Datasets:

nickypro

/

minipile

like 0

Round Dining Table for 8 Round Dining Table for 8 – Each part entrance should have some other form and uniqueness. Including the living area at home. Not simply could be the dining-room a place to enjoy with your loved ones, you’ll find it becomes methods to gather and hang out with family. One important aspect in the dining area will be the dining table. Indeed, the development of the structure and model of the dining room table itself will vary, without considering the utilization and ergonomic aspects of the dining room table itself. Well, on this occasion Kania is evaluating a specialized table design and almost always is an inspiration to your dining room. Like what? Come see round dining table for 8 below!

They'll do something because as it stands 'The Man of Steel' is the only DC movie they'll have to lead into this. Every Marvel movie was doing this from the beginning. I think they've got to do something similar to get attention to the film. Thing is, they haven't yet announced if Cavill will be the JLA Supes. It's almost as if they're waiting to see how MOS does before making that call. They've got to be planning on having him in a MOS2 at the very least, but look how that worked out for GL2...

It Starts Here Fitness Grand Opening Feb. 3 from 8 a.m. - 8 p.m. Brad Lane, a certified personal trainer, welcomes you to the grand opening of his new gym, It Starts Here Fitness on Jefferson Boulevard. Posted 1/30/14 A healthy body has to start somewhere, and according to certified personal trainer and competitive athlete Brad Lane, it starts right here at his new gym, It Starts Here Fitness on Jefferson Boulevard. Celebrating its Grand Opening on Monday, February 3rd, It Starts Here Fitness is the brainchild and passion of Warwick native Lane who has been an advocate for health and fitness since his youth. A lifelong athlete, he is eager to inspire fellow health-seekers to jumpstart their fitness goals and to be their "mentor and motivator". It Starts Here Fitness is not your average gym - in fact, it is the place to go for those ready to achieve their personal fitness goals through individualized, customized and one-on-one workout sessions. Lane, an avid volleyball player who coaches at Ocean State Volleyball in West Warwick and is the strength & conditioning coach for the Warwick Vets HS girls volleyball team, works with each client on a personal level to help them achieve their goals, and then to constantly challenge them to push themselves to the next level. While the ultimate objective is to help them reach independence, he is right by their side to help them turn fitness ideals into reality. Whether you are in a sports or training program, or are interested in weight loss, body toning, overhauling your fitness regiment or in post-rehab, Lane is there to devise a plan that works just for you. Using the state-of-the-art equipment available at his new gym, he will work with groups of up to four people, but his preference is to work one-on-one with his clients to achieve an optimal outcome. Watch for upcoming "spin classes" as well! On Monday, February 3rd, Brad invites you to come in and check out this brand new workout facility. At the Grand Opening, Lane will answer your fitness and health questions, introduce you to the staff and show you the equipment. Most importantly, he will set up your own personal training appointment to give you that extra motivation to get started on your 2014 fitness goals. Come any time from 8:00am to 8:00pm ~ all are welcome and no appointments are needed. It Starts Here Fitness offers a functional, non-traditional approach to fitness that is designed to help you realize those long-postponed desires to get back in shape and enjoy a healthier lifestyle. This is not something you need to do alone, and with the expertise, guidance and inspiration of Brad Lane, you can start right here, right now. Don't wait another day. Open Monday through Friday from 6:00am until 8:00pm, and Saturdays from 9:00am until 2:00pm (after hours and Sunday by appointment only), It Starts Here Fitness is located at 380 Jefferson Boulevard in Warwick. For more information, call 738-3700 or visit their soon to be completed website www.ishfitness.com.

It was the culmination of Forgy’s six-year journey to become an engineer in the United States, one filled with setbacks, heartache and perseverance. An International Journey Forgy’s dream began as a child growing up in Ignacio Zaragoza, Chihuahua, Mexico, where her family would often drive past an auto parts manufacturing plant. She would see the workers, each wearing a color-coded shirt representing their position. One day, the 10-year-old asked her parents, “Who are the people wearing white shirts?” Those are the engineers, they told her. Forgy knew that one day, she wanted to be among them. Forgy earned her first “white shirt” position after completing her undergraduate degree in industrial engineering at Instituto Tecnologico Superior de Nuevo Casas Grandes in 2002. She began working full time at the plant in Ignacio Zaragoza. But she wanted more. She visited Nampa, Idaho, to be near her sisters and improve her English. While in Nampa, she met Colin Forgy, whom she married in 2006. The couple began their life together in Boise, and Forgy started working at Micron as a production operator. Impressed by her dedication and effort, Forgy’s managers recommended she pursue an advanced engineering degree and recommended Engineering Management Program offered at UI Boise by the College of Engineering. The distance-education program is designed for engineering professionals who want to further their careers. Worth Persevering Forgy was accepted to the program, and program manager Denise Engebrecht confirmed UI would accept her undergraduate degree from Mexico. But before she could start classes, Forgy was laid off from Micron, losing access to the educational benefits the employer offered. Without the benefits, she couldn’t afford the program. Forgy took a job as a quality lead at Boise-based Fresca Mexican Food, and she and Colin welcomed two daughters. Eventually, she got another job with Micron, and again enrolled at UI Boise. In addition to her engineering classes, Forgy took English courses to improve her language skills and joined Toastmasters International to become a stronger public speaker. Through it all, she continued applying for engineering positions at Micron. Pregnant with her son, Forgy said some discouraged her from pursuing her degree and seeking promotion. “I remember some of the comments were not kind, but I think it helped me realize that I had to overcome those obstacles if I wanted my ‘white shirt’ dream to come true in the U.S.,” she said. She had support, too. At UI, she was cheered on by Engebrecht, college Dean Larry Stauffer and Engineering Outreach Associate Dean Barry Willis. Her husband, family and coworkers also rallied around her. One of her biggest supporters, Forgy said, was her father, Benjamin Beltran, who died during her first semester of the program. “Every time I wanted to quit, I thought of my father and about making him proud,” she said. A Vandal Success Story At one point while pursuing her degree, Forgy said a manager impressed with her work asked her why she wasn’t an engineer. “No one’s believed in me yet,” she told him. But people did believe in her — and in 2014, her hard work was rewarded with her current post of process engineer. Forgy credits her achievement with her instructors and supporters at UI. “Denise and Dr. Willis were key for achieving my engineering management degree,” she said. “They both kept it professional and helped me with the best advice on classes and work. Denise’s advising has been crucial in this long journey; she never gave up on me, she was more than an advisor through this process. She was an advocate and a friend and always believed in me. “UI cares for their students and I am so proud to be a Vandal.” After she graduated from the program in 2017, her Micron team bought a cake to celebrate. She told them more about her journey, and her lifelong quest for that “white shirt.” A few days later, she received a gift. “One week after that celebration, my production manager gave me a white shirt with the Micron logo on it,” Forgy said.

Belgian literature Because Belgium is a multilingual country, Belgian literature is divided into two main linguistic branches following the two most prominently spoken languages in the country - Dutch and French. German is the third language in Belgium and is spoken by a small community of about 70,000 German-speakers of the German-speaking Community of Belgium bordering on Germany. Some literature also exists in the regional languages of Belgium, with published works in both the Walloon language, which is related to French, and also in various regional Flemish or Dutch-related dialects. Belgian literature in Dutch Hugo Claus Louis Paul Boon Hendrik Conscience Eric de Kuyper Guido Gezelle Willem Elsschot Erwin Mortier Tom Lanoye Jef Geeraerts Marnix Gijsen Herman de Coninck Cyriel Buysse Dimitri Verhulst Herman Brusselmans Dutch language Flemish Literature, which is part of the Dutch Literature Flemish Community See also Lijst van Vlaamse schrijvers (list of Flemish authors) Belgian literature in French Nicolas Ancion Charles De Coster Michel de Ghelderode André-Paul Duchâteau Maurice Grevisse Georges Simenon Alain Le Bussy Francis Baudouin Suzanne Lilar Maurice Maeterlinck Thierry Martens Pierre Mertens Henri Michaux Amélie Nothomb Jean Ray aka John Flanders for his works in Dutch J.H. Rosny and J.-H. Rosny aîné & J.-H. Rosny jeune Stanislas-André Steeman Jean-Philippe Toussaint Emile Verhaeren Henri Vernes Arthur Xhignesse Marguerite Yourcenar Francophone literature Belgian French French Community of Belgium Belgian literature in Walloon Literature in Walloon has been printed since the 16th century or at least since the beginning of the 17th century. Its golden age was in the 19th century: 'That period saw an efflorescence of Walloon literature, plays and poems primarily, and the founding of many theaters and periodicals.' Yves Quairiaux counted 4800 plays for 1860–1914, published or not. In this period plays were almost the only popular show in Wallonia. But this theater remains popular in present-day Wallonia: Theatre is still flourishing with over 200 non-professional companies playing in the cities and villages of Wallonia for an audience of over 200,000 each year. Jacques Ancion wanted to develop a regular adult audience. This regional literature most commonly deals with local folklore and ancient traditions, the most prominent Walloon author being Arthur Masson. Charles-Nicolas Simonon (1774-1847): "Li Côparèye" (1822) Nicolas Defrecheux (1825-1874): "Lèyîs-m'plorer" (Let me weep, 1854) Edward Remouchamps (1836-1900) wrote the vaudeville theater piece "Tatî l'pèriquî" (Gautier, the barber, 1885) Salme Dieudonné: the novel "Li Houlot" (The cadet, 1888) Willame Georges (1863-1917), sonnets François Renkin (1872-1906), stylized prose Henri Simon (1856-1939): "Li Mwert di l'abe" (The death of the tree, 1909) and "Li pan dè bon Dieu" (The Bread of the Good Lord, 1914) Jules Claskin (1884-1926), poetry Laloux Auguste (1908-1976): "Li p'tit Bêrt", written before 1940, published in 1963 Geo Libbrecht (1891-1976): poetry, "Les cloques / Les cleokes (1964)." See also Belgian comics French literature Dutch literature External links Hendrik Conscience Heritage Library Antwerp for Flemish and French literature in Belgium Notes and references Notes: References: Category:Belgian writers in French

Neville Hodge Neville Gomez Hodge (born 8 December 1955) is a former United States Virgin Islands sprinter who competed in the men's 100m competition at the 1992 Summer Olympics. He recorded a 10.71, not enough to qualify for the next round past the heats. His personal best is 10.32, set in 1993. He also ran that Olympiad for the USVI 4x100m team, which recorded a 40.48, good for 5th place. Previously, in the 1988 Summer Olympics, he ran a 10.73 in the 100m contest. In the 1984 Summer Olympics, he ran 21.12 in the 200m, enough to qualify for the next round, where he did not start (DNS). He also ran in the 100m contest in 1984, scoring a 10.58, enough to qualify for round 2, where a 10.69 was not enough to advance further. He won a bronze medal in the 4 x 100 metres relay at the 1991 Pan American Games. References Category:1955 births Category:Living people Category:United States Virgin Islands male sprinters Category:Athletes (track and field) at the 1984 Summer Olympics Category:Athletes (track and field) at the 1988 Summer Olympics Category:Athletes (track and field) at the 1992 Summer Olympics Category:Olympic track and field athletes of the United States Virgin Islands Category:Athletes (track and field) at the 1987 Pan American Games Category:Athletes (track and field) at the 1991 Pan American Games Category:Pan American Games medalists in athletics (track and field) Category:Pan American Games bronze medalists for the United States Virgin Islands Category:World Athletics Championships athletes for the United States Virgin Islands

Police-minority relations are not black and white Midwest City Police Department Community Action Officer Roland “Rollie” Branham, speaks with with 86 year old Cora Rolison at her home next Randolph Grayson a neighbor who lives across the street, recently in MWC. (Mark Hancock) Clashes between police and residents in Ferguson, Missouri, over the past two weeks have ignited debate over the use of deadly force, racial profiling and protester rights. They have also shined a spotlight on the relationship between law enforcement and African-American communities, which has a long history of friction across America. In conversations with leaders and residents from black communities across the Oklahoma City metro, it appears a skeptical eye toward police still exists but is mostly based on historical events. When asked to speak freely, some black residents of OKC said friction can exist between African-Americans and police. But overall, there is a higher level of trust today than in years past, and many believe the police department has taken steps to improve relations. No local Ferguson There is no city in the Oklahoma City metro near size of Ferguson (population 21,203) that has a majority of black residents. However, there are a handful of area cities and communities with sizable black populations, and in conversations with both community leaders and law enforcement from those cities, most agree that relations here, while not perfect, are better than in Ferguson. “Some [African-Americans] in Midwest City feel that the law enforcement is against them,” said Councilwoman Christine C. Price Allen. “But I think things are getting better.” Allen is the lone African-American elected official in Midwest City, which is 21 percent black, according to the latest U.S. Census Bureau figures. However, Ward 5, the ward Allen represents, is closer to 60 percent African-American. Allen said she has looked for ways to strengthen the city’s relationship with its black community since her election a few years ago and she believes the police department has taken steps to improve its image with minorities. However, she would like to see more minorities on the police force, where just seven commissioned offers out of 94 are black. Midwest City’s arrest stats show that 39 percent of all arrests are African-Americans, a rate nearly twice as high as the city’s population demographics. While Allen says those statistics might lend cause for concern, the city’s police chief believes the numbers do not tell the whole story. “We take a community-based approach to [policing] that I think helps us connect with the neighborhoods and minorities,” Midwest City Chief of Police Brandon Clabes said. Clabes also said the rate of arrests does not take into consideration whether an officer initiated the arrest or was responding to a call. He also said officer employment rates struggle to mirror the community because there is a low number of minority applicants, which is something police chiefs complain of across the country. Having stats on racial demographics of arrests and police employment can provide a starting point in discussing law enforcement relations with minorities, and it has been a major talking point in Ferguson, where, despite being 67 percent African-American, only 6 percent of the city’s police officers are black, a statistic that has not created trust in that community. With police employment stats that are similar to Ferguson, Midwest City police have also drawn skepticism from blacks in the community. “I think the black community in Midwest City is sometimes suspicious of police,” said Charles, a black resident who did not wish to give his last name. “But that’s part of the culture even if it’s not based on actual problems. I actually don’t think the problems you see in [Ferguson] exist here.” Knowing employment and arrest statistics at least gives the Midwest City police something to review. In Del City, where 18 percent of residents are black, the local police department could not offer racial breakdowns of arrests or police officers and said it would not offer those numbers following a request by Oklahoma Gazette last week. However, all five members of the Del City council and mayor are white. Community Action Officer Roland “Rollie” Branham arrives in a Midwest City neighborhood to visit with residents on Big Oak Drive. (Mark Hancock) Oklahoma City Midwest City and Del City have the largest percentages of African-American residents of area cities larger than 2,000. Unlike the St. Louis area, which includes Ferguson, no large cities in the OKC region are majority black. Those that are, like Forest Park and Arcadia, have fewer than 1,200 residents. Oklahoma City is 15 percent African-American, and its police force is 6 percent black. Like Midwest City, police in OKC say there is a shortage of minority candidates and admit there can be a stigma in the black community about becoming a police officer. “I think the relationship [between police and African-Americans], over time, has gotten far better than how it used to be,” said Ward 7 Councilman John Pettis Jr., who represents a ward that is home to a large percentage of the city’s black community. Like Allen in Midwest City, Pettis said the police are often a topic of discussion between him and his constituents. “Is it perfect? No, I would have to say it isn’t perfect,” said Pettis, who is the council’s lone African-American member. “But I think we are getting better.” Pettis said he has done several police ride-alongs during his time as a councilman and will often pull over when he sees a lot of police activity in his ward. “It’s good for the community to see their councilman interacting in a positive note [with police],” Pettis said. “There is a negative view sometimes of the police department [in my community].” Pettis also referenced the police department’s citizen advisory board as a reason he views the relationship between minorities and police as improving. The 11-member board is made up of mostly minority citizens and reviews investigations when there is a citizen complaint. Other programs, like the Police Athletic League, are designed to get officers out in the community, having positive interactions with young residents in an effort to build trust. Pettis said blacks in Oklahoma City were closely following the events in Ferguson and he believes the situation points to misconduct by the police officer who shot an unarmed 18-year-old. But Pettis also believes the situation would play out differently in Oklahoma City. Police officials in both Midwest City and Oklahoma City have agreed, saying they believe their departments would be better about releasing information. PCR The Oklahoma City Police Department also looks for ways to increase positive interactions between its officers and the community through the work of its police community relations (PCR) officers. “The officer that is assigned to calls, they don’t have time to talk about what happened two weeks ago or a month ago,” said Erick Huff, a PCR officer in the Springlake Patrol Division in northeast Oklahoma City. “The PCR officers are ones that can spend a little more time in the neighborhoods, talking about the issues.” Huff said his role allows him to interact more with members of the community, listen to concerns and even offer explanation about an issue. Huff, who is black, said he doesn’t believe there is as much of a negative impression about police from the black community like there once was. He has been at neighborhood meetings where concern over race has been raised but has been able to talk with residents and help them see that most negative thoughts are based on events from another era. Capt. Dexter Nelson, a public information officer with the department, agreed. “When I was here as a kid … you were always being told to be careful around police,” said Nelson, who is black. “The black community has historically not been in a good light with law enforcement. It’s just a historical fact across this country. But the younger generation hasn’t had their own negative experiences.” Conversations with black youth and young adults in Oklahoma City yielded stories of perceived profiling and a general dislike for law enforcement. Told their names would not be printed, some said they felt like they had been stopped because of their race when driving in a mostly white part of town or have experienced officers using derogatory terms. But no one felt like the problems of Ferguson existed to the same extent in Oklahoma City, and most said they believe the majority of police officers are good people. Of course, each person has his or her own perspective of the police and no individual or small group can speak for entire community. However, both Huff and Nelson say the nature of the job is such that many people don’t like a visit or stop from the police, no matter their race. Trust The key component in law enforcement relations with minority communities is trust, and that has been a hard thing to develop in many black communities across the nation. As residents in Ferguson complain that their local police department does not reflect the demographics of the community, the same could be said of departments in the OKC metro. Local departments say they want to hire more minority officers, but that has been a tough goal to meet and might get even tougher. “It is likely that the events in Ferguson will make it extremely difficult to hire African-Americans, at least in the near future,” Ronald Weitzer, a professor of sociology at George Washington University who has written extensively about police relations with ethnic minorities, told The Kansas City Star in a story about police demographics. However, while Oklahoma City and Midwest City might share the problem of a lack of black officers, few believe the same type of mistrust that is playing out in Ferguson is bubbling beneath the surface here. That said, recent events have challenged the public’s trust. OKC police announced last week that one of its officers had sexually assaulted at least seven women, all African-American, over the past several months. 2013 was the deadliest year in a decade for police shootings in OKC and sparked an investigative series on the use of deadly force, which highlighted the mistrust that police shootings can create, by The Oklahoman. Through community policing, citizen advisory boards and youth activities, local departments have taken steps to promote positive interactions between officers and citizens, especially minorities. But police also say their job has never been about winning a popularity contest. “A lot of people just don’t like the police,” said Clabes, remarking that it seems to be a trend that has gotten worse in recent decades. “This is a tough job.” Community policing Oklahoma City police say they have several programs that are designed to promote positive interactions between the community and officers, especially in high-risk and minority communities across the city. Here are some of those programs: Police Athletic League: The Oklahoma City Police Athletic League offers educational and athletic activities for children, primarily in high-risk neighborhoods. Police officers volunteer their time, giving children the chance to have positive experiences with officers. PAL is a chapter member of the National Association of Police Athletic/Activities Leagues, which is recognized as the largest juvenile crime prevention program in the nation.Police Community Relations officers: Oklahoma City’s PCR officers spend time presenting information to neighborhood associations, businesses, churches and other groups, giving residents a chance to have more in-depth conversations with police officers. Each police division has a PCR officer.Citizens Advisory Board: Oklahoma City’s Citizens Advisory Board is made up of 11 citizens, which includes several representatives of the city’s minority communities. The police say the goal of the board is to maintain a partnership with the community in an effort to reduce crime and to enhance the quality of life. The board meets to review investigations into citizen complaints and provide feedback on how the department can improve policies toward the community. Police demographics by the numbers Oklahoma City, Del City and Midwest City are the three large cities in the metro with the largest African-American population. Ben is an urban affairs reporter covering local government and education in Oklahoma City. He lives in OKC with his wife, Lori, and son, Satchel. Ben holds a masters in new media journalism from Full Sail University and is an OKC transplant from Kansas City, Mo. Twitter: @benfelder_okg

If you only have $100 to spend on marketing your music, here’s what to do [This article was written by Tyler Allen and it originally appeared on the Sonicbids Blog.] Your band is an investment. You’ve probably already spent hundreds or thousands of dollars on equipment like PA systems, stands, strings, new instruments, and a plethora of other equipment, right? It’s normal to put money into something you care about and invest in something that helps pay the bills. So, just as we put money into our equipment and sound, we should also set aside money for marketing our work. Naturally, this seems like a daunting task, as no one wants to take a gamble on marketing if the outcome is unsure, especially when labels and wealthier artists dump thousands upon thousands into their marketing. But it’s actually easier than you think. Even better, it can also be cheaper than you think. Let’s say you only have $100 a month to spend on marketing your music. If you have no idea where to start or how you can get the most bang for your buck, here’s how you might want to split up that cash. Facebook advertising: $25 to $50 Yep, this could eat up half of your monthly budget, but it’s an important facet of marketing. The way Facebook’s current algorithm works is that posts that aren’t engaged with won’t appear on your fans’ timelines. Even if you have 15,000 fans, if your post gets zero interactions, most of those fans won’t even see it. Is this Facebook’s way of nearly forcing brands to pay up for reach? A little bit. But fortunately, even $5 or $10 could get you significant reach on Facebook. There are a few ways of going about advertising on Facebook. One way is to promote your whole page for $5 to $10 a day for five days. Ensure you’re drilling down your audience, too. You can target people by interest, so make sure you include your genre, similar artists, and any other important details in your page information. Another route would be promoting a SoundCloud or YouTube clip that’s posted on your Facebook page. This way, you can also rack up on YouTube views or SoundCloud views, too. For $10 a day for five days, your post could easily reach a minimum of 2,000 to 5,200 people each day. Will this necessarily lead to a corresponding number of likes, views, and listens? Potentially! If your content is written well, it’ll certainly get some love. And if you can’t manage $10 a day, even $5 a day isn’t a bad deal, since it’ll get you a reach of about 980 to 2,600 people daily. Google AdWords for video: $25 to $50 Obviously, you’ll have to adjust your spend here depending on how much you put towards your Facebook campaign. However, Google AdWords is a great way to invest a chunk of your marketing budget – namely in YouTube’s TrueView, which is AdWords for video. This creates sponsored video ads on YouTube which can lead people to your video, channel, or website. There’s also a very easy and efficient walk through when creating an ad, which makes this very easy to use and customize. I’d recommend a total of $5 to $10 for five days. Since it’s PPC (pay-per-click), you’ll only be charged each time your ad is clicked – plus, you get to choose the cap on the amount you spend (i.e., your $5). With this budget of $5 to $10 a day, you can easily achieve up to 1,000 impressions daily. Website, social media, or EPK cleanup: remaining budget Let’s say you spent $25 between the Facebook ads and Google AdWords, or decided to forgo YouTube TrueView as you don’t have a video to push. Now, you have $25 or $50 left over. Think about spending that on a nice graphic set for an upcoming show, or even hiring a strategist to rework some of your bio or copy on your website. Now, I’m sure any designers reading this are cringing at the thought of only working for $25 on design, but for one or two simple social media graphics, or a new cover photo, that’s surely reasonable. A final word of warning: when you start marketing your work, people are going to see it – lot’s of ’em – so make sure whatever you’re putting out there is clean and fresh. The last thing you want is money spent on promoting a post or video with poor wording or quality. So be prepared! As a music marketing strategist, Tyler Allen works with an extensive array of artists, labels, music tech, and music retail entities. Tyler began his music industry career with Sony Music Entertainment and RED Distribution, as well as the advertising industry. He is dedicated to giving veteran artists the tools to preserve their legacy, and new artists the tools to begin theirs (as well as everything in between). Learn more at wtylerconsulting.com.

E85 Flex Fuel Specification ASTM International developed a specification for gasoline-ethanol blends containing 51% to 83% ethanol to ensure proper vehicle starting, operation, and safety in varying temperature conditions. The table below shows the requirements of the ASTM D5798 Standard Specification for Ethanol Fuel Blends for Flexible-Fuel Automotive Spark-Ignition Engines. Fuel retailers or fleets purchasing E85 should require their fuels to meet quality standards as a condition in their supply contracts in order to help guarantee their product is ASTM-compliant. Like gasoline and diesel fuel, E85 and other ethanol-gasoline blends are adjusted seasonally and geographically to ensure proper starting and performance. For example, E85 sold during colder months often contains lower levels of ethanol to produce the vapor pressure necessary for starting in cold temperatures. For this reason, fueling site operators offering ethanol blends typically cannot carry over summer-blend E85 into the winter months. They must instead "blend down" any remaining summer fuel to meet the ASTM specification's requirements for winter temperature conditions. This can be done with relative ease by adding gasoline to the storage tank. On the other hand, there is no concern with carrying over winter fuel into the summer months because flexible-fuel vehicles can operate during warm weather on any blend of ethanol and gasoline. For retail stations, seasonal fuel adjustments are handled automatically at the wholesale fuel terminal.

COURT OF APPEALS SECOND DISTRICT OF TEXAS FORT WORTH NO. 02-14-00139-CV MARY ELLIS JOHNSON APPELLANT V. RONNIE RAY JOHNSON, JR., APPELLEES SHENA JOHNSON DANIELS, RONICA SHAVON JOHNSON, AND ANDRE KEITH JOHNSON ------------ FROM THE 17TH DISTRICT COURT OF TARRANT COUNTY TRIAL COURT NO. 017-269146-13 ------------ MEMORANDUM OPINION 1 AND JUDGMENT ------------ We have considered the parties’ “Agreed Motion for Remand to Enforce Mediation Agreement.” It is the court’s opinion that the motion should be granted; therefore, we set aside the trial court’s judgment without regard to the 1 See Tex. R. App. P. 47.4. merits and remand this case to the trial court to render judgment in accordance with the parties’ agreement. See Tex. R. App. P. 42.1(a)(2)(B); Innovative Office Sys., Inc. v. Johnson, 911 S.W. 2d 387, 388 (Tex. 1995). PER CURIAM PANEL: LIVINGSTON, C.J.; DAUPHINOT and GARDNER, JJ. DELIVERED: September 18, 2014 2 

See below. Can we get some help on the IBM issues? ----- Forwarded by Steven J Kean/NA/Enron on 11/12/2000 02:36 PM ----- Erin Rice 11/10/2000 11:08 AM To: Steven J Kean/NA/Enron@Enron, Mark Palmer/Corp/Enron@ENRON cc: Courtney Votaw/NA/Enron@Enron, Mary Clark/Corp/Enron@ENRON Subject: Re: BackWeb Steve: At this point, our IT contacts are backpedalling a bit and suggesting they can overcome the TIBCO and Terminal Server problems. There are still four important issues, however: IT still cannot commit to transferring messages across domains. This means that messages initiated at Corp and intended for the entire Enron organization will not reach any business units outside the Corp domain. No messages will reach the EES organization unless IBM agrees not to use their proprietary message delivery tool, WebSphere, and will use WebLogic instead. WebLogic is required by BackWeb, although it is designed by a separate company. HR, intended to be a key user of this tool, will not use BackWeb because survey responses cannot be made anonymous. HR has already purchased a tool called CONFIRMIT that can execute anonymous surveys. Messages will not be delivered simultaneously to all users in the same domain, nor will they be delivered for two to five hours after they are sent by the message administrator. Another thing to consider is that these messages will be set to expire and disappear within a set period of time, meaning users cannot retrieve them and read them later (as they can with e-mail). This means that I could be away from the office for several days and miss a message entirely, because it would have expired and disappeared by the time I returned. The plain fact is that a few members of IT are pushing this initiative, but they lack commercial sponsorship. They are hoping Corp will foot the bill for a pilot which will allow them to fully test this tool before implementing it company-wide. Please let us know if you have additional questions. - er ----- Forwarded by Courtney Votaw/NA/Enron on 11/09/2000 12:08 PM ----- Steven J Kean 11/09/2000 11:35 AM To: Courtney Votaw/NA/Enron@Enron cc: Subject: Re: BackWeb Do we have a sense for how many we can reach, how many we can't and where they are? Are whole offices (eg Tokyo) unreachable or is it only those who have home offices? Courtney Votaw 11/08/2000 11:02 AM To: Mark Palmer/Corp/Enron@ENRON, Steven J Kean/NA/Enron@Enron cc: Erin Rice/Corp/Enron@Enron Subject: BackWeb Mark and Steve- Erin Rice and I would like to meet with you to discuss the issues concerning BackWeb before we proceed. As you can see from the Design Document, they are pretty significant. Thanks, Courtney

Q: Sending an email via PHP error, with CPanel error I have the following code to send an email. <?php $NowDate = date('Y-m-d H:i:s'); $subject = "test subject"; $message ="test message"; $emailFrom = "[email protected]"; $EmailAddress = "[email protected]"; $headers = "MIME-Version: 1.0\r\n"; $headers .= "Content-type: text/html; charset=iso-8859-1\r\n"; $headers .= "From: My Site <".$emailFrom.">\r\n"; $headers .= "To: <".$EmailAddress.">\r\n"; mail($EmailAddress,$subject,$message,$headers); ?> It runs successfully but the email doesn't getting sent with the following error listed in CPanel. How do I go about resolving this? ECDHE-RSA-AES256-GCM-SHA384:256 CV=no: SMTP error from remote mail server after end of data: 550 Messages should have one or no To headers, not 2. A: You need to remove the To header. The first parameter of the mail function writes that header value. With it assigned in the header as well you send 2 tos which causes the error. So remove: $headers .= "To: <".$EmailAddress.">\r\n";

Thursday, October 3, 2013 So, here we are Thursday. It's the unofficial launch of ACL Festival Part 1 of 2. The first Official Late Night Shows kick-off this evening and tomorrow we start the big show. Hopefully you've been listening to this Spotify Playlist I made for you, featuring 50 of my favorite artists playing this year's festival. Well, it's go time kids. Let's get right down to it. Below the break, I've planned Friday for you. Then I've rambled on about things. Enjoy. Ok, so here's the deal. If you look above you'll notice a lot of overlap. There are several strategies here. Read the crowd, if it feel like you can easily traverse the park and see several bands within an hour or two hour block. Go for it. On Friday, this is especially easy before 4pm. The other strategy, which is what I recommend, is you choose a side of the park and sort of pick a spot in the field that's somewhat between the two largest stages. If you look closely to the schedule of artists above, the stages in bold are are on the West side. That's toward the left after you walk through the gates. The stages listed in italics are on the East side of the park, which is toward the right. The stage that is underlined, is closer to the west stages but it's closest to the food. So, it might be a good idea to plan your eating in a way that allows you to hear some of the sets from the Austin Ventures stage. Not taking into account the artists performing on the stages themselves, the West side stages are definitely more advantageous. The west stages are closer to the gates, the main stages themselves are closer to each other and are placed in a way that is more parallel than the major stages on the east side. I also think it's easier to get to the water refill station on the west side of the park and the access to porta-potties is handier. Also, let's get real, the headliner on the East stage is always harder to hear than the headliner on the West stage. The big stage on the East side is on a lower plane than the big stage on the West side so, the sound naturally drifts from the west toward the east. If you're planning to bring a folding chair, it's easy to find a spot that is situated between the two West side stages, you'll be able to see and hear both stages with little to no shifting of your chair. That is not the case on the east side. With that all being said, there are obviously some great artists playing on both sides of the park. Regardless of which side you choose, or whether you decide to move throughout the park without a real plan, make sure the first place you walk once you get through the gates is the water station. There are stations to the right or the left but the closest one once you walk through the gate is sort of straight and to the left. Grab a paper festival guide from a volunteer, there will be a map there. If you have a child with you, make sure to get them geo-tagged or whatever they do. You'll see that on the map as well. Oh, and one last thing. Be prepared to have giant, ridiculous "flags" obstructing your view of the stage. It's annoying but if we prepare ourselves maybe it will be a bit more tolerable. Happy Festing!

Rowan Sawers Rowan Sawers (born 19 October 1954) is a former Australian rules football umpire and current Australian Football League Umpires' Coach. Sawers umpired 410 VFL/AFL senior games, including four grand finals, in his career. Sawers was recruited from the Southern Umpires' Association, which is based in Seaford, Victoria. He began umpiring in the Victorian Football Association in 1975, and began his Victorian Football League career in 1977. His first VFL match was in May 1977 at Moorabbin Oval “My first bounce in League football didn’t bounce – the ball got stuck in the mud. Paul Callery, the St Kilda rover, plucked the Sherrin out of the bog and played on.” In 1997, Sawers became the VFL/AFL games record holder for a field umpire. He finished his career with 410 premiership matches, which was the record until passed by Hayden Kennedy in September 2007. Career summary: VFL/AFL Umpiring career: 1977-1997; Games: 410, Finals: 31 VFL/AFL Grand Finals: 4 (1982, 1984, 1987, 1990) Sawers also umpired eight State of Origin games, two International rules football tours to Ireland, and at least one VFA grand final. He is currently a member of the AFL's Laws of the Game Committee and head coach of umpiring in the Essendon District Football League Umpires Association. He was the head umpire coach for AFL umpires for many years. In 2002 he was named in the AFL Umpires Association Umpires' Team of the Century, and in 2004 the Australian Football League inducted into Sawers to the Australian Football Hall of Fame joining a select group of 11 umpires so honoured to date. References Australian Football Hall of Fame AFL Umpires' Association Category:Living people Category:1954 births Category:Australian Football League umpires Category:Australian Football Hall of Fame inductees Category:Victorian Football Association umpires

//===-- HexagonELFObjectWriter.cpp - Hexagon Target Descriptions ----------===// // // The LLVM Compiler Infrastructure // // This file is distributed under the University of Illinois Open Source // License. See LICENSE.TXT for details. // //===----------------------------------------------------------------------===// #include "Hexagon.h" #include "MCTargetDesc/HexagonFixupKinds.h" #include "llvm/MC/MCAssembler.h" #include "llvm/MC/MCELFObjectWriter.h" #include "llvm/MC/MCValue.h" #include "llvm/Support/Debug.h" #include "llvm/Support/raw_ostream.h" #define DEBUG_TYPE "hexagon-elf-writer" using namespace llvm; using namespace Hexagon; namespace { class HexagonELFObjectWriter : public MCELFObjectTargetWriter { private: StringRef CPU; public: HexagonELFObjectWriter(uint8_t OSABI, StringRef C); unsigned getRelocType(MCContext &Ctx, MCValue const &Target, MCFixup const &Fixup, bool IsPCRel) const override; }; } HexagonELFObjectWriter::HexagonELFObjectWriter(uint8_t OSABI, StringRef C) : MCELFObjectTargetWriter(/*Is64bit*/ false, OSABI, ELF::EM_HEXAGON, /*HasRelocationAddend*/ true), CPU(C) {} unsigned HexagonELFObjectWriter::getRelocType(MCContext &Ctx, MCValue const &Target, MCFixup const &Fixup, bool IsPCRel) const { MCSymbolRefExpr::VariantKind Variant = Target.getAccessVariant(); switch ((unsigned)Fixup.getKind()) { default: report_fatal_error("Unrecognized relocation type"); break; case FK_Data_4: switch(Variant) { case MCSymbolRefExpr::VariantKind::VK_DTPREL: return ELF::R_HEX_DTPREL_32; case MCSymbolRefExpr::VariantKind::VK_GOT: return ELF::R_HEX_GOT_32; case MCSymbolRefExpr::VariantKind::VK_GOTREL: return ELF::R_HEX_GOTREL_32; case MCSymbolRefExpr::VariantKind::VK_Hexagon_GD_GOT: return ELF::R_HEX_GD_GOT_32; case MCSymbolRefExpr::VariantKind::VK_Hexagon_IE: return ELF::R_HEX_IE_32; case MCSymbolRefExpr::VariantKind::VK_Hexagon_IE_GOT: return ELF::R_HEX_IE_GOT_32; case MCSymbolRefExpr::VariantKind::VK_Hexagon_LD_GOT: return ELF::R_HEX_LD_GOT_32; case MCSymbolRefExpr::VariantKind::VK_Hexagon_PCREL: return ELF::R_HEX_32_PCREL; case MCSymbolRefExpr::VariantKind::VK_TPREL: return ELF::R_HEX_TPREL_32; case MCSymbolRefExpr::VariantKind::VK_None: return IsPCRel ? ELF::R_HEX_32_PCREL : ELF::R_HEX_32; default: report_fatal_error("Unrecognized variant type"); }; case FK_PCRel_4: return ELF::R_HEX_32_PCREL; case FK_Data_2: switch(Variant) { case MCSymbolRefExpr::VariantKind::VK_DTPREL: return ELF::R_HEX_DTPREL_16; case MCSymbolRefExpr::VariantKind::VK_GOT: return ELF::R_HEX_GOT_16; case MCSymbolRefExpr::VariantKind::VK_Hexagon_GD_GOT: return ELF::R_HEX_GD_GOT_16; case MCSymbolRefExpr::VariantKind::VK_Hexagon_IE_GOT: return ELF::R_HEX_IE_GOT_16; case MCSymbolRefExpr::VariantKind::VK_Hexagon_LD_GOT: return ELF::R_HEX_LD_GOT_16; case MCSymbolRefExpr::VariantKind::VK_TPREL: return ELF::R_HEX_TPREL_16; case MCSymbolRefExpr::VariantKind::VK_None: return ELF::R_HEX_16; default: report_fatal_error("Unrecognized variant type"); }; case FK_Data_1: return ELF::R_HEX_8; case fixup_Hexagon_B22_PCREL: return ELF::R_HEX_B22_PCREL; case fixup_Hexagon_B15_PCREL: return ELF::R_HEX_B15_PCREL; case fixup_Hexagon_B7_PCREL: return ELF::R_HEX_B7_PCREL; case fixup_Hexagon_LO16: return ELF::R_HEX_LO16; case fixup_Hexagon_HI16: return ELF::R_HEX_HI16; case fixup_Hexagon_32: return ELF::R_HEX_32; case fixup_Hexagon_16: return ELF::R_HEX_16; case fixup_Hexagon_8: return ELF::R_HEX_8; case fixup_Hexagon_GPREL16_0: return ELF::R_HEX_GPREL16_0; case fixup_Hexagon_GPREL16_1: return ELF::R_HEX_GPREL16_1; case fixup_Hexagon_GPREL16_2: return ELF::R_HEX_GPREL16_2; case fixup_Hexagon_GPREL16_3: return ELF::R_HEX_GPREL16_3; case fixup_Hexagon_HL16: return ELF::R_HEX_HL16; case fixup_Hexagon_B13_PCREL: return ELF::R_HEX_B13_PCREL; case fixup_Hexagon_B9_PCREL: return ELF::R_HEX_B9_PCREL; case fixup_Hexagon_B32_PCREL_X: return ELF::R_HEX_B32_PCREL_X; case fixup_Hexagon_32_6_X: return ELF::R_HEX_32_6_X; case fixup_Hexagon_B22_PCREL_X: return ELF::R_HEX_B22_PCREL_X; case fixup_Hexagon_B15_PCREL_X: return ELF::R_HEX_B15_PCREL_X; case fixup_Hexagon_B13_PCREL_X: return ELF::R_HEX_B13_PCREL_X; case fixup_Hexagon_B9_PCREL_X: return ELF::R_HEX_B9_PCREL_X; case fixup_Hexagon_B7_PCREL_X: return ELF::R_HEX_B7_PCREL_X; case fixup_Hexagon_16_X: return ELF::R_HEX_16_X; case fixup_Hexagon_12_X: return ELF::R_HEX_12_X; case fixup_Hexagon_11_X: return ELF::R_HEX_11_X; case fixup_Hexagon_10_X: return ELF::R_HEX_10_X; case fixup_Hexagon_9_X: return ELF::R_HEX_9_X; case fixup_Hexagon_8_X: return ELF::R_HEX_8_X; case fixup_Hexagon_7_X: return ELF::R_HEX_7_X; case fixup_Hexagon_6_X: return ELF::R_HEX_6_X; case fixup_Hexagon_32_PCREL: return ELF::R_HEX_32_PCREL; case fixup_Hexagon_COPY: return ELF::R_HEX_COPY; case fixup_Hexagon_GLOB_DAT: return ELF::R_HEX_GLOB_DAT; case fixup_Hexagon_JMP_SLOT: return ELF::R_HEX_JMP_SLOT; case fixup_Hexagon_RELATIVE: return ELF::R_HEX_RELATIVE; case fixup_Hexagon_PLT_B22_PCREL: return ELF::R_HEX_PLT_B22_PCREL; case fixup_Hexagon_GOTREL_LO16: return ELF::R_HEX_GOTREL_LO16; case fixup_Hexagon_GOTREL_HI16: return ELF::R_HEX_GOTREL_HI16; case fixup_Hexagon_GOTREL_32: return ELF::R_HEX_GOTREL_32; case fixup_Hexagon_GOT_LO16: return ELF::R_HEX_GOT_LO16; case fixup_Hexagon_GOT_HI16: return ELF::R_HEX_GOT_HI16; case fixup_Hexagon_GOT_32: return ELF::R_HEX_GOT_32; case fixup_Hexagon_GOT_16: return ELF::R_HEX_GOT_16; case fixup_Hexagon_DTPMOD_32: return ELF::R_HEX_DTPMOD_32; case fixup_Hexagon_DTPREL_LO16: return ELF::R_HEX_DTPREL_LO16; case fixup_Hexagon_DTPREL_HI16: return ELF::R_HEX_DTPREL_HI16; case fixup_Hexagon_DTPREL_32: return ELF::R_HEX_DTPREL_32; case fixup_Hexagon_DTPREL_16: return ELF::R_HEX_DTPREL_16; case fixup_Hexagon_GD_PLT_B22_PCREL: return ELF::R_HEX_GD_PLT_B22_PCREL; case fixup_Hexagon_LD_PLT_B22_PCREL: return ELF::R_HEX_LD_PLT_B22_PCREL; case fixup_Hexagon_GD_GOT_LO16: return ELF::R_HEX_GD_GOT_LO16; case fixup_Hexagon_GD_GOT_HI16: return ELF::R_HEX_GD_GOT_HI16; case fixup_Hexagon_GD_GOT_32: return ELF::R_HEX_GD_GOT_32; case fixup_Hexagon_GD_GOT_16: return ELF::R_HEX_GD_GOT_16; case fixup_Hexagon_LD_GOT_LO16: return ELF::R_HEX_LD_GOT_LO16; case fixup_Hexagon_LD_GOT_HI16: return ELF::R_HEX_LD_GOT_HI16; case fixup_Hexagon_LD_GOT_32: return ELF::R_HEX_LD_GOT_32; case fixup_Hexagon_LD_GOT_16: return ELF::R_HEX_LD_GOT_16; case fixup_Hexagon_IE_LO16: return ELF::R_HEX_IE_LO16; case fixup_Hexagon_IE_HI16: return ELF::R_HEX_IE_HI16; case fixup_Hexagon_IE_32: return ELF::R_HEX_IE_32; case fixup_Hexagon_IE_GOT_LO16: return ELF::R_HEX_IE_GOT_LO16; case fixup_Hexagon_IE_GOT_HI16: return ELF::R_HEX_IE_GOT_HI16; case fixup_Hexagon_IE_GOT_32: return ELF::R_HEX_IE_GOT_32; case fixup_Hexagon_IE_GOT_16: return ELF::R_HEX_IE_GOT_16; case fixup_Hexagon_TPREL_LO16: return ELF::R_HEX_TPREL_LO16; case fixup_Hexagon_TPREL_HI16: return ELF::R_HEX_TPREL_HI16; case fixup_Hexagon_TPREL_32: return ELF::R_HEX_TPREL_32; case fixup_Hexagon_TPREL_16: return ELF::R_HEX_TPREL_16; case fixup_Hexagon_6_PCREL_X: return ELF::R_HEX_6_PCREL_X; case fixup_Hexagon_GOTREL_32_6_X: return ELF::R_HEX_GOTREL_32_6_X; case fixup_Hexagon_GOTREL_16_X: return ELF::R_HEX_GOTREL_16_X; case fixup_Hexagon_GOTREL_11_X: return ELF::R_HEX_GOTREL_11_X; case fixup_Hexagon_GOT_32_6_X: return ELF::R_HEX_GOT_32_6_X; case fixup_Hexagon_GOT_16_X: return ELF::R_HEX_GOT_16_X; case fixup_Hexagon_GOT_11_X: return ELF::R_HEX_GOT_11_X; case fixup_Hexagon_DTPREL_32_6_X: return ELF::R_HEX_DTPREL_32_6_X; case fixup_Hexagon_DTPREL_16_X: return ELF::R_HEX_DTPREL_16_X; case fixup_Hexagon_DTPREL_11_X: return ELF::R_HEX_DTPREL_11_X; case fixup_Hexagon_GD_GOT_32_6_X: return ELF::R_HEX_GD_GOT_32_6_X; case fixup_Hexagon_GD_GOT_16_X: return ELF::R_HEX_GD_GOT_16_X; case fixup_Hexagon_GD_GOT_11_X: return ELF::R_HEX_GD_GOT_11_X; case fixup_Hexagon_LD_GOT_32_6_X: return ELF::R_HEX_LD_GOT_32_6_X; case fixup_Hexagon_LD_GOT_16_X: return ELF::R_HEX_LD_GOT_16_X; case fixup_Hexagon_LD_GOT_11_X: return ELF::R_HEX_LD_GOT_11_X; case fixup_Hexagon_IE_32_6_X: return ELF::R_HEX_IE_32_6_X; case fixup_Hexagon_IE_16_X: return ELF::R_HEX_IE_16_X; case fixup_Hexagon_IE_GOT_32_6_X: return ELF::R_HEX_IE_GOT_32_6_X; case fixup_Hexagon_IE_GOT_16_X: return ELF::R_HEX_IE_GOT_16_X; case fixup_Hexagon_IE_GOT_11_X: return ELF::R_HEX_IE_GOT_11_X; case fixup_Hexagon_TPREL_32_6_X: return ELF::R_HEX_TPREL_32_6_X; case fixup_Hexagon_TPREL_16_X: return ELF::R_HEX_TPREL_16_X; case fixup_Hexagon_TPREL_11_X: return ELF::R_HEX_TPREL_11_X; case fixup_Hexagon_23_REG: return ELF::R_HEX_23_REG; } } MCObjectWriter *llvm::createHexagonELFObjectWriter(raw_pwrite_stream &OS, uint8_t OSABI, StringRef CPU) { MCELFObjectTargetWriter *MOTW = new HexagonELFObjectWriter(OSABI, CPU); return createELFObjectWriter(MOTW, OS, /*IsLittleEndian*/ true); }

This opinion will be unpublished and may not be cited except as provided by Minn. Stat. § 480A.08, subd. 3 (2012). STATE OF MINNESOTA IN COURT OF APPEALS A14-0102 Dezeray Marie Roblero-Barrios, Appellant, vs. Lucinda Jesson, Commissioner of Human Services, Respondent. Filed July 14, 2014 Affirmed Smith, Judge Olmsted County District Court File No. 55-P6-99-002869 David A. Jaehne, West St. Paul, Minnesota (for appellant) Lori Swanson, Attorney General, Uzodima Franklin Aba-Onu, Assistant Attorney General, St. Paul, Minnesota; and Mark A. Ostrem, Olmsted County Attorney, Geoffrey A. Hjerleid, Assistant County Attorney, Rochester, Minnesota (for respondent) Considered and decided by Halbrooks, Presiding Judge; Hudson, Judge; and Smith, Judge.  UNPUBLISHED OPINION SMITH, Judge We affirm the judicial appeal panel’s dismissal of appellant’s petition for a full discharge or a provisional discharge from her civil commitment as a sexually dangerous person because appellant failed to introduce any competent evidence that she meets the statutory criteria for relief. FACTS After serving time in prison for convictions of second-degree assault and second- degree attempted criminal-sexual conduct, based on an incident involving a six-year-old boy in the restroom of a retail store, appellant Dezeray Marie Roblero-Barrios was indeterminately committed to the Minnesota Sex Offender Program (MSOP) as a sexually dangerous person in June 2001. She is in the first phase of treatment at MSOP. In June 2012, Roblero-Barrios petitioned the special review board (SRB) for a full discharge or a provisional discharge from civil commitment, and submitted a “predischarge” plan from the department of corrections (DOC). The SRB conducted a hearing on the petition. It found that Roblero-Barrios’s treatment history has been “inconsistent and marred” by her behavior, which has included “inappropriate sexual boundaries with peers; difficulty managing emotions; motivational problems; rule violations; aggressive/violent behavior; and sexual acting out.” It also found that Roblero-Barrios has been revoked to the DOC four times for assaultive behavior and noncompliance with treatment and that, as a result, she has spent “significant time” outside of treatment at MSOP. The SRB noted that Olmsted County, MSOP staff, 2 Roblero-Barrios’s treatment team, and the risk assessor who worked with Roblero- Barrios all opposed her petition. The SRB recommended that the petition be denied. Roblero-Barrios requested that a judicial appeal panel reconsider the SRB’s recommendation. The appeal panel appointed Thomas L. Alberg, Ph.D., to independently review records and psychologically examine Roblero-Barrios. Dr. Alberg submitted an evaluation report, and the appeal panel held a hearing at which Dr. Alberg and Roblero-Barrios testified. Dr. Alberg wrote in his report that he does not support Roblero-Barrios’s request to be moved to a less restrictive setting. He stated that, because Roblero-Barrios has been revoked and sent to the DOC numerous times, she has spent a “relatively short” period of time in treatment since her commitment in 2001. Although Dr. Alberg noted that Roblero-Barrios “has been engaged in treatment and appears to be doing relatively well” since returning from her most recent incarceration, he stated that phase one of MSOP “still appears to be an appropriate placement” for her. Dr. Alberg wrote that Roblero- Barrios “needs to be able to demonstrate significant ability to abide by programming rules and be able to demonstrate responsible behavior before [she] moves to phase two.” He concluded that “there is no reason to believe that [Roblero-Barrios] would be able to receive treatment in a non-secure setting without any danger to the public.” Dr. Alberg testified at the appeal panel hearing that he concurred with Roblero- Barrios’s mental health diagnoses. He stated that Roblero-Barrios’s scores on tests indicated that she has several dynamic risk factors, which indicate an increased likelihood of reoffending, and a “high degree of psychopathy.” Dr. Alberg opined that Roblero- 3 Barrios still needs in-patient sex-offender treatment and supervision, and he did not believe any other treatment programs would take her in her current condition. He added that “there really hasn’t been any significant change from [Roblero-Barrios’s] initial commitment” and reiterated that she would not be able to receive treatment in a nonsecure setting without presenting a danger to the public. Roblero-Barrios testified that she requested discharge because she believes she has progressed far enough through the program to warrant outpatient treatment. She admitted that she still needs sex-offender treatment and stated that she would like to move to Rochester Transitional Living Center or Alpha Human Services in Minneapolis. She acknowledged that she had not been admitted to either program. Roblero-Barrios also stated that her core treatment group is considered advanced and has begun some work for the second phase of MSOP treatment. She said that she receives daily positive reinforcement and support from staff for her changed behavior. At the close of Roblero-Barrios’s case, the commissioner of human services moved to dismiss Roblero-Barrios’s petition under Minn. R. Civ. P. 41.02(b) and Minn. Stat. § 253D.28, subd. 2(d) (Supp. 2013).1 The appeal panel granted the motion and denied Roblero-Barrios’s petition. 1 In 2013, the legislature recodified the statutes governing civil commitment of sexually dangerous persons. See 2013 Minn. Laws, ch. 49 (codified at Minn. Stat. ch. 253D). Here, we cite the current versions of the statutes because, for purposes of this case, the legislature merely clarified pre-existing law without making any substantive changes. See Braylock v. Jesson, 819 N.W.2d 585, 588–89 (Minn.2012) . 4  DECISION We review de novo a judicial appeal panel’s dismissal of a civil-commitment discharge petition under Minn. R. Civ. P. 41.02(b). Larson v. Jesson, ___ N.W.2d ___, ___, 2014 WL 2565834, at *2 (Minn. App. June 9, 2014). A person who is committed as a sexually dangerous person may petition the special review board for a discharge or provisional discharge from commitment. Minn. Stat. § 253D.27, subds. 1, 2 (Supp. 2013). “If the special review board recommends that the commissioner deny the committed person’s discharge petition, then the committed person may request reconsideration by the judicial appeal panel.” Larson, 2014 WL 2565834, at *2. The committed person may be fully discharged only if the judicial appeal panel determines that she “is capable of making an acceptable adjustment to open society, is no longer dangerous to the public, and is no longer in need of inpatient treatment and supervision.” Minn. Stat. § 253D.31 (Supp. 2013). The judicial appeal panel must consider “whether specific conditions exist to provide a reasonable degree of protection to the public and to assist the committed person in adjusting to the community.” Id. “If the desired conditions do not exist, the discharge shall not be granted.” Id. Likewise, the committed person cannot be provisionally discharged unless she “is capable of making an acceptable adjustment to open society.” Minn. Stat. § 253D.30, subd. 1(a) (Supp. 2013). Two factors to be considered when deciding whether to grant a provisional discharge are: (1) whether the committed person’s course of treatment and present mental status indicate there is no longer 5  a need for treatment and supervision in the committed person’s current treatment setting; and (2) whether the conditions of the provisional discharge plan will provide a reasonable degree of protection to the public and will enable the committed person to adjust successfully to the community. Id., subd. 1(b) (Supp. 2013). A petitioner before an appeal panel “bears the burden of going forward with the evidence, which means presenting a prima facie case with competent evidence to show that the person is entitled to the requested relief.” Minn. Stat. § 253D.28, subd. 2(d). This is “only a burden of production.” Coker v. Jesson, 831 N.W.2d 483, 490 (Minn. 2013). The petitioner must “come forward only with sufficient, competent evidence that, if proven, would entitle the petitioner to relief.” Id. “If the committed person satisfies [her] burden of production, then the party opposing the petition ‘bears the burden of proof by clear and convincing evidence that the discharge or provisional discharge should be denied.’” Id. at 486 (quoting Minn. Stat. § 253B.19, subd. 2(d) (2012)). The commissioner may move to dismiss the petition under Minn. R. Civ. P. 41.02(b) after the petitioner’s presentation of evidence is complete. See id. at 488. The relevant portion of the rule provides: After the plaintiff has completed the presentation of evidence, the defendant, without waiving the right to offer evidence in the event the motion is not granted, may move for a dismissal on the ground that upon the facts and the law, the plaintiff has shown no right to relief . . . . 6 Minn. R. Civ. P. 41.02(b); see also Coker, 831 N.W.2d at 490-91 (holding that subsequent sentences of Minn. R. Civ. P. 41.02(b) do not apply because they conflict with the commitment statute). When deciding whether the petitioner has satisfied the burden of production, the appeal panel must “view the evidence produced at the first-phase hearing in a light most favorable to the committed person.” Coker, 831 N.W.2d at 491. It “may not weigh the evidence or make credibility determinations.” Id. at 490. A trier of fact viewing the evidence in a light most favorable to the petitioner can reject an independent examiner’s opinion that the petitioner is not ready for discharge while also accepting the examiner’s more favorable testimony. See id. at 492. The appeal panel here concluded that Roblero-Barrios “has not produced any competent evidence to meet her initial burden to establish a prima facie case for a discharge or provisional discharge.” Roblero-Barrios insists that this conclusion was wrong. She relies solely on Coker to argue that Dr. Alberg’s and her own testimony, when viewed in the light most favorable to her, satisfied her burden of production. But Roblero-Barrios’s evidence is significantly distinguishable from that in Coker. Testimony from Coker’s independent examiner established that Coker had made “considerable progress” in MSOP. Id. at 487. Dr. Alberg testified that Roblero-Barrios has made “some” progress. Testimony from Coker’s examiner established that Coker “had accomplished more than anyone else that he had evaluated at MSOP.” Id. Dr. Alberg said that Roblero-Barrios has had “some ability to participate in the program” and “some awareness of things such as an offense cycle.” Testimony from Coker’s examiner 7 established that one of Coker’s test results “could evidence a remission of sexual deviance.” Id. at 487, 492. Dr. Alberg did not say the same about Roblero-Barrios. The select portions of Dr. Alberg’s testimony that were favorable did not establish that Roblero-Barrios is capable of making an acceptable adjustment to open society. Neither did Roblero-Barrios’s own testimony. As she highlights, Roblero-Barrios testified that she believes she has progressed far enough in MSOP, she is in an advanced core group of phase one that has started some phase-two goals, she receives satisfactory or better scores in the program, and she receives positive feedback from MSOP workers. While suggesting progress, these statements fail to demonstrate that Roblero-Barrios no longer needs MSOP treatment. They present no information about the current state of her condition or what treatment she would receive outside MSOP. Roblero-Barrios also insists that she submitted a provisional discharge plan, as required for a provisional discharge. See Minn. Stat. § 253D.30, subd. 1(b)(2). The record reflects that she completed a predischarge plan with the DOC. The special review board considered it, as did Dr. Alberg. But to support her petition, the plan must be “developed, implemented, and monitored by the executive director” of MSOP. Minn. Stat. §§ 246B.01, subd. 2c, 253D.02, subd. 7, 253D.30, subd. 2 (Supp. 2013). And as the appeal panel noted, Roblero-Barrios “has yet to reach the phase of treatment where a provisional discharge plan is worked on with the [MSOP] treatment team.” Therefore, Roblero-Barrios’s DOC predischarge plan is insufficient. Although an appeal panel can reject an independent examiner’s unsupportive testimony and accept the examiner’s favorable statements, the petitioner still has the 8 burden of producing evidence to meet the statutory discharge standards. Roblero-Barrios failed to satisfy her burden. Her testimony and the favorable portions of Dr. Alberg’s testimony did not demonstrate that she is capable of making an acceptable adjustment to open society. At best, they established that Roblero-Barrios has had some positive results during the earliest stage of treatment. Even viewing the evidence in the light most favorable to Roblero-Barrios, she has failed to produce evidence that, if proven, would entitle her to a provisional discharge. See Minn. Stat. § 253D.30, subd. 1(a). Roblero- Barrios has therefore also failed to produce evidence that, if proven, would entitle her to a discharge. See Minn. Stat. § 253D.31. The appeal panel did not err by granting the commissioner’s motion to dismiss Roblero-Barrios’s petition. Affirmed. 9 

