to determine chemically the remaining organic acid content in the coolant to provide information on the coolant status.

Q: Unable to get provider com.facebook.internal.FacebookInitProvider: java.lang.ClassNotFoundException I am trying to share a photo from my application to facebook. I have added the Facebook SDK and done the initial setup. But when I run the application its crashing and I am getting the following exception. Here is my logcat: java.lang.RuntimeException: Unable to get provider com.facebook.internal.FacebookInitProvider: java.lang.ClassNotFoundException: Didn't find class "com.facebook.internal.FacebookInitProvider" on path: DexPathList[[zip file "/data/app/com.ignite.a01hw909350.kolamdemo-2/base.apk", zip file "/data/app/com.ignite.a01hw909350.kolamdemo-2/split_lib_slice_1_apk.apk"],nativeLibraryDirectories=[/data/app/com.ignite.a01hw909350.kolamdemo-2/lib/arm64, /data/app/com.ignite.a01hw909350.kolamdemo-2/base.apk!/lib/arm64-v8a, /data/app/com.ignite.a01hw909350.kolamdemo-2/split_lib_slice_1_apk.apk!/lib/arm64-v8a, /vendor/lib64, /system/lib64]] at android.app.ActivityThread.installProvider(ActivityThread.java:5267) at android.app.ActivityThread.installContentProviders(ActivityThread.java:4859) at android.app.ActivityThread.handleBindApplication(ActivityThread.java:4799) at android.app.ActivityThread.access$1600(ActivityThread.java:168) at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1434) at android.os.Handler.dispatchMessage(Handler.java:102) at android.os.Looper.loop(Looper.java:148) at android.app.ActivityThread.main(ActivityThread.java:5609) at java.lang.reflect.Method.invoke(Native Method) at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:797) at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:687) Caused by: java.lang.ClassNotFoundException: Didn't find class "com.facebook.internal.FacebookInitProvider" on path: DexPathList[[zip file "/data/app/com.ignite.a01hw909350.kolamdemo-2/base.apk", zip file "/data/app/com.ignite.a01hw909350.kolamdemo-2/split_lib_slice_1_apk.apk"],nativeLibraryDirectories=[/data/app/com.ignite.a01hw909350.kolamdemo-2/lib/arm64, /data/app/com.ignite.a01hw909350.kolamdemo-2/base.apk!/lib/arm64-v8a, /data/app/com.ignite.a01hw909350.kolamdemo-2/split_lib_slice_1_apk.apk!/lib/arm64-v8a, /vendor/lib64, /system/lib64]] at dalvik.system.BaseDexClassLoader.findClass(BaseDexClassLoader.java:56) at java.lang.ClassLoader.loadClass(ClassLoader.java:511) at java.lang.ClassLoader.loadClass(ClassLoader.java:469) at android.app.ActivityThread.installProvider(ActivityThread.java:5252) at android.app.ActivityThread.installContentProviders(ActivityThread.java:4859)  at android.app.ActivityThread.handleBindApplication(ActivityThread.java:4799)  at android.app.ActivityThread.access$1600(ActivityThread.java:168)  at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1434)  at android.os.Handler.dispatchMessage(Handler.java:102)  at android.os.Looper.loop(Looper.java:148)  at android.app.ActivityThread.main(ActivityThread.java:5609)  at java.lang.reflect.Method.invoke(Native Method)  at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:797)  at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:687)  Suppressed: java.lang.ClassNotFoundException: com.facebook.internal.FacebookInitProvider at java.lang.Class.classForName(Native Method) at java.lang.BootClassLoader.findClass(ClassLoader.java:781) at java.lang.BootClassLoader.loadClass(ClassLoader.java:841) at java.lang.ClassLoader.loadClass(ClassLoader.java:504) ... 12 more Caused by: java.lang.NoClassDefFoundError: Class not found using the boot class loader; no stack trace available Here is my Manifest.xml <application android:name=".AppController" android:allowBackup="true" android:icon="@mipmap/ic_launcher" android:label="@string/app_name" android:largeHeap="true" android:roundIcon="@mipmap/ic_launcher_round" android:supportsRtl="true" android:theme="@style/AppTheme"> <meta-data android:name="com.facebook.sdk.ApplicationId" android:value="@string/facebook_app_id"/> <activity android:name=".MainActivity" /> <activity android:name=".ARCameraActivity" android:configChanges="orientation|screenSize" android:screenOrientation="fullSensor" /> <activity android:name=".RegistrationActivity" android:screenOrientation="portrait" /> <activity android:name=".LoginActivity" android:screenOrientation="portrait" /> <activity android:name=".SplashActivity" android:screenOrientation="portrait"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> <activity android:name=".MenuActivity" android:screenOrientation="portrait" /> <activity android:name=".ScanAndDrawActivity" android:screenOrientation="portrait" /> <activity android:name=".GalleryActivity" android:screenOrientation="portrait" /> <activity android:name=".PdfKolamActivity" android:screenOrientation="portrait" /> <service android:name=".BluetoothService" android:enabled="true" android:exported="true"> <intent-filter> <action android:name="com.ignite.a01hw909350.kolamdemo.BluetoothService" /> </intent-filter> </service> <receiver android:name=".MyScheduleReceiver" android:enabled="true"> <intent-filter> <action android:name="android.bluetooth.adapter.action.STATE_CHANGED" /> </intent-filter> </receiver> <activity android:name=".BotDialogActivity" android:launchMode="singleInstance" android:noHistory="true" android:theme="@style/Theme.AppCompat.Light.Translucent" /> <activity android:name=".ModelActivity" /> <activity android:name=".PanchangActivity" /> <receiver android:name=".MyStartServiceReceiver" android:exported="true"/> <service android:name=".services.AlarmService" android:enabled="true"> <intent-filter> <action android:name="NOTIFICATION_SERVICE" /> </intent-filter> </service> <receiver android:name=".BootReceiver" android:enabled="true"> <intent-filter> <action android:name="android.intent.action.BOOT_COMPLETED" /> <action android:name="android.intent.action.QUICKBOOT_POWERON" /> </intent-filter> </receiver> <provider android:authorities="com.facebook.app.FacebookContentProvider43234236033829" android:name="com.facebook.FacebookContentProvider" android:exported="true"/> </application> Here is my build.gradle: apply plugin: 'com.android.application' android { compileSdkVersion 25 buildToolsVersion "25.0.2" defaultConfig { applicationId "com.ignite.a01hw909350.kolamdemo" minSdkVersion 17 targetSdkVersion 25 versionCode 1 versionName "1.0" testInstrumentationRunner "android.support.test.runner.AndroidJUnitRunner" } buildTypes { release { minifyEnabled false proguardFiles getDefaultProguardFile('proguard-android.txt'), 'proguard-rules.pro' } } aaptOptions { noCompress 'KARMarker' noCompress 'armodel' } repositories { jcenter() maven() } } dependencies { compile fileTree(include: ['*.jar'], dir: 'libs') androidTestCompile('com.android.support.test.espresso:espresso-core:2.2.2', { exclude group: 'com.android.support', module: 'support-annotations' }) compile project(':KudanAR1') compile project(':eventbus-3.0.0') compile 'com.android.support:appcompat-v7:25.3.1' compile 'com.android.support.constraint:constraint-layout:1.0.2' compile 'com.android.volley:volley:1.0.0' compile 'com.scottyab:secure-preferences-lib:0.1.4' compile 'com.jrummyapps:animated-svg-view:1.0.1' compile 'me.zhanghai.android.materialprogressbar:library:1.3.0' compile 'io.palaima:smoothbluetooth:0.1.0' compile 'com.android.support:recyclerview-v7:25.3.1' compile 'com.afollestad.material-dialogs:core:0.9.3.0' compile 'com.flurgle:camerakit:0.9.13' compile 'com.github.zhukic:sectioned-recyclerview:1.0.0' compile 'com.android.support:support-vector-drawable:25.3.1' compile 'com.android.support:cardview-v7:25.3.1' compile 'com.prolificinteractive:material-calendarview:1.4.3' compile 'com.github.bumptech.glide:glide:3.7.0' compile 'com.android.support:design:25.3.1' compile 'com.github.barteksc:android-pdf-viewer:2.4.0' compile 'org.rajawali3d:rajawali:1.1.668@aar' compile 'com.tapadoo.android:alerter:1.0.8' compile 'com.google.android.gms:play-services-location:10.0.1' compile 'uk.co.chrisjenx:calligraphy:2.3.0' compile 'com.facebook.android:facebook-android-sdk:[4,5)' testCompile 'junit:junit:4.12' } Where is the problem coming from? A: I had the same error because a badly set multidex. The problem occurred on device with Android 4.4.2. This i had in build.gradle: defaultConfig { multiDexEnabled true } And I had to add to build.gradle: dependencies { compile 'com.android.support:multidex:1.0.2' } And this method to my application class: protected void attachBaseContext(Context base) { super.attachBaseContext(base); MultiDex.install(this); } Answer is originaly from here, which problem I had to solve when I avoided facebook problem by removing facebook SDK. So maybe can help another tip from there.