971 F.2d 1487 3 NDLR P 54 Carlton JOHNSON, by Sharon JOHNSON as his next friend;Stonewall Jackson Smith, deceased, by and through FriedaSmith and John Smith; Melissa Camp, deceased, by andthrough Cheparney Camp; and the Spina Bifida Association ofAmerica; Plaintiffs-Appellants,andSharon Johnson; and the Association for Persons With SevereHandicaps, individually and on behalf of otherssimilarly situated, Plaintiffs,v.Webb THOMPSON, M.D., Chief of Staff and Medical Director,Oklahoma Children's Memorial Hospital, in his individual andofficial capacities; Jerry D. Razook, M.D., AttendingAssistant Professor of Pediatrics, Pediatric CardiologyService, Oklahoma Children's Memorial Hospital, in hisindividual capacity; Gregory Herbeck, M.D., InternDepartment of Pediatrics, Oklahoma Children's MemorialHospital, in his individual capacity; Cynthia Houdesheldt,M.D., in her individual capacity; Richard H. Gross, M.D.,in his individual capacity; William R. Burkett, PattyEaton, Reginald Barnes, W.E. Farha, Joseph W. Stafford, JaneHartley, Virginia Kidd, John E. Orr, Wayne C. Chandler,Members, Oklahoma Commission for Human Services; RobertBonar, Administrator, Children's Hospital of Oklahoma;Andrew A. Lasser, C.E.O., Oklahoma Medical Center; RonDorris, Chief Operation Officer, Oklahoma Medical Center;Laura Tull, R.N.; Ruth Tatyrek, M.S.W.; John Stuemky,M.D.; Michael P. Morris, M.D.; Benjamin Demps, Jr.,Director, Oklahoma Department of Human Services; J. AndrewSullivan, M.D.; David Yngve, M.D.; William E. Barnes,M.D.; Harriet Coussons, M.D.; and Alan Olson, M.D.,Defendants-Appellees,andThomas Pratt, M.D., J. Patrick Livingston, M.D., and W.J.Craig, M.D., in their individual capacities, Defendants. No. 90-6107. United States Court of Appeals,Tenth Circuit. Aug. 6, 1992. Larry A. Tawwater of Lampkin, McCaffrey & Tawwater, Oklahoma City, Okl. (Ben T. Lampkin and Jo L. Slama of Lampkin, McCaffrey & Tawwater, and James Bopp, Jr., Thomas J. Marzen, and Mary M. Nimz of The National Legal Center for the Medically Dependent and Disabled, Inc., Indianapolis, Ind., with him on the brief), for plaintiffs-appellants Carlton Johnson, Stonewall Jackson Smith, and Melissa Camp. St. John Barrett, Washington, D.C., on the brief for plaintiff-appellant The Spina Bifida Ass'n of America. Robert C. Margo (John Wiggins and Cynthia L. Sparling with him on the brief) of Short Barnes Wiggins Margo & Adler, Oklahoma City, Okl., for defendants-appellees Richard Gross, M.D., J. Andrew Sullivan, M.D., David Yngve, M.D., William Barnes, M.D., Harriet Coussons, M.D., Webb Thompson, M.D., Jerry Razook, M.D., Gregory Herbeck, M.D., John Stuemky, M.D., Alan Olson, M.D., and Cynthia Houdesheldt, M.D. John G. Fears, Asst. General Counsel, Dept. of Human Services, Oklahoma Com'n for Human Services, Oklahoma City, Okl., for defendants-appellees Benjamin Demps, Jr., William R. Burkett, Patty Eaton, Reginald Barnes, W.E. Farha, Joseph W. Stafford, Jane Hartley, Virginia Kidd, John E. Orr, Wayne C. Chandler, Robert Bonar, Andrew A. Lasser, Ron Dorris, Laura Tull, R.N., and Ruth Tatyrek, M.S.W. Before HOLLOWAY and EBEL, Circuit Judges, and OWEN, District Judge.* EBEL, Circuit Judge. 1 This appeal requires us to confront a variety of issues regarding the medical treatment provided to certain infants born with spina bifida. We address primarily whether the infants' rights under the Constitution and under section 504 of the Rehabilitation Act of 1973, 29 U.S.C. § 794, were violated. The district court entered judgment for the defendants. We affirm. I. Background 2 Plaintiffs-Appellants Carlton Johnson, Melissa Camp, and Stonewall Jackson Smith were all born with myelomeningocele ("MM"), a type of spina bifida, at Oklahoma Children's Memorial Hospital ("OCMH"). The appellants allege that they received discriminatory treatment based on their handicap and on their socioeconomic status. The parties sharply dispute many of the facts in this case. However, the record supports the following factual background. 3 Defendant-appellee Dr. Richard H. Gross led a team of doctors and other health professionals ("the MM team") at OCMH who treated newborn infants with myelomeningocele. This treatment, which includes surgery and the administering of antibiotics, must take place soon after birth. In some cases, however, the infant will not survive even with treatment. In such cases, treating the infant merely prolongs his or her suffering. 4 In conjunction with his work at the hospital, Dr. Gross performed a study and published an article, entitled Early Management and Decision Making for the Treatment of Myelomeningocele, 72 Pediatrics 450 (1983). This study covered the period 1977 through 1982, during which time the MM team evaluated sixty-nine infants born with myelomeningocele. The MM team recommended "vigorous treatment," i.e., surgery and antibiotics, for thirty-six of the infants. One of these infants later died of unrelated causes; the rest survived. The team recommended "supportive care," i.e., no treatment other than making the infants as comfortable as possible, for the remaining thirty-three infants. The parents of five infants in the latter group rejected the recommendations, and three of these infants survived. Several other infants survived without treatment for several months and were subsequently treated. The remaining twenty-four infants receiving supportive care died. 5 The appellants allege that when the MM team made its recommendations, it considered both medical and nonmedical criteria, the latter including the parents' socioeconomic status. The appellants allege that the MM team discriminated against infants who came from families that the team believed lacked the intellectual and financial resources to provide the appropriate continuing care for a child with MM. According to the appellants, the MM team was more likely to recommend only supportive care for infants from such families. The appellants further allege that the MM team did not inform parents of its consideration of such factors when it made its recommendation. Although the appellees argue that the parents made the ultimate treatment decision, parents of sixty-four of the sixty-nine infants followed the MM team's recommendation. Thus, the appellants argue, the MM team was the true decisionmaker. 6 Melissa Camp and Stonewall Jackson Smith were participants in the study. The team recommended, and each infant received, only supportive care; both died. Carlton Johnson was born after completion of the study, but while the team allegedly continued to use the study's criteria to make its recommendation. The MM team recommended and Johnson received only supportive care. He survived without treatment for seventeen months, when surgery was finally performed. He was still alive at the time of trial, but suffered a severe mental handicap allegedly due, in part, to the team's failure to treat him immediately. 7 The hospital changed its practice in 1984. Since then, all infants born with spina bifida have received vigorous treatment, with the exception of one infant for whom treatment clearly would have been futile. 8 The parents of Camp, Smith, and Johnson, on behalf of their children, together with the Spina Bifida Association of America ("SBAA") and the Association for Persons with Severe Handicaps ("the plaintiffs"), filed suit against the members of the MM team, various other physicians, and a number of state officials. The plaintiffs sought class certification on behalf of 156 potential members, all infants born with MM at OCMH during the pendency of the study and all those born afterward while OCMH allegedly continued to use the study criteria. In their complaint, the plaintiffs asserted causes of action from violations of rights arising under, among other sources, the Due Process Clause, the Equal Protection Clause, section 504 of the Rehabilitation Act of 1973 ("section 504"), and state law. The plaintiffs sought compensatory and punitive damages along with declaratory and injunctive relief. 9 The district court denied the plaintiff's application for class certification, 125 F.R.D. 169. In addition, the court dismissed, pursuant to Fed.R.Civ.P. 12(b)(6), the cause of action brought under section 504. It granted summary judgment in favor of the defendants on the claims for declaratory and injunctive relief and accordingly dismissed from the action all defendants against whom the plaintiffs had sought only such relief. The court also granted summary judgment in favor of defendant Dr. Alan Olson. 10 Trial commenced in 1990 against the remaining defendants on the plaintiffs' claims based on 42 U.S.C. § 1983 and state common law negligence. Prior to submitting the case to the jury, however, the district court directed verdicts in favor of the defendants on all claims asserted on behalf of plaintiff Stonewall Jackson Smith, all claims asserted against defendants Dr. Gregory Herbeck and Dr. Jerry D. Razook, and all claims asserted under 42 U.S.C. § 1983. The court then submitted Carlton Johnson's and Melissa Camp's negligence claims against the remaining physician defendants to the jury, which found for the defendants. 11 Camp, Smith, and Johnson, together with the SBAA, filed a timely notice of appeal.1 We have jurisdiction pursuant to 28 U.S.C. § 1291. II. Section 504 12 The appellants argue that the district court erred in dismissing their cause of action under section 504 of the Rehabilitation Act of 1973, 29 U.S.C. § 794. Because the court dismissed this claim on the pleadings pursuant to Fed.R.Civ.P. 12(b)(6), we review its order de novo. Ayala v. Joy Mfg. Co., 877 F.2d 846, 847 (10th Cir.1989). 13 At the time this action was brought, section 504 provided in relevant part: 14 No otherwise qualified handicapped individual in the United States, as defined in [29 U.S.C. § 706(7) ], shall, solely by reason of his handicap, be excluded from the participation in, be denied the benefits of, or be subjected to discrimination under any program or activity receiving Federal financial assistance or under any program or activity conducted by any Executive agency.... 15 29 U.S.C.A. § 794 (West 1985).2 Thus, to state a claim under section 504, "a plaintiff must prove (1) that he is a 'handicapped individual' under the Act, (2) that he is 'otherwise qualified' for the [benefit] sought, (3) that he was [discriminated against] solely by reason of his handicap, and (4) that the program or activity in question receives federal financial assistance." Strathie v. Department of Transp., 716 F.2d 227, 230 (3d Cir.1983) (citation omitted); see also Rothschild v. Grottenthaler, 907 F.2d 286, 289-90 (2d Cir.1990). 16 The district court held that "[w]hen the intervention of parental decision, well based on adequate medical briefings or not, necessarily lies in the path of the infant's receipt of the benefit, it cannot be said either that the infant is [']otherwise qualified['] or that the discrimination is [']solely['] because of handicap." R., Vol. I, Doc. 158, at 1. The appellants argue that if the MM team's actions rendered parental consent a sham, such "consent" cannot be considered an intervening cause that makes section 504 inapplicable. We agree with this argument by the appellants, but nonetheless conclude that the district court's dismissal of the section 504 claim was proper, albeit for different reasons. 17 Whether section 504 applies to "individual medical treatment decisions involving handicapped infants" is a controversial issue that the Supreme Court has expressly left open. See Bowen v. American Hosp. Ass'n., 476 U.S. 610, 624, 106 S.Ct. 2101, 2110, 90 L.Ed.2d 584 (1986) (plurality opinion). The appellants argue that the MM team's conduct constituted discrimination in violation of section 504 based on two principal grounds. They argue primarily that the team recommended only supportive care for Camp, Smith, and Johnson because their families were of low socioeconomic status. They argue secondarily that, in general, the team recommended supportive care for those infants as to whom they anticipated a greater degree of handicap. In addition, the SBAA makes a third argument that the hospital discriminated against all infants born with MM. We deal with each argument in turn. 18 A. Discrimination Based on Socioeconomic Status 19 In essence, the appellants argue that but for (1) having spina bifida and (2) being of low socioeconomic status, the MM team would not have recommended that they receive only supportive care. Because of the discrimination based on these two conditions, the appellants assert a violation of section 504. To evaluate their claim, we consider whether the appellants have met section 504's four conditions. 20 The Supreme Court's decision in Bowen establishes that the first condition--that infants born with spina bifida are "handicapped individuals" under the Rehabilitation Act of 1973--has been met. Although the Supreme Court did not issue a majority opinion in that case, seven Justices agreed that the term encompasses "an infant who is born with a congenital defect." See Bowen, 476 U.S. at 624, 106 S.Ct. at 2110 (opinion of Stevens, J., joined by Marshall, Blackmun & Powell, JJ.); id. at 652, 106 S.Ct. at 2125 (opinion of White, J., joined by Brennan & O'Connor, JJ.). 21 The appellants' complaint fails to satisfy both the second and third conditions. However, for purposes of our holding with regard to these particular allegations, we need address only the third condition, that the discrimination resulted "solely by reason of [the] handicap." 29 U.S.C. § 794. In essence, the appellants argue that the team discriminated against them in relation to other infants with spina bifida because of their low socioeconomic status. Section 504, by its very terms, does not cover discrimination among similarly handicapped persons. See Clark v. Cohen, 613 F.Supp. 684, 693 (E.D.Pa.1985), aff'd on other grounds, 794 F.2d 79 (3d Cir.), cert. denied, 479 U.S. 962, 107 S.Ct. 459, 93 L.Ed.2d 404 (1986). The word solely provides the key: the discrimination must result from the handicap and from the handicap alone. If others with the same handicap do not suffer the discrimination, then the discrimination does not result "solely by reason of [the] handicap." Here, the appellants allege that the discrimination resulted at least in part from their low socioeconomic status. That discrimination is not actionable under section 504. Accordingly, we hold that the district court correctly dismissed the causes of action based on those allegations for failure to state a claim under section 504. 22 B. Discrimination Based on Degree of Handicap 23 The appellants argue that the MM team "used the anticipated degree of handicap as a basis for recommending that beneficial medical treatment not be provided" and in so doing violated section 504. Corrected Br. in Chief of Appellants Carlton Johnson, Stonewall Jackson Smith and Melissa Camp at 30 [hereinafter Appellants' Br. in Chief]. We reject this argument because the appellants fail to satisfy the second condition of section 504, that they were "otherwise qualified" for the treatment they did not receive. 24 The "otherwise qualified" language, when considered in conjunction with the "solely" language of the third condition, poses a formidable obstacle for anyone alleging discrimination in violation of section 504 based upon the failure to receive medical treatment for a birth defect. Such a plaintiff must prove that he or she was discriminatorily denied medical treatment because of the birth defect and, at the same time, must prove that, in spite of the birth defect, he or she was "otherwise qualified" to receive the denied medical treatment. Ordinarily, however, if such a person were not so handicapped, he or she would not need the medical treatment and thus would not "otherwise qualify" for the treatment. 25 We agree, therefore, with the Second Circuit's analysis in United States v. University Hospital, State University of New York at Stony Brook, 729 F.2d 144 (2d Cir.1984). In that case, the court considered the application of section 504, and its second requirement in particular, to infants born with multiple birth defects. The court stated that the term otherwise qualifiedannot ordinarily be applied "in the comparatively fluid context of medical treatment decisions without distorting its plain meaning. In common parlance, one would not ordinarily think of a newborn infant suffering from multiple birth defects as being 'otherwise qualified' to have corrective surgery performed." Id. at 156. The court reasoned, "[w]here the handicapping condition is related to the condition(s) to be treated, it will rarely, if ever, be possible to say ... that a particular decision was 'discriminatory.' " Id. at 157.3 26 C. Discrimination Against All Infants with MM 27 The SBAA argues that the team discriminated against all infants with MM by designating them as subjects of a medical research project without their parents' knowledge or consent. Because all infants with MM were part of the study during its pendency, the SBAA contends the discrimination was "solely" due to the handicap, thereby meeting the third condition. 28 Under this argument, the appellants still fail to satisfy the second condition. The infants required the medical treatment sought only because they were born with MM. Thus, they were not "otherwise qualified" to receive the medical treatment denied to them because of the alleged discrimination. 29 Section 504 proscribes discrimination between the nonhandicapped and the "otherwise qualified" handicapped. It does not create any absolute substantive right to treatment. As the plurality stated in Bowen, " 'Section 504 seeks to assure evenhanded treatment'; 'neither the language, purpose, nor history of [section] 504 reveals an intent to impose an affirmative-action obligation' on recipients of federal financial assistance." Bowen, 476 U.S. at 640, 106 S.Ct. at 2118 (plurality opinion) (citations omitted). The plurality also noted that "nothing in the legislative history ... even remotely suggests that Congress contemplated the possibility that 'section 504 could or would be applied to treatment decisions[ ] involving defective newborn infants.' " Id. at 645 n. 33, 106 S.Ct. at 2121 n. 33 (citation omitted; alteration added). Without a showing that the nonhandicapped received the treatment denied to the "otherwise qualified" handicapped, the appellants cannot assert that a violation of section 504 has occurred. 30 In sum, we hold that the appellants failed to state a claim for violation of section 504 and that the district court therefore did not err in dismissing the claim brought under this section. III. Section 1983 31 In their complaint below, the appellants asserted that discrimination based on socioeconomic factors violated their procedural due process and equal protection rights, that the MM team's failure to provide vigorous treatment violated their substantive due process rights, that discrimination on the basis of handicap violated their rights under section 504, and that the MM team's recommendations deprived the parents of the opportunity to make decisions regarding their children's care in violation of their fundamental right to privacy. For each of these alleged violations of federal rights, the appellants brought a cause of action under 42 U.S.C. § 1983. The district court granted the appellees' motions for directed verdicts on all of these causes of action. The appellants now argue that the district court erred in doing so. 32 We review de novo the district court's ruling on a motion for directed verdict. Hill v. Goodyear Tire & Rubber, Inc., 918 F.2d 877, 880 (10th Cir.1990). We look to the record to see if the evidence, construed in the light most favorable to the nonmoving party, supports only one resolution of the issue. See Ralston Dev. Corp. v. United States, 937 F.2d 510, 512 (10th Cir.1991). 33 A. Discrimination on the Basis of Socioeconomic Status 34 The appellants argue that discrimination on the basis of socioeconomic status violates their right to due process and equal protection. The district court directed a verdict on this issue after concluding that no evidence supported the claim: 35 The article makes reference to socioeconomic factors as being considered, theoretically, but we don't have any evidence here that the children who were selected for [vigorous] treatment enjoyed a socioeconomic status any different from the ones that were recommended for supportive [care]. We don't have any evidence that wealthy parents' babies lived and poor parents' babies died; we don't have any evidence of a racial basis or anything other than a medical determination based upon degree of handicap and not on mere presence of handicap. 36 R., Vol. XX, at 592. 37 On appeal, the appellants argue that "[t]he constitutional right to be free from discrimination requires no citation." Appellants' Br. in Chief at 38. However, the district court did not direct a verdict because of a defect in the appellants' legal theory--it directed the verdict because of a lack of evidence. The appellants do not point us to any evidence that the district court may have overlooked. Indeed, they do not discuss the evidence at all. 38 The appellants presented as evidence only Dr. Gross' article, which indicates that the MM team considered socioeconomic factors in making its recommendation. However, the appellants presented no evidence that these factors affected the outcome of the recommendations in their individual cases. In other words, there is no evidence to establish that the appellants' socioeconomic status was a factor that caused the recommendation that they receive only supportive care. After our review of the record, we therefore agree with the district court that the appellants presented no evidence of discriminatory harm and that the district court correctly granted the motion for a directed verdict. B. Substantive Due Process 39 The appellants argue that the appellees' conduct violated their substantive due process rights by depriving them of their liberty interests in their own lives. Because of this deprivation, the appellants urge us to reverse the district court's decision to direct a verdict for the appellees on the appellants' section 1983 claim based on substantive due process. 40 The Due Process Clause does protect an interest in life. E.g., Cruzan v. Director, Missouri Dep't of Health, 497 U.S. 261, 271, 110 S.Ct. 2841, 2853, 111 L.Ed.2d 224 (1990). It does not follow, however, that the state necessarily has a constitutional duty to take affirmative steps to preserve life. In DeShaney v. Winnebago County Department of Social Services, 489 U.S. 189, 109 S.Ct. 998, 103 L.Ed.2d 249 (1989), the Supreme Court explained: 41 The [Due Process] Clause is phrased as a limitation on the State's power to act, not as a guarantee of certain minimal levels of safety and security. It forbids the State itself to deprive individuals of life, liberty, or property without "due process of law," but its language cannot fairly be extended to impose an affirmative obligation on the State to ensure that those interests do not come to harm through other means. 42 Id. at 195, 109 S.Ct. at 1002. 43 In effect, the appellants argue that substantive due process implies a right to treatment. Such a right exists only in narrow circumstances, however. Specifically, "when the State takes a person into its custody and holds him there against his will, the Constitution imposes upon it a corresponding duty to assume some responsibility for his safety and general well-being." Id. at 199-200, 109 S.Ct. at 1005 (citations omitted); see Youngberg v. Romeo, 457 U.S. 307, 324, 102 S.Ct. 2452, 2462, 73 L.Ed.2d 28 (1982) (involuntarily committed mental patient entitled to adequate medical care). 44 Infants born with spina bifida do not fall into the above category; accordingly, such infants cannot claim a constitutional right to treatment. Without such a right, the appellants cannot claim a deprivation of their liberty interest if the state failed to treat them. Cf. DeShaney, 489 U.S. at 196-97, 109 S.Ct. at 1003-04 ("If the Due Process Clause does not require the State to provide its citizens with particular protective services, it follows that the State cannot be held liable under the Clause for injuries that could have been averted had it chosen to provide them.") (footnote omitted). 45 The fact that the state did provide some medical services does not alter this analysis. The First Circuit recently stated in an analogous situation involving a section 1983 claim: 46 Although the [state] may have played some causal role in the harm, it did so only because [the plaintiff] voluntarily availed himself of a [state] service. The [state] did not force [the plaintiff], against his will, to become dependent upon it. Thus, the [state's] actions, while possibly negligent or even willfully indifferent or reckless, did not take on the added character of violations of the federal Constitution. 47 Monahan v. Dorchester Counseling Center, Inc., 961 F.2d 987, 993 (1st Cir.1992). Similarly, the fact that the appellants had received some medical benefits at OCMH did not entitle them to further treatment based on substantive due process. 48 We accordingly affirm the district court's decision to grant a directed verdict for the appellees on the appellants' section 1983 cause of action for violation of their substantive due process rights. C. Section 504 49 The appellants assert a violation of their rights under section 504. We held in Part II of this opinion that no violation occurred, even taking all of the appellants' allegations as true. We therefore hold that the district court did not err in directing a verdict for the appellees on the appellants' section 1983 claim for violation of rights secured by section 504. D. Parental Rights 50 The parents argue that the MM team deprived them of the right to choose what type of medical care their children should receive. They contend that this right is inherently part of the right to privacy protected by the Fourteenth Amendment. Thus, they argue, the district court erred in directing a verdict for the appellees on their section 1983 cause of action for violation of their right to privacy. 51 The parents did not file a notice of appeal in their own right, however, but rather took this appeal only as representatives of the infants. If a party's name does not appear in a timely filed notice of appeal, that party has not appealed any adverse judgment. Torres v. Oakland Scavenger Co., 487 U.S. 312, 314-18, 108 S.Ct. 2405, 2407-09, 101 L.Ed.2d 285 (1988). The parents therefore are not parties to this appeal except as representatives of the infants,4 and they have no standing to assert claims on their own behalf. Accordingly, we have no jurisdiction to hear the parents' argument regarding violation of their own rights.IV. Denial of Discovery of Identities of Study Participants 52 The appellants argue that the district court erred in denying their motion to compel discovery of the names of all participants in the MM team's study. We review orders relating to discovery for an abuse of discretion. See Willner v. Budig, 848 F.2d 1032, 1035-36 (10th Cir.1988), cert. denied, 488 U.S. 1031, 109 S.Ct. 840, 102 L.Ed.2d 972 (1989). We hold that the district court did not abuse its discretion in denying the motion. 53 The magistrate who initially decided the appellants' motion concluded that the privacy interests of the other study participants outweighed the appellants' need for the information. The appellants appealed this decision to the district court, which upheld the magistrate's judgment. 54 The appellants argue that the information sought went to the heart of their allegations. The appellants presented the MM team's article as preliminary evidence. The members of the team contend, however, that they did not actually make "recommendations" to the parents, but rather only presented options to them, and that they did not actually base medical decisions on socioeconomic data. Thus, the appellants sought testimony from other study participants to show the existence of a concerted plan to use socioeconomic criteria in making recommendations for appropriate treatment and to refute the appellees' contention that they merely presented options to parents who made the final choice. To obtain such testimony, the appellants sought to learn the identities of these other participants. 55 The decision whether to administer heroic life-sustaining treatment to a severely handicapped newborn is one of the most heartwrenching decisions a parent can be called upon to make. See American Academy of Pediatrics v. Heckler, 561 F.Supp. 395, 396-97 (D.D.C.1983). Parents who have had to make such a decision are entitled to privacy and confidentiality. We believe that the magistrate was correct to balance the relevance and necessity of the information the appellants requested against the rights of other participants to maintain their privacy. See Lukaszewicz v. Ortho Pharmaceutical Corp., 90 F.R.D. 708, 709 (E.D.Wis.1981). 56 The appellees did provide information about the care rendered to each participant in the study. However, the appellees did not disclose the identities of the other infants. Thus, if the appellants desired to impeach the appellees' representations regarding treatment to those other infants, the appellants had to ascertain the identities of the infants' families through other means. That no doubt presented a difficult--perhaps impossible--task for the appellants. Nonetheless, given the important interests of the other infants and their families to preserve the confidential nature of their contacts with the physicians and the hospital, we cannot say that the magistrate abused his discretion in refusing to order this discovery. V. Other Issues 57 The appellants raise a number of other issues, which we need only discuss briefly. A. Statute of Limitations 58 The appellants argue that the district court erred in submitting to the jury the issue of whether Melissa Camp's negligence claim was time-barred. Because her father testified without contradiction that he did not learn of the MM team's actions until 1986, the appellants argue that the district court should have directed a verdict on this issue in favor of Melissa Camp. Instead, the court submitted the issue to the jury, which decided that Melissa Camp's claims were barred by the statute of limitations. 59 Under Oklahoma law, the relevant statute of limitations requires that a plaintiff bring a suit within "two years from the date [the] plaintiff knew or should have known, through the exercise of reasonable diligence[,] of the existence of the death, injury or condition complained of." Redwine v. Baptist Medical Center of Okla., Inc., 679 P.2d 1293, 1295 (Okla.1983). Moreover, "[w]hether plaintiff exercised 'reasonable diligence' in ascertaining the cause of ... death is a question of fact to be determined by the jury." Id. Because the issue was not when Melissa's father learned of the relevant facts, but rather when he should have learned of them, the district court properly denied the motion for a directed verdict.5 B. Class Certification 60 The appellants contend that the district court erred in denying their application for class certification. We review the district court's decision for abuse of discretion. Pilots Against Illegal Dues v. Air Line Pilots Ass'n, 938 F.2d 1123, 1134 (10th Cir.1991). The district court held that the number of infants denied vigorous treatment was too small to meet the numerosity requirement of Fed.R.Civ.P. 23(a)(1). Given our deferential standard of review, we cannot say that the court's decision was in error. See Rex v. Owens, 585 F.2d 432, 436 (10th Cir.1978) ("no set formula" to determine whether numerosity requirement was met; instead, this is a fact-specific inquiry best left to discretion of district court). C. Declaratory and Injunctive Relief 61 The appellants argue that the district court erred in granting summary judgment to the appellees on the claims for declaratory and injunctive relief. Declaratory relief is discretionary, Green v. Mansour, 474 U.S. 64, 72, 106 S.Ct. 423, 427, 88 L.Ed.2d 371 (1985), and we find no abuse of that discretion in the court's declining to exercise jurisdiction over the appellants' claims for such relief. With regard to injunctive relief, we agree with the district court that the appellants' failure to present any evidence of continuing discrimination since 1984 renders concerns of future recurrence purely speculative. We therefore affirm the district court's grant of summary judgment on these issues. D. Jury Instructions 62 The appellants argue that the district court instructed the jury incorrectly regarding the differing standards of conduct applicable to appellees Dr. Gross and Dr. Thompson. We find no error in the district court's reliance on Fox v. Oklahoma Memorial Hospital, 774 P.2d 459 (Okla.1989), which held that a plaintiff must show gross negligence to overcome the sovereign immunity enjoyed by a physician employed at a state hospital at the time of Melissa Camp's birth. Id. at 461. Furthermore, the court specifically explained to the jury that it was to apply a different standard of negligence to Carlton Johnson's claims because they arose at a time when Oklahoma law was different. See R., Vol. V, Doc. 480, Instruction No. 15. 63 The appellants also challenge the adequacy of the informed consent instruction given to the jury. However, the appellants failed to object to the instruction below, and on review we do not find the instruction to be plain error. E. Summary Judgment for Dr. Olson 64 The appellants appeal the district court's denial of their motion for reconsideration of the dismissal of appellee Dr. Alan Olson on summary judgment. The standard of review for the denial of a motion for reconsideration depends on the nature of the underlying decision. See Federal Kemper Ins. Co. v. Rauscher, 807 F.2d 345, 348-49 (3d Cir.1986). In this case, because the motion was for reconsideration of summary judgment, our review is de novo. Applied Genetics Int'l, Inc. v. First Affiliated Sec., Inc., 912 F.2d 1238, 1241 (10th Cir.1990). After reviewing the record, we agree with the appellees that Dr. Olson's status as an attending physician did not connect him sufficiently to the treatment decisions made and that summary judgment was appropriate. 65 F. Directed Verdicts for Dr. Herbeck and Dr. Razook 66 The appellants argue that the district court incorrectly directed verdicts for appellees Dr. Herbeck and Dr. Razook regarding the decision to administer supportive care to Stonewall Jackson Smith. The appellants had argued below that Smith's mother had not given informed consent to withhold vigorous treatment. 67 Under Oklahoma law, a plaintiff must prove that injury resulted in order to present a prima facie case of breach of duty to inform. Scott v. Bradford, 606 P.2d 554, 557-59 (Okla.1979). The appellees sought to avoid liability by showing that Smith would not have survived even with vigorous treatment. In support, they introduced evidence that Smith suffered from anencephaly, a congenital absence of the brain; when such a condition is present, an infant cannot survive with or without treatment. 68 In response, the appellants introduced evidence that the test the appellees used to test for anencephaly was not always accurate. They also introduced testimony that Smith might have survived if the test were inaccurate and he did not have anencephaly. The appellants presented no evidence, however, that the test was in fact inaccurate in this particular case or that Smith would have survived. They therefore failed to show that an injury resulted from the lack of informed consent, as required under Scott. Under these circumstances, we affirm the district court's decision to direct a verdict. G. Other Rulings 69 The appellants challenge various evidentiary rulings and a ruling denying a mistrial. After reviewing the record, we find no abuse of discretion on these rulings. 70 The appellants also list several other issues in their "Statement of the Issues," but fail to brief them. In general, we do not address issues not briefed. See American Airlines v. Christensen, 967 F.2d 410, 415 n. 8 (10th Cir.1992) ("It is insufficient merely to state in one's brief that one is appealing an adverse ruling below without advancing reasoned argument as to the grounds for appeal.") (citing Fed.R.App.P. 28(a)(4), recodified as Fed.R.App.P. 28(a)(5)). VI. Conclusion 71 Because we hold that the district court committed no reversible error, we AFFIRM its judgment. * Honorable Richard Owen, Senior District Judge, United States District Court for the Southern District of New York, sitting by designation 1 For convenience, we will refer to the infants Camp, Smith, and Johnson as "the appellants." 2 Section 504 was amended in 1986, after the appellants first filed this action, and again in 1988. Neither amendment substantively affects the meaning of the section as relevant to the instant appeal 3 Several jurists have hypothesized situations in which the handicap that forms the basis of the section 504 discrimination bears no relation to the medical treatment sought but denied. For example, Justice White stated in Bowen: An esophageal obstruction, for example, would not be part and parcel of the handicap of a baby suffering from Down's syndrome, and the infant would benefit from and is thus otherwise qualified for having the obstruction removed in spite of the handicap. In this case, the treatment is completely unrelated to the baby's handicapping condition. If an otherwise normal child would be given the identical treatment, so should the handicapped child if discrimination on the basis of the handicap is to be avoided. Bowen, 476 U.S. at 655, 106 S.Ct. at 2127 (footnote omitted) (White, J., dissenting); see also University Hospital, 729 F.2d at 162 (Winter, J., dissenting). We do not decide whether section 504 might apply in such a situation, but it would seem that the "otherwise qualified" condition might be satisfied under such a scenario. See Glanz v. Vernick, 750 F.Supp. 39, 45-46 (D.Mass.1990) (AIDS patient denied treatment for ear perforation stated claim under section 504). We do not find such a situation here. 4 Sharon Johnson, Carlton Johnson's mother, originally appeared as a plaintiff. She voluntarily dismissed her claims without prejudice and is no longer a party except as a representative of her son. See R., Vol. V, Doc. 469, at 2 5 In view of our resolution of this issue, the appellee's Motion to Strike Juror Affidavit and Request for Corrected Brief in Chief is moot

# # Copyright 2014 Facebook # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from __future__ import absolute_import, division, print_function from contextlib import closing import os import socket from tornado.concurrent import Future from tornado.netutil import bind_sockets, Resolver from tornado.queues import Queue from tornado.tcpclient import TCPClient, _Connector from tornado.tcpserver import TCPServer from tornado.testing import AsyncTestCase, gen_test from tornado.test.util import skipIfNoIPv6, unittest, refusing_port, skipIfNonUnix from tornado.gen import TimeoutError # Fake address families for testing. Used in place of AF_INET # and AF_INET6 because some installations do not have AF_INET6. AF1, AF2 = 1, 2 class TestTCPServer(TCPServer): def __init__(self, family): super(TestTCPServer, self).__init__() self.streams = [] self.queue = Queue() sockets = bind_sockets(None, 'localhost', family) self.add_sockets(sockets) self.port = sockets[0].getsockname()[1] def handle_stream(self, stream, address): self.streams.append(stream) self.queue.put(stream) def stop(self): super(TestTCPServer, self).stop() for stream in self.streams: stream.close() class TCPClientTest(AsyncTestCase): def setUp(self): super(TCPClientTest, self).setUp() self.server = None self.client = TCPClient() def start_server(self, family): if family == socket.AF_UNSPEC and 'TRAVIS' in os.environ: self.skipTest("dual-stack servers often have port conflicts on travis") self.server = TestTCPServer(family) return self.server.port def stop_server(self): if self.server is not None: self.server.stop() self.server = None def tearDown(self): self.client.close() self.stop_server() super(TCPClientTest, self).tearDown() def skipIfLocalhostV4(self): # The port used here doesn't matter, but some systems require it # to be non-zero if we do not also pass AI_PASSIVE. addrinfo = self.io_loop.run_sync(lambda: Resolver().resolve('localhost', 80)) families = set(addr[0] for addr in addrinfo) if socket.AF_INET6 not in families: self.skipTest("localhost does not resolve to ipv6") @gen_test def do_test_connect(self, family, host, source_ip=None, source_port=None): port = self.start_server(family) stream = yield self.client.connect(host, port, source_ip=source_ip, source_port=source_port) server_stream = yield self.server.queue.get() with closing(stream): stream.write(b"hello") data = yield server_stream.read_bytes(5) self.assertEqual(data, b"hello") def test_connect_ipv4_ipv4(self): self.do_test_connect(socket.AF_INET, '127.0.0.1') def test_connect_ipv4_dual(self): self.do_test_connect(socket.AF_INET, 'localhost') @skipIfNoIPv6 def test_connect_ipv6_ipv6(self): self.skipIfLocalhostV4() self.do_test_connect(socket.AF_INET6, '::1') @skipIfNoIPv6 def test_connect_ipv6_dual(self): self.skipIfLocalhostV4() if Resolver.configured_class().__name__.endswith('TwistedResolver'): self.skipTest('TwistedResolver does not support multiple addresses') self.do_test_connect(socket.AF_INET6, 'localhost') def test_connect_unspec_ipv4(self): self.do_test_connect(socket.AF_UNSPEC, '127.0.0.1') @skipIfNoIPv6 def test_connect_unspec_ipv6(self): self.skipIfLocalhostV4() self.do_test_connect(socket.AF_UNSPEC, '::1') def test_connect_unspec_dual(self): self.do_test_connect(socket.AF_UNSPEC, 'localhost') @gen_test def test_refused_ipv4(self): cleanup_func, port = refusing_port() self.addCleanup(cleanup_func) with self.assertRaises(IOError): yield self.client.connect('127.0.0.1', port) def test_source_ip_fail(self): ''' Fail when trying to use the source IP Address '8.8.8.8'. ''' self.assertRaises(socket.error, self.do_test_connect, socket.AF_INET, '127.0.0.1', source_ip='8.8.8.8') def test_source_ip_success(self): ''' Success when trying to use the source IP Address '127.0.0.1' ''' self.do_test_connect(socket.AF_INET, '127.0.0.1', source_ip='127.0.0.1') @skipIfNonUnix def test_source_port_fail(self): ''' Fail when trying to use source port 1. ''' self.assertRaises(socket.error, self.do_test_connect, socket.AF_INET, '127.0.0.1', source_port=1) @gen_test def test_connect_timeout(self): timeout = 0.05 class TimeoutResolver(Resolver): def resolve(self, *args, **kwargs): return Future() # never completes with self.assertRaises(TimeoutError): yield TCPClient(resolver=TimeoutResolver()).connect( '1.2.3.4', 12345, timeout=timeout) class TestConnectorSplit(unittest.TestCase): def test_one_family(self): # These addresses aren't in the right format, but split doesn't care. primary, secondary = _Connector.split( [(AF1, 'a'), (AF1, 'b')]) self.assertEqual(primary, [(AF1, 'a'), (AF1, 'b')]) self.assertEqual(secondary, []) def test_mixed(self): primary, secondary = _Connector.split( [(AF1, 'a'), (AF2, 'b'), (AF1, 'c'), (AF2, 'd')]) self.assertEqual(primary, [(AF1, 'a'), (AF1, 'c')]) self.assertEqual(secondary, [(AF2, 'b'), (AF2, 'd')]) class ConnectorTest(AsyncTestCase): class FakeStream(object): def __init__(self): self.closed = False def close(self): self.closed = True def setUp(self): super(ConnectorTest, self).setUp() self.connect_futures = {} self.streams = {} self.addrinfo = [(AF1, 'a'), (AF1, 'b'), (AF2, 'c'), (AF2, 'd')] def tearDown(self): # Unless explicitly checked (and popped) in the test, we shouldn't # be closing any streams for stream in self.streams.values(): self.assertFalse(stream.closed) super(ConnectorTest, self).tearDown() def create_stream(self, af, addr): stream = ConnectorTest.FakeStream() self.streams[addr] = stream future = Future() self.connect_futures[(af, addr)] = future return stream, future def assert_pending(self, *keys): self.assertEqual(sorted(self.connect_futures.keys()), sorted(keys)) def resolve_connect(self, af, addr, success): future = self.connect_futures.pop((af, addr)) if success: future.set_result(self.streams[addr]) else: self.streams.pop(addr) future.set_exception(IOError()) # Run the loop to allow callbacks to be run. self.io_loop.add_callback(self.stop) self.wait() def assert_connector_streams_closed(self, conn): for stream in conn.streams: self.assertTrue(stream.closed) def start_connect(self, addrinfo): conn = _Connector(addrinfo, self.create_stream) # Give it a huge timeout; we'll trigger timeouts manually. future = conn.start(3600, connect_timeout=self.io_loop.time() + 3600) return conn, future def test_immediate_success(self): conn, future = self.start_connect(self.addrinfo) self.assertEqual(list(self.connect_futures.keys()), [(AF1, 'a')]) self.resolve_connect(AF1, 'a', True) self.assertEqual(future.result(), (AF1, 'a', self.streams['a'])) def test_immediate_failure(self): # Fail with just one address. conn, future = self.start_connect([(AF1, 'a')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assertRaises(IOError, future.result) def test_one_family_second_try(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) self.resolve_connect(AF1, 'b', True) self.assertEqual(future.result(), (AF1, 'b', self.streams['b'])) def test_one_family_second_try_failure(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) self.resolve_connect(AF1, 'b', False) self.assertRaises(IOError, future.result) def test_one_family_second_try_timeout(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) # trigger the timeout while the first lookup is pending; # nothing happens. conn.on_timeout() self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) self.resolve_connect(AF1, 'b', True) self.assertEqual(future.result(), (AF1, 'b', self.streams['b'])) def test_two_families_immediate_failure(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b'), (AF2, 'c')) self.resolve_connect(AF1, 'b', False) self.resolve_connect(AF2, 'c', True) self.assertEqual(future.result(), (AF2, 'c', self.streams['c'])) def test_two_families_timeout(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_timeout() self.assert_pending((AF1, 'a'), (AF2, 'c')) self.resolve_connect(AF2, 'c', True) self.assertEqual(future.result(), (AF2, 'c', self.streams['c'])) # resolving 'a' after the connection has completed doesn't start 'b' self.resolve_connect(AF1, 'a', False) self.assert_pending() def test_success_after_timeout(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_timeout() self.assert_pending((AF1, 'a'), (AF2, 'c')) self.resolve_connect(AF1, 'a', True) self.assertEqual(future.result(), (AF1, 'a', self.streams['a'])) # resolving 'c' after completion closes the connection. self.resolve_connect(AF2, 'c', True) self.assertTrue(self.streams.pop('c').closed) def test_all_fail(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_timeout() self.assert_pending((AF1, 'a'), (AF2, 'c')) self.resolve_connect(AF2, 'c', False) self.assert_pending((AF1, 'a'), (AF2, 'd')) self.resolve_connect(AF2, 'd', False) # one queue is now empty self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) self.assertFalse(future.done()) self.resolve_connect(AF1, 'b', False) self.assertRaises(IOError, future.result) def test_one_family_timeout_after_connect_timeout(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) conn.on_connect_timeout() # the connector will close all streams on connect timeout, we # should explicitly pop the connect_future. self.connect_futures.pop((AF1, 'a')) self.assertTrue(self.streams.pop('a').closed) conn.on_timeout() # if the future is set with TimeoutError, we will not iterate next # possible address. self.assert_pending() self.assertEqual(len(conn.streams), 1) self.assert_connector_streams_closed(conn) self.assertRaises(TimeoutError, future.result) def test_one_family_success_before_connect_timeout(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', True) conn.on_connect_timeout() self.assert_pending() self.assertEqual(self.streams['a'].closed, False) # success stream will be pop self.assertEqual(len(conn.streams), 0) # streams in connector should be closed after connect timeout self.assert_connector_streams_closed(conn) self.assertEqual(future.result(), (AF1, 'a', self.streams['a'])) def test_one_family_second_try_after_connect_timeout(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) conn.on_connect_timeout() self.connect_futures.pop((AF1, 'b')) self.assertTrue(self.streams.pop('b').closed) self.assert_pending() self.assertEqual(len(conn.streams), 2) self.assert_connector_streams_closed(conn) self.assertRaises(TimeoutError, future.result) def test_one_family_second_try_failure_before_connect_timeout(self): conn, future = self.start_connect([(AF1, 'a'), (AF1, 'b')]) self.assert_pending((AF1, 'a')) self.resolve_connect(AF1, 'a', False) self.assert_pending((AF1, 'b')) self.resolve_connect(AF1, 'b', False) conn.on_connect_timeout() self.assert_pending() self.assertEqual(len(conn.streams), 2) self.assert_connector_streams_closed(conn) self.assertRaises(IOError, future.result) def test_two_family_timeout_before_connect_timeout(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_timeout() self.assert_pending((AF1, 'a'), (AF2, 'c')) conn.on_connect_timeout() self.connect_futures.pop((AF1, 'a')) self.assertTrue(self.streams.pop('a').closed) self.connect_futures.pop((AF2, 'c')) self.assertTrue(self.streams.pop('c').closed) self.assert_pending() self.assertEqual(len(conn.streams), 2) self.assert_connector_streams_closed(conn) self.assertRaises(TimeoutError, future.result) def test_two_family_success_after_timeout(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_timeout() self.assert_pending((AF1, 'a'), (AF2, 'c')) self.resolve_connect(AF1, 'a', True) # if one of streams succeed, connector will close all other streams self.connect_futures.pop((AF2, 'c')) self.assertTrue(self.streams.pop('c').closed) self.assert_pending() self.assertEqual(len(conn.streams), 1) self.assert_connector_streams_closed(conn) self.assertEqual(future.result(), (AF1, 'a', self.streams['a'])) def test_two_family_timeout_after_connect_timeout(self): conn, future = self.start_connect(self.addrinfo) self.assert_pending((AF1, 'a')) conn.on_connect_timeout() self.connect_futures.pop((AF1, 'a')) self.assertTrue(self.streams.pop('a').closed) self.assert_pending() conn.on_timeout() # if the future is set with TimeoutError, connector will not # trigger secondary address. self.assert_pending() self.assertEqual(len(conn.streams), 1) self.assert_connector_streams_closed(conn) self.assertRaises(TimeoutError, future.result)

Q: LINQ & Enums as IQueryable I basically have an enum public enum WorkingDays { Monday, Tuesday, Wednesday, Thursday, Friday } and would like to do a comparison against an input, which happens to be a string //note lower case string input = "monday"; The best thing I could come up with was something like this WorkingDays day = (from d in Enum.GetValues(typeof(WorkingDays)).Cast<WorkingDays>() where d.ToString().ToLowerInvariant() == input.ToLowerInvariant() select d).FirstOrDefault(); Is there any better way to do it ? Edit: Thanks Aaron & Jason. But what if the parse fails ? if(Enum.IsDefined(typeof(WorkingDay),input))//cannot compare if case is different { WorkingDay day = (WorkingDay)Enum.Parse(typeof(WorkingDay), input, true); Console.WriteLine(day); } A: Are you trying to convert a string to an instance of WorkingDays? If so use Enum.Parse: WorkingDays day = (WorkingDays)Enum.Parse(typeof(WorkingDays), "monday", true); Here we are using the overload Enum.Parse(Type, string, bool) where the bool parameter indicates whether or not to ignore case. On a side note, you should rename WorkingDays to WorkingDay. Look at like this. When you have an instance of WorkingDay, say, WorkingDay day = WorkingDay.Monday; note that day is a working day (thus WorkingDay) and not working days (thus not WorkingDays). For additional guidelines on naming enumerations, see Enumeration Type Naming Guidelines.

The amygdala modulates morphine-induced state-dependent memory retrieval via muscarinic acetylcholine receptors. The current study was conducted to examine the involvement of muscarinic acetylcholine receptors of the amygdala in morphine-induced state-dependent memory retrieval. Male Wistar rats implanted bilaterally with cannulas in the amygdala were submitted to a step-through type passive avoidance task, and tested 24 h after training to measure step-through latency. Post-training s.c. administration of morphine at the doses of 5 and 7.5 mg/kg impaired the memory on the test day, which was restored when the same doses of morphine were used as a pre-test drug. This phenomenon is well known as morphine-induced state-dependent memory retrieval. Bilateral microinjection of the non-selective muscarinic acetylcholine receptor agonist, pilocarpine (0.25 and 0.5 microg/side), into the amygdala with an ineffective dose of morphine (0.5 mg/kg s.c.) significantly improved the memory retrieval and mimicked the effects of pre-test administration of a higher dose of morphine. It should be noted that in the animals that received saline after training and tested following intra-amygdala administration of pilocarpine (0.125, 0.25 and 0.5 microg/side) and those which received post-training morphine (7.5 mg/kg s.c.) and pre-test intra-amygdala microinjection of the same doses of pilocarpine, no significant change was observed in the step-through latencies. On the other hand, pre-test intra-amygdala microinjection of a selective muscarinic acetylcholine receptor antagonist scopolamine (0.125 and 0.25 microg/side) inhibited morphine-induced state-dependent memory retrieval. In addition, no significant changes were seen in memory retrieval of the animals trained before saline treatment and tested following intra-amygdala microinjection of the same doses of scopolamine (0.0625, 0.125 and 0.25 microg/side). Bilateral microinjection of scopolamine into the amygdala reversed the pilocarpine-induced potentiation of the morphine response. In view of the known actions of the drugs used, the present data point to the involvement of amygdala muscarinic acetylcholine receptors in morphine-induced state-dependent memory retrieval.

//////////////////////////////////////////////////////////////////////////////////////////////////////// // Part of Injectable Generic Camera System // Copyright(c) 2017, Frans Bouma // All rights reserved. // https://github.com/FransBouma/InjectableGenericCameraSystem // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions are met : // // * Redistributions of source code must retain the above copyright notice, this // list of conditions and the following disclaimer. // // * Redistributions in binary form must reproduce the above copyright notice, // this list of conditions and the following disclaimer in the documentation // and / or other materials provided with the distribution. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" // AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE // IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE // DISCLAIMED.IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE // FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL // DAMAGES(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR // SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER // CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, // OR TORT(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE // OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. //////////////////////////////////////////////////////////////////////////////////////////////////////// #pragma once #include "stdafx.h" #include "Gamepad.h" namespace IGCS { // System defaults #define FRAME_SLEEP 8 // in milliseconds #define IGCS_OVERLAY_INI_FILENAME "IGCS_overlay.ini" #define IGCS_SETTINGS_INI_FILENAME "IGCS_settings.ini" #define IGCS_SETTINGS_SAVE_DELAY 5.0f // in seconds #define IGCS_SPLASH_DURATION 2.0f // in seconds // Keyboard system control #define IGCS_KEY_TOGGLE_OVERLAY VK_INSERT // With control #define IGCS_KEY_CAMERA_ENABLE VK_INSERT #define IGCS_KEY_CAMERA_LOCK VK_HOME #define IGCS_KEY_ROTATE_RIGHT VK_RIGHT // yaw #define IGCS_KEY_ROTATE_LEFT VK_LEFT #define IGCS_KEY_ROTATE_UP VK_UP // pitch #define IGCS_KEY_ROTATE_DOWN VK_DOWN #define IGCS_KEY_MOVE_FORWARD VK_NUMPAD8 #define IGCS_KEY_MOVE_BACKWARD VK_NUMPAD5 #define IGCS_KEY_MOVE_LEFT VK_NUMPAD4 #define IGCS_KEY_MOVE_RIGHT VK_NUMPAD6 #define IGCS_KEY_MOVE_UP VK_NUMPAD7 #define IGCS_KEY_MOVE_DOWN VK_NUMPAD9 #define IGCS_KEY_TILT_LEFT VK_NUMPAD1 // roll #define IGCS_KEY_TILT_RIGHT VK_NUMPAD3 #define IGCS_KEY_FOV_RESET VK_MULTIPLY #define IGCS_KEY_FOV_INCREASE VK_ADD #define IGCS_KEY_FOV_DECREASE VK_SUBTRACT #define IGCS_KEY_BLOCK_INPUT VK_DECIMAL #define IGCS_KEY_TIMESTOP VK_NUMPAD0 #define IGCS_KEY_DECREASE_HOTSAMPLE_FACTOR VK_OEM_4 // [{ #define IGCS_KEY_INCREASE_HOTSAMPLE_FACTOR VK_OEM_6 // ]} #define IGCS_KEY_HOTSAMPLE_ENABLE VK_DELETE #define IGCS_BUTTON_FOV_DECREASE Gamepad::button_t::UP #define IGCS_BUTTON_FOV_INCREASE Gamepad::button_t::DOWN #define IGCS_BUTTON_RESET_FOV Gamepad::button_t::B #define IGCS_BUTTON_TILT_LEFT Gamepad::button_t::LEFT #define IGCS_BUTTON_TILT_RIGHT Gamepad::button_t::RIGHT #define IGCS_BUTTON_FASTER Gamepad::button_t::Y #define IGCS_BUTTON_SLOWER Gamepad::button_t::X #define IGCS_BUTTON_BLOCK_INPUT Gamepad::button_t::RB static const byte jmpFarInstructionBytes[6] = { 0xff, 0x25, 0, 0, 0, 0 }; // instruction bytes for jmp qword ptr [0000] }

Intestinal lactase activity and calcium absorption in the aging female with osteoporosis. In 11 postmenopausal women with histologically proven osteoporosis and normal lactose tolerance, a direct correlation between calcium absorption and intestinal lactase activity was observed. The results suggest that varying degrees of relative deficiencies in intestinal lactase might contribute to the graded decrease in calcium absorption which characterizes the aging female population.

Q: cvc-complex-type.2.4.c: The matching wildcard is strict, but no declaration can be found for element I do see org.xml.sax.SAXParseException in my project, but I cannot tell why it occurs. Error Message is like following: SEVERE: Exception sending context initialized event to listener instance of class org.springframework.web.context.ContextLoaderListener org.springframework.beans.factory.xml.XmlBeanDefinitionStoreException: Line 17 in XML document from ServletContext resource [/conf/appcontext-datasource.xml] is invalid; nested exception is org.xml.sax.SAXParseException; lineNumber: 17; columnNumber: 100; cvc-complex-type.2.4.c: The matching wildcard is strict, but no declaration can be found for element 'jee:jndi-lookup'. at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.doLoadBeanDefinitions(XmlBeanDefinitionReader.java:396) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:334) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:302) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:174) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:209) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:180) at org.springframework.web.context.support.XmlWebApplicationContext.loadBeanDefinitions(XmlWebApplicationContext.java:125) at org.springframework.web.context.support.XmlWebApplicationContext.loadBeanDefinitions(XmlWebApplicationContext.java:94) at org.springframework.context.support.AbstractRefreshableApplicationContext.refreshBeanFactory(AbstractRefreshableApplicationContext.java:130) at org.springframework.context.support.AbstractApplicationContext.obtainFreshBeanFactory(AbstractApplicationContext.java:537) at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:451) at org.springframework.web.context.ContextLoader.configureAndRefreshWebApplicationContext(ContextLoader.java:389) at org.springframework.web.context.ContextLoader.initWebApplicationContext(ContextLoader.java:294) at org.springframework.web.context.ContextLoaderListener.contextInitialized(ContextLoaderListener.java:112) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:5003) at org.apache.catalina.core.StandardContext.startInternal(StandardContext.java:5517) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1574) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1564) at java.util.concurrent.FutureTask.run(FutureTask.java:266) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617) at java.lang.Thread.run(Thread.java:745) Caused by: org.xml.sax.SAXParseException; lineNumber: 17; columnNumber: 100; cvc-complex-type.2.4.c: The matching wildcard is strict, but no declaration can be found for element 'jee:jndi-lookup'. at com.sun.org.apache.xerces.internal.util.ErrorHandlerWrapper.createSAXParseException(ErrorHandlerWrapper.java:203) at com.sun.org.apache.xerces.internal.util.ErrorHandlerWrapper.error(ErrorHandlerWrapper.java:134) at com.sun.org.apache.xerces.internal.impl.XMLErrorReporter.reportError(XMLErrorReporter.java:437) at com.sun.org.apache.xerces.internal.impl.XMLErrorReporter.reportError(XMLErrorReporter.java:368) at com.sun.org.apache.xerces.internal.impl.XMLErrorReporter.reportError(XMLErrorReporter.java:325) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator$XSIErrorReporter.reportError(XMLSchemaValidator.java:458) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.reportSchemaError(XMLSchemaValidator.java:3237) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.handleStartElement(XMLSchemaValidator.java:1917) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.emptyElement(XMLSchemaValidator.java:766) at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.scanStartElement(XMLNSDocumentScannerImpl.java:356) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDriver.next(XMLDocumentFragmentScannerImpl.java:2786) at com.sun.org.apache.xerces.internal.impl.XMLDocumentScannerImpl.next(XMLDocumentScannerImpl.java:606) at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.next(XMLNSDocumentScannerImpl.java:117) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanDocument(XMLDocumentFragmentScannerImpl.java:510) at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:848) at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:777) at com.sun.org.apache.xerces.internal.parsers.XMLParser.parse(XMLParser.java:141) at com.sun.org.apache.xerces.internal.parsers.DOMParser.parse(DOMParser.java:243) at com.sun.org.apache.xerces.internal.jaxp.DocumentBuilderImpl.parse(DocumentBuilderImpl.java:348) at org.springframework.beans.factory.xml.DefaultDocumentLoader.loadDocument(DefaultDocumentLoader.java:75) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.doLoadBeanDefinitions(XmlBeanDefinitionReader.java:388) ... 22 more Then this is the appcontext-datasource.xml that causes this problem <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:jee="http://www.springframework.org/schema/jee" xmlns:util="http://www.springframework.org/schema/util" xsi:schemaLocation=" http://www.springframework.org/schema/jee http://www.springframework.org/schema/jee/spring-jee-3.2.xsd http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-3.2.xsd http://www.springframework.org/schema/util http://www.springframework.org/schema/util/spring-util-3.2.xsd"> <jee:jndi-lookup id="dataSource" jndi-name="jdbc/iasDB" expected-type="javax.sql.DataSource" /> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="dataSource"/> </bean> <bean id="sqlSessionFactory" class="org.mybatis.spring.SqlSessionFactoryBean"> <property name="dataSource" ref="dataSource" /> <property name="configLocation" value="/conf/sql/alias-context.xml"></property> </bean> <bean class="org.mybatis.spring.mapper.MapperScannerConfigurer"> <property name="sqlSessionFactoryBeanName" value="sqlSessionFactory" /> <property name="basePackage" value="com.example.ias.dao" /> </bean> As you can see, I specified the schema location of jee, but all it could say is no declaration can be found. FYI, this project worked perfectly fine until yesterday when I had decided to clean tomcat server for no reason. Thank you for your help A: After I deleted tomcat server and add new tomcat server, the problem solved. It looked like previous tomcat server could not read jndi for some reason after I cleaned it.

Q: Exists only to defeat instantiation in singleton In many of the Singleton examples, I have come across constructor having comment as "Exists only to defeat instantiation", can you please give me details and explain more about it. A: It's common to create a private constructor when implementing the Singleton pattern so that the default constructor cannot be used to instantiate multiple Singleton objects. See the example from Wikipedia's Singleton pattern article. public class SingletonDemo { private static SingletonDemo instance = null; private SingletonDemo() { } public static synchronized SingletonDemo getInstance() { if (instance == null) { instance = new SingletonDemo (); } return instance; } } By making a private constructor, you insure that the compiler can't make a default constructor with the same signature, which forces any client code to call the getInstance() method.

DE 1200809 describes two ways to prepare chloromethanesulfonic acid chloride. Both use s-trithian as starting material and produce yields of only 51.6% and 61.7%. In addition, the relatively expensive starting material, s-trithian is also required to prepare the desired derivatives. Also, pure products are not obtained by this process. Rather, mixtures of mono- and polychloroalkylsulfonic acid chlorides are produced, which are difficult to separate completely. Also a number of sulfur-containing side products are produced, the waste disposal of which can cause problems. DE-OS 2545644 discloses a process by which R-Hal compounds are reacted with sulfite salts by phase transfer catalysis in water to give salts of sulfonic acids. In a separate second step, after isolation and drying, the sulfonic acid salts obtained are converted into the corresponding sulfonic acid chlorides by means of a chlorinating agent. Yields of 69% are achieved. In this process, production of the sulfonic acid and chlorination are separated by a drying stage. The disadvantage is that the salt mixture which is used for chlorination has to be extremely dry (s. Organikum 1986, 16th edition VEB, bottom cf p. 422), since residues of the aqueous solvent from the first step lead to a higher consumption of the chlorinating agent and to an increase in the range of secondary products. This extreme drying of salt mixtures, however, is very difficult to achieve in an industrial process and leads to a time-consuming, cost-intensive drying procedure. Also, the handling of solids is an obstacle to industrial use of the process.

From FoundSF And it takes little but little imagination to smell the sweet, cloying vapors of opium drifting from places below sidewalk level... --Samuel Dickson The first shipment of Chinese opium fifty-two boxes in all arrived in San Francisco in 1861 aboard the clipper Ocean Pearl. By 1864, "the Year of Opium" in San Francisco, huge shipments were arriving regularly, and the City's first three big drug busts occurred: On January 16th and April 22nd, shipments from the ships Derby and Pallas were seized, and on June 19th a shipment of eggs turned out to have something other than white and yolk in the shells. Despite occasional crackdowns, the opium trade was never seriously menaced by law enforcement. Chinatown itself was hardly ever visited by police, and the opium dens were almost completely ignored. An English journalist wrote in the 1880's: "Occasionally, when the police are short of funds, they make a descent on some of the dens but, as a rule, the proprietors are left unmolested." (The same situation prevails today, except that with asset forfeiture laws the police are legally allowed to keep and sell the property they seize during drug busts, even if the arrestee is later judged innocent.) The police, who occasionally did find themselves short of funds, encouraged the passage of anti-drug legislation with tirades about the evils of opium. One of the milder ones came from New York Police Chief George W. Walling, who wrote: "Reveries, dreams and stupefaction do not come with one pipe. Again and again the smoker cooks his lump of opium, packs it into the bowl and lazily watches the smoke curl up around the lamp. After awhile the pipe drops from his nerveless hand and there is a glaze on his eyes which are half-shut like a mad man's. His head falls upon his breast and he is in the opium trance which is either paradise or hell according to the degree of his indulgence in the narcotic." The clergy, who were peddling their own opiate-of-the-masses, joined in the anti-opium chorus. Reverend Frederic J. Masters described a San Francisco opium den thus: "The air is sultry and oppressive. A stupefying smoke fills the hovel through the gloom of which the feeble yellow light of three or four opium lamps struggles hopelessly to penetrate. There are two or three wooden beds covered with matting and each is furnished with lamp and pipe. Three Chinamen lie in different stages of stupefaction. The room is about fifteen feet by ten feet, ceiling and walls black with years of smoke. We have been in this den about five minutes and no one has spoken a word. It is like being in a sepulcher with the dead." "Typical Opium Den," c. 1900 The Burlingame Treaty of 1868 was the first attempt to stymie the opium trade in the US. The treaty formally banned the importation of opium in the US, but said nothing about opium dens. At first, the treaty was widely ignored. In the 1880's and 1890's, local laws of ever-increasing severity attempted to stop the flow of opium and prohibited Americans from visiting opium dens. San Francisco's reputation as America's capital of opium debauchery stimulated the City authorities to at least take cosmetic steps. A handful of Americans were jailed, and by the late 1890's, as the laws grew more severe, fewer and fewer Americans visited the dens. The hysteria that led to the no-whites-in-the-dens law was stimulated by lurid tales about white girls being forced into wild opium-fueled orgies with the Slant-Eyed Sultans of Smoke. A Grand Jury reported that "white girls between the ages of thirteen and twenty are enticed into these opium dens, become regular habitues, and finally are subject wholly to the wishes of the Oriental visitors." A police captain corroborated the story: "It is only we detectives who know the extent to which the opium habit has caught on amongst high-toned women in San Francisco. And the trouble is that the high-spirited and most adventurous women seem to succumb first." In the late 1880's the San Francisco Call estimated that there were about 300 opium dens in the city, most of them in Chinatown, serving the roughly 3,000 hardcore "hopheads" or "opium fiends," along with the countless others who indulged less immoderately. The opium dens bore red signs above their doors reading PIPES AND LAMPS ALWAYS CONVENIENT in Chinese calligraphy. The opium dens were finally wiped out in the earthquake and fire of 1906; most were never rebuilt, and the few that lingered were put out of business by the nationwide drug crackdown a decade later. In a public event that took place sometime around 1920, San Francisco police burned confiscated opium in the middle of rebuilt Chinatown. The event was apparently worth photographing several times and was well-attended. To our eyes, the public burning may represent many things--the formal display of civic authority, the ritualized expunging of sin, the vigilant surveillance of Chinatown's streets, the symbolic punishment of vice in the public sphere. What was being burned was not the body of a particular sinner but the recalcitrant body of underground Chinatown itself. The burning gave ceremonial form to the claim that the new tourist quarter, like the old, was still ridden with vice, despite the appealing pagoda lamps and colorful streaming banners.

329 F.2d 360 In the Matter of Leo Jones, Bankrupt.Leo JONES and Annie Ruth Jones, Petitioners-Appellants,v.BANK OF LINCOLNWOOD, Respondent-Appellee. No. 14345. United States Court of Appeals Seventh Circuit. March 20, 1964. Albert Koretzky, Chicago, Ill., for appellants. Lewis W. Schlifkin, James C. Wickline, A. E. Peterson, Chicago, Ill., for Bank of Lincolnwood. Before HASTINGS, Chief Judge, and SCHNACKENBERG and KILEY, Circuit judges. HASTINGS, Chief Judge. 1 Petitioners, Leo Jones and Annie Ruth Jones, his wife, appeal from an order of the district court affirming an order of the referee in bankruptcy dismissing their petition against respondent Bank of Lincolnwood. 2 The district court modified the referee's order to provide that such dismissal be without prejudice to petitioners' right to make their claims and seek relief in the state courts. 3 Petitioners filed the petition, during bankruptcy proceedings against Leo Jones, seeking an order declaring a trust deed to be invalid. The trust deed was given to secure a loan by respondent to petitioners. 4 Petitioners alleged the trust deed was procured by fraud, lacked valid consideration and that a note secured by the trust deed was tainted with usury. 5 Petitioners contend that upon sale of the property in question through bankruptcy proceedings, Leo Jones is entitled to a homestead exemption under Illinois law1 and Annie Jones an inchoate dower interest. 6 Respondent was the owner of a note in the amount of $7,789.80, which included principal of $5,564, together with interest computed for a period of five years. The note was secured by a trust deed running to Chicago Title and Trust Company as trustee. Record title to the property in question at the time the trust deed was executed was in Lawndale National Bank as trustee under an Illinois land trust. 7 Petitioners, who were in possession of the premises at the time the trust deed was executed, signed a written order to Lawndale to execute the trust deed to Chicago Title and Trust Company. Respondent, believing petitioners to be the beneficial owners of the property, accepted the order and forwarded it to Lawndale. Lawndale returned the order and by letter advised respondent that petitioners had no interest in the trust. 8 Respondent wrote to an agent of Lawndale, agreeing to repay a loan made by Friendly Loan Company to petitioners upon condition that all interest in the property would be released to petitioners. The letter was accompanied by the trust deed and note for execution. 9 The agent obtained execution of the trust deed and note, and returned them to respondent with written instructions concerning recording the trust deed and repaying petitioners' loan. Petitioners received a copy of this letter. The trust deed was recorded. 10 Respondent received a written direction from petitioners to disburse the proceeds of its loan. It issued checks in reliance upon this direction. 11 Respondent, by letter to an agent of Lawndale, requested an assignment of beneficial interest in the trust to petitioners. Respondent was informed by letter that such an assignment could not be made. 12 Title was then conveyed by Lawndale, as trustee, to petitioners 'subject to the lien of every trust deed or mortgage (if any there be) of record in said county, given to secure the payment of money and remaining unreleased on the date hereof.' Petitioners executed a written guaranty in which they assumed and agreed to pay the note secured by the trust deed and agreed to be bound by all the terms, provisions and conditions of the note and trust deed. 13 Pursuant to the written direction of petitioners, the proceeds of this loan were disbursed to pay their debts and for improvements on their property. Petitioners made nine monthly payments to respondent under the trust deed and then defaulted. Leo Jones was adjudicated a bankrupt and during the bankruptcy proceedings filed the present petition, in which his wife joined, attacking the validity of the trust deed. 14 The referee in bankruptcy conducted hearings and at the close of petitioners' case entered an order dismissing the petition. In his order the referee made specific findings of fact and conclusions of law to the effect that respondent was not guilty of fraud, misrepresentation or in charging usurious interest rates in connection with the execution of the trust deed; that respondent was a bona fide purchaser for value; that respondent had relied upon record title in disbursing funds under the trust deed; that petitioners had waived their homestead and dower interests in the property in the trust deed; and that petitioners had ratified the transaction and were estopped to deny the validity of the trust deed. 15 The district court, entertaining a petition for review, affirmed the referee's order. 16 The referee made findings of fact left undisturbed by the trial court on its review. These are amply supported by the record and are not clearly erroneous. They fully support the conclusions reached by the referee and sustained by the district court. In Re Rafdo Enterprises, Inc., 7 Cir., 297 F.2d 505, 507 (1962). 17 It is clear to us, as it was to the referee and the district court, that respondent Bank of Lincolnwood is a bona fide mortgagee and that it disbursed its loan in reliance upon the record title in good faith and upon the written direction of and for the sole benefit of petitioners. 18 It is apparent that by the guaranty, the disbursement certificate, the direction to Lawndale Bank to execute the trust deed, all signed by petitioners, and by accepting the benefits of the loan and making payments thereon, petitioners ratified the entire transaction under scrutiny and are estopped to deny the validity of the trust deed. See Hilton v. Meier, 257 Ill. 500, 100 N.E. 962 (1913); Loughran v. Gorman, 256 Ill. 46, 99 N.E. 886 (1912). 19 We find no merit in the contention that petitioners' waiver of homestead was limited to and effective only for their deed in trust to Lawndale Bank. 20 Finding no error, the order of the district court appealed from is affirmed. 21 Affirmed. 1 Sections 1 and 4 of Ill.Rev.Stat. ch. 52 (1959) provide: '1. Homestead.) 1. Every householder having a family, shall be entitled to an estate of homestead, to the extent in value of $2,500, in the farm or lot of land and buildings thereon, owned or rightly possessed, by lease or otherwise, and occupied by him or her as a residence; and such homestead, and all right and title therein, shall be exempt from attachment, judgment, levy or execution, sale for the payment of his debts, or other purposes * * * except as hereinafter provided.' '4. How estate extinguished.) 4. No release, waiver or conveyance of the estate so exempted, shall be valid, unless the same is in writing, subscribed by the householder and his or her wife or husband, * * * and acknowledged in the same manner as conveyances of real estate are required to be acknowledged * * *.'

The present invention relates to quartz glass-made optical fibers coated with a silicone composition and a method for the preparation thereof or, more particularly, to silicone-coated, quartz glass-made optical fibers from which the coating layer of cured rubbery silicone is readily peelable to facilitate the connecting works for making joints between the terminals of the optical fibers in extending the lines. As is known, the technology of communication by use of optical fibers is under rapid growing in which, although optical fibers can be made of various transparent materials including fused quartz glass, multicomponent glasses and synthetic plastic resins and the like, most of the practically and currently employed optical fibers are made of fused quartz glass in view of the lightweight, low transmission loss, absence of induction and heat and weathering resistance as well as the large transmission capacity thereof. Since a quartz glass-made optical fiber is usually very slender having a diameter of only a fraction of a millimeter and hence fragile and is also subject to contamination with external stainas well as deterioration by moisture, it is a generally undertaken way that quartz glass-made optical fibers are provided on the surface with a protective coating which is usually formed by first coating the fiber with a primary coating composition capable of being converted into a rubbery layer and an overcoating is provided thereon with a coating material having larger toughness. The coating material used for the primary coating should satisfy various requirements such as low temperature-dependency of the rigidity, versatility in a wide temperature range of use, effectiveness for mechanical reinforcement and stress relaxation, low transmission loss even in bending of the fiber with a small radius of curvature and little tendency to cause noise by light scattering. In this regard, several types of silicone compositions are widely accepted for the purpose as the most suitable ones among a variety of polymeric coating materials. In practice, conventionally used silicone materials for providing coating on quartz glass-made optical fibers are limited to a few types and the method for providing coating is accordingly limited (see, for example, Japanes Patent Publication No. 56-11122 and -11123 and U.S. Pat. Nos. 3,980,390 and 4,270,840). For example, a composition of a thermally curable silicone admixed with an organic peroxide is applied on to the surface of the optical fibers followed by curing with heating. Alternatively, curing of a silicone composition is performed by heating a mixture comprising an organopolysiloxane having silicon-bonded vinyl groups in the molecule and an organohydrogenpolysiloxane having hydrogen atoms directly bonded to the silicon atoms as catalyzed by a platinum catalyst to cause addition reaction of so-called hydrosilation. One of the problems in these methods is that the curing must be effected with heating in an oven kept at a high temperature according to the types of the silicone so that uniformity in curing can hardly be ensured in the absence of very accurate control of the oven temperature in addition to the inherent disadvantage that the velocity of curing in these methods is limited. Therefore, these methods are not suitable for high-speed production of optical fibers. Moreover, high-temperature curing of the silicone coating composition necessarily causes sticking of the coating layer to the surface of quartz glass so that peeling of the coating layer can be performed with great difficulties as is required when extension of the communication lines is desired by making a joint between terminals of the optical fibers.

Riverboat Rhythm Riverboat Rhythm is a 1946 American comedy film directed by Leslie Goodwins and written by Charles E. Roberts. The film stars Leon Errol, Glen Vernon, Walter Catlett, Marc Cramer and Jonathan Hale. The film was released on February 13, 1946, by RKO Pictures. Plot Cast Leon Errol as Matt Lindsay Glen Vernon as John Beeler Walter Catlett as Colonel Jeffrey 'Smitty' Witherspoon Marc Cramer as Lionel Beeler Jonathan Hale as Colonel Edward Beeler Joan Newton as Midge Lindsey Emory Parnell as Sheriff Martin Harry Harvey, Sr. as Ezra Beeler Florence Lake as Penelope Beeler Witherspoon Dorothy Vaughan as Belle Crowley Ben Carter as Benjamin Mantan Moreland as Mantan Frankie Carle as Band Leader Frankie Carle Frankie Carle's Orchestra as Orchestra References External links Category:1946 films Category:American films Category:American black-and-white films Category:English-language films Category:RKO Pictures films Category:Films directed by Leslie Goodwins Category:American comedy films Category:1940s comedy films

Retention mechanisms in reversed-phase liquid chromatography. Stationary-phase bonding density and partitioning. The partitioning model of retention for reversed-phase liquid chromatography, described by mean-field statistical thermodynamic theory, asserts that one principal driving force for solute retention is the creation of a solute-sized cavity in the stationary phase. Beyond a critical stationary phase bonding density, increased grafted chain density should result in enhanced chain ordering, which will increase the energy necessary for solute cavity formation and result in decreased chromatographic partition coefficients. We have evaluated chromatographic partition coefficients over an octadecyl bonding density range of 1.6-4.1 mumol/m2 and have found a maximum in partition coefficient at approximately 3.1 mumol/m2. Retention, however, approximately plateaus due to compensating changes in the partition coefficient and stationary phase volume. This provides unequivocal evidence that partitioning is the dominant form of retention for small nonpolar solutes.

Q: Enter several parameters in SQL stored procedures from python with sqlalchemy I can successfully connect to SQL Server from my jupyter notebook with this script: from sqlalchemy import create_engine import pyodbc import csv import time import urllib params = urllib.parse.quote_plus('''DRIVER={SQL Server Native Client 11.0}; SERVER=SV; DATABASE=DB; TRUSTED_CONNECTION=YES;''') engine = create_engine("mssql+pyodbc:///?odbc_connect=%s" % params) And I can successfully execute SQL stored procedures without parameters from jupyter notebook with the following function : def execute_stored_procedure(engine, procedure_name): res = {} connection = engine.raw_connection() try: cursor = connection.cursor() cursor.execute("EXEC "+procedure_name) cursor.close() connection.commit() res['status'] = 'OK' except Exception as e: res['status'] = 'ERROR' res['error'] = e finally: connection.close() return res How please could I transform this previous function for stored procedures having several parameters (two in my case) ? A: Solution of my problem, working only for stored procedures with 0 or 2 parameters (just edit the 10th line if you want another number of parameters): def execute_stored_procedure(engine, procedure_name,params_dict=None): res = {} connection = engine.raw_connection() try: cursor = connection.cursor() if params_dict is None: cursor.execute("EXEC "+procedure_name) else: req = "EXEC "+procedure_name req += ",".join([" @"+str(k)+"='"+str(v)+"'" for k,v in params_dict.items()]) cursor.execute(req) cursor.close() connection.commit() res['status'] = 'OK' except Exception as e: res['status'] = 'ERROR' res['error'] = e finally: connection.close() return res

Stade Municipal (Foumban) Stade Municipal is a multi-use stadium in Foumban, Cameroon. It is currently used mostly for football matches. It serves as a home ground of Fédéral Noun. The stadium holds 5,000 people. Category:Football venues in Cameroon

Q: Scale coloring of ContourPlot The answer given here solved how to use the same color scale across multiple plots within the function ListContourPlot. I can't for the life of me map this solution onto the function ContourPlot that I am using. Say for example I have the code r = Norm[{x, y}]; plot1 = Plot3D[{r^2, -r^2}, {x, -Pi, Pi}, {y, -Pi, Pi}, ColorFunction -> "ThermometerColors", BoxRatios -> {2, 2, 3}]; plot2 = ContourPlot[r^2, {x, -Pi, Pi}, {y, -Pi, Pi}, ColorFunction -> "ThermometerColors"]; GraphicsRow[{plot1, plot2}] which gives me the plots. If you look at the code you will see that in the contour plot I am only plotting the positive solutions and so for consistency my plot should be contours that are shades of red. How can I achieve this? *****EDIT 1***** kguler submitted an answer that solved this example question, but for a reason I can't understand it doesn't work in the actual system that I'm using. Here is my full code: Clear["Global`*"]; DynamicEvaluationTimeout -> Infinity; (*Nearest neighbour vectors*) {e1, e2, e3} = # & /@ {{0, -1}, {Sqrt[3]/2, 1/2}, {-Sqrt[3]/2, 1/2}}; (*dispersion*) w[theta_, phi_] := Module[{c1, c2, c3, fq}, {c1, c2, c3} = 1 - 3 Sin[theta]^2 Cos[phi - 2 Pi (# - 1)/3]^2 & /@ {1, 2, 3}; fq = Total[#[[1]] Exp[I q.#[[2]]] & /@ {{c1, e1}, {c2, e2}, {c3, e3}}]; Sqrt[1 + 2 # Omega Norm[fq]] & /@ {1, -1} ] Omega = 0.01; q = {qx, qy}; (***Figure3a***) {theta, phi} = {Pi/2, Pi/2}; dirac3a = {(2/Sqrt[3]) ArcCos[2/5], 4 Pi/3}; zoom = 0.005 Pi; With[ {plotopts = {Mesh -> None, PlotStyle -> Opacity[0.7], Ticks -> {{1.33, 1.34, 1.35}, {4.18, 4.19, 4.20}, Automatic}, BoxRatios -> {2, 2, 2}, PlotPoints -> 50, MaxRecursion -> 2, AxesEdge -> {{-1, -1}, {1, -1}, {-1, -1}}, ColorFunction -> "ThermometerColors", LabelStyle -> Large, ClippingStyle -> None, BoxStyle -> Opacity[0.5], ViewPoint -> {1.43, -2.84, 1.13}, ViewVertical -> {0., 0., 1.}}}, figure3a = Plot3D[w[theta, phi], {qx, dirac3a[[1]] - zoom, dirac3a[[1]] + zoom}, {qy, dirac3a[[2]] - zoom, dirac3a[[2]] + zoom}, plotopts] ] (***Figure3b***) With[{plotopts = {Frame -> True, FrameTicks -> {{{4.18, 4.19, 4.20}, None}, {{1.33, 1.34, 1.35}, None}}, ColorFunction -> "ThermometerColors", LabelStyle -> Large, PlotRangePadding -> None, ColorFunctionScaling -> False, ColorFunction -> ColorData[{"ThermometerColors", {0.9996, 1.0004}}] } }, figure3b = ContourPlot[w[theta, phi][[1]], {qx, dirac3a[[1]] - zoom, dirac3a[[1]] + zoom}, {qy, dirac3a[[2]] - zoom, dirac3a[[2]] + zoom}, plotopts] ] (***Figure3b legend***) legend = {0.9996 + 0.0001 #, 0.9996 + 0.0001 #} & /@ {0, 1, 2, 3, 4, 5, 6, 7, 8}; figure3bLegend = ArrayPlot[legend, ColorFunction -> "ThermometerColors", DataRange -> {{0, 1}, {0.9996, 1.0004}}, FrameTicks -> {{0.9996, 0.9997, 0.9998, 0.9999, {1.0000, "1.0000"}, 1.0001, 1.0002, 1.0003, 1.0004}, None}, AspectRatio -> 7, LabelStyle -> Large] where I have incorporated the suggestion, but it gives me a plot that is monochrome. The values 0.9996 and 1.0004 correspond to the maxima and minima. What is going on here? A: plot1 = Plot3D[{r^2, -r^2}, {x, -Pi, Pi}, {y, -Pi, Pi}, ColorFunctionScaling -> False, ColorFunction -> ColorData[{"ThermometerColors", {-20, 20}}], BoxRatios -> {2, 2, 3}]; plot2 = ContourPlot[r^2, {x, -Pi, Pi}, {y, -Pi, Pi}, ColorFunctionScaling -> False, ColorFunction -> ColorData[{"ThermometerColors", {-20, 20}}]]; Legended[GraphicsRow[{plot1, plot2}], BarLegend[{"ThermometerColors", {-20, 20}}, 20]] Update: For the specific example in OP's updated question, the following changes produce the desired result: Change plotops appearing in the part generating figure3b to plotopts = {Frame -> True, FrameTicks -> {{{4.18, 4.19, 4.20}, None}, {{1.33, 1.34, 1.35}, None}}, LabelStyle -> Large, ImageSize -> 400, PlotRangePadding -> None, ColorFunctionScaling -> False, ColorFunction -> ColorData[{"ThermometerColors", {0.9996, 1.0004}}]} and use the same scaled colors in the ArrayPlot that generates the legend: figure3bLegend = ArrayPlot[legend, ColorFunctionScaling -> False, ImageSize -> {200, 350}, ColorFunction -> ColorData[{"ThermometerColors", {0.9996, 1.0004}}], DataRange -> {{0, 1}, {0.9996, 1.0004}}, FrameTicks -> {{0.9996, 0.9997, 0.9998, 0.9999, {1.0000, "1.0000"}, 1.0001, 1.0002, 1.0003, 1.0004}, None}, AspectRatio -> 7, LabelStyle -> Large] and add the option ImageSize->400 in plotops used in generation of figure3a. With these changes Row[{figure3a, figure3b, figure3bLegend}, Spacer[5]] gives

IN THE COURT OF APPEALS OF TENNESSEE STATE OF TENNESSEE, ) FILED C/A NO. 03A01-9701-CV-00002 DEPARTMENT OF HUMAN SERVICES, ) ) September 29, 1997 Plaintiff-Appellee, ) ) Cecil Crowson, Jr. ) Appellate C ourt Clerk ) APPEAL AS OF RIGHT FROM THE v. ) HAWKINS COUNTY JUVENILE COURT ) ) ) ) REBECCA WALLACE RUSSELL, ) ) HONORABLE JOHN S. ANDERSON, Defendant-Appellant.) JUDGE For Appellant For Appellee MARK A. SKELTON JOHN KNOX WALKUP Rogersville, Tennessee Attorney General and Reporter Nashville, Tennessee DOUGLAS EARL DIMOND Assistant Attorney General General Civil Division Nashville, Tennessee MEMORANDUM OPINION AFFIRMED AND REMANDED Susano, J. 1  The trial court terminated the parental rights of Rebecca Wallace Russell (“Mother”) in and to her minor child, Kayla Michelle Wallace, whose date of birth is February 10, 1993. Mother appealed, arguing that the evidence preponderates against the trial court’s determination that there is clear and convincing evidence that termination is in the child’s best interest and that one or more of the conditions set forth in T.C.A. § 37-1-147(d)(1)(A)-(C) (Supp. 1995)1 exist in this case. We affirm. A parent has a fundamental right to the care, custody and control of his or her child. Stanley v. Illinois, 405 U.S. 645, 92 S.Ct. 1208, 31 L.Ed.2d 551 (1972). However, this right is not absolute; it may be terminated if there is clear and convincing evidence justifying such termination under the applicable statute. Santosky v. Kramer, 455 U.S. 745, 102 S.Ct. 1388, 71 L.Ed.2d 599 (1982). In the instant case, we are called 1 At the time of the hearing below, i.e., May 18, 1995, T.C.A. § 37-1- 147(d) provided, in pertinent part, as follows: After hearing evidence on a termination petition, the court may terminate parental rights if it finds on the basis of clear and convincing evidence that termination is in the child’s best interest and that one (1) or more of the following conditions exist: (1) The child has been removed from the custody of the parent by the court for at least one (1) year and the court finds that: (A) The conditions which led to the removal or other conditions which in all reasonable probability would cause the child to be subjected to further abuse or neglect and which, therefore, prevent the child’s return to the care of the parent(s) still persists; (B) There is little likelihood that these conditions will be remedied at an early date so that the child can be returned to the parent in the near future; and (C) The continuation of the legal parent and child relationship greatly diminishes the child’s chances of early integration into a stable and permanent home;.... 2 upon to determine whether the evidence preponderates against the trial court’s finding that there is clear and convincing evidence in the record (a) that termination of Mother’s parental rights is in the best interest of the child, and (b) that one or more of the conditions set forth in T.C.A. § 37-1-147(d)(1)(A)-(C) (Supp. 1995) exist in this case. See Rule 13(d), T.R.A.P. We have carefully reviewed the record in this case. The evidence does not preponderate against the trial court’s findings. On the contrary, we find clear and convincing evidence in the record that termination of Mother’s parental rights is in the best interest of Kayla Michelle Wallace; that the child was removed from Mother in May, 1993, more than one year prior to the hearing below; and that one or more of the conditions set forth in T.C.A. § 37-1-147(d)(1)(A)-(C) (Supp. 1995) exist. We affirm this case pursuant to the provisions of Rule 10(b), Ct. of App. R.2 Costs on appeal are taxed against the appellant. This case is remanded to the trial court for enforcement of its judgment and collection of costs assessed below, all pursuant to applicable law. __________________________ Charles D. Susano, Jr., J. 2 Rule 10(b), Ct. of App. R., provides as follows: The Court, with the concurrence of all judges participating in the case, may affirm, reverse or modify the actions of the trial court by memorandum opinion when a formal opinion would have no precedential value. When a case is decided by memorandum opinion it shall be designated “MEMORANDUM OPINION,” shall not be published, and shall not be cited or relied on for any reason in a subsequent unrelated case. 3 4 CONCUR: ________________________ Houston M. Goddard, P.J. ________________________ Herschel P. Franks, J. 5 

Q: Xcode 4 Scheme Hell? I have a serious ongoing issue with Xcode 4. I have been using Xcode 3 for years, and had everything set up perfectly. All my Build Configurations worked A-OK. I updated to iOS 5 GM, and naturally I have to use Xcode 4 to submit my app to the Store or use TestFlight. I can't change my Build Configuration. I've tried making a new "Scheme" (which are stupid IMHO, when the old system worked 100%), and everytime I do, I set everything the same, I go "Product" > "Archive"....it works, and I share the IPA to my Desktop, to upload it to TestFlight, or I save it as a ZIP and send it to Application Loader. IT NEVER WORKS. On TestFlight, my testers will install it, and immediately the application will crash. It won't even launch, no matter how I build the app, regardless of Scheme. It worked 100% and I have made ZERO changes since updating to Xcode 4. Xcode 4 only works when I wish to "Debug" my app on my own device. It builds, installs and runs perfectly. Why won't it work on AdHoc or App Store? PLEASE HELP! I'm ready to pull my hair out. A: To answer this question, it was an absolutely STUPID issue! I was checking the size of my Info.plist for any changes, and for some ridiculous reason only Apple can comprehend, updating to iOS 5 made that code obsolete. So the use of the code in my Release/AppStore/AdHoc builds was making it crash on launch. Once I commented the code out, everything is back working 100%. Strange. Even Apple Technical Support couldn't figure it out and they had my whole project to peruse. Apple REALLY need to improve their software when they change it. Not create a massive learning curve for their users and encourage code-cleanups if the SDK decides it doesn't like 4.3 code.

Conventionally, a semiconductor apparatus that uses a trench formed in a depth direction of a substrate with a high aspect ratio (e.g., MOSFET (see Patent Publication 1 for example), super junction MOSFET (see Patent Publication 2 for example) has been known. A semiconductor apparatus having the structure as described above forms an impurity diffused layer having a high aspect ratio by burying an epitaxial film in a trench (see Patent Publications 3 and 4 for example). Patent Publication 1: Japanese Unexamined Patent Application Publication No. 2001-274398 Patent Publication 2: Japanese Unexamined Patent Application Publication No. 2003-124464 Patent Publication 3: Japanese Unexamined Patent Application Publication No. 2001-196573 Patent Publication 4: Japanese Unexamined Patent Application Publication No. 2005-317905

LU TP 99–31\ hep-ph/9910288\ October 1999 [**QCD Interconnection Effects[^1]**]{}\ [Torbjörn Sjöstrand[^2]]{}\ [*Department of Theoretical Physics,*]{}\ [*Lund University, Lund, Sweden*]{} [**Abstract**]{}\ Heavy objects like the $W$, $Z$ and $t$ are short-lived compared with typical hadronization times. When pairs of such particles are produced, the subsequent hadronic decay systems may therefore become interconnected. We study such potential effects at Linear Collider energies. This talk mainly reports on work done in collaboration with Valery Khoze [@work]. The widths of the $W$, $Z$ and $t$ are all of the order of 2 GeV. A Standard Model Higgs with a mass above 200 GeV, as well as many supersymmetric and other Beyond the Standard Model particles would also have widths in the range. Not far from threshold, the typical decay times $\tau = 1/\Gamma \approx 0.1 \, {\mathrm{fm}} \ll \tau_{\mathrm{had}} \approx 1 \, \mathrm{fm}$. Thus hadronic decay systems overlap, between pairs of resonances ($W^+W^-$, $Z^0Z^0$, $t\bar{t}$, $Z^0H^0$, …), so that the final state may not be just the sum of two independent decays. Pragmatically, one may distinguish three main eras for such interconnection: Perturbative: this is suppressed for gluon energies $\omega > \Gamma$ by propagator/timescale effects; thus only soft gluons may contribute appreciably. Nonperturbative in the hadroformation process: normally modelled by a colour rearrangement between the partons produced in the two resonance decays and in the subsequent parton showers. Nonperturbative in the purely hadronic phase: best exemplified by Bose–Einstein effects. The above topics are deeply related to the unsolved problems of strong interactions: confinement dynamics, $1/N^2_{\mathrm{C}}$ effects, quantum mechanical interferences, etc. Thus they offer an opportunity to study the dynamics of unstable particles, and new ways to probe confinement dynamics in space and time [@GPZ; @ourrec], [*but*]{} they also risk to limit or even spoil precision measurements [@ourrec]. So far, studies have mainly been performed in the context of $W$ mass measurements at LEP2. Perturbative effects are not likely to give any significant contribution to the systematic error, $\langle \delta m_W \rangle {\raisebox{-0.8mm}{\hspace{1mm}$\stackrel{<}{\sim}$\hspace{1mm}}}5$ MeV [@ourrec]. Colour rearrangement is not understood from first principles, but many models have been proposed to model effects [@ourrec; @otherrec; @HR], and a conservative estimate gives $\langle \delta m_W \rangle {\raisebox{-0.8mm}{\hspace{1mm}$\stackrel{<}{\sim}$\hspace{1mm}}}40$ MeV. For Bose–Einstein again there is a wide spread in models, and an even wider one in results, with about the same potential systematic error as above [@ourBE; @otherBE; @HR]. The total QCD interconnection error is thus below $m_{\pi}$ in absolute terms and 0.1% in relative ones, a small number that becomes of interest only because we aim for high accuracy. ------------------------------------------------------------------------ More could be said if some experimental evidence existed, but a problem is that also other manifestations of the interconnection phenomena are likely to be small in magnitude. For instance, near threshold it is expected that colour rearrangement will deplete the rate of low-momentum particle production [@lowmom], Fig. \[figlowmom\]. Even with full LEP2 statistics, we are only speaking of a few sigma effects, however. Bose-Einstein appear more promising to diagnose, but so far experimental results are contradictory [@BEstatus]. One area where a linear collider could contribute would be by allowing a much increased statistics in the LEP2 energy region. A 100 fb$^{-1}$ $W^+W^-$ threshold scan would give a $\sim 6$ MeV accuracy on the $W$ mass [@Wilson], with negligible interconnection uncertainty. This would shift the emphasis from $m_W$ to the understanding of the physics of hadronic cross-talk. A high-statistics run, e.g. 50 fb$^{-1}$ at 175 GeV, would give a comfortable signal for the low-momentum depletion mentioned above, and also allow a set of other tests [@othertest; @lowmom]. Above the $Z^0Z^0$ threshold, the single-$Z^0$ data will provide a unique $Z^0Z^0$ no-reconnection reference. Thus, high-luminosity, LEP2-energy LC (Linear Collider) runs would be excellent to [*establish*]{} a signal. To explore the [*character*]{} of effects, however, a knowledge of the energy dependence could give further leverage. ------------------------------------------------------------------------ In QED, the interconnection rate dampens with increasing energy roughly like $(1 - \beta)^2$, with $\beta$ the velocity of each $W$ in the CM frame [@QED]. By contrast, the nonperturbative QCD models we studied show an interconnection rate dropping more like $(1 - \beta)$ over the LC energy region (with the possibility of a steeper behaviour in the truly asymptotic region), Fig. \[figprob\]. If only the central region of $W$ masses is studied, also the mass shift dampens significantly with energy, Fig. \[figprob\]. However, if also the wings of the mass distribution are included (a difficult experimental proposition, but possible in our toy studies), the average and width of the mass shift distribution do not die out. Thus, with increasing energy, the hadronic cross-talk occurs in fewer events, but the effect in these few is more dramatic. ------------------------------------------------------------------------ The depletion of particle production at low momenta, close to threshold, turns into an enhancement at higher energies [@lowmom]. However, in the inclusive $W^+W^-$ event sample, this and other signals appear too small for reliable detection. One may instead turn to exclusive signals, such as events with many particles at low momenta, or at central rapidities, or at large angles with respect to the event axis, Fig. \[figexclusive\]. Unfortunately, even after such a cut, fluctuations in no-reconnection events as well as ordinary QCD four-jet events (mainly $q\bar{q}gg$ split in $qg + \bar{q}g$ hemispheres, thus with a colour flow between the two) give event rates that overwhelm the expected signal. It could still be possible to observe an excess, but not to identify reconnections on an event-by-event basis. The possibility of some clever combination of several signals still remains open, however. ------------------------------------------------------------------------ Since the $Z^0$ mass and properties are well-known, $Z^0Z^0$ events provide an excellent hunting ground for interconnection. Relative to $W^+W^-$ events, the set of production Feynman graphs and the relative mixture of vector and axial couplings is different, however, and this leads to non-negligible differences in angular distributions, Fig. \[figzzww\]. Furthermore, the higher $Z^0$ mass means that a $Z^0$ is slower than a $W^{\pm}$ at fixed energy, and the larger $Z^0$ width also brings the decay vertices closer. Taken together, at 500 GeV, the reconnection rate in $Z^0Z^0$ hadronic events is likely to be about twice as large as in $W^+W^-$ events, while the cross section is lower by a factor of six. Thus $Z^0Z^0$ events are interesting in their own right, but comparisons with $W^+W^-$ events will be nontrivial. (2880,1728)(0,0) (1836,1049)[(0,0)\[r\][[$\Delta R$]{}]{}]{} (1836,1149)[(0,0)\[r\][[$\langle\delta m_{W}^{4j}\rangle$ $\mathrm{BE}_m'$]{}]{}]{} (1836,1249)[(0,0)\[r\][[$\langle\delta m_{W}^{4j}\rangle$ $\mathrm{BE}_m$]{}]{}]{} (2896,907)[(0,0)\[l\][(fm)]{}]{} (2896,1021)[(0,0)\[l\][$\Delta R$]{}]{} (2741,251)[(0,0)\[l\][0.0]{}]{} (2741,536)[(0,0)\[l\][0.2]{}]{} (2741,821)[(0,0)\[l\][0.4]{}]{} (2741,1107)[(0,0)\[l\][0.6]{}]{} (2741,1392)[(0,0)\[l\][0.8]{}]{} (2741,1677)[(0,0)\[l\][1.0]{}]{} (1648,31)[(0,0)[$E_{\mbox{cm}}$ (GeV)]{}]{} (220,964) (0,0)\[b\] (2587,151)[(0,0)[1000]{}]{} (2145,151)[(0,0)[800]{}]{} (1704,151)[(0,0)[600]{}]{} (1262,151)[(0,0)[400]{}]{} (821,151)[(0,0)[200]{}]{} (540,1677)[(0,0)\[r\][1000]{}]{} (540,1392)[(0,0)\[r\][800]{}]{} (540,1107)[(0,0)\[r\][600]{}]{} (540,821)[(0,0)\[r\][400]{}]{} (540,536)[(0,0)\[r\][200]{}]{} (540,251)[(0,0)\[r\][0]{}]{} ------------------------------------------------------------------------ As noted above, the Bose–Einstein interplay between the hadronic decay systems of a pair of heavy objects is at least as poorly understood as is colour reconnection, and less well studied for higher energies. In some models [@ourBE], the theoretical mass shift increases with energy, when the separation of the $W$ decay vertices is not included, Fig. \[figboei\]. With this separation taken into account, the theoretical shift levels out at around 200 MeV. How this maps onto experimental observables remains to be studied, but experience from LEP2 energies indicates that the mass shift is significantly reduced, and may even switch sign. ------------------------------------------------------------------------ The $t\bar{t}$ system is different from the $W^+W^-$ and $Z^0Z^0$ ones in that the $t$ and $\bar{t}$ always are colour connected. Thus, even when both tops decay semileptonically, $t \to b W^+ \to b \ell^+ \nu_{\ell}$, the system contains nontrivial interconnection effects. For instance, the total hadronic multiplicity, and especially the multiplicity at low momenta, depends on the opening angle between the $b$ and $\bar{b}$ jets: the smaller the angle, the lower the multiplicity [@topmult], Fig. \[figtop\]. On the perturbative level, this can be understood as arising from a dominance of emission from the $b\bar{b}$ colour dipole at small gluon energies [@dipole], on the nonperturbative one, as a consequence of the string effect [@string]. Uncertainties in the modelling of these phenomena imply a systematic error on the top mass of the order of 30 MeV already in the semileptonic top decays. When hadronic $W$ decays are included, the possibilities of interconnection multiply. This kind of configurations have not yet been studied, but realistically we may expect uncertainties in the range around 100 MeV. In summary, LEP2 may clarify the Bose–Einstein situation and provide some hadronic cross-talk hints. A high-luminosity LEP2-energy LC run would be the best way to establish colour rearrangement, however. Both colour rearrangement and BE effects (may) remain significant over the full LC energy range: while the fraction of the (appreciably) affected events goes down with energy, the effect per such event comes up. If the objective is to do electroweak precision tests, it appears feasible to reduce the $WW/ZZ$ “interconnection noise” to harmless levels at high energies, by simple proper cuts. It should also be possible, but not easy, to dig out a colour rearrangement signal at high energies, with some suitably optimized cuts that yet remain to be defined. The $Z^0Z^0$ events should display about twice as large interconnection effects as $W^+W^-$ ones, but cross sections are reduced even more. The availability of a single-$Z^0$ calibration still makes $Z^0Z^0$ events of unique interest. While detailed studies remain to be carried out, it appears that the direct reconstruction of the top mass could be uncertain by maybe 100 MeV. Finally, in all of the studies so far, it has turned out to be very difficult to find a clean handle that would help to distinguish between the different models proposed, both in the reconnection and Bose–Einstein areas. Much work thus remains for the future. [99]{} V.A. Khoze and T. Sjöstrand, LU TP 99-23, hep-ph/9908408, to appear in the Proceedings of the International Workshop on Linear Colliders, Sitges (Barcelona), Spain, April 28 - May 5, 1999 G. Gustafson, U. Pettersson and P. Zerwas, Phys. Lett. [**B209**]{} (1988) 90. T. Sjöstrand and V.A. Khoze, Z. Physik [**C62**]{} (1994) 281, Phys. Rev. Lett. [**72**]{} (1994) 28.. G.Gustafson and J.Häkkinen, Z. Physik [**C64**]{} (1994) 659;\ L. Lönnblad, Z. Physik [**C70**]{} (1996) 107;\ Š. Todorova–Nová, DELPHI Internal Note 96-158 PHYS 651;\ J. Ellis and K. Geiger, Phys. Rev. [**D54**]{} (1996) 1967, Phys. Lett. [**B404**]{} (1997) 230;\ B.R. Webber, J. Phys. [**G24**]{} (1998) 287. J. Häkkinen and M. Ringnér, Eur. Phys. J. [**C5**]{} (1998)275. L. Lönnblad and T. Sjöstrand, Phys. Lett. [**B351**]{} (1995)293, Eur. Phys. J. [**C2**]{} (1998) 165. S. Jadach and K. Zalewski, Acta Phys. Polon. [**B28**]{} (1997) 1363;\ V. Kartvelishvili, R. Kvatadze and R. M[ø]{}ller, Phys. Lett. [**B408**]{} (1997) 331;\ K. Fia[ł]{}kowski and R. Wit, Acta Phys. Polon. [**B28**]{} (1997) 2039, Eur. Phys. J. [**C2**]{} (1998) 691;\ Š. Todorova–Nová and J. Rameš, hep-ph/9710280. V.A. Khoze and T. Sjöstrand, Eur. Phys. J. [**C6**]{} (1999) 271. F. Martin, presented at XXXIV Rencontres de Moriond, France, March 20—27, 1999, preprint LAPP–EXP 99.04. G. Wilson, presented at the International Workshop on Linear Colliders, Sitges (Barcelona), Spain, April 28 – May 5, 1999 E. Norrbin and T. Sjöstrand, Phys. Rev. [**D55**]{} (1997) R5. A.P. Chapovsky and V.A. Khoze, Eur. Phys. J. [**C9**]{} (1999) 449. V.A. Khoze and T. Sjöstrand, Phys. Lett. [**B328**]{} (1994) 466. Ya.I. Azimov, Yu.L. Dokshitzer, V.A. Khoze and S.I. Troyan, Phys. Lett. [**B165**]{} (1985) 147. B. Andersson, G. Gustafson, G. Ingelman and T. Sjöstrand, Phys. Rep. [**97**]{} (1983) 31. [^1]: To appear in the Proceedings of the Workshop on the development of future linear electron-positron colliders for particle physics studies and for research using free electon lasers, Lund, Sweden, 23–26 September 1999 [^2]: [email protected]

Title Authors Document Type Article Publication Date 2006 Abstract The central thesis of this article is that the use of the profit-sacrifice test as the sole liability standard for exclusionary conduct, or as a required prong of a multi-pronged liability standard is fundamentally flawed. The profit-sacrifice test may be useful, for example, as one type of evidence of anticompetitive purpose. In unilateral refusal to deal cases, it can be useful in determining the non-exclusionary benchmark. However, the test is not generally a reliable indicator of the impact of allegedly exclusionary conduct on consumer welfare - the primary focus of the antitrust laws. The profit-sacrifice test also is prone to several significant pitfalls and often would be complex and subjective to implement in practice. As a result, relying on the profit-sacrifice test as the legal standard would lead to significant legal errors. Comments This information or any portion thereof may not be copied or disseminated in any form or by any means or downloaded or stored in an electronic database or retrieval system without the express written consent of the American Bar Association.

/* P動作--企圖進入一關鍵區 */ void semaphore_P(int sem_id) { struct sembuf sb; sb.sem_num = 0; sb.sem_op = -1; /* P動作－訊號量值減少 */ sb.sem_flg = SEM_UNDO; /* 若果死亡，解除訊號量請求*/ if (semop(sem_id, &sb, 1) == -1){ fprintf(stderr,”semaphore_P failed\n”); return(0); } return(1); } /* V動作--離開關鍵區 */ void semaphore_V(int sem_id) { struct sembuf sb; sb.sem_num = 0; sb.sem_op = 1; /* V動作－訊號量值增加 */ sb.sem_flg = SEM_UNDO; /* 若果死亡，解除訊號量請求*/ if (semop(sem_id, &sb, 1) == -1){ fprintf(stderr,”semaphore_V failed\n”); return(0); } return(1); }

Q: Highest or Lowest Occurrences? Challenge: Inputs: A string containing printable ASCII (excluding spaces, tabs and new-lines) A boolean † Output: The parts of the String are divided into four groups: Lowercase letters Uppercase letters Digits Other Based on the boolean, we either output the highest occurrence of one (or multiple) of these four groups, or the lowest, replacing everything else with spaces. For example: Input: "Just_A_Test!" It contains: - 3 uppercase letters: JAT - 6 lowercase letters: ustest - 0 digits - 3 other: __! These would be the outputs for true or false: true: " ust est " // digits have the lowest occurrence (none), so everything is replaced with a space false: " " (Note: You are allowed to ignore trailing spaces, so the outputs can also be " ust est" and "" respectively.) Challenge rules: The input will never be empty or contain spaces, and will only consist of printable ASCII in the range 33-126 or '!' through '~'. You are allowed to take the input and/or outputs as character-array or list if you want to. † Any two consistent and distinct values for the boolean are allowed: true/false; 1/0; 'H'/'L'; "highest"/"lowest"; etc. Note that these distinct values should be used (somewhat) as a boolean! So it's not allowed to input two complete programs, one that gives the correct result for true and the other for false, and then having your actual code only be <run input with parameter>. Relevant new default loophole I've added, although it can still use a lot of finetuning regarding the definitions.. If the occurrence of two or more groups is the same, we output all those occurrences. The necessary trailing spaces are optional, and a single trailing new-line is optional as well. Necessary leading spaces are mandatory. And any other leading spaces or new-lines aren't allowed. General rules: This is code-golf, so shortest answer in bytes wins. Don't let code-golf languages discourage you from posting answers with non-codegolfing languages. Try to come up with an as short as possible answer for 'any' programming language. Standard rules apply for your answer, so you are allowed to use STDIN/STDOUT, functions/method with the proper parameters, full programs. Your call. Default Loopholes are forbidden. If possible, please add a link with a test for your code. Also, please add an explanation if necessary. Test cases: Inputs: Output: "Just_A_Test!", true " ust est " (or " ust est") "Just_A_Test!", false " " (or "") "Aa1!Bb2@Cc3#Dd4$", either "Aa1!Bb2@Cc3#Dd4$" "H@$h!n9_!$_fun?", true " @$ ! _!$_ ?" "H@$h!n9_!$_fun?", false "H 9 " (or "H 9") "A", true "A" "A", false " " (or "") "H.ngm.n", true " ngm n" "H.ngm.n", false " " (or "") "H.ngm4n", false "H. 4 " (or "H. 4") A: Jelly, 31 bytes ØṖḟØBṭØBUs26¤f€³Lİ⁴¡$ÐṀFf ¹⁶Ç?€ Try it online! The boolean values are 2 and 1 (or any other positive even/odd pair), which represent True and False respectively. I will try to add an explanation after further golfing. Thanks to caird coinheringaahing for saving 2 bytes, and to Lynn for saving 4 bytes! Thanks to one of Erik's tricks, which inspired me to save 4 bytes! How it works Note that this is the explanation for the 35-byte version. The new one does roughly the same (but tweaked a bit by Lynn), so I won't change it. ØBUs26f€³µ³ḟØBW,µẎLİ⁴¡$ÐṀF - Niladic helper link. ØB - String of base digits: '0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ abcdefghijklmnopqrstuvwxyz'. U - Reverse. s26 - Chop into sublists of length 26, preserving shorter trailing substrings. f€³ - For each, keep the common characters with the input. ØB - Base digits. ³ḟ - Get the signs in the input. Filter the characters of the input that aren't alphanumeric. W,µẎ - Concatenate (wrap, two element list, tighten). ÐṀ - Keep the elements with maximal link value. L - Length. ⁴¡ - Do N times, where N is the second input. İ - Inverse. Computes 1 ÷ Length. 2 maps to the length itself, because 1 ÷ (1 ÷ Length) = length; 1 yields (1 ÷ Length), swapping the maximal numbers with minimal ones. F - Flatten. ¹⁶e¢$?€ - Main link. € - For each character. e¢? - If it is contained by the last link (called niladically), then: ¹ - Identity, the character itself, else: ⁶ - A space. A: Python 2, 166 158 bytes t=lambda c:('@'<c<'[','`'<c<'{','/'<c<':',1-c.isalnum()) def f(s,b):x=map(sum,zip(*map(t,s)));print''.join([' ',c][x[t(c).index(1)]==sorted(x)[-b]]for c in s) Try it online! A: R, 193 186 179 158 bytes -7 bytes thanks to NofP and his suggestion of cbind -6 bytes using outer, -1 byte switching [^a-zA-Z0-9] with [[:punct:]] -21 bytes thanks to MickyT for pointing out a list of characters is allowed function(S,B){y=outer(c("[a-z]","[A-Z]","\\d","[[:punct:]]"),S,Vectorize(grepl)) S[!colSums(y[(s=rowSums(y))=="if"(B,max,min)(s),,drop=F])]=" " cat(S,sep='')} Verify all test cases Takes 1/T as truthy (max) and 0/F as falsey (min), and takes S as a list of single characters. Try it online! In my original version (with NofP's suggestions), the matrix y is constructed by evaluating grepl(regex, S) for each regex, then concatenating them together as columns of a matrix. This results in multiple calls to grepl, but as S is fixed, it seemed that something else needed to be done. As I noted: There are potentially shorter approaches; mapply, for example: y=mapply(grepl,c("[a-z]","[A-Z]","\\d","[^a-zA-Z0-9]"),list(S)) unfortunately, this will not simplify as a matrix in the 1-character example of "A". I used outer rather than mapply, which always returns an array (a matrix in this case), and was forced to Vectorize grepl, which is really just an mapply wrapper around it. I also discovered the predefined character group [:punct:] which matches punctuation (non-space, non-alphanumeric) characters.

Q: Error with html checkbox value retrieval In my html I have: <div id="case_filter" style="float: bottom"> <input type="checkbox" name="bC" value="B C" checked> No B C<br> <input type="checkbox" name="fN" value="f NC" > No F NC<br> <input type="checkbox" name="rR" value="RR" > No RR<br> </div> I kept the first checkbox checked by default. I want to access the value of the checkbox in my JS. I am doing this below, but it returns null (when I console.log it). var checkedValue = document.querySelector('.bC:checked').value; A: . is for class selector. [] is for name selector. You could try either: var checkedValue = document.querySelector('[name="bC"]:checked').value; or <input type="checkbox" class="bC" value="B C" checked> No B C<br>

Q: How to read Json array in jquery in Laravel 5.2 I am using ajax-jquery to fetch multiple eloquent objects in laravel 5.2 This is what i am getting as response in jquery { "screens": [{"screen_id":1,"screen_name":"Screen 1 ","screen_msg":"Hello","screen_status":"Active","cinema_id":1,"created_at":"2016-09-08 04:34:28","updated_at":"2016-09-08 04:34:28"}], "showtime": [{"show_id":6,"movie_id":1,"dimensional":"2D","cinema_id":1,"screen_id":1,"show_date":"2016-10-04","show_time":"00:57:00","show_status":"Active","created_at":"2016-09-08 12:21:06","updated_at":"2016-09-08 12:21:06"}, {"show_id":7,"movie_id":1,"dimensional":"2D","cinema_id":1,"screen_id":1,"show_date":"2016-10-04","show_time":"00:57:00","show_status":"Active","created_at":"2016-09-08 12:22:15","updated_at":"2016-09-08 12:22:15"}] } my controller function code public function getscreen($id) { $screens=Movies_screen::where('cinema_id',$id)->get(); $showtime=Movies_showtimes::where('cinema_id',$id)->get(); return response()->json(['screens' => $screens, 'showtime' => $showtime]); } I am reading those json array in jquery as $("#cinemahall").on("change click",function(){ var cinema_id=$("#cinemahall option:selected").val(); //ajax $.get('/askspidy/admin/showtime/getscreen/' + cinema_id, function(data){ $("#screenname").empty(); $("#screenname").append('<option value=0>Select Screen</option>'); $.each(data,function(index,screenobj){ $("#screenname").append('<option value="' +screenobj.screens[0].screen_id + '">' +screenobj.screens[0].screen_name +'</option>'); }); }); }); In console i can see proper data without any error but i am unable to access each and every field of json response using screenobj.screens[0].screen_name Need help to figure out this issue. A: Do data.screens[0].screen_name you don't need the loop or $.each(data.screens,function(index,screenobj){ $("#screenname").append('<option value="' +screenobj.screen_id + '">' +screenobj.screen_name +'</option>'); });

Loads such as packaged lumber, pipe, etc. shipped via open railcar must be securely tied-down to the railcar for shipment in compliance with regulations set by the railways. Conventionally, the load is carefully arranged in accordance with such regulations and tied down to the railcar surface using steel strapping and dunnage. Typically, about U.S. $200 worth of strapping and dunnage, about four man-hours of manual labor and about two machine-hours of automated labor (i.e. employing a forklift) are consumed in the tie-down operation. The strapping and dunnage adds about 1,500 pounds in weight, which must be taken into account in planning the railcar loading operation. The strapping and dunnage comprising this extra weight is scrapped when the railcar reaches its destination and the load is removed. Newer style "center beam" railcars are provided with an integral cable-stayed load tie-down system. Such cars have a vertically extending divider which runs longitudinally along the railcar's center line. However, center beam railcars are subject to several disadvantages. For example, the divider in a center beam car precludes use of such cars in rail yards which are equipped to load or unload cars from only one side of the car. (It is not possible to load or unload only one side of a center beam car at a time, since this could cause the car to tip over. Both sides must be evenly loaded or unloaded.) Another disadvantage is that some rail yard operators use overhead cranes for loading and unloading. Center beam railcars have a roof member atop the divider which restricts load height and prevents usage of overhead cranes with such cars. During the course of loading or unloading a center beam railcar, one or more workers must climb atop the car to attach or release components of the car's cable-stayed load tie-down system. This presents a potential safety hazard which the present invention avoids by allowing all railcar loading or unloading operations to be performed from the ground adjacent the railcar. A further potential safety hazard of the center beam railcar cable-stayed load tie-down system is its use of loose, heavy metal components such as corner brackets which must be manually positioned on the top corners of loads placed on the car before they are fixed in place. Such components may be inadvertently dropped while they are being installed, presenting serious risk of injury to persons below. The present invention does not require workers to clamber atop the loaded railcar, nor does it require heavy, loose components which may be dropped as aforesaid. The older bulkhead style cars mentioned above do not have center dividers. By contrast, such cars have a simple flat deck which extends between a pair of transverse, vertical bulkheads located at opposed ends of the railcar. The present invention adapts such cars for the shipment of packaged lumber and similar loads in a manner which substantially reduces the need for metal strapping and dunnage, thereby reducing costs and redundant weight on the car, and minimizing the problem of having to dispose of large amounts of scrapped metal strapping and dunnage. The invention also simplifies the railcar loading and unloading operation, which again reduces costs. Because bulkhead railcars can be loaded or unloaded from either side, and have no roof members, they are not subject to the aforementioned disadvantages of center beam cars. Further, the invention does not interfere with any traditional usage of bulkhead cars, but remains available for use in any load tie-down situation. Thus, bulkhead cars adapted in accordance with the invention can be used in "two-way" mode, to ship loads such as packaged lumber in one direction and different loads such as pipe in the return direction. This helps reduce non-revenue generating "empty miles" in which empty railcars travel in the return direction.