“No one ever got fired for hiring IBM.” That was a classic business cliche in the 1970s, and a true one, as a colleague reminded me recently. Now for many Health IT companies (and some platform-based medical device companies) selling into hospitals, it’s the big EMR companies like Epic and Cerner with lots of APIs, apps, and extensions, that beat them out because customers feel the “big boys” are the safer choice. Let’s say you are a small to mid size company. You can apply key principles of persuasion to increase your chances of winning business in this ultra-competitive space. Here’s a 3-step process you can use: 1. Emotional Alignment: First establish empathy by emotionally aligning with the healthcare customer: a) Acknowledge that when making purchasing decisions like this, some people choose one of the big-name brands because they assume it’s a safer bet. b) Acknowledge that for some hospitals that’s a reasonable way to go. c) Acknowledge – carefully – that for some people it’s a “CYA” decision and that may trump looking at what will be best for the hospital in some circumstances. d) Acknowledge that it can be hard to know when it may be a better choice to go with a smaller, more specialized brand. Now the customer will feel understood and more open to considering other options. You have disarmed several points of resistance. You rightly have not pitched your brand yet. 2. Initial Decision Guidelines: Second, help the customer know when they should and should not evaluate different brands. a) Give them a few specific guidelines to inform this first decision – whether they should broaden their assessment beyond the big-name brands or not (have this as a tool you provide to them too). b) Explicitly explain the conditions under which it does NOT make sense to broaden their assessment beyond the big-name brands. This step is critical for you to be credible. c) Explicitly explain the conditions under which it DOES make sense to broaden their assessment beyond the big-name brands. 4) Walk the customer through the use of the initial decision guidelines for their setting. You have now provided them with a reasonable way to decide if they should explore further and they should have arrived at an appropriate decision. Note you still have not pitched your brand yet – good job being patient! 3. Guided Influence: Third, if and when the initial decision guidelines suggest the customer should evaluate other brands, provide a set of criteria for comparing brands. a) Be sure the customer agrees the criteria make sense, and if needed explain the relevance of each. Be willing to add or subtract a criterion to better fit the customer’s situation. b) Now it is time to talk about your brand. Show how you compare on the criteria. Admit when competitors are better on certain points. Reinforce that in this circumstance, your brand is actually the safer choice. c) Provide specific reasons to believe and an emotionally compelling story to support each of your claim of superiority. Now do your thing as a professional sale rep to respectfully get an initial commitment, close the sale, or something in-between. Recognize that once in a while your initial decision guidelines (Step 2 above) will lead customers to stay with the big-name brands, which means you’re done for the moment. That’s OK. You will have established yourself as a trustworthy partner concerned about what’s best for them – even if you did not get the sale. This is customer intimacy in practice, and it will pay off big – if not immediately, then certainly in the long-term. A new take on wearable technologies: The familiar red forehead dot – or bindi – has been a traditional symbol of beauty in India and other countries in Southeast Asia for centuries. Now the cultural adornment doubles as a slow-release iodine patch, potentially saving the lives of millions of women in rural communities with iodine deficiencies and no other access to the much-needed supplement. When I was serving on an expert FDA Risk Communication Advisory panel last week, a colleague described the “6Ms” marketing communications framework to the FDA staff we were advising. It’s been around for awhile and is still a useful mnemonic to remember what to consider when crafting a campaign. The 6 Ms are: Mission, Market, Message, Media, Money, Metrics. Of course the classic marketing framework – or marketing mix – is the 4Ps popularized by Dr. Phil Kotler: Product, price, place (of distribution), and promotion. Now the 4Ps have morphed into the 4Es: In our version, Product becomes Experience, Price become Equity, Place becomes Environment, and Promotion becomes Evangelists. I see this 4Es model as being the most customer-centric and thereby useful for developing a powerful customer/patient experience. More here. I serve on an FDA panel called the Risk Communication Advisory Council, and just got back from a two-day session on medication warning labels, drug addiction, and pregnancy. The key issue was how to effectively communicate warnings about side effects that won’t also scare off providers from prescribing the medication. One point I made that applies to most health-related communicators is to NOT assume the target audience will engage in thorough information-processing and rational decision-making. Do NOT assume that if you just give people correct information, logical consequences will ensue. Rather, plan for people to take mental shortcuts, make assumptions, interpret with bias, and react emotionally. By creating messages that meet people where they’re at instead of requiring them to follow your agenda, you get engaged consumers who feel understood and are open to taking in what you want to tell them. “It’s like a cancer,” he said. I was in a limo in DC asking the driver who owns a fleet of town cars and vans, what he thought of Uber. He told me his wife just had a recurrence of a serious cancer and he likened it to Uber’s relentless and heartless intrusion into his transportation business. Bottom line, Uber has tremendously disrupted his business and he is pissed. What most people admire and call a brilliant business model (UberX), he considers unfair and unjust. And he’s not alone, as this Bloomberg article points out. This is what disruptive innovation does. It stirs things up, hurts the status quo. It causes pain and suffering to people invested in the product or service that was disrupted. Some pivot and take advantage of the disruption. Others get protective of their turf and fight back. Sometimes they have enough power to fend off or minimize the disruption. Like with stethoscopes, which should by now be a relic, replaced by high-resolution hand-held ultrasound devices, as Eric Topol points out. And sometimes it’s a long drawn-out war. Like between some med device companies and durable medical equipment suppliers (DMEs), many of whom may be replaced by other distribution outlets coupled with new patient monitoring systems. Is disruptive innovation bad? No. By definition, it serves a higher good. But we need to acknowledge it does cause pain to some. We can disrupt with compassion for those who are supplanted. It keeps us all a little more human. I put on a workshop last week at the WLSA Convergence Summit on how to determine which new ideas to invest in — and which to avoid. One key idea was the right way and wrong way to get and leverage customer input for new medical devices. Wrong: Ask customers what features they want in your products or services. Right: Ask customers what outcomes they want from using your product or service. Most of the time, when we ask customers about solutions, we are abdicating our responsibilities and setting ourselves up for failure. It is not the responsibility of customers to figure out what features will provide the experience they desire or achieve the result the want. What customers can meaningfully talk about is what experience and outcomes they want. Once we know that, then we can back into why those outcomes are important. Then we translate that understanding into a product requirement and validate its accuracy and importance. For example, we might hear respiratory therapists tell us in focus groups that they want the mask to be a certain shape. That’s a solution. If we took that solution at face value and passed it on to the engineers and designers as a recommendation, we would likely be misleading them because we don’t yet know the desired outcome. Instead we dig deeper to reveal why RTs want the mask to be a certain shape and what outcome it will achieve. We learn that the outcome is about maximizing patient comfort in older patients, not about minimizing air leakage. We can then propose and validate a measurable requirement designed to achieve that outcome, such as “Maximize comfort for older patients wearing a mask for more than one week.” Now the engineers and designers take over to bring the requirement to fruition.

We Are the Void We Are the Void is the ninth full-length studio album by the Swedish melodic death metal band Dark Tranquillity. It is their first and only album with bassist, Daniel Antonsson who joined in 2008 and left in 2013. The band began writing for this album in late 2008 (except for the majority of "Iridium" which was written sometime between 1996-1998 but was left out until this album), all the way up to its recording and is considered to be the second part to their previous album, Fiction, as it continued many of the latter's elements, including the Drop B tuning that was largely present and the clean vocals Mikael Stanne re-introduced on that album. The band also began to release songs from this album on their MySpace page starting with "Dream Oblivion" on 21 December 2009, "At the Point of Ignition" on 14 January 2010 and finally the entire album was available for free streaming on 19 February 2010. Music videos were released for "Shadow in Our Blood" on 10 February 2010 and "In My Absence" on 22 February 2012. Reception Kyle Ward, of Sputnik Music, described the album like this: "If you take Fiction, cut out the awesome guitar riffs, increase the keyboard presence tenfold, and then make it more depressed-sounding, you will have exactly what We Are The Void delivers." The metalunderground website said that the album is "Excellent melodic death metal, but it feels like Dark Tranquillity has released the same album three times in a row now." Track listing Inside The Void DVD Personnel Dark Tranquillity Mikael Stanne – vocals, lyrics Martin Henriksson – rhythm guitar, sound recording Niklas Sundin – lead guitar, album artwork Anders Jivarp – drums Martin Brändström – keyboards, engineering Daniel Antonsson – bass guitar, lead guitar solo (on "Shadow in Our Blood" (1st part) and "At the Point of Ignition"), engineering Guests Tue Madsen – mixing (October–November 2009) & mastering (Antfarm Studio in Århus) Anders Björler - filmed "Studio Report 2009" Hasse Kosonen - engineering Daniel Antonsson - engineering Stefan Wibbeke - artwork Katja Kuhl - band photo References Category:2010 albums Category:Century Media Records albums Category:Dark Tranquillity albums

Walmart has the cheapest iPhone 5s, iPhone 5c yet Walmart is ready to sell buyers looking for on-contract smartphone even cheaper iPhone 5s models, as well as other smartphones, CNN Money (via 9to5Mac) reports. Purchased with a two-year contract with either AT&T or Verizon, the iPhone 5s costs only $119, down from its previous $145 price. Similarly, the iPhone 5c now costs $29 on-contract, down from $45, while Samsung’s Galaxy S4 is priced at $49 instead of $99. Furthermore, buying any Samsung smartphone between March 9th and March 22nd will net buyers a free $50 Walmart gift card, as long as the deal involves inking a new carrier contract. Walmart isn’t the only retailer ready to offer buyers a cheaper iPhone, as Best Buy is currently offering the handset for $50 off the regular price, or $149.99 with new contracts. The same deal applies to the colored iPhone as well, as Best Buy sells the iPhone 5c for $49.99 with new contracts. However, Walmart appears to be ready to do anything to beat its rival when it comes to iPhone prices.

To install packages of sourceforge (for instance), I need to configure them first. Meanwhile I know it is possible to do "make" and "make install" with gcc, but how will I be able to do "./configure"? Is there a package in Debian I can install for it? Or what?I have to mention that I have a full hd installation. "./configure" is a script included with most source code packages for Linux. Unlike the other commands, it exists in the directory of the program you want to compile (hence why you type "./" before it). You don't download it separately. Often simply typing "./configure" will set things up automatically as required for your system. However you can type "./configure --help", or to scroll through the text, "./configure --help | less", to see a list of options that may be added to the "./configure" line in order to make specific choices about the compillation. Also, just a note that gcc doesn't actually control the "make" command, there is a specific program called "make" for that, but gcc is used by it to compile the package. that explains a lot."Sourcecode package" does that mean, from "Sourceforge", or is that from Debian in our (DSL) case?What I allso wanted to know is: When I want to start an installed package and the output is: errot while loading shared libraries (eg) 'gimpprint.so.1' no such file or directory, and I can't find gimpprint.so.1, why should this than work with gimpprint.dev? Source Code is the common way to distribute programs for Linux so that they can be used with a range of different distributions. If a project on Sourceforge offers a Linux version, it probably has the source package available, but many linux programs from elsewhere on the net will have them too. They usually have the "tar.gz" extension (or tar.xz, tar.bz2). Note though that the ".tar.gz" packages in the MyDSL repository are not Source Code packages. For your second problem, if you downloaded a package for the program you're using, it might be looking for GIMP-print when it isn't installed on your computer. If you compiled it, you should check for a "./configure" option to disable GIMP-print. If the program can't run without GIMP-print for some reason, you might need to install it, though I'm not sure if it is compatible with DSL.