Eventbrite, and certain approved third parties, use functional, analytical and tracking cookies (or similar technologies) to understand your event preferences and provide you with a customised experience. By closing this banner or by continuing to use Eventbrite, you agree. For more information please review our cookie policy. Event Information Date and Time Location Refund Policy No Refunds Event description Description Do not fear Inner Westies, we haven’t forgotten about you! We understand it can be hard to make new friends, particularly when you’re always working or busy with life. With this event you can head over after work, bring a friend or simply come alone! This Newtown restaurant is new to the Social Table line-up and is chosen as it has the perfect atmosphere to relax, converse and enjoy great food.

As i`m not very happy with the imminant arrival of Donna Noble in the series I was just wondering who could have been maybe a better choice from what we`ve seen in the first three new series so far - vote now!_________________Class of `82 I've heard whispers from people insinde the industry that Catherine Tate was forced onto the production team as the programme is getting too popular. Well, it's made by BBC Wales not BBC London and that would never do, would it? They've lost one viewer, certainly. Me. I cannot stand Catherine Tate and the TV goes off when she's on. Shrill voiced talentless harpie. That and RTD's writing as the final 3 episodes of the last season ranked as some of the worst Who I've ever seen, and that includes Time and the Rani._________________"Now then, Butch Harry, tell us about Fulham..." Wouldnt it have been great to see Reinette explore the universe with the Doctor - just how great would that have been? And it would have added something extra special to the world of DW to see her surprise and awe at many superb spectacles -instead we get another boring non companion in Donna Noble! _________________Class of `82 I've heard whispers from people insinde the industry that Catherine Tate was forced onto the production team as the programme is getting too popular. Well, it's made by BBC Wales not BBC London and that would never do, would it? They've lost one viewer, certainly. Me. I cannot stand Catherine Tate and the TV goes off when she's on. Shrill voiced talentless harpie. That and RTD's writing as the final 3 episodes of the last season ranked as some of the worst Who I've ever seen, and that includes Time and the Rani. I've heard whispers from people insinde the industry that Catherine Tate was forced onto the production team as the programme is getting too popular. Well, it's made by BBC Wales not BBC London and that would never do, would it? They've lost one viewer, certainly. Me. I cannot stand Catherine Tate and the TV goes off when she's on. Shrill voiced talentless harpie. That and RTD's writing as the final 3 episodes of the last season ranked as some of the worst Who I've ever seen, and that includes Time and the Rani. i liked time and the rani but i agree it could be quite dodgy with CT...but am willing to hope that someone else will write a few stories.......RTD is terrible Given that we never see the Movellans again, I assume they must have lost their war against the Daleks. According to Ressurection The Movellans won the war with the Daleks, using a virus. However, as we never see them again, it seems likely they were later wiped out. In the Remembrance novelisation, there's reference to the Imperial Daleks waging a war of vengeance against them. Davros had addapted their biological make-up, so those Daleks were probably imune to the virus. IMO, the Movellans were created by the Time Lords, possibly the Celestial Intrervention Agency._________________Everything in life is only for now.

Use of recombinant human interleukin-2 in conjunction with bone marrow transplantation as a model for control of minimal residual disease in malignant hematological disorders: I. Treatment of murine leukemia in conjunction with allogeneic bone marrow transplantation and IL-2-activated cell-mediated immunotherapy. Immunotherapy with recombinant human interleukin-2 (IL-2) and allogeneic spleen cells has led to significant antitumor effects in B-cell leukemia- (BCL1) bearing mice following transplantation with T-lymphocyte-depleted allogeneic bone marrow cells. Graft versus leukemia (GVL) effects were studied in a model mimicking minimal residual disease following bone marrow transplantation (BMT). Lethally irradiated (BALB/c x C57BL/6)F1 recipients were reconstituted with 20 x 10(6) T-lymphocyte-depleted C57BL/6 bone marrow cells mixed with 10(4) to 10(6) BCL1 cells followed by administration of sequential increments of allogeneic C57BL/6 spleen cells; 10(6) cells on Day +1, 10(7) cells on Day +5, and 5 x 10(7) cells on Day +9, with or without concomitant IL-2 treatment (intraperitoneal injections of 20,000 U twice daily for 3 days) together with each spleen cell administration. All mice receiving 10(4)-10(6) BCL1 cells developed marked splenomegaly by Day +21 and all adoptive recipients of 10(5) spleen cells obtained from these mice developed leukemia within 21-36 days. Treatment of mice which received 10(4) BCL1 cells by either three courses of low dose IL-2 or three increments of allogeneic spleen cells alone and certainly by a combination of both resulted in normalization of splenomegaly on Day +21, but only adoptive recipients of 10(5) spleen cells obtained from mice treated by both allogeneic spleen cells and IL-2 (10/10) or allogeneic spleen cells alone (8/10) were disease free (greater than 100 days). Mice inoculated with 10(5) BCL1 cells developed mild splenomegaly on Day +21 after IL2 treatment alone, but showed no clinical evidence of disease following administration of allogeneic spleen cells or both allogeneic spleen cells and IL-2. Following adoptive transfer of 10(5) spleen cells obtained from each treated group no leukemia (greater than 100 days) was evident in recipients of spleen cells obtained from mice treated with both allogeneic spleen cells and IL-2 (10/10) whereas a partial effect was observed in mice treated by allogeneic spleen cells only (4/10). Mice inoculated with a high dose of BCL1 cells (10(6] showed some delay in onset of splenomegaly, but no curative antileukemic effects could be observed even following a synergistic combination of IL-2 and allogeneic spleen cells. Our data suggest that immunocompetent allogeneic lymphocytes may play an important role against leukemic relapse and thus cell therapy may be used therapeutically to treat minimal residual disease after BMT even following initial reconstitution with T-cell-depleted bone marrow cells.(ABSTRACT TRUNCATED AT 400 WORDS)

Q: Pandas GroupBy and total sum within group Let's say I have a dataframe that looks like this: interview longitude latitude 1 A1 34.2 90.2 2 A1 54.2 23.5 3 A3 32.1 21.5 4 A4 54.3 93.1 5 A2 45.1 29.5 6 A1 NaN NaN 7 A7 NaN NaN 8 A1 NaN NaN 9 A3 23.1 38.2 10 A5 -23.7 -98.4 I would like to be able to perform some sort of groupby method that outputs me the total present values within each subgroup. So, desired output for something like this would be: interview longitude latitude occurs 1 A1 2 2 4 2 A2 1 1 1 3 A3 2 2 2 4 A4 1 1 1 5 A5 1 1 1 6 A7 0 0 1 I tried to use this command to try with latitudes, but not getting the desired output: df.groupby(by=['interview', 'latitude'])['interview'].count() Thanks! A: Using notna before groupby + sum s1=(df[['**longitude**','**latitude**']].notna()).groupby(df['**interview**']).sum() s2=df.groupby(df['**interview**']).size()# note size will count the NaN value as well pd.concat([s1,s2.to_frame('**occurs** ')],axis=1) Out[115]: **longitude** **latitude** **occurs** **interview** A1 2.0 2.0 4 A2 1.0 1.0 1 A3 2.0 2.0 2 A4 1.0 1.0 1 A5 1.0 1.0 1 A7 0.0 0.0 1

sequenceDiagram participant Initiating participant Responding Initiating->>Responding: M1 Responding->>Initiating: M2 Initiating->>Responding: M3 Responding->>Initiating: M4 Initiating->>Responding: M5

Clinicopathologic features, diagnosis, and treatment of fibrosarcoma of bone. Fibrosarcoma of bone is a relatively rare tumor; it accounts for less than 5% of bone sarcomas. The anatomical sites most commonly involved are the metaphyses of long tubular bones. Local pain, swelling, limitation of motion, and pathologic fracture are the common clinical signs and symptoms. Typical imaging findings include eccentrically located lytic lesions, with a geographic, moth-eaten, or permeative pattern of bone destruction, and extension into adjacent soft tissues. Surgery is the treatment of choice. The type of surgical procedure depends mainly on histologic grade, local conditions, and tumor location. With a high probability of metastases (>70%) after surgical treatment, perioperative adjuvant treatment modalities should be considered for high-grade tumors. The most important prognostic factors affecting survival include tumor grade, patient's age, and tumor location.

Sensitivity and workload for manual and automated gynecologic screening: best current estimates. Sensitivity for screening gynecologic cytology appears to be correlated with workload, but data in the literature is limited. We gathered all known published data that included independently estimated measures of sensitivity and workload, for manual and automated screening, including individual cytotechnologist (CT) and laboratory data. We then attempted to synthesize the best estimates of sensitivity with workload volume. While this interpretation is limited by the scarcity of collected data and the few assumptions needed to combine the data, our results suggest that manual and automated screening correlate differently with workload. Manual screening was directly related to total workload volume, appeared to reach near 100% sensitivity for some individual CTs at workloads of ~30 slides/day, and decreased to below 80% sensitivity at ~70 slides /day. Most CTs performed at a higher sensitivity than the laboratory averages, but a small subset of CTs had significantly lower sensitivities with similar workload volumes. Sensitivity of automated screening, on the other hand, was more closely correlated with epithelial cell abnormality (ECA)-adjusted workload (ECA × total slides/day). While these results are preliminary and additional studies are warranted to confirm them, our results may be useful in monitoring workload limits in gynecologic cytology.

All microarray data are available from the Gene Expression Omnibus database (Accession Number GSE70280). Introduction {#sec001} ============ Melanocytes are melanin-producing cells that, in addition to hold a major role in the pigmentary phenotype, also play an important part in the protection of the skin against the damaging effects of ultraviolet-B (UVB) radiation, such as erythema, sunburn, development of malignant melanoma or other skin cancers \[[@pone.0134911.ref001]--[@pone.0134911.ref004]\]. The advent of cDNA microarray technology has allowed a preliminary understanding of the gene interactions and regulatory networks that take place in pigmentary cells in response to UVB \[[@pone.0134911.ref005]--[@pone.0134911.ref007]\]. One of the first reports using cDNA microarrays in various cell lines of human melanocytes for around 9,000 human genes \[[@pone.0134911.ref005]\] showed that various genes, mainly related to DNA/RNA synthesis and modification, ribosomal proteins or solute carriers and ionic channels, were modulated 4 hours after a single dose of UVB irradiation (100mJ/cm^2^). Later, Yang et al. \[[@pone.0134911.ref006]\] using a higher density microarray (with probes for approximately 47,000 transcripts), although for a single cell line of melanocytes, analysed the response of melanocytes to UVB. In contrast to Valéry et al. \[[@pone.0134911.ref005]\], Yang et al. \[[@pone.0134911.ref006]\] selected a 24-hour time point after UVB irradiation and reported a set of p53-target genes as major agents involved in the UV response. However, many questions remain unsolved yet. For example, although the damage and the collateral consequences of UVB in the human skin are known to differ among individuals of different geographical origin and skin color \[[@pone.0134911.ref008]\], the different transcriptional responses that could arise between cultured human melanocytes from dark and light donors (hereinafter DM and LM, respectively) have not been completely elucidated. A recent work \[[@pone.0134911.ref009]\] performed a genome-wide transcriptome analysis of both DM and LM under basal conditions using RNA-Seq technology and found only 16 genes differentially expressed in the two cell types. However, their results could be somehow limited by the small number of melanocyte lines of each type (2 DM and 2 LM) analysed. Furthermore, the response of melanocytes to UV radiation is known to be mediated by paracrine factors released by keratinocytes, which modulate the growth rate and dendricity of melanocytes, and which ultimately lead to an increased production of melanin \[[@pone.0134911.ref010]--[@pone.0134911.ref018]\]. In some cases this has been shown by growing melanocytes with keratinocyte conditioned media (KCM) *in vitro;* however, the procedure by which this medium is obtained varies among studies. Thus, while in some experiments this medium is collected after the irradiation of keratinocytes (hereinafter KCM+) \[[@pone.0134911.ref019]--[@pone.0134911.ref020]\], in other studies the medium is collected from keratinocytes that have not been previously irradiated (hereinafter KCM-) \[[@pone.0134911.ref010], [@pone.0134911.ref021]--[@pone.0134911.ref022]\]. Given the current lack of a consensus to define how to collect this media, we aimed to analyse the putative different responses that might arise when culturing melanocytes with either KCM- or KCM+. Therefore, the objective of this work was to achieve a full view of the regulatory mechanisms that melanocytes undergo in response to UVB. Thus, we analyse herein the whole-genome transcriptional profile of dark and light melanocytes under basal conditions and after UVB irradiation at different time points (6, 12 and 24 hours) by means of gene expression microarrays. Further, we also aimed to assess the effect of different keratinocyte-conditioned media on melanocytes at a whole-genome level. With that aim, melanocytes were cultured in medium supplemented with keratinocyte-conditioned medium obtained both from non-irradiated (KCM-) and irradiated keratinocytes (KCM+). This work outperforms previous studies in many regards: 1) we interrogate a large number of probes in the genome, including genes (28,000) and other non-coding RNAs (7,419), 2) we include both DM and LM and assess their transcriptional differences, 3) importantly, we use a relatively high number of biological replicates (6 cell lines of DM and 6 of LM), which minimises the noise from variability among individuals, 4) we perform a time-series analysis that detects both early and later stress responses and 5) we cultivate melanocytes with KCM- and KCM+ and assess their distinct influence. Materials and Methods {#sec002} ===================== Cell cultures {#sec003} ------------- Human epidermal keratinocytes were purchased from Cascade Biologics (Life technologies, Carlsbad, CA, USA). Cells were cultured in EpiLife Medium supplemented with human keratinocyte growth supplement (HKGS). Human epidermal melanocytes were also purchased from Cascade Biologics: six lines isolated from lightly pigmented neonatal foreskin (LM), and six lines from darkly pigmented neonatal foreskin (DM). These melanocytes were cultivated in Medium 254 supplemented with 1% human melanocyte growth supplement (HMGS). All the cell lines were maintained in an incubator under an atmosphere of 5% CO~2~ at 37°C. Media were refreshed every two days. UV irradiation and Keratinocyte-conditioned medium {#sec004} -------------------------------------------------- UV irradiation was performed in an ICH2 photoreactor (LuzChem, Canada) at 37°C. Cultures were irradiated at 75 mJ/cm^2^ UVB, based on our previous work \[[@pone.0134911.ref020]\], as we observed that this dosage led to a notable physiological effect but did not affect cell viability in both keratinocytes and melanocytes. Keratinocyte supernatants were harvested from both non-irradiated (KCM-) and irradiated keratinocytes (24 hours after treatment) (KCM+) and kept frozen at -80°C until subsequent use. Subconfluent melanocyte cultures were cultivated in Medium 254 supplemented with HMGS and KCM+ or KCM- medium in a proportion 1:1. The following day they were irradiated with 75 mJ/cm^2^ of UVB, and harvested at 6, 12 and 24 hours post irradiation. We used non-irradiated control cultures that were covered by aluminium foil during irradiation ([Fig 1](#pone.0134911.g001){ref-type="fig"}). {#pone.0134911.g001} Microarrays {#sec005} ----------- RNA from irradiated and non-irradiated melanocytes was extracted using the RNA extraction kit from Ambion (Life technologies). Samples were quantified using a UV/VIS NanoDrop 8000 (Thermo Fisher, Waltham, MA, USA), and RNA integrity was analysed through an Agilent 2100 Bioanalyzer using Agilent RNA 6000 Nano Chips (Agilent Technologies, Santa Clara, CA, USA). For each labeling reaction 100 ng RNA were used, with the Low input Quick Amp Labeling kit, one color (Agilent Technologies). First, total RNA was retrotranscribed using AffinityScript Reverse Transcriptase (Agilent Technologies) and Oligo dT primers linked to promoter T7. The synthesized double stranded cDNA was *in vitro* transcribed by T7 RNA polymerase with Cy3-CTP in order to achieve labeled and amplified cRNA. These samples were purified with RNeasy Mini kit columns (Qiagen, Hilden, Germany) and quantified to determinate the yield (which should be higher than 0.825 μg per reaction) and the specific activity of the fluorochrome Cyanine 3 (which should be higher than 6 pmol/μg). All the samples satisfied these requirements. Samples were analysed using SurePrint G3 Human GE Microarrays (Agilent Technologies), which have probes for 27,958 annotated genes and 7,419 long intergenic non-coding RNAs (lincRNAs). The hybridization step was performed using the SureHyb hybridization chamber (Agilent Technologies) and 600 ng of labeled cRNA samples, for 17 hours at 65°C and 10,000 rpms in a hybridization oven. Microarrays were stabilized with ozone-barrier slide covers (Agilent Technologies). Image processing of the microarrays was performed by using the Agilent Feature Extraction software v10.7.3.1. This software performs 9 evaluation parameters to check the quality of the microarrays. The quality control parameters included, among others, the coefficient of variation of the processed signal from non-control probes and spike-ins (%CV), the percentage of outlier probes as regards the replicated probes population, the intensity of the signal of the negative controls and the limit of detection and linearity of the Spike-Ins signal. Microarray data pre-processing and normalization {#sec006} ------------------------------------------------ Raw data were processed with GeneSpring GX software v11.5.1 (Agilent Technologies). Feature extraction flags were transformed as follows: if feature was not positive and significant, not uniform, not well above background or was a population outlier: compromised; if feature was saturated: not detected. We performed a variance-stabilizing transformation of the data, which is a key step, but often not considered, in the pre-processing of microarrays data. Most of the subsequent statistical analyses assume that the data follow a normal distribution, with a constant variance independent of the mean of the data. Gene-expression microarray data, however, often have a variance that changes non-linearly with the mean, and thus, log transformations, which are used in the transformation of these data, can inflate the variance of observations near the background. Thus, our data were subjected to a DDHF (Data-Driven Haar-Fisz) transformation for variance stabilization with the R package DDHFm \[[@pone.0134911.ref023]\]. This method stabilizes the variance of replicated intensities from microarray data and produces transformed intensities that are much closer to the Gaussian distribution than other methods. Furthermore, it can be adapted to different or uncertain distributions, and therefore, it is ideal for the variance stabilization of microarray data. Data were transformed to log base 2 and normalized following the quantile method \[[@pone.0134911.ref024]\]. Flag spot information in data files was used to filter probe sets. Entities in which more than 50% of samples in 1 out of any 7 conditions (0h, 6h KCM-, 12h KCM-, 24h KCM, 6h KCM+, 12h KCM+ and 24h KCM+) had "detected" flags were maintained for the analyses. Quality (QC) Metrics and Principal Component Analysis (PCA) {#sec007} ----------------------------------------------------------- QC-Metrics was performed with GeneSpring GX software. Gene expression of the transformed and normalized data were subjected to unsupervised classification by means of Principal Component Analysis (PCA) as a preliminary exploratory approach to detect outliers, or the existence of defined clusters based on time points, pigmentation of the cells or the type of KCM used for culture. We used The Unscrambler X v10.3 (CAMO A/S, Trondheim, Norway) and applied the full cross validation method to estimate the stability and performance of the model. Comparison of expression profiles {#sec008} --------------------------------- Statistical analysis for the comparison of expression profiles was performed with SAM (Significance Analysis of Microarrays, \[[@pone.0134911.ref025]\]), using two class non-pairwise comparisons and 500 permutations in each test. The significance of the tests was given by the lowest False Discovery Rate at which the gene is called significant based on \[[@pone.0134911.ref026]\], adjusted for multiple tests. Pathway enrichment analysis {#sec009} --------------------------- Enrichment analysis was performed using Web-based Gene Set Analysis Toolkit (WebGestalt) (<http://bioinfo.vanderbilt.edu/-webgestalt/option.php>), using all the probes analyzed in the microarray as the reference list, and The Kyoto Encyclopedia of Genes and Genomes (KEGG) database of pathways. The significance analysis was performed using the Hypergeometric test. P-values were corrected for multiple tests following the Bonferroni procedure. The minimum number of genes for enrichment was set at 5, and the significance level at Bonferroni adjusted-p\<0.01, in order to be conservative, avoid false positives and achieve more robust results. Validation by RT-qPCR {#sec010} --------------------- We selected 6 genes showing a change in expression between dark and light melanocytes or after UV irradiation in the microarrays for validation with Real-Time quantitative PCR (RT-qPCR). cDNA was synthesized from 2 μg of total extracted RNA using the First Strand cDNA Synthesis Kit (ThermoFisher) and was used as a template for RT-qPCR analyses. Four different cell lines were analysed (2 of dark melanocytes, and 2 of light melanocytes). RT-qPCR reactions were performed with SYBR Green in a StepOne thermocycler (Life Technologies). Primer sequences (5\'-3\') were the following: MIFf_GAAGGCCATGAGCTGGTCT, MIFr_GGTTCCTCTCCGAGCTCAC, FDXRf_CTGAGGCAGAGTCGAGTGAAG, FDXRr_CCCGAAGCTCCTTAATGGTGA, TP53I3f_AATGCTTTCACGGAGCAAATTC, TP53I3r_TTCGGTCACTGGGTAGATTCT, ATP6VOBf_CCATCGGAACTACCATGCAGG, ATP6VOBr_TCCACAGAAGAGGTTAGACAGG, MDM2f_GAATCATCGGACTCAGGTACATC, MDM2r_TCTGTCTCACTAATTGCTCTCCT, RPL6f_ATTCCCGATCTGCCATGTATTC and RPL6r_TACCGCCGTTCTTGTCACC. Thermocycling conditions were optimized for each pair of primers to obtain 95--100% efficiency and r^2^\>0.99 in the reaction. Gene expression was normalized to the housekeeping gene *GAPDH*. Each reaction was performed in triplicate and values were averaged to calculate relative expression levels. Selection tests {#sec011} --------------- Preliminary screenings to detect deviations from neutrality were performed using the 1000 Genomes Selection Browser (<http://hsb.upf.edu/>) \[[@pone.0134911.ref027]\], which implements several neutrality tests (Tajima's D, Fay & Wu's H, Fu's F, Fu and Li's F\*, Fu and Li's D\* and EHH, among many others) and provides genome based rank "p-values", that help to identify which SNPs or regions have significantly high scores compared to the rest of the genome. Further selection tests in candidate loci were performed with DnaSP \[[@pone.0134911.ref028]\]. We obtained the genotypes of the European (n = 760 chromosomes), African (n = 492) and Asian (n = 572) populations from the 1000 Genomes Project (Phase I May 2011) using SPSmart v5.1.1 (dbSNP build 132) \[[@pone.0134911.ref029]\]. The orthologous sequence of the chimpanzee was obtained from the UCSC Genome Browser and aligned to the human sequences with ClustalW. For each population, we calculated Tajima's D, Fu & Li's D and Fay & Wu's H with DnaSP \[[@pone.0134911.ref028]\]. P-values for these tests were obtained using the interface for standard coalescent simulations conditioned on the number of segregating sites. Results and Discussion {#sec012} ====================== Quality metrics and PCA {#sec013} ----------------------- QC-Metrics revealed 2 outlier arrays that did not satisfy the quality parameters: L_5.6K- (LM; replicate_5; 6h; KCM-) and L_4.24K- (LM; replicate_4; 24h; KCM-). Thus, those samples were removed from the subsequent statistical analyses. Second, we performed a Principal Component Analysis (PCA), an exploratory multivariate statistical technique for simplifying complex data sets \[[@pone.0134911.ref030]\], that has been used for the analysis of microarray data in search of outlier genes \[[@pone.0134911.ref031]\] or to identify temporal patterns in time-series analyses \[[@pone.0134911.ref032]\]. The PCA ([Fig 2](#pone.0134911.g002){ref-type="fig"}) allowed us to have an overview of the temporal patterns or differentially expressed genes between dark and light melanocytes, or between the culture with KCM+ or KCM-. It showed an apparent general homogeneity, revealing no additional potential outliers and a coherent clustering of our samples according to different variables, which was valuable to discard the presence of outliers or experimental errors. The PCA showed a time-point clustering defined by the second component, revealing a major separation of the samples at 6 hours, while the samples corresponding to 12 and 24 hours clustered close to the controls (0 hours), thus suggesting an early response from melanocytes to UVB that returned again to basal levels after the first 6 hours. At 6 hours we also observed a differential response according to pigmentation defined by the first component. At 24 hours, an apparent clustering regarding the culture of light melanocytes with KCM- or KCM+ was also noticed. {#pone.0134911.g002} Identification of differentially expressed probes after UVB {#sec014} ----------------------------------------------------------- A total of 26,493 probes were examined per microarray. By means of SAM \[[@pone.0134911.ref025]\] we identified the statistically significant differentially expressed genes. Because probes may correspond to both genes and non-coding RNAs, we explicitly indicated when they corresponded to non-coding RNA. We first looked for common genes differentially expressed in DM and LM across time after UVB irradiation. We focused on the top upregulated and downregulated genes at 6, 12 and 24h, and in order to provide robust results, we identified those genes that were significantly up- or downregulated at more than one point (Tables [1](#pone.0134911.t001){ref-type="table"} and [2](#pone.0134911.t002){ref-type="table"}). The adjusted p-value for all these genes was \<0.0001. 10.1371/journal.pone.0134911.t001 ###### Most significantly upregulated genes at more than one time point (non-coding RNAs are indicated with \*) (Bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t001g} Time points Gene symbol Accession number Description ----------------------------------- -------------- ------------------------------------------------------------------------------------- ------------------------------------------------------------------- **6, 12 and 24h** *FDXR* NM_004110 ferredoxin reductase, nuclear gene encoding mitochondrial protein *EPHA2* NM_004431 EPH receptor A2 *RPL6* NM_001024662 ribosomal protein L6 *VWCE* NM_152718 von Willebrand factor C and EGF domains *UBD* NM_006398 ubiquitin D *CXCL1* NM_001511 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) *MDM2* NM_002392 Mdm2 p53 binding protein homolog (mouse), transcript variant MDM2 *RPL41* NM_001035267 ribosomal protein L41 *TNFRSF10C* NM_003841 tumor necrosis factor receptor superfamily, member 10c *DDB2* NM_000107 damage-specific DNA binding protein 2, 48kDa *GRM2* NM_000839 glutamate receptor, metabotropic 2 *TP53I3* NM_004881 tumor protein p53 inducible protein 3 *ISCU* NM_014301 iron-sulfur cluster scaffold homolog (E. coli) **6 and 12h** *GADD45A* NM_001924 growth arrest and DNA-damage-inducible, alpha *PLK3* NM_004073 polo-like kinase 3 *BTG2* NM_006763 BTG family, member 2 *TRIAP1* NM_016399 TP53 regulated inhibitor of apoptosis 1 *PIDD* NM_145886 p53-induced death domain protein *CDKN1A* NM_078467 cyclin-dependent kinase inhibitor 1A (p21, Cip1) *TP53INP1* NM_033285 tumor protein p53 inducible nuclear protein 1 *SESN1* THC2527965 Sestrin 1, partial (68%) *BAG1* NM_004323 BCL2-associated athanogene *XPC* NM_004628 xeroderma pigmentosum, complementation group C \*lincRNA chrX:64042150--64093950 **12 and 24h** *RPS2* NM_002952 ribosomal protein S2 *RPL26* THC2550570 ribosomal protein L26, partial (91%) *PLXNB2* NM_012401 plexin B2 *KRT17* NM_000422 keratin 17 *ACTA2* NM_001613 actin, alpha 2, smooth muscle, aorta *SULF2* NM_018837 sulfatase 2 *PVRL4* NM_030916 poliovirus receptor-related 4 *CSRP2* NM_001321 cysteine and glycine-rich protein 2 *DRAM1* NM_018370 DNA-damage regulated autophagy modulator 1 *BBC3* NM_014417 BCL2 binding component 3 *\*LOC344887* NR_033752 NmrA-like family domain containing 1 pseudogene, non-coding RNA *RELB* NM_006509 v-rel reticuloendotheliosis viral oncogene homolog B *\*LOC642335* AK098072 cDNA FLJ40753 fis, clone TRACH2001188. *KIAA1324* NM_020775 KIAA1324 *NOV* NM_002514 nephroblastoma overexpressed gene *RPS27L* NM_015920 ribosomal protein S27-like *PRODH* NM_016335 proline dehydrogenase (oxidase) 1, nuclear gene encoding mitochondrial protein **6 and 24h** *GDF15* NM_004864 growth differentiation factor 15 *NFKBIA* NM_020529 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 10.1371/journal.pone.0134911.t002 ###### Most significantly downregulated genes at more than one time point (non-coding RNAs are indicated with \*) (Bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t002g} Time points Gene symbol Accession number Description ----------------------------------------------------- -------------- ------------------------------------------------------------------------ ---------------------------------------------- **6, 12 and 24h** *LGALS3* NM_002306 lectin, galactoside-binding, soluble, 3 *PDSS2* NM_020381 prenyl (decaprenyl) diphosphate synthase, subunit 2 *MAGI3* NM_152900 membrane associated guanylate kinase, WW and PDZ domain containing 3 *PSD3* NM_015310 pleckstrin and Sec7 domain containing 3 \*lincRNA chr10:114583921--114587485 forward strand **6 and 12h** *SBF2* NM_030962 SET binding factor 2 *XRCC4* NM_022550 X-ray repair complementing defective repair in Chinese hamster cells 4 *VAV2* NM_003371 vav 2 guanine nucleotide exchange factor *ROR1* NM_005012 receptor tyrosine kinase-like orphan receptor 1 *ERC1* NM_178040 ELKS/RAB6-interacting/CAST family member 1 \*lincRNA chr17:67547498--67549996 forward strand **12 and 24h** *HMG20B* NM_006339 high mobility group 20B *TUBA1B* NM_006082 tubulin, alpha 1b *SMYD3* NM_022743 SET and MYND domain containing 3 *SCFD2* NM_152540 sec1 family domain containing 2 *VTI1A* NM_145206 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) *PRR4* NM_007244 proline rich 4 (lacrimal) *PARD3* NM_019619 par-3 partitioning defective 3 homolog (C. elegans) *RABGAP1L* NM_014857 RAB GTPase activating protein 1-like *TTC28* NM_001145418 tetratricopeptide repeat domain 28 *PCCA* NM_000282 propionyl CoA carboxylase, alpha polypeptide *MAN1C1* NM_020379 mannosidase, alpha, class 1C, member 1 *A4GALT* NM_017436 alpha 1,4-galactosyltransferase *MSRA* NM_012331 methionine sulfoxide reductase A *ANO4* NM_178826 anoctamin 4 *SSBP2* NM_012446 single-stranded DNA binding protein 2 *STX8* NM_004853 syntaxin 8 *REXO1* NM_020695 REX1, RNA exonuclease 1 homolog (S. cerevisiae) *SH3KBP1* NM_031892 SH3-domain kinase binding protein 1 *BBS9* NM_198428 Bardet-Biedl syndrome 9 *BCKDHB* NM_000056 branched chain keto acid dehydrogenase E1, beta polypeptide *SORCS1* NM_001206572 sortilin-related VPS10 domain containing receptor 1 *TPK1* NM_022445 thiamin pyrophosphokinase 1 *LINGO2* NM_152570 leucine rich repeat and Ig domain containing 2 *FRY* NM_023037 furry homolog (Drosophila) *PDE3B* NM_000922 phosphodiesterase 3B, cGMP-inhibited *KCNQ2* NM_172109 potassium voltage-gated channel, KQT-like subfamily, member 2 *PPIA* THC2525667 Peptidylprolyl isomerase A \*lincRNA chr2:7214634--7218011 reverse strand \*lincRNA chr4:79892901--80229698 forward strand \*lincRNA chr18:42263052--42278652 forward strand \*lincRNA chr18:74178337--74203637 forward strand \*lincRNA chr7:125564239--125734564 forward strand **6 and 24h** *FAM78B* NM_001017961 family with sequence similarity 78, member B *VAV3* NM_006113 vav 3 guanine nucleotide exchange factor ### Common upregulated genes after UVB irradiation {#sec015} Some of the genes included in this category ([Table 1](#pone.0134911.t001){ref-type="table"}) have already been reported to be associated with the response to ultraviolet irradiation, which gives robustness to our inferences. The most significantly upregulated gene was *FDXR*, which serves as the first electron transfer protein in all the mitochondrial P450 systems, and has been reported to be upregulated in response to UV irradiation damage in dendritic cells \[**[@pone.0134911.ref033]**\] and melanocytes \[**[@pone.0134911.ref006]**\]. Importantly, we also observed several genes involved in the regulation of the cell cycle, in the response to stress, in the repair of DNA damage caused by UV that can lead to xeroderma pigmentosum, as well as genes that are associated with melanoma. We also observed several genes that take part in the regulation of the cell cycle and in the cellular response to stress and that are directly or indirectly involved in the p53 pathway. Some of them modulate P53-mediated apoptosis or cell death in response to stresses like UV irradiation or DNA damage, like *TP53I3*, *PLK3*, *TRIAP1*, *PIDD*, *CDKN1A*, *TP53INP1*, *SESN1*, *BBC3*, *TNFRSF10C*, *DRAM1* and *MDM2*. Other genes that also are upregulated and participate in UV irradiation-induced apoptosis include *RELB* and *EPHA2*. Another group of the upregulated genes are components of the nucleotide excision repair (NER) pathway that are associated with the reparation of DNA damage caused by UV, and which include *XPC* or *DDB2*. Malfunction of these genes can lead to xeroderma pigmentosum, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development. Several other genes among the top upregulated ones have been reported to be directly or indirectly associated with melanoma, such as *BTG2*, *BAG1*, *CXCL1*, *PLXNB2*, *CSRP2*, *PRODH* or *GDF15*. Various genes that encode ribosomal proteins such as *RPL6*, *RPL41*, *RPS2*, *RPL26* and *RPS27L* were also observed. Intriguingly, we observed an upregulation of the gene *NOV*. The protein encoded by this gene is of particular relevance as it has been reported to be essential for the correct development and growth of melanocytes \[[@pone.0134911.ref034]\]. During development, melanocytes migrate to the epidermis and attach to the basement membrane upon contact with keratinocytes. Development of melanocytes must be tightly regulated and must remain at stable levels in relation to keratinocytes. Fukunaga-Kalabis et al. \[[@pone.0134911.ref034]\] discovered that *NOV* is upregulated in melanocytes upon contact with keratinocytes in culture, mediating the growth inhibition of melanocytes in order to regulate their spatial location and number. Our results suggest that this gene could also participate in the regulation of melanocytes\' growth in response to UVB, most likely by inhibiting their proliferation and allowing either the triggering of cell death or reparation events. ### Common downregulated genes after UVB irradiation {#sec016} Among the top downregulated genes in response to UVB irradiation ([Table 2](#pone.0134911.t002){ref-type="table"}), of particular interest was *LGALS3*, which plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation, and regulates the expression of several genes that are aberrantly expressed in highly aggressive melanoma cells \[**[@pone.0134911.ref035]**\]. Another interesting downregulated gene was *PDSS2*, which encodes the prenyl side-chain of coenzyme Q (CoQ), one of the key elements in the respiratory chain. As it has been reported that UV light depletes CoQ10 from the skin \[**[@pone.0134911.ref036]**\], this consequently suggests that the downregulation of *PDSS2* could be one of the first inducers of reactive oxygen species (ROS) production and, consequently, of oxidative damage to the DNA in the cells ultimately caused by UVB. Several neuron-related genes were also downregulated by UVB, like ROR1, ERC1, PARD3, SORCS1, LINGO2 and KCNQ2. As neurons and melanocytes share the same embryonic origin (the neural crest) they might likely share some cell regulatory processes \[[@pone.0134911.ref037]\]. Our results suggest that some genes that are involved in neuronal growth or migration could also be found in melanocytes exerting similar functions. In this regard, it was noticeable that a handful of lincRNAs were also downregulated after UVB irradiation. Although for most lincRNAs biological functions and mechanisms of action remain unknown, our results suggest that some lincRNAs are likely key elements of the regulatory machinery of melanocytes. Differential transcriptional profile of dark and light melanocytes 6 hours after UVB {#sec017} ------------------------------------------------------------------------------------ As inferred from the unsupervised PCA ([Fig 2](#pone.0134911.g002){ref-type="fig"}) the greatest differences among melanocytes were found at 6 hours after UVB irradiation. From that point, melanocytes seem to have started to go back to the basal state. Thus, we focused on determining the differential expression between DM and LM at 6 hours after irradiation (the results for other time points can be found in [S1](#pone.0134911.s001){ref-type="supplementary-material"}--[S4](#pone.0134911.s004){ref-type="supplementary-material"} Tables). ### Upregulated genes in LM vs DM 6 hours after UVB irradiation {#sec018} The significant upregulation of *EDA2R* in LM ([Table 3](#pone.0134911.t003){ref-type="table"}) suggests a putative role for this gene in response to UVB irradiation in light skinned individuals. *EDA2R* has been reported to be affected by recent natural positive selection \[**[@pone.0134911.ref038]**--**[@pone.0134911.ref039]**\], and its paralog, *EDAR*, has been strongly associated with skin pigmentation variability in humans \[**[@pone.0134911.ref040]**\]. Strikingly, the intergenic region between *EDA2R* and the next gene on the same chromosome (*AR)* is the most divergent genomic segment between Africans and East Asians in the human genome \[**[@pone.0134911.ref041]**\]. 10.1371/journal.pone.0134911.t003 ###### Top 50 upregulated genes in LM vs DM at 6 hours after UVB irradiation (non-coding RNAs are indicated with \*) (Bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t003g} Gene symbol Accession number Description ----------------------------------------------------- ------------------ ---------------------------------------------------------------------- *CDKN2A* NM_000077 cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) *SNAR-A3* NR_024214 small ILF3/NF90-associated RNA A3, small nuclear RNA *KIAA1377* NM_020802 uncharacterized protein KIAA1377 *TTC18* NM_145170 tetratricopeptide repeat domain 18 *NCAM1* NM_001242607 neural cell adhesion molecule 1, tr. variant 5 *HOXB13* NM_006361 homeobox B13 *PYCARD* NM_013258 PYD and CARD domain containing *CSRNP3* NM_001172173 cysteine-serine-rich nuclear protein 3 *PKMYT1* NM_182687 protein kinase, membrane associated tyrosine/threonine 1 \*lincRNA:chr1:85932812--85974062 reverse strand *QPCT* NM_012413 glutaminyl-peptide cyclotransferase *EDA2R* NM_001242310 ectodysplasin A2 receptor *SGMS1* NM_147156 sphingomyelin synthase 1 *RPL37A* NM_000998 ribosomal protein L37a *HIST1H4L* NM_003546 histone cluster 1, H4l *GDPD1* NM_182569 glycerophosphodiester phosphodiesterase domain containing 1 *HIST1H3B* NM_003537 histone cluster 1, H3b \*lincRNA:chr10:133738235--133744210 forward strand *GDPD5* NM_030792 Glycerophosphodiester phosphodiesterase domain containing 5 *SUV420H2* NM_032701 suppressor of variegation 4--20 homolog 2 (Drosophila) *MOBKL2B* NM_024761 MOB1, Mps One Binder kinase activator-like 2B (yeast) *MXD3* NM_031300 MAX dimerization protein 3 *TUBA1B* NM_006082 tubulin, alpha 1b *SAC3D1* NM_013299 SAC3 domain containing 1 \**LOC390595* NM_001163692 ubiquitin-associated protein 1-like *SNORD15A* NR_000005 small nucleolar RNA, C/D box 15A, small nucleolar RNA *ZNF711* NM_021998 zinc finger protein 711 \*lincRNA:chrX:102139220--102156619 forward strand *LTBP3* ENST00000525443 latent transforming growth factor beta binding protein 3 *FAM164A* NM_016010 family with sequence similarity 164, member A *ARHGEF10* ENST00000523711 Rho guanine nucleotide exchange factor (GEF) 10 *S100B* NM_006272 S100 calcium binding protein B *HMGN2* NM_005517 high mobility group nucleosomal binding domain 2 *C1orf15-NBL1* NM_001204088 C1ORF15-NBL1 readthrough *GALNT14* NM_024572 polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) *SPTLC3* NM_018327 serine palmitoyltransferase, long chain base subunit 3 *IFI27L2* NM_032036 interferon, alpha-inducible protein 27-like 2 *RNF6* NM_005977 ring finger protein (C3H2C3 type) 6 *TUBB8* NM_177987 tubulin, beta 8 *PDGFRL* NM_006207 platelet-derived growth factor receptor-like *ARPC5* ENST00000367534 actin related protein 2/3 complex, subunit 5, 16kDa *PTGDS* NM_000954 prostaglandin D2 synthase 21kDa (brain) *SLC2A13* NM_052885 solute carrier family 2 (facilitated glucose transporter), member 13 *CTSF* NM_003793 Cathepsin F \**C1orf133* NR_024337 SERTAD4 antisense RNA 1 *WFDC1* NM_021197 WAP four-disulfide core domain 1 *TUBG1* NM_001070 tubulin, gamma 1 *SLC12A8* NM_024628 solute carrier family 12, member 8 *CXADR* NM_001338 coxsackie virus and adenovirus receptor *SOX5* NM_152989 SRY (sex determining region Y)-box 5 We also identified as upregulated some genes related to melanoma, like *CDKN2A*, whose expression has already been reported to be induced by UV radiation \[[@pone.0134911.ref042]\] and which could be conferring light skinned individuals a higher susceptibility to develop melanoma in response to UV radiation, as well as several neuron-related genes and genes associated with the formation of tubulin, the major constituent of microtubules of the cytoskeleton, and which have been shown to mediate the transport the melanosomes inside the cell \[[@pone.0134911.ref043]\]. ### Upregulated genes in DM vs LM 6 hours after UVB irradiation {#sec019} Next, we focused on the most significant upregulated genes in DM vs LM ([Table 4](#pone.0134911.t004){ref-type="table"}). In this case, we found several genes involved in inflammatory reactions. Some of them have been reported to be particularly involved in sunburn or inflammatory skin reactions in response to UVB, like IL6 \[**[@pone.0134911.ref044]**\], PTGS2 \[**[@pone.0134911.ref045]**\] or CCL2 \[**[@pone.0134911.ref046]**\]. Similarly to LM, DM also showed an upregulation of various genes involved in melanoma progression as well as several genes related to the development of the central nervous system and neuronal processes. 10.1371/journal.pone.0134911.t004 ###### Top 50 upregulated genes in DM vs LM at 6 hours after UVB irradiation (non-coding RNAs are indicated with \*) (Bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t004g} Gene symbol Accession numer Description ---------------------------------------------------- ----------------- -------------------------------------------------------------------------------- *HUMRPL26X* THC2550570 ribosomal protein L26 partial (91%) *MMP1* NM_002421 matrix metallopeptidase 1 (interstitial collagenase) *RPL7A* NM_000972 ribosomal protein L7a *CCL2* NM_002982 chemokine (C-C motif) ligand 2 *NPTX2* NM_002523 neuronal pentraxin II *COL6A2* NM_058174 collagen, type VI, alpha 2 *S100A4* NM_002961 S100 calcium binding protein A4 *CXCL1* NM_001511 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) *IL6* NM_000600 interleukin 6 (interferon, beta 2) *TMEM158* NM_015444 transmembrane protein 158 (gene/pseudogene) *PAMR1* NM_015430 peptidase domain containing associated with muscle regeneration 1 *TMEM8B* NM_001042590 collagen, type VI, alpha 2 *CXCL5* NM_002994 chemokine (C-X-C motif) ligand 5 *TDRD9* NM_153046 tudor domain containing 9 *ANGPTL4* NM_139314 angiopoietin-like 4 *PMEPA1* NM_020182 prostate transmembrane protein, androgen induced 1 *\*MEG3* NR_003531 maternally expressed 3 (non-protein coding) non-coding RNA *\*C1D* ENST00000412019 C1D nuclear receptor corepressor pseudogene *C1QBP* NM_001212 complement component 1, q subcomponent binding protein *\*FAM27A* NR_024060 family with sequence similarity 27, member A, non-coding RNA *TMEM132A* NM_017870 transmembrane protein 132A *SLC16A2* NM_006517 solute carrier family 16, member 2 (monocarboxylic acid transporter 8) *ANPEP* NM_001150 alanyl (membrane) aminopeptidase \*lincRNA:chr2:239460050--239536125 forward strand *FN1* NM_054034 fibronectin 1 *MYOF* NM_133337 myoferlin *NR4A3* NM_173200 nuclear receptor subfamily 4, group A, member 3 *EFS* NM_005864 embryonal Fyn-associated substrate *GRTP1* NM_024719 growth hormone regulated TBC protein 1 *TNFRSF11B* NM_002546 tumor necrosis factor receptor superfamily, member 11b *DEF6* NM_022047 differentially expressed in FDCP 6 homolog (mouse) \**FAM27A* NR_024060 family with sequence similarity 27, member A, non-coding RNA *PTGS2* NM_000963 prostaglandin-endoperoxide synthase 2 *GUCA1B* NM_002098 guanylate cyclase activator 1B (retina) *IL1RAP* NM_134470 interleukin 1 receptor accessory protein *SUSD3* NM_145006 sushi domain containing 3 \*lincRNA:chr17:73585552--73590170 forward strand *TNNI3* NM_000363 troponin I type 3 (cardiac) *C10orf116* NM_006829 chromosome 10 open reading frame 116 *SPON2* NM_012445 spondin 2, extracellular matrix protein *LYPD1* NM_144586 LY6/PLAUR domain containing 1 *IL27RA* NM_004843 interleukin 27 receptor, alpha *FUT1* NM_000148 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) *CARD9* NM_052813 caspase recruitment domain family, member 9 1 *SLC22A17* NM_016609 solute carrier family 22, member 17 *IL11* NM_000641 interleukin 11 *TNFAIP2* NM_006291 tumor necrosis factor, alpha-induced protein 2 *C15orf48* NM_032413 chromosome 15 open reading frame 48 *NT5E* NM_002526 5\'-nucleotidase, ecto (CD73) *CXCL3* NM_002090 chemokine (C-X-C motif) ligand 3 An interesting observation was the upregulation of the *lincRNA MEG3*. The expression of this *lincRNA*, stimulated by cyclic-AMP (cAMP), seems to act as a growth suppressor in tumour cells through the activation of *P53* \[[@pone.0134911.ref047]\]. As UVR is one of the main stimulatory sources of cAMP, these results suggest that in response to UV radiation, DM upregulate the expression of *MEG3* via cAMP liberation, which could confer protection against melanoma. ### Pathway enrichment analysis {#sec020} Focusing on single loci allows deciphering the differentially expressed genes between different categories (i.e. time or pigmentation). However, although this is useful to determine which genes can be key in the response to UVB, the full biological mechanisms underlying this response may remain obscure. Therefore, we used WebGestalt to look for pathways in KEGG (Kyoto Encyclopedia of Genes and Genomes) that were differentially overrepresented at each time point ([Table 5](#pone.0134911.t005){ref-type="table"}) in LM and DM. We observed that the most significant pathways overrepresented among the upregulated genes corresponded to *ribosome* and *P53 signaling pathway* in both LM and DM. Further analyses using other databases of pathways implemented in WebGestalt (Pathway Commons and Wikipathways) confirmed the involvement of these two pathways in the response to UVB (data not shown). 10.1371/journal.pone.0134911.t005 ###### KEGG pathway enrichment analysis of the upregulated and downregulated genes in DM and LM after UVB irradiation. {#pone.0134911.t005g}   DM   LM   --------------------------------------------- ----------------------- ----------------------------------------- --------------------------------------------- ---------- **Upregulated at 6h** p53 signaling pathway 9.49E-07 p53 signaling pathway 7.04E-07 Ribosome 3.00E-04 Ribosome 2.43E-06 **Upregulated at 12h** Ribosome 3.22E-11 Systemic lupus erythematosus 1.16E-06 RNA transport 7.11E-07 Ribosome 1.47E-06 Ribosome biogenesis in eukaryotes 7.00E-04 p53 signaling pathway 1.10E-03 p53 signaling pathway 2.13E-02 Mismatch repair 5.40E-03     Pathways in cancer 6.90E-03     Apoptosis 7.90E-03 **Upregulated at 24h** Ribosome 1.06E-09 Ribosome 7.38E-06 p53 signaling pathway 1.50E-03     **Downregulated at 6h** Adherens junction 1.51E-08 Ubiquitin mediated proteolysis 6.84E-12 Ubiquitin mediated proteolysis 7.21E-08 Adherens junction 5.23E-11 Wnt signaling pathway 9.12E-06 Endocytosis 6.14E-06 Colorectal cancer 3.53E-05 Wnt signaling pathway 3.14E-05 Progesterone-mediated oocyte maturation 4.04E-05 Progesterone-mediated oocyte maturation 5.32E-05 Endocytosis 6.24E-05 Cell cycle 7.36E-05 Pathways in cancer 7.60E-05 Insulin signaling pathway 5.00E-04 Systemic lupus erythematosus 1.00E-04 Oocyte meiosis 7.00E-04 Cell cycle 9.00E-04 Pathways in cancer 7.00E-04 Oocyte meiosis 1.00E-03 Colorectal cancer 1.20E-03 Endometrial cancer 1.10E-03 Neurotrophin signaling pathway 2.60E-03 Fc epsilon RI signaling pathway 1.70E-03 Fc gamma R-mediated phagocytosis 8.60E-03 B cell receptor signaling pathway 1.80E-03 Endometrial cancer 1.18E-02 ErbB signaling pathway 1.90E-03 Chronic myeloid leukemia 1.54E-02 Fc gamma R-mediated phagocytosis 2.20E-03 Bacterial invasion of epithelial cells 1.76E-02 T cell receptor signaling pathway 2.50E-03 Fc epsilon RI signaling pathway 2.11E-02 Insulin signaling pathway 5.30E-03 Chemokine signaling pathway 4.22E-02 Neurotrophin signaling pathway 1.97E-02 ErbB signaling pathway 4.22E-02     T cell receptor signaling pathway 4.22E-02 **Downregulated at 12h** Metabolic pathways 4.43E-05 Protein processing in endoplasmic reticulum 2.00E-03 Adherens junction 1.00E-04     Fc gamma R-mediated phagocytosis 3.00E-04     Propanoate metabolism 1.10E-03     Protein processing in endoplasmic reticulum 2.70E-03     Systemic lupus erythematosus 3.10E-03     Purine metabolism 4.90E-03     Regulation of actin cytoskeleton 1.20E-02     Valine, leucine and isoleucine degradation 4.30E-02     Pyrimidine metabolism 4.30E-02     **Downregulated at 24h**     Cell cycle 2.20E-08     Systemic lupus erythematosus 8.56E-06  -   DNA replication 2.54E-05     Oocyte meiosis 2.00E-03     Lysine degradation 2.12E-02 The role of *P53*, a tumour suppressor that promotes either cell cycle arrest and DNA repair, apoptosis or senescence \[[@pone.0134911.ref048]\] in the response to UVB has already been reported \[[@pone.0134911.ref006]\]. Our results are consistent with the proposed mechanism of P53 pathway regulation by ribosomal proteins \[[@pone.0134911.ref049]--[@pone.0134911.ref051]\]. Thus, we propose that under stress, there is an upregulation of the ribosomal biogenesis leading to an excess of ribosomal proteins that do not participate in the assembly of ribosomes. Instead, these translocate to the nucleoplasm where they interact with MDM2. Under normal conditions, MDM2 binds to the tumour suppressor P53 inhibiting its transcription. But if ribosomal proteins bind to MDM2, then the inhibition of P53 exerted by MDM2 is suppressed. The upregulation of *MDM2* is usually modulated by P53 after the activation of P53-dependent targets, in order to inhibit the activity of P53 and thus restore the normal growth of the cell. However, if the stressing conditions are not completely restablished or DNA damage still exists in the cell, ribosomal proteins could continue interacting with MDM2 to allow to maintain the expression of *P53* ([Fig 3](#pone.0134911.g003){ref-type="fig"}). Among the ribosomal proteins that can bind to MDM2 are RPL5 \[[@pone.0134911.ref052]\] and RPL11 \[[@pone.0134911.ref053]\], both of which were among the upregulated ribosomal genes in this work. {#pone.0134911.g003} On the other hand, several pathways were significantly overrepresented among the genes that were downregulated after UVB exposure, especially in the first 6h in both DM and LM ([Table 5](#pone.0134911.t005){ref-type="table"}). Interestingly, the *adherens junction* pathway was downregulated in both cell types and at different time points. Adherens junctions play an important role maintaining skin homeostasis by mediating the interaction of melanocytes and keratinocytes, which control the proliferation of melanocytes \[[@pone.0134911.ref054]\], thus preventing the development and progression of melanoma \[[@pone.0134911.ref055]\]. The effect of keratinocyte conditioned medium {#sec021} --------------------------------------------- Next, we assessed the expression profiles of melanocytes supplemented with keratinocyte-conditioned medium obtained both from non-irradiated (KCM-) and irradiated keratinocytes (KCM+). Again, differentially expressed genes were obtained with SAM and we performed a pathway enrichment analysis ([Table 6](#pone.0134911.t006){ref-type="table"}). We did not observe any significantly downregulated pathways in melanocytes growing with KCM+ vs KCM-. As regards the upregulated pathways, various pathways were affected in LM, most of them related to *signaling pathways*. We did not detect any upregulated pathway in DM, which suggests that DMs could have lower requirements for keratinocyte-derived factors to start the response mechanisms against UV irradiation. On the contrary, LM show a significant upregulation of several pathways when cultivated with KCM+ compared to KCM-, which could suggest that for these cells, the type or the concentration of factors present in KCM- is not enough and they require more factors to engage in certain metabolic activities. 10.1371/journal.pone.0134911.t006 ###### KEGG pathway enrichment analysis for genes upregulated in the culture with KCM+ vs KCM- (significant pathways for the downregulated ones were not observed). {#pone.0134911.t006g}   LM   DM   ------------------------------------------- -------------------------------- ---------- ---------------- ---------- **6h** Ubiquitin mediated proteolysis 1.00E-03 \-   mTOR signaling pathway 4.34E-02     **12h** Neurotrophin signaling pathway 8.03E-05 \-   Phosphatidylinositol signaling system 5.50E-03   Endocytosis 2.28E-02     **24h** RNA transport 1.50E-03 Focal adhesion 4.85E-05 Insulin signaling pathway 4.70E-03   Ubiquitin mediated proteolysis 4.90E-03   Homologous recombination 7.60E-03   mRNA surveillance pathway 8.30E-03   SNARE interactions in vesicular transport 9.50E-03   Spliceosome 1.24E-02   Cell cycle 1.66E-02   Pyrimidine metabolism 1.89E-02   Ribosome biogenesis in eukaryotes 2.23E-02   Wnt signaling pathway 4.46E-02     Among the results obtained, of particular interest was the *mTOR signaling pathway*, which was upregulated in LM at 6h after UVB irradiation growing in KCM+. mTOR can be activated by UVR through the triggering of growth factor receptors bearing receptor tyrosine kinase (RTK) activity \[[@pone.0134911.ref056]--[@pone.0134911.ref058]\] like keratinocyte-derived EGF, FGF or HGF. mTOR signaling reciprocally interacts with p53 as a life/death regulator of irradiated skin cells. It has been shown that upon activation by UVR, mTOR can inhibit apoptosis and force cell cycle transition, or drive cells into senescence. This work reveals that the keratinocyte-derived factors activate the mTOR signaling pathway in LM to induce cell proliferation, consistent with the upregulation of cell cycle observed later at 24 hours. We propose that in this case mTOR forces cell cycle transition. This, however, could increase the susceptibility to develop melanoma, especially if DNA damage caused by UVB has not been repaired yet. In fact, mTOR pathway has been shown to be activated in the majority of malignant melanomas \[[@pone.0134911.ref059]\]. The fact that this pathway was activated in LM in culture with KCM+ suggests that some keratinocyte-derived factors, secreted after the irradiation of keratinocytes with UVB, could also be at the base of melanocytes' malignancy. Other signaling pathways that were upregulated in the presence of KCM+ are also activated by keratinocyte derived factors, such as the neurotrophin signaling pathway, which is activated by NGF and promotes the survival of melanocytes. Identification of differentially expressed genes in LM and DM under basal conditions {#sec022} ------------------------------------------------------------------------------------ In order to identify putative candidate genes involved in normal pigmentation variability, we compared the transcriptional profiles of DM and LM under basal conditions (i.e. at time 0, without irradiation). No significantly overrepresented pathways were observed here. Therefore, we focused on the 50 most significant genes in each category (Tables [7](#pone.0134911.t007){ref-type="table"} and [8](#pone.0134911.t008){ref-type="table"}). The most significant genes upregulated in LM ([Table 7](#pone.0134911.t007){ref-type="table"}) were *ATP6V0B* and *ATP6VOD1*. These encode two components of the V-ATPase, which is responsible for maintaining an adequate acidic environment within melanosomes for the synthesis of melanin \[[@pone.0134911.ref060]\]. The most significantly upregulated gene in DM compared to LM ([Table 8](#pone.0134911.t008){ref-type="table"}) was *MIF*. *MIF* has been identified as a regulator of melanogenesis, as it shows D-dopachrome tautomerase activity, which transforms D-dopachrome, dopaminechrome or its derivatives into precursors of melanin or neuromelanin \[[@pone.0134911.ref061]\]. It has also been suggested that *MIF* mediates melanogenesis in the skin through the activation of protease-activated receptor (PAR-2) and stem cell factor (SCF) expression in keratinocytes after exposure to UVB \[[@pone.0134911.ref062]\]. Interestingly, Polimanty et al \[[@pone.0134911.ref063]\] reported a correlation between the CNV 22q11.23 containing the gene *MIF* with environmental variables. In particular, they suggested that *MIF*-related gene dosage could be associated with the adaptation to UVR, and that darker skins were correlated with haplotypes carrying no deletions. Copy number variability, and the higher frequency of deletions at this locus in light skinned individuals could be leading to a decreased *MIF* gene dosage, as observed in this work. 10.1371/journal.pone.0134911.t007 ###### Top 50 upregulated genes in LM vs DM under basal conditions (non- coding RNAs are indicated with \*) (bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t007g} Locus name Accession number Description ------------------ ------------------ --------------------------------------------------------------- *ATP6V0B* NM_004047 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b *ATP6V0D1* NM_004691 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 *FUT6* NM_000150 fucosyltransferase 6 (alpha (1,3) fucosyltransferase) *SLC16A12* NM_213606 solute carrier family 16, member 12 *HSCB* NM_172002 HscB iron-sulfur cluster co-chaperone homolog (E. coli) *ZNF865* NM_001195605 zinc finger protein 865 *EFS* NM_005864 embryonal Fyn-associated substrate *KRT31* NM_002277 keratin 31 *RPL36A-HNRNPH2* NM_001199973 RPL36A-HNRNPH2 readthrough *JMJD5* NM_001145348 jumonji domain containing 5 *HIST1H4C* NM_003542 histone cluster 1, H4c *GFRA3* NM_001496 GDNF family receptor alpha 3 *KIAA1826* NM_032424 KIAA1826 *DNAJC19* NM_145261 DnaJ (Hsp40) homolog, subfamily C, member 19 *HAP1* NM_177977 huntingtin-associated protein 1 *UXS1* NM_025076 UDP-glucuronate decarboxylase 1 *SCAMP1* NM_004866 secretory carrier membrane protein 1 *LTA4H* NM_000895 leukotriene A4 hydrolase *DYNC1LI1* NM_016141 dynein, cytoplasmic 1, light intermediate chain 1 *LRRFIP2* NM_006309 leucine rich repeat (in FLII) interacting protein 2 *C10orf88* NM_024942 chromosome 10 open reading frame 88 *PDCD1* NM_005018 programmed cell death 1 *MZT2A* ENST00000491265 mitotic spindle organizing protein 2A *MCM3* NM_002388 minichromosome maintenance complex component 3 *C6orf163* NM_001010868 chromosome 6 open reading frame 163 *DTX4* NM_015177 deltex homolog 4 (Drosophila) *CLCN6* NM_021735 chloride channel 6 (CLCN6) *RFK* NM_018339 riboflavin kinase *WHSC2* NM_005663 Wolf-Hirschhorn syndrome candidate 2 *FGFRL1* NM_001004356 fibroblast growth factor receptor-like 1 *BTBD6* NM_033271 BTB (POZ) domain containing 6 *N4BP1* NM_153029 NEDD4 binding protein 1 *MAP2K6* NM_002758 mitogen-activated protein kinase kinase 6 *POMP* NM_015932 proteasome maturation protein *GABPA* NM_002040 GA binding protein transcription factor, alpha subunit 60kDa *UPF3A* NM_023011 UPF3 regulator of nonsense transcripts homolog A (yeast) *PLEKHA3* NM_019091 pleckstrin homology domain containing, family A member 3 *CD276* NM_001024736 CD276 molecule (CD276) *ENTPD2* NM_203468 ectonucleoside triphosphate diphosphohydrolase 2 *DEDD* NM_032998 death effector domain containing *FAM70B* ENST00000375348 family with sequence similarity 70, member B *MCM5* NM_006739 minichromosome maintenance complex component 5 *LOC100131257\** NR_034022 zinc finger protein 655 pseudogene *SCARNA13* NR_003002 small Cajal body-specific RNA 13 *SMNDC1* NM_005871 survival motor neuron domain containing 1 *CALML4* NM_033429 calmodulin-like 4 *C1orf131* NM_152379 chromosome 1 open reading frame 131 *RNGTT* NM_003800 RNA guanylyltransferase and 5\'-phosphatase *KCNQ3* NM_004519 potassium voltage-gated channel, KQT-like subfamily, member 3 *WASF3* NM_006646 WAS protein family, member 3 10.1371/journal.pone.0134911.t008 ###### Top 50 upregulated genes in DM vs LM under basal conditions (non- coding RNAs are indicated with \*) (bonferroni-adjusted p-value \<0.0001). {#pone.0134911.t008g} Locus name Accession number Description ------------------ ------------------ ---------------------------------------------------------------- *MIF* NM_002415 macrophage migration inhibitory factor *TTC19*\* ENST00000395886 tetratricopeptide repeat domain 19 *CYTB* ENST00000361789 mitochondrially encoded cytochrome b *NBEA* NM_015678 neurobeachin *CTSO* NM_001334 cathepsin O *SNORA23* NR_002962 small nucleolar RNA, H/ACA box 23 *PMP22* NM_000304 peripheral myelin protein 22 *CXCL1* NM_001511 chemokine ligand (melanoma growth stimulating activity, alpha) *CDKN2A* NM_058197 cyclin-dependent kinase inhibitor 2A (melanoma, p16) *LDB3* NM_001171610 LIM domain binding 3 *MIPEP* NM_005932 mitochondrial intermediate peptidase *MAPK8* NM_139047 mitogen-activated protein kinase 8 *SNORD15A* NR_000005 small nucleolar RNA, C/D box 15A *SNAR-A3\** NR_024214 small ILF3/NF90-associated RNA A3 *ASCC1* NM_015947 activating signal cointegrator 1 complex subunit 1 *ZNF235* NM_004234 zinc finger protein 235 *MBIP* NM_001144891 MAP3K12 binding inhibitory protein 1 *C13orf38* NM_001198908 chromosome 13 open reading frame 38 *LOC100132707*\* NR_024477 hypothetical LOC100132707 *UTRN* NM_007124 utrophin *CALM2* NM_001743 calmodulin 2 (phosphorylase kinase, delta) *MOCS1\** NM_005943 molybdenum cofactor synthesis 1 *ZNF212* NM_012256 zinc finger protein 212 *KIAA0090* NM_015047 KIAA0090 (KIAA0090) *SNORD3B-1* NR_003271 small nucleolar RNA, C/D box 3B-1 *HLX* NM_021958 H2.0-like homeobox *C9orf72* NM_145005 chromosome 9 open reading frame 72 *SEC23B* NM_032985 Sec23 homolog B (S. cerevisiae) *WRAP73* NM_017818 WD repeat containing, antisense to TP73 *MAN1A1* NM_005907 mannosidase, alpha, class 1A, member 1 *S100B* NM_006272 S100 calcium binding protein B *CCDC93* NM_019044 coiled-coil domain containing 93 *ZNF3* NM_032924 zinc finger protein 3 *FTH1* NM_002032 ferritin, heavy polypeptide 1 *RAB30* NM_014488 RAB30, member RAS oncogene family *RDM1* NM_001034836 RAD52 motif 1 *BTAF1* NM_003972 BTAF1 RNA polymerase II, *HLA-F* NM_018950 major histocompatibility complex, class I, F *CABYR* NM_012189 calcium binding tyrosine-(Y)-phosphorylation regulated *MAP4K2* NM_004579 mitogen-activated protein kinase 2 *PRPF18* ENST00000320054 PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae) *CALM3* NM_005184 calmodulin 3 (phosphorylase kinase, delta) *ALKBH4* NM_017621 alkB, alkylation repair homolog 4 (E. coli) *LOC399744*\* NR_024497 hypothetical LOC399744 *SETD6* NM_024860 SET domain containing 6 *SH3TC2* NM_024577 SH3 domain and tetratricopeptide repeats 2 *ARHGAP35* NM_004491 Rho GTPase activating protein 35 *CHCHD6* NM_032343 coiled-coil-helix-coiled-coil-helix domain containing 6 *RC3H2* NM_018835 ring finger and CCCH-type domains 2 *WDR46* NM_005452 WD repeat domain 46 For the other genes in Tables [7](#pone.0134911.t007){ref-type="table"} and [8](#pone.0134911.t008){ref-type="table"} we did not find any evident direct correlation with pigmentary phenotype. Validation by RT-qPCR {#sec023} --------------------- Six genes were selected for validation of the microarrays\' results, which showed either a change of expression after UV treatment or a differential expression between LM and DM (*ATP6VOB*, *TP53I3*, *MDM2*, *MIF*, *RPL6* and *FDXR*), and measured their expression levels by quantitative real-time PCR (RT-qPCR). We assessed the expression of 4 melanocytic cell lines (2 DM and 2 LM) at basal conditions and at 6 and 12 hours after UVB irradiation. The expression patterns and direction of changes of all of the genes were consistent with the microarray data ([Fig 4](#pone.0134911.g004){ref-type="fig"}), observing a significant increase in the expression of *TP53I3*, *MDM2*, *RPL6* and *FDXR* in both LM and DM after UVB. The expression analysis of *ATP6VOB* and *MIF* also supported the differential expression of these genes by LM and DM, being *ATP6VOB* more expressed by LM, while *MIF* was more significantly expressed by DM (both at basal conditions and after UVB irradiation). {#pone.0134911.g004} Natural selection tests {#sec024} ----------------------- In order to assess the biological relevance of the genes that were differentially expressed between DM and LM under basal conditions, we performed evolutionary neutrality tests on these genes (Tables [7](#pone.0134911.t007){ref-type="table"} and [8](#pone.0134911.t008){ref-type="table"}) using the populations from the 1000 Genomes Project (1KGP). For this, we performed a first screening of different neutrality tests using the 1000 Genomes Selection Browser to identify putative signatures of selection. After multiple test correction, the gene *ATP6V0D1* (ATPase, H+ Transporting, Lysosomal 38kDa, V0 Subunit D1) seemed to deviate from neutrality in the European populations. Further neutrality tests using DnaSP \[[@pone.0134911.ref028]\] supported significant signatures of selection acting on *ATP6V0D1* in Europeans (Tajima\'s D: -2.31, p-value = 0; Fay & Wu\'s H: -10.66, p-value = 0.001), thus suggesting that this gene might be involved in human pigmentary phenotype. This reinforces the notion that selective pressures can shape pigmentation variability by driving the evolution of melanosomal genes. So, besides the well-known *OCA2*, *SLC45A2* and *SLC24A5*, we support *ATP6V0D1* as an additional melanosomal-membrane gene that has been subjected to selective pressures and might be involved in pigmentation variability in Europeans. No deviations from neutrality were detected in any population for the *MIF* gene (data not shown). However, we should take into account that *MIF* is embedded in a CNV \[[@pone.0134911.ref063]\] and in a previous work we observed how a variation in copy number can interfere with neutrality tests by altering the frequencies of polymorphisms leading to an excess of detected homozygosity \[[@pone.0134911.ref064]\]. A loss of copies would result in apparent homozygosity, and duplications of one allele would mask possible variant alleles in sequencing or genotyping experiments. Therefore, although with the available tools and our knowledge we cannot detect deviations from neutrality, we cannot still exclude the possibility that this gene is under selection. Conclusions {#sec025} =========== We have provided an overview of the most significant genes that are up and downregulated in response to UVB irradiation and revealed the interaction of ribosomal proteins and P53 signaling pathway in the response to UVB in both DM and LM. We have also observed that DM and LM show differentially expressed genes after irradiation and in particular in the first 6 hours. These are mainly associated with inflammatory skin reactions, cell survival or melanoma. Furthermore, the culture with KCM+ compared with KCM- had a noticeable effect on LM, but not in DM, triggering various signaling pathways in LM such as the mTOR signaling pathway. And importantly, the comparison of the transcriptional profile of LM and DM under basal conditions allowed us to highlight the significant involvement of *MIF* and *ATP6V0B* in the normal variability of human skin pigmentation. Supporting Information {#sec026} ====================== ###### Top 50 upregulated genes in LM vs DM 12 hours after UVB. (PDF) ###### Click here for additional data file. ###### Top 50 upregulated genes in DM vs LM 12 hours after UVB. (PDF) ###### Click here for additional data file. ###### Top 50 upregulated genes in LM vs DM 24 hours after UVB. (PDF) ###### Click here for additional data file. ###### Top 50 upregulated genes in DM vs LM 24 hours after UVB. (PDF) ###### Click here for additional data file. The authors thank for technical and human support provided by the Genomics and Proteomics Service of the UPV/EHU (SGIker). [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: SL ISZ SA. Performed the experiments: SL ISZ AGG SA. Analyzed the data: SL ISZ SA. Contributed reagents/materials/analysis tools: MDB OG JG CMC NI CR AGG. Wrote the paper: SL ISZ SA. [^3]: Current address: University College London Genetics Institute (UGI). University College London, London, United Kingdom