Hmmm, you are using a Gmail.com email address... Google has declared war on the independent media and has begun blocking emails from NaturalNews from getting to our readers. We recommend GoodGopher.com as a free, uncensored email receiving service, or ProtonMail.com as a free, encrypted email send and receive service. Thanks to addictive opioids, senior citizens are the new drug dealers (Natural News) Most people have a certain image that comes to mind when they imagine drug dealers. More often than not, it’s an unkempt younger man lurking in the shadows of a side street looking the worse for wear. Few people would expect to find an 85-year-old woman being charged with drug dealing, but this is exactly what is happening, in increasing numbers, thanks to the opioid addiction that is gripping the nation. Laura Viehdeffer, an 85-year-old New Yorker, told CBS2 that she was approached by a girl who said she heard she had some pills, so she said she gave them to her because she “felt sorry for her.” The girl in question turned out to be an undercover police officer, and Viehdeffer became the oldest person in her county to be charged with drug dealing after selling hydrocodone pills she was prescribed for arthritis for $10 each. She was given five years of probation. The Long Island Council on Alcoholism and Drug Dependence’s Steve Chassman said it is not uncommon to see senior citizens who get monthly prescriptions selling some of their pills to people they know or even on the street. He said that a 30-milligram pill of oxycodone could net someone as much as $30, which means a 90-day supply could give a much-needed boost to those who live on a fixed income. Experts believe that tougher sentences could help deter senior citizens from selling their pills, but prosecutors are sometimes reluctant to charge them in the first place, given their advanced age. Overprescription remains a big problem Wouldn’t a far better solution be to add stricter controls to prescription practices? Many of those selling the drugs must not truly be in the kind of debilitating pain that calls for opioid prescriptions, or their doctors are simply giving them many more than they need. A flawed system that sees doctors enjoying kickbacks from pharmaceutical companies means that some are giving these dangerous and highly addictive pills out like candy. In fact, a recent analysis found that some 68,000 doctors were bribed with $47 million by Big Pharma to prescribe such drugs between August 2013 and December 2015. The Inspector General’s Office of the Health and Human Services Department says that around 70,000 people on Medicare’s drug plan were given “extreme” amounts of narcotic painkillers last year; most people under this plan are older than 65. Half a million of those on the drug plan took these addictive drugs in amounts that are considered too big under CDC standards, and this figure has already accounted for those in hospice or with cancer who have a more legitimate need for such high doses. That report also showed that 678 people were given more than 1,000 milligrams per day for the whole year, which is a level that indicates they were giving their drugs to other people or selling them. Besides making ends meet, an Australian pharmacist has pointed to another reason some older people start selling their painkillers. Ewen McPhee told Australia’s ABC News that he had heard of elderly people being intimated by drug dealers outside of pharmacies and doctor’s offices. In some cases, they try to befriend the elderly people; in others, they may be threatening. In one case, a drug dealer pressured an older person into selling their drugs to help take the burden of their funeral bills off of their family. The opioid crisis is ruining lives in so many ways that it’s hard to even quantify the scope of the problem, and it’s clear that not enough is being done to control it. Get alerted on heavy metals and pesticide test results for foods and supplements Natural News is about to begin releasing lab test results for off-the-shelf food, supplement and pet food products, covering heavy metals, nutritive minerals, pesticides and herbicides. These details will be released exclusively to Natural News email newsletter subscribers (FREE) and will NOT be publicly posted on the website. To be alerted, join our free email newsletter now, and watch for lab test results in the weeks ahead. Enter your email address below to subscribe to our email announcement list (but don't use gmail). Your privacy is protected and you can unsubscribe at any time. If you don't join our email list, you may never see our valuable content again via Facebook, Google or YouTube. CENSORSHIP has now reached EXTREME levels across the 'net. The truth is being suffocated. Subscribe now if you want to escape the delusional bubble of false reality being pushed by Google and Facebook.

1. Field of the Invention The present invention relates generally to a device for use in vacuum casting and more specifically to a combination vacuum chamber and casting flask. This device is used in the process known as the lost wax method for producing precision castings which is often used in the dental and jewelry fields. This process begins with the pouring of an investment slurry into a flask which contains a wax model of the desired end product. Once the slurry has hardened, the flask and investment are subject to a burn-out treatment to thereby burn away the wax model. The flask is placed over a vacuum source in order to pull air through the hardened investment. Molten metal is then poured into the void left by the wax model, and is pulled into extreme portions of the void. The molten metal is then allowed to solidify and cool. 2. Description of the Prior Art Various types of casting flasks have been proposed in the prior art. For example, in U.S. Pat. No. 1,429,322 to Brophy, a casting flask is provided with holes in its side walls to thereby aid in the drying and burning out and heating of the investment compound. A sleeve is provided to slide over the flask so as to allow the investment slurry to be poured into the flask without pouring out through the holes. U.S. Pat. Nos. 1,473,278 and 1,490,090 to Burns disclose receptacles to hold different sized casting flasks. U.S. Pat. No. 3,780,787 to Rasmussen discloses a method of vacuum investment casting in which the investment is removed from the flask before molten metal is poured therein. The investment is cast with a shoulder portion which rests upon the upper edge of a vacuum chamber during vacuuming. The book by Murray Bovin entitled "Centrifugal or Lost Wax Jewelry Casting" discloses at pages 80-81, FIGS. 180-181, a prior art vacuum casting machine. This machine is very large and is prohibitively expensive for the small businessman. It also has the disadvantage that in its use, the casting flask is cooled considerably, first, because it is initially outside of the chamber and subject to ambient air, and secondly, because the chamber is much larger than the flask and thus a longer time is required in forming the vacuum which itself rapidly cools the flask. While each of these prior inventions has contributed to the casting process to various extents, there remains a need to improve upon the evacuation of air from the investment to thereby uniformly pull the molten metal into the mold. There is also a need to speed the vacuum process so as to cause less cooling of the flask. This cooling of the flask occurs at the rate of approximately 100.degree. F. for every minute it is exposed to the ambient air. Furthermore, the vacuum chamber and associated apparatus are often prohibitively expensive for the small businessman.

World’s Saddest Prom Happening in High School Otaku’s Basement Anime Maru is here to bring you live coverage of the hottest party happening tonight, the anime themed prom hosted by otaku high schooler Gavin Campbell within his parent’s basement. This party, planned in a drunken stupor half an hour ago as a reaction to the “social structures” that led to Gavin’s love confession to his longtime crush Charlotte Evans being rejected, is being held concurrently to that other lame prom that all of Gavin’s classmates are attending. Several of this season’s hottest anime figurines are attending this year’s prom. Fate/Stay Night’s Saber is attending the prom in a suit jacket and button-down shirt sans pants, and Rin Tohsaka is by her side stealing the show with an eye-catching maid uniform. Gintoki Sakatai is also in attendance wearing a very stylish white kimono, showing off far more swagger than that asshole jock Brad could ever pull off, and he could totally beat up Brad too. Of course, the eye of the ball is this year’s celebrity pairing, Gavin and his new girlfriend, Kosaki Onodera. Gavin has been heard flattering Onodera with compliments about what a nice and innocent girl she is, unlike that slut Charlotte who probably only decided to go to prom with Jackson because his daddy’s rich, which is totally how he got into Yale when he’d normally go to community college along with Gavin. Oh, and who’s this appearing on the basement carpet? Why it’s Gavin’s mother, sporting a horrified look on her face as she sees Gavin’s half dressed state and… oh, it appears our reporters are being escorted out. Well, that about wraps up our coverage of tonight’s party. But don’t worry, prom season isn’t over yet, and we’ll be here to bring you live coverage of every high school anime fan’s descent into self-pity that goes along with it! About the author Bob_Squob is neither a Bob nor a Squob, but they’re both common enough names to form an alias. After roaming the earth for 10,000 years with no purpose, he came upon Anime Maru, and thought to himself, “It is good. I will make my home here.” He currently resides in the darkness for fear that his taste in anime will be discovered and exploited as a weakness. Twitter: @Bob_Squob 4 thoughts on “World’s Saddest Prom Happening in High School Otaku’s Basement”

BP’s safety violations far outstrip its fellow oil companies. According to the Center for Public Integrity, in the last three years, BP refineries in Ohio and Texas have accounted for 97 percent of the “egregious, willful” violations handed out by the Occupational Safety and Health Administration (OSHA).

Preparation and performance of arsenate (V) adsorbents derived from concrete wastes. Solid adsorbent materials, prepared from waste cement powder and concrete sludge were assessed for removal of arsenic in the form of arsenic (As(V)) from water. All the materials exhibited arsenic removal capacity when added to distilled water containing 10-700 mg/L arsenic. The arsenic removal isotherms were expressed by the Langmuir type equations, and the highest removal capacity was observed for the adsorbent prepared from concrete sludge with heat treatment at 105°C, the maximum removal capacity being 175 mg-As(V)/g. Based on changes in arsenic and calcium ion concentrations, and solution pH, the removal mechanism for arsenic was considered to involve the precipitation of calcium arsenate, Ca3(AsO4)2. The enhanced removal of arsenic for the adsorbent prepared from concrete sludge with heat treatment was thought to reflect ion exchange by ettringite. The prepared adsorbents, derived from waste cement and concrete using simple procedures, may offer a cost effective approach for arsenic removal and clean-up of contaminated waters, especially in developing countries.