Q: Adding a static gridline to a JFreeChart time series chart I am trying to implement a timeseries chart with a peculiar requirement in JFreeChart. I can draw the chart, but I don't know how to implement the vertical red line at the last value in the chart. It should always be in the same spot and should always intersect with the last value. I am absolutely out of ideas on how this would be done. I was thinking that it might be possible to implement it as a static gridline, but I don't know how to specify one. Also, the size of the charts will be static, so some roundabout way of doing this is acceptable, hopefully without introducing any 3rd party libraries. An image of what I am trying to achieve can be found here. Thanks. A: Well, I solved it using a marker. Here's the code that does it: JFreeChart chart = ChartFactory.createTimeSeriesChart(...); XYPlot plot = chart.getXYPlot(); Long timestampToMark = new Date().getTime(); Marker m = new ValueMarker(timestampToMark); m.setStroke(new BasicStroke(2)); m.setPaint(Color.RED); plot.addDomainMarker(m); Maybe someone else will find this useful.

Application of NMR spectroscopy in the development of a biomimetic approach for hydrophobic drug association with physical hydrogels. The clinical application of sparingly soluble drugs is hampered by the wide range of problems associated to their delivery. Herein we present a new physical hydrogel as a delivery system for these drugs. The strategy behind the design of this delivery system involved the incorporation of the protein albumin into the hydrogel with the aim of exploiting its intrinsic capacity to bind small hydrophobic molecules. Prednisolone and ketoconazole were used as model drug molecules. A combination of the saturation transfer difference (STD) spectra and a novel double titration assay followed by NMR was applied to study all of the possible binding modes between albumin and each drug. Finally, the ability of the hydrogel system to release the two model drugs was corroborated. The results of the release studies were in agreement with the drug binding capacities derived from the NMR studies, thus confirming that the potential of the NMR approach as a predictive technique could be useful in evaluating the designs of new drug delivery systems.

The effect of different lubricants on cochlear implant electrode insertion forces. Application of different lubricants during the cochlear implant electrode insertion can affect the insertion forces. Parameters related to cochlear trauma, such as insertion forces, gained more and more importance, especially in regard to preservation of residual hearing. The impact of lubricants on the insertion forces has not been systematically examined yet. Nucleus 24 Contour Advance electrodes were inserted into an artificial model of the human scala tympani filled with glycerin, sodium hyaluronate (Healon), and water or soap solution of 10% Bathox and 90% distilled water. A specially designed insertion protocol was applied so as any remains of the lubricants in the scala tympani model or on the electrodes' surface could be completely removed. Force measurements were performed by a force measurement system equipped with a 10 N load cell. Average (AF) and maximum (MF) insertion forces were recorded for every lubricant. The highest values were documented with water (AF = 0.139 N, MF = 0.367 N) and the lowest with the soap solution (AF = 0.065 N, MF = 0.148 N). Application of Healon and glycerin resulted in low, comparable values between each other. The application of lubricants affects significantly the electrode insertion forces. As soap solution is not usable, for the time being, in human cochlear implantation, low insertion forces combined with the antiadhesive features of Healon make it a proper lubricant for intracochlear application. Because of the low recorded forces, soap solution represents an ideal experimental model for in vitro electrode-mechanics studies.

1. Field of the Invention The present invention relates to a method of treating ovarian, tubal and peritoneal cancer, especially for applying a pharmaceutical composition comprising a copper chelator, a platinum-based chemotherapeutic agent and an anthracycline to a subject in need thereof. The copper chelator lowers intracellular copper ion levels and promoting activation of transcription factor Sp1 and human copper transporter 1 (hCTR1), resulting in an increased uptake of the platinum-based chemotherapeutic agent as well as the anthracycline, and reduced proliferation of cancer cells. 2. Description of Related Art Growing evidence implicates tubal cancer, ovarian cancer, and so-called primary peritoneal carcinomas as having a common origin, pathogenesis, and behavior (Annu Rev Pathol. 2014; 9:27-45). Hence, ovarian cancer cell lines are usually used for in-vitro and animal studies for these three cancers. Regarding the treatment, the NCCN Guidelines discuss fallopian tube cancer and primary peritoneal cancer that are managed in a similar manner to epithelial ovarian cancer. In the clinic, these cancers are treated with the same chemotherapeutic agents even when they recur after primary therapy. Additionally, clinical trials for ovarian cancer are commonly designed to enroll patients with these three cancers. Usually, tubal cancer, ovarian cancer, and primary peritoneal carcinomas are found at a late stage. According to NCCN Clinical Practice Guidelines in Oncology, these patients are generally administered with platinum-based chemotherapeutic compounds after a debulking operation. However, cancer cells treated with platinum-based chemotherapeutic drugs frequently develop chemoresistance and result in treatment failure. Hence, an increased dosage of drugs or different strategies for improving the treatment against chemoresistant cancer cells is necessary. Currently a variety of treatment strategies are developed, e.g. liposomal doxorubicin, hycamtin and the like. However, the use of these second-line drugs may not enhance the treatment efficacy. As a result, the mortality rate remains high due to cancer recurrence. Additionally, US Patent Pub. No. 2006/0013819, have disclosed a method for treating platinum-resistant, ovarian cancer, primary peritoneal carcinoma or fallopian tube carcinoma with the combination of a HER2 antibody that effectively inhibits HER dimerization as well as gemcitabine. However, the therapeutic effect of abovementioned method is still limited. The present inventors found that copper chelator can lower intracellular copper ion levels and increase Sp1 and hCTR1 activation, allowing chemotherapeutic agents to be transported into ovarian cancer cells in basic research. Furthermore, they also observed significantly treatment effect in animal experiments. Nowadays there are numerous chemotherapeutic agents on the market. Therefore, how to develop a pharmaceutical composition comprising copper chelating agents in combination with chemotherapeutic agents for overcoming chemoresistance of these three cancers is still an important goal in cancer therapy.

Handprint Campfire - Kid Craft Handprint Campfire - Kid Craft This Handprint Campfire Craft is great for capturing the size of your child and keeping as a momento for when they'll older. Want excellent helpful hints regarding arts and crafts? Head to my amazing site! Add Sparkle to the Garden With This Beautiful Beaded Wind Chime How to make a sparkling bead wind chime with bells! I’ll admit I’m a bit of a craft supply hoarder and have accumulated a massive amount of beautiful beads over the years but have barely used them. This project is the perfect excuse to get out my bead supply and make something I’ll enjoy seeing out my window every day.

“America’s Next Top Model” Winners: Where Are They Now? Camila Villafane America’s Next Top Model winners: See what they’re doing now America’s Next Top Model is like a gift that keeps on giving. Fans have tuned in cycle after cycle, ever since airing its first episode in 2003. We binge watch every episode to get our fix of beauty, editorial fashion, makeovers, and of course, all the drama. For the past 24 cycles, Tyra Banks inspired and molded a group of aspiring young models who wanted nothing more than to become America’s next top model. But after several seasons, hundreds of contestants, and a few network changes, have you ever wondered what became of the America’s Next Top Model winners? Well, put on your runway shoes because you’re going to take a quick trip back in time. Take a look at what these boys and girls have been doing after the show. Adrianne Curry, (Cycle 1) Then IMAGE BY: The CW Adrianne Curry was the first winner of the entire show. After the show ended, she signed with Wilhelmina Models, but shortly after that, ANTM cut ties with her agency. During cycle 2, Curry was asked to brag about Top Model, which pissed off Wilhelmina and they took it out on Curry. But she went on to star in several reality shows after her win.

Intervertebral body spacers have been in use for many years. Typically, these spacers are constructed from polymers, such as polyetherether ketone (PEEK) polymer, titanium, and stainless steels. By inserting these devices into a disc space, restoration of the disc space height is reestablished. The device removes pressure on nerve structures and eliminates nerve entrapment caused by the otherwise collapsed disc space. More recently developed devices, constructed of polymers or composites, provide an additional benefit of being radiolucent when viewed by xray techniques. The most significant problem of the aforementioned conventional intervertebral body spacers is that the rigidity of the spacer does not allow for load sharing with a bone graft or bone substitute. Such grafts are disposed in the intervertebral space in order to fuse the vertebral surfaces that define the space together. The aforementioned prior art devices cannot fuse the vertebrae together alone, so bone, bone substitutes, and bone morphogenetic protein (BMP) type materials are used to provide a means of bone fixation. However, Wolff's law states that bone grows along lines of stress. For good fusion to occur, the implant spacer must distribute a load to the graft. Another problem with conventional spacers that are made from bioresorbable materials, such as poly-L-lactides (PLLA), is that these materials have limited strength and are designed to resorb completely away. With limited strength, these devices can fracture under the high loads of the spine. In addition to the above, fusion in vivo is a variable process. It may happen quickly, slowly, or not at all due to a variety of other reasons characteristic of the intervertebral space. If fusion does not take place and the bioresorbable materials resorb, the space established during surgery closes and the preoperative painful condition returns. While the aforementioned devices can be suitable for a particular purpose to which they address, they are not as suitable to providing a device that permits load sharing with the bone graft or bone substitute material while providing sufficiently rigid support of the spine during a healing process. In contradistinction, the present invention provides an apparatus primarily developed for the purpose of creating controlled load sharing while providing sufficiently rigid support of a spinal implant system and preventing full collapse of the disc space should a fusion fail to occur.

Radiopacity with vertical indentations. An elliptical radiopacity with vertical indentations at its border was seen in the radiograph of an edentulous patient. Interpretation of the image was based on a correlation of the clinical findings with a review of the image projection that occurs during exposure of a maxillary posterior periapical radiograph.

Chain branching approach in structure modification of TRPV1 receptor antagonist MK056 and its analogs. A series of chain branched 1,3-dibenzylthiourea derivatives were designed, synthesized, and evaluated for their antagonist activity against TRPV1. The synthesized chain branched 1,3-dibenzylthioureas 9a-g were tested for their antagonist activities against TRPV1 by (45)Ca(2+)-influx assay using neonatal rat cultured spinal sensory neurons. Fluorinated ethyl-branched analog 9g showed the most potent antagonist activity with an IC(50) value of 0.41 μM, but all of the chain branched analogs were less potent than the parent compounds MK-056 and SC-0030, indicating that chain branching on the benzylic position of B-ring is detrimental to potency. Optimized receptor binding seems to be interfered by chain branching, and resulted in decrease in potency.

Q: Sharepoint Online: Get List Items from Documents List with over 5000 Items using Powershell My goal is to create a powershell script that will change the created by value in my Sharepoint online documents list. Fyi this list contains 10005 items. I'm at the very beggining and already stuck because of this error: Exception calling "ExecuteQuery" with "0" argument(s): "The attempted operation is prohibited because it exceeds the list view threshold enforced by the administrator." Here is my script: ##Variables for Processing $SiteUrl = "https://xyz.sharepoint.com/sites/xyz" $UserName ="[email protected]" $Password ="xyz" $ListName ="Documents" #Setup Credentials to connect $Credentials = New-Object Microsoft.SharePoint.Client.SharePointOnlineCredentials($UserName,(ConvertTo-SecureString $Password -AsPlainText -Force)) #Setup the context $Context = New-Object Microsoft.SharePoint.Client.ClientContext($SiteUrl) $Context.Credentials = $Credentials #Get the list (documents) $Web = $context.Web $documentsList = $Web.Lists.GetByTitle($ListName) #Get All List items $ListItems = $documentsList.GetItems([Microsoft.SharePoint.Client.CamlQuery]::CreateAllItemsQuery()) $context.Load($ListItems) $context.ExecuteQuery() Write-host "Total Number of List Items found:"$ListItems.count I want to loop through the list items and change the created by value. How do you get around the 5000 item limit in this case? Thank you. A: I'd like to thank Lee_MSFT for his help. I used the code and inspiration from here. I'm answering my own question for those who are looking for something complete. Note that I was able to change the Created By value in my Sharepoint online documents list containing 10005 items, ONLY if I changed the Modified By value at the same time. If I only tried to do the Created By value, I would not be able to change anything. An explanation was found here The solution that worked 100%, see code: ##Variables for Processing $SiteUrl = "https://xyz.sharepoint.com/" $UserName ="[email protected]" $Password ="xyz" $ListName ="Documents" #Setup Credentials to connect $Credentials = New-Object Microsoft.SharePoint.Client.SharePointOnlineCredentials($UserName,(ConvertTo-SecureString $Password -AsPlainText -Force)) #Setup the context $Context = New-Object Microsoft.SharePoint.Client.ClientContext($SiteUrl) $Context.Credentials = $Credentials #Get the list (documents) $Web = $context.Web #$Lists = $web.Lists; $documentsList = $Web.Lists.GetByTitle($ListName) $context.Load($documentsList) # Prepare the query $BatchSize = 500 $query = New-Object Microsoft.SharePoint.Client.CamlQuery $Query.ViewXml = "<View Scope='RecursiveAll'><Query><OrderBy><FieldRef Name='ID' Ascending='TRUE'/></OrderBy></Query><RowLimit Paged='TRUE'>$BatchSize</RowLimit></View>" #Get the User $UserID="[email protected]" $User = $Context.Web.EnsureUser($UserID) $Context.Load($user) #Get All List items #change Created By and Modified By do { $ListItems = $documentsList.GetItems($query) $Context.Load($ListItems) $Context.ExecuteQuery() $query.ListItemCollectionPosition = $ListItems.ListItemCollectionPosition foreach($item in $listItems) { Try { # Add each item $item["Author"]=$User $item['Editor'] = $User $item.Update() $Context.ExecuteQuery() } Catch [System.Exception] { # This shouldn't happen, but just in case Write-Host $_.Exception.Message } } } While($query.ListItemCollectionPosition -ne $null)

For Neighbors, Being Close Really Counts By CARIN RUBENSTEIN Published: September 29, 2002 THE scene could be from an old-fashioned black-and-white vision of a warm and welcoming American neighborhood. Yet it's in living color, happening here in Westchester County, right now. A dozen neighborhood children play together. Some ride bikes down the gentle slope of the dead-end street in Tappan Landing in Tarrytown. Others take pet birds out of cages and wander off, cockatiels perched on narrow shoulders. Parents barbecue on a grill that has been wheeled out into the street, adding an extra hamburger or two whenever another neighbor shows up for the impromptu outdoor meal. ''We're always saying that we're the luckiest people in the world, because we have each other,'' said Lauren Wendle, 46, one of the burger flippers at Tappan Landing, commenting on the way the people on the block feel about where they live. Ms. Wendle, an associate publisher of a photography magazine in Manhattan, has lived here with her daughters, Katie and Lily, for 13 years, both before and after her divorce seven years ago. ''All my neighbors will always be my friends,'' said Lily Wendle, 12, with the emphatic optimism of the young. The Wendles and their friendly neighbors have created a microneighborhood for themselves, one that includes every resident of the five houses on their cul de sac: a divorced single mother, three married couples, a gay couple and nine children of various ages. This group of close-knit neighbors are bound together by the proximity of their homes, a common passion for gardening and gossiping, and the loyalty and affection they feel for one another. In some ways, this intimate enclave is unusual. Research shows that there has been a decline of community in America, and that neighbors socialized with one another less often in 1998 than they did in 1974, according to Robert Putnam, a professor of public policy at Harvard University and the author of ''Bowling Alone: The Collapse and Revival of American Community'' (Simon & Schuster). In general, Americans' ''connection with their community has dried up over the past 25 or 30 years,'' Dr. Putnam said in an interview. But despite this finding and a news media-driven obsession with a community in cyberspace, the real people who live next door still matter most, said Barrett Lee, a professor of sociology at Pennsylvania State University who has studied neighborhood networks. ''For certain kinds of support, like emergency help and borrowing the proverbial cup of sugar, proximity is most important,'' Mr. Lee said. Indeed, microneighborhoods like the one in Tappan Landing are blooming in special spots across Westchester County, in densely packed suburban neighborhoods with small homes, in more spacious neighborhoods with larger homes and even in urban apartment complexes. These neighborhood ties still exist because ''we're more likely to be connected to people who live very close to us,'' Dr. Putnam said. Indeed, the closer people live to one another, the more likely they are to be friends, according to several classic psychological studies conducted in the 1950's. Next-door neighbors were about twice as likely to be friends as those who lived farther away, according to research conducted in a neighborhood in Cambridge, Mass. Even now, about half of Americans, 47 percent, said they spend a social evening with neighbors at least once a month, in a random national survey of 1,878 Americans conducted in 2000 by the National Opinion Research Center at the University of Chicago. More than half of Americans, 56 percent, said that they have had a meal with some or all of their close neighbors, according to a national survey of 924 American adults conducted in July 2002, according to data provided by the Roper Center for Public Opinion Research at the University of Connecticut. Close members of microneighborhoods do more than just eat together. They trade and share plants and animal traps -- they even weed one another's gardens. They remove barbed-wire fences between their properties and build little pathways, instead, that connect the backyards. They share the cost of an invisible fence, so the dogs can have the run of both properties, in a kind of separate-but-equal canine microneighborhood. Sharing Holidays and Values Many such neighbors develop holiday traditions. In Tappan Landing, children with summer birthdays celebrate in the street with a ''circle cake,'' bought at a local ice cream shop for everyone on the cul de sac to share. There are water balloons and sprinklers for the children, and everyone stays outside until it is too dark to see or until a skunk wanders by, said one of the neighbors, Joanne Fahey, 39. The Tappan Landing group watches fireworks together on the Fourth of July and they have a pudding party at Christmas, where everyone brings a dessert. They also tend a joint pumpkin patch, which they harvest in late October, carving 50 pumpkins or so that line the dead-end street on Halloween night. This year, the children put up a sign to name the garden in honor of Pamela Moore, a much-loved former neighbor who died last year.

Domazet, Ivana and Kovačević, Milica (2018) The role of green marketing in achieving sustainable development. In: Sustainable growth and development in small open economies. Institute of World Economics; Centre for Economic and Regional Studies of the Hungarian Academy of Sciences, Budapest, pp. 57-72. ISBN 978-963-301-663-3 Anđelić, Slavica and Brnjas, Zvonko and Domazet, Ivana (2017) Education and entrepreneurship. In: Insights and potential sources of new entrepreneurial growth: Proceedings of the international roundtable on entrepreneurship. Faculty of business economics and entrepreneurship, Belgrade, pp. 383-393. ISBN 978-88-95922-84-3 Domazet, Ivana and Marjanović, Darko (2017) Tax incentives as a factor of economic growth. In: The state and the market in economic development: in pursuit of millennium development goals. The International Institute for Development Studies, Brisbane, Australia, pp. 93-107. ISBN 978-0-646-94775-4

Kichline - Manzoni October 24, 2004|The Morning Call Anjanette M. Kichline and Alfred E. Manzoni, Jr. were united in marriage on May 1, 2004 at St. Elizabeth of Hungary Catholic Church in Pen Argyl. Parents of the bride are Mr. and Mrs. Gary and Joanne Kichline of Nazareth. The groom is a son of Mr. and Mrs. Alfred and Betty Manzoni of Dallas, Pa. Marisa Kichline, sister of the bride, was maid of honor, and James Manzoni, brother of the groom, served as best man. The bride is a graduate of Pen Argyl Area High School and of Duquesne University. She received her MBA from Cleveland State University and is a Bank Examiner with the Federal Reserve Bank of Cleveland. The groom is a graduate of Lake Lehman High School and of The Pennsylvania State University. He completed his graduate degree in MIS at the University of Pittsburgh and is a GIS Consultant with Ajilon Consulting.

// Scintilla source code edit control /** @file LexMaxima.cxx ** Lexer for Maxima (http://maxima.sourceforge.net). ** Written by Gunter Königsmann based on the lisp lexer by Alexey Yutkin and Neil Hodgson . **/ // Copyright 2018 by Gunter Königsmann <[email protected]> // The License.txt file describes the conditions under which this software may be distributed. #include <stdlib.h> #include <string.h> #include <stdio.h> #include <stdarg.h> #include <assert.h> #include <ctype.h> #include "ILexer.h" #include "Scintilla.h" #include "SciLexer.h" #include "WordList.h" #include "LexAccessor.h" #include "Accessor.h" #include "StyleContext.h" #include "CharacterSet.h" #include "LexerModule.h" using namespace Scintilla; static inline bool isMaximaoperator(char ch) { return (ch == '\'' || ch == '`' || ch == '(' || ch == ')' || ch == '[' || ch == ']' || ch == '{' || ch == '}' || ch == '!' || ch == '*' || ch == '/' || ch == '^' || ch == ',' || ch == ':' || ch == '+' || ch == '-'); } static void ColouriseMaximaDoc(Sci_PositionU startPos, Sci_Position length, int lastStyle, WordList *[], Accessor &styler) { styler.StartAt(startPos); Sci_PositionU lengthDoc = startPos + length; styler.StartSegment(startPos); Sci_PositionU i = startPos; // If we are in the middle of a comment we go back to its start before highlighting if(lastStyle == SCE_MAXIMA_COMMENT) { while((i>0) && !((styler.SafeGetCharAt(i+1) == '*') && (styler.SafeGetCharAt(i) == '/'))) i--; } for (; i < lengthDoc; i++) { char ch = styler.SafeGetCharAt(i); char chNext = styler.SafeGetCharAt(i + 1); if (styler.IsLeadByte(ch)) continue; // Handle comments. // Comments start with /* and end with */ if((ch == '/') && (chNext == '*')) { i++;i++; chNext = styler.SafeGetCharAt(i); for (; i < lengthDoc; i++) { ch = chNext; chNext = styler.SafeGetCharAt(i + 1); if((ch == '*') && (chNext == '/')) { i++; i++; break; } } if(i > lengthDoc) i = lengthDoc; i--; styler.ColourTo(i, SCE_MAXIMA_COMMENT); continue; } // Handle Operators if(isMaximaoperator(ch)) { styler.ColourTo(i, SCE_MAXIMA_OPERATOR); continue; } // Handle command endings. if((ch == '$') || (ch == ';')) { styler.ColourTo(i, SCE_MAXIMA_COMMANDENDING); continue; } // Handle numbers. Numbers always begin with a digit. if(IsASCII(ch) && isdigit(ch)) { i++; for (; i < lengthDoc; i++) { ch = chNext; chNext = styler.SafeGetCharAt(i + 1); if(ch == '.') continue; // A "e" or similar can be followed by a "+" or a "-" if(((ch == 'e') || (ch == 'b') || (ch == 'g') || (ch == 'f')) && ((chNext == '+') || (chNext == '-'))) { i++; chNext = styler.SafeGetCharAt(i + 1); continue; } if(!IsASCII(ch) || !(isdigit(ch) || islower(ch) || isupper(ch))) { i--; break; } } styler.ColourTo(i, SCE_MAXIMA_NUMBER); continue; } // Handle strings if(ch == '\"') { i++; for (; i < lengthDoc; i++) { ch = chNext; chNext = styler.SafeGetCharAt(i + 1); if(ch == '\\') i++; else { if(ch == '\"') break; } } styler.ColourTo(i, SCE_MAXIMA_STRING); continue; } // Handle keywords. Maxima treats Non-ASCII chars as ordinary letters. if(((!IsASCII(ch))) || isalpha(ch) || (ch == '_')) { char cmd[100]; int cmdidx = 0; memset(cmd,0,100); cmd[cmdidx++] = ch; i++; for (; i < lengthDoc; i++) { ch = chNext; chNext = styler.SafeGetCharAt(i + 1); if(ch == '\\') { if(cmdidx < 99) cmd[cmdidx++] = ch; i++; if(cmdidx < 99) cmd[cmdidx++] = ch; continue; } if(isMaximaoperator(ch) || ((IsASCII(ch) && !isalpha(ch) && !isdigit(ch) && (ch != '_')))) { i--; break; } if(cmdidx < 99) cmd[cmdidx++] = ch; } // A few known keywords if( (strncmp(cmd,"if",99) == 0) || (strncmp(cmd,"then",99) == 0) || (strncmp(cmd,"else",99) == 0) || (strncmp(cmd,"thru",99) == 0) || (strncmp(cmd,"for",99) == 0) || (strncmp(cmd,"while",99) == 0) || (strncmp(cmd,"do",99) == 0) ) { styler.ColourTo(i, SCE_MAXIMA_COMMAND); continue; } // All other keywords are functions if they are followed // by an opening parenthesis char nextNonwhitespace = ' '; for (Sci_PositionU o = i + 1; o < lengthDoc; o++) { nextNonwhitespace = styler.SafeGetCharAt(o); if(!IsASCII(nextNonwhitespace) || !isspacechar(nextNonwhitespace)) break; } if(nextNonwhitespace == '(') { styler.ColourTo(i, SCE_MAXIMA_COMMAND); } else { styler.ColourTo(i, SCE_MAXIMA_VARIABLE); } continue; } styler.ColourTo(i-1, SCE_MAXIMA_UNKNOWN); } } LexerModule lmMaxima(SCLEX_MAXIMA, ColouriseMaximaDoc, "maxima", 0, 0);

/** * @file * Styles used by the Update Manager module. */ .checked .button { margin: 1em; vertical-align: middle; } table.update { width: 100%; margin-top: .5em; } .update tr { position: relative; } .update .project { font-weight: bold; font-size: 110%; } @media all and (min-width: 550px) { .update .project { float: left; /* LTR */ } [dir="rtl"] .update .project { float: right; } .update .version-status { float: right; /* LTR */ } [dir="rtl"] .update .version-status { float: left; } .update .versions, .update .project-info { clear: both; } } @media all and (min-width: 550px) { .update .version-status { text-align: right; font-size: 110%; position: static; float: right; /* LTR */ padding-left: 10px; } [dir="rtl"] .update .version-status { float: left; padding-left: 0; padding-right: 10px; } } .update .version-date { white-space: nowrap; display: none; } @media all and (min-width: 550px) { .update .version-date { display: inline-block; } } .current-version, .new-version { direction: ltr; /* Note: version numbers should always be LTR. */ } .update .version { padding-top: 5px; } .update .version div { box-sizing: border-box; padding: 0; margin: 0; } @media all and (min-width: 550px) { .update .version-info { width: 66%; display: inline-block; vertical-align: top; } .update .version-links { width: 33%; display: inline-block; vertical-align: top; } .update .version-details { display: inline-block; } } .update .version-links ul { font-size: .9em; list-style-type: none; padding: 0; margin: 5px 0 0 0; } @media all and (min-width: 550px) { .update .version-links ul { text-align: right; /* LTR */ } [dir="rtl"] .update .version-links { text-align: left; } } .update .security-error, .update .version-recommended-strong .version-title { font-weight: bold; } .update .version-security .version-title { color: #EC351C; } .update .check-manually { padding-left: 1em; /* LTR */ } [dir="rtl"] .update .check-manually { padding-left: 0; padding-right: 1em; } .update .project-info { display: none; } @media all and (min-width: 768px) { .update .project-info { display: block; } } .update-major-version-warning { color: #ff0000; }

Zoe and Kian return in a long-awaited sequel, Sherlock Holmes returns to solve more crimes, and a game full of shadows that's set in the 1920s Posted: 06/23/13 | Category: | Platform: The story so far: The dual themes of this year’s E3 coverage are Shadows and Special Powers. Today’s games reflect those two themes as well! The Return of Zoe in Dreamfall: ChaptersI was delighted to catch up with our old friend Ragnar Tǿrnquist. The prolific and prodigiously capable Ragnar has used his Special Powers to help create such games as Anarchy Online, The Secret World, and of course The Longest Journey and its sequel Dreamfall. Last fall, Ragnar left his long-time studio, FunCom, to found Red Thread games. Why? To help all of us return to the worlds of The Longest Journey, of course. Yes, one of our favorite series ever is coming out of the shadows at last! To launch the new game, a Kickstarter campaign was held. It was massively successful, almost doubling its goal of $850,000. The new game, called Dreamfall Chapters, will be co-written by Dag Scheve, who co-wrote Dreamfall. Many of the original voice actors will be returning, including (I was so happy to hear) Roger Raines as Crow. Ragnar promises that Chapters will wrap up Zoe’s story as well as some of the other dangling threads from the last game. The format of the game will be in full 3D, but will still be point-and-click. Zoe and Kian will be playable characters. The game will take place on Stark, Arcadia, plus a third realm, The World of Dreams. He hopes for release around November 2014 on PC, Mac, Linux and PERHAPS on consoles. Of course we’ll be following this one closely! Switching FocusFocus Home Interactive was showing two games at the show that intrigued me. Sherlock Returns!Frogwares has been creating a very successful series of six Sherlock Holmes mysteries for years. Its most recent title, The Testament of Sherlock Holmes, pushed the limits of the point-and-click format and was lauded by critics and players. The creative team is attempting to build on the success of Testament by pushing the envelope even further with their upcoming title, Sherlock Holmes: Crimes and Punishments. For the first time in the series, Frogwares is abandoning its own house-built game engine. For this game they licensed the legendary Unreal engine, and the visual results are sumptuous. Imagine Victorian London recreated with all the power a first-class 3D engine has to offer! The game consists of eight cases, and the overall mission statement the game creators are working with is this: They want the player to become Sherlock Holmes. The demo I saw involved The Cast of Black Peter, which is based on a canonical Sherlock Holmes novel. You (and by “you,” I mean Sherlock) have to discover who murdered the title character, who had been pinned to a wall with a whale harpoon. This time around, Sherlock has a Special Power: “Sherlock Vision.” When using it he can, quite literally, see things that others cannot. Throughout each case you will examine crime scenes, search for clues, analyze evidence, interrogate witnesses and suspects, and come to conclusions. Each case will have three to five possible solutions, with additional moral choices that Sherlock must make. By the end of the story, the eight cases will have some kind of connection. The game should be available by Q1 2014 for PC, XBox, and PS3. One last thing, as a special bonus observation from your most shallow of correspondents: I can report that the Sherlock in this game is perhaps the most ruggedly handsome Sherlock I’ve ever seen. Contrast: Eerie and BeautifulFocus is also working with a very small studio (eight people) in Montreal called Compulsion Games. The team is quite experienced, but Contrast is their first title as a studio. Contrast is a gorgeous game set in the 1920s in a “semi-European” city. Its style is heavily influenced by film noir, Art Deco, and German Expressionism. In other words, it’s seriously yummy visually. The story-driven game is about a troubled little nine-year old girl named Didi. But you don’t play as Didi. Nope, you play as her imaginary friend. This game is heavily marked by this week’s dual themes of Shadows and Special Powers. Dawn, Didi’s imaginary friend, is a beautiful young woman who doesn’t let the fact that she’s not actually real get her down. This is largely because she has the ability to help Didi solve problems. Didi’s special power is that she can actually turn into a shadow. It’s a very cool mechanic: To make it work, you simply have to get Didi into a spot where she’s brightly lit, then press a button, and presto! She’s a two-dimensional shadow. This is a vital Special Power, because as a shadow, she can explore the world in two dimensions. Let’s say Dawn needs to get up to a high balcony, but there’s no actual way to reach it. If there’s a shadow on the wall leading up to the balcony, she can turn into shadow and run up the shadow! What this means is that Contrastis an adventure puzzle platformer. Sam Abbott, Compulsion’s PR and Community Manager, told me that the game was inspired by Portal. I hasten to add, though, that the game is most definitely NOT a “Portal Clone.” (Not that there’s anything wrong with a game being a Portal Clone; there have been several worthy titles that could be described as that.) Story-wise, it’s clear that poor little Didi has some big problems. She seems all alone in the world. She’s not an orphan exactly, but her mother (a sexy cabaret singer) and her father (a musician), like all other people in the game other than Dawn and Didi, only appear as shadows. I assume this mysterious truth will be explained by the game’s end. But in the meantime, like Ofelia in Pan’s Labyrinth, Didi is a tough little girl who uses her imagination to help her survive difficult circumstances. I got to play a few minutes of the game, and it’s one of those hybrids that I really think will appeal to adventure lovers of all stripes. The game should ship by the end of the year for PC, XBox, PS3 and PS4. The expected price point will be about $15! But Wait.. There’s more!I have lots more to tell you about in upcoming installments of my 2013 E3 Report! Stay tuned!

Automated dispensing systems are often used to store quantities of items, often in bulk, and to dispense the items to a container or user in response to an instruction to fill an order. Automated dispensing systems may dispense various articles, such as medications when filling prescription orders. Automated dispensing systems provide a mechanism for accurately and repeatably filling orders in a manner that is faster and more efficient than manual methods. The accuracy of the quantity and type of item dispensed may be of great importance, particularly when the automated dispensing system is dispensing medications. Further, the quantity of articles items dispensed may be of great importance to ensure a prescription is completely filled and costly overfills are avoided. Automated dispensing systems may provide a mechanism for ensuring the quantity and type of item dispensed is accurate; however, the dispensing system must be properly replenished with the correct items in order to maintain the accuracy of the dispensing system.

--- title: Quebec Province of Canada homepage: https://www.donneesquebec.ca/en/ category: Government description: version: keywords: image: temporal: spatial: access_level: copyrights: accrual_periodicity: specification: data_quality: false data_dictionary: language: en license: publisher: organization: issued_time: sources: []

An arrangement by John A. Behnke of the sturdy German tune JESUS IST KOMMEN, GRUND EWIGER FREUDE for 3-5 octave handbells with optional drum. Level II+. This hymn with redemption themes is hymn of the day for Proper 9 (year C). …promise to the faithful, a reason to take heart! We are called to pass on the truth of what God has done in our lives. God brings order out of the chaos with His Word. Jesus is the Word! Because of Jesus, people change, and changed people change the culture in which they live! To learn more about… …First Article – How Does God Protect Us? 13. The Second Article – Who is Jesus? 14. The Second Article – What HasJesus Done for Us? 15. The Third Article – How Do We Come to Faith in Jesus? 16. The Third Article – How Do We Receive Forgiveness of Sins and Eternal Life?… …First Article – How Does God Protect Us? 13. The Second Article – Who is Jesus? 14. The Second Article – What HasJesus Done for Us? 15. The Third Article – How Do We Come to Faith in Jesus? 16. The Third Article – How Do We Receive Forgiveness of Sins and Eternal Life?… …character. If Jesus was a real human being, then he must have been born on a specific date. Upon what historical evidence does this claim of the true humanity of the person Jesus of Nazareth rely? This is the place where Ware’s painstaking labors come to our aid. When Was Jesus Really Born?… …character. If Jesus was a real human being, then he must have been born on a specific date. Upon what historical evidence does this claim of the true humanity of the person Jesus of Nazareth rely? This is the place where Ware’s painstaking labors come to our aid. When Was Jesus Really Born?… …Jesus' ascension into heaven reminds us that, not only hasJesus gone away to prepare a place for us in heaven, but that he will return to bring us there. "'Men of Galilee,' they said, ‘why do you stand here looking into the sky? This same Jesus, who has been taken from you into heaven, will come… …Christian lives full of the joys (and the crosses) that come with living a life of service toward God and neighbor. This volume will equip you to: * Find Jesus where He has chosen to reveal Himself - in Church * Find Jesus where He has chosen to reveal Himself - in His Word * Learn with the… This particular edition highlights the artistry of Gunther Martin Göttsche. Gunther is currently the director of the Academy of Church Music in Schluechtern, Germany, where he teaches organ, theory, and choral conducting. …that help participants apply God’s Word to their daily lives. The apostle Matthew writes his gospel to proclaim to the world that its promised Savior hascome. Pointing to Jesus as the fulfillment of the Old Testament prophesies, Matthew proclaims the universality of Jesus’ love. …of encouragement for living holy Christian lives full of the joys (and the crosses) that come with living a life of service toward God and neighbor. This volume will equip you to: • Find Jesus where He has chosen to reveal Himself—in Church and in His Word • Learn with the disciples… …compositions were conceived in an environment of improvisation, but they should not be necessarily be viewed as improvisations because each element has been carefully constructed and reconstructed in order to create a precise effect. The organ used for this recording is the instrument that was used… A collection of eight hymn preludes for use throughout the Church Year for organ with instrumentalist by Benjamin M. Culli. This volume includes parts for organ and French horn. Alternate parts for C instrument, high and low B-flat instrument, E-flat instrument, alto clef, and bass clef are… The reign of God hascome in Jesus Christ, but in hiddenness, in humility and lowliness. Jesus came to serve and give his life as a ransom for many (10:45). Jesus promised a triumphant revelation of himself after the cross (14:28), but within Mark (ending at 16:8) the disciples do not yet see the… Free Shipping Details Qualifying orders include sales of select in-stock CPH merchandise/product only and exclude special-order items (drop-ship or print-on-demand), gift cards or gift certificates, prepublications, technology subscriptions, technology support, other subscription or perpetual purchases, and Lutherans For Life (LFL), Lutheran Women’s Missionary League (LWML), Bethesda, and Synod products. This offer is valid for new orders placed through cph.org or phone only. This offer is not available for sales of products purchased for resale. Minimum order of $49 USD. U.S. and Canada only. Standard UPS ground and commercial shipping only. Some exclusions may apply. Valid December 15, 2017 (CST) only. Print on Demand Shipping Information Shipping within the United States Shipping rates are determined by total amount of your POD order. Please refer to the grid below: POD Item Total Shipping cost 0 - $20 $5 $20 - $50 $7 $50 - $100 $10 $100 - $250 9% of POD Item total $250 - $500 8% of POD Item total $500 - $1000 7% of POD Item total > $1000 6% of POD Item total Shipping to Canada A flat shipping fee of $15.00 will be applied to your order. Shipping outside the United States or Canada If you are a customer outside the U.S. or Canada, please indicate which shipping method you prefer in the “Order Notes” field on the My Cart page. Your shipping options include: Non-Trackable Shipping: A flat shipping fee of $15.00 will be applied to your order. Trackable Shipping: A flat shipping fee of $120.00 will be applied to your order.

Johnny Madhouse - 2011-04-13 I could only take fifteen minutes. I hated this. The scientist had belief in her cause, but not much charisma. She just couldn't understand why porcine assholes were attacking her carefully chosen words as offensive. She was unprepared for the ugliness of the conservative legislature. This was disgusting. Watching ignorant jackasses misinterpret academic language and then dogpile the speaker, one idiot after another, is just too frustrating to watch. BorrowedSolution - 2011-04-13 That poor lady. 5 for some of the truest evil out there. The Mothership - 2011-04-13 yea, I couldn't take it once the guy with no prefixes or suffixes started to sweet-talk. Menudo con queso - 2011-04-13 No, just the south and large hunks of the suburbs. Keep your eyes peeled for the next General Sherman because in 2023 we're gonna need someone merciless to lead another march to the sea, burning every tract home development along the way. Preybyemail - 2011-04-14 Oooooo! Can we leave another 360,000 yankees face down in a pool of their own blood again? Spastic Avenger - 2011-04-13 The irony of mentioning Socrates in this environment.

Reapplying Candidates who did not receive an offer of admission may choose to reapply for admission in a later term. Although it is likely that an applicant will receive the same decision, in some cases applicants may receive a different determination based on new or additional information that is provided or because the application is submitted earlier in the admissions cycle than in a prior year. Applications are maintained by the Office of Graduate Admissions for one year. If you applied to Georgetown Law during the last admissions cycle, you may reactivate your application by submitting the following documents to supplement those already in our files: Application Form & Fee: Please download and submit the current paper application form together with the $90 application processing fee. Please be sure to check the "Reapplicant" box so that we will include your previous materials with your new application file. Updated Resume and Personal Statement: Please submit an updated resume and personal statement describing your activities within the past year and reasons for reapplying. Updated Transcripts: Please submit an official final transcript, if you were still enrolled in your law program at another academic program at the time of your original application. New Letters of Recommendation:New letters of recommendation are welcome but not required. Please be advised that candidates who applied before the last admissions cycle must resubmit all application information.

Best Practices Among Food-Based Community Organizations: A Qualitative Analysis. Food-based community organizations (FBCO) have positive impacts on community health, yet little is known about best practices that facilitate organization sustainability. To identify strategies among FBCOs used to facilitate member engagement/retention, reach future members/participants, and support organizational growth, key informants from four FBCOs in Texas participated in in-depth interviews. Semi-structured interviews were informed by grounded theory, voice recorded, and transcribed. Results from eight interviews, representing four organizations, indicated five themes for organization sustainability: commitment to a mission, supportive leadership, physical meeting space, clear communication, and community partnerships. Implementation of these strategies may benefit other FBCOs by helping them create sustainable organizations.

INTRODUCTION {#s1} ============ Hepatocellular carcinoma (HCC), one of the most prevalent types of cancer worldwide \[[@R1]--[@R4]\], is the major histological subtype of liver cancer, accounting for about four fifths of total primary liver cancer cases \[[@R5], [@R6]\]. The therapy landscape for late-stage HCC has changed with the advent of molecular-targeted therapy \[[@R7]\]. Sorafenib, a relatively recent molecular therapy for late-stage HCC, has been used in Japan since mid 2009 \[[@R4], [@R8]--[@R10]\]. The tyrosine kinase inhibitor sorafenib has been demonstrated to induce tumor cell apoptosis. Its targets include multiple kinases such as vascular-endothelial and platelet-derived growth factor receptors, as well as the proto-oncoprotein c-Raf and other molecules \[[@R11]--[@R14]\]. Administration of sorafenib to advanced HCC patients was demonstrated to be efficacious and safe in the Sorafenib HCC Assessment Randomized Protocol (SHARP) \[[@R15]\] and Asia-Pacific studies \[[@R16]\]; however, the survival benefits of the drug are limited even when combined with immunomodulatory agents \[[@R14], [@R17]\]. As the duration of survival benefit is determined by disease condition, patients undergo sorafenib treatment with the aim of maintaining stable disease (SD). In spite of the multiple clinical trials conducted to test molecular therapeutic agents other than sorafenib, no agent has been found to have an efficacy superior to that of sorafenib to treat unresectable HCC \[[@R18]--[@R21]\]. Second-line therapies for late-stage HCC after sorafenib are lacking, and the selection of a treatment modality after first progression remains controversial \[[@R14]\]. For patients who develop progressive disease (PD) after being treated with sorafenib, the medication is often discontinued in favor of second-line trials \[[@R22], [@R23]\]. Consequently, continued sorafenib treatment has been selective for patients with late-stage HCC who present tumor progression; however, the efficacy of sorafenib for advanced HCC patients with continued treatment has not been determined \[[@R4], [@R14]\]. Here, we aimed to determine whether continued sorafenib treatment in advanced HCC patients who develop PD is beneficial. We identified prognostic indicators in patients with late-stage HCC treated with sorafenib, and evaluated alternative treatments in those patients who develop PD after sorafenib. MATERIALS AND METHODS {#s2} ===================== Patients {#s2_1} -------- Eligibility criteria for this study were similar to those of the SHARP trial \[[@R15]\], and were equivalent to the criteria we employed in our previous studies \[[@R4], [@R9]\]. Briefly, all enrolled patients met the following requirements: (a) Eastern Cooperative Oncology Group performance status of 0--1, (b) measurable disease using the Response Evaluation Criteria in Solid Tumors (RECIST) \[[@R24]\], (c) Child-Pugh class A or B liver function, (d) leukocyte count of ≥2,000/mm^3^, (e) platelet count of ≥50×10^9^/L, (f) hemoglobin level of ≥8.5 g/dL, (g) serum creatinine level of \<1.5 mg/dL, and (h) no ascites or encephalopathy. We enrolled 315 consecutive patients who were diagnosed with advanced HCC between May 2009 and September 2014 and who received sorafenib in this study. HCC was either confirmed histologically or diagnosed using noninvasive criteria according to the European Association for the Study of Liver \[[@R25]\]. Enrolled patients were treated with sorafenib at one of the 14 experienced member institutions of the Kurume Liver Cancer Study Group of Japan: Asakura Medical Association Hospital, Chikugo City Hospital, Kurume General Hospital, Kurume University Medical Center, Kurume University School of Medicine, Kyushu Medical Center, Nagata Hospital, Ōmuta City Hospital, Saga Central Hospital, Social Insurance Tagawa Hospital, St. Mary\'s Hospital, Tobata Kyoritsu Hospital, Yame General Hospital, and Yokokura Hospital. The primary outcome of this study was overall survival time, which was defined as the time from initiation of sorafenib treatment to the date of death or the patient\'s last follow-up. Relevant data from all patients' clinical records, including medical history, laboratory results, radiological findings, histological results, and survival data, as well as the dosage and adverse events associated with sorafenib therapy, were prospectively collected. The study protocol was approved by the Ethics Committee of Kurume University (No. 10009) and the University Hospital Medical Information Network (UMIN) Center (No. UMIN000007427), and conformed to the guidelines of the 1975 Declaration of Helsinki. Patients were given comprehensive information on the details of the clinical study, and each provided written informed consent prior to participation. Diagnosis {#s2_2} --------- Intrahepatic lesions and vascular invasion were diagnosed using a combination of contrast-enhanced computed tomography (CT), magnetic resonance imaging (MRI), ultrasonography (US), and digital subtraction angiography. Additionally, alpha-fetoprotein (AFP), lens culinaris agglutinin-reactive fraction of AFP (AFP-L3), and des-gamma-carboxy prothrombin (DCP) serum levels were measured up to one month before treatment. Intra-abdominal metastases were detected via abdominal CT, MRI, and US, which were performed to evaluate intrahepatic lesions. Pulmonary lesions were detected on chest radiography or CT, which was routinely performed up to one month before treatment. Additional examinations, such as bone scintigraphy and brain CT or MRI, were indicated when symptoms attributable to extrahepatic metastasis appeared. These examinations were also conducted when AFP, AFP-L3, or DCP levels were elevated in a manner that could not be explained by the status of the intrahepatic lesions \[[@R25]\]. Tumor stage was determined according to the Barcelona Clinic Liver Cancer (BCLC) staging classification \[[@R26]\]. Sorafenib treatment {#s2_3} ------------------- Performance status was used to determine the initial sorafenib dose, at the discretion of the chief physician. Discontinuation and dose reduction were allowed based on tolerance. Side effects of sorafenib treatment were documented according to the National Cancer Institute\'s Common Terminology Criteria for Adverse Events (CTCAE), version 4.0. Treatments were discontinued upon development of CTCAE grade 3 or higher adverse events with the exception of a platelet count of \<25×10^9^/L and a leukocyte count of \<1,500/mm^3^. Assessment of tumor response {#s2_4} ---------------------------- Imaging studies were performed four weeks after the initiation of sorafenib treatment and every 4--6 weeks thereafter to assess tumor response. The assessment was conducted according to the RECIST, version 1.1 \[[@R24]\] as follows: complete response (CR), all measurable lesions disappeared for more than four weeks; partial response (PR), the sum of the diameters of the largest target lesions decreased by more than 30%, and no new lesions developed for more than four weeks; PD, the sum of the largest diameters increased by more than 20%, or a new lesion appeared; and SD, where neither PR nor PD was observed \[[@R27]\]. Patients who died before their first radiographic assessment were classified as having PD. The time to radiologic progression was defined as the time from sorafenib treatment initiation to disease progression. Data from patients who died without tumor progression were censored. The disease-control rate was defined, on the basis of independent radiologic review, as the percentage of patients whose best-response RECIST rating of CR, PR, or SD was maintained for at least one month after the first demonstration of such a rating. Statistical analysis {#s2_5} -------------------- Baseline patient characteristics were analyzed using descriptive statistical methods. Survival curves were calculated using the Kaplan-Meier method. Univariate analysis of survival curves was performed using the log-rank test. A *p*-value of \<0.05 was considered statistically significant. The Cox proportional-hazards model was used to evaluate the interaction between baseline characteristics and the effect of sorafenib on overall survival. The JMP software (SAS Institute, Inc., Cary, NC, USA), version 11, was used for all analyses. RESULTS {#s3} ======= Patient characteristics {#s3_1} ----------------------- Some of the results in our present study are consistent with those reported in a previous study by our group \[[@R4]\]. Here, we also investigated the benefits of alternative treatments in patients with late-stage HCC who presented PD after being treated with sorafenib. The population of patients was composed of 246 (78%) men and 69 (22%) women. The mean age of patients was 72 years (Table [1](#T1){ref-type="table"}). The main causes of HCC were chronic hepatitis C (n = 195; 62%) and hepatitis B (n = 57; 18%) virus infections. Of the patients enrolled in our study, 161 (51%) had a Child-Pugh score of 5, and 104 (33%) had a Child-Pugh score of 6 while 265 (84%) patients had Child-Pugh class A and 50 (16%) had class B liver cirrhosis. Per the BCLC staging system, 101 (32%) patients were in stage B HCC, and 214 (68%) were in stage C. Prior to sorafenib administration, 280 (89%) patients had undergone surgical, loco-regional, or pharmacologic treatment. Of these, 178 were treated with transcatheter arterial chemoembolization (TACE), 109 were underwent hepatic arterial infusion chemotherapy (HAIC), 93 underwent hepatic resection, and 77 had radiofrequency ablation. ###### Characteristics of the total cohort (no. with % and median with range) Variable ------------------------------------------------- ----------------------- Age - median in years \[range\] 72 \[33 - 94\] Gender - n (%)   Male 246 (78)   Female 69 (22) Etiology - n (%)   HBV 57 (18)   HCV 195 (62)   both negative 63 (20) Child-Pugh class - n (%)   A 265 (84)   B 50 (16) Tumor stage - n (%)   BCLC-B 101 (32)   BCLC-C 214 (68) Initial sorafenib dose - n (%)   400mg 217 (69)   800mg 98 (31)   Extrahepatic metastasis- n (%) 178 (57)   Lung 105 (34)   Bone 40 (13)   Lymph node 38 (12)   Peritoneum 17 (5)   Adrenal gland 11 (3) Macrovascular invasion- n (%)   Presence 82 (26)   Absence 233 (74)   Albumin - median in g / L \[range\] 3.50 \[2.39 - 4.70\]   Total bilirubin - median in mg / dL \[range\] 0.78 \[0.15 - 3.70\]   Prothrombin time - median in % \[range\] 83.3 \[10.8 - 136.0\]   AFP - median in ng / mL \[range\] 100 \[1 - 987600\]   AFP L3- median in % \[range\] 22.3 \[0.0 -- 99.6\]   DCP - median in mAU / mL \[range\] 738 \[2 - 621000\] HBV = hepatitis B virus; HCV = hepatitis C virus; BCLC= Barcelona Clinic Liver Cancer; AFP = Alpha-fetoprotein; DCP = Des-gamma-carboxy prothrombin Treatment compliance {#s3_2} -------------------- The daily dose of oral sorafenib was 400 mg for 217 patients and 800 mg for 98 patients. By the end of the follow-up period, 277 patients had discontinued treatment for a variety of reasons including adverse reactions in 150 patients, radiologic and symptomatic progression in 92, and worsening of performance status in 22; moreover, 13 patients requested cessation of their treatment. Overall response and efficacy {#s3_3} ----------------------------- Of the enrolled patients, 261 (83%) underwent sorafenib treatment for longer than a month. The median duration of sorafenib treatment was 3.6 months (range: 0.1--53.5 months), and the median follow-up period was 8.7 months (range: 0.4--57.3 months). Fifty-four patients who received sorafenib for less than a month were treated with other therapeutic modalities, including TACE, HAIC, systemic chemotherapy, or radiofrequency ablation. A total of 230 patients (73%) died during the observation period while 85 (27%) survived through the follow-up period. Table [2](#T2){ref-type="table"} shows the results at the first radiologic assessment according to the RECIST; the rate of disease control was 49%. ###### Therapeutic effects in all patients (n =315) Therapeutic effect n (%) -------------------- ---------- PR 19 (6) SD 136 (43) PD 141 (45) Not evaluable 19 (6) PR = partial response; SD = stable disease; PD = progressive disease Factors correlated with survival outcome {#s3_4} ---------------------------------------- The cumulative survival curves for all patients in Figures [1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"} yielded a median survival time of (MST) 10.6 months (range: 0.4--57.3 months), a 44% rate of one-year survival, and a median progression-free survival (PFS) time of 3.9 months (range: 0.1--34.3 months; Figure [2](#F2){ref-type="fig"}). Univariate analyses of overall survival identified eight baseline patient characteristics as prognostic indicators for overall survival: sex, Child-Pugh class, initial sorafenib dose, serum AFP level at baseline, serum AFP-L3 level at baseline, serum DCP level at baseline, treatment duration, and therapeutic effect (Table [3](#T3){ref-type="table"}). Therapeutic effect was a significant risk factor in all patients. Figure [3](#F3){ref-type="fig"} shows curves for cumulative survival of patients with disease control and PD, with respective MSTs of 14.9 and 7.6 months (*p* \< 0.0001). {#F1} {#F2} ###### Univariate analyses of overall survival in all patients Variable *p* value HR (95% CI) ------------------------------------- ----------- ---------------------- Age (≥72 years) 0.318 1.147 (0.876--1.502) Gender (Male) 0.014 0.654 (0.476--0.916) Etiology (HCV) 0.780 0.961 (0.731--1.272) Child-Pugh class (B) \<0.001 2.136 (1.442--3.076) Tumor stage (BCLC-C) 0.759 0.959 (0.732--1.258) Initial sorafenib dose (800 mg) 0.005 0.690 (0.526--0.899) Extrahepatic metastasis (With) 0.880 1.019 (0.795--1.310) Macrovascular invasion (Presence) 0.168 1.216 (0.918-1.591) AFP (≥100 ng/ml) 0.001 1.578 (1.204--2.072) AFP-L3 (≥22.3 %) 0.002 1.654 (1.214-2.260) DCP (≥738 mAU/ml) \<0.001 1.864 (1.398-2.443) Duration of treatment (≥3.6 months) \<0.001 0.525 (0.396--0.692) Therapeutic effect (PD) \<0.001 1.679 (1.268--2.225) HR = hazard ratio; 95% CI = 95% confidence interval; HCV = hepatitis C virus; BCLC= Barcelona Clinic Liver Cancer; AFP = alpha-fetoprotein; DCP = des-gamma-carboxy prothrombin; PD = progressive disease {#F3} Analysis of patients with PD after sorafenib {#s3_5} -------------------------------------------- Of 141 patients who developed PD after sorafenib treatment, 58 continued treatment with sorafenib monotherapy, and 13 received no treatment at all. Seventy patients received treatments other than sorafenib (Table [4](#T4){ref-type="table"}). Cumulative survival curves of PD patients treated with either sorafenib monotherapy or alternative treatments are shown in Figure [4](#F4){ref-type="fig"}, with respective MSTs of 6.1 and 12.2 months (*p* \< 0.0001). The MST for patients who received no treatment at all was 2.4 months. ###### Additional treatments in advanced HCC patients with PD after sorafenib (n =141) Additional treatment n (%) -------------------------------------------- --------- Sorafenib monotherapy 58 (41) TACE 24 (17) HAIC 21(15) Systemic chemotherapy except for sorafenib 18 (13) Radiation therapy 18 (13) Hepatic resection 3 (2) No treatment 13 (9) HCC = Hepatocellular carcinoma; PD = progressive disease; TACE = transcatheter arterial chemoembolization; HAIC = hepatic arterial infusion chemotherapy {#F4} DISCUSSION {#s4} ========== Sorafenib is an oral multikinase inhibitor that has been recently used for molecularly targeted therapy of late-stage HCC patients \[[@R4]\]. Sorafenib treatment is well tolerated and has improved patient survival in two phase III clinical trials that were randomized and placebo-controlled \[[@R15], [@R16]\]. In our current study, we assessed prognostic indicators in advanced HCC patients, and evaluated alternative treatments in such patients who experienced PD after sorafenib. The MST (10.6 months) of sorafenib-treated patients was longer in our study (Figure [1](#F1){ref-type="fig"}) than in the Asia-Pacific study (6.5 months) \[[@R16]\] while being comparable to the MST observed for SHARP patients (10.7 months) \[[@R4], [@R15]\]. Using exploratory univariate analysis, we identified eight prognostic indicators of survival: sex, Child-Pugh class, initial sorafenib dose, serum AFP level at baseline, serum AFP-L3 level at baseline, serum DCP level at baseline, treatment duration, and therapeutic effect (Table [3](#T3){ref-type="table"}). We demonstrated that PD after sorafenib was a risk factor that negatively affected survival (Figure [3](#F3){ref-type="fig"}). In line with other reports showing that early radiologic progression after sorafenib treatment is a sign of poor prognosis, patients in our cohort with early PD development also showed decreased survival \[[@R23], [@R28]\]. Although the purpose of administering sorafenib to advanced HCC patients is to maintain disease control over a long period of time, our data suggest that developing PD reduces the ability of sorafenib to provide survival benefits \[[@R29]\]. While previous clinical trials (SHARP and Asia--Pacific) showed that sorafenib can prolong the survival of patients with advanced HCC \[[@R15], [@R16]\], these studies made no recommendations as to whether sorafenib should be continued when PD first develops \[[@R14]\]. In our cohort, patients treated with alternatives to sorafenib survived longer than patients treated with sorafenib monotherapy (Figure [4](#F4){ref-type="fig"}) \[[@R30]\]. Therefore, our study suggests that sorafenib should be discontinued in favor of alternative treatments in advanced HCC patients with PD. Hypoxia induced by some therapeutic approaches might promote tumor progression and metastasis \[[@R31]\]. It has been proposed that cancer cells can adapt to treatment and regenerate new tumors \[[@R32]\], and that carcinogen resistance may drive the accumulation of somatic mutations in oncogenes and tumor suppressors as an adaptive mechanism \[[@R33]\]. Therefore, drug combinations may be necessary to circumvent the problems of multiple mutations and drug resistance \[[@R34]\]. Currently, there are no effective second-line treatments for patients with HCC who have developed PD after being treated with sorafenib \[[@R23]\]. To improve prognosis for such patients, it is critical for clinicians to be able to predict tumor response to sorafenib treatment \[[@R21]\]. There are currently few biomarkers to predict the effects of sorafenib treatment; however, some genomic changes have been found to correlate with a favorable therapeutic response to sorafenib, and additional biomarkers might be identified in the next few years \[[@R21]\]. Our current study has several limitations. First, the alternative treatments in patients who developed PD after sorafenib treatment were selected at the discretion of the chief physician and were not randomized. This resulted in a selection bias for patients treated with sorafenib monotherapy and those administered alternative treatments. Second, some patients in the groups other than that administered sorafenib monotherapy received multiple treatments. Lastly, the size of the study cohort was relatively small. To confirm the superiority of alternative treatments (including the aforementioned combinatorial drugs) for abolishing sorafenib resistance in patients who develop PD after sorafenib treatment, prospective randomized studies with a larger number of subjects are required. In conclusion, our results showed that PD after sorafenib treatment was a significantly negative prognostic indicator for patients with late-stage HCC. Those who developed PD after treatment with sorafenib and were administered alternative treatments had better survival potential compared to those who maintained treatment with sorafenib monotherapy. Therefore, alternative treatments for patients who develop PD after sorafenib treatment should be considered. The authors thank the staff of the Kurume Liver Cancer Study Group of Japan for their valuable support, and also thank Editage ([www.editage.jp](http://www.editage.jp/)) for English language editing. **CONFLICTS OF INTEREST** No conflicts of interest to declare. **FUNDING** This study was supported in part by a Health and Labor Sciences Research Grant for Research on Hepatitis from the Ministry of Health, Labor and Welfare of Japan.

The objective of this proposal is to understand how people perceive tactile patterns. The project will focus on the processing of tactile spatial patterns. Studies will be conducted comparing interactions between spatial patterns presented to the same location and to separate locations. Results from the psychophysical and perceptual measures will be related to neurophysiological studies of peripheral and central responses to tactile stimuli. Tactile spatial patterns will be generated by means of several types of displays. One is the newly-developed dense array, which consists of 400 independently-controlled tactors in a 20 x 20 matrix. The center-to-center spacing of the contactor points can be varied from 0.5 mm to 1.0 mm. The dense array will be used to generate spatial patterns that selectively activate different populations of mechanoreceptors and to study spatial sensitivity on the fingerpad and palm. The dense array will also be used to examine the conditions for producing perceptual changes related to sensory plasticity. Studies will be conducted with the dense array as well as arrays from the Optacon, a reading aid for the blind, to investigate such perceptual phenomena as temporal integration, temporal masking, response competition, and selective attention. Measurements will also be made of subjects' abilities to resolve spatial gratings. One of the aims of the project is to compare the results obtained with tactile stimuli to studies conducted with visual and auditory stimuli. Results from the project will be relevant to the development of cutaneous communication systems for the deaf, blind, and deaf-blind and to the measurement and understanding of neurological problems.

Q: What causes this bigger SourceAlpha than SourceGraphic I was trying to make the following box have a bigger clickable area: <svg width="150" height="150"> <rect x="10.5" y="10.5" width="10" height="10" stroke="black" stroke-width="3" fill="none"/> </svg> so to do that, I messed around a bit with filters; first I applied a color matrix, and then I wanted to start changing the size of the black background part, but it was somehow already bigger than the original graphic: <svg width="150" height="150"> <filter id="fillBlack"> <feColorMatrix type="matrix" in="SourceAlpha" result="blackBox" values="0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1"/> <feComposite operator="over" in="SourceGraphic" in2="blackBox"/> </filter> <rect x="50" y="50" width="10" height="10" filter="url(#fillBlack)" stroke="transparent" stroke-width="50" fill="white"/> </svg> Now, this seems to come pretty close to my desired result already, but there are two problems: firstly, I really don't understand why this would work, and secondly, because I don't know what causes this, I can't resize the black background. It seems like the background is always 10% bigger; try changing the values for width and height on the <rect>, and the black background will be a border of 10% the entered width/height around the original box So what causes the SourceAlpha to be bigger, and how do I actually resize the black background so I can have it the size I want? PS: I'd very much prefer not to put another <rect> over the current one, but rather I'd have everything done with a filter like what I've got here. A: By default, the filter region is 10% bigger on all sides. This is to allow for filter primitives like feGaussianBlur which can make the graphic bigger. You can change the filter effects region by using the attributes x, y, width and height on the <filter> element. They default to -10%, -10%, 120% and 120% respectively. I recommend reading the section on filters in the SVG spec. But even though filters can result in something being drawn larger, it shouldn't change the actual size or shape of the region that responds to pointer events. There is only one way I can think of that you can use to make the click area larger without adding extra elements. Give the shape a large, but invisible, stroke width Set pointer-events="all" Setting pointer-events to "all" makes both the stroke and fill areas sensitive even if they are invisible. Compare the behaviour of the squares in this example. rect:hover { fill: orange; } <svg width="350" height="200"> <rect x="50" y="50" width="100" height="100" fill="red"/> <rect x="200" y="50" width="100" height="100" fill="green" stroke="black" stroke-opacity="0" stroke-width="40" pointer-events="all"/> </svg>

Introduction {#Sec1} ============ Sterols are vital components of all eukaryotic cells where they modulate structure and function of membranes and, as precursors of signaling molecules, they control growth and development. Plant sterols, commonly named phytosterols, are involved in morphogenesis, development, reproduction and stress response^[@CR1]--[@CR3]^. Analogously, microalgal sterols showed critical physiological roles related to photosynthesis, growth, light response and fatty acid metabolism^[@CR4]^. Sterols are terpenes deriving from a complex process of polymerization of six isoprene units. In animals and fungi, the mevalonic acid (MVA) pathway is the only route for the biosynthesis of the isoprene units isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). In higher plants and algae, IPP and DMAPP derive either from the MVA pathway in the cytoplasm or the methylerythritol phosphate (MEP) pathway in the plastids^[@CR5]^. Without a clear cellular compartmentalization, both biochemical routes have been also reported in mosses and streptomyces. Sterol biosynthesis from IPP and DMAPP is generally taxa-specific and proceeds via lanosterol by lanosterol synthase (LSS) in nonphotosynthetic organisms (e.g. animals and fungi) or cycloartenol by cycloartenol synthase (CAS) in photosynthetic lineages (e.g. plants and algae)^[@CR6]^. Cholesterol is the major animal sterol but its biosynthesis in tomato has been recently shown to derive from a cycloartenol-dependent pathway composed of enzymes either shared with phytosterols or evolved from phytosterol biosynthetic genes^[@CR7]^. Furthermore, insects and lower eukaryotes, including marine invertebrates and a few microalgae, are suggested to convert phytosterols to cholesterol and *vice versa*^[@CR8]--[@CR11]^. Diatoms represent an important component of the aquatic ecosystem^[@CR12],[@CR13]^ and form the largest biological group of marine phytoplankton^[@CR14],[@CR15]^. These microalgae are major global producers by contributing to fixation of CO~2~ and geochemical cycles in the world oceans^[@CR16],[@CR17]^. Furthermore, they can biosynthesize a number of secondary metabolites^[@CR18]^ including domoic acid^[@CR19],[@CR20]^, oxylipins^[@CR21]--[@CR24]^, carotenoids^[@CR25],[@CR26]^, as well as organic and inorganic biopolimers such as chitin, silica and calcite^[@CR27]--[@CR30]^. Recently, we showed that a specific class of sterol derivatives, namely sterol sulfates (StS), operate as chemical trigger of cell death programs in the diatom *Skeletonema marinoi*^[@CR31]^. The report is new but underlines the possible role of sterols to control cell survival during phytoplankton blooms. Diatoms possess both plant (e.g. brassicasterol) and animal (e.g. cholesterol) sterols^[@CR32]^. To explain this unconventional blend, Fabris *et al*. have recently suggested a mixed plant and fungal pathway on the basis of molecular studies in the diatom *Phaeodactylum tricornutum*^[@CR33]^. However, diatoms usually do not produce ergosterol, the typical fungal sterol, as well as they lack homologs of the eukaryotic proteins required for its synthesis from lanosterol^[@CR34]^. On the whole, the "fungal" hypothesis does not have so far biochemical confirmation and sterol biogenesis is still an undisclosed question in these microalgae. In the present study, we have investigated the biosynthesis of sterols, from acetyl-CoA to the final products, with the aim to find a unified pathway suitable to produce both plant and animal sterols in diatoms. Combination of transcriptomic approach with labelling methods and GC-MS profiling has been used to disclose the origin of the complex mixtures of sterols in the diatoms *Skeletonema marinoi* and *Cyclotella cryptica*. Post analysis of the molecular data, sterol profiling and comparison with other diatom species provides general significance to this study. Results {#Sec2} ======= Profiling and identification of diatom sterols {#Sec3} ---------------------------------------------- Four different Δ5-sterols, namely 24-methylene cholesterol, dihydrobrassicasterol, clionasterol (also named γ-sitosterol) and fucosterol were identified by standard comparison in the GC-MS profiles of *C. cryptica* (Fig. [1](#Fig1){ref-type="fig"}). The above phytosterols together with cholesterol and minor level of desmosterol were also observed in *S. marinoi*. Dihydrobrassicasterol (β-orientation of the methyl group at C-24) was distinguished from campesterol (α-orientation at C-24) on the basis of the ^1^H- and ^13^C-chemical shift of Me-28^[@CR35],[@CR36]^ after purification of the natural product. Analogously, NMR comparison with an original standard confirmed the *E* configuration of fucosterol^[@CR37]--[@CR39]^ while stereochemistry at C-24 of clionasterol (β-orientaion of the ethyl group) required a complete NMR analysis after purification by HPLC (Supporting Material). The proton chemical shifts of this natural product were very similar to the values reported in the literature for clionasterol^[@CR35],[@CR40]^ but showed differences with a standard of β-sitosterol for H~3~-26 (0.8308 vs 0.8371 ppm), H~3~-27 (0.8106 vs 0.8163 ppm) and H~3~-29 (0.8578 vs 0.8462) (Supplementary Fig. [S1](#MOESM1){ref-type="media"}). As shown in Table [1](#Tab1){ref-type="table"}, ^13^C NMR data of the diatom product provided additional agreement with the literature^[@CR35]^ and corroborated the differences between the two 24-ethyl epimers at C-23 (26.4 vs 26.1 ppm), C-24 (46.1 vs 45.8), C-26 (19.0 vs 19.8) and C-27 (19.6 vs 19.1), thus giving definitive confirmation of the assignment of clionasterol in the diatom extracts.Figure 1Sterols in *S. marinoi* and *C. cryptica*. (**A**) Structures and (**B**) GC-MS chromatograms of acetylated derivatives. β-chiral descriptor in side chain is in agreement with Nes^[@CR6]^.Table 1^13^C NMR (CDCl~3~, 125 MHz) data of clionasterol (24β-ethyl epimer) from *C. cryptica* and an authentic standard of β-sitosterol (24α-ethyl epimer).CClionasterol^a^β-SitosterolCClionasterol^a^β-Sitosterol137.337.31628.228.2231.731.61756.056.0371.871.71811.911.8442.3^b^42.2^c^1919.419.45140.8140.72036.336.16121.7121.72118.818.8731.9^d^31.9^d^2233.933.9831.9^d^31.9^d^2326.426.1950.150.12446.145.81036.436.52528.929.21121.121.02619.019.81239.839.82719.619.11342.3^b^42.3^c^2823.023.01456.856.82912.312.01524.324.3^a^Natural product; ^b,c,d,e^Overlapped signals. To provide general significance to these results, we also performed additional GC-MS profiling of the diatoms *Skeletonema costatum*, *Thalassiosira weissflogii*, *Phaeodactylum tricornutum, Pseudonitzschia arenysensis*. In agreement with the most recent reports, 24-methylene cholesterol was the recurrent sterol in these diatoms, often accompanied by dihydrobrassicasterol and cholesterol (Supplementary Table [S1](#MOESM1){ref-type="media"}). In addition, desmosterol and 24-ethyl cholesterol (likely clionasterol) were found in *P. tricornutum* while desmosterol was present in *S. costatum* and *T. weissflogii*. In agreement with the literature^[@CR32],[@CR41]--[@CR44]^, the results show an evident variability of the sterol composition in these diatoms but confirm the original assumption that diatoms can in principle biosynthesize sterols from cyclization of both cycloartenol and lanosterol. Another characteristic of the analyzed diatoms is the β configuration at C-24 of dihydrobrassicasterol and clionasterol which is commonly found in organisms, such as algae o fungi, that are considered lower than vascular plants in the evolutionary hierarchy^[@CR45],[@CR46]^. Isoprene origin from mevalonate pathway {#Sec4} --------------------------------------- In order to clarify the sterol biosynthetic pathway of *S. marinoi* and *C. cryptica*, transcriptome assembly and sequence alignments were performed by triplicates of each species. The analysis revealed the whole set of genes of the MVA pathway from acetyl-CoA C-acetyltransferase to isopentenyl diphosphate isomerase (Fig. [2](#Fig2){ref-type="fig"}). Experimental support to these results was addressed by labelling studies with \[1-^13^C\]-glucose. Diatoms are photo-autotrophic organisms thus use of an organic substrate required acclimation of the species to heterotrophic conditions. To this aim, *C. cryptica* was grown heterotrophically as previously reported^[@CR47],[@CR48]^. After extraction and fractionation of the cell pellets, labeled and unlabeled dihydrobrassicasterol were compared by ^13^C NMR spectroscopy^[@CR36]^. Spectra of these products clearly revealed selective incorporation at C-1, C-3, C-5, C-7, C-9, C-13, C-15, C-17, C-18, C-19, C-21, C-22, C-24, C-26, C-27 and C-28 (Supplementary Fig. [S2](#MOESM1){ref-type="media"}). A few positions such as C-6 (121.74 ppm) and C-16 (28.25 ppm) were not labeled while other carbon atoms (C-1, 37.3 ppm; C-7, 31.9 ppm; C-18, 11.9 ppm; C-19, 19.4 ppm) resulted highly enriched. Mapping of these positions permitted to conclude that labeling was specifically present at C-2, C-4 and C-5 of the six isoprene units that give origin to the rearranged terpene skeleton of dihydrobrassicasterol (Fig. [2](#Fig2){ref-type="fig"}). On the contrary, very low or no labeling were observed at carbon positions derived from C-1 of the isoprene units. According to the Rohmer's method^[@CR49]^, this enrichment study proved the synthesis of dihydrobrassicasterol unambiguously by the mevalonate pathway with no contribution from MEP. Similar results were obtained for fucosterol and clionasterol (Supplementary Figs. [S3](#MOESM1){ref-type="media"} and [S4](#MOESM1){ref-type="media"}). Intense flanking doublets due to incorporation in vicinal carbons were very evident in those signals, namely C-13/C-18 and C-13/C-17, whose proximity is in agreement with the cyclization of the sterol skeleton from squalene. A strong coupling between C-24/C-28 supported labelling of these carbon atoms in dihydrobrassicasterol. Analogous effects were also observed between C-24/C-28 and C-28/C-29 in fucosterol and clionasterol. The carbon atoms C-28 and C-29 of these metabolites do not originate from the isoprene unit but derive from labelled S-adenosyl methionine (SAM) (Fig. [2](#Fig2){ref-type="fig"}). In plants, the two reactions are dependent on sterol 24C-methyl transferase 1 (SMT1) and sterol 24C-methyl transferase 2 (SMT2) that catalyze transfer of the methyl group from SAM to cycloartenol or 24-methylenelophenol, respectively. Orthologs of the sequences related to genes of the MVA pathway in *S. marinoi* and *C. cryptica* were also identified in the published genomes of *Thalassiosira oceanica, Thalassiosira pseudonana, Phaeodactylum tricornutum, and Fragilariopsis cylindrus* (Supplementary Table [S2](#MOESM1){ref-type="media"}).Figure 2Mevalonate biosynthesis of sterols in *S.marinoi* and *C. cryptica*. (**A**) Incorporation of ^13^C-labelling (red spot and blue square) in dihydrobrassicasterol, fucosterol and clionasterol after feeding of 1-^13^C-glucose to *C. cryptica* under heterotrophic conditions. SAMe = S-adenosyl methionine; (**B**) Transcript sequences of genes coding for enzymes of the mevalonate pathway in *S. marinoi* and *C. cryptica*. Cyclization of sterol skeleton by cycloartenol synthase {#Sec5} ------------------------------------------------------- Table [2](#Tab2){ref-type="table"} reports the list of transcripts coding for putative enzymes related to synthesis of sterols from IPP and DMAPP in *S. marinoi* and *C. cryptica*. FPKM counts were obtained for the gene toolbox that oversees each biosynthetic step except for squalene epoxidase (SQE) that did not give confident coverage with any known sequence. Despite the conservation of this enzyme in animals, fungi and plants, more than one polyphyletic group of eukaryotes have shown the lack of the corresponding gene. Very recently, an alternative SQE (AltSQE) belonging to the fatty acid hydroxylase family has been described in diatoms^[@CR50]^. Analysis of the transcripts of *S. marinoi* and *C. cryptica* supported the presence of orthologs of AltSQE (Sm-TR7561 and Cc-TR29442) thus suggesting that this enzyme catalyzes epoxidation of squalene also in these species. It is worth noting that AltSQE of *S. marinoi* and *C. cryptica*, as well those of other diatoms, showed high sequence similarities (above 60%) with plant Δ5-sterol reductase (DWARF7) that is responsible for one of the latest steps of the phytosterol biosynthesis. The successive reaction of cyclization is proposed to give cycloartenol by cycloartenol synthase (CAS) that was significantly upregulated in both *S. marinoi* and *C. cryptica*. Orthologous CAS genes were also identified in the published genomes of *T. oceanica, T. pseudonana, P. tricornutum and F. cylindrus*. The phylogenetic analysis of these sequences showed clusterization of these proteins with plant CASs despite the diatom sequences form an independent group from plants (Fig. [3](#Fig3){ref-type="fig"}). Within the lineage, the putative enzymes were splitted in two sub-branches with separation of the centric species *S. marinoi, C. cryptica, T. pseudonana* and *T. oceanica* from the pennates *P. tricornutum, P. arenysensis, Fragilariopsis solaris* and *F. cylindrus*. Cyclase activity of *Arabidopsis* CAS1 is strictly dependent on the conserved domains KMQGYNGSQ (406 aa -- 414 aa) and TADHGWPISDC (474 aa -- 484 aa), with Tyr410, His477 and Ile481 that are key residues for the catalytic mechanism^[@CR51]^. Putative CAS from *S. marinoi* and *C. cryptica* showed domains \[(830 aa - 838 aa) and (910 aa- 920 aa) in *S. marinoi*; (353 aa - 361 aa) and (436 aa - 446 aa) in *C. crytica*\] and catalytic residues (Tyr834, His913, Ile917 in *S. marinoi*; Tyr357, His439 and Ile443 in *C. crytica*) that were identical to those of *A. thaliana* (Supplementary Fig. [S5](#MOESM1){ref-type="media"}).Table 2Transcript sequences of genes coding for enzymes of sterol biosynthetic pathway in *S. marinoi* and *C. cryptica*.Biosynthetic FunctionPredicted enzymatic function by Blast2GO*S. marinoi* transcriptsExpression (FPKM counts)*C. cryptica* transcriptsExpression (FPKM counts)Replicate 1Replicate 2Replicate 3Replicate 1Replicate 2Replicate 3Terpene elongation and cyclization*Farnesyl pyrophosphate synthetase***FPPS**TR577474714692779TR24671158013631796*Squalene synthase***SQS**TR58377653907710903TR9057731114737648*Alternative Squalene Epoxidase***AltSQE**TR7561770810051765TR29442139161672610147*Cycloartenol synthase***CAS**TR12960490255975266TR3126282530113105Construction of the sterol skeleton*Cycloartenol-C-24-methyltransferase -1***SMT1**TR612399669547431495121TR445224872456210006*Cycloartenol-C-24-methyltransferase -2***SMT1**------------TR45147346392572033901*Sterol Methyl transferase***SMT2**TR11812190231379415818TR29102667316202570507*Sterol Methyl transferase***SMT2**TR21333243441399714326TR17021338054240637980*C-4 Methylsterol oxidase***3βHSD-D**TR28093228725231960------------*Sterol-4-methyl oxidase 1***SMO1**TR11964405343709035927TR32604209792982725702*Sterol-4-methyl oxidase 1***SMO1**TR30213306132582926TR283290.00017312017*Sterol-4-methyl oxidase 2***SMO2**TR319170191873618676TR32604209792982725702*Sterol-4-alpha-carboxylate 3-dehydrogenase***ERG26/D4C**TR28078483292954139087TR1463811001780011499*Cycloeucalenol cycloisomerase***CPI**TR11937867388648943TR30071308136434002*Sterol 14 demethylase -1***CYP**TR7602582231613628TR12199325813839840078*Sterol 14 demethylase -2***CYP**------------TR23734639647105582*Sterol 14 demethylase -3***CYP**------------TR30096709036549074001*Delta 14 sterol reductase***C14SR**TR13312563057715383TR19404477994620750117*Delta 5 Sterol desaturase***Δ5 SD/DWARF7**TR28093228725231960TR487240.00071682531*7 Dehydrocholesterol reductase***Δ7SR/DWARF5**TR263676531718713127TR240681080197659443*Delta(24(24(1*)*))-sterol reductase***24SR/ERG4**TR213147501830818373TR29411883457804966050*24 dehydrocholesterol reductase -2***24-DHCR**TR10998452996458264882------------*22 sterol desaturase***ERG5**------------TR3228115351246013684Figure 3Un-rooted phylogenetic tree of cycloartenol synthase (CAS) and lanosterol synthase (LSS) in diatoms, plants, algae fungi and animals. Alignment used maximum likelihood method. The bootstrapping test (replicate = 100) is reported on each node. Red square = *S. marinoi*; Green square = *C. cryptica*; Light blue spot = other diatom. C4-Demetylation of the triterpene precursor {#Sec6} ------------------------------------------- C4-demethylation is a crucial step in sterol biosynthesis in plants, mammals and fungi. The biochemical transformation requires the consecutive action of three enzymes widely conserved across phyla, namely sterol-4-methyl oxidase (SMO), 3-hydroxysteroid dehydrogenase/C4-decarboxylase (C4D), and a sterone ketoreductase (SKR)^[@CR52]^. The complex is tethered to the membrane by ergosterol biosynthetic protein 28 (ERG28), a fourth protein that has no catalytic function but plays a key role in preventing accumulation of biosynthetic 4-methyl sterol intermediates^[@CR53],[@CR54]^. Removal of both methyl groups occurs successively by a single SMO in mammals and yeast, whereas in plants the process proceeds in two steps under control of two different SMOs, named SMO1 and SMO2. The analysis of the transcripts of *S. marinoi* and *C. cryptica* did not reveal any presence of ERG28. In analogy with phytosterol biosynthesis, we found sequences that correlate with plant SMO1 (Sm-TR11964, Sm-TR30213) and SMO2 (Sm-TR319) in *S. marinoi*, whereas the transcriptome of *C. cryptica* showed only one sequence for a putative SMO1 (Cc-TR32604). It is interesting that the BLAST analysis of the putative SMO1 encoded by Sm-TR11964 and Cc-TR32604 indicated a good homology with the human C4 methyl sterol oxidase that participates in the C4-demethylation of cholesterol precursors (Supplementary Table [S3](#MOESM1){ref-type="media"}). Both diatoms also revealed sequences related to fungal ERG26, a decarboxylating enzyme of the C4D family that is responsible for the formation of 3 oxo-sterols from several 3β-4-carboxysterols in fungi, plants and mammals. Biosynthesis of phytosterols {#Sec7} ---------------------------- *S. marinoi* and *C. cryptica* transcriptomes exhibited respectively, 13 and 16 expressed genes related to the steps leading to C~28~ and C~29~ phytosterols from cycloartenol in agreement with a common plant pathway (Table [2](#Tab2){ref-type="table"}). Expressed genes of key steps in phytosterol biosynthesis showed perfect matching among *S. marinoi* and *C. cryptica*, and high percentage of query coverage and identity with plant genes (Supplementary Table [S3](#MOESM1){ref-type="media"} and Supporting Material). Following the labelling results reported above, the analysis revealed orthologs of plant SMT-1 and SMT-2 that are implied in the methylation of cycloartenol and 24-methylenelophenol to give C24-methyl and C24-ethyl derivatives, respectively. On phylogenetic basis, Sm-TR612, Cc-TR44522 and Cc-TR45147 were identified as SMT1 orthologs and clustered with sequences of plants, fungi and other diatoms (Fig. [4](#Fig4){ref-type="fig"}). On the other hand, Sm-TR11812, Sm-TR21333, Cc-TR29102 and Cc-TR17021 formed an independent group of SMT that diverged from SMT2 of plants and the green alga *Chlamydomonas reinhardtii* but showed homology with sequences of diatoms and the red alga *Chondrus crispus*. Phylogenesis using the plant nicotinate methyltransferase (NANMT)^[@CR55]^ as outgroup revealed that differentation of this group of genes from SMT of plants and green algae may have occurred very early and prior to specialization between SMT 1 and SMT2 (Supplementary Fig. [S6](#MOESM1){ref-type="media"}). We have not proved the catalytic function of this separate class of putative SMT but it is intriguing to speculate that their occurrence is related to the *E* stereochemistry of fucosterol that is found in diatom and red algae in contrast with the *Z* configuration of isofucosterol that is common in plants.Figure 4Un-rooted phylogenetic tree of sterol methyl transferase (SMT) of diatoms (Red square = *S. marinoi*; Green square = *C. cryptica*; Light blue spot = other diatom), plants and algae. Reactions catalyzed by SMT are shown next to each sub-family (SMT1, SMT2 and red-SMT). Alignment used maximum likelihood method. The bootstrapping test (replicate = 100) is reported on each node. SMT1 = sterol methyl transferase 1; SMT2 = sterol methyl transferase 2; redSMT = sterol methyl transferase of diatoms and red algae. In plants and microalgae, C5-sterol desaturase (DWARF7), 7-dehydrocholesterol reductase (DWARF5) and 24-sterol reductase (DWARF1) control the latest steps in the pathway for isomerization of the double bond in the B-ring and reduction of C24(C28)-double bond in the alkyl chain. Transcripts of *S. marinoi* and *C. cryptica* showed sequences homologous to DWARF7 and DWARF5 that grouped with putative proteins of other diatoms (similarities above 40%) and a query coverage ranged from 50% to 86% to proteins of *A. thaliana*. In particular, At-DWARF7 and At-DWARF5 are homologous to the putative proteins Sm-TR28093 and Sm-TR2636 of *S. marinoi*, as well as to Cc-TR48724 and Cc-TR24068 of *C. cryptica*. In agreement with these results, un-rooted phylogenetic trees constructed using DWARF7/C5SR/ERG3 and DWARF5/7DHCR from plants, animals, fungi and yeasts showed clusterization of diatom sequences in the plant branch (Supplementary Figs. [S7](#MOESM1){ref-type="media"} and [S8](#MOESM1){ref-type="media"}). Transcripts did not identify significant match with plant DWARF1 but indicated the presence of two putative sequences (Sm-TR213 and Cc-TR29411) with high similarity with Delta-(24)-sterol reductase (ERG4) from *Saccharomyces cerevisiae* and other fungi and yeasts (Fig. [5](#Fig5){ref-type="fig"}). Comparison versus different diatoms (*T. oceanica, T. pseudonana, P. tricornutum* and *F. cylindrus)* identified orthologous sequences of Sm-TR213 and Cc-TR29411, thus suggesting the wide occurrence and function of these genes in the lineage. Interestingly, the divergence of the diatom transcripts from the plant pathway for the reduction of the alkenyl group at C-24 is consistent with the β-stereochemistry of dihydrobrassicasterol and clionasterol in comparison to the α-orientation of campesterol and β-sitosterol in plants (Fig. [5](#Fig5){ref-type="fig"}). We have not been able to establish an unambiguous identification Δ~22~ sterols (trace components) in our study even if the molecular analysis of *C. cryptica* showed a transcript related to fungal 22-sterol reductase (ERG5) (Table [2](#Tab2){ref-type="table"}).Figure 5Un-rooted phylogenetic tree of 24-sterol reductases in diatoms, plants, algae, fungi and animals. Reactions catalyzed by each sub-family are shown next to the enzymatic groups. Alignment used maximum likelihood method. The bootstrapping test (replicate = 100) is reported on each node. Red square = *S. marinoi*; Green square = *C. cryptica*; Light blue spot = other diatom. DAWRF1 = plant 24-sterol reductase; SSR = plant sterol side chain reductase; 24-DHCR = animal 24-dehydrocholesterol reductase; 24(28)SR/ERG4 = fungal Delta(24(24)1))-sterol reductase. Biosynthesis of cholesterol and desmosterol {#Sec8} ------------------------------------------- In plants, cholesterol and related sterols are little common. Only recently, a biosynthetic pathway of cholesterol has been proposed on the basis of functional assays including gene silencing and reactivity of recombinant tomato proteins^[@CR7]^. According to this study, plant cholesterogenesis follows the Kandutsch-Russell pathways based on enzymes derived from the phytosterol biosynthesis after methylation of cycloartenol by sterol side chain reductase (SSR2)^[@CR56]^. In addition to phytosterols, *S. marinoi* produces desmosterol and cholesterol, while these products are absent in *C. cryptica*. Desmosterol is directly converted to cholesterol by 24-DHCR in animals but it has been seldom reported in plants. For these reasons, *S. marinoi* and *C. cryptica* can serve as useful models to study the cholesterol biosynthesis in diatoms and, in analogy to plants, to investigate whether enzymes of the phytosterol pathway are possibly utilized for cholesterogenesis in this microalgal lineage. Differential analysis of the two diatoms identified a sequence of a putative 24-DHCR (Sm-TR10998) that was present only in *S. marinoi*. Interestingly, Sm-TR10998 showed high similarity with the human 24-DHCR (Query coverage 94.7%; Positivies 67.4%) and, at less extent, with SSR2 of tomato (*Solanum lycopersicum*, Query coverage 92%; Positivies 53%) (Supplementary Fig. [S7](#MOESM1){ref-type="media"}). No similar sequences were found in *C. cryptica*. As showed in the un-rooted phylogenetic tree of Fig. [5](#Fig5){ref-type="fig"}, Sm-TR10998 clustered in the 24-DHCR branch together with homologous sequences of the diatoms *F. cylindrus* (NCBI accession number: OEU21854) and *Pseudo-nitzschia multistriata (*NCBI accession number: VEU38364*)* that are both able to biosynthesize cholesterol^[@CR32]^. In agreement with the evolutionary origin of diatoms, an ortholog of Sm-TR10998 was found in the red alga *C. crispus (*NCBI accession number: XP_005713924) that biosynthesizes sterol mixtures containing up to 94% of cholesterol^[@CR57]^. Discussion {#Sec9} ========== *C. cryptica* and *S. marinoi* are cosmopolitan diatom species that contribute significantly to phytoplankton blooms in temperate oceans. GC-MS profiling revealed a common mixture of sterols that is dominated by phytosterols with presence of cholesterol and desmosterol only in the latter species. These data are consistent with the literature that indicates major presence of C~27~ sterols in radial centrics like *S. marinoi*^[@CR32]^. As depicted in the biosynthetic proposal of Fig. [6](#Fig6){ref-type="fig"}, the route to the sterol skeleton of 24-methylene cholesterol, dihydrobrassicasterol, fucosterol and clionasterol from IPP and DMAPP can have high similarity with plants. 24-Methylene cholesterol is the most common sterol of diatoms^[@CR32]^ and a key intermediate of the biosynthesis of phytosterols. Despite this, levels of 24-methylene cholesterol in plants are usually low while this metabolite together with fucosterol and clionasterol (also known as γ-sitosterol) has been often reported in algae and lower invertebrates^[@CR6],[@CR9]^.Figure 6Proposed biosynthetic pathway of sterols in diatoms. Transcript sequences (Red = *S. marinoi*; Blue = *C. cryptica*) are in agreement with Table [1](#Tab1){ref-type="table"} and deposited under accession code SRP108217 and PRJNA561910. Red square = mammal sterols; Green square = phytosterols. In the literature, there are contrasting data about the biosynthesis of the isoprene units in diatoms. In fact, while *Rhizosolenia setigera*, *P. tricornutum*, and *Nitzschia ovalis* are reported to use mevalonate (MVA), *Haslea ostrearia* shows evidence for methylerythritol (MEP) as precursor of sterols^[@CR58],[@CR59]^. By feeding studies with labelled glucose, we proved origin of the sterol skeleton only by the MVA pathway in *C. cryptica* thus corroborating the results on desmosterol of *R. setigera* by incorporation of 1-^13^C acetate^[@CR58]^. The results of the labelling experiments found a match in the transcriptome sequences which showed a complete and expressed MVA pathway in *C. cryptica* (Fig. [2](#Fig2){ref-type="fig"}). Significantly, orthologs of these genes were well represented in the transcriptome of *S. marinoi*, as well as were found in the genome of *T. oceanica, T. pseudonana, P. tricornutum and F. cylindrus* (Supplementary Table [S2](#MOESM1){ref-type="media"}). After conversion of farnesyl pyrophosphate to squalene, the key step of the process is cyclization to cycloartenol by cycloartenol synthase (CAS) *via* squalene oxide. *C. cryptica* and *S. marinoi* showed a single copy of a plant-like CAS and the presence of a terbinafine-insensitive SQE, named AltSQE, that has been recently proposed to catalyze synthesis of squalene oxide in *S. marinoi* and other diatoms^[@CR50]^. The wide occurrence of 24-methylene cholesterol in diatoms^[@CR32]^ is consistent with the suggestion that, like in plants, methylation of the sterol side chain occurs very early in the biosynthetic process. In agreement with this view, the transcriptome analyses indicated the presence of different orthologs of plant SMT1, which are presumably responsible for C-24 methylation of cycloartenol to oryzanol^[@CR33],[@CR60]^. On the other hand, our results showed major differences between plants and diatoms for SMT2 that presides methylation of 24-methylenelophenol to yield C~28~ phytosterols. It is noteworthy that this divergence corresponds to the difference in the stereochemistry of fucosterol and isofucosterol (Fig. [4](#Fig4){ref-type="fig"}) that are the end products of these enzymes in diatoms and plants respectively. SMTs embrace a class of proteins that have inherited a high degree of sequence similarity from a common ancestor. Recently, Nes and coworkers have discussed the differences of SMTs in relation to substrate- and phylum-specificity in green algae^[@CR61]^ Our comparative analysis suggests that diatoms and the red alga *C. crispus* contain SMT sequences that may have evolved independently from plants, green algae and fungi. It is possible that diatoms have acquired these genes by the red alga that was engulfed during the secondary endosymbiotic event that is common to all stramenophiles, as well as we cannot exclude that these "red SMTs" can accept substrates other than 24-methylenelophenol. Further studies are necessary to prove the catalytic function of these proteins and the substrate specificity. However, the absence of scrambling of methyl groups in fucosterol and clionasterol indicates a high affinity of these enzymes for the substrates. The high and specific ^13^C-incorporation of phytosterols of *C. cryptica*, as well as the absence of isotopic scrambling, features the operation of a unique and straightforward route similar to brassinolide pathway. In support to this view, sequence alignment of the putative enzymes of *S. marinoi* and *C. cryptica* revealed high homology with the corresponding proteins of plants. We found only major divergences of the transcript sequences (Sm-TR213 and Cc-TR29411) related to the reduction steps leading from 24-methylene cholesterol and fucosterol to dihydrobrassicasterol and clionasterol, respectively. These latter compounds are common algal metabolites and, despite the structural similarities with campesterol and β-sitosterol of plants, are produced by stereochemical reduction that envisages a mechanism sharply different from that described for phytosterols^[@CR6]^. Accordingly, Sm-TR213 and Cc-TR29411 show high homology with fungal ERG4 that catalyzes hydrogen attack on 24-*si* face of the Δ24(28) double bond, which is consistent with the β-stereochemistry of the methyl and ethyl groups of dihydrobrassicasterol and clionasterol in *S. marinoi* and *C. cryptica* (Fig. [5](#Fig5){ref-type="fig"}). On the basis of the phylogenetic results, we suggest that reduction of 24-methylene cholesterol and fucosterol can be carried out by a single fungal-like Δ24(28)-sterol reductase. A similar hypothesis has been also put forward for the reduction of 24-methylene cholesterol and isofucosterol by a single 24-sterol reductase in plants^[@CR6]^. Differently from the report on *P. tricornutum*^[@CR33]^, *S. marinoi* and *C. cryptica* do not synthesise Δ~22~ sterols (e.g. diatomsterol). It is possible that the Δ~22~ unsaturation can be introduced in the late steps of the pathway by a 22-sterol desaturase similar to ERG5 that was detected in the transcripts of *C. cryptica*. However, the absence of typical fungal sterols (e.g. ergosterol) together with the lack of other molecular proofs argue against a fungus-like process for the sterol biosynthesis in these diatoms. Our data clearly indicated no lanosterol synthase genes in *S. marinoi* and *C. cryptica* thus highlighting origin of cholesterol and desmosterol from cycloartenol. This process has been recently proved in tomato that can synthesize C~27~, C~28~ and C~29~ sterols by a promiscuous pathway^[@CR7]^. Interestingly, despite the phylogenetic distances between tomato and diatoms, a certain degree of similarities can be identified in the sequences of key enzymes of sterol biosynthesis (Supporting Material). In tomato the divergence between cholesterol and phytosterols stems from the conversion of cycloartenol to cycloartanol by sterol side chain reductase enzyme (SSR2)^[@CR56]^. However, since this reaction occurs very early in the sequence of enzymatic steps leading to cholesterol, the pathway is not compatible with the synthesis of desmosterol. On the other hand, desmosterol can accumulate as terminal product in diatoms and red algae (e.g. *Porphyridium purpureum*). Desmosterol is mostly known as the immediate precursor of cholesterol in the Block pathway in animals including humans, as well as it is a common intermediate in the conversion of C~28~ and C~29~ plant sterols to cholesterol by the tobacco hornworm and other insects^[@CR11],[@CR62]^. Transcriptome of *S. marinoi* indicated a sequence (Sm-TR10998) with a predicted function related to 24-DHCR from *Homo sapiens*. The enzyme reduces desmosterol to cholesterol with the highest affinity for sterol skeleton lacking methyl groups at C-4, like desmosterol and 7,24-cholestandiol^[@CR63]^. Differently from the proposal role of SSR2 in tomato, this specificity and the finding of desmosterol in *S. marinoi* suggest occurrence of 24-reduction in the late steps of the pathway (Fig. [6](#Fig6){ref-type="fig"}). Orthologs of Sm-TR10998 occur in all known genomes of diatoms producing cholesterol^[@CR32]^, thus highlighting a general role of this enzyme in the lineage. In conclusion, we suggest that the sterol pathway of *S. marinoi* and *C. cryptica* preserves the general architecture recently described in Solanaceae plants with cyclization of squalene oxide to cycloartenol rather than lanosterol that is characteristic of the fungal genealogy^[@CR7]^. Major differences seem to be related to the putative enzymes that preside modification, namely methylation and reduction, of the alkyl side chain by enzymes encoded by genes probably derived from algae, fungi and animals. The acquisition of these genes explains well the composition and the stereochemistry of sterols in diatoms, as well as confirms the metabolic plasticity of these microalgae that are evolved through multiple events of symbiosis and horizontal gene transfer. Further studies are in progress to correlate the molecular data with biochemical tests. Methods {#Sec10} ======= General {#Sec11} ------- HPLC analyses have been performed on a Jasco system (PU-2089 Plus-Quaternary gradient pump equipped with a Jasco MD-2018 Plus photodiode array detector). Cell pellet were lyophilized by a Savan Micro Modulyo freeze dryer (Thermo Scientific, Austin, TX, USA). GC-MS analysis was carried out by an Ion-Trap Polaris Q MS instrument (Thermo) coupled to a Focus gas chromatograph (Thermo). ^1^H and ^13^C NMR spectra were recorded on Bruker DRX 600 spectrometer equipped with an inverse TCI CryoProbe. All chemicals and analytical grade solvents were purchased from Sigma Aldrich. Molecular and bioinformatics analyses were performed by Genomix 4Life s.r.l. (Baronissi, Salerno, Italy). Microalgae cultures {#Sec12} ------------------- Stock cultures of the diatom *Skeletonema marinoi* (CCMP 2092), *Skeletonema costatum, Pseudonitzchia arenysensis* (B758), *Thalassiosira weissflogii* (P09), *Cyclothella criptica* (CCMP 331) and *Phaeodactylum tricornutum* were purchased from Bigelow Laboratories. Strains were maintained in f/2 medium^[@CR64]^ in a growth chamber at 20 ± 2 °C under 14:10 light:dark cycle with a photon flux density of 100 μmol quanta m^−2^ sec^−1^. Cultures were harvested by centrifugation at 3750 rpm for 10 minutes at 12 °C using a swing-out rotor. Pellets were frozen in liquid nitrogen and stored at −80 °C until analysis. Labelling studies {#Sec13} ----------------- For biosynthetic experiments, *C. criptica* was incubated in 1 L-sterile culture flasks (TPP25--300 cm^2^) in prefiltered sterile (0.22 µm) f/2 medium supplemented with antibiotics according to published protocols^[@CR65],[@CR66]^. Under these conditions, cells were grown heterotrophically on 2 g L^−1^ of glucose or 1-^13^C-glucose in the dark at 20 ± 2 °C under constant gentle agitation. Cultures were harvested and stored at −80 °C until analysis, as described above. Sterol extraction and purification {#Sec14} ---------------------------------- After lyophilization, microalgal pellets were extracted by the modified Folch method. The oily residues were dried, reconstituted in diethyl ether and methylated by diazomethane (0.4 mL of a saturated ether solution per 10 mg extract). After removing the organic solvent under N~2~, sterols were purified on silica gel column (100 mg silica gel/ mg fraction). Homogeneous fractions of sterol mixtures were achieved in petroleum ether/diethyl ether 85:15 (v/v). Product elution was monitored by SiO~2~-TLC on 0.2-mm aluminum-coated sheets (Merck, Germany) developed with petroleum ether/ethyl ether (1:1; v/v). Final purification of sterols was carried out by HPLC on a reverse phase column (C18-Luna, Phenomenex, 5 μm 100 A 250 × 10 mm) by methanol/acetonitrile/water/iPrOHl/acetone (33:33:4:5:25; v-v) according to our published protocols^[@CR67],[@CR68]^. Elution was accomplished by a flow of 1 mL min^−1^ and monitored by UV absorbance at 210 nm. Sterol analysis {#Sec15} --------------- For GC-MS analysis, sterols were acetylated by Ac~2~O (100 µL/ 0.5 mg sample) in dry pyridine (500 µL/0.5 mg sample) under magnetic stirring overnight at room temperature. The excess of organic solvents was removed under N~2~ stream. GC-MS runs of acetylated sterols were carried out in EI mode (70 eV) by isocratic elution at 300 °C for 30 min, with a 5% diphenyl-polysiloxane capillary column (OV-5 column) (15 m x 0.32 mm ID, 0.10 µm) and helium as gas carrier. Samples dissolved in n-hexane were directly injected (2 μL) in split mode (1:10), with a blink window of 3 minutes, inlet temperature of 300 ° C, transfer line set at 310 ° C and ion source temperature of 300 ° C. Sterols were identified according to literature and for comparison with commercial standards^[@CR35]--[@CR40],[@CR69]--[@CR72]^. For NMR experiments (^1^H, ^13^C, COSY, TOCSY, HSQC), natural and standard sterols were dissolved in 700 µL CDCl~3~ and transferred to 5-mm NMR tube. For biosynthetic studies, ^13^C NMR spectra were acquired with a relaxation delay of 6 seconds to reduce the effect of longitudinal relaxation. Transcriptome analysis and bioinformatics {#Sec16} ----------------------------------------- RNA was extracted by Trizol method and RNA sequencing experiment was performed on three biological replicates for diatoms. Before use, RNA concentration in each sample was assayed with a ND-1000 spectrophotometer (NanoDrop) and quality was assessed with the Agilent 2100 Bioanalyzer with Agilent RNA 6000 nano kit (Agilent Technologies, Santa Clara, CA, USA). Indexed libraries were prepared from 4 μg/ea purified RNA with TruSeq Stranded mRNA Sample Prep Kit (Illumina) according to the manufacturer's instructions. Libraries were quantified using the Agilent 2100 Bioanalyzer (Agilent Technologies) and pooled such that each index-tagged sample was present in equimolar amounts, with a final concentration of the pooled samples of 2 nM. The pooled samples were subject to cluster generation and sequencing using an Illumina HiSeq. 2500 System (Illumina)in a 2 × 100 paired-end format at a final concentration of 8 pmol. Transcriptome was assembled using Trinity^[@CR73]^. The high-quality reads were selected as input to perform the transcriptome assembly and the resulting sequences were translated into proteins by using the longest complete ORF. The sequences of the assembled transcripts were translated into proteins with Transdecoder and the software Blast2GO was used to associate a function to identified transcripts. To compute abundance estimation, the high-quality reads were aligned to the Trinity transcriptome using bowtie2. Then, either RSEM is executed to estimate expression values based on the resulting alignments, generating the raw counts. In order to define the set of expressed genes, raw read counts were normalized using the TMM method (Trimmed mean). Phylogenetic analyses were refined by MEGA 6.0 software^[@CR74]^ and alignments were obtained by the MUSCLE algorithm. Phylogenetic trees were built by the maximum likelihood method with the LG + G substitution model (for CAS, 7DHCR/DWF5, SMT and 24-DHCR/DWF1) and LG + G + I (for C5SD/DWF7). Test of phylogeny was performed by the bootstrap method with a number of bootstrap replication equal to 100. Supplementary information ========================= {#Sec17} Supplementary Information and Supporting Material. **Publisher's note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. These authors contributed equally: Carmela Gallo, Simone Landi and Giuliana d'Ippolito. Supplementary information ========================= is available for this paper at 10.1038/s41598-020-60993-5. This study was supported by the project "Integrated Exploitation of Algal Biomass for Production of Energy" (PON01_02740) funded by the National Operational Program for Research and Competitiveness 2007--2013. The authors acknowledge the technical support of Mr Lucio Caso and Dr. Salvatore Morra. AF thanks the Doctorate School of Biology of the University of Naples "Federico II". C.G. carried out the experiments and supported bioinformatic analysis; S.L. performed bioinformatic analysis; G.N. and E.M. carried out chemical analysis, structure elucidation, sterol semisynthesis and sterol derivatization; A.S. gave support to development of culture conditions and diatom cultivation; G.dI. conceived the original idea and supervised the experiments; A.F. designed the study, planned and supervised the experiments, analyzed the data; A.F. wrote the manuscript in consultation with C.G., S.L., G.dI. and G.N. The raw sequencing data from this study have been submitted to the NCBI SRA database (<http://www.ncbi.nlm.nih.gov>). The RNA sequencing data of *S. marinoi* and *C. cryptica* have been deposited under accession code SRP108217 and PRJNA561910. The sterol related sequences of interest are reported in the Supplementary Material. All other supporting data from this study are available within the article and its Supplementary Information Files, or from the corresponding authors upon request. The authors declare no competing interests.