Summer heat waves can be deadly, particularly for vulnerable populations such as the elderly. Prior to a heat wave's arrival many cities warn their residents to take precautions such as making sure they drink enough water. But what are the best criteria for issuing a warning of an impending heat wave? A team of scientists from the New York City Department of Health and New York University Medical School compared different metrics used to predict these potentially lethal events **\[*EHP*** **118:80--86; Metzger et al.\]**. They found that New York City's current method of basing advisories on the maximum heat index provided a realistic prediction of mortality risk during hot weather. New York City is one of several places where alerts of excessive heat are triggered by rises in the maximum heat index, a combination of heat and humidity conditions that are forecast for the succeeding 24--48 hr. Alerts typically are issued when the maximum heat index is forecast to exceed 100--105°F (depending on location); some meteorological judgment can be applied by National Weather Service regional staff in whether to issue a heat alert. In other cities, alerts are triggered by certain spatial synoptic classification (SSC) categories. Under the SSC system, the dominant local weather pattern is categorized into one of several types depending on temperature, dew point, wind direction, wind speed, and cloud cover, as measured four times daily. The SSC categories classified as potentially dangerous weather patterns are determined for a local area by calculating the historical number of deaths in the local region associated with those weather patterns. The researchers evaluated models using the maximum heat index, the SSC, and maximum, minimum, and average temperatures to predict heat wave deaths in New York City between 1997 and 2006. They found the National Weather Service maximum heat index provided the most reliable prediction of heat-related deaths as confirmed by mortality data from the city's Office of Vital Statistics, with a spike in the magnitude of the heat--mortality association at maximum heat indices of 95--100°F. Using more variables such as wind speed and precipitation in forecasting heat waves improved the predictive models slightly but also complicated the task of translating complex forecasts into meaningful public health messages. The authors conclude New York City officials should continue to issue heat alerts when the maximum heat index is forecast to exceed 95--100°F. They also say that repeated warnings should be issued throughout the heat wave and as the maximum heat index increases. Before other cities adopt use of the maximum heat index, however, they should conduct their own analyses with local data. {#f1-ehp-118-a35b}

JSW, India's biggest steelmaker, and Duferco had a prepayment deal in 2006 for $150 million in upfront cash that would be repaid over seven years with steel cargoes, but the scale of the proposed new deal is much larger.

Vesicular release of glutamate mediates bidirectional signaling between astrocytes and neurons. The major excitatory neurotransmitter in the CNS, glutamate, can be released exocytotically by neurons and astrocytes. Glutamate released from neurons can affect adjacent astrocytes by changing their intracellular Ca(2+) dynamics and, vice versa, glutamate released from astrocytes can cause a variety of responses in neurons such as: an elevation of [Ca(2+)](i), a slow inward current, an increase of excitability, modulation of synaptic transmission, synchronization of synaptic events, or some combination of these. This astrocyte-neuron signaling pathway might be a widespread phenomenon throughout the brain with astrocytes possessing the means to be active participants in many functions of the CNS. Thus, it appears that the vesicular release of glutamate can serve as a common denominator for two of the major cellular components of the CNS, astrocytes and neurons, in brain function.

Q: Show Button 5 seconds after program start Does someone know how to show a button (Javafx) 5 seconds after the program start. It is a button that allows to go to the next page. A: Just use PauseTransition and set event handler on finished transition. Start your transition on primary stage on shown event handler. Button delayedButton = new Button("Next"); delayedButton.setVisible(false); primaryStage.setOnShown(ev -> { PauseTransition pt = new PauseTransition(Duration.seconds(5)); pt.setOnFinished(e -> { delayedButton.setVisible(true); }); pt.play(); });

Dec 30, 2014 Exhibition of Design for Resilience at BAC w/ Terreform ONE Exploring the Rebuild by Design proposals, along with new work from Terreform ONE, opens a window that suggests how Boston could arrive at a safer tomorrow.Design for Resilience, Boston Architectural College (BAC), McCormick Gallery, MA. Terreform ONE projects: Governors Hook, Resilient Water Infrastructure, and Urbaneering. Terreform ONE A non-profit design group that promotes smart design in cities. Through our creative projects and outreach efforts, we aim to illuminate the environmental possibilities of New York City and inspire solutions in areas like it around the world. Search This Blog Translate Profile Mitchell Joachim is the Co-Founder of Terreform ONE and an Associate Professor of Practice at NYU. Formerly, he was an architect at the offices of Frank Gehry and I.M. Pei. He is a TED Senior Fellow and has been awarded fellowships with Moshe Safdie and Martin Society for Sustainability. He was chosen by Wired magazine for "The Smart List” and selected by Rolling Stone for “The 100 People Who Are Changing America”. Mitchell won many awards including; AIA New York Urban Design Merit Award, 1st Place International Architecture Award, Victor Papanek Social Design Award, Zumtobel Group Award for Sustainability, History Channel Infiniti Award for City of the Future, and Time magazine’s Best Invention with MIT Smart Cities Car. He's featured as “The NOW 99” in Dwell magazine and “50 Under 50 Innovators of the 21st Century" by Images Publishers. He co-authored the books, “Super Cells: Building with Biology” and “Global Design: Elsewhere Envisioned”. His design work has been exhibited at MoMA and the Venice Biennale. He earned: PhD at Massachusetts Institute of Technology, MAUD Harvard University, MArch Columbia University.

A self-proclaimed nerd attempts to decipher the world of cosmetics and fashion. 23 August 2011 How To Cheat at a French Mani Hello, there! Well, I figured out a way to make a French Mani easier than using globs of white "French Tip" polish. I got the idea from bubzbeauty on YouTube, and tweaked it a little, to use what I had. Here are pics of the finished product: Ya like my Hello Kitty spoon? Got it at Yogurtland. Hellz yeah. The pics don't do it justice. I mean, it's not GLITTER, but it still makes the mani look polished and clean with that extra oomph. It shimmers like a Twilight vampire's skin... D: I might do a video tutorial on it; I might not. I don't think I'd be very good at editing, but we'll see.

As China Hacked, U.S. Businesses Turned a Blind Eye - derchu https://www.npr.org/2019/04/12/711779130/as-china-hacked-u-s-businesses-turned-a-blind-eye ====== watertom Forget about the hacking. U.S. business walked into China and handed over all of their technology and Intellectual Property, just to have it used against them by the Chinese government. China has only resorted to hacking lately in order to get more technology and IP. ~~~ TaylorAlexander And I think that’s a good thing. Intellectual Property is harmful to most and only benefits a few. If we abandoned the notion we’d be better off. ~~~ NicoJuicy Samsung spend 130 million on research on bendable phones. It got stolen by China. How can that be justified? [https://edition.cnn.com/2018/11/30/tech/samsung-china- tech-t...](https://edition.cnn.com/2018/11/30/tech/samsung-china-tech- theft/index.html) ~~~ rcw4256 As a result of this 'theft', consumers now have more bendable phone options. ~~~ sgt101 But in the future they will see less innovation as R&D is further slashed. ~~~ izacus I see this thrown around all the time when we talk about monopolizing IP and having huge corporations put their lawyer boots on smaller company throats... but is it really true? Will making IP protection weaker actually stifle innovation? Was innovation in industrial era hugely stuffled by not protecting every single patent a huge multi-national conglomerates throw out? ~~~ sgt101 Well, yes, hence the development of patents. "The English patent system evolved from its early medieval origins into the first modern patent system that recognised intellectual property in order to stimulate invention; this was the crucial legal foundation upon which the Industrial Revolution could emerge and flourish." ([1]Wikipedia) Without patents what you do is create trade secrets, patents publish the concepts that are protected, they are fully disclosed (or the patent is junk) and after 25 years _anyone_ can use them. The 25 years is the time that you have to get payback on your invention - forcing investment in development _now_ before your monopoly expires. [1] [https://en.wikipedia.org/wiki/Patent](https://en.wikipedia.org/wiki/Patent) ------ CharlesColeman > Hickton opened an investigation and quickly set his sights on a special unit > of the Chinese military — a secretive group known as Unit 61398. > Investigators were able to watch as the unit's officers, sitting in an > office building in Shanghai, broke into the computer systems of American > companies at night, stopped for an hour break at China's lunchtime and then > continued in the Chinese afternoon. > ... > But when Hickton went to the companies, eager for them to become plaintiffs, > he ran into a problem. None of the companies wanted any part of it. Hickton > says they had too much money on the line in China. There really ought to be a law that mandates that 1) companies disclose any and all hacking incidents/data breaches they become aware of and 2) co-operate with the government in the investigation of those breaches. Though I'm a little confused why they would need the "the companies to become plaintiffs." Wouldn't hacking be a criminal matter that's would be directly prosecuted by the government? Did they want to go against the hackers both criminally and civilly? ~~~ subcosmos Why is it that intelligence agencies are still conducting their activities during their countries working hours? You'd figure it would be easier to find nocturnal neckbeards anyways. ~~~ scintill76 In this case, the timezones probably line up to make Chinese working hours the best time to do this work. ------ _cs2017_ > unfair business practices originating from China are costing the American > economy more than $57 billion a year, White House officials believe And yet the companies who supposedly lose that money don't care. It reminds me a little of the $200-250B "lost" to piracy by the movie and music industry ([http://freakonomics.com/2012/01/12/how-much-do-music-and- mov...](http://freakonomics.com/2012/01/12/how-much-do-music-and-movie-piracy- really-hurt-the-u-s-economy/)). To be more precise it reminds me of how everyone likes to create large impressive numbers that prove their point or support their agenda. ~~~ westiseast I suspect the amount is a mix of things: * Investment in IP that then gets stolen. * Loss of potential earnings as American companies are locked out of Chinese markets * Loss of actual earnings as American/global consumers switch to Chinese companies (eg huawei) that are accused of unfair business practices or receiving unfair government subsidies. Some companies “don’t care” because they aren’t actually losing money, they’re just not making as much as they could be. But other companies are ‘coerced’ into not caring because what happens if they complain? They lose Chinese government contracts. They effectively admit to shareholders that their IP has been stolen and lost. They waste time and resources fighting unwinnable legal battles against Chinese national champions (ie. the Chinese state). I’ve met plenty of small/medium sized business owners who are so sickened by their experiences with China and the Chinese market that they’re happy to just ignore it all and save themselves the heartache. ~~~ _cs2017_ If you count being locked out of the Chinese markets, I think the number is actually much, much larger than $50B. But that seems to be rather unrelated to hacking? In fact most countries openly or secretly try to lock out foreign owned businesses. If the point is that China does it more than others, perhaps it's true, but it's a lot more complex issue than outright hacking. ~~~ westiseast I think the hacking and being cut out of domestic markets is fairly closely linked. If you’ve already stolen the IP, you don’t need to let the foreign business in to provide that service. Possibly even more widespread though has been the standard practice over the last 20 years of lettin foreign businesses setup shop in China, hacking/stealing all their tech, then the state uses its legal/political resources to make life horrendously difficult for the original foreign business. ------ aristophenes The government sponsored professional hacking team that was mentioned in the article was the focus of the infamous APT1 report by Mandiant (now FireEye), with investigations from 2006 and later: [https://www.fireeye.com/content/dam/fireeye- www/services/pdf...](https://www.fireeye.com/content/dam/fireeye- www/services/pdfs/mandiant-apt1-report.pdf) There have been many APT groups named and tracked since then, not just in China. ~~~ tgragnato Oh, memento. Those events fit the climate described in the article. > Intrusion Truth's controversial approach of anonymously unmasking > government-backed hackers and exposing a foreign intelligence agency is > something new and seen as a method to put pressure on Chinese companies > cooperating with state-sponsored hacking efforts. [https://www.zerohedge.com/news/2018-10-04/intrusion-truth- my...](https://www.zerohedge.com/news/2018-10-04/intrusion-truth-mysterious- group-doxing-chinas-hacking-army) \- [https://motherboard.vice.com/en_us/article/wjka84/intrusion-...](https://motherboard.vice.com/en_us/article/wjka84/intrusion- truth-group-doxing-hackers-chinese-intelligence) \- [https://twitter.com/intrusion_truth](https://twitter.com/intrusion_truth) \- [https://intrusiontruth.wordpress.com](https://intrusiontruth.wordpress.com) ~~~ dmix Also even naming the group APT which was a corporate buzzword at the time (for advanced persistent threat aka anything above script kiddies and aimless bots). ~~~ Spooky23 APT is anything that happens to you. ------ rrggrr USGOV and all but the largest businesses don't mesh. The solution to the spying threat is extending tort liability and statutory damages to negligence when there are compromises. Not different than product safety, liability will make quick work of the problem. ~~~ nostrademons Who's the plaintiff in your suggestion? The article is not about companies leaking Americans' private data to China (though I'm sure that happens too), it's about them turning a blind eye when _their own_ company confidential technology and product designs are stolen by China. For tort liability to be a factor here, the company would have to initiate a lawsuit against itself, which would never happen. The type of industrial espionage described in the article is actually a form of temporal arbitrage - it's present shareholders stealing from future shareholders and then hoping to unload the shares before the consequences of their decisions are reaped. In order to get access to the lucrative Chinese market _now_ (and goose this quarter's earnings), they put up with Chinese industrial espionage that results in reduced competitiveness 10 years down the road. In 10 years, they probably won't be working at the company, nor will they hold many shares, and so the consequences don't affect them personally. This is a big problem in general (not just with industrial espionage - short- termism also affects labor practices, financial health, social fabric, environmental pollution, and global warming), but it's hard to see how any legal solution would fix it. Future shareholders are generally not entitled to sue until they actually become shareholders, at which point everybody says "Well, you should've known how fucked up the company was when you bought the shares". Similarly, unborn children don't get a vote on societal policies that may destroy the earth or society they live in before they're born. Usually the best alternative is just to deal with the problem with band-aids in the future, once it becomes widely recognized as a problem. ~~~ pm90 > In order to get access to the lucrative Chinese market now (and goose this > quarter's earnings), they put up with Chinese industrial espionage that > results in reduced competitiveness 10 years down the road. Alternate reality: they stay alive instead of being hammered in earnings by their competitors, invest increased earnings to get better at security and prevent future data exfiltrations, use their existing corpus of innovation to get even more competitive and continue to exist long into the future. Innovations are important and must be protected. But the short-sightedness of today is partially driven by a change in reality: the rate of technological advances is brutally fast. ------ sonnyblarney "When I pressed them on why they were not taking stronger action against China, their response was, 'We have a multifaceted relationship with China.' " And this is it: don't want to upset the promise future sales. And this is how 'dividing and conquering' works. One side speaks with 'one voice', the other with 'thousands of little voices' \- and it's game. ~~~ creato And the one company highlighted in the article as speaking out is on the verge of being broken up by Western governments. The western world is being played like a fiddle. Negotiating power is everything, and western democracies and their private and corporate citizens have absolutely none compared to autocratic regimes. ~~~ math_and_stuff That one company has also completely reversed its stance over the last year and now openly defends censoring human rights and complying with the CCP's surveillance demands. Google has no reason to hold its head high. ~~~ vatueil Why is Google singled out for reprobation when, as the article points out, they've spoken out more than other companies? Sure, no one is spotless, but as it stands it's Microsoft that runs a censored search engine (Bing in China) and Apple that handed over its Chinese users iCloud encryption keys. To be fair, you could say Apple and Microsoft had their reasons for doing so (as people including the Chinese themselves have argued). But why all the focus on Google then? Is the idea of a Chinese search engine (which has since been cancelled) worse than actually running a censored search engine such as Bing China? It's gotten to the point where people commonly think Google is cozier with Chinese authorities than other companies, when if anything it's the opposite. That seems perverse. ~~~ math_and_stuff I completely agree with the argument that Google is no worse -- and have publicly campaigned to this effect -- but I was responding to the claim that Google should be proud of its history of standing up against authoritarian pressure. It no longer deserves that honor. But, yes, Microsoft and Apple are equally, if not more, deserving of shame. ------ paulcarroty “Honey or condensed milk with your bread?” he was so excited that he said, “Both,” and then, so as not to seem greedy, he added, “but don’t bother about the bread, please.” (c) Winnie the Pooh ------ novaRom I remember iRobot was quite popular few years ago here in Europe, today everybody buys much cheaper Chinese devices. Same about smartphones: Apple/Samsung->Huawei. Same about Quadrocopters. It looks like it's just a matter of time until CPUs, GPUs, FPGAs, E-vehicles will be designed/produced by Chinese companies. ------ novaRom Look, you can really protect your intellectual property in Europe and in USA, but you cannot do that in the rest of the world. It means your innovations will be copied and much cheaper products will be created. You can protect your own internal national market, but you cannot compete on all the remaining world markets. So what to do? End of intellectual property? Back to trade secrets? Even this will probably not help in long term. ------ aheneghana China hacked. Because it seems they are better at their job than their counterparts in the U.S. - saw first hand their capability. Small cubicles, 3 sq yd, 30 in a row, all with different language skills, ( any language ), Computer science graduates from the No 1 University in China. Pay is a fraction of what a compatible grad is being paid in the U.S. No competition. High pay won't make the leverage. ------ anonymous_fun I saw Mr. Hickton speak a few nights ago. It was really an interesting talk about some of the challenges for the future: [https://www.youtube.com/watch?v=8Zktw-m5hTI](https://www.youtube.com/watch?v=8Zktw-m5hTI) ------ freeflight It's super weird how everybody considered Trump odd for his hate for China, yet these days so many people just repeat the, usually completely baseless, anti-China FUD. Whether it's Huawei supposedly spying on everybody or the Chinese government putting implants on Super Micro boards, nothing is too absurd to be spread by, out of all parties, Five eyes themselves. Does China hack? Of course, so does the US, it even steals IP from allies. But I seriously doubt the damages for that go into the $57 billion, that's just a piracy-damages like inflated number. In reality, a whole lot of interesting innovation, particularly on the hardware level, has already been happening in China for years already. They gonna out-make the US maker movement, on a massive scale [0]. [0] [https://youtu.be/SGJ5cZnoodY](https://youtu.be/SGJ5cZnoodY) ~~~ whenchamenia There is plenty of truth to much of the china situation, not just FUD. While the Potus has bounced between 'i love china' and 'we need to do something about these people', the rampant IP theft negatively affects nearly everyone on HN. ~~~ freeflight > There is plenty of truth to much of the china situation, not just FUD. Yet FUD is all we get and people eat it up like the best thing ever. Even here on HN barely anybody questioned the Super Micro narrative, even tho that Bloomberg story was super sketchy from the very beginning by not disclosing who did that audit, just like their inability to produce a sample of the chip. Trump also never "bounced" on China, China is pretty much the only thing he doesn't bounce on, it's been his one constant since the election [0] and just because he throws an "I love China" in there, does not reflect or change any of his policy decisions. This is much more "I love my enemies because they are so stupid" posturing [1] than an declaration of actual sympathies. [0] [https://www.youtube.com/watch?v=RDrfE9I8_hs](https://www.youtube.com/watch?v=RDrfE9I8_hs) [1] [https://abcnews.go.com/Politics/10-times-trump-attacked- chin...](https://abcnews.go.com/Politics/10-times-trump-attacked-china-trade- relations-us/story?id=46572567) ------ netsa I think the root cause is because of China has no human-rights. ------ adinobro How is this any different to the NSA and Chinese companies? We already know the NSA did this to Huawei for multiple years. ~~~ wpasc One could make the case that Chinese businesses and governments have a tighter relationship where the fruits of such hacking could be used to benefit businesses. While the NSA/other US gov agencies may be hacking chinese companies, I have yet to see any indication that it is done for the purposes of IP theft and/or anything is being shared with US businesses. ~~~ hansjorg [https://www.bbc.com/news/world- europe-32542140](https://www.bbc.com/news/world-europe-32542140) ~~~ Mindless2112 "[Checking] whether European companies were breaking trade embargos" is not the same as government-assisted industrial espionage. ~~~ hansjorg The EU claims information obtained by the US government was fed to amongst others Boeing and McDonnel Douglas.