1. Field of the Invention This invention relates to water-based hydraulic fluids and metalworking compositions. 2. Prior Art In the technology of hydraulic power transmission, mechanical power is imparted to a fluid called "a hydraulic fluid" in the form of pressure by means of a hydraulic pump. Power is utilized where desired by tapping a source of said hydraulic fluid thus transforming the power as pressure back to mechanical motion by a mechanism called a hydraulic motor. The hydraulic fluid is utilized as a pressure and volume transmitting medium. Any non-compressible fluid can perform this function. Water is the oldest fluid used for this purpose and is still sometimes used alone for this purpose. In the prior art, there has been a heavy emphasis on the development of petroleum oils for use as hydraulic fluids and, consequently, much of the equipment utilized with hydraulic fluids has been designed and manufactured specifically for use with petroleum oils. A petroleum oil in comparison with water as a hydraulic fluid possesses the advantage of inhibiting the development of rust of the ferrous components of the mechanical equipment utilized in conjunction with hydraulic fluids, (i.e., hydraulic pumps, motors, etc.) and in preventing wear of the machinery since the hydraulic fluid must lubricate the equipment. Petroleum oils have a second advantage over the use of water as a hydraulic fluid in that the petroleum oils normally exhibit a substantially higher viscosity than water and thus contribute to reduction of the leakage of the fluid in the mechanical equipment utilized. In addition, the technology relating to additives for petroleum oils has developed to such an extent that the viscosity, foam stability, wear prevention and corrosion prevention properties of such petroleum oil-based hydraulic fluids can be further enhanced by the use of said additives. Over the past 25 years, various substitutes for petroleum oil-based hydraulic fluids have been developed in order to overcome one of the major deficiencies of petroleum oils, namely, flammability. Recent interest in the use of hydraulic fluids having up to 99 percent or more of water has resulted from the higher cost of petroleum oils and recent emphasis on problems of ecologically suitable disposal of contaminated or spent petroleum oil-based hydraulic fluids. Metalworking fluids of the so-called "soluble oil" type have been considered for use as hydraulic fluids. Such fluids contain mineral oil and emulsifiers as well as various additives to increase corrosion resistance and improve antiwear and defoaming properties. Such fluids, when used as hydraulic fluids, are not generally suitable for use in ordinary industrial equipment designed specifically for use with the petroleum oil-based hydraulic fluids since such fluids do not adequately prevent wear damage in pumps and valves of such equipment. However, such fluids have found application in specially designed, high cost, large size equipment which, because of said large size and thus inflexibility, is not suitable for use in most industrial plants. The soluble oil hydraulic fluid usage has thus been quite limited; usage has been largely confined to large installations where flexibility and size are not critical, such as in steel mills. It is known from U.S. Pat. No. 3,249,538 to prepare an aqueous lubricant concentrate and lubricating composition consisting essentially of molybdenum disulfide and a water-soluble viscosity increasing agent such as polyvinyl alcohol and an emulsifiable mineral oil. It is also known from U.S. Pat. No. 3,970,569 to prepare aqueous lubricating compositions containing a water-soluble mixed ester obtained by transesterification of a polyoxyethylene glycol and a triglyceride. It is also known from U.S. Pat. No. 3,933,658 that a mixture of a phosphate ester and a sulfur compound can be used in a water-based metalworking composition to obtain extreme pressure, antiwear and corrosion inhibiting properties. Such additives are used with a suitable vehicle such as mineral oil, vegetable oil, aliphatic acid ester, etc. The sulfur compounds disclosed are not sulfurized molybdenum compounds but rather are derivatives of 2-mercaptobenzothiazole. The phosphate esters and salts of the instant invention, however, are similar to those disclosed in this reference. These are alkylene oxide derivatives of an alkyl, aryl or aralalkyl phosphate which are converted in situ from the free acid form to the neutralized form wherein the phosphate ester is neutralized with an alkali or alkaline earth metal hydroxide or carbonate, ammonia or an amine. The use of these phosphate ester acids and the sodium or triethanolamine salts thereof in water-based metalworking fluids is suggested in ASLE Transactions 7, pages 398 to 405, at page 405. It is also known to use, in equipment designed for use in mineral oil-based hydraulic fluids, flame-resistant glycol-water based hydraulic fluids such as are disclosed in U.S. Pat. No. 2,947,699. Up until now, water-based hydraulic fluids containing about 70 to 95 percent water, have had very poor lubricating characteristics. While hydraulic fluids are used primarily to transmit forces, it is necessary that they provide lubrication for the impeller, rings, vanes, gears, pistons and cylinders and other mechanical parts of hydraulic pumps in such systems in order to prevent excessive wear on such parts. Many prior art fluids, such as the petroleum oil type, are highly flammable and unsuitable for certain uses where such fluids have frequently been the source of fire. Where these fluids are used to control such industrial operations as heavy casting machines, which are operated largely by hydraulic means, danger of fire exists. Therefore, there is a growing demand for hydraulic fluids characterized by reduced flammability. Hydraulic fluids obtained by blending water and a synergistic mixture of a phosphate ester, with a sulfur-containing compound, etc., and where desirable, a polyglycol type polymeric thickener to increase viscosity are disclosed in U.S. Pat. No. 4,138,346. The sulfur compounds employed in the patent are ammonia, amine or metal salts of 2-mercaptobenzothiazole or 5-, 6-, or 7-substituted 2-mercaptobenzothiazole. Molybdenum oxide phosphorodithioates are disclosed in U.S. Pat. No. 3,402,188 as useful as additives in power transmitting fluids. It appears that the power transmitting fluids with which these compounds may be used are those which are soluble in hydrocarbon compositions in view of the statement at the beginning of the patent: "Those which are soluble in hydrocarbon compositions have found uses as additives in gasolines, fuel oils, lubricating oils and greases, cutting oils, transformer oils, hydraulic fluids, and other power transmitting fluids." A hydraulic fluid or metalworking lubricant, of compositions having water as a base and yet possessing superior lubricating and wear preventing characteristics, is disclosed in U.S. Pat. No. 4,151,099. The fluids comprise (1) a water-soluble polyoxyethylated ester of an aliphatic acid and a monohydric or polyhydric aliphatic alcohol, either one or both said acid and said alcohol being polyoxyethylated, (2) a sulfurized molybdenum or antimony compound or alternatively mixtures of (1) and (2) with (3) a phosphate ester salt. In accordance with this patent, the water-soluble polyoxyethylated ester (1) is an essential component while the phosphate ester salt (3) may be employed but is not essential. In no one of the references discussed above is there any suggestion that a water-based hydraulic fluid or metalworking lubricant can be provided by combining (1) a sulfurized molybdenum or antimony compound with (2) a phosphate ester or salt thereof.

Introduction {#intro} ============ One-dimensional or quasi-one-dimensional magnetic systems show many fascinating properties which continue to attract an intense theoretical activity. One of these properties is the presence of a spin gap in antiferromagnetic Heisenberg chains with integer spin[@haldane] and in ladders.[@ladders] Another, particularly complex, system which presents a spin gap is the spin-Peierls (SP) system. In this system a Heisenberg chain coupled to the lattice presents an instability at a critical temperature, $T_{SP}$, below which a dimerized lattice pattern appears and a spin gap opens in the excitation spectrum.[@pytte] The interest in the spin-Peierls phenomena was recently revived after the first inorganic SP compound, CuGeO$_3$, was found.[@hase] This inorganic material allows the preparation of better samples than the organic SP compounds and hence several experimental techniques can be applied to characterize the properties of this system.[@regnault] Besides, this compound can be easily doped with magnetic and non-magnetic impurities, leading to a better understanding of its ground state and excitations.[@lussier] Spin-Peierls systems present also a very rich and interesting behavior in the presence of an external magnetic field. Below the spin-Peierls transition temperature, and for magnetic fields $H$ smaller than a critical value $H_{cr}(T)$, the system is in its spin-Peierls phase, characterized by a gapped nonmagnetic ($S^z=0$) ground state with a dimerized pattern or alternating nearest-neighbor (NN) interactions. For $T < T_{tc} < T_{SP}$, at $H=H_{cr}(T)$ a transition occurs from the dimerized phase to a gapless incommensurate (IC) state characterized by a finite magnetization, $S^z > 0$. $T_{tc}$ is the temperature of the point at which the dimerized, incommensurate and uniform phases meet. The dimerized-IC transition was predicted by some theories[@cross2] to be of first order at low temperatures, and this is the behavior found in experimental studies[@hase2; @loosd]. Other theories predict that this transition is a second order one.[@fujita] A simple picture of the dimerized-IC transition can be obtained by mapping the Heisenberg spin chain to a spinless fermion system by a Jordan-Wigner transformation. The effect of the magnetic field favoring a nonzero $S^z$ due to the Zeeman energy can be interpreted as a change in the band filling of the equivalent spinless fermion system. As a result, the momentum of the lattice distortion moves away from $\pi$ as $\tilde{q} = (1-S^z/N) \pi$, where $N$ is the number of sites on the chain. However, since [*umklapp*]{} processes pin the momentum at $\pi$ up to a critical field $H_{cr}(T)$, the lattice distortion will remain a simple dimerization and the magnetic ground state will remain a singlet.[@crossfisher] Theoretical[@fujita; @nakano; @buzdin] and experimental[@kiry; @fagot] studies indicate that the lattice distortion pattern in the IC phase corresponds to an array of solitons. A complementary picture indicating how a soliton lattice could appear as a consequence of the finite magnetization in the IC phase is the following. Let’s assume that the dominant contribution to the magnetic ground state comes from a state of NN singlets or dimers. An up spin replacing a down spin destroys a singlet and gives rise to two domain-walls or solitons separating regions of dimerized order which are shifted in one lattice spacing with respect to each other. Each soliton carries a spin-1/2. Due to the spin-lattice coupling it is expected that the lattice solitons are driven by these magnetic solitons. The soliton formation in spin-Peierls systems has been studied analytically by bosonization techniques applied to the spinless fermion model.[@affleck] The coupling to the lattice is treated usually in the adiabatic approximation. The resulting field-theory formalism has lead to important results, the most remarkable being the relation between the soliton width and the spin-Peierls gap, $\xi \sim \Delta^{-1}$.[@nakano] Although this formalism has been extended to a Heisenberg model with competing NN and next-nearest-neighbor (NNN) antiferromagnetic interactions[@zang2; @dobryriera], it presents some unsatisfactory features. In the first place, there are some recent experimental results[@kiry] for the soliton width in the IC phase in CuGeO$_3$ indicating a disagreement with the theoretical prediction. Although there might be a contribution to the soliton width coming from magnetic[@zang2] or elastic[@dobryriera] interchain couplings which would explain at least partially this disagreement, it is also possible that the differences could be due to several approximations involved in the bosonized field theory. One should take into account that these theories are valid in principle in the long wave-length limit, and the applicability of their results to real materials can not be internally assessed. Then, our first motivation to start a numerical study of the IC phase in spin-Peierls systems is to measure the importance of these approximations in the analytical approach. In the second place, the field theory approach does not provide a detailed dependence of the magnitudes involved in terms of the original parameters of the microscopical models. For example, even for the simplest case[@nakano] the expression obtained for the spin-wave velocity must be replaced by the exact one known from Bethe’s exact solution of the Heisenberg chain. In this sense, numerical studies could give information about how the relevant magnitudes depend on the original parameters without further approximations. With these motivations, in this article we want to initiate the study of the incommensurate phase in SP systems using numerical methods. These methods give essentially exact results for finite clusters, and they can be used to check various approximations required by the analytical approaches and the validity of their predictions. Besides, the numerical simulations provide a detailed information of the dominant magnetic and lattice states. In Section \[lanczos\] we present the model considered and we study several features of the soliton formation in the IC phase using the Lanczos algorithm. In particular we analyze the effect of NNN interactions on the soliton width. In Section \[monte\] we perform Monte Carlo simulations using the world line algorithm –which allows us to study larger chains than the ones accessible to the Lanczos algorithm– in order to reduce finite size effects. Exact diagonalization study {#lanczos} =========================== The one-dimensional model which contains both the antiferromagnetic Heisenberg interactions and the coupling to the lattice is: $$\begin{aligned} {\cal H} &=& J \sum_{i = 1}^N (1 + (u_{i+1}- u_{i}))\; {\bf S}_i \cdot {\bf S}_{i+1} \nonumber \\ &+& J_2 \sum_{i = 1}^N {\bf S}_i \cdot {\bf S}_{i+2} + \frac{K}{2} \sum_{i=1}^N (u_{i+1}- u_{i})^2 \label{hamtot}\end{aligned}$$ where ${\bf S}_i$ are the spin-1/2 operators and $u_i$ is the displacement of magnetic ion $i$ with respect to its equilibrium position. Periodic boundary conditions are imposed. The first term, which corresponds to the nearest neighbor (NN) interactions, contains the spin-lattice coupling in the adiabatic approximation. The second term contains the AF NNN interactions, which were proposed in Refs. \[\] to fit the experimental magnetic susceptibility data in CuGeO$_3$. Several other properties of this material have been reasonably described using this model.[@haas; @rierakoval; @poilblanc] As in Ref. \[\], we assume for simplicity that the lattice distortion does not affect the second neighbor interactions. In principle, the NNN interactions should be corrected by a term proportional to $(u_{i+2}- u_{i})$ which vanishes in the dimerized phase but not necessarily in the incommensurate phase. This correction should be important precisely in the region around a soliton. It is customary to introduce the frustration constant $\alpha= J_2/J$. The estimated value of $\alpha$ in CuGeO$_3$ varies between 0.24 (Ref. \[\]) and 0.36 (Ref. \[\]). In this second case, $\alpha$ is larger than the critical value $\alpha_c \approx 0.2411$ above which in the absence of dimerization a gap opens in the excitation spectrum.[@okamoto] Our purpose is to study numerically Hamiltonian (\[hamtot\]) with exact diagonalization (Lanczos) techniques and by Monte Carlo simulations. In this latter case, in order to avoid the well-known sign problem due to the frustration, we will consider only the diagonal second neighbor interaction $$\begin{aligned} {\cal H}_2^{zz} = J_2^{z} \sum_{i = 1}^N S_i^{z} S_{i+2}^{z}, \label{h2n-zz}\end{aligned}$$ instead of the isotropic NNN interactions (second term of Eq. \[hamtot\]). It is quite apparent that the main numerical difficulty is related to the handling of the set of displacements $\{u_i\}$, which in principle can take arbitrary values to describe the various distortion patterns present in the dimerized and IC phases of the system. These displacements are calculated self-consistently by the following iterative procedure. First, we introduce the bond distortions defined as $\delta_i = (u_{i+1}- u_{i})$. Then, the equilibrium conditions for the phononic degrees of freedom: $$\begin{aligned} \frac{\partial \langle {\cal H} \rangle}{\partial \delta_i} + \lambda = 0 \label{eqcond}\end{aligned}$$ lead to the set of equations: $$\begin{aligned} J \langle {\bf S}_i \cdot {\bf S}_{i+1} \rangle + K \delta_i - {J \over N} \sum_{i=1}^N \langle {\bf S}_i \cdot {\bf S}_{i+1} \rangle = 0 , \label{distor-eqn}\end{aligned}$$ which satifies the constraint $\sum_i \delta_i =0$. This constraint has been included in Eq. (\[eqcond\]) through the corresponding Lagrange multiplier $\lambda$. The expectation values are taken with respect to the ground state of the system. The iterative procedure starts with an initial distortion pattern $\{ \delta_i^{(0)} \}$, which in general we choose at random. At the step $n$, with a distortion pattern $\{ \delta_i^{(n-1)} \}$, we diagonalize Hamiltonian (\[hamtot\]) using the Lanczos algorithm and compute the correlations $\langle {\bf S}_i \cdot {\bf S}_{i+1} \rangle$. We replace these correlations in Eq. (\[distor-eqn\]) and the new set $\{ \delta_i^{(n)} \}$ is obtained. We repeat this iteration until convergence. Essentially the same procedure is followed in the quantum Monte Carlo algorithm, as it is discussed in Section \[monte\]. We have applied this exact diagonalization procedure to determine the distortion patterns in the 20 site chain at $T=0$. In the first place we consider the case of $S^z=0$. As mentioned above, this corresponds to a dimerized lattice, i.e. $\delta_i = (-1)^i \delta_0$. Notice that for this simple case, the equilibrium distortion amplitude $\delta_0$ could be determined in an easier way by computing the energies of the spin part of Hamiltonian for a set of values of $\delta_0$. Then, adding the elastic energy and interpolating one obtains the minimum total energy. We have performed this calculation in order to check our iterative algorithm. The results for $\delta_0$ vs. $K$, for $S^z=0$, are shown in Fig.1 for $\alpha = 0.0$, 0.2 and 0.4, and $J_2^{z} = 0.2$, and 0.4. It can be seen that, as expected, for $\alpha >0$ the dimerized state is more favorable and this leads to a larger $\delta_0$ for a given $K$. To a lesser extent this trend is also present for $J_2^{z} > 0$. The dependence of $\delta_0$ with $K$ can be inferred from the scaling relation between the energy and the dimerization, $E_0(\delta_0)-E_0(0) \sim \delta_0^{2\nu}$ (plus logarithmic corrections) with $\nu=2/3$, in principle valid for $\alpha < \alpha_c$ and small $\delta_0$.[@crossfisher; @spronken; @laukamp] Then, it is easy to obtain $\delta_0 \sim K^{-3/2}$, a relation which is approximately satisfied by our numerical data. The fact that $\delta_0$ vanishes at a finite value $\hat{K}$ of the elastic constant, is just a finite size effect. By diagonalizing chains of $N=12$, 16 and 20 sites, for $\alpha=0$, we have verified that $\hat{K}$ increases with the lattice size, as it can be seen in Fig. \[fig1.5\], and it should eventually diverge in the bulk limit. Once we have determined the equilibrium distortion as a function of $K$, we are able to compute the singlet-triplet spin gap, defined as the following difference of ground state energies: $$\begin{aligned} \Delta = E_{0,dim}(S^z=1)-E_0(S^z=0) \label{spingap}\end{aligned}$$ It is worth to emphasize that $E_{0,dim}$ is the ground state energy of the system for $S^z=1$ with the dimerization obtained for $S^z=0$ and the same set of parameters. The results of this calculation are shown in Fig. \[fig2\]. Consistently with the larger $\delta_0$ shown in Fig. \[fig1\], the gap increases with $\alpha$. The effect of $J_2^{z}$ is much weaker than that of the isotropic second neighbor interaction which is not surprising since the 1D ground state magnetic structure, with a dominant dimerized state, has essentially a quantum (off-diagonal) origin. This small increase in $\Delta$ for a given $K$ is consistent with the small increase in $\delta_0$ shown in Fig. \[fig1\]. The corresponding scaling relation, $\Delta \sim K^{-1}$, obtained from the relation between the singlet-triplet gap and the dimerization, $\Delta \sim \delta_0^{2/3}$, is again reasonably satisfied by our numerical data. . \[fig2\] We now consider the case of $S^z=1$, which corresponds to the incommensurate region just above the dimerized-incommensurate transition. We have determined the distortion pattern for a 20 site chain using the iterative procedure described above. As discussed at the beginning of this section, the two solitons or domain walls separating dimerized regions are clearly distinguishable. (A typical pattern can be seen in Fig. \[soliton\].) The maximum distortion $\delta_0$, shown in Fig. \[fig3\], presents similar behavior as the one shown in Fig. \[fig1\] corresponding to $S^z=0$. In particular, the fact that $\delta_0$ vanishes at a finite $K$ is again due to finite size effects. In order to compute the soliton width, we use the following form to fit the numerically obtained distortion patterns: $$\begin{aligned} \delta_i = (-1)^i \tilde{\delta} \tanh \left(\frac{i-i_0 - {\frac d 2}}{\xi} \right)\tanh \left(\frac{i-i_0+{\frac d 2}}{\xi}\right), \label{fittanh}\end{aligned}$$ which corresponds to modeling each soliton as an hyperbolic tangent, as obtained in the analytical approach to this problem.[@nakano] The amplitude $\tilde{\delta}$, the soliton width $\xi $, and the soliton-antisoliton distance $d$, are the parameters determined by the numerical fitting. The amplitude $\tilde{\delta}$ should be equal to the maximum distortion $\delta_0$ defined above for well separated solitons, i.e. $d \gg \xi$. The main limitation of this calculation arises in the region where, for a given $\alpha$, $K$ is so large that the solitons have a substantial overlap in the 20 site chain, and the fitting function (\[fittanh\]) is no longer appropriate. In this case, the elliptic sine should be used to describe the soliton lattice. This is the region where finite size effects are important, as it was discussed above with respect to Figs. \[fig1\] and \[fig3\]. However, this situation is not directly relevant to experiment since in real materials the solitons are well-separated.[@kiry] We show in Fig. \[fig4\] the soliton width as a function of the gap $\Delta$ for the 20 site chain, for the same values of $\alpha$ and $J_2^{z}$ as before. It can be seen that the there is a linear dependence of the soliton width with the inverse of the gap. This behavior is consistent with the theoretical prediction:[@nakano] $$\begin{aligned} \xi =v_s/\Delta, \label{width-gap}\end{aligned}$$ where $v_s$ is the spin-wave velocity for $\alpha < \alpha_c$. It was recently shown that the relation (\[width-gap\]), originally obtained for the unfrustrated chain,[@nakano] is also valid in the presence of frustration.[@dobryriera] For $\alpha > \alpha_c$, $\Delta$ contains a contribution from the frustration due to the presence of a gap even in the absence of dimerization. A linear fitting of these curves in the region $\xi > 2.5$ gives the slopes 1.87, 1.70 and 1.63 , for $\alpha =0.0,\;0.2$ and $0.4$ respectively. Recently, a numerical study[@fledder] has proposed the law: $v_s=\frac \pi 2 (1-1.12 \alpha )$ in the bulk limit for $\alpha < \alpha_c$, From this law one gets $v_s =$ 1.57, 1.22, for $\alpha =0.0$ and $0.2$ respectively. We can observe that the slopes obtained by fitting the curves shown in Fig. (\[fig4\]) are systematically larger than these values of $v_s$. Besides, the effect of $\alpha$ is weaker in the numerical data than that predicted by Eq. (\[width-gap\]). For $\alpha= 0.4 > \alpha_c \approx 0.2411$, we have estimated $v_s$ by fitting the excitation dispersion relation $\varepsilon(k) = E_{0,dim}(S^z=1,k) - E_0(S^z=0,k=0)$ with the law $\varepsilon(k)^2 = \Delta^2 + v_s^2 k^2 + c k^4$ around $k=0$ and $\delta_i =0$. For $L=20$ we obtained $v_s = 0.707$, a value which is also smaller than the slope of the curve $\xi$ vs. $1/\Delta$ for $\alpha=0.4$ in Fig. (\[fig4\]). This disagreement between the prediction obtained by the continuum bosonized theory and the numerical results could be due to the approximations involved in the former or to finite size effects present in the latter. The study of much larger lattices than those considered in this section will be done in the following section using quantum Monte Carlo simulations. On the other hand, for the case of $J_2^z = 0.4$ the slope is actually [*larger*]{} ($\approx 2.1$) than the value obtained for the Heisenberg chain with NN interactions only. This effect is opposite to that of the isotropic NNN interactions and it will be further discussed in the next section. Monte Carlo simulations {#monte} ======================= In order to treat longer chains than those considered in the Lanczos diagonalization study of the previous section, we have implemented a world-line Monte Carlo algorithm[@WLMC] suited to this problem. The partition function is re-expressed as a functional integral over wordline configurations, where the contribution on each imaginary-time slice is given by the product of the two-site evolution matrix elements, $$\begin{aligned} W_{i,i+1}(\tau )=\langle S_{i,\tau }^zS_{i+1,\tau }^z\left| {\rm e}^{- \Delta \tau J_i {\bf S}_i \cdot {\bf S}_{i+1}}\right| S_{i,\tau +\Delta \tau }^zS_{i+1,\tau +\Delta \tau }^z\rangle \nonumber\end{aligned}$$ where $J_i = J(1 + \delta_i)$. These matrix elements are the Boltzmann weights associated with a bond ($ i,i+1$) in a time step $\Delta \tau =1/mT$ in the Trotter direction, where $ T $ is the temperature and $m$ is the Trotter number. Since the exchange couplings depend on the lattice displacements, these matrix elements are site dependent. We implemented the algorithm with the addition of a dynamic minimization of the free energy with respect to the lattice displacements. Starting from a given initial configuration (random distribution of spins and a dimerized pattern for the lattice displacements) we typically considered $2\times 10^3$ sweeps for thermalization. During the next $4\times 10^3$ sweeps we measured the derivative of the magnetic free energy, which, in the limit of $T \rightarrow 0$, is given by $$\frac{\partial {\cal F}_M}{\partial \delta _i}=J\langle \langle {\bf S}_i {\bf \cdot S}_{i+1}\rangle \rangle _T \ . \label{DF}$$ Leaving 3 sweeps between each measurement for de-correlation this produces $10^3$ independent values to obtain the thermal average. With this free-energy gradient we corrected the displacements according to (\[distor-eqn\]) and repeated the procedure, including the $2\times 10^3$ sweeps for thermalization since the spins have to accommodate to the new lattice distorsions. Once the displacement pattern is stabilized within statistical fluctuations —we typically considered $\sim $150 iterations, see Fig. \[150\]— we performed measurements of several quantities. For this we obtained 100 independent groups of $10^3$ measurements each, following the same procedure as described above, [*i.e.*]{}, i) thermalization, ii) measurements of $\frac{\partial {\cal F}_M}{\partial \delta _i}$ and observables, and iii) correction of the displacement pattern due to statistical fluctuations. In our calculations we considered chains of 64 sites with periodic boundary conditions and a temperature $T=0.05J$. We checked that this value is low enough to study ground-state properties by comparison with measurements at even lower temperatures. On the other hand, at higher temperatures the soliton is not observed and there is no definite pattern of lattice displacements. We took $m=80$ for the Trotter number, which is large enough to reproduce the Lanczos results on smaller chains (see Fig. \[fig1.5\]). For some particular quantities like the energy gap, which require more precision, we considered also $m=160.$ In addition, comparison with results for a longer chain with $N=128$ indicates that in the parameter range of our calculations the Monte Carlo results have no sizeable finite-size effects. In Fig. \[fig1.5\] we show the Monte Carlo results for the homogeneous dimerization of the 64 site chain in the $S^z=0$ subspace as a function of the elastic constant $K$, together with the Lanczos results for smaller chains. Notice that in the parameter range considered the 64 site chain does not have the finite size effects present for smaller chains, namely, the vanishing of $\delta_0$ for finite values of $K$. The inset shows the expected scaling behavior $\delta \propto K^{-3/2}$ discussed in the previous section. As a further check, we have also reproduced the scaling behavior of the energy gain $E_0(\delta_0)-E_0(0)$ and gap with $\delta_0$ with a measured exponent $\nu =2/3$ within statistical errors. =9.00cm The soliton structure in the subspace with $S^z=1$ is given in Fig. \[soliton\], where we plot the displacement envelope $\widetilde{\delta }_i=(-)^i\delta_i$ and the local magnetization $\langle S_i^z\rangle $ , for different values of the elastic constant $K.$ Notice that the displacements are normalized by their maximum values (shown in Fig. \[fig1.5\]) and the local magnetization by the classical value $S=1/2.$ Consequently, the size of lattice distortions in different panels cannot be directly compared. For small values of $K$ there is a well defined soliton-antisoliton structure in the distortion pattern, with the associated local magnetization following a staggered order. There is a net $1/2$ spin density near each domain wall, which makes the excess $S^z=1$. As in the previous section, we fitted a two-soliton solution (\[fittanh\]), with $\tilde{\delta }_0=1$ because of the normalization adopted. The results for the soliton width $\xi$ are shown in Fig. \[xi-k\]. For increasing values of $K$ the soliton width grows until the displacement profile resembles a sine law (see Fig. \[soliton\]). This sinusoidal pattern is typical of the soliton lattice, observed for large values of $S^z$. It can be seen that the scaling $\xi \sim K$ obtained in \[\] is well reproduced in the whole parameter range considered, as indicated by the linear fit to the data (dashed line). This figure shows that the soliton width for $J_2^z = 0.3$ also presents a linear dependence with $K$. These features observed in the 64 site chain are qualitatively similar to those present in the 20 site chain as determined by exact diagonalization. Besides, it can seen in this figure that the reduction of $\xi$ is much stronger when the isotropic NNN is taking into account. We have performed a simple study on the soliton-antisoliton interaction. For this study we fixed the distortion pattern to the law (\[fittanh\]) with the previously fitted value of $\xi ,$ and considered increasing values of $d.$ For small $K$ ($\leq 2J$) we found that the total energy becomes a constant (within statistical fluctuations) when $ d\geq 4\xi ,$ which implies that the soliton-antisoliton pairs shown in the left panels of Fig. 4 are not interacting. This was confirmed by allowing the lattice distortion to evolve starting from a pattern like (\[fittanh\]) with an initial separation larger than $d,$ which produces the same result for $\xi $ and the total energy. Next, we study the behavior of the soliton width $\xi $ with the spin-Peierls gap $\Delta $. That is, we compare the quantity $\xi $ that characterizes the $S^z=1$ soliton state, with the singlet-triplet excitation gap $\Delta $ above the dimerized $S^z=0$ ground state. As shown in Fig. \[xi-gap\], these two quantities are inversely related to each other, as discussed in the previous section. The slope of the linear fit is $1.9$, very close to the value 1.87 obtained by exact diagonalization of the 20 site chain in the previous section. This result confirms the disagreement between the numerical results with the analytical prediction pointed out in Section \[lanczos\]. Also shown in Fig. \[xi-gap\] are the results for $J_2^z = 0.3$. A linear fit to these results leads to a slope $\approx 2.3$ , i.e. larger than the value corresponding to $J_2^z = 0.0$. This increase of the slope between $\xi$ and $\Delta^{-1}$ is consistent with the result obtained for the 20 site lattice by exact diagonalization and $J_2^z = 0.4$. This behavior should be contrasted with the [*reduction*]{} of the slope found for the isotropic NNN interaction. A possible explanation of this behavior could be the following. As discussed in the previous section, the term ${\cal H}_2^{zz}$ leads to a smaller increase of the spin gap than the fully isotropic NNN interaction. On the other hand, the Ising interaction could be more effective in punishing the excess $\langle S^z \rangle$ which appears around a soliton leading to a smaller reduction of the soliton width than the one caused by the isotropic term, as it can be seen in Fig. \[xi-k\]. A more detailed study of the Hamiltonian in the presence of the term of ${\cal H}_2^{zz}$ is clearly necessary to fully understand this behavior. Finally, it is possible to estimate the critical value of the magnetic field at zero temperature. By adding a Zeeman term to the Hamiltonian (\[hamtot\]), $-g \mu_B S^z H$ ($\mu_B$: Bohr’s magneton), $H_{cr}$ may be calculated as: $$\begin{aligned} H_{cr} = E_0(S^z=1)-E_0(S^z=0) \label{hmagcrit}\end{aligned}$$ in units of $g \mu_B$. $E_0(S^z=1)$ is the ground state energy of (\[hamtot\]), and then $H_{cr} < \Delta$, which is the value expected of a gapped system in the absence of magneto-elastic coupling. The behavior of $H_{cr}$ as a function of $\Delta$ is shown in Fig. \[hcritvsgap\] for the 64 site chain, $\alpha=J_2^z=0.0$, and for the 20 site chain, $\alpha=J_2^z=0.4$. It is apparent a linear dependence over all the range studied, which is in agreement with the mean-field prediction[@pytte; @crossfisher], $H_{cr} \approx 0.84 \Delta$. However, we obtain a coefficient considerable smaller, $H_{cr}/\Delta \approx 0.47$, almost independent of $\alpha$. This value is also smaller than twice the soliton formation energy calculated in Ref. \[\]. The finite value at the origin of the curves corresponding to $\alpha=J_2^z=0.4$ is a finite size effect. Conclusions {#conclu} =========== In this article we have analyzed the magnetic soliton lattice in the incommensurate phase of spin-Peierls systems using numerical methods. There is a remarkable agreement between the results obtained by exact diagonalization using the Lanczos algorithm and those obtained by quantum Monte Carlo with the world-line algorithm. The relations among various features of the solitons and magnetic properties of the system have been determined and compared with analytical results. Our starting point is a microscopical model proposed to describe several properties of CuGeO$_3$, consisting of a 1D AF Heisenberg model with nearest and next-nearest neighbor interactions. In the first place we have not detected any crossover in the behavior of the quantities examined as $\alpha$, the ratio of NNN to NN interactions, becomes greater than $\alpha_c$ at least for the small chains considered. That is, there are only smooth changes as $\alpha$ varies between 0.0 and 0.4. The most important effect of the competing NNN interaction is a [*reduction*]{} of the soliton width $\xi$ as a function of the inverse of the singlet-triplet spin gap $\Delta$. Furthermore, the effect of the diagonal term (\[h2n-zz\]) is much less important and in some cases even qualitatively different to that of the isotropic NNN term. Although several functional forms predicted by continuum analytical theories have been confirmed by our numerical data, there are some important quantitative differences. The most important disagreement between our numerical results and the analytical predictions is related to the coefficient in the relation $\xi \sim \Delta^{-1}$, i.e. we have obtained a systematically higher value than the theoretical value which is the spin-wave velocity. The estimated value of $H_{cr}/\Delta$ is also noticeable smaller than the mean-field result and slighly smaller than the prediction of bosonized field theory. The relevance of these numerical results to real SP materials, such as CuGeO$_3$ and the recently discovered NaV$_2$O$_5$,[@navo] has to be determined experimentally. The numerical procedures developed in this article could be applied to the study of several other properties of the incommensurate phase of spin-Peierls systems, such as the static magnetization as a function of the magnetic field (recently measured in CuGeO$_3$ by Fagot-Revurat [*et al.*]{}[@fagot]) and the order of the transition from the dimerized to the incommensurate phases.[@loosd] F. D. M. Haldane, Phys. Rev. Lett. [**50**]{}, 1153 (1983). For a recent review see [*Physics Today*]{}, Search and Discovery, pg. 17 October 1996. E. Pytte, Phys. Rev. B [**10**]{}, 2309 (1974). M. Hase, I. Terasaki and K. Uchinokura, Phys. Rev. Lett. [**70**]{}, 3651 (1993). L. P. Regnault [*et al.*]{}, Phys. Rev. B [**53**]{}, 5579 (1996). J.-L. Lussier [*et al.*]{}, J. Phys. Condens. Matter [**7**]{}, 325 (1995). M. C. Cross, Phys. Rev. B [**20**]{}, 4606 (1979). M. Hase [*et al.*]{}, Phys. Rev. B [**48**]{}, 9616 (1993). P. H. M. van Loosdrecht [*et al.*]{}, Phys. Rev. B [**54**]{}, 3730 (1996). M. Fujita and K. Machida, J. Phys. Jpn [**53**]{}, 4395 (1984). M.S. Cross and D.S. Fisher, Phys. Rev. B [**19**]{}, 402 (1979). T. Nakano and H. Fukuyama, J. Phys. Jpn [**49**]{}, 1679 (1980). A. I. Buzdin, M. L. Kulic, and V. V. Tugushev, Solid State Commun. [**48**]{}, 483 (1983). V. Kiryukhin [*et al.*]{}, Phys. Rev. Lett. [**76**]{}, 4608 (1996); V. Kiryukhin [*et al.*]{}, Phys. Rev. B [**54**]{}, 7269 (1996). Y. Fagot-Revurat [*et al.*]{}, Phys. Rev. Lett. [**77**]{}, 1861 (1996). I. Affleck, [*Fields, Strings and Critical Phenomena*]{}, edited by E. Brézin and J.Zinn-Justin (North-Holland, Amsterdam, 1990), pg. 563. J. Zang, S. Chakravarty and A.R. Bishop, cond-mat/9702185. A. Dobry and J. Riera, (to be published). J. Riera and A. Dobry, Phys. Rev. B [**51**]{}, 16098 (1995). G. Castilla, S. Chakravarty and V.J. Emery, Phys. Rev. Lett. [**75**]{}, 1823 (1995). S. Haas and E. Dagotto, Phys. Rev. B [**52**]{}, 14396 (1995). J. Riera and S. Koval, Phys. Rev. B [**53**]{}, 770 (1996). D. Poilblanc [*et al.*]{}, Phys. Rev. B, to appear (1997). K. Okamoto and K. Nomura, Phys. Lett. A [**169**]{}, 433 (1992). G. Spronken, B. Fourcade, and Y. Lépine, Phys. Rev. [**33**]{}, 1886 (1986), and references therein. Numerical calculations indicate that this relation still holds with an exponent $\nu$ close to 2/3, for $\alpha > \alpha_c$, at least for not too small $\delta_0$ and $\alpha < 1/2$; M. Laukamp and J. Riera, (to be published). A. Fledderjohann and C. Gros, cond-mat/9612013. J. E. Hirsch [*et al.*]{}, Phys. Rev. B [**26**]{}, 5033 (1982). M. Isobe and Y. Ueda, J. Phys. Soc. Jpn. [**65**]{}, 1178 (1996); M. Weiden, R. Hauptmann, C. Geibel, F. Steglich, M. Fischer, P. Lemmens and G. Güntherodt, preprint cond-mat/9703052.

The present invention relates to improvements in a wire electric discharge machining method and a wire electric discharge machine in which an electric discharge is induced in a gap formed between a wire electrode and a workpiece so that the workpiece can be machined. Electric discharge machining has acquired a steadfast position as a technique for machining metallic dies and others. Therefore, electric discharge machining has been widely used for machining metallic dies in the automobile industry, electric appliance industry and semiconductor industry. FIGS. 4A to 4E are schematic illustrations for explaining a mechanism of electric discharge machining. In the drawing, reference numeral 1 is an electrode, reference numeral 2 is a workpiece, reference numeral 3 is an arc column, reference numeral 4 is a machining solution and reference numeral 5 represents chips produced in the process of electric discharge machining. While the following processes (a) to (e), which correspond to FIGS. 4A to 4E, are being repeatedly conducted, removal machining is conducted on the workpiece 2 by electric discharges. Each process proceeds as follows. (a) Formation of the arc column 3 by the generation of electric discharges (b) Local melt of the workpiece and vaporization of the machining solution 4 by the thermal energy of electric discharges (c) Generation of vaporizing explosive power by the machining solution 4 (d) Dispersion of the melted portion (chips 5) (e) Cooling, coagulation and restoration of insulation between the electrodes executed by the machining solution The present invention relates to wire electric discharge machining used for gouging, cutting and so forth. Concerning the technique of wire electric discharge machining, there is a strong demand for higher accuracy. For example, when metallic dies used in the field of manufacturing semiconductors, the dimensional accuracy of which is high, are machined, it is necessary to conduct machining with high accuracy of 1 to 2xcexcm. FIGS. 5A to 5C are schematic illustrations showing an example of the wire electric discharge machining process. In the drawing, reference numeral 1a is a wire electrode, reference numeral 2 is a workpiece, reference numeral 4a is water which is a machining solution, and reference numeral 6 is an initial hole. FIG. 5A shows a first cut process which is a rough machining process, FIG. 5B shows a second cut process which is an intermediate finishing process to be conducted after the rough machining process, and FIG. 5C shows a third cut process which is a final finishing process. An example of the first cut process shown in FIG. 5A shows a gouging process in which the wire electrode 1a is threaded into the initial hole 6 and the workpiece 2 is gouged by electric discharges. In the case of the first cut process described above, since the surface roughness and the accuracy are finished in the later process, it is unnecessary to machine the workpiece with smooth surface roughness high accuracy, and it is important to increase a rate of machining so as to enhance the productivity. In order to enhance the rate of wire electric discharge machining, water 4a is strongly jetted out between the electrodes so that chips can be effectively ejected from between the electrodes. In order to spray water 4a between the electrodes uniformly and prevent the breaking of the wire electrode 1a, a method is adopted in which water 4a is stored up in a machining tank not shown and the workpiece 2 is dipped in the water 4a. In the conventional wire electric discharge machining method described above, the second cut process (shown in FIG. 5B), which is executed after the first cut process (shown in FIG. 5A), and the third cut process (shown in FIG. 5C), are executed in the water 4a which is a machining solution. When a voltage is impressed between the wire electrode 1a and the workpiece 2, an electrostatic force is generated between the positive and the negative polarity. By this electrostatic force, the wire electrode 1a, the rigidity of which is low, is drawn onto the workpiece 2 side, which could be a cause of vibration of the wire electrode 1a. Due to the vibration, it becomes difficult to conduct electric discharge machining with high accuracy. When vaporizing explosive power is generated in the machining solution by electric discharge energy (for example, as shown in FIG. 4C), the wire electrode 1a is given a strong force by the vaporizing explosive power created in the machining solution in a direction opposite to the workpiece 2, and vibration is generated. Due to the vibration, irregularities are caused on the profile of the workpiece 2, which impairs the dimensional accuracy. In the industry of semiconductors in which wire electric discharge machining is utilized, the following uses are increased. For example, in the case of machining metallic dies of IC lead frames, very high accuracy and very smooth surface roughness are required when a workpiece is machined, the dimensional accuracy of which is not more than 1 xcexcm, and the surface roughness of which is not more than 1 xcexcm Rmax, and further it becomes necessary to enhance the productivity. Especially, in the case where high accuracy and smooth surface roughness are required as described above, remarkable problems are caused by the aforementioned vibration of the wire electrode. As a means for solving the above problems caused in wire electric discharge machining conducted in the machining solution, there is disclosed a technique of wire electric discharge machining conducted in the atmosphere while a machining solution is not being interposed between the electrodes. This technique is disclosed by the title of xe2x80x9cEnhancement of Accuracy of Second Cut by Electric Discharge Machining Conducted in Atmospherexe2x80x9d written by Adachi et al. of Tokyo University of Agriculture and Technology on page 154 of the seventh issue of the fourteenth volume of xe2x80x9cDie Technologyxe2x80x9d published by Nikkan Kogyo Shinbunsha in 1999. According to this technique, it is disclosed that the straightness of a cut section of a workpiece can be enhanced by wire electric discharge machining conducted in the atmosphere. From the viewpoint of enhancing the accuracy, this technique has a great significance. However, it is difficult to put this technique into practical use because a short circuit tends to occur between the wire electrode and the workpiece compared with the electric discharge machining conducted in a machining solution and the machining can not be stabilized and the rate of machining can not be increased. It is an object of the present invention to provide a wire electric discharge machining method and a wire electric discharge machine capable of realizing the high accuracy and quality of wire electric discharge machining and also capable of realizing the enhancement of productivity of wire electric discharge machining. The present invention provides a wire electric discharge machining method in which electric discharge is generated between the electrodes of a wire electrode and a workpiece so as to machine the workpiece by the electric discharge, comprising the steps of: a first step of conducting rough machining in a machining solution; and a second step of conducting finish machining in gas, wherein a relative traveling speed of the wire electrode with the workpiece in the second step is set at a constant speed not lower than a predetermined speed at which a short circuit between the electrodes can not continue for a predetermined period of time and more which has been previously set according to a required specification. The present invention also provides a wire electric discharge machining method in which electric discharge is generated between the electrodes of a wire electrode and a workpiece so as to machine the workpiece by the electric discharge, comprising the steps of: a first step of conducting rough machining in a machining solution; and a second step of conducting finish machining in gas, wherein a relative traveling speed of the wire electrode with the workpiece in the second step is set at a variable speed not lower than a predetermined speed at which a short circuit between the electrodes can not continue for a predetermined period of time and more which has been previously set according to a required specification. The present invention also provides a wire electric discharge machining method, in which the variable relative traveling speed is controlled so that it can be increased in the case where the number of normal electric discharge pulses per unit time is large, and the variable relative traveling speed is controlled so that it can be decreased in the case where the number of normal electric discharge pulses per unit time is small. The present invention also provides a wire electric discharge machining method, in which the predetermined traveling speed at which the short circuit can not continue for a predetermined period of time and more which has been previously set according to the required specification is compared with the predetermined traveling speed at which a frequency of concentrated generation of electric discharge is lower than a frequency which has been previously set according to the required specification, and the relative traveling speed is controlled so that it can be a speed not lower than the faster speed of the two traveling speeds. The present invention provides a wire electric discharge machine in which electric discharge energy is supplied between a wire electrode and a workpiece by a machining electric power supply means so as to machine the workpiece in gas when the wire electrode and the workpiece are relatively traveled with each other by a positioning means, comprising a control means for controlling the positioning means so that a relative traveling speed of the wire electrode with the workpiece can be set at a constant speed not lower than a predetermined speed at which a short circuit between the electrodes can not continue for a predetermined period of time or more which has been previously set according to a required specification. The present invention also provides a wire electric discharge machine in which electric discharge energy is supplied between a wire electrode and a workpiece by a machining electric power supply means so as to machine the workpiece in gas when the wire electrode and the workpiece are relatively traveled with each other by a positioning means, comprising a control means for controlling the positioning means so that a relative traveling speed of the wire electrode with the workpiece can be set at a variable speed not lower than a predetermined speed at which a short circuit between the electrodes can not continue for a predetermined period of time and more which has been previously set according to a required specification. The present invention also provides a wire electric discharge machine, further comprising a control means for controlling the variable relative traveling speed so that it can be increased in the case where the number of normal electric discharge pulses per unit time is large and also for controlling the variable relative traveling speed so that it can be decreased in the case where the number of normal electric discharge pulses per unit time is small. The present invention also provides a wire electric discharge machine, further comprising a control means for controlling the positioning means in such a manner that the relative traveling speed is controlled so that it can be a speed not lower than the faster speed of the two traveling speeds when the predetermined traveling speed at which the short circuit can not continue for a predetermined period of time and more which has been previously set according to the required specification is compared with the predetermined traveling speed at which a frequency of concentrated generation of electric discharge is lower than a frequency which has been previously set according to the required specification. Since the wire electric discharge machining method and the electric discharge machine of the present invention are composed as described above, it is possible to enhance the stability of wire electric discharge machining conducted in gas and further it is possible to increase the rate of machining. Therefore, the accuracy, quality and productivity of wire electric discharge machining can be enhanced.

Clicks Vs Impressions Clicks Vs Impressions In search engine marketing, or PPC marketing, the words impression and click are occasionally intertwined. They’re both ways of measuring the effectiveness of your advertising campaign, but do you know what the difference is between the two? And which is better in terms of measuring engagement? Impressions are the most basic interaction you can have with someone’s ad.It’s the number of times your ad, whether it’s a image, button, or text link, has been (or will be) exposed to a potential viewer. In simpler terms, this is the number of times your ad appeared on any computer, cell phone or other device. You might say what’s the point of an impression? Well, you can’t have a click without an impression right? For example, you wouldn’t buy a shirt online without seeing an image of it first before clicking to see more of a description. Now for clicks. A click-through rate is the actual number of times someone clicks on your ad and is taken to your website. This is the best way to manage the effectiveness of your ad because it takes the guesswork out of the equation. You will know how many visitors to your website were directly linked to that ad. The more clicks, the more engaging that ad is. Having a good ad isn’t enough though. Your website should be engaging and interactive in order to keep visitors on it long enough to contact you to learn more about what you offer. Just as we mentioned above, you need an impression in order to get a click. Likewise, you need a click in order to get a conversion. This is why clicks are so important to measure. It’s important to know the difference between these two terms because it will make a difference in how you measure the effectiveness of your Pay-Per-Click campaign.

Entertainment news and trivia for film fans and animal lovers. Sit. Stay. Read. Note: This is a seattlepi.com reader blog. It is not written or edited by the P-I. The authors are solely responsible for content. E-mail us at [email protected] if you consider a post inappropriate.. Posts filtered on Tag BBC “The thing about Doctor Who – it’s very hard to explain without sounding like a lunatic…it sounds a bit nonsensical…I’m not going to explain it…Just watch it once and you’ll want to watch it again.” -David Tennant, the tenth Doctor Are you new to WHO? BBC wants you! Just check out the season premiere or […] [Read More] Note: This is a seattlepi.com reader blog. It is not written or edited by the P-I. The authors are solely responsible for content. E-mail us at [email protected] if you consider a post inappropriate..

tex1010 wrote:Does anyone know if STCL has a minimum LSAT score requirment to be eligible for a merit scholarship? I would assume that they offer scholarships to students that can increase their medians, so I would assume that if you're above a 153 LSAT you should be in the running for some money. Man, I'd like to think that (hope you are right), but I am just unsure if that's going to happen.(check LSN) I took a look at their past cycles there, and I saw some 153s and 154s with some scholarship money. Also, I just KNOW that they give out more scholarship money than LSN would indicate. Or they're very, very miserly. tex1010 wrote:Does anyone know if STCL has a minimum LSAT score requirment to be eligible for a merit scholarship? I would assume that they offer scholarships to students that can increase their medians, so I would assume that if you're above a 153 LSAT you should be in the running for some money. Man, I'd like to think that (hope you are right), but I am just unsure if that's going to happen.(check LSN) I took a look at their past cycles there, and I saw some 153s and 154s with some scholarship money. Also, I just KNOW that they give out more scholarship money than LSN would indicate. Or they're very, very miserly. I try not to be but I am a very spiteful man. If I do not hear back from South Texas by March 18th I wouldn't go if it was free. Idiotic yes, childish definitely. obviously they wouldnt care either way but on pure principle of putting me through such agonizing torture for a school of their level or tier I just cant understand it. I mean yale, pitt, lsu, columbia wutever drag me out till april 20th and ill be on the first plane. But really South Texas? I mean really lol well id have to go if it was free, but id have an angry face every class. Im well above all the standards, like everyone in my range gets accepted according to that chart, wtf First time posting...Does anyone know the chances of someone getting into South Texas with a 2.8 and 158 LSAT? This is my first choice of school and I'm really anxious. I was told that by the end of March most of the decisions would be made. Do they really take into serious consideration factors such as: working full-time throughout undergrad and drastic improvements in GPA over the course of undergrad? OoOLaLa wrote:First time posting...Does anyone know the chances of someone getting into South Texas with a 2.8 and 158 LSAT? This is my first choice of school and I'm really anxious. I was told that by the end of March most of the decisions would be made. Do they really take into serious consideration factors such as: working full-time throughout undergrad and drastic improvements in GPA over the course of undergrad? I would say you have an above-average shot at getting into South Texas...say around 60-65%. OoOLaLa wrote:First time posting...Does anyone know the chances of someone getting into South Texas with a 2.8 and 158 LSAT? This is my first choice of school and I'm really anxious. I was told that by the end of March most of the decisions would be made. Do they really take into serious consideration factors such as: working full-time throughout undergrad and drastic improvements in GPA over the course of undergrad? I would say you have an above-average shot at getting into South Texas...say around 60-65%. Thanks, I'm so nerved up because reading this thread it seems like many people are still in limbo not knowing. I hope to hear something by the end of March. They don't even start making decisions until Feb. Got mine Feb 7 and still have not heard about scholarship. I would love to go here, bc a lot of my friends are moving to houston and there are a lot of opportunities in the field i want to practice. (and i got waitlisted at u of h) But they have been terrible at responding to my questions, slow about getting decisions made for admissions and scholarships, and generally weak effort from their admissions office compared to other schools. I don't want to discourage anyone else from going bc I'm sure it's a fine school, but they have mostly just annoyed me this cycle. TheGetUpKid wrote:They don't even start making decisions until Feb. Got mine Feb 7 and still have not heard about scholarship. I would love to go here, bc a lot of my friends are moving to houston and there are a lot of opportunities in the field i want to practice. (and i got waitlisted at u of h) But they have been terrible at responding to my questions, slow about getting decisions made for admissions and scholarships, and generally weak effort from their admissions office compared to other schools. I don't want to discourage anyone else from going bc I'm sure it's a fine school, but they have mostly just annoyed me this cycle. I would really like to go here because I work full-time & they offer a part-time program. From what I've been reading, it's not even worth the time to go to Thurgood Marshall. TheGetUpKid wrote:They don't even start making decisions until Feb. Got mine Feb 7 and still have not heard about scholarship. I would love to go here, bc a lot of my friends are moving to houston and there are a lot of opportunities in the field i want to practice. (and i got waitlisted at u of h) But they have been terrible at responding to my questions, slow about getting decisions made for admissions and scholarships, and generally weak effort from their admissions office compared to other schools. I don't want to discourage anyone else from going bc I'm sure it's a fine school, but they have mostly just annoyed me this cycle. I try and stay optimistic and think they just have a lot on their plate, but I have only called over their once and they just seemed like they really did not want to speak to me. I have been more impressed with the admissions at every other school i have spoken too. TheGetUpKid wrote:They don't even start making decisions until Feb. Got mine Feb 7 and still have not heard about scholarship. I would love to go here, bc a lot of my friends are moving to houston and there are a lot of opportunities in the field i want to practice. (and i got waitlisted at u of h) But they have been terrible at responding to my questions, slow about getting decisions made for admissions and scholarships, and generally weak effort from their admissions office compared to other schools. I don't want to discourage anyone else from going bc I'm sure it's a fine school, but they have mostly just annoyed me this cycle. I would really like to go here because I work full-time & they offer a part-time program. From what I've been reading, it's not even worth the time to go to Thurgood Marshall. TheGetUpKid wrote:They don't even start making decisions until Feb. Got mine Feb 7 and still have not heard about scholarship. I would love to go here, bc a lot of my friends are moving to houston and there are a lot of opportunities in the field i want to practice. (and i got waitlisted at u of h) But they have been terrible at responding to my questions, slow about getting decisions made for admissions and scholarships, and generally weak effort from their admissions office compared to other schools. I don't want to discourage anyone else from going bc I'm sure it's a fine school, but they have mostly just annoyed me this cycle. I would really like to go here because I work full-time & they offer a part-time program. From what I've been reading, it's not even worth the time to go to Thurgood Marshall. True statement. +111111They don't rank 3/4 tiers, but I'd be willing to bet TSU is like 195+/200 I will agree, STCL's lack of rolling admissions is frustrating (and I only had to wait a week after Feb. 15, I'm sure you'll be getting that admit email any day now, Tonio), but they have been consistently saying that the scholarship info will be released by the end of March (I guess they wanna get a good number of admissions out of the way before they start handing out money), and I haven't had any problems with the Admissions Dept, but I have heard (I think it was from txadv11) that the Administration can sometimes be frustrating, but it's a good school overall. Also, as to the TSU thing, all of it is credited. It would be free for me to go there, but I would rather work at Mickey D's than gamble with my future by going there.