The use of polymeric materials for medical devices is an area where vast improvements in polymeric materials have evolved and are still evolving. Physical properties of these polymers can be fine tuned for use in different environments or to behave in a predictable manner. Polymers for use in fabricating IOLs need to be adapted allowing for smaller incisions during implantation. In addition to polymers with physical properties adapted for use in the optic region, polymeric material can be adapted for various applications elsewhere. Various medical devices other than optic implants can incorporate elastomeric polymeric material, for example, implantable medical device coatings, breast implants, prosthetic joins and other body augmentation implants. These types of applications each require polymeric material that may be vastly different from another. The ability of a skilled artisan is necessary to fine tune the physical properties of the polymers. In addition to medical devices and medical device coatings, polymeric material can be incorporated into topical formulations. A low degree of polymerization can be used, for example, to form a more liquid polymeric material which can be useful in such formulations as eye drops or hair sprays. Increasing the degree of polymerization can cause the polymer to become more viscous wherein the polymer may be useful in skin creams or lotions. The degree of polymerization can be tailored for the appropriate application and various other variations are possible. In the area of ophthalmic devices, IOLs have been designed for ever smaller incisions in the eye. Elastomeric IOLs are typically implanted using inserters to roll or fold the IOL, insert the IOL into the capsular sac, and then allow the IOL to unfold once inside. Occasionally, the fold of the IOL before insertion may result in permanent deformation, which adversely affected the implant's optical qualities. Further, while foldable IOLs have eliminated the need for the large incision, foldable IOLs are not without drawbacks. In particular, both non-deformable and foldable IOLs are susceptible to mechanical dislocation resulting in damage to the corneal endothelium. Another approach to small incision IOL implantation uses an elastomeric polymer that becomes pliable when heated to body temperature or slightly above. Specifically, the IOL is made pliable and is deformed along at least one axis, reducing its size for subsequent insertion through a small incision. The IOL is then cooled to retain the modified shape. The cooled IOL is inserted into the capsular sac and the natural body temperature warms the IOL at which point it returns to its original shape. The primary drawback to this type of thermoplastic IOL is the limited number of polymers that meet the exacting needs of this approach. Most polymers are composed of polymethylacrylate which have solid-elastomeric transition temperatures above 100° C. Modifications of the polymer substrate require the use of plasticizers that may eventually leach into the eye causing harmful effects. Dehydrated hydrogels have also been used with small incision techniques. Hydrogel IOLs are dehydrated before insertion and naturally rehydrated once inside the capsular sac. However, once fully rehydrated the polymer structure is notoriously weak due to the large amount of water absorbed. The typical dehydrated hydrogel's diameter will expand from 3 mm to 6 mm resulting in an IOL that is 85% water. At this water concentration the refractive index (RI) drops to about 1.36, which is unacceptable for an IOL since lower RI materials require the optic to be thicker to achieve a given optical power. Modern acrylate IOLs generally possess excellent mechanical properties such as foldability, tear resistance and physical strength. Acrylate IOLs also are known to possess desirable optical properties (transparency, high refractive index, etc.) and biocompatibility. While pure acrylic IOLs have desirable mechanical, optical and biological properties, they may have unacceptable molecular response times such that the folded or compacted IOL may not unfold as quickly as desired. A pure acrylate IOL fabricated to have a relatively fast molecular response time may be extremely tacky and lack the desired mechanical strength. In this case, the resulting IOL may tear and/or the resulting self-tack can unfolding difficult. Pure silicone IOLs generally possess excellent mechanical, optical and biological properties similar to pure acrylate IOLs. Unlike acrylic IOLs, silicone IOLs generally possess faster molecular response times. In fact, the silicone IOLs may be so responsive that when folded small enough to be inserted through a 3 mm or smaller incision, the stored energy can cause the IOL to unfold more quickly than desired. There is a need for a polymeric material with a molecular response time which makes it suitable for use near fragile body tissues, such as within the eye of a subject. There is also a need for ophthalmic devices in which one polymeric material is useful for both low modulus and high modulus elements of a single device to, inter alia, simplify the multi-part polymeric article manufacturing process and create better integrated multi-part polymeric articles in which the various elements of the device have a common value of a property such as a refractive index, but a different value of another property such as modulus, tensile strength, resiliency, or the like.

In our continuing effort to expand the Dashboard, the following items have been added: New Categories for your personalized portal window: New categories have been added for each group in ET&S Business Development and Marketing. This gives each group the ability to post/publish their information on the dashboard for viewing. These new categories are listed below: ? Storage Services ? Risk Mgmt & Report ? Pricing & Structuring ? North Power Bus Dev ? South Power Bus Dev ? Offshore Bus Dev ? North LDC Team ? Central LDC Team ? Marketing Analysis ? Information Services To add these new categories to your dashboard simply click on the personalize button, highlight the new available category in Pane 1 (left), Pane 2 (center), or Pane 3 (right) and click on the add button. This action will move this category from available to the bottom of the selected categories. If you would like to change the order within a pane you click on the selected category then move it up or down using the arrows to the right of the selected categories pane. You then click save to exit the personalize screen and return to the dashboard. If you have any problems or questions please contact Bobby Mason @ (713) 853-5196 or Martha Janousek @ (713) 853-7275.

Share Sponsor A crowd gathers around Cousins Maine Lobster, a food truck in Los Angeles owned by cousins Sabin Lomac and Jim Tselikis. Lomac and Tselikis grew up in Scarborough and Cape Elizabeth, respectively. Photo: Courtesy Cousins Maine Lobster Jim Tselikis, left, and Sabin Lomac, owners of Cousins Maine Lobster. Photo: Courtesy Cousins Maine Lobster Lobster tacos with cabbage, pico de gallo and a spicy cilantro-lime sauce. Photo: Courtesy Cousins Maine Lobster Lobster martini: Naked lobster meat and a lobster-stuffed olive. The result is Cousins Maine Lobster, a crustacean-centric food truck recently launched on the streets of Los Angeles by Sabin Lomac, 31, originally from Scarborough, and Jim Tselikis, 27, who grew up in Cape Elizabeth. Lomac and Tselikis have fresh lobster flown across the country the day before its served to customers. They won't identify their distributor: "We don't want our competitors out here exploiting our local connections," Tselikis said in a telephone interview. In L.A. the lobster is served in rolls, bisque, tacos or even as a "martini" – naked in a glass. If all goes according to the business plan, the lobster will be cooked and eaten before it's been off the ocean floor a day. For the two cousins, the business venture is about more than just cooking and cashing in on the West Coast food truck culture. It's about home. "Jimmy and I, we're proud of where we're from," Lomac said. "This reminds me a lot of he and I as kids, getting together and all of us cooking lobster or going to Two Lights and having lobster rolls." The food truck opened last weekend at an event in Artesia, Calif. Tselikis said they served about 200 people on opening day, with lobster rolls priced at $13 leading their sales. And while fresh Maine seafood is a key selling point for the duo, it's just part of what they're trying to achieve with Cousins Maine Lobster. On the outside of the food truck is a plasma TV, where they show videos of lobstermen out on the open ocean. Lobster traps, familiar to anyone in coastal Maine, are spread around the truck as impromptu chairs, tables or conversation pieces. Buoys, too. "We're trying to create an experience for people," Tselikis said. "They're getting the freshest product, but they're also getting conversations with local Mainers, seeing that connection to Maine and getting information about an industry that's not really well known out here." Lomac, a real estate broker and actor, has lived in Los Angeles for about six years. Tselikis lives in Boston and flew out to LA to help with the first couple weeks of operations. He also turned to his sister, Annie Tselikis, who works for the Maine Lobstermen's Association, as a resource on the cultural education that comes with eating at Cousins Maine Lobster. "We thought it was important to have one of the owners out here with our director of operations and our staff, and to have the other guy, myself, on the East Coast so we can make sure our product, coming from our vendors, is going as smoothly as possible," Tselikis said. The two cousins grew up together, but drifted apart when Lomac went to New York to pursue acting. Eventually he moved to L.A. They reconnected about three years ago. "We started thinking of how we could work together and create something cool," Lomac said. "This is what we came up with, and it's amazing to see it become a reality." Both cousins are nostalgic for their time spent growing up in southern Maine. Lomac recalled working at many of Scarborough's seafood institutions: Ken's, The Clam Bake and Dimitri's. Tselikis talked about how excited he is to bring Maine lobster to people who may never have had it. "We're just spoiled with it growing up," he said. "It's so accessibly in Maine. People (in L.A.) don't get to have that experience." Maine lobster, Homarus Americanus, is found only in the waters of the North Atlantic. Its distant relative, the "spiny" or "rock" lobster, can be found in the waters of California. Dr. Robert Bayer, executive director of the The Lobster Institute in Orono, said that while its probably not as fresh as Cousins' product, most Angelinos who have eaten lobster probably ate the Maine variety, not its shrimpy, spiny cousin. There's even an L.A. Lobster Festival held every year, at which Maine lobster is served. "Everybody seems to like their own lobster," Bayer said. "But it's my impression that there's not a huge demand for the spiny lobster, even in California. When I've been out there, I've never even seen one." He said its the cousins' connection to the Maine coast that will let them stand out against their competition. "Having Maine guys out there, selling directly to the consumer, I bet they do well, if the price is right," Bayer said. Tselikis said people out West appreciate the "Maine mentality" the cousins bring to their business. He describes it as kind of a folksy demeanor, some kind of whimsical Maine-ness inherent to people who grew up in the Pine Tree State.

Gaza truce holding as 10,000 Israelis join protests in Tel Aviv A fragile ceasefire extension between Hamas and Israel enters its second day Friday, as thousands of Israelis call on government and army to end Palestinian rocket attacks from Gaza once and for all People hold signs during a rally in Tel Aviv's Rabin Square, to show solidarity with residents of Israel's southern communitiesPhoto: Reuters By AFP 7:44AM BST 15 Aug 2014 A fragile ceasefire extension between Hamas and Israel entered its second day Friday as the two sides in the Gaza conflict ponder Egyptian-mediated efforts to secure a lasting peace. Egyptian mediators brokered the five-day extension to an existing truce to allow for further negotiations on a long-term ceasefire to fighting that has killed 1,962 Palestinians and 67 people on the Israeli side since July 8. The calm held throughout Thursday, after a flurry of Hamas rocket attacks and Israeli air strikes the previous night, even if great uncertainty persists on both sides about the future. As the ceasefire continued, the Wall Street Journal reported Thursday that Israel secured supplies of ammunition from the Pentagon last month without the approval of the White House or the State Department. President Barack Obama's administration, caught off guard as it tried to restrain Israel's campaign in Gaza, has since tightened controls on arms shipments to Israel, the newspaper said, quoting US and Israeli officials. Around 10,000 Israelis poured into Rabin Square in Tel Aviv late Thursday, police said, calling on the government and the army to end Palestinian rocket attacks from Gaza once and for all. It was the first major demonstration in Israel since the fighting began and organisers said it united people across often bitter divides of left and right-wing, as well as religious and secular communities. "This is a universal principle. We want to live in peace," Alon Davidi, mayor of the southern town of Sderot, told the rally as Israel's security cabinet met to discuss the mediation in Cairo. "I have full confidence in the government and in the army, but at the same time I ask as mayor of Sderot that they put an end to this situation once and for all," Davidi said. Members of the crowd waved Israeli flags and held up banners calling for peace with the Palestinians and others scrawled with the words: "Occupy Gaza now!" A man holds a sign during a rally in Tel Aviv's Rabin Square (Reuters) The Egyptian foreign ministry said both sides had agreed to extend the ceasefire for five days to allow more time for thorny negotiations. Palestinian chief negotiator Azzam al-Ahmed said the delegations had reached "agreement on many points" concerning the lifting of Israel's eight-year blockade on Gaza but needed more time to settle a number of remaining disputes. Israel confirmed it accepted the Egyptian proposal. "We're honouring the ceasefire and let's see what Hamas does," a senior official told AFP. Israeli negotiators and various members of the Palestinian delegation have left Cairo for consultations with their respective bases and are not expected to return before Saturday night at the earliest. The Israeli security cabinet met on Thursday and discussions were expected to continue on Friday. Speaking to reporters in Gaza City, Hamas politburo member Khalil al-Haya said there was "still a real chance of reaching an agreement", but only if Israel "would stop playing with words". If observed, the latest truce should herald potentially the longest period of calm in the five-week conflict. An earlier truce collapsed in a firestorm of violence on August 8. Egyptian mediators have proposed that talks on a seaport and airport in Gaza be delayed until a month after a permanent ceasefire takes effect, according to documents seen by AFP. Negotiations over the exchange of the remains of two dead Israeli soldiers for the release of Palestinian prisoners held by Israel would also be postponed. An Israeli-imposed buffer zone inside the Gaza border would be gradually reduced, and eventually policed by forces under the command of Palestinian president Mahmud Abbas. Israel has said it will facilitate Gaza's reconstruction only if the enclave is fully disarmed, a demand rejected by the Palestinians. The conflict has seen a surge in tensions in the West Bank, including Israeli-annexed east Jerusalem. Police arrested 52 Palestinians in east Jerusalem overnight, taking to more than 600 the number of alleged rioters detained since unrest erupted in early July over the hate killing of a Palestinian teenager by Jewish extremists.

Please Note: As of Sep 29, 2009, we are disallowing the creation of new accounts, which are required for editing and creating pages. If you need an account and have a CS NetID, please send email to CS Staff. If you do not have a CS NetID, please request someone who does send the request on your behalf. This wiki exists as an experiment to see how it can be used for interaction and collaboration in an academic context (see here). CS community members are to feel free to create pages and experiment (non-CS community members see above). Please note that anything you post here is subject to editing by fellow users! 1: Not really a table of contents because a wiki doesn't have a single hierarchical layout. Pages can be organized into namespaces, folders, and Categories. For an index by namespace and page title, use this page.

Q: cloning a private git repo in jenkins, bitbucket I am having errors cloning a private bitbucket repo with Jenkins. I've followed the debug steps from here: https://wiki.jenkins-ci.org/display/JENKINS/Git+Plugin Create ssh keys Added ssh key to bitbucket as a deployment key Successfully cloned that repo with that ssh key in my user account on the server Copied keys and known hosts into C:\Windows\SysWOW64\config\systemprofile.ssh Checked that the Jenkins service was running under local system account Start build and then -> Error What am I doing wrong? ERROR: Error cloning remote repo 'origin' : Could not clone ssh:///[email protected]:myUsername/myRepo.git hudson.plugins.git.GitException: Could not clone ssh:///[email protected]:myUsername/myRepo.git Caused by: hudson.plugins.git.GitException: Command "git.exe clone --progress -o origin ssh:///[email protected]:myUsername/myRepo.git C:\Program Files (x86)\Jenkins\workspace\myProject" returned status code 128: stdout: Cloning into 'C:\Program Files (x86)\Jenkins\workspace\myProject'... stderr: ssh: connect to host port 22: Bad file number fatal: The remote end hung up unexpectedly A: Ok, dumb fix. In jenkins I was putting in the reqpository url in the project configuration like their example ssh://[email protected]:me/project.git Which was incorrect, it should be [email protected]:me/project.git

1. Field of the Invention The invention relates to a trash receptacle. More particularly, the invention relates to a three-part snap together trash receptacle having a base portion designed to store a plurality of trash bags, a body portion designed to store a single trash bag full of trash in such a way as to allow the full bag to be easily removed from the body portion, and a lid portion that seals the body portion closed. 2. Background and Related Art There are numerous problems associated with standard household trash receptacles that have made trash storage and removal a dreaded task. Perhaps the most frustrating task is attempting to remove a full bag from the receptacle. This is often rather difficult because the trash stored in the bag tends to bulge against the walls of the trash receptacle, thus making it difficult to remove. In addition, as the bag is filled up, air is often trapped between the bag and the receptacle walls. This causes a vacuum effect that makes it even more difficult to remove the full bag. Because a full bag is so difficult to remove, when the bag is pulled straight upward, the entire receptacle often lifts up with the bag rather than the bag lifting out of the receptacle. Therefore, the user must often call on the assistance of another person to hold the receptacle steady, or else the user must squeeze the receptacle between the knees while pulling the bag out. Another problem with conventional style trash receptacles is that they do not force trash to be compacted within the receptacle. Therefore, when the full bag is removed, the user must attempt to shake the trash further down into the bag and compact it so that the bag may be tied shut. Yet another drawback is that twist ties or other such fastening means are not provided with the receptacle, thus forcing the user to search for a tie each time a bag is removed. Still further, once the full bag of trash has been removed from the receptacle, the user must also locate a new bag to put in the receptacle. Unfortunately, even properly positioning a new bag within conventional trash bags is often difficult because the walls of the empty bag tend to cling together in the center of the receptacle rather than fitting against the walls and bottom of the receptacle. This is especially undesirable as the bag begins to be filled, as air becomes trapped between the wall of the container and the bag. This prevents the bag from being completely filled, and makes it difficult to remove the bag from the receptacle once it is filled with trash. To date, very few solutions have been proposed for remedying these problems associated with trash receptacles. Rather, it seems that more attention has been giving to improving the design of trash bags instead of that of trash receptacles. For instance, one such improvement includes the implementation of an integral pull-tie means around the upper edge of the trash bags so as to allow bags to simply be pulled closed when full rather than forcing the user to search for a fastener. While this and other such improvements may solve some of the above described problems, no prior art trash receptacles have been designed to solve the above described difficulties associated with conventional trash receptacles. Thus there is a clear need for an improved trash receptacle device that remedies the above described problems. Such a device would contain up to an abundant supply of ties and bags, and would present the bags in a way that automatically dispenses a new bag in place once the full bag is removed. Such a device would also be designed specifically to ensure that the bag fills in a compact manner, and would also make it extremely easy to remove full bags. The present invention provides these and other such advantages as further detailed in the following Summary of the Invention.

Casa Font-Ubides Casa Font-Ubides (English: Font-Ubides House), also known as the Residencia Monsanto (English: Monsanto Residence) is a historic building located on the north side of Castillo Street in Ponce, Puerto Rico, in the city's historic district. The building dates from 1913. It was designed by the architect Blas Silva. The architecture consists of 19th Classical revival and Art Nouveau architectural styles. The building is of architectural significance for its aggressive incorporation of curvilinear forms and ornaments. The complete preservation of the original architecture of the Monsanto Residence, its unique design amongst the houses of Ponce, and its location within the historic urban core of the city qualify it as one of a series of grand houses and an integral part of the character of Ponce. Significance The Monsanto Residence at Calle Castillo No.34 is an architectural landmark in the city of Ponce. Designed by the well-known architect Blas Silva in 1913, the residence stands out among the great houses of Ponce for its aggressive incorporation of curvilinear forms and ornament. Adapting the curves of the "Art Nouveau" to the persistent Neo-classicism of Puerto Rico and the recently born Creole vocabulary of Ponce, Silva succeeded in creating a movement in architecture which broke away from the traditional forms while remaining within them. The traditional continuous raised verandah along the front facade is broken up into two and twisted out of its usual linearity into the curved forms preserved today. Characteristic of the architecture to abound in Ponce contemporaneous to Castillo 34 is a profusion of aplique, and eclectic combination and juxtaposition of shapes, particularly curvilinear, and a general ostentation of articulation. Blas Silva was probably the most established of the "wedding-cake architects" and was thus sought after mostly by the "nouveau riche" of the period. Silva's houses are among the richest in Ponce, among which the Monsanto Residence stands put for its circular porches. Other buildings by Blas Silva include the Frau Residence and the Salazar-Candal Residence, both also listed in the NRHP. Physical appearance and description The Monsanto Residence, located at 34 Castillo Street, is a one-storey, detached, masonry and stone building on the north side of the street, between Virtud and Salud Streets, in the Ponce Historic Zone. The house consists of plastered masonry at the living level and pinkstone ashlar at the podium. Excessive ornamentation and exuberance of volumes denominates this house as what is known locally as "wedding cake architecture." The facade is organized into three similar bays, each one consisting of a narrow, arched doorway with wooden panel double-doors, stained-glass lights and tiffany-style stained-glass fanlights. The central entrance doors contain wrought-iron panels in curved Art Nouveau lines. Each opening is articulated with intricate, decorative plaster surrounds and flaked with plaster festoon mouldings. In addition, the central entry is crowned with a plaster cartouche displaying the initials of the first owners, PF (Providencia Ubides and Federico Font). A heavily ornamented three-bay facade is shaded by two gazebo-like front terraces. Each bay consists of a series of four Corinthian columns upon pedestals, arranged around a 3/4-circle plan. Decorative wrought-iron railings in curvilinear Art Nouveau designs span between each of the pedestals. Each series of columns supports a cornice with a festooned frieze and a parapet above, decorated with circular-wreath balusters. The cornice wraps around the two porches, connecting the two in a curved pediment motif above the central entrance. Roman amphorae are located above the parapet, one at the location of each column. A second-floor "mirador" or "belvedere" projects upward above the first bay in a baroque manner. The volume is generally cubical in proportions, capped with an upwardly-curving cornice on each of its four sides, thus creating a groin-vault roof and ceiling. A small masonry pinnacle is located above the cornice at each of the four corners of the mirador and a circular oculus with stained glass panels occupies each of the four sides. A curvilinear stair or "stoop" conforms to the space available between the podiums of the two terraces, flowing up to the central entry. Once inside, a long, narrow hallway extends back from the street entry. Parlors and bedrooms open onto the hallway at either side, and the hallway terminates at a grand dining room at rear, with a kitchen at left and a terrace along the entire rear wall of the house. The upper level mirador is accessed by a cast-iron spiral staircase located on the southeast corner of the parlor at bay 1. Characteristic interior features of the house include: decorative native ceramic tile floors, intricate, pressed-tin ceilings in biblical motifs, and skillfully carved wooden fanlights. See also Efrain Perez-Chanis, Gran Enciclopedia de Puerto Rico, Arquitectura. Archivo Histórico de Ponce, Teatro La Perla, Ponce. Revista Plástica, Liga de Arte de San Juan, No. 15, Vol. 2, Sept. 1986. References External links Category:Houses completed in 1913 Category:National Register of Historic Places in Ponce, Puerto Rico Category:Houses on the National Register of Historic Places in Puerto Rico Category:Ponce Creole architecture Category:1987 in Puerto Rico Category:1913 establishments in Puerto Rico Category:Art Nouveau houses