<?xml version="1.0" encoding="utf-8"?> <!-- /* ** ** Author: Jishnu Mohan <[email protected]> ** Copyright © 2013-2014 Jishnu Mohan, Swathanthra Malayalam Computing (SMC), International Centre for Free and Open Source Software (ICFOSS) ** ** Licensed under the Apache License, Version 2.0 (the "License"); ** you may not use this file except in compliance with the License. ** You may obtain a copy of the License at ** ** http://www.apache.org/licenses/LICENSE-2.0 ** ** Unless required by applicable law or agreed to in writing, software ** distributed under the License is distributed on an "AS IS" BASIS, ** WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ** See the License for the specific language governing permissions and ** limitations under the License. */ --> <merge xmlns:latin="http://schemas.android.com/apk/res-auto" > <include latin:keyboardLayout="@xml/key_styles_common" /> <Row latin:keyWidth="7.692%p" > <include latin:keyboardLayout="@xml/rowkeys_tamil_inscript1" /> </Row> <Row latin:keyWidth="7.692%p" > <include latin:keyboardLayout="@xml/rowkeys_tamil_inscript2" /> </Row> <Row latin:keyWidth="7.692%p" > <include latin:keyboardLayout="@xml/rowkeys_tamil_inscript3" latin:keyXPos="3.846%p" /> <Key latin:keyStyle="deleteKeyStyle" latin:keyWidth="fillRight" latin:visualInsetsLeft="1%p" /> </Row> <Row latin:keyWidth="7.692%p" > <Key latin:keyStyle="shiftKeyStyle" latin:keyWidth="11.538%p" latin:visualInsetsRight="1%p" /> <include latin:keyboardLayout="@xml/rowkeys_tamil_inscript4" /> <Key latin:keyStyle="shiftKeyStyle" latin:keyWidth="fillRight" latin:visualInsetsLeft="1%p" /> </Row> <include latin:keyboardLayout="@xml/row_pcqwerty5" /> </merge>

Disruptive: Synthetic Biology In this inaugural episode, radio host Terrence McNally discusses with Wyss Core Faculty Pam Silver and George Church the high-impact benefits of their synthetic biology work, as well as how they manage potential unintended consequences. Listen and subscribe on Soundcloud.

(833)) + 3 - ((sqrt(833) + 1)*-6 + sqrt(833) - sqrt(833))) + ((sqrt(833) + 0)*-6 - sqrt(833) - (-1 + sqrt(833))*3) + 5)**2. -952*sqrt(17) + 13617 Simplify sqrt(7)*3*1 + (sqrt(7) + 1)*-3 + (-5*(sqrt(448) + (sqrt(448)*-1 - sqrt(448))) - sqrt(448))**2 + 2. 7167 Simplify ((sqrt(704) + 3)*-3 + (sqrt(1584) - (sqrt(1584) - (sqrt(1584) - 1*(0 + sqrt(1584)))))*-1)**2. 432*sqrt(11) + 6417 Simplify -6*(-2*-1*(sqrt(77) + (sqrt(77) - -1*sqrt(77))*-5 + sqrt(77) + sqrt(77)))/((3*sqrt(110)*-1)/((sqrt(70)*-2)/sqrt(7))). 56*sqrt(7) Simplify 0 + (sqrt(128)/sqrt(4))**2 + -3 + sqrt(72)*-1 - (6*(-3 + (sqrt(242)*1 - sqrt(242)) - (-4 + (sqrt(242) + 1 - sqrt(242)))))**2. -6*sqrt(2) + 29 Simplify (6*(sqrt(495) - (sqrt(495) + sqrt(495) + 6*(3*sqrt(495) + sqrt(495))))/(sqrt(35)/sqrt(7)*-6*3))**2. 6875 Simplify (((sqrt(19)*2 - sqrt(19) - sqrt(19))*4 - (sqrt(19) + sqrt(38)/sqrt(2))*4) + 5 - (sqrt(1216) + sqrt(1216) + -3 + 2 + -4))**2. -480*sqrt(19) + 11044 Simplify (4 + -1 + -6*2*(sqrt(304) - (-1 + -1 + sqrt(304) + sqrt(304)))*6 + 5)**2. -78336*sqrt(19) + 1594432 Simplify 3 + 2*sqrt(28)/sqrt(4) + -5 + ((sqrt(63) + sqrt(1575))*5 + 5)**2. 902*sqrt(7) + 56723 Simplify 0 + 2 + (sqrt(98) - (1*sqrt(98)*-1)**2 - (1 + ((sqrt(98) + 2 - sqrt(98)) + sqrt(98))**2)) + -3. -202 - 21*sqrt(2) Simplify ((3*(-5 + (2*(sqrt(1100) + 0) - (sqrt(1100) + -4*sqrt(1100)*-1))) + 4)*4)**2. 31680*sqrt(11) + 1427536 Simplify ((3 + (sqrt(245) - (1 + sqrt(245))) + 3)*1 - (1 + (1 + sqrt(245) - sqrt(245)))*6*-3)**2. 1681 Simplify (sqrt(576)*3*3*4)/((sqrt(1620)*-2)/(sqrt(1000) - (2*sqrt(1000) + sqrt(1000) + sqrt(1000) + sqrt(1000)))). 960*sqrt(2) Simplify sqrt(425) + 2 + 0 + -3 + sqrt(425)*1 - (-4 + 2*sqrt(425) - (-1 + sqrt(425) - sqrt(425))*-3)**2. -1750 + 150*sqrt(17) Simplify -2*(sqrt(132) - (sqrt(132) - (sqrt(132) + (sqrt(132)*-3 - sqrt(132)))*-2))/(sqrt(396)*-3) + -4 + 4. 4*sqrt(3)/3 Simplify (6*sqrt(105)/(sqrt(49)/(sqrt(7)*-1)))/((sqrt(300) - (sqrt(300) + sqrt(300)*2 + sqrt(300) - sqrt(300)))*-4 - -2*1*sqrt(300)). -3*sqrt(5)/50 Simplify -1 + (2*sqrt(91)*-4 - sqrt(91)*1*5)/(sqrt(56)/sqrt(2) - ((sqrt(7) - sqrt(112)*3 - sqrt(7)) + sqrt(7)))*5. -5*sqrt(13) - 1 Simplify ((4*(sqrt(252) + -1) - (4 + sqrt(252) + 0))**2 - (2*sqrt(252) + 3 + sqrt(252) + sqrt(252) + -1 + sqrt(252) + -3)) + 0 + 1. -318*sqrt(7) + 2334 Simplify sqrt(13) + (-1 + sqrt(13))*5 - ((sqrt(91) - (sqrt(91) - 2*sqrt(91)))/sqrt(7))**2 - (sqrt(1053)*-3 + 2)*1. -59 + 33*sqrt(13) Simplify (-1 + (-1 + sqrt(68))**2 + 2*sqrt(68)*-2 - (5*sqrt(68)*2 - (4 + sqrt(68) + 1)))*-1. -73 + 30*sqrt(17) Simplify (-3*sqrt(1008)*2 - sqrt(1008)) + -4 + sqrt(1008) + (sqrt(1008) + 1)**2 - (-3 + 3*3*(-1 + sqrt(7))). -57*sqrt(7) + 1017 Simplify (-1 + 1 + 4*-2*(sqrt(343) - (sqrt(343) + (3*sqrt(343) - sqrt(343))) - sqrt(343)) + -1)**2 + 1. -336*sqrt(7) + 197570 Simplify 5*(((sqrt(16) + sqrt(144)*-4)*3)/(-1*sqrt(16)/(sqrt(12)/sqrt(6))) + 4)**2. 1320*sqrt(2) + 10970 Simplify (-1 + -2*-5*(-1 + (sqrt(700) + 6*(0 + sqrt(700) - sqrt(700)) - (sqrt(700) - (sqrt(700) + -5 + -2 + sqrt(700) + sqrt(700)))) + -4))**2. -72600*sqrt(7) + 644641 Simplify 2 + 6*(sqrt(325))**2*4 - 4*(-3*(sqrt(156) - (sqrt(156) - sqrt(156)*-2)))/sqrt(12). -24*sqrt(13) + 7802 Simplify 0 + ((1*sqrt(27)/sqrt(3) + sqrt(9))/(sqrt(18)/sqrt(96)) - ((-4 + sqrt(3) + -2 + sqrt(3))**2 + sqrt(3) + sqrt(432))). -48 + 19*sqrt(3) Simplify (sqrt(847) + -4 + -1)**2*5 + 4 - ((sqrt(847) - 3*sqrt(847))**2 + 3 + -2*(sqrt(847) - (sqrt(847)*-1)**2)). -528*sqrt(7) - 721 Simplify 1 + (((2*sqrt(363) + sqrt(363))*-5)**2 - (sqrt(363) + (-6*(sqrt(363) - 1*sqrt(363)))**2)) + (1 + sqrt(363))**2 + 3 + -2 + 0. 11*sqrt(3) + 82041 Simplify ((-6*sqrt(108)*-2)/(-1*sqrt(1452)))/(-1*sqrt(363)*-2 + sqrt(363) - sqrt(363)*-2*-4). 12*sqrt(3)/605 Simplify ((-1*((sqrt(132) - -1*sqrt(132)) + sqrt(132)) + sqrt(132) + (-3*(sqrt(132)*2 - sqrt(132)) - sqrt(132)))/(sqrt(72)/sqrt(6)*5 + 1*sqrt(12)*3))**2. 99/16 Simplify -4 + -2*((sqrt(539)*2)**2 + 0)*3*6 + 5. -77615 Simplify ((((-2 + sqrt(243))*-5 + sqrt(243) + 2 + -3)**2 - ((2 + sqrt(243) - sqrt(243))*5*1)**2) + 5)*-5. -19370 + 3240*sqrt(3) Simplify ((-4 + sqrt(1088))*-4*5)**2 - 6*(3 + sqrt(136)/(sqrt(8) + sqrt(512) + sqrt(8))). -128003*sqrt(17)/5 + 441582 Simplify 4*sqrt(1088) + 4*(-1 + sqrt(17)) - (-6*(sqrt(187)*1 + sqrt(187)) - sqrt(187))/(sqrt(539) + -2*sqrt(539)). -4 + 239*sqrt(17)/7 Simplify ((-6*sqrt(352)*-2 + (-5*sqrt(352)*2 - sqrt(352)))*2)/(-5*(sqrt(288) - (sqrt(288)*2 + sqrt(288) + sqrt(288) - sqrt(288))) + -2*sqrt(288)*1). sqrt(11)/12 Simplify (-6*(sqrt(187) + (6*sqrt(187) + sqrt(187) - sqrt(187)) + sqrt(187))*4)/(-1*(sqrt(539)*-2 + sqrt(11)))*-3. 576*sqrt(17)/13 Simplify (-6*1*(-1*(sqrt(90)*2 + sqrt(90) - sqrt(90)))/((-2*2*sqrt(10))/sqrt(5)) + 3)**2. -54*sqrt(5) + 414 Simplify 1*((sqrt(1088)*4*4)**2 + sqrt(612) + -5 + -1*sqrt(612) + sqrt(612)) + 3. 6*sqrt(17) + 278526 Simplify 5 + -3 + (1*-4*sqrt(500)*-2*1)**2 + -3 + -1. 31998 Simplify ((((sqrt(85)*3 - sqrt(85)) + sqrt(85))*-6 - sqrt(85))*-3)/(sqrt(10)/(sqrt(6)/(sqrt(3) + sqrt(30)/sqrt(10)))). 57*sqrt(17)/2 Simplify (-4 + 5*(-4 + 1*sqrt(539) + sqrt(539) + -1 + 2*sqrt(539) - (1 + (sqrt(539)*-2 + sqrt(539) - sqrt(539)) + 3)))**2. -20580*sqrt(11) + 487501 Simplify 5*(3 + (5*(sqrt(187) + sqrt(187)*1 + sqrt(187))*-5)/(sqrt(891) - ((sqrt(891) - (sqrt(891)*3 - sqrt(891)) - sqrt(891)) + sqrt(891))*-2)). 15 + 125*sqrt(17)/3 Simplify (-1 + -4 + -5 + (-1*sqrt(72) - sqrt(72) - sqrt(72)) + -5 + 5 + -1)**2*-2. -1538 - 792*sqrt(2) Simplify -1*(((sqrt(176)*-1 + sqrt(176))*4)/(sqrt(484) + sqrt(484) + sqrt(484) + -1*sqrt(484) + sqrt(484) + sqrt(484)) + 0). 0 Simplify 3 + (4 + -3*((sqrt(68) - 2*(sqrt(68) + 0 + sqrt(68))**2) + (sqrt(68)*1 + 3)**2 + -4))*-1. -1414 + 42*sqrt(17) Simplify -3*(-1 + (2*sqrt(147) - sqrt(147)) - (sqrt(147) - (sqrt(147) + 0 + -2)) - (-1*(-2 + (0 + sqrt(147) - sqrt(147)))*-3)**2). -21*sqrt(3) + 117 Simplify (1*((sqrt(847) - (sqrt(847) + -1))*-5 - (3 + sqrt(847) + 0 + sqrt(847))) + -1*sqrt(847)*6*1 + -3)**2. 1936*sqrt(7) + 54329 Simplify ((((-2*sqrt(80) + sqrt(80))*3)**2 - (sqrt(80) + sqrt(80) + sqrt(80)*1)**2*2) + -2 + 0)*-1. 722 Simplify ((6*-2*sqrt(209) + sqrt(209))*3)/((sqrt(121) + sqrt(121)*1)/sqrt(11) + sqrt(77)/(sqrt(21)/sqrt(3)))*1. -11*sqrt(19) Simplify 0 + (-2 + (sqrt(931) - (sqrt(931) + sqrt(931) + sqrt(931) + 1 + 4)))**2 - ((-4*sqrt(931))**2*-4 - ((2 + sqrt(931) - sqrt(931)) + -1)). 196*sqrt(19) + 63358 Simplify (-5*sqrt(64) + (sqrt(40)/sqrt(160) - sqrt(4)))/(-1*sqrt(200)*5 - ((sqrt(200) + 2*sqrt(200))*2 - sqrt(200))). 83*sqrt(2)/400 Simplify -4 + ((((sqrt(19) - (sqrt(304) + -1)) + 5)**2 - ((sqrt(19) - -3*(sqrt(19) + 1)) + 5)) + 0)*-5. -999 + 200*sqrt(19) Simplify ((-3*(sqrt(228)*-1 - sqrt(228)))/(sqrt(36)/sqrt(3)*1) - ((sqrt(2736)*2 - sqrt(2736)) + 2 + sqrt(19) + -5))**2. -42*sqrt(19) + 940 Simplify 1*((sqrt(80)/(sqrt(5) + sqrt(80)*-4))/((sqrt(288)*-2 + sqrt(288))*-6))**2. 1/145800 Simplify 5*(-1 + sqrt(1900)*-2)*-6 + (-5 + sqrt(1900)*-2)*1 + 5. 30 + 580*sqrt(19) Simplify (-2 + 4*(4*(sqrt(1088) + 2 + sqrt(1088)) - (-1 + sqrt(1088) + -1 + sqrt(1088))) + -2 + -3 + -5)**2. 10752*sqrt(17) + 627472 Simplify (-3*-2*sqrt(320)*-2)/((sqrt(1440) - sqrt(1440)*-1)*1 + 3*-1*sqrt(1440)). 4*sqrt(2) Simplify (-2*(-3*sqrt(3400) - sqrt(3400))*4)/(sqrt(128)*-6 - (sqrt(32) + sqrt(192)/sqrt(6))). -40*sqrt(17)/7 Simplify ((-5*(-1 + sqrt(720) + 1))**2 + (sqrt(720) + (sqrt(720) - (sqrt(720)*2 - sqrt(720)))*5)*-6)*1. -72*sqrt(5) + 18000 Simplify (sqrt(11) + (sqrt(121)/(sqrt(11)*-5))**2 - (-5*sqrt(539))**2) + (4*(sqrt(55) + (sqrt(55) - sqrt(495))))/(sqrt(45)*3). -336864/25 + 5*sqrt(11)/9 Simplify (4*-2*sqrt(833)*4 - ((sqrt(102)/sqrt(6) + 1)**2 - sqrt(85)/sqrt(125)))*-6 + 3. 111 + 6774*sqrt(17)/5 Simplify (-2 + 3*-5*(-2*sqrt(2736) - sqrt(2736)) - (((sqrt(95)*2 - sqrt(95)) + sqrt(95))*1)/(sqrt(60)/(2*sqrt(12)) - sqrt(5)))**2. -2176*sqrt(19) + 5622788 Simplify -4 + ((sqrt(135)*1*5)/((sqrt(18)/sqrt(3))/sqrt(2)))/(2*(sqrt(90)/(sqrt(20)/sqrt(2)) - (sqrt(81) - sqrt(9))*-6)). -4 + 5*sqrt(5)/26 Simplify (-3*(4*(3*sqrt(99) + 0) + (sqrt(99) - -2*sqrt(99)*-1) + -3)*4)**2. -28512*sqrt(11) + 1726272 Simplify -6*3*6*1*2*(sqrt(200) + (sqrt(200)*-1)**2 + sqrt(200))*-6. 25920*sqrt(2) + 259200 Simplify (6*(4 + (sqrt(425) - (4*(sqrt(425) + -2) + sqrt(425)))))**2 - (

Howard Simons Howard Simons (June 3, 1929 - June 13, 1989) was the managing editor of the Washington Post at the time of the Watergate scandal, and later curator of the Nieman Foundation for Journalism at Harvard University. Early life and education Simons was born to a Jewish family and raised in Albany, New York, and received a BA from Union College in Schenectady in 1951 and a master's degree a year later from the Columbia University Graduate School of Journalism. After service in the Korean War, he became a science reporter in Washington for several news organizations, and joined The Post as a science writer in 1961. He became assistant managing editor in 1966 and managing editor in 1971. Watergate coverage According to Carol Felsenthal of Politico Magazine, Simons took the first phone call, on June 18, 1972, from Democratic National Committee general counsel Joseph Califano Jr., about a break-in, the night before, at DNC headquarters at the Watergate complex. Simons took charge and with help from fellow editors Barry Sussman and Harry Rosenfeld, guided Woodward and Bernstein, and championed the young reporters for what became a national story. Simons is credited with dubbing Mark Felt, their well-placed source, "Deep Throat," in reference to the pornographic film of the same name. "When the time came, it was managing editor Howard Simons--not Ben Bradlee or other ranking editors--who made the crucial early decisions that led to the Washington Posts extraordinary coverage of the Watergate scandal, especially the decision to allow the metropolitan staff, which did not normally report on national politics, to pursue the story." The Great Cover-Up by Barry Sussman, page 66. Simons was portrayed by Martin Balsam in All the President's Men, the 1976 film based on Bernstein and Woodward's book of the same name, depicting the Post's investigation of Watergate. After The Washington Post Simons left The Post for a position as Curator at The Nieman Foundation for Journalism at Harvard university in 1984. Simons authored Jewish Times: Voices of the American Jewish Experience, (Houghton-Mifflin, 1988), and Simons' List Book (1977). He edited two books with Joseph A. Califano, Jr., The Media and the Law and The Media and Business, and in 1986 wrote a spy novel with Haynes Johnson called The Landing. A well-known quotation attributed to Simons: "People who are funny and smart and return phone calls get much better press than people who are just funny and smart." He stepped down from the Nieman position on May 25, 1989, on medical leave, and succumbed to pancreatic cancer three weeks later, aged 60. A scholarship named after him assists minority students aspiring in journalism (see). References Epstein, Noel. Howard Simons, Ex-Managing Editor of Post and Nieman Curator, Dies. Washington Post, June 14, 1989. Jones, Alex S. Howard Simons Dies at Age 60, an Ex-Editor at Washington Post. New York Times, June 14, 1989. Category:1929 births Category:1989 deaths Category:Deaths from pancreatic cancer Category:Harvard University staff Category:Writers from Albany, New York Category:Union College (New York) alumni Category:Columbia University Graduate School of Journalism alumni Category:Jewish American journalists

High-Intensity Bowel Protocol for Trauma Patients. Internal performance improvement data showed extended length of stay (LOS) in addition to an increased number of patients with constipation. This study was designed to evaluate the number of hospital days a trauma patient with opioid use had a bowel movement (BM) utilizing a high-intensity bowel protocol compared with the standard hospital bowel protocol. This was a retrospective analysis of the trauma registry at a Level I trauma center from 2 different time periods to assess the number of hospital days that patients had a BM. These patients had a traumatic mechanism of injury that required admission to the hospital with a LOS equivalent to 3 or more days. Other data analyzed included age, gender, injury severity score (ISS), morphine equivalents (ME), and hospital days with a BM. A total of 282 patients were included in the final analysis. Group 1 represented the standard hospital bowel protocol (n = 166), and Group 2 represented the high-intensity bowel protocol (n = 116). No significant difference was calculated between age, gender, ISS, or ME per day. A significant difference was observed with the number of hospital days with a BM between these 2 groups. The group with the high-intensity bowel protocol exhibited more days with a BM than the standard bowel protocol group (p < .05). The high-intensity bowel protocol averaged 1 BM every 2 days, whereas the standard hospital bowel protocol averaged 1 BM every 3 days. There was no significant change in LOS.

Symfony Debug Extension for PHP 5 ================================= This extension publishes several functions to help building powerful debugging tools. It is compatible with PHP 5.3, 5.4, 5.5 and 5.6; with ZTS and non-ZTS modes. It is not required thus not provided for PHP 7. symfony_zval_info() ------------------- - exposes zval_hash/refcounts, allowing e.g. efficient exploration of arbitrary structures in PHP, - does work with references, preventing memory copying. Its behavior is about the same as: ```php <?php function symfony_zval_info($key, $array, $options = 0) { // $options is currently not used, but could be in future version. if (!array_key_exists($key, $array)) { return null; } $info = array( 'type' => gettype($array[$key]), 'zval_hash' => /* hashed memory address of $array[$key] */, 'zval_refcount' => /* internal zval refcount of $array[$key] */, 'zval_isref' => /* is_ref status of $array[$key] */, ); switch ($info['type']) { case 'object': $info += array( 'object_class' => get_class($array[$key]), 'object_refcount' => /* internal object refcount of $array[$key] */, 'object_hash' => spl_object_hash($array[$key]), 'object_handle' => /* internal object handle $array[$key] */, ); break; case 'resource': $info += array( 'resource_handle' => (int) $array[$key], 'resource_type' => get_resource_type($array[$key]), 'resource_refcount' => /* internal resource refcount of $array[$key] */, ); break; case 'array': $info += array( 'array_count' => count($array[$key]), ); break; case 'string': $info += array( 'strlen' => strlen($array[$key]), ); break; } return $info; } ``` symfony_debug_backtrace() ------------------------- This function works like debug_backtrace(), except that it can fetch the full backtrace in case of fatal errors: ```php function foo() { fatal(); } function bar() { foo(); } function sd() { var_dump(symfony_debug_backtrace()); } register_shutdown_function('sd'); bar(); /* Will output Fatal error: Call to undefined function fatal() in foo.php on line 42 array(3) { [0]=> array(2) { ["function"]=> string(2) "sd" ["args"]=> array(0) { } } [1]=> array(4) { ["file"]=> string(7) "foo.php" ["line"]=> int(1) ["function"]=> string(3) "foo" ["args"]=> array(0) { } } [2]=> array(4) { ["file"]=> string(102) "foo.php" ["line"]=> int(2) ["function"]=> string(3) "bar" ["args"]=> array(0) { } } } */ ``` Usage ----- To enable the extension from source, run: ``` phpize ./configure make sudo make install ```

This invention relates to improvements in a recording/playing circuit for use in a recording/playing apparatus for magnetic tapes, and more particularly, to a recording/playing circuit including a muting function which may be more easily fabricated using IC techniques. In recording/playing apparatus, such as cassette tape decks and the like, it is desirable to provide a muting function to avoid the generation of switching shock noise during switching between the play and record operations, upon actuation of the stop switch or as a result of abnormal key entries. This is accomplished generally by some means which serves to isolate the output of the apparatus during the switching function; however, such isolation means may involve an additional switching function in the output circuit of the apparatus to switch in a muting amplifier or the like during normal switching operations. Another important consideration in the design of such circuits is the ability to fabricate the circuits using IC technology. In this regard, the trend in the manufacture of all electronic products has been toward the total integration of circuits in order to reduce costs of manufacture and improve reliability and performance. Thus, in the design of a recording/playing circuit which includes a muting circuit, consideration must be given to a design which will facilitate IC manufacture thereof.

Dominic Fagan HR Manager Dominic joined Link Contracting in January, 2016. He brings with him 20 years’ experience of Human Resources and Operations Management gained in the Retail sector. He has hands-on experience in the implementation of HR initiatives including policy design, performance management, recruiting, training, career progression, employee relations and compliance issues. With a strong emphasis on the development of staff through formal, structured performance & appraisal systems, he has created teams with skills that have helped grow businesses and add to their success. In Dominic’s spare time he enjoys playing competitive tennis, and plays with his club in the Warrington & Bolton Tennis Leagues.

GMO-free Philippines: In the catacombs of broken dreams? A very significant event happened this year, that is for those who believe that farming or agriculture must not only provide healthy and abundant food for everyone but must give substantial benefits to the farmers who are the producers. This was what I believed was the overarching message of this year’s 9th National Organic Agriculture Congress held in Madaue City, in Cebu last Nov 6-8. With the theme “Food Security and Business Opportunity”, I wanted to believe that the “business opportunity” discussed here is more favorable to the small farmers than the big traders and multinationals. The small farmers after all are at the core of the Philippine agricultural landscape. My thoughts are centered on the output of the congress where resolutions were passed and approved overwhelmingly without objection. Among the approved resolutions were; the wider promotion of the OA Act and its Implementing Rules; a call to the DILG to ensure that Technical Committees are organized in all LGUs; strong support be given to small and marginal farmers and fisherfolks including agrarian reform beneficiaries in terms of production, processing and marketing; more investment by government in equipment and facilities; establishment of organic markets in Metro Manila and other regional centers; for BSWM to increase commercialization of organic agricultural inputs and other methods of soil nutrition enhancement; for the AMAS to upscale organic market by giving benefits to producers and consumers; to include other forms of guaranty systems more appropriate and accessible to farmers like the Participatory Guarantee System; to harmonize our Philippine National Organic Standards with the Asian Regional Organic standards and other international standards and explore recognition of our certifying bodies internationally; more public investment in research and development with end in view of creating organic farmer entrepreneurs; more aggressive promotion by integrating in school curriculum to further inculcate to students the values and principles of OA; that DA set-up mechanisms that ensure active, broader, equitable and substantial participation from farmers / private stakeholders in NOACs and other localized conferences on organic agriculture; That BPI, Institute Plant Breeding and other government plant breeding institutions to produce and breed open pollinated varieties of plants and support community based seed producers; and other resolutions (twenty-four all in all) that if implemented will surely bring organic agriculture in a level never before attained here in our country. The most debated resolution which took almost two hours to resolve was on GMOs. The approved resolution stated, “That a GMO- FREE country policy be continuously pushed and advocated knowing that the use of GMO goes against the OAA and that a moratorium in the field testing of GMOs should be implemented and a body formed to investigate the impact of GMO in the country”. I actively participated in the discussion of this topic and so with other pro and con GMO participants. Although oneformer DA official wanted to stress that GMO and Organic Agriculture can co-exist, the voting showed that the over 1,800 participants in that congress believed it isn’t so. When the votes were taken, there was overwhelming support, with no objection, and only two abstained. Now with bated breath, I wait for the NOAB to inform the public about this development. And it is more than one month since the historic sentiment of the organic agriculture practicing farmers, traders, consumers and advocates was expressed but until now we still have to hear from them. The resolution was furnished to the Secretaries of Department of Agriculture, Department of Interior and Local Government, Department of Agrarian Reform, Department of Health, Department of Education, Department of Science and Technology, Department of Trade and Industry and the National Organic Agriculture Board. Christmas is just around the corner, but the bells that will be ringingthat is most welcome to the ears of not only those who attended the congress but also the bulk of small farmers, fisherfolks, traders and consumers who believe in organic agriculture is the public announcement of this resolution passed during the 9th NOAC. It is a strong sentiment for a sustainable agriculture and healthy food production for the generations to come in the Philippines. It is a strong call for everyone to take notice of, including those who promote GMOs (in and outside of government) here in our country. I ask, WHERE IS THE RESOLUTION NOW? I hope it will not be forgotten in the “catacombs of broken dreams”. Leonardo Avila is the former Officer-in-charge of the City Agriculturist Office since July of 2010 and is appointed by Mayor Sara Z. Duterte as a Fishery Officer with full power and authority to enforce all existing fishery ordinances, laws, rules and regulations since October 2011. One approach to convincing Philippine farmers to grow GMO-free organic fruits, vegetables, legumes and grains is to create a demand. After learning that there are no continuing care retirement communities (CCRCs) in the United States who are meeting the dietary needs of retired vegans, vegetarians and organic consumers, the decision is to start such communities in Asia. The main reason is affordability. The first CCRC will be built before the end of 2013 in Batangas. At maturity the estimate is the residents will spend between P24 to P48 million for their food requirements.

Frank Haynes David Francis Haynes (8 March 1926 – 11 September 1998) was a British politician. A member of the Labour Party, he served at the Member of Parliament (MP) for Ashfield from 1979-92. Born in Wandsworth, London, a former miner, Haynes became the MP for Ashfield in 1979, regaining a seat that had been lost to the Conservatives in a 1977 by-election. Haynes served until 1992 when he retired and was succeeded by Geoff Hoon. Haynes was famous for having one of the loudest and most resonant voices in the House of Commons. He was sponsored by the National Union of Mineworkers, and during the 1984-85 strike remained loyal to the union rather than support the majority of Nottinghamshire miners who broke away to form the Union of Democratic Mineworkers. He frequently highlighted the problems of the very poorest in society when putting questions to Margaret Thatcher and her ministers. Haynes died in Westwood, Nottinghamshire, in September 1998 at the age of 72. References The Times Guide to the House of Commons, Times Newspapers Ltd, 1987 Category:1926 births Category:1998 deaths Category:Labour Party (UK) MPs for English constituencies Category:National Union of Mineworkers-sponsored MPs Category:UK MPs 1979–1983 Category:UK MPs 1983–1987 Category:UK MPs 1987–1992

A Ca(2+) channel blocker-like effect of dehydrocurdione on rodent intestinal and vascular smooth muscle. Effects of dehydrocurdione, a zedoary-derived sesquiterpene, on smooth muscle were investigated by recording the mechanical activity of intestines and aorta from guinea pigs and rats. Dehydrocurdione (0.1-3 mM) induced a sustained relaxation of rat duodenum and inhibited spontaneous motility. Dehydrocurdione (0.1-1 mM) inhibited the contractile response of guinea pig ileum induced by acetylcholine (0.01-10 microM), histamine (0.03-10 microM) and substance P (0.1-30 nM) in a non-competitive manner. Acetylcholine (0.5 microM) elicited a transient contraction followed by a sustained contraction of guinea pig ileum, and dehydrocurdione pretreatment inhibited the sustained component, which depends on Ca(2+) entry from the extracellular space. The high K(+)-induced contraction of rat aortic ring is reported to be blocked by Ca(2+) channel blockers, while the norepinephrine-induced contraction includes a Ca(2+) channel blocker-resistant component. Dehydrocurdione (1 mM) blocked the high K(+) (60 mM)-induced contraction of rat aortic ring by 81%, while it inhibited the norepinephrine (1 microM)-induced contraction by only 28%. Dehydrocurdione (1 mM) significantly reduced the high K(+)-stimulated increase in cytosolic Ca(2+) level of Fura-2-loaded mesenteric artery from rats. These results suggest that the inhibitory effects of dehydrocurdione on intestinal and vascular smooth muscle are mediated by blockade of Ca(2+) entry from the extracellular space.

{ "images" : [ { "idiom" : "universal", "scale" : "1x" }, { "idiom" : "universal", "filename" : "[email protected]", "scale" : "2x" }, { "idiom" : "universal", "filename" : "[email protected]", "scale" : "3x" } ], "info" : { "version" : 1, "author" : "xcode" } }

Effect of heating on vascular reactivity in rat mesenteric arteries. Vasoconstriction in the viscera is one of the primary cardiovascular adjustments to heating. Local temperature can influence vascular responsiveness to catecholamines and sympathetic nerve activity. Therefore, we hypothesized that heating would alter vascular reactivity in rat mesenteric arteries. Concentration-response curves to norepinephrine, phenylephrine, potassium chloride (KCl), calcium, acetylcholine, and sodium nitroprusside were obtained in vascular ring segments from rat mesenteric arteries at 37 and 41 degrees C. In some rings, basal tension increased slightly during heating. Heating to 41 degrees C did not alter the contractile responses to norepinephrine in endothelium-intact or -denuded rings but augmented the responses to KCl and calcium in endothelium-intact rings. The potentiating effect of heating on the responses to KCl and calcium was eliminated after endothelium removal. In contrast, the relaxant responses to acetylcholine and sodium nitroprusside were significantly attenuated at 41 degrees C. Collectively, these results demonstrate that heating alters vascular reactivity in rat mesenteric arteries. Furthermore, these data imply that heating reduces the ability of vascular smooth muscle to relax, possibly due to a decrease in sensitivity to nitric oxide.

Apply Now Important: Applicants with disabilities may request any reasonable accommodation necessary to complete this application, or to take any test required for the position for which the applicant has applied, by making a request at the time of application or testing. Equal Employment Opportunity: It is the ABHS’s policy to seek and employ the best qualified employees and to provide equal opportunity for the advancement of employees and to administer all of our employment policies in a manner that will not discriminate against any person because of race, color, religion, age, sex, sexual orientation, gender identity, marital or veteran status, national origin, ancestry, disability, genetic information, on-the- job injuries, or any other legally protected status. Criminal and/or Driving Records: ABHS may ask for additional information from applicants who receive a conditional offer of employment. The additional information will be about the applicant’s criminal and/or driving record, including convictions of any crime (whether a felony, misdemeanor, or other violation or offense), or pleas of guilty or no contest, or forfeitures of bail or bond. We may also ask for this information as part of a background check. A criminal or driving record is not an automatic bar to employment. Factors such as the nature and gravity of the crime, the length of time since the conviction and/or completion of any sentence, and the nature of the job for which you have applied will be considered. Drug Testing: All offers of employment are subject to a urinalysis or alternative test(s) for the presence of unlawful drugs. Position & Qualifications Please fill out the details regarding the position you're interested in and your qualifications. Position* Which Position are you Applying for? Position Location* Select the Location which you are applying Have you ever worked for us before? Yes No Are you 18 years of age or older? Yes No Availability What is your availability? Days Swing Graveyard Weekdays Mon Tue Wed Thurs Fri Sat Sun Relatives and Friends Qualified relatives and friends are eligible for employment except in unusual situations when the Company needs to avoid possible conflicts of interest. Do you have any relatives or friends (such as roommates or domestic partners) who currently work for us? Yes No If yes, state name(s) If you have a relative or friend that works for ABHS, please provide their name. Qualifications Please list any education, training and/or specialized experience (such as schools; colleges; degrees; vocational, technical or military experience; hobbies, etc.) you believe would help you perform the work for which you are applying. Where did you acquire the qualifications? (Name/address of school, program, military branch and specialty, or other source) Level of Education Please select your highest level of education. Employment History Please account for all periods of employment by month and year, including any self-employment and military service. Current/Most Recent EmployerSupervisor Job Title/Job Duties Hire Date Date Left Phone Reason for Leaving Resume & Cover Letter Please attach your resume and cover letter if available. Upload Resume & Cover Letter Drop files here or Accepted file types: jpg, png, pdf. Verification, Authorization and Signature Please read and accept through the Verification and Authorization agreement below. I authorize the investigation of all matters which ABHS, Inc deems relevant to my qualifications for employment, including all information given in this application and in any supplemental application attachments or supporting documents. I authorize ABHS, Inc to request and receive such information, and I release from all liability any persons (such as current or former supervisors or employers) supplying it. I further agree to sign an Authorization and Consent form allowing an outside agency selected by ABHS, Inc to verify all of the information I have provided as well as to provide any other information ABHS, Inc deems relevant to my qualifications or suitability for employment. I also release ABHS, Inc from all liability which might result from making the investigation. I certify that the facts and information in this application and in any attachments or supporting documents are true and complete to the best of my knowledge. I understand that any falsification, misrepresentation or omission, as well as any misleading statements or omissions, generally will result in denial of employment or immediate termination, regardless of when and how discovered. I understand that I may be required to submit to pre- or post-employment physical or other professional examinations, medical inquiries and/or urinalysis or alternative tests for the presence of drugs and/or alcohol. I agree to such examinations, inquiries and/or testing at the ABHS's expense. I authorize release of the results to ABHS, Inc and their use to evaluate my suitability for employment. I also release ABHS, Inc from all liability arising out of or connected with any examinations, inquiries and/or testing. I understand and agree that I may resign or be terminated, without cause or notice, at any time, unless otherwise stated in a written employment contract. I also understand and agree that ABHS’s President is the only person who will ever have the authority to agree to any other terms and/or to enter into such contracts, and that all such agreements for other terms of employment or contracts must be in writing and signed by both parties. I also understand that unless otherwise stated in a written employment contract, ABHS, Inc may change, withdraw and interpret other policies (including wages, hours and working conditions) as it deems appropriate. This application for employment will only be considered active for 60 days. I understand and agree that if I am hired, the statements in these paragraphs will become a binding part of my employment relationship. I have read (or had read to me in a language I understand) each of these statements. I have also reviewed all of the information provided in this application and in any attachments or supporting documents. Agreement* Check here to indicate you have read and agree to the above terms of the ABHS Application

817 What is the derivative of 446 - 905*w - 398*w + 1736*w wrt w? 433 Find the second derivative of -86*d**4 + 62*d - 48*d**4 - 116*d + 2 wrt d. -1608*d**2 Let n(c) = c**2 - 13*c - 27. Let g be n(16). What is the third derivative of -g*b**2 + 995 - 26*b**4 - 995 wrt b? -624*b Let v(s) be the first derivative of 11*s**6/360 - 5*s**4/6 - 22*s**3/3 + 21. Let m(z) be the third derivative of v(z). Differentiate m(f) with respect to f. 22*f Let w(t) be the third derivative of -34*t**4/3 + 229*t**3/6 + 228*t**2. Find the first derivative of w(q) wrt q. -272 Let g(b) = 3*b**2 + 3*b + 15. Let x be g(-3). What is the second derivative of -23*z**5 + 2*z - x*z - 8*z + 2*z wrt z? -460*z**3 What is the third derivative of -133*o**4 + 133*o**4 - 568*o**2 + 418*o**6 + 70*o**2 wrt o? 50160*o**3 Let c(y) be the third derivative of 0*y**6 - 13*y**2 + 0*y + 0*y**4 + 7/6*y**3 + 1/35*y**7 + 0*y**5 + 0. What is the derivative of c(j) wrt j? 24*j**3 Let a(i) = i**4 + i**3 + i**2 + i + 1. Let n(f) = 16*f**4 - 6*f**3 - 6*f**2 - 6*f + 108. Let k(r) = 6*a(r) + n(r). What is the first derivative of k(h) wrt h? 88*h**3 Let t = -51 + 58. Differentiate -t - 32*d + 63*d - 29*d wrt d. 2 Suppose 3*s + 3 = 0, 3*v + 0*s + 2*s = 7. Find the second derivative of -19*r**v - 19*r - 5*r**3 + 12*r wrt r. -144*r Let u be -1*-1*(-1 + 3). Suppose 4*p - d - 13 = 0, u*d = 4*p - 3 - 11. What is the third derivative of -3*o**3 + 2*o**4 + 3*o**p + 3*o**2 wrt o? 48*o Let u(q) be the third derivative of -13*q**4/12 + 164*q**3/3 + 268*q**2. What is the derivative of u(g) wrt g? -26 Let f be 1/(-4) - (-468)/16. What is the first derivative of -6*z - 17*z + f*z + 4 wrt z? 6 Let r(x) be the second derivative of -10*x + 9/2*x**2 + 0*x**3 + 0 - 3/20*x**5 + 0*x**4. Differentiate r(u) with respect to u. -9*u**2 Let r(y) be the first derivative of 107*y**4/4 + 9*y**2/2 - y - 113. What is the second derivative of r(a) wrt a? 642*a Let b(w) be the second derivative of -4*w**3/3 - 83*w**2/2 - 93*w. What is the first derivative of b(c) wrt c? -8 Let x = -8 + 13. Suppose -4*n = 3*v - 0*n + 16, x*n + 20 = -3*v. What is the third derivative of 3*o**4 + v*o**4 - 5*o**2 - 4*o**4 wrt o? -24*o Let r(b) = 564*b**2 + 22*b - 540. Let x(t) = 282*t**2 + 12*t - 269. Let c(m) = 6*r(m) - 11*x(m). What is the derivative of c(w) wrt w? 564*w Let n(z) be the second derivative of -71*z**3/2 + 43*z**2 + 257*z. What is the derivative of n(r) wrt r? -213 What is the derivative of 18 + 57 - 5*k**2 - 10 - 6*k**2 wrt k? -22*k What is the third derivative of -89*y**2 - 2423*y**6 + 2304*y**6 + 174*y**2 + 195*y**2 wrt y? -14280*y**3 Let c(v) = 84*v**2 - 131*v + 5. Let b(j) = -42*j**2 + 66*j - 3. Let z(u) = -5*b(u) - 3*c(u). What is the second derivative of z(r) wrt r? -84 Let s = -33 + 54. What is the second derivative of -22 + 10 + s*q + 12 + 7*q**2 wrt q? 14 Let w(o) be the first derivative of 0*o - 1/2*o**2 + 0*o**5 - 1/6*o**6 + 0*o**4 - 6 + 0*o**3. Find the second derivative of w(i) wrt i. -20*i**3 Let t(p) = -63*p - 90. Let r(x) = -3*x + 1. Let j(z) = r(z) + t(z). Differentiate j(n) with respect to n. -66 Let r(o) be the second derivative of 0*o**5 - 29*o + 0*o**3 - 4/21*o**7 + 0 + 0*o**2 - 13/6*o**4 + 0*o**6. Find the third derivative of r(f) wrt f. -480*f**2 Let o(j) = -11*j - 30. Let b be o(-3). Let g(n) be the second derivative of -n + 5/6*n**b + 1/12*n**4 + 0 + 0*n**2. What is the second derivative of g(i) wrt i? 2 Find the second derivative of 106*p**2 - 30*p**2 + 2*p - 22*p**2 + p**3 - 40*p**2 wrt p. 6*p + 28 Let b(m) = 5*m**3 + 18*m**2 + 3*m + 70. Let s(j) = 4*j**3 + 17*j**2 + 2*j + 69. Let p(t) = -2*b(t) + 3*s(t). Differentiate p(x) with respect to x. 6*x**2 + 30*x Let r(s) be the second derivative of s + 0*s**2 + 0*s**6 + 0*s**4 + 1/20*s**5 + 35/6*s**3 + 5/7*s**7 - 24. What is the second derivative of r(p) wrt p? 600*p**3 + 6*p Suppose 0 = -2*c + 3*n + 987, 0*c - 3*c + 1513 = 2*n. Find the second derivative of -501*x**3 + 6*x**4 - 2*x + c*x**3 wrt x. 72*x**2 Let s(u) = -372*u**2 - 333*u + 6. Let q(i) = -374*i**2 - 334*i + 9. Let h(t) = -2*q(t) + 3*s(t). What is the second derivative of h(o) wrt o? -736 Let v(d) = d**2 - 4*d + 9. Let u be v(6). Let k = -11 + u. Differentiate -4 + 4*x**3 + 2*x**3 - k*x**3 wrt x. -12*x**2 Let x(w) be the first derivative of 9*w**5/5 - 7*w**4/2 + 2*w**3/3 - 52*w**2 - 196. Find the third derivative of x(u) wrt u. 216*u - 84 Let q(z) be the second derivative of 0*z**3 + 37/12*z**4 + 0 - 25*z + 0*z**2 - 3/5*z**6 + 0*z**5. What is the third derivative of q(n) wrt n? -432*n What is the third derivative of 707*c**6 + 410*c**2 + 53*c - 53*c + 5 - 5 wrt c? 84840*c**3 Let v(h) = -h - 1. Let n(j) = j**2 - 4*j - 11. Let a be n(6). Let s(k) = 24*k + 22. Let i(y) = a*s(y) - 2*v(y). Differentiate i(w) with respect to w. 26 Let b(j) = 2*j**2 - 5*j - 3. Let d be b(-2). Differentiate -11*c**2 - d*c**2 - 30 - 5*c**2 wrt c. -62*c Let p = -4 - -7. Suppose i + 6 = p*i. What is the second derivative of 44 - 44 - 6*f + f**3 - 2*f**i wrt f? -6*f Let x = 8 - 9. Let g = x + 5. What is the first derivative of -4*c**2 + 1 + 2 + 4*c**2 + 5*c**g wrt c? 20*c**3 Let j = -66 + 69. Find the third derivative of -5*b**6 - 8*b**6 - 5*b**6 - 17*b**2 - j*b**2 wrt b. -2160*b**3 Let w(f) = 2*f + 7. Let c be w(-2). Differentiate -n**3 + 19 + c*n**3 - 10 - 14 wrt n. 6*n**2 Let x(p) be the second derivative of p**6/15 + 33*p**5/4 + 11*p**3 + 2*p**2 + p + 266. What is the second derivative of x(m) wrt m? 24*m**2 + 990*m Suppose -3*y - u - 3 = -4*u, -2*y + 19 = 5*u. What is the second derivative of 25*w**y - 5*w + 10*w + 10*w wrt w? 50 Let v(z) be the first derivative of -87*z**6 - 32*z**3 + 356. What is the third derivative of v(x) wrt x? -31320*x**2 Suppose -4*v = a - 3*v + 2, v = 3*a - 10. What is the third derivative of -5*m**2 + 8*m**a - 10*m**5 - 4*m**5 wrt m? -840*m**2 Let n(a) = -132*a + 298. Let x(o) = -397*o + 892. Let d(w) = -11*n(w) + 4*x(w). Find the first derivative of d(l) wrt l. -136 Suppose -2*l + 4 = -0. Find the third derivative of 3*r**5 - 5*r**2 + 2*r**5 + 6*r**l - 11*r**2 wrt r. 300*r**2 Let r(o) be the second derivative of -19*o**8/56 - o**7/14 - 155*o**4/12 - o**3/3 + 85*o + 2. Find the third derivative of r(z) wrt z. -2280*z**3 - 180*z**2 Let b = -4 + 24. Suppose -b = -c - 4*c. Find the third derivative of -2*g**2 - 4*g**4 - g**2 + 8*g**c wrt g. 96*g Let a(g) be the first derivative of -85*g**4/4 + 119*g**3/3 + 440. Find the third derivative of a(o) wrt o. -510 Find the second derivative of -48*b**2 + 72*b - 23*b**2 - 2*b - 11*b**2 wrt b. -164 Let v(o) = -36*o**2 + 67*o - 3. Let r(b) = 37*b**2 - 68*b + 4. Let s(t) = -3*r(t) - 4*v(t). What is the second derivative of s(m) wrt m? 66 Let u(q) = 15*q**3 + 5*q**2 - 21*q - 10. Let l(k) = -22*k**3 - 8*k**2 + 31*k + 16. Let f(i) = 5*l(i) + 8*u(i). What is the second derivative of f(z) wrt z? 60*z Let a(k) = -162*k**2 + 219*k + 4. Let z(l) = 323*l**2 - 434*l - 9. Let b(y) = -9*a(y) - 4*z(y). What is the second derivative of b(d) wrt d? 332 Let v(b) be the first derivative of 19*b**4/24 - b**3 + 10*b**2 + 21. Let r(p) be the second derivative of v(p). What is the first derivative of r(n) wrt n? 19 Let i(y) be the second derivative of -y**7/21 - 199*y**6/15 + 53*y**4/12 + 7*y**2/2 + 38*y - 7. Find the third derivative of i(x) wrt x. -120*x**2 - 9552*x Suppose -3*l - l - 24 = 0. Let r be 1 - l/(4 - 2). What is the derivative of -38 - r*m**4 + 43 + m**4 wrt m? -12*m**3 Let f = -18 - -18. Suppose f = -4*m + 5*c - 21, 3*c - 4*c = -5*m. Find the first derivative of -5 - m + 3 - 8*h**4 - 2 wrt h. -32*h**3 Let g(u) be the first derivative of 191*u**4/4 + 110*u**3/3 - 150. Find the third derivative of g(c) wrt c. 1146 Let x(d) be the first derivative of -505*d**6/6 + 437*d**3/3 - 466. What is the third derivative of x(l) wrt l? -30300*l**2 Let t(z) = -4*z + 2. Let l(c) = -5*c + 5. Let x(s) = -6*s + 6. Let f(k) = 5*l(k) - 4*x(k). Let w(m) = -2*f(m) - t(m). Differentiate w(v) with respect to v. 6 Find the first derivative of 90*f**4 + 752*f**2 - 752*f**2 - 87 wrt f. 360*f**3 Suppose 3*m = -4*n + 29, n - 20 = 4*m - 9*m. Suppose 5 = v - n. Find the third derivative of -2*f**3 + 2*f**3 - v*f**4 + 16*f**2 - 21*f**2 wrt f. -240*f Let f(g) = g**3 - 2*g + 1. Let x(y) = 2*y**4 + 6*y**

Objective:The objective of this program is to develop scholars for the future growth of Zarathustrian Religion. This is a full time (boarding) and an intensive program. Degree:1. B.A. in "Zarathustrian Studies," with Major in Religion and Education. 2. Ph.D. in "Philosophy of Zarathushtra" 3. Masters in Administration by Gatha Value Duration:We require a minimum of six and half years. Students are required to take 43 credits per year for his or her undergraduate degree-a total of 129 credits. To earn a graduate degree student must take 30-doctorate credit per year, with a total of 90 credits for doctorate degree. Students who have difficulty in English, their duration will take longer than the normal period. Important Note: In order to receive any certificate or degree a student must complete the full program. Students who will be on scholarship would not receive any certificate, degree, or academic transcript unless he/she completes the doctorate program. Location: Spenta uses Internet to connect to the top professors in the field and the American Educational system with its Pune campus, India. Student Minimum Qualification for Entrance: H.S.C (for students in India) or High School Diploma (for other than India). Minimum Age: 17 years This program is open to all castes and creeds. Application Procedure:Students are required to send their application and all official documents (School Grades) to Spenta's Administration Office in India. Students should have legal travelling documents, like the Visa, during their tenure with us. You can even write to our Executive Officer for further details or for application at: [email protected] Selection Procedure:We select a student based on the date of the application, grade transcripts, medical examination, and an interview with the Admission Board. Student Qualifications at Graduation:The program objective is to qualify students to: Be teachers of Zarathushtra's Message. Prepare them to pursue a teaching and/or research based position in a University. The program which is in English is divided into the following seven parts: Physical Education (P.E.): This education includes: General Fitness Exercises, Cross Training: i.e. Running, Bicycling, Walking and First aid, and CPR. Physical Education is on a daily basis throughout the doctorate program. Discipline: Spenta enforces Military customs and practices to develop discipline, leadership qualities and teamwork among students. Discipline is on a daily basis and it is carried on throughout the program. We require that all students to wear uniform during their study at Spenta. General Studies: This is a general program to introduce students to English, General Education, and the Message of Zarathushtra. In this section the student will take the following classes: Research: Research is based on two pillars: Classes and Projects . CLASSES are as follows: Research Fundamentals, Library research and Doctoral Dissertation. The PROJECTS are on daily basis throughout the doctorate program. Teaching Tours: Before students' graduation, we require that each student completes at least two summers teaching tours. Each tour is three month long, as arranged by the University.Specialty Studies: Students will take their undergraduate and graduate specialty courses. These classes are as follows: · Zarathushtrian Religion Classes · Teaching: Counseling, teaching, leadership and administration. Foreign Language: Students must learn modern Persian and one foreign language. Computer Programming in C, C++ Detail: In each semester students take five courses and one internship. Students do not choose courses. Courses are taught primarily in English. Video conferences, Audio video presentation, Internet, independent study, research work, and fieldwork are used for instruction. Thirty percent of average week is unstructured. Calendar: Semester and summer short terms. Living Arrangements: Students live in the Spenta's housing facilities.

In the screening of fluidizable suspensions, such as medium consistency paper pulp, it is desirable to utilize a simple yet effective apparatus, and one which will allow the production of a number of different accept streams. Medium consistency pulp typically is pulp having a consistency of about 6-15 percent, and most typically within the range of about 8-12 percent solids. In order to effectively screen such suspensions, it is necessary to fluidize them by producing pulsations and shear forces in the suspension. When the suspension is fluidized the fibers or other solid materials therein move relative to each other, and can be separated according to different sizes, shapes, or weights utilizing an appropriate screening apparatus. In co-pending application Ser. No. 836,123 filed Mar. 4, 1986 (the disclosure of which is hereby incorporated by reference herein) a simple yet effective screening device which is particularly adapted for screening medium consistency pulp (although it may be utilized in the screening of other fluidizable suspensions) is illustrated. That screening device is typically utilized with chemical pulps, or mechanical pulps, such as TMP, CTMP, or the like. While the screening device illustrated therein is eminently practical, it has been found according to the present invention that such a device may be made even more useful by effecting reduction of shives, and other components of the rejects, within the screening device housing itself. According to the present invention, for a screening device such as illustrated in said co-pending application Ser. No. 836,123, or a like screening device having a rotor which is rotatable with respect to a screen, rejects refining is provided directly in the screen housing itself by providing first and second grinding elements downstream of the screening means, that is between the screens and the rejects outlet from the housing. The grinding elements comprise a first element operatively mounted to the housing, and a second element operatively mounted to, and rotatable with, the rotor. The grinding elements preferably are in the form of rings which are removably attached to the housing and the rotor, respectively, and define a grinding slot between them. The dimensions of the grinding slot may be adjusted by replacing one or both of the annular grinding elements, or by forming the grinding elements so that they have a conical shape and adjusting the axial position of the rotor within the housing. It has also been found, according to the present invention, that further shive reduction can be effected by utilizing vanes attached to the rotor, downstream of the grinding elements, which vanes simultaneously effect pumping of the rejects out of the main outlet. The vanes are as described in said co-pending application Ser. No. 836,123. According to the present invention a method of treating a suspension of finely comminuted cellulosic fibrous material also is provided. The method comprises the following steps: (a) Introducing suspension having a consistency between about 6-15 percent into the housing inlet. (b) Effecting fluidization of the suspension within the housing to effect screening thereof, at least one accept stream being discharged from the housing through said at least one accepts outlet. (c) During screening of the suspension, effecting thickening of the suspension so that the suspension is thickened to a consistency of between about 15-20 percent. And (d), effecting reduction of the reject material in the thickened suspension prior to discharging the reject material out of the main outlet. Step (d) is practiced by passing the rejects through a grinding slot defined by the relatively rotatable grinding elements. Further shive reduction, and powered discharge of the rejects from the housing, is practiced by supplying dilution liquid to the suspension after grinding so that it is diluted to a consistency of between about 6-15 percent, and then acting on the suspension with rotating vanes (which effect the further shive reduction and pump the rejects out of the housing). Further reject reduction can be provided exterior of the housing, too, with a significant reduction in the energy expended in practicing the subsequent refining to get the desired results. It is the primary object of the present invention to provide a device and procedure which are eminently suited for effecting screening of paper pulp (preferably medium consistency), or the like, while additionally effecting reduction of shives and other rejects material. This and other objects of the invention will become clear from an inspection of the detailed description of the invention and from the appended claims.