Digital X-rays are here; why aren't you using them? Digital imaging is here. It is cost-effective and helps dentists glean more useful information to make treatment decisions. Many more choices of digital systems are available for dentists to adopt than when the technology was introduced. The hardware is less costly than it was even one year ago, and image storage is now very inexpensive. Technical time is reduced, and no special training is required if the dentist or auxiliary has used a paralleling system. Insurance companies are gearing up to accept image files attached to claims. Why, then, are dentists not buying these systems as fast as manufacturer's can build them? This article explores that question and discusses the false assumptions behind perceived obstacles.

Looking for Water Trails? The mission of the Jefferson County Trails Council is to build, construct, and maintain a network of trails for public use and enjoyment, and to promote, inform, and educate the general public about the trail system.

Q: Microsoft Unit Testing for ASP.NET with VS2012 I am ripping apart and putting back together a large website and want to take this opportunity to do some test driven development as the site is recreated. The issue that I am running into is how. A lot of the items that I need to test deal with session variables (or other variables) that are being set when a user logs in. But if I am testing an individual page I don't ever log in. For example: [TestMethod()] [HostType("ASP.NET")] [UrlToTest("http://localhost:64769/UsersDetail.aspx")] public void GetCompanyId_Test() { var testID = GetCompanyID(); Assert.AreEqual("123456789", testID); } Now, the problem is that in order for GetCompanyID to work, it has to have variables available that are set at login. Is this possible? Do I have to mock up the data in some way ? Thanks A: You'll probably have to change the GetCompanyID function to use some variables that are filled by the session in the livesystem, and by your testsetup in the unit test system. Alas, you can't mock HttpSessionState in ASP.NET - see here: How do I mock/fake the session object in ASP.Net Web forms? Another idea would be to actually do the loginaction in the testsetup.

A FIST IN THE HORNET'S NEST: On the Ground in Baghdad Before, During and After the War Journalist Engel's gripping account of the recent war in Iraq begins with himself rushing around in flak jacket and helmet to videotape an attack on Baghdad's Palestine Hotel, a woman journalist nearby shouting, "We're all going to die"; he conveys his shock on learning the hotel, which housed Western journalists, had been fired on by an American tank. This scene is just the first of many vivid depictions of Engel's life in the war zone. Unlike most U.S. correspondents, who covered the war "embedded" with U.S. troops, Engel worked apart from the troops as ABC-TV's main Baghdad correspondent. The world he describes is filled with fascinating, terrible dynamics: he depicts local residents waiting with a strange calm for the fighting to begin; journalists attempting to outwit the Iraqi "minders" assigned by Saddam Hussein's regime to watch over them; Iraqis overjoyed at Saddam's fall but ambivalent about a Western occupation. He also describes the experience of reporting while ducking both American and Iraqi shooting; in one incident, he relates, reporters became "human shields," providing cover for Iraqis firing anti-aircraft missiles at American planes. Engel navigates a tightrope: he conveys the excitement of being a war correspondent without neglecting the horrifying aspects of war. Most important, he manages to convey an accurate, balanced portrayal of Iraq both during the war and after. As a result, this book might restore some of the public's lost faith in journalism. (Mar. 3)

<?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>BuildMachineOSBuild</key> <string>17B48</string> <key>CFBundleDevelopmentRegion</key> <string>en</string> <key>CFBundleExecutable</key> <string>Shiki</string> <key>CFBundleIdentifier</key> <string>as.vit9696.Shiki</string> <key>CFBundleInfoDictionaryVersion</key> <string>6.0</string> <key>CFBundleName</key> <string>Shiki</string> <key>CFBundlePackageType</key> <string>KEXT</string> <key>CFBundleShortVersionString</key> <string>2.2.0</string> <key>CFBundleSignature</key> <string>????</string> <key>CFBundleSupportedPlatforms</key> <array> <string>MacOSX</string> </array> <key>CFBundleVersion</key> <string>2.2.0</string> <key>DTCompiler</key> <string>com.apple.compilers.llvm.clang.1_0</string> <key>DTPlatformBuild</key> <string>9B55</string> <key>DTPlatformVersion</key> <string>GM</string> <key>DTSDKBuild</key> <string>17B41</string> <key>DTSDKName</key> <string>macosx10.13</string> <key>DTXcode</key> <string>0910</string> <key>DTXcodeBuild</key> <string>9B55</string> <key>IOKitPersonalities</key> <dict> <key>as.vit9696.Shiki</key> <dict> <key>CFBundleIdentifier</key> <string>as.vit9696.Shiki</string> <key>IOClass</key> <string>Shiki</string> <key>IOMatchCategory</key> <string>Shiki</string> <key>IOProviderClass</key> <string>IOResources</string> <key>IOResourceMatch</key> <string>IOKit</string> </dict> </dict> <key>NSHumanReadableCopyright</key> <string>Copyright © 2017 vit9696. All rights reserved.</string> <key>OSBundleCompatibleVersion</key> <string>1.0</string> <key>OSBundleLibraries</key> <dict> <key>as.vit9696.Lilu</key> <string>1.2.0</string> <key>com.apple.kpi.bsd</key> <string>12.0.0</string> <key>com.apple.kpi.dsep</key> <string>12.0.0</string> <key>com.apple.kpi.iokit</key> <string>12.0.0</string> <key>com.apple.kpi.libkern</key> <string>12.0.0</string> <key>com.apple.kpi.mach</key> <string>12.0.0</string> <key>com.apple.kpi.unsupported</key> <string>12.0.0</string> </dict> <key>OSBundleRequired</key> <string>Root</string> </dict> </plist>

The distribution of amyloid plaques in the cerebellum and brain stem in Down's syndrome and Alzheimer's disease: a light microscopical analysis. The distribution and severity of the neuropathological changes in 57 cases of Alzheimer's disease, and 11 patients with Down's syndrome were investigated with reference to the cerebellum. A modified silver stain and a monoclonal antibody raised against amyloid beta-protein were used to identify amyloid plaques. The highest incidence of amyloid plaques in the cerebellum (93%) was found in the group of patients who developed dementia before 65 years of age. This figure dropped to 56% in those patients with dementia beginning after 75 years. In 37 of these cases the distribution of the pathological changes of the disease were also examined in the brain stem. The severity of the pathological changes in the cerebellum corresponded to the involvement of the brain stem nuclei with connections to the cerebellar cortex. The possibility that the disease process spreads to the cerebellum by involving the fibres from the brain stem is discussed with reference to previous anatomical and neurochemical studies.

In increasing performance of a FET, it is known that gate dielectric reliability vs. Tiny scaling is a major industry trade-off. For example, increasing the thickness of a dielectric material stack increases reliability of the semiconductor device, but this increase in stack thickness will also decrease performance. Conversely, decreasing the thickness of a dielectric material stack can decrease reliability of the semiconductor device, but this decrease in stack thickness will also increase performance. Also, as MOSFET devices are scaled down to less than 100 nanometers in gate or channel length, highly doped, shallow source and drain extension regions can be employed to achieve high drive current capability. The dopants are activated by conducting laser annealing or other millisecond-scale (mSec) annealing of the implanted extension regions either prior, during, or after a more conventional, second-scale Rapid Thermal Anneal (RTA).

James Belton James Belton (1855 – 12 June 1935) was an Australian politician. He was born in Talbot, Victoria. In 1909 he was elected to the Tasmanian House of Assembly as a Labor member for Darwin. He was a minister from 1914 to 1916, but resigned to run (unsuccessfully) for the Senate in 1917. He was re-elected in a by-election in July of that year and served until his defeat in 1931. Belton died in 1935 at Wynyard. References Category:1855 births Category:1935 deaths Category:Australian Labor Party members of the Parliament of Tasmania Category:Members of the Tasmanian House of Assembly Category:People from Victoria (Australia)

The striker assembly of the present invention is particularly adapted for use in a compact semi-automatic handgun. A striker assembly of the type used in such a small handgun usually comprises an intricate mechanism having several small interacting parts which require considerable manual dexterity to handle and assemble. Consequently, the occasional stripping, cleaning and reassembling operation essential to proper gun maintenance and which requires handling these small parts can prove to be a troublesome chore for the average gun owner